University of Southern California Dissertations and Theses

KSHV-mediated modulation of immunoreceptor surface expression

(USC Thesis Other)

KSHV-mediated modulation of immunoreceptor surface expression

PDF

Download

Open document

Flip pages

Download a page range

Download transcript

Copy asset link

Request this asset

Transcript (if available)

Content ! KSHV-mediated Modulation of Immunoreceptor Surface Expression A dissertation presented to faculty of University of Southern California In candidacy for the Degree of Doctor of Philosophy By Kevin Brulois Thesis advisor: Dr. Jae U. Jung March 2014 ! i! Acknowledgements ! ! I am extremely grateful to my advisor, Dr. Jae Jung. He gave me the opportunity to work in his lab as technician and ever since, has provided guidance, mentorship, and supervision. He has helped me to grow as a scientist and gain an appreciation for a variety of topics. His positive attitude and passion for science is a continuous source of inspiration. I am also thankful to my dissertation committee: Dr. James Ou, Dr. Pinghui Feng, Dr. Keigo Machida and Dr. Young-Kwon Hong. Their guidance and constructive criticisms were very helpful. I am also very grateful to Dr. Armin Ensser, whose guidance and mentorship during his collaborative visits were instrumental to my progress. I also grateful to Dr. Cannon and Jill Henley for their help tremendous help with the humanized mouse project. I am thankful to Dr. Omid Akbari's lab, especially Hadi, Jonathan and Vincent, who always took the time to help me. I would also like to thank all the current and past members of Dr. Jung's lab for all their kind help and generosity. I am especially grateful to Dr. Amy Si-Ying Lee, who established the groundwork for the BACmid project and has been a good friend throughout my time in JJ's lab. Dr. Heesoon Chang, who introduced me to bench work and showed great patience as I performed experiments for the first time. I am extremely grateful to Dr. Lai-Yee Wong, Dr. Sun-Hwa Lee and Dr. Zsolt Toth for their continuous guidance and advice on experiments and results. I also wish to thank Dr. Samad Amini-Bavil-Olyaee and Dr. Dongwook Lee for their caring natures and great sense of humor. Finally, I would like to thank my parents and my brother. They have shown me nothing but love, support and encouragement throughout my life. This accomplishment would not have been possible with them. ! ii! Table of Contents Acknowledgements!.......................................................................................................................!i! Chapter!1!..........................................................................................................................................!1! Introduction!....................................................................................................................................!1! 1.1!KSHV!Biology!....................................................................................................................................!2! Significance!..............................................................................................................................................................!2! Taxonomy!.................................................................................................................................................................!2! Genome!Organization !..........................................................................................................................................!4! Viral!Lifecycle!..........................................................................................................................................................!6! Cellular!Tropism!....................................................................................................................................................!9! 1.2!KSHV@associated!Diseases!............................................................................................................!9! Kaposi's!sarcoma!(KS)!.........................................................................................................................................!9! Primary!effusion!lymphoma!(PEL)!.............................................................................................................!11! Multicentric!Castleman's!disease!(MCD)!..................................................................................................!12! Unconfirmed/Emerging/Rare!KSHVOassociated!Diseases!...............................................................!13! Role!of!the!Immune!System!in!KSHVOassociated!Pathogenesis!.....................................................!13! 1.3!KSHV!Manipulation!of!the!Immune!System!..........................................................................!14! Significance!...........................................................................................................................................................!14! Evasion!of!the!antigen!presentation!pathway!.......................................................................................!14! The!KSHV!Immunoevasins,!K3!and!K5,!are!prototypic!MARCH!family!members!..................!16! Substrates!of!K3!and!K5!...................................................................................................................................!17! Mechanism!of!K3!and!K5Omediated!downregulation!.........................................................................!18! KSHV!evasion!of!NK!cells!.................................................................................................................................!19! Immunoevasins!of!βO!and!γOherpesviruses!..............................................................................................!21! ! iii! In#vivo!role!of!immunoevasins!......................................................................................................................!21! 1.4!Genetic!Engineering!of!Large!DNA!Viruses!...........................................................................!22! Significance!...........................................................................................................................................................!22! Bacterial!artificial!chromosomes!.................................................................................................................!22! 'Recombineering'!................................................................................................................................................!24! Designing!a!herpesviral!BAC!clone!.............................................................................................................!27! 1.5!Summary!of!thesis!.........................................................................................................................!29! Chapter!2!.......................................................................................................................................!30! Construction!and!manipulation!of!a!new!KSHV!...............................................................!30! bacterial!artificial!chromosome!clone!................................................................................!30! 2.1!Introduction!....................................................................................................................................!31! 2.2!Results!...............................................................................................................................................!32! Generation!of!an!rKSHV.219Oderived!BAC!clone!..................................................................................!32! Genetic!analysis!of!candidate!clones!..........................................................................................................!33! Stable!propagation!of!BAC16!in!E.#coli#DH10B!.......................................................................................!35! Complete!sequencing!analysis!of!the!KSHV!BAC16!.............................................................................!36! Production!of!high!titer!BACOderived!virus!stock!................................................................................!38! Generation!of!K3!and!K5!deleted!recombinant!KSHV!........................................................................!38! Characterization!of!BACOderived!WT!and!mutant!viruses!...............................................................!40! K5!but!not!K3!is!required!for!KSHVOmediated!reduction!of!MHCOI!surface!expression! during!viral!reactivation!in!iSLK!cells!........................................................................................................!42! K5,!but!not!K3,!is!required!for!the!reduction!of!MHCOI!surface!expression!following!de# novo!infection!.......................................................................................................................................................!43! 2.3!Discussion!..........................................................................................................................................!46! ! iv! Chapter!3!.......................................................................................................................................!51! KSHV!K3!and!K5!ubiquitin!E3!ligases!have!stage@specific!immune!evasion!roles! during!lytic!replication!............................................................................................................!51! 3.1!Introduction!....................................................................................................................................!52! 3.2!Results!...............................................................................................................................................!53! Construction!of!recombinant!KSHV!with!altered!disposition!of!K3!and!K5!ORFs !.................!53! The!K5!locus!is!more!conducive!to!high!protein!expression!...........................................................!54! At!low!K3!and!K5!expression!levels,!K5!is!more!effective!compared!to!K3!at!MHCOI! downregulation!...................................................................................................................................................!58! Positioning!K5!within!the!K3!locus!causes!delayed!ICAMO1!downregulation!.........................!59! Construction!and!characterization!of!RGBOBAC16!..............................................................................!61! Construction!and!characterization!of!RGBOderived!K3!and!K5!deletion!mutants!..................!63! 3.3!Discussion!........................................................................................................................................!68! Chapter!4!.......................................................................................................................................!73! Conclusion!and!Future!Directions!........................................................................................!73! 4.1!BAC16:!future!outlook!.................................................................................................................!74! 4.2!Immune!evasion!roles!of!K3!and!K5!.......................................................................................!78! Chapter!5!.......................................................................................................................................!81! Materials!and!Methods!.............................................................................................................!81! 5.1!Virus!and!Cells!................................................................................................................................!82! 5.2!Plasmids!...........................................................................................................................................!82! 5.3!BAC16!construction!......................................................................................................................!84! 5.4!BAC!DNA!isolation!and!analysis!...............................................................................................!85! ! v! 5.5!Production!of!BAC16!virus!stock!.............................................................................................!85! 5.6!Mutagenesis!of!BAC16!in!GS1783!............................................................................................!86! 5.7!Quantification!of!infectious!virus!and!KSHV!DNA!levels!in!cells!...................................!87! 5.8!Immunoblotting!.............................................................................................................................!88! 5.9!Flow!cytometry!..............................................................................................................................!88! 5.10!RNA!isolation!and!qPCR!............................................................................................................!89! References!....................................................................................................................................!92! ! ! 1! ! ! Chapter 1 Introduction ! 2! 1.1 KSHV Biology Significance In terms of distinguishing features, Kaposi's sarcoma-associated herpesvirus (KSHV), also known as human herpesvirus 8 (HHV-8), is the most recently identified human herpesvirus (1); it is one of seven viruses known to cause cancer in humans (2) and it is the most common cause of cancer in untreated acquired immunodeficiency syndrome (AIDS) patients (3). KSHV is associated with its namesake, Kaposi's sarcoma (KS), and the presence of the virus in KS lesions has been confirmed by different techniques (4-6). Subsequent studies also show an association between KSHV and two rare lymphoproliferative disorders: primary effusion lymphoma (PEL) and multicentric Castleman's disease (MCD) (7). As with other malignancies associated with AIDS and transplant patients, the immune system plays a pivotal role in controlling KSHV-induced pathogenesis. Conversely, as a chronic lymphotrophic pathogen, the KSHV genome is equipped with an array of immune evasion genes. Although the incidence of KS in developing nations has declined significantly since the implementation of highly active antiretroviral therapy (HAART) (8), there is still an ongoing epidemic in the KS belt of sub- Saharan Africa, where KS is the most frequently diagnosed cancer in some countries (3). Taxonomy KSHV belongs to the order Herpesvirales, which currently comprises 101 members which are subdivided into three Families: Alloherpesviridae, Herpesviridae, and Malacoheresviridae (9). Members of this order can infect a variety of species ranging from invertebrates to mammals (10). Herpesvirales typically feature an icosahedral capsid, consisting of 12 pentavalent and 150 hexavalent capsomeres (~125nm in diameter) and a large dsDNA genome of varying sizes ranging between 108 kbp (Ateline herpesvirus 3) and ! 3! 241 kbp (Chimpanzee cytomegalovirus) of unique sequence (11). The capsid is surrounded by tegument layer, which in turn is encompassed within a lipid bilayer harboring glycoproteins. Among the 67 Herpesviridae, eight are known to infect humans and each has the ability to cause a different set of diseases (Table 1). Based on their genome sequences and biological properties, Herpesviridae are grouped into three subfamilies, α, β, and γ. The γ-herpesviruses are further subdivided into four genus: Lymphocyrptovirus, Macavirus, Percavirus, and Rhadinovirus (9). KSHV belongs to the genus Rhadinovirus, named for their fragile genomes as evidenced by fragmentation during density centrifugation (Rhadino= fragile in Greek), a characteristic stemming from the high GC- content of the terminal repeat (TR) region relative to the rest of the viral genome (12). The other human γ-herpesvirus, Epstein-Barr virus (EBV), belongs to the Lymphocryptoviruses. It should be noted that the ability to induce cancer is so far an exclusive feature of γ- herpesviruses (13) and together, EBV and KSHV are responsible for a significant portion of virus-induced cancers worldwide (14). Table 1: Human Herpesviruses Name Subfamily Synonym HHV-1 α Herpes simplex virus 1 HSV-1 HHV-2 α Herpes simplex virus 2 HSV-2 HHV-3 α Varicella zoster virus VZV HHV-4 γ Epstein-Barr virus EBV HHV-5 β Cytomegalovirus CMV HHV-6 β Human herpesvirus 6 HHV-7 β Human herpesvirus 7 HHV-8 γ Kaposi’s sarcoma-associated herpesvirus KSHV ! 4! Genome Organization In the viral particle, the KSHV genome is a linear duplex that consists of ~140kb of unique coding sequence flanked by tandem terminal repeats composed of ~25-50 copies of a GC-rich, 801bp sequence. Upon infection of a host cell, the viral genome is delivered to the nucleus where it circularizes via homologous recombination between the two flanking TRs and is subsequently maintained as a non-integrated episome (Fig. 1.1) (15). On occasion, large portions (~30kb) of the unique region are found in duplicate, with the second copy located within the TR region (16). Following this initial observation (16) in the KSHV-positive cell lines, BC-1 and HBL-6, an analogous genome structure was found in a recombinant genome derived from BCBL-1 cells (17). Furthermore, since the TR region can vary in size from different KS, PEL and MCD isolates, the size of the TR has been used as a readout for strain variation between samples (18, 19). Interestingly, these studies have also found evidence for rearrangements involving a duplication of part of the unique region (18, 19). The first complete sequencing of the KSHV genome revealed 87 open reading frames (ORFs), including an extensive array of cellular homologues (12, 16), many of which have putative roles in immune modulation and tumorigenesis (13, 20). KSHV ORFs were numbered according to the prototypic γ-herpesvirus, herpesvirus saimiri (HVS); ORFs that did not have a corresponding homologue in HVS were given a 'K' designation (16). Comparative analysis of different γ-herpesvirus genomes shows four major blocks of conserved genes separated by clusters of K genes (21). Subsequently, KSHV was found to be most closely related to rhesus monkey rhadinovirus (RRV) and retroperitoneal fibromatosis-associated herpesvirus (RFHV) (22). Compared to other viruses, the KSHV genome is highly conserved between different isolates (<1% variation at the nucleotide level). However, a certain amount of ! 5! ! Figure 1.1: Schematic of the KSHV genome. Conserved blocks are shown in white. 'K' genes are indicated in gray. Important regions of the genome are indicated outside. Outward tick marks indicate kilobase pairs. . ! 6! variation can be found throughout the genome (23), especially at the K1 gene locus (24). Sequencing of the K1 gene has been completed for several hundred samples of KSHV obtained from all over the world, including Africa, Florida, Germany, Pacific Islands, Saudi Arabia, Taiwan, and New Zealand (23). Subsequent analysis has revealed a total of seven subtypes (designated A, B, C, D, E, F, Z) (25). In addition to K1, the internal repeat domain (IRD) of LANA has significant sequence variation (26) and two different forms of K15, termed P and M (for predominant and minor), have been found (27). The P and M form of K15 are not linked to any specific clade, suggesting the formation of chimeric genomes through homologous recombination (23). It has been suggested that subtype A is associated with more rapid progression of classic KS (28) and higher viral loads in the saliva and infectivity of epithelial cells (29), although evidence for strain-specific differences is sparse. Viral Lifecycle Like other herpesviruses, the KSHV lifecycle is divided into two phases: latent and lytic. Latent infection is characterized by a restricted viral gene expression program that mainly involves genes spanning a ~10kb region of the genome called the latency locus. These core latency genes include LANA, vCyclin, vFLIP, Kaposin-A -B and -C, and 12 pre- miRNA (30-32). The expression of these latency genes occurs from a complex set of spliced, polycistronic transcripts (33), one of which harbors the intronic precursor of miRNAs (34). In addition to these core latency genes, PEL and MCD samples show expression of an additional latent gene, vIRF-3, also known as LANA-2 (35). Moreover, limiting-dilution analysis of mRNA from KSHV-infected cells showed that K1 is expressed at low levels in a variety of latently infected cell-types and latent vIL-6 transcripts could also be detected in some context (36). Like the cellular genome, KSHV episomes are bound to ! 7! histones. Chromatin-modifying enzymes, such as EZH2 of the Polycomb complex, are crucial for maintaining the suppression of lytic gene expression during latency (37, 38). Latent factors are involved in a variety of activities, including episomal maintenance (LANA/ORF73) (39), cell-cycle regulation (vCyclin/ORF72) (40), NFκB activation (vFLIP/ORF71) (41), stabilization of cytokine and other mRNAs (Kaposin B/K12) (42), and regulation of entry into the lytic phase (miRNA) (43, 44). During latency, viral episomes are maintained at 10-50 copies per cell in PEL and MCD samples (45). LANA, the major latency protein of KSHV, is required for both the replication and segregation of the viral genome during the host cell cycle, thereby preventing exponential decline of the latent episome copy number with each cell division (46). Although latent replication is thought to initiate at latent origins of replication (ORIs) in the TR (47-49), single molecule analysis showed initiation sites were uniformly distributed across the entire length of the KSHV genome (50). The segregation function of LANA is executed through its ability to tether the viral genome to the host chromosome, a function that requires the amino-terminal region, which interacts with histones, and the carboxyl-terminal domain, which binds to the latent ORIs in the TR (48, 51). Despite continued LANA expression, episomal maintenance is inefficient in cultured cells, necessitating the inclusion of positive selection markers to avoid genome loss during prolonged passaging (52, 53). Another major function of LANA is the repression of lytic gene expression through the suppression of the RTA promoter (54-56), thereby perpetuating the latent phase. The lytic phase is defined by replication of linear viral genomes and an ordered cascade of viral gene expression that culminates in the lysis and release of mature virion particles from the host cell. Lytic genes can be divided into three sequentially transcribed kinetic classes, immediate-early genes (IE), early (E), and late (L), which are defined by differential sensitivity to protein translation inhibitors such as cycloheximide (CHX) and viral DNA polymerase inhibitors such as phosphonoacetic acid (PAA). In KSHV, this ordered ! 8! cascade of gene expression is initiated by Replication and transcription activator (RTA), a major viral transcription factor that binds to RTA-responsive elements (RREs) present on many viral promoters (57). Besides RTA, IE genes also include bZIP/K8, ORF45, K3, K4.2, and K5 (58Haque, 2000 #390, 59, 60). E gene products include additional immune modulatory proteins as well as factors involved in viral DNA replication and L gene transcription. L genes encode capsid subunits, glycoproteins and proteins involved in packaging and assembly of mature virion particles (16). Although KSHV has two functional lytic origins of replication, termed OriLyt-L and OriLyt-R (61-64), DNA replication is thought initiate primarily from the OriLyt-L (65). There are multiple triggers of lytic replication of KSHV, including phorbol esters, HDAC inhibitors (66, 67), hypoxia (68, 69), B-cell antigen receptor engagement (70), expression of the ER-stress and plasma cell differentiation marker, XBP-1 (71), activation of TLR7/8 (72), NFκB inhibitors (73), apoptosis (74), and coinfection with HIV (75) or HCMV (76). Unlike productive RRV infection, entry of KSHV- infected cells into the lytic phase is asynchronous (77, 78), making it difficult to examine different stages of the lytic phase based solely on the time since induction. In addition to the latent and lytic gene expression programs, non-canonical induction of lytic genes can occur in some contexts. For example, Notch signal transduction activates a subset of lytic genes, including v-IL6, K3 and K5, but does not result in full-blown lytic replication in BCBL-1 cells (79, 80). Lymphatic endothelial cells undergo a unique transcription program that includes expression of several lytic genes such as ORF45 (81, 82). Similarly, expression of RTA, as well as several immune modulatory proteins such as vIL-6, vMIP-II, K5 and ORF54, was observed following de novo infection of KSHV (83). It is thought that de novo lytic gene expression, also dubbed 'lytic burst,' helps protect infected cells before latency is established. Importantly, this pre-latency period is accompanied by sequential changes in the viral chromatin that regulate the timely shutdown of lytic gene expression (84). ! 9! Cellular Tropism In KS patients, KSHV DNA was found primarily in CD19-positive PBMCs (85), suggesting B-cells are the latent reservoir of KSHV infection. B-cell tropism was further confirmed by experimental infections using a variety of approaches, including in vitro infection of human PBMCs (86, 87), umbilical cord mononuclear cells (UCMC) (88), and CD34-positive cells (89) and in vivo infection of NOD-SCID mice (90), humanized mice (91), and common marmosets (92). The other major target cell of KSHV is endothelial cell (93), which undergo reprogramming upon KSHV infection (94, 95). However, KSHV infection of other cell types has also been reported, such as NK cells and dendritic cells of NOD-SCID mice (90) and monocytes of KS tissue (96). In addition, KSHV can infect T cells when applied in vitro to primary tonsillar explants (97). Infection of plasmacytoid dendritic cells (pDC) has also been demonstrated (98). A variety of cultured cell lines are susceptible to KSHV infection, including human fibroblasts, 293, HEp-2, and DU145 cells (53). Cultured B-cell lines were initially shown to be refractory to KSHV infection (88), however, subsequent studies have been able to overcome this block (86, 99-101). Recombinant KSHV genomes can also be introduced into B-cell lymphoma lines by transfection but the resulting cells are inefficiently induced into the lytic phase (102). 1.2 KSHV-associated Diseases Kaposi's sarcoma (KS) Kaposi's sarcoma was first described in the late 19 th century by the Hungarian dermatologist, Moriz Kaposi, who noted idiopathic skin lesions on the lower extremities of elderly men with classic KS (103). KS is a multicentric heterogeneous neoplasm characterized by the presence of proliferating KSHV-infected spindle cells of endothelial origin, significant infiltration of inflammatory cells, and an abundance of leaky neovasulature ! 10! (104). KS skin lesions involve the dermis layer of the skin and progress through three stages: patch, plaque, and nodular (104). Lesions tend to appear on the nose, ears, hands, feet, or other extremity and in damaged tissue wounds (105). These observations are provocative given the involvement of hypoxia and inflammatory cytokines in KSHV replication. In severe cases, KS can involve visceral organs such as the lung and gastro intestinal tract (106, 107). Although a small percentage of spindle cells express lytic antigens (108, 109), KS is primarily driven by latently infected cells. Notably, treatment of KS patients with ganciclovir can prevent the formation of new lesions (110), pointing to the involvement of KSHV lytic replication in pathogenesis. Substantial epidemiological evidence linked Kaposi's sarcoma with an infectious etiology before the discovery of KSHV in 1994 (1). Most importantly KS was not equally prevalent in different groups of AIDS patients: 21% of homosexual or bisexual men developed KS compared to only 1% of haemophilia patients (111), suggesting a sexually transmitted infectious etiology. In fact, prior to widespread use of HAART, rates of KS were 100,000-fold higher in homosexual men compared to the general population (112). Following the discovery of KSHV and the development of serological assays for KSHV, the importance of sexual transmission as an infection route has been diminished (113, 114). It is now believed that transmission occurs largely by saliva, a notion supported by fact that saliva is the most common body fluid to harbor KSHV (115) and KSHV DNA is frequently found in saliva samples (116, 117). Nevertheless, transmission has also been shown to occur by other routes, including blood transfusion (118), organ transplantation (119), and injection drug use (120). The presence of KSHV in donated blood is associated with significant risk, especially in regions with a high KSHV seroprevalence (121, 122). Unlike other herpesviruses, KSHV is not uniformly prevalent among the human population. In North America and Europe, seroprevalence is less than 10%. In contrast, seropositivity is markedly elevated in certain geographical regions, including sub-Saharan ! 11! Africa (>50%) and the Mediterranean basin (20-30%) (123). In addition, a higher KSHV prevalence has been observed among men who have sex with men (MSM) (124, 125), Amerindians of South American (116) and the Xinjiang and Zhejiang regions of China (126). KSHV is also more prevalent among patients afflicted with certain diseases such as systemic lupus erythematosus (SLE) (127), although the association between KSHV and SLE is still unclear. While KS is primarily recognized as an AIDS-defining illness, it occurs in three other epidemiological forms: iatrogenic (also known as transplant-associated), endemic (also known as African), and classic (also known as Mediterranean) (128). While AIDS- associated and iatrogenic KS both occur in the context immune suppression, AIDS- associated KS is coincident with the epidemic of HIV infections in Africa and iatrogenic KS is most common in developed countries. Endemic KS is common in specific regions of sub- Saharan Africa where the soil is rich in heavy metals (129). In adults, it is 15 times more common in men than in women and a less common but more aggressive form of endemic KS can occur in children (129). Although endemic KS is not associated with systemic immune suppression, it most common on cutaneous extremities where it is believed that localized immune suppression contributes to pathogenesis (129). Classic KS is usually indolent and is common in the Mediterranean basin where it is associated with elderly men of Mediterranean, Eastern European, and Ashkenazi descent (130). Like other forms of KS, it is associated with a decline in immune function that accompanies old age, although genetic factors are also thought to play a role. Primary effusion lymphoma (PEL) Soon after its discovery as the cause of KS, KSHV was also linked with two rare lymphoproliferative disorders: primary effusion lymphoma (PEL) (7) and the plasmablast variant of multicentric Castleman's disease (MCD) (131). PEL is an AIDS-defining illness ! 12! that accounts for 3%-4% of all AIDS-related non-Hodgkin's lymphoma (NHL) (132). It is most prevalent among end-stage AIDS patients and is usually concomitant with MCD or advanced KS (132). In the HIV-positive patients, more than 90% of PEL cases are associated with EBV coinfection (133). PEL, also known as body cavity lymphoma, is characterized by effusions of proliferating LANA-positive plasmablast-like cells in pleural, pericardial and abdominal spaces (134). Neoplastic cells are usually monoclonal, have large plasmablast morphology and express markers associated with late-stage B-cell differentiation: CD45 + , CD19 - , CD20 - , CD38 + , and CD138 + (133, 135). While LANA is present in nearly all PEL cells, very few cells show expression of lytic antigens. Some PEL patients develop a solid tumor mass, which has been described by various names, including diffuse large B-cell lymphoma or extracavitary PEL or KSHV large B-cell lymphoma (KSHV-LBL) (136). Multicentric Castleman's disease (MCD) KSHV was suspected as a cause of multicentric Castleman's disease (MCD) because a significant fraction (13%) of MCD patients also develop KS (137) and linkage with the plasmablastic subset of MCD cases has since been confirmed (138). KSHV is associated with nearly 100% of HIV-positive MCD cases and 40-50% of HIV-negative cases (139). MCD involves a non-neoplastic polyclonal proliferation of IgMλ-restricted B- cells driven by high levels of IL-6 (140, 141). Disease presentation includes intermittent flares of systemic symptoms such as fever and lymphadenopathy (142). Unlike PEL, up to 30% of MCD cells show expression of vIL-6 and other lytic markers, a finding that reflects an expanded latency program rather than productive lytic replication. ! 13! Unconfirmed/Emerging/Rare KSHV-associated Diseases Following the controversial association of KSHV with multiple myeloma (MM) (143, 144) and pulmonary arterial hypertension (PAH) (145, 146), there is much skepticism concerning the validity of unconfirmed KSHV disease associations. Nevertheless, limited evidence exists for an association between PAH and MCD (147). This link was made noteworthy by a study of the KSHV encoded protein, K5, which can downregulate BMPR-II (148), a protein that it is often mutated in familial PAH (147, 149). However, this association remains controversial. There is also epidemiological evidence for KSHV involvement in Splenic Marginal Zone lymphoma (150). While it has not been confirmed, this finding is supported by the demonstration that transgenic mice harboring the latency locus expressed under the control of its natural promoter elements developed marginal zone (MZ) B-cell hyperplasia (151). A fraction of HAART-naïve KS patients (~14%) become afflicted with Kaposi's sarcoma associated paradoxical immune reconstitution inflammatory syndrome (KS-IRIS) following the initiation of HAART therapy (152). This is a rare, life-threatening illness characterized high levels of inflammation (152). Role of the Immune System in KSHV-associated Pathogenesis Epidemiological evidence alone, particularly the existence of the AIDS-associated and iatrogenic forms of KS, strongly implicates a pivotal role for the immune system in the control of KSHV-related pathogenesis. For example, iatrogenic KS goes into remission upon cessation of immunosuppressive regimens (153) and compared to the general population, incidence rates of KS are more than 600-fold higher among people with HIV/AIDS (154). In addition, there is a significant correlation between measures of immune function and the presence and severity of KSHV-associated disease among KSHV-infected individuals. For example, studies of asymptomatic and symptomatic KSHV-positive subjects found a higher frequency of KSHV-specific CD8+ T cells was correlated with the absence of ! 14! KS (155, 156). Moreover, reduced NK cell-mediated immunity was primarily observed in patients experiencing ongoing AIDS-associated KS (157). It was also shown that NK cells from patients with active KS have reduced expression of the activating receptor, NKG2D, a defect that was not seen in normal blood donors or patients with resolved KS (158). However, the mechanism by which KSHV can affect the expression of NK cell receptors is not known. In conclusion, a healthy immune system is critical for the control KSHV pathogenesis but is not sufficient to completely eliminate KSHV from the body. 1.3 KSHV Manipulation of the Immune System Significance More than 25% of the KSHV genome consists of genes dedicated to immune modulatory functions (3, 159). KSHV-encoded proteins have been shown to interfere with the regulation of a variety of host cell responses, including interferon signaling, apoptosis, autophagy, complement control, chemokine networks, cytokine production, and host gene expression (reviewed in (159, 160)). This section highlights KSHV genes with putative roles in evasion of CD8+ T cell and NK cell responses. Evasion of the antigen presentation pathway Viral peptides presented in the context of major histocompatibility complex class I (MHC-I) molecules on the surface of infected cells is critical for CD8+ T cell activation and cytotoxic T lymphocyte- (CTL-) mediated lysis of virus-infected cells. The antigen presentation pathway begins with the proteasomal degradation of viral proteins into peptide fragments which are then translocated into the endoplasmic reticulum (ER), loaded onto MHC-I molecules and trafficked to the cell surface. The suppression of lytic gene expression ultimately limits the availability of antigenic viral peptides for presentation on ! 15! MHC-I molecules and this feature of latency is one of the fundamental ways that infected cells remain immunologically silent. In addition, the major latency protein, LANA, harbors a central IRD domain consisting of repetitive amino acid motifs that inhibit proteasomal degradation in cis thereby blocking LANA peptide presentation to CD8+ T cells (161, 162). An analogous mechanism has been shown for the EBNA1 protein of EBV (163, 164) and the LANA protein of MHV-68 (165), suggesting that this is a generalized immune evasion strategy of γ-herpesviruses. It should be noted that despite this countermeasure, LANA- specific CTLs are still found in KSHV-infected individuals (166). Robust T cell responses are also dependent on the interaction of costimulatory molecules such as ICAM-1 and B7-2 with lymphocyte function-associated antigen 1 (LFA-1) and cytotoxic T-lymphocyte antigen 4 (CTLA4), respectively, expressed on the surface of T cells. In addition, viral peptides can also be presented in the context of MHC-II molecules via autophagy (167). As a countermeasure, many host cell surface protein expression are modulated in latently infected cells. Following de novo infection, MHC-I and ICAM-1 surface expression is reduced and remains downregulated for an at least 23 days post infection (168, 169). Another study has shown that latently-infected THP-1 cells have reduced levels of the costimulatory molecules, CD86 and CD83 (170). The B-cell-specific latent protein, vIRF-3, was shown to downregulate MHC-II surface expression in PEL cells (171). However, with the exception of vIRF-3, the role of other latent genes in surface protein downregulation is not clear. NK cells are part of the innate immune response as they rapidly respond to infection and do not require selection or expansion to function optimally (172). Upon activation, they kill target cells by secreting perforin and granzymes. In addition, NK cells produce IFN-γ and other cytokines that recruit other immune cells to the site of infection. Activation of NK cells occurs through the integration of positive and negative signals from receptors ! 16! expressed on the cell surface. Activating receptors of NK cells include NKG2D, 2B4, DNAM-1, NKp80 and the natural cytotoxicity receptors (NCR): NKp30 (NCR3), NKp44 (NCR2) and NKp48 (NCR1) (173). During latency, the KSHV encoded miRNA, miR-K12-7, downregulates the expression of the NKG2D ligand, MHC class I-related chain B (MICB) (174). It should be noted that additional NK cell evasion strategies are employed during the lytic phase (175-177). Given the importance of latency as a viral immune evasion strategy, it is not surprising that the switch from latent to lytic replication is tightly regulated. As part of this regulation, LANA suppresses the activation of RTA gene expression by binding to the transcription factor, RBP-Jκ (54-56). Moreover, several miRNAs participate in the suppression of the lytic cycle (44, 174, 178, 179). In addition, rapid chromatinization and epigenetic repression of lytic gene expression contribute to the establishment and stable maintenance of latent infection (37, 84). Interestingly, CD4+ T cells are involved in suppressing lytic replication of KSHV following in vitro infection of tonsillar B cells (87), suggesting a complex balance between immune control and latency. The KSHV Immunoevasins, K3 and K5, are prototypic MARCH family members The majority of KSHV genes are expressed during the lytic phase, including several antigenic proteins (180). Many viruses including KSHV, encode proteins called immunoevasins to circumvent the antigen presentation pathway (181, 182). The major KSHV immunoevasins are K3 and K5, also known as Modulator of Immune Recognition (MIR) 1 and 2, respectively (183). K3 and K5 are prototypic members of the membrane- associated RING-CH (MARCH) family of membrane-bound E3 ubiquitin ligases, named for the characteristic amino terminal C 4 HC 3 zinc-binding domain and type-III membrane topology shared by most members (184). Members of this family are part of a growing number of E3 ligases that target plasma membrane proteins for ubiquitin-dependent ! 17! internalization (185, 186). Several poxviruses and γ-herpesviruses encode MARCH ligases and 11 cellular homologues (termed MARCH 1-11) have been identified in the human genome (187). Like their viral counterparts, many cellular MARCH proteins appear to play a role in tempering immune responses by targeting immune synapse (IS) components and other immune cell activators (187-192). While a positionally conserved homologue of K3 can be found in several other γ- herpesvirus genomes (22, 193-195), the presence of more than one vMARCH gene is a unique feature of KSHV. It has been suggested that K5 arose from a gene duplication event (196). This may have facilitated the evolution of specialized roles for K3 and K5. The rfK3 protein of the closely related Old World primate rhadinovirus RFHV, was able to induce endocytosis of MHC-I as well as ICAM-1 (197), suggesting some of the functions of K3 and K5 were originally combined in one gene and may have been selectively lost as K3 and K5 became more dedicated. Substrates of K3 and K5 K3 and K5 proteins were originally identified by their ability to downregulate surface MHC-I molecules (196, 198, 199). Subsequent studies have revealed an increasing number of K5 substrates, including the NKT cell ligand, CD1d (200); the MHC-I-related molecules, HFE (201); the adhesion molecules, ICAM-1 (176, 202), PECAM (203), VE-cadherin (204), ALCAM (205), DC-SIGN, DC-SIGNR (206); the co-stimulatory molecule, B7-2 (176, 202); the NK-cell activating ligands, MICA, MICB, and AICL (177); the cellular restriction factor, tetherin (207); the cytokine receptor, IFN-γR1 (208); the plasma membrane t-SNARE syntaxin-4 (209); and the TGF-β family member, BMPRII (148). In addition, Timms et al. reported several novel K5 substrates, including 8 verified targets: CD32, CD33, CD99, EPHB4, Plexin A1, PMZL2, Kit (CD117), IL9R (CD129); and 66 potential new targets, all of ! 18! which were identified through a quantitative mass spectrometry approach (210). Thus, K5 appears to be a multifunctional protein capable of significant remodeling of the plasma membrane proteome of host cells. In contrast, K3 has more specific set of substrates, including MHC-I molecules (HLA-A, B, C, and E) (196), CD1d (200), PECAM, ALCAM (205) and IFN-γR1 (208), with HLA-C and HLA-E being the only substrates exclusive to K3. Mechanism of K3 and K5-mediated downregulation The substrate recognition function of K3 and K5 has been mapped to their transmembrane (TM) domains; replacing the TM domains of K3 with those of K5 was sufficient to confer the ability to downregulate B7-2, a substrate not normally targeted by K3 (211). Moreover, the susceptibility of K3 and K5 substrates is dependent on their TM domains; replacing the TM of HLA-C with that of HLA-A confers susceptibility of HLA-C to K5-mediated downregulation (196). Internalization of K3 and K5 target substrates involves the ubiqitination of cytosolic target residues of plasma membrane substrates (212), a function that is usually dependent on an intact RING-CH domain (211, 213). Subsequently, ubiqitinated substrates are subject to endocytosis and endolysosomal degradation in manner that requires components of the ESCRT-I complex (214). It has also been shown that non-lysine residues are subject to ubiqitination by K3 and K5 (215, 216). Even though evidence predominantly suggests endocytosis-induced downregulation of their target substrates (196, 213, 214), K3 and K5 are predominantly localized in the ER (196). Notably, homologues of K3 and K5 from rodent γ-herpesviruses use the ER-associated degradation (ERAD) pathway to downregulate their substrates (195, 217). Despite significant homology and structural similarities (183, 211, 213), K3 and K5 have a number of distinctions in the way they target substrates for downregulation. First, while K3 preferentially induces K63-linked ubiquitin chains on MHC-I substrates (214), K5 ! 19! expression results in K11 and K63 mixed chain linkages (218). Second, K3 preferentially targets the membrane distal K340 residue of HLA-A2 molecules (219), while K5 favors the membrane proximal K335 residue (216). Third, although both K3 and K5 require dynamin and proteolipid protein 2 (PLP2) for their activities (202, 210), they may also use distinct cell machinery to internalize target substrates. K3 requires the E2 conjugating enzymes, UbcH5b/c and Ubc13; the ESCRT-1 component, Tsg101; and other components including clatherin, epsin 1, and eps15R (214). Fourth, unlike K3, palmitoylation is required for in order for K5 to function properly; palmitoylation may potentially facilitate its localization lipid rafts or otherwise modulate its interaction with substrates (220). KSHV evasion of NK cells When inhibitory receptors on the surface of NK cells, especially killer Ig-like receptors (KIR) and CD94/NKG2A, are not engaged by MHC-I molecules on the surface of target cells, it leads to NK cell activation and targeted killing (173). This increased susceptibility to NK cell lysis referred to as the 'missing self' hypothesis represents a significant dilemma for viral immune evasion. Viruses use three main strategies to counteract the threat of NK cell surveillance: expression of decoy MHC-I molecules, selective downregulation of HLA-A and HLA-B molecules, and downregulation of activating ligands for NK cell activating receptors (221). KSHV employs the latter two. As described above, K5 induces selective downregulation of HLA-A and HLA-B (196). In addition K5 expression can reduce the surface expression of activating ligands for NKG2D and NKp80 (177) and costimulatory molecules such as ICAM-1 and B7-2 (176, 202). Moreover, ORF54 can induce downregulation of NKp44L (175), while miR-K12-7 reduces the NKG2D ligand, MICB (174). The role of KSHV-encoded factors in CD8+ T cell and NK cell evasion is illustrated in Figure 1.2. ! 20! Figure 1.2: Depiction of CD8+ cell and NK cell immune evasion mechanisms of KSHV. Ubiquitin, Ub; viral FLICE-inhibitory protein (vFLIP) interacts with Inhibitor of IκBα Kinase α/β/γ (IKKα/β/γ) complex to induce IκB degradation and NFκB translocation resulting in increased MHC-I transcription. vIRF-1 competes with CBP/p300, thereby blocking NFκB-mediated upregulation of MHC-I transcription. vIRF3 blocks the class I major histocompatibility complex, transactivator (CIITA)-mediated transcription of MHC-II. LANA blocks IRF4-mediated transcription of CIITA. ORF37 degrades host mRNA. Intercellular adhesion molecules 1 (ICAM-1) MHC class I-related chain A/B (MICA/B), activation-induced C-type lectin (AICL). For miR-K12-7, K3, K5, ORF54, see text.! K5 K3 K5 MHC$II& MHC$I& Ub ICAM-1 MHC-I/CD1d MICA/B AICL ICAM-1 B7-2 Ub Ub Ub Ub Ub Ub Ub Ub Enodosomal Sorting and Lysosomal Degradation Ub ORF37 miR-K12-7 AAAAAA AAAAAA MICB Host mRNA Cytoplasm CIITA& CIITA IRF4 vIRF1 vIRF3 LANA vFLIP IKKα/β/γ IκBα p50 p65 NFκB IRF1 CBP Proteosomal Degradation p300 Nucleus ORF54 NKp44L ? CTL/ NKT NK ! 21! Immunoevasins of β- and γ-herpesviruses Immunoevasins have been identified in dozens of viruses, ranging from HIV to HCMV, and use a variety of mechanisms to alter the trafficking and stability of MHC-I molecules (181). A hallmark of immunoevasin activity is their ability to reduce MHC-I surface expression, a phenotype that is tightly correlated with reduced susceptibility to CTL lysis. While most immunoevasins, such as US2, US3, and US11 of HCMV, prevent MHC-I molecules from maturing through the ER to the cell surface, K3 and K5 are distinguished by their ability accelerate endocytosis and endolysosomal degradation without affecting maturation (181). It should be noted that this distinction applies mainly to MHC-I substrates of K3 and K5; K5-mediated downregulation of PECAM-1 can occur via ERAD (203) and K5- mediated downregulation of B7-2 can occur in the absence of internalization under some circumstances (213). In vivo role of immunoevasins The in vivo significance of viral interference with antigen presentation is still not clear. Deletion of mK3, the only vMARCH gene encoded by MHV-68 (193), resulted in abnormally low levels of latent viral load during primary infection of C57BL/6 mice, a defect that was complemented by depleting CD8+ T cells (222). Notably, deletion of mK3 did not completely abolish MHV-68-mediated downregulation of MHC-I levels relative to uninfected cells, suggesting that (1) other immunoevasins may be encoded by MHV-68 and (2) only partial recovery of MHC-I surface expression was sufficient to impact latency establishment. The situation in β-herpesviruses is more complicated (223). In immune competent hosts, mutants of murine CMV (MCMV) and rhesus monkey (rhCMV) that completely lack known immunoevasins are able to establish primary infection as efficiently as their WT counterparts (224, 225). In contrast, this rhCMV mutant showed a striking defect in the ! 22! establishment of secondary infections (224) and thus, it has been suggested that immunoevasins may have evolved for the dissemination of viruses among immune- experienced hosts (223). It was also observed that, during MCMV infection, antigen presentation by uninfected antigen presenting cells (APCs) plays an important role in priming CD8+ T cells and this process is actually enhanced by the presence of immunoevasins (226). Thus, viral-mediated immune evasion does not prevent stimulation of CD8+ T-cells but rather, it protects infected cells from already primed CD8+ T cells. More studies are needed to determine how β-herpesvirus immune evasion paradigms are altered in γ-herpesviruses. 1.4 Genetic Engineering of Large DNA Viruses Significance A major component of this thesis is the establishment of essential reagents that enable the analysis of KSHV genes in the context of viral infection. Central to this objective was the construction of an infectious clone of the KSHV genome (Chapter 2). In addition, recently developed recombinant DNA techniques were extensively applied in order to uncover the roles of K3 and K5 during different stages of the KSHV lifecycle (Chapter 3). This section highlights significant technical advances that facilitate efficient and versatile manipulation of large DNA virus genomes. Bacterial artificial chromosomes As a herpesvirus, the KSHV genome is not accessible to standard molecular cloning methods. Although genetically altered viruses can be constructed within infected eukaryotic cells by homologous recombination between a linear DNA fragment and the viral genome ! 23! (227), this is a cumbersome and inefficient process. Separation of recombinant progeny from the parental virus is a time-consuming process requiring multiple rounds of plaque purification or limiting dilutions. This is particularly problematic for the isolation of replication defective mutants or when modifying viruses that do not undergo amplification during serial propagation, e.g. KSHV (228, 229). A significant advancement was the demonstration that virus could be reconstituted from overlapping cosmid clones covering the length of the viral genome as was shown for varicella-zoster virus (VZV) and herpes simplex virus type 1 (HSV-1) (230, 231). Transfection of uninfected eukaryotic cells with linearized cosmid fragments is sufficient to produce full-length virus resulting from multiple recombination events between the overlapping ends of the cosmid inserts. This technique allows the more precise genetics manipulation within bacteria and bypasses the need for separating recombinant virus from the parental virus. However, unwanted second-site mutation and illegitimate recombination are problematic for virus reconstitution and approximately 3 to 5 cosmids are needed for a single herpesvirus. These issues are circumvented by the use of bacterial artificial chromosomes (BACs), large capacity vectors derived from the E. coli F-plasmid, which accommodate inserts of up to 350kb (232). BAC vectors, also known as minimal fertility factor replicon (mini-F), encode an origin of replication, Ori2; the BAC DNA replication proteins, RepE and RepF; the partitioning proteins, SopA and SopB; the cis-acting partitioning region, SopC; and an antibiotic resistance marker (usually cat). SopA and SopB ensure that a single copy of the BACmid is delivered to each daughter cell, a function that is central to the stable maintenance of large, extra chromosomal DNA in E. coli (232-234). Since herpesviral genomes range in size from 120 to 250kb, they are perfectly suited for the capacity of BAC vectors. Cloning full-length viral genomes as a single entity can be achieved using established techniques for the generation of recombinant viruses in eukaryotic cells as was first demonstrated for MCMV (235). Typically, a linear construct ! 24! containing a BAC vector flanked by viral genomic sequences homologous to the target region of the viral genome are transfected into infected cells. A mammalian selection marker is often included adjacent to the BAC vector to allow efficient recovery of recombinant BAC-containing virus. Since the establishment of this method, genomes of several dozen members of the Herpesviridae and Poxviridae have been cloned and mutagenized as infectious BACs [reviewed in (236)]. In addition, BAC vectors have also been used to clone large nonsegmented RNA virus genomes, including those of transmissible gastroenteritis coronavirus (237) and SARS-related coronavirus (238). 'Recombineering' A major advantage of BACmids is their ability to propagate in E. coli, where recombination-based techniques have been highly optimized. In fact, practically any modification is possible, including the removal of genes or other elements (239-241); the insertion of epitope tags (242-244), fluorescent protein fusions (242), or reporter genes (245); and even the introduction of a single nucleotide addition (246) or substitution (247). Although the copy number of BACmids in E. coli is tightly regulated, their stability can still be compromised by intramolecular recombination events (248). This is especially relevant to herpesviral genomes, which harbor numerous segments of direct tandem repeats (16, 193, 249). To minimize such events, BACmids are maintained in recombination deficient E. coli; e.g. DH10B, which are RecA - (250). Due to their size, restriction enzyme-mediated cloning followed by in vitro ligation and transformation are not feasible. Fortunately, herpesviral genomes can tolerate transient expression of proteins involved in recombination, a critical step for recombineering-based mutagenesis. Over the past 15 years, three major recombination systems have been used to induce so-called 'hyper-rec' states: RecA and the RecET and Red recombination systems. In RecA based mutagenesis the RecA recombinase of E. coli is transiently delivered to complement RecA- ! 25! deficient DH10B (251). However, this approach requires long homology arms flanking a selection marker (252) and thus additional cloning steps are needed prior to introducing the targeting construct into the BAC-containing E. coli. A significant improvement was the identification of recombination functions on the Rac prophage integrated into the genome of some E. coli strains by screening for recombination between ends of a linear DNA fragment and circular target DNA (253). Subsequently, an analogous system was found in the Red genes of the bacteriophage λ, consisting of three genes: exo, bet, and gam (254). Both the RecET and Red systems require the presence of Gam, which inhibits the activity of the RecBCD, a bacterial enzyme that degrades linear DNA (255). Recombination functions are mediated by the 5'-3' exonucleases, Exo or RecE, and the Bet and RecT proteins bind and protect single stranded DNA (256, 257). The major advantage of these systems is that flanking homology regions of only 40bp are sufficient and can be easily incorporated into large primers. Thus, a recombination substrate harboring a selection marker can be generated from a single PCR amplification step. Once a selection marker has been introduced into the target locus, it is usually desirable to do a second recombination step to eliminate the selection marker, hence the term 'two-step' recombination. Marker elimination permits multiple rounds of mutagenesis using the same marker and the avoidance of unwanted effects on neighboring genes. For example, an ORF54null MHV-68 BAC-derived virus showed a replication defect after transposon mutagenesis but not when a more precise mutation was introduced (258, 259). Several approaches have been applied to eliminate the selection markers form the target site, Cre- or flp-mediated recombination (260), negative selection markers such as galk (261), and brute-force recombination, where a short, markerless, linear DNA fragment is introduced and mutants are identified by PCR (262). ! 26! The recombineering system used throughout this thesis is encompassed within a DH10B derivative called GS1783 (263, 264)(Fig. 1.3). For marker elimination, it takes advantage of the mitochondrial homing endonuclease, I-SceI, which recognizes a degenerate sequence that is 18bp in length. Since this sequence is not found in E. coli or mammalian genomes, transient expression of this enzyme will specifically cleave an engineered target site that harbors the recognition sequence. By including this site adjacent to a positive selection marker, a double stranded DNA break can be introduced at a specific Figure 1.3: Schematic depiction of the GS1783-based recombineering method cI857 and P BAD are temperature-sensitive and arabinose-inducible promoters of λ- phage and E. coli, respectively. soi, sequence of interest. P BAD % I' SceI %Enzyme% cI857%% λ'Red%Operon% >37°C% gam% bet% exo% RecBCD' E.#Coli%GS173%Chromosome% Kan% I' SceI %site% Highly'efficient'recombina6on' Kan% soi% b% I' SceI %RestricIon%Site:% a% c% b% d% b% a% c% d% c% c% b% c% Kan% b% d% c% b% a% c% b% a% c% d% 42°C' 42°C' Electropora6on' GeneIc%Analysis% GeneIc%Analysis% ~40bp% a% d% b% c% and' each'represent'~20bp'of'iden6cal'sequence' ! 27! location. The resulting linearized BAC DNA can be resolved by a second Red-mediated recombination between a sequence duplication introduced during the first recombination step. Since the second recombination is an intramolecular event, the efficiency of this step is high. Notably, G1783 harbors stably integrated sequences for the Red operon (exo, bet, and gam) and I-SceI, with each under the control of different inducible promoter systems. This bypasses the need to introduce recombination functions via suicide plasmids. Thus, GS1783 is a versatile 'scarless' mutagenesis system that enables the generation of almost any modification. Designing a herpesviral BAC clone The construction of herpesvirus BACs involves a number of design considerations. Since the BAC vector is typically not removed from the viral genome following reconstitution in eukaryotic cells, the insertion site must be carefully selected to avoid disrupting normal viral replication. An advantage of KSHV and other herpesviruses is the presence of regions with low gene density (21). Insertion sites are typically chosen where genes with opposing directions of transcription terminate at the same intergenic region, thereby minimizing the possibility of affecting viral promoter elements. A precedent for this strategy is exemplified by the construction of rKSHV.219 and BAC36, two recombinant KSHV genomes widely used in the field (53, 265). However, exogenous DNA insertions can potentially result in an attenuated virus, even when currently annotated viral genes are left intact. Fortunately, an elegant recombineering-based approach was devised to seamlessly and specifically transpose the BAC vector backbone within an existing BACmid (266), enabling the derivation of variants with more optimal dispositions of the inserted BAC vector. This strategy would bypass the need to reconstruct a BACmid in eukaryotic cells if it is found that novel genetic elements encompass the BAC insertion site. ! 28! Nevertheless, attenuated replication of infectious BAC clones is often unavoidable (248). In the case of MHV-68 BAC, virus replication was only defective in vivo (267). With this in mind, many herpesvirus BACs include FRT or loxP sites flanking the BAC insertion site (268, 269). In addition, a scarless excision approach can implemented by flanking the BAC vector with a duplicated region of the viral genome, allowing excision to occur upon transfection of cells as was originally established for MCMV (270). However, this duplicated region can compromise stability during propagation in E. coli. A refined self-excision strategy involves an inverted homology region that can be used to excise the BAC vector upon virus reconstitution but this region does not compromise stable propagation in E. coli (271). However, all self-excisions are predicated on de novo lytic replication of the transfected virus and attenuated replication of the BAC-containing virus. Therefore, self- excision would not be suitable for a KSHV BACmid. Although two previous approaches have produced full-length BAC clones of the KSHV genome (265, 272), they each have limitations. The first BAC clone was constructed using the BC-3 PEL cell line by inserting BAC sequences at a SpeI site within ORF56 (272). Although this clone included the entire KSHV genome, it was unable to undergo lytic replication because the BAC insertion interrupts ORF56, which encodes an important DNA replication factor homologous to the EBV DNA primase, BSLF-1 (272). The requirement of ORF56 trans-complementation severely limits the utility of this construct. A second BAC clone called BAC36 was constructed in BCBL-1 cells using the intergenic region between ORF18 and ORF19 as the insertion site, thereby avoiding the disruption of any known coding sequence (265). BAC36 has been successfully used to analyze the function of several viral genes [reviewed in (273)]. However, subsequent analysis showed that it contains a duplication spanning a 9kb region of the KSHV genome, including 6 complete KSHV ORFs and the BAC cassette (17). This duplicated fragment is localized within the terminal repeat region of the BAC and may be responsible for its instability in both E. coli ! 29! and mammalian cells (274). Furthermore, K5 is among the genes present on the duplicated region. Thus, the development of a new BAC clone of the KSHV genome was essential for the ultimate goal of characterizing the roles of K3 and K5 in infected cells. 1.5 Summary of thesis Technical difficulties have limited studies of KSHV, especially those involving the generation and analysis of recombinant viruses. To ameliorate this shortcoming, a new bacterial artificial chromosome clone of the KSHV genome was constructed and characterized. To demonstrate its utility, the role of K3 and K5 was examined in the context of infected cells. Using a variety of recombinant viruses, I identified stage-specific roles for K3 and K5 during lytic replication. These results not only provide new insight into γ- herpesvirus immune evasion but they demonstrate the utility and importance of examining viral gene function in the context of infected cells. ! 30! Chapter 2 Construction and manipulation of a new KSHV bacterial artificial chromosome clone (This chapter is adapted from a paper published in Journal of Virology, in September 2012 J Volume 86(18):page 9708-20) Authors: Kevin F. Brulois, Heesoon Chang, Amy Si-Ying Lee, Armin Ensser, Lai-Yee Wong, Zsolt Toth, Sun Hwa Lee, Hye-Ra Lee, Jinjong Myoung, Don Ganem, Tae-Kwang Oh, Jihyun F. Kim, Shou-Jiang Gao and Jae U. Jung ! 31! 2.1 Introduction Much effort has been devoted to overcoming technical difficulties inherent to the study of KSHV, including inefficient and asynchronous lytic replication, inefficient infection of B cells, lack of efficient cellular transformation models, and lack of good animal models. Although many of these challenges have been met, there was still a need for a new BAC clone of the KSHV genome. The goal of this study was to construct this reagent in order to allow efficient construction of recombinant KSHV. Efficient genetic modification of herpesviruses such as KSHV has come to rely on BAC technology. In order to facilitate this approach, I generated a new KSHV BAC clone, called BAC16, derived from the rKSHV.219 virus, which stems from KSHV and EBV coinfected JSC1 primary effusion lymphoma (PEL) cells. As discussed in Chapter 1, K3 and K5 have been well characterized by individual overexpression in uninfected cells. However, relatively less is known about the functional contribution of K3 and K5 in the context of KSHV infection. Both K3 and K5 transcripts are induced as part of the lytic replication gene expression program and can be expressed as either immediate-early or early transcripts (60, 275). Although its mRNA is not evident within the virion particle, K5 can be transiently expressed shortly after de novo KSHV infection (83, 276, 277). In addition, the K5 gene is inducible by Notch signaling and can be expressed independently of RTA (79, 278). K3 expression occurs from multiple transcripts, including a constitutively expressed transcript in PEL cells as well as immediate-early and early transcripts (59, 60). siRNA-mediated knock-down of K5 following de novo KSHV infection of endothelial cells showed that K5 is important for KSHV-mediated downregulation of MHC-I and ICAM-I during this early stage of infection (169). However, the additional contribution of other KSHV genes is difficult to analyze without the use of complete gene knockout viruses. Moreover, the role of K3 or K5 in MHC-I or ICAM-1 downregulation has not been examined during other stages of the KSHV life cycle. BAC36 ! 32! contains a duplication spanning a 9kb region of the KSHV genome, including 6 complete KSHV ORFs and the BAC cassette (17). Since K5 is among the genes present on the duplicated region, the development of a new BAC clone of the KSHV genome was essential for the ultimate goal of characterizing the roles of K3 and K5 in infected cells. As part of the characterization of BAC16, I generated deletion mutants of either the K3 or K5 to show the feasibility of genetic manipulation. While previous studies have shown that individual expression of either K3 or K5 results in efficient downregulation of the surface expression of MHC-I molecules, I found that K5, but not K3, was the primary factor critical for the downregulation of MHC-I surface expression during KSHV lytic reactivation or following de novo infection. The data presented in this chapter demonstrate the utility of BAC16 for the generation and characterization of KSHV knockout and mutant recombinants, and further emphasize the importance of functional analysis of viral genes in the context of the KSHV genome besides individual gene expression study. 2.2 Results ! Generation of an rKSHV.219-derived BAC clone To facilitate the study of KSHV gene function, I constructed an rKSHV.219-derived, infectious BAC clone of the full-length KSHV genome (Fig. 2.1A). As previously reported, rKSHV.219 was generated by the insertion of a RFP-GFP-PURO R cassette at nt 83527 (GQ994935), which lies within an intergenic region of the KSHV derived from JSC1 PEL cells (53). In order to introduce BAC vector elements into the rKSHV.219 genome, I replaced the RFP-GFP-PURO R cassette with a loxP-flanked mini-F-GFP-HYGRO R vector. For this purpose, I generated a modified pBeloBAC11 plasmid, pBelo45, which includes KSHV genomic sequences immediately upstream and downstream of nt 83527 (GQ994935) (Fig. 2.1A, see Material and Methods). ! 33! Following linearization at a unique PmeI site engineered between the homology arms, pBelo45 was transfected into Vero cells stably harboring rKSHV.219. Recombinant BAC virus was selected in the presence of hygromycin B and the absence of puromycin. In order to enrich for infectious, full-length rKSHV.219-BAC, hygromycin-resistant cells were treated with a histone deacetylase (HDAC) inhibitor, Trichostatin A (TSA), to induce lytic replication. The virus-containing supernatants were used to infect naïve Vero cells and establish a new hygromycin-resistant cell line. Two additional rounds of serial propagation to naïve Vero cells resulted in the loss of TSA-induced RFP expression, presumably due to enrichment of hygromycin-resistant 219BAC virus. Circular KSHV DNA was extracted from the final round of infected, hygromycin-selected Vero cells and then introduced into E. coli (DH10B) by electroporation. Genetic analysis of candidate clones Restriction endonuclease and Southern blotting analyses were used to identify bacterial clones harboring a pBelo45 cassette that had correctly recombined with the full- length KSHV genome. Of the 32 total clones analyzed, BAC16 and BAC25 were among 14 clones that appeared to harbor a complete KSHV genome. Digestion of BAC16 and BAC25 with KpnI revealed KSHV DNA fragments of various sizes, which matched well with the predicted digestion pattern based on published genomic sequence data (NC_009333) and migrated comparably to most of the fragments from BAC36, a previously characterized full-length BAC clone of KSHV (Fig. 2.1A and B). Southern blot hybridization with a labeled Z2 probe spanning the right-hand side of the KSHV genome detected the expected fragment sizes of 4.2-kb and 9.5-kb as well as a high molecular-weight fragment predicted to contain the TR region. An extra fragment of ~13-kb detected in BAC36 likely correlates with the presence of a duplicated sequence that was recently shown to be present in the ! 34! Figure 2.1: Construction and analysis of rKSHV.219-derived BAC clones. (A) Schematic diagram of the KSHV genome, the rKSHV.219 and 219-BAC insertion site (GQ994935), the RFP-GFP-PURO R cassette, and the pBelo45 targeting construct containing the BAC vector, GFP-HYGRO R cassette, flanking loxP sites, and flanking sequences for homologous recombination (dashed lines). A majority of 219BAC clones also contain a Tn1000 insertion immediately following the TAA codon of the cam gene, as depicted. KpnI recognition sites are indicated by inward tick marks or below the diagrammed sequence features. KpnI fragment sizes (in kilobase pairs) are indicated as ovals and were based on the GK18 sequence (NC_009333) and the pBelo45 sequence. Fragment sizes marked with an asterisk result from the depicted integration events. (B) Gel electrophoresis of KpnI digested BAC DNA. Two different clones of 219 BAC, BAC16 and BAC25, were analyzed. BAC36 DNA was used as a positive control (+) (265). M: 1kb marker. (C-E) Southern blot hybridization using a 32 P-labeled probe from Z2 (C), Z8 (D), and pBelo45 (E) to detect KSHV and 219BAC-specific sequences. The 2.4 and 9.0kb fragments in (E) are the result of a Tn1000 insertion. 0 10K 20K 30K 40K 50K 60K 70K 80K 90K 100K 110K 120K 130K 140K 150K 160K ORFs 16-48 Z8 Terminal Repeats ORFs 58-69 Z2 ORFs 4-11 74-75 52-56 LANA K10 K9ORF57 K10.5 miRNAs K3 K1 K14 vcyclin K5 K8 K2 vFLIP K11 K7 K6 K4 K8.1 kaposins K15 RTA nt 83527 KSHV episome 6.0 1.2 5.4 3.8 5.9 rKSHV.219 rKSHV.219-BAC pBelo45: Tn1000 2.4 9.0 *" *" *" *" Z8 Z2 pBelo45 + 16 25 M 2 3 4 5 6 10 + 16 25 + 16 25 + 16 25 KpnI KpnI KpnI KpnI KpnI 3.2 4.6 *" *" *" *" 2.4 2.2 3.7 8.1 3.6 6.3 18.9 5.3 5.4 3.3 3.5 2.7 13.7 18.4 ~33 4.2 9.5 3.0 A. B. C. D. E. ! 35! TR region (17). Fragments of 5.9-kb and 3.8-kb predicted to result from proper BAC integration within the KSHV genome were evident in both BAC16 and BAC25 and also detectable by Southern blot analysis using either a KSHV-specific probe (Z8) or a pBelo45- specific probe (Fig. 2.1D, E). In addition, a fragment of 1.2-kb derived exclusively from the BAC cassette was apparent in both BAC16 and BAC25 clones and detected only by the pBelo45 probe (data not shown). However, a 5.4-kb fragment, also consisting exclusively of BAC vector DNA, while detected in BAC25, was absent in BAC16 and instead, fragments of ~2.4-kb and ~9.0-kb appeared only in BAC16 (Fig. 2.1E). Sequencing of the ~9.0kb fragment and direct sequencing of the BAC16 vector backbone revealed that the additional DNA fragments resulted from insertion of a Tn1000 transposon between the chloramphenicol and hygromicin resistance genes (Fig. 2.1A and data not shown). Stable propagation of BAC16 in E. coli DH10B Besides BAC25, only one additional clone showed the predicted KpnI restriction pattern for 219BAC lacking a Tn1000 (data not shown). On the other hand, most clones appeared identical to the BAC16, with addition KpnI fragments corresponding to a Tn1000 insertion located at the diagramed position (Fig. 2.1A). Given the pervasiveness of the Tn1000 sequence among the clones, I decided to perform additional Southern blot analysis to determine if the Tn1000 had inserted elsewhere in either the BAC16 or BAC25 genomes. BAC16 and BAC25 DNAs were digested with either CpoI or SbfI, followed by Southern blot hybridization of the resolve fragments with a Tn1000-specific probe. Indeed, the Tn1000 was only detected at the expected site of BAC16 and was completely absent from BAC25 (Fig. 2.2A, B, C, D). Next, I compared the stability of BAC16 and BAC25 after serial passage in DH10B, a recA- E. coli strain. Following 5 days of daily passaging in liquid culture, single colonies were recovered on LB agar plates and purified BAC DNA was analyzed by CpoI digestion (Fig. 2.2E and F). DNA fragments derived exclusively from the ! 36! long unique region (LUR) did not undergo significant changes compared to single-passage BAC DNA. However, as seen in two representative gels, the ~48-kb and ~54-kb fragments containing the TR region from BAC16 and BAC25, respectively, were significantly shorter in several long-term cultured clones (Fig. 2.2E and F). Although instability of the TR region was observed in both BAC16 and BAC25, I found that only 15 out of 32 long-term cultured clones from BAC16 had a shortened TR-containing fragment compared to 28 out of 32 such clones from BAC25 (Fig. 2.2G). Given that TR-deletions were observed less frequently in long-term cultured BAC16 clones, I chose to use BAC16 for further characterization and mutagenesis. Complete sequencing analysis of the KSHV BAC16 BAC16 was completely sequenced via solexa sequencing method and deposited into Genbank (GQ994935). Importantly, sequence reads were represented equally across the LUR portion of BAC16, indicating a lack of a large-scale duplication. In previous work, several loci of the KSHV genome were sequenced via PCR amplification directly from JSC- 1 cells, including ORF26 region, ORF75-E, gB, gH, gL, gM, gN, K8.1, and ORF68 (23, 279). Comparison of these loci sequences with the BAC16 sequence showed 100% identity, with the exception of a synonymous point mutation at A242 of ORF75 (data not shown). This indicates that the genomic sequence of JSC-1-derived KSHV had not undergone any significant changes during its propagation as rKSHV.219 and BAC16 and that this sequence likely reflects the actual JSC-1 viral genome sequence. Moreover, with the exception of the K1 sequence, I found very low levels of sequence variations across the entire BAC16 genome as compared to other complete genomic sequences of KSHV (BCBL-1: HQ404500, BC-1: U75698, KS-derived: U93872, NC_009993). ! 37! Figure 2.2: Stability of BAC16 and BAC25. (A) Schematic of CpoI and SbfI recognition sites (inward tick marks). Predicted fragment sizes (in kb) are depicted as ovals for 219BAC lacking a Tn1000. As the Tn1000 sequence does not contain any CpoI or SbfI sites, the 6.0 kb Tn1000 insertion within BAC16, the 45.4 kb (CpoI) and 31.8 kb (SbfI) fragment sizes are predicted to be 51.4 kb and 37.8 kb, respectively. (B) Gel electrophoresis of CpoI or SbfI digested BAC16 or BAC25 DNA. M: mid-range PFGE or 1kb size marker. (C and D) Southern blot hybridization with an EF1-α-specific probe (C) or a Tn1000-specific probe (D). (E and F) E. coli DH10B harboring BAC16 (E) or BAC25 (F) was passaged daily in liquid culture for a total of 5 days. DNAs isolated from single colonies derived from this long-term culture were analyzed by CpoI digestion and gel electrophoresis. BAC16 and BAC25 DNA from overnight cultures (o/n) were analyzed in parallel. (G) The percentage of TR-fragment deleted clones (among a total of 32 clones) analyzed from each long-term culture. ~63.0 18.5 6.3 31.8 32.7 12.0 9.8 34.7 45.4 12.5 7.9 9.3 ~48.0 18.2 CpoI SbfI EF1-α Tn1000 5 15 33.5 48.5 63.5 82.0 6 10 16 25 16 25 16 25 16 25 16 25 16 25 M M CpoI CpoI o/n o/n long-term cultured BAC16 long-term cultured BAC25 5 15 33.5 48.5 10 M M M M 63.5 0" 10" 20" 30" 40" 50" 60" 70" 80" 90" 100" BAC16 BAC25 % of TR-deleted clones 5 15 33.5 48.5 10 63.5 A. B. C. D. E. F. G. ! 38! Production of high titer BAC-derived virus stock Inefficient production of cell-free infectious KSHV has limited the range of experimental systems utilized by researchers in the field. The combined use of exogenous RTA expression and sodium butyrate treatment was shown to synergistically activate the lytic cycle, yielding substantial quantities of rKSHV.219 from Vero cells (53). Furthermore, the use of spin infection is capable of increasing the infection levels approximately up to 70 fold (53, 280). The production of infectious cell-free KSHV was further refined by Myoung et al., who reported the utility of newly generated doxycycline-inducible RTA cell lines (called iVero and iSLK) for producing high titer virus stocks, including BAC-derived stocks (281). Indeed, I was also able to produce such a virus stock with a titer of ~5x10 7 from iSLK cells carrying WT BAC16 based on GFP-positive cells (see Materials and Methods). Using different volumes of virus stock, we were able to infect 293A cells and obtain a various percentages of GFP positive cells (Fig. 2.3). In addition, TIVE and HMVECs that are less susceptible to KSHV infection were successfully infected with BAC16 (data not shown). Thus, BAC16 appears suitable for experiments requiring high virus titer. Generation of K3 and K5 deleted recombinant KSHV In order to demonstrate the feasibility of BAC16 for the study of KSHV gene function, I generated a set of deletion mutants of K3 and K5. The entire coding sequence of either K3 or K5 was removed from BAC16 using ‘scarless’ mutagenesis (263, 264). Then, V5-His-tagged K3 and K5 coding sequences were inserted into their endogenous loci within the ΔK3 and ΔK5 genomes, respectively, to generate tagged revertant viruses. Likewise, a catalytically dead RING C>S mutant coding sequence of either K3 or K5 was introduced into the ΔK3 and ΔK5 BACs, respectively. Each mutant genome was analyzed by PCR, restriction enzyme digestion, and direct sequencing analysis (Fig. 2.4A and B and data not ! 39! shown). The K3 and K5 genes reside on CpoI fragments of 9.3-kb and 7.9-kb, respectively Figure 2.3: Infectious BAC16 virus production. A BAC16 virus stock was generated as described in the Materials and Methods. Four 15 cm plates containing iSLK cells harboring BAC16 were seeded at ~70% confluency and treated with 1µg/ml of doxycycline and 1mM sodium butyrate for 96 hours. Approximately 40 ml of virus-containing supernatants were concentrated via centrifugation using a SW32 rotor. Virus pellets were then resuspended in the residual media (~300µl). Then 293A cells were infected with 0.008, 0.04, or 0.2 µl of this BAC16 virus stock and analyzed by fluorescent microscopy and flow cytometry at 24 hours post infection. Phase GFP .008 .04 .2 Mock GFP ! 40! (Fig. 2.4A). These fragments were predictably reduced to 8.3-kb and 7.1-kb following the targeted deletion of either K3 or K5, respectively, and restored to their WT sizes in the V5- His-tagged BACs: K3rev, K3-RING C>S, K5rev, and K5 RING C>S (Fig. 2.4B). Importantly, CpoI fragments of other parts of the BAC16 genome did not show any detectable size changes following genetic manipulation (Fig. 2.4B). Characterization of BAC-derived WT and mutant viruses WT, null, point mutant, and revertant viruses were reconstituted in iSLK cells which contain a doxycycline-inducible RTA expression system stably integrated in the cellular chromosome (281). Upon doxycycline treatment, RTA expression is sufficient to initiate the lytic replication phase that results in the induction of K3 and K5 gene expression and culminates in the release of infectious virion particles from the cells. GFP expression from BAC16 appeared stable and full-length BAC genomes were readily recovered from infected cells, indicating stable propagation of BAC16 and BAC16 mutants in eukaryotic cells (data not shown). Following the hygromycin selection of BAC16-transfected cells, comparable amounts of viral DNA were found in iSLK cells harboring the different KSHV-BACs (Fig. 2.4C). Viral gene expression was analyzed by Western blot in the absence and presence of doxycycline treatment (Fig. 2.4D). As expected, the deletion mutants showed no detectable protein expression from their respective deleted genes. Moreover, the expression level of K3 did not appear to be affected by the absence of K5 and vice versa. Protein expression was restored in the respective revertant and enzymatically dead RING C>S mutant BACs, albeit at lower levels. LANA or K8 protein levels were comparable in all cell lines. As expected, since iSLK cells have been engineered to express RTA in a doxycycline-inducible manner via an expression cassette integrated within the cellular DNA, RTA expression was detected in all the doxycycline-treated iSLK cells, including uninfected ! 41! Figure 2.4: Characterization of WT and mutant BAC16 virus. (A) Schematic diagram of CpoI digestion of BAC16 (including Tn1000 sequence) (B) Pulse-field gel analysis of CpoI digested WT and mutant BAC16 DNA. Triangles denote the 9.3 kb and 7.9 kb fragments predicted to harbor the K3 and K5 coding sequences, respectively. (C) iSLK cells stably transfected with WT or mutant BAC16 were analyzed by qPCR to determine relative DNA copy number. (D) The same set of cells was analyzed by western blot analysis using the indicated antibodies. (E) Infectious units were quantified from viral supernatants harvested from the indicated iSLK-BAC16 cell lines following 4 days of treatment with both doxycycline and sodium butyrate (see Materials and Methods). Note, the viral supernatants from this experiment were not concentrated by centrifugation and thus had a lower titer than those in Figure 2.3. 5 15 33.5 48.5 63.5 6 10 K3 K5 CpoI B. A. 34.7 51.3 12.5 7.9 9.3 ~45.0 18.2 C. D. α-K3 α-K5 α-V5 α-V5 (long expo) α-K8 α-RTA α-LANA α-Actin M M Untreated Doxycyclin (24h) 0 0.5 1 1.5 2 2.5 3 Fold Fig. 4 E. ! 42! cells (281). Next, I determined whether the absence of K3 or K5 had an effect on the efficiency of infectious virus production from iSLK cells. Following two days of doxycycline treatment, serial dilutions of cell-free supernatants was transferred to 293A cells and infectious virus was quantified by FACS analysis of GFP expression at 24 hours post infection (Fig. 2.4E). The levels of infectious viruses were comparable between the WT and derivative viruses, indicating that neither K3 deletion nor K5 deletion significantly affect virus production. This is in contrast to published data that showed that the siRNA-mediated depletion of K5 in KSHV-infected HeLa cells significantly reduced infectious virus release (207). The reason for this discrepancy is unknown but perhaps reflects differences in tetherin expression levels between HeLa and iSLK cells as it was shown previously that knockdown of the tetherin in K5 depleted cells restores infectious virus release from HeLa cells (207). K5 but not K3 is required for KSHV-mediated reduction of MHC-I surface expression during viral reactivation in iSLK cells ! MHC-I and ICAM-1 surface expression levels were compared between iSLK cells harboring WT, ΔK3, ΔK5, K3rev, K5rev, K3-RING C>S, K5-RING C>C, and ΔK3ΔK5 BAC16 viruses (Fig. 2.5A, B). Without treatment, there was no significant difference in the MHC-I surface expression of iSLK cells harboring WT and recombinant BAC16 compared to that of naïve iSLK cells. However, ICAM-1 surface expression was slightly reduced in small percentages of WT BAC16 cells relative to uninfected iSLK cells (Fig. 2.5A). This phenotype was dependent on the expression of WT K5 as a deletion mutant of K5 lacked the ability to downregulate ICAM-1. This phenotype was restored in cells harboring the K5 revertant but not in those carrying the K5 RING C>S mutant, confirming the previous reports that an intact RING-CH domain is required for K5-mediated downregulation of ICAM-1 (176). Furthermore, this indicates that K5 is functionally active in a small ! 43! percentage of cells under non-lytic replicating conditions. Finally, my data confirm the previous report that K5 downregulates ICAM-1 more efficiently than MHC-I (169). Upon doxycycline treatment, I found that both MHC-I and ICAM-1 were efficiently removed from the cell surface in the majority of WT BAC16 stable cells (Fig. 2.5B). K5- deficient viruses showed the complete abrogation of downregulation of both ICAM-1 and MHC-I surface expression compared to WT (Fig. 2.5B). A K5 revertant virus was nearly as effective as WT at reducing MHC-I and ICAM-1 surface expression. However, a virus engineered to express the K5 gene harboring point mutations (C>S) in the RING domain was not able to restore KSHV-mediated reduction of MHC-I or ICAM-1 surface expression (Fig. 2.5B). On the other hand, deletion of the K3 gene showed no significant defect in MHC-I downregulation, nor did the K3 RING C>S virus (Fig. 2.5B). Thus, K5 appears to be the major viral protein required for MHC-I downregulation during KSHV reactivation in iSLK cells. K5, but not K3, is required for the reduction of MHC-I surface expression following de novo infection Previous work has demonstrated a critical role of K5 in MHC-I and ICAM-1 downregulation following de novo infection of HUVEC cells by using siRNA-mediated knockdown of K5 (169). However, due to the imperfect efficiency of siRNA approaches, it remains unclear whether other KSHV genes can also modulate surface expression of MHC- I molecules during this stage of infection. Thus, I measured MHC-I surface expression following infection of 293A cells with WT, ΔK3, ΔK5, K3rev, K5rev, K3-RING C>S, and K5- RING C>S viruses (Fig. 2.6). 293A cells infected with WT BAC16 showed a significant population of cells with reduced MHC-I surface expression. On the other hand, the ΔK5 virus showed a complete lack of KSHV-mediated reduction of MHC-I at 36 hours post ! 44! infection of 293A cells, indicating that K5 is the primary gene that appears to play a role in Figure 2.5: Flow cytometry analysis of ICAM-I and MHC-I surface expression of iSLK- BAC16 cell lines during latency (A) or reactivation after 24 hours of doxycycline treatment (B). Each iSLK-BAC16 stable cell line sample was stained with both MHC-I (W6/32) and ICAM-I antibodies. iSLK cells lacking KSHV were also stained with the indicated antibodies or with isotype control antibodies (see Chapter 5). Live cells were gated via FSC and SSC profiling and analyzed for GFP, APC (ICAM-I), and APC-Cy7 (MHC-I) fluorescence. All BAC16 cell lines were ~100% GFP positive (data not shown). MHC-I downregulation at this stage of infection (Fig. 2.6). Moreover, this ability could be restored in the K5 revertant virus, confirming that loss of MHC-I downregulation in the MHC-I ICAM-I Isotype No Virus WT Isotype No Virus WT Deletion RING-C->S Revertant K3 K5 K3 K5 Reactivation Latency B. A. ! 45! deletion virus was indeed due to a lack of the K5 gene (Fig. 2.6). In contrast, BAC16-ΔK3 could downregulate MHC-I surface expression comparably to WT BAC16 following de novo infection (Fig. 2.6). This indicates that K5, but not K3, is required for the reduction of MHC-I surface expression following de novo infection. Figure 2.6: MHC-I surface expressions of 293A cells following infection with WT or mutant BAC16 virus. At 36 hours post-infection with WT or mutant BAC16 virus (MOI=0.5), GFP-positive 293A cells were gated and examined for MHC-I surface expression. Untitled Workspace.jo Layout 5/23/11 8:49 AM Page 1 of 1 (FlowJo v6.4.7) 63.1 16.6 17.6 2.63 0 4.72e-3 8.56 91.4 4.4e-3 4.4e-3 2.41 97.6 77.3 10.8 7.84 4.04 0 4.05e-3 3.19 96.8 0 0 1.23 98.8 78.3 9.48 8.28 3.94 0 0 4.08 95.9 0 8.6e-3 1.86 98.1 71.3 13.3 12.6 2.83 0 0.017 6.25 93.7 0 4.02e-3 1.95 98 49.1 46.2 2.19 2.59 4.39e-3 0.013 16.2 83.8 0 4.51e-3 6.75 93.2 69.6 16 9.69 4.74 0 0 4.72 95.3 0 0.012 2.01 98 78.9 16.1 0.51 4.5 0 4.7e-3 3.84 96.2 0 4.31e-3 1.69 98.3 83.2 8.33 0.51 8.01 0 0 1.97 98 4.06e-3 4.06e-3 0.72 99.3 Untitled Workspace.jo Layout 5/23/11 8:49 AM Page 1 of 1 (FlowJo v6.4.7) 63.1 16.6 17.6 2.63 0 4.72e-3 8.56 91.4 4.4e-3 4.4e-3 2.41 97.6 77.3 10.8 7.84 4.04 0 4.05e-3 3.19 96.8 0 0 1.23 98.8 78.3 9.48 8.28 3.94 0 0 4.08 95.9 0 8.6e-3 1.86 98.1 71.3 13.3 12.6 2.83 0 0.017 6.25 93.7 0 4.02e-3 1.95 98 49.1 46.2 2.19 2.59 4.39e-3 0.013 16.2 83.8 0 4.51e-3 6.75 93.2 69.6 16 9.69 4.74 0 0 4.72 95.3 0 0.012 2.01 98 78.9 16.1 0.51 4.5 0 4.7e-3 3.84 96.2 0 4.31e-3 1.69 98.3 83.2 8.33 0.51 8.01 0 0 1.97 98 4.06e-3 4.06e-3 0.72 99.3 Untitled Workspace.jo Layout 5/23/11 8:49 AM Page 1 of 1 (FlowJo v6.4.7) 63.1 16.6 17.6 2.63 0 4.72e-3 8.56 91.4 4.4e-3 4.4e-3 2.41 97.6 77.3 10.8 7.84 4.04 0 4.05e-3 3.19 96.8 0 0 1.23 98.8 78.3 9.48 8.28 3.94 0 0 4.08 95.9 0 8.6e-3 1.86 98.1 71.3 13.3 12.6 2.83 0 0.017 6.25 93.7 0 4.02e-3 1.95 98 49.1 46.2 2.19 2.59 4.39e-3 0.013 16.2 83.8 0 4.51e-3 6.75 93.2 69.6 16 9.69 4.74 0 0 4.72 95.3 0 0.012 2.01 98 78.9 16.1 0.51 4.5 0 4.7e-3 3.84 96.2 0 4.31e-3 1.69 98.3 83.2 8.33 0.51 8.01 0 0 1.97 98 4.06e-3 4.06e-3 0.72 99.3 Untitled Workspace.jo Layout 5/23/11 8:49 AM Page 1 of 1 (FlowJo v6.4.7) 63.1 16.6 17.6 2.63 0 4.72e-3 8.56 91.4 4.4e-3 4.4e-3 2.41 97.6 77.3 10.8 7.84 4.04 0 4.05e-3 3.19 96.8 0 0 1.23 98.8 78.3 9.48 8.28 3.94 0 0 4.08 95.9 0 8.6e-3 1.86 98.1 71.3 13.3 12.6 2.83 0 0.017 6.25 93.7 0 4.02e-3 1.95 98 49.1 46.2 2.19 2.59 4.39e-3 0.013 16.2 83.8 0 4.51e-3 6.75 93.2 69.6 16 9.69 4.74 0 0 4.72 95.3 0 0.012 2.01 98 78.9 16.1 0.51 4.5 0 4.7e-3 3.84 96.2 0 4.31e-3 1.69 98.3 83.2 8.33 0.51 8.01 0 0 1.97 98 4.06e-3 4.06e-3 0.72 99.3 Untitled Workspace.jo Layout 5/23/11 8:49 AM Page 1 of 1 (FlowJo v6.4.7) 63.1 16.6 17.6 2.63 0 4.72e-3 8.56 91.4 4.4e-3 4.4e-3 2.41 97.6 77.3 10.8 7.84 4.04 0 4.05e-3 3.19 96.8 0 0 1.23 98.8 78.3 9.48 8.28 3.94 0 0 4.08 95.9 0 8.6e-3 1.86 98.1 71.3 13.3 12.6 2.83 0 0.017 6.25 93.7 0 4.02e-3 1.95 98 49.1 46.2 2.19 2.59 4.39e-3 0.013 16.2 83.8 0 4.51e-3 6.75 93.2 69.6 16 9.69 4.74 0 0 4.72 95.3 0 0.012 2.01 98 78.9 16.1 0.51 4.5 0 4.7e-3 3.84 96.2 0 4.31e-3 1.69 98.3 83.2 8.33 0.51 8.01 0 0 1.97 98 4.06e-3 4.06e-3 0.72 99.3 Untitled Workspace.jo Layout 5/23/11 8:49 AM Page 1 of 1 (FlowJo v6.4.7) 63.1 16.6 17.6 2.63 0 4.72e-3 8.56 91.4 4.4e-3 4.4e-3 2.41 97.6 77.3 10.8 7.84 4.04 0 4.05e-3 3.19 96.8 0 0 1.23 98.8 78.3 9.48 8.28 3.94 0 0 4.08 95.9 0 8.6e-3 1.86 98.1 71.3 13.3 12.6 2.83 0 0.017 6.25 93.7 0 4.02e-3 1.95 98 49.1 46.2 2.19 2.59 4.39e-3 0.013 16.2 83.8 0 4.51e-3 6.75 93.2 69.6 16 9.69 4.74 0 0 4.72 95.3 0 0.012 2.01 98 78.9 16.1 0.51 4.5 0 4.7e-3 3.84 96.2 0 4.31e-3 1.69 98.3 83.2 8.33 0.51 8.01 0 0 1.97 98 4.06e-3 4.06e-3 0.72 99.3 Untitled Workspace.jo Layout 5/23/11 8:49 AM Page 1 of 1 (FlowJo v6.4.7) 63.1 16.6 17.6 2.63 0 4.72e-3 8.56 91.4 4.4e-3 4.4e-3 2.41 97.6 77.3 10.8 7.84 4.04 0 4.05e-3 3.19 96.8 0 0 1.23 98.8 78.3 9.48 8.28 3.94 0 0 4.08 95.9 0 8.6e-3 1.86 98.1 71.3 13.3 12.6 2.83 0 0.017 6.25 93.7 0 4.02e-3 1.95 98 49.1 46.2 2.19 2.59 4.39e-3 0.013 16.2 83.8 0 4.51e-3 6.75 93.2 69.6 16 9.69 4.74 0 0 4.72 95.3 0 0.012 2.01 98 78.9 16.1 0.51 4.5 0 4.7e-3 3.84 96.2 0 4.31e-3 1.69 98.3 83.2 8.33 0.51 8.01 0 0 1.97 98 4.06e-3 4.06e-3 0.72 99.3 WT K3 K5 Deletion RING-C->S Revertant GFP MHC-I ! 46! 2.3 Discussion ! In!this!chapter,!I!described!the!construction!of!a!new!infectious!recombinant! KSHV! bacmid! called! BAC16! and! demonstrate! its! utility! in! studying! gene! function! during!the!course!of!KSHV!infection.!Previous!reverse!genetic!studies!have!relied!on! BAC36!for!the!genetic!manipulation!of!KSHV.!However,!recent!evidence!suggests!that! this! clone! may! present! unnecessary! complications! for! reverse! genetic! studies,! especially!those!involving!genes!that!reside!within!the!duplicated!region!of!the!BAC36! genome,!which!may!be!a!reason!for!a!low!level!of!viral!production!(17).!Besides!lacking! genomic!duplications!or!other!rearrangements!of!the!LUR,!BAC16!differs!from!BAC36! in!several!aspects.!First,!the!BAC!vector!and!selection!cassette!were!inserted!within!the! intergenic!region!between!ORF57!and!K9!wh ereas!the!BAC!insertion!of!BAC36!is! located!at!a!PmeI!site!between!ORF18!and!ORF19! (265).!A!BAC!cassette!was!inserted! into!an!analogous!location!within!the!RRV!genome!(between!ORF57!and!R9),!resulting! in!its!successful!cloning!(269).!Second,!BAC16!is!a!clone!of!rKSHV.219,!a!JSCO1Oderived! recombinant!virus,!while!BAC36!is!derived!from!BCBLO1!cells.!!While!both!BAC16!and! BAC36!harbor!the!predominant!(P)!allele!of!K15,!their!sequences!belong!to!different! subtypes:!C3!and!A3,!respectively!(23,!282).!!Subtype!sequence!variation!can!be!found! throughout!the!genome!and!is!particularly!evident!within!two!variable!regions!of!the! K1!coding!sequence!(282).!However,!the!consequence!of!this!sequence!variation!is! unclear.!!The!pBelo45!construct!may!prove!useful!for!the!cloning!and!characterization! of!other!strains!of!KSHV.!!Finally,!BAC16!was!constructed!using!a!GFPOIRESOHygro! cassette!rather!than!the!dual!promoters!used!with!BAC36.!!Based!on!FACS!analysis,! GFP!expression!was!stably!maintained!in!close!to!100%!of!hygromycinOresistant!iSLKO ! 47! BAC16!stable!cell!lines!for!the!duration!of!their!propagation!(~3!months)!(data!not! shown).!!In!contrast,!GFPOnegative,!hygromycinOresistant!cells!have!been!frequently! observed!in!BAC36!stable!cell!lines!(274).!!! One peculiar aspect of this study is the unexpected presence of Tn1000 in the majority of clones I analyzed. Furthermore, the Tn1000 insertion site was identical in all the Tn1000-containing clones: it is located adjacent to the pA signal for the BAC vector cam and Hygro R genes, an AT-rich locus. Although the target sequence specificity of Tn1000 has not been well-studied, related transposons such as Tn3 and Tn1456 show a strong preference for insertion into AT-rich target sequences (283, 284). I also observed enhanced stability of the BAC16, a Tn1000 containing clone, compared to the BAC25, which does not contain a Tn1000 insertion. Interestingly, the presence of Tn1000 in a pBR322-derived plasmid has been shown to stabilize that plasmid (285). It is possible that the presence of Tn1000 in BAC16 may contribute to its stability compared to BAC25. Lastly, I did not observe any unwanted transposition events in BAC16, even after long-term culturing. K3 and K5 have been well characterized as post-translational regulators of several plasma membrane proteins, notably MHC-I. In addition, several other KSHV gene products have been implicated in the potential modulation of MHC-I gene expression at the transcription level, including a global suppressor of cellular gene expression, shutoff and exonuclease (SOX), encoded by ORF37; a p300 transcription modulator, viral interferon regulatory factor-1 (vIRF-1); and a NFκB inducer, viral FLICE inhibitory protein (vFLIP) (286, 287). My data suggest that only one of these genes, K5, is critical for downregulating MHC-I surface expression during KSHV reactivation in endothelial cells or de novo infection of 293A cells. Without K5, MHC-I surface expression levels in KSHV reactivating cells and de novo infected 293A cells were identical to that of uninfected cells. This is in contrast to another γ-herpesvirus, MHV-68, which encodes one homologue of the KSHV K3 and K5, ! 48! called mK3 (288). While MHC-I surface expression was significantly increased in ΔmK3- infected cells compared with WT infected cells, it was not restored to the level found uninfected cells, suggesting that MHV-68 gene(s) other than mK3 also reduce MHC-I surface expression (222). Overexpression of either K3 or K5 in KSHV-negative cells has revealed a variety of substrates; K3 has been shown to target all HLA allotypes, CD1d, IFNGR1, PECAM (CD31), and ALCAM (CD166), while K5 substrates include HLA-A and B, CD1d, ICAM-1, B7-2, IFNGR1, MICA/B, AICL, PECAM, ALCAM, and BST-2 (Tetherin) (176, 177, 196, 198, 199, 202, 203, 205, 207-209, 275, 289). More recent evidence suggests a broad role for K5 in various aspects of cellular physiology and homeostasis, including remodeling of endothelial cell junctions through downregulation of VE-cadherins, modulation of iron import and export via HFE degradation, inhibition of BMPRII signaling, and increase of monocyte metabolism and proliferation via modulation of the localization-dependent activity of certain receptor tyrosine kinases (148, 201, 204, 290). Interestingly, this latter function can be mediated by K5 mutants lacking an intact RING-CH domain, suggesting E3 ligase activity is not required for certain K5 functions. Analysis of these additional functions using the BAC16 mutant K3 and K5 viruses may provide a better understanding how these functions are important for the KSHV lifecycle. Individual expression of either K3 or K5 is sufficient to reduce MHC-I surface expression and this effect is more dramatic in cells over-expressing K3 compared to K5 (196, 198). However, the ability of KSHV to reduce MHC-I surface expression in iSLK cells was not affected by the absence of K3. Moreover, deletion of the K3 from the ΔK5 virus did not produce any changes in MHC-I surface expression compared to single deletion of the K5 (data not shown). The data suggests that K3 does not appear to significantly contribute to KSHV-mediated reduction of MHC-I surface expression during reactivation in SLK cells. ! 49! Interestingly, I observed a lower level of K3 protein level compared with that of K5 as assessed by western blotting of the V5-tagged revertant viruses (Fig. 2.4D). However, additional work is needed to clarify whether this is due to a generally low level of K3 expression in all reactivating cells or whether K3 expression is limited to a very small fraction of these cells. If the latter is true, the K3-expressing cell population may be too small to detect a significant population of MHC-I-reduced cells by flow cytometry but nonetheless show detectable K3 expression via western blot. Another possibility is the presence of a KSHV-specific factor that can post- translationally inactivate K3. Thus, the regulatory mechanism(s) that determine(s) whether K3 is expressed or active may be the key to understanding its role in the context of KSHV- infection. In this chapter, I examined the K3 function in iSLK cells. However, K3 may be active or expressed more robustly in other cell types such as the B-cells, the other major target cell of KSHV and the major latent reservoir of KSHV. In addition, my study was limited to 12, 24, and 48 hours post-reactivation and 36-hours post-infection (Fig. 2.5 and 2.6 and data not shown). Although I did not detect any K3-specific functionality using K3 deficient viruses, K3 may still play a role in MHC-I downregulation during other periods of the KSHV lifecycle (will be explored in Chapter 3). The broader substrate range of K5 includes activating (MICA/B and AICL) and co-stimulatory molecules (ICAM-1 and B7-2) involved in NK cell activation, but spares HLA-C and HLA-E (177, 202, 291). On the other hand, indiscriminant targeting of HLA allotypes by K3, including the NK cell inhibitory ligands of KIR and CD94/NKG2A, HLA-C and HLA-E, causes slightly increased susceptibility to NK cell lysis in K3 expressing cells (176). Thus, K3 expression may be detrimental for cells, especially in the absence of K5, suggesting a need for the tightly controlled gene expression regulation of K3. The data presented in this chapter demonstrate the utility of BAC16 for the generation and characterization of KSHV knockout and mutant viruses. The KSHV genome ! 50! encodes several gene products with seemingly redundant function. A stable BAC provides a basis for the targeted mutagenesis procedures necessary to tease apart these overlapping functions and characterize viral gene function in biologically relevant settings. Like K3 and K5, other KSHV immune evasion genes have been characterized extensively in overexpression systems. Understanding how these and other genes contribute to the establishment of persistent infection and pathogenesis requires a reverse genetics approach wherein the effects of viral genetic deficiencies are evaluated in a relevant infection model. Such approaches will hopefully lead to a better understanding of KSHV pathogenesis. ! 51! Chapter 3 KSHV K3 and K5 ubiquitin E3 ligases have stage-specific immune evasion roles during lytic replication ! ! (This has been submitted for publication in Journal of Virology) Authors: Kevin F. Brulois, Zsolt Toth, Lai-Yee Wong, Pinghui Feng, Shou-Jiang Gao, Armin Ensser and Jae U. Jung ! 52! 3.1 Introduction Kaposi's sarcoma-associated herpesvirus (KSHV) encodes two membrane-bound ubiquitin E3 ligases called K3 and K5, which share the ability to induce internalization and degradation of MHC-I molecules. Although individual functions of K3 and K5 are well- characterized outside of the viral genome, their roles during the KSHV lifecycle are still unclear. The characterization of K3 and K5 deletion mutant KSHV showed the importance of K5 in surface receptor modulation but surprisingly, no obvious changes in MHC-I surface expression were apparent in cells infected with K3 deficient viruses (239), indicating that K5, but not K3, plays a dominant role in the context of infected cells. A similar conclusion was reached for KSHV-mediated downregualtion of DC-SIGN and DC-SIGNR (206), two substrates that are targeted by both K3 and K5. Nevertheless, the role of K3 in the context of infected cells remains unclear. To better understand the role of K3 and K5 in KSHV-infected cells, specifically the reasons for the apparent inactivity of K3, I generated recombinant viruses harboring a single copy of K3 or K5 in their authentic loci or at interchanged genomic positions. The ability of these viruses to induce surface receptor downregulation was examined in iSLK cells undergoing lytic replication. In addition, a novel reporter virus harboring an EF1α- mRFP1-pPAN-EGFP-pK8.1-tagBFP expression cassette was used to analyze the role of K3 and K5 in relation to viral promoter activity and lytic replication. This enabled the identification of a significant role for K3-mediated surface receptor downregulation during later stages of lytic replication. ! 53! 3.2 Results ! Construction of recombinant KSHV with altered disposition of K3 and K5 ORFs As detailed in Chapter 2, I found no obvious role for K3 during lytic replication (239). Based on revertant viruses that express V5-tagged versions of either K3 or K5, I observed that protein levels of K3 were lower compared to those of K5 (Fig. 2.4D) (239). Thus, the apparent inactivity of K3 might be due to insufficient protein expression. To address this possibility, a single copy of either the K3 or the K5 protein-coding sequence was individually reintroduced into a ΔK3ΔK5 KSHV BAC16 (239) either at original genomic locations (K3- >K3loc and K5->K5loc) or at interchanged positions (K3->K5loc and K5->K3loc) (Fig. 3.1A). The reintroduced K3 and K5 ORFs included a carboxyl-terminal V5 tag to enable comparison of protein levels. The recombinant BACmids were verified by pulse-field gel analysis of CpoI-digested BAC DNA and direct sequencing of the respective modified regions. Pulsed-field gel electrophoresis showed the expected digestion pattern for WT and mutant BACs, including full-length terminal repeat sequences (Fig. 3.1B). Since the K3 and K5 ORFs reside on CpoI fragments of 9,272bp and 7,930bp in length, respectively, the size of these fragments varied according to the presence or absence of ORFs at each locus (Fig. 3.1B). Recombinant viruses were produced by introducing BAC DNA into iSLK cells as described in Chapter 4 (239). I have observed significant differences in viral replication from iSLK-BAC16 cell lines that were independently established by transfection of the same WT BAC DNA, even when each cell line was transfected and selected at the same time and under the same conditions (data not shown). It is possible that low BAC DNA transfection efficiency leads to the selection of distinct subpopulations of iSLK cells and this may ultimately lead to extraneous differences in viral replication. In any case, to exclude this potential source of variation, the recombinant viruses were purified from cell-free ! 54! supernatants and infections were initiated at the same time by applying virus to naive iSLK cells at an MOI of ~1. Cells were subsequently maintained under hygromycin selection for ~2 weeks in order to establish latently infected cell lines and allow sufficient time for transient lytic gene expression to subside. To verify that an equivalent dose of each virus was delivered, infected iSLK cells were analyzed for GFP expression at 24 hours post- infection and again at 10 days post-infection (Fig. 3.1C). At 24 hours after infection, the percentages of GFP-positive cells were comparable (62-73%) between the different recombinants (Fig. 3.1C, upper panel). Following 10 days of selection, all cells were GFP- positive and showed a similar distribution of fluorescent intensities (Fig. 3.1C, lower panel). In order to characterize the replication of these recombinant viruses, iSLK cell lines were harvested following induction with a combination of doxycycline and sodium butyrate for 0, 36, and 72 hours. Comparable amounts of viral DNA were detected from cells carrying WT and mutant viruses during both latent infection and lytic reactivation (Fig. 3.1D). Furthermore, infectious virus production was quantified by seeding equivalent cell numbers of each cell line, inducing lytic replication for 72 hours and applying serial dilutions of cell-free supernatants to naïve iSLK cells (Fig. 3.1E). Infectious virus production was not significantly altered by the presence, absence, or altered location of K3 or K5, verifying that these genes are not required for KSHV lytic replication in iSLK cells (Fig. 3.1E). The K5 locus is more conducive to high protein expression K3 and K5 are expressed during lytic replication and can be transcribed with immediate-early kinetics (59, 275). I have previously observed that, at the protein level, K3 was markedly lower compared to K5 (Fig. 2.4D) (239). To further examine the influence of genomic context on the expression of K3 and K5, iSLK stable cell lines harboring the K3 and K5 positional mutant viruses were harvested at 0, 36 and 72 hours post lytic induction. Protein levels of the latent gene, LANA the constitutively expressed GFP marker, and the ! 55! Figure 3.1: Construction and replication of recombinants with altered dispositions of the K3 and K5 ORFs (A) Schematic depiction of the KSHV genomic region harboring the K3 and K5 ORFs (WT) and the BAC16-derived recombinants (ΔK3ΔK5, K3->K3loc, K3->K5loc, K5->K3loc, K5- >K5loc) generated for this study (not drawn to scale). Targeted deletions in the ΔK3ΔK5 recombinant span the amino acid entire coding sequences of K3 and K5, including start and stop codons. Blue arrows indicate carboxyl-terminal V5 tag coding-sequences included with the reintroduced K3 and K5 ORFs. (B) Pulsed-field gel electrophoresis of CpoI- digested BAC DNAs. CpoI fragment sizes in bp of WT BAC16: [51,393] [45,802] [34,729] [18, 240] [12,497] [9,272] [7,930] [243]. (C) Flow cytometry analysis of GFP fluorescence 24 hours (upper panel) and 10 days (lower panel) post-infection of the indicated recombinant viruses. (D) Relative amounts of viral DNA were quantified in latently infected cells (0 hour) and lytically replicating cells (36 and 72 hours post treatment with 1µg/mL of doxycycline and 1mM sodium butyrate). ORF11-specific primers were used to detect viral DNA and values were normalized to cellular DNA levels. The graph shows relative viral DNA copy number with the level of WT viral DNA during latency set to 1. (E) Cell-free supernatants were collected from iSLK cells after 72 hours of lytic induction and infectious virus particles were quantified by infecting 293A cells and counting GFP+ cells by flow cytometry. The experiment was performed in triplicate; error bars represent the standard deviation between replicates. ΔK3ΔK5 ORF2 ORF70 K4 K4.1 K4.2 K6 Ori-lyt ORF2 K3 ORF70 K4 K4.1 K4.2 K5 K6 Ori-lyt WT K5 K3 ORF2 ORF70 K4 K4.1 K4.2 K6 Ori-lyt ORF2 ORF70 K4 K4.1 K4.2 K6 Ori-lyt K3 ORF2 ORF70 K4 K4.1 K4.2 K6 Ori-lyt ORF2 ORF70 K4 K4.1 K4.2 K6 Ori-lyt K5 K3->K3loc K3->K5loc K5->K3loc K5->K5loc A. CpoI B. 15.0 33.5 48.5 63.5 82.0 5.0 M D. 1.00E+03 1.00E+04 1.00E+05 1.00E+06 1.00E+07 GFP+ cells/well Infectious Virus Production E. C. 0 10 2 10 3 10 4 10 5 GFP-A 0 20 40 60 80 100 % of Max 5in5 5in3 3in5-8 3in3 del3del5 WT Negative 5in5 D10 5in3 D10 3in5 D10 3in3 D10 del3del5 D10 WT D10 Negative D10 0 10 2 10 3 10 4 10 5 GFP-A 0 20 40 60 80 100 % of Max 0" 10" 20" 30" 40" 50" 60" 70" 80" 90" 100" 0" 36" 72" Rela%ve'viral'DNA' WT ΔK3ΔK5 K3->K3loc K3->K5loc K5->K3loc K5->K5loc ! 56! immediate-early genes, K8 and RTA were similar between the different recombinants (Fig. 3.2A). Recombinant RTA is produced from a doxycline-inducible expression cassette stably integrated within the iSLK cell genome and therefore expresses in the absence of KSHV infection (281). Recombinants harboring K3 or K5 in the K5 locus produced higher levels of protein compared to those harboring K3 or K5 in the K3 locus (Fig. 3.2A). Based on densitometry analysis, the average difference in expression level between the two loci was more than 30-fold, suggesting that the genomic context of these genes is an important determinant of their expression level. An internal initiation codon within the K3 gene was recently identified (292). It is in-frame with the primary ORF and produces a smaller protein, termed K3A, predicted to be 18.8 kD (22.0 kD in the carboxyl-terminal tagged recombinants). However, the expression of this gene product was not detected, suggesting levels of K3A may be too low to detect (Fig. 3.2A). K3-encoding transcripts were generated by the K3->K3loc and K3->K5loc recombinants and K5-encoding transcripts were generated by the K5->K3loc and K5- >K5loc viruses. Since both sets of viruses harbored identical sequences in two different loci, the amount mRNA produced at each locus was compared by qPCR using K3-specific as well as K5-specific primers (Fig. 3.2B). Analysis of total RNA isolated from cells after 72 hours of lytic replication showed slightly (~2-3-fold) higher levels of the K5 locus transcripts compared to the K3 locus transcripts, a result that was consistent using either K3 or K5- specific primers (Fig. 3.2B). Although this was a significant increase, it might not fully explain the strikingly higher levels of protein generated from the K5 locus. Moreover, K3 protein levels in the K3->K5loc infected cells were higher than those of WT as shown in the K3-specific western blot panel (Fig. 3.2A, lanes 5 and 6 compared to lanes 14 and 15), even though the K3->K5loc recombinant showed lower K3 mRNA levels compared to the WT (Fig. 3.2B). While a modest difference in mRNA expression levels between the K3 and K5 loci was evident, it does not fully explain the discrepancy in protein levels, suggesting ! 57! that low K3 protein levels may be largely due to additional regulation besides transcriptional activity. Figure 3.2: The K5 locus is more conducive to high protein expression compared to the K3 locus (A) iSLK cells or iSLK cells carrying the different recombinant KSHV were induced with doxycycline and sodium butyrate for 36 or 72 hours and protein levels from whole cell lysates were analyzed by immunoblotting using the indicated antibodies. (B) mRNA was analyzed by RT-qPCR using the indicated primers. Values were normalized to 18S and are the average of two independent experiments. The graphs shows relative expression with WT levels set to 1. K3 K3 K5 K5 No Virus WT ΔK3ΔK5 K3locus K5locus K3locus K5locus 0 36 72 0 36 72 0 36 72 0 36 72 0 36 72 0 36 72 0 36 72 V5 K3 K5 K8 RTA LANA GFP β-Actin 0" 0.5" 1" 1.5" 2" Relative mRNA K3 0" 0.5" 1" 1.5" 2" Relative mRNA K5 0 0.5 1 1.5 2 Relative mRNA K2 0 0.5 1 1.5 2 Relative mRNA RTA A. B. 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 ! 58! At low K3 and K5 expression levels, K5 is more effective compared to K3 at MHC-I downregulation MHC-I molecules can be downregulated upon overexpression of either K3 or K5 (196, 198, 199). However, I have previously reported that K3 is not required for MHC-I downregulation in the context of infected cells (Chapter 2) (239). Given the low protein expression from the K3 locus, I examined whether the genomic position of K3 and K5 was also important for KSHV-mediated downregulation of MHC-I. Of particular interest was whether the higher K3 expression levels detected in the K3->K5loc recombinant were sufficient to restore WT levels of MHC-I downregulation activity during lytic replication. iSLK cells harboring different K3 and K5 positional mutants were collected after 3 days of doxycycline and sodium butyrate treatment and MHC-I surface expression was measured using an HLA-ABC specific antibody (W6/32). Cells were subsequently permeablized and stained with an APC-conjugated V5 specific antibody to monitor intracellular levels of recombinant K3 and K5. FACS analysis showed impaired downregulation of MHC-I by the ΔK3ΔK5 recombinant compared to WT (Fig. 3.3A). This defect was significantly reversed when either K3 or K5 was expressed from the K5 locus (Fig. 3.3A). In contrast, iSLK cells harboring the K3->K3loc and K5->K3loc recombinants showed minimal MHC-I downregulation (Fig. 3.3A). Under these conditions, MHC-I was reduced in ~8% of K5- >K3loc virus infected-cells, while only 3% of K3->K3loc virus infected-cells showed reduced MHC-I expression, suggesting stronger downregulation activity of K5 compared to K3 even at low expression levels (Fig. 3.3A). Likewise, although the K3->K5loc recombinant could significantly restore downregulation activity (~22% of cells showed reduced MHC-I levels), the K5->K5loc virus induced more extensive MHC-I downregulation (~34%) (Fig. 3.3A). Interestingly, intracellular staining of K3 in these infected cells revealed a distinctive, non-linear relationship between MHC-I surface levels and K3 expression level; low levels of K3 expression were completely insufficient to induce MHC-I downregulation, a ! 59! phenomenon that was abruptly reversed once K3 reached higher expression levels (Fig. 3.3A and B). By striking contrast, low levels of K5 expression were just as effective at MHC- I downregulation as high levels of K5 expression (Fig. 3.3A and B). Notably, MHC-I downregulation was also evident in cells expressing K5 at levels that were below the detection limit (Fig. 3.3A). These results show an intrinsic difference between K3- versus K5-mediated downregulation of MHC-I and suggest that K3 is less effective than K5 for MHC-I downreguation unless it reaches a certain expression threshold. To confirm this, BJAB cells were electroporated with K3 or K5 expression plasmids. A co-transfected GFP- expressing plasmid was used as a surrogate indication of K3 and K5 expression levels. MHC-I surface expression in these transfected BJAB cells showed a similar pattern: K3 only affected MHC-I surface expression in cells expressing high levels of GFP, while K5 could induce MHC-I downregulation in both low and high GFP expressing cells (Fig. 3.3C). This suggests that, at low expression levels, K3 and K5 show differing abilities to affect MHC-I surface expression (Fig. 3.3C). Positioning K5 within the K3 locus causes delayed ICAM-1 downregulation ICAM-1 is robustly cleared from the cell surface by K5 (but not K3) (176, 202) and its downregulation is evident even in cells that express normal levels of MHC-I (169, 239). Thus, I used ICAM-1 surface expression as a sensitive readout to assess whether positioning the K5 gene within the K3 locus affects immunoreceptor downregulation kinetics. iSLK cells harboring different K3 and K5 positional mutant viruses were treated with doxycycline and sodium butyrate to induce lytic replication and ICAM-1 surface expression was measured at 0, 12, 24, 48, and 72 hours post-treatment (Fig. 3.4 A and B). While the K5->K5loc recombinant showed prompt ICAM-1 downregulation as early as 12 hours post-induction, the ability of the K5->K3loc recombinant to downregulate ICAM-1 surface levels was significantly delayed, with extensive downregulation appearing only after ! 60! Figure 3.3: MHC-I is more susceptible to K5-mediated downregulation than K3- mediated downregulation (A) iSLK cells harboring different K3 and K5 positional mutant viruses were induced with doxycline and sodium butyrate for 3 days and subsequently analyzed by flow cytometry. MHC-I surface expression was detected using a biotin-conjugated HLA-ABC specific antibody (W6/32) and APC-e780-conjugated Strepavidin. V5-tagged recombinant K3 and K5 were detected using an APC-conjugated V5 specific antibody. Boxed areas of the K3- >K5loc and K5->K5loc flow plots represent the V5-low and V5-high gated cell populations used in (B). (B) MHC-I surface expression among V5-low and V5-high cell populations of iSLK cells carrying the indicated mutant viruses. (C) BJAB cells were analyzed by flow cytometry at 24 hours postelectroporation with empty vector, K3 or K5 expression plasmids and analyzed by FACS 24 hours later. An Alexa647-conjugated HLA-ABC specific antibody (W6/32) was used for surface staining. 0 10 2 10 3 10 4 10 5 <APC-A> 0 10 2 10 3 10 4 10 5 <APC-eFL780-A> 17.4 31.4 36.7 25.9 26.9 9.5 0 10 2 10 3 10 4 10 5 <APC-A> 0 10 2 10 3 10 4 10 5 <APC-eFL780-A> 75.3 13.9 6.15 4.61 0 10 2 10 3 10 4 10 5 <APC-A> 0 10 2 10 3 10 4 10 5 <APC-eFL780-A> 34.9 26.3 31.2 45.6 22.2 1.01 0 10 2 10 3 10 4 10 5 <APC-A> 0 10 2 10 3 10 4 10 5 <APC-eFL780-A> 80.2 14.2 3.15 2.38 0 10 2 10 3 10 4 10 5 <APC-A> 0 10 2 10 3 10 4 10 5 <APC-eFL780-A> 95.9 0.55 0.37 3.15 0 10 2 10 3 10 4 10 5 <APC-A> 0 10 2 10 3 10 4 10 5 <APC-eFL780-A> 66.3 0.2 0.018 33.5 Intracellular V5 Surface MHC-I Surface MHC-I V5-low V5-high WT ΔK3ΔK5 K3->K3loc K3->K5loc K5->K3loc K5->K5loc K5->K5loc K3->K5loc ΔK3ΔK5 A. B. 0 10 2 10 3 10 4 10 5 <APC-A> 0 10 2 10 3 10 4 10 5 <APC-eFL780-A> 36.7 25.9 26.9 10.5 0 10 2 10 3 10 4 10 5 <APC-A> 0 10 2 10 3 10 4 10 5 <APC-eFL780-A> 75.3 13.9 6.15 4.61 0 10 2 10 3 10 4 10 5 <APC-A> 0 10 2 10 3 10 4 10 5 <APC-eFL780-A> 31.2 45.6 22.2 1.01 0 10 2 10 3 10 4 10 5 <APC-A> 0 10 2 10 3 10 4 10 5 <APC-eFL780-A> 80.2 14.2 3.15 2.38 0 10 2 10 3 10 4 10 5 <APC-A> 0 10 2 10 3 10 4 10 5 <APC-eFL780-A> 95.9 0.55 0.37 3.15 0 10 2 10 3 10 4 10 5 <APC-A> 0 10 2 10 3 10 4 10 5 <APC-eFL780-A> 66.3 0.2 0.018 33.5 0 10 2 10 3 10 4 10 5 <APC-eFL780-A> 0 20 40 60 80 100 % of Max 0 10 2 10 3 10 4 10 5 <APC-eFL780-A> 0 20 40 60 80 100 % of Max 0 10 2 10 3 10 4 10 5 0 10 2 10 3 10 4 10 5 48.8 35.6 10 5.57 0 10 2 10 3 10 4 10 5 0 10 2 10 3 10 4 10 5 52.3 11.8 32.8 3.17 0 10 2 10 3 10 4 10 5 0 10 2 10 3 10 4 10 5 40.1 3.33 43.1 13.5 C. Surface MHC-I GFP Vector K3 K5 ! 61! 48 or 72 hours of lytic replication (Fig. 3.4A and B). As expected, the K3->K3loc and K3- >K5loc viruses did not affect ICAM-1 surface expression (Fig. 3.4B). Together, these data suggest that, while the K5 locus is equipped for prompt downregulation of surface receptors, the K3 locus imposes inherent limitations on protein expression that result in delayed downregulation kinetics. Construction and characterization of RGB-BAC16 The analysis of positional mutants of K3 and K5 described above indicates that a K3-specific phenotype would likely be limited to an early or late stage of lytic replication. However, lytic replication of KSHV is asynchronous in cultured cells and furthermore, only between 5 and 20% of cells can be found in a given stage of lytic replication (e.g. immediate-early, early, or late) following chemical induction of lytic replication (77, 78). Thus, a stage-specific effect on MHC-I surface expression would be difficult to pinpoint unless the expression of lytic genes within individual cells was monitored in parallel. To facilitate such an approach, I constructed a novel reporter virus called RGB-BAC16, wherein expression of mRFP1, EGFP, and tagBFP was placed under the control of the constitutively active EF1α, the immediate-early PAN and the late K8.1 promoters, respectively (Fig. 3.5A). This was accomplished in two steps. First, the coding sequence of EGFP was replaced with that of mRFP1 using a two-step recombination procedure (263, 264). Next, a subsequent round of two-step recombination was applied to introduce a pPAN-GFP-pK8.1-tagBFP-pA expression cassette (Fig. 3.5A). Genomic integrities of R- BAC16 and RGB-BAC16 were verified by pulsed-field gel electrophoresis and direct sequencing of the reporter gene regions (Fig. 3.5B). The presence of a SbfI site within the mRFP1 sequence and the introduction of the lytic gene reporter cassette each resulted in alterations of the SbfI digestion pattern of these BACmids (the 37,839bp fragment of BAC16 becomes 26,800bp and 11,001bp in R-BAC16; the 26,800bp fragment of R-BAC16 ! 62! Figure 3.4: ICAM-1 downregulation is delayed when K5 is expressed from the K3 locus (A) iSLK cells harboring different K3 and K5 positional mutant viruses were induced with doxycyline and sodium butyrate for 12, 24, 48 and 72 hours. ICAM-1 surface expression was detected by flow cytometry analysis using an APC-conjugated ICAM-1 antibody. Dead cells were excluded using a fixable Live/Dead stain kit. (B) Geometric means of fluorescent intensity (MFI) of ICAM-1 surface staining were compared between iSLK cells harboring the indicated recombinants. MFI values from the ΔK3ΔK5-infected cells were set to 100%. 0 10 2 10 3 10 4 10 5 APC-A 0 20 40 60 80 100 % of Max 0 10 2 10 3 10 4 10 5 APC-A 0 20 40 60 80 100 % of Max 0 10 2 10 3 10 4 10 5 APC-A 0 20 40 60 80 100 % of Max 0 10 2 10 3 10 4 10 5 APC-A 0 20 40 60 80 100 % of Max 0 10 2 10 3 10 4 10 5 APC-A 0 20 40 60 80 100 % of Max Surface ICAM-I NT Isotype ΔK3ΔK5 K5->K3loc K5->K5loc 0 20 40 60 80 100 120 0 24 48 72 Surface expression (%MFI) Hours Post-induction 12hr 24hr 48hr 72hr A. B. ! 63! becomes 28,687 in RGB-BAC16) (Fig. 3.5B). It should be noted that because the genetic origins of tagBFP, EGFP, and mRFP1 are different, there was negligible sequence identity, leaving little or no chance of homologous recombination between these fluorescent protein genes. The kinetics of reporter gene expression of WT-RGB-BAC16 was analyzed by flow cytometry following induction of lytic replication in the presence or absence of the viral DNA replication inhibitor, phosphonoacedic acid (PAA) (Fig. 3.5C). As expected, pPAN-driven EGFP expression was promptly induced, while pK8.1-driven tagBFP expression was only detected after the onset of viral DNA replication, which occurs between 24 and 48 hours post induction ((292) and data not shown). Moreover, tagBFP but not EGFP expression was sensitive to PAA-treatment, consistent with authentic viral gene expression kinetics, where viral DNA replication is only necessary for the expression of late genes. To further verify that tagBFP accurately marks late gene expressing cells, K8.1 surface expression and tagBFP expression were analyzed at 72 hours post-induction (Fig. 3.5D). Indeed, tagBFP expression was coincident with K8.1 expression (Fig. 3.5D). These results demonstrate that RGB-BAC16 can be used to accurately identify cells at specific stages of lytic replication without necessitating the use of fixatives or antibody-mediated detection. Construction and characterization of RGB-derived K3 and K5 deletion mutants My previous analysis of deletion mutants of K3 and K5 described in Chapter 2 has shown that in the absence of K5, KSHV-mediated downregulation of MHC-I is abolished, even in the presence of an intact K3 gene (239). However, those results were limited to relatively early time points of lytic replication (24 and 48 hour post-induction) and did not incorporate concurrent analysis of lytic gene expression. Thus, I decided to revisit the role of K3 in KSHV-mediated immunoreceptor downregulation using RGB-BAC16. To this end, the K3 and K5 coding sequences were removed from RGB-BAC16, either individually or in ! 64! Figure 3.5: Construction and characterization of RGB-BAC16 (A) Schematic depiction of the cloning strategy used in the construction of R-BAC16 and its descendent, RGB-BAC16 (not drawn to scale). (B) Pulsed-field gel electrophoresis of SbfI- digested BAC DNAs. SbfI digestion of WT-BAC16 generates the following fragment sizes in bp: [62,983] [37,839] [32,720] [18,531] [11,989] [9,750] [6,294] (C) Flow cytometry analysis of EGFP and tagBFP fluorescence of iSLK cells harboring RGB-BAC16 following 0, 6,12, 24, 48 and 72 hours of doxycycline and sodium butyrate treatment in the absence (top two rows) or presence (bottom row) of PAA. (D) Flow cytometry analysis of iSLK-RGB-BAC16 cells without treatment (left panel) and following 72 hours of doxycycline and sodium butyrate treatment (right panel). K8.1 surface levels were detected using a K8.1 specific antibody and an APC-e780-conjugated secondary antibody. B. SbfI R M RGB G 15.0 33.5 48.5 63.5 82.0 5.0 EF1-α pA IRES Hygro R BAC ORF57 K9 GFP A. BAC16 R-BAC16 RGB-BAC16 RFP Kan R RFP EF1-α pA IRES Hygro R BAC ORF57 K9 RFP GFP pPAN pK8.1 BFP pA GFP pPAN pK8.1 BFP pA RFP I-SceI Kan R I-SceI EF1-α IRES K9 RFP Two-step Recombination Two-step Recombination pPAN-GFP pK8.1-BFP C. 0 10 2 10 3 10 4 10 5 0 10 2 10 3 10 4 10 5 0 0 92 8 0 10 2 10 3 10 4 10 5 0 10 2 10 3 10 4 10 5 0 0.019 97.7 2.36 0 10 2 10 3 10 4 10 5 0 10 2 10 3 10 4 10 5 0 0 96 4.06 0 10 2 10 3 10 4 10 5 0 10 2 10 3 10 4 10 5 4.93e-3 0 88.4 11.6 0 10 2 10 3 10 4 10 5 0 10 2 10 3 10 4 10 5 3.31e-3 0 65.4 34.6 0 10 2 10 3 10 4 10 5 0 10 2 10 3 10 4 10 5 0 0 21.6 78.4 0 10 2 10 3 10 4 10 5 0 10 2 10 3 10 4 10 5 0 0 16.3 83.7 0 10 2 10 3 10 4 10 5 0 10 2 10 3 10 4 10 5 1.89e-3 1.89e-3 22.9 77.1 0 10 2 10 3 10 4 10 5 0 10 2 10 3 10 4 10 5 4.64e-3 4.64e-3 0.97 99 0 10 2 10 3 10 4 10 5 0 10 2 10 3 10 4 10 5 4.23e-3 4.23e-3 0.33 99.6 0 10 2 10 3 10 4 10 5 0 10 2 10 3 10 4 10 5 0 0 90.7 9.32 0 10 2 10 3 10 4 10 5 0 10 2 10 3 10 4 10 5 8.03e-3 0 89.9 10.1 0 10 2 10 3 10 4 10 5 0 10 2 10 3 10 4 10 5 0 13.6 82.5 3.93 0 10 2 10 3 10 4 10 5 0 10 2 10 3 10 4 10 5 9.46e-3 0.29 83.9 15.8 0 10 2 10 3 10 4 10 5 0 10 2 10 3 10 4 10 5 0.012 0.043 75.6 24.4 0 10 2 10 3 10 4 10 5 0 10 2 10 3 10 4 10 5 6.61e-3 8.78 80 11.2 0 10 2 10 3 10 4 10 5 0 10 2 10 3 10 4 10 5 6.51e-3 0.23 70.9 28.9 0 10 2 10 3 10 4 10 5 0 10 2 10 3 10 4 10 5 0 6.27e-3 60.3 39.7 PAA 0 10 2 10 3 10 4 10 5 0 10 2 10 3 10 4 10 5 0 0 92 8 0 10 2 10 3 10 4 10 5 0 10 2 10 3 10 4 10 5 0 0.019 97.7 2.36 0 10 2 10 3 10 4 10 5 0 10 2 10 3 10 4 10 5 0 0 96 4.06 0 10 2 10 3 10 4 10 5 0 10 2 10 3 10 4 10 5 4.93e-3 0 88.4 11.6 0 10 2 10 3 10 4 10 5 0 10 2 10 3 10 4 10 5 3.31e-3 0 65.4 34.6 0 10 2 10 3 10 4 10 5 0 10 2 10 3 10 4 10 5 0 0 21.6 78.4 0 10 2 10 3 10 4 10 5 0 10 2 10 3 10 4 10 5 0 0 16.3 83.7 0 10 2 10 3 10 4 10 5 0 10 2 10 3 10 4 10 5 1.89e-3 1.89e-3 22.9 77.1 0 10 2 10 3 10 4 10 5 0 10 2 10 3 10 4 10 5 4.64e-3 4.64e-3 0.97 99 0 10 2 10 3 10 4 10 5 0 10 2 10 3 10 4 10 5 4.23e-3 4.23e-3 0.33 99.6 0 10 2 10 3 10 4 10 5 0 10 2 10 3 10 4 10 5 0 0 90.7 9.32 0 10 2 10 3 10 4 10 5 0 10 2 10 3 10 4 10 5 8.03e-3 0 89.9 10.1 0 10 2 10 3 10 4 10 5 0 10 2 10 3 10 4 10 5 0 13.6 82.5 3.93 0 10 2 10 3 10 4 10 5 0 10 2 10 3 10 4 10 5 9.46e-3 0.29 83.9 15.8 0 10 2 10 3 10 4 10 5 0 10 2 10 3 10 4 10 5 0.012 0.043 75.6 24.4 0 10 2 10 3 10 4 10 5 0 10 2 10 3 10 4 10 5 6.61e-3 8.78 80 11.2 0 10 2 10 3 10 4 10 5 0 10 2 10 3 10 4 10 5 6.51e-3 0.23 70.9 28.9 0 10 2 10 3 10 4 10 5 0 10 2 10 3 10 4 10 5 0 6.27e-3 60.3 39.7 72 24 48 72 24 48 0 6 12 Vehicle D. Surface K8.1 pK8.1-BFP 0 10 2 10 3 10 4 10 5 0 10 2 10 3 10 4 10 5 5.69e-3 7.75e-4 0.064 99.9 0 10 2 10 3 10 4 10 5 0 10 2 10 3 10 4 10 5 3.66 11.7 1.37 83.3 ! 65! succession, to generate single and double deletion mutants (Fig. 3.6A). The successful removal of K3 and K5 and the overall integrity of the mutant genomes were verified by pulse-field gel electrophoresis and direct sequencing as described above (Fig. 3.6B). The BACmids were introduced into iSLK cells as detailed previously. Following 3 days of doxycycline and sodium buyrate treatment, iSLK cells harboring the different recombinants were collected and reporter gene expression was analyzed by flow cytometry (Fig. 3.6C). Comparable levels of pPAN- and K8.1-drive gene expression were detected in the recombinant BACmids, consistent with my previous findings demonstrating that K3 and K5 are dispensable for lytic gene expression and viral replication (239) (Fig. 3.6C and Fig. 2.4). Next, I examined the immunoreceptor downregulation capabilities of K3 and K5 in the RGB-BAC16 backbone. iSLK cells carrying RGB-derived viruses lacking either or both K3 and K5 were induced with doxycycline and sodium butyrate treatment for 72 hours (as above) and the expression of MHC-I, EGFP and tagBFP were analyzed by flow cytometry (Fig. 3.7A and B). Consistent with the findings presented in Chapter 2, K3 was not required for MHC-I downregulation when the K5 gene was intact (Fig. 3.7A, WT vs. ΔK3). In the absence of K5, on the other hand, K3 was required for MHC-I downregulation in a population of cells (~17.7%) that expressed high levels of pPAN-driven EGFP (EGFP high ) and were enriched for the late marker, tagBFP (~19%); MHC-I downregulation in this cell population was abolished in ΔK3ΔK5-infected cells (Fig. 3.7A, ΔK5 compared to ΔK3ΔK5). MHC-I surface expression in these cells was also analyzed by gating on specific cell populations that were defined based on EGFP and tag BFP expression levels (Fig. 3.7B). This analysis demonstrated that the subtle effect of K3 on MHC-I surface expression was more apparent by comparing gated cell populations; MHC-I downregulation in ΔK5-infected cells is approximately 38% in EGFP high cells and nearly 100% in BFP + GFP + cells, both of which were markedly higher compared to non-gated populations (Fig. 3.7B). These results ! 66! reaffirm the requirement of K5, particularly during the immediate-early phase of infection. In addition, the data suggest a novel role for K3 during later stages of lytic replication. Figure 3.6: Construction and characterization of K3 and K5 deletion mutants of RGB- BAC16 (A) Schematic depiction of RGB-BAC16 recombinants generated. Complete and 'scarless' deletions (from start to stop codon) were engineered within the K3 or K5 ORFs and a ΔK3ΔK5 BAC was subsequently derived from the ΔK3 recombinant (not drawn to scale). (B) Pulsed-field gel electrophoresis of CpoI-digested BAC DNA. CpoI fragment sizes in bp for WT RGB-BAC16: [51,390] [45,802] [36,578] [18,240] [12,497] [9,272] [7,930] [243] (C) EGFP and tagBFP fluorescence of iSLK cells harboring WT or mutant RGB-BACmids following 72 hours of doxycycline and sodium butyrate treatment was analyzed by FACS. A. ΔK3 ORF2 CpoI M 15.0 33.5 48.5 63.5 5.0 B. ΔK5 ΔK3ΔK5 K3 ORF70 K4 K4.1 K4.2 K5 K6 Ori-lyt ORF2 ORF70 K4 K4.1 K4.2 K5 K6 Ori-lyt ORF2 K3 ORF70 K4 K4.1 K4.2 K6 Ori-lyt ORF2 ORF70 K4 K4.1 K4.2 K6 Ori-lyt WT 0 10 2 10 3 10 4 10 5 0 10 2 10 3 10 4 10 5 0 10 2 10 3 10 4 10 5 0 10 2 10 3 10 4 10 5 0 10 2 10 3 10 4 10 5 0 10 2 10 3 10 4 10 5 0 10 2 10 3 10 4 10 5 0 10 2 10 3 10 4 10 5 0 10 2 10 3 10 4 10 5 0 10 2 10 3 10 4 10 5 0 10 2 10 3 10 4 10 5 0 10 2 10 3 10 4 10 5 0 10 2 10 3 10 4 10 5 0 10 2 10 3 10 4 10 5 0 10 2 10 3 10 4 10 5 0 10 2 10 3 10 4 10 5 39.8 7.36 0 10 2 10 3 10 4 10 5 0 10 2 10 3 10 4 10 5 40.8 5.4 0 10 2 10 3 10 4 10 5 0 10 2 10 3 10 4 10 5 42.1 6.33 0 10 2 10 3 10 4 10 5 0 10 2 10 3 10 4 10 5 37.8 4.49 0 10 2 10 3 10 4 10 5 0 10 2 10 3 10 4 10 5 WT ΔK3 ΔK5 ΔK3ΔK5 C. pPAN-GFP pK8.1-BFP ! 67! Figure 3.7: K3-mediated MHC-I downregulation is enriched in EGFP high and tagBFP + cells (A) iSLK cells harboring different RGB-BACmids were collected after 3 days of doxycycline and sodium butyrate treatment and MHC-I, EGFP and tagBFP were analyzed by flow cytometry. MHC-I surface expression was measured using a biotin-conjugated HLA-ABC specific antibody (W6/32) and APC-e780-conjugated Strepavidin. (B) Lytic cell populations of iSLK cells infected with the indicated recombinant viruses were gated according to the strategy depicted. Histograms represent MHC-I surface expression among the indicated cell populations. Isotype WT ΔK3 ΔK5 ΔK3ΔK5 0 10 2 10 3 10 4 10 5 0 20 40 60 80 100 0 10 2 10 3 10 4 10 5 0 20 40 60 80 100 WT ΔK3 ΔK5 ΔK3ΔK5 pPAN-GFP pK8.1-BFP pK8.1-BFP pPAN-GFP MHC-I 0 10 2 10 3 10 4 10 5 0 10 2 10 3 10 4 10 5 39.9 25.5 7.65 0 10 2 10 3 10 4 10 5 0 10 2 10 3 10 4 10 5 40.5 31.7 5.59 0 10 2 10 3 10 4 10 5 0 10 2 10 3 10 4 10 5 43.5 25.9 6.87 0 10 2 10 3 10 4 10 5 0 10 2 10 3 10 4 10 5 33.7 27 4.89 0 10 2 10 3 10 4 10 5 0 10 2 10 3 10 4 10 5 26.5 12 31.3 30.1 0 10 2 10 3 10 4 10 5 0 10 2 10 3 10 4 10 5 49.5 4.96 3.25 42.3 0 10 2 10 3 10 4 10 5 0 10 2 10 3 10 4 10 5 24.8 21.1 30.6 23.5 0 10 2 10 3 10 4 10 5 0 10 2 10 3 10 4 10 5 58.5 4.92 3.81 32.7 0 10 2 10 3 10 4 10 5 0 10 2 10 3 10 4 10 5 50 29.1 17.7 3.18 0 10 2 10 3 10 4 10 5 0 10 2 10 3 10 4 10 5 80.3 3.05 3.23 13.4 0 10 2 10 3 10 4 10 5 0 10 2 10 3 10 4 10 5 49 45.5 3.68 1.87 0 10 2 10 3 10 4 10 5 0 10 2 10 3 10 4 10 5 89.9 7.28 1.63 1.22 0 10 2 10 3 10 4 10 5 0 10 2 10 3 10 4 10 5 39.9 25.5 7.65 0 10 2 10 3 10 4 10 5 0 10 2 10 3 10 4 10 5 40.5 31.7 5.59 0 10 2 10 3 10 4 10 5 0 10 2 10 3 10 4 10 5 43.5 25.9 6.87 0 10 2 10 3 10 4 10 5 0 10 2 10 3 10 4 10 5 33.7 27 4.89 0 10 2 10 3 10 4 10 5 0 10 2 10 3 10 4 10 5 26.5 12 31.3 30.1 0 10 2 10 3 10 4 10 5 0 10 2 10 3 10 4 10 5 49.5 4.96 3.25 42.3 0 10 2 10 3 10 4 10 5 0 10 2 10 3 10 4 10 5 24.8 21.1 30.6 23.5 0 10 2 10 3 10 4 10 5 0 10 2 10 3 10 4 10 5 58.5 4.92 3.81 32.7 0 10 2 10 3 10 4 10 5 0 10 2 10 3 10 4 10 5 50 29.1 17.7 3.18 0 10 2 10 3 10 4 10 5 0 10 2 10 3 10 4 10 5 80.3 3.05 3.23 13.4 0 10 2 10 3 10 4 10 5 0 10 2 10 3 10 4 10 5 49 45.5 3.68 1.87 0 10 2 10 3 10 4 10 5 0 10 2 10 3 10 4 10 5 89.9 7.28 1.63 1.22 MHC-I MHC-I 0 10 2 10 3 10 4 10 5 0 20 40 60 80 100 0 10 2 10 3 10 4 10 5 0 20 40 60 80 100 No Gating Gating Strategy GFPlow BFP+GFP+ GFPhiBFP- GFPlow BFP+ GFP+ GFPhi BFP- A. B. ! 68! 3.3 Discussion In this chapter, I identified a role for K3 in KSHV-mediated downregulation of MHC-I molecules during the lytic phase of infection. While K5 is essential during the immediate- early stage, both K3 and K5 appear to contribute to surface protein downregulation during later stages. Particularly striking was the functional contribution of K3 in late-gene expressing cells (Fig. 3.7). Stage-specific activity of immunoevasins has also been described in other herpesviruses: two evolutionarily related glycoproteins of HCMV, US3 and US11, are sequentially deployed and, in turn, interfere with MHC-I surface expression via distinct mechanisms during the immediate-early and early phases of infection, respectively (293). In addition, the BNLF2a protein of EBV was shown to be important for evading recognition by CD8+ T cells specific for immediate-early and early epitopes, but not late epitopes, a phenotype that correlated with the transient expression of the BNLF2a protein (294). Thus, stage-specific activity of immunoevasins is a common feature of herpesviruses to establish life-long persistent infection. The selective advantage of encoding multiple antagonists of antigen presentation is not entirely clear. The sheer diversity of MHC class I molecules among outbred hosts may exert selective pressure for multiple means of counteraction by a single virus. In addition, MHC class I molecules, especially HLA-C and HLA-E, are involved in the suppression of NK cell cytotoxicity (295). Many viruses selectively downregulate the expression of HLA-A and HLA-B while sparing HLA-C and HLA-E and this is thought to be a way of optimally navigating the threats posed by CD8+ T cells and NK cells (196, 296-298). In the case of KSHV, K5 selectively removes HLA-A and HLA-B allotypes, while K3 targets HLA-A, HLA- B, HLA-C, and HLA-E (196). In addition, the removal of ligands for activating receptors on NK cells has emerged as a common way that viruses prevent NK cell activation (299) and KSHV encodes several factors, including K5, that reduce surface expression of such receptors (174, 175, 177). The distinct timing and substrate specificities of K3 and K5 ! 69! suggest that allotype-specific downregulation of MHC class I molecules occurs during the immediate-early stage of lytic replication while indiscriminant and extensive reduction surface MHC class I molecules is confined to later stages. This strategy might be particularly relevant after viral DNA replication when antigenic late proteins are highly expressed (180, 300) and the threat of surveillance from NK cells has been diminished by the activities of K5 and other viral factors (175-177, 301). The ability of K3 to target HLA-C may be especially significant in light of recent studies showing an important role for HLA-C- restricted CD8+ T cells in the control of viral infections (302, 303), a finding that likely reflects the HLA selectivity of viral immunoevasins such as Nef (304). It is also worth noting that, analogously to K3, the BILF1 protein of EBV was shown to be a broadly specific antagonist of MHC-I molecules: it targets HLA-A, HLA-B, and HLA-E and also shows some ability to downregulate HLA-C, albeit weakly (305). Interestingly, BILF1 is expressed later during lytic infection compared to the other major EBV-encoded antagonists of antigen presentation, BNLF2a and BGLF5, and the NK-cell antagonist, vIL10 (294, 306, 307). Thus, the delayed deployment of broadly specific MHC-I antagonists may represent an evolutionarily conserved immune evasion strategy involving specialized roles for different immunoevasins. Encoding multiple genes that interfere with antigen presentation may also be important during infection of different cell types, where conditions could favor the use of one immunoevasin over another as was shown for the US2 and US11 proteins of HCMV in primary dendritic cells (308). I focused on the role of KSHV in iSLK cells because K3 and K5 are expressed as part of the lytic gene expression program and this cell line provides a robust means of inducing the lytic phase (239, 281, 292). Although KSHV tends to establish and remain in latency (309), recent advances have demonstrated lytic replication in various cell types, including the B-cell line, MC116 (100), and the oral epithelial cell line, OEPI (84). In addition, it was recently shown that KSHV-infected lymphatic endothelial cells (LECs) ! 70! undergo a unique transcription program that includes the expression of several lytic genes (81). Thus, in addition to their stage-specific roles, it may be worthwhile to examine potential cell-type specific functions of K3 and K5. Based on current data, K3 and K5 appear to function independently of one another. While the effect of K3 on MHC-I surface expression was only apparent in the absence of K5, it is likely that sustained K5-mediated downregulation overshadows the subtle effects of K3 in WT RGB-BAC16 (Fig. 7). However, I cannot exclude the possibility that K3 and K5 somehow antagonize or cooperate with one another. Collaborative and antagonistic effects on MHC-I surface expression have been demonstrated for the m04, m06, and m152 immunoevasins of MCMV (310, 311). In addition, the US3 protein of HCMV was shown to enhance US-2-mediated downregulation (312). In contrast, US3 inhibits US11-mediated downregulation (313). Since the expression of K3 coincides with K5 expression during lytic replication, there is potential for interplay between these proteins. Furthermore, protein purification experiments show that K3 and K5 interact with one another during lytic replication (Brulois and Jung, unpublished data). However, the functional significance of this interaction and the potential interplay between K3 and K5 has yet to be determined. Although K3 and K5 have redundant expression kinetics at the mRNA level (59, 275), this study showed that inefficient protein production from the K3 locus and the ineffectiveness of K3 at low expression levels contribute to delayed K3-mediated downregulation of MHC-I in the context of KSHV infected cells. The former mechanism is supported by the finding that lower levels of K3 protein were detected in cells harboring WT BAC16 compared to those harboring the K3->K5loc recombinant, even though higher levels of K3-containing mRNA were present in WT-infected cells (Fig. 3.2). Lower protein levels were observed when either K3 or K5 was expressed from the K3 locus, excluding the possibility that potential differences in codon-usage between the K3 and K5 coding sequences are involved in restricting protein expression. In contrast to K5, which is ! 71! expressed from a single monocistronic mRNA (275, 292), transcriptional analysis of the K3 locus showed that, the major K3-containing mRNA species harbor K3 as a second cistron in a bicistronic mRNA (59). Thus a translation regulatory mechanism may be involved in delayed K3 expression. In such a scenario, K3 would not conform to an established kinetic class of viral genes. Instead, it is tempting to speculate that K3 may have evolved to sense elevated viral protein synthesis or other alterations in translation that may be coincident with a need for more comprehensive inhibition of antigen presentation. In line with this, K3 mediated-downregulation was only detectable in cells with high pPAN-driven gene expression (Fig. 3.7). Peculiarly, K3 and K5 transcripts detected in the positional mutants were consistently lower (~2-3 fold) compared to WT, despite comparable levels of RTA and K2 mRNA (Fig. 3.2B). It is possible that the extra sequences encoding the carboxyl-terminal epitope tags have a general destabilizing effect on mRNA. Nevertheless, this anomaly is unlikely to affect the main conclusions. I also observed distinct capabilities of K3 and K5 to downregulate of MHC-I molecules, particularly when these viral proteins were present at low levels (Fig. 3.3). To my knowledge, this is the first study to do parallel analysis of both the intracellular level of an endogenously expressed MARCH family member and the surface expression level of its cognate substrate. Notably, when overexpressed, K3 is a more potent downregulator of MHC-I compared to K5 (196, 198). The analysis in figure 3.3 does not contradict this fact, but instead highlights previously unappreciated distinctions between K3 and K5 at low expression levels, an observation that may have relevance at physiological expression levels of viral infection. The differential effectiveness of K3 and K5 may have multiple origins; despite significant homology and structural similarities between these proteins (183, 211, 213), a number of fundamental differences in their modes of action have been identified (202, 210, 214, 216, 218-220). The use of chimeras of K3 and K5 may help ! 72! identify the mechanism(s) that contribute to the distinct patterns of MHC-I downregulation observed in this study. In summary, the data presented in this chapter uncovered a role for K3 in the removal of MHC-I molecules from the cell suface during lytic replication. In contrast to K5, K3 activity was restricted to the later stages of lytic replication. Future work on the on K3 and K5 will focus on delineating the in vivo roles of these genes in the establishment and maintenance of latent infection. ! 73! Chapter 4 Conclusion and Future Directions ! 74! 4.1 BAC16: future outlook The establishment of an infectious clone represents a milestone for any virus field (251). The generation of mutant recombinants is a key step to confirm viral gene function in the context of infection (239-244, 246, 247). This is especially important for KSHV, which has an abundance of duplicated or redundantly functioning genes (16), making RNAi- mediated knock-down techniques insufficient in many cases. Several genes are postulated to have direct roles in KS pathogenesis (3). However, in most cases, the function of these genes in KSHV-induced pathogenesis is not clear. Putative lytic oncogenes are particularly puzzling because, in the context of the viral genome, their oncogenic effects would occur in cells that are fated to die from lysis. Several models have been proposed, including paracrine and autocrine effects of lytic gene products (3), dissemination of virus to replenish latently infected cells and alternative latent gene expression programs involving an expanded subset of genes (81, 82). BAC16 will be an essential reagent for delving into the validity of each these models. In addition, cellular transformation models such as the one developed by Jones et al., will be instrumental in improving our understanding of KSHV- mediated oncogenes on a gene-by-gene basis (314, 315). Although mutant viruses are a valuable tool in cell culture models, their full potential lies in vivo, where RNAi-mediated knock-down is not feasible or inefficient. In vivo models of KSHV have been slow to develop and new models are continually replacing old ones. Early efforts relied on subdermal inoculations of PEL cell lines (316, 317). Subsequently, Parsons et al. performed intravenous inoculation of NOD-SCID mice with cell-free KSHV (90). Another alternative approach used in vitro infection of human CD34-positive cells followed by intravenous inoculation of NOD-SCID mice (89). Notably, among 16 mice inoculated with KSHV-infected CD34-positive cells, 3 developed pleural effusions of CD45/mu-CD19+ cells (89). In an effort to model KS-pathogenesis, Mutlu et al. transfected KSHV genomes into mouse bone-marrow endothelial-lineage cells and these cells were ! 75! then implanted into nude mice where they formed KS-like lesions (318). Other milestones include the successful infection of common marmosets (92) and humanized mice (91). A number of transgenic knockin mice have been used to study the in vivo effects of KSHV genes, most notably the recent establishment of transgenic mice harboring the entire latency locus (151). Our current efforts to establish conditions for KSHV infection of humanized mice are still being optimized. Nevertheless, I was able to obtain significant levels of infection in (Fig 4.1) in the limited pilot experiment. Further optimization of this system will be part of the ongoing effort to understand KSHV biology in the in vivo setting using BAC16. A histone 2B (H2B)-GFP fusion protein has been successfully used as a marker to enhance tracking of MHV-68-infected cells in vivo (319). Efforts to establish an analogous KSHV recombinant are ongoing. Another significant advancement has been the development of RGB-BAC16. Currently, a recombinant KSHV called rKSHV.219 is used to monitor lytic gene expression in live cells and relies on a pPAN-driven mRFP1 expression cassette (53). While this system has proven extremely useful to KSHV researchers, RGB-BAC16 has several advantages over rKSHV.219. First, the use of EGFP instead of mRFP1 as a lytic-specific marker allows for compatibility with a wider range of fluorescent detection machines, making it easier to quantify cells in the various stages of lytic gene expression. Second, the use of a late gene-specific reporter cassette, pK8.1-tagBFP, provides a convenient means of detecting and sorting cells that have undergone DNA replication. This is the first fluorescent protein-based detection method to distinguish KSHV-infected cells that have undergone viral DNA replication. Thus, researchers will be able to monitor cells expressing late genes, as I demonstrated in Chapter 3. Finally, unlike rKSHV.219, the genome of RGB- BAC16 is readily modifiable in bacteria, providing a rapid means to assess the effects of viral gene mutations on lytic gene expression. ! 76! Figure 4.1: Evaluation of splenocytes from NSG-hu mice infected with KSHV. NOD.Cg-Prkdc scid Il2rg tm1 Wj/SzJ (NSG) mice were engrafted with human CD34+ hematopoietic stem cells (HSCs) and subsequently inoculated with BAC16-derived KSHV. GFP-expressing splenocytes were analyzed by fluorescent microscopy (A and B) and FACS (D) using the indicated antibodies. Immunohistochemistry was performed using a LANA-specific antibody (C). DIC GFP Merge DAPI GFP LANA Merge A. B. 5 weeks post-infection Uninfected C. 0 10 2 10 3 10 4 10 5 0 10 2 10 3 10 4 10 5 56.4 0.39 0.029 43.2 0 10 2 10 3 10 4 10 5 0 10 2 10 3 10 4 10 5 79.2 0.22 0.063 20.5 0 10 2 10 3 10 4 10 5 0 10 2 10 3 10 4 10 5 0 72.1 27.9 0 0 10 2 10 3 10 4 10 5 0 10 2 10 3 10 4 10 5 5.94 0.039 0.25 93.8 0 10 2 10 3 10 4 10 5 0 10 2 10 3 10 4 10 5 0 0.84 99.2 0 0 10 2 10 3 10 4 10 5 0 1000 2000 3000 4000 0.25 0 10 2 10 3 10 4 10 5 0 1000 2000 3000 4000 1.95e-3 0 10 2 10 3 10 4 10 5 0 10 2 10 3 10 4 10 5 7.23 0.14 0.15 92.5 GFP CD19 CD3 FSC GFP+ cells Uninfected 5 weeks post-infection 0 1000 2000 3000 4000 FSC-A 0 20 40 60 80 100 % of Max 0 1000 2000 3000 4000 FSC-A 0 20 40 60 80 100 % of Max 0 1000 2000 3000 4000 FSC-A 0 20 40 60 80 100 % of Max CD19+/GFP+ cells Uninfected/CD19+ Infected/CD19+ FSC D. ! 77! RGB-BAC16 has proven useful in delineating the stage-specific roles of K3 and K5 during lytic replication (Chapter 3). This proof-of-concept may be applicable other situations as well. For example, Madrid et al. found comparable levels of NKp44L downregulation in cells harboring ORF54null KSHV compared to cells harboring WT KSHV, even though they could clearly demonstrate that overexpression of ORF54 results in a reduction of NKp44L surface levels. Thus, there may be redundancy in the downregulation of NKp44L and the function ORF54 may only be apparent in the presence of other viral gene mutations. In addition, RGB-BAC16 may provide added sensitivity for the identification of a potentially subtle ORF54 phenotype. BAC16 is derived from the PEL cell line, JSC-1, which harbors a KSHV genome that groups with subtype 3C according to its K1 sequence (23). The KSHV genome of JSC-1 was the 4 th KSHV genome to be completely sequenced (239). There are currently four full- length KSHV genome sequences available in Genbank, with efforts underway to sequence many more. Subtype-specific differences between KSHV isolates remain a largely unexplored area. The pBelo45 vector backbone of BAC16 can serve as a starting point for the cloning and characterization of broad range of KSHV subtypes. Although a laborious process, it may expand our understanding of how subtype-specific differences can potentially influence disease severity. Alternatively, since most subtype variation is limited to the K1 gene (23), different K1 subtypes can introduced into a ΔK1 BACmid. Lastly, previously unappreciated coding potential has become increasingly evident from the ongoing discovery of new features within the KSHV genome, including long noncoding RNAs (lncRNA) (320), upstream ORFs (uORF) (247), and small ORFs (sORF) (292). Notably, BACmid clones can be easily adapted should a novel genome feature be found to overlap the BAC insertion site (266). ! 78! 4.2 Immune evasion roles of K3 and K5 K3 and K5 are the main genes required for KSHV-mediated MHC-I downregulation; in the absence of both K3 and K5, MHC-I surface levels were similar to those of uninfected cells (239). In contrast, deletion of mK3 only partially abrogates MHV-68-mediated downregulation of MHC-I (222). From this point of view, the ability of a γ-herpesvirus to establish latency in vivo in the complete absence of immunoevasin activity remains an open question. Infection of humanized mice with ΔK3ΔK5 KSHV will be an important step in understanding γ-herpesvirus immune evasion. In addition, the positional mutants of K3 and K5 (described in Chapter 3) suggest a tightly regulated deployment of K3 and K5 during lytic replication. Analysis of these mutants in an in vivo setting would provide a way of assessing the importance of timely K3 and K5 expression; premature expression of K3, as in the K3->K5loc virus infected cells, may compromise optimal immune evasion since it would predispose infected cells to NK cell lysis. One caveat is the increasingly diverse range of functions of K5, including its involvement in viral release (via tetherin downregulation) (207) and cell proliferation (321). However, these emerging new functions will make it more complicated to interpretation of potential in vivo defects in viral latency. The use of immune cell depletion to complement any defects will be critical to delineating between immune modulatory roles of K5 and its other functions. This work also implicates the existence of a post-transcriptional regulatory mechanism to either dampen K3 protein levels or enhance K5 protein levels. K3 is transcribed as a second cistron in a bicistronic mRNA. IRES-dependent translation of vFLIP has been shown to dampen protein expression levels (322-324). Further analysis of the K3 locus may help elucidate such a mechanism. Another possibility is that K5 translation may be significantly enhanced. Interestingly, uORFs were identified for K5 (292), although the effect of these uORFs on K5 gene expression is still unexplored. Although best ! 79! characterized as repressive elements (325), a uORF was recently shown to enhance translation of ORF36 (244, 247). While the stage-specific roles of K3 and K5 could be explained by their MHC-I allotype specificities (Chapter 3), further insights might be provided by the identification of additional target substrates of K3 and K5. For unknown reasons, studies to identify novel K5 substrates have largely ignored K3 (191, 210). Given its confirmed role in the viral lifecycle, it may be worthwhile to do a comprehensive screen for K3 substrates using stable isotope labeling of amino-acids in cell culture (SILAC). The identification of KSHV genes that interfere with antigen presentation was based on their ability to reduce MHC-I surface expression (196, 198), regarded as a hallmark of immunoevasin activity. Although lower MHC-I surface expression on target cells is correlated with reduced CD8+ T cell-mediated killing, there may be additional factors that do not necessarily affect MHC-I surface levels but are nevertheless able to block antigen presentation to CD8+ T cells. Although m04/gp34 protein of MCMV was proposed to be such an immunoevasin (326, 327), this interpretation is controversial (328). Although current data indicates that K3 and K5 function independently of one another during lytic replication, the possibility of cooperative or antagonistic affects cannot be excluded. Moreover, protein purification of endogenously expressed epitope tagged versions of K3 and K5 during lytic replication revealed that K3 and K5 are the main binding partners of one another (Fig 4.2). This finding suggests that these proteins somehow affect one another. One possibility is that K5 enables K3 to target K5-specific substrates or vice versa. In summary, this work demonstrates the utility of a new genetic manipulation system for KSHV. The development of a novel reporter virus and the use of positional swapping mutants led to the identification of stage-specific roles for K3 and K5 during lytic replication. ! 80! This work provides new insight into herpesviral immune evasion and paves the way for delineating the roles of other KSHV genes in the context of viral infection. Figure 4.2: Protein purification of K3 and K5 during lytic replication. iSLK cells Harboring WT (No Tag), K3-3xFLAG, or K5-3xFLAG recombinant virus were treated with doxycycline and sodium butyrate for 48 hours. Cell lysates were subjected to FLAG IP followed by SDS-PAGE followed by silver staining or western blotting with the indicated antibodies. Flag IP WCL Silver Stain Flag K3 K5 WB ! 81! Chapter 5 Materials and Methods ! 82! 5.1 Virus and Cells Vero, Vero-rKSHV.219, HEK293A, iSLK, iSLK-BAC16 cells were cultured in DMEM supplemented with 10% fetal bovine serum and 1% penicilin/streptomycin. iSLK cells were cultured in the presence of 1µg/ml puromycin and 250µg/ml G418. BAC16 and its derivatives were introduced into iSLK cells via Fugene HD transfection. In brief, BAC DNA was isolated from a 5ml bacteria culture and resuspended in a 40µl of distilled water. iSLK cells were seeded at 2x10 5 cells/well of a 6-well plate or ~70% confluency. On following day, the media was changed to optiMEM 30 minutes prior to adding the transfection complexes (FBS and penicilin/streptomycin were excluded from the media). Transfection complexes were prepared by combining approximately 25% (10µl) of the total miniprepped BAC DNA and 90µl of optiMEM, followed by the addition of 5µl of Fugene HD. After 10 minutes of incubation at room temperature, the complexes were added to the cells. Three hours after adding the transfection complexes, FBS was added to the optiMEM to a final concentration of 10%. On following day, transfected cells were trypsinized and transferred to 10cm dishes and cultured in the presence of DMEM supplemented with 10% FBS and 1% penicillin/streptomycin but in the absence of other antibiotics. Two days after transfection, iSLK-BAC cell lines were established and maintained in the presence of 1µg/ml puromycin, 250µg/ml G418, and 1200µg/ml hygromycin B. 5.2 Plasmids pBelo45 was constructed by replacing the fragment of pBeloBAC11 (NEB) with an EF1α-driven (pTracer, Invitrogen) GFP-IRES-HYG cassette (pL_UGIH, signaling-gateway) and KSHV genomic sequences positioned on either side of an unique PmeI site. KSHV genomic DNA on the left hand side of the insertion site was PCR amplified from rKSHV.219 using the ORF57 primer set containing the indicated restriction enzyme sites for cloning ! 83! purposes and a loxP site (Table 2). This PCR product was cloned into pSP72 via unique XhoI and EcoRI sites, resulting in pSP72A. Similarly, KSHV genomic DNA from the right hand side of the insertion site was PCR amplified using the K9 primer set and the product was introduced into pSP72A via PmeI and ClaI, resulting in pSP72B. GFP-IRES-HYG was PCR amplified from pL_UGIH using the GFP-HYG primer set. In order to place these coding sequences under the control of the EF1α promoter, the GFP-IRES-HYG PCR product was digested with SpeI and HpaI and ligated with SpeI- and PmeI-digested pTracer. The resulting plasmid, pTracer-GFP-IRES-HYG, contains the GFP-IRES-HYG coding sequence positioned downstream of the EF1α promoter. The EF1α-GFP-HYG-pA primer set was used to PCR amplify the complete selection cassette from pTracer-GFP- IRES-HYG. This PCR product was cloned into pSP72B using the unique ClaI and HpaI sites, resulting in pSP72C. The selection cassette and adjacent KSHV genomic targeting DNA were subcloned into pBeloBAC11, released from pSP72C by FspI and HpaI digestion and ligated into pBeloBAC11 using the unique SrfI and HpaI sites, resulting in pBelo45. Proper orientation of all ligation products was verified by restriction enzyme digestion and primer walking was used to completely sequence pBelo45. The sequence of the non- KSHV portion of the pBelo45 vector backbone is available in the supplemental material (Fig. S1). In order to introduce K3 or K5 coding sequences (either WT or RING-C>S versions) into the KSHV genome, we generated universal transfer constructs derived from plasmids harboring V5-His-tagged K3 or K5 coding sequences within the pTracer vector (208) using a strategy described previously (263). In brief, a positive selection marker and an adjacent I-SceI recognition site were cloned into a unique restriction site within the desired insertion sequence. An at least 40bp duplication immediately adjacent to the restriction site is included, enabling ‘scarless’ removal of the Kan cassette following I-Sce-I-mediated ! 84! cleavage. For our purposes, the Kan-in-K3 primer set was used to PCR amplify a DNA fragment containing a Kan selection cassette and an adjacent Isce-I site from pEPkan-S (263). This DNA fragment was introduced into either the pTracer K3 WT or RINGmut vector using blunt ligation via a unique EcoRV site occurring within the K3 coding sequence. A 60bp duplication of the K3 coding sequence immediately downstream of the EcoRV site was included on the 5’ end of Kan-in-K3-1 primer. An NheI digestion was used to identify clones with a correctly oriented ligation product such that the duplication flanks the intervening Kan and I-SceI sequences. A similar procedure was used to generate pTracer-K5-in and pTracer-K5-RING-C>S-in by utilizing a unique XbaI site within the parental pTracer-K5 WT and RING-C>S constructs. To construct the pK8.1-tagBFP-Kan R -pPAN-EGFP-pA insertion cassette, the PAN promoter (nt 28470-28640; GQ994935) and a KanR cassette (including an adjacent I-SceI cleavage site) were positioned adjacently by overlapping PCR and cloned into the MCS of pEGFP-N1 (Clontech) to generate pKan R -pPAN-EGFP. A primer that included the K8.1 promoter {Tang, 2004 #1096} (nt 75673-75732; GQ994935) was used to PCR amplify tagBFP (Evrogen) and clone it into the MCS of pKan R -pPAN-EGFP-pA to generate ppK8.1- tagBFP-Kan R -pPAN-EGFP-pA. This plasmid also included a 40 bp duplication of the pPAN promoter positioned in between the tagBFP and the KanR cassette, allowing scarless removal of the KanR cassette during the subsequent recombination steps in GS1783- BAC16. 5.3 BAC16 construction 219BAC virus was generated by spontaneous homologous recombination following transfection of pBelo45 linearized with PmeI into Vero cells stably carrying rKSHV.219 (53). Two days following transfection, recombinant BAC virus was selected using 400ug/mL of hygromycin. To enrich for infectious 219-BAC, hygromycin-resistant cells were treated with ! 85! 75nM Trichostatin A (TSA) and the virus-containing supernatant was used to infect naïve Vero cells and establish a new hygromycin-resistant cell line. A total of three rounds of serial propagation to naïve Vero cells were carried out to ensure that BAC clones recovered from Vero cells were infectious. 5.4 BAC DNA isolation and analysis Circular viral DNA was extracted from Vero cells using a genomic DNA isolation kit (Qiagen). 100ng of gDNA was used to electroporate E. coli DH10B (2.0kV, 200Ω, and 25µF). BAC DNA was purified from chloramphenicol-resistant colonies using an alkaline lysis procedure followed by isopropanol precipitation. Purified BAC DNA was digested with KpnI, CpoI, or SbfI and separated on 0.8% agarose gels or using pulse-field gel electrophoresis (CHEF-DR II, Biorad) with the following conditions: 1% PFGE-grade agarose, 6V/cm for 15 hours; initial and final switch times of 1 and 5 seconds, respectively; and 14°C. For Southern blot hybridization, resolved BAC-DNA fragments were transferred to a nylon membrane and hybridized with 32 P-labeled probes. Complete sequencing of BAC16 and BAC25 was performed using a Solexa sequencer and gaps were sequenced using the Sanger method. The sequence of BAC16, not including the BAC insertion, was submitted to Genbank (accession number: GQ994935). 5.5 Production of BAC16 virus stock BAC16 stocks were prepared from stable iSLK cells as previously described but using a puromycin-resistant version of these cells in order to allow selection of hygromycin- resistant BAC16-containing cells (281). Briefly, BAC16 DNA was introduced into iSLK-puro cells and selected with 1200µg/ml of hygromycin B. Stable iSLK-BAC16 cells were induced in the presence of both doxycycline (1µg/ml) and sodium butyrate (1 mM) and the absence ! 86! of hygromycin, puromycin, and G418. Four days later, supernatant was collected and cleared of cells and debris by centrifugation (950 g for 10 minutes at 4° C) and filtration (0.45 µm). Virus particles were pelleted by ultracentrifugation (25,000 g for 3 hours at 4° C) using an SW32Ti rotor. 5.6 Mutagenesis of BAC16 in GS1783 To modify the KSHV genome, BAC16 was introduced into the GS1783 E. coli strain (a kind gift from Dr. Greg Smith) by electroporation (0.1cm cuvette, 1.8kV, 200Ω, 25µF). Gene deletions were introduced as previously described (264). Briefly, PCR amplification was used to generate a linear DNA fragment containing a kanamycin resistance expression cassette, an I-SceI restriction enzyme site, and flanking sequences derived from KSHV genomic DNA, each of which include a ~40bp copy of a duplication shown in bold (Table 3). This fragment was then electroporated into GS1783 cells harboring BAC16 and transiently expressing gam, bet, and exo. These three proteins are required for homologous recombination of linear DNA fragments with a target sequence and can be expressed in a temperature-inducible manner from the lambda Red operon engineered within the endogenous GS1783 chromosome. Integration of the Kan R /I-SceI cassette was verified by PCR and restriction enzyme digestion of the purified BAC DNA. The GS1783 stain is also equipped with an arabinose-inducible gene encoding the I-SceI enzyme. Upon treatment with 1% L-arabinose, the integrated Kan R /I-SceI cassette is cleaved, resulting in a transiently linearized BAC16. A second Red-mediated recombination between the duplicated sequences results in recircularization of the BAC DNA and ‘scarless’ loss of the Kan R /I-SceI cassette. Kanamycin-sensitive colonies were screened via replica plating. The amino acid coding sequences of K3 or K5 from BAC16-WT using the DELK3 and DELK5 primer sets, respectively, to yield BAC16-ΔK3 and BAC16ΔK5 (Table 2). Similarly, the K5 ! 87! coding sequence was removed from BAC16-ΔK3 to generate BAC16-ΔK3ΔK5 lacking both coding sequences. The K3in primer set was used to amplify from the K3 and Kan portions of the pTracer-K3in or pTracer-k3-RING-C>S-in plasmids. These PCR products were introduced into BAC16-ΔK3 to yield revertant or RING-C->S mutant BAC16. Similarly, the K5in primer set was used to generate BAC16-K5rev and BAC16-K5-RING-C->S. In order to reintroduce K3 and K5 into their original genomic positions, we used the K3in and K5in primer sets and the pTracer-K3in and pTracer-K5in plasmid templates, respectively, all of which have been previously described {Brulois, 2012 #817}. For the reintroduction of K3 into the K5 locus, the pTracer-K3in template was amplified using K3- >K5loc-For and K3->K5loc-Rev. For the reintroduction of K5 into the K3 locus, the pTracer- K5in template was amplified using K5->K3loc-For and K5->K3loc-Rev. For the replacement of EGFP with mRFP1, the pEPmRFP1-in template {Tischer, 2006 #270} was amplified using the primers: mRFP1replEGFP-For and mRFP1replEGFP-Rev. The pK8.1-tagBFP- Kan R -pPAN-EGFP-pA cassette was amplified from the ppK8.1-tagBFP-Kan R -pPAN-EGFP- pA plasmid (described below) using the primers: GB-For and GB-Rev. This expression cassette was inserted next to the EF1α promoter. Primers were purchased as ultramers from Integrated DNA Technologies. 5.7 Quantification of infectious virus and KSHV DNA levels in cells Various amounts of cell-free virus supernatant were diluted in fresh medium (1ml final volume/well) and used to inoculate 293A cells that were seeded at approximately 2x10 5 cells/well in 12-well plates 12hours prior to infection. Following inoculation, plates were immediately centrifuged (2000 g for 45 min at 30 o C) and then placed back into the CO 2 incubator. One hour later, the inoculum was removed and replaced with fresh media. Cells were collected 24 hours later and washed once with cold phosphate-buffered saline ! 88! (PBS). The percentage of GFP-positive cells was determined using a FACS CantoII (BD Bioscience, San Jose, CA). Infectious units (IU) are expressed as the number of GFP positive cells in each well at the time of analysis. Purification of genomic DNA from infected cells and the quantification of KSHV DNA level were described previously (329). KSHV ORF11-specfic primers were used to quantify the amount of KSHV DNA in BAC16- transfected stable iSLK cell lines. The KSHV DNA amount was normalized to the amount of purified host cellular DNA. 5.8 Immunoblotting Cell pellets were lysed in radioimmunoprecipitation assay (RIPA) buffer. 15µg of whole cell lysate was resolved by SDS-PAGE and transferred onto a polyvinylidene difluoride membrane (Bio-Rad). The membranes were blocked using 5% nonfat milk and then probed with antibodies diluted in phosphate buffered saline with 0.1% Tween-20, pH7.4. The following primary antibodies were used: rabbit polyclonal α-K3 (52), monoclonal mouse α-K5 and α-RTA (gifts from at Koichi Yamanishi (Osaka University, Japan), monoclonal mouse α-K8 (Abcam; ab36617), monoclonal rat α-LANA (ABI; 13-210-100), β- Actin (Santa Cruz; 47778), mouse α-V5 (Invitrogen) and α-GFP (Santa Cruz; 9996). Secondary horseradish peroxidase-conjugated antibodies: α-mouse (Cell Signaling; 7076), α-rabbit (Cell Signaling; 7074) and α-rat (Santa Cruz; 2006). Chemiluminescence was detected using an LAS-4000 (GE Healthcare). 5.9 Flow cytometry 293A or iSLK cells were detached following a short (~3 minutes) incubation with 0.25% trypsin. 1x10 6 cells per sample were stained and washed in FACS buffer (PBS with 0.5% BSA and 1mM EDTA). The following antibodies were used for surface staining: α- ! 89! HLA-ABC Biotin (W6/32) and α-CD54 APC (HA58) (both from BD Bioscience, San Jose, CA) and α-HLA-ABC Alexa647 (W6/32) (Santa Cruz, Santa Cruz, CA). Following surface staining, cells were either fixed in PBS with 2% paraformaldehyde and set aside for analysis or incubated with permeabilization buffer (PBS with 0.5% BSA, 0.1% Saponin, and 0.01% sodium azide), fixed, and stained for intracellular K3 and K5 using α-V5 APC (Invitrogen). Biotin conjugates were detected using Streptavidin APC-eFluor 780 (eBioscience, San Diego, CA). In some experiments, a violet dead cell stain (Invitrogen) was used to exclude dead cells. Fluorescent protein expression and antigen staining was analyzed on an 8-color FACSCanto II flow cytometer (BD Bioscience). Data was analyzed using FlowJo v.6.4.7 software (Tree Star, Ashland, OR). 5.10 RNA isolation and qPCR Total cellular RNA was extracted with Tri reagent (Sigma) according to the manufacture's instructions. 1µg of total RNA was treated with DNase I (Sigma) and reverse transcribed by iScript cDNA Synthesis kit (Bio-Rad). cDNA was quantified using iQ SYBR green supermix (Bio-Rad) and a CFX96 qPCR machine (Bio-Rad). The relative quantification of gene expression was calculated using the comparative Ct method (2 - ΔΔ Ct ) {Schmittgen,!2008! #1095} and 18S RNA was used as a reference. RT-PCR graphs were made based on the average of at least two experiments. ! ! 90! Table 2 Primer Name Sequence Generation of pBelo45 ORF57-1 CCGCTCGAGCGGTGCGCAATAACTTCGTATAATGTATGCTATACGAAGTTATCTGGTGGCGGTCTGGTG ORF57-2 GAATTCCCGGCGCGCCGTTTAAACATGATAATTGACGGTGAGAGCCCCCGC K9-1 AGCTTTGTTTAAACATGGACCCAGGCCAAAGACCGAACCCTTTTGGGGCGCC K9-2 ATCGATGTGGCACCCAACATCCATTATGGAAAAACCCCGCGCCACCTTCCGCC GFP-HYG-1 GGACTAGTGCCACCATGGTGAGCAAGGGCGAGGAGCT GFP-HYG-2 GTTAACCTATTCCTTTGCCCTCGGACGAGTGCTGGGGCGT EF1a-GFP-HYG-pA-1 CCATCGATATAACTTCGTATAATGTATGCTATACGAAGTTATGCTCCGGTGCCCGTCAGTGGGCAGAGCG EF1a-GFP-HYG-pA-2 GTTAACCATAGAGCCCACCGCATCCCCAGCATGCCTGCTATTGTCTTCC Generation of BAC16 mutants Kan-in-K3-1 ATCCTTCCACAGGGTTTGCCTGGGGGTGGCTATGGTTCCATGGGCGTGATTAGGAAACGTTAGGGATAACAGGGTAATC GATTTATTC Kan-in-K3-2 TGCTAGCCAGTGTTACAACCAATTAACC Kan-in-K5-1 CCCTCTAGAACCGTTGTTTTTTGGATGATTTTTCCGCACCGGCTTTTTTGTGGGCGCGCATAGTGCTAGCCAGTGTTACA ACCAATTAAC Kan-in-K5-2 GGTTCTAGATAGGGATAACAGGGTAATCGATTTATTC DELK3-1 GGGTTAATGCCATGTTTTATTGTGGGTTCTCTCTCAGGATAAGTATATAAGAGCACACTGAGGATGACGACGATAAGTAG GG DELK3-2 GGTAAACACCACCAACCACACAGTGTGCTCTTATATACTTATCCTGAGAGAGAACCCACACAACCAATTAACCAATTCTGA TTAG DELK5-1 GGGCGTCACGTCACATATCTCTGTGCACCCAAGTGGTTGTCTCTGCAGCTGGGGTGGAAGAGGATGACGACGATAAGTA GGG DELK5-2 TCCCCTTTCCCTTTTTCAGACTTCCACCCCAGCTGCAGAGACAACCACTTGGGTGCACAGCAACCAATTAACCAATTCTG ATTAG K3in-1 CGAGGGTATAGGTAAACACCACCAACCACACAGTGTGCTCTTATATACTTTCAATGGTGATGGTGATGATGACCGGTACG CGTAG K3in-2 CACTTGTTGCAGGGGTTAATGCCATGTTTTATTGTGGGTTCTCTCTCAGGATATGGAAGATGAGGATGTTCCTGTCTG K5in-1 GGTGCATAACACCCAGGGCGTCACGTCACATATCTCTGTGCACCCAAGTGGTTGTTCAATGGTGATGGTGATGATGACC GGTAC K5in-2 CACTCTGCTCACCTCCCCTTTCCCTTTTTCAGACTTCCACCCCAGCTGCAGAGATGGCGTCTAAGGACGTAGAAGAGG K3-K5loc-For CACTCTGCTCACCTCCCCTTTCCCTTTTTCAGACTTCCACCCCAGCTGCAGAGATGGAAGATGAGGATGTTCCTGTCTG K3->K5loc-Rev GGTGCATAACACCCAGGGCGTCACGTCACATATCTCTGTGCACCCAAGTGGTTGTTCAATGGTGATGGTGATGATGACC GGTACGCGTAG K5->K3loc-For CACTTGTTGCAGGGGTTAATGCCATGTTTTATTGTGGGTTCTCTCTCAGGATATGGCGTCTAAGGACGTAGAAGAGG K5->K3loc-Rev CGAGGGTATAGGTAAACACCACCAACCACACAGTGTGCTCTTATATACTTTCAATGGTGATGGTGATGATGACCGGTAC Generation of RGB-BAC16 mRFP1replEGFP-For TGGTACCGAGCTCGGATCCACTAGTCCGCCACCATATGGCCTCCTCCGAGGACGTCATCAAGGAGT mRFP1replEGFP-Rev GGGGGAGGGAGAGGGGCGGAATTCCTCTAGTGCGGCCGAGTCGCGGCCGCTTCTTGTACAAGGCGC GB-For GTGGGCGATGTGCGCTCTGCCCACTGACGGGCACCGGAGCGCTTCGAATTCCGGCAGCAATA GB-Rev GTTGGGTGCCACATAACTTCGTATAATGTATGCTATACGAAGTTATCCACAACTAGAATGCAGTGA qPCR ORF11-For GGCACCCATACAGCTTCTACGA ORF11-Rev CGTTTACTACTGCACACTGCA HS1-For TTCCTATTTGCCAAGGCAGT HS1-Rev CTCTTCAGCCATCCCAAGAC 18S-For TTCGAACGTCTGCCCTATCAA 18S-Rev GATGTGGTAGCCGTTTCTCAGG K3-For TCCTGGTAAGTCAGCCGAGGCA ! 91! K3-Rev GGAAATGAGAGATTTAGAGCCT K5-For TAAGCACTTGGCTAACAGTGT K5-Rev GGCCACAGGTTAAGGCGACT K2-For TCACTGCGGGTTAATAGGATTT K2-Rev CATGACGTCCACGTTTATCACT RTA-For TTGCCAAGTTTGTACAACTGCT RTA-Rev ACCTTGCAAAGACCATTCAGAT ! 92! References 1.! Chang!Y,!Cesarman!E,!Pessin!MS,!Lee!F,!Culpepper!J,!Knowles!DM,!Moore! PS.!1994.!Identification!of!herpesvirusOlike!DNA!sequences!in!AIDSOassociated! Kaposi's!sarcoma.!Science!266:1865O1869.! 2.! Bergonzini!V,!Salata!C,!Calistri!A,!Parolin!C,!Palu!G.!2010.!View!and!review!on! viral!oncology!research.!Infect!Agent!Cancer!5:11.! 3.! Mesri!EA,!Cesarman!E,!Boshoff!C.!2011.!Kaposi's!sarcoma!and!its!associated! herpesvirus.!Nat!Rev!Cancer!10:707O719.! 4.! Schulz!TF.!1999.!Epidemiology!of!Kaposi's!sarcomaOassociated! herpesvirus/human!herpesvirus!8.!Adv!Cancer!Res!76:121O160.! 5.! Dupin!N,!Grandadam!M,!Calvez!V,!Gorin!I,!Aubin!JT,!Havard!S,!Lamy!F,! Leibowitch!M,!Huraux!JM,!Escande!JP,!et!al.!1995.!HerpesvirusOlike!DNA! sequences!in!patients!with!Mediterranean!Kaposi's!sarcoma.!Lancet!345:761O 762.! 6.! Boshoff!C,!Whitby!D,!Hatziioannou!T,!Fisher!C,!van!der!Walt!J,!Hatzakis!A,! Weiss!R,!Schulz!T.!1995.!Kaposi'sOsarcomaOassociated!herpesvirus!in!HIVO negative!Kaposi's!sarcoma.!Lancet!345:1043O1044.! 7.! Cesarman!E,!Chang!Y,!Moore!PS,!Said!JW,!Knowles!DM.!1995.!Kaposi's! sarcomaOassociated!herpesvirusOlike!DNA!sequences!in!AIDSOrelated!bodyO cavityObased!lymphomas.!The!New!England!journal!of!medicine!332:1186O 1191.! 8.! Engels!EA,!Pfeiffer!RM,!Goedert!JJ,!Virgo!P,!McNeel!TS,!Scoppa!SM,!Biggar! RJ,!Study!HACM.!2006.!Trends!in!cancer!risk!among!people!with!AIDS!in!the! United!States!1980O2002.!AIDS!20:1645O1654.! 9.! ,!posting!date.!International!Committee!onTaxonomy!of!Viruses.![Online.] ! 10.! Davison!AJ,!Eberle!R,!Ehlers!B,!Hayward!GS,!McGeoch!DJ,!Minson!AC,!Pellett! PE,!Roizman!B,!Studdert!MJ,!Thiry!E.!2009.!The!order!Herpesvirales.!Arch! Virol!154:171O177.! 11.! Davison!AJ.!2010.!Herpesvirus!systematics.!Veterinary!microbiology!143:52O 69.! 12.! Neipel!F,!Albrecht!JC,!Fleckenstein!B.!1997.!CellOhomologous!genes!in!the! Kaposi's!sarcomaOassociated!rhadinovirus!human!herpesvirus!8:!determinants! of!its!pathogenicity?!J!Virol!71:4187O4192.! 13.! Damania!B.!2004.!Oncogenic!gamma Oherpesviruses:!comparison!of!viral! proteins!involved!in!tumorigenesis.!Nat!Rev!Microbiol!2:656O668.! 14.! Damania!B.!2007.!DNA!tumor!viruses!and!human!cancer.!Trends!Microbiol! 15:38O44.! 15.! Renne!R,!Lagunoff!M,!Zhong!W,!Ganem!D.!1996.!The!size!and!conformation!of! Kaposi's!sarcomaOassociated!herpesvirus!(human!herpesvirus!8)!DNA!in! infected!cells!and!virions.!J!Virol!70:8151O8154.! 16.! Russo!JJ,!Bohenzky!RA,!Chien!MC,!Chen!J,!Yan!M,!Maddalena!D,!Parry!JP,! Peruzzi!D,!Edelman!IS,!Chang!Y,!Moore!PS.!1996.!Nucleotide!sequence!of!the! ! 93! Kaposi!sarcomaOassociated!herpesvirus!(HHV8).!Proc!Natl!Acad!Sci!U!S!A! 93:14862O14867.! 17.! Yakushko!Y,!Hackmann!C,!Gunther!T,!Ruckert!J,!Henke!M,!Koste!L,! Alkharsah!K,!Bohne!J,!Grundhoff!A,!Schulz!TF,!Henke@Gendo!C.!2011.! Kaposi's!sarcomaOassociated!herpesvirus!bacterial!artificial!chromosome! contains!a!duplication!of!a!long!uniqueOregion!fragment!within!the!terminal! repeat!region.!Journal!of!Virology!85:4612O4617.! 18.! Judde!JG,!Lacoste!V,!Briere!J,!Kassa@Kelembho!E,!Clyti!E,!Couppie!P,! Buchrieser!C,!Tulliez!M,!Morvan!J,!Gessain!A.!2000.!Monoclonality!or! oligoclonality!of!human!herpesvirus!8!terminal!repeat!sequences!in!Kaposi's! sarcoma!and!other!diseases.!Journal!of!the!National!Cancer!Institute!92:729O 736.! 19.! Duprez!R,!Lacoste!V,!Briere!J,!Couppie!P,!Frances!C,!Sainte@Marie!D,!Kassa@ Kelembho!E,!Lando!MJ,!Essame!Oyono!JL,!Nkegoum!B,!Hbid!O,!Mahe!A,! Lebbe!C,!Tortevoye!P,!Huerre!M,!Gessain!A.!2007.!Evidence!for!a!multiclonal! origin!of!multicentric!advanced!lesions!of!Kaposi!sarcoma.!Journal!of!the! National!Cancer!Institute!99:1086O1094.! 20.! Lee!HR,!Brulois!K,!Wong!L,!Jung!JU.!2012.!Modulation!of!Immune!System!by! Kaposi's!SarcomaOAssociated!Herpesvirus:!Lessons!from!Viral!Evasion! Strategies.!Front!Microbiol!3:44.! 21.! Nicholas!J,!Zong!JC,!Alcendor!DJ,!Ciufo!DM,!Poole!LJ,!Sarisky!RT,!Chiou!CJ,! Zhang!X,!Wan!X,!Guo!HG,!Reitz!MS,!Hayward!GS.!1998.!Novel!organizational! features,!captured!cellular!genes,!and!strain!variability!within!the!genome!of! KSHV/HHV8.!J!Natl!Cancer!Inst!Monogr:79O88.! 22.! Bruce!AG,!Ryan!JT,!Thomas!MJ,!Peng!X,!Grundhoff!A,!Tsai!CC,!Rose!TM.! 2013.!NextOgeneration!sequence!analysis!of!the!genome!of!RFHVMn,!the! macaque!homolog!of!Kaposi's!sarcoma!(KS)Oassociated!herpesvirus,!from!a!KSO like!tumor!of!a!pigOtailed!macaque.!J!Virol!87:13676O13693.! 23.! Poole!LJ,!Zong!JC,!Ciufo!DM,!Alcendor!DJ,!Cannon!JS,!Ambinder!R,!Orenstein! JM,!Reitz!MS,!Hayward!GS.!1999.!Comparison!of!genetic!variability!at!multiple! loci!across!the!genomes!of!the!major!subtypes!of!Kaposi's!sarcomaOassociated! herpesvirus!reveals!evidence!for!recombination!and!for!two!distinct!types!of! open!reading!frame!K15!alleles!at!the!rightOhand!end.!J!Virol!73:6646O6660.! 24.! Zong!JC,!Ciufo!DM,!Alcendor!DJ,!Wan!X,!Nicholas!J,!Browning!PJ,!Rady!PL,! Tyring!SK,!Orenstein!JM,!Rabkin!CS,!Su!IJ,!Powell!KF,!Croxson!M,!Foreman! KE,!Nickoloff!BJ,!Alkan!S,!Hayward!GS.!1999.!HighOlevel!variability!in!the!ORF O K1!membrane!protein!gene!at!the!left!end!of!the!Kaposi's!sarcomaOassociated! herpesvirus!genome!defines!four!major!virus!subtypes!and!multiple!variants!or! clades!in!different!human!populations.!J!Virol!73:4156O4170.! 25.! Zhang!D,!Pu!X,!Wu!W,!Jin!Y,!Juhear!M,!Wu!X.!2008.!Genotypic!analysis!on!the! ORF OK1!gene!of!human!herpesvirus!8!from!patients!with!Kaposi's!sarcoma!in! Xinjiang,!China.!Journal!of!genetics!and!genomics!=!Yi!chuan!xue!bao!35:657O 663.! 26.! Zhang!YJ,!Deng!JH,!Rabkin!C,!Gao!SJ.!2000.!HotOspot!variations!of!Kaposi's! sarcomaOassociated!herpesvirus!latent!nuclear!antigen!and!application!in! genotyping!by!PCRORFLP.!J!Gen!Virol!81:2049O2058.! ! 94! 27.! Choi!JK,!Lee!BS,!Shim!SN,!Li!M,!Jung!JU.!2000.!Identification!of!the!novel!K15! gene!at!the!rightmost!end!of!the!Kaposi's!sarcomaOassociated!herpesvirus! genome.!J!Virol!74:436O446.! 28.! Mancuso!R,!Biffi!R,!Valli!M,!Bellinvia!M,!Tourlaki!A,!Ferrucci!S,!Brambilla!L,! Delbue!S,!Ferrante!P,!Tinelli!C,!Clerici!M.!2008.!HHV8!a!subtype!is!associated! with!rapidly!evolving!classic!Kaposi's!sarcoma.!J!Med!Virol!80:2153O2160.! 29.! Matteoli!B,!Broccolo!F,!Scaccino!A,!Cottoni!F,!Angeloni!A,!Faggioni!A,! Ceccherini@Nelli!L.!2012.!In!vivo!and!in!vitro!evidence!for!an!association! between!the!routeOspecific!transmission!of!HHVO8!and!the!virus!genotype.!J!Med! Virol!84:786O791.! 30.! Verma!SC,!Lan!K,!Robertson!E.!2007.!Structure!and!function!of!latencyO associated!nuclear!antigen.!Curr!Top!Microbiol!Immunol!312:101O136.! 31.! Cai!X,!Lu!S,!Zhang!Z,!Gonzalez!CM,!Damania!B,!Cullen!BR.!2005.!Kaposi's! sarcomaOassociated!herpesvirus!expresses!an!array!of!viral!microRNAs!in! latently!infected!cells.!Proc!Natl!Acad!Sci!U!S!A!102:5570O5575.! 32.! Gottwein!E.!2012.!Kaposi's!SarcomaOAssociated!Herpesvirus!microRNAs.!Front! Microbiol!3:165.! 33.! Dittmer!D,!Lagunoff!M,!Renne!R,!Staskus!K,!Haase!A,!Ganem!D.!1998.!A! cluster!of!latently!expressed!genes!in!Kaposi's!sarcomaOassociated!herpesvirus.! J!Virol!72:8309O8315.! 34.! Cai!X,!Cullen!BR.!2006.!Transcriptional!origin!of!Kaposi's!sarcomaOassociated! herpesvirus!microRNAs.!J!Virol!80:2234O2242.! 35.! Rivas!C,!Thlick!AE,!Parravicini!C,!Moore!PS,!Chang!Y.!2001.!Kaposi's! sarcomaOassociated!herpesvirus!LANA2!is!a!BOcellOspecific!latent!viral!protein! that!inhibits!p53.!J!Virol!75:429O438.! 36.! Chandriani!S,!Ganem!D.!2010.!ArrayObased!transcript!profiling!and!limitingO dilution!reverse!transcriptionOPCR!analysis!identify!additional!latent!genes!in! Kaposi's!sarcomaOassociated!herpesvirus.!J!Virol!84:5565O5573.! 37.! Toth!Z,!Maglinte!DT,!Lee!SH,!Lee!HR,!Wong!LY,!Brulois!KF,!Lee!S,!Buckley! JD,!Laird!PW,!Marquez!VE,!Jung!JU.!2010.!Epigenetic!analysis!of!KSHV!latent! and!lytic!genomes.!PLoS!Pathog!6:e1001013.! 38.! Lieberman!PM.!2013.!Keeping!it!quiet:!chromatin!control!of! gammaherpesvirus!latency.!Nat!Rev!Microbiol!11:863O875.! 39.! Ballestas!ME,!Chatis!PA,!Kaye!KM.!1999.!Efficient!persistence!of! extrachromosomal!KSHV!DNA!mediated!by!latencyOassociated!nuclear!antigen.! Science!284:641O644.! 40.! Li!M,!Lee!H,!Yoon!DW,!Albrecht!JC,!Fleckenstein!B,!Neipel!F,!Jung!JU.!1997.! Kaposi's!sarcomaOassociated!herpesvirus!encodes!a!functional!cyclin.!J!Virol! 71:1984O1991.! 41.! Liu!L,!Eby!MT,!Rathore!N,!Sinha!SK,!Kumar!A,!Chaudhary!PM.!2002.!The! human!herpes!virus!8Oencoded!viral!FLICE!inhibitory!protein!physically! associates!with!and!persistently!activates!the!Ikappa!B!kinase!complex.!J!Biol! Chem!277:13745O13751.! 42.! McCormick!C,!Ganem!D.!2005.!The!kaposin!B!protein!of!KSHV!activates!the! p38/MK2!pathway!and!stabilizes!cytokine!mRNAs.!Science!307:739O741.! ! 95! 43.! Bellare!P,!Ganem!D.!2009.!Regulation!of!KSHV!lytic!switch!protein!expression! by!a!virusOencoded!microRNA:!an!evolutionary!adaptation!that!fineOtunes!lytic! reactivation.!Cell!Host!&!Microbe!6:570O575.! 44.! Lei!X,!Bai!Z,!Ye!F,!Xie!J,!Kim!CG,!Huang!Y,!Gao!SJ.!2010.!Regulation!of!NFO kappaB!inhibitor!IkappaBalpha!and!viral!replication!by!a!KSHV!microRNA.! Nature!cell!biology!12:193O199.! 45.! Asahi@Ozaki!Y,!Sato!Y,!Kanno!T,!Sata!T,!Katano!H.!2006.!Quantitative!analysis! of!Kaposi!sarcomaOassociated!herpesvirus!(KSHV)!in!KSHVOassociated!diseases.! J!Infect!Dis!193:773O782.! 46.! Ye!FC,!Zhou!FC,!Yoo!SM,!Xie!JP,!Browning!PJ,!Gao!SJ.!2004.!Disruption!of! Kaposi's!sarcomaOassociated!herpesvirus!latent!nuclear!antigen!leads!to! abortive!episome!persistence.!J!Virol!78:11121O11129.! 47.! Ballestas!ME,!Kaye!KM.!2001.!Kaposi's!sarcomaOassociated!herpesvirus! latencyOassociated!nuclear!antigen!1!mediates!episome!persistence!through!cisO acting!terminal!repeat!(TR)!sequence!and!specifically!binds!TR!DNA.!J!Virol! 75:3250O3258.! 48.! Cotter!MA,!2nd,!Robertson!ES.!1999.!The!latencyOassociated!nuclear!antigen! tethers!the!Kaposi's!sarcomaOassociated!herpesvirus!genome!to!host! chromosomes!in!body!cavityObased!lymphoma!cells.!Virology!264:254O264.! 49.! Cotter!MA,!2nd,!Subramanian!C,!Robertson!ES.!2001.!The!Kaposi's!sarcomaO associated!herpesvirus!latencyOassociated!nuclear!antigen!binds!to!specific! sequences!at!the!left!end!of!the!viral!genome!through!its!carboxyOterminus.! Virology!291:241O259.! 50.! Verma!SC,!Lu!J,!Cai!Q,!Kosiyatrakul!S,!McDowell!ME,!Schildkraut!CL,! Robertson!ES.!2011.!Single!molecule!analysis!of!replicated!DNA!reveals!the! usage!of!multiple!KSHV!genome!regions!for!latent!replication.!PLoS!Pathog! 7:e1002365.! 51.! Domsic!JF,!Chen!HS,!Lu!F,!Marmorstein!R,!Lieberman!PM.!2013.!Molecular! basis!for!oligomericODNA!binding!and!episome!maintenance!by!KSHV!LANA.! PLoS!Pathog!9:e1003672.! 52.! Grundhoff!A,!Ganem!D.!2004.!Inefficient!establishment!of!KSHV!latency! suggests!an!additional!role!for!continued!lytic!replication!in!Kaposi!sarcoma! pathogenesis.!J!Clin!Invest!113:124O136.! 53.! Vieira!J,!O'Hearn!PM.!2004.!Use!of!the!red!fluorescent!protein!as!a!marker!of! Kaposi's!sarcomaOassociated!herpesvirus!lytic!gene!expression.!Virology! 325:225O240.! 54.! Jin!Y,!He!Z,!Liang!D,!Zhang!Q,!Zhang!H,!Deng!Q,!Robertson!ES,!Lan!K.!2012.! CarboxylOterminal!amino!acids!1052!to!1082!of!the!latencyOassociated!nuclear! antigen!(LANA)!interact!with!RBPOJkappa!and!are!responsible!for!LANAO mediated!RTA!repression.!J!Virol!86:4956O4969.! 55.! Li!Q,!Zhou!F,!Ye!F,!Gao!SJ.!2008.!Genetic!disruption!of!KSHV!major!latent! nuclear!antigen!LANA!enhances!viral!lytic!transcriptional!program.!Virology! 379:234O244.! 56.! Lan!K,!Kuppers!DA,!Robertson!ES.!2005.!Kaposi's!sarcomaOassociated! herpesvirus!reactivation!is!regulated!by!interaction!of!latencyOassociated! nuclear!antigen!with!recombination!signal!sequenceObinding!protein!Jkappa,!the! ! 96! major!downstream!effector!of!the!Notch!signaling!pathway.!J!Virol!79:3468O 3478.! 57.! Sun!R,!Lin!SF,!Gradoville!L,!Yuan!Y,!Zhu!F,!Miller!G.!1998.!A!viral!gene!that! activates!lytic!cycle!expression!of!Kaposi's!sarcomaOassociated!herpesvirus.! Proc!Natl!Acad!Sci!U!S!A!95:10866O10871.! 58.! Zhu!FX,!Cusano!T,!Yuan!Y.!1999.!Identification!of!the!immediateOearly! transcripts!of!Kaposi's!sarcomaOassociated!herpesvirus.!J!Virol!73:5556O5567.! 59.! Rimessi!P,!Bonaccorsi!A,!Sturzl!M,!Fabris!M,!Brocca@Cofano!E,!Caputo!A,! Melucci@Vigo!G,!Falchi!M,!Cafaro!A,!Cassai!E,!Ensoli!B,!Monini!P.!2001.! Transcription!pattern!of!human!herpesvirus!8!open!reading!frame!K3!in! primary!effusion!lymphoma!and!Kaposi's!sarcoma.!Journal!of!Virology!75:7161O 7174.! 60.! Taylor!JL,!Bennett!HN,!Snyder!BA,!Moore!PS,!Chang!Y.!2005.!Transcriptional! analysis!of!latent!and!inducible!Kaposi's!sarcomaOassociated!herpesvirus! transcripts!in!the!K4!to!K7!region.!J!Virol!79:15099O15106.! 61.! Lin!CL,!Li!H,!Wang!Y,!Zhu!FX,!Kudchodkar!S,!Yuan!Y.!2003.!Kaposi's!sarcomaO associated!herpesvirus!lytic!origin!(oriOLyt)Odependent!DNA!replication:! identification!of!the!oriOLyt!and!association!of!K8!bZip!protein!with!the!origin.!J! Virol!77:5578O5588.! 62.! Wang!Y,!Li!H,!Chan!MY,!Zhu!FX,!Lukac!DM,!Yuan!Y.!2004.!Kaposi's!sarcomaO associated!herpesvirus!oriOLytOdependent!DNA!replication:!cisOacting! requirements!for!replication!and!oriOLytOassociated!RNA!transcription.!J!Virol! 78:8615O8629.! 63.! Wang!Y,!Tang!Q,!Maul!GG,!Yuan!Y.!2006.!Kaposi's!sarcomaOassociated! herpesvirus!oriOLytOdependent!DNA!replication:!dual!role!of!replication!and! transcription!activator.!J!Virol!80:12171O12186.! 64.! Wang!Y,!Li!H,!Tang!Q,!Maul!GG,!Yuan!Y.!2008.!Kaposi's!sarcomaOassociated! herpesvirus!oriOLytOdependent!DNA!replication:!involvement!of!host!cellular! factors.!J!Virol!82:2867O2882.! 65.! Xu!Y,!Rodriguez@Huete!A,!Pari!GS.!2006.!Evaluation!of!the!lytic!origins!of! replication!of!Kaposi's!sarcomaOassociated!virus/human!herpesvirus!8!in!the! context!of!the!viral!genome.!J!Virol!80:9905O9909.! 66.! Renne!R,!Zhong!W,!Herndier!B,!McGrath!M,!Abbey!N,!Kedes!D,!Ganem!D.! 1996.!Lytic!growth!of!Kaposi's!sarcomaOassociated!herpesvirus!(human! herpesvirus!8)!in!culture.!Nat!Med!2:342O346.! 67.! Lu!F,!Zhou!J,!Wiedmer!A,!Madden!K,!Yuan!Y,!Lieberman!PM.!2003.! Chromatin!remodeling!of!the!Kaposi's!sarcomaOassociated!herpesvirus!ORF50! promoter!correlates!with!reactivation!from!latency.!J!Virol!77:11425O11435.! 68.! Davis!DA,!Rinderknecht!AS,!Zoeteweij!JP,!Aoki!Y,!Read@Connole!EL,!Tosato! G,!Blauvelt!A,!Yarchoan!R.!2001.!Hypoxia!induces!lytic!replication!of!Kaposi! sarcomaOassociated!herpesvirus.!Blood!97:3244O3250.! 69.! Haque!M,!Davis!DA,!Wang!V,!Widmer!I,!Yarchoan!R.!2003.!Kaposi's!sarcomaO associated!herpesvirus!(human!herpesvirus!8)!contains!hypoxia!response! elements:!relevance!to!lytic!induction!by!hypoxia.!J!Virol!77:6761O6768.! 70.! Kati!S,!Tsao!EH,!Gunther!T,!Weidner@Glunde!M,!Rothamel!T,!Grundhoff!A,! Kellam!P,!Schulz!TF.!2013.!Activation!of!the!B!cell!antigen!receptor!triggers! ! 97! reactivation!of!latent!Kaposi's!sarcomaOassociated!herpesvirus!in!B!cells.!J!Virol! 87:8004O8016.! 71.! Lai!IY,!Farrell!PJ,!Kellam!P.!2011.!XObox!binding!protein!1!induces!the! expression!of!the!lytic!cycle!transactivator!of!Kaposi's!sarcomaOassociated! herpesvirus!but!not!EpsteinOBarr!virus!in!coOinfected!primary!effusion! lymphoma.!J!Gen!Virol!92:421O431.! 72.! Gregory!SM,!West!JA,!Dillon!PJ,!Hilscher!C,!Dittmer!DP,!Damania!B.!2009.! TollOlike!receptor!signaling!controls!reactivation!of!KSHV!from!latency.!Proc! Natl!Acad!Sci!U!S!A!106:11725O11730.! 73.! Brown!HJ,!Song!MJ,!Deng!H,!Wu!TT,!Cheng!G,!Sun!R.!2003.!NFOkappaB! inhibits!gammaherpesvirus!lytic!replication.!J!Virol!77:8532O8540.! 74.! Prasad!A,!Lu!M,!Lukac!DM,!Zeichner!SL.!2012.!An!alternative!Kaposi's! sarcomaOassociated!herpesvirus!replication!program!triggered!by!host!cell! apoptosis.!J!Virol!86:4404O4419.! 75.! Varthakavi!V,!Browning!PJ,!Spearman!P.!1999.!Human!immunodeficiency! virus!replication!in!a!primary!effusion!lymphoma!cell!line!stimulates!lyticOphase! replication!of!Kaposi's!sarcomaOassociated!herpesvirus.!J!Virol!73:10329O 10338.! 76.! Vieira!J,!O'Hearn!P,!Kimball!L,!Chandran!B,!Corey!L.!2001.!Activation!of! Kaposi's!sarcomaOassociated!herpesvirus!(human!herpesvirus!8)!lytic! replication!by!human!cytomegalovirus.!J!Virol!75:1378O1386.! 77.! Zoeteweij!JP,!Eyes!ST,!Orenstein!JM,!Kawamura!T,!Wu!L,!Chandran!B,! Forghani!B,!Blauvelt!A.!1999.!Identification!and!rapid!quantification!of!earlyO! and!lateOlytic!human!herpesvirus!8!infection!in!single!cells!by!flow!cytometric! analysis:!characterization!of!antiherpesvirus!agents.!J!Virol!73:5894O5902.! 78.! Adang!LA,!Parsons!CH,!Kedes!DH.!2006.!Asynchronous!progression!through! the!lytic!cascade!and!variations!in!intracellular!viral!loads!revealed!by!highO throughput!singleOcell!analysis!of!Kaposi's!sarcomaOassociated!herpesvirus! infection.!Journal!of!Virology!80:10073O10082.! 79.! Chang!H,!Dittmer!DP,!Shin!YC,!Hong!Y,!Jung!JU.!2005.!Role!of!Notch!signal! transduction!in!Kaposi's!sarcomaOassociated!herpesvirus!gene!expression.!J! Virol!79:14371O14382.! 80.! Chang!H.!2006.!Notch!signal!transduction!induces!a!novel!profile!of!Kaposi's! sarcomaOassociated!herpesvirus!gene!expression.!Journal!of!microbiology! 44:217O225.! 81.! Chang!HH,!Ganem!D.!2013.!A!unique!herpesviral!transcriptional!program!in! KSHVOinfected!lymphatic!endothelial!cells!leads!to!mTORC1!activation!and! rapamycin!sensitivity.!Cell!Host!Microbe!13:429O440.! 82.! Yogev!O,!Boshoff!C.!2013.!Redefining!KSHV!latency.!Cell!Host!Microbe!13:373O 374.! 83.! Krishnan!HH,!Naranatt!PP,!Smith!MS,!Zeng!L,!Bloomer!C,!Chandran!B.!2004.! Concurrent!expression!of!latent!and!a!limited!number!of!lytic!genes!with! immune!modulation!and!antiapoptotic!function!by!Kaposi's!sarcomaOassociated! herpesvirus!early!during!infection!of!primary!endothelial!and!fibroblast!cells! and!subsequent!decline!of!lytic!gene!expression.!J!Virol!78:3601O3620.! ! 98! 84.! Toth!Z,!Brulois!K,!Lee!HR,!Izumiya!Y,!Tepper!C,!Kung!HJ,!Jung!JU.!2013.! Biphasic!euchromatinOtoOheterochromatin!transition!on!the!KSHV!genome! following!de!novo!infection.!PLoS!Pathog!9:e1003813.! 85.! Ambroziak!JA,!Blackbourn!DJ,!Herndier!BG,!Glogau!RG,!Gullett!JH,! McDonald!AR,!Lennette!ET,!Levy!JA.!1995.!HerpesOlike!sequences!in!HIVO infected!and!uninfected!Kaposi's!sarcoma!patients.!Science!268:582O583.! 86.! Hassman!LM,!Ellison!TJ,!Kedes!DH.!2011.!KSHV!infects!a!subset!of!human! tonsillar!B!cells,!driving!proliferation!and!plasmablast!differentiation.!J!Clin! Invest!121:752O768.! 87.! Myoung!J,!Ganem!D.!2011.!Active!lytic!infection!of!human!primary!tonsillar!B! cells!by!KSHV!and!its!noncytolytic!control!by!activated!CD4+!T!cells.!J!Clin!Invest! 121:1130O1140.! 88.! Blackbourn!DJ,!Lennette!E,!Klencke!B,!Moses!A,!Chandran!B,!Weinstein!M,! Glogau!RG,!Witte!MH,!Way!DL,!Kutzkey!T,!Herndier!B,!Levy!JA.!2000.!The! restricted!cellular!host!range!of!human!herpesvirus!8.!AIDS!14:1123O1133.! 89.! Wu!W,!Vieira!J,!Fiore!N,!Banerjee!P,!Sieburg!M,!Rochford!R,!Harrington!W,! Jr.,!Feuer!G.!2006.!KSHV/HHVO8!infection!of!human!hematopoietic!progenitor! (CD34+)!cells:!persistence!of!infection!during!hematopoiesis!in!vitro!and!in!vivo.! Blood!108:141O151.! 90.! Parsons!CH,!Adang!LA,!Overdevest!J,!O'Connor!CM,!Taylor!JR,!Jr.,!Camerini! D,!Kedes!DH.!2006.!KSHV!targets!multiple!leukocyte!lineages!during!longOterm! productive!infection!in!NOD/SCID!mice.!J!Clin!Invest! 116:1963O1973.! 91.! Wang!LX,!Kang!G,!Kumar!P,!Lu!W,!Li!Y,!Zhou!Y,!Li!Q,!Wood!C.!2014.! HumanizedOBLT!mouse!model!of!Kaposi's!sarcomaOassociated!herpesvirus! infection.!Proc!Natl!Acad!Sci!U!S!A.! 92.! Chang!H,!Wachtman!LM,!Pearson!CB,!Lee!JS,!Lee!HR,!Lee!SH,!Vieira!J,! Mansfield!KG,!Jung!JU.!2009.!NonOhuman!primate!model!of!Kaposi's!sarcomaO associated!herpesvirus!infection.!PLoS!Pathog!5:e1000606.! 93.! Dupin!N,!Fisher!C,!Kellam!P,!Ariad!S,!Tulliez!M,!Franck!N,!van!Marck!E,! Salmon!D,!Gorin!I,!Escande!JP,!Weiss!RA,!Alitalo!K,!Boshoff!C.!1999.! Distribution!of!human!herpesvirusO8!latently!infected!cells!in!Kaposi's!sarcoma,! multicentric!Castleman's!disease,!and!primary!effusion!lymphoma.!Proc!Natl! Acad!Sci!U!S!A!96:4546O4551.! 94.! Wang!HW,!Trotter!MW,!Lagos!D,!Bourboulia!D,!Henderson!S,!Makinen!T,! Elliman!S,!Flanagan!AM,!Alitalo!K,!Boshoff!C.!2004.!Kaposi!sarcoma! herpesvirusOinduced!cellular!reprogramming!contributes!to!the!lymphatic! endothelial!gene!expression!in!Kaposi!sarcoma.!Nat!Genet!36:687O693.! 95.! Hong!YK,!Foreman!K,!Shin!JW,!Hirakawa!S,!Curry!CL,!Sage!DR,!Libermann! T,!Dezube!BJ,!Fingeroth!JD,!Detmar!M.!2004.!Lymphatic!reprogramming!of! blood!vascular!endothelium!by!Kaposi!sarcomaOassociated!herpesvirus.!Nat! Genet!36:683O685.! 96.! Blasig!C,!Zietz!C,!Haar!B,!Neipel!F,!Esser!S,!Brockmeyer!NH,!Tschachler!E,! Colombini!S,!Ensoli!B,!Sturzl!M.!1997.!Monocytes!in!Kaposi's!sarcoma!lesions! are!productively!infected!by!human!herpesvirus!8.!J!Virol!71:7963O7968.! ! 99! 97.! Myoung!J,!Ganem!D.!2011.!Active!lytic!infection!of!human!primary!tonsillar!B! cells!by!KSHV!and!its!noncytolytic!control!by!activated!CD4+!T!cells.!The!Journal! of!clinical!investigation!121:1130O1140.! 98.! West!JA,!Gregory!SM,!Sivaraman!V,!Su!L,!Damania!B.!2011.!Activation!of! plasmacytoid!dendritic!cells!by!Kaposi's!sarcomaOassociated!herpesvirus.!J!Virol! 85:895O904.! 99.! Myoung!J,!Ganem!D.!2011.!Infection!of!lymphoblastoid!cell!lines!by!Kaposi's! sarcomaOassociated!herpesvirus:!critical!role!of!cellOassociated!virus.!J!Virol! 85:9767O9777.! 100.! Dollery!SJ,!Santiago@Crespo!RJ,!Kardava!L,!Moir!S,!Berger!EA.!2014.!Efficient! infection!of!a!human!B!cell!line!with!cellOfree!Kaposi's!sarcomaOassociated! herpesvirus.!J!Virol!88:1748O1757.! 101.! Rappocciolo!G,!Hensler!HR,!Jais!M,!Reinhart!TA,!Pegu!A,!Jenkins!FJ,!Rinaldo! CR.!2008.!Human!herpesvirus!8!infects!and!replicates!in!primary!cultures!of! activated!B!lymphocytes!through!DCOSIGN.!J!Virol!82:4793O4806.! 102.! Chen!L,!Lagunoff!M.!2005.!Establishment!and!maintenance!of!Kaposi's! sarcomaOassociated!herpesvirus!latency!in!B!cells.!J!Virol!79:14383O14391.! 103.! Braun!M.!1982.!Classics!in!Oncology.!Idiopathic!multiple!pigmented! sarcoma!of! the!skin!by!Kaposi.!CA:!a!cancer!journal!for!clinicians!32:340O347.! 104.! Ganem!D.!2010.!KSHV!and!the!pathogenesis!of!Kaposi!sarcoma:!listening!to! human!biology!and!medicine.!J!Clin!Invest!120:939O949.! 105.! Pantanowitz!L,!Dezube!BJ.!2008.!Kaposi!sarcoma!in!unusual!locations.!BMC! cancer!8:190.! 106.! Danzig!JB,!Brandt!LJ,!Reinus!JF,!Klein!RS.!1991.!Gastrointestinal!malignancy! in!patients!with!AIDS.!The!American!journal!of!gastroenterology!86:715O718.! 107.! Lee!VW,!Fuller!JD,!O'Brien!MJ,!Parker!DR,!Cooley!TP,!Liebman!HA.!1991.! Pulmonary!Kaposi!sarcoma!in!patients!with!AIDS:!scintigraphic!diagnosis!with! sequential!thallium!and!gallium!scanning.!Radiology!180:409O412.! 108.! Staskus!KA,!Zhong!W,!Gebhard!K,!Herndier!B,!Wang!H,!Renne!R,!Beneke!J,! Pudney!J,!Anderson!DJ,!Ganem!D,!Haase!AT.!1997.!Kaposi's!sarcomaO associated!herpesvirus!gene!expression!in!endothelial!(spindle)!tumor!cells.!J! Virol!71:715O719.! 109.! Parravicini!C,!Chandran!B,!Corbellino!M,!Berti!E,!Paulli!M,!Moore!PS,!Chang! Y.!2000.!Differential!viral!protein!expression!in!Kaposi's!sarcomaOassociated! herpesvirusOinfected!diseases:!Kaposi's!sarcoma,!primary!effusion!lymphoma,! and!multicentric!Castleman's!disease.!Am!J!Pathol!156:743O749.! 110.! Martin!DF,!Kuppermann!BD,!Wolitz!RA,!Palestine!AG,!Li!H,!Robinson!CA.! 1999.!Oral!ganciclovir!for!patients!with!cytomegalovirus!retinitis!treated!with!a! ganciclovir!implant.!Roche!Ganciclovir!Study!Group.!The!New!England!journal!of! medicine!340:1063O1070.! 111.! Beral!V,!Peterman!TA,!Berkelman!RL,!Jaffe!HW.!1990.!Kaposi's!sarcoma! among!persons!with!AIDS:!a!sexually!transmitted!infection?!Lancet!335:123O 128.! 112.! Biggar!RJ,!Rosenberg!PS,!Cote!T.!1996.!Kaposi's!sarcoma!and!nonOHodgkin's! lymphoma!following!the!diagnosis!of!AIDS.!Multistate!AIDS/Cancer!Match!Study! ! 100! Group.!International!journal!of!cancer.!Journal!international!du!cancer!68:754O 758.! 113.! de!Sanjose!S,!Mbisa!G,!Perez@Alvarez!S,!Benavente!Y,!Sukvirach!S,!Hieu!NT,! Shin!HR,!Anh!PT,!Thomas!J,!Lazcano!E,!Matos!E,!Herrero!R,!Munoz!N,! Molano!M,!Franceschi!S,!Whitby!D.!2009.!Geographic!variation!in!the! prevalence!of!Kaposi!sarcomaOassociated!herpesvirus!and!risk!factors!for! transmission.!J!Infect!Dis!199:1449O1456.! 114.! Malope!BI,!MacPhail!P,!Mbisa!G,!MacPhail!C,!Stein!L,!Ratshikhopha!EM,! Ndhlovu!L,!Sitas!F,!Whitby!D.!2008.!No!evidence!of!sexual!transmission!of! Kaposi's!sarcoma!herpes!virus!in!a!heterosexual!South!African!population.!AIDS! 22:519O526.! 115.! Pauk!J,!Huang!ML,!Brodie!SJ,!Wald!A,!Koelle!DM,!Schacker!T,!Celum!C,!Selke! S,!Corey!L.!2000.!Mucosal!shedding!of!human!herpesvirus!8!in!men.!The!New! England!journal!of!medicine!343:1369O1377.! 116.! de!Souza!VA,!Sumita!LM,!Nascimento!MC,!Oliveira!J,!Mascheretti!M,!Quiroga! M,!Freire!WS,!Tateno!A,!Boulos!M,!Mayaud!P,!Pannuti!CS.!2007.!Human! herpesvirusO8!infection!and!oral!shedding!in!Amerindian!and!nonOAmerindian! populations!in!the!Brazilian!Amazon!region.!J!Infect!Dis!196:844O852.! 117.! Olp!LN,!Shea!DM,!White!MK,!Gondwe!C,!Kankasa!C,!Wood!C.!2013.!Early! childhood!infection!of!Kaposi's!sarcomaOassociated!herpesvirus!in!Zambian! households:!a!molecular!analysis.!International!journal!of!cancer.!Journal! international!du!cancer!132:1182O1190.! 118.! Hladik!W,!Pellett!PE,!Hancock!J,!Downing!R,!Gao!H,!Packel!L,!Mimbe!D,! Nzaro!E,!Mermin!J.!2012.!Association!between!transfusion!with!human! herpesvirus!8!antibodyOpositive!blood!and!subsequent!mortality.!J!Infect!Dis! 206:1497O1503.! 119.! Marcelin!AG,!Calvez!V,!Dussaix!E.!2007.!KSHV!after!an!organ!transplant:! should!we!screen?!Curr!Top!Microbiol!Immunol!312:245O262.! 120.! Atkinson!J,!Edlin!BR,!Engels!EA,!Kral!AH,!Seal!K,!Gamache!CJ,!Whitby!D,! O'Brien!TR.!2003.!Seroprevalence!of!human!herpesvirus!8!among!injection! drug!users!in!San!Francisco.!J!Infect!Dis!187:974O981.! 121.! Operskalski!EA.!2012.!HHVO8,!transfusion,!and!mortality.!J!Infect!Dis! 206:1485O1487.! 122.! Gobbini!F,!Owusu@Ofori!S,!Marcelin!AG,!Candotti!D,!Allain!JP.!2012.!Human! herpesvirus!8!transfusion!transmission!in!Ghana,!an!endemic!region!of!West! Africa.!Transfusion!52:2294O2299.! 123.! Uldrick!TS,!Whitby!D.!2011.!Update!on!KSHV!epidemiology,!Kaposi!Sarcoma! pathogenesis,!and!treatment!of!Kaposi!Sarcoma.!Cancer!Lett!305:150O162.! 124.! Katano!H,!Yokomaku!Y,!Fukumoto!H,!Kanno!T,!Nakayama!T,!Shingae!A,! Sugiura!W,!Ichikawa!S,!Yasuoka!A.!2013.!Seroprevalence!of!Kaposi's!sarcomaO associated!herpesvirus!among!men!who!have!sex!with!men!in!Japan.!J!Med!Virol! 85:1046O1052.! 125.! Zhang!T,!Lin!H,!Minhas!V,!Zhu!W,!Wood!C,!He!N.!2013.!Prevalence!and! correlates!of!Kaposi's!sarcomaOassociated!herpesvirus!infection!in!a!sample!of! men!who!have!sex!with!men!in!Eastern!China.!Epidemiology!and!infection! 141:1823O1830.! ! 101! 126.! Zhang!T,!Shao!X,!Chen!Y,!Zhang!T,!Minhas!V,!Wood!C,!He!N.!2012.!Human! herpesvirus!8!seroprevalence,!China.!Emerging!infectious!diseases!18:150O152.! 127.! Sun!Y,!Sun!S,!Li!W,!Li!B,!Li!J.!2011.!Prevalence!of!human!herpesvirus!8!infection! in!systemic!lupus!erythematosus.!Virol!J!8:210.! 128.! Ganem!D.!2006.!KSHV!infection!and!the!pathogenesis!of!Kaposi's!sarcoma.! Annu!Rev!Pathol!1:273O296.! 129.! Ziegler!JL.!1993.!Endemic!Kaposi's!sarcoma!in!Africa!and!local!volcanic!soils.! Lancet!342:1348O1351.! 130.! Armstrong!AW,!Lam!KH,!Chase!EP.!2013.!Epidemiology!of!classic!and!AIDSO related!Kaposi's!sarcoma!in!the!USA:!incidence,!survival,!and!geographical! distribution!from!1975!to!2005.!Epidemiology!and!infection!141:200O206.! 131.! Soulier!J,!Grollet!L,!Oksenhendler!E,!Cacoub!P,!Cazals@Hatem!D,!Babinet!P,! d'Agay!MF,!Clauvel!JP,!Raphael!M,!Degos!L,!et!al.!1995.!Kaposi's!sarcomaO associated!herpesvirusOlike!DNA!sequences!in!multicentric!Castleman's!disease.! Blood!86:1276O1280.! 132.! Little!RF,!Gutierrez!M,!Jaffe!ES,!Pau!A,!Horne!M,!Wilson!W.!2001.!HIVO associated!nonOHodgkin!lymphoma:!incidence,!presentation,!and!prognosis.! JAMA!:!the!journal!of!the!American!Medical!Association!285:1880O1885.! 133.! Nador!RG,!Cesarman!E,!Chadburn!A,!Dawson!DB,!Ansari!MQ,!Sald!J,! Knowles!DM.!1996.!Primary!effusion!lymphoma:!a!distinct!clinicopathologic! entity!associated!with!the!Kaposi's!sarcomaOassociated!herpes!virus.!Blood! 88:645O656.! 134.! Du!MQ,!Bacon!CM,!Isaacson!PG.!2007.!Kaposi!sarcomaOassociated! herpesvirus/human!herpesvirus!8!and!lymphoproliferative!disorders.!J!Clin! Pathol!60:1350O1357.! 135.! Gaidano!G,!Gloghini!A,!Gattei!V,!Rossi!MF,!Cilia!AM,!Godeas!C,!Degan!M,! Perin!T,!Canzonieri!V,!Aldinucci!D,!Saglio!G,!Carbone!A,!Pinto!A.!1997.! Association!of!Kaposi's!sarcomaOassociated!herpesvirusOpositive!primary! effusion!lymphoma!with!expression!of!the!CD138/syndecanO1!antigen.!Blood! 90:4894O4900.! 136.! Pan!ZG,!Zhang!QY,!Lu!ZB,!Quinto!T,!Rozenvald!IB,!Liu!LT,!Wilson!D,!Reddy! V,!Huang!Q,!Wang!HY,!Ren!YS.!2012.!Extracavitary!KSHVOassociated!large!BO Cell!lymphoma:!a!distinct!entity!or!a!subtype!of!primary!effusion!lymphoma?! Study!of!9!cases!and!review!of!an!additional!43!cases.!The!American!journal!of! surgical!pathology!36:1129O1140.! 137.! Peterson!BA,!Frizzera!G.!1993.!Multicentric!Castleman's!disease.!Seminars!in! oncology!20:636O647.! 138.! Dupin!N,!Diss!TL,!Kellam!P,!Tulliez!M,!Du!MQ,!Sicard!D,!Weiss!RA,!Isaacson! PG,!Boshoff!C.!2000.!HHVO8!is!associated!with!a!plasmablastic!variant!of! Castleman!disease!that!is!linked!to!HHVO8Opositive!plasmablastic!lymphoma.! Blood!95:1406O1412.! 139.! Stebbing!J,!Pantanowitz!L,!Dayyani!F,!Sullivan!RJ,!Bower!M,!Dezube!BJ.! 2008.!HIVOassociated!multicentric!Castleman's!disease.!American!journal!of! hematology!83:498O503.! ! 102! 140.! Parravicini!C,!Corbellino!M,!Paulli!M,!Magrini!U,!Lazzarino!M,!Moore!PS,! Chang!Y.!1997.!Expression!of!a!virusOderived!cytokine,!KSHV!vILO6,!in!HIVO seronegative!Castleman's!disease.!Am!J!Pathol!151:1517O1522.! 141.! Du!MQ,!Liu!H,!Diss!TC,!Ye!H,!Hamoudi!RA,!Dupin!N,!Meignin!V,! Oksenhendler!E,!Boshoff!C,!Isaacson!PG.!2001.!Kaposi!sarcomaOassociated! herpesvirus!infects!monotypic!(IgM!lambda)!but!polyclonal!naive!B!cells!in! Castleman!disease!and!associated!lymphoproliferative!disorders.!Blood! 97:2130O2136.! 142.! Oksenhendler!E,!Duarte!M,!Soulier!J,!Cacoub!P,!Welker!Y,!Cadranel!J,! Cazals@Hatem!D,!Autran!B,!Clauvel!JP,!Raphael!M.!1996.!Multicentric! Castleman's!disease!in!HIV!infection:!a!clinical!and!pathological!study!of!20! patients.!AIDS!10:61O67.! 143.! Olsen!SJ,!Tarte!K,!Sherman!W,!Hale!EE,!Weisse!MT,!Orazi!A,!Klein!B,!Chang! Y.!1998.!Evidence!against!KSHV!infection!in!the!pathogenesis!of!multiple! myeloma.!Virus!Res!57:197O202.! 144.! Rettig!MB,!Ma!HJ,!Vescio!RA,!Pold!M,!Schiller!G,!Belson!D,!Savage!A,! Nishikubo!C,!Wu!C,!Fraser!J,!Said!JW,!Berenson!JR.!1997.!Kaposi's!sarcomaO associated!herpesvirus!infection!of!bone!marrow!dendritic!cells!from!multiple! myeloma!patients.!Science!276:1851O1854.! 145.! Cool!CD,!Rai!PR,!Yeager!ME,!Hernandez@Saavedra!D,!Serls!AE,!Bull!TM,! Geraci!MW,!Brown!KK,!Routes!JM,!Tuder!RM,!Voelkel!NF.!2003.!Expression! of!human!herpesvirus!8!in!primary!pulmonary!hypertension.!New!England! Journal!of!Medicine!349:1113O1122.! 146.! Yoder!BJ,!Yen@Lieberman!B,!Kohn!D,!Procop!GW,!Pellett!PE,!Comhair!SAA,! Xu!W,!Farver!CF.!2005.!The!lack!of!expression!of!human!herpesvirus!8!in! primary!pulmonary!hypertension.!Laboratory!Investigation!85:321AO321A.! 147.! Bull!TM,!Cool!CD,!Serls!AE,!Rai!PR,!Parr!J,!Neid!JM,!Geraci!MW,!Campbell! TB,!Voelkel!NF,!Badesch!DB.!2003.!Primary!pulmonary!hypertension,! Castleman's!disease!and!human!herpesvirusO8.!The!European!respiratory! journal!22:403O407.! 148.! Durrington!HJ,!Upton!PD,!Hoer!S,!Boname!J,!Dunmore!BJ,!Yang!J,!Crilley!TK,! Butler!LM,!Blackbourn!DJ,!Nash!GB,!Lehner!PJ,!Morrell!NW.!2010.! Identification!of!a!Lysosomal!Pathway!Regulating!Degradation!of!the!Bone! Morphogenetic!Protein!Receptor!Type!II.!Journal!of!Biological!Chemistry! 285:37641O37649.! 149.! Deng!Z,!Morse!JH,!Slager!SL,!Cuervo!N,!Moore!KJ,!Venetos!G,!Kalachikov!S,! Cayanis!E,!Fischer!SG,!Barst!RJ,!Hodge!SE,!Knowles!JA.!2000.!Familial! primary!pulmonary!hypertension!(gene!PPH1)!is!caused!by!mutations!in!the! bone!morphogenetic!protein!receptorOII!gene.!American!journal!of!human! genetics!67:737O744.! 150.! Benavente!Y,!Mbisa!G,!Labo!N,!Casabonne!D,!Becker!N,!Maynadie!M,! Foretova!L,!Cocco!PL,!Nieters!A,!Staines!A,!Bofetta!P,!Brennan!P,!Whitby!D,! de!Sanjose!S.!2011.!Antibodies!against!lytic!and!latent!Kaposi's!sarcomaO associated!herpes!virus!antigens!and!lymphoma!in!the!European!EpiLymph! caseOcontrol!study.!British!journal!of!cancer!105:1768O1771.! ! 103! 151.! Sin!SH,!Dittmer!DP.!2013.!Viral!latency!locus!augments!BOcell!response!in!vivo! to!induce!chronic!marginal!zone!enlargement,!plasma!cell!hyperplasia,!and! lymphoma.!Blood!121:2952O2963.! 152.! Letang!E,!Lewis!JJ,!Bower!M,!Mosam!A,!Borok!M,!Campbell!TB,!Naniche!D,! Newsom@Davis!T,!Shaik!F,!Fiorillo!S,!Miro!JM,!Schellenberg!D,!Easterbrook! PJ.!2013.!Immune!reconstitution!inflammatory!syndrome!associated!with! Kaposi!sarcoma:!higher!incidence!and!mortality!in!Africa!than!in!the!UK.!AIDS! 27:1603O1613.! 153.! Barozzi!P,!Bonini!C,!Potenza!L,!Masetti!M,!Cappelli!G,!Gruarin!P,!Whitby!D,! Gerunda!GE,!Mondino!A,!Riva!G,!Vallerini!D,!Quadrelli!C,!Bosco!R,!Ciceri!F,! Bordignon!C,!Schulz!TF,!Torelli!G,!Luppi!M.!2008.!Changes!in!the!immune! responses!against!human!herpesvirusO8!in!the!disease!course!of!posttransplant! Kaposi!sarcoma.!Transplantation!86:738O744.! 154.! Chaturvedi!AK,!Mbulaiteye!SM,!Engels!EA.!2008.!Underestimation!of!relative! risks!by!standardized!incidence!ratios!for!AIDSOrelated!cancers.!Ann!Epidemiol! 18:230O234.! 155.! Lambert!M,!Gannage!M,!Karras!A,!Abel!M,!Legendre!C,!Kerob!D,!Agbalika!F,! Girard!PM,!Lebbe!C,!Caillat@Zucman!S.!2006.!Differences!in!the!frequency!and! function!of!HHV8Ospecific!CD8!T!cells!between!asymptomatic!HHV8!infection! and!Kaposi!sarcoma.!Blood!108:3871O3880.! 156.! Guihot!A,!Dupin!N,!Marcelin!AG,!Gorin!I,!Bedin!AS,!Bossi!P,!Galicier!L,! Oksenhendler!E,!Autran!B,!Carcelain!G.!2006.!Low!T!cell!responses!to!human! herpesvirus!8!in!patients!with!AIDSOrelated!and!classic!Kaposi!sarcoma.!J!Infect! Dis!194:1078O1088.! 157.! Sirianni!MC,!Vincenzi!L,!Topino!S,!Giovannetti!A,!Mazzetta!F,!Libi!F,! Scaramuzzi!D,!Andreoni!M,!Pinter!E,!Baccarini!S,!Rezza!G,!Monini!P,!Ensoli! B.!2002.!NK!cell!activity!controls!human!herpesvirus!8!latent!infection!and!is! restored!upon!highly!active!antiretroviral!therapy!in!AIDS!patients!with! regressing!Kaposi's!sarcoma.!European!Journal!of!Immunology!32:2711O2720.! 158.! Dupuy!S,!Lambert!M,!Zucman!D,!Choukem!SP,!Tognarelli!S,!Pages!C,!Lebbe! C,!Caillat@Zucman!S.!2012.!Human!Herpesvirus!8!(HHV8)!Sequentially!Shapes! the!NK!Cell!Repertoire!during!the!Course!of!Asymptomatic!Infection!and!Kaposi! Sarcoma.!Plos!Pathogens!8:e1002486.! 159.! Coscoy!L.!2007.!Immune!evasion!by!Kaposi's!sarcomaOassociated!herpesvirus.! Nat!Rev!Immunol!7:391O401.! 160.! Liang!C,!Lee!JS,!Jung!JU.!2008.!Immune!evasion!in!Kaposi's!sarcomaOassociated! herpes!virus!associated!oncogenesis.!Semin!Cancer!Biol!18:423O436.! 161.! Zaldumbide!A,!Ossevoort!M,!Wiertz!EJ,!Hoeben!RC.!2007.!In!cis!inhibition!of! antigen!processing!by!the!latencyOassociated!nuclear!antigen!I!of!Kaposi! sarcoma!herpes!virus.!Mol!Immunol!44:1352O1360.! 162.! Kwun!HJ,!da!Silva!SR,!Qin!H,!Ferris!RL,!Tan!R,!Chang!Y,!Moore!PS.!2011.!The! central!repeat!domain!1!of!Kaposi's!sarcomaOassociated!herpesvirus!(KSHV)! latency!associatedOnuclear!antigen!1!(LANA1)!prevents!cis!MHC!class!I!peptide! presentation.!Virology!412:357O365.! 163.! Levitskaya!J,!Coram!M,!Levitsky!V,!Imreh!S,!Steigerwald@Mullen!PM,!Klein! G,!Kurilla!MG,!Masucci!MG.!1995.!Inhibition!of!antigen!processing!by!the! ! 104! internal!repeat!region!of!the!EpsteinOBarr!virus!nuclear!antigenO1.!Nature! 375:685O688.! 164.! Yin!Y,!Manoury!B,!Fahraeus!R.!2003.!SelfOinhibition!of!synthesis!and!antigen! presentation!by!EpsteinOBarr!virusOencoded!EBNA1.!Science!301:1371O1374.! 165.! Bennett!NJ,!May!JS,!Stevenson!PG.!2005.!GammaOherpesvirus!latency!requires! T!cell!evasion!during!episome!maintenance.!PLoS!biology!3:e120.! 166.! Bihl!F,!Narayan!M,!Chisholm!JV,!3rd,!Henry!LM,!Suscovich!TJ,!Brown!EE,! Welzel!TM,!Kaufmann!DE,!Zaman!TM,!Dollard!S,!Martin!JN,!Wang!F,! Scadden!DT,!Kaye!KM,!Brander!C.!2007.!Lytic!and!latent!antigens!of!the! human!gammaherpesviruses!Kaposi's!sarcomaOassociated!herpesvirus!and! EpsteinOBarr!virus!induce!TOcell!responses!with!similar!functional!properties! and!memory!phenotypes.!J!Virol!81:4904O4908.! 167.! Klein!L,!Munz!C,!Lunemann!JD.!2010.!AutophagyOmediated!antigen!processing! in!CD4(+)!T!cell!tolerance!and!immunity.!FEBS!Lett!584:1405O1410.! 168.! Tomescu!C,!Law!WK,!Kedes!DH.!2003.!Surface!downregulation!of!major! histocompatibility!complex!class!I,!PEOCAM,!and!ICAMO1!following!de!novo! infection!of!endothelial!cells!with!Kaposi's!sarcomaOassociated!herpesvirus.!J! Virol!77:9669O9684.! 169.! Adang!LA,!Tomescu!C,!Law!WK,!Kedes!DH.!2007.!Intracellular!Kaposi's! sarcomaOassociated!herpesvirus!load!determines!early!loss!of!immune!synapse! components.!Journal!of!Virology!81:5079O5090.! 170.! Gregory!SM,!Wang!L,!West!JA,!Dittmer!DP,!Damania!B.!2012.!Latent!KSHV! infection!of!monocytes!downregulates!expression!of!adaptive!immune!response! costimulatory!receptors!and!proinflammatory!cytokine!expression.!Journal!of! Virology.! 171.! Schmidt!K,!Wies!E,!Neipel!F.!2011.!Kaposi's!sarcomaOassociated!herpesvirus! viral!interferon!regulatory!factor!3!inhibits!gamma!interferon!and!major! histocompatibility!complex!class!II!expression.!Journal!of!Virology!85:4530O 4537.! 172.! Orange!JS,!Ballas!ZK.!2006.!Natural!killer!cells!in!human!health!and!disease.! Clin!Immunol!118:1O10.! 173.! Moretta!L,!Bottino!C,!Pende!D,!Castriconi!R,!Mingari!MC,!Moretta!A.!2006.! Surface!NK!receptors!and!their!ligands!on!tumor!cells.!Seminars!in!immunology! 18:151O158.! 174.! Nachmani!D,!Stern@Ginossar!N,!Sarid!R,!Mandelboim!O.!2009.!Diverse! herpesvirus!microRNAs!target!the!stressOinduced!immune!ligand!MICB!to! escape!recognition!by!natural!killer!cells.!Cell!Host!Microbe!5:376O385.! 175.! Madrid!AS,!Ganem!D.!2012.!Kaposi's!sarcomaOassociated!herpesvirus! ORF54 /dUTPase!downregulates!a!ligand!for!the!NK!activating!receptor!NKp44.!J! Virol!86:8693O8704.! 176.! Ishido!S,!Choi!JK,!Lee!BS,!Wang!C,!DeMaria!M,!Johnson!RP,!Cohen!GB,!Jung! JU.!2000.!Inhibition!of!natural!killer!cellOmediated!cytotoxicity!by!Kaposi's! sarcomaOassociated!herpesvirus!K5!protein.!Immunity!13:365O374.! 177.! Thomas!M,!Boname!JM,!Field!S,!Nejentsev!S,!Salio!M,!Cerundolo!V,!Wills!M,! Lehner!PJ.!2008.!DownOregulation!of!NKG2D!and!NKp80!ligands!by!Kaposi's! ! 105! sarcomaOassociated!herpesvirus!K5!protects!against!NK!cell!cytotoxicity.!Proc! Natl!Acad!Sci!U!S!A!105:1656O1661.! 178.! Murphy!E,!Vanicek!J,!Robins!H,!Shenk!T,!Levine!AJ.!2008.!Suppression!of! immediateOearly!viral!gene!expression!by!herpesvirusOcoded!microRNAs:! Implications!for!latency.!Proceedings!of!the!National!Academy!of!Sciences!of!the! United!States!of!America!105:5453O5458.! 179.! Lin!X,!Liang!D,!He!Z,!Deng!Q,!Robertson!ES,!Lan!K.!2011.!miROK12O7O5p! encoded!by!Kaposi's!sarcomaOassociated!herpesvirus!stabilizes!the!latent!state! by!targeting!viral!ORF50/RTA.!PLoS!One! 6:e16224.! 180.! Robey!RC,!Lagos!D,!Gratrix!F,!Henderson!S,!Matthews!NC,!Vart!RJ,!Bower!M,! Boshoff!C,!Gotch!FM.!2009.!The!CD8!and!CD4!TOCell!Response!against!Kaposi's! SarcomaOAssociated!Herpesvirus!Is!Skewed!Towards!Early!and!Late!Lytic! Antigens.!PLoS!One! 4.! 181.! Hansen!TH,!Bouvier!M.!2009.!MHC!class!I!antigen!presentation:!learning!from! viral!evasion!strategies.!Nat!Rev!Immunol!9:503O513.! 182.! Randow!F,!Lehner!PJ.!2009.!Viral!avoidance!and!exploitation!of!the!ubiquitin! system.!Nat!Cell!Biol!11:527O534.! 183.! Coscoy!L,!Ganem!D.!2003.!PHD!domains!and!E3!ubiquitin!ligases:!viruses!make! the!connection.!Trends!Cell!Biol!13:7O12.! 184.! Ohmura@Hoshino!M,!Goto!E,!Matsuki!Y,!Aoki!M,!Mito!M,!Uematsu!M,!Hotta! H,!Ishido!S.!2006.!A!novel!family!of!membraneObound!E3!ubiquitin!ligases.!J! Biochem!140:147O154.! 185.! d'Azzo!A,!Bongiovanni!A,!Nastasi!T.!2005.!E3!ubiquitin!ligases!as!regulators!of! membrane!protein!trafficking!and!degradation.!Traffic!6:429O441.! 186.! Nathan!JA,!Lehner!PJ.!2009.!The!trafficking!and!regulation!of!membrane! receptors!by!the!RINGOCH!ubiquitin!E3!ligases.!Exp!Cell!Res!315:1593O1600.! 187.! Bartee!E,!Mansouri!M,!Hovey!Nerenberg!BT,!Gouveia!K,!Fruh!K.!2004.! Downregulation!of!major!histocompatibility!complex!class!I!by!human!ubiquitin! ligases!related!to!viral!immune!evasion!proteins.!J!Virol!78:1109O1120.! 188.! Hoer!S,!Smith!L,!Lehner!PJ.!2007.!MARCHOIX!mediates!ubiquitination!and! downregulation!of!ICAMO1.!FEBS!Lett!581:45O51.! 189.! De!Gassart!A,!Camosseto!V,!Thibodeau!J,!Ceppi!M,!Catalan!N,!Pierre!P,!Gatti! E.!2008.!MHC!class!II!stabilization!at!the!surface!of!human!dendritic!cells!is!the! result!of!maturationOdependent!MARCH!I!downOregulation.!Proc!Natl!Acad!Sci!U! S!A!105:3491O3496.! 190.! Thibodeau!J,!Bourgeois@Daigneault!MC,!Huppe!G,!Tremblay!J,!Aumont!A,! Houde!M,!Bartee!E,!Brunet!A,!Gauvreau!ME,!de!Gassart!A,!Gatti!E,!Baril!M,! Cloutier!M,!Bontron!S,!Fruh!K,!Lamarre!D,!Steimle!V.!2008.!InterleukinO10O induced!MARCH1!mediates!intracellular!sequestration!of!MHC!class!II!in! monocytes.!Eur!J!Immunol!38:1225O1230.! 191.! Bartee!E,!Eyster!CA,!Viswanathan!K,!Mansouri!M,!Donaldson!JG,!Fruh!K.! 2010.!MembraneOAssociated!RINGOCH!proteins!associate!with!Bap31!and!target! CD81!and!CD44!to!lysosomes.!PLoS!One! 5:e15132.! 192.! Jahnke!M,!Trowsdale!J,!Kelly!AP.!2012.!Ubiquitination!of!human!leukocyte! antigen!(HLA)ODM!by!different!membraneOassociated!RINGOCH!(MARCH)! ! 106! protein!family!E3!ligases!targets!different!endocytic!pathways.!J!Biol!Chem! 287:7256O7264.! 193.! Virgin!HWt,!Latreille!P,!Wamsley!P,!Hallsworth!K,!Weck!KE,!Dal!Canto!AJ,! Speck!SH.!1997.!Complete!sequence!and!genomic!analysis!of!murine! gammaherpesvirus!68.!J!Virol!71:5894O5904.! 194.! Loh!J,!Zhao!G,!Nelson!CA,!Coder!P,!Droit!L,!Handley!SA,!Johnson!LS,! Vachharajani!P,!Guzman!H,!Tesh!RB,!Wang!D,!Fremont!DH,!Virgin!HW.! 2011.!Identification!and!sequencing!of!a!novel!rodent!gammaherpesvirus!that! establishes!acute!and!latent!infection!in!laboratory!mice.!J!Virol!85:2642O2656.! 195.! Herr!RA,!Wang!X,!Loh!J,!Virgin!HW,!Hansen!TH.!2012.!Newly!discovered!viral! E3!ligase!pK3!induces!endoplasmic!reticulumOassociated!degradation!of!class!I! major!histocompatibility!proteins!and!their!membraneObound!chaperones.!J! Biol!Chem!287:14467O14479.! 196.! Ishido!S,!Wang!C,!Lee!BS,!Cohen!GB,!Jung!JU.!2000.!Downregulation!of!major! histocompatibility!complex!class!I!molecules!by!Kaposi's!sarcomaOassociated! herpesvirus!K3!and!K5!proteins.!J!Virol!74:5300O5309.! 197.! Harris!S,!Lang!SM,!Means!RE.!2010.!Characterization!of!the!rhesus! fibromatosis!herpesvirus!MARCH!family!member!rfK3.!Virology!398:214O223.! 198.! Coscoy!L,!Ganem!D.!2000.!Kaposi's!sarcomaOassociated!herpesvirus!encodes! two!proteins!that!block!cell!surface!display!of!MHC!class!I!chains!by!enhancing! their!endocytosis.!Proc!Natl!Acad!Sci!U!S!A!97:8051O8056.! 199.! Haque!M,!Ueda!K,!Nakano!K,!Hirata!Y,!Parravicini!C,!Corbellino!M,! Yamanishi!K.!2001.!Major!histocompatibility!complex!class!I!molecules!are! downOregulated!at!the!cell!surface!by!the!K5!protein!encoded!by!Kaposi's! sarcomaOassociated!herpesvirus/human!herpesvirusO8.!Journal!of!General! Virology!82:1175O1180.! 200.! Sanchez!DJ,!Gumperz!JE,!Ganem!D.!2005.!Regulation!of!CD1d!expression!and! function!by!a!herpesvirus!infection.!J!Clin!Invest!115:1369O1378.! 201.! Rhodes!DA,!Boyle!LH,!Boname!JM,!Lehner!PJ,!Trowsdale!J.!2010.! Ubiquitination!of!lysineO331!by!Kaposi's!sarcomaOassociated!herpesvirus! protein!K5!targets!HFE!for!lysosomal!degradation.!Proc!Natl!Acad!Sci!U!S!A! 107:16240O16245.! 202.! Coscoy!L,!Ganem!D.!2001.!A!viral!protein!that!selectively!downregulates!ICAMO 1!and!B7O2!and!modulates!T!cell!costimulation.!Journal!of!Clinical!Investigation! 107:1599O1606.! 203.! Mansouri!M,!Douglas!J,!Rose!PP,!Gouveia!K,!Thomas!G,!Means!RE,!Moses! AV,!Fruh!K.!2006.!Kaposi!sarcoma!herpesvirus!K5!removes!CD31/PECAM!from! endothelial!cells.!Blood!108:1932O1940.! 204.! Mansouri!M,!Rose!PP,!Moses!AV,!Fruh!K.!2008.!Remodeling!of!endothelial! adherens!junctions!by!Kaposi's!sarcomaOassociated!herpesvirus.!Journal!of! Virology!82:9615O9628.! 205.! Manes!TD,!Hoer!S,!Muller!WA,!Lehner!PJ,!Pober!JS.!2010.!Kaposi's!sarcomaO associated!herpesvirus!K3!and!K5!proteins!block!distinct!steps!in! transendothelial!migration!of!effector!memory!CD4+!T!cells!by!targeting! different!endothelial!proteins.!J!Immunol!184:5186O5192.! ! 107! 206.! Lang!SM,!Bynoe!MO,!Karki!R,!Tartell!MA,!Means!RE.!2013.!Kaposi's!sarcomaO associated!herpesvirus!K3!and!K5!proteins!down!regulate!both!DCOSIGN!and! DCOSIGNR.!PLoS!One! 8:e58056.! 207.! Mansouri!M,!Viswanathan!K,!Douglas!JL,!Hines!J,!Gustin!J,!Moses!AV,!Fruh! K.!2009.!Molecular!mechanism!of!BST2/tetherin!downregulation!by!K5/MIR2! of!Kaposi's!sarcomaOassociated!herpesvirus.!J!Virol!83:9672O9681.! 208.! Li!Q,!Means!R,!Lang!S,!Jung!JU.!2007.!Downregulation!of!gamma!interferon! receptor!1!by!Kaposi's!sarcomaOassociated!herpesvirus!K3!and!K5.!J!Virol! 81:2117O2127.! 209.! Bartee!E,!McCormack!A,!Fruh!K.!2006.!Quantitative!membrane!proteomics! reveals!new!cellular!targets!of!viral!immune!modulators.!PLoS!Pathog!2:e107.! 210.! Timms!RT,!Duncan!LM,!Tchasovnikarova!IA,!Antrobus!R,!Smith!DL,!Dougan! G,!Weekes!MP,!Lehner!PJ.!2013.!Haploid!genetic!screens!identify!an!essential! role!for!PLP2!in!the!downregulation!of!novel!plasma!membrane!targets!by!viral! E3!ubiquitin!ligases.!PLoS!Pathog!9:e1003772.! 211.! Sanchez!DJ,!Coscoy!L,!Ganem!D.!2002.!Functional!organization!of!MIR2,!a! novel!viral!regulator!of!selective!endocytosis.!J!Biol!Chem!277:6124O6130.! 212.! Lorenzo!ME,!Jung!JU,!Ploegh!HL.!2002.!Kaposi's!sarcomaOassociated! herpesvirus!K3!utilizes!the!ubiquitinOproteasome!system!in!routing!class!major! histocompatibility!complexes!to!late!endocytic!compartments.!J!Virol!76:5522O 5531.! 213.! Means!RE,!Lang!SM,!Jung!JU.!2007.!The!Kaposi's!sarcomaOassociated! herpesvirus!K5!E3!ubiquitin!ligase!modulates!targets!by!multiple!molecular! mechanisms.!J!Virol!81:6573O6583.! 214.! Duncan!LM,!Piper!S,!Dodd!RB,!Saville!MK,!Sanderson!CM,!Luzio!JP,!Lehner! PJ.!2006.!LysineO63Olinked!ubiquitination!is!required!for!endolysosomal! degradation!of!class!I!molecules.!EMBO!J! 25:1635O1645.! 215.! Cadwell!K,!Coscoy!L.!2005.!Ubiquitination!on!nonlysine!residues!by!a!viral!E3! ubiquitin!ligase.!Science!309:127O130.! 216.! Cadwell!K,!Coscoy!L.!2008.!The!specificities!of!Kaposi's!sarcomaOassociated! herpesvirusOencoded!E3!ubiquitin!ligases!are!determined!by!the!positions!of! lysine!or!cysteine!residues!within!the!intracytoplasmic!domains!of!their!targets.! J!Virol!82:4184O4189.! 217.! Wang!X,!Ye!Y,!Lencer!W,!Hansen!TH.!2006.!The!viral!E3!ubiquitin!ligase!mK3! uses!the!Derlin/p97!endoplasmic!reticulumOassociated!degradation!pathway!to! mediate!downOregulation!of!major!histocompatibility!complex!class!I!proteins.!J! Biol!Chem!281:8636O8644.! 218.! Boname!JM,!Thomas!M,!Stagg!HR,!Xu!P,!Peng!J,!Lehner!PJ.!2010.!Efficient! internalization!of!MHC!I!requires!lysineO11!and!lysineO63!mixed!linkage! polyubiquitin!chains.!Traffic!11:210O220.! 219.! Hewitt!EW,!Duncan!L,!Mufti!D,!Baker!J,!Stevenson!PG,!Lehner!PJ.!2002.! Ubiquitylation!of!MHC!class!I!by!the!K3!viral!protein!signals!internalization!and! TSG101Odependent!degradation.!EMBO!J! 21:2418O2429.! 220.! Anania!VG,!Coscoy!L.!2011.!Palmitoylation!of!MIR2!Is!Required!for!Its! Function.!Journal!of!Virology!85:2288O2295.! ! 108! 221.! Jonjic!S,!Babic!M,!Polic!B,!Krmpotic!A.!2008.!Immune!evasion!of!natural!killer! cells!by!viruses.!Curr!Opin!Immunol! 20:30O38.! 222.! Stevenson!PG,!May!JS,!Smith!XG,!Marques!S,!Adler!H,!Koszinowski!UH,! Simas!JP,!Efstathiou!S.!2002.!K3Omediated!evasion!of!CD8(+)!T!cells!aids! amplification!of!a!latent!gammaOherpesvirus.!Nat!Immunol!3:733O740.! 223.! Lemmermann!NA,!Bohm!V,!Holtappels!R,!Reddehase!MJ.!2011.!In!vivo! impact!of!cytomegalovirus!evasion!of!CD8!TOcell!immunity:!facts!and!thoughts! based!on!murine!models.!Virus!Res!157:161O174.! 224.! Hansen!SG,!Powers!CJ,!Richards!R,!Ventura!AB,!Ford!JC,!Siess!D,!Axthelm! MK,!Nelson!JA,!Jarvis!MA,!Picker!LJ,!Fruh!K.!2010.!Evasion!of!CD8(+)!T!Cells!Is! Critical!for!Superinfection!by!Cytomegalovirus.!Science!328:102O106.! 225.! Bohm!V,!Simon!CO,!Podlech!J,!Seckert!CK,!Gendig!D,!Deegen!P,!Gillert@ Marien!D,!Lemmermann!NAW,!Holtappels!R,!Reddehase!MJ.!2008.!The! Immune!Evasion!Paradox:!Immunoevasins!of!Murine!Cytomegalovirus!Enhance! Priming!of!CD8!T!Cells!by!Preventing!Negative!Feedback!RegulationO.!Journal!of! Virology!82:11637O11650.! 226.! Bohm!V,!Simon!CO,!Podlech!J,!Seckert!CK,!Gendig!D,!Deegen!P,!Gillert@ Marien!D,!Lemmermann!NA,!Holtappels!R,!Reddehase!MJ.!2008.!The! immune!evasion!paradox:!immunoevasins!of!murine!cytomegalovirus!enhance! priming!of!CD8!T!cells!by!preventing!negative!feedback!regulation.!J!Virol! 82:11637O11650.! 227.! Spaete!RR,!Mocarski!ES.!1987.!Insertion!and!deletion!mutagenesis!of!the! human!cytomegalovirus!genome.!Proc!Natl!Acad!Sci!U!S!A!84:7213O7217.! 228.! Foreman!KE,!Friborg!J,!Jr.,!Kong!WP,!Woffendin!C,!Polverini!PJ,!Nickoloff! BJ,!Nabel!GJ.!1997.!Propagation!of!a!human!herpesvirus!from!AIDSOassociated! Kaposi's!sarcoma.!The!New!England!journal!of!medicine!336:163O171.! 229.! Renne!R,!Blackbourn!D,!Whitby!D,!Levy!J,!Ganem!D.!1998.!Limited! transmission!of!Kaposi's!sarcomaOassociated!herpesvirus!in!cultured!cells.!J! Virol!72:5182O5188.! 230.! Cohen!JI,!Seidel!KE.!1993.!Generation!of!varicellaOzoster!virus!(VZV)!and!viral! mutants!from!cosmid!DNAs:!VZV!thymidylate!synthetase!is!not!essential!for! replication!in!vitro.!Proceedings!of!the!National!Academy!of!Sciences!of!the! United!States!of!America!90:7376O7380.! 231.! Cunningham!C,!Davison!AJ.!1993.!A!cosmidObased!system!for!constructing! mutants!of!herpes!simplex!virus!type!1.!Virology!197:116O124.! 232.! Shizuya!H,!Birren!B,!Kim!UJ,!Mancino!V,!Slepak!T,!Tachiiri!Y,!Simon!M.! 1992.!Cloning!and!stable!maintenance!of!300OkilobaseOpair!fragments!of!human! DNA!in!Escherichia!coli!using!an!FOfactorObased!vector.!Proceedings!of!the! National!Academy!of!Sciences!of!the!United!States!of!America!89:8794O8797.! 233.! Adachi!S,!Hori!K,!Hiraga!S.!2006.!Subcellular!positioning!of!F!plasmid! mediated!by!dynamic!localization!of!SopA!and!SopB.!J!Mol!Biol!356:850O863.! 234.! Mori!H,!Kondo!A,!Ohshima!A,!Ogura!T,!Hiraga!S.!1986.!Structure!and!function! of!the!F!plasmid!genes!essential!for!partitioning.!J!Mol!Biol!192:1O15.! 235.! Messerle!M,!Crnkovic!I,!Hammerschmidt!W,!Ziegler!H,!Koszinowski!UH.! 1997.!Cloning!and!mutagenesis!of!a!herpesvirus!genome!as!an!infectious! bacterial!artificial!chromosome.!Proc!Natl!Acad!Sci!U!S!A!94:14759O14763.! ! 109! 236.! Warden!C,!Tang!QY,!Zhu!H.!2011.!Herpesvirus!BACs:!Past,!Present,!and!Future.! Journal!of!Biomedicine!and!Biotechnology:O.! 237.! Almazán!F,!González!JM,!Pénzes!Z,!Izeta!A,!Calvo!E,!Plana@Durán!J,!Enjuanes! L.!2000.!Engineering!the!largest!RNA!virus!genome!as!an!infectious!bacterial! artificial!chromosome.!Proceedings!of!the!National!Academy!of!Sciences! 97:5516O5521.! 238.! Almazan!F,!Dediego!ML,!Galan!C,!Escors!D,!Alvarez!E,!Ortego!J,!Sola!I,! Zuniga!S,!Alonso!S,!Moreno!JL,!Nogales!A,!Capiscol!C,!Enjuanes!L.!2006.! Construction!of!a!severe!acute!respiratory!syndrome!coronavirus!infectious! cDNA!clone!and!a!replicon!to!study!coronavirus!RNA!synthesis.!J!Virol! 80:10900O10906.! 239.! Brulois!KF,!Chang!H,!Lee!AS,!Ensser!A,!Wong!LY,!Toth!Z,!Lee!SH,!Lee!HR,! Myoung!J,!Ganem!D,!Oh!TK,!Kim!JF,!Gao!SJ,!Jung!JU.!2012.!Construction!and! manipulation!of!a!new!Kaposi's!sarcomaOassociated!herpesvirus!bacterial! artificial!chromosome!clone.!J!Virol!86:9708O9720.! 240.! Lee!HR,!Doganay!S,!Chung!B,!Toth!Z,!Brulois!K,!Lee!S,!Kanketayeva!Z,!Feng! P,!Ha!T,!Jung!JU.!2014.!Kaposi's!SarcomaOAssociated!Herpesvirus!Viral! Interferon!Regulatory!Factor!4!(vIRF4)!Targets!Expression!of!Cellular!IRF4!and! the!Myc!Gene!To!Facilitate!Lytic!Replication.!J!Virol!88:2183O2194.! 241.! Liang!Q,!Chang!B,!Brulois!KF,!Castro!K,!Min!CK,!Rodgers!MA,!Shi!M,!Ge!J,! Feng!P,!Oh!BH,!Jung!JU.!2013.!Kaposi's!sarcomaOassociated!herpesvirus!K7! modulates!RubiconOmediated!inhibition!of!autophagosome!maturation.!J!Virol! 87:12499O12503.! 242.! Full!F,!Jungnickl!D,!Reuter!N,!Bogner!E,!Brulois!K,!Scholz!B,!Sturzl!M,! Myoung!J,!Jung!JU,!Stamminger!T,!Ensser!A.!2014.!Kaposi's!sarcoma! associated!herpesvirus!tegument!protein!ORF75!is!essential!for!viral!lytic! replication!and!plays!a!critical!role!in!the!antagonization!of!ND10Oinstituted! intrinsic!immunity.!PLoS!Pathog!10:e1003863.! 243.! Wong!LY,!Brulois!K,!Toth!Z,!Inn!KS,!Lee!SH,!O'Brien!K,!Lee!H,!Gao!SJ,! Cesarman!E,!Ensser!A,!Jung!JU.!2013.!The!product!of!Kaposi's!sarcomaO associated!herpesvirus!immediate!early!gene!K4.2!regulates!immunoglobulin! secretion!and!calcium!homeostasis!by!interacting!with!and!inhibiting!pERP1.!J! Virol!87:12069O12079.! 244.! Kronstad!LM,!Brulois!KF,!Jung!JU,!Glaunsinger!BA.!2014.!Reinitiation!after! Translation!of!Two!Upstream!Open!Reading!Frames!Governs!Expression!of!the! ORF35 O37!KSHV!Polycistronic!mRNA.!Journal!of!Virology.! 245.! Milho!R,!Smith!CM,!Marques!S,!Alenquer!M,!May!JS,!Gillet!L,!Gaspar!M,! Efstathiou!S,!Simas!JP,!Stevenson!PG.!2009.!In!vivo!imaging!of!murid! herpesvirusO4!infection.!Journal!of!General!Virology!90:21O32.! 246.! Toth!Z,!Brulois!KF,!Wong!LY,!Lee!HR,!Chung!B,!Jung!JU.!2012.!Negative! elongation!factorOmediated!suppression!of!RNA!polymerase!II!elongation!of! Kaposi's!sarcomaOassociated!herpesvirus!lytic!gene!expression.!J!Virol!86:9696O 9707.! 247.! Kronstad!LM,!Brulois!KF,!Jung!JU,!Glaunsinger!BA.!2013.!Dual!short! upstream!open!reading!frames!control!translation!of!a!herpesviral!polycistronic! mRNA.!PLoS!Pathog!9:e1003156.! ! 110! 248.! Smith!GA,!Enquist!LW.!1999.!Construction!and!transposon!mutagenesis!in! Escherichia!coli!of!a!fullOlength!infectious!clone!of!pseudorabies!virus,!an! alphaherpesvirus.!J!Virol!73:6405O6414.! 249.! Searles!RP,!Bergquam!EP,!Axthelm!MK,!Wong!SW.!1999.!Sequence!and! genomic!analysis!of!a!Rhesus!macaque!rhadinovirus!with!similarity!to!Kaposi's! sarcomaOassociated!herpesvirus/human!herpesvirus!8.!J!Virol!73:3040O3053.! 250.! Durfee!T,!Nelson!R,!Baldwin!S,!Plunkett!G,!3rd,!Burland!V,!Mau!B,!Petrosino! JF,!Qin!X,!Muzny!DM,!Ayele!M,!Gibbs!RA,!Csorgo!B,!Posfai!G,!Weinstock!GM,! Blattner!FR.!2008.!The!complete!genome!sequence!of!Escherichia!coli!DH10B:! insights!into!the!biology!of!a!laboratory!workhorse.!J!Bacteriol!190:2597O2606.! 251.! Tischer!BK,!Kaufer!BB.!2012.!Viral!bacterial!artificial!chromosomes:! generation,!mutagenesis,!and!removal!of!miniOF!sequences.!J!Biomed!Biotechnol! 2012:472537.! 252.! Borst!EM,!Hahn!G,!Koszinowski!UH,!Messerle!M.!1999.!Cloning!of!the!human! cytomegalovirus!(HCMV)!genome!as!an!infectious!bacterial!artificial! chromosome!in!Escherichia!coli:!a!new!approach!for!construction!of!HCMV! mutants.!J!Virol!73:8320O8329.! 253.! Zhang!Y,!Buchholz!F,!Muyrers!JP,!Stewart!AF.!1998.!A!new!logic!for!DNA! engineering!using!recombination!in!Escherichia!coli.!Nat!Genet!20:123O128.! 254.! Murphy!KC.!1998.!Use!of!bacteriophage!lambda!recombination!functions!to! promote!gene!replacement!in!Escherichia!coli.!J!Bacteriol!180:2063O2071.! 255.! Sakaki!Y,!Karu!AE,!Linn!S,!Echols!H.!1973.!Purification!and!properties!of!the! gammaOprotein!specified!by!bacteriophage!lambda:!an!inhibitor!of!the!host! RecBC!recombination!enzyme.!Proc!Natl!Acad!Sci!U!S!A!70:2215O2219.! 256.! Poteete!AR.!2001.!What!makes!the!bacteriophage!lambda!Red!system!useful!for! genetic!engineering:!molecular!mechanism!and!biological!function.!Fems! Microbiology!Letters!201:9O14.! 257.! Muyrers!JP,!Zhang!Y,!Stewart!AF.!2001.!Techniques:!Recombinogenic! engineeringOOnew!options!for!cloning!and!manipulating!DNA.!Trends!in! biochemical!sciences!26:325O331.! 258.! Leang!RS,!Wu!TT,!Hwang!SM,!Liang!LT,!Tong!LM,!Truong!JT,!Sun!R.!2011.! The!AntiOinterferon!Activity!of!Conserved!Viral!dUTPase!ORF54!is!Essential!for! an!Effective!MHVO68!Infection.!Plos!Pathogens!7.! 259.! Song!MJ,!Hwang!S,!Wong!WH,!Wu!TT,!Lee!S,!Liao!HI,!Sun!R.!2005.! Identification!of!viral!genes!essential!for!replication!of!murine!gammaO herpesvirus!68!using!signatureOtagged!mutagenesis.!Proc!Natl!Acad!Sci!U!S!A! 102:3805O3810.! 260.! Lee!EC,!Yu!D,!Martinez!de!Velasco!J,!Tessarollo!L,!Swing!DA,!Court!DL,! Jenkins!NA,!Copeland!NG.!2001.!A!highly!efficient!Escherichia!coliObased! chromosome!engineering!system!adapted!for!recombinogenic!targeting!and! subcloning!of!BAC!DNA.!Genomics!73:56O65.! 261.! Warming!S,!Costantino!N,!Court!DL,!Jenkins!NA,!Copeland!NG.!2005.!Simple! and!highly!efficient!BAC!recombineering!using!galK!selection.!Nucleic!Acids!Res! 33:e36.! ! 111! 262.! Swaminathan!S,!Ellis!HM,!Waters!LS,!Yu!D,!Lee!EC,!Court!DL,!Sharan!SK.! 2001.!Rapid!engineering!of!bacterial!artificial!chromosomes!using! oligonucleotides.!Genesis!29:14O21.! 263.! Tischer!BK,!von!Einem!J,!Kaufer!B,!Osterrieder!N.!2006.!TwoOstep!redO mediated!recombination!for!versatile!highOefficiency!markerless!DNA! manipulation!in!Escherichia!coli.!Biotechniques!40:191O197.! 264.! Tischer!BK,!Smith!GA,!Osterrieder!N.!2010.!En!passant!mutagenesis:!a!two! step!markerless!red!recombination!system.!Methods!Mol!Biol!634:421O430.! 265.! Zhou!FC,!Zhang!YJ,!Deng!JH,!Wang!XP,!Pan!HY,!Hettler!E,!Gao!SJ.!2002.! Efficient!infection!by!a!recombinant!Kaposi's!sarcomaOassociated!herpesvirus! cloned!in!a!bacterial!artificial!chromosome:!application!for!genetic!analysis.!J! Virol!76:6185O6196.! 266.! Wussow!F,!Fickenscher!H,!Tischer!BK.!2009.!RedOmediated!transposition!and! final!release!of!the!miniOF!vector!of!a!cloned!infectious!herpesvirus!genome.! PLoS!One! 4:e8178.! 267.! Adler!H,!Messerle!M,!Koszinowski!UH.!2001.!Virus!reconstituted!from! infectious!bacterial!artificial!chromosome!(BAC)Ocloned!murine! gammaherpesvirus!68!acquires!wildOtype!properties!in!vivo!only!after!excision! of!BAC!vector!sequences.!J!Virol!75:5692O5696.! 268.! Wu!TT,!Liao!HI,!Tong!L,!Leang!RS,!Smith!G,!Sun!R.!2011.!Construction!and! characterization!of!an!infectious!murine!gammaherpesivrusO68!bacterial! artificial!chromosome.!Journal!of!biomedicine!&!biotechnology!2011:926258.! 269.! Estep!RD,!Powers!MF,!Yen!BK,!Li!H,!Wong!SW.!2007.!Construction!of!an! infectious!rhesus!rhadinovirus!bacterial!artificial!chromosome!for!the!analysis! of!Kaposi's!sarcomaOassociated!herpesvirusOrelated!disease!development.!J! Virol!81:2957O2969.! 270.! Wagner!M,!Jonjic!S,!Koszinowski!UH,!Messerle!M.!1999.!Systematic!excision! of!vector!sequences!from!the!BACOcloned!herpesvirus!genome!during!virus! reconstitution.!J!Virol!73:7056O7060.! 271.! Tischer!BK,!Kaufer!BB,!Sommer!M,!Wussow!F,!Arvin!AM,!Osterrieder!N.! 2007.!A!selfOexcisable!infectious!bacterial!artificial!chromosome!clone!of! varicellaOzoster!virus!allows!analysis!of!the!essential!tegument!protein!encoded! by!ORF9.!J!Virol! 81:13200O13208.! 272.! Delecluse!HJ,!Kost!M,!Feederle!R,!Wilson!L,!Hammerschmidt!W.!2001.! Spontaneous!activation!of!the!lytic!cycle!in!cells!infected!with!a!recombinant! Kaposi's!sarcomaOassociated!virus.!J!Virol!75:2921O2928.! 273.! Sturzl!M,!Konrad!A,!Alkharsah!KR,!Jochmann!R,!Thurau!M,!Marquardt!G,! Schulz!TF.!2009.!The!contribution!of!systems!biology!and!reverse!genetics!to! the!understanding!of!Kaposi's!sarcomaOassociated!herpesvirus!pathogenesis!in! endothelial!cells.!Thromb!Haemost!102:1117O1134.! 274.! Budt!M,!Hristozova!T,!Hille!G,!Berger!K,!Brune!W.!2011.!Construction!of!a! lytically!replicating!Kaposi's!sarcomaOassociated!herpesvirus.!Journal!of! Virology!85:10415O10420.! 275.! Haque!M,!Chen!J,!Ueda!K,!Mori!Y,!Nakano!K,!Hirata!Y,!Kanamori!S,! Uchiyama!Y,!Inagi!R,!Okuno!T,!Yamanishi!K.!2000.!Identification!and!analysis! ! 112! of!the!K5!gene!of!Kaposi's!sarcomaOassociated!herpesvirus.!J!Virol!74:2867O 2875.! 276.! Bechtel!J,!Grundhoff!A,!Ganem!D.!2005.!RNAs!in!the!virion!of!Kaposi's! sarcomaOassociated!herpesvirus.!Journal!of!Virology!79:10138O10146.! 277.! Yoo!SM,!Zhou!FC,!Ye!FC,!Pan!HY,!Gao!SJ.!2005.!Early!and!sustained!expression! of!latent!and!host!modulating!genes!in!coordinated!transcriptional!program!of! KSHV!productive!primary!infection!of!human!primary!endothelial!cells.!Virology! 343:47O64.! 278.! Okuno!T,!Jiang!YB,!Ueda!K,!Nishimura!K,!Tamura!T,!Yamanishi!K.!2002.! Activation!of!human!herpesvirus!8!open!reading!frame!K5!independent!of! ORF50!expression.!Virus!Res! 90:77O89.! 279.! Shin!YC,!Jones!LR,!Manrique!J,!Lauer!W,!Carville!A,!Mansfield!KG,! Desrosiers!RC.!2010.!Glycoprotein!gene!sequence!variation!in!rhesus!monkey! rhadinovirus.!Virology!400:175O186.! 280.! Yoo!SM,!Ahn!AK,!Seo!T,!Hong!HB,!Chung!MA,!Jung!SD,!Cho!H,!Lee!MS.!2008.! Centrifugal!enhancement!of!Kaposi's!sarcomaOassociated!virus!infection!of! human!endothelial!cells!in!vitro.!J!Virol!Methods!154:160O166.! 281.! Myoung!J,!Ganem!D.!2011.!Generation!of!a!doxycyclineOinducible!KSHV! producer!cell!line!of!endothelial!origin:!Maintenance!of!tight!latency!with! efficient!reactivation!upon!induction.!J!Virol!Methods!174:12O21.! 282.! Zong!JC,!Metroka!C,!Reitz!MS,!Nicholas!J,!Hayward!GS.!1997.!Strain!variability! among!Kaposi!sarcomaOassociated!herpesvirus!(human!herpesvirus!8)! genomes:!evidence!that!a!large!cohort!of!United!States!AIDS!patients!may!have! been!infected!by!a!single!common!isolate.!J!Virol!71:2505O2511.! 283.! Tu!CP,!Cohen!SN.!1980.!Translocation!specificity!of!the!Tn3!element:! characterization!of!sites!of!multiple!insertions.!Cell!19:151O160.! 284.! Karlovsky!P,!Vaskova!M.!1986.!Hot!spot!for!Tn1000!insertions!in!cloned! repressor!gene!of!the!L!phage.!Plasmid!16:219O221.! 285.! Bellani!M,!Shlain!V,!Nudel!C,!SanchezRivas!C.!1997.!Tn1000!(gamma!delta)! insertions!stabilize!pBR322Oderived!recombinant!plasmids!in!Escherichia!coli.! Biotechnology!Letters!19:1O5.! 286.! Glaunsinger!B,!Ganem!D.!2004.!Lytic!KSHV!infection!inhibits!host!gene! expression!by!accelerating!global!mRNA!turnover.!Molecular!Cell!13:713O723.! 287.! Lagos!D,!Trotter!MW,!Vart!RJ,!Wang!HW,!Matthews!NC,!Hansen!A,!Flore!O,! Gotch!F,!Boshoff!C.!2007.!Kaposi!sarcoma!herpesvirusOencoded!vFLIP!and! vIRF1!regulate!antigen!presentation!in!lymphatic!endothelial!cells.!Blood! 109:1550O1558.! 288.! Boname!JM,!Stevenson!PG.!2001.!MHC!class!I!ubiquitination!by!a!viral! PHD/LAP!finger!protein.!Immunity!15:627O636.! 289.! Sanchez!DJ,!Gumperz!JE,!Ganem!D.!2005.!Regulation!of!CD1d!expression!and! function!by!a!herpesvirus!infection.!The!Journal!of!clinical!investigation! 115:1369O1378.! 290.! Karki!R,!Lang!SM,!Means!RE.!2011.!The!MARCH!Family!E3!Ubiquitin!Ligase!K5! Alters!Monocyte!Metabolism!and!Proliferation!through!Receptor!Tyrosine! Kinase!Modulation.!Plos!Pathogens!7.! ! 113! 291.! Thomas!M,!Wills!M,!Lehner!PJ.!2008.!Natural!killer!cell!evasion!by!an!E3! ubiquitin!ligase!from!Kaposi's!sarcomaOassociated!herpesvirus.!Biochem!Soc! Trans!36:459O463.! 292.! Arias!C,!Weisburd!B,!Stern@Ginossar!N,!Mercier!A,!Madrid!AS,!Bellare!P,! Holdorf!M,!Weissman!JS,!Ganem!D.!2014.!KSHV!2.0:!A!Comprehensive! Annotation!of!the!Kaposi's!SarcomaOAssociated!Herpesvirus!Genome!Using! NextOGeneration!Sequencing!Reveals!Novel!Genomic!and!Functional!Features.! PLoS!Pathog!10:e1003847.! 293.! Ahn!K,!Angulo!A,!Ghazal!P,!Peterson!PA,!Yang!Y,!Fruh!K.!1996.!Human! cytomegalovirus!inhibits!antigen!presentation!by!a!sequential!multistep! process.!Proc!Natl!Acad!Sci!U!S!A!93:10990O10995.! 294.! Croft!NP,!Shannon@Lowe!C,!Bell!AI,!Horst!D,!Kremmer!E,!Ressing!ME,!Wiertz! EJ,!Middeldorp!JM,!Rowe!M,!Rickinson!AB,!Hislop!AD.!2009.!StageOspecific! inhibition!of!MHC!class!I!presentation!by!the!EpsteinOBarr!virus!BNLF2a!protein! during!virus!lytic!cycle.!PLoS!Pathog!5:e1000490.! 295.! Lanier!LL.!2005.!NK!cell!recognition.!Annu!Rev!Immunol!23:225O274.! 296.! Barel!MT,!Ressing!M,!Pizzato!N,!van!Leeuwen!D,!Le!Bouteiller!P,!Lenfant!F,! Wiertz!EJ.!2003.!Human!cytomegalovirusOencoded!US2!differentially!affects! surface!expression!of!MHC!class!I!locus!products!and!targets!membraneObound,! but!not!soluble!HLAOG1!for!degradation.!J!Immunol!171:6757O6765.! 297.! Llano!M,!Guma!M,!Ortega!M,!Angulo!A,!Lopez@Botet!M.!2003.!Differential! effects!of!US2,!US6!and!US11!human!cytomegalovirus!proteins!on!HLA!class!Ia! and!HLAOE!expression:!impact!on!target!susceptibility!to!NK!cell!subsets.!Eur!J! Immunol!33:2744O2754.! 298.! Cohen!GB,!Gandhi!RT,!Davis!DM,!Mandelboim!O,!Chen!BK,!Strominger!JL,! Baltimore!D.!1999.!The!selective!downregulation!of!class!I!major! histocompatibility!complex!proteins!by!HIVO1!protects!HIVOinfected!cells!from! NK!cells.!Immunity!10:661O671.! 299.! Odom!CI,!Gaston!DC,!Markert!JM,!Cassady!KA.!2012.!Human!herpesviridae! methods!of!natural!killer!cell!evasion.!Adv!Virol!2012:359869.! 300.! Vider@Shalit!T,!Fishbain!V,!Raffaeli!S,!Louzoun!Y.!2007.!PhaseOdependent! immune!evasion!of!herpesviruses.!Journal!of!Virology!81:9536O9545.! 301.! Nachmani!D,!Stern@Ginossar!N,!Sarid!R,!Mandelboim!O.!2009.!Diverse! Herpesvirus!MicroRNAs!Target!the!StressOinduced!Immune!Ligand!MICB!to! Escape!Recognition!by!Natural!Killer!Cells.!Cell!Host!&!Microbe!5:376O385.! 302.! Apps!R,!Qi!Y,!Carlson!JM,!Chen!H,!Gao!X,!Thomas!R,!Yuki!Y,!Del!Prete!GQ,! Goulder!P,!Brumme!ZL,!Brumme!CJ,!John!M,!Mallal!S,!Nelson!G,!Bosch!R,! Heckerman!D,!Stein!JL,!Soderberg!KA,!Moody!MA,!Denny!TN,!Zeng!X,!Fang!J,! Moffett!A,!Lifson!JD,!Goedert!JJ,!Buchbinder!S,!Kirk!GD,!Fellay!J,!McLaren!P,! Deeks!SG,!Pereyra!F,!Walker!B,!Michael!NL,!Weintrob!A,!Wolinsky!S,!Liao! W,!Carrington!M.!2013.!Influence!of!HLAOC!expression!level!on!HIV!control.! Science!340:87O91.! 303.! Ameres!S,!Mautner!J,!Schlott!F,!Neuenhahn!M,!Busch!DH,!Plachter!B,! Moosmann!A.!2013.!Presentation!of!an!immunodominant!immediateOearly! CD8+!T!cell!epitope!resists!human!cytomegalovirus!immunoevasion.!PLoS! Pathog!9:e1003383.! ! 114! 304.! Kulpa!DA,!Collins!KL.!2011.!The!emerging!role!of!HLAOC!in!HIVO1!infection.! Immunology!134:116O122.! 305.! Griffin!BD,!Gram!AM,!Mulder!A,!Van!Leeuwen!D,!Claas!FH,!Wang!F,!Ressing! ME,!Wiertz!E.!2013.!EBV!BILF1!evolved!to!downregulate!cell!surface!display!of! a!wide!range!of!HLA!class!I!molecules!through!their!cytoplasmic!tail.!J!Immunol! 190:1672O1684.! 306.! Jochum!S,!Moosmann!A,!Lang!S,!Hammerschmidt!W,!Zeidler!R.!2012.!The! EBV!immunoevasins!vILO10!and!BNLF2a!protect!newly!infected!B!cells!from! immune!recognition!and!elimination.!PLoS!Pathog!8:e1002704.! 307.! Zuo!J,!Thomas!W,!van!Leeuwen!D,!Middeldorp!JM,!Wiertz!EJ,!Ressing!ME,! Rowe!M.!2008.!The!DNase!of!gammaherpesviruses!impairs!recognition!by! virusOspecific!CD8+!T!cells!through!an!additional!host!shutoff!function.!J!Virol! 82:2385O2393.! 308.! Rehm!A,!Engelsberg!A,!Tortorella!D,!Korner!IJ,!Lehmann!I,!Ploegh!HL,! Hopken!UE.!2002.!Human!cytomegalovirus!gene!products!US2!and!US11!differ! in!their!ability!to!attack!major!histocompatibility!class!I!heavy!chains!in! dendritic!cells.!J!Virol!76:5043O5050.! 309.! Bechtel!JT,!Liang!Y,!Hvidding!J,!Ganem!D.!2003.!Host!range!of!Kaposi's! sarcomaOassociated!herpesvirus!in!cultured!cells.!J!Virol!77:6474O6481.! 310.! Wagner!M,!Gutermann!A,!Podlech!J,!Reddehase!MJ,!Koszinowski!UH.!2002.! Major!histocompatibility!complex!class!I!alleleOspecific!cooperative!and! competitive!interactions!between!immune!evasion!proteins!of!cytomegalovirus.! J!Exp!Med!196:805O816.! 311.! Kavanagh!DG,!Gold!MC,!Wagner!M,!Koszinowski!UH,!Hill!AB.!2001.!The! multiple!immuneOevasion!genes!of!murine!cytomegalovirus!are!not!redundant:! m4!and!m152!inhibit!antigen!presentation!in!a!complementary!and!cooperative! fashion.!J!Exp!Med!194:967O978.! 312.! Noriega!VM,!Tortorella!D.!2009.!Human!cytomegalovirusOencoded!immune! modulators!partner!to!downregulate!major!histocompatibility!complex!class!I! molecules.!J!Virol!83:1359O1367.! 313.! Noriega!VM,!Hesse!J,!Gardner!TJ,!Besold!K,!Plachter!B,!Tortorella!D.!2012.! Human!cytomegalovirus!US3!modulates!destruction!of!MHC!class!I!molecules.! Mol!Immunol!51:245O253.! 314.! Jones!T,!Ramos!da!Silva!S,!Bedolla!R,!Ye!F,!Zhou!F,!Gao!SJ.!2014.!Viral!cyclin! promotes!KSHVOinduced!cellular!transformation!and!tumorigenesis!by! overriding!contact!inhibition.!Cell!cycle!13.! 315.! Jones!T,!Ye!F,!Bedolla!R,!Huang!Y,!Meng!J,!Qian!L,!Pan!H,!Zhou!F,!Moody!R,! Wagner!B,!Arar!M,!Gao!SJ.!2012.!Direct!and!efficient!cellular!transformation!of! primary!rat!mesenchymal!precursor!cells!by!KSHV.!J!Clin!Invest!122:1076O 1081.! 316.! Picchio!GR,!Sabbe!RE,!Gulizia!RJ,!McGrath!M,!Herndier!BG,!Mosier!DE.!1997.! The!KSHV/HHV8Oinfected!BCBLO1!lymphoma!line!causes!tumors!in!SCID!mice! but!fails!to!transmit!virus!to!a!human!peripheral!blood!mononuclear!cell!graft.! Virology!238:22O29.! ! 115! 317.! Miyagi!J,!Masuda!M,!Takasu!N,!Nagasaki!A,!Shinjyo!T,!Uezato!H,!Kakazu!N,! Tanaka!Y.!2002.!Establishment!of!a!primary!effusion!lymphoma!cell!line!(RMO P1)!and!in!vivo!growth!system!using!SCID!mice.!Int!J!Hematol!76:165O172.! 318.! Mutlu!AD,!Cavallin!LE,!Vincent!L,!Chiozzini!C,!Eroles!P,!Duran!EM,!Asgari!Z,! Hooper!AT,!La!Perle!KM,!Hilsher!C,!Gao!SJ,!Dittmer!DP,!Rafii!S,!Mesri!EA.! 2007.!In!vivoOrestricted!and!reversible!malignancy!induced!by!human! herpesvirusO8!KSHV:!a!cell!and!animal!model!of!virally!induced!Kaposi's! sarcoma.!Cancer!Cell!11:245O258.! 319.! Collins!CM,!Speck!SH.!2012.!Tracking!murine!gammaherpesvirus!68!infection! of!germinal!center!B!cells!in!vivo.!PLoS!One! 7:e33230.! 320.! Chandriani!S,!Xu!Y,!Ganem!D.!2010.!The!lytic!transcriptome!of!Kaposi's! sarcomaOassociated!herpesvirus!reveals!extensive!transcription!of!noncoding! regions,!including!regions!antisense!to!important!genes.!Journal!of!Virology! 84:7934O7942.! 321.! Karki!R,!Lang!SM,!Means!RE.!2011.!The!MARCH!family!E3!ubiquitin!ligase!K5! alters!monocyte!metabolism!and!proliferation!through!receptor!tyrosine!kinase! modulation.!PLoS!Pathog!7:e1001331.! 322.! Low!W,!Harries!M,!Ye!H,!Du!MQ,!Boshoff!C,!Collins!M.!2001.!Internal! ribosome!entry!site!regulates!translation!of!Kaposi's!sarcomaOassociated! herpesvirus!FLICE!inhibitory!protein.!J!Virol!75:2938O2945.! 323.! Grundhoff!A,!Ganem!D.!2001.!Mechanisms!governing!expression!of!the!vOFLIP! gene!of!Kaposi's!sarcomaOassociated!herpesvirus.!J!Virol!75:1857O1863.! 324.! Bieleski!L,!Talbot!SJ.!2001.!Kaposi's!sarcomaOassociated!herpesvirus!vCyclin! open!reading!frame!contains!an!internal!ribosome!entry!site.!J!Virol!75:1864O 1869.! 325.! Morris!DR,!Geballe!AP.!2000.!Upstream!open!reading!frames!as!regulators!of! mRNA!translation.!Mol!Cell!Biol!20:8635O8642.! 326.! Kleijnen!MF,!Huppa!JB,!Lucin!P,!Mukherjee!S,!Farrell!H,!Campbell!AE,! Koszinowski!UH,!Hill!AB,!Ploegh!HL.!1997.!A!mouse!cytomegalovirus! glycoprotein,!gp34,!forms!a!complex!with!folded!class!I!MHC!molecules!in!the! ER!which!is!not!retained!but!is!transported!to!the!cell!surface.!EMBO!J! 16:685O 694.! 327.! Kavanagh!DG,!Koszinowski!UH,!Hill!AB.!2001.!The!murine!cytomegalovirus! immune!evasion!protein!m4/gp34!forms!biochemically!distinct!complexes!with! class!I!MHC!at!the!cell!surface!and!in!a!preOGolgi!compartment.!J!Immunol! 167:3894O3902.! 328.! Holtappels!R,!Gillert@Marien!D,!Thomas!D,!Podlech!J,!Deegen!P,!Herter!S,! Oehrlein@Karpi!SA,!Strand!D,!Wagner!M,!Reddehase!MJ.!2006.! Cytomegalovirus!encodes!a!positive!regulator!of!antigen!presentation.!J!Virol! 80:7613O7624.! 329.! Toth!Z,!Maglinte!DT,!Lee!SH,!Lee!HR,!Wong!LY,!Brulois!KF,!Lee!S,!Buckley! JD,!Laird!PW,!Marquez!VE,!Jung!JU.!2010.!Epigenetic!analysis!of!KSHV!latent! and!lytic!genomes.!Plos!Pathogens!6:e1001013.! 330.! Ciufo!DM,!Cannon!JS,!Poole!LJ,!Wu!FY,!Murray!P,!Ambinder!RF,!Hayward!GS.! 2001.!Spindle!cell!conversion!by!Kaposi's!sarcomaOassociated!herpesvirus:! formation!of!colonies!and!plaques!with!mixed!lytic!and!latent!gene!expression! ! 116! in!infected!primary!dermal!microvascular!endothelial!cell!cultures.!Journal!of! Virology!75:5614O5626.!

Abstract (if available)

Abstract The generation and analysis of recombinant viruses is an essential technique for the interrogation of viral gene function under physiologically relevant conditions. Manipulation of large DNA viruses such as KSHV requires the use of bacterial artificial chromosomes, large capacity replicons that allow the propagation of up to 300kb of sequence. I constructed and characterized a new bacterial artificial chromosome clone of the KSHV genome. To demonstrate its utility, the role of K3 and K5 was examined at various stages of the KSHV lifecycle. Using a variety of recombinant viruses, I identified stage-specific roles for K3 and K5 during lytic replication. These results not only provide new insight into γ-herpesvirus immune evasion but they demonstrate the utility of BAC16 as a new genetic system for examining KSHV gene function in the context of infected cells.

Linked assets

University of Southern California Dissertations and Theses

Conceptually similar

PDF

Kaposi's sarcoma associated herpes-virus induces cellular proxi expression to modulate host gene expression that benefits viral infection and oncogenesis

PDF

Epigenomic analyses of Kaposi's sarcoma-associated herpesvirus

PDF

Protein deamidation mediated metabolic reprogramming during KSHV lytic replication

PDF

Single cell gene expression analysis of KSHV infection in three-dimensional oral epithelial tissue cultures

PDF

Virus customization of host protein machinery for efficient propagation

PDF

Regulation of acute KSHV infection by SIRT1

PDF

FoxO1 suppresses Kaposi's sarcoma-associated herpesvirus lytic replication and controls viral latency

PDF

Molecular characterization of the HIV-1 Vpu protein and its role in antagonizing the cellular restriction factor BST-2/tetherin both in vitro and in vivo

PDF

Mechanism of ethanol-mediated increase of SARS-COV-2 entry through GRP78 induction

PDF

Identification and characterization of the enhancer elements for lymphatic-specific expression of Prox1

PDF

Visualization and characterization of rat lymphatic vasculature in a Prox1-EGFP bacterial artificial chromosome (BAC) transgenic rat: a novel animal model for physiological and pathological lymph...

PDF

Epigenetic plasticity of cultured female human embryonic stem cells and regulation of gene expression and chromatin by PR-SET7 mediated H4K20me1

PDF

Placental growth factor mediated transcriptional and post-transcriptional regulation of hemeoxygenase-1

PDF

Hepatic c-Jun overexpression metabolically reprograms cancer cells through mTORC2/AKT pathway

PDF

UVRAG mediates Atg9 transport upon autophagy induction

PDF

trans-translation in mycobacteria: expression, regulation, and the effects of ribosome inhibitors

PDF

Exploration of the roles of cancer stem cells and survivin in the pathogenesis and progression of prostate cancer

PDF

Study of protein deamidation in innate immune signaling

PDF

The essential role of histone H2A deubiquitinase MYSM1 in natural killer cell maturation and HSC homeostasis

PDF

Rib resection and healing in the mouse: a new model of bone repair

Asset Metadata

Creator Brulois, Kevin (author)

Core Title KSHV-mediated modulation of immunoreceptor surface expression

School Keck School of Medicine

Degree Doctor of Philosophy

Degree Program Biology

Publication Date 04/15/2015

Defense Date 03/18/2014

Publisher University of Southern California (original), University of Southern California. Libraries (digital)

Tag HHV-8,K3,K5,KSHV,MIR1,MIR2,OAI-PMH Harvest

Format application/pdf (imt)

Language English

Contributor Electronically uploaded by the author (provenance)

Advisor Jung, Jae U. (committee chair), Feng, Pinghui (committee member), Hong, Young-Kwon (committee member), Machida, Keigo (committee member), Ou, J.-H. James (committee member)

Creator Email brulois@usc.edu,kevin.brulois@gmail.com

Permanent Link (DOI) https://doi.org/10.25549/usctheses-c3-379206

Unique identifier UC11295397

Identifier etd-BruloisKev-2360.pdf (filename),usctheses-c3-379206 (legacy record id)

Legacy Identifier etd-BruloisKev-2360-0.pdf

Dmrecord 379206

Document Type Dissertation

Format application/pdf (imt)

Rights Brulois, Kevin

Type texts

Source University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Access Conditions The author retains rights to his/her dissertation, thesis or other graduate work according to U.S. copyright law. Electronic access is being provided by the USC Libraries in agreement with the a...

Repository Name University of Southern California Digital Library

Repository Location USC Digital Library, University of Southern California, University Park Campus MC 2810, 3434 South Grand Avenue, 2nd Floor, Los Angeles, California 90089-2810, USA