University of Southern California Dissertations and Theses

Induction of hypersignaling as a therapeutic approach for treatment of BCR-ABL1 positive Acute Lymphoblastic Leukemia (ALL) cells

(USC Thesis Other)

Induction of hypersignaling as a therapeutic approach for treatment of BCR-ABL1 positive Acute Lymphoblastic Leukemia (ALL) cells

PDF

Download a page range

Download transcript

Copy asset link

Request this asset

Transcript (if available)

Content i

Induction of hypersignaling as a therapeutic approach for treatment of BCR-ABL1
positive Acute Lymphoblastic Leukemia (ALL) cells

by

Seyedmehdi Shojaee

A Dissertation Presented to the
FACULTY OF THE USC GRADUATE SCHOOL
UNIVERSITY OF SOUTHERN CALIFORNIA
In Partial Fulfillment of the
Requirements for the Degree
DOCTOR OF PHILOSOPHY
(GENETIC, MOLECULAR AND CELLULAR BIOLOGY)

May 2013

Copyright 2013 Seyedmehdi Shojaee

ii

Acknowledgements
I would like to take the opportunity and sincerely thank all the people who have helped
me in some manner during the course of my PhD.
Dr. Markus Müschen, my advisor and PI, who trusted me to work with and gave me the
opportunity to learn. With no doubt, his ambitions and manners would be a role model
for my future academic career.
I am very grateful to all our collaborators, Dr. Ari Melnick, Dr. Phillip Koeffler, Dr. Thomas
Graeber and Dr. Björn Titz, who provided us with resources or experimental data. Next I
thank my committee members – Dr. Michael Lieber, Dr. Jae Jung, Dr. Eleanora
Heisterkamp and Dr. Yong-Mi Kim for their constant guidance and support during the
completion of the work for this thesis.
Dr. Zoltan Tokes helped me to join USC, I appreciate his trust forever.
I thank all my current and past lab members for their help with experiments. Having them
by my side, I was rest assured than I have enough help and support whenever I would
need it. I would specially like to thank Hilde Schjerven for her great support in writing my
thesis.
My friends Reza Kalhor, Narges, Sara, Reza Tabatabai, Amjad, Niki, Yassan, Kaveh,
Hossein, Nader, Pardis and Kiana; You guys did a lot, thank you.
Not seeing my mother and brother during my PhD, I cannot describe how much I missed
them. Although their love and support was with me all throughout this time.
And finally, I have to say without having Marzi, my wife and all time supporter, I would
not have been able to stand many tough moments. A heartfelt thank you is the least I
can offer…
iii

Table of Contents
Acknowledgements ...................................................................................................... ii
List of Tables ...............................................................................................................vii
List of Figures ............................................................................................................. viii
Abstract .........................................................................................................................xi
Chapter 1 ....................................................................................................................... 1
Introduction .................................................................................................................. 1
1.1. Kinase driven tumors and their therapeutic strategies .......................................... 1
1.2. Kinase dependent acute lymphoblastic leukemia (ALL) ....................................... 1
1.3. Philadelphia (Ph) chromosome ............................................................................ 3
1.4 Drug treatment and resistance .............................................................................. 4
1.5. Hypersignaling in transformed cells ..................................................................... 5
1.6. Reactive oxygen species and their effects in transformed cells ............................ 6
1.7. An overview of the objectives and conclusions of this thesis. ............................... 7
Chapter 2 ....................................................................................................................... 8
Inhibition of negative feedback regulators of the MAPK pathway in kinase driven
leukemia ........................................................................................................................ 8
2.1. Introduction .......................................................................................................... 8
2.1.1. Negative regulators in kinase dependent signaling ........................................ 8
2.1.2 Mitogen-activated protein kinases (MAPK) pathway ....................................... 9
2.1.3 MAPK Negative feedback regulators .............................................................10
2.1.3.1. SPRY2 ..................................................................................................12
2.1.3.2. DUSP6 ..................................................................................................13
2.2. Materials and methods........................................................................................16
2.2.1. Patient samples, human cells and cell lines ..................................................16
2.2.2. Extraction of bone marrow cells from mice and generation of BCR-ABL1+ B
cell lineage ALL ......................................................................................................16
2.2.3. Western blotting ............................................................................................17
2.2.4. Flow cytometry .............................................................................................17
2.2.5. Colony forming assay for mouse ALL ...........................................................17
2.2.6. Retrovirus production and transduction ........................................................18
2.2.7. Senescence-associated β-galactosidase assay ............................................18
2.2.8. Cell-cycle analysis ........................................................................................19
2.2.9. ROS staining ................................................................................................19
2.2.10. Cell viability assay for murine cells .............................................................20
2.2.11. Cell viability assay for human cells .............................................................20
iv

2.3. Results ...............................................................................................................21
2.3.1 Hypersignaling is not a favorable condition for leukemia cells ........................21
2.3.2. Characterizing the negative feedback regulators in Ph+ ALL cells ................22
2.3.3. Genetic deletion of Spry2 in Ph+ like ALL causes drastic apoptosis and cell
cycle arrest .............................................................................................................23
2.3.4. Deletion of Spry2 in Ph+ like ALL decreases their ability to engraft in recipient
mice .......................................................................................................................25
2.3.5. Dusp6-/- pre-B cells are less competent for BCR-ABL1 kinase transformation
than wildtype cells ..................................................................................................26
2.3.6. Dusp6-/- B cell lineage BCR-ABL1 cells have less self-renewal ability and
higher sensitivity to cellular senescence than wildtype leukemia ............................28
2.3.7. ROS generation is a possible contributor to cell toxicity in the presence of
hypersignaling ........................................................................................................29
2.3.8. Small molecule inhibition of DUSP6 using BCI .............................................31
2.3.9. BCI treatment increases the NADPH oxidase dependent ROS level ............33
2.3.10. P53 and ARF are required for the toxicity of BCI ........................................35
2.3.11. Cross-talk between MAPK and JAK/STAT pathways occurs in the presence
of MAPK hypersignaling .........................................................................................36
2.3.12. MAPK pathway hyperactivation causes the dephosphorylation of STAT5 ...38
2.3.13. Constitutively active STAT5 can alleviate the toxicity of MAPK
hyperactivation .......................................................................................................39
2.3.14. PTPN6 phosphatase links the MAPK and JAK/STAT pathways .................40
2.3.15. Therapeutic applications of small molecule inhibitor of DUSP6 ...................42
2.4. Conclusion ..........................................................................................................44
Chapter 3: ....................................................................................................................48
Targeting inhibitory phosphatase signaling in Ph+ ALL ........................................48
3.1. Introduction .........................................................................................................48
3.1.1 Inhibitory receptors and phosphatases ..........................................................48
3.1.2. PI3K/AKT pathway and its regulators ...........................................................49
3.1.3. PTEN ............................................................................................................50
3.1.4. INPP5D ........................................................................................................51
3.1.5. PTPN6 ..........................................................................................................52
3.2. Materials and methods........................................................................................54
3.2.1. Patient samples, human cells and cell lines ..................................................54
3.2.2. Extraction of bone marrow cells from mice and generation of BCR-ABL1
+
B
cell lineage ALL ......................................................................................................54
3.2.3. Western blotting ............................................................................................55
v

3.2.4. Flow cytometry .............................................................................................55
3.2.5. Colony forming assay for mouse ALL ...........................................................56
3.2.6. Retrovirus production and transduction ........................................................56
3.2.7. Senescence-associated β-galactosidase assay ............................................57
3.2.8. Cell-cycle analysis ........................................................................................57
3.2.9. ROS staining ................................................................................................57
3.2.10. Affymetrix gene expression analysis ...........................................................58
3.2.11. Tyrosine Kinase Inhibitors (Imatinib), PTEN inhibitor (VO-OH) and INPP5D
inhibitor (3-AC) .......................................................................................................59
3.2.12. Cell viability assay for murine cells .............................................................59
3.2.13. Cell viability assay for human cells .............................................................59
3.3. Results ...............................................................................................................61
3.3.1 PI3K/AKT pathway hypersignaling is unfavorable for B cell lineage Ph
+
ALL
cells ........................................................................................................................61
3.3.2 Ph
+
ALL cells show higher expression levels of inhibitory receptors and
inhibitory phosphatases ..........................................................................................62
3.3.3 Genetic models for deletion of inhibitory phosphatases in Ph
+
ALL and CML
cells ........................................................................................................................65
3.3.4 Deletions of inhibitory phosphatases cause drastic cell death only in B cell
lineage BCR-ABL1 ALL cells ..................................................................................66
3.3.5 Deletions of inhibitory phosphatases decrease the self-renewal ability and
induce cellular senescence in B cell lineage BCR-ABL1
+
ALL cells ........................70
3.3.6 Deletions of inhibitory phosphatases induce cell cycle arrest in B cell lineage
BCR-ABL1
+
ALL cells .............................................................................................71
3.3.7 Deletions of inhibitory phosphatases increase the signaling level within the B
cell lineage BCR-ABL1 ALL cells ............................................................................72
3.3.8 Deletions of inhibitory phosphatases increase the level of reactive oxygen
species (ROS) and result in accumulation of DNA damage check point proteins ....76
3.3.9 Phosphatase null BCR-ABL1 ALL cells are less capable of initiating full blown
leukemia in vivo upon transplantation .....................................................................77
3.3.10 Deletion of either of the inhibitory phosphatases lead to similar global gene
expression changes as compared to wildtype cells ................................................79
3.3.11 Deletions of inhibitory phosphatases increase the sensitivity of BCR-ABL1
ALL cells to tyrosine kinase inhibitors .....................................................................80
3.3.12 Side effects of Pten deletion in BCR-ABL1 cells are dosage dependent ......82
3.3.13 Small molecule inhibition of PTEN is a potential therapeutic approach for Ph
+

ALL .........................................................................................................................83
vi

3.3.14 Small molecule inhibitor of INPP5D shows therapeutic benefit in Ph
+
ALL
treatment ................................................................................................................85
3.4. Conclusion ..........................................................................................................89
Chapter 4 ......................................................................................................................92
Conclusions ...............................................................................................................92
4.1. Discussion ..........................................................................................................92
Bibliography ................................................................................................................97
Appendix .................................................................................................................... 113
Supplementary tables .............................................................................................. 113

vii

List of Tables
Table S1: List of primary cases and cell lines .............................................................. 113
Table S2: List of primary cases and cell lines .............................................................. 114
Table S3: List of primary cases and cell lines .............................................................. 115
Table S4: Genetic mouse models ................................................................................ 116
Table S5: Antibodies used for Western blot ................................................................. 117
Table S6: Antibodies used for flow cytometry .............................................................. 118
Table S7: Sequences of oligonucleotide primers used ............................................... 119

viii

List of Figures
Figure 1.1. Schematic of BCR-ABL1 and its downstream pathways. .............................. 4
Figure 2.1.Schematic of the MAPK Signaling pathway and two feedback negative
regulators. .....................................................................................................................11
Figure 2.2.Kinase activity of BCR-ABL1 is not favorable for Ph
-
ALL cells. ....................21
Figure 2.3.Characterizing negative feedback regulator candidates for induction of
hypersignaling. ..............................................................................................................23
Figure 2.4.Deletion of Spry2 resulted in extensive negative outcomes in B cell lineage
BCR-ABL1 transformed cells. ........................................................................................24
Figure 2.5.Spry2 deletion decreases leukemia engraftment in vivo. ..............................25
Figure 2.6.DUSP6 is required for efficient transformation of pre-B cells by kinase
oncogenes. ....................................................................................................................27
Figure 2.7.DUSP6

potentiates the self-renewal of BCR-ABL1 ALL cells and its absence
increases their sensitivity to cellular senescence. ..........................................................29
Figure 2.8.Deficiency in negative feedback regulators results in elevated ROS levels. ..30
Figure 2.9.Small molecule inhibition of DUSP6 induces signaling imbalance and
apoptosis in Ph
+
ALL. ....................................................................................................32
Figure 2.10.BCI induces toxicity via NADPH oxidase dependent elevation of ROS. ......34
Figure 2.11. BCI toxicity in Ph
+
ALL cells are P53 and ARF dependent. ........................35
Figure 2.12.DUSP6 inhibition with BCI affects the JAK/STAT pathway. .........................37
Figure 2.13.MAPK hyperactivation causes STAT5 dephosphorylation which is toxic for
Ph
+
ALL. ........................................................................................................................38
Figure 2.14.Consitututvely active form of STAT5 is beneficial in the presence of MAPK
hyperactivity. .................................................................................................................40
Figure 2.15.PTPN6 is the connecting phosphatase between JAK/STAT and MAPK
pathways. ......................................................................................................................41
Figure 2.16.In vivo treatment of Ph
+
ALL with BCI. ........................................................42
Figure 2.17.Ex vivo treatment of Ph
+
ALL with BCI. .......................................................43
Figure 3.1 Schematic of the inhibitory phosphatases PTEN, INPP5D and PTPN6. .......50
Figure 3.2. Induction of hypersignaling in the PI3K/AKT pathway in BCR-ABL1
transformed cells. ..........................................................................................................62
Figure 3.3. Expression levels of different negative regulatory genes in progenitor B cells,
kinase dependent and kinase independent transformed B cells. ...................................63
ix

Figure 3.4. Analysis of differential expression of inhibitory receptors. ............................64
Figure 3.5. Western blots for the inhibitory phosphatasesINPP5D and PTPN6. .............65
Figure 3.6. Confirmation of genetic deletions of inhibitory phosphatases in B cell lineage
Ph
+
like ALL. ..................................................................................................................66
Figure 3.7. Toxic effects of the inhibitory phosphatase deletion are lineage restricted. ..67
Figure 3.8. Mechanisms for different responses to phosphatase deletion in different
hematopoietic cell types. ...............................................................................................69
Figure 3.9. Deletions of inhibitory phosphatases in BCR-ABL1 ALL cells result in loss of
self-renewal ability and increase in cellular senescence. ...............................................71
Figure 3.10. Deletion of the inhibitory phosphatases in BCR-ABL1 ALL cells results in
cell cycle perturbation. ...................................................................................................72
Figure 3.11. Deletion of inhibitory phosphatases induced hypersignaling in BCR-ABL1
ALL cells. .......................................................................................................................73
Figure 3.12. Activation of the PI3K/AKT pathway suppressed the JAK/STAT5 pathway
activity. ..........................................................................................................................74
Figure 3.13.Hyperactivity of STAT5 is less toxic in the Pten null BCR-ABL1 ALL cells. .75
Figure 3.14. Negative outcomes upon deletion of inhibitory phosphatases may depend
on ROS generation and accumulation of DNA damage molecules. ...............................77
Figure 3.15. The inhibitory phosphatase deficient BCR-ABL1 ALL cells are less potent in
vivo than the wildtype leukemia. ....................................................................................78
Figure 3.16. Alterations in gene expression profiles after deletion of each inhibitory
phosphatase. .................................................................................................................80
Figure 3.17. Phosphatase null BCR-ABL1 cells are more sensitive to tyrosine kinase
inhibition. .......................................................................................................................81
Figure 3.18. Negative effects of Pten deletion in BCR-ABL1 ALL cells is dosage
dependent. ....................................................................................................................82
Figure 3.19. Small molecule inhibitor of PTEN is beneficial in treatment of Ph
+
Leukemia.
......................................................................................................................................84
Figure 3.20. Chemical inhibition of PTEN sensitizes the BCR-ABL1 ALL cells to the TKI
treatment. ......................................................................................................................85
Figure 3.21. Small molecule inhibitor of INPP5D is toxic for Ph
+
ALL cells.....................87
Figure 3.22. Ex vivo treatment of Ph
+
ALL with 3AC decreases the leukemiagenesis. ...88
Figure 4.1. Illustration of the kinase signaling and its regulatory mechanisms in B lineage
BCR-ABL1 leukemia cells. .............................................................................................94
x

Figure 4.2. Illustration of the comfort zone. ....................................................................95

xi

Abstract
Current therapy approaches for tyrosine kinase driven leukemia including Ph
+
ALL and
CML are almost entirely focused on the development of more potent tyrosine kinase
inhibitors (TKI). The ultimate goal in this approach is to reduce the oncogenic signaling
below a minimum threshold that is required for the survival of leukemia cells. Despite the
successful results obtained so far, this approach has its own drawbacks. Unfortunately,
TKI treatment is not very effective in Ph+ ALL patients. Furthermore, in CML patients it
can lead to the appearance of resistant tumors that are not sensitive to therapy
anymore. Therefore, new strategies for killing the Ph
+
leukemia independent of kinase
inhibition are necessary.
Hypersignaling has been known as an unfavorable condition for the survival of cells, and
induction of hypersignaling may result in stalled proliferation or cellular senescence.
However, its implication as a therapeutic mean has not been well-characterized. One
strategy for induction of hypersignaling is to suppress the inhibitory regulators of
signaling pathways. Therefore, we hypothesized that inhibition of negative feedback
regulators or inhibitory phosphatases in Ph+ kinase leukemia could raise the signaling
level and induce cell cycle arrest or senescence in transformed cells. Importantly, cells
lacking high oncogenic kinase activity should be insensitive to such inhibition of negative
feedback signaling
In chapter two of this thesis, we focused on the mitogen-activated protein kinase (MAPK)
pathway. By the analysis of gene expression changes and evaluation of protein levels,
we found that DUSP6 and SPRY2, two negative feedback regulators of the MAPK
pathway, are highly expressed in human B cell lineage Ph
+
ALL, while they are not
expressed in B cell progenitor cells. Interestingly, in contrast to BCR-ABL1 kinase driven
xii

leukemia, non kinase-driven B cell Non-Hodgkin-Lymphoma (B-NHL) lack expression of
these genes. To study the function of DUSP6 and SPRY2 in a genetic mouse model of
Ph+ like leukemia, we transduced bone marrow pre-B cells from DUSP6
-/-
, SPRY2
fl/fl

mice and respective wildtype controls with retroviral BCR-ABL1. Defects in either of
these two negative feedback mediators caused profound signaling imbalances in BCR-
ABL1 leukemia cells and resulted in drastic negative consequences for the cells. For
instance, Dusp6-deficient leukemia cells rapidly underwent cellular senescence and
were less capable of colony formation in semisolid culture. In addition, Lack of Dusp6
and Spry2 dramatically increased cellular reactive oxygen species (ROS). Furthermore,
inducible Cre-mediated deletion of Spry2 in leukemia cells resulted in rapid cell death.
To test whether negative feedback signaling molecules represent a potential target for
pharmacological inhibition in the treatment of kinase driven leukemia, we tested the
DUSP6 small molecule inhibitor 2-benzylidene-3-(cyclohexylamino)-1-Indanone
hydrochloride (BCI). BCI induced massive accumulation of ROS and subsequent cell
death in a panel of patient-derived cases of Ph+ ALL, including two cases with T315I
mutation. In vivo and ex vivo studies showed that BCI can increase the survival of
NOD/SCID recipient mice transplanted with patient-derived Ph
+
ALL cells with T315I
mutation.
In chapter three, we turn to the inhibitory phosphatases in Ph
+
ALL cells. We found that
three key inhibitory phosphatases (INPP5D/SHIP1, PTEN and PTPN6/SHP1) are
expressed at high levels in these cells. INPP5D and PTEN negatively regulate AKT
mediated signaling by dephosphorylating phosphatidylinositol-3,4,5-trisphosphate, at 5-
and 3-phosphates, respectively. In addition, PTPN6 and INPP5D can both be recruited
to the ITIM motifs of various inhibitory surface receptors and negatively regulate
activation signals from tyrosine kinases and activating receptors.
xiii

We showed that Cre-mediated deletion of Pten, Inpp5d and Ptpn6 in B cell lineage BCR-
ABL1

ALL cells resulted in increased signaling downstream of the BCR-ABL1 kinase.
Interestingly, this hypersignaling resulted in a variety of negative outcomes for the ALL
cells such as drastic upregulation of reactive oxygen species (ROS), accumulation of
DNA damage molecules, increased levels of cellular senescence and cell death.
Studying B cell lineage BCR-ABL1 transformed Inpp5d
fl/fl
, Pten
fl/fl
and Ptpn6
fl/fl
leukemia
cells in vivo, we observed that deletion of these inhibitory phosphatases resulted in
prolonged survival of leukemia transplant recipient mice. In addition, using small
molecule inhibitors of INPP5D (3AC) and PTEN (VO-OHpic) recapitulated the genetic
findings and killed patient-derived leukemia cells carrying the T315I mutant BCR-ABL1.
We also found that one of the side effects of hypersignaling is the crosstalk between
different signaling pathways. Surprisingly, induction of hypersignaling in the MAPK or
PI3K/AKT pathways caused downregulation of the JAK/STAT pathway. While STAT5
activity is necessary for survival of the Ph+ leukemia cells, hypersignaling in other two
pathways lead to acute dephosphorylation of STAT5.
In summary, our studies identify negative feedback regulators of the MAPK pathway
(including DUSP6 and SPRY2) and inhibitory phosphatases such as PTEN, INPP5D and
PTPN6 as novel therapeutic targets in BCR-ABL1 positive B cell lineage leukemia.
Pharmacological blockade of these molecules represents a fundamentally novel and
powerful approach to increase oncogenic signaling beyond a tolerable threshold, thus
causing excessive accumulation of ROS, crosstalk between different signaling pathways
and subsequent cell death.

1

Chapter 1
Introduction
1.1. Kinase driven tumors and their therapeutic strategies
The most commonly mutated domain in tumor cells is the protein kinase domain (Futreal
et al., 2004). Gene amplifications, gene fusions, mutations and epigenetic alternations all
may result in hyperactive kinases, and over-activation of kinases in different proliferation
and survival pathways can cause transformation in different types of cells (Paul and
Mukhopadhyay, 2004). In solid tumors, BRAF mutations and HER2 amplification are
examples of such tumors‟ etiology (Montagut and Settleman, 2009). Examples of such
kinase driven malignancies are also common among the blood cancers such as the
constitutive active ABL1 kinase in Philadelphia chromosome (Ph) acute lymphoblastic
leukemia (ALL) and Chronic myeloid Leukemia (CML) (Wong and Witte, 2004), and
mutations in FLT3 in acute myeloid leukemia (AML) (Yokota et al., 1997).
1.2. Kinase dependent acute lymphoblastic leukemia (ALL)
Acute lymphoblastic leukemia (ALL) represents one of the major types of Leukemia and
accounts for about 20% of acute leukemia in adults. ALL arises mostly from B cell
progenitors (Pui et al., 2004). ALL originates from various genetic and molecular
mutations that contribute to the malignant transformation by maintaining or enhancing an
unlimited self-renewal capacity, suppressing the controls of normal proliferation, blocking
differentiation, and promoting resistance to apoptosis (Pui et al., 2004).
ALL is a genetically heterogeneous disease. Different genetic abnormalities have been
found in ALL. One of the most frequent abnormalities is the translocation between
2

chromosomes 12 and 21 which results in a TEL-AML1 chimeric protein which occurs in
25% of pediatric ALL (Golub et al., 1995). The TEL-AML1 contains the basic helix-loop-
helix (bHLH) domain of TEL (ETV6) fused to the DNA-binding and transactivation
domains of AML1 (RUNX1).
Hyperactivation of kinases is also common among ALLs. The most well characterized
kinase driven leukemia is Philadelphia chromosome positive ALL (Ph
+
ALL).
Philadelphia chromosome is generated by t(9;22)(q34;q11) translocation which results in
constitutively active oncogenic tyrosine kinase BCR-ABL1 (Wong and Witte, 2004). Ph
+

ALL patients show particular poor prognosis. The frequency of the BCR-ABL1
translocation among adult ALL patients is 20 percent and increases by more than 50
percent in patients older than 50 years (Pui and Evans, 2006). Although less common in
pediatric patients, the BCR-ABL1 translcoation is also found in 2 percent of pediatric ALL
cases (Mullighan CG 2012). Furthermore, BCR-ABL1 is also present in almost every
case of chronic myelogenous leukemia (CML), a chronic type of leukemia affecting
myeloid lineage cells. CML develops from a hematopoietic stem cell and consequently
displays multilineage differentiation potential (Calabretta and Perrotti 2004). CML
progression in human happens in three phases. It starts as the indolent chronic phase
(CML-CP) which leads to an intermediate accelerated phase and eventually a blast crisis
of myeloid phase (CML-MBC) (Calabretta and Perrotti 2004). The molecular basis of
transition from the chronic phase to blast crisis is still largely unknown. However, the
majority of patients in blast crisis have acquired secondary mutations or deletions of the
ARF, MYC, RB1, AML1, TP53, and RAS genes, which are believed to accelerate
disease progression (Melo and Barnes 2007).
FLT3 receptor tyrosine kinase is another kinase which can be activated in cancers. In
fact, FLT3 mutations are very common in acute myeloid leukemia (AML) and are present
in up to 45% of AML patients. Furthermore, FLT3 mutations have been found in around
3

20% of infant ALL patients with mixed lineage leukemia (MLL) and hyperdiploid ALL
which are two subtypes of childhood ALL (Taketani et al., 2004; Armstrong et al., 2004).
1.3. Philadelphia (Ph) chromosome
The Philadelphia chromosome results from a chromosomal translocation, which fuses
the breakpoint cluster region (BCR) gene on chromosome 22 to the ABL1 kinase gene
on chromosome 9, encoding the BCR-ABL1 fusion protein (de Klein et al., 1982;
Groffen et al., 1984; Heisterkamp et al., 1985).
BCR is a ubiquitously expressed molecule. It contains different domains including N-
terminal serine-threonine kinase, SH2 binding, GTP/GDP exchange and GTPase-
activating (Maru and Witte 1991). It was shown that BCR is a GTPase-activating protein
for RAC1 and CDC42, and it interacts with Mint3 and PDZK1 to control vesicular
trafficking in cells (Diekmann et al., 1991; Malmberg et al., 2004; Olabisi et al., 2006).
C-ABL1 is a non-receptor tyrosine kinase which is ubiquitously expressed and is
involved in diverse cellular functions. Nuclear localization of c-ABL1 modulates the
cellular response induced by DNA damage and leads to cell cycle arrest and apoptosis
(Gong et al., 1999; Preyer et al., 2007). In contrast, its cytoplasmic form is activated by
various extracellular stimuli and promotes mitogenesis (Plattner et al., 1999; Furstoss et
al., 2002; Sini et al., 2004).
Under normal conditions, the enzymatic activity of c-ABL1 is regulated through several
intra-molecular interactions that maintain the kinase domain in a closed inactive
conformation (Barila and Superti-Furga 1998; Pluk et al., 2002) Fusion of ABL1 with
BCR disrupts the auto-inhibition and results in a constitutively active ABL1 kinase that is
predominantly localized in the cytoplasm (Hantschel et al., 2005; Nagar et al., 2006).
The BCR-ABL1 fusion protein is a potent tyrosine kinase which phosphorylates many
efector molecules within the cells and activates different survival pathways including
4

JAK2/STAT5, PI3K/AKT and RAS/MAPK (Dengler et al., 2011). Each of these signaling
pathways encompasses different negative regulators (Figure 2.1) (Yasukawa et al., 2000
and Pratilas et al., 2009). Additionally, BCR-ABL1 is able to induce AID and endogenous
reactive oxygen species (ROS) causing DNA damage and mutagenesis (Koptyra et al.,
2006; Feldhahn et al., 2007). This genomic instability can generate mutations that confer
drug resistance and progression of leukemia.

Figure 1.1. Schematic of BCR-ABL1 and its downstream pathways.
BCR-ABL1 activates many downstream signaling pathways including JAK/STAT,
RAS/MAPK and PI3K/AKT. Each signaling pathway has different negative feedback
regulator(s).
1.4 Drug treatment and resistance
The current approach to cure the Ph
+
leukemia is to treat the patients with tyrosine
kinase inhibitors (TKIs). TKI treatment causes signal starvation and brings the level of
tyrosine kinase activity below a vital threshold for the transformed cells (O‟Hare et al.,
5

2012). The small-molecule inhibitor Imatinib mesylate (known as STI571 or Gleevec)
inhibits the kinase activity by blocking adenosine tri-phosphate (ATP) from entering into
the nucleotide-binding pocket of BCR-ABL1 (Schindler et al., 2000). Inhibition of the
ABL1 kinase activity suppresses the proliferation of BCR-ABL1-driven leukemia cells
and induces apoptosis (Druker et al., 2001). While CML-CP can be effectively treated
with Imatinib for many years (5-year overall survival ~ 95%), CML LBC and Ph
+
ALL are
invariably multidrug-resistant and fatal within weeks or months (Druker et al., 2001;
Druker et al., 2006).
Resistance to Imatinib is associated with mutations in the ABL1 kinase domain,
overexpression of BCR-ABL1 and activation of BCR-ABL1 independent survival
pathways (le Coutre et al., 2000; Ottmann and Pfeifer, 2009). The most common BCR-
ABL1 mutation in resistant or relapsed cases is T315I (threonine is substituted by
isoleucin at amino acid position 315) which dramatically increases the IC50 value,
resulting in a virtual insensitivity to Imatinib (Shah et al., 2002). The isoleucin
substitution at residue 315 is called „„gatekeeper‟‟ because it creates a steric hindrance
that precludes the binding of all currently approved TKIs and therefore prevents the
therapeutic intervention.
1.5. Hypersignaling in transformed cells
In vitro models of hypersignaling show that the hyperactivity of signaling pathways could
be harmful for the cells. The main consequence of hypersignaling is cellular senescence
which is also known as “oncogene induced senescence” (Braig and Schmitt, 2006). For
example, within the MAPK pathway, induction of RAS and BRAF provokes an immediate
arrest in cultured cells (Serrano et al., 1997) and also leads to senescent growth
cessation in premalignant, hyperplastic lesions in vivo (Michaloglou et al., 2005).
Although this type of senescence is dependent on P53 and ARF, a requirement for
6

silencing of growth promoting genes by heterochromatin formation has also been
demonstrated (Braig et al., 2005). This silencing is associated with Suv39h1-dependent
methylation of histone H3 lysine 9 (H3K9me). Another example is the hyperactivation of
PI3K/AKT pathway. Constitutive activation of AKT promotes senescence-like arrest of
cell growth via a P53 and P21 dependent pathway (Miyauchi et al., 2004). In summary,
induction of hypersignaling is harmful for the cells and could potentially be considered an
approach for killing the tumor cells.
1.6. Reactive oxygen species and their effects in transformed
cells
Studies have shown that cancer cells are under increased oxidative stress (Szatrowski
and Nathan, 1991). The defining characteristic of oxidative stress is the presence of
reactive oxygen species (ROS) (Luo et al., 2009). Reactive oxygen species consist of
oxygen free radicals and associated entities that include superoxide free radicals,
hydrogen peroxide, singlet oxygen, nitric oxide (NO), and peroxynitrite (Chong et al.,
2005). Elevated level of ROS in cancer cells is associated with oncogenic
transformation and alterations in metabolic activity (S. Toyokuni, 1995; Hileman et al.,
2003).
Regulation of ROS level is critical for the cells. Although the presence of ROS has some
advantages for the cancer cells due to their role in induction of genomic instability
(Koptyra et al., 2006) and proliferation (Hu et al., 2005), the excess generation of ROS
can be lethal. ROS can result in oxidative damage to DNA, proteins, lipids, and other
cellular components and therefore cause significant cellular stress. This cellular stress
may eventually lead to the apoptotic destruction of the cells (Wang et al., 2003, Pelicano
et al., 2004). ROS generation can also lead to the inhibition of complex enzymes in the
7

electron transport chain of mitochondria resulting in the blockade of mitochondrial
respiration (Yamamoto et al., 2002).
Several studies on small molecules which increase the ROS level have shown selectivity
in killing tumor cells and not the normal cells (Bonnet et al., 2007 and Lakshmi et al.,
2012). These studies suggested that this behavior is because the transformed cells are
more dependent than normal cells on mechanisms which regulate the cellular stress
(such as enhanced ROS).
1.7. An overview of the objectives and conclusions of this
thesis.
In this thesis, I attempt to study the effects of induction of hypersignaling in B cell lineage
BCR-ABL1 ALL. Although in vitro and in vivo induction of hypersignaling in different
signaling pathways has been studied previously, its use as therapeutic tool has to the
best of my knowledge not been suggested before.
In chapter 2 of this thesis, I studied the effects of hypersignaling in the MAPK pathway in
BCR-ABL1 transformed cells and human Ph
+
ALL. We induced the hypersignaling by
inhibiting the negative feedback regulators of MAPK pathway, DUSP6 and SPRY2.
In chapter 3, we studied the hyperactivity of the PI3K/AKT pathway in BCR-ABL1 cells.
PI3K/AKT is a well characterized signaling pathway in Ph
+
ALL cells. We induced
hypersignaling by inhibition of two known inhibitory phosphatases of the PI3K/AKT
pathway, PTEN and INPP5D. We also showed that other inhibitory phosphatases such
as PTPN6 could be targeted for induction of therapeutic hypersignaling in Ph
+
ALL cells.

8

Chapter 2
Inhibition of negative feedback regulators of the MAPK
pathway in kinase driven leukemia
2.1. Introduction
2.1.1. Negative regulators in kinase dependent signaling
Negative feedback regulation is a common component of many signaling pathways
within normal cells (M Freeman, 2000). Different mechanisms of negative
inhibition/regulation are present within the cells, and are responsible for diverse cellular
behaviors such as differentiation and organ development (M Freeman, 2000). For
instance, in the Drosophila wing, a variation on the theme of negative feedback limits
signaling by Hedgehog (Hh) to the anterior/posterior compartment boundary. A key
molecule in this negative feedback loop is Patched which is a component of the Hh
receptor that binds Hh but which does not have transducing activity (Hooper et al.,
1989).
Despite the variety in function, the main purpose of all negative feedback mechanisms is
to adjust the amplitude of signaling pathways to a confined zone to protect the cells from
the side effects of hypersignaling. While in the normal cells the main function of
negative regulators is to suppress the stimulated pathway back to the basal level, in the
transformed cells the constant presence of stimulation causes the constant expression
and activity of these negative feedback molecules (Amit et al., 2007).
Although the level of signaling is increased in many transformed cells due to mutations
or deletions of well known negative regulators such as PTEN in PI3K pathway (Vivanco
9

et al., 2002), there are many reports that show the increased activity of negative
regulators in transformed cells (Amit et al., 2007; Hakansson et al., 2008 and Pratilas et
al., 2009). Studies of the kinetics and activities of negative regulators in kinase driven
cancers such as EGF activated (Amit et al., 2007) and BRAF mutated cancers (Pratilas
et al., 2009) have shown that the activity of negative regulators are highly dependent on
the presence of signal activation. It is interesting that in these kinase dependent tumors,
the high level activity of negative feedback regulators is not preventing their growth and
survival. Remarkably, studies suggest that at least in the case of mutant BRAF in
melanoma, the oncoprotein is insensitive to the feedback regulation (Pratilas et al.,
2009) and the BRAF V600E mutant can signal independently of the constraints imposed
by negative feedback regulation of receptor tyrosine kinases (RTKs) and RAS
(Poulikakos et al., 2010). However, this does not rule out the possibility that individual
components of the negative feedback program may be lost or disabled also during
transformation with mutant BRAF.

2.1.2 Mitogen-activated protein kinases (MAPK) pathway
The mitogen-activated protein kinases (MAPK) family includes the Extracellular-
regulated Kinases (ERK1 and 2), the Stress-Activated Protein kinases (SAPKs) p38α
and c-Jun N-terminal kinases (JNK) (Bermudez et al., 2010).
ERK1 and 2 are activated by various stimuli such as growth factors and cytokines and
leads to cellular responses such as proliferation, differentiation, survival, and migration
(Krishna et al., 2008). JNK and p38α pathways are activated in response to a variety of
stress factors including osmotic shock, ultraviolet irradiation, inflammatory cytokines, as
well as other stressful conditions such as oxidative stress (Haddad, 2004).
10

Activation of MAPKs can also be initiated in response to ligand binding to receptor
tyrosine kinase (RTKs), which in turn activate the small GTPase RAS. This step is
accomplished by the recruitment of a protein complex consisting of the RAS exchange
factor son-of-sevenless (SOS) and the growth factor-receptor bound protein-2 (GRB2) to
a tyrosine phosphate docking site on the receptors themselves or on receptor-substrate
proteins (Raman et al., 2003). Activated RAS triggers the activation of the MAPKKK
(RAF). Activated RAF then phosphorylates the MAPKK (MEK) on serine residues
leading to its activation. Subsequently, activated MEK catalyses the phosphorylations of
the ERK, JNK or P38α. Phosphorylated MAPK translocate to the nucleus where they
phosphorylate and activate transcription factors.
2.1.3 MAPK Negative feedback regulators
Similar to other signaling pathways, the MAPK pathway requires negative feedback
regulation. Since phosphorylation is the main mechanism of signal relay in this pathway,
MAPK phosphatases (MKPs) are the major negative regulators of the MAPK pathway
(Bhalla et al., 2002). Bhalla and colleagues showed that in addition to suppression of
the activity of the MAPK pathway, the MKPs also regulate the state and function of the
pathway as well. They showed that growth factor stimulated MAPK signaling can
operate with one (monostable) or two (bistable) stable states and importantly the factors
that determine the type of state are MKPs. At low concentrations of the MAPK
phosphatase, the system exhibits bistable behavior. In this state, a brief stimulus results
in a sustained MAPK activation. Interestingly, the MAPK-induced increase in the
amounts of MAPK phosphatases eliminates the prolonged response capability and
moves the network to a monostable state. In the monostable state the pathway behaves
as a proportional response system responding acutely to stimulus. These results
11

revealed more complex functions for MAPK negative feedback regulators than was
previously recognized, and especially for the MKPs.
MKP3 (DUSP6) is the ERK1/2 phosphatase and one of the most extensively studied
MAPK phosphatases (Hakansson et al., 2008 and Pratilas et al., 2009). In addition to
phosphatases, other regulatory molecules can also affect the activity of kinases in the
MAPK pathway and act as negative regulators of this pathway. For instance SPRY2,
another well characterized negative regulator of MAPK, is not a phosphatase but it
affects RAS and RAF GTPase activities as will be described in the following section
(Hakansson et al., 2008 and Pratilas et al., 2009)(Figure 2.1).

Figure 2.1.Schematic of the MAPK Signaling pathway and two feedback negative
regulators.
12

SPRY2 can suppress the activity of MAPK by blocking activation of RAS or RAF.
DUSP6 is a dual specific phosphatase which mainly dephosphorylates ERK1/2 and to
lesser extent P38α and JNK.

2.1.3.1. SPRY2
SPRY2 is a ubiquitously expressed molecule (Su et al., 2002). Genetic experiments
have demonstrated that the inhibitory activity of SPRY2 is exerted upstream of
ERK/MAPK and downstream of the receptor tyrosine kinases (RTKs). However, it seems
that the target of SPRY2 in suppression of RTK signaling varies in different systems. For
instance in mouse fibroblasts, SPRY2 interferes with growth factor induced ERK/MAPK
signaling at the level of RAS activation (Gross et al., 2001), whereas in human epithelial
cells, it functions at the level of RAF activation (Yusoff et al., 2002).
Hanafusa and colleagues demonstrated that after stimulation by growth factors SPRY2
translocates to the plasma membrane and binds to the adaptor protein GRB2. This
interaction inhibits the activation of the GRB2–SOS complex. SOS (son of sevenless) is
the RAS guanine-nucleotide exchange factor (GEF, exchanges GDP with GTP) thus its
inhibition blocks activation of the RAS and subsequently the extracellular-signal-
regulated kinase (ERK1/2) (Hanafusa et al., 2002).
SPRY2 is an important regulator in development and most of the studies on SPRY2 are
focused on its developmental functions (Shim et al., 2005 and Kim et al., 2004).
However, some studies also address its role in cancer cells. Wang and colleagues
showed that inactivation of SPRY2 by using a dominant negative mutant (Y55F)
accelerated AKT-induced hepatocarcinogenesis in a mouse model. The liver lesions had
increased proliferation and glycolysis rates and exhibited a significantly stronger
induction of MAPK and pyruvate kinase M2 (PKM2) pathways than in AKT control
lesions (Wang et al., 2012).
13

SPRY2 down-regulation has been shown in prostate (McKie et al., 2005), liver (Fong et
al., 2006) and non-small-cell lung cancers (Sutterluty et al., 2007). Consistently,
overexpression of SPRY2 in lung cancer cell lines significantly reduced cell proliferation
(Sutterluty et al., 2007) and inhibited the carcinogen induced lung cancer in lung
epithelial cells (Minowada and Miller, 2009). Interestingly, overexpression of SPRY2
only antagonized MAPK activity in cell lines homozygous for K-Ras wildtype and not in
NSCLC cells expressing mutated K-Ras.
In contrast to the mentioned reports, SPRY2 overexpression has been reported in
melanomas with BRAF and NRAS mutations (Bloethner et al., 2005) and colon
adenocarcinomas (Holgren et al., 2010). Genetic studies by Lito and colleagues showed
that SPRY2 expression is required for transformation of fibroblast cells with HRAS (Lito
et al., 2008). Furthermore, Holgren and colleagues showed that SPRY2 up-regulation
enhanced the transformed phenotype in colon cancer cells (Holgren et al., 2010).
BCR-ABL1 Leukemia cells show high expression of SPRY2 which is dependent on the
kinase activity of BCR-ABL. Furthermore, the expression of SPRY2 in BCR-ABL1 cells is
abolished by tyrosine kinase inhibitor treatment (Hakansson et al., 2008).
2.1.3.2. DUSP6
DUSP6 (Dual specificity phosphatase 6, MKP3) is a cytoplasmic member of the MAPK
phosphatases which acts more selectively on the ERK family of MAPK and
dephosphorylates the stress-activated protein kinases JNK and P38α with lower
efficiency (Muda et al., 1996) (Figure 2.1). DUSP6 is regulated at the promoter level by
ETS1 and 2, well-known nuclear targets of activated ERK (Ekerot et al., 2008; Zhang et
al., 2010). DUSP6 shuttles between the nucleus and the cytosol but mostly exhibits a
cytoplasmic localization which depends on a leucin-rich nuclear export signal located in
its NH2-terminal domain (Karlsson et al., 2004).
14

Dusp6
-/-
mice are viable, fertile and appear normal in most aspects studied. However,
basal levels of ERK1/2 phosphorylation, but not P38α and JNK, show an increase in
many organs such as heart, spleen, kidney and fibroblasts (Maillet et al., 2008).
The role of DUSP6 has been studied in progression and chemo-resistance of many
types of cancers. DUSP6 has promiscuous behaviors in cancer and while it is down-
regulated in some cancer cells which suggests a tumor suppressor activity, it shows
upregulation in other types.
In pancreatic cancer tissues and cell lines, the Dusp6 promoter is often hyper-
methylated which causes lower expression of Dusp6 (Xu et al., 2005). Furthermore,
overexpression of DUSP6 in these cells resulted in down-regulation of ERK1/2 signaling,
suppression of cell growth and increased apoptosis. Similarly, DUSP6 is shown to be
down-regulated in lung cancer, and restoration of its expression resulted in suppressed
tumor growth (Okudela et al., 2009).
In contrast, DUSP6 is up-regulated in other types of cancers such as those with
activating mutations in the RAS/MAPK pathway. For examples, DUSP6 level is higher in
melanoma cell lines with the BRAF V600E and NRAS Q61R mutations (Bloethner et al.,
2005). High levels of DUSP6 expression is also reported in keratinocytes and breast
cancer cells expressing oncogenic HRAS (Warmka et al., 2004). In addition, DUSP6
expression is a predictor of invasiveness in papillary thyroid cancer (PTC) and its
silencing significantly decreased the cell viability and migration rate in BRAF V600E
thyroid cancer cell lines. In addition, high DUSP6 expression has also been associated
with Tamoxifen resistance in metastatic breast cancers (Cui et al., 2006).
The role of DUSP6 in cancer is complicated, therefore different aspects of the cancer
cells such as etiology and stage should be considered. For example, it has been shown
that the expression of DUSP6 in pancreatic cancer is sinusoidal and despite being up-
15

regulated in intraepithelial neoplasia compared with normal cancer cells, it is often totally
abrogated in the invasive ductal carcinoma state (Furukawa et al., 2005).
In kinase driven FLT3-ITD AML and BCR-ABL1 CML samples, elevated expression of
DUSP6 has been detected (Arora et al., 2012 and Hakansson et al., 2008). In addition,
in AML, high level of DUSP6 expression is associated with the presence of FLT3-ITD
and also is dependent on FLT3-ITD kinase activity and ERK1/2 signaling (Arora et al.,
2012). The increased expression of DUSP6 in the presence of active MAPK signaling
suggests that it is upregulated by MAPK pathway as a negative feedback molecule.
However, data obtained with different tumor types indicate that mutations leading to the
MAPK activation do not necessarily predict a specific fate for DUSP6 expression levels.
In this chapter, we show that the inhibition of DUSP6 and SPRY2 using genetic tools
and also chemical inhibition of DUSP6 leads to the increase in the signaling level of
MAPK within the BCR-ABL1 transformed cells. This increased signaling is not favorable
for the B cell lineage BCR-ABL1 ALL cells and causes harmful effects. We suggest the
inhibition of negative feedback molecules of the MAPK pathway as a new method to
treat kinase driven leukemia particularly in the Ph
+
ALL.

16

2.2. Materials and methods
2.2.1. Patient samples, human cells and cell lines
Patient samples (Table S1) were provided from the USC Norris Comprehensive Cancer
Center in compliance with the IRB of the University of Southern California Health
Sciences Campus. Human cells (Table S2-3) were maintained in Roswell Park Memorial
Institute medium (RPMI-1640, Invitrogen, Carlsbad, CA) with GlutaMAX containing 20%
fetal bovine serum, 100 IU/ml penicillin and 100 μg/ml streptomycin at 37°C in a
humidified incubator with 5% CO2. Primary human ALL xenografts were cultured on
OP9 stromal cells.
2.2.2. Extraction of bone marrow cells from mice and generation of
BCR-ABL1+ B cell lineage ALL
Bone marrow cells were extracted from young Dusp6
+/+
, Dusp6
-/-
and Spry2
fl/fl
mice
younger than 6 weeks of age(Table S4). Bone marrow cells were obtained by flushing
cavities of femur and tibia with PBS. After filtration through 70 μm filters and depletion of
erythrocytes using lysis buffer (BD PharmLyse, BD Biosciences), washed cells were
either frozen for storage or subjected to further experiments. Bone marrow cells were
retrovirally transformed by BCR-ABL1 in the presence of 10 ng interleukin-7 per milliliter
(PeproTech). Cells were maintained in Iscove‟s modified Dulbecco‟s medium (IMDM,
Invitrogen) with GlutaMAX containing 20% fetal bovine serum, 100 IU ml−1 penicillin,
100 μg ml−1 streptomycin and 50 µM 2-mercaptoethanol. BCR–ABL1 transformed ALL
cells were propagated only for short periods of time and usually not longer than for
2 months to avoid acquisition of additional genetic lesions during long-term cell culture.
For in vivo experiments ALL cells were then labeled with firefly luciferase (D.B. Kohn,
University of California Los Angeles, Los Angeles, CA), selected based on antibiotic
17

resistance (Blasticidin), and injected via tail into sublethally irradiated (300 cGy)
NOD/SCID recipient mice. Engraftment was monitored using luciferase bioluminescence
imaging (VIS 100 bioluminescence/optical imaging system; Xenogen). D-Luciferin
(Xenogen) dissolved in PBS was injected intraperitoneally (i.p.) at a dose of 2.5 mg per
mouse 15 min before measuring the light emission. All mouse experiments were subject
to approval by the Children‟s Hospital Los Angeles Institutional Animal Care and Use
Committee.
2.2.3. Western blotting
Cells were lysed in CelLytic buffer (Sigma, St. Louis, MO) supplemented with 1%
protease inhibitor cocktail (Pierce, Rockford, IL). 15 μg of protein mixture per sample
were separated on NuPAGE (Invitrogen, Carlsbad, CA) 4-12% Bis-Tris gradient gels and
transferred on PVDF membranes (Immobilion, Millipore, Temecula, CA). For the
detection of mouse and human proteins by Western blot, primary antibodies were used
together with the WesternBreeze immunodetection system (Invitrogen). Details of
antibodies used are in Table S5.
2.2.4. Flow cytometry
Antibodies used in flow cytometry are mentioned in Table S6. For apoptosis analyses,
Annexin V and 7-AAD (BD Biosciences) were used.
2.2.5. Colony forming assay for mouse ALL
The methylcellulose colony-forming assays were performed with 10,000 BCR-ABL1
transformed cells. Cells were re-suspended in murine MethoCult medium (StemCell
Technologies, Vancouver, BC, Canada) and cultured on dishes (3 cm in diameter) with
18

an extra water supply dish to prevent evaporation. After 7 to 14 days, colonies were
counted.
2.2.6. Retrovirus production and transduction
Transfections of MSCV-based retroviral constructs were performed using Lipofectamine
2000 (Invitrogen, Carlsbad, CA) with Opti-MEM media (Invitrogen). Retroviral
supernatant was produced by co-transfecting 293FT cells with the plasmids pHIT60
(gag-pol) and pHIT123 (ecotropic env; kindly provided by Donald B Kohn, UCLA).
Cultivation was performed in high glucose Dulbecco‟s modified Eagle‟s medium (DMEM,
Invitrogen) with GlutaMAX containing 10% fetal bovine serum, 100 IU/ml penicillin, 100
μg/ml streptomycin, 25mM HEPES, 1 mM sodium pyruvate and 0.1 mM non-essential
amino acids. Regular media were replaced after 16 hours by growth media containing 10
mM sodium butyrate. After 8 hours incubation, the media was changed back to regular
growth media. 18 hours later, the virus supernatant were harvested, filtered through a
0.45 µm filter and loaded by centrifugation (2000 x g, 90 min at 32 °C) two times on
50 ug/ml RetroNectin (Takara, Madison, WI) coated non-tissue 6-well plates. 1-2 x 10
6

pre-B cells were transduced per well by centrifugation at 600 x g for 30 minutes and
maintained overnight at 37°C with 5% CO
2
for 2 days before transferring into culture
flasks.
2.2.7. Senescence-associated β-galactosidase assay
Senescence-associated β-galactosidase assay was performed on cytospin preparations.
Briefly, a fixative solution (0.25% glutaraldehyde, 2% paraformaldehyde in PBS pH 5.5
for mouse cells) was freshly generated. To this end, 1 g paraformaldehyde was
dissolved in 50 ml PBS at pH 5.5 by heating followed by addition of 250 μl of a 50% stock
glutaraldehyde solution. 1× X-gal staining solution (10 ml) was prepared as follows:
19

9.3 ml PBS/MgCl2, 0.5 ml 20× KC solution (that is, 820 mg K3Fe(CN)6 and 1,050 mg
K4Fe(CN)6 × 3H2O in 25 ml PBS) and 0.25 ml 40× X-gal (that is, 40 mg 5-bromo-4-
chloro-3-indolyl β-D-galactoside per milliliter of N,N-dimethylformamide) solutions were
mixed. For BCR–ABL1-transformed ALL cells, 100,000 cells per cytospin were used
(700 r.p.m., 8 min). The fixative solution was pipetted onto cytospins and incubated for
10 min at room temperature, then washed twice for 5 min in PBS/MgCl2. Cytospin
preparations were submerged in 1× X-gal solution, incubated overnight at 37 °C in a
humidified chamber and washed twice in PBS.
2.2.8. Cell-cycle analysis
For cell-cycle analysis in BCR–ABL1 ALL cells, the BrdU flow cytometry kit for cell-cycle
analysis (BD Biosciences) was used according to manufacturer‟s instructions. BrdU
incorporation (FITC-labeled anti-BrdU antibodies) was measured along with DNA
content (7-amino-actinomycin-D) in fixed and permeabilized cells. The analysis was
gated on viable cells that were identified based on scatter morphology.
2.2.9. ROS staining
For evaluation of intracellular ROS levels, ALL cells were incubated for 7 min with 1 µM
5-(and 6-)chloromethyl-2′,7′-dichlorodihydrofluorescein diacetate (CM-H2DCFDA,
Invitrogen, Carlsbad, CA) at 37°C for oxidation of the dye by ROS. After washing with
PBS, the cells were incubated additional 15 min at 37°C in PBS to allow complete
deacetylation of the oxidized form of CM-H2DCFDA by intracellular esterases. The
levels of fluorescence were then directly analyzed by flow cytometry, gated on viable (PI
-
) cells. To determine a functional role of ROS in BCI-mediated toxicity, 1x10E6 patient-
derived xenograft ALL cells (SFO2, TXL3, LAX2, ICN1, BLQ5) were seeded in OP9-
feeder layer coated wells of a 24 well plate and treated with vehicle (DMSO), 6 µM BCI,
20

vehicle and ROS inducer L-buthionine-S,R-sulfoximine (BSO, 200 µM, Sigma Aldrich) or
the ROS scavenger catalase (500 U/ml, Sigma Aldrich), or the combination of 6 µM BCI
and BSO or catalase. After 24h (BSO) or 48h (Catalase) viability was assessed by flow
cytometry using propidium iodide.
2.2.10. Cell viability assay for murine cells
100,000 BCR-ABL1 transformed ALL cells per well were seeded in a volume of 100 μl
medium on Optilux 96-well plate (BD Biosciences, San Jose, CA). Chemicals were
diluted in medium and added at the indicated concentration in a total culture volume of
150 μl. After 3 days culturing, 15 μl of Resazurin (R&D, Minneapolis, MN) was added on
each well and incubated for 4 hours at 37 °C. The fluorescent signal was monitored
using 535 nm excitation wavelength and 590 nm emission wavelength. Fold changes
were calculated using baseline values of untreated cells as a reference (set to 100
percent).
2.2.11. Cell viability assay for human cells
50,000 human derived xenograft cells per well were seeded in a volume of 80 μl medium
on clear 96-well plate (BD Biosciences, San Jose, CA). Chemicals were diluted in
medium and added at the indicated concentration in a total culture volume of
100 μl. After 3 days culturing, 10 μl of CCK-8 solution (DMT Inc.,Rockville,MD) was
added on each well and incubated for 4 hours at 37 °C. The absorbance signal was
measured at 450 nm. Fold changes were calculated using baseline values of untreated
cells as a reference (set to 100 percent).

21

2.3. Results
2.3.1 Hypersignaling is not a favorable condition for leukemia cells
To study the effects of hypersignaling in leukemia cells, we transduced the rs4,11 cell
line (Ph
-
leukemia) with a BCR-ABL1-GFP retroviral virus. Surprisingly, the activity of the
BCR-ABL1 oncoprotein in rs4,11 cells was not favorable and the percentage of GFP
cells dropped drastically within two weeks in BCR-ABL1 transduced cells while there
was no detectable decrease in the empty vector transduced cells (Figure 2.2). This
unfavorable outcome could be prevented by the suppression of BCR-ABL1 kinase
activity in the presence of 2µM Tyrosine Kinase Inhibitor (TKI, Imatinib). Interestingly,
after removal of Imatinib from the medium, the percentage of GFP positive cells in BCR-
ABL1 transduced cells declined (Figure 2.2A-B).

Figure 2.2.Kinase activity of BCR-ABL1 is not favorable for Ph
-
ALL cells.
A: Human B cell lineage ALL cells (RS4;11, MLL-AF4 positive) were transduced with
the mouse ecotropic receptor to permit subsequent entry of retroviral BCR-ABL1-GFP
and GFP empty vectors (EV) pseudotyped with murine ecotropic envelope. GFP
expression was measured by flow cytometry and normalized ratio of GFP positive cells
are depicted on y-axis. Transductions with BCR-ABL1-GFP and GFP empty vectors
(EV) were also performed in the presence of 2 μM Imatinib. Washout of Imatinib is
indicated with an arrow. B: Representative flow cytometry plots. The plots are gated for
live cells (propidium iodide negative). Plots related to samples under Imatinib treatment
are shown within the blue box.

22

This experiment demonstrates the presence of negative effects of BCR-ABL1
hypersignaling and suggests that induction of too much signaling could be potentially
harmful for the cells.

2.3.2. Characterizing the negative feedback regulators in Ph+ ALL
cells
To find negative feedback molecules in the Ph
+
ALL cells, we analyzed a set of publicly
available RNA expression microarray data. As the first criteria, we searched for the
genes that were up-regulated in Ph
+
ALL cells in comparison with normal progenitor pre-
B cells. Among the top genes, we identified several known negative feedback molecules
for different signaling pathways (Figure 2.3A). For instance SPRY2, DUSP6, SOCS2
and CISH are known negative feedback regulators where the former two suppress the
MAPK pathway while the latter two inhibit the JAK/STAT pathway (Hakansson et al.,
2008 and Yasukawa et al., 2000).
In this project we chose to focus on the MAPK pathway, and we therefore selected the
SPRY2 and DUSP6 negative feedback molecules of the MAPK pathway for further
studies. Analyzing the protein levels of these molecules in a panel of normal human
CD19
+
B cells, Ph
+
ALL and B cell Non-Hodgkin-Lymphoma we confirmed that the
expression of these proteins are significantly higher in Ph
+
ALL as compared to normal B
cells and NHL cells (Figure 2.3B). This suggests that the activities of these molecules
are BCR-ABL1 dependent. We tested this hypothesis by inhibiting the BCR-ABL1 kinase
activity. 24 hours treatment of Ph
+
ALL cell lines (BV173, SUP-B15, Nalm1 and TOM1)
with 10 µM of Tyrosine kinase inhibitor Imatinib resulted in a significant decrease in the
protein level of SPRY2 and DUSP6 (Figure 2.3C). The only exception was the SPRY2
in TOM1 cell lines which showed no difference. Based on these observations and what
23

had been already documented in the literature about the DUSP6 and SPRY2, we
hypothesized that these could be the candidate negative feedback molecules in Ph
+
ALL
for further studies.

Figure 2.3.Characterizing negative feedback regulator candidates for induction of
hypersignaling.
A: Gene expression levels before and after transformation with BCR-ABL1 kinase
activity. Heatmap shows the array expression results for human CD19+ B cell precursor
(n=13) and Ph+ ALL (n=15) samples. Raw data were obtained from
http://www.stjuderesearch.org/data/ALL3l (Ross et al. 2003. Blood. doi:10.1182/blood-
2003-01-0338 and http://130.161.42.18/; van Zelm et al. 2005. J. Immunol.175:5912–
5922). B: Western blots for the DUSP6 and SPRY2 in normal human CD19+ bone
marrow cells (n=5), patient-derived Ph+ ALL (n=10) and B cell Non-Hodgkin‟s lymphoma
cell lines (B-NHL, n=7). β-ACTIN was used as loading control. The Ph+ xenografts from
left to right are LAX2, SF02, ICN01, TXL3, TXL2, PDX59, BLQ11, BLQ5, BLQ1, and
LAX9. Lymphoma cell lines from left to right are JEKO1, KMH2, KARPAS422, DB,
MEC1, U266 and Mn-60 C: Western blot for DUSP6 and SPRY2 in four Ph+ ALL cell
lines before and after inhibition of BCR-ABL1 activity using Tyrosine kinase inhibitor (±10
µM Imatinib for 24 hours) (table S1and S3).
2.3.3. Genetic deletion of Spry2 in Ph+ like ALL causes drastic
apoptosis and cell cycle arrest
To study the effects of the deletion of the MAPK negative feedback regulator SPRY2, we
obtained bone marrow from mice carrying Spry2
fl/fl
alleles (Shim et al., 2005). To
generate the Ph
+
like ALL model, we transduced the B cell lineage cells with retroviral
BCR-ABL1. The resulting Spry2
fl/fl
ALL cells were later transduced with either Cre-ER
T2

24

or ER
T2
empty vector (EV) with a puromycin resistance gene. Addition of 4-hydroxy-
tamoxifen (4-OHT) in the medium results in the transport of the Cre-ER
T2
to the nucleus
and deletion of the Spry2
flox
alleles. Deletion of Spry2 was confirmed by Western blot
(Figure 2.4A). Furthermore, we showed that deletion of Spry2 correlated with
hyperactivity of the MAPK pathway, demonstrated by increase in phosphorylation of
ERK1/2 on Threonine 202 and Tyrosine 204 (Figure 2.4A). Surprisingly, Annexin V
staining showed that the deletion of Spry2 induced drastic apoptosis in Ph
+
like ALL
(Figure 2.4B). On day four after induction of deletion, the ratio of viable BCR-ABL1 ALL
cells dropped by 80 percent while the viability of control cells showed no noticeable
change (Figure 2.4C). We also studied the effect of Spry2 deletion on cell cycle. In a
BrdU incorporation based assay we analyzed the fractions of the cells in each stage of
the cell cycle after short exposure of the cells with BrdU. Interestingly, deletion of Spry2
in B cell lineage ALL resulted in a significant decrease in the number of cells presented
in S phase (44% vs. 28%, P value = 0.0026) (Figure1.4D).

Figure 2.4.Deletion of Spry2 resulted in extensive negative outcomes in B cell lineage
BCR-ABL1 transformed cells.

25

A: Inducible deletion of Spry2 using Cre-ER
T2
in BCR-ABL1 leukemia cells resulted in
loss of Spry2 protein expression and strong increase in ERK1/2 phosphorylation. B:
Flow cytometry plots of Annexin V and 7AAD staining confirmed the presence of
extensive apoptosis in BCR-ABL1 ALL cells after the deletion of Spry2. C: Viability of the
cells was determined with PI staining using flow cytometry. Normalized viabilities are
depicted on the y axis after induction of Cre and deletion of Spry2. D: B cell lineage
BCR-ABL1 ALL cells with and without Spry2 deletion were treated with 10 µM BrdU for
30 minutes. After fixation and permeabilization, the cells were treated with DNase and
the incorporation of BrdU was measured using anti-BrdU antibody. The total amount of
DNA was determined by 7AAD staining. The ratio of cells presented in S phase dropped
from 44% to 28% (P value =0.003).

2.3.4. Deletion of Spry2 in Ph+ like ALL decreases their ability to
engraft in recipient mice
To investigate the role of Spry2 in engraftment ability of Ph
+
like leukemia cells, Spry2
fl/fl
ALL cells were transduced with ER
T2
(empty vector) or Cre-ER
T2
labeled with retroviral
firefly-luciferase. One day after induction of deletion with 4-OHT, one million cells were
injected via tail vein into sublethally irradiated NOD/SCID mice (n=14). Starting one
week after injection, leukemia engraftment was monitored by bioluminescence imaging
(Figure 2.5A). The leukemia initiation was slower in mice that received ALL with Spry2
deletion in comparison of wildtype ALL, and the survival of recipient mice was
significantly longer than the control group (P value = 0.046) (Figure 2.5).

Figure 2.5.Spry2 deletion decreases leukemia engraftment in vivo.
26

A: One million luciferase labeled B cell lineage BCR-ABL1 transformed cells with or
without Spry2 were injected into the sublethally irridiated NOD/SCID recipient mice
(n=14). Leukemia initiation in NOD/SCID recipients was monitored by luciferase
bioluminescence imaging. B: Kaplan-Meier curves show significant increase in survival
of mice that received Spry2 null ALL cells.

2.3.5. Dusp6-/- pre-B cells are less competent for BCR-ABL1 kinase
transformation than wildtype cells
To investigate the role of DUSP6 in negative feedback regulation of BCR-ABL1 kinase
transformed cells, we obtained bone marrows from Dusp6
+/+
and Dusp6
-/-
mice (Maillet et
al., 2008). Since Dusp6
-/-
cells were straight knockout, we expected that the redundant
effect of other DUSP molecules could compensate for the lack of DUSP6 in their
transformation ability. To examine the transformation ability of these cells in an acute
manner, we designed a wash out experiment. We transduced Dusp6
+/+
and Dusp6
-/-
pre-
B cells with retroviral BCR-ABL1-GFP construct in the presence of 1 µM Imatinib. The
presence of Imatinib was inhibiting the kinase activity of BCR-ABL1 oncoprotein. Three
days after transduction we washed out Imatinib by washing the cells with PBS twice and
putting them in fresh medium with IL7. This approach caused an increase in the level of
BCR-ABL1 kinase signaling in a short period of time and simulated a hypersignaling like
condition. Next, we measured the percentage of GFP

positive cells in the following days.
Interestingly, after removal of Imatinib the presence of BCR-ABL1 only showed an
advantage for the wildtype cells and the percentage of GFP positive cells increased only
among wildtype and not the Dusp6
-/-
pre-B cells (Figure 2.6A).
In another experiment, instead of BCR-ABL1, we used retroviral NRAS
G12D
to transform
the DUSP6
+/+
and DUSP6
-/-
pre-B cells. For each group we injected one million
NRAS
G12D
positive luciferase labeled cells into the sublethally irridiated recipient
NOD/SCID mice via tail vein (n=7). Surprisingly, while all the mice injected with wildtype
27

cells died of leukemia within 60 days after injection, all mice injected with Dusp6
-/-
cells
survived with no sign of cancer for the duration of the experiment (120 days) (Figure
2.6B-C). These results demonstrate that the presence of a functional negative feedback
regulation is necessary for effective BCR-ABL1 and RAS dependent kinase
transformation in B cell lineage cells.

Figure 2.6.DUSP6 is required for efficient transformation of pre-B cells by kinase
oncogenes.
A: Dusp6
-/-
and Dusp6
+/+
bone marrow cells were isolated and propagated in the
presence of IL7. After expansion of Dusp6
-/-
and Dusp6
+/+
pre-B cells, TKI (Imatinib, 1
μM) was added and pre-B cells were transduced with BCR-ABL1-GFP. Upon wash out
of TKI, the fraction of BCR-ABL1-GFP positive cells rapidly increased for Dusp6
+/+
pre-B
cells, indicating successful kinase transformation. In Dusp6
-/-
pre-B cells, TKI washout
did not cause noticeable increase in GFP percentage. B: One million Dusp6
-/-
and
Dusp6
+/+
pre-B cell after transduction with NRAS
G12D
were injected into the sublethally
irridiated NOD/SCID recipient mice (n=7). Leukemia-initiation in NOD/SCID recipients
was monitored by luciferase bioluminescence imaging. C: Kaplan-Meier curves show
significant difference in the ability of Dusp6
-/-
and Dusp6
+/+
cells to initiate RAS
dependent leukemia in recipient mice.

28

2.3.6. Dusp6-/- B cell lineage BCR-ABL1 cells have less self-renewal
ability and higher sensitivity to cellular senescence than wildtype
leukemia
Despite showing different tendencies for transformation, both Dusp6
+/+
and Dusp6
-/-
pre-
B cells were finally transformed with BCR-ABL1 oncoprotein. However, there were still
characteristics differences between the Dusp6
+/+
and Dusp6
-/-
ALL cells. One of these
characteristics was the ability of the leukemia cells for self-renewal. Self-renewal
potential of the cells can be quantified by their ability to form colonies in the semi-solid
cultures. Dusp6
-/-
BCR-ABL1 ALL cells showed weaker self-renewal ability in
comparison with wildtype cells and generated fewer and smaller colonies (Figure 2.7A).
As we discussed in chapter one, cellular senescence is one of the main side effects of
the hypersignaling (Braig et al., 2005). We measured the amount of cellular senescence
with senescence-associated beta-galactosidase (SA-βgal) assay. Cells undergoing
senescence show SA-βgal activity at pH around 6. Treatment of chemically fixed cells
with X-gal yields an insoluble blue compound when cleaved by β-galactosidase.
Because of the higher pH than lysosomal pH (=4), the SA-βgal could be distinguished
from the lysosomal β-galactosidase activity (Dimiri et al., 1995). SA-βgal assay showed
that the Dusp6
-/-
ALL cells had higher level of cellular senescence in comparison with the
wildtype cells (12% vs. 0.2%, P value= 0.0002) (Figure 2.7B). We then increased the
signaling of the MAPK pathway by retroviral transduction of the BCR-ABL1 cells with
NRAS
G12D
(active form). NRAS
G12D
activity amplified the cellular senescence in both cell
types but still the Dusp6
-/-
ALL cells showed higher sensitivity to cellular senescence
than the wildtype cells (60% vs. 12%, P value = 0.0003) (Figure 2.7B).
29

Figure 2.7.DUSP6

potentiates the self-renewal of BCR-ABL1 ALL cells and its absence
increases their sensitivity to cellular senescence.
A: 10,000 Dusp6+/+ and Dusp6-/- ALL cells were plated in methylcellulose for ten days.
B: Dusp6+/+ and Dusp6-/- BCR-ABL1 leukemia cells were studied for their propensity to
cellular senescence (senescence-associated β-galactosidase; SA-βgal; pH 5.5) upon
transduction with hyperactive NrasG12D or an empty vector control. Percentages of SA-
βgal positive cells (blue stains) are shown with bar chart.
2.3.7. ROS generation is a possible contributor to cell toxicity in the
presence of hypersignaling
One of the side effects of hypersignaling is the increase in generation of reactive oxygen
species (ROS) (Pelicano et al., 2004; Benhar et al., 2002). As we discussed in chapter
one, High levels of ROS are toxic for the cells and can cause DNA damage and
apoptosis. Therefore we hypothesized that the negative outcomes after inhibition of
30

negative feedback regulators could be dependent on ROS generation. Intracellular ROS
levels can be measured by CM-H2DCFDA staining. CM-H2DCFDA can passively diffuse
into the cells. There, first the acetate groups are cleaved by intracellular esterases and
then oxidation yields a fluorescent adduct (DCF) (Invitrogen, Carlsbad, CA). Fluorescent
emission of DCF can be measured by flow cytometry which is representative of ROS
levels.
DCF measurements showed that the level of ROS increased after deletion of Spry2 in B
cell lineage BCR-ABL1

ALL cells (Figure 2.8A). Similarly, the level of ROS was higher in
Dusp6
-/-
BCR-ABL1 cells than wildtype

cells (Figure 2.8A). Furthermore, Dusp6
-/-
ALL
cells showed higher accumulation of ARF and P53 DNA damage molecules (Figure
2.8B). The protein expression levels of these molecules showed no significant difference
upon Spry2 deletion (data not shown).

Figure 2.8.Deficiency in negative feedback regulators results in elevated ROS levels.
A: Dusp6- and Spry2-deficient and wildtype BCRABL1 leukemia cells were stained with
CM-H2DCFDA which labels cells based on intracellular levels of ROS. Mean
fluorescence intensities (MFI) for DCF [ROS] are depicted. B: Western blots for P53 and
ARF shows more accumulation of these molecules in the DUSP6 deficient BCR-ABL1
cells.

31

2.3.8. Small molecule inhibition of DUSP6 using BCI
Our genetic findings suggested that inhibition of negative feedback molecules such as
DUSP6 and SPRY2 in kinase driven leukemia could be a potential therapeutic approach.
A recent study (Molina et al., 2009) in a zebrafish model had performed a compound
screen for DUSP6 inhibitors in the context of FGF signaling. This screen identified 2-
Benzylidene-3-(Cyclohexylamino)-1-Indanone (BCI, Sigma, St. Louis, MO) as an
allosteric inhibitor of Dusp6 that prevents the catalytic stimulation of phosphatase activity
induced by substrate binding (Molina et al., 2009).
Treatment of Ph
+
ALL cells with BCI inhibited the DUSP6 activity as demonstrated by
increased phosphorylation of its substrates in the MAPK pathway such as ERK1/2, P38α
and JNK (Figure 2.9A). Importantly, this hypersignaling resulted in drastic cell death and
apoptosis in a panel of human Ph
+
ALL xenografts. Interestingly, treatment with same
concentrations of Imatinib showed no significant effect on the studied xenografts sample
(Figure 2.9.B-C). Two of these human Ph
+
ALL samples (BLQ5 and LAX2) were carrying
T315I mutation and therefore were totally nonresponsive to TKI treatment (Figure 2.9.B-
C). To investigate how specific BCI is for DUSP6, we treated the Dusp6
+/+
and Dusp6
-/-

ALL cells with BCI. As expected, the wildtype cells were more sensitive to BCI treatment
than the Dusp6
-/-
cells (Figure 2.9D). We also compared the sensitivity of the kinase
driven Ph
+
ALL and various B cell lymphomas to BCI (Figure 2.9E). Consistent with the
differences that we observed in the protein level (Figure 2.3.A), Ph+ ALL xenografts
were strikingly more sensitive to BCI treatment than the lymphoma cells (Figure 2.9E).

32

Figure 2.9.Small molecule inhibition of DUSP6 induces signaling imbalance and
apoptosis in Ph
+
ALL.
A: The effects of chemical inhibition of DUSP6 using BCI on MAPK signaling pathway
have been studied using Western blots for phosphorylation of Dusp6 substrates ERK1/2,
P38α and JNK. Human Ph+ xenograft (BLQ5) was treated with 8 µM BCI and Western
blots have been carried out for the ERK1/2pT202/Y204, p38αpY180/182,
JNK1pT183/Y185 and their respective global forms. β-ACTIN was used as loading
33

control. B: Five primary human Ph+ ALL samples including two cases with BCR-
ABL1T315I (BLQ5, LAX2) were treated with Imatinib (kinase inhibitor; green) or BCI
(DUSP6 inhibitor, red) at various concentrations for three days. Normalized values for
cell viabilities are shown on the y axis. C: Representative flow cytometry plots for
Annexin V staining for BCI, TKI treated and control cells. D: BCI is more toxic for
Dusp6+/+ BCR-ABL1 cells than the Dusp6-/- which suggests the specificity of BCI for
DUSP6 in mouse cells. E: To test selectivity of BCI-mediated toxicity on kinase driven
tumor cells, four primary cases of Ph+ ALL (red lines) and 11 B-NHL (gray lines) were
treated with BCI at various concentrations for three days. Normalized cell viabilities are
shown on the y axis.
2.3.9. BCI treatment increases the NADPH oxidase dependent ROS
level
Observing negative outcomes upon chemical inhibition of DUSP6, we hypothesized that
similar to genetic deletion; ROS could be involved in these outcomes. Flow cytometry
analysis after DCF staining showed that similar to genetic deletion of negative feedback
molecules, treatment of BCR-ABL1 cells with BCI increased the level of ROS (Figure
2.10A). There are two well-described sources for ROS generation in BCR-ABL1 cells,
mitochondria (Sattler et al., 2000) and the NADPH oxidase pathway (Naughton et al.,
2009). NCF1 is a component of the NADPH oxidase complex. Using a knockout model
for NCF1 (Table S4) we demonstrated that B cell lineage Ncf1
-/-
BCR-ABL1 cells showed
weaker increase in ROS after BCI treatment in comparison with wildtype ALL (Figure
2.10B). Consistently, Ncf1
-/-
ALL cells showed higher resistance to BCI treatment (Figure
2.10C). These results suggest that the NADPH oxidase complex is involved in elevation
of ROS level after BCI treatment.
To further clarify the role of ROS in cell death, we used other chemicals to shift the level
of cellular ROS and studied their effects on BCI treatment. L-buthionine-S,R-sulfoximine
(BSO, Sigma Aldrich) is a selective inhibitor of γ-glutamyl cysteine synthase, an enzyme
in the glutathione biosynthetic pathway. BSO treatment results in depletion of glutathione
which itself causes more accumulation of ROS. Interestingly, combination of BCI with
34

BSO (200 µM) increased the cell toxicity of BCI (P value =0.002) (Figure 2.10D). In
contrast, co-treatment of cells with BCI and the ROS scavenger catalase (500 U/ml,
Sigma Aldrich) increased the viability of cells treated with BCI (P value =0.018) (Figure
2.10E). These results confirm the mechanistic role of ROS in toxicity of BCI on BCR-
ABL1 cells.

Figure 2.10.BCI induces toxicity via NADPH oxidase dependent elevation of ROS.
A: 24 hours treatment with 2μmol/l BCI results in an increase in the level of ROS in BCR-
ABL1 leukemia cells. B: Ncf1+/+ and Ncf1-/- BCR-ABL1 leukemia cells were treated with
BCI or vehicle (DMSO) for 24 hours and intracellular ROS levels were measured by flow
cytometry after DCF staining. The Ncf1 null cells generate less ROS in the presence of
BCI. C: Wildtype or Ncf1 null BCR-ABL1 ALL cells were treated with vehicle (DMSO) or
3µM BCI. The normalized viabilities are shown by the bar chart. D: Five Ph+ patient-
derived xenograft ALL cells (SFO2, TXL3, LAX2, ICN1 and BLQ5) were treated with
vehicle (DMSO), 5 μmol/l BCI, 200 μmol/l ROS inducer L-buthionine-S,R-sulfoximine
(BSO,Sigma Aldrich) or the combination of BCI and BSO for 24 hours. Viabilities of the
cells were measured by flow cytometry using propidium iodide. Means of viabilities of
five ALL ± SD are shown. E: Five patient-derived xenograft ALL (SFO2, TXL3, LAX2,
ICN1 and BLQ5) were treated with 5 μmol/l BCI or combination of BCI and ROS
scavenger catalase (500 U/ml,Sigma Aldrich) for 48 hours in vitro. Viabilities were
assessed by flow cytometry using propidium iodide. Pairwise t-test was performed.

35

2.3.10. P53 and ARF are required for the toxicity of BCI
To elucidate the mechanisms of cell cytotoxicity after treatment with BCI, we looked for
the DNA damage check point molecules which were also found to be up-regulated in the
Dusp6
-/-
ALL (Figure 2.8B). By analysis of the P53 and ARF protein levels by Western
blot, we confirmed that BCI treatment resulted in accumulation of these molecules in a
panel of patient-derived Ph
+
ALL samples (Figure 2.11A-B). To confirm the role of P53
and ARF in cell death, we studied the effect of BCI in the P53- and ARF deficient BCR-
ABL1 ALL cells (Figure 2.11C-D). Interestingly, deletion of P53 and ARF in ALL cells
drastically increased the BCI resistance (20% vs. 80% in P53 deletion and 30% vs. 80%
in ARF deletion). This suggests that the P53/ARF pathway is a main effector of cell
death upon BCI treatment.

Figure 2.11. BCI toxicity in Ph
+
ALL cells are P53 and ARF dependent.
A-B: Five Ph+ patient-derived xenografts were treated with 5 μM BCI for 12 hours and
were analyzed by Western blot for the expression of ARF and P53 using β-ACTIN as
loading control. C: Tp53fl/fl and Cdkn2afl/fl (Arf) BCR-ABL1 leukemia cells carrying
either Cre or an empty vector control (EV) were treated with 2 µM BCI or vehicle
(DMSO) for 24 hours and cell viabilities were measured by flow cytometry. Numbers
represent the percentages of viable cells (PI negative cells) in the four conditions.
36

2.3.11. Cross-talk between MAPK and JAK/STAT pathways occurs in
the presence of MAPK hypersignaling
To more broadly investigate the various phosphorylation changes occurring upon BCI-
induced hypersignaling, we used a phospho-array kit (R& D Systems) to study the
changes in phospho-profile of the Ph
+
ALL cells after BCI treatment. Treatment of two
patient-derived Ph
+
ALL BLQ5 and LAX2 (both with T315I mutation) for 4 hours with 8
µM BCI led to innumerous changes in the phosphorylation level of different proteins
(Figure 2.12A). In addition to the expected elevated level of phosphorylation of DUSP6
substrates such as ERK1/2, P38α and JNK, we surprisingly observed dramatic decrease
in STAT5 phosphorylation (Figure 2.12A-B). STAT5 is a transcription factor that is
activated by Janus kinases (JAKs) by phosphorylation on tyrosine 694 and 699 (mainly
JAK2 in Ph
+
Leukemia) (Carlesso et al., 1996). STAT5 activity is necessary for the
survival of BCR-ABL1 ALL cells (Nieborowska-Skorska et al., 1999). We next studied
the kinetics of STAT5 dephosphorylation by a time course Western blot assay in a
human patient derived Ph
+
ALL (BLQ5). Interestingly, we found that drastic
dephosphorylation of STAT5 occurs within less than 30 minutes of BCI treatment in
these cells (Figure 2.12C).
We have previously shown that treatment of BCR-ABL1 cells with tyrosine kinase
inhibitor results in dephosphorylation of STAT5 (Duy et al., 2011). Therefore, observing
STAT5 dephosphorylation upon BCI treatment, we hypothesized that BCI and TKI may
have synergistic effects. We tested this hypothesis by treatment of BCR-ABL1
transformed murine cells with BCI alone or in combination with 0.5 µM of Imatinib
(Figure 2.12D). As we hypothesized, TKI treatment enhanced BCI toxicity which
suggests a synergistic behavior. Notably, we also observed that BCI dependent
dephosphorylation of STAT5 is less impressive in the Dusp6
-/-
than Dusp6
+/+
BCR-ABL1
37

cells (Figure 2.12E). This observation demonstrated that acute inhibition of DUSP6 lead
to STAT5 dephosphorylation.

Figure 2.12.DUSP6 inhibition with BCI affects the JAK/STAT pathway.
A: BLQ5 and LAX2, two patient-derived Ph+ ALLs were treated with 8 µM BCI for 4
hours. We studied the alterations in their phospho-profile using a phospho-array kit (R&
D Systems). B: The results of the phospho-arrays are shown by the heatmap. C: STAT5
dephosphorylation was confirmed in BLQ5 cells using time course Western blots. D:
Since both Imatinib and BCI treatments result in STAT5 dephosphorylation, the efficacy
of BCI treatment was studied in the presence or absence of Imatinib (TKI). Normalized
viabilities of cells after three days of treatment are shown on y axis. E: BCI mediated
dephosphorylation of STAT5 is stronger in Dusp6+/+ ALL than Dusp6-/-. This suggests
the specificity of BCI for Dusp6.

38

2.3.12. MAPK pathway hyperactivation causes the dephosphorylation
of STAT5
The strong dephosphorylation of STAT5 upon DUSP6 inhibition by BCI treatment could
be either the outcome of hypersignaling in MAPK pathway or a DUSP6 specific incident.
To clarify the mechanism involved, we transduced the BCR-ABL1 cells with a retroviral
NRAS
G12D
. NRAS
G12D
is the active form of NRAS and activates the MAPK pathway
downstream of RAS. Remarkably, Similar to inhibition of DUSP6 by BCI, the genetic
hyperactivation of the MAPK with NRAS
G12D
resulted in dephosphorylation of STAT5
(Figure 2.13A). This suggests that dephosphorylation of STAT5 is due to the activation
of RAS/MAPK pathway. This crosstalk between the JAK/STAT and MAPK pathways is a
novel finding and to the best of my knowledge has not been mentioned before in the
literature.

Figure 2.13.MAPK hyperactivation causes STAT5 dephosphorylation which is toxic for
Ph
+
ALL.
39

A: Hyperactivation of MAPK pathway using NRADG12D increases the phosphorylation
of ERK1/2 and dephosphorylates STAT5. B: BCR-ABL1 ALL cells were transduced with
a constitutively active form of STAT5 (Stat5CA-GFP) or empty vector (GFP). On day 1
after transduction, BCR-ABL1 leukemia cells were treated with different concentrations
of BCI (0, 0.5, 1 and 2 μM). GFP+ cells were measured 18 hrs after treatment by flow
cytometry. The ratios of STAT5 vs. empty vector containing cells are shown by the bar
plot. Cells carrying STAT5CA are more resistant to BCI toxicity and the ratio of GFP
positive cells increased in higher BCI concentration. C: Representative plots for GFP
measurements are shown. All plots are gated for viable cells (PI-). The percentages of
GFP positive cells are shown on the plots.

2.3.13. Constitutively active STAT5 can alleviate the toxicity of MAPK
hyperactivation
Considering dephosphorylation of STAT5 as one of the mechanisms for the cell death in
ALL cells after MAPK hyperactivation, we hypothesized that re-activation of STAT5
could overcome the toxic effect of BCI and also benefit the cells in the presence of
NRAS
G12D
activity. BCI treatment of BCR-ABL1 cells with a constitutively active form of
STAT5 (STAT5
CA
-GFP) (Nosaka et al., 1999) showed that despite the toxicity of BCI for
the cells, the percentage of GFP positive cells increased at higher BCI concentrations.
This demonstrates that cells carrying STAT5
CA
have better survival advantages in the
presence of BCI (Figure 2.13B-C).
In another experiment, BCR-ABL1 ALL cells with or without NRAS
G12D
were transduced
with GFP or STAT5
CA
-GFP retroviruses. Measuring the percentages of GFP positive

cells showed that STAT5
CA
activity in control cells is extremely unfavorable and the
fraction of GFP positive cells dropped among them rapidly. But the presence of
NRAS
G12D
within the cells increased the tolerance of cells to the STAT5
CA
activity (Figure
2.14A). The ratio of GFP positive cells between NRAS
G12D
and control cells showed
significant increase by the time only in STAT5
CA
positive cells (Figure 2.14B). This again
suggests that the NRAS suppress the STAT5
CA
activity. It is noteworthy that the toxicity
of STAT5
CA
is consistent with hypersignaling model (Figure 2.14A).
40

Figure 2.14.Consitututvely active form of STAT5 is beneficial in the presence of MAPK
hyperactivity.
A: BCR-ABL1 cells transduced with NRASG12D or empty vector were selected with
puromycin. Next, they were transduced with constitutively active STAT5 (STAT5CA-
GFP) or empty vector (GFP). Percentages of GFP positive cells were measured using
flow cytometry for six consecutive days after transduction. The ratio of GFP cells
between NRASG12D and MIP transduced cells are shown by bar plot. B:
Representative plots for GFP measurements are shown. All plots are gated for viable
cells (PI-).

2.3.14. PTPN6 phosphatase links the MAPK and JAK/STAT
pathways
Considering the dephosphorylation of STAT5 as an effector mechanism in MAPK
hypersignaling-induced cell death, we decided to search for the efector phosphatases(s).
PTPN6 and PTPN11 are two well documented phosphatases for STAT5 (Chen et al.,
2003; Xiao et al., 2009). We studied the activities of PTPN6 and PTPN11 by Western
blots against their active phosphorylated forms which are Phospho-tyrosine 564 and 542
respectively. Interestingly, we found that BCI treatment of BLQ5 cells, a patient derived
Ph
+
ALL, only increased the activity of PTPN6 but not PTPN11 (Figure 2.15A). We then
investigated whether the phosphatase activity of PTPN6 was required for
dephosphorylation ofSTAT5 by deletion of PTPN6 in BCR-ABL1 cells. Cre dependent
41

deletion of Ptpn6
fl/fl
in BCR-ABL1 ALL resulted in increased STAT5 phosphorylation
which supports PTPN6 as a STAT5 phosphatase (Figure 2.15B). We also demonstrated
that hyperactivity of the MAPK pathway by BCI treatment or NRAS
G12D
expression
increased the activity of PTPN6

in BCR-ABL1 ALL cells (Figure 2.15C-D). These results
highly support the role of PTPN6 as the crosstalk factor between JAK/STAT and MAPK
pathways in the presence of MAPK hypersignaling.

Figure 2.15.PTPN6 is the connecting phosphatase between JAK/STAT and MAPK
pathways.
A: BCI treatment increases the activity of PTPN6 but not PTPN11 in BCR-ABL1 cells
within twenty minutes in a patient derived Ph+ ALL (BLQ5). The activations of these
molecules have been assessed using antibody against their activatory phosphorylation
sites. B: Deletion of PTPN6 in BCR-ABL1 ALL cells results in an increase in STAT5
phosphorylation on tyrosine 694. Ptpn6 was deleted in Ptpn6fl/fl BCR-ABL1 cells using
Cre vector. C: BCI treatment increases the activity of PTPN6 in murine BCR-ABL1 ALL
cells. D: Hyperactivation of the MAPK in the presence of NRASG12D increases the
activity of PTPN6.

42

2.3.15. Therapeutic applications of small molecule inhibitor of DUSP6
To investigate the therapeutic application of DUSP6 inhibition we injected one million
luciferase labeled T315I mutated patient-derived Ph
+
Leukemia cells (LAX2) into
recipient NOD/SCID mice. Starting at day 3 after injection of leukemia cells, mice were
treated with a daily dose of 40 mg/Kg Nilotinib (TKI), 40 mg/Kg BCI or vehicle via I.P.
injection. Mice were treated for 10 days with a seven day break in between to avoid the
side effects of drug accumulation. Although BCI had side effects for the mice and 4 out
of 7 mice under BCI treatment died at early time points (Figure 2.16A), those mice that
tolerated the early side effects of BCI, showed prolonged survival compared to the
control groups (Figure 2.16B). LAX2 cells are T315I mutated and as expected there was
no survival advantage in Nilotinib treated group.

Figure 2.16.In vivo treatment of Ph
+
ALL with BCI.
A: Patient derived Ph+ ALL cells (LAX2, T315I mutated) were labeled with firefly
luciferase and injected into sublethally irradiated NOD/SCID mice (one million cells per
mouse). Starting day 3 after injection, mice were treated with vehicle, 40 mg/kg of the
tyrosine kinase inhibitor (Nilotinib) or 40 mg/kg BCI daily for 10 days. Treatment days are
shown by bars on the X axis. Luciferase bioluminescence imaging was performed on
days 7, 15 and 30. B: Kaplan-Meier curves show significant increase in survival of mice
in BCI treatment group.

43

To overcome the side effects of BCI in mice under the treatment we did an ex vivo
experiment. Two patient-derived Ph
+
ALL samples (BLQ5 and LAX2) were treated with
either DMSO or 5 µM BCI for 4 hours and were injected to the sublethally irradiated
NOD/SCID mice. The flow cytometry plots for the cells before injection show that the
viability of the cells were similar at the time of injection (Figure 2.17A).The cells were
labeled with Luciferase and leukemia progression was monitored by bioluminescence
imaging (Figure 2.17A). Consistent with our previous results, the mice recipient of BCI
treated ALL cells showed significantly longer survival than those which received control
cells (P value < 0.003) (Figure 2.17B-C).

Figure 2.17.Ex vivo treatment of Ph
+
ALL with BCI.
A: Luciferase labeled patient derived Ph+ ALL cells (LAX2 and BLQ5) were treated for 4
hours with vehicle (DMSO) or 5μM BCI and injected into NOD/SCID recipient mice. Flow
cytometry measurements with propidium iodide staining prior to injection show no
noticeable difference in cell viabilities. Leukemia progression in NOD/SCID recipients
was monitored by luciferase bioluminescence imaging. B-C: Kaplan-Meier curves show
significant increase in survival of recipient of BCI treated ALL cells.
44

2.4. Conclusion
The negative outcomes of hypersignaling in different cell types have been studied
extensively by in vitro and in vivo models (Serrano et al., 1997 and Michaloglou et al.,
2005). BCR-ABL1 is a strong oncoprotein and is able to transform progenitor pre-B cells
within a couple of days. Surprisingly, BCR-ABL1 activity is undesirable for other
leukemia cell lines (rs4,11 and Kasumi2 with MLL-AF4 and E2A-PBX1 respectively;
Kasumi2 data were not shown) (section 2.3.1). This suggests that the presence of too
much signaling (oncogenic kinase activity in this example) is not favorable even for the
transformed cells and could be harmful for their survival. Therefore we hypothesized that
induction of hypersignaling could be toxic for kinase-driven transformed cells and
potentially would be of therapeutic use for killing this class of cancer cells.
Different approaches could be utilized to induce hypersignaling such as activation of an
oncoprotein or increase in the level of external stimulatory signal. In this chapter, we
focused on inhibition of negative feedback regulatory molecules as a possible strategy to
induce hypersignaling. There are several advantages in using this approach instead of
introducing an oncoprotein. First, it is easier to clinically inhibit a molecule using small
molecule inhibitors than activating specific targets. Second and the more important
advantage is its potential specificity for transformed cells. Normal un-stimulated cells
usually have weak and low signaling activities; hence the level of feedback regulation is
negligible among them. In contrast, the transformed cells show higher signaling activity
therefore the level of negative feedback regulation is higher in these cells (section 2.3.2),
So potentially the inhibition of negative feedback regulators should affect the
transformed cells more than the normal cells.
In this chapter we focused on the outcomes of induction of hypersignaling in the MAPK
pathway in B cell lineage BCR-ABL1 acute lymphoblastic leukemia (Ph
+
like ALL). Using
45

genetic and chemical tools we studied the inhibition of two negative feedback regulators
of the MAPK pathway, SPRY2 and DUSP6 in this kinase dependent model.
Interestingly, our results showed that the inhibition of the negative feedback regulation is
lethal for the BCR-ABL1 leukemia cells. Furthermore, we found that the presence of
negative feedback regulation is required for the efficient transformation of the cells. Our
in vitro and in vivo experiments showed that the genetic deletion of SPRY2 and DUSP6
resulted in cell death, reduction in cell proliferation, reduced self-renewal ability and
rendered the cells more susceptibility to cellular senescence. Furthermore, the Dusp6
null cells were less susceptible for transformation with kinase activities of BCR-ABL1 or
NRAS oncoproteins (section 2.3.5). These data highly suggest that an effective and
functional negative feedback regulation is necessary for both transformation and survival
of the kinase driven leukemia cells.
We also suggested the elevation in reactive oxygen species (ROS) level as the main
effector of toxic effects upon inhibition of negative regulators and induction of
hypersignaling. Genetic deletion of Dusp6 and Spry2 and chemical inhibition of DUSP6
all resulted in the elevation in ROS level. In addition, we demonstrated that genetic and
chemical Inhibition of DUSP6 resulted in accumulation of DNA damage molecules such
as ARF and P53 (section 2.3.7).
Another exciting finding in our study was the presence of crosstalk between JAK/STAT
and MAPK pathways in the case of hypersignaling of the MAPK pathway (section
2.3.11). We showed that hyperactivation of the MAPK pathway, either by genetic tools
(such as NRAS
G12D
) or chemical inhibition of negative regulators (such as BCI against
DUSP6) causes dephosphorylation and hence deactivation of STAT5. JAK2/STAT5 is
one the main survival signaling pathway in BCR-ABL1 cells and decrease in its activity
could impact the cells negatively. In addition, we suggested PTPN6 as the candidate
46

phosphatase that implements the crosstalk between these two pathways (section
2.3.14).
In summary, we suggested three mechanisms involved in toxicity of MAPK
hypersignaling in B cell lineage BCR-ABL1 leukemia:
1- Increase in reactive oxygen species (ROS) level
2- Accumulation of DNA damage check point molecules such as P53 and ARF
3- The crosstalk between the MAPK and JAK/STAT signaling pathways
ROS generation and DNA damage response are closely connected but we do not know
about the possible effects of signaling crosstalk on ROS generation or DNA damage
response.
Finally, we studied the therapeutic application of inhibiting negative feedback regulators
to induce hypersignaling in kinase driven leukemia. Treatment with BCI, a small
molecule inhibitor of DUSP6, resulted in dramatic cell death in patient derived Ph
+
ALL
which was more effective than treatment with kinase inhibitors such as Imatinib (section
2.3.8). These results were also more specific in kinase driven Ph
+
ALL cells than
lymphoma cell lines.
One great advantage of this new therapeutic approach is its effectiveness on Ph
+

leukemia cells which are not responsive to tyrosine kinase inhibitors due to the
complications such as T315I mutation.
To the best of my knowledge there is no published study that employs the inhibition of
negative regulators as an approach to kill tumor cells and utilize this concept as a
therapeutic approach in cancer treatment. We specifically studied the negative
regulators of the MAPK pathway in B cell lineage BCR-ABL1 ALL but we hypothesize
similar outcomes in hyperactivation of other pathways in BCR-ABL1 cells such
JAK/STAT5 pathway. Therefore, negative regulators of JAK/STAT5 pathway such as
CISH, SOC2 and SOC3 are also potential target for future studies. We also hypothesize
47

that one will observe similar outcomes in other kinase driven tumors such as lung, breast
and melanoma cancers with BRAF, EGFR and HER2 etiology. However, due to side
effects, BCI is probably not the best option for use in clinical therapy, but our findings
would encourage researchers to develop better and more specific inhibitors for negative
feedback molecules in MAPK and other signaling pathways.

48

Chapter 3:
Targeting inhibitory phosphatase signaling in Ph+ ALL
3.1. Introduction
3.1.1 Inhibitory receptors and phosphatases
Philadelphia chromosome positive (Ph
+
) B acute lymphoblastic leukemia (B-ALL)
originates from committed B cells in early developmental stages (Signer et al., 2010).
Therefore, mechanisms involved in regulation of B cell signaling could potentially be
important within these cells. One of the major regulatory mechanisms in immune cells
such as B cells is immunoreceptor tyrosine-based activation or inhibitory motifs (ITAM or
ITIM) (Figure 3.1A). These motifs are present in many receptors on the immune cell
surface (Billadeau and Leibson, 2002). Regulation of the immune response in different
immune cell types is determined by interactions among molecules carrying these two
opposing motifs. For instance, in B cell receptor signaling (BCR), the phosphorylation of
tyrosine residues of ITAMs motif on the cytoplasmic domains of the Igα and β
heterodimer results in binding and activating of Src family protein tyrosine kinases such
as SYK and LYN (Kurosaki, 1999). On the other hand, the FcγRIIB receptor inhibits BCR
signaling via its ITIM motif on its cytoplasmic tail.
Upon co-clustering with an activating, ITAM-containing receptor, Src family PTKs
phosphorylates the tyrosine residue in the ITIM sequence. The phospho-tyrosine can
then recruit either of two SH2 domain–containing negative regulators: the inositol
phosphatase INPP5D (Ravetch and Lanier, 2000) or the tyrosine phosphatase PTPN6
(Burshtyn et al., 1996). ITIMs share a consensus amino acid sequence in their
cytoplasmic tail, namely (I/V/L/S)-X-Y-X-X-(L/V), where X denotes any amino acid (Vivier
49

and Daëron, 1997). A leucine in the (Y+2) position favors binding to INPP5D, whereas
an isoleucine in the (Y–2) position favors PTPN6 binding (Burshtyn et al., 1997, Bruhns
et al., 2000). We will discuss the inhibitory activities of PTPN6 and INPP5D in next
sections.
3.1.2. PI3K/AKT pathway and its regulators
The phosphatidylinositol 3 kinase (PI3K)/AKT pathway is one of the downstream
effectors of the BCR-ABL1 kinase (Varticovski et al., 1991; Ptasznik et al., 2002). PI3K
is composed of a catalytic P110α subunit and a regulatory P85 subunit and
phosphorylates membrane glycerophospholipid phosphatidylinositol (PI) 4,5-
bisphosphate [PI(4,5)P2] resulting in production of PI 3,4,5 trisphosphate (PIP3) and PI
3,4 trisphosphate(PIP2). AKT is a serine/threonine kinase that binds to PIP3 via its
pleckstrin-homology (PH) domain. AKT is activated by binding to PIP3 and the
subsequent phosphorylations on threonine 308 and serine 473 by PDK1 and PDK2
respectively (Vanhaesebroeck et al., 2000; Alessi et al., 1997). AKT activation stimulates
proliferation, survival and growth through phosphorylation of many physiological
substrates (I Vivanco and CL Sawyers, 2002).
Regulation of PIP3 level is a mechanism for regulation of AKT signaling. PTEN and
INPP5D remove 3- and 5-phosphates from PIP3 respectively and therefore inhibit the
AKT recruitment and activation (Leung et al., 2009 and T Maehama and JE Dixon, 1998)
(Figure 3.1B). Another molecule involved in PI3K/AKT inhibition is PTPN6. This inhibition
occurs via association of PTPN6 with the P85 regulatory subunit of PI3K. Under normal
conditions, the P85 subunit serves to both stabilize and inactivate the P110α catalytic
subunit (Yu et al., 1998). As expected, PTPN6 deficient mice demonstrated enhanced
activation of PI3K/AKT pathway in skeletal muscle and liver (Dubois et al., 2006).

50

Figure 3.1 Schematic of the inhibitory phosphatases PTEN, INPP5D and PTPN6.
A: Immunoreceptor tyrosine-based inhibititory motifs (ITIMs) carrying receptors can
recruit the ITIM binding phosphatases such as PTPN6 and INPP5D which suppress the
PI3K/AKT , JAK/STAT and Src kinase molecules. B: PTEN and INPP5D reduce the
activity of the PI3K/AKT pathway by dephosphorylating two different phosphate groups
from PIP3.

3.1.3. PTEN
PTEN (phosphatase and tensin homolog deleted on chromosome 10) is the most
important regulator of the PI3K/AKT pathway. PTEN is a dual protein and lipid
phosphatase and its main substrate is PIP3 which is the product of PI3K (T Maehama
and JE Dixon, 1998).
PTEN activity is lost by mutations, deletions or promoter methylation at high frequency in
many primary and metastatic human cancers (I Vivanco and CL Sawyers, 2002). Germ
51

line mutations of PTEN are also found in Cowden and Bannayan-Riley-Ruvalcaba
syndromes, both familial cancer predisposition syndromes (Liaw et al., 1997 and Marsh
et al., 1999). All these alterations cause higher activity of AKT which results in
tumorigenesis via mechanisms such as inhibition of apoptosis (Plas et al., 2005), over-
expression of cyclin D (Weng et al., 2001) and interactions with MDM2 that lead to
increased p53 degradation (Gottlieb et al., 2002). In addition, AKT independent
mechanisms of PTEN-mediated tumorigenesis have been suggested such as direct
PTEN association with P53 or cyclin D (Freeman et al., 2003). Furthermore, transgenic
studies showed that although knockout of PTEN is embryonically lethal, heterozygous
mice develop tumors in several organs (Suzuki et al., 1998).
PTEN mutations play a major role in T cell acute lymphoblastic leukemia (T-ALL) and
genetic variations in PTEN, PI3K and AKT are present in up to 50% of T-ALL cases
(Gutierrez et al., 2009). Mice with Pten deletion in adult hematopoietic cells develop and
die of acute myeloid leukemia (AML) and acute lymphoblastic leukemia (ALL) (Zhang et
al., 2006). Peng and colleagues suggested PTEN as a tumor suppressor in BCR-ABL1
positive CML cells. They showed that the PTEN deletion caused acceleration of CML
development. In addition, in their model, overexpression of PTEN delayed the
development of CML as well as B-ALL and prolonged survival of leukemia mice (Peng et
al., 2010).
3.1.4. INPP5D
INPP5D (SHIP, Src homology 2–containing inositol polyphosphate 5-phosphatase)
hydrolyzes the PIP3 into PI 3,4-biphosphate and suppress the activity of AKT at the
plasma membrane (Leung et al., 2009). INPP5D knockout mice are viable and fertile but
have shortened lifespan (Helgason et al., 1998). INPP5D deficiency in mice leads to
increased number of granulocytes and macrophages, progressive splenomegaly, and
52

massive myeloid infiltration of the lungs, ultimately resulting in lethality (Helgason et al.,
1998).
Despite the functional similarity between PTEN and INPP5D, the mutation profiles for
these two genes in cancer patients are quite different. For instance, while loss of
heterozygosity (LOH) and loss of function (LOF) mutations in Pten are widely found in
variety of cancers, there are not that many known mutations in Inpp5d (Gilby et al.,
2007). Interestingly, it has been shown that BCR-ABL1 activity directly inhibits
expression of INPP5D (Sattler al, 2009). This occurs via tyrosine phosphorylation of
INPP5D that triggers its ubiquitination and subsequent degradation by the proteasome
(Ruschmann et al., 2010). This suppression is reversible and inhibition of BCR-ABL1
kinase activity by Imatinib causes rapid increases in INPP5D level.
3.1.5. PTPN6
PTPN6 (SHP-1,Src homology 2–containing protein tyrosine phosphatase-1) is a tyrosine
phosphatase. It has two Src homology 2 (SH2) domains at the amino-terminal end that
determine the PTPN6 substrates and also autoregulate the activity of the catalytic
domain (Ozawa et al., 2007). PTPN6 can be activated by Src kinase phosphorylation
and in return it inhibits other Src substrates, and it is therefore considered as a negative
feedback regulator of Src kinase (Frank et al., 2004). PTPN6 is also able to suppress the
JAK/STAT pathway. It has been shown that PTPN6 directly associates with and
dephosphorylates JAK2 kinase in an EPO-dependent human leukemia cell line (Jiao et
al., 1996). Also, biochemical analysis has shown that PTPN6 is capable of
dephosphorylating STAT5 (Xiao et al., 2009). In addition, PTPN6 can dephosphorylate
ERK1/2 in response to vascular endothelial growth factor administration in endothelial
cells (Cai et al., 2006).
53

In hematopoietic cancers, methylation of PTPN6 gene occurs quite frequently in
leukemia (52% in AML, 24% in ALL) (Chim et al., 2004) and multiple myeloma (79%)
(Chim et al., 2004). In contrast, overexpression of PTPN6 has been reported in epithelial
cancers such as prostate (Zapata et al., 2002), ovarian (Mok et al., 1995), and breast
cancers (Yip et al., 2000 and Insabato et al., 2009). Studies of in vitro system also show
different results for PTPN6. For instance, while transfection of a dominant-negative form
of PTPN6 in rat fetal vascular smooth muscle cells leads to the attenuation of apoptosis
during angiotensin II type 2 receptor activation (Cui et al., 2001), PTPN6 depletion by
small interfering RNAs in PC-3 prostate cancer cell line causes G1 phase cell cycle
arrest (Rodríguez-Ubreva et al., 2010). In summary, it is hard to conclude form the
results of different studies on the role of PTPN6 in cancer.

54

3.2. Materials and methods
3.2.1. Patient samples, human cells and cell lines
Patient samples (Table S1) were provided from the USC Norris Comprehensive Cancer
Center in compliance with the IRB of the University of Southern California Health
Sciences Campus. Human cells were maintained in Roswell Park Memorial Institute
medium (RPMI-1640, Invitrogen, Carlsbad, CA) with GlutaMAX containing 20% fetal
bovine serum, 100 IU/ml penicillin and 100 μg/ml streptomycin at 37°C in a humidified
incubator with 5% CO2. Primary human ALL xenografts were cultured on OP9 stromal
cells.
3.2.2. Extraction of bone marrow cells from mice and generation of
BCR-ABL1
+
B cell lineage ALL
Bone marrow cells were extracted from young Pten
fl/fl
, Pten
+/fl
, Inpp5d
fl/fl
and Ptpn6
+/fl
mice (younger than 6 weeks of age). Bone marrow cells were obtained by flushing
cavities of femur and tibia with PBS. After filtration through a 70 μm filter and depletion of
erythrocytes using a lysis buffer (BD PharmLyse, BD Biosciences), washed cells were
either frozen for storage or subjected to further experiments. For B cell lineage selection
bone marrow cells were treated with 10 ng interleukin-7 (IL7) per milliliter and for LSK
(Lin
−
, Sca-1
+
, c-Kit
+
) cell selection, they were treated with 10 ng/ml recombinant mouse
interleukin -3 (IL3), 25 ng/ml recombinant mouse interleukin -6 (IL6), and 50 ng/ml
recombinant mouse stem cell factor (SCF) for one week (PeproTech). Cytokine treated
cells were retrovirally transformed by BCR-ABL1. Transformation of B cell and LSK cell
with BCR-ABL1 generated ALL and CML-like models respectively. Cells were
maintained in Iscove‟s modified Dulbecco‟s medium (IMDM, Invitrogen) with GlutaMAX
containing 20% fetal bovine serum, 100 IU ml−1 penicillin, 100 μg ml−1 streptomycin and
55

50 µM 2-mercaptoethanol. BCR-ABL1 transformed ALL cells were propagated only for
short periods of time and usually not longer than for 2 months to avoid acquisition of
additional genetic lesions during long-term cell culture. For in vivo experiments ALL cells
were then labeled with retroviral firefly luciferase, selected based on antibiotic resistance
(Blasticidin), and injected via tail into sublethally irradiated (300 cGy) NOD/SCID
recipient mice. Engraftment was monitored using luciferase bioluminescence imaging
(VIS 100 bioluminescence/optical imaging system; Xenogen). D-Luciferin (Xenogen)
dissolved in PBS was injected intraperitoneally (i.P.) at a dose of 2.5 mg per mouse 15
min before measuring the light emission. All mouse experiments were subject to
approval by the Children‟s Hospital Los Angeles Institutional Animal Care and Use
Committee.
3.2.3. Western blotting
Cells were lysed in CelLytic buffer (Sigma, St. Louis, MO) supplemented with 1%
protease inhibitor cocktail (Pierce, Rockford, IL). 15 μg of protein mixture per sample
were separated on NuPAGE (Invitrogen, Carlsbad, CA) 4-12% Bis-Tris gradient gels and
transferred on PVDF membranes (Immobilion, Millipore, Temecula, CA). For the
detection of mouse and human proteins by Western blot, primary antibodies were used
together with the WesternBreeze immunodetection system (Invitrogen). Details of
antibodies used are in Table S5.
3.2.4. Flow cytometry
Antibodies used in flow cytometry are mentioned in Table S6. For apoptosis analyses,
Annexin V, propidium iodide and 7-AAD (BD Biosciences) were used.
56

3.2.5. Colony forming assay for mouse ALL
The methylcellulose colony-forming assays were performed with 10,000 BCR-ABL1-
transformed cells. Cells were re-suspended in murine MethoCult medium (StemCell
Technologies, Vancouver, BC, Canada) and cultured on dishes (3 cm in diameter) with
an extra water supply dish to prevent evaporation. After 7 to 14 days, colonies were
counted.
3.2.6. Retrovirus production and transduction
Transfections of MSCV-based retroviral constructs were performed using Lipofectamine
2000 (Invitrogen, Carlsbad, CA) with Opti-MEM media (Invitrogen). Retroviral
supernatant was produced by co-transfecting 293FT cells with the plasmids pHIT60
(gag-pol) and pHIT123 (ecotropic env; kindly provided by Donald B Kohn, UCLA).
Cultivation was performed in high glucose Dulbecco‟s modified Eagle‟s medium (DMEM,
Invitrogen) with GlutaMAX containing 10% fetal bovine serum, 100 IU/ml penicillin, 100
μg/ml streptomycin, 25mM HEPES, 1 mM sodium pyruvate and 0.1 mM non-essential
amino acids. Regular media were replaced after 16 hours by growth media containing 10
mM sodium butyrate. After 8 hours incubation, the media was changed back to regular
growth media. 18 hours later, the virus supernatant were harvested, filtered through a
0.45 µm filter and loaded by centrifugation (2000 x g, 90 min at 32 °C) two times on
50 ug/ml RetroNectin (Takara, Madison, WI) coated non-tissue 6-well plates. 1-2 x 10
6

pre-B cells were transduced per well by centrifugation at 600 x g for 30 minutes and
maintained overnight at 37°C with 5% CO
2
for 2 days before transferring into culture
flasks.
57

3.2.7. Senescence-associated β-galactosidase assay
Senescence-associated β-galactosidase assay was performed on cytospin preparations.
Briefly, a fixative solution (0.25% glutaraldehyde, 2% paraformaldehyde in PBS pH 5.5
for mouse cells) was freshly generated. To this end, 1 g paraformaldehyde was
dissolved in 50 ml PBS at pH 5.5 by heating followed by addition of 250 μl of a 50% stock
glutaraldehyde solution. 1× X-gal staining solution (10 ml) was prepared as follows:
9.3 ml PBS/MgCl2, 0.5 ml 20× KC solution (that is, 820 mg K3Fe(CN)6 and 1,050 mg
K4Fe(CN)6 × 3H2O in 25 ml PBS) and 0.25 ml 40× X-gal (that is, 40 mg 5-bromo-4-
chloro-3-indolyl β-D-galactoside per milliliter of N,N-dimethylformamide) solutions were
mixed. For BCR–ABL1-transformed ALL cells, 100,000 cells per cytospin were used
(700 r.p.m., 8 min). The fixative solution was pipetted onto cytospins and incubated for
10 min at room temperature, then washed twice for 5 min in PBS/MgCl2. Cytospin
preparations were submerged in 1× X-gal solution, incubated overnight at 37 °C in a
humidified chamber and washed twice in PBS.
3.2.8. Cell-cycle analysis
For cell-cycle analysis in BCR–ABL1 ALL cells, the BrdU flow cytometry kit for cell-cycle
analysis (BD Biosciences) was used according to manufacturer‟s instructions. BrdU
incorporation (FITC-labeled anti-BrdU antibodies) was measured along with DNA
content (7-amino-actinomycin-D) in fixed and permeabilized cells. The analysis was
gated on viable cells that were identified based on scatter morphology.
3.2.9. ROS staining
For evaluation of intracellular ROS levels, ALL cells were incubated for 7 min with 1 µM
5-(and 6-)chloromethyl-2′,7′-dichlorodihydrofluorescein diacetate (CM-H2DCFDA,
58

Invitrogen, Carlsbad, CA) at 37°C for oxidation of the dye by ROS. After washing with
PBS, the cells were incubated additional 15 min at 37°C in PBS to allow complete
deacetylation of the oxidized form of CM-H2DCFDA by intracellular esterases. The
levels of GFP were then directly analyzed by flow cytometry, gated on viable (PI
-
) cells.
3.2.10. Affymetrix gene expression analysis
Total RNA from cells used for microarray or RT-PCR analysis was isolated by RNeasy
(Qiagen, Valencia, CA) purification. RNA quality was first checked by using an Agilent
Bioanalyzer (Agilent Technologies, Santa Clara, CA). Biotinylated cRNA was generated
and fragmented according to the Affymetrix protocol and hybridized to Mouse Gene 1.0
ST Array (Affymetrix, High Wycombe, UK). After scanning (scanner from Affymetrix) of
the GeneChip arrays, the generated CEL files were imported to Partek Genomics suite
6.5 and processed using the RMA algorithm (Robust Multi-array Average) for
normalization and summarization. The log transformed expression values have been
used to calculate the fold-change and t-test. Next the perturbation score was calculated
for each gene and each perturbation. This score combines the expression fold-change
and t-test with a positive score indicating an up-regulation of the gene by the
perturbation. Finally, all genes were ranked by the average perturbation score of the
three phosphatase perturbations.
Separately for each phosphatases deletion dataset, each gene row was mean centered
and scaled by the standard deviation. For each deletion and each gene a perturbation
score was calculated. This perturbation score combines the fold-change difference and
t-test between the perturbation samples and controls and corresponds to the projection
of the (log2 average) fold-change and the (signed log10) t-test values onto their first
principal component axis. A combined perturbation signature was calculated by
averaging the perturbation scores of individual signatures.
59

Pair-wise Spearman correlation coefficients were calculated for the score-ranked
signatures. The results were represented as a clustered correlation matrix.
3.2.11. Tyrosine Kinase Inhibitors (Imatinib), PTEN inhibitor (VO-OH)
and INPP5D inhibitor (3-AC)
Imatinib and VO-OHpic trihydrate were obtained from LC Laboratories (Woburn, MA)
and Biovision (Mountain View, CA) respectively. Imatinib were dissolved in sterile
distilled water and VO-OH dissolved in PBS for use. INPP5D inhibitor, 3α-
Aminocholestane, SH2-domain-containing inositol 5′-phosphatase 1(3AC) were obtained
from Millipore (Billerica, MA) and dissolved in ethanol for further experiments.
3.2.12. Cell viability assay for murine cells
100,000 BCR-ABL1 transformed ALL cells per well were seeded in a volume of 100 μl
medium on Optilux 96-well plate (BD Biosciences, San Jose, CA). Chemicals were
diluted in medium and added at the indicated concentration in a total culture volume of
150 μl. After 3 days culturing, 15 μl of Resazurin (R&D, Minneapolis, MN) was added on
each well and incubated for 4 hours at 37 °C. The fluorescent signal was monitored
using 535 nm excitation wavelength and 590 nm emission wavelength. Fold changes
were calculated using baseline values of untreated cells as a reference (set to 100
percent).
3.2.13. Cell viability assay for human cells
50,000 human derived xonegraft cells per well were seeded in a volume of 80 μl medium
on clear 96-well plate (BD Biosciences, San Jose, CA). Chemicals were diluted in
medium and added at the indicated concentration in a total culture volume of
60

100 μl. After 3 days culturing, 10 μl of CCK-8 solution (DMT Inc.,Rockville,MD) was
added on each well and incubated for 4 hours at 37 °C. The absorbance signal was
measured at 450 nm. Fold changes were calculated using baseline values of untreated
cells as a reference (set to 100 percent).
61

3.3. Results
3.3.1 PI3K/AKT pathway hypersignaling is unfavorable for B cell
lineage Ph
+
ALL cells
In chapter two, we showed that an additional increase in signaling level within leukemia
cells is not favorable. Absence or inhibition of the MAPK pathway‟s negative regulators
such as DUSP6 and SPRY2 was disadvantageous for BCR-ABL1 or NRAS
G12D

transduced leukemia cells (sections 2.3.1 and 2.3.6). Our focus in chapter two was
mainly on hypersignaling in the MAPK pathway. In this chapter we are studying
hypersignaling in the PI3K/AKT pathway.
To evaluate the effects of hypersignaling in the PI3K/AKT pathway in BCR-ABL1 cells,
we transduced murine B cell lineage BCR-ABL1 leukemia cells with either empty vector
(MIG), myristoylated P110α (catalytic subunit of PI3K, P110α-Myr-MIG) or myristoylated
AKT (AKT-Myr-MIG) (Figure 3.2). Transductions of BCR-ABL1 positive ALL cells with
P110α-Myr or AKT-Myr resulted in increased PI3K/AKT pathway activity. Consistent with
our findings on hypersignaling induction in the MAPK pathway, increased signaling level
in the presence of P110α-Myr or AKT-Myr was undesirable for the BCR-ABL1 cells,
demonstrated by the significant decrease in the fraction of GFP positive cells (Figure
3.2A). We also confirmed the hyperactivation of PI3K/AKT by analyzing the levels of
global and phosphorylated forms of AKT (Figure 3.2C). This observation suggests that
there is a negative selection of the cells with hyperactivated PI3K/AKT signaling. These
results suggest that induction of hypersignaling in the PI3K/AKT pathway is a potential
approach to kill BCR-ABL1 positive leukemia cells.

62

Figure 3.2. Induction of hypersignaling in the PI3K/AKT pathway in BCR-ABL1
transformed cells.
A: BCR-ABL1 cells were transduced with either empty vector (MIG), myristoylated
P110α (P110α-Myr-MIG) or myristoylated AKT (AKT-Myr-MIG). The percentages of GFP
positive cells were measured by flow cytometry analysis. Normalized values are shown
on Y axis. B: The representative flow cytometry plots for GFP measurements on days 1,
4 and 8 after transduction. C: Western blot analysis for the global AKT and phospho-
Ser473 AKT on days 1 and 2 after transduction. β -ACTIN was used as loading control.

3.3.2 Ph
+
ALL cells show higher expression levels of inhibitory
receptors and inhibitory phosphatases
To analyze the expression levels of inhibitory phosphatases and receptors we did a
meta-analysis on a panel of microarray expression data from Pre-B cells (n=14), Ph
+
ALL
(n=15) and B cell Non-Hodgkin-Lymphoma (n=15) (GEO# GSE12453). Among the
genes that showed selective higher expression levels in Ph
+
ALL, there were many of
the immunoreceptor tyrosine-based inhibitory motif (ITIM) carrying molecules such as
63

LAIR1, PECAM1, CEACAM6, CD22, CD200 and FCRL2 (Figure 3.3). In addition,
inhibitory phosphatases such as PTEN, INPP5D and PTPN6 showed a similar pattern in
this analysis (Figure 3.3).This suggested that the activities of these inhibitory receptors
and phosphatases are positively correlated with BCR-ABL1 kinase transformed B cells.

Figure 3.3. Expression levels of different negative regulatory genes in progenitor B cells,
kinase dependent and kinase independent transformed B cells.
Analysis of microarray gene expression data for human pre-B cell precursors (n= 14),
Ph+ ALL (n=15) and B cell lymphoma (n=16) samples. Raw data for Ph+ ALL and
precursor B cells were obtained from http://www.stjuderesearch.org/data/ALL3l (Ross et
al. 2003. Blood. doi:10.1182/blood-2003-01-0338 and http://130.161.42.18/; van Zelm et
al. 2005. J. Immunol.175:5912–5922.). Raw data for the lymphoma samples are from
Gene Expression Omnibus (GEO) database: GSE12453.

We evaluated the array‟s results for the six inhibitory receptors (Figure 3.3, blue letters)
by flow cytometry measurements in a panel of human bone marrow (n=2), patient-
derived Ph
+
ALL (n=4) and B-NHL (n=3) samples (Figure 3.4). The flow cytometry
measurements were largely consistent with the array data as the tested ITIM carrying
receptors showed higher expression in Ph
+
ALL in comparison with Pre-B cells and B
cell Lymphoma.
64

Figure 3.4. Analysis of differential expression of inhibitory receptors.
Flow cytometry data were generated by double staining with antibodies against each
ITIM carrying receptor and CD19 antibody. List of the antibodies is available in table S6.
All plots are gated on viable cells (propidium iodide negative).

We furthermore evaluated the array‟s results by measuring the protein expression levels
of PTEN, PTPN6 and INPP5D in a panel of MACS (magnetic-activated cell sorting)
sorted human CD19
+
cells, patient derived Ph
+
ALL and B cell Non-Hodgkin-Lymphoma.
The Western blot measurements showed that these inhibitory phosphatases are highly
expressed in Ph
+
ALL. In addition, their expressions in Ph
+
ALL are higher than
lymphoma cells (Figure 3.5). Using an antibody against the active form of INPP5D (p-
Y10120) we found that although the expression levels of INPP5D in CD19 cells are
comparable to Ph
+
ALL, this phosphatase is less active in CD19 B cells. So in
conclusion, we showed that inhibitory receptors are more highly expressed and active in
65

B cell lineage kinase driven Ph+ leukemia cells in comparison with B cell lymphoma and
progenitor B cells.

Figure 3.5. Western blots for the inhibitory phosphatasesINPP5D and PTPN6.
CD19+ cells were from three normal human peripheral blood samples which had been
sorted using MACS anti human CD19 beads. From left, the patient derived Ph+ ALL
samples are BLQ4, BLQ6, BLQ11, ICN1, LAX2, SF02, TXL2, TXL3 and B cell NHL cell
lines are BC-1, BCP-1, DB and JSC-1. List of antibodies is available in table S5.

3.3.3 Genetic models for deletion of inhibitory phosphatases in Ph
+

ALL and CML cells
To investigate the effects of the inhibitory phosphatases deletion in genetic models we
obtained bone marrow cells from mice with Pten
fl/fl
, Pten
fl/+
, Inpp5d
fl/fl
and Ptpn6
fl/+
from
collaborator labs (Table S4). For generation of B cell lineage ALL, bone marrow cells
were transformed with retroviral BCR-ABL1 in the presence of IL7. LSK cells were
selected by treatment of the bone marrow cells with IL3, IL6 and SCF. BCR-ABL1
transformation of LSK cells resulted in generation of a CML like model. For inducible
deletion of the phosphatases, each cell type were transduced with ER
T2
(empty vector)
or Cre-ER
T2
vectors. Addition of 0.5 µM 4-OHT in the medium resulted in transport of
66

Cre-ER
T2
into the nucleus and induction of deletion. The confirmation of deletions in
BCR-ABL1 ALL cells on both DNA and protein levels are shown in Figure 3.6.A and B.

Figure 3.6. Confirmation of genetic deletions of inhibitory phosphatases in B cell lineage
Ph
+
like ALL.
A: PCR results for confirmation of deletions on genomic level. The primer list is available
in table S7. B: Western blots for confirmation of deletion on protein level. Deletion of
Inpp5d results in a shorter isoform (INPP5DΔ70). In the Ptpn6 model, the bone marrow
was obtained from mice with one Ptpn6flox and one wildtype allele, therefore after
deletion of the floxed allele, the expression of the wildtype allele is still present.

3.3.4 Deletions of inhibitory phosphatases cause drastic cell death
only in B cell lineage BCR-ABL1 ALL cells
Based on the hypersignaling model, we hypothesized that the toxic effects after deletion
of the inhibitory phosphatases should be observed in both ALL- and CML-like BCR-
ABL1 cells and not in the progenitor cells. To test our hypothesis for each of the three
phosphatases under the study, we transduced pre-B and LSK cells (Lin
−
, Sca-1
+
, c-Kit
+
)
and their BCR-ABL1 transformed versions (ALL- and CML- like cells respectively) with
ER
T2
or Cre-ER
T2
vectors with a puromycin resistance gene. The pre-B cells and LSK
cells are cytokine dependent (IL7 for pre-B and IL3, IL6 and SCF for LSK cells) while
ALL and CML are cytokine independent. We monitored the viabilities of these four cell
67

types after induced deletion of each phosphatase. We measured the viabilities by flow
cytometry analysis of Propidium Iodide negative cells in triplicate (Figure 3.7). As we
expected, there was not any significant cell death in normal progenitor cells upon
deletion of any of the three inhibitory phosphatases studied. Pten deletion in Pre-B cells
showed the highest toxicity among the normal cells but after one week of deletion more
than half of the cells were still viable (Figure 3.7). Interestingly, consistent with the
hypersignaling model, deletion of each of the three inhibitory phosphatases under the
study caused dramatic cell death in B cell lineage BCR-ABL1 cells (Figure 3.7). The
drastic cell deaths started on day two after induction of phosphatase deletions.
Representative flow cytometry plots for B cell lineage ALL cells on day 5 after deletion
are shown in figure 3.8A.

Figure 3.7. Toxic effects of the inhibitory phosphatase deletion are lineage restricted.
Viabilities of the cells were measured in triplicate using flow cytometry analysis by
propidium iodide (PI) staining. Normalized values of cell viabilities are depicted on the y-
axis. Progenitor normal cells were not sensitive to phosphates deletions. Among the
68

BCR-ABL1 positive cells, only B cell lineage cells (ALL like) were sensitive and the
myeloid lineage cells (CML like) showed no response to phosphatase deletion.

Surprisingly, we found that in contrast to the B cell lineage BCR-ABL1 cells (Ph
+
like
ALL), myeloid lineage BCR-ABL1 cells (CML-like model) were not responsive to deletion
of either of the three phosphatases (Figure 3.7). Initially, this observation seemed to be
in contrary with the hypersignaling model. We therefore measured the activity of BCR-
ABL1 (a tyrosine kinase) among these four cell types by Western blot analysis of global
phospho-tyrosine level (using the 4G10 antibody) (Figure 3.8B). Interestingly, we
observed that there was a huge difference between the phospho-tyrosine activity of
BCR-ABL1 in B lineage and myeloid lineage BCR-ABL1 cells. This observation might
explain the different outcomes after deletion of phosphatases in our ALL- and CML- like
models, and is consistent with our hypersignaling model. In the ALL cells, because of
high levels of BCR-ABL1 signaling, deletion of either inhibitory phosphatase causes a
drastic imbalance in signaling. But in the CML model, the basal level of BCR-ABL1
activity is significantly lower than in the ALL cells, therefore the perturbations in their
signaling are not as harmful as in ALL.
69

Figure 3.8. Mechanisms for different responses to phosphatase deletion in different
hematopoietic cell types.
A: Flow cytometry plots for PI staining of ALL like cells after 5 days of phosphatase
deletions. The percentages of PI negative cells (viable cells) are shown on the plots. B:
Western blot analysis against phospho-tyrosine shows significantly higher level of
phospho-tyrosine in B cell lineage BCR-ABL1 cells than in the myeloid lineage cells and
progenitor cells. BCR-ABL1 position is shown by the red bar. The region of blot covering
BCR-ABL1 region with longer exposure time is shown on the bottom of panel B and
marked with asterix. C: Inhibitory phosphatases have different expression profiles in
different hematopoietic cell lineage.

In addition to the different level of tyrosine kinase activity, we hypothesized that
differential expression of phosphatases could explain the different outcome of their
deletion as well. Analyzing the basal protein level of these three phosphatases in the
progenitor and the BCR-ABL1 transformed cells showed that the myeloid lineage BCR-
ABL1 cells downregulate the expression of PTEN. We also observed that two different
isoforms of Ptpn6 were expressed in B versus myeloid lineage cells, and furthermore,
the level of expression of PTPN6 in CML like cells was much lower than in ALL cells.
70

Finally, as it has also been shown before (Sattler al, 2009), INPP5D is downregulated in
BCR-ABL1 ALL cells. Based on these finding we chose to focus on B cell lineage BCR-
ABL1 ALL cells for future experiments.

3.3.5 Deletions of inhibitory phosphatases decrease the self-renewal
ability and induce cellular senescence in B cell lineage BCR-ABL1
+

ALL cells
To analyze the self-renewal ability of BCR-ABL1 ALL cells we performed a colony
forming assay and seeded out 10,000 ALL cells with and without deletion of Pten,
Inpp5d and Ptpn6 in semi-solid methylcellulose medium. Deletion of either three
inhibitory phosphatases in this study caused dramatic decrease in number of colonies
formed in the methylcellulose culture assay (Figure 3.9A).
In addition, we observed that the deletion of these three phosphatases also induced
cellular senescence in ALL cells (Figure 3.9B). We measured senescence-associated β-
galactosidase (SA-βgal) activity at pH 5.5 to determine the level of cellular senescence.
Treatment of fixed cells with X-gal yields an insoluble blue compound when cleaved by
β-galactosidase. Because of the pH =5.5, the SA-βgal can be distinguished from the
lysosomal β-galactosidase activity which acts at pH = 4 (Dimiri et al., 1995). The highest
fraction of cellular senescence in Ph
+
like ALL cells was observed after deletion of Pten
in which the percentage of cells undergoing senescence raised from 2.5% to 37%. The
increase in cellular senescence after deletion of Inpp5d and Ptpn6 was not as strong as
Pten deletion but both were still significant (Figure 3.9B).
71

Figure 3.9. Deletions of inhibitory phosphatases in BCR-ABL1 ALL cells result in loss of
self-renewal ability and increase in cellular senescence.
A: Microscopy images of colonies after 10 days of culturing ALL cells in semi-solid
methylcellulose culture. Numbers of colonies per dishes are shown on the images. P
values were calculated by Student's t-Test for each experiment. B: Blue dots in SA-βgal
assay (PH= 5.5) are hallmarks of senescence. Percentages of SA-βgal positive cells
(blue stains) are shown on the images. P values were calculated by Student's t-Test for
each experiment.

3.3.6 Deletions of inhibitory phosphatases induce cell cycle arrest in
B cell lineage BCR-ABL1
+
ALL cells
To investigate the effects of inhibitory phosphatases deletions on the cell cycle we
measured the fractions of cell presented in each stage of cell cycle in a BrdU
incorporation assay. Thirty minutes treatment with 10 µM BrdU resulted in its
incorporation into the DNA structure during the S phase. Flow cytometry analysis for
BrdU incorporation in wildtype and phosphatase null ALL cells showed that the deletion
of inhibitory phosphatases caused cell cycle arrest and there were less cells presented
in S phase (Figure 3.10). While in SA-βgal assay, Pten deletion showed the most
dramatic outcomes, in the cell cycle assay, deletion of Ptpn6 resulted in the most
72

significant different outcome (56% vs. 35% in S phase). These results suggest the
presence of different mechanisms for the unfavorable outcomes after deletion of the
inhibitory phosphatases in Ph
+
like ALL cells.

Figure 3.10. Deletion of the inhibitory phosphatases in BCR-ABL1 ALL cells results in
cell cycle perturbation.
ALL cells transduced with ER
T2
or Cre-ER
T2
were treated with 4-OT for 48 hours. Next,
10 µM BrdU were added to their medium for 30 minutes. After fixation and
permeabilization, the cells were treated with DNAase and the incorporations of BrdU
were measured using anti-BrdU antibody. The total amount of DNA was determined by
7AAD staining. P values are calculated for the percentages of cells present in S phase
using Student‟s t-Test.

3.3.7 Deletions of inhibitory phosphatases increase the signaling level
within the B cell lineage BCR-ABL1 ALL cells
To analyze the changes in signaling pathway activation after deletions of the inhibitory
phosphatases, we studied three major signaling pathways in BCR-ABL1 ALL cells,
JAK/STAT5, PI3K/AKT and MAPK. We measured the phosphorylation levels of STAT5,
AKT and ERK1/2 by time course Western blots after 12, 24 and 48 hours of
phosphatase deletion. As we expected, deletion of each of the three inhibitory
phosphatases in this study increased the amplitudes of different signaling pathways
73

(Figure 3.11). Consistent with the role of PTEN in suppressing the PI3K/AKT pathway,
Pten deletion increased the activity of this pathway as demonstrated by increased AKT
phosphorylation (Figure 3.11, left). Deletion of Inpp5d not only increased the activity of
PI3K/AKT but also of the JAK/STAT5 pathway (Figure 3.11, middle). Finally, Ptpn6
deletion increased both the MAPK and JAK/STAT5 pathways activities (Figure 3.11,
right).

Figure 3.11. Deletion of inhibitory phosphatases induced hypersignaling in BCR-ABL1
ALL cells.
From three major signaling pathways in BCR-ABL1 transformed cells, JAK/STAT,
PI3K/AKT and MAPK, we studied the activities of three representative molecules,
STAT5, AKT and ERK1/2 respectively. The phosphorylation sites for STAT5, AKT and
ERK1/2 are Tyrosine 694, Serine 473 and Threonine202/Thyrosine204 respectively. The
list of primary antibodies is available in table S5.

A surprising outcome of this experiment was that Pten deletion decreased the STAT5
phosphorylation (Figure 3.11, left). This was similar to what we had observed in
presence of the MAPK pathway hyperactivity in chapter two (section 2.3.11). This
suggested that similar to the crosstalk between JAK/STAT5 and RAS/MAPK pathways,
there could be also a crosstalk between JAK/STAT5 and PI3K/AKT pathways. To test
this hypothesis we studied the level of STAT5 phosphorylation in the presence of AKT
hyperactivation using AKT-Myr and P110α-Myr retroviral viruses (Figure 3.12A).
74

Interestingly, we found that similar to Pten deletion, direct activation of PI3K/AKT
pathway could decrease the activity of the JAK/STAT pathway by dephosphorylating
STAT5 (Figure 3.12A-B). In chapter two we suggested PTPN6 as the connecting
phosphatase between the JAK/STAT and RAS/MAPK pathways (section 2.3.14).
Therefore, we looked for the activity of PTPN6 after activation of the PI3K pathway.
Surprisingly, both direct activation of PI3K/AKT pathway using active forms of AKT and
PI3K and indirect activation of AKT by Pten deletion increased the activity of PTPN6
(Figure 3.12C and D).

Figure 3.12. Activation of the PI3K/AKT pathway suppressed the JAK/STAT5 pathway
activity.
A: Transduction of BCR-ABL1 ALL cells with myristoylated forms of AKT or P110α
resulted in dephosphorylation of STAT5, the main efector of JAK/STAT pathway in BCR-
ABL1 cells. B: Pten deletion decreases the STAT5 phosphorylation (48 hours). C-D:
Activation of PI3K/AKT pathway resulted in PTPN6 activation by increase in
phosphorylation of PTPN6 on Tyrosine 564.

Subsequently, we hypothesized that similar to hyperactivation of the MAPK pathway; the
dephosphorylation of STAT5 should be responsible for Ph
+
ALL cell death upon
hyperactivation of PI3K. To test this hypothesis we tried to rescue the cells from cell
75

death by a constitutively active form of STAT5 (STAT5
CA
) (Nosaka et al., 1999). We
transduced the Pten wildtype and null BCR-ABL1 ALL cells with GFP or STAT5
CA
-GFP
retroviral vectors (Figure 3.13A). As we observed in previous experiment (section 2.3.13)
the STAT5
CA
overexpression was unfavorable in the BCR-ABL1 cells which can be
considered as another example of hypersignaling. But importantly, Pten null cells
tolerated the STAT5
CA
activity better than wildtype cells and while the ratio of GFP
positive cells between Pten null and wildtype cells remained constant in the control
group, it increased with the time in the presence of the STAT5
CA
. This results support
our previous finding that Pten deletion can suppress the activation of STAT5.

Figure 3.13.Hyperactivity of STAT5 is less toxic in the Pten null BCR-ABL1 ALL cells.
A: The Pten
fl/fl
ALL with or without Cre where transduced with GFP or STAT5
CA
-GFP
vectors. The bars show the normalized ratio between the percentages of GFP

positive
cells between Pten deleted and wildtype cells. STAT5 hyperactivity can be tolerated
better in Pten deleted cells than wildtype cells. B: The representative flow cytometry
plots for STAT5-GFP transduced cells.

76

3.3.8 Deletions of inhibitory phosphatases increase the level of
reactive oxygen species (ROS) and result in accumulation of DNA
damage check point proteins
As discussed in chapter two (section 2.3.7), a possible side effect of hypersignaling is
the increase in level of Reactive Oxygen Species (ROS). We measured the cellular level
of ROS after deletion of either of the three inhibitory phosphatases by flow cytometry
analysis after CM-H2DCFDA staining, an indicator of ROS. Interestingly, deletion of
each of the three inhibitory phosphatases increased the level of ROS (Figure 3.14A) and
subsequently resulted in accumulation of DNA damage check point molecules (Figure
3.14B). Pten deletion resulted in the accumulation of P53 and P21 molecules while
Inpp5d deletion increased the levels of P53 and P27 and finally Ptpn6 deletion caused
elevation in levels of P53, ARF and P21. Taken together, these results suggest ROS
generation and DNA damage as major mechanisms of cell toxicity upon deletion of
inhibitory phosphatases. Using an antibody against the oxidized form of tyrosine
phosphatases active sites (inactive form), we showed that after Pten and Ptpn6
deletions, the initial increase in ROS level could lead to deactivation of other
phosphatases which potentially could act as a vicious cycle that results in further
increased signaling within the cells (Figure 3.14C). For the Inpp5d deletion, despite
increased ROS level we did not observe any significant increase in the global
phosphatase oxidation and the reason for this observation in unknown for us.

77

Figure 3.14. Negative outcomes upon deletion of inhibitory phosphatases may depend
on ROS generation and accumulation of DNA damage molecules.
A: Pten- , Inpp5d- and Ptpn6-deficient and wildtype BCR-ABL1 leukemia cells were
stained with CM-H2DCFDA which labels cells based on intracellular levels of ROS.
Mean fluorescence intensities (MFI) for DCF [ROS] are shown on the plots. B: Western
blots for DNA damage response molecules ARF, P53, P21 and P27 after 48 hours of
deletion of inhibitory phosphatases. C: Western blots for oxidized form of tyrosine-
phosphatases active sites after deletions of the inhibitory phophatases. β-ACTIN was
used as loading control. The antibody list is presented in table S5.

3.3.9 Phosphatase null BCR-ABL1 ALL cells are less capable of
initiating full blown leukemia in vivo upon transplantation
We investigated the ability of the phosphatase null BCR-ABL1 ALL cells to initiate full
blown leukemia by in vivo experiments. We injected one million Pten- , Inpp5d- or Ptpn6
deleted BCR-ABL1 ALL cells and respective control cells into sublethally irradiated
NOD/SCID mice (n=7). The cells were labeled with luciferase and the leukemia
progressions were followed by bioluminescence imaging (Figure 3.15A). Consistent with
78

the in vitro results, in all three cases, the phosphatase null ALLs showed weaker
leukemia initiation and progression and the recipient mice survived longer (Figure
3.15B).

Figure 3.15. The inhibitory phosphatase deficient BCR-ABL1 ALL cells are less potent in
vivo than the wildtype leukemia.
A: One million luciferase labeled BCR-ABL1 transformed ALL cells with or without
phosphatase deletion were injected into sublethally irradiated NOD/SCID recipient mice
(n=7). Leukemia-initiation in NOD/SCID recipients was monitored by luciferase based
bioluminescence imaging. B: Kaplan-Meier curves show significant increase in survival
of mice recipient of phosphatase null ALL cells

79

3.3.10 Deletion of either of the inhibitory phosphatases lead to similar
global gene expression changes as compared to wildtype cells
To further elucidate the mechanisms involved in the negative outcomes after deletion of
the inhibitory phosphatases, we analyzed the changes in gene expression by Mouse
Gene 1.0 ST array (Affymetrix, High Wycombe, UK). For each phosphatase deletion, the
RNA extraction was done 48 hours after induction of deletion in BCR-ABL1 cells. Next
we calculated the perturbation scores (section 3.2.10). Ranked & normalized expression
matrix based on perturbation scores is shown by the heatmap (Figure 3.16A). The
consistent up- and down- regulated genes at the top and bottom of the list is apparent.
Correlation values among phosphatase deletions was calculated (Figure 3.16B, C), and
an unrelated expression array analysis of the overexpression study of activation-induced
deaminase (AID) enzyme in ALL cells was used as a negative control. Spearman
correlation coefficients higher than 0.1 were observed solely among the phosphates
deletion experiments and not the unrelated control (Figure 3.16C). The similarity among
the phosphatase deletion signatures was higher than significant threshold (P<0.01),
suggesting the presence of common gene-expression change signature.

80

Figure 3.16. Alterations in gene expression profiles after deletion of each inhibitory
phosphatase.
A: Gene expression analysis was performed using Mouse Gene 1.0 ST arrays.
Perturbation scores were calculated as mentioned in section 3.2.10. Heatmap for
perturbation scores are shown for all three phosphatases. B-C: Pair wise spearman
correlation coefficients were calculated using the three phosphatases studied plus an
additional unrelated analysis (AID overexpression in ALL) as a negative control for the
correlation value.
3.3.11 Deletions of inhibitory phosphatases increase the sensitivity of
BCR-ABL1 ALL cells to tyrosine kinase inhibitors
Tyrosine kinase inhibitors (TKIs) such as Imatinib are the main therapeutics for Ph
+

leukemia. Therefore, we studied the effect of inhibitory phosphatases deletion on
sensitivity of the BCR-ABL1 cells to TKI treatment. We treated Pten-, Inpp5d- and Ptpn6-
null ALL cells and their respective wildtype cells with different concentrations of Imatinib
for three days and determined the viability using the Resazurin assay (section 3.2.12)
(Figure 3.17A). We found that deletion of either of the three inhibitory phosphatases
81

resulted in increased sensitivity of the BCR-ABL1 cells to Imatinib treatment. To
elucidate the mechanisms of this behavior, we analyzed the BCL6 expression.
Previously we have shown that BCL6 is an anti-apoptotic transcription factor in Ph
+
ALL
cells. TKI treatment of BCR-ABL1 ALL cells results in upregulation of BCL6 as a defense
mechanism against cell death (Duy et el., 2011). We have previously shown that PTEN
is required for expression of BCL6 and PTEN-null cells are incapable of over-expressing
BCL6 in the presence of Imatinib (Duy et el., 2011) (Figure 3.17B, left). Interestingly, we
observed similar behavior in Ptpn6 null ALL cells (Figure 3.17B, right). However this was
not true for Inpp5d null cells. These data suggest that the increased sensitivity to TKI
treatment in the cases of Ptpn6 and Pten deletions could be dependent on BCL6
expression while in the case of Inpp5d deletion, other mechanisms seems to be
involved.

Figure 3.17. Phosphatase null BCR-ABL1 cells are more sensitive to tyrosine kinase
inhibition.
A: By a series of cell viability assays we found that deletions of inhibitory phosphatases
increased the sensitivity of ALL cells to the TKI treatment. Deletion of the three
phosphatases under the study had been induced by 24 hours 4-OHT treatment. Next,
cells were treated with different concentrations of Imatinib for three days. Viabilities of
ALL cells were measured in triplicate. Normalized viability values are shown on the y
axis. B: Western blots for the BCL6 show that PTEN and PTPN6 are required for the
upregulation of BCL6 after TKI treatment.
82

3.3.12 Side effects of Pten deletion in BCR-ABL1 cells are dosage
dependent
To investigate the dosage dependency of the negative outcomes after Pten deletion in
ALL cells, we studied the Pten
fl/+
BCR-ABL1 cells. Interestingly, as we observed in Ptpn6
deletion, single-allele deletion of Pten resulted in negative outcomes comparable to
double-allele deletion of Pten both in vivo and in vitro (Figure 3.18).

Figure 3.18. Negative effects of Pten deletion in BCR-ABL1 ALL cells is dosage
dependent.
A: SA-βgal assay for measuring the cellular senescence levels in BCR-ABL1
transformed ALL cells. The percentages of cells with blue dots are shown on the figures.
B: microscopy images of the leukemia colonies after 10 days of culturing ALL cells in
semi-solid methylcellulose culture. C: One million luciferase labeled BCR-ABL1
transformed ALL cells after deletion of one or both alleles of Pten were injected into
sublethally irridiated NOD/SCID recipient mice (n=7). Leukemia-initiation in recipients
was monitored by bioluminescence imaging. D: Kaplan-Meier curve shows significant
increase in survival of mice recipient of ALL with single or double Pten deletions.

83

Deletion of one allele of Pten induced drastic cellular senescence, although with lower
magnitude than the deletion of both alleles (2.5%, 20% and 38% for wildtype, single-
allele deleted and double-allele deleted, respectively) (Figure 3.18A). The self-renewal
ability and colony forming potential of the ALL cells also dropped by deletion of only one
allele of Pten (from 292 to 27 colonies) (Figure 3.18B). In addition, in vivo
transplantation of Pten
+/-
, Pten
-/-
and wildtype cells into NOD/SCID recipient mice showed
significant prolonged survival of the mice transplanted with both single- and double-allele
Pten deleted BCR-ABL1 leukemia cells (Figure 3.18C-D).
3.3.13 Small molecule inhibition of PTEN is a potential therapeutic
approach for Ph
+
ALL
To elucidate the therapeutic application of our genetic findings, we studied the effects of
small molecule inhibitors for the phosphatases under the study. Based on our genetic
findings, we hypothesized that chemical inhibition of inhibitory phosphatases should be
toxic in Ph
+
ALL cells. VO-OHpic, a vanadyl compound in complex with hydroxypicolinic
acid, is a well characterized and relatively specific inhibitor of PTEN (Rosivatz et al.,
2006) (Figure 3.19A). We tested the effect of VO-OHpic on three different patient
derived Ph
+
ALL cells that all carried T315I mutation and therefore were resistant to TKI
treatment (Figure 3.19B). Measuring the viabilities of these cells by Flow cytometry
analysis for PI negative cells showed that while expectedly the cells were not responsive
to Imatinib, they were sensitive to VO-OHpic treatment and after three days of VO-OHpic
treatment their viability dropped significantly.

84

Figure 3.19. Small molecule inhibitor of PTEN is beneficial in treatment of Ph
+
Leukemia.
A: Structure of VO-OHpic, PTEN inhibitor. B: Three Patient derived Ph
+
ALL xenografts,
all with T315I mutation, were treated with different concentrations of Imatinib, VO-OHpic
or vehicle for three days. Viabilities of cells were measured using PI staining. Values on
the plots represent the percentage of live, PI negative cells.

One of the outcomes of genetic deletion of Pten was the increased sensitivity of BCR-
ABL1 ALL cells into to the TKI treatment (Section 3.3.11). To investigate this effect by
chemical inhibition of PTEN, we tested combinational treatment of BCR-ABL1 cells with
TKI and PTEN inhibitor (Figure 3.20A and B). Cell viability assays showed that while
VO-OHpic alone was not toxic for the murine BCR-ABL1 cells even at 30 µM, the
presence of a relatively low concentration of Imatinib (0.5 µM) sensitized the cells to VO-
OHpic significantly (Figure 3.20A). In addition, VO-OHpic increased the sensitivity of
85

BCR-ABL1 ALL cells to Imatinib (Figure 3.20B). These results demonstrated that the
small molecule inhibitor of PTEN VO-OHpic increased the sensitivity of mouse BCR-
ABL1 ALL cells to TKI treatment.

Figure 3.20. Chemical inhibition of PTEN sensitizes the BCR-ABL1 ALL cells to the TKI
treatment.
A: While VO-OHpic is not toxic for mouse ALL cells even at 30 µM, the presence of 0.5
µM of TKI increases the sensitivity of the cells to VO-OHpic. B: VO-OHpic treatment
makes the BCR-ABL1 cells more sensitive to TKI treatment. Viabilities of cells were
measured in triplicate after three days of treatment. Normalized values are shown on the
y axis.

3.3.14 Small molecule inhibitor of INPP5D shows therapeutic benefit
in Ph
+
ALL treatment
3α-aminocholestane (3AC) has been described as the specific inhibitor of INPP5D
(Brooks et al., 2010) (Figure 3.21A). Analysis of the cellular ROS levels after 3AC
treatment showed that consistent with the hypersignaling model, the chemical inhibition
of INPP5D in BCR-ABL1 ALL cells acutely increased the ROS levels (Figure 3.21B). In
addition, investigating the effects of INPP5D inhibition by 3AC treatment on patient
derived Ph
+
ALL xenografts and B cell Non-Hodgkin-Lymphoma showed that Ph
+
ALL
cells are dramatically more sensitive than B-NHL cells (Figure 3.21C). These results are
86

consistent with the higher expression of INPP5D in ALL than lymphoma (Figure 3.5).
Cell viability measurements also showed that 3AC is a more potent agent for killing the
Ph
+
ALL than Imatinib. The outcomes were more drastic for human xenografts with
T315I mutations since they were not responsive to TKI at all (Figure 3.21D).
To study global alterations in different signaling pathways within the cells upon 3AC
treatment we used a phospho-array kit (R& D Systems). We analyzed the phospho-
profile of patient-derived Ph
+
ALL BLQ5 cells after 24 hours treatment with 25 µM 3AC
(Figure 3.21E). Interestingly, the MAPK, JAK/STAT and PI3K/AKT, three important
signaling pathways in BCR-ABL1 cells showed increased activity upon 3AC treatment.
Their increased activities were demonstrated by elevated phosphorylation levels of
P38α, JNK, ERK1/2, STAT3/5 and AKT. Surprisingly, while 3AC treatment resulted in
increased phosphorylation of AKT on threonine 308, it resulted in decreased AKT serine
473 phosphorylation. Although it has been known that threonine 308 phosphorylation is
necessary and sufficient for AKT activation (Stokoe et al., 1997), we do not know the
mechanism and outcome of serine 473 dephosphorylation by 3AC.

87

Figure 3.21. Small molecule inhibitor of INPP5D is toxic for Ph
+
ALL cells.
A: The structure of INPP5D inhibitor, 3α-aminocholestane (3AC). B: ROS levels after
treatment of BCR-ABL1 cells with 3AC are measured using DCF staining. Mean
fluorescence intensities (MFI) for DCF [ROS] are depicted. C: Five patient derived Ph+
ALL xenografts and four B cell Non-Hodgkin-Lymphoma cell lines were treated for three
days with different concentrations of 3AC. The normalized valued for viabilities are
shown on y axis. D: Six patient derived Ph+ ALL xenografts, including three samples
with BCR-ABL1T315I mutations (BLQ11, LAX2 and TXL3) were treated with tyrosine
kinase inhibitor (Imatinib; green) or INPP5D inhibitor (3AC, red) at various
concentrations in triplicates for three days. Viability was measured using CCK-8 solution.
The normalized valued for viabilities are shown on y axis. E: BLQ5 patient derived Ph+
ALL cells were treated with 25 µM 3AC for 24 hours. Alterations in the phospho-profile
had studied using a phospho-array kit (R& D Systems). The results of the phospho-array
kit are shown by the heatmap.

To test the ability of 3AC to prevent leukemia initiation and engraftment in vivo, we
treated a patient derived Ph
+
ALL xenograft (BLQ5, T315I mutated) with 3AC or vehicle
for 24 hours in vitro. Next, we injected the cells into the sublethally irridiated recipient
NOD/SCID mice (n=7). The BLQ5 cells were labeled with Luciferase and leukemia
engraftment was followed by bioluminescence imaging (Figure 3.22A). 3AC treatment
88

caused a noticeable delay in leukemia initiation and significantly increased the survival
of recipient mice (P = 0.0002) (Figure 3.22B). These data suggest that INPP5D inhibitors
such as 3AC can be considered as therapeutic means in Ph
+
ALL treatment.

Figure 3.22. Ex vivo treatment of Ph
+
ALL with 3AC decreases the leukemiagenesis.
A: Luciferase labeled patient derived BCR-ABL1 leukemia cells (BLQ5) were treated for
24 hours with vehicle (DMSO) or 10μM 3AC and injected into NOD/SCID recipient mice
(n=7). Leukemia progression in NOD/SCID recipients was monitored by luciferase
bioluminescence imaging. B: Kaplan-Meier curves show significant increase in survival
of mice transplanted with 3AC treated ALL cells.

89

3.4. Conclusion
In chapter two, we inhibited the negative regulators of the MAPK pathway to induce
hypersignaling within the B cell lineage BCR-ABL1 ALL cells. MAPK pathway is only one
of the active signaling pathways involved in survival and proliferation of BCR-ABL1 cells.
Other pathways such as JAK/STAT and PI3K/AKT are also active in Ph
+
ALL and
contribute to the transforming ability of the BCR-ABL1 oncoprotein. Regulations of these
pathways are also necessary for the proper function of the cells. These signaling
pathways are normally activated by various extracellular signals but on the other hand,
there are also inhibitory molecules to suppress the activity of these stimulatory signals.
In this chapter, among these inhibitory molecules, we focused on three inhibitory
phosphatases PTEN, INPP5D and PTPN6. They are all suppressor of the PI3K/AKT
pathway. In addition INPP5D and PTPN6 are ITIM binding molecules and can suppress
other signaling pathways such as JAK/STAT and Src kinases.
At first, using overexpression of active forms of AKT and PI3K, we showed that
hyperactivity in the PI3K/AKT pathway is unfavorable for the BCR-ABL1 leukemia cells
(section 3.3.1). Therefore we hypothesized that inhibition of the inhibitory phosphatases
such as PTEN, INPP5D and PTPN6 might result in similar unfavorable outcomes in Ph
+

like ALL.
Our in vitro and in vivo studies on the B lineage BCR-ABL1 leukemia showed that while
deletions of each of these three inhibitory phosphatases increased the signaling activity
in their respective pathways (section 3.3.7), it also caused a variety of negative
outcomes in the B-ALL cells. These negative outcomes were cell death, increased
cellular senescence, cell cycle arrest, less self-renewal ability and increased sensitivity
to tyrosine kinase inhibitors. The amplitudes and extends of these behaviors were
different upon deletion of different phosphatases. For instance while PTEN deleted cells
90

showed the highest amount of cellular senescence, the PTPN6 null cells showed most
drastic cell cycle arrest ( sections 3.3.5 and 3.3.6). Considering the fact that the
inhibitory phosphatases under this study were involved in different signaling pathways,
these differences are not unexpected.
We also showed that similar to hypersignaling in the MAPK pathway, increase in ROS
generation and accumulation of DNA damage check point molecules are one of the
negative outcomes upon deletion of inhibitory phosphatases that can explain the
mechanism of cell death.
Interestingly, in hyperactivity of the PI3K/AKT pathway after PTEN deletion or AKT
activation, we found a crosstalk between PI3K/AKT and JAK/STAT pathways, similar to
our finding on the MAPK and JAK/STAT pathways. As the result of this crosstalk, the
hyperactivity of PI3K/AKT pathway leads to dephosphorylation of STAT5. Similar to the
MAPK pathway crosstalk, we suggested PTPN6 as the candidate phosphatase that
mediates this crosstalk (section 3.3.7).
Deletions of the three inhibitory phosphatases studied in this chapter showed no cell
toxicity in non-transformed progenitor cells which suggests the dependency of the
negative outcomes on the presence of hyperactive signaling (section 3.3.13).
Surprisingly, our myeloid lineage BCR-ABL1 model that resembled the human CML cells
showed no sensitivity to deletion of any of these inhibitory phosphatases. Comparing the
BCR-ABL1 activity among the transformed murine B cell and LSK cells we found that the
BCR-ABL1 activity in the LSK model was extremely low. Indeed, the tyrosine
phosphorylation profile in BCR-ABL1 positive LSK cells was similar to non-transformed
progenitor cells (Figure 3.8). This observation suggests that the signaling level must be
higher than a minimum threshold to let the hypersignaling to be harmful for the cells.
We also studied the potential therapeutic application of the inhibition of inhibitory
phosphatases using small molecule inhibitors. VO-OHpic and 3AC are small molecule
91

inhibitors of PTEN and INPP5D respectively. They were able to kill the human Ph
+

leukemia xenografts more effective than B cell lymphoma. We also found that 3AC
treatment caused extensive hypersignaling and elevation in ROS level.
Inhibition of inhibitory phosphatases in kinase driven cancers such as BCR-ABL1 ALL
cells is a novel approach for treatment of these cancer types. Although the negative
outcomes after deletion or inhibition of the phosphatases such as PTPN6 and INPP5D
have been described before (Rodríguez-Ubreva et al., 2010; Fuhler et al. 2012), it has
not been studied in the context of hypersignaling. To the best of my knowledge, our
study for the first time is suggesting that hypersignaling and ROS generation are the
main mechanisms of cellular toxicity upon deletion or inhibition of inhibitory
phosphatase.

92

Chapter 4
Conclusions
4.1. Discussion
Currently one of the main strategies for treatment of kinase driven cancers is to inhibit
their kinase activity below a vital level which is necessary for their survival (Weinstein
and Joe, 2006). Clinical applications of tyrosine kinase inhibitors (TKIs) such as Imatinib
against BCR-ABL1 leukemia (Hughes et al., 2003), Gefitinib against EGFR in non-small-
cell lung cancer (Shepherd et al., 2005) and Erlotinib against EGFR in pancreatic cancer
(Moore 2005) are all successful examples of this treatment strategy. The constitutive
activity of these kinases makes them essential for the survival of the transformed cells to
the extent that without the high level of kinase activity the cells cannot survive or
proliferate. This extreme dependence on oncogene activity in the cancer cells is called
“oncogene addiction” (Weinstein et al., 1997).
One of the main drawbacks of TKI treatment strategy is the development of drug-
resistant tumors. After initial TKI treatment, cancer patients can frequently present
relapse due to the acquisition of new genomic alterations such as mutations (Corbin et
al., 2003; Kobayashi et al., 2005) or amplifications (le Coutre et al., 2000) which make
them resistant to TKI treatment regimen. The T315I mutation in the BCR-ABL1 gene is
one of the best characterized mutations in this category which eliminates the sensitivity
of BCR-ABL1 positive cells to TKI. To overcome the problem of such TKI-resistant
tumors, new strategies are needed to fight the kinase-driven cancer cells independent of
kinase inhibition.
Hypersignaling in different signaling pathways has been described to lead to negative
outcomes, such as “oncogene induced senescence” (Courtois-Cox et al., 2006; Alimonti
93

et al., 2010). However, the clinical application of hypersignaling has not been extensively
studied. Acute inhibition of PTEN in prostate cancer is one of the few studies that
address clinical relevance (Chen et al., 2005 and Alimonti et al., 2010). In their studies,
the authors suggested that PTEN inhibition in prostate cancer cells could be beneficial
due to induction of a special type of senescence which they called “Pten-loss induced
cellular senescence” (PICS) (Alimonti et al., 2010). They showed that the mechanism of
“PICS” is different from “oncogene induced senescence”. Later the same research group
showed that PICS is due to disruption in interaction between nuclear PTEN and APC
complex (Song et al., 2011).
Induction of hypersignaling is possible either directly by increasing the signaling level or
indirectly by suppression of inhibitory mechanisms. Due to feasible therapeutic
applications, we chose the indirect approach and studied two groups of inhibitory
molecules in B cell lineage BCR-ABL1 leukemia cells; negative feedback regulators and
inhibitory phosphatases (Figure 4.1).
In chapter two we studied two negative feedback molecules, SPRY2 and DUSP6, both
regulating the MAPK pathway. In chapter three we focused on the PI3K/AKT pathway
and studied PTEN and two ITIM binding molecules, INPP5D and PTPN6. Genetic
studies by in vitro and in vivo experiments showed that the inhibition of these negative
regulatory molecules causes diverse negative outcomes in B cell lineage BCR-ABL1
leukemia cells. These negative outcomes included cell death, decreased self-renewal
ability, cellular senescence and cell cycle arrest. Therefore, we proposed the chemical
inhibition of these molecules as a therapeutic approach for treatment of BCR-ABL1
leukemia treatment. We tested three small molecule inhibitors against DUSP6, PTEN
and INPP5D (BCI, VO-OHpic and 3AC respectively). We confirmed our hypothesis by
showing that chemical inhibition of these negative regulatory molecules can recapitulate
94

the outcome of their genetic deletions; therefore suggesting that these inhibitors can be
clinically beneficial for Ph
+
ALL patients.

Figure 4.1. Illustration of the kinase signaling and its regulatory mechanisms in B lineage
BCR-ABL1 leukemia cells.
Deletion/inhibition of these inhibitory molecules results in variety of negative outcomes.

Based on our finding, we suggest the presence of a “comfort zone” for oncogenic
signaling within the cells (Figure 4.2). Comfort zone refers to a range of signaling
strength within the cells that within this signaling zone cells can survive and proliferate
properly. This proposed hypothetical range contains two limiting sides. One side of this
comfort zone is too low signal (signal starvation) while the opposite side is too high
signaling condition (hypersignaling). As long as the signaling level of the cells stays
within these two limits, the cells will survive and proliferate. But if the signaling level
passes beyond each one of those two thresholds, there would be a cellular homeostatic
imbalance and negative consequences.
The aim of TKI treatment approach is to push the kinase dependent cancer cells beyond
their lower limit of signaling. Although mechanisms such as oncogene addiction can
cause cell death on this side of the comfort zone, there is always chance of appearance
of resistant colonies. However, based on the comfort zone hypothesis, it would be
95

possible to push the TKI-resistant cells beyond their comfort zone by induction of
hypersignaling.
In the presence of hypersignaling, mechanisms such as ROS elevation, DNA damage
response and crosstalk between signaling pathways cause damage to the cells which
could be of significant therapeutic relevance. The width of this hypothetical zone is not
equal for different cells and varies from cell to cell. The borders and limits of this comfort
zone are determined by the basal level of signaling within the cells. An interesting
illustration of this difference was observed in our study of B lineage and myeloid lineage
BCR-ABL1 positive cells. Despite the presence of similar oncoprotein, they showed
different behavior in response to perturbations in their signaling levels, presumably
because of difference in the activity of the oncoprotein (section 3.3.13).
The main advantage of utilizing the comfort zone idea and application of the
hypersignaling approach (in addition to current conventional TKI treatment) is that it
would help to overcome the resistance problem observed in cases of relapse in kinase
driven cancers.

Figure 4.2. Illustration of the comfort zone.

There are very limited studies that employ hypersignaling as an approach to kill tumor
cells or that suggest utilizing this concept as a therapeutic approach for cancer.
96

Therapeutic inhibition of PTEN in prostate cancer is one of the rare studies on this
concept, and this study focused solely on PTEN-dependent behavior (Alimonti et al.,
2010). Our results on PTEN deletion in B cell lineage BCR-ABL1 leukemia cells support
their finding, but we furthermore extend this to a general concept by the use of two
alternative approaches for induction of therapeutic hypersignaling: Inhibition of negative
feedback regulators and inhibitory phosphatases. To the best of my knowledge, these
approaches are novel and not tested before, and our study suggests this to be a general
feature of kinase-driven cancers that might be amenable for therapeutic targeting.

In conclusion, we have demonstrated that the perturbation of signaling homeostasis via
induction of hypersignaling in B cell lineage BCR-ABL1 transformed leukemia is
extremely disadvantageous for cell survival. The inhibition of molecules regulating the
steady state signaling resulted in cell death, cellular senescence and cell cycle arrest.
We introduced three main mechanisms involved in these behaviors, increase in reactive
oxygen species, accumulation of DNA damage check point molecules and finally the
crosstalk between the signaling pathways. Although our focus in this thesis was on B
lineage BCR-ABL1 Leukemia, we hypothesize that our findings will be applicable to
other kinase dependent transformations.

97

Bibliography

[1] Alessi, D.R., James, S.R., Downes, C.P., Holmes, A.B., Gaffney, P.R., Reese,
C.B., and Cohen, P. (1997). Characterization of a 3-phosphoinositide-
dependent protein kinase which phosphorylates and activates protein kinase
Balpha. Curr. Biol. 7, 261–269.
[2] Alimonti, A., Nardella, C., Chen, Z., Clohessy, J.G., Carracedo, A., Trotman,
L.C., Cheng, K., Varmeh, S., Kozma, S.C., Thomas, G., et al. (2010). A novel
type of cellular senescence that can be enhanced in mouse models and
human tumor xenografts to suppress prostate tumorigenesis. J. Clin. Invest.
120, 681–693.
[3] Amit, I., Citri, A., Shay, T., Lu, Y., Katz, M., Zhang, F., Tarcic, G., Siwak, D.,
Lahad, J., Jacob-Hirsch, J., et al. (2007). A module of negative feedback
regulators defines growth factor signaling. Nat. Genet. 39, 503–512.
[4] Armstrong, S.A., Mabon, M.E., Silverman, L.B., Li, A., Gribben, J.G., Fox,
E.A., Sallan, S.E., and Korsmeyer, S.J. (2004). FLT3 mutations in childhood
acute lymphoblastic leukemia. Blood 103, 3544–3546.
[5] Arora, D., Köthe, S., Van den Eijnden, M., Hooft van Huijsduijnen, R., Heidel,
F., Fischer, T., Scholl, S., Tölle, B., Böhmer, S.-A., Lennartsson, J., et al.
(2012). Expression of protein-tyrosine phosphatases in Acute Myeloid
Leukemia cells: FLT3 ITD sustains high levels of DUSP6 expression. Cell
Commun. Signal 10, 19.
[6] Barilá, D., and Superti-Furga, G. (1998). An intramolecular SH3-domain
interaction regulates c-Abl activity. Nat. Genet. 18, 280–282.
[7] Benhar, M., Engelberg, D., and Levitzki, A. (2002). ROS, stress-activated
kinases and stress signaling in cancer. EMBO Rep. 3, 420–425.
[8] Bermudez, O., Pagès, G., and Gimond, C. (2010). The dual-specificity MAP
kinase phosphatases: critical roles in development and cancer. Am. J.
Physiol., Cell Physiol. 299, C189–202.
[9] Bhalla, U.S., Ram, P.T., and Iyengar, R. (2002). MAP kinase phosphatase as
a locus of flexibility in a mitogen-activated protein kinase signaling network.
Science 297, 1018–1023.
[10] Billadeau, D.D., and Leibson, P.J. (2002). ITAMs versus ITIMs: striking a
balance during cell regulation. J. Clin. Invest. 109, 161–168.
[11] Bloethner, S., Chen, B., Hemminki, K., Müller-Berghaus, J., Ugurel, S.,
Schadendorf, D., and Kumar, R. (2005). Effect of common B-RAF and N-RAS
98

mutations on global gene expression in melanoma cell lines. Carcinogenesis
26, 1224–1232.
[12] Bonnet, S., Archer, S.L., Allalunis-Turner, J., Haromy, A., Beaulieu, C.,
Thompson, R., Lee, C.T., Lopaschuk, G.D., Puttagunta, L., Bonnet, S., et al.
(2007). A mitochondria-K+ channel axis is suppressed in cancer and its
normalization promotes apoptosis and inhibits cancer growth. Cancer Cell 11,
37–51.
[13] Braig, M., and Schmitt, C.A. (2006). Oncogene-induced senescence:
putting the brakes on tumor development. Cancer Res. 66, 2881–2884.
[14] Braig, M., Lee, S., Loddenkemper, C., Rudolph, C., Peters, A.H.F.M.,
Schlegelberger, B., Stein, H., Dörken, B., Jenuwein, T., and Schmitt, C.A.
(2005). Oncogene-induced senescence as an initial barrier in lymphoma
development. Nature 436, 660–665.
[15] Brooks, R., Fuhler, G.M., Iyer, S., Smith, M.J., Park, M.-Y., Paraiso, K.H.T.,
Engelman, R.W., and Kerr, W.G. (2010). SHIP1 inhibition increases
immunoregulatory capacity and triggers apoptosis of hematopoietic cancer
cells. J. Immunol. 184, 3582–3589.
[16] Bruhns, P., Vely, F., Malbec, O., Fridman, W.H., Vivier, E., and Daeron, M.
(2000). Molecular basis of the recruitment of the SH2 domain-containing
inositol 5-phosphatases SHIP1 and SHIP2 by fcgamma RIIB. J. Biol. Chem.
275, 37357–37364.
[17] Burshtyn, D.N., Scharenberg, A.M., Wagtmann, N., Rajagopalan, S.,
Berrada, K., Yi, T., Kinet, J.P., and Long, E.O. (1996). Recruitment of tyrosine
phosphatase HCP by the killer cell inhibitor receptor. Immunity 4, 77–85.
[18] Burshtyn, D.N., Yang, W., Yi, T., and Long, E.O. (1997). A novel
phosphotyrosine motif with a critical amino acid at position -2 for the SH2
domain-mediated activation of the tyrosine phosphatase SHP-1. J. Biol.
Chem. 272, 13066–13072.
[19] Cai, J., Jiang, W.G., Ahmed, A., and Boulton, M. (2006). Vascular
endothelial growth factor-induced endothelial cell proliferation is regulated by
interaction between VEGFR-2, SH-PTP1 and eNOS. Microvasc. Res. 71, 20–
31.
[20] Calabretta, B., and Perrotti, D. (2004). The biology of CML blast crisis.
Blood 103, 4010–4022.
[21] Carlesso, N., Frank, D.A., and Griffin, J.D. (1996). Tyrosyl phosphorylation
and DNA binding activity of signal transducers and activators of transcription
(STAT) proteins in hematopoietic cell lines transformed by Bcr/Abl. J. Exp.
Med. 183, 811–820.
[22] Chandarlapaty, S. (2012). Negative feedback and adaptive resistance to
the targeted therapy of cancer. Cancer Discov 2, 311–319.
99

[23] Chen, H.-Y., Yu, S.-L., Chen, C.-H., Chang, G.-C., Chen, C.-Y., Yuan, A.,
Cheng, C.-L., Wang, C.-H., Terng, H.-J., Kao, S.-F., et al. (2007). A five-gene
signature and clinical outcome in non-small-cell lung cancer. N. Engl. J. Med.
356, 11–20.
[24] Chen, Y., Wen, R., Yang, S., Schuman, J., Zhang, E.E., Yi, T., Feng, G.-S.,
and Wang, D. (2003). Identification of Shp-2 as a Stat5A phosphatase. J. Biol.
Chem. 278, 16520–16527.
[25] Chen, Z., Trotman, L.C., Shaffer, D., Lin, H.-K., Dotan, Z.A., Niki, M.,
Koutcher, J.A., Scher, H.I., Ludwig, T., Gerald, W., et al. (2005). Crucial role of
p53-dependent cellular senescence in suppression of Pten-deficient
tumorigenesis. Nature 436, 725–730.
[26] Chim, C.S., Wong, A.S.Y., and Kwong, Y.L. (2004a). Epigenetic
dysregulation of the Jak/STAT pathway by frequent aberrant methylation of
SHP1 but not SOCS1 in acute leukaemias. Ann. Hematol. 83, 527–532.
[27] Chim, C.-S., Fung, T.-K., Cheung, W.-C., Liang, R., and Kwong, Y.-L.
(2004b). SOCS1 and SHP1 hypermethylation in multiple myeloma:
implications for epigenetic activation of the Jak/STAT pathway. Blood 103,
4630–4635.
[28] Chong, Z.Z., Li, F., and Maiese, K. (2005). Oxidative stress in the brain:
novel cellular targets that govern survival during neurodegenerative disease.
Prog. Neurobiol. 75, 207–246.
[29] Corbin, A.S., La Rosée, P., Stoffregen, E.P., Druker, B.J., and Deininger,
M.W. (2003). Several Bcr-Abl kinase domain mutants associated with imatinib
mesylate resistance remain sensitive to imatinib. Blood 101, 4611–4614.
[30] Courtois-Cox, S., Genther Williams, S.M., Reczek, E.E., Johnson, B.W.,
McGillicuddy, L.T., Johannessen, C.M., Hollstein, P.E., MacCollin, M., and
Cichowski, K. (2006). A negative feedback signaling network underlies
oncogene-induced senescence. Cancer Cell 10, 459–472.
[31] Le Coutre, P., Tassi, E., Varella-Garcia, M., Barni, R., Mologni, L., Cabrita,
G., Marchesi, E., Supino, R., and Gambacorti-Passerini, C. (2000). Induction
of resistance to the Abelson inhibitor STI571 in human leukemic cells through
gene amplification. Blood 95, 1758–1766.
[32] Cui, T., Nakagami, H., Iwai, M., Takeda, Y., Shiuchi, T., Daviet, L.,
Nahmias, C., and Horiuchi, M. (2001). Pivotal role of tyrosine phosphatase
SHP-1 in AT2 receptor-mediated apoptosis in rat fetal vascular smooth
muscle cell. Cardiovasc. Res. 49, 863–871.
[33] Cui, Y., Parra, I., Zhang, M., Hilsenbeck, S.G., Tsimelzon, A., Furukawa,
T., Horii, A., Zhang, Z.-Y., Nicholson, R.I., and Fuqua, S.A.W. (2006).
Elevated expression of mitogen-activated protein kinase phosphatase 3 in
100

breast tumors: a mechanism of tamoxifen resistance. Cancer Res. 66, 5950–
5959.
[34] Dengler, M.A., Staiger, A.M., Gutekunst, M., Hofmann, U., Doszczak, M.,
Scheurich, P., Schwab, M., Aulitzky, W.E., and Van der Kuip, H. (2011).
Oncogenic stress induced by acute hyper-activation of Bcr-Abl leads to cell
death upon induction of excessive aerobic glycolysis. PLoS ONE 6, e25139.
[35] Diekmann, D., Brill, S., Garrett, M.D., Totty, N., Hsuan, J., Monfries, C.,
Hall, C., Lim, L., and Hall, A. (1991). Bcr encodes a GTPase-activating protein
for p21rac. Nature 351, 400–402.
[36] Dimri, G.P., Lee, X., Basile, G., Acosta, M., Scott, G., Roskelley, C.,
Medrano, E.E., Linskens, M., Rubelj, I., and Pereira-Smith, O. (1995). A
biomarker that identifies senescent human cells in culture and in aging skin in
vivo. Proc. Natl. Acad. Sci. U.S.A. 92, 9363–9367.
[37] Druker, B.J., Sawyers, C.L., Kantarjian, H., Resta, D.J., Reese, S.F., Ford,
J.M., Capdeville, R., and Talpaz, M. (2001). Activity of a specific inhibitor of
the BCR-ABL tyrosine kinase in the blast crisis of chronic myeloid leukemia
and acute lymphoblastic leukemia with the Philadelphia chromosome. N. Engl.
J. Med. 344, 1038–1042.
[38] Druker, B.J., Guilhot, F., O‟Brien, S.G., Gathmann, I., Kantarjian, H.,
Gattermann, N., Deininger, M.W.N., Silver, R.T., Goldman, J.M., Stone, R.M.,
et al. (2006). Five-year follow-up of patients receiving imatinib for chronic
myeloid leukemia. N. Engl. J. Med. 355, 2408–2417.
[39] Dubois, M.-J., Bergeron, S., Kim, H.-J., Dombrowski, L., Perreault, M.,
Fournès, B., Faure, R., Olivier, M., Beauchemin, N., Shulman, G.I., et al.
(2006). The SHP-1 protein tyrosine phosphatase negatively modulates
glucose homeostasis. Nat. Med. 12, 549–556.
[40] Duy, C., Hurtz, C., Shojaee, S., Cerchietti, L., Geng, H., Swaminathan, S.,
Klemm, L., Kweon, S., Nahar, R., Braig, M., et al. (2011). BCL6 enables Ph+
acute lymphoblastic leukaemia cells to survive BCR-ABL1 kinase inhibition.
Nature 473, 384–388.
[41] Eden, T. (2010). Aetiology of childhood leukaemia. Cancer Treat. Rev. 36,
286–297.
[42] Ekerot, M., Stavridis, M.P., Delavaine, L., Mitchell, M.P., Staples, C.,
Owens, D.M., Keenan, I.D., Dickinson, R.J., Storey, K.G., and Keyse, S.M.
(2008). Negative-feedback regulation of FGF signalling by DUSP6/MKP-3 is
driven by ERK1/2 and mediated by Ets factor binding to a conserved site
within the DUSP6/MKP-3 gene promoter. Biochem. J. 412, 287–298.
[43] Feldhahn, N., Henke, N., Melchior, K., Duy, C., Soh, B.N., Klein, F., Von
Levetzow, G., Giebel, B., Li, A., Hofmann, W.-K., et al. (2007). Activation-
101

induced cytidine deaminase acts as a mutator in BCR-ABL1-transformed
acute lymphoblastic leukemia cells. J. Exp. Med. 204, 1157–1166.
[44] Fong, C.W., Chua, M.-S., McKie, A.B., Ling, S.H.M., Mason, V., Li, R.,
Yusoff, P., Lo, T.L., Leung, H.Y., So, S.K.S., et al. (2006). Sprouty 2, an
inhibitor of mitogen-activated protein kinase signaling, is down-regulated in
hepatocellular carcinoma. Cancer Res. 66, 2048–2058.
[45] Frank, C., Burkhardt, C., Imhof, D., Ringel, J., Zschörnig, O., Wieligmann,
K., Zacharias, M., and Böhmer, F.-D. (2004). Effective dephosphorylation of
Src substrates by SHP-1. J. Biol. Chem. 279, 11375–11383.
[46] Freeman, M. (2000). Feedback control of intercellular signalling in
development. Nature 408, 313–319.
[47] Freeman, D.J., Li, A.G., Wei, G., Li, H.-H., Kertesz, N., Lesche, R., Whale,
A.D., Martinez-Diaz, H., Rozengurt, N., Cardiff, R.D., et al. (2003). PTEN
tumor suppressor regulates p53 protein levels and activity through
phosphatase-dependent and -independent mechanisms. Cancer Cell 3, 117–
130.
[48] Fuhler, G.M., Brooks, R., Toms, B., Iyer, S., Gengo, E.A., Park, M.-Y.,
Gumbleton, M., Viernes, D.R., Chisholm, J.D., and Kerr, W.G. (2012).
Therapeutic potential of SH2 domain-containing inositol-5‟-phosphatase 1
(SHIP1) and SHIP2 inhibition in cancer. Mol. Med. 18, 65–75.
[49] Furstoss, O., Dorey, K., Simon, V., Barilà, D., Superti-Furga, G., and
Roche, S. (2002). c-Abl is an effector of Src for growth factor-induced c-myc
expression and DNA synthesis. EMBO J. 21, 514–524.
[50] Furukawa, T., Fujisaki, R., Yoshida, Y., Kanai, N., Sunamura, M., Abe, T.,
Takeda, K., Matsuno, S., and Horii, A. (2005). Distinct progression pathways
involving the dysfunction of DUSP6/MKP-3 in pancreatic intraepithelial
neoplasia and intraductal papillary-mucinous neoplasms of the pancreas.
Mod. Pathol. 18, 1034–1042.
[51] Futreal, P.A., Coin, L., Marshall, M., Down, T., Hubbard, T., Wooster, R.,
Rahman, N., and Stratton, M.R. (2004). A census of human cancer genes.
Nat. Rev. Cancer 4, 177–183.
[52] Gilby, D.C., Goodeve, A.C., Winship, P.R., Valk, P.J., Delwel, R., and
Reilly, J.T. (2007). Gene structure, expression profiling and mutation analysis
of the tumour suppressor SHIP1 in Caucasian acute myeloid leukaemia.
Leukemia 21, 2390–2393.
[53] Golub, T.R., Barker, G.F., Bohlander, S.K., Hiebert, S.W., Ward, D.C.,
Bray-Ward, P., Morgan, E., Raimondi, S.C., Rowley, J.D., and Gilliland, D.G.
(1995). Fusion of the TEL gene on 12p13 to the AML1 gene on 21q22 in
acute lymphoblastic leukemia. Proc. Natl. Acad. Sci. U.S.A. 92, 4917–4921.
102

[54] Gong, J.G., Costanzo, A., Yang, H.Q., Melino, G., Kaelin, W.G., Jr,
Levrero, M., and Wang, J.Y. (1999). The tyrosine kinase c-Abl regulates p73
in apoptotic response to cisplatin-induced DNA damage. Nature 399, 806–
809.
[55] Gottlieb, T.M., Leal, J.F.M., Seger, R., Taya, Y., and Oren, M. (2002).
Cross-talk between Akt, p53 and Mdm2: possible implications for the
regulation of apoptosis. Oncogene 21, 1299–1303.
[56] Groffen, J., Stephenson, J.R., Heisterkamp, N., De Klein, A., Bartram,
C.R., and Grosveld, G. (1984). Philadelphia chromosomal breakpoints are
clustered within a limited region, bcr, on chromosome 22. Cell 36, 93–99.
[57] Gross, A.J., Lyandres, J.R., Panigrahi, A.K., Prak, E.T.L., and DeFranco,
A.L. (2009). Developmental acquisition of the Lyn-CD22-SHP-1 inhibitory
pathway promotes B cell tolerance. J. Immunol. 182, 5382–5392.
[58] Gross, I., Bassit, B., Benezra, M., and Licht, J.D. (2001). Mammalian
sprouty proteins inhibit cell growth and differentiation by preventing ras
activation. J. Biol. Chem. 276, 46460–46468.
[59] Gutierrez, A., Sanda, T., Grebliunaite, R., Carracedo, A., Salmena, L., Ahn,
Y., Dahlberg, S., Neuberg, D., Moreau, L.A., Winter, S.S., et al. (2009). High
frequency of PTEN, PI3K, and AKT abnormalities in T-cell acute lymphoblastic
leukemia. Blood 114, 647–650.
[60] Håkansson, P., Nilsson, B., Andersson, A., Lassen, C., Gullberg, U., and
Fioretos, T. (2008). Gene expression analysis of BCR/ABL1-dependent
transcriptional response reveals enrichment for genes involved in negative
feedback regulation. Genes Chromosomes Cancer 47, 267–275.
[61] Hanafusa, H., Torii, S., Yasunaga, T., and Nishida, E. (2002). Sprouty1 and
Sprouty2 provide a control mechanism for the Ras/MAPK signalling pathway.
Nat. Cell Biol. 4, 850–858.
[62] Hantschel, O., Wiesner, S., Güttler, T., Mackereth, C.D., Rix, L.L.R., Mikes,
Z., Dehne, J., Görlich, D., Sattler, M., and Superti-Furga, G. (2005). Structural
basis for the cytoskeletal association of Bcr-Abl/c-Abl. Mol. Cell 19, 461–473.
[63] Heisterkamp, N., Stam, K., Groffen, J., De Klein, A., and Grosveld, G.
(1985). Structural organization of the bcr gene and its role in the Ph‟
translocation. Nature 315, 758–761.
[64] Helgason, C.D., Damen, J.E., Rosten, P., Grewal, R., Sorensen, P.,
Chappel, S.M., Borowski, A., Jirik, F., Krystal, G., and Humphries, R.K.
(1998). Targeted disruption of SHIP leads to hemopoietic perturbations, lung
pathology, and a shortened life span. Genes Dev. 12, 1610–1620.
[65] Hileman, E.O., Liu, J., Albitar, M., Keating, M.J., and Huang, P. (2004).
Intrinsic oxidative stress in cancer cells: a biochemical basis for therapeutic
selectivity. Cancer Chemother. Pharmacol. 53, 209–219.
103

[66] Holgren, C., Dougherty, U., Edwin, F., Cerasi, D., Taylor, I., Fichera, A.,
Joseph, L., Bissonnette, M., and Khare, S. (2010). Sprouty-2 controls c-Met
expression and metastatic potential of colon cancer cells: sprouty/c-Met
upregulation in human colonic adenocarcinomas. Oncogene 29, 5241–5253.
[67] Hooper, J.E., and Scott, M.P. (1989). The Drosophila patched gene
encodes a putative membrane protein required for segmental patterning. Cell
59, 751–765.
[68] Horvat, A., Schwaiger, F., Hager, G., Brocker, F., Streif, R., Knyazev, P.,
Ullrich, A., and Kreutzberg, G.W. (2001). A novel role for protein tyrosine
phosphatase shp1 in controlling glial activation in the normal and injured
nervous system. J. Neurosci. 21, 865–874.
[69] Hu, Y., Rosen, D.G., Zhou, Y., Feng, L., Yang, G., Liu, J., and Huang, P.
(2005). Mitochondrial manganese-superoxide dismutase expression in ovarian
cancer: role in cell proliferation and response to oxidative stress. J. Biol.
Chem. 280, 39485–39492.
[70] Hughes, T.P., Kaeda, J., Branford, S., Rudzki, Z., Hochhaus, A., Hensley,
M.L., Gathmann, I., Bolton, A.E., Van Hoomissen, I.C., Goldman, J.M., et al.
(2003). Frequency of major molecular responses to imatinib or interferon alfa
plus cytarabine in newly diagnosed chronic myeloid leukemia. N. Engl. J. Med.
349, 1423–1432.
[71] Insabato, L., Amelio, I., Quarto, M., Zannetti, A., Tolino, F., De Mauro, G.,
Cerchia, L., Riccio, P., Baumhoer, D., Condorelli, G., et al. (2009). Elevated
expression of the tyrosine phosphatase SHP-1 defines a subset of high-grade
breast tumors. Oncology 77, 378–384.
[72] Jiao, H., Berrada, K., Yang, W., Tabrizi, M., Platanias, L.C., and Yi, T.
(1996). Direct association with and dephosphorylation of Jak2 kinase by the
SH2-domain-containing protein tyrosine phosphatase SHP-1. Mol. Cell. Biol.
16, 6985–6992.
[73] Karlsson, M., Mathers, J., Dickinson, R.J., Mandl, M., and Keyse, S.M.
(2004). Both nuclear-cytoplasmic shuttling of the dual specificity phosphatase
MKP-3 and its ability to anchor MAP kinase in the cytoplasm are mediated by
a conserved nuclear export signal. J. Biol. Chem. 279, 41882–41891.
[74] Kim, H.Y., Park, S.J., Joe, E., and Jou, I. (2006). Raft-mediated Src
homology 2 domain-containing proteintyrosine phosphatase 2 (SHP-2)
regulation in microglia. J. Biol. Chem. 281, 11872–11878.
[75] Kiyoi, H., and Naoe, T. (2006). FLT3 mutations in acute myeloid leukemia.
Methods Mol. Med. 125, 189–197.
[76] De Klein, A., Van Kessel, A.G., Grosveld, G., Bartram, C.R., Hagemeijer,
A., Bootsma, D., Spurr, N.K., Heisterkamp, N., Groffen, J., and Stephenson,
104

J.R. (1982). A cellular oncogene is translocated to the Philadelphia
chromosome in chronic myelocytic leukaemia. Nature 300, 765–767.
[77] Kobayashi, S., Ji, H., Yuza, Y., Meyerson, M., Wong, K.-K., Tenen, D.G.,
and Halmos, B. (2005). An alternative inhibitor overcomes resistance caused
by a mutation of the epidermal growth factor receptor. Cancer Res. 65, 7096–
7101.
[78] Koptyra, M., Falinski, R., Nowicki, M.O., Stoklosa, T., Majsterek, I.,
Nieborowska-Skorska, M., Blasiak, J., and Skorski, T. (2006). BCR/ABL
kinase induces self-mutagenesis via reactive oxygen species to encode
imatinib resistance. Blood 108, 319–327.
[79] Krishna, M., and Narang, H. (2008). The complexity of mitogen-activated
protein kinases (MAPKs) made simple. Cell. Mol. Life Sci. 65, 3525–3544.
[80] Kurosaki, T. (1999). Genetic analysis of B cell antigen receptor signaling.
Annu. Rev. Immunol. 17, 555–592.
[81] Leung, W.-H., Tarasenko, T., and Bolland, S. (2009). Differential roles for
the inositol phosphatase SHIP in the regulation of macrophages and
lymphocytes. Immunol. Res. 43, 243–251.
[82] Liaw, D., Marsh, D.J., Li, J., Dahia, P.L., Wang, S.I., Zheng, Z., Bose, S.,
Call, K.M., Tsou, H.C., Peacocke, M., et al. (1997). Germline mutations of the
PTEN gene in Cowden disease, an inherited breast and thyroid cancer
syndrome. Nat. Genet. 16, 64–67.
[83] Lito, P., Mets, B.D., Kleff, S., O‟Reilly, S., Maher, V.M., and McCormick,
J.J. (2008). Evidence that sprouty 2 is necessary for sarcoma formation by H-
Ras oncogene-transformed human fibroblasts. J. Biol. Chem. 283, 2002–
2009.
[84] Loh, M.L., Silverman, L.B., Young, M.L., Neuberg, D., Golub, T.R., Sallan,
S.E., and Gilliland, D.G. (1998). Incidence of TEL/AML1 fusion in children with
relapsed acute lymphoblastic leukemia. Blood 92, 4792–4797.
[85] Luo, J., Solimini, N.L., and Elledge, S.J. (2009). Principles of cancer
therapy: oncogene and non-oncogene addiction. Cell 136, 823–837.
[86] Maas, M., Wang, R., Paddock, C., Kotamraju, S., Kalyanaraman, B.,
Newman, P.J., and Newman, D.K. (2003). Reactive oxygen species induce
reversible PECAM-1 tyrosine phosphorylation and SHP-2 binding. Am. J.
Physiol. Heart Circ. Physiol. 285, H2336–2344.
[87] Maehama, T., and Dixon, J.E. (1998). The tumor suppressor,
PTEN/MMAC1, dephosphorylates the lipid second messenger,
phosphatidylinositol 3,4,5-trisphosphate. J. Biol. Chem. 273, 13375–13378.
[88] Maillet, M., Purcell, N.H., Sargent, M.A., York, A.J., Bueno, O.F., and
Molkentin, J.D. (2008). DUSP6 (MKP3) null mice show enhanced ERK1/2
105

phosphorylation at baseline and increased myocyte proliferation in the heart
affecting disease susceptibility. J. Biol. Chem. 283, 31246–31255.
[89] Mak, L.H., Vilar, R., and Woscholski, R. (2010). Characterisation of the
PTEN inhibitor VO-OHpic. J Chem Biol 3, 157–163.
[90] Malmberg, E.K., Andersson, C.X., Gentzsch, M., Chen, J.H., Mengos, A.,
Cui, L., Hansson, G.C., and Riordan, J.R. (2004). Bcr (breakpoint cluster
region) protein binds to PDZ-domains of scaffold protein PDZK1 and vesicle
coat protein Mint3. J. Cell. Sci. 117, 5535–5541.
[91] Marsh, D.J., Kum, J.B., Lunetta, K.L., Bennett, M.J., Gorlin, R.J., Ahmed,
S.F., Bodurtha, J., Crowe, C., Curtis, M.A., Dasouki, M., et al. (1999). PTEN
mutation spectrum and genotype-phenotype correlations in Bannayan-Riley-
Ruvalcaba syndrome suggest a single entity with Cowden syndrome. Hum.
Mol. Genet. 8, 1461–1472.
[92] Maru, Y., and Witte, O.N. (1991). The BCR gene encodes a novel
serine/threonine kinase activity within a single exon. Cell 67, 459–468.
[93] McKie, A.B., Douglas, D.A., Olijslagers, S., Graham, J., Omar, M.M., Heer,
R., Gnanapragasam, V.J., Robson, C.N., and Leung, H.Y. (2005). Epigenetic
inactivation of the human sprouty2 (hSPRY2) homologue in prostate cancer.
Oncogene 24, 2166–2174.
[94] Melo, J.V., and Barnes, D.J. (2007). Chronic myeloid leukaemia as a model
of disease evolution in human cancer. Nat. Rev. Cancer 7, 441–453.
[95] Mena-Duran, A.V., Togo, S.H., Bazhenova, L., Cervera, J., Bethel, K.,
Senent, M.L., Nieva, J., Sanz, G.F., Sanz, M.A., Saven, A., et al. (2005).
SHP1 expression in bone marrow biopsies of myelodysplastic syndrome
patients: a new prognostic factor. Br. J. Haematol. 129, 791–794.
[96] Michaloglou, C., Vredeveld, L.C.W., Soengas, M.S., Denoyelle, C.,
Kuilman, T., Van der Horst, C.M.A.M., Majoor, D.M., Shay, J.W., Mooi, W.J.,
and Peeper, D.S. (2005). BRAFE600-associated senescence-like cell cycle
arrest of human naevi. Nature 436, 720–724.
[97] Minowada, G., and Miller, Y.E. (2009). Overexpression of Sprouty 2 in
mouse lung epithelium inhibits urethane-induced tumorigenesis. Am. J.
Respir. Cell Mol. Biol. 40, 31–37.
[98] Miyauchi, H., Minamino, T., Tateno, K., Kunieda, T., Toko, H., and Komuro,
I. (2004). Akt negatively regulates the in vitro lifespan of human endothelial
cells via a p53/p21-dependent pathway. EMBO J. 23, 212–220.
[99] Mok, S.C., Kwok, T.T., Berkowitz, R.S., Barrett, A.J., and Tsui, F.W.
(1995). Overexpression of the protein tyrosine phosphatase, nonreceptor type
6 (PTPN6), in human epithelial ovarian cancer. Gynecol. Oncol. 57, 299–303.
106

[100] Molina, G., Vogt, A., Bakan, A., Dai, W., Queiroz de Oliveira, P., Znosko,
W., Smithgall, T.E., Bahar, I., Lazo, J.S., Day, B.W., et al. (2009). Zebrafish
chemical screening reveals an inhibitor of Dusp6 that expands cardiac cell
lineages. Nat. Chem. Biol. 5, 680–687.
[101] Montagut, C., and Settleman, J. (2009). Targeting the RAF-MEK-ERK
pathway in cancer therapy. Cancer Lett. 283, 125–134.
[102] Moore, M.J. (2005). Brief communication: a new combination in the
treatment of advanced pancreatic cancer. Semin. Oncol. 32, 5–6.
[103] Muda, M., Theodosiou, A., Rodrigues, N., Boschert, U., Camps, M.,
Gillieron, C., Davies, K., Ashworth, A., and Arkinstall, S. (1996). The dual
specificity phosphatases M3/6 and MKP-3 are highly selective for inactivation
of distinct mitogen-activated protein kinases. J. Biol. Chem. 271, 27205–
27208.
[104] Mullighan, C.G. (2012). The molecular genetic makeup of acute
lymphoblastic leukemia. Hematology Am Soc Hematol Educ Program 2012,
389–396.
[105] Nagar, B., Hantschel, O., Seeliger, M., Davies, J.M., Weis, W.I., Superti-
Furga, G., and Kuriyan, J. (2006). Organization of the SH3-SH2 unit in active
and inactive forms of the c-Abl tyrosine kinase. Mol. Cell 21, 787–798.
[106] Naughton, R., Quiney, C., Turner, S.D., and Cotter, T.G. (2009). Bcr-Abl-
mediated redox regulation of the PI3K/AKT pathway. Leukemia 23, 1432–
1440.
[107] Nieborowska-Skorska, M., Wasik, M.A., Slupianek, A., Salomoni, P.,
Kitamura, T., Calabretta, B., and Skorski, T. (1999). Signal transducer and
activator of transcription (STAT)5 activation by BCR/ABL is dependent on
intact Src homology (SH)3 and SH2 domains of BCR/ABL and is required for
leukemogenesis. J. Exp. Med. 189, 1229–1242.
[108] Nosaka, T., Kawashima, T., Misawa, K., Ikuta, K., Mui, A.L., and Kitamura,
T. (1999). STAT5 as a molecular regulator of proliferation, differentiation and
apoptosis in hematopoietic cells. EMBO J. 18, 4754–4765.
[109] O‟Hare, T., Zabriskie, M.S., Eiring, A.M., and Deininger, M.W. (2012).
Pushing the limits of targeted therapy in chronic myeloid leukaemia. Nat. Rev.
Cancer 12, 513–526.
[110] Okudela, K., Yazawa, T., Woo, T., Sakaeda, M., Ishii, J., Mitsui, H.,
Shimoyamada, H., Sato, H., Tajiri, M., Ogawa, N., et al. (2009). Down-
regulation of DUSP6 expression in lung cancer: its mechanism and potential
role in carcinogenesis. Am. J. Pathol. 175, 867–881.
[111] Onishi, M., Nosaka, T., Misawa, K., Mui, A.L., Gorman, D., McMahon, M.,
Miyajima, A., and Kitamura, T. (1998). Identification and characterization of a
107

constitutively active STAT5 mutant that promotes cell proliferation. Mol. Cell.
Biol. 18, 3871–3879.
[112] Ottmann, O.G., and Pfeifer, H. (2009). Management of Philadelphia
chromosome-positive acute lymphoblastic leukemia (Ph+ ALL). Hematology
Am Soc Hematol Educ Program 371–381.
[113] Ozawa, T., Nakata, K., Mizuno, K., and Yakura, H. (2007). Negative
autoregulation of Src homology region 2-domain-containing phosphatase-1 in
rat basophilic leukemia-2H3 cells. Int. Immunol. 19, 1049–1061.
[114] Paul, M.K., and Mukhopadhyay, A.K. (2004). Tyrosine kinase - Role and
significance in Cancer. Int J Med Sci 1, 101–115.
[115] Pelicano, H., Carney, D., and Huang, P. (2004). ROS stress in cancer cells
and therapeutic implications. Drug Resist. Updat. 7, 97–110.
[116] Peng, C., Chen, Y., Yang, Z., Zhang, H., Osterby, L., Rosmarin, A.G., and
Li, S. (2010). PTEN is a tumor suppressor in CML stem cells and BCR-ABL-
induced leukemias in mice. Blood 115, 626–635.
[117] Plas, D.R., and Thompson, C.B. (2005). Akt-dependent transformation:
there is more to growth than just surviving. Oncogene 24, 7435–7442.
[118] Plattner, R., Kadlec, L., DeMali, K.A., Kazlauskas, A., and Pendergast,
A.M. (1999). c-Abl is activated by growth factors and Src family kinases and
has a role in the cellular response to PDGF. Genes Dev. 13, 2400–2411.
[119] Pluk, H., Dorey, K., and Superti-Furga, G. (2002). Autoinhibition of c-Abl.
Cell 108, 247–259.
[120] Poulikakos, P.I., Zhang, C., Bollag, G., Shokat, K.M., and Rosen, N.
(2010). RAF inhibitors transactivate RAF dimers and ERK signalling in cells
with wild-type BRAF. Nature 464, 427–430.
[121] Pratilas, C.A., Taylor, B.S., Ye, Q., Viale, A., Sander, C., Solit, D.B., and
Rosen, N. (2009). (V600E)BRAF is associated with disabled feedback
inhibition of RAF-MEK signaling and elevated transcriptional output of the
pathway. Proc. Natl. Acad. Sci. U.S.A. 106, 4519–4524.
[122] Preyer, M., Shu, C.-W., and Wang, J.Y.J. (2007). Delayed activation of Bax
by DNA damage in embryonic stem cells with knock-in mutations of the Abl
nuclear localization signals. Cell Death Differ. 14, 1139–1148.
[123] Ptasznik, A., Urbanowska, E., Chinta, S., Costa, M.A., Katz, B.A.,
Stanislaus, M.A., Demir, G., Linnekin, D., Pan, Z.K., and Gewirtz, A.M. (2002).
Crosstalk between BCR/ABL oncoprotein and CXCR4 signaling through a Src
family kinase in human leukemia cells. J. Exp. Med. 196, 667–678.
[124] Pui, C.-H., and Evans, W.E. (2006). Treatment of acute lymphoblastic
leukemia. N. Engl. J. Med. 354, 166–178.
108

[125] Pui, C.-H., Relling, M.V., and Downing, J.R. (2004). Acute lymphoblastic
leukemia. N. Engl. J. Med. 350, 1535–1548.
[126] Raj, L., Ide, T., Gurkar, A.U., Foley, M., Schenone, M., Li, X., Tolliday, N.J.,
Golub, T.R., Carr, S.A., Shamji, A.F., et al. (2011). Selective killing of cancer
cells by a small molecule targeting the stress response to ROS. Nature 475,
231–234.
[127] Raman, M., and Cobb, M.H. (2003). MAP kinase modules: many roads
home. Curr. Biol. 13, R886–888.
[128] Ramnarain, D.B., Park, S., Lee, D.Y., Hatanpaa, K.J., Scoggin, S.O., Otu,
H., Libermann, T.A., Raisanen, J.M., Ashfaq, R., Wong, E.T., et al. (2006).
Differential gene expression analysis reveals generation of an autocrine loop
by a mutant epidermal growth factor receptor in glioma cells. Cancer Res. 66,
867–874.
[129] Ravetch, J.V., and Lanier, L.L. (2000). Immune inhibitory receptors.
Science 290, 84–89.
[130] Rodríguez-Ubreva, F.J., Cariaga-Martinez, A.E., Cortés, M.A., Romero-De
Pablos, M., Ropero, S., López-Ruiz, P., and Colás, B. (2010). Knockdown of
protein tyrosine phosphatase SHP-1 inhibits G1/S progression in prostate
cancer cells through the regulation of components of the cell-cycle machinery.
Oncogene 29, 345–355.
[131] Rolli, V., Gallwitz, M., Wossning, T., Flemming, A., Schamel, W.W.A., Zürn,
C., and Reth, M. (2002). Amplification of B cell antigen receptor signaling by a
Syk/ITAM positive feedback loop. Mol. Cell 10, 1057–1069.
[132] Rosivatz, E., Matthews, J.G., McDonald, N.Q., Mulet, X., Ho, K.K., Lossi,
N., Schmid, A.C., Mirabelli, M., Pomeranz, K.M., Erneux, C., et al. (2006). A
small molecule inhibitor for phosphatase and tensin homologue deleted on
chromosome 10 (PTEN). ACS Chem. Biol. 1, 780–790.
[133] Roux, P.P., and Blenis, J. (2004). ERK and p38 MAPK-activated protein
kinases: a family of protein kinases with diverse biological functions. Microbiol.
Mol. Biol. Rev. 68, 320–344.
[134] Ruschmann, J., Ho, V., Antignano, F., Kuroda, E., Lam, V., Ibaraki, M.,
Snyder, K., Kim, C., Flavell, R.A., Kawakami, T., et al. (2010). Tyrosine
phosphorylation of SHIP promotes its proteasomal degradation. Exp. Hematol.
38, 392–402, 402.e1.
[135] Sattler, M., Verma, S., Byrne, C.H., Shrikhande, G., Winkler, T., Algate,
P.A., Rohrschneider, L.R., and Griffin, J.D. (1999). BCR/ABL directly inhibits
expression of SHIP, an SH2-containing polyinositol-5-phosphatase involved in
the regulation of hematopoiesis. Mol. Cell. Biol. 19, 7473–7480.
[136] Sattler, M., Verma, S., Shrikhande, G., Byrne, C.H., Pride, Y.B., Winkler,
T., Greenfield, E.A., Salgia, R., and Griffin, J.D. (2000). The BCR/ABL tyrosine
109

kinase induces production of reactive oxygen species in hematopoietic cells.
J. Biol. Chem. 275, 24273–24278.
[137] Schindler, T., Bornmann, W., Pellicena, P., Miller, W.T., Clarkson, B., and
Kuriyan, J. (2000). Structural mechanism for STI-571 inhibition of abelson
tyrosine kinase. Science 289, 1938–1942.
[138] Serrano, M., Lin, A.W., McCurrach, M.E., Beach, D., and Lowe, S.W.
(1997). Oncogenic ras provokes premature cell senescence associated with
accumulation of p53 and p16INK4a. Cell 88, 593–602.
[139] Shah, N.P., Nicoll, J.M., Nagar, B., Gorre, M.E., Paquette, R.L., Kuriyan, J.,
and Sawyers, C.L. (2002). Multiple BCR-ABL kinase domain mutations confer
polyclonal resistance to the tyrosine kinase inhibitor imatinib (STI571) in
chronic phase and blast crisis chronic myeloid leukemia. Cancer Cell 2, 117–
125.
[140] Shepherd, F.A., Rodrigues Pereira, J., Ciuleanu, T., Tan, E.H., Hirsh, V.,
Thongprasert, S., Campos, D., Maoleekoonpiroj, S., Smylie, M., Martins, R., et
al. (2005). Erlotinib in previously treated non-small-cell lung cancer. N. Engl. J.
Med. 353, 123–132.
[141] Shim, K., Minowada, G., Coling, D.E., and Martin, G.R. (2005). Sprouty2, a
mouse deafness gene, regulates cell fate decisions in the auditory sensory
epithelium by antagonizing FGF signaling. Dev. Cell 8, 553–564.
[142] Signer, R.A.J., Montecino-Rodriguez, E., Witte, O.N., and Dorshkind, K.
(2010). Immature B-cell progenitors survive oncogenic stress and efficiently
initiate Ph+ B-acute lymphoblastic leukemia. Blood 116, 2522–2530.
[143] Sini, P., Cannas, A., Koleske, A.J., Di Fiore, P.P., and Scita, G. (2004).
Abl-dependent tyrosine phosphorylation of Sos-1 mediates growth-factor-
induced Rac activation. Nat. Cell Biol. 6, 268–274.
[144] Song, M.S., Carracedo, A., Salmena, L., Song, S.J., Egia, A., Malumbres,
M., and Pandolfi, P.P. (2011). Nuclear PTEN regulates the APC-CDH1 tumor-
suppressive complex in a phosphatase-independent manner. Cell 144, 187–
199.
[145] Stein, S.J., and Baldwin, A.S. (2011). NF-κB suppresses ROS levels in
BCR-ABL(+) cells to prevent activation of JNK and cell death. Oncogene 30,
4557–4566.
[146] Stokoe, D., Stephens, L.R., Copeland, T., Gaffney, P.R., Reese, C.B.,
Painter, G.F., Holmes, A.B., McCormick, F., and Hawkins, P.T. (1997). Dual
role of phosphatidylinositol-3,4,5-trisphosphate in the activation of protein
kinase B. Science 277, 567–570.
[147] Su, A.I., Cooke, M.P., Ching, K.A., Hakak, Y., Walker, J.R., Wiltshire, T.,
Orth, A.P., Vega, R.G., Sapinoso, L.M., Moqrich, A., et al. (2002). Large-scale
110

analysis of the human and mouse transcriptomes. Proc. Natl. Acad. Sci.
U.S.A. 99, 4465–4470.
[148] Sutterlüty, H., Mayer, C.-E., Setinek, U., Attems, J., Ovtcharov, S., Mikula,
M., Mikulits, W., Micksche, M., and Berger, W. (2007). Down-regulation of
Sprouty2 in non-small cell lung cancer contributes to tumor malignancy via
extracellular signal-regulated kinase pathway-dependent and -independent
mechanisms. Mol. Cancer Res. 5, 509–520.
[149] Suzuki, A., De la Pompa, J.L., Stambolic, V., Elia, A.J., Sasaki, T., Del
Barco Barrantes, I., Ho, A., Wakeham, A., Itie, A., Khoo, W., et al. (1998).
High cancer susceptibility and embryonic lethality associated with mutation of
the PTEN tumor suppressor gene in mice. Curr. Biol. 8, 1169–1178.
[150] Szatrowski, T.P., and Nathan, C.F. (1991). Production of large amounts of
hydrogen peroxide by human tumor cells. Cancer Res. 51, 794–798.
[151] Taketani, T., Taki, T., Sugita, K., Furuichi, Y., Ishii, E., Hanada, R.,
Tsuchida, M., Sugita, K., Ida, K., and Hayashi, Y. (2004). FLT3 mutations in
the activation loop of tyrosine kinase domain are frequently found in infant ALL
with MLL rearrangements and pediatric ALL with hyperdiploidy. Blood 103,
1085–1088.
[152] Toyokuni, S. (1998). Oxidative stress and cancer: the role of redox
regulation. Biotherapy 11, 147–154.
[153] Valencia, A.M., Oliva, J.L., Bodega, G., Chiloeches, A., López-Ruiz, P.,
Prieto, J.C., Susini, C., and Colás, B. (1997). Identification of a protein-
tyrosine phosphatase (SHP1) different from that associated with acid
phosphatase in rat prostate. FEBS Lett. 406, 42–48.
[154] Vanhaesebroeck, B., and Alessi, D.R. (2000). The PI3K-PDK1 connection:
more than just a road to PKB. Biochem. J. 346 Pt 3, 561–576.
[155] Varticovski, L., Daley, G.Q., Jackson, P., Baltimore, D., and Cantley, L.C.
(1991). Activation of phosphatidylinositol 3-kinase in cells expressing abl
oncogene variants. Mol. Cell. Biol. 11, 1107–1113.
[156] Vivanco, I., and Sawyers, C.L. (2002). The phosphatidylinositol 3-Kinase
AKT pathway in human cancer. Nat. Rev. Cancer 2, 489–501.
[157] Vivier, E., and Daëron, M. (1997). Immunoreceptor tyrosine-based
inhibition motifs. Immunol. Today 18, 286–291.
[158] Wang, C., Delogu, S., Ho, C., Lee, S.A., Gui, B., Jiang, L., Ladu, S.,
Cigliano, A., Dombrowski, F., Evert, M., et al. (2012). Inactivation of Spry2
accelerates AKT-driven hepatocarcinogenesis via activation of MAPK and
PKM2 pathways. J. Hepatol. 57, 577–583.
[159] Wang, J.-Y., Shum, A.Y.C., Ho, Y.-J., and Wang, J.-Y. (2003). Oxidative
neurotoxicity in rat cerebral cortex neurons: synergistic effects of H2O2 and
111

NO on apoptosis involving activation of p38 mitogen-activated protein kinase
and caspase-3. J. Neurosci. Res. 72, 508–519.
[160] Warmka, J.K., Mauro, L.J., and Wattenberg, E.V. (2004). Mitogen-activated
protein kinase phosphatase-3 is a tumor promoter target in initiated cells that
express oncogenic Ras. J. Biol. Chem. 279, 33085–33092.
[161] Weinstein, I.B., and Joe, A.K. (2006). Mechanisms of disease: Oncogene
addiction--a rationale for molecular targeting in cancer therapy. Nat Clin Pract
Oncol 3, 448–457.
[162] Weinstein, I.B., Begemann, M., Zhou, P., Han, E.K., Sgambato, A., Doki,
Y., Arber, N., Ciaparrone, M., and Yamamoto, H. (1997). Disorders in cell
circuitry associated with multistage carcinogenesis: exploitable targets for
cancer prevention and therapy. Clin. Cancer Res. 3, 2696–2702.
[163] Weng, L.P., Brown, J.L., and Eng, C. (2001). PTEN coordinates G(1) arrest
by down-regulating cyclin D1 via its protein phosphatase activity and up-
regulating p27 via its lipid phosphatase activity in a breast cancer model.
Hum. Mol. Genet. 10, 599–604.
[164] Wong, S., and Witte, O.N. (2004). The BCR-ABL story: bench to bedside
and back. Annu. Rev. Immunol. 22, 247–306.
[165] Xiao, W., Hong, H., Kawakami, Y., Kato, Y., Wu, D., Yasudo, H., Kimura,
A., Kubagawa, H., Bertoli, L.F., Davis, R.S., et al. (2009). Tumor suppression
by phospholipase C-beta3 via SHP-1-mediated dephosphorylation of Stat5.
Cancer Cell 16, 161–171.
[166] Xu, S., Furukawa, T., Kanai, N., Sunamura, M., and Horii, A. (2005).
Abrogation of DUSP6 by hypermethylation in human pancreatic cancer. J.
Hum. Genet. 50, 159–167.
[167] Yamamoto, T., Maruyama, W., Kato, Y., Yi, H., Shamoto-Nagai, M.,
Tanaka, M., Sato, Y., and Naoi, M. (2002). Selective nitration of mitochondrial
complex I by peroxynitrite: involvement in mitochondria dysfunction and cell
death of dopaminergic SH-SY5Y cells. J Neural Transm 109, 1–13.
[168] Yang, J., Liu, L., He, D., Song, X., Liang, X., Zhao, Z.J., and Zhou, G.W.
(2003). Crystal structure of human protein-tyrosine phosphatase SHP-1. J.
Biol. Chem. 278, 6516–6520.
[169] Yasukawa, H., Sasaki, A., and Yoshimura, A. (2000). Negative regulation
of cytokine signaling pathways. Annu. Rev. Immunol. 18, 143–164.
[170] Yi, T.L., Cleveland, J.L., and Ihle, J.N. (1992). Protein tyrosine
phosphatase containing SH2 domains: characterization, preferential
expression in hematopoietic cells, and localization to human chromosome
12p12-p13. Mol. Cell. Biol. 12, 836–846.
112

[171] Yip, S.S., Crew, A.J., Gee, J.M., Hui, R., Blamey, R.W., Robertson, J.F.,
Nicholson, R.I., Sutherland, R.L., and Daly, R.J. (2000). Up-regulation of the
protein tyrosine phosphatase SHP-1 in human breast cancer and correlation
with GRB2 expression. Int. J. Cancer 88, 363–368.
[172] Yokota, S., Kiyoi, H., Nakao, M., Iwai, T., Misawa, S., Okuda, T., Sonoda,
Y., Abe, T., Kahsima, K., Matsuo, Y., et al. (1997). Internal tandem duplication
of the FLT3 gene is preferentially seen in acute myeloid leukemia and
myelodysplastic syndrome among various hematological malignancies. A
study on a large series of patients and cell lines. Leukemia 11, 1605–1609.
[173] Yu, Z., Su, L., Hoglinger, O., Jaramillo, M.L., Banville, D., and Shen, S.H.
(1998). SHP-1 associates with both platelet-derived growth factor receptor
and the p85 subunit of phosphatidylinositol 3-kinase. J. Biol. Chem. 273,
3687–3694.
[174] Yusoff, P., Lao, D.-H., Ong, S.H., Wong, E.S.M., Lim, J., Lo, T.L., Leong,
H.F., Fong, C.W., and Guy, G.R. (2002). Sprouty2 inhibits the Ras/MAP
kinase pathway by inhibiting the activation of Raf. J. Biol. Chem. 277, 3195–
3201.
[175] Zapata, P.D., Ropero, R.M., Valencia, A.M., Buscail, L., López, J.I., Martín-
Orozco, R.M., Prieto, J.C., Angulo, J., Susini, C., López-Ruiz, P., et al. (2002).
Autocrine regulation of human prostate carcinoma cell proliferation by
somatostatin through the modulation of the SH2 domain containing protein
tyrosine phosphatase (SHP)-1. J. Clin. Endocrinol. Metab. 87, 915–926.
[176] Zhang, J., Grindley, J.C., Yin, T., Jayasinghe, S., He, X.C., Ross, J.T.,
Haug, J.S., Rupp, D., Porter-Westpfahl, K.S., Wiedemann, L.M., et al. (2006).
PTEN maintains haematopoietic stem cells and acts in lineage choice and
leukaemia prevention. Nature 441, 518–522.
[177] Zhang, J., Yang, P.L., and Gray, N.S. (2009). Targeting cancer with small
molecule kinase inhibitors. Nat. Rev. Cancer 9, 28–39.
[178] Zhang, Z., Kobayashi, S., Borczuk, A.C., Leidner, R.S., Laframboise, T.,
Levine, A.D., and Halmos, B. (2010). Dual specificity phosphatase 6 (DUSP6)
is an ETS-regulated negative feedback mediator of oncogenic ERK signaling
in lung cancer cells. Carcinogenesis 31, 577–586.

113

Appendix
Supplementary tables

Table S1: List of primary cases and cell lines

Notes: All primary samples are bone marrow biopsies, blast content >80%; LAX, Los
Angeles; BLQ, Bologna; TXL, Berlin; SFO, San Francisco; ICN, Seoul;

Ph
+
ALL
case
Disease

Karyotype

Sample type

Gender

Age

TXL2 at diagnosis t(9;22)(q34;q11) Bone marrow
TXL3 at diagnosis t(9;22)(q34;q11) Bone marrow
ICN1 at diagnosis t(9;22)(q34;q11) Bone marrow
SFO2 at diagnosis t(9;22)(q34;q11) Bone marrow 7
LAX2
T3151,
Relapse
(Imatinib)
t(9;22)(q34;q11) Bone marrow Male 38
BLQ1
T3151,
Relapse
(Imatinib)
FISH der(9), der(22)

Bone marrow
BLQ5
T3151,
Relapse
(Imatinib)
FISH der(9), der(22)

Bone marrow Female
BLQ6
Relapse
(Imatinib)
Bone marrow Male
BLQ11
T3151,
Relapse
(Imatinib)
FISH der(9), der(22)

Bone marrow Male
LAX9 at diagnosis Bone marrow Male
PDX59
46,XY,del(9)(p13),t(
9;22)(q34;q11.2)[12]
/46,XY,del(9)(p13),d
er(9)t(9;22)(q34;q11.
2),ider(22)(q10)t(9;2
2)(q34;q11.2)[4]/46,
XY[7]

Bone marrow Male 6
114

Table S2: List of primary cases and cell lines

cell line Type Source
BV173 B lymphoid blast crisis, p210 DSMZ
SUP-B15 Relapse, p190 DSMZ
Nalm1 B lymphoid blast crisis, p210 DSMZ
TOM1 Refractory, p190 DSMZ
RS4;11 B cell precursor leukemia, MLL-AF4 DSMZ
115

Table S3: List of primary cases and cell lines

Cell line
Lymphoma
entity

Genetic
alteration/Oncogenic lesion

Source
Toledo
B-NHL –Diffuse
large B cell
lymphoma
Complex karyotype ATCC
JSC-1
B-NHL -Primary
effusion
lymphoma
KSHV+ EBV+, HIV
associated
Dr. J.Jung, USC
BCP-1
B-NHL -Primary
effusion
lymphoma
KSHV+, HIV negative Dr. J.Jung, USC
BCBL-1
B-NHL -Primary
effusion
lymphoma
KSHV+, HIV associated,
BCL6 mutation
Dr. J.Jung, USC
BC-1
B-NHL -Primary
effusion
lymphoma
KSHV+ EBV+ Dr. J.Jung, USC
Karpas-
422
B-NHL - Diffuse
large B cell
lymphoma
t(14;18)(q32;q21) → IGH-
BCL2 genes altered
DSMZ
KM-H2
Hodgkin
lymphoma
amplifications: CCND2,
FGFR3/MMSET, JAK2; BCL6
mutation
DSMZ
Jeko-1
B-NHL –Mantel
cell lymphoma
ATM amplification, MYC
amplification, P16INK4A
deletion, P53
deletion/mutation, SYK
amplification
DSMZ
U-266
B-NHL -
Myeloma
P16INK4A methylation, P53
mutation, PTEN deletion
DSMZ
Mn-60
B-NHL -Burkitt‟s
lymphoma
t(8;14)(q24;q32) → MYC-IGH
genes altered
DSMZ
DB
Diffuse large cell
lymphoma
human hypertriploid
karyotype
DSMZ
116

Table S4: Genetic mouse models
___________________________________________

Mouse strain Source
___________________________________________

Dusp6
-/-
Jackson Laboratories

a
Spry1/2
fl/fl
Dr. Gail Martin, UCSF

Ncf1
-/-
Jackson Laboratories

b
P53
fl/fl
NCI Mouse Repository

c
Arf
fl/fl
NCI Mouse Repository

d
Pten
fl/fl
Dr. Hung Wu, UCLA

e
Pten
fl/fl
Hung Wu- UCLA

f
Inpp5d
fl/fl
Silvia Bolland- NIAID/NIH

Ptpn6
fl/fl
Jackson Laboratories

NOD/SCID Jackson Laboratories

___________________________________________

a. Katherine Shim, George Minowada, Donald E. Coling, Gail R. Martin. Sprouty2, a
Mouse Deafness Gene, Regulates Cell Fate Decisions in the Auditory Sensory
Epithelium by Antagonizing FGF Signaling. Developmental Cell, Vol. 8, 553–564, 2005.

b. Jonkers J, Meuwissen R, van der Gulden H, Peterse H, van der Valk M, Berns A.
Synergistic tumor suppressor activity of BRCA2 and p53 in a conditional mouse model
for breast cancer. Nat Genet. 2001 Dec;29(4):418-25

c. Gromley A, Churchman ML, Zindy F, Sherr CJ. Transient expression of the Arf
tumor suppressor during male germ cell and eye development in Arf-Cre reporter mice.
Proc Natl Acad Sci U S A. 2009 Apr 14;106(15):6285-90

d. Lesche R, Groszer M, Gao J, Wang Y, Messing A, Sun H, Liu X, Wu H. Cre/loxP-
mediated inactivation of the murine Pten tumor suppressor gene. Genesis. 2002
Feb;32(2):148-9.

e. Lesche R, Groszer M, Gao J, Wang Y, Messing A, Sun H, Liu X, Wu H. Cre/loxP-
mediated inactivation of the murine Pten tumor suppressor gene. Genesis. 2002
Feb;32(2):148-9.

f. Karlsson MC, Guinamard R, Bolland S, Sankala M, Steinman RM, Ravetch JV.
Macrophages control the retention and trafficking of B lymphocytes in the splenic
marginal zone. J Exp Med. 2003 Jul 21;198(2):333-40.

117

Table S5: Antibodies used for Western blot

Antigen Clone ID Company
ACTB Polyclonal (ab8227) Abcam
ARF-Hu Polyclonal (ab470) Abcam
ARF- Mo Polyclonal (ab80) Abcam
SPRY2 Polyclonal(ab85670) Abcam
ETV5 ab54704 Abcam
SOCS2 ab3692 Abcam
CISH H-80 Santa Cruz Biotechnology
P21 C-19 Santa Cruz Biotechnology
P27 F-8 Santa Cruz Biotechnology
BCL6 D8 Santa Cruz Biotechnology
DUSP6 G-4 Santa Cruz Biotechnology
c-Abl K-12 Santa Cruz Biotechnology
PTEN A2B1 Santa Cruz Biotechnology
P-c-Abl(Y412) 247C7 Cell Signaling
P53 1C12 Cell Signaling
NCF1 Polyclonal (4312) Cell Signaling
ERK1/2 Polyclonal (9102) Cell Signaling
P-ERK1/2 (T202/Y204) D13.14.4E Cell Signaling
P- STAT5(Tyr694) Polyclonal (9351) Cell Signaling
STAT5 Polyclonal (9363) Cell Signaling
p38 5F11 Cell Signaling
p-P38(Thr180/Tyr182) Polyclonal (9211) Cell Signaling
JNK Polyclonal (9252) Cell Signaling
p-JNK(Thr183/Tyr185) Polyclonal (9251) Cell Signaling
p-S6 Ribosomal Pr.Ser235/236 2F9 Cell Signaling
S6 Ribosomal Pr. 5G10 Cell Signaling
118

Table S6: Antibodies used for flow cytometry

p-P70 S6 Kinase(Thr389) Polyclonal (9205) Cell Signaling
P70 S6 Kinase Polyclonal (9202) Cell Signaling
PTPN6 C14H6 Cell Signaling
P-PTPN6(Tyr564) D11G5 Cell Signaling
AKT Polyclonal (9272) Cell Signaling
P-AKT (Ser473) Polyclonal (9271) Cell Signaling
Anti-Phospho-tyrosine 4G10 millipore
pNCF1 Polyclonal (S345) Kind gift from J. E.Benna
Surface antigen Clone ID Company
CD19-Mouse 1D3 BD Biosciences
FCRL2-Hu Polyclonal ( AF2048)
R & D systems
CEACAM6-Hu 439424
R & D systems
CD22-Hu HIB22
BD Biosciences
CD200-Hu MRC OX-104 BD Biosciences
PECAM1-Hu WM59 BD Biosciences
LAIR1-Hu DX26 BD Biosciences
CD19-Hu HIB19 BD Biosciences
119

Table S7: Sequences of oligonucleotide primers used

___________________________________________
Pten_66_F: 5’-TCCCAGAGTTCATACCAGGA- 3’
Pten_69_R: 5’-GCAATGGCCAGTACTAGTGAAC- 3’
Pten_73_R: 5’-AATCTGTGCATGAAGGGAAC-3’
Inpp5d-58_F: 5’- GTGGAGCAAAGCTAACTCTAG - 3’
Inpp5d-59_R: 5’- GTTTCTTTATCCGCTATGTCC - 3’
Inpp5d-78_R: 5’- GGTATCGATAAGCTTCGAGGG - 3’
Ptpn6_F: 5’- ACCCTCCAGCTCCTCTTC - 3’
Ptpn6_R: 5’- TGAGGTCCCGGTGAAACC - 3’
___________________________________________

Abstract (if available)

Abstract Current therapy approaches for tyrosine kinase driven leukemia including Ph⁺ ALL and CML are almost entirely focused on the development of more potent tyrosine kinase inhibitors (TKI). The ultimate goal in this approach is to reduce the oncogenic signaling below a minimum threshold that is required for the survival of leukemia cells. Despite the successful results obtained so far, this approach has its own drawbacks. Unfortunately, TKI treatment is not very effective in Ph⁺ ALL patients. Furthermore, in CML patients it can lead to the appearance of resistant tumors that are not sensitive to therapy anymore. Therefore, new strategies for killing the Ph⁺ leukemia independent of kinase inhibition are necessary. ❧ Hypersignaling has been known as an unfavorable condition for the survival of cells, and induction of hypersignaling may result in stalled proliferation or cellular senescence. However, its implication as a therapeutic mean has not been well-characterized. One strategy for induction of hypersignaling is to suppress the inhibitory regulators of signaling pathways. Therefore, we hypothesized that inhibition of negative feedback regulators or inhibitory phosphatases in Ph⁺ kinase leukemia could raise the signaling level and induce cell cycle arrest or senescence in transformed cells. Importantly, cells lacking high oncogenic kinase activity should be insensitive to such inhibition of negative feedback signaling. ❧ In chapter two of this thesis, we focused on the mitogen-activated protein kinase (MAPK) pathway. By the analysis of gene expression changes and evaluation of protein levels, we found that DUSP6 and SPRY2, two negative feedback regulators of the MAPK pathway, are highly expressed in human B cell lineage Ph⁺ ALL, while they are not expressed in B cell progenitor cells. Interestingly, in contrast to BCR-ABL1 kinase driven leukemia, non kinase-driven B cell Non-Hodgkin-Lymphoma (B-NHL) lack expression of these genes. To study the function of DUSP6 and SPRY2 in a genetic mouse model of Ph⁺ like leukemia, we transduced bone marrow pre-B cells from DUSP6-/-, SPRY2fl/fl mice and respective wildtype controls with retroviral BCR-ABL1. Defects in either of these two negative feedback mediators caused profound signaling imbalances in BCR-ABL1 leukemia cells and resulted in drastic negative consequences for the cells. For instance, Dusp6-deficient leukemia cells rapidly underwent cellular senescence and were less capable of colony formation in semisolid culture. In addition, Lack of Dusp6 and Spry2 dramatically increased cellular reactive oxygen species (ROS). Furthermore, inducible Cre-mediated deletion of Spry2 in leukemia cells resulted in rapid cell death. ❧ To test whether negative feedback signaling molecules represent a potential target for pharmacological inhibition in the treatment of kinase driven leukemia, we tested the DUSP6 small molecule inhibitor 2-benzylidene-3-(cyclohexylamino)-1-Indanone hydrochloride (BCI). BCI induced massive accumulation of ROS and subsequent cell death in a panel of patient-derived cases of Ph⁺ ALL, including two cases with T315I mutation. In vivo and ex vivo studies showed that BCI can increase the survival of NOD/SCID recipient mice transplanted with patient-derived Ph⁺ ALL cells with T315I mutation. ❧ In chapter three, we turn to the inhibitory phosphatases in Ph⁺ ALL cells. We found that three key inhibitory phosphatases (INPP5D/SHIP1, PTEN and PTPN6/SHP1) are expressed at high levels in these cells. INPP5D and PTEN negatively regulate AKT mediated signaling by dephosphorylating phosphatidylinositol-3,4,5-trisphosphate, at 5- and 3-phosphates, respectively. In addition, PTPN6 and INPP5D can both be recruited to the ITIM motifs of various inhibitory surface receptors and negatively regulate activation signals from tyrosine kinases and activating receptors. ❧ We showed that Cre-mediated deletion of Pten, Inpp5d and Ptpn6 in B cell lineage BCR-ABL1 ALL cells resulted in increased signaling downstream of the BCR-ABL1 kinase. Interestingly, this hypersignaling resulted in a variety of negative outcomes for the ALL cells such as drastic upregulation of reactive oxygen species (ROS), accumulation of DNA damage molecules, increased levels of cellular senescence and cell death. ❧ Studying B cell lineage BCR-ABL1 transformed Inpp5dfl/fl, Ptenfl/fl and Ptpn6fl/fl leukemia cells in vivo, we observed that deletion of these inhibitory phosphatases resulted in prolonged survival of leukemia transplant recipient mice. In addition, using small molecule inhibitors of INPP5D (3AC) and PTEN (VO-OHpic) recapitulated the genetic findings and killed patient-derived leukemia cells carrying the T315I mutant BCR-ABL1. ❧ We also found that one of the side effects of hypersignaling is the crosstalk between different signaling pathways. Surprisingly, induction of hypersignaling in the MAPK or PI3K/AKT pathways caused downregulation of the JAK/STAT pathway. While STAT5 activity is necessary for survival of the Ph+ leukemia cells, hypersignaling in other two pathways lead to acute dephosphorylation of STAT5. ❧ In summary, our studies identify negative feedback regulators of the MAPK pathway (including DUSP6 and SPRY2) and inhibitory phosphatases such as PTEN, INPP5D and PTPN6 as novel therapeutic targets in BCR-ABL1 positive B cell lineage leukemia. Pharmacological blockade of these molecules represents a fundamentally novel and powerful approach to increase oncogenic signaling beyond a tolerable threshold, thus causing excessive accumulation of ROS, crosstalk between different signaling pathways and subsequent cell death.

Linked assets

University of Southern California Dissertations and Theses

Conceptually similar

PDF

Loss of checkpoint controls in acute lymphoblastic leukemia

PDF

Pre-B cell receptor signaling in acute lymphoblastic leukemia

PDF

The role of survivin in drug resistant pediatric acute lymphoblastic leukemia

PDF

Role of integrin α4 in drug resistant acute lymphoblastic leukemia

PDF

The role of adipocytes in acute lymphoblastic leukemia cell migration and survival against daunorubicin

PDF

Therapeutic resistance in acute lymphoblastic leukemia: cIAP2 inhibition sensitizes B cell acute lymphoblastic leukemia to anti-CD19 chimeric antigen receptor T cell

PDF

Clinical outcomes of allogeneic hematopoietic stem cell transplant in acute lymphoblastic leukemia patients: a quality improvement project and systematic review meta-analysis

PDF

Integrin mediated cellular adhesion may alter the cytokine profile in acute lymphoblastic leukemia

PDF

The role of endoplasmic reticulum protein GRP78 in normal hematopoeises and PTEN-null leukemogenesis

PDF

Induction therapy in relapse adult acute lymphoblastic leukemia

PDF

Characterizing the protein expression of S1P receptors in T-cell acute lymphoblastic leukemia (T-ALL) cell lines

PDF

Understanding acute lymphoblastic leukemia in different ethnic groups in the United States

PDF

Maternal embryonic leucine zipper kinase (MELK) as a novel therapeutic target in the treatment of acute lymphoblastic leukemia

PDF

Mechanisms of nucleases in non-homologous DNA end joining

PDF

The effect of cytomegalovirus on gene expression of pediatric acute lymphoblastic leukemia

PDF

Molecular mechanism of transforming growth factor-beta signaling in skin wound healing

PDF

The role of endoplasmic reticulum chaperones in regulating hematopoietic stem cells and hematological malignancies

PDF

Understanding the role of BRCA1 and Aurora A kinase in polyploidy development in ovarian carcinoma precursor cells

PDF

Novel roles for Maf1 in embryonic stem cell differentiation and adipogenesis

PDF

Role of STAT3 phosphorylation in mouse embryonic stem cell self-renewal and differentiation

Asset Metadata

Creator Shojaee, Seyedmehdi (author)

Core Title Induction of hypersignaling as a therapeutic approach for treatment of BCR-ABL1 positive Acute Lymphoblastic Leukemia (ALL) cells

School Keck School of Medicine

Degree Doctor of Philosophy

Degree Program Genetic, Molecular and Cellular Biology

Publication Date 04/05/2013

Defense Date 03/11/2013

Publisher University of Southern California (original), University of Southern California. Libraries (digital)

Tag acute lymphoblastic leukemia,hypersignaling,OAI-PMH Harvest

Language English

Contributor Electronically uploaded by the author (provenance)

Advisor Muschen, Markus (committee chair), Heisterkamp, Eleanora C. (committee member), Jung, Jae U. (committee member), Kim, Yong-Mi (committee member), Lieber, Michael R. (committee member)

Creator Email shojaee.m@gmail.com,shojaee@usc.edu

Permanent Link (DOI) https://doi.org/10.25549/usctheses-c3-231158

Unique identifier UC11294040

Identifier usctheses-c3-231158 (legacy record id)

Legacy Identifier etd-ShojaeeSey-1515.pdf

Dmrecord 231158

Document Type Dissertation

Rights Shojaee, Seyedmehdi

Type texts

Source University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Access Conditions The author retains rights to his/her dissertation, thesis or other graduate work according to U.S. copyright law. Electronic access is being provided by the USC Libraries in agreement with the a...

Repository Name University of Southern California Digital Library

Repository Location USC Digital Library, University of Southern California, University Park Campus MC 2810, 3434 South Grand Avenue, 2nd Floor, Los Angeles, California 90089-2810, USA