/

University of Southern California Dissertations and Theses

/

The expected and unexpected roles of TRPM8: cold pain and metabolism

(USC Thesis Other)

The expected and unexpected roles of TRPM8: cold pain and metabolism

PDF

Download

Open document

Flip pages

Contact Us

Copy asset link

Request this asset

Transcript (if available)

Content The expected and unexpected roles of TRPM8: Cold Pain and Metabolism by Daniel David McCoy A Dissertation Presented to the FACULTY OF THE USC GRADUATE SCHOOL UNIVERSITY OF SOUTHERN CALIFORNIA In Partial Fulfillment of the Requirements for the Degree DOCTOR OF PHILOSOPHY (Molecular Biology) May 2014 Copyright 2014 Daniel McCoy ii DEDICATION For my wife Stacy, “You and Me” iii ACKNOWLEDEGMENTS Graduate school is a long and arduous journey and I am certain that without the help of my friends, family and colleagues I would never have finished. Dr. David McKemy has been a fantastic mentor. He has always been available for scientific, personal and career discussions and I will be forever indebted to him for his sage advice and guidance over the years. His encouragement and enthusiasm in the face of scientific heartbreak has been instrumental in keeping me motivated and focused on my work and I can proudly say I am a better scientist because of him. I would also like to thank the members of my guidance committee Drs. Don Arnold, Sergey Nuzhdin and Jeannie Chen for their valuable insights and counsel along the way. The feedback and technical help provided by Dr. Alan Watts, Dr. Ligang Zhou, Dr. Casey Donovan and Anh-‐Khoi Nguyen were essential to the completion of this work and I would like to thank them for their collaborative efforts, without which I would not have been able to pursue such a project outside our lab’s realm of expertise. I have been fortunate enough to have shared a lab with a number of wonderful people and I would like to thank them all for their support and camaraderie. Dr. Luke Daniels, Dr. Yoshio Takashima and Dr. Wendy Knowlton were always welcoming and available while I was learning my way around the lab. Wendy was particularly helpful in training me how to work with live animals and manage a colony, a daunting task as a new student. I have grown as a scientist with Erika Lippoldt and Radhika Palkar and their different perspectives over the years of sitting through, what sometimes seemed iv like never-‐ending lab meetings, have been a great asset. Also, working with Yuening Yang and the “super undergrads” Rebecca Romanu, Jessica Chen and Melissa Sajnani has been a very rewarding experience. Misery loves company and I can’t thank my fellow MCB friends enough for our graduate student vent sessions and numerous activities over the years. Displays of our athleticism (or lack thereof) in softball, basketball, flag football etc. served to reinforce my decision to stick to science. The frequent lunches at Caveman and occasional ping pong sessions in RRI with Jared Peace, Zac Ostrow and Ian Slaymaker in particular kept me sane and grounded. My friendships outside of science from Reading, Wake Forest and Los Angeles have also been influential during my time at USC. I would especially like to thank Steven Clough and Justin St. James for the hours of phone conversations and multiple visits over the years and Pete Byrne for being crazy enough to move to San Diego following my own selfish endorsement. I would also like to thank my Lakeshore friends for providing me some semblance of a social life while here (Halloween, Thanksgiving, Super Bowl, July 4th, Field Day and various other get-‐togethers). My family has been hugely supportive during my tenure as a graduate student. Words cannot describe my gratefulness for the love and support of my parents Lynn and John, sisters Natalie and Jenny and in-‐laws Betsey, Julie and Darrick. The science gene did not skip a generation and I would particularly like to thank my parents for being wonderful role models and my sisters for inspiring me to follow my passions as they do their own. v Lastly, and most importantly, I would like to thank my incredible wife Stacy without whom none of this would have been possible. Through the ups and downs of school and life she has been my rock, my constant, my everything. vi TABLE OF CONTENTS DEDICATION ii ACKNOWLEDGEMENTS iii LIST OF FIGURES ix ABSTRACT xi CHAPTER ONE Introduction 1 TRPM8 cloning, modulation, and mechanism in vitro 2 TRPM8 confers cold sensation in vivo 8 Cold and chronic pain 15 How can TRPM8 mediate both innocuous cool and noxious cold? 17 Conclusion: TRPM8 as a Therapeutic Target 22 CHAPTER TWO Enhanced insulin clearance in mice lacking TRPM8 channels 25 Introduction 26 Materials and Methods 28 Results 37 Streptozotocin sensitivity, decreased body weight, and decreased 37 fasting insulin in TRPM8 -‐/-‐ mice Normal morphology and function in pancreatic β-‐cells in Trpm8 -‐/-‐ 40 mice Trpm8 -‐/-‐ mice show prolonged hypoglycemia in response to insulin 41 Enhanced insulin clearance in Trpm8 -‐/-‐ mice 44 TRPM8-‐expressing afferent fibers innervate the hepatic portal vein 46 Increased insulin-‐degrading enzyme (IDE) expression in Trpm8 -‐/-‐ liver 47 Conclusion 50 vii CHAPTER THREE TRPM8 pore dilation allows for permeation of large cationic 55 molecules Introduction 56 Materials and Methods 61 Results 65 PO-‐PRO3 can permeate both TRPA1 and TRPV1 65 WS-‐12 can stimulate PO-‐PRO3 dye uptake in heterologous cells 65 WS-‐12-‐mediated PO-‐PRO3 uptake is TRPM8-‐specific 69 WS-‐12 can stimulate PO-‐PRO3 dye uptake in cultured sensory 69 neurons expressing TRPM8 WS-‐12/QX-‐314 co-‐administration can block the development of cold-‐ 72 hypersensitivity in response to WS-‐12 in vivo Conclusion 74 CHAPTER FOUR Translational profiling approach for the molecular 77 characterization of TRPM8 expressing sensory neurons Introduction 78 Materials and Methods 82 Results 88 Targeting of the TRPM8-‐eGFP-‐L10a transgenic mouse line 88 TRPM8-‐eGFP-‐L10a mice express eGFP-‐L10a in a subset of small, 88 menthol-‐sensitive sensory neurons Immunoprecipitation of eGFP-‐L10a and associated transcripts from 93 transfected HEK cell lysates Immunoprecipitation of eGFP-‐L10a and associated transcripts from 93 TRPM8-‐eGFP-‐L10a sensory tissue Development of a Lox-‐mCherry-‐L10a-‐Lox-‐eGFP-‐L10a construct for the 94 profiling of two distinct cell populations at once Conclusion 98 CHAPTER FIVE Conclusion 101 REFERENCES 109 viii APPENDIX Development of a TRPA1-‐CRE BAC-‐transgenic mouse line 120 Introduction 121 Materials and Methods 123 Results 127 Generation of the TRPA1-‐CRE BAC-‐transgenic mouse line 127 TRPA1-‐CRE mouse lines express CRE in a subset of sensory neurons 127 and in many non-‐neuronal cell types TRPA1-‐CRE driven tomato expression overlaps with other markers 132 TRPA1-‐CRE-‐Tomato cultured neurons indicate functional responses 135 to Cinnamaldehyde irrespective of reporter expression TRPA1 transcript levels unchanged in TRPA1-‐CRE-‐DTA ablated mice 137 Conclusion 139 ix LIST OF FIGURES CHAPTER ONE Introduction 1.1. Temperature preference and temperature avoidance in TRPM8 -‐/-‐ mice 14 1.2. Model for innocuous cool vs. noxious cold TRPM8 afferent subtypes 21 CHAPTER TWO Enhanced insulin clearance in mice lacking TRPM8 channels 2.1. Streptozotocin (STZ) sensitivity in TRPM8 -‐/-‐ mice 38 2.2. Metabolic characterization of TRPM8 -‐/-‐ mice 40 2.3. Pancreatic β-‐cell function in TRPM8 -‐/-‐ mice 42 2.4. TRPM8 -‐/-‐ mice exhibit heightened insulin sensitivity in vivo 43 2.5. Enhanced insulin clearance in TRPM8 -‐/-‐ mice 46 2.6. Innervation of TRPM8-‐expressing afferent fibers in the hepatic portal vein (HPV) 48 2.7. Insulin-‐degrading enzyme expression is increased in TRPM8 -‐/-‐ mouse liver 49 CHAPTER THREE TRPM8 pore dilation allows for permeation of large cationic molecules 3.1. PO-‐PRO3 dye uptake in TRPA1 and TRPV1-‐transfected HEK cells 66 3.2. PO-‐PRO3 dye uptake in TRPM8-‐transfected HEK cells 67 3.3. Relative quantification of PO-‐PRO3 dye uptake in TRPM8-‐ transfected HEK cells 68 3.4. WS-‐12-‐mediated dye uptake is TRPM8 specific 70 3.5. WS-‐12-‐mediated dye uptake in TRPM8-‐expressing sensory neurons 71 3.6. QX-‐314/WS-‐12 co-‐administration can block WS-‐12-‐mediated cold hypersensitivity in vivo 73 x CHAPTER FOUR Translational profiling approach for the molecular characterization of TRPM8 expressing sensory neurons 4.1. BAC-‐TRAP technique work flow 81 4.2. Targeting strategy of the TRPM8-‐eGFP-‐L10a transgenic mouse line 89 4.3. The TRPM8-‐eGFP-‐L10a mouse line expresses eGFP-‐L10a in a subset of small sensory neurons 91 4.4. GFP + neurons from the TRPM8-‐eGFP-‐L10a mouse line functionally respond to menthol 92 4.5. eGFP-‐L10a and associated transcripts can be immunoprecipitated from transfected HEK cell lysates 95 4.6. Development of a Lox-‐mCherry-‐L10a-‐Lox-‐eGFP-‐L10a construct for the profiling of two distinct cell populations at once 97 APPENDIX Development of a TRPA1-‐CRE BAC-‐transgenic mouse line molecules A.1. Development of the TRPA1-‐CRE BAC-‐transgenic mouse line 128 A.2. CRE-‐driven LacZ expression in TRPA1-‐CRE mice crossed with the ROSA-‐STOP-‐LacZ reporter line 130 A.3. Sensory neuron size distribution in TRPA1-‐CRE mice crossed with the ROSA-‐STOP-‐Tomato reporter line 131 A.4. Tomato expression is widespread in tissues isolated from TRPA1-‐ CRE X ROSA-‐STOP-‐Tomato mice 132 A.5. Immunostaining in TRPA1-‐CRE X ROSA-‐STOP-‐Tomato sensory tissue shows significant overlap in the tomato-‐expressing and TRPV1-‐ expressing neuron populations 134 A.6. Calcium imaging reveals no correlation between tomato expression and TRPA1 agonist sensitivity in TRPA1-‐CRE X ROSA-‐STOP-‐Tomato cultured TG neurons 136 A.7. qPCR analysis reveals no change in TRPA1 transcript in TRPA1-‐CRE-‐ cell ablated sensory tissue 138 xi ABSTRACT Over the last sixteen years, a number of nonselective cation channels belonging to the transient receptor potential (TRP) family have been found to play instrumental roles in thermosensation. The two most prominent thermosensory TRP channels are TRPV1, which responds to noxious heat and heat mimetics such as capsaicin (the active ingredient in chili peppers), and TRPM8, which responds to cold and cold mimetics such as menthol (the active ingredient in mint). These channels are highly expressed in sensory afferents innervating the skin and knockout studies have implicated them in both acute thermosensation and the development of thermal hypersensitivity. Although the role of these channels in thermosensation is firmly established, we currently know little in regards to the causal intracellular mechanisms controlling thermal hypersensitivity. Furthermore, there are no TRP channel-‐specific treatments for sensory-‐ related conditions that do not have serious side effects. This area of research is complicated by the fact that many TRP family channels have been found in areas of the body that are not exposed to the temperatures necessary for their activation, suggesting roles for these channels in other cellular processes. Here we identify a novel role of the cold-‐sensitive channel TRPM8 in insulin homeostasis. We find that Trpm8 -‐/-‐ mice have heightened insulin clearance compared to wildtype, a phenotype that also correlates with increased insulin degrading enzyme (IDE) in the liver, the predominant organ involved in insulin clearance. Furthermore, as previous studies have shown that TRPV1 + afferents in the hepatic portal vein (HPV) are xii instrumental in glucose sensing, the presence of TRPM8 + sensory afferents in the HPV suggests that TRPM8-‐expressing neurons may be influencing liver insulin clearance by controlling localized expression of IDE. In addition to identifying a new role of TRPM8 outside of thermosensation, we show that TRPM8 pore dilation can be used to selectively target the large cationic dye PO-‐PRO3 to cold-‐sensing neurons, a finding that refutes previous work claiming that TRPM8 does not allow such large cationic molecule permeation. These results provide proof of principle for this technique to be used to selectively block cold sensing neurons using the positively charged lidocaine derivative QX-‐314. Finally, to better understand what is going on inside of cold-‐sensing neurons, we have developed a transgenic mouse line that enables the specific immunoprecipitation of actively translating transcripts from TRPM8-‐expressing cells. The data we present here furthers our understanding of TRPM8, its role outside of thermosensation, and opens the door to a new therapeutic methodology for the treatment of chronic cold hypersensitivity. Future studies using the tools developed herein will help to identify targets and pathways involved in cold sensation and aid in the development of new treatments for various sensory-‐related conditions. 1 CHAPTER ONE Introduction Adapted from: McCoy, D.D., Knowlton, W.M., and McKemy, D.D. (2011). Scraping through the ice: uncovering the role of TRPM8 in cold transduction. American Journal of Physiology Regulatory, Integrative and Comparative Physiology. 300(6): R1278-‐87. 2 Introduction Temperature discrimination is vital for the survival of most organisms as failure to avoid non-‐optimal temperatures can result in tissue damage, or even death. While not as robust or precipitous as the sensation of heat, exposure to cold can produce strong and uncomfortable sensations, and can be dangerous in terms of tissue damage (frostbite) and maintenance of core body temperature. Cold can also be therapeutic as it is a common treatment strategy in response to injury. Thus, understanding how cold—an external stimuli—is converted to neural activity—an internal signal—is an important question both biologically and clinically. Within the last decade and a half, a subset of genes of the Transient Receptor Potential (TRP) family of ion channels has emerged as key mediators of temperature sensation with the preponderance of the thermal-‐sensitive channels involved in heat sensation (McKemy 2005). In this chapter we will discuss the well-‐defined role of TRPM8 in cold sensation as well as its therapeutic potential outside of its known sensory roles. TRPM8 cloning, modulation, and mechanism in vitro TRPM8 (or Trp-‐p8) was originally discovered in a subtractive screen for molecules highly expressed in cancerous prostate cells, but neither its functional properties nor its expression in sensory ganglia were reported (Tsavaler, Shapero et al. 2001). In a remarkable convergence, two independent groups, using different experimental strategies, identified TRPM8 as a putative cold sensor in primary sensory 3 afferents (McKemy, Neuhausser et al. 2002; Peier, Moqrich et al. 2002). One approach was based on a genomic screen for TRP ion channels with robust expression in sensory ganglia (Peier, Moqrich et al. 2002). This intuitive strategy was based on the previous identification of the heat-‐sensitive channel TRPV1 in sensory neurons (Caterina, Schumacher et al. 1997) and, in addition to TRPM8, was instrumental in the identification of other somatosensory relevant TRP channels such as TRPA1 and TRPV3 (Peier, Reeve et al. 2002; Smith, Gunthorpe et al. 2002; Xu, Ramsey et al. 2002; Story, Peier et al. 2003). The second strategy used an expression cloning paradigm similar to that used to identify TRPV1, in this case a screen for trigeminal sensory neuron transcripts which could confer menthol-‐ and cold-‐sensitivity to a heterologous cell-‐type (McKemy, Neuhausser et al. 2002). The hypothesis for this strategy stemmed from Hensel and Zotterman’s original posit that menthol’s action is “upon an enzyme, which is concerned in the thermally conditioned regulation of the discharge of the cold receptors” (Hensel and Zotterman 1951). Thus, if the molecular mediator of menthol’s action were to be identified it, like that previously for capsaicin (Caterina, Schumacher et al. 1997), would provide insights into cold transduction (McKemy, Neuhausser et al. 2002). This indeed was the case, and once cloned, the functional properties of recombinant TRPM8 channels were found to be remarkably similar to that observed for menthol-‐ and cold-‐gated currents in cold-‐responsive afferents, including temperature sensitivity, menthol sensitivity, cation selectivity, channel rectification, and Ca 2+ -‐ 4 dependent adaptation (McKemy, Neuhausser et al. 2002; Peier, Moqrich et al. 2002; Reid and Flonta 2002). Aside from menthol, a number of natural and synthetic chemicals have been shown to activate TRPM8 (Eid and Cortright 2009). Another plant-‐derived chemical, eucalyptol, was also found to activate the channel, albeit mildly, whereas the synthetic chemical icilin (AG-‐3-‐5) is a much more potent TRPM8 agonist, thus its designation as a “super-‐cooling” agent (Wei and Seid 1983; McKemy, Neuhausser et al. 2002). A number of menthol-‐derived WS compounds have been reported to gate the channel, with WS-‐ 12 being the most potent known agonist of TRPM8 to date (Bodding 2007). Although endogenous TRPM8 activators have been reported, such as lysophospholipids produced by the activity of calcium-‐independent phospholipases (iPLA2), the mechanism and purpose of non-‐thermal TRPM8 activation is unknown (Vanden Abeele, Zholos et al. 2006; Andersson, Nash et al. 2007). Overall, the effect of chemical activators of TRPM8 is to shift the temperature gating curve of the channel so that it is more likely to open at warmer temperatures (Reid and Flonta 2001). Another mode of TRPM8 modulation is the rapid calcium-‐dependent adaptation of the channel upon cold or agonist stimulation (McKemy, Neuhausser et al. 2002). Like many sensory systems, cold receptors adapt to prolonged cold stimuli, a process that is essential for signal discrimination in a changing thermal environment (Darian-‐Smith, Johnson et al. 1973; Campero, Serra et al. 2001). In vitro, recombinant TRPM8 channels also adapt or desensitize to prolonged cold stimulation in a manner that is Ca 2+ -‐ 5 dependent (McKemy, Neuhausser et al. 2002). The mechanism of adaptation was recently demonstrated to be a negative feedback loop due to cleavage of the membrane lipid phosphatidylinositol-‐(4,5)-‐bisphosphate (PIP2) via calcium-‐dependent activation of cytosolic phospholipase C (PLC) (Liu and Qin 2005; Rohacs, Lopes et al. 2005; Daniels, Takashima et al. 2009). Evidence suggests that an influx of calcium ions through the channel activates Ca 2+ -‐sensitive PLCδ isozymes, likely PLCδ3 or 4 (Daniels, Takashima et al. 2009), which cleaves PIP2 in the inner leaflet of the plasma membrane into the second messengers diacylglycerol (DAG) and inositol¬(1,4,5)-‐trisphosphate (IP3). Since the direct association of PIP2 with TRPM8 is necessary for normal channel function, its enzymatic cleavage or removal by PIP2-‐scavenging molecules results in the reduction of TRPM8 currents (Liu and Qin 2005; Rohacs, Lopes et al. 2005; Daniels, Takashima et al. 2009). Subsequent stimulation of the channel is impaired until normal PIP2 levels are restored, which can be achieved by warming the cell to physiological temperatures and PIP2 resynthesis by PI-‐kinases (Liu and Qin 2005; Daniels, Takashima et al. 2009). As PLC is a common downstream effector protein of many cell surface signaling receptors (Basbaum, Bautista et al. 2009), this form of regulation likely strongly influences cold signaling via TRPM8 (Daniels, Takashima et al. 2009). Specifically, if the rate of PIP2 breakdown is larger than synthesis, activation of TRPM8 channels would produce a less-‐than-‐optimal change in membrane potential, thereby necessitating a more robust stimulus for nerve activation. This may influence cold signaling in two ways. First, under pathological conditions which lead to increased PLC activity, cold 6 receptors may require a more robust stimulus for activation. For example, cold and menthol evoked responses are diminished in DRG neurons treated with inflammatory mediators such as bradykinin, prostaglandin E2, or histamine (Linte, Ciobanu et al. 2007). Second, some cell types may have intrinsically lower PIP2 levels due to differential effects of breakdown/synthesis pathways. Thus, in this scenario, reduced TRPM8¬mediated currents are present, thereby requiring a stronger stimulus for activation. Precedence for lower levels of functional TRPM8 expression has been reported in vitro for cold-‐sensitive cells with significantly colder thresholds for activation (Madrid, de la Pena et al. 2009). Thus, one postulate for TRPM8 function in innocuous cool versus noxious cold signaling afferents could include differential levels of PIP2 and/or PIP2 synthesis and degradation pathways. The physical mechanism of temperature sensing for TRPM8, as well as other thermosensitive TRP channels, is an area of intensive study. Both TRPV1 and TRPM8 do show some voltage-‐dependency in that each is characterized as having currents with strong outward rectification (Caterina, Schumacher et al. 1997; Tominaga, Caterina et al. 1998; McKemy, Neuhausser et al. 2002). These properties suggest that activation by temperature and voltage are intimately linked, as temperature has been shown to affect the maximum open probability of the channel in response to voltage changes, and a change in the channel’s ability to sense voltage affects its thermal gating (Brauchi, Orio et al. 2004; Voets, Droogmans et al. 2004; Voets, Owsianik et al. 2007). For instance, neutralization of positively charged residues in the fourth transmembrane domain (S4) 7 and the S4-‐S5 linker domain of the channel reduce the number of gating charges, suggesting that this is the site of a voltage sensor (Voets, Owsianik et al. 2007). However, there is evidence that temperature-‐, agonist-‐, and voltage-‐dependent gating are independent processes since distinct activation domains for each have been identified, suggesting that the effect of one gating mechanism acts on another in an allosteric fashion (Brauchi, Orio et al. 2004; Brauchi, Orta et al. 2006; Brauchi, Orta et al. 2007; Matta and Ahern 2007; Daniels, Takashima et al. 2009). For example, chimeric TRPM8 and TRPV1 channels suggest that the temperature sensor is a modular C-‐ terminal domain and not associated with the S4-‐S5 domains previously linked to temperature and voltage sensing (Brauchi, Orta et al. 2006; Voets, Owsianik et al. 2007). Similarly, PIP2-‐ and PLC-‐mediated adaptation leads to a change in the voltage dependence of the channel but does not alter thermal sensitivity of TRPM8 channels (Daniels, Takashima et al. 2009). This, as well as recent evidence of the dissociation of thermal and voltage gating in TRPV1, suggests that the mechanisms of activation of TRPM8 by cold and by voltage, although related, are separate processes (Voets, Droogmans et al. 2004; Daniels, Takashima et al. 2009; Grandl, Kim et al. 2010). It should be noted, however, that despite these distinct activation domains certain TRPM8-‐specific antagonists have been shown to inhibit more than one process (Lashinger, Steiginga et al. 2008). 8 TRPM8 confers cold sensation in vivo In 2007, three independent groups created mouse lines in which the trpm8 genomic allele was disrupted which, when bred to homozygosity, were null for functional TRPM8 channels (Bautista, Siemens et al. 2007; Colburn, Lubin et al. 2007; Dhaka, Murray et al. 2007). In a wide array of cellular and behavioral assays, these TRPM8-‐knockout mice were shown to have severe deficits in cold sensation and lacked cold allodynia and analgesia (Bautista, Siemens et al. 2007; Colburn, Lubin et al. 2007; Dhaka, Murray et al. 2007). Classical thermal behavioral assays include a heated or cooled plate from which the animals’ latency to paw withdrawal is recorded as an indicator of thermal sensitivity. While this test is relatively robust for heat, rodent behavior on a cold plate is spurious at best. Indeed, as compared to the hot plate test, the latencies to response in the cold plate test tend to be highly variable from group to group (Daniels and McKemy 2007). Two groups reported no difference between TRPM8-‐knockout mice and their wildtype littermates when placed on cold plates held at 10, 0,-‐1,-‐5 or -‐10°C (Bautista, Siemens et al. 2007; Dhaka, Murray et al. 2007), while a third group did find a significant difference on a 0°C cold plate test (Colburn, Lubin et al. 2007). Furthermore, the time to paw withdrawal at near freezing temperatures for wildtype mice ranged from 5-‐50 seconds (5, 20, and 50 seconds) between the three studies. These significant differences in animal behavior highlight the difficulty of these assays, and demonstrate the need for additional experimental paradigms. 9 With such variability in the cold plate assay, a variation on this approach using lightly restrained mice was reported recently (Gentry, Stoakley et al. 2010). This method allows for easier measurements of both paws independently as only one is placed on a cold plate at a time. Additionally, this assay eliminates any confounds caused by whole body exposure to cold and subsequent reduction in mobility as seen in the cold plate assay. However, the act of restraining and habituating the animals to being restrained can be problematic. Using this assay, Gentry et al. found that TRPM8 knockout mice had significantly higher withdrawal latencies than wildtype when their hind paws were placed on a 10°C plate (WT=~15s, TRPM8-‐KO=~29s), thus reaffirming that TRPM8 plays a role in cold sensation (Gentry, Stoakley et al. 2010). The use of the evaporative cooling assay, in which acetone is applied to the hind paw, has further implicated TRPM8 in this process, with two groups both showing reductions in acetone-‐evoked behaviors in TRPM8 knockout mice (Bautista, Siemens et al. 2007; Dhaka, Murray et al. 2007). In addition, TRPM8 knockout mice appear to have altered thermal preference as seen by their spending the majority of their time in the 26-‐27°C range, differing significantly from the 30-‐31°C range seen in wildtypes, on a thermal gradient from 15-‐53.5°C (Dhaka, Murray et al. 2007). The two-‐temperature choice assay has also proven to be a useful tool in characterizing the role of TRPM8 in cold sensation (Fig. 1.1A). Mice are placed in a chamber and given a choice between two surfaces held at different temperatures. If both surfaces are maintained at 30°C—the optimal, or “thermoneutral,” surface 10 temperature for normal mice (59)—they will explore the entire chamber and spend an equal amount of time on each surface. If one surface is held at a cooler temperature, wildtype mice show a strong preference for 30°C by spending the majority of the time on that warmer surface. However, Bautista et al., showed that TRPM8-‐knockout mice display no preference for the 30°C surface when the test plate is held at temperatures down to 15°C (Bautista, Siemens et al. 2007). Thus, mice lacking intact TRPM8 channels cannot discriminate between warm and putative innocuous cool temperatures. Once temperatures drop into the noxious range (10 and 5°C), TRPM8-‐knockouts display a preference for the warm side, albeit less than what is observed for wildtype mice (Bautista, Siemens et al. 2007). Data by Dhaka and colleagues support these findings using a variety of temperature pairings (Dhaka, Murray et al. 2007). Since cool temperatures in the range of 15-‐30°C are generally considered innocuous while lower temperatures are noxious, at first approximation these data suggest not only a TRPM8-‐ dependent mechanism for innocuous cold transduction, but also the presence of a TRPM8-‐independent mechanism for noxious cold transduction. Yet, Colburn et al. reported a clear effect of knocking out TRPM8 when the temperatures were set to room temperature (~25°C) and 5°C with wildtypes showing a strong preference for the warmer temperature whereas the knockouts showing no preference between the two (Colburn, Lubin et al. 2007). This incongruity suggests that the interpretation of these results deserves a reexamination. Although two mouse lines lacking functional TRPM8 were shown to 11 spend more time on the plate held at 30°C than the one held at 10°C or lower, it is not clear if this preference for warmth is due to a drive to avoid a detected unpleasant stimulus, or perhaps, as we would suggest, results from a concurrent drive to seek/remain in a comfortably warm environment (Fig. 1.1A-‐B). Such a signal may be vital for proper maintenance of body temperature, and in the absence of this input (perhaps signaled through warm-‐tuned fibers) animals would actively seek a thermoneutral environment. TRPM8-‐knockout mice may not be able to discern the noxious cold signal, but are attracted to the thermoneutral 30°C surface, thus displaying a preference for the warmer side in absence of any purely cold-‐sensory behaviors. Indeed, in the above example from Colburn et al., setting up the assay so the warmer side is set to a temperature below the thermoneutral point (25°C) abolishes the confound of this warmth-‐seeking drive (Colburn, Lubin et al. 2007). Further support for our hypothesis comes from a subtly different interpretation of the two-‐temperature plate assay data that our lab recently reported (Knowlton, Fisher et al. 2010). When the number of times an animal crosses from the 30°C surface to the test surface and back again is counted, wildtype mice show a precipitous drop in the number of crossing events as one plate is cooled (Knowlton, Fisher et al. 2010). In this light, the two-‐temperature choice assay can be viewed as an operant conditioning assay, with the discomfort and/or pain from the cold surface serving as the punishment for sampling that part of the chamber, thus resulting in fewer excursions into that portion of the chamber for the remainder of the testing period regardless of a 12 concurrent drive to seek a comfortably warm surface. Furthermore, in this paradigm, a single sampling of a stimulus within the noxious cold range could be sufficient to result in an immediate drop in the behavior, namely the exposure of the paws to the aversive cold surface. Indeed, when the test plate is held at 5°C, wildtype mice cross the threshold between the two surfaces an average of two times (from warm to cold and back again), indicating that one exposure to the aversive stimulus is sufficient to steeply reduce the sampling behavior (Knowlton, Fisher et al. 2010). If TRPM8 was only responsible for signaling within the innocuous range of temperatures, it could be argued that as the temperature of the paw skin cools from warm to cool to noxiously cold, wildtype mice use the initial innocuous phase of skin cooling as a cue for the impending noxious stimulus, while TRPM8 mice would not have this information and thus would not respond until skin temperatures reached the noxious range. If this were so, then we would expect the aversive stimulus to still be effective in this conditioning paradigm and the TRPM8-‐knockout mice should display reduced crossings with lower temperatures. However, TRPM8-‐knockout mice show no avoidance at even 5°C with a crossing rate equal to when both surfaces are held at 30°C, clearly indicating that the mice fail to sense the aversive stimulus (Knowlton, Fisher et al. 2010). It is important to note two additional points: 1. this temperature (5°C) is indeed noxious, since experiments with wildtype mice have shown that, counter intuitively, the chill of 5°C is actually more aversive than the heat of 45°C, and 2. TRPM8-‐knockout mice are still able to sense and avoid noxious stimuli since they avoid a hot surface of 45°C (Colburn, Lubin et al. 2007). 13 These data, along with the observation that even at 5°C TRPM8-‐knockouts show small but significant impairment in preference for 30°C than their wildtype counterparts, suggest that the preference quantification method of the two-‐temperature choice assay may be assessing multiple behavioral drives than simply cold-‐sensory responses, and that TRPM8 does in fact mediate at least a significant component of noxious cold sensation. Consistent with these results, chemical-‐evoked cooling and in vivo measures of neural activity also point to TRPM8 as a noxious cold transducer (Dhaka, Murray et al. 2007; Knowlton, Fisher et al. 2010). For example, intraperitoneal administration of the super-‐cooling agent icilin produces a distinct “wet dog shake” behavior, characterized by prolonged grooming and shaking (Wei and Seid 1983). Strikingly, this behavior is completely abolished in TRPM8-‐knockout mice (Dhaka, Murray et al. 2007). Similarly, hind paw injections of icilin induce a robust nocifensive flinching and guarding response that is absent in TRPM8-‐nulls (Knowlton, Fisher et al. 2010). Furthermore, neural activation of cold-‐sensing circuits, as measured by activation of the immediate early gene c-‐Fos in the spinal cord, was found to be TRPM8-‐dependent in response to menthol, icilin, and 0°C stimuli (Knowlton, Fisher et al. 2010). Thus, a role for TRPM8 in noxious cold transduction appears to be likely, but why all aspects of noxious cold sensing, using current behavioral assays, cannot be accounted for by TRPM8 remains to be fully explained. 14 FIGURE 1.1 Temperature preference and temperature avoidance in TRPM8 -‐/-‐ mice A) In the temperature preference assay the proportion of the testing period that the mice spend on each plate is measured with a 50% reading for any given plate indicating no preference. As the temperature of one of the plates is lowered, WT mice spend a greater proportion of the testing period on the 30°C plate, while KO mice show little to no preference for the 30°C plate. KO mice do show some preference for the 30°C plate when the test plate is set to 5°C; however, their responses are still reduced compared with WT mice. This can be explained by the presence of two partially overlapping drives: a discomfort avoidance drive, and a thermoregulatory drive to maintain proper bodily temperatures by reducing the thermoregulatory burden. At warm or mildly cool temperatures, this second drive does not significantly affect animal behavior, thus the behavior is driven solely by the discomfort avoidance drive. However, at noxious cold temperatures, this autonomic drive would engage and direct the behavior of both WT and KO mice to spend more time in the thermoregulation-‐ favorable environment. B) Thermal avoidance is quantified as the number of times the mouse crosses the plate boundary, with WT mice showing dramatically reduced numbers of crossings as the test plate temperature is lowered. The KO mice, on the other hand, continue crossing at a high rate regardless of the temperature of the test plate. Since the autonomic thermoregulatory drive in (A) would not be involved in crossing behavior, only the discomfort drive would be influencing this behavior. Since KO mice show no changes in crossings across the temperatures tested, this indicates that TRPM8 is responsible for the detection of both innocuous and noxious cold through the skin. 15 Cold and chronic pain Outside of acute thermosensation, TRPM8 also plays a role in cold hypersensitivity in conditions of chronic pain. After injury, painful stimuli become more intense (hyperalgesia) and normally innocuous stimuli become painful (allodynia). Both cold hyperalgesia and allodynia are well-‐documented phenomena in chronic pain patients, and behavioral assays testing induced models of chronic pain in animals have been developed (Zimmermann 2001). Rodents with induced chronic pain show both hyperalgesia and allodynia in a variety of thermal and mechanical behavioral assays, including tests of cold responses. Using the cold plate test, rats with neuropathic (using the chronic constriction injury, or CCI, model) or inflammatory (using injection of Complete Freund’s adjuvant, or CFA, into one hind paw) pain show a marked increase in both the number and duration of paw withdrawals from a noxious cold surface (Bennett and Xie 1988; Jasmin, Kohan et al. 1998; Allchorne, Broom et al. 2005). In another model of neuropathic pain (spinal nerve ligation, or SNL), rats exhibit a heightened response to normally innocuous evaporative cooling via the application of acetone to the affected hind paw (Choi, Yoon et al. 1994), as well as reduced latencies in paw-‐ withdrawals on a cold plate (Allchorne, Broom et al. 2005). Colburn et al. directly investigated the role of TRPM8 in both the CCI and CFA chronic injury models using TRPM8-‐knockout mice (Chung and Caterina 2007). In both models, TRPM8-‐null mice exhibited significantly lower response intensities and durations in the evaporative cooling assay as compared to injured wildtypes. Importantly, hypersensitivity to heat 16 and mechanical stimuli remained intact in TRPM8¬nulls, indicating that the deletion of TRPM8 specifically affected cold hypersensitivity and no other aspects of chronic pain hypersensitivity. Although differing results in the noxious cold-‐plate test under normal conditions have been reported for TRPM8-‐null mice, the role of TRPM8 in cold hyperalgesia in this assay has not yet been reported (Bautista, Siemens et al. 2007; Colburn, Lubin et al. 2007; Dhaka, Murray et al. 2007). Almost paradoxically, TRPM8 is also involved in cooling-‐mediated analgesia. Cold packs and cooling compounds such as menthol have long been used for their analgesic properties in treatment of both acute and chronic pain symptoms. In an elegant study, Proudfoot and colleagues reported that activation of TRPM8 by moderate cooling or cooling chemicals results in analgesia in the CCI and CFA models (Proudfoot, Garry et al. 2006). In mice treated with either topical or intrathecal menthol or icilin, thermal (heat) and mechanical hypersensitivities were nearly abolished ipsilateral to the injury. Intrathecal application of TRPM8-‐directed antisense oligonucleotides eliminated this analgesic effect, providing a direct link between TRPM8 and analgesia. These findings were further corroborated by Dhaka and colleagues with studies in TRPM8 knockout mice using formalin, a compound which elicits acute followed by inflammatory pain (Dhaka, Murray et al. 2007). When wildtype mice were given a single hind paw injection of formalin, they exhibited fewer nocifensive responses during both acute and inflammatory pain phases when placed on a cool 17°C surface. This effect was lost in injected TRPM8-‐knockout mice placed on a cool surface. Of note, Proudfoot et al. 17 observed that if analgesic cooling was more than moderate (i.e. less than 15°C and therefore in the noxious cold range), then the stimulus was switched to a hyperalgesic effect (Proudfoot, Garry et al. 2006). Again, it remains unclear whether the hyperalgesic effect of cold in chronic pain is due to TRPM8 or other receptors, but it will be intriguing to explore how this one channel is involved in such diverse actions as thermosensation, nociception, hypersensitivity, and analgesia. How can TRPM8 mediate both innocuous cool and noxious cold? In humans, the sensation of cold has been shown to be mediated by both myelinated Aδ-‐ and unmyelinated C-‐fibers (Campero, Serra et al. 2001). Psychophysical studies in humans have shown that the sensation of cool begins at temperatures below 30°C and becomes painful at temperatures below 15°C (Morin and Bushnell 1998). Cold-‐sensitive Aδ fibers have been generally accepted to convey innocuous cool sensation, as selective block of these fibers significantly impairs cool temperature discrimination (Mackenzie, Burke et al. 1975). Recent research, however, has shown a substantial amount of overlap between the cold responsive properties of what are considered to be nociceptive (C) and non-‐nociceptive (Aδ) fibers, and suggests a more complex view of cold sensation and the roles of specific fiber types (Campero, Baumann et al. 2009). Furthermore, it has been suggested that the burning sensation associated with extreme cold is mediated by a class of polymodal cold-‐sensitive C fibers which also respond to heat (Campero, Serra et al. 2001; Campero, Baumann et al. 2009). Other 18 factors, including skin type and cooling rates have also been shown to further diversify cold sensation (Harrison and Davis 1999). How does TRPM8 fit into this seemingly complex picture of the different modalities of cold sensation? Although TRPM8 was originally cloned out of a sensory neuron cDNA library, its expression patterns in the body were unknown. Recently, the use of genetically encoded axonal tracers (such as GFP) has allowed the labeling of TRPM8-‐expressing afferents in vivo (Takashima, Daniels et al. 2007; Dhaka, Earley et al. 2008). This technique has enabled the visualization of TRPM8-‐expressing neurons with robust GFP labeling in afferents projecting to the skin, where innervation can be sparse (Takashima, Daniels et al. 2007). Consistent with the broad range of cold-‐related behaviors reported, TRPM8+ neurons express both nociceptive and non-‐nociceptive markers as well as markers for both Aδ-‐ and C-‐fibers. Furthermore, TRPM8 axon terminals can be observed in both the skin and the tooth, a highly cold-‐sensitive organ, in at least two distinct peripheral regions with unique reported pain-‐sensing characteristics, supporting the hypothesis that the overall population of TRPM8 + neurons is quite diverse in function, containing both nociceptors and non-‐nociceptors (Jyvasjarvi and Kniffki 1987; Morin and Bushnell 1998; Takashima, Daniels et al. 2007). How is this diversity in expression phenotype correlated to function? As discussed above, sodium and potassium currents can affect a cell’s ability to fire action potentials, and both the sodium channel Nav1.8 and Kv1 potassium channels have been implicated in cold responses (Zimmermann, Leffler et al. 2007; Abrahamsen, Zhao et al. 19 2008; Madrid, de la Pena et al. 2009). Nav1.8, a tetrodotoxin-‐resistant sodium channel expressed in peripheral sensory neurons, is resistant to the cold-‐induced inhibition seen in all other sodium channels (Zimmermann, Leffler et al. 2007). Although cold does not cause this channel to fire action potentials directly, it reduces the voltage-‐activation threshold for the channel making it more sensitive to changes in membrane currents (such as those generated by TRPM8). Mice lacking the Nav1.8 gene, or whose Nav1.8-‐ expressing neurons have been genetically ablated, show severe deficits in responses to cold stimuli as well as to mechanical stimuli and inflammatory hypersensitivity (Zimmermann, Leffler et al. 2007; Abrahamsen, Zhao et al. 2008). Menthol-‐evoked sensitization of cold fibers was retained, although significantly reduced, in the presence of TTX in wildtype mice, but completely abolished in Nav1.8-‐null mice (Zimmermann, Leffler et al. 2007). Indeed, we have found that greater than one-‐quarter of TRPM8-‐ expressing neurons in the mouse are immunoreactive for Nav1.8 (R. Romanu, W.M. Knowlton, D.D. McKemy unpublished observations). Thus these data suggest that TRPM8 and Nav1.8 function in noxious cold receptors, and that Nav1.8 likely acts as the second step in the cold transduction process, turning the initial currents generated by TRPM8 into action potentials. As for potassium channels, provocative data suggests that the relative expression of TRPM8 and hyperpolarizing potassium conductances are critical in determining a neuron’s thermal threshold (Madrid, de la Pena et al. 2009). Several groups have reported that cold-‐sensitive neurons in vitro fall into two loosely related 20 categories, those with a low-‐ (LT) or high-‐thermal (HT) activation threshold responding at either innocuous cool or noxious cold temperatures, respectively (Fig. 1.2A) (Reid, Babes et al. 2002; Thut, Wrigley et al. 2003; Madrid, de la Pena et al. 2009). Madrid et al. recently reported that menthol exerts a more prominent effect on LT cold-‐sensitive neurons in comparison to the HT population; a difference to which they postulated is due to decreased TRPM8 channel expression in the latter cell type (Madrid, de la Pena et al. 2009). This same study also found a correlation between temperature threshold and the level of expression of a voltage-‐dependent slowly inactivating K + current, termed IKD. Specifically, cells with a high temperature threshold expressed high levels of IKD currents which were attributed to Kv1 channels. Thus, these results indicate that neurons which fall into the LT subtype and likely mediate responses to innocuously cool temperatures express high levels of TRPM8, but have low expression of a particular type(s) of Kv1 channel (Madrid, de la Pena et al. 2009). Conversely, the expression ratios of TRPM8 and Kv1’s are reversed in the HT subtype, thereby necessitating a more robust thermal stimulus to activate sufficient TRPM8 currents in order to overcome the excitability brake established by the K + conductances (Fig. 1.2B). This attractive model provides a robust explanation for the range of cold responses that TRPM8 has been shown to mediate in vivo. However, the molecular identification of the critical components of the K + conductances has yet to be elucidated, and the contribution of other ionic conductances (e.g. Nav1.8, TREK-‐1, TRAAK) that have been shown to be 21 important for cold transduction have not been incorporated into this functionally distinct cellular model. FIGURE 1.2 Model for innocuous cool vs. noxious cold TRPM8 afferent subtypes Cold-‐sensitive neurons respond to different threshold stimuli and are characterized by differential molecular landscapes. A) Low threshold (LT) cold-‐sensitive neurons respond to innocuous stimuli starting ~25°C, while high threshold (HT) cold-‐sensitive neurons respond to noxious stimuli starting ~15°C. B: LT neurons are predominantly controlled by heightened TRPM8-‐mediated currents due to high channel expression and/or activity regulated by high levels of phosphatidylinositol-‐(4,5)-‐ bisphosphate (PIP2) (the substrate for PLCδ). Potassium brake currents associated with voltage-‐gated potassium channels belonging to the Kv1 family are reduced relative to HT neurons, resulting in more easily excitable cells. Unknown voltage-‐gated sodium channels may also be involved in LT cold transduction. HT neurons have reduced TRPM8-‐mediated currents due to low expression and/or activity facilitated by lower levels of PIP2. They are strongly influenced by heightened potassium brake currents coming from channels such as Kv1, TREK, and TRAAK. HT cold-‐sensing neurons also express the voltage-‐gated sodium channel Nav1.8 (a cold-‐insensitive channel), which directly facilitates action potential generation at lower temperatures where other sodium channels would be inhibited. 22 Conclusion: TRPM8 as a Therapeutic Target TRPM8’s involvement in the development of cold hypersensitivity has made it an ideal target for the treatment of various forms of chronic pathological cold pain. Diabetes is often accompanied by some forms of polyneuropathy as a result of the direct, toxic effects of glucose on nerve cells, and in some cases this can manifest itself as cold hyperalgesia (Pluijms, Huygen et al. 2010). The chemotherapeutic drug oxaliplatin is also known to result in moderate to severe cold dysesthesia (Attal, Bouhassira et al. 2009). Both of these conditions can be debilitating, and with no specific treatments available patients are often left with no options for directly alleviating their symptoms. Future development of TRPM8-‐specific antagonists could be the answer for these patients, but as it stands now, no published antagonist has been found without significant off-‐target effects (Behrendt, Germann et al. 2004; Madrid, Donovan-‐Rodriguez et al. 2006; Malkia, Madrid et al. 2007; Lashinger, Steiginga et al. 2008; Meseguer, Karashima et al. 2008). As mentioned above, TRPM8 has been implicated in both injury-‐related cold hypersensitivity as well as the widely known analgesic effects of both mild cooling and menthol, a paradox which remains to be explained and further complicates the channels therapeutic potential (Proudfoot, Garry et al. 2006; Colburn, Lubin et al. 2007). Studies have shown that TRPM8 agonists like menthol and icilin can both facilitate and alleviate itch depending on dosage and application (Han JH Khoi HK 2012)(Patel T Yosipovitch G, 2010) (panahi Y Davoodi SM, 2007) (Bromm B Scharein E, 1995) (Yosipovitch G Szolar C 23 1996) (Lucaciu OC Connel GP, 2013). The TRPM8-‐dependence of these effects has yet to be tested and therefore, the role of TRPM8 in itch remains an intriguing topic for future investigation. Furthermore, TRPM8 has been shown to be expressed in a number of cell types in which there appears to be no thermosensory function: bladder, lungs, heart, and prostate to name a few (Stein, Santos et al. 2004; Yang, Lin et al. 2006; Sabnis, Shadid et al. 2008). The TRPM8 antagonist N-‐(3-‐aminopropyl)-‐2-‐{[(3¬methylphenyl) methyl]oxy}-‐ N-‐(2-‐thienylmethyl)benzamide hydrochloride salt (AMTB) has been shown to diminish the frequency of volume-‐induced bladder contractions in rat models of overactive and painful bladder syndrome for instance (Lashinger, Steiginga et al. 2008). Additionally, TRPM8 expression has been shown to be up regulated in a number of cancers including prostate, breast, skin, colorectal, lung and bladder, and could have additional therapeutic relevance in regards to their treatment (Tsavaler, Shapero et al. 2001; Yamamura, Ugawa et al. 2008; Li, Wang et al. 2009). Although the main known function of TRPM8 lies in cold transduction, the expression of TRPM8 in tissues not exposed to environmental changes in temperature leaves the door open for a multitude of other possible therapeutic applications. Before these avenues can be explored however, research must first be done to determine its function in tissues of interest. Here we describe novel findings that further expand our knowledge relating to the channel properties of TRPM8 and the role it plays outside of thermosensation. Our in vivo studies in mice show TRPM8-‐dependent regulation of insulin clearance that 24 correlates with both the presence of TRPM8-‐expressing neuronal projections in the HPV and an enhanced liver expression of Insulin-‐degrading enzyme. Additionally, we show that activation of the TRPM8 channel can be used as a means of delivering large cationic molecules to cold-‐sensing neurons, a method which opens the door to new treatment methodologies targeted at conditions of chronic cold hypersensitivity. Finally, we will discuss the development of a transgenic mouse line that allows for the screening of genes associated with TRPM8-‐expressing cell populations. Such screens, under normal and pathological conditions, will help to identify new targets and pathways involved in cold-‐pain and have the potential to enhance our understanding of TRPM8-‐expressing cells both inside and outside of the peripheral nervous system. 25 CHAPTER TWO Enhanced insulin clearance in mice lacking TRPM8 channels Adapted from: McCoy, D.D., Ngyuyen, A.K., Watts, A.G., Donovan, C.M., and McKemy, D.D. (2013). Enhanced insulin clearance in mice lacking TRPM8 channels. American Journal of Physiology Endocrinology and Metabolism. 305(1): E78-‐88. 26 INTRODUCTION Many TRP family cation channels are essential for the detection of environmental stimuli and their functional role in somatosensation is well-‐established (Basbaum, Bautista et al. 2009). However, these channels are also expressed in primary sensory neurons innervating internal tissues, where the environment changes little, and likely monitor the body’s internal environment (Uchida and Tominaga 2011). For example pancreatic sensory neurons expressing TRPV1, a noxious heat-‐gated ion channel that is the receptor for capsaicin, the “hot” ingredient in chili peppers, mediate insulin resistance and islet inflammation (Razavi, Chan et al. 2006). Furthermore, TRPV1 + neurons innervate the hepatic portal vein (HPV) and are involved in the detection of hypoglycemia (Fujita, Bohland et al. 2007). Complicating the neuronal role of these channels, recent evidence suggests many are also expressed in non-‐neuronal tissues and involved in other cellular processes related to glucose metabolism. TRPV1 expression has been reported in pancreatic β-‐cell lines where it may modulate insulin secretion (Akiba, Kato et al. 2004), although it is not clear if TRPV1 is expressed in native β-‐cells (Uchida and Tominaga 2011). Similarly, TRPA1, a broad spectrum irritant receptor (Jordt, Bautista et al. 2004), is found in native β-‐cells and its activation by endogenous ligands induces insulin release via an increase in intracellular calcium (Cao, Zhong et al. 2012). Lastly, several TRPM channels mediate insulin secretion by sensing changes in intracellular second-‐messengers such as Ca 2+ and NAD metabolites, and are integral in regulation through hormone receptors (Uchida and Tominaga 2011). Thus, 27 TRP ion channels appear to be novel regulators of insulin secretion and pancreatic function yet, mechanistically, their role in such processes is unclear. Like TRPV1, TRPM8 is a temperature gated ion channel activated by cool to cold temperatures and mediates the psychophysical sensation of cold associated with menthol, the active ingredient in mint (McKemy, Neuhausser et al. 2002; McCoy, Knowlton et al. 2011). TRPM8 is the predominant mediator of cold perception in mammals owing to its robust expression in a subset of peripheral sensory neurons (Takashima, Daniels et al. 2007). However, TRPM8 has non-‐somatosensory functions in tissues such as the bladder where it has been implicated in the bladder micturition reflex and over-‐active bladder syndromes (Mukerji, Yiangou et al. 2006; Lashinger, Steiginga et al. 2008). TRPM8 was initially identified in prostate and its expression is androgen-‐dependent and elevated in the initial stages of epithelial prostate malignancies, making the channel a potential marker for prostate cancer (Tsavaler, Shapero et al. 2001; Zhang and Barritt 2006). Nonetheless, a role for TRPM8 outside of the peripheral nervous system has yet to be established. Here we report data suggesting that mice with a targeted mutation in the Trpm8 gene (Trpm8 -‐/-‐ ) (McKemy, Neuhausser et al. 2002; Bautista, Siemens et al. 2007) have heightened insulin sensitivity likely due to compensatory mechanisms related to enhanced insulin clearance, results demonstrating a novel role for this channel in insulin homeostasis. 28 MATERIALS AND METHODS Breeding Scheme Trpm8 -‐/-‐ mice are of the C57BL/6 genetic background and were obtained from The Jackson Laboratory. For weight tracking and food intake studies Trpm8 -‐/-‐ and wildtype (both littermates and aged matched C57/Bl6 mice from Jackson) were used, generated from crosses of heterozygous animals (Trpm8 +/-‐ ) as described (Bautista, Siemens et al. 2007; Knowlton, Bifolck-‐Fisher et al. 2010; Knowlton, Daniels et al. 2011; Knowlton, Palkar et al. 2013). All experiments were approved by the University of Southern California (USC) Institutional Animal Care and Use Committee and performed in accordance with the recommendations of the National Institutes of Health Guide for the Care and Use of Laboratory Animals. STZ experiments All animals used were males aged 8-‐12 weeks of age (C57/BL6 background). 180mg/kg of streptozotocin was administered by intraperitoneal injection (i.p.). Bodyweight and blood glucose were then monitored at varying intervals over a 2 week period. DAB Labeling for Islet size quantification Fixed/frozen pancreatic sections (10µm) were thawed for 10min and permeabilized in PBST (0.1M PBS, 0.1% Triton X-‐100) for 30min. Sections were pre-‐ 29 treated in 1% H 2 O 2 for 30min, washed 3 times for 5min in PBST, and blocked for 1hr in 5% normal goat serum (NGS)/PBST. Sections were then incubated overnight at 4°C in primary antibody solution containing 1:500 diluted guinea pig anti-‐insulin (AB7842, Abcam) in 1% NGS/PBST, washed as before, and incubated in 1:200 diluted biotinylated rabbit anti-‐guinea pig secondary antibody (Vectastain ABC kit) in 1% NGS/PBST for 1hr at room temperature. After 3 washes slides were incubated in ABC reagent for 1hr at room temperature, washed again as before, and incubated first for 15min in DAB solution (DAB in PBS) and then for 5min in DAB solution + 0.003% H 2 O 2 . Slides were then washed 3 more times, cover slipped, and analyzed. Islet isolation After clamping the duodenum on both sides of the major duodenal papilla, the pancreas was inflated via the common bile duct with 3ml of collagenase solution (1X HBSS pH 7.4, 1mM CaCl 2 , 1mg/ml Collagenase XI) using a 30½G needle. The inflated pancreas was then removed and incubated in 2ml of collagenase solution for 25min at 37°C with frequent vigorous mixing by hand. Collagenase digestion was stopped by adding 25ml of ice cold re-‐suspension solution (1X HBSS pH 7.4, 1mM CaCl 2 ) and the cells were pelleted at 500g for 30s. The above steps were repeated 2 times to wash the pellet. The cell suspension was then filtered through a 70µm nylon filter, and washed over with 25ml of re-‐suspension solution. The nylon filter was then turned upside down and any islets stuck to the filter surface were washed off using 10ml of growth media 30 (RPMI 1640 media, 20mM L-‐glutamine, 100U/ml penicillin, 100µg/ml streptomycin, 10% FBS). Islets were then picked by pipette and allowed to recover for 2hrs in a 37°C 5% CO2 humidified incubator before use. Static insulin secretion assay Similarly sized islets (approx. 100-‐200µm in diameter ) were grouped into sets of 10, added to 1ml of assay solution (10mM HEPES pH 7.4, 129mM NaCl, 4.7mM KCl, 1.2mM KH 2 PO 4 , 2mM CaCl 2 , 5mM NaHCO 3 , 2.8mM glucose, 0.1% BSA), and allowed to equilibrate for 30min in the incubator. Each set of 10 islets was then added to a baseline well of a 24-‐well plate containing 1ml of assay solution. After 15min the islets were then promptly removed from the baseline well and added to an experimental well containing assay solution with 16.8mM glucose or 40mM KCl depending on the experiment. After 15min the islets were removed from the experimental well and insulin content quantified using the Insulin (Mouse) Ultrasensitive ELISA kit (ALPCO). Total Pancreatic insulin content Each mouse pancreas was incubated in 10ml of Acid-‐Ethanol solution (1.5% HCl in 70% EtOH) overnight at -‐20°C, homogenized, and then incubated again overnight at -‐ 20°C. Extracts were centrifuged at ~850g at 4°C for 15min and samples were neutralized by adding an equal volume of 1M Tris pH7.5 solution. Insulin content was measured 31 using the Insulin (Mouse) Ultrasensitive ELISA kit (ALPCO) and expressed as a function of total protein content found via Bradford assay. qPCR/RTPCR RNA was isolated from RNAlater ICE-‐stabilized tissue using the RNeasy mini kit with in-‐column DNAse digestion (Qiagen). The iScript cDNA synthesis kit (Bio-‐Rad) was used for synthesizing cDNA from purified RNA samples, and qPCR was carried out using Ssofast EvaGreen supermix (Bio-‐Rad) and a Bio-‐Rad CFX96 detection system. RTPCR experiments were carried out on the same cDNA used for qPCR but a standard Taq polymerase was used in place of Ssofast EvaGreen. The primers used are listed below. Insulin FWD: 5’ TCAGCAAGCAGGTCATTGTTTC 3’ (212bp) REV: 5’ CTTGTGGGTCCTCCACTTCA 3’ PDX1 FWD: 5’ GAAACGTAGTAGCGGGACCC 3’ (457bp) REV: 5’ CAGATCTGGCCATTCGCTTG 3’ GLUT2 FWD: 5’ GATCACCGGAACCTTGGC 3’ (400bp) REV: 5’ GGGCTCCAGTCAATGAGAGG 3’ TRPM8 (5’) FWD: 5’ GCTGCCTGAAGAGGAAATTG 3’ (600bp) REV: 5’ GCCCAGATGAAGAGAGCTTG 3’ TRPM8 (3’)(pore) FWD: 5’ CTTCCGCTCTGTCATCTATG 3’ (127bp) REV: 5’ CACACACAGTGGCTTGGACT 3’ 32 GAPDH FWD: 5’ TGTAGACCATGTAGTGAGGTCA 3’ (123bp) REV: 5’ AGGTCGGTGTGAACGGATTTG 3’ Alpha-‐1-‐anti-‐trypsin FWD: 5’ CCTCTCCGGAATCACAGAGG 3’ (327bp) REV: 5’ GGACTTGCTGTAGCATCAGG 3’ Glucose Tolerance/Insulin Tolerance Tests GTT experiments were carried out on acute (5.5hrs) or overnight (14-‐16hrs) fasted animals. Following 2g/kg IP administration of glucose, blood was sampled from the tail vein every 30mins for 2hrs and glucose levels were measured using an AlphaTRAK (Abbot) blood glucose monitor. For serum insulin measurement, approximately 20µl of blood was sampled at each time point and allowed to clot in serum separator tubes (Sarstedt) for 20mins at room temperature. After clotting, serum was immediately isolated by spinning at 10,000g for 5mins and stored on ice before being frozen at -‐20°C upon completion of the experiment. Serum insulin and C-‐ peptide was then measured using the Insulin (Mouse) Ultrasensitive ELISA kit and (Mouse) C-‐peptide ELISA kit per manufacturer’s instructions (ALPCO). ITT experiments were carried out on fed or acute fasted animals. Following 0.75U IP administration of recombinant Humulin (Lilly), blood glucose was measured as described previously, every 15mins for 1hr and every 30mins for an additional 1hr. 33 Core temperature monitoring and activity measurements Mice were implanted with G2 e-‐mitters (Mini Mitter, Bend, OR) as described (Knowlton, Daniels et al. 2011), and allowed to recover from surgery for at least one week to ensure the absence of infection and fever. On the day of experiments, animals were acclimated to the experiment room at least one hour prior to the commencement of monitoring. Mice were placed in mouse cages containing food, water bottles and bedding, with the cages placed on top of a telemeter receiver. Core temperature and gross motor activity (detected as a change in location by the telemetric receiver) were collected every 10 seconds for 24-‐48hrs at ambient temperatures of 24°C. Studies began at 6:00 A.M. when the lights were turned on, and the lights were turned off at 6:00 P.M. Data are represented as the mean ± standard error in 10min blocks and statistical significance was determined using a Student’s t-‐test. Western blots and quantification Fresh tissue samples were isolated from wildtype and Trpm8 -‐/-‐ mice and immediately homogenized using a Tissue Tearor model 985-‐370 (Biospec Products, INC) in RIPA buffer containing 0.5% sodium deoxycholate, 1% NP40 and 0.1% SDS. Samples were then incubated for 1hr with agitation at 4°C to ensure complete lysis. After centrifuging at 18,000g for 20mins to remove cellular debris, supernatants were then flash frozen in liquid nitrogen and stored at -‐80°C. 50µg of total denatured protein was run on a 4%/10% polyacrylamide gel and transferred to a PVDF membrane. Membranes 34 were blocked for 1hr at room temperature in 2.5% BSA, 2.5% normal donkey serum (NDS) in PBST (0.1% Tween 20). Primary antibody incubations were carried out overnight at 4°C at dilutions of 1:1000 for each antibody in 1% BSA, 1% NDS in PBST. The primary antibodies used were as follows: Chicken anti B.actin (AB13822, Abcam), Chicken anti GAPDH (AB83956, Abcam), Rabbit anti INSR (SC-‐711, Santa Cruz), Rabbit anti IDE (AB32216, Abcam). After four 5min washes in PBST, secondary antibody incubations were carried out for 30-‐60mins at room temperature at dilutions of 1:15,000 for each antibody in 1% BSA, 1% NDS in PBST plus 0.02% SDS. The secondary antibodies used were as follows: Donkey anti Chicken 680 (926-‐68028, Li-‐Cor), and Donkey anti Rabbit 800 (926-‐32213, Li-‐Cor). After four 5min washes in PBST, membranes were then imaged using a Li-‐Cor model 9120 Odyssey imager. Western band quantification was done using the Gel Analysis tool in ImageJ following standard methods (see http://lukemiller.org/index.php/2010/11/analyzing-‐ gels-‐and-‐western-‐blots-‐with-‐image-‐j/) Band intensities for target proteins were normalized across each membrane and expressed as a percentage of summed intensities for each target. These values were then compared to loading control values from the same membrane to get relative protein expression values. For liver and kidney βactin was used as a loading control and for muscle GAPDH was used. 35 Immunostaining Mice and rats were transcardially perfused with ice cold 4% paraformaldehyde (PFA) solution in 0.1M PBS. Tissues were carefully dissected and post-‐fixed for 2hrs on ice in 4% PFA, and dehydrated in 30% sucrose solution in 0.1M PBS overnight at 4°C. Pancreas tissue was quickly frozen in OCT on dry ice, sectioned with a cryostat at 10µm onto Superfrost Plus slides (VWR) and stored at -‐80°C. Hepatic portal vein (HPV) tissue was cut on one side to flatten and stored in cryoprotectant solution (30% sucrose, 30% ethylene glycol in 0.1M PBS) at -‐20°C. Cryosections were thawed at room temperature for 10mins, permeabilized in PBST for 30mins, washed 3 times in PBS for 5mins and blocked for 1hr at room temperature in PBST + 5% NGS. Primary antibodies were diluted 1:500 in a working solution of PBST + 1% NGS and incubated on the slides overnight at 4°C in a humidified box. The primary antibodies used are as follows: Rabbit anti-‐GFP (A11122, Invitrogen), Chicken anti-‐GFP (GFP1020, Aves), and Guinea pig anti-‐PGP9.5 (AB5898, Millipore). Slides were washed 3 times in PBST for 5mins and incubated in secondary antibody solution (1:1000 secondary antibody, PBST + 1% NGS) for 2hrs at room temperature. The secondary antibodies used were fluorescently conjugated Alexa-‐488 or Alexa-‐ 594(Invitrogen). Slides were washed 3 times in PBST for 10mins and cover slipped with Vectorshield-‐DAPI (Vector Labs), or Prolong Gold (Invitrogen) mounting medium. Imaging was carried out on a Zeiss Axio Imager M2 with Apotome. 36 Hepatic portal vein tissue was stained whole mount. HPV tissue was removed from cryoprotectant and washed 6 times in TBS for 5min, blocked in TBST + 2% NGS for 2hrs at room temperature, and then incubated for 48hrs at 4°C with primary antibody diluted 1:1000 in TBST + 2%NGS. The primary antibodies used were as follows: Chicken anti-‐GFP (GFP1020, Aves), Rabbit anti-‐TRPM8 (C-‐terminus). Tissue was washed 6 times in TBS for 5mins, incubated for 24hrs at 4°C with secondary antibody diluted 1:1000 in TBST + 2% NGS, washed 6 times again with TBS for 5mins, mounted, cover slipped and imaged as described. Statistics All statistical analysis was carried out using the Students unpaired t-‐test, and means are expressed ± standard error of the mean (sem) with p values less the 0.05 considered statistically significant. 37 RESULTS Streptozotocin sensitivity, decreased body weight, and decreased fasting insulin in TRPM8 -‐/-‐ mice Streptozotocin (STZ), a glucosamine-‐nitrosourea compound that causes DNA alkylation and cell death, is commonly used to induce type I diabetes in rodents (Brosky and Logothetopoulos 1969). The diabetogenicity of STZ comes from its structural similarity to glucose allowing the compound to be exclusively taken up by insulin-‐ secreting β-‐cells, resulting in their specific ablation. The ablation of these β-‐cells leads to a reduction in insulin secretion and the development of a type I diabetic/hyperglycemic state. After STZ (180mg/kg) was administered by i.p. injection, we observed a rapid decline in body weight of Trpm8 -‐/-‐ mice (4 of 8 mice) compared to STZ-‐injected control littermates (Fig. 2.1A). These mice were lethargic with matted fur and exhibited some rigidity (Fig. 2.1B), results suggesting that Trpm8 -‐/-‐ mice are highly sensitive to STZ in a model of type I diabetes. Next we asked if Trpm8 -‐/-‐ mice display obvious metabolic abnormalities. On further examination, untreated Trpm8 -‐/-‐ mice were found to be >10% smaller than their wildtype littermates, examined up to 4 months of age (Fig. 2.1C). This was not due to a developmental difference in body size as body length was similar in both male and female wildtype and Trpm8 -‐/-‐ mice (Fig. 2.1D). Moreover, weights of Trpm8 -‐/-‐ mice of both genders were significantly smaller than wildtypes (Fig. 2.1E), despite consuming equivalent amounts of food per day (Fig. 2.1F). 38 FIGURE 2.1 Streptozotocin (STZ) sensitivity in TRPM8 -‐/-‐ mice A) Body weight tracking in wild-‐type and TRPM8 -‐/-‐ mice injected with 180 mg/kg STZ or vehicle (veh: n = 4–6, STZ: n = 4). B) Representative picture of wild-‐type and TRPM8 -‐/-‐ mice 1 wk following STZ administration. C) Weight tracking in male littermates (male and female) from 4–16 wk of age fed normal chow (wt: 24.1 ± 1.0; TRPM8 -‐/-‐ : 21.1 ± 0.3 g by 12 wk, P 0.001, n = 6 each genotype). D) Body length measurements of TRPM8 -‐/-‐ and wild-‐type mice of both sexes. E) Weight tracking in mice from D; P > 0.05 NS, *P < 0.05, **P < 0.01, n = 6–8 mice. Food intake [wt: 3.68 ± 0.11; Trpm8 -‐/-‐ : 3.72 ± 0.09 g/day, P = 0.75 (F); wt: 0.17 ± 0.004, Trpm8 -‐/-‐ : 0.19 ± 0.01 g/day/g body wt, P = 0.01, n = 11–12 (G)]. 39 However, when food intake was adjusted for bodyweight Trpm8 -‐/-‐ mice ate approximately 12% more per day than wildtypes (Fig. 2.1G). TRPM8 is a cold-‐gated ion channel that is known to be involved in hypothermia (Knowlton, Daniels et al. 2011). Therefore we asked whether Trpm8 -‐/-‐ mice had distinct differences in thermoregulation under controlled, non-‐stimulating environments. Wildtype and Trpm8 -‐/-‐ littermates were monitored for diurnal changes in core body temperatures with implantable internal telemetric monitors. Over a 48-‐hr period we observed no differences between each genotype in core body temperature (Fig. 2.2A), nor were they statistically different (p>0.05) between day and night temperatures (Fig. 2.2B). Next, we examined resting blood glucose and serum insulin levels, finding the former comparable in wildtype and Trpm8 -‐/-‐ mice under fed and fasting conditions (Fig. 2.2C). Similarly, serum insulin levels were equivalent in both genotypes under fed conditions, but were significantly lower in Trpm8 -‐/-‐ mice after either acute (5.5hrs) or overnight fasts (14-‐16hrs) (Fig. 2.2D). After an acute fast serum insulin was 0.73±0.4 and 0.55±0.05mg/dl (p<0.05) in wildtype and Trpm8 -‐/-‐ mice, respectively, and 0.40±0.03 and 0.22±0.02mg/dl (p<0.001) after an overnight fast in wildtype and Trpm8 -‐/-‐ mice, respectively (Fig. 2.2D). Thus, in addition to differences in body weight and food intake, Trpm8 -‐/-‐ mice are deficient in insulin homeostasis when food restricted. 40 Normal morphology and function in pancreatic β-‐cells in Trpm8 -‐/-‐ mice Since serum insulin levels were reduced in fasted animals, we determined if this phenotype was due to altered pancreatic β-‐cell physiology and function. Gross pancreas morphology, based on islet shape and size distribution (Fig. 2.3A-‐B), was normal in Trpm8 -‐/-‐ mice, as was total pancreas insulin content (Fig. 2.3C). Additionally, there was no difference in expression of common β-‐cell specific transcripts, measured by qPCR, FIGURE 2.2 Metabolic characterization of TRPM8 -‐/-‐ mice A) Telemetric monitoring of core body temperature in wild-‐type and TRPM8 -‐/-‐ mice. Scatter plot and averaged data are shown over a 48-‐h period (n=2). B) mean core body temperature during light (day: 6 AM-‐^ PM) and dark cycles (night: 6 PM-‐6 AM) for wild-‐type and TRPM8 -‐/-‐ mice (n=4). Blood glucose (C) and serum insulin (D) levels under fed and fasting conditions (n=7-‐16). Values are expressed as means ± SE. *P < 0.05, **P < 0.01, ***P < 0.001 by Student’s unpaired t-‐test. 41 between wildtype and Trpm8 -‐/-‐ mice (Fig. 2.3D). To determine if the decrease in serum insulin levels observed in Trpm8 -‐/-‐ mice was a result of a deficiency in insulin release mechanisms, we performed in vitro analyses of stimulus evoked insulin release from isolated pancreatic islets. Isolated islets, stimulated with 16.8mM glucose or depolarized with 40mM KCl, released equivalent amounts of insulin from islets isolated from both wildtype and Trpm8 -‐/-‐ mice (p=0.4-‐0.8, Fig. 2.3E). Trpm8 -‐/-‐ mice show prolonged hypoglycemia in response to insulin The above results prompted us to examine the response of Trpm8 -‐/-‐ mice to metabolic challenges to determine if the STZ, weight, food intake, and fasted serum insulin phenotypes we observe in these animals are a result of altered metabolism of glucose or insulin. To test insulin function in vivo, we utilized both the glucose (GTT) and insulin tolerance tests (ITT), induced by bolus (i.p.) injections of either substance, under fed and fasting conditions. Consistent with normal basal glucose levels observed in these animals when both fed and fasted (Fig. 2.2C), we found that Trpm8 -‐/-‐ mice respond similarly to wildtype mice to an injection of glucose (2g/kg) after acute and overnight fasts (Fig. 2.4A-‐B). However, when given a bolus i.p. injection of insulin (0.75U/kg) after an acute fast, Trpm8 -‐/-‐ mice had a prolonged hypoglycemia with blood glucose levels dropping significantly to 137.3±13.8 and 89.3±7mg/dl for wildtype and Trpm8 -‐/-‐ mice, respectively, by 60min post-‐injection (p<0.01, Fig. 2.4C). These results are consistent with lowered basal insulin levels observed in fasted mice (Fig. 2.2D). Of 42 FIGURE 2.3 Pancreatic β-‐cell function in TRPM8 -‐/-‐ mice A) Representative immunostaining for insulin in mouse pancreatic islets. B) Distribution of pancreatic islet sizes in TRPM8 -‐/-‐ compared with wild-‐type mice (n = 2,076 islets measured from 3 mice of each genotype). C) Whole pancreatic insulin content expressed as ng insulin/µg total protein (wt: 3.5 ± 1.3ng/µg, TRPM8 -‐/-‐ : 4.8 ±1.3 ng/µg protein, P = 0.51, n = 3). D) Gene expression analysis of common β-‐ cell-‐specific transcripts in isolated pancreatic islets by qPCR. Values expressed as ΔCT relative to GAPDH expression (n = 3). E) Insulin secretion stimulated by 16.8 mM glucose (wt: 0.58 ± 0.02, TRPM8 -‐ /-‐ : 0.63 ± 0.06 ng/islet/15 min), or 40 mM KCl (wt: 0.72 ± 0.03, TRPM8 -‐/-‐ : 0.75 ± 0.06 ng/islet/15 min, P = 0.05, n = 3) from isolated islets (baseline: 2.8 mM glucose). All experiments were carried out on adult male mice aged 8–12 wk old unless otherwise noted. Values are expressed as means ± SE; P > 0.05 NS by Student’s unpaired t-‐test. 43 FIGURE 2.4 TRPM8 -‐/-‐ mice exhibit heightened insulin sensitivity in vivo Intraperitoneal (IP) glucose tolerance test (IPGTT) performed on acute-‐ (5.5 h; A) and overnight-‐fasted (14–16 h; B) mice by injecting 2.0 g/kg body wt IP glucose (n = 14–16 for acute and n = 18–19 for overnight). C) Blood glucose concentrations in an insulin tolerance (IPITT) test performed on acute-‐ fasted mice by injecting 0.75 U/kg body wt IP insulin (n = 17–18). D) Insulin tolerance test performed on fed mice by injecting 0.75 U/kg insulin IP (n = 5–6). E) Serum insulin (basal: wt: 0.42 ± 0.04, TRPM8 -‐ /-‐ : 0.24 ± 0.01 ng/ml, P < 0.01; at 60 min: wt: 0.59 ± 0.07, TRPM8 -‐/-‐ : 0.55 ± 0.06 ng/ml, P = 0.68, n = 14– 17) following 2.0 g/kg body wt IP glucose to overnight-‐fasted mice. Values are expressed as means ± SE. **P < 0.01 by Student’s unpaired t-‐test. 44 note, fed Trpm8 -‐/-‐ mice responded similarly to wildtypes (Fig. 2.4D), in line with their normal serum insulin levels when fed (Fig. 2.2D). To test the regulation of insulin secretion in Trpm8 -‐/-‐ mice we monitored serum insulin levels following a glucose challenge in mice fasted overnight. After a 2.0g/kg glucose injection, spiking serum insulin levels were significantly lower in Trpm8 -‐/-‐ mice compared to wildtype littermates, peaking at 15min post-‐injection to 0.53±0.06 and 0.80±0.08ng/ml, respectively (p<0.01, Fig. 2.4E). Interestingly, while these and starting serum insulin levels in Trpm8 -‐/-‐ mice were reduced, they recovered to values similar to wildtype by 60min after the injection. Enhanced insulin clearance in Trpm8 -‐/-‐ mice As Trpm8 -‐/-‐ mice have normal insulin content and β-‐cell function in vitro (Fig. 2.3C,E), and reduced spiking serum insulin levels following glucose challenge in vivo, we examined insulin clearance in these animals. To test this, we examined the content and release of C-‐peptide in Trpm8 -‐/-‐ mice (Polonsky and Rubenstein 1984; Lebowitz and Blumenthal 1993). The mature form of insulin results from the cleavage of proinsulin into insulin and C-‐peptide in the secretory granules of the β -‐cell. Since the content of C-‐ peptide and insulin is 1:1 as a result of this process, when the secretory granules of the β -‐cell release their contents into the blood upon stimulation they release equimolar concentrations of insulin and C-‐peptide. Due to the half-‐life of C-‐peptide being 10-‐fold longer than that of insulin in the bloodstream, serum C-‐peptide levels are an accurate measure of insulin secretion following glucose challenge. The ratio of C-‐peptide to 45 insulin following such a challenge is often used as a measure of insulin clearance as C-‐ peptide clearance rates remain constant while insulin clearance rates can vary (Polonsky and Rubenstein 1984; Lebowitz and Blumenthal 1993). Resting levels of C-‐peptide in fed as well as acute and overnight fasted mice were similar in both genotypes (Fig. 2.5A), unlike the significant decrease in serum insulin under similar fasting conditions (Fig. 2.2D). Moreover, distinct from the significant reduction in the spike in serum insulin after a glucose challenge in Trpm8 -‐/-‐ versus wildtype animals (Fig. 2.4E), there was no difference in C-‐peptide release in the IPGTT assay (Fig. 2.5B). As serum insulin concentration is the net of the rates of release versus clearance, we measured the molar insulin:C-‐peptide ratio, a measure of insulin clearance, after glucose challenge, observing significantly lowered values in Trpm8 -‐/-‐ mice at both baseline and 15min post glucose challenge (p<0.05, Fig. 2.5C). Lastly, in a further measurement of clearance we compared the incremental increase in both peptides at 15min following glucose challenge, finding no differences in the molar amount of C-‐peptide (p=0.97), but a significantly decreased level of insulin in Trpm8 -‐/-‐ mice (p<0.001, Fig. 2.5D), evidence demonstrating enhanced insulin clearance in these animals. 46 TRPM8-‐expressing afferent fibers innervate the hepatic portal vein Pancreatic expression of TRPM8 has not been reported (Tsavaler, Shapero et al. 2001), and consistent with these data we did not detect TRPM8 transcripts in this tissue by RT-‐PCR (Fig. 6A). The liver is the primary organ involved in insulin clearance, responsible for removing over 50% of blood insulin after one pass through the hepatic network (Valera Mora, Scarfone et al. 2003). As in the pancreas, trpm8 transcripts were FIGURE 2.5 Enhanced insulin clearance in TRPM8 -‐/-‐ mice A) Resting serum C-‐peptide levels in fed and fasted mice (n = 7–10). B) Serum C-‐peptide following 2.0 g/kg body wt IP glucose to overnight-‐fasted mice (n = 6). C) Serum insulin-‐to-‐C-‐peptide ratios during different intervals following glucose injection. D) Incremental increase of insulin (wt: 116.1 ± 2.6, TRPM8 -‐/-‐ : 52.4 ± 3.5 pmol/l) compared with C-‐peptide (wt: 249.1 ± 38.2, TRPM8 -‐/-‐ : 251.1 ± 46.0 pmol/l) from 0–15 min following glucose challenge. Values are expressed as means ± SE. *P < 0.05, ***P < 0.001, NS P > 0.05 by Student’s unpaired t-‐test. 47 undetectable in the liver (Fig. 2.6A), results consistent with previous expression analysis in non-‐neuronal tissues (Tsavaler, Shapero et al. 2001). However, using a TRPM8 reporter line (Takashima, Daniels et al. 2007), we do find TRPM8-‐expressing afferent fibers innervating the hepatic portal vein (HPV, Fig. 2.6B-‐C). This is of note as it is well established that afferent innervation of the HPV is important for proper glucose/insulin homeostasis (Fujita, Bohland et al. 2007). As TRPM8 antibodies are not reliable in mouse tissue staining, we confirmed that TRPM8 is being expressed in these axonal projections in the HPV by immunolabeling rat HPV tissue directly with an antibody raised against the C terminus of TRPM8 (Fig. 2.6D). Consistent with mouse reporter expression, we found TRPM8 immunolabeling in the rat HPV, immunoreactivity that was absent when the antibody was pre-‐incubated with the antigen peptide (Fig. 2.6E). These results confirm TRPM8 expression in neurons innervating the HPV, results consistent with previous reports showing TRPV1 expression in this tissue (Uchida and Tominaga 2011). Increased insulin-‐degrading enzyme (IDE) expression in Trpm8 -‐/-‐ liver As Trpm8 -‐/-‐ mice clear insulin at a faster rate than wildtype, and TRPM8 afferent innervation was found in the hepatic portal vein we next determined if liver function was altered in the absence of TRPM8 channels. Insulin clearance occurs in two main phases: 1) receptor binding and internalization and 2) degradation. As the Insulin receptor (InsR) is required for the first phase of this process and insulin-‐degrading 48 FIGURE 2.6 Innervation of TRPM8-‐expressing afferent fibers in the hepatic portal vein (HPV) A) RT-‐PCR from cDNA from trigeminal/dorsal root ganglia, whole pancreas, isolated islets, or liver. Two primer sets were used to amplify both 5’-‐ (M8 5’) and 3’-‐ (M8 3’) regions of TRPM8. GAPDH (GAP) was used as a universal control for sample integrity, and insulin (INS) and α1-‐anti-‐trypsin (α-‐AT) were used as tissue-‐specific controls for pancreas and liver, respectively. All experiments were carried out on male mice age 8–12 wk. Values are expressed as means ± SE. *P < 0.05, **P < 0.01, ***P < 0.001 by Student’s unpaired t-‐test. B and C) Whole-‐mount staining shows TRPM8-‐expressing afferents (green) in the HPV of Trpm8GFP reporter mice vs. all afferent fibers labeled with the pan-‐neuronal marker PGP9.5 (red). Arrowheads demarcate axons, and all experiments were carried out on male mice aged 8–12 wk. D) Immunoreactivity to TRPM8 (green) and PGP9.5 (red) from whole-‐mount rat HPV. E) TRPM8 immunoreactivity was absent when tissue was probed with TRPM8 antibodies pretreated with the antigenic peptide. 49 enzyme (IDE) is required for the second phase, we looked at expression levels of these proteins in relevant tissues regarding insulin clearance, the liver, kidney and muscle. By quantitative western blot analysis we observed that IDE expression levels in liver were significantly increased in Trpm8 -‐/-‐ mice (Fig. 2.7A), but unchanged in both kidney (Fig. 2.7B) and muscle (Fig. 2.7C), results consistent with the enhanced insulin clearance phenotype. In contrast, InsR was found to be expressed at statistically similar levels in all three tissues of wildtype and Trpm8 -‐/-‐ animals (Fig. 2.7D). FIGURE 2.7 Insulin-‐degrading enzyme expression is increased in TRPM8 -‐/-‐ mouse liver Semi-‐quantitative Western blotting on whole tissue lysates isolated from overnight-‐fasted wild-‐type and TRPM8 -‐/-‐ mice. A–C) Insulin-‐degrading enzyme (IDE) protein expression is quantified in liver (A), kidney (B), and muscle (C). Expression levels are shown by animal (left) and means ± SE (right) for each genotype relative to β-‐actin (liver and kidney) or GAPDH (muscle). D) Insulin receptor (InsR) expression levels in the 3 aforementioned tissues expressed as means ± SE (n = 3). *P < 0.05, by Student’s unpaired t-‐test. 50 CONCLUSION Our studies show that TRPM8 plays a role in insulin homeostasis by influencing the regulation of insulin clearance and suggest a change in insulin sensitivity that may result from lower insulin levels under non-‐fed conditions. Our data shows that TRPM8 is most likely not mediating these changes in insulin response via pancreatic β or liver cell function directly, but support the growing evidence that sensory neuron innervation is critical for metabolic homeostasis (Islam 2011; Uchida and Tominaga 2011). Expression levels of IDE, the enzyme required for the degradation of insulin, were found to be higher in the Trpm8 -‐/-‐ liver relative to wildtype. Taken together with data showing TRPM8-‐expressing afferents innervating the hepatic portal vein, these results suggest TRPM8-‐expressing afferents regulate liver function in regards to insulin clearance. It remains to be determined if this difference in insulin clearance occurs as a direct or indirect result of the loss of TRPM8 function, and future studies are warranted to determine the mechanistic function of TRPM8 in this regard. These results add to the newly appreciated role of TRP channels and their afferents in regulating the internal milieu in addition to their robust function in monitoring changes in the external environment (Uchida and Tominaga 2011). Numerous non-‐selective cation channels of the TRP family have been implicated in the regulation of insulin. Their involvement has been shown at the cellular level in β-‐ cells, as well as the neuronal level via afferent innervation of the liver and pancreas 51 (Islam 2011; Uchida and Tominaga 2011; Gao, Miyata et al. 2012). TRP channels of the TRPC (C1-‐6), TRPM (M3-‐5), TRPV (TRPV1-‐2,V4) and TRPA (A1) subfamilies are reportedly expressed in mammalian pancreatic β-‐cells (Islam 2011; Cao, Zhong et al. 2012). Although their roles in this context are not completely understood, evidence suggests they function in establishing excitability that is important for the switching of the β-‐cell from a basal to a stimulated state. For example, analyses of mice lacking functional TRPM2 and TRPM5 channels have shown that when either gene is eliminated, glucose-‐ induced insulin secretion is significantly reduced or abolished, solidifying an active role of TRP channels in insulin secretion (Brixel, Monteilh-‐Zoller et al. 2010; Colsoul, Schraenen et al. 2010; Uchida, Dezaki et al. 2011). Aside from the direct influence various TRP channels have on β-‐cell function, and relevant to our own studies regarding TRPM8, TRPV1 has also been shown to be expressed in neurons innervating the pancreas, suggesting an indirect role in the regulation of insulin and glucose homeostasis (Razavi, Chan et al. 2006; Tanaka, Shimaya et al. 2011). The pancreas is heavily innervated by both afferent and efferent neurons of both extrinsic and intrinsic origin and as a result of this complexity our understanding of the pancreatic neural network is somewhat limited (Niebergall-‐Roth and Singer 2001). TRPV1 afferents release calcitonin gene-‐related peptide (CGRP) and Substance P in response to robust afferent stimulation and this release is involved in inflammatory responses and vasodilation (Benemei, Nicoletti et al. 2009). Recent studies have found that TRPV1-‐expressing afferents innervating the pancreas regulate insulin secretion and 52 β-‐cell physiology through the release of Substance P suggesting a negative feedback model in which insulin and Substance P are maintained at levels to preserve proper β-‐ cell function (Razavi, Chan et al. 2006). In agreement with this study, treatment with a TRPV1 antagonist has been shown to increase insulin secretion and sensitization in diabetic ob/ob mice and is believed to mediate this through suppressing TRPV1-‐ mediated neuropeptide secretion (Tanaka, Shimaya et al. 2011). Given that approximately 40% of TRPM8-‐expressing sensory neurons have been shown to co-‐ localize with TRPV1, and TRPM8-‐expessing afferents were also found to innervate the pancreas (data not shown), it is plausible that the phenotype observed here could somehow be correlated with these pancreatic afferents, although with Trpm8 -‐/-‐ mice having no observable differences in pancreatic function this is unlikely (Takashima, Daniels et al. 2007). The influence of neural projections in the liver are perhaps more intriguing in this regard. TRPV1/CGRP-‐expressing afferents innervating the hepatic portal vein (HPV) have been shown to be required for the proper detection of hypoglycemic conditions (Fujita, Bohland et al. 2007). The elimination of TRPV1 + HPV neurons significantly suppresses the sympathoadrenal response to hypoglycemia, highlighting the importance of these neurons in glucose sensing (Fujita, Bohland et al. 2007). Furthermore, TRPV1-‐mediated regulation of liver-‐related paraventricular nucleus (PVN) neurons has also been shown, suggesting a direct influence of TRPV1 in the regulation of hepatic glucose production (Gao, Miyata et al. 2012). Interestingly, TRPV1-‐mediated excitation of liver-‐related PVN 53 neurons was found to be reduced in a mouse model of type 1 diabetes, and this activity was restored by insulin administration in a phosphatidylinositol 3-‐kinase/protein kinase C-‐dependent manner, illustrating the ability of insulin to control TRPV1 activity (Gao, Miyata et al. 2012). This phenotype is reminiscent of human subjects who have undergone liver transplant and highlight the influence of hepatic innervation on insulin clearance. All hepatic neuronal connections are eliminated as a result of this transplant surgery and two independent studies found that transplant patients cleared insulin at a faster rate than control patients in a manner that was independent of immunosuppressive treatment (Perseghin, Regalia et al. 1997; Schneiter, Gillet et al. 1999). Thus, TRPM8-‐mediated neuronal signals may provide negative regulation of insulin clearance via hepatic neural innervations influencing local IDE expression levels. In such a scenario hepatic insulin clearance is heightened due to dis-‐inhibition of this circuit in the absence of TRPM8 channels. In summary, our studies suggest that TRPM8 plays an important role in insulin homeostasis through the regulation of insulin clearance. As the liver is essential for proper hypoglycemic detection and clearance of insulin, the presence of TRPM8 afferents in the HPV is intriguing. Given that TRP channels have been shown to be important in the regulation of insulin on both β-‐cell and neuronal levels, future studies are warranted to understand the mechanistic role of TRPM8 in insulin clearance. Understanding these pathways could shed new light on how insulin is regulated in the 54 body with the potential to yield new therapeutic targets for the treatment and prevention of diabetes and other metabolic disorders. 55 CHAPTER THREE TRPM8 pore dilation allows for permeation of large cationic molecules 56 INTRODUCTION The sensing of pain, referred to as nociception, is important for survival as it signals when something is wrong and teaches to avoid harmful situations in which tissue damage might occur. The signaling network involved is finely tuned to distinguish between noxious (painful) and innocuous (nonpainful) stimuli and communicates to higher order brain centers via action potentials generated in peripheral sensory neurons. Pain signals are carried by pain-‐sensing neurons (nociceptors) that fall into two categories, those that are myelinated and those that are not. The traditional primary sharp shooting pain experienced when burning your hand on a stove for example, is carried by myelinated Aδ fibers, while the secondary more dull aching pain that follows is carried by unmyelinated C fibers (Basbaum, Bautista et al. 2009). Regardless of which type of pain is being experienced the same behavior results, avoidance of the noxious stimuli. However, problems arise when this signaling network is not properly controlled. For instance, loss of function mutations in the nociceptive sodium channel Nav1.7 lead to a condition referred to as Congenital Insensitivity to Pain (CIP) (Goldberg, MacFarlane et al. 2007). Although CIP patients show normal awareness to what others consider painful, they are unable to sense pain themselves and often die at a young age due to the complications that arise when pain goes unnoticed (Goldberg, MacFarlane et al. 2007). Conversely, errant sensitization of nociceptors can occur and manifest itself as chronic pain. Interestingly, a recent study found that 31% of people 57 surveyed reported some sort of chronic pain, highlighting its prevalence in the general population (Bouhassira, Lanteri-‐Minet et al. 2008). Pain caused by thermal hypersensitivity is very common and one of the first examples that come to mind involves the thermal sensitivity of the tooth. Dentine thermal sensitivity occurs in 10-‐30% of people and can be exacerbated by things like diet and eating habits or dental work (Shiau 2012). The severity of the hypersensitivity can vary but in the vast majority of cases it is merely an irritant and not severe in nature. However, other conditions in which thermal hypersensitivity can be quite debilitating also exist. For instance, patients with the inflammatory disorder fibromyalgia (FM) often report extreme sensitivity to mild heat and/or cold (Rehm, Koroschetz et al. 2010). Diabetic patients are also known to develop thermal polyneuropathies caused by the stress put on sensory neurons under prolonged hyperglycemia (Pluijms, Huygen et al. 2010). Finally, over 50% of patients with complex regional pain syndrome have hypersensitivities to both heat and cold (Tahmoush, Schwartzman et al. 2000). Because the mechanisms underlying thermal hypersensitivity are poorly understood, treatment options are often limited to general anesthetics that have significant off-‐target effects. Thus, there is a significant need for the specific treatment of thermal hypersensitivity. As mentioned in Chapter one, TRPM8-‐expressing neurons are required for the development of cold hypersensitivity in models of inflammatory injury and chronic neuropathic pain. More recently it has been found that these neurons are also involved in the cold dysesthesia that accompanies the use of the common chemotherapeutic 58 drug oxaliplatin (Knowlton, Daniels et al. 2011). With this in mind, it is not unreasonable to think that the targeting of cold-‐sensing/TRPM8-‐expressing neurons could be a viable option for the specific treatment of cold-‐hypersensitive conditions. TRPM8-‐specific antagonists could be the answer for such conditions, but as it stands today no commercially available antagonist exists without significant off-‐target effects, highlighting the need for alternative approaches (Behrendt, Germann et al. 2004; Madrid, Donovan-‐Rodriguez et al. 2006; Malkia, Madrid et al. 2007; Lashinger, Steiginga et al. 2008; Meseguer, Karashima et al. 2008; Knowlton, Daniels et al. 2011; Almeida, Hew-‐Butler et al. 2012; Matthews, Qin et al. 2012). In 2007 work done by Binshtok et al. demonstrated that the silencing of heat nociceptors could be achieved by selectively targeting QX-‐314, a cationic derivative of the local anesthetic lidocaine, to TRPV1-‐expressing neurons (Binshtok, Bean et al. 2007). Like lidocaine, QX-‐314 is a voltage-‐gated sodium channel blocker that prevents nerve firing. However, while lidocaine is able to cross lipid bilayers indiscriminately due to its hydrophobic nature, the positive charge of QX-‐314 requires that it be transported across the membrane in order to bind to its target. In these studies it was shown that robust stimulation with capsaicin caused TRPV1 channels to dilate, allowing QX-‐314 to enter the cell through the channel pore and block nerve firing in vitro (Binshtok, Bean et al. 2007). Furthermore, when QX-‐314 was co-‐administered with capsaicin via intraplantar hind paw and sciatic injections, deficits in acute mechanical and thermal pain resulted while motor and tactile responses remained intact (Binshtok, Bean et al. 2007). Based 59 on these studies, it was posited that pore dilation of TRPM8 could be similarly used to selectively silence cold-‐sensing neurons. Two studies have been published on this subject with both concluding that TRPM8 cannot be used in such a manner. The most recent work published in 2013 studied the permeability of TRPM8 to QX-‐314 via hind paw injections, but curiously only measured behavioral heat responses following injection (Nakagawa and Hiura 2013). They then concluded that because QX-‐314/menthol co-‐administration did not block heat pain responses, QX-‐314 could not permeate TRPM8 channels, a conclusion that is very perplexing given that TRPM8-‐expressing neurons are known to have no significant effect on heat responses in vivo (Knowlton, Palkar et al. 2013; Nakagawa and Hiura 2013). Chen et al. showed that in HEK 293 cells expressing human TRPM8 neither the large cationic dye YO-‐PRO-‐1 (357da) nor the smaller charge carrier NMDG + (195da) could significantly permeate the channel upon 100µM menthol stimulation (Chen, Kim et al. 2009). As QX-‐314 (263da) is larger in size than NMDG + , it was concluded that it too would not permeate TRPM8 (Chen, Kim et al. 2009). However, as the highest concentration of menthol used in this study was 100µM, a concentration very close to its published half maximal effective concentration (EC50) of 66.7µM (McKemy, Neuhausser et al. 2002), we cannot be certain TRPM8 channels were sufficiently stimulated to allow for pore dilation. Furthermore, a high-‐throughput FLIPR-‐based approach was used in this study with the change in fluorescence of an entire well being used as a measure of channel-‐mediated dye permeation. Although convenient, this 60 approach is highly sensitive to differences in transfection efficiency, plate confluency and cell viability and, as a result, tends to have a much higher background and lower sensitivity. For these reasons we believed that large cationic permeation via TRPM8 warranted further study. Here we describe TRPM8-‐mediated uptake of the large cationic dye PO-‐PRO3 (351da) in both heterologous cells and neurons using the super agonist WS-‐12, a phenomena that we found could be blocked by the TRPM8 antagonist PBMC. As WS-‐12 is a menthol derivative and previous work has shown in vitro menthol-‐mediated currents through another TRP channel, TRPA1, we tested the specificity of WS-‐12 in this assay and found that no dye was taken up through TRPA1 channels in the presence of the agonist. Furthermore, preliminary studies in vivo indicate that co-‐administration of WS-‐12 and QX-‐314 can block the development of cold-‐hypersensitive behaviors in mice, evidence supporting the hypothesis that the silencing of cold-‐sensing neurons can be achieved using TRPM8 pore dilation. 61 MATERIALS AND METHODS Heterologous cell culture Mammalian expression vectors containing cDNA clones of rTRPM8, rTRPA1, and rTRPV1 were transfected into the human embryonic kidney cell line 293 (HEK293) using TransIT-‐LT1 reagent (Mirus) following manufacturer’s instructions. Cells were split onto round matrigel-‐coated (BD) coverglass 24hrs after transfection and imaged within 48hrs of splitting. Cells were maintained in Dulbecco’s Modification of Eagle’s Medium (DMEM) supplemented with 10% fetal bovine serum (FBS) and 1% penicillin-‐ streptomycin inside a 37°C, 5% CO2 humidified incubator. Dye uptake experiments All experiments were carried out in standard calcium imaging buffer lacking calcium (CIB -‐ ) unless otherwise noted. CIB -‐ contains: 136mM NaCl, 5.4mM KCl, 1mM MgCL 2 , 10mM EGTA, 10mM HEPES, 10mM glucose and 0.33mM NaH 2 PO 4 adjusted to pH 7.4. CIB buffer is the same as CIB -‐ buffer only it contains instead of 10mM EGTA, 1.8mM CaCl 2 . After acclimating HEK 293 cells transiently transfected with rTRPM8/V1/A1 or sensory neurons in CIB -‐ at room temperature for approximately 20 mins, cells were first perfused with CIB -‐ containing 1µM PO-‐PRO3 (Life Technologies) for 2mins to identify dead cells. Subsequent incubations were then carried out in solutions containing the various experimental compounds tested and 1µM PO-‐PRO3. 62 Neuron culture Trigeminal Ganglia were dissected from newborn transgenic mice (<P14) engineered to express GFP in TRPM8 + sensory neurons and dissociated with 0.25% collagenase Type 1 (Roche) in a solution of 50% DMEM and 50% F-‐12 for 30mins. The ganglia were then pelleted and resuspended in 0.05% trypsin and incubated at 37°C for 2mins. After washing in DMEM/F12 and pelleting, cells were triturated gently with a fire-‐polished Pasteur pipette in culture medium (DMEM/F-‐12 with 10% FBS and penicillin-‐streptomycin). Cells were then spun through a percol gradient consisting of 60% percol overlaid by 30% percol in culture media. Enriched sensory neurons were then collected from the interphase between the 30% and 60% layers, washed, pelleted and resuspended in culture medium supplemented with nerve growth factor 7S (Invitrogen) (100ng/ml) and plated onto coverslips coated with Matrigel (BD) (20µl/ml). Cultures were then used 12-‐24hrs after plating for dye uptake experiments. Calcium imaging (for neurons) To identify live functioning neurons in sensory neuron cultures, cells were tested via calcium imaging. Neurons were preloaded for 1hr at room temperature with 10µM Fura-‐2, a cell permeable fluorescent dye that is differentially excited by 340nm and 380nm light based on whether or not it is bound to calcium. Positive PO-‐PRO3 dye uptake was defined as fluorescence exceeding a threshold of 3 standard deviations above baseline measurements carried out on non-‐responding neurons over a 10 minute 63 window. After PO-‐PRO3 dye uptake experiments had concluded cells were perfused with CIB for 10mins followed by a brief 15s pulse of CIB containing 50mM KCl to depolarize all electrically active cells. Subsequent changes in intracellular calcium were measured via radiometric imaging and used to identify live functioning neurons for quantification purposes. Acetone behavior/paw injections Cold behavioral responses were measured using the evaporative cooling assay and performed as follows: mice were acclimated for 30mins inside a 4 chambered plexiglass housing on top of a metal mesh platform. A syringe with tubing attached to the end was used to apply 1 drop, or ~50µl, of acetone to the hind paw of the mouse and behavioral responses were recorded by video camera. Behaviors were then scored according to the magnitude of the response along the following scale: 0-‐no response; 1-‐ brief lift, sniff, flick, or startle; 2-‐jumping, paw shaking; 3-‐multiple lifts, paw lick; 4-‐ prolonged paw lifting, licking, shaking, or jumping; 5-‐paw guarding. The scale was designed so that the extreme values (0 and 5) occurred only rarely. Mice were tested four at a time in a sequential/alternating fashion so that each mouse was tested once every 2mins and each paw once every 4mins for a total of 3 trials for each paw. WS-‐12/QX-‐314 paw injections were carried out via intraplantar injection of 20 µl of corn oil (Sigma) containing 20µg WS-‐12 (Tocris), 2% QX-‐314 (Sigma), or both. Acetone behavioral responses were then recorded every 30mins following injection. All 64 experiments were performed according to the policies and recommendations of the International Association for the Study of Pain and approved by the University of Southern California Animal Care and Use Committee. 65 RESULTS PO-‐PRO3 can permeate both TRPA1 and TRPV1 As previous studies had shown that the large cationic dye YO-‐PRO1 could permeate both TRPA1 and TRPV1 upon channel stimulation we first set out to confirm that this could be replicated in our own hands as a positive control (Binshtok, Bean et al. 2007; Chen, Kim et al. 2009). We chose to work with the similarly sized cationic dye PO-‐ PRO3, mainly because its fluorescence properties are in the red channel. We reasoned that should PO-‐PRO3 prove able to permeate TRPM8 in heterologous cells, we could use this same dye in later experiments looking at dye uptake in GFP-‐labeled TRPM8 + sensory neurons. As the fluorescence spectrum of YO-‐PRO1 overlaps with that of GFP, these experiments would not be possible using this dye. We determined that HEK293 cells expressing rTRPA1 or rTRPV1 were able to robustly take up PO-‐PRO3 upon stimulation with 300µM Allyl isothiocyanate (AITC) or 10µM capsaicin respectively, with no dye uptake in control cells transfected with empty vector (pcDNA3) (Fig. 3.1). WS-‐12 can stimulate PO-‐PRO3 dye uptake in heterologous cells With successful PO-‐PRO3 dye uptake established in TRPV1 and TRPA1-‐expressing HEK293 cells, we next determined if this was possible in TRPM8-‐expressing cells. As the only other known study published on this subject found that TRPM8 could not allow uptake of YO-‐PRO1 upon stimulation with menthol (EC50 66.7µM), a known weak agonist for TRPM8, we sought to test if the potent agonist WS-‐12 (EC50 193nM) would 66 be more successful (McKemy, Neuhausser et al. 2002; Bodding, Wissenbach et al. 2007). We found that HEK293 cells transfected with rTRPM8 were able to take up PO-‐PRO3 dye in the presence of WS-‐12 in a concentration-‐dependent manner with a maximal response coming from concentrations equal or greater to 2µM, and no dye uptake seen at any concentration in control empty vector-‐transfected cells (Fig. 3.2A-‐B, Fig. 3.3A). Similar results were found using menthol although equivalent dye uptake seen using 2µM WS-‐12 was seen using 1mM menthol (Fig. 3.2C-‐D, Fig. 3.3B). This difference is further shown in a comparative dose response curve (EC50 WS-‐12 = ~813nM, EC50 Menthol = ~409µM) with WS-‐12 being over 500 times more potent than menthol in FIGURE 3.1 PO-‐PRO3 dye uptake in TRPA1 and TRPV1-‐transfected HEK cells HEK 293 cells transfected with rTRPA1 and rTRPV1 can take up dye in the presence of mustard oil and capsaicin respectively. Cells were first profused with 1µM PO-‐PRO3 for 2 minutes (120s), followed by 10 minutes (600s) of 1µM PO-‐PRO3 plus agonist (300µM MO or 10µM CAP demarcated by arrow). Values are expressed as arbitrary fluorescence units ± SE (n=15 cells, 3 experiments). 67 FIGURE 3.2 PO-‐PRO3 dye uptake in TRPM8-‐transfected HEK cells A) Untransfected HEK 293 cells transfected do not take up dye in the presence saturating concentrations of WS-‐12 (10µM). B-‐D) HEK 293 cells transfected with rTRPM8 take up dye in the presence of 2µM WS-‐12 (B), 100µM menthol (C), and 1mM menthol (D). Cells were first profused with 1µM PO-‐PRO3 for 2 minutes, followed by 10 minutes of 1uM PO-‐PRO3 plus agonist. 68 facilitating TRPM8-‐dependent dye uptake (Fig. 3.3C). However, when these experiments were repeated in the presence of Ca 2+ the amount of dye uptake in response to WS-‐12 stimulation dropped precipitously, results consistent with previous findings regarding calcium-‐dependent desensitization of TRPM8 channels (Fig. 3.3D)(McKemy, Neuhausser et al. 2002). FIGURE 3.3 Relative quantification of PO-‐PRO3 dye uptake in TRPM8-‐transfected HEK cells A) HEK 293 cells transfected with rTRPM8 take up dye in the presence of WS-‐12 (A) and menthol (B) in a concentration-‐dependent manner. C) Concentration response curves for WS-‐12 and menthol-‐evoked PO-‐PRO3 dye uptake. D) WS-‐12-‐mediated dye uptake in the presence or absence of extracellular Ca 2+ . PO-‐PRO3 dye uptake experiments were carried out by first perfusing 1µM PO-‐PRO3 for 2 minutes, followed by 10 minutes of 1uM PO-‐PRO3 plus agonist. Values are expressed as arbitrary fluorescence units ± SE (n=15 cells, 3 experiments) 69 WS-‐12-‐mediated PO-‐PRO3 uptake is TRPM8-‐specific To further test the TRPM8-‐specificity of PO-‐PRO3 uptake in heterologous cells transfected with rTRPM8, we incubated cells with the specific antagonist PBMC. In the presence of 25nM PBMC PO-‐PRO3 uptake was both prevented, if pre-‐treated, and halted, if administered during WS-‐12-‐mediated dye uptake experiments (Fig. 3.4A). A previous study has shown that TRPA1 can be activated by menthol at certain concentrations in vitro (Karashima, Damann et al. 2007). As WS-‐12 is a menthol derivative, we tested the agonist on rTRPA1-‐transfected cells and found that even at super saturating concentrations of 10µM, WS-‐12 did not induce dye uptake. However, the addition of the TRPA1-‐specific agonist AITC following WS-‐12 administration did induce uptake in these cells, proving that they were in fact expressing TRPA1 (Fig. 3.4B). Taken together these data support a TRPM8-‐specific dye uptake resulting from administration of the potent agonist WS-‐12. WS-‐12 can stimulate PO-‐PRO3 dye uptake in cultured sensory neurons expressing TRPM8 With TRPM8-‐specific dye uptake seen in heterologous cells using WS-‐12 and menthol, we next turned our focus on whether these same results could be replicated in native cells. Trigeminal ganglia from the TRPM8-‐GFP BAC-‐transgenic mouse line engineered by our lab to express GFP in TRPM8 + neurons were first dispersed and cultured overnight. We found that 87.4 +/-‐ 5.0% of GFP + neurons responded with an 70 increase in PO-‐PRO3 fluorescence in response to 2µM WS-‐12. Moreover, we only observed dye uptake in 1.9% of GFP -‐ cells, results consistent with TRPM8-‐mediated dye uptake (7 experiments, 175 neurons measured, 20.6% of neurons were GFP + )(Fig. 3.5). FIGURE 3.4 WS-‐12-‐mediated dye uptake is TRPM8 specific A) HEK 293 cells transfected with rTRPM8 take up PO-‐PRO3 in the presence of WS-‐12 (2µM) but do not take up dye if simultaneously incubated with the TRPM8-‐specific antagonist PBMC (25nM) (B) Saturating concentrations of WS-‐12 (10µM) does not cause dye uptake in HEK 293 cells transfected with rTRPA1. PO-‐PRO3 dye uptake experiments were carried out by first perfusing 1µM PO-‐PRO3 for 2 minutes, followed by 5 or 10 minute experimental treatments in the presence of 1uM PO-‐ PRO3. Values are expressed as arbitrary fluorescence units ± SE (n=15 cells, 3 experiments) 71 FIGURE 3.5 WS-‐12-‐mediated dye uptake in TRPM8-‐expressing sensory neurons Representative trigeminal sensory neuron culture from TRPM8-‐GFP + mice. A) Bright field (left) and bright field superimposed with GFP channel (right). Green arrow marks a GFP + neuron while yellow arrows mark GFP -‐ neurons. B) Calcium imaging in cells loaded with Fura-‐2 dye (340:380nm) before (left) and after (right) brief membrane depolarization (via 50mM KCl exposure) identify active neurons. C) PO-‐PRO3 dye uptake experiments after 2 minutes PO-‐PRO3 alone (left) and after subsequent 10 minute incubation with PO-‐PRO3 and WS-‐12 (right). 72 WS-‐12/QX-‐314 co-‐administration can block the development of cold-‐hypersensitivity in response to WS-‐12 in vivo The lidocaine derivative QX-‐314 is normally membrane impermeable due to its permanent positive charge. Like lidocaine, it blocks neuronal transmission by binding to the cytosolic surface of voltage-‐gated sodium channels once inside the cell, blocking their activity. As it is approximately 25% smaller than PO-‐PRO3 (263da vs 351da), we next wanted to see if WS-‐12 stimulation could block cold sensation in vivo by facilitating the entry of QX-‐314 via TRPM8. Wildtype mice exhibit cold hypersensitivity in response to intraplantar hind paw injection of 10µg of WS-‐12, with a peak hypersensitivity seen 30 minutes post injection via acetone behavior test (Fig. 3.6A). When 2% QX-‐314 is co-‐ injected with 10µg WS-‐12 however, the development of cold hypersensitivity is abolished with near identical values to vehicle (saline) injected mice (Fig. 3.6B). These data suggest that robust TRPM8 stimulation can be used as a means of targeting positively charged therapeutics, like QX-‐314, to cold-‐sensing neurons in vivo. 73 (Data courtesy of Radhika Palkar) FIGURE 3.6 QX-‐314/WS-‐12 coadministration can block WS-‐12-‐mediated cold hypersensitivity in vivo A) Acetone response scores following intraplantar hindpaw injection of 10ug WS-‐12 in wild type mice (n=4-‐6). B) Acetone response scores following intraplantar hindpaw injection of vehicle (2% QX-‐314), 10ug WS-‐12 alone, and 10ug WS-‐12 + 2% QX-‐314 (n=4-‐6). Values are expressed as means ± SE. *P < 0.05, **P < 0.01, ***P < 0.001, by Student’s unpaired t-‐test. 74 CONCLUSION Here we have presented evidence that TRPM8 channels can allow large cationic molecules to pass in response to strong agonist stimulation. Specifically, we have shown that the cationic dye PO-‐PRO3 is taken up by heterologous cells transfected with rTRPM8 when robustly stimulated by WS-‐12 and menthol. Previously published work concluded that the large cationic dye YO-‐PRO1 could not permeate TRPM8 in such a manner, a conclusion we believed to be premature based on flaws in their experimental model (Chen, Kim et al. 2009; Nakagawa and Hiura 2013). Although we did see significant PO-‐PRO3 uptake in cells stimulated with 100µM menthol, the maximum concentration used in the previously mentioned study resulting in no dye uptake, our ability to measure this amount of dye uptake was enhanced by the sensitivity of our approach. While Chen et al. used a high throughput FLIPR based approach in which the entire fluorescence of a lawn of cells from a well was summed for an overall measurement of dye uptake, we measured dye uptake in individual cells (Chen, Kim et al. 2009). In addition to the FLIPR assay being less sensitive due to the unknown transfection efficiency of the cells being measured, it also has higher background due to variations in cell confluency and its inclusion of non-‐specific dye uptake in dead or dying cells. Taken together with the fact that this study used a submaximal 100µM concentration of menthol (EC50 66.7uM), we believe the authors were unable to see TRPM8-‐mediated dye uptake due to the limitations of their assay design (McKemy, Neuhausser et al. 2002). By more robustly stimulating TRPM8 with menthol and the 75 super-‐potent agonist WS-‐12 (EC50 193nM), and controlling for sensitivity and background issues by measuring individual cells, we were able to definitively show dye uptake in TRPM8-‐transfected heterologous cells (Bodding, Wissenbach et al. 2007). To further test the TRPM8-‐specificity of this phenomenon we showed that the TRPM8-‐ specific antagonist PBMC could be used to both prevent and block the progression of WS-‐12-‐mediated dye uptake. Additionally, in agreement with previously published reports on the high specificity of WS-‐12 for TRPM8, we showed that WS-‐12 did not cause dye uptake in cells expressing other TRP family channels TRPA1 or TRPV1 (Ma, G et al. 2008; Anand, Otto et al. 2010). Using our TRPM8-‐GFP BAC-‐transgenic mouse line, we next showed similar WS-‐ 12-‐mediated dye uptake in cultured native cells. We found that dye uptake in the presence of WS-‐12 overlapped almost exclusively with the TRPM8-‐expressing subpopulation of sensory neurons with 87.4 +/-‐ 5.0% of GFP + neurons vs 1.9% GFP -‐ neurons taking up dye. These results are consistent with previously published work characterizing calcium responses using menthol in similarly cultured sensory neurons (Takashima, Daniels et al. 2007). Lastly, we tested if cold behavioral responses could be silenced using this method in vivo. We found that mice injected with 20µg WS-‐12 IP into the hind paw develop cold hypersensitivity, a phenotype not seen in control mice injected with vehicle or 2% QX-‐314 alone. However, when WS-‐12 was co-‐injected with 2% QX-‐314 we saw no cold hypersensitivity develop in response to acetone. These preliminary studies serve as the first evidence that support the hypothesis that TRPM8 76 pore dilation can be used to specifically target therapeutics to cold sensing neurons. Future electrophysiological studies will show definitively if QX-‐314 can permeate TRPM8 and block neuron firing in vitro, and shed light on the physical pore dilation properties of the channel itself. Although the high degree of specificity of WS-‐12 for TRPM8 has been published, WS-‐12 paw injections in TRPM8-‐knockout mice will tell us if WS-‐12-‐induced cold hypersensitivity is dependent on TRPM8 in vivo (Ma, G et al. 2008; Anand, Otto et al. 2010). Furthermore, as we and others have shown that TRPM8 is involved in a variety of chronic cold pain models, whether it be inflammatory (CFA), neuropathic (CCI), or chemotherapeutic-‐induced (Oxaliplatin), further testing the utility of this approach will provide valuable insights into the treatments of these and similar conditions (Colburn, Lubin et al. 2007; Knowlton, Daniels et al. 2011; Knowlton, Palkar et al. 2013). 77 CHAPTER FOUR Translational profiling approach for the molecular characterization of TRPM8-‐expressing sensory neurons 78 INTRODUCTION The sensory nervous system is responsible for the detection of a wide variety of environmental cues. One sensory pathway in which biological players have been identified is that of temperature sensation. As discussed previously, a series of Transient Receptor Potential (TRP) ion channels have been found to play integral roles in the perception of temperature in that they are thermally-‐gated, leading to the depolarization of the neurons and nerve firing upon activation (Jordt, McKemy et al. 2003). The channel TRPM8 detects both noxious and innocuous cold and is the molecular basis for the cooling associated with menthol (McKemy, Neuhausser et al. 2002; Bautista, Siemens et al. 2007). Knockout mouse studies have shown TRPM8’s involvement in cold nociception, cold-‐mediated analgesia, and cold hyperalgesia (Bautista, Siemens et al. 2007; Colburn, Lubin et al. 2007; Dhaka, Murray et al. 2007). How one gene can be involved in these varied phenotypes remains unclear, and the mechanisms that may regulate TRPM8 function in this regard have yet to be identified. Furthermore, TRPM8 has been directly implicated in pain models associated with diabetic and chemotherapeutic-‐induced cold neuropathies (Knowlton, Daniels et al. 2011; McCoy, Zhou et al. 2013). These conditions are often debilitating, and with no clear understanding of the underlying mechanisms involved, patients are left with no way of directly alleviating their symptoms. As TRPM8 has a myriad of functions, a transcriptional snapshot of these cold-‐sensitive, TRPM8-‐expressing neurons under normal and pathological conditions would help in our understanding of thermal 79 sensitivity and has the potential to reveal new therapeutic targets for the treatment of cold-‐hypersensitive conditions. Typical gene expression profiling approaches use fluorescence-‐activated cell sorting (FACS) to collect a specific cell type to be profiled. However, TRPM8 is expressed in a very small subset of sensory neurons and, due to the inefficiencies in attaining ample amounts of mRNA using FACS, an alternative approach was needed (Takashima, Daniels et al. 2007). Here we describe applying a new translating ribosome affinity purification (TRAP) technique for this purpose (Fig. 4.1). This technique employs the use of an eGFP labeled ribosomal protein L10a (eGFP-‐L10a) as a means to pull down cell-‐ specific translating mRNA sequences when genetically targeted to TRPM8 expressing neurons (Heiman, Schaefer et al. 2008). The advantages of this technique are numerous but include: 1) shorter processing time, minimizing mRNA degradation and expression changes brought on by cell stress, 2) cell-‐type specificity due to its genetic targeting, and 3) provides a more accurate reflection of protein levels due to the specificity for mRNA transcripts actively being translated by ribosomes. Described herein is the development of a TRPM8-‐BAC-‐transgenic line where eGFP-‐L10a has been targeted to cold-‐sensitive, TRPM8-‐expressing neurons (TRPM8-‐ eGFP-‐L10a). Although dozens of transgenic mouse lines have been generated using the BAC-‐TRAP methodology (Doyle, Dougherty et al. 2008), this mouse is the first in which a sensory neuron population has been targeted. Successful pull-‐down of ribosomal protein and intact translating transcripts from heterologous cells provide proof of 80 principle for this technique to be used to isolate TRPM8 neuron-‐specific transcripts from our mouse line. Furthermore, as the TRPM8-‐expressing neuronal population is functionally heterogeneous in nature, we will also discuss the development of a CRE recombinase based approach in which eGFP-‐L10a and mCherry-‐L10a can be specifically targeted to distinct TRPM8 subpopulations allowing for their comparison following tag-‐ specific immunoprecipitation. These tools will serve two main purposes 1) to better understand molecular expression in cold-‐sensitive, TRPM8-‐expressing neurons and 2) to identify genes involved in the development of cold hypersensitivity. 81 (Emery and Barres 2008) FIGURE 4.1 BAC-‐TRAP technique work flow BAC-‐TRAP technique work flow highlighting the cell-‐specific isolation of mRNA transcripts using the ribosomal subunit L10a 82 MATERIALS AND METHODS TRPM8-‐L10a-‐eGFP mouse BAC-‐transgenic generation The TRPM8 bacterial artificial chromosome (BAC) clone was modified by homologous recombination as described (Heiman, Schaefer et al. 2008), targeting an L10a-‐eGFP transgene to the second exon at nucleotide position 1927 in the TRPM8 gene (numbering based on the Ensembl Genome Browser; gene ID, ENS-‐MUSG00000036251). A targeting (Abox) sequence consisting of ~370 bp upstream (5’) to the recombination site was cloned into the S296 shuttle vector containing L10a-‐eGFP (a gift from N. Heintz, Rockefeller University, New York). TRPM8-‐Abox-‐L10a-‐eGFP shuttle vector DNA was then electroporated into electrocompetent bacteria containing the TRPM8-‐BAC and a Recombinase-‐A (RecA) plasmid and selected in Luria Broth (LB) medium containing carbenicillin (shuttle vector), chloramphenicol (TRPM8-‐BAC), and tetracycline (RecA) overnight. The culture was then plated onto carbenicillin/chloramphenicol growth plates and again grown overnight. Identification of cointegrates was done via PCR analysis using the following BAC-‐specific and transgene-‐specific primers: P1 (5’ BAC-‐specific), 5’-‐GCAAACAGAAGAGACATCGCTAGC-‐3’ P2 (3’ GFP-‐specific), 5’-‐GTTCAGCGTGTCCGGCGAGGGCG-‐3’ P3 (5’ R6K-‐specific), 5’CAGGTTGAACTGCTGATCAACAGATC-‐3’ P4 (3’ BAC-‐specific), 5’-‐GCAATAAAACTCCCTGCTTCATAG-‐3’ Modified BAC clones were also screened via Southern blot analysis using a Biotin labeled probe corresponding to the targeting Abox sequence. Modified BAC-‐DNA was 83 purified over a sepharose column and dialyzed for 2 days in excess injection buffer (10nM EDTA, 10mM Tris, 100mM NaCl pH 7.5). Purified DNA was then injected into the pronucleus of fertilized ova at the University of Southern California (USC) Transgenic Core Facility. Transgenic founder mice were identified by PCR and mated to C57BL/6 mice. All animals were handled and cared for in accordance with guidelines established by the USC Animal Care and Use Committee. Immunostaining Mice were transcardially perfused with ice cold 4% paraformaldehyde (PFA) solution in 0.1M PBS. Tissues were carefully dissected and post-‐fixed for 2hrs on ice in 4% PFA, and dehydrated in 30% sucrose solution in 0.1M PBS overnight at 4°C. Sensory tissue was quickly frozen in OCT on dry ice, sectioned with a cryostat at 10µm onto Superfrost Plus slides (VWR) and stored at -‐80°C. Cryosections were thawed at room temperature for 10mins, permeabilized in PBST (0.1M PBS, 0.1% Triton X-‐100) for 30mins, washed 3 times in PBS for 5mins and blocked for 1hr at room temperature in PBST + 5% Normal Goat Serum (NGS). Slides were then incubated with a 1:500 dilution of Guinea pig anti PGP9.5 (AB5898, Millipore) in PBST + 1% NGS overnight at 4°C in a humidified box to label all sensory neurons. Slides were washed 3 times in PBST for 5mins and incubated in secondary antibody solution (1:1000 Alexa-‐594 (Invitrogen) in PBST + 1% NGS) for 2hrs at room temperature. Slides were washed 3 times in PBST for 10mins and cover slipped with Vectorshield-‐DAPI (Vector Labs), or Prolong Gold 84 (Invitrogen) mounting medium. Imaging was carried out on a Zeiss Axio Imager M2 with Apotome. Note: GFP labeling was not needed as L10a-‐eGFP transgene was bright enough to label cells on its own. Neuron culture and Calcium imaging Trigeminal Ganglia were dissected from newborn transgenic mice (<P14) engineered to express L10a-‐eGFP in TRPM8-‐positive sensory neurons and dissociated with 0.25% collagenase Type 1 (Roche) in a solution of 50% DMEM and 50% F-‐12 for 30mins. The ganglia were then pelleted and resuspended in 0.05% trypsin and incubated at 37°C for 2mins. After washing in DMEM/F12 and pelleting, cells were triturated gently with a fire-‐polished Pasteur pipette in culture medium (DMEM/F-‐12 with 10% FBS and penicillin-‐streptomycin). Cells were then spun through a percol gradient consisting of 60% percol overlaid by 30% percol in culture media. Enriched sensory neurons were then collected from the interphase between the 30% and 60% layers, washed, pelleted and resuspended in culture medium supplemented with nerve growth factor 7S (Invitrogen) (100ng/ml) and plated onto coverslips coated with Matrigel (BD) (20µl/ml). Cultures were then used 12-‐24hrs after plating. Neurons were preloaded for 1hr at room temperature with 10µM Fura-‐2, a cell permeable fluorescent dye that is differentially excited by 340nm and 380nm light based on whether or not it is bound to calcium. Cells were first acclimated to calcium imaging buffer (CIB) containing: 136mM NaCl, 5.4mM KCl, 1mM MgCL 2 , 1.8mM CaCl 2 , 85 10mM HEPES, 10mM glucose and 0.33mM NaH 2 PO 4 adjusted to pH 7.4. Next, cells were perfused with 500µM menthol in CIB to identify TRPM8-‐expressing neurons. Finally, cells were perfused with CIB spiked with 50mM KCl to identify all active neurons in the culture. Changes in intracellular calcium were measured via radiometric imaging (340:380nm ratio) and used to identify live functioning neurons for quantification purposes. Mammalian cell culture and transfection Mammalian expression vectors containing L10a-‐eGFP, LC(L10a)LG(L10a), or CRE were transfected into the human embryonic kidney cell line 293 (HEK293) using TransIT-‐ LT1 reagent (Mirus) following the manufacturer’s instructions. Cells were split onto round matrigel-‐coated (BD) coverglass 24hrs after transfection and imaged within 48hrs of splitting. Cells were maintained in Dulbecco’s Modification of Eagle’s Medium (DMEM) supplemented with 10% fetal bovine serum (FBS) and 1% penicillin-‐ streptomycin inside a 37°C, 5% CO 2 humidified incubator. Immunoprecipitation HEK cells transfected with L10a-‐eGFP, LC(L10a)LG(L10a), or CRE were harvested 48hrs post transfection and lysates immunoprecipitated (IP) as described (Heiman, Schaefer et al. 2008). Briefly, cells were first resuspended in polysome extraction buffer (10mM HEPES, 5mM MgCl 2 , 150mM KCl, 0.5mM dithiothreitol, 100μM cycloheximide, 86 protease inhibitors, and RNase inhibitors pH 7.4) and immediately homogenized using a teflon-‐glass homogenizer. Lysates were centrifuged for 10mins at 2,000 x g at 4°C to pellet cell debris, and NP-‐40 and DHPC were added to the supernatant at a final concentration of 1% and 30mM respectively. Supernatants were then incubated on ice for 30mins with frequent hand over hand mixing and centrifuged for 10mins at 13,000 x g to pellet unsolubilized material. Mouse anti-‐GFP (clones 19C8 and 19F7 from MSKCC) or mouse anti-‐mCherry (Clontech) coated MyOne T1 Dynabeads (precoated with biotinylated protein L) were added to the supernatant and incubated at 4°C with end-‐ over-‐end rotation for 30min-‐overnight. Beads were washed three times on a magnetic rack with high-‐salt polysome wash buffer (10mM HEPES, 5mM MgCl 2 , 150mM KCl, 0.5mM dithiothreitol, 100μM cycloheximide pH 7.4) and resuspended in 2X SDS (for western blotting) or Qiagen RNA-‐cleanup lysis buffer (for RNA purification). RTPCR RNA isolated by IP was purified using the RNeasy minipret kit with in-‐column DNase digestion per manufacturer’s instructions (Qiagen). RTPCR was then carried out on RNA samples using the SuperScript III One-‐Step RT-‐PCR kit per manufacturer’s instructions (Invitrogen) using β-‐actin-‐specific primers as a measure of intact RNA following IP/purification. Samples were visualized via gel electrophoresis after 40 cycles. The β-‐actin primers used were as follows: FWD 5’-‐TCCTTCGTTGCCGGTCCACA-‐3’ and REV 5’-‐GGGCCACACGCAGCTCATTGTA-‐3’ (329bp). 87 Western Blotting Protein samples isolated by IP were loaded and run on a 4%/10% polyacrylamide gel and transferred to a PVDF membrane. Membranes were blocked for 1hr at room temperature in 2.5% BSA, 2.5% normal donkey serum (NDS) in PBST (0.1% Tween 20). Primary antibody incubations were carried out overnight at 4°C at dilutions of 1:1000 for each antibody in 1% BSA, 1% NDS in PBST. The primary antibodies used were as follows: Mouse anti-‐L10a (H00004736-‐M01, Abnova), Rabbit anti-‐GFP (A11122, Invitrogen), Mouse anti-‐mCherry (Clontech). After four 5min washes in PBST, secondary antibody incubations were carried out for 30-‐60mins at room temperature at dilutions of 1:10,000 for each antibody in 1% BSA, 1% NDS in PBST plus 0.02% SDS. The secondary antibodies used were as follows: Donkey anti Rabbit-‐HRP (Jackson Immuno), and Donkey anti Mouse-‐HRP (Jackson Immuno). After four 5min washes in PBST, membranes were then incubated for 5mins in SuperSignal West Pico substrate (34079, Pierce) and immediately imaged on X-‐ray film. 88 RESULTS Targeting of the TRPM8-‐eGFP-‐L10a transgenic mouse line The TRPM8-‐eGFP-‐L10a BAC transgenic mouse line was generated using the methods pioneered by Nathaniel Heintz’s lab at Rockefeller University (Heiman, Schaefer et al. 2008). Specifically, a shuttle vector containing a TRPM8-‐specific Abox sequence followed by the eGFP-‐L10a transgene was targeted to a bacterial artificial chromosome (BAC) containing TRPM8 and its upstream regulatory region via homologous recombination (Fig. 4.2A). Successful modification of BAC DNA was confirmed via PCR analysis using BAC-‐specific and transgene-‐specific primers and via Southern Blot (Fig. 4.2B). Purified BAC DNA was then injected into 200 single cell stage mouse embryos and implanted in six pseudopregnant females. Four out of six females gave birth to litters with only one litter of five mice surviving past neonatal age. Three targeted mice out of the five were identified via PCR analysis of genomic DNA taken from the tail, two of which were found to have targeted the germline, and one of which reproduced past the F1 generation (Fig. 4.2C). All of the mouse data presented beyond this point was using this mouse line and is referred to as the TRPM8-‐eGFP-‐L10a line. TRPM8-‐eGFP-‐L10a mice express eGFP-‐L10a in a subset of small, menthol-‐sensitive sensory neurons To confirm correct expression of eGFP-‐L10a in TRPM8-‐expressing sensory neurons, trigeminal (TG) and dorsal root ganglia (DRG) were sectioned and stained with 89 FIGURE 4.2 Targeting strategy of the TRPM8-‐eGFP-‐L10a transgenic mouse line A) A shuttle vector containing the L10a-‐eGFP transgene and a homologous region of TRPM8 sequence was targeted to a Bacterial artificial chromosome (BAC) containing the genomic sequence of TRPM8 using Recombinase A (RecA). B-‐C) BAC modification was confirmed via PCR analysis using specific external (P1+4) and internal (P2+3) primers (A) and Southern blot analysis using a biotin-‐labeled TRPM8-‐target sequence probe (B). Bands expected are ~9.85kb for unmodified TRPM8-‐BAC DNA and ~9.2kb + ~2.2kb for modified TRPM8-‐BAC DNA. D) PCR analysis on mouse genomic DNA isolated from the tail show successful targeting of the TRPM8-‐eGFP-‐L10a BAC transgene (Tg1 = Transgenic founder #1). 90 the pan neuronal marker PGP9.5. GFP fluorescence was visualized without immunolabeling and appeared to be somatic in nature with no GFP signal seen in axonal projections, as expected for a ribosomal marker (Fig. 4.3A). Higher magnification images showed punctate fluorescence around the nucleus of labeled neurons, characteristic of polysome labeling (Fig. 4.3A right) (Doyle, Dougherty et al. 2008). GFP fluorescence was found in 15.8 ± 1.4% of neurons in the TG (n=3 mice, 3925 neurons) and 11.0 ± 0.8% of neurons in the DRG (n=3 mice, 2500 neurons) (Fig. 4.3A). Furthermore, GFP + neurons were small in diameter averaging 19.1 ± 0.23μM in the TG (n=506) and 16.5 ± 0.30μM in the DRG (n=225), results consistent with TRPM8-‐expressing neurons (Fig. 4.3B) (Takashima, Daniels et al. 2007). Although by expression patterns it appeared that eGFP-‐ L10a had been successfully targeted to the TRPM8-‐expressing sensory neuron population, in the absence of a commercially available TRPM8 antibody that labels mouse tissue we could not be certain. To circumvent this problem we turned to in vitro calcium-‐imaging studies. It was found that 93.5 ± 4.3% of GFP + and only 5.7 ± 2.5% of GFP -‐ neurons responded to the TRPM8-‐agonist menthol (9 experiments 144 total neurons), results again consistent with the eGFP-‐L10a transgene being correctly targeted to the cold-‐sensitive, TRPM8-‐expressing neuron population (Fig.4A-‐B). 91 FIGURE 4.3 The TRPM8-‐eGFP-‐L10a mouse line expresses eGFP-‐L10a in a subset of small sensory neurons A) Fluorescence in TRPM8-‐L10a-‐eGFP + mouse DRG (Top) and TG (Bottom) stained with pan neuronal marker PGP9.5 (red). Green channel confocal high magnification shown to the right. TG (n=3 mice, 3925 neurons) and DRG (n=3 mice, 2500 neurons). B) Distribution of GFP + sensory neuron diameters from the DRG/TG of TRPM8-‐L10a-‐eGFP + mice. Values are expressed as percentage ± SE (TG n = 3 mice, 506 neurons, DRG n = 3 mice, 225 neurons) 92 FIGURE 4.4 GFP + neurons from the TRPM8-‐eGFP-‐L10a mouse line functionally respond to menthol A) Calcium imaging on sensory neurons isolated from P9 TRPM8-‐L10a-‐eGFP mice using the indicator Fura-‐2. 93.5 +/-‐ 4.3% of GFP positive neurons responded to 500µM menthol bath application (9 experiments n=144 neurons). B) Quantification of A) as measured by A340/380nm. 93 Immunoprecipitation of eGFP-‐L10a and associated transcripts from transfected HEK cell lysates To provide proof of principal that we could use the TRAP technique to IP mRNA from TRPM8-‐expressing sensory tissue using our TRPM8-‐eGFP-‐L10a transgenic line, we first tested the technique in a heterologous system. Using a modified protocol provided by Myrian Heiman (Rockefeller University), we were able to successfully isolate ribosomal protein from HEK293T cells transiently transfected with eGFP-‐L10a, as evidenced by western blot analysis of IP protein samples (Fig. 4.5A). Additionally, using β-‐actin as a marker of intact mRNA, we were able to show that mRNA could also be co-‐ immunoprecipitated in a manner that was dependent on the use of anti-‐GFP coated beads, as expected (Fig. 4.5B). Taken together, these data show successful IP of polysomes and their associated intact mRNA transcripts. Immunoprecipitation of eGFP-‐L10a and associated transcripts from TRPM8-‐eGFP-‐L10a sensory tissue Although eGFP-‐L10a protein and associated transcripts were successfully immunoprecipitated from heterologously transfected cells, attempting this using sensory tissue proved to be quite difficult (data not shown). This is most likely due to the presence of more connective tissue in sensory ganglia compared to the brain, the tissue source in which this protocol was first optimized. Western blot analysis of protein samples isolated from TRPM8-‐eGFP-‐L10a TG/DRG tissue showed that we could identify 94 eGFP-‐L10a using anti GFP antibodies, however, much of the protein was trapped in the cell pellets following centrifugation and not in the supernatant as expected. Despite prolonged and more rigorous homogenization of the tissue using a motorized glass Teflon homogenizer or a plastic mini microcentrifuge tube pestle homogenizer, the majority of eGFP-‐L10a remained in pellet lysate samples. Furthermore, attempts at immunoprecipitating eGFP-‐L10a and associated mRNA from TG/DRG isolated from as many as 16 mice were also unsuccessful. No enrichment for TRPM8 mRNA was seen when comparing samples incubated with beads bound with anti GFP antibody versus those incubated with beads alone. Future experiments will need to focus on optimizing the homogenization of sensory tissue to maximize the amount of free eGFP-‐L10a bound to mRNA before immunoprecipitation. It will be critical to ensure that both polysomes and RNA remain intact throughout the processing of the samples and the use of a bioanalyzer will aid in the troubleshooting of this process. Development of a Lox-‐mCherry-‐L10a-‐Lox-‐eGFP-‐L10a construct for the profiling of two distinct cell populations at once As the TRPM8-‐expressing neuronal population has been found to be extremely heterogeneous in terms of gene expression and function, future studies on distinct subpopulations is warranted (McKemy, Neuhausser et al. 2002; Takashima, Daniels et al. 2007; Madrid, de la Pena et al. 2009). To this end we have developed a CRE-‐based approach that allows for mRNA from two distinct subpopulations to be 95 FIGURE 4.5 eGFP-‐L10a and associated transcripts can be immunoprecipitated from transfected HEK cell lysates A) Western blot analysis of immunoprecipitated L10a-‐eGFP protein from transfected HEK cell lysates. Loaded amounts are 0.5% for input lysate and flow through samples and 5% for IP samples. B) 2-‐Step RTPCR for the housekeeping gene Beta-‐actin on mRNA isolated from IP experiments in A). 96 immunoprecipitated simultaneously using the TRAP technique (Fig. 4.6A). A lox-‐ mCherry-‐L10a-‐lox-‐eGFP-‐L10a (LC(L10a)LG(L10a)) cassette was cloned into the mammalian expression vector pCDNA3 and transfected into HEK293T cells. Cells transfected with the LC(L10a)LG(L10a) plasmid alone fluoresced in the red channel but not in the green channel, indicative of exclusive expression of the mCherry-‐L10a fusion protein (Fig. 4.6.B). Conversely, cells transfected with LC(L10a)LG(L10a) and CRE showed mosaic fluorescence in both channels in a manner that directly correlated with the ratio of CRE to LC(L10a)LG(L10a) transfected, indicative of successful excision of the mCherry-‐ L10a cassette and subsequent expression of the eGFP-‐L10a fusion protein (Fig. 4.6B). Expression of these fusion proteins was later confirmed via Western blot analysis on cell lysates (Fig. 4.6C). Both mCherry-‐L10a and eGFP-‐L10a were successfully immunoprecipitated from mixed lysates with no cross reactivity seen between capture antibodies, serving as proof of principle for this technique (Fig. 4.6C). The LC(L10a)LG(L10a) cassette was then targeted to the TRPM8-‐BAC using the same strategy used to generate the TRPM8-‐eGFP-‐L10a transgenic line and confirmed by PCR (Fig. 4.6D). 97 FIGURE 4.6 Development of a Lox-‐mCherry-‐L10a-‐Lox-‐eGFP-‐L10a construct for the profiling of two distinct cell populations at once A) Design and function of the Lox-‐mCherry-‐L10a-‐Lox-‐eGFP-‐L10a (LCLG) targeting construct. L10a-‐ mCherry is expressed in the absence of CRE while L10a-‐eGFP is expressed in the presence of CRE. B) HEK 293-‐T cells transiently transfected with pcDNA3-‐LCLG express mCherry-‐L10a, while cells co-‐ transfected with CRE recombinase express eGFP-‐L10a. C) IPs on pooled lysates containing mCherry-‐ L10a and eGFP-‐L10a show antigen specificity. D) PCR analysis of 5’ and 3’ recombination sites confirm successful targeting of the LCLG construct to the TRPM8-‐BAC. 98 CONCLUSION Here we have described the development of a BAC-‐transgenic mouse line that can be used to identify molecular candidates involved in cold sensation. We have shown that the eGFP-‐L10a transgene has been successfully targeted to cold-‐sensitive, TRPM8-‐ expressing sensory neurons and, as proof of principle, we have used the TRAP technique to IP mRNA from heterologous cells. As stated previously, this TRPM8-‐eGFP-‐L10a mouse line will be used for two main purposes: 1) to better understand molecular expression in cold-‐sensitive, TRPM8-‐expressing neurons and 2) to identify genes involved in the development of cold hypersensitivity. Specifically, this will be accomplished by first profiling the TRPM8-‐expressing neuron population under normal conditions and then repeating this process using mice under various models of cold hypersensitivity (inflammatory, neuropathic, oxaliplatin-‐induced). Recent work has identified candidate molecules involved in the sensitization to cold stimuli. For example, specific potassium channel (Kv1) inhibitors have been shown to increase cold sensitive neuron temperature thresholds in vitro (Madrid, de la Pena et al. 2009). Additionally, work in our lab has shown that Phospholipase C (PLC)-‐mediated depletion of the phospholipid PIP2 results in reduced cold-‐induced TRPM8 currents (Daniels, Takashima et al. 2009). In a model of cold hypersensitivity we would expect that genes involved in the regulation of Kv1 expression and/or PIP2 synthesis could be differentially regulated compared to controls. TRPM8 is involved in both innocuous and noxious cold sensation, involved in the development of cold hypersensitivity, required for cooling-‐induced analgesia, and has 99 been implicated in the alleviation of itch (Bromm, Scharein et al. 1995; Proudfoot, Garry et al. 2006; Bautista, Siemens et al. 2007; Colburn, Lubin et al. 2007; Dhaka, Murray et al. 2007; Frolich, Enk et al. 2009; Knowlton, Bifolck-‐Fisher et al. 2010; Knowlton, Daniels et al. 2011; Knowlton, Palkar et al. 2013). The diverse roles of this channel suggest that TRPM8 expression is not limited to merely one sensory circuit, but rather TRPM8 subpopulations are functionally distinct. As highlighted in Chapter 1, several groups have shown that cold-‐sensitive neurons fall into two loosely related categories in vitro, those with low thermal (LT) activation thresholds and those with high thermal (HT) activation thresholds responding to either innocuous or noxious cold temperatures respectively (Reid, Babes et al. 2002; Thut, Wrigley et al. 2003; Madrid, de la Pena et al. 2009). In fact, lower levels of functional TRPM8 expression have been reported in vitro for cold-‐sensitive neurons with significantly colder thresholds for activation, results consistent with this categorization of cold-‐sensing neurons (Madrid, de la Pena et al. 2009). Furthermore, approximately 40% of TRPM8 neurons express Nav1.8, a voltage-‐ gated sodium channel known to be highly expressed in nociceptors, suggesting that this subpopulation of TRPM8 neurons is specifically involved in cold pain (Knowlton, Palkar et al. 2013). In line with this theory, when Nav1.8-‐expressing neurons were ablated, mice exhibited severe deficits in cold pain behaviors while innocuous cold detection was unaffected (Abrahamsen, Zhao et al. 2008). To better study TRPM8-‐expressing subpopulations we have expanded the BAC-‐TRAP technique to allow for the specific IP of transcripts from two different populations simultaneously. Specifically, we have 100 generated a targeting construct containing a floxed mCherry-‐L10a transgene inserted upstream of the eGFP-‐L10a cassette (LC(L10a)LG(L10a). The utility of this approach is when a LC(L10a)LG(L10a) BAC-‐transgenic line is crossed with a CRE-‐driver line, mCherry-‐ L10a, and eGFP-‐L10a are expressed in distinct subsets within the BAC-‐driven cell population. We have shown that heterologous cells transfected with LC(L10a)LG(L10a) and CRE express both mCherry and eGFP as expected, and lysates from these cells can be specifically pulled down in a capture antibody-‐specific manner. We have targeted this LC(L10a)LG(L10a) cassette to the same TRPM8-‐BAC used to generate the TRPM8-‐ eGFP-‐L10a transgenic line and future experiments will involve the targeting and characterization of this transgenic line. Once the line has been generated, subsequent crossings with one of the hundreds of CRE-‐driver lines that exist in the Jackson database will allow for the profiling of TRPM8-‐expressing neuron subpopulations. Of particular interest will be crossing this BAC-‐transgenic line with the Nav1.8-‐CRE and/or TRPV1-‐CRE lines, allowing for the specific profiling of presumptive cold-‐nociceptors. In summary, the development of the TRPM8-‐eGFP-‐L10a BAC-‐transgenic mouse line provides a means to better study the internal milieu of TRPM8-‐expressing neurons. Future profiling of these neurons in various pain models has the potential to reveal new targets and pathways for the treatment of cold-‐hypersensitive conditions. Furthermore, the development our CRE-‐based BAC-‐TRAP approach will allow us to expand our understanding of what defines functionally distinct sensory subpopulations. 101 CHAPTER FIVE Conclusion 102 CONCLUSION In this dissertation we have described two novel characteristics of the cold-‐ sensitive ion channel TRPM8. In testing the TRPM8 dependence of cold hypersensitivity in a model of type I diabetes, we serendipitously found that the lack of TRPM8 resulted in enhanced insulin clearance, suggesting an inhibitory role of the channel in this process. Additionally, we found that strong activation of TRPM8 allows for large positively charged molecules to permeate the channel, a result contrary to previously published findings and relevant for future therapeutic approaches using TRPM8 as a means of targeting cold-‐sensitive neurons. Finally, we have developed a transgenic mouse line that will enable the study of TRPM8 neurons on a transcriptional level, and has the potential to help in the identification of new targets and pathways involved in the development of cold-‐pain. In chapter 2, we discussed how mice lacking functional TRPM8 were found to be more susceptible to the diabetogenic drug Streptozotocin, showing rapid weight loss and lethargy soon after I.P. injection. This phenotype correlated with lower resting levels of serum insulin and heightened insulin sensitivity in uninjected TRPM8 -‐/-‐ mice compared to wildtype. These differences in insulin and insulin sensitivity were not due to differences in pancreatic function, but appeared to be due to enhanced insulin clearance. The lower incremental increases in serum insulin following glucose challenge in TRPM8 -‐/-‐ mice vs. wildtype controls showed that insulin was being cleared at a faster rate in these animals as incremental increases in C-‐peptide under the same conditions 103 were the same across genotypes. Although we can’t be sure about the mechanism by which TRPM8 is exerting its influence on insulin clearance, the heightened expression of IDE in TRPM8 -‐/-‐ liver samples suggests this influence to be hepatic in nature. The presence of TRPM8 neuronal projections in the hepatic-‐portal vein is intriguing in this regard as the HPV carries 75% of the blood supply to the liver and innervations of the HPV have already been shown to be required for hypoglycemic detection (Fujita, Bohland et al. 2007). Additionally, human liver transplant patients in which all hepatic innervations are disrupted have been shown to have heightened hepatic insulin clearance (Perseghin, Regalia et al. 1997; Schneiter, Gillet et al. 1999), a phenotype similar to what we see in TRPM8 -‐/-‐ mice. Taken together, these data suggest that TRPM8 mediated neuronal signals may provide negative regulation of insulin clearance via hepatic neural innervations influencing local IDE expression levels. In such a scenario, hepatic insulin clearance is heightened in TRPM8 -‐/-‐ mice due to the disinhibition of this circuit in the absence of functional TRPM8 channels. Future studies on these hepatic TRPM8 + neurons will provide a better understanding of the mechanism by which TRPM8 is working in regards to insulin clearance and have the potential for profound therapeutic relevance in the treatment of diabetes and other metabolic disorders. In chapter 3, we tested whether or not large positively charged molecules could permeate TRPM8 channels following robust channel activation. Previously published reports concluded that TRPM8 could not pass large cationic molecules in such a manner 104 (Chen, Kim et al. 2009; Nakagawa and Hiura 2013). We questioned the validity of these conclusions for a number of reasons. First, the TRPM8 agonist previously used, menthol, is known to be a rather weak agonist for the channel and it was possible that this agonist was not potent enough to cause TRPM8 pore dilation. Second, the maximal concentration used in this study was close to the previously reported EC50 values for menthol in in vitro systems (66.7µM)(McKemy, Neuhausser et al. 2002). We postulated this may have resulted in the mischaracterization of the channel due to suboptimal doses of agonist being used. Finally, the previous study used a high throughput 96-‐well format in which the changes in fluorescence of an entire well of TRPM8-‐transfected cells were used as a measure of dye uptake. This method proved to be fast and convenient but the different transfection efficiencies and cell viabilities between wells most likely resulted in a rather high background signal and low sensitivity. In our studies we addressed these three issues by 1) using the super-‐potent TRPM8 agonist WS-‐12 (EC50 ~193nM), 2) testing higher concentrations of menthol, and 3) measuring increases in fluorescence in individual viable cells to minimize background and increase sensitivity. We found that WS-‐12 activated HEK cells transfected with rTRPM8 robustly enough to allow the entry of the large cationic dye PO-‐PRO3 with a maximal response attained at concentrations greater than or equal to 2µM. Similarly, we repeated the experiment using menthol and found that the maximal concentration used by the previous group (100µM) was sufficient enough to allow dye entry in a TRPM8-‐dependent manner although this was nowhere near the maximal responses seen using WS-‐12. 105 Furthermore, when a 10-‐fold higher concentration of menthol was used (1mM) a maximal response similar to that of WS-‐12 was seen. As WS-‐12 is a menthol derivative and a previously published work has shown in vitro menthol-‐mediated currents through another TRP channel, TRPA1 (Karashima, Damann et al. 2007), we tested the specificity of WS-‐12 in this assay using HEK cells transfected with rTRPA1. We found that no dye was taken up by these cells even at maximal concentrations, results consistent with previous studies showing WS-‐12 to be TRPM8-‐specific (Ma, G et al. 2008; Anand, Otto et al. 2010). Additionally, to ensure that the dye influx was mediated by TRPM8 and did not occur as a consequence of some other channel activation or general cell death, we showed that WS-‐12 mediated entry of POPRO-‐3 could be halted in HEK cells transfected with rTRPM8 by adding the TRPM8-‐specific antagonist PBMC. Finally, we used our mouse TRPM8-‐GFP reporter line to show that TRPM8-‐expressing sensory neurons in culture could be stimulated by WS-‐12 to take up PO-‐PRO3, with 87.4 +/-‐ 5.0% of GFP + neurons vs 1.9% GFP -‐ neurons taking up dye upon stimulation. Our results prove that TRPM8 can in fact be used to allow entry of large cationic molecules upon robust channel activation in vitro, results contrary to previously published work (Chen, Kim et al. 2009; Nakagawa and Hiura 2013). It remains to be seen whether positively charged drugs can be used to block TRPM8 neuron firing both in vitro and in vivo using this method but preliminary data from the lab showing the successful block of cold hypersensitivity in response to WS-‐12 paw injections when it is co-‐administered with the lidocaine derivative QX-‐314 is promising. The ability of the TRPM8 channel to 106 facilitate delivery of therapeutics to cold-‐sensing neurons opens the door for the development of treatment paradigms that are highly specific to cold pain conditions. In chapter four, we discussed the development of a mouse BACTRAP transgenic line in which an eGFP tagged version of the ribosomal subunit L10a is targeted to TRPM8-‐expressing neurons. The BACTRAP technique, developed by the lab of Nathaniel Heintz at Rockefeller University, employs the use of anti GFP antibodies to co-‐ immunoprecipitate mRNA associated with actively translating GFP tagged ribosomes (Heiman, Schaefer et al. 2008). The purpose of our TRPM8-‐L10a-‐eGFP mouse line was twofold. First we wanted to understand how cold-‐sensing neurons differ from other sensory neurons on a transcriptome level. Second, we wanted to identify gene expression changes in cold-‐sensing neurons under conditions of chronic cold pain, with the aim of identifying candidate cold-‐transduction molecules in both scenarios. To this end we have successfully engineered a TRPM8-‐L10a-‐eGFP mouse line with GFP labeling in 13.9 ± 1.0% of sensory neurons, results consistent with TRPM8 expression. Additionally, we found that 93.5 ± 4.3% of these GFP + sensory neurons respond to the TRPM8 agonist menthol in culture via calcium imaging, further evidence that our transgene was successfully targeted. In preliminary studies in HEK cells transfected with L10a-‐eGFP we have shown successful immunoprecipitation of protein and intact mRNA transcripts. Future studies will work to bring this technique in vivo using mouse sensory neuron tissue from our TRPM8-‐L10a-‐eGFP line. As cold-‐sensory neurons are functionally heterogeneous in nature, we also engineered a CRE recombinase based 107 approach that allows for the comparison of gene expression between different TRPM8 subpopulations. We have generated a targeting construct with a floxed L10a-‐mCherry transgene upstream to the L10a-‐eGFP used in the aforementioned transgenic mouse line. When targeted, this construct allows for CRE-‐driven expression of L10a-‐eGFP within the BAC-‐transgenic cell population while retaining L10a-‐mCherry expression in cells lacking CRE. The result is a mosaic of L10a-‐eGFP and L10a-‐mCherry-‐expressing cells where transcripts from CRE + vs CRE -‐ subpopulations can be pulled down simultaneously using specific antibodies to eGFP and mCherry respectively. Proof of principle experiments in HEK cells have shown successful expression of L10a-‐mCherry and L10a-‐ eGFP in the absence or presence of co-‐transfected CRE. Furthermore, western blot studies on mixed HEK cell lysates IPed with both mCherry and eGFP antibodies indicate no cross reactivity. We have generated a modified TRPM8-‐BAC containing these transgenes and when this mouse line is ready to be made, future studies will allow for the molecular definition of distinct TRPM8 subpopulations under normal and pathological conditions. TRPM8 has proven to be a versatile channel with roles including, but not limited to, innocuous and noxious cold sensation, cold hypersensitivity, cooling-‐mediated analgesia, pruritus, and thermoregulation (Bautista, Siemens et al. 2007; Colburn, Lubin et al. 2007; Dhaka, Murray et al. 2007; Knowlton, Daniels et al. 2011; Knowlton, Palkar et al. 2013; Lippoldt, Elmes et al. 2013). Here we have expanded our understanding of the functional role of TRPM8 to include insulin homeostasis, established methodologies 108 to utilize the channel itself as a means of delivering therapeutics to cold-‐sensing neurons, and developed transgenic tools that will allow for the cells expressing this channel to be studied long term. These studies have not only broadened our understanding of TRPM8 and its therapeutic potential in areas not before considered, but have also provided new tools and valuable information that will inform future work studying this channel and the cells that express it. 109 REFERENCES Abrahamsen, B., J. Zhao, et al. (2008). "The cell and molecular basis of mechanical, cold, and inflammatory pain." Science 321(5889): 702-‐5. Akiba, Y., S. Kato, et al. (2004). "Transient receptor potential vanilloid subfamily 1 expressed in pancreatic islet beta cells modulates insulin secretion in rats." Biochem Biophys Res Commun 321(1): 219-‐25. Allchorne, A. J., D. C. Broom, et al. (2005). "Detection of cold pain, cold allodynia and cold hyperalgesia in freely behaving rats." Mol Pain 1: 36. Almeida, M. C., T. Hew-‐Butler, et al. (2012). "Pharmacological blockade of the cold receptor TRPM8 attenuates autonomic and behavioral cold defenses and decreases deep body temperature." J Neurosci 32(6): 2086-‐99. Anand, U., W. R. Otto, et al. (2010). "Sensitization of capsaicin and icilin responses in oxaliplatin treated adult rat DRG neurons." Mol Pain 6: 82. Anand, U., W. R. Otto, et al. (2008). "TRPA1 receptor localisation in the human peripheral nervous system and functional studies in cultured human and rat sensory neurons." Neurosci Lett 438(2): 221-‐7. Andersson, D. A., C. Gentry, et al. (2011). "TRPA1 mediates spinal antinociception induced by acetaminophen and the cannabinoid Delta(9)-‐ tetrahydrocannabiorcol." Nat Commun 2: 551. Andersson, D. A., M. Nash, et al. (2007). "Modulation of the cold-‐activated channel TRPM8 by lysophospholipids and polyunsaturated fatty acids." J Neurosci 27(12): 3347-‐55. Atoyan, R., D. Shander, et al. (2009). "Non-‐neuronal expression of transient receptor potential type A1 (TRPA1) in human skin." J Invest Dermatol 129(9): 2312-‐5. Attal, N., D. Bouhassira, et al. (2009). "Thermal hyperalgesia as a marker of oxaliplatin neurotoxicity: a prospective quantified sensory assessment study." Pain 144(3): 245-‐52. Bandell, M., G. M. Story, et al. (2004). "Noxious cold ion channel TRPA1 is activated by pungent compounds and bradykinin." Neuron 41(6): 849-‐57. Barabas, M. E., E. A. Kossyreva, et al. (2012). "TRPA1 is functionally expressed primarily by IB4-‐binding, non-‐peptidergic mouse and rat sensory neurons." PLoS One 7(10): e47988. 110 Basbaum, A. I., D. M. Bautista, et al. (2009). "Cellular and molecular mechanisms of pain." Cell 139(2): 267-‐84. Bautista, D. M., S. E. Jordt, et al. (2006). "TRPA1 mediates the inflammatory actions of environmental irritants and proalgesic agents." Cell 124(6): 1269-‐82. Bautista, D. M., P. Movahed, et al. (2005). "Pungent products from garlic activate the sensory ion channel TRPA1." Proc Natl Acad Sci U S A 102(34): 12248-‐52. Bautista, D. M., J. Siemens, et al. (2007). "The menthol receptor TRPM8 is the principal detector of environmental cold." Nature 448(7150): 204-‐8. Behrendt, H. J., T. Germann, et al. (2004). "Characterization of the mouse cold-‐menthol receptor TRPM8 and vanilloid receptor type-‐1 VR1 using a fluorometric imaging plate reader (FLIPR) assay." Br J Pharmacol 141(4): 737-‐45. Benemei, S., P. Nicoletti, et al. (2009). "CGRP receptors in the control of pain and inflammation." Curr Opin Pharmacol 9(1): 9-‐14. Bennett, G. J. and Y. K. Xie (1988). "A peripheral mononeuropathy in rat that produces disorders of pain sensation like those seen in man." Pain 33(1): 87-‐107. Binshtok, A. M., B. P. Bean, et al. (2007). "Inhibition of nociceptors by TRPV1-‐mediated entry of impermeant sodium channel blockers." Nature 449(7162): 607-‐10. Bodding, M. (2007). "TRP proteins and cancer." Cell Signal 19(3): 617-‐24. Bodding, M., U. Wissenbach, et al. (2007). "Characterisation of TRPM8 as a pharmacophore receptor." Cell Calcium 42(6): 618-‐628. Bouhassira, D., M. Lanteri-‐Minet, et al. (2008). "Prevalence of chronic pain with neuropathic characteristics in the general population." Pain 136(3): 380-‐7. Brauchi, S., P. Orio, et al. (2004). "Clues to understanding cold sensation: thermodynamics and electrophysiological analysis of the cold receptor TRPM8." Proc Natl Acad Sci U S A 101(43): 15494-‐9. Brauchi, S., G. Orta, et al. (2007). "Dissection of the components for PIP2 activation and thermosensation in TRP channels." Proc Natl Acad Sci U S A 104(24): 10246-‐51. Brauchi, S., G. Orta, et al. (2006). "A hot-‐sensing cold receptor: C-‐terminal domain determines thermosensation in transient receptor potential channels." J Neurosci 26(18): 4835-‐40. 111 Breitman, M. L., H. Rombola, et al. (1990). "Genetic ablation in transgenic mice with an attenuated diphtheria toxin A gene." Mol Cell Biol 10(2): 474-‐9. Brierley, S. M., J. Castro, et al. (2011). "TRPA1 contributes to specific mechanically activated currents and sensory neuron mechanical hypersensitivity." J Physiol 589(Pt 14): 3575-‐93. Brixel, L. R., M. K. Monteilh-‐Zoller, et al. (2010). "TRPM5 regulates glucose-‐stimulated insulin secretion." Pflugers Arch 460(1): 69-‐76. Bromm, B., E. Scharein, et al. (1995). "Effects of menthol and cold on histamine-‐induced itch and skin reactions in man." Neurosci Lett 187(3): 157-‐60. Brosky, G. and J. Logothetopoulos (1969). "Streptozotocin diabetes in the mouse and guinea pig." Diabetes 18(9): 606-‐11. Campero, M., T. K. Baumann, et al. (2009). "Human cutaneous C fibres activated by cooling, heating and menthol." J Physiol 587(Pt 23): 5633-‐52. Campero, M., J. Serra, et al. (2001). "Slowly conducting afferents activated by innocuous low temperature in human skin." J Physiol 535(Pt 3): 855-‐65. Cao, D. S., L. Zhong, et al. (2012). "Expression of transient receptor potential ankyrin 1 (TRPA1) and its role in insulin release from rat pancreatic beta cells." PLoS One 7(5): e38005. Caterina, M. J., M. A. Schumacher, et al. (1997). "The capsaicin receptor: a heat-‐ activated ion channel in the pain pathway." Nature 389(6653): 816-‐24. Chen, J., D. Kim, et al. (2009). "Pore dilation occurs in TRPA1 but not in TRPM8 channels." Mol Pain 5: 3. Choi, Y., Y. W. Yoon, et al. (1994). "Behavioral signs of ongoing pain and cold allodynia in a rat model of neuropathic pain." Pain 59(3): 369-‐76. Chung, M. K. and M. J. Caterina (2007). "TRP channel knockout mice lose their cool." Neuron 54(3): 345-‐7. Colburn, R. W., M. L. Lubin, et al. (2007). "Attenuated cold sensitivity in TRPM8 null mice." Neuron 54(3): 379-‐86. Collier, R. J. (2001). "Understanding the mode of action of diphtheria toxin: a perspective on progress during the 20th century." Toxicon 39(11): 1793-‐803. 112 Colsoul, B., A. Schraenen, et al. (2010). "Loss of high-‐frequency glucose-‐induced Ca2+ oscillations in pancreatic islets correlates with impaired glucose tolerance in Trpm5-‐/-‐ mice." Proc Natl Acad Sci U S A 107(11): 5208-‐13. Dai, Y., S. Wang, et al. (2007). "Sensitization of TRPA1 by PAR2 contributes to the sensation of inflammatory pain." J Clin Invest 117(7): 1979-‐87. Daniels, R. L. and D. D. McKemy (2007). "Mice left out in the cold: commentary on the phenotype of TRPM8-‐nulls." Mol Pain 3: 23. Daniels, R. L., Y. Takashima, et al. (2009). "Activity of the Neuronal Cold Sensor TRPM8 Is Regulated by Phospholipase C via the Phospholipid Phosphoinositol 4,5-‐ Bisphosphate." J Biol Chem 284(3): 1570-‐82. Darian-‐Smith, I., K. O. Johnson, et al. (1973). ""Cold" fiber population innervating palmar and digital skin of the monkey: responses to cooling pulses." J Neurophysiol 36(2): 325-‐46. Dhaka, A., T. J. Earley, et al. (2008). "Visualizing cold spots: TRPM8-‐expressing sensory neurons and their projections." J Neurosci 28(3): 566-‐75. Dhaka, A., A. N. Murray, et al. (2007). "TRPM8 is required for cold sensation in mice." Neuron 54(3): 371-‐8. Doyle, J. P., J. D. Dougherty, et al. (2008). "Application of a translational profiling approach for the comparative analysis of CNS cell types." Cell 135(4): 749-‐62. Earley, S., A. L. Gonzales, et al. (2009). "Endothelium-‐dependent cerebral artery dilation mediated by TRPA1 and Ca2+-‐Activated K+ channels." Circ Res 104(8): 987-‐94. Eid, S. R. and D. N. Cortright (2009). "Transient receptor potential channels on sensory nerves." Handb Exp Pharmacol(194): 261-‐81. Emery, B. and B. A. Barres (2008). "Unlocking CNS cell type heterogeneity." Cell 135(4): 596-‐8. Frolich, M., A. Enk, et al. (2009). "Successful treatment of therapy-‐resistant pruritus in lichen amyloidosis with menthol." Acta Derm Venereol 89(5): 524-‐6. Fujita, S., M. Bohland, et al. (2007). "Hypoglycemic detection at the portal vein is mediated by capsaicin-‐sensitive primary sensory neurons." Am J Physiol Endocrinol Metab 293(1): E96-‐E101. 113 Gao, H., K. Miyata, et al. (2012). "Transient receptor potential vanilloid type 1-‐ dependent regulation of liver-‐related neurons in the paraventricular nucleus of the hypothalamus diminished in the type 1 diabetic mouse." Diabetes 61(6): 1381-‐90. Garcia-‐Anoveros, J. and K. Nagata (2007). "Trpa1." Handb Exp Pharmacol(179): 347-‐62. Gentry, C., N. Stoakley, et al. (2010). "The roles of iPLA2, TRPM8 and TRPA1 in chemically induced cold hypersensitivity." Mol Pain 6: 4. Goldberg, Y. P., J. MacFarlane, et al. (2007). "Loss-‐of-‐function mutations in the Nav1.7 gene underlie congenital indifference to pain in multiple human populations." Clin Genet 71(4): 311-‐9. Grandl, J., S. E. Kim, et al. (2010). "Temperature-‐induced opening of TRPV1 ion channel is stabilized by the pore domain." Nat Neurosci Epub ahead of print. Harrison, G. S., F. Maxwell, et al. (1991). "Activation of a diphtheria toxin A gene by expression of human immunodeficiency virus-‐1 Tat and Rev proteins in transfected cells." Hum Gene Ther 2(1): 53-‐60. Harrison, J. L. and K. D. Davis (1999). "Cold-‐evoked pain varies with skin type and cooling rate: a psychophysical study in humans." Pain 83(2): 123-‐35. Heiman, M., A. Schaefer, et al. (2008). "A translational profiling approach for the molecular characterization of CNS cell types." Cell 135(4): 738-‐48. Hensel, H. and Y. Zotterman (1951). "The effect of menthol on the thermoreceptors." Acta Physiol Scand 24: 27-‐34. Islam, M. S. (2011). "TRP channels of islets." Adv Exp Med Biol 704: 811-‐30. Jasmin, L., L. Kohan, et al. (1998). "The cold plate as a test of nociceptive behaviors: description and application to the study of chronic neuropathic and inflammatory pain models." Pain 75(2-‐3): 367-‐82. Jordt, S. E., D. M. Bautista, et al. (2004). "Mustard oils and cannabinoids excite sensory nerve fibres through the TRP channel ANKTM1." Nature 427(6971): 260-‐5. Jordt, S. E., D. D. McKemy, et al. (2003). "Lessons from peppers and peppermint: the molecular logic of thermosensation." Curr Opin Neurobiol 13(4): 487-‐92. 114 Jyvasjarvi, E. and K. D. Kniffki (1987). "Cold stimulation of teeth: a comparison between the responses of cat intradental A delta and C fibres and human sensation." J Physiol 391: 193-‐207. Karashima, Y., N. Damann, et al. (2007). "Bimodal action of menthol on the transient receptor potential channel TRPA1." J Neurosci 27(37): 9874-‐84. Karashima, Y., K. Talavera, et al. (2009). "TRPA1 acts as a cold sensor in vitro and in vivo." Proc Natl Acad Sci U S A 106(4): 1273-‐8. Knowlton, W. M., A. Bifolck-‐Fisher, et al. (2010). "TRPM8, but not TRPA1, is required for neural and behavioral responses to acute noxious cold temperatures and cold-‐ mimetics in vivo." Pain 150(2): 340-‐50. Knowlton, W. M., R. L. Daniels, et al. (2011). "Pharmacological Blockade of TRPM8 Ion Channels Alters Cold and Cold Pain Responses in Mice." PLoS One 6(9): e25894. Knowlton, W. M., A. Fisher, et al. (2010). "TRPM8, but not TRPA1, is required for neural and behavioral responses to acute noxious cold temperatures and cold-‐mimetics in vivo. ." Pain 150(2): 340-‐350. Knowlton, W. M., R. Palkar, et al. (2013). "A Sensory-‐Labeled Line for Cold: TRPM8-‐ Expressing Sensory Neurons Define the Cellular Basis for Cold, Cold Pain, and Cooling-‐Mediated Analgesia." J Neurosci 33(7): 2837-‐48. Kochukov, M. Y., T. A. McNearney, et al. (2006). "Thermosensitive TRP Ion Channels Mediate Cytosolic Calcium Response in Human Synoviocytes." Am J Physiol Cell Physiol. Kondo, T., K. Obata, et al. (2009). "Transient receptor potential A1 mediates gastric distention-‐induced visceral pain in rats." Gut 58(10): 1342-‐52. Kwan, K. Y., A. J. Allchorne, et al. (2006). "TRPA1 Contributes to Cold, Mechanical, and Chemical Nociception but Is Not Essential for Hair-‐Cell Transduction." Neuron 50(2): 277-‐289. Kwan, K. Y., J. M. Glazer, et al. (2009). "TRPA1 modulates mechanotransduction in cutaneous sensory neurons." J Neurosci 29(15): 4808-‐19. Lashinger, E. S., M. S. Steiginga, et al. (2008). "AMTB, a TRPM8 channel blocker: evidence in rats for activity in overactive bladder and painful bladder syndrome." Am J Physiol Renal Physiol 295(3): F803-‐10. 115 Lebowitz, M. R. and S. A. Blumenthal (1993). "The molar ratio of insulin to C-‐peptide. An aid to the diagnosis of hypoglycemia due to surreptitious (or inadvertent) insulin administration." Arch Intern Med 153(5): 650-‐5. Li, Q., X. Wang, et al. (2009). "Menthol induces cell death via the TRPM8 channel in the human bladder cancer cell line T24." Oncology 77(6): 335-‐41. Linte, R. M., C. Ciobanu, et al. (2007). "Desensitization of cold-‐ and menthol-‐sensitive rat dorsal root ganglion neurones by inflammatory mediators." Exp Brain Res 178(1): 89-‐98. Lippoldt, E. K., R. Elmes, et al. (2013). "Artemin, a glial cell line-‐derived neurotrophic factor family member, induces TRPM8-‐dependent cold pain." J Neurosci submitted. Liu, B. and F. Qin (2005). "Functional control of cold-‐ and menthol-‐sensitive TRPM8 ion channels by phosphatidylinositol 4,5-‐bisphosphate." J Neurosci 25(7): 1674-‐81. Ma, S., G. G, et al. (2008). "Menthol derivative WS-‐12 selectively activates transient receptor potential melastatin-‐8 (TRPM8) ion channels." Pak J Pharm Sci 21(4): 370-‐8. Mackenzie, R. A., D. Burke, et al. (1975). "Fibre function and perception during cutaneous nerve block." J Neurol Neurosurg Psychiatry 38(9): 865-‐73. Madrid, R., E. de la Pena, et al. (2009). "Variable threshold of trigeminal cold-‐ thermosensitive neurons is determined by a balance between TRPM8 and Kv1 potassium channels." J Neurosci 29(10): 3120-‐31. Madrid, R., T. Donovan-‐Rodriguez, et al. (2006). "Contribution of TRPM8 channels to cold transduction in primary sensory neurons and peripheral nerve terminals." J Neurosci 26(48): 12512-‐25. Malkia, A., R. Madrid, et al. (2007). "Bidirectional shifts of TRPM8 channel gating by temperature and chemical agents modulate the cold sensitivity of mammalian thermoreceptors." J Physiol 581(Pt 1): 155-‐74. Matta, J. A. and G. P. Ahern (2007). "Voltage is a partial activator of rat thermosensitive TRP channels." J Physiol 585(2): 469-‐482. Matthews, J. M., N. Qin, et al. (2012). "The design and synthesis of novel, phosphonate-‐ containing transient receptor potential melastatin 8 (TRPM8) antagonists." Bioorg Med Chem Lett 22(8): 2922-‐6. 116 Maxwell, R. J., R. J. Devenish, et al. (1986). "The nucleotide sequence of the mitochondrial DNA genome of an abundant petite mutant of Saccharomyces cerevisiae carrying the ori1 replication origin." Biochem Int 13(1): 101-‐7. McCoy, D. D., W. M. Knowlton, et al. (2011). "Scraping through the ice: uncovering the role of TRPM8 in cold transduction." Am J Physiol Regul Integr Comp Physiol 300(6): R1278-‐87. McCoy, D. D., L. Zhou, et al. (2013). "Enhanced insulin clearance in mice lacking TRPM8 channels." Am J Physiol Endocrinol Metab. McKemy, D. D. (2005). "How cold is it? TRPM8 and TRPA1 in the molecular logic of cold sensation." Mol Pain 1(1): 16. McKemy, D. D., W. M. Neuhausser, et al. (2002). "Identification of a cold receptor reveals a general role for TRP channels in thermosensation." Nature 416(6876): 52-‐8. Meseguer, V., Y. Karashima, et al. (2008). "Transient receptor potential channels in sensory neurons are targets of the antimycotic agent clotrimazole." J Neurosci 28(3): 576-‐86. Morin, C. and M. C. Bushnell (1998). "Temporal and qualitative properties of cold pain and heat pain: a psychophysical study." Pain 74(1): 67-‐73. Mukerji, G., Y. Yiangou, et al. (2006). "Cool and menthol receptor TRPM8 in human urinary bladder disorders and clinical correlations." BMC Urol 6: 6. Nagata, K., A. Duggan, et al. (2005). "Nociceptor and hair cell transducer properties of TRPA1, a channel for pain and hearing." J Neurosci 25(16): 4052-‐61. Nakagawa, H. and A. Hiura (2013). "Comparison of the transport of QX-‐314 through TRPA1, TRPM8, and TRPV1 channels." J Pain Res 6: 223-‐30. Niebergall-‐Roth, E. and M. V. Singer (2001). "Central and peripheral neural control of pancreatic exocrine secretion." J Physiol Pharmacol 52(4 Pt 1): 523-‐38. Nozawa, K., E. Kawabata-‐Shoda, et al. (2009). "TRPA1 regulates gastrointestinal motility through serotonin release from enterochromaffin cells." Proc Natl Acad Sci U S A 106(9): 3408-‐13. Palmiter, R. D., R. R. Behringer, et al. (1987). "Cell lineage ablation in transgenic mice by cell-‐specific expression of a toxin gene." Cell 50(3): 435-‐43. 117 Peier, A. M., A. Moqrich, et al. (2002). "A TRP channel that senses cold stimuli and menthol." Cell 108(5): 705-‐15. Peier, A. M., A. J. Reeve, et al. (2002). "A heat-‐sensitive TRP channel expressed in keratinocytes." Science 296(5575): 2046-‐9. Perseghin, G., E. Regalia, et al. (1997). "Regulation of glucose homeostasis in humans with denervated livers." J Clin Invest 100(4): 931-‐41. Pluijms, W., F. Huygen, et al. (2010). "18. Painful Diabetic Polyneuropathy." Pain Pract 11(2): 191-‐198. Polonsky, K. S. and A. H. Rubenstein (1984). "C-‐peptide as a measure of the secretion and hepatic extraction of insulin. Pitfalls and limitations." Diabetes 33(5): 486-‐94. Proudfoot, C. J., E. M. Garry, et al. (2006). "Analgesia Mediated by the TRPM8 Cold Receptor in Chronic Neuropathic Pain." Curr Biol 16(16): 1591-‐605. Razavi, R., Y. Chan, et al. (2006). "TRPV1+ sensory neurons control beta cell stress and islet inflammation in autoimmune diabetes." Cell 127(6): 1123-‐35. Rehm, S. E., J. Koroschetz, et al. (2010). "A cross-‐sectional survey of 3035 patients with fibromyalgia: subgroups of patients with typical comorbidities and sensory symptom profiles." Rheumatology (Oxford) 49(6): 1146-‐52. Reid, G., A. Babes, et al. (2002). "A cold-‐ and menthol-‐activated current in rat dorsal root ganglion neurones: properties and role in cold transduction." J Physiol 545(Pt 2): 595-‐614. Reid, G. and M. L. Flonta (2001). "Cold current in thermoreceptive neurons." Methods 111: 1-‐8. Reid, G. and M. L. Flonta (2002). "Ion channels activated by cold and menthol in cultured rat dorsal root ganglion neurones." Neurosci Lett 324(2): 164-‐8. Rohacs, T., C. M. Lopes, et al. (2005). "PI(4,5)P2 regulates the activation and desensitization of TRPM8 channels through the TRP domain." Nat Neurosci 8(5): 626-‐34. Sabnis, A. S., M. Shadid, et al. (2008). "Human lung epithelial cells express a functional cold-‐sensing TRPM8 variant." Am J Respir Cell Mol Biol 39(4): 466-‐74. Schneiter, P., M. Gillet, et al. (1999). "Hepatic nonoxidative disposal of an oral glucose meal in patients with liver cirrhosis." Metabolism 48(10): 1260-‐6. 118 Shiau, H. J. (2012). "Dentin hypersensitivity." J Evid Based Dent Pract 12(3 Suppl): 220-‐8. Smith, G. D., M. J. Gunthorpe, et al. (2002). "TRPV3 is a temperature-‐sensitive vanilloid receptor-‐like protein." Nature 418(6894): 186-‐90. Stein, R. J., S. Santos, et al. (2004). "Cool (TRPM8) and hot (TRPV1) receptors in the bladder and male genital tract." J Urol 172(3): 1175-‐8. Story, G. M., A. M. Peier, et al. (2003). "ANKTM1, a TRP-‐like Channel Expressed in Nociceptive Neurons, Is Activated by Cold Temperatures." Cell 112(6): 819-‐29. Streng, T., H. E. Axelsson, et al. (2008). "Distribution and function of the hydrogen sulfide-‐sensitive TRPA1 ion channel in rat urinary bladder." Eur Urol 53(2): 391-‐9. Tahmoush, A. J., R. J. Schwartzman, et al. (2000). "Quantitative sensory studies in complex regional pain syndrome type 1/RSD." Clin J Pain 16(4): 340-‐4. Takashima, Y., R. L. Daniels, et al. (2007). "Diversity in the neural circuitry of cold sensing revealed by genetic axonal labeling of transient receptor potential melastatin 8 neurons." J Neurosci 27(51): 14147-‐57. Tanaka, H., A. Shimaya, et al. (2011). "Enhanced insulin secretion and sensitization in diabetic mice on chronic treatment with a transient receptor potential vanilloid 1 antagonist." Life Sci 88(11-‐12): 559-‐63. Thut, P. D., D. Wrigley, et al. (2003). "Cold transduction in rat trigeminal ganglia neurons in vitro." Neuroscience 119(4): 1071-‐83. Tominaga, M., M. J. Caterina, et al. (1998). "The cloned capsaicin receptor integrates multiple pain-‐producing stimuli." Neuron 21(3): 531-‐43. Tsavaler, L., M. H. Shapero, et al. (2001). "Trp-‐p8, a novel prostate-‐specific gene, is up-‐ regulated in prostate cancer and other malignancies and shares high homology with transient receptor potential calcium channel proteins." Cancer Res 61(9): 3760-‐9. Uchida, K., K. Dezaki, et al. (2011). "Lack of TRPM2 impaired insulin secretion and glucose metabolisms in mice." Diabetes 60(1): 119-‐26. Uchida, K. and M. Tominaga (2011). "The role of thermosensitive TRP (transient receptor potential) channels in insulin secretion." Endocr J 58(12): 1021-‐8. Valera Mora, M. E., A. Scarfone, et al. (2003). "Insulin clearance in obesity." J Am Coll Nutr 22(6): 487-‐93. 119 Vanden Abeele, F., A. Zholos, et al. (2006). "Ca2+-‐independent phospholipase A2-‐ dependent gating of TRPM8 by lysophospholipids." J Biol Chem 281(52): 40174-‐ 82. Vetter, I., F. Touska, et al. (2012). "Ciguatoxins activate specific cold pain pathways to elicit burning pain from cooling." EMBO J 31(19): 3795-‐808. Voets, T., G. Droogmans, et al. (2004). "The principle of temperature-‐dependent gating in cold-‐ and heat-‐sensitive TRP channels." Nature 430(7001): 748-‐54. Voets, T., G. Owsianik, et al. (2007). "TRPM8 voltage sensor mutants reveal a mechanism for integrating thermal and chemical stimuli." Nat Chem Biol 3(3): 174-‐82. Wei, E. T. and D. A. Seid (1983). "AG-‐3-‐5: a chemical producing sensations of cold." J Pharm Pharmacol 35(2): 110-‐2. Xu, H., I. S. Ramsey, et al. (2002). "TRPV3 is a calcium-‐permeable temperature-‐sensitive cation channel." Nature 418(6894): 181-‐6. Yamamura, H., S. Ugawa, et al. (2008). "TRPM8 activation suppresses cellular viability in human melanoma." Am J Physiol Cell Physiol 295(2): C296-‐301. Yang, X. R., M. J. Lin, et al. (2006). "Functional Expression of Transient Receptor Potential Melastatin-‐ (TRPM) and Vanilloid-‐Related (TRPV) Channels in Pulmonary Arterial and Aortic Smooth Muscle." Am J Physiol Lung Cell Mol Physiol 290(6): L1267-‐L1276. Yoshida, N., K. Kobayashi, et al. (2011). "Inhibition of TRPA1 channel activity in sensory neurons by the glial cell line-‐derived neurotrophic factor family member, artemin." Mol Pain 7: 41. Zhang, L. and G. J. Barritt (2006). "TRPM8 in prostate cancer cells: a potential diagnostic and prognostic marker with a secretory function?" Endocr Relat Cancer 13(1): 27-‐38. Zimmermann, K., A. Leffler, et al. (2007). "Sensory neuron sodium channel Nav1.8 is essential for pain at low temperatures." Nature 447(7146): 855-‐8. Zimmermann, M. (2001). "Pathobiology of neuropathic pain." Eur J Pharmacol 429(1-‐3): 23-‐37. 120 APPENDIX Development of a TRPA1-‐CRE BAC-‐transgenic mouse line 121 INTRODUCTION The ability of organisms to sense pain is vitally important for survival. Not only does pain draw attention to a wound so that it can be tended to, but it also warns about potential damage. Transient receptor potential ankyrin 1 (TRPA1) is a chemosensory ion channel that has been shown to mediate acute and chronic pain, and play an important role in inflammation and hypersensitivity to both thermal and mechanical stimuli via mouse knockout studies (Bautista, Jordt et al. 2006; Kwan, Allchorne et al. 2006; Garcia-‐ Anoveros and Nagata 2007; Karashima, Talavera et al. 2009). It is mainly known for its activation by allyl isothiocyanate (AITC -‐ the active ingredient in mustard oil and wasabi), but has also been shown to be activated by a number of irritant compounds including hydrogen peroxide, acrolein (found in tear gas and exhaust fumes), formalin, cinnamaldehyde (found in cinnamon), and many thiosulfanates (found in things like garlic and onions) and is widely considered to be a general irritant/pain receptor (Bandell, Story et al. 2004; Jordt, Bautista et al. 2004; Nagata, Duggan et al. 2005; Bautista, Jordt et al. 2006; Garcia-‐Anoveros and Nagata 2007). Outside of its known roles in sensory neurons however, TRPA1 has also been suggested to be expressed in a number of non-‐neuronal cell types including hair cells, enterochromaffin cells, keratinocytes, cerebellar and cerebral artery epithelium, urothelium, melanocytes, and fibroblasts to name a few (Nagata, Duggan et al. 2005; Kochukov, McNearney et al. 2006; Anand, Otto et al. 2008; Streng, Axelsson et al. 2008; Atoyan, Shander et al. 2009; Earley, Gonzales et al. 2009; Kwan, Glazer et al. 2009; Nozawa, Kawabata-‐Shoda et al. 122 2009). Very little is known about its function in these cell types/areas and with there being no adequate antibody for recognizing the protein in mice, the primary model organism used in the TRP channel field, it has proven to be a difficult channel to study. Here we show the development of a BAC-‐transgenic mouse line in which CRE recombinase is targeted to TRPA1-‐expressing cells. The motivation behind making this mouse was that when crossed with a CRE-‐dependent reporter line TRPA1-‐expressing cells could theoretically be labeled without the need of antibodies. Such a labeled mouse could then be used to identify and study TRPA1-‐expression in the body and also track its expression through development. The advantage of making this mouse over more conventional transgenic methods, driving marker expression using the TRPA1 promoter region, was that it could also be crossed with other CRE-‐specific lines to allow for the selective ablation or silencing of TRPA1-‐expressing cells. Thus, this mouse would allow us to not only study the channel itself, but also the cells in which it is expressed. Although we report here that we have successfully targeted the CRE transgene to two independent mouse lines, we have conflicting data regarding whether or not it is specifically expressed in TRPA1-‐expressing cells. Future characterization of this mouse line will tell if it is viable for the study of this enigmatic channel. 123 MATERIALS AND METHODS TRPA1-‐CRE mouse BAC transgenesis The TRPA1 bacterial artificial chromosome (BAC) clone was modified by homologous recombination as described in Chapter 4 (see Chapter 4 Materials and Methods). A targeting (Abox) sequence consisting of 1027 bp upstream (5’) to the recombination site was used to target the CRE transgene to the TRPA1 BAC. Identification of cointegrates was done via PCR analysis using the following BAC-‐specific and transgene-‐specific primers: P1 (5’ BAC-‐specific), 5’-‐CACCTATGCTGTGGAG-‐3’ P2 (3’ CRE-‐specific), 5’-‐GAACCTGAAGATGTTCGCG-‐3’ P3 (5’ R6K-‐specific), 5’-‐CAGGTTGAACTGCTGATCAACAGATC-‐3’ P4 (3’ BAC-‐specific), 5’-‐GAAATGGCAGGAGACAGTATC-‐3’ Modified BAC clones were also screened via Southern blot analysis using a Biotin labeled probe corresponding to the targeting Abox sequence. Purified DNA was then injected into the pronucleus of fertilized ova at the University of Southern California (USC) Transgenic Core Facility. Transgenic founder mice were identified by PCR and mated to C57BL/6 mice. All animals were handled and cared for in accordance with guidelines established by the USC Animal Care and Use Committee. 124 Mouse breeding The following mouse strains ordered from Jackson were bred against our TRPA1-‐ CRE transgenic lines: Rosa-‐STOP-‐DTA (B6;129-‐Gt(ROSA)26Sortm1(DTA)Mrc/J, stock #010527), Rosa-‐STOP-‐LacZ (B6;129S4-‐Gt(ROSA)26Sortm1Sor/J, stock #003309), Rosa-‐ STOP-‐Tomato (B6.Cg-‐Gt(ROSA)26Sortm14(CAG-‐tdTomato)Hze/J, stock #007914). All experiments were approved by the University of Southern California (USC) Institutional Animal Care and Use Committee and performed in accordance with the recommendations of the National Institutes of Health Guide for the Care and Use of Laboratory Animals. LacZ staining After thawing freshly frozen tissue sections at room temperature for 5 mins, slides were fixed for 10mins at 4°C in a slide mailer (fixative = 0.2% Glutaraldehyde in PBS). Slides were washed first in PBS, followed by detergent rinse (0.02% NP-‐40, 0.01% Sodium Deoxycholate, 2mM MgCl2 in PBS) for 10mins each. After 2hrs of incubating at 37°C in X-‐gal staining solution (detergent rinse solution + 5mM Potassium ferricyanide, 5mM Potassium Ferrocyanide, 1mg/ml Xgal), slides were post-‐fixed in 4% PFA in PBS at 4°C for 10mins, followed by two 10min PBS washes before mounting and imaging. 125 Immunofluorescence Immunofluorescence experiments were carried out as described in Chapter 2 (see Chapter 2 Materials and Methods) using the following antibodies: 1° guinea pig anti-‐PGP9.5 (AB5898, Millipore), 1° goat anti-‐NF200 (N4142, Sigma), 1° rabbit anti-‐ peripherin (AB1530, Millipore), 1° rabbit anti-‐TRPV1 (AB5889, Millipore), 2° donkey anti-‐ guinea pig-‐AMCA (706-‐155-‐148, Jackson Immuno), 2° donkey anti-‐goat-‐488 (A11055, Invitrogen), 2° donkey anti-‐rabbit-‐488 (A11034, Invitrogen). Neuron culture Trigeminal Ganglia were dissected from newborn transgenic mice crossed with the Rosa-‐STOP-‐Tomato reporter line (<P14) and neurons isolated as described in Chapter 3 (see Chapter 3 Materials and Methods). Neurons were purified through a 60:30% percoll gradient to separate neurons from large cell debris and smaller cells such as glia. Calcium imaging experiments were carried out as described in Chapter 3 with 500µM cinnamaldehyde and 1µM capsaicin used to correlate transgene driven tomato expression with functional TRPA1 and TRPV1 responses respectively. qPCR analysis qPCR was carried out on TG/DRG samples as described previously in Chapter 2 (See Chapter 2 Materials and Methods). The primers used are listed below: 126 GAPDH (123bp) FWD: 5’ TGTAGACCATGTAGTGAGGTCA 3’ REV: 5’ AGGTCGGTGTGAACGGATTTG 3’ TRPM8 (600bp) FWD: 5’ GCTGCCTGAAGAGGAAATTG 3’ REV: 5’ GCCCAGATGAAGAGAGCTTG 3’ TRPV1 #1 (294bp) FWD: 5’ GGAGGTGGCAGATAACACAGC 3’ REV: 5’ CAGGTGTCAATGCAGGACAGG 3’ TRPV1 #2 (391bp) FWD: 5’ CATGCTGGTGTCTGTGGTACTG 3’ REV: 5’ GTTCTCGGTGAACTCCAGGTC 3’ TRPA1 #1 (302bp) FWD: 5’ CACCATGACCTGGCAGAATAC 3’ REV: 5’ CAGGCATAATGGAGAGGTGTG 3’ TRPA1 #2 (333bp) FWD: 5’ GCTACAATGCTGACATCCTCC 3’ REV: 5’ CCACATCCTGGGTAGGTGCTA 3’ TRPA1 #3 (237bp) FWD: 5’ GGTAGAATACCTCCCCGAGTG 3’ REV: 5’ CTACACACAGGGTGGTTGAGG 3’ 127 RESULTS Generation of the TRPA1-‐CRE BAC-‐transgenic mouse line The TRPA1-‐CRE BAC transgenic mouse line was generated using the methods pioneered by the lab of Nathaniel Heintz at Rockefeller University (Heiman, Schaefer et al. 2008). Specifically, a shuttle vector containing a TRPA1-‐specific Abox sequence followed by the CRE transgene was targeted to a bacterial artificial chromosome (BAC) containing TRPA1 and its upstream regulatory region via homologous recombination (Fig. A1.A-‐B). Successful modification of BAC DNA was confirmed via PCR analysis using BAC-‐specific and transgene-‐specific primers, and Southern Blot (Fig. A1.C-‐D). Purified BAC DNA was then injected into 250 single cell stage mouse embryos and implanted in nine pseudopregnant females. Five out of nine females gave birth to litters yielding twenty total pups. Seven of the twenty mice were identified as being successfully targeted via PCR analysis of genomic DNA taken from the tail, three of which were found to have targeted the germline, and two of which expressed CRE as evidenced by subsequent LacZ reporter mouse line crossings. All of the mouse data presented beyond this point will refer to these two lines as TRPA1-‐CRE-‐Line1 and 2. TRPA1-‐CRE mouse lines express CRE in a subset of sensory neurons and in many non-‐ neuronal cell types To confirm that the two TRPA1-‐CRE transgenic lines were expressing functional CRE recombinase we first crossed them with a CRE reporter line in which a floxed STOP 128 FIGURE A.1 Development of the TRPA1-‐CRE BAC-‐transgenic mouse line A) A shuttle vector containing the CRE transgene and a homologous region of TRPA1 sequence was targeted to a Bacterial artificial chromosome (BAC) containing the genomic sequence of TRPA1 using Recombinase A (RecA). B) Example crossing of the TRPA1-‐CRE BAC-‐transgenic and ROSA-‐STOP-‐Tomato reporter mouse line results in CRE-‐mediated Tomato expression. C) PCR analysis confirming successful BAC targeting using primer sets flanking 5’ and 3’ junction sites. The P1+P2 primer set yields a band only using wildtype TRPA1-‐BAC DNA template as the modified BAC amplicon is too large to amplify under controlled conditions. The P1+CreR and R6K+P2 primer sets only yield bands using modified BAC DNA template as wildtype TRPA1-‐BAC DNA lacks the transgene-‐specific sequence required for the Cre and R6K primers to anneal. D) Southern blot analysis of EcoRI digested wildtype and modified TRPA1-‐ BAC DNA using a biotin-‐labeled targeting sequence probe. Wildtype TRPA1-‐BAC DNA yields 1 band (~2.93kb) while successfully modified BAC DNA yields 2 bands (~3.33kb + ~1.1kb) due to the addition of a duplicate targeting sequence as part of the targeting paradigm. 129 cassette is removed in the presence of CRE recombinase, allowing for subsequent LacZ expression (ROSA-‐STOP-‐LacZ). We found that 29.2 ± 0.8% and 32.0 ± 1.1% of TG and DRG neurons from Line 1 crossed mice expressed LacZ while 38.0 ± 2.2% and 29.9 ± 1.1% of TG and DRG neurons did from Line 2 (Fig. A2). These data agree with previous published findings on TRPA1 expression in sensory neurons (Jordt, Bautista et al. 2004; Bautista, Movahed et al. 2005; Yoshida, Kobayashi et al. 2011). Next, we crossed Line 1 with a similar CRE reporter line engineered to express the fluorescent tdTomato (Tom) protein in CRE + cells to better measure neuron cell sizes. We found that Tom was expressed in neurons of all sizes. Specifically, TG Tom + cells averaged 355 ± 7µM 2 while Tom -‐ cells averaged 338 ± 5µM 2 and DRG Tom + cells averaged 350 ± 10µM 2 while Tom -‐ cells averaged 327 ± 6µM 2 (Fig. A3). In both cases there was no statistical difference between the sizes of Tom + and Tom -‐ neurons. Similar results were found using Line 2 crosses (not shown). This data goes against the notion that TRPA1 expression is limited to small diameter neurons (Jordt, Bautista et al. 2004; Bautista, Movahed et al. 2005; Nagata, Duggan et al. 2005; Brierley, Castro et al. 2011; Barabas, Kossyreva et al. 2012), but is in line with a previously published report finding TRPA1 expression in neurons of all sizes (Kwan, Glazer et al. 2009). Furthermore, Tom does appear to be expressed in sensory nerve endings in the skin as expected, but its diffuse presence in the spinal cord is different from the known expression pattern of TRPA1 in the most superficial layers of the dorsal horn (Fig. A4) (Andersson, Gentry et al. 2011). Moreover, the presence of Tom in every tissue source we sampled was perplexing. 130 FIGURE A.2 CRE-‐driven LacZ expression in TRPA1-‐CRE mice crossed with the ROSA-‐STOP-‐LacZ reporter line LacZ staining in DRG and TG tissue isolated from 2 independent TRPA1-‐CRE transgenic mouse lines yields CRE-‐mediated LacZ expression in ~30-‐40% of sensory neurons. Values are expressed as averages ± SE (n = 3 mice for all panels, Neurons counted: Line1 TG = 3,827, DRG = 5,979, Line2 TG = 3,679, DRG = 2,829) 131 FIGURE A.3 Sensory neuron size distribution in TRPA1-‐CRE mice crossed with the ROSA-‐STOP-‐Tomato reporter line PGP9.5 staining and cell area measurements in TG (A) and DRG (B) isolated from TRPA1-‐CRE-‐Line1 X ROSA-‐STOP-‐Tomato mice. Values are expressed as averages ± SE (n = 3 mice, Total neurons measured: TG = 1,730, DRG = 1,575) 132 TRPA1-‐CRE driven tomato expression overlaps with other markers To better characterize the CRE-‐expressing neuronal population we next stained Tom + neurons with various markers. Unfortunately there is no anti-‐TRPA1 antibody that works staining mouse tissue. To work around this, we stained for other markers known to co-‐localize with TRPA1. Previous work has shown that the TRPA1-‐expressing neuronal population exists almost entirely within the population expressing the noxious heat FIGURE A.4 Tomato expression is widespread in tissues isolated from TRPA1-‐CRE X ROSA-‐STOP-‐Tomato mice Tomato expression can be seen throughout the body in TRPA1-‐CRE-‐Line1 X ROSA-‐STOP-‐Tomato mice. Tissues were sampled from Adult mice ~12 weeks of age. 133 receptor TRPV1 (Jordt, Bautista et al. 2004; Bautista, Jordt et al. 2006; Dai, Wang et al. 2007). We found that 79.4% of Tom + TG neurons are immunoreactive for TRPV1, results consistent with previous TRPA1/TRPV1 staining in rat sensory tissue (Fig. A5) (Dai, Wang et al. 2007; Kondo, Obata et al. 2009). As TRPA1 is considered to be highly expressed in nociceptors we next stained with the nociceptive marker peripherin. We found that 22.6% of Tom + neurons co-‐labeled with peripherin, a proportion much lower than has been previously reported (Fig.A5) (Vetter, Touska et al. 2012). Furthermore the presence of NF200 immunoreactivity, a marker for large myelinated neurons, in 50.9% of Tom + neurons further complicated our findings as the majority of previous reports indicate little to no overlap in the TRPA1 and NF200-‐expressing populations (Fig. A5) (Dai, Wang et al. 2007; Kondo, Obata et al. 2009; Vetter, Touska et al. 2012). Although the overlap of TRPV1 and Tom is in line with the hypothesis that Tom is expressed in the TRPA1-‐expressing population, the unexpected overlap with peripherin and NF200 was problematic. As the Tom + population using this CRE-‐based approach theoretically represented all cells that expressed TRPA1 at some stage in development, we reasoned that it was possible that some of these cells did not actually express TRPA1 at the time they were sectioned. This theory could explain why we saw greater overlap with the NF200 marker, widely believed to be expressed in cells outside of the TRPA1-‐expressing neuron population, but the low correlation between Tom and peripherin was could not be explained using this logic. We next focused on determining if functional TRPA1 responses were seen in these Tom + neurons. 134 FIGURE A.5 Immunostaining in TRPA1-‐CRE X ROSA-‐STOP-‐Tomato sensory tissue shows significant overlap in the tomato-‐expressing and TRPV1-‐expressing neuron populations A) Representative images from triple labeling experiments using TRPA1-‐CRE-‐Line1 X ROSA-‐STOP-‐ Tomato mouse TG (Tomato expression = red, Marker staining = green, pan neuronal marker PGP9.5 staining = blue). B) Quantification of triple labeling experiments shown in A. 135 TRPA1-‐CRE-‐Tomato cultured neurons indicate functional responses to Cinnamaldehyde irrespective of reporter expression To better determine if CRE recombinase was correctly targeted to the TRPA1-‐ expressing sensory neuron population, we carried out calcium imaging experiments on cultured TG neurons isolated from TRPA1-‐CRE-‐Line1 X ROSA-‐STOP-‐Tomato mice. We found that only 22.6% of Tom + neurons responded to the TRPA1 agonist Cinnamaldehyde (CA) (Fig. A6). Furthermore 39.8% of Tom -‐ neurons were found to respond to CA with a response seen in 34.8% of all neurons (Fig. A6). Although the overall percentage of neurons responding to CA (22.6% / 39.8% Tom + / Tom -‐ ) and the high correlation between CA and capsaicin (CAP) responses (67.6% / 74.7% Tom + / Tom -‐ ) are consistent with previous findings regarding TRPA1-‐mediated calcium responses in cultured sensory neurons (Jordt, Bautista et al. 2004; Bautista, Movahed et al. 2005), the fact that the Tom + population did not account for all CA responses suggested that our CRE transgene was not in fact targeted to TRPA1-‐expressing sensory neurons (Fig. A6). Similar results were also found using line 2 and another potent TRPA1 agonist AITC (data not shown). Although previous work has shown that sensory neurons can change their expression patterns as a result of the culturing process (Barabas, Kossyreva et al. 2012), the fact that our findings show that CA responses were seen in cells irrespective of the presence of Tom solidified the fact that we could not be certain whether or not our transgene was correctly targeted to all TRPA1-‐expressing sensory neurons. 136 FIGURE A.6 Calcium imaging reveals no correlation between tomato expression and TRPA1 agonist sensitivity in TRPA1-‐CRE X ROSA-‐STOP-‐Tomato cultured TG neurons Representative images from calcium imaging on cultured TG neurons from TRPA1-‐CRE-‐Line1 X ROSA-‐ STOP-‐Tomato mouse pups (<P14). Red arrows mark Tomato + electrically active neurons (as determined calcium responses following KCl depolarization) and white triangles mark Tomato -‐ neurons responding to the TRPA1 agonist Cinnamaldehyde. Quantification of the experiments is seen in the table below. 137 TRPA1 transcript levels unchanged in TRPA1-‐CRE-‐DTA ablated mice Simultaneous to crosses with Tom reporter lines, we also crossed the TRPA1-‐CRE lines to a mouse engineered to express diphtheria toxin subunit A (DTA) in CRE + cells. Cells in which DTA is expressed die due to inhibition of protein translation, but as the toxin lacks subunit B, which is required for cell entry, the toxicity is limited to the cells in which subunit A is expressed (Maxwell, Devenish et al. 1986; Palmiter, Behringer et al. 1987; Breitman, Rombola et al. 1990; Harrison, Maxwell et al. 1991; Collier 2001). As we still did not know whether our transgene was correctly targeted, we reasoned that we would be able to use this crossing to quantitatively measure the amount of TRPA1 transcript in ablated vs. non-‐ablated mice, with the presumption being that if CRE was correctly targeted TRPA1 transcript would be lost in ablated mice. By qPCR analysis adult Line 1 ablated mice appeared to have TRPA1 transcript expression levels indistinguishable from their non-‐ablated littermates (Fig. A7). Similar results were seen in 3 week old Line 2 ablated mice (not shown). Interestingly however, despite line 1 and line 2 being remarkably similar in regards to reporter expression patterns in sensory ganglia, line 2 ablated mice were very sickly, rarely surviving beyond weaning age of 3 weeks, while line 1 ablated mice appeared to be healthy (personal observations). These data further complicated our assessment but supported our prior results suggesting that our transgene was not targeted to the correct population. 138 FIGURE A.7 qPCR analysis reveals no change in TRPA1 transcript in TRPA1-‐CRE-‐cell ablated sensory tissue Pooled cDNA isolated from TG and DRG tissue from TRPA1-‐CRE-‐Line1 X ROSA-‐STOP-‐DTA (Ablated) mice show similar TRPA1 transcript levels as control ROSA-‐STOP-‐DTA (Non-‐Ablated). Values are expressed as the average difference in cycle number from the internal control GAPDH at threshold (ΔCt (GAPDH)(n = 3 mice per condition assayed in duplicate). 139 CONCLUSION The experiments described here show that we have successfully generated a CRE-‐expressing transgenic line. Although we have successfully targeted CRE to the ATG start site of the TRPA1 genomic sequence contained within a BAC clone, and this modified BAC has integrated into the germ line of 2 independent mouse lines, we still do not know if CRE is specifically expressed in all TRPA1-‐expressing cells. In the absence of a commercially available anti-‐TRPA1 antibody that works staining mouse tissue we were forced to turn to alternative methods to confirm successful transgene targeting. Reporter line crosses show our transgenic lines express CRE in a percentage of sensory neurons that is reminiscent of TRPA1 expression, and CRE expression overlaps with TRPV1 as expected, however, the overlap seen with other markers and the presence of CRE in larger neurons conflicts with most studies on TRPA1-‐expressing sensory neurons (Jordt, Bautista et al. 2004; Bautista, Movahed et al. 2005; Dai, Wang et al. 2007; Kondo, Obata et al. 2009; Vetter, Touska et al. 2012). CRE does appear to be expressed in sensory afferents innervating the skin, but it is also present diffusely in the spinal cord and not localized to the most superficial layers of the dorsal horn as expected (Andersson, Gentry et al. 2011). Furthermore, we found reporter expression in subsets of cells from every tissue we assayed, which could be very interesting developmentally if it is in fact reflective of TRPA1-‐expression, but does little to help confirm whether or not our transgene has been successfully targeted. Functional experiments on cultured sensory neurons show no correlation between reporter expression and calcium 140 responses to TRPA1-‐specific agonists, and mice in which TRPA1-‐CRE-‐expressing neurons are selectively ablated show no reduction in TRPA1 transcript levels in sensory ganglia. Taken together these data suggest that that our transgene is not targeted to TRPA1-‐ expressing neurons. Although it is possible our transgene is targeted to a subset of TRPA1-‐ expressing/lineage neurons and our BAC-‐targeting scheme did not include all the regulatory elements controlling TRPA1-‐expression, it is equally possible that our transgene is targeted to some other population of sensory neurons entirely. Regardless of what is going on, future experiments must focus on proving if TRPA1 transcript or protein physically overlaps with transgene expression. Preliminary studies trying to correlate reporter expression to an in situ probe that hybridizes to TRPA1 mRNA have been unsuccessful, but future work should focus on this technique. If we are unable to visualize in situ probe hybridization and reporter expression simultaneously, we could try multiplex fluorescence in situ hybridization (M-‐FISH) using probes for both TRPA1 and CRE. If TRPA1 mRNA is found in cells not expressing CRE then our transgenic line has not been successfully targeted to all TRPA1-‐expressing cells. Alternatively, if no transcript is found outside the CRE-‐expressing population we can be confident that our transgenic line is in fact targeted correctly and that the negative results presented earlier could be due to artifacts caused by the experimental methods. If we find that our transgenic lines have been correctly targeted to the TRPA1-‐ expressing cell population, we will be able to study TRPA1-‐expression and how it varies 141 during development using CRE reporters, and look at the role of TRPA1-‐expressing cells in pain and other systems through their selective ablation and/or silencing.

Abstract (if available)

Abstract Over the last sixteen years, a number of nonselective cation channels belonging to the transient receptor potential (TRP) family have been found to play instrumental roles in thermosensation. The two most prominent thermosensory TRP channels are TRPV1, which responds to noxious heat and heat mimetics such as capsaicin (the active ingredient in chili peppers), and TRPM8, which responds to cold and cold mimetics such as menthol (the active ingredient in mint). These channels are highly expressed in sensory afferents innervating the skin and knockout studies have implicated them in both acute thermosensation and the development of thermal hypersensitivity. Although the role of these channels in thermosensation is firmly established, we currently know little in regards to the causal intracellular mechanisms controlling thermal hypersensitivity. Furthermore, there are no TRP channel‐specific treatments for sensory‐related conditions that do not have serious side effects. This area of research is complicated by the fact that many TRP family channels have been found in areas of the body that are not exposed to the temperatures necessary for their activation, suggesting roles for these channels in other cellular processes. ❧ Here we identify a novel role of the cold-sensitive channel TRPM8 in insulin homeostasis. We find that Trpm8-/- mice have heightened insulin clearance compared to wildtype, a phenotype that also correlates with increased insulin degrading enzyme (IDE) in the liver, the predominant organ involved in insulin clearance. Furthermore, as previous studies have shown that TRPV1⁺ afferents in the hepatic portal vein (HPV) are instrumental in glucose sensing, the presence of TRPM8⁺ sensory afferents in the HPV suggests that TRPM8‐expressing neurons may be influencing liver insulin clearance by controlling localized expression of IDE. ❧ In addition to identifying a new role of TRPM8 outside of thermosensation, we show that TRPM8 pore dilation can be used to selectively target the large cationic dye PO-PRO3 to cold‐sensing neurons, a finding that refutes previous work claiming that TRPM8 does not allow such large cationic molecule permeation. These results provide proof of principle for this technique to be used to selectively block cold sensing neurons using the positively charged lidocaine derivative QX-314. ❧ Finally, to better understand what is going on inside of cold-sensing neurons, we have developed a transgenic mouse line that enables the specific immunoprecipitation of actively translating transcripts from TRPM8-expressing cells. ❧ The data we present here furthers our understanding of TRPM8, its role outside of thermosensation, and opens the door to a new therapeutic methodology for the treatment of chronic cold hypersensitivity. Future studies using the tools developed herein will help to identify targets and pathways involved in cold sensation and aid in the development of new treatments for various sensory‐related conditions.

Linked assets

University of Southern California Dissertations and Theses

Conceptually similar

PDF

The roles of TRPM8 in cold sensation: the six sides of TRPM8

PDF

Functional regulation of the neuronal cold sensor TRPM8

PDF

The selective role of GFRα3 in cold pain

PDF

The genetic axonal labeling of TRPM8 neurons

PDF

Elucidating the elusive role of TRPA1 in neurogenic inflammatory cold pain

PDF

Selective inhibition of inflammatory and neuropathic cold pain

PDF

Transient receptor potential melastatin 8 is required for migraine-like pain behaviors in mice

PDF

Gating mechanisms of transient receptor potential ion channels TRPM5 and TRPM4 in native and heterologous cells

PDF

Investigation of the molecular mechanisms underlying polarized trafficking of the potassium channels Kv4.2 and Kv1.3 in neurons

PDF

The role of the cofilin/Limk1 signaling pathway in axon growth during development and regeneration

PDF

The role of glial cells in spinal muscular atrophy

PDF

The roles of endoplasmic reticulum chaperones in regulating liver homeostasis and tumorigenesis

PDF

The role of fibroblast growth factor signaling on postnatal hepatic progenitor cell expansion

PDF

The role of neuregulin receptors in cell differentiation and the response to inflammatory cytokines in the intestinal epithelium

PDF

Generation of monoclonal antibodies via phage display and in vitro affinity maturation using activation induced deoxycytidine deaminase and DNA polymerase eta