University of Southern California Dissertations and Theses

Monoamine oxidase and cancer

(USC Thesis Other)

Monoamine oxidase and cancer

PDF

Download a page range

Download transcript

Copy asset link

Request this asset

Transcript (if available)

Content

MONOAMINE OXIDASE AND CANCER

by

Ying Chen

A Thesis Presented to the
FACULTY OF THE USC GRADUATE SCHOOL
UNIVERSITY OF SOUTHERN CALIFORNIA
In Partial Fulfillment of the
Requirements for the Degree
MASTER OF SCIENCE
(PHARMACEUTICAL SCIENCES)

August 2013

Copyright 2013 Ying Chen

i
Acknowledgements

First and foremost, I would like to thank my advisor Dr. Jean C Shih for her invaluable guidance
and immerse support in two years’ research and study as well as the final thesis. During the final
stage of my graduation, she offered me extensive training in writing and continuously motivated me
to think broadly and creatively. I wouldn’t have finished my work without her precious help and
guidance.

In addition, I want to convey my gratitude to Dr. Okamoto and Dr. Olenyuk for their help in my
thesis writing. I would also thank my lab members who have been helping me with experiments and
ideas in thesis writing. I’m thankful to Dr. Kevin Chen, Tzu Ping Lin, Tzu Shao Yeh and Bin Qian
for all your support and help along the way.

Last but not least, I would like to thank my parents for their support and love, without which it
would be impossible for me to study and do research in such a great environment and get through
all the difficult challenges in these two years.

ii
Table of Contents

Acknowledgements .......................................................................................................................... i

Abstract .......................................................................................................................................... iii

Chapter 1: Introduction to Monoamine oxidase ............................................................................. 1
Monoamine oxidase A and B ..................................................................................................................... 1
Monoamine oxidase in diseases ................................................................................................................ 2
Monoamine oxidase (MAO) inhibitors ................................................................................................... 3

Chapter 2: Monoamine oxidase genes regulation ........................................................................... 4
Transcriptional regulation of MAO genes.............................................................................................. 4
Transcriptional repressor R1 for MAO A gene ..................................................................................... 5
Hormone regulation, MAO A/B, and cancer ......................................................................................... 6

Chapter 3: Monoamine oxidase and cancer .................................................................................... 8
MAOA and prostate cancer ..................................................................................................................... 14
Serotonin and prostate cancer ................................................................................................................. 15
Hydrogen peroxide and cancer ............................................................................................................... 19
Genetics of MAO A and MAO B .......................................................................................................... 22

Chapter 4: MAO and apoptosis .................................................................................................... 24
Cancer and apoptosis ................................................................................................................................. 24
MAOs and apoptosis ................................................................................................................................. 26

Chapter 5: Conclusion .................................................................................................................. 28

Bibliography ................................................................................................................................. 30

iii
Abstract

Accumulating experimental evidence has indicated that monoamine oxidase A (MAO-A) plays an
important role in prostate cancer development. Many researchers have found that the expression of
MAO-A is in correlation with the progression of cancer. The knock-down or knock-out of MAO-A
gene is seeing results in the decrease in tumor proliferation and thus inhibiting the progression of
tumor growth. Despite the contradictory results in some studies, it is still meaningful to look into
the roles of MAO A and MAO A inhibitors in the treatment of certain level of cancer such as
prostate cancer. In view of all the studies of MAO-A genes and proteins, it is important to have a
general summary of the current study of monoamine oxidase in different fields to better figure out
its role in the cancer development. This review is based on literatures from early as 1970 until the
most recent study of monoamine oxidase, providing information including basic MAO A and B
genes, MAO A and B genes regulation, catalytic by-products, and the involvement in different
tumor proliferation pathways and at the meantime raising questions about the future studies in
finding out the role of monoamine oxidase in a wide range of cancers.

1
Chapter 1: Introduction to Monoamine oxidase

Monoamine oxidase A and B

Monoamine oxidase (MAO), is an enzyme that can oxidatively deaminate monoamine
neurotransmitters and dietary amines, with the production of aldehyde, ammonia and hydrogen
peroxide. (Shih et al., 1999)

MAO exists in two different but genetically related isoenzymes, MAO A and MAO B. These two
isoenzymes are derived from and encoded by two different genes (Bach et al., 1988), which both
locate on the X chromosome (Lan et al., 1989b). MAO A and MAO B proteins share 70% common
amino acid sequence identity (Shih et al., 2011). However, these two isoenzymes have different
distributions, substrate preferences, inhibitor specificities and biological functions. MAO A enzyme
is predominantly located in catecholaminergic neurons and MAO B is found mainly in serotonergic
and histaminergic neurons and glial cells. (Shih et al., 1999) They also have different substrates.
MAO A is mainly oxidizing serotonin (5-HT), norepinephrine (NE) and epinephrine, while MAO B
is mainly oxidizing phenylethylamine (PEA). MAO A and MAO B also share some common
substrates such as dopamine (DA) and tyramine. For their respective inhibitors, MAO A is
irreversibly inhibited by clorgyline and MAO B is irreversibly inhibited by deprenyl. (Shih et al.,

2
1999)

The MAO A and MAO B activity have been implicated in numerous neurological and psychiatric
disorders. (Bortolato et al., 2011; Bortolato and Shih, 2011; Scott et al., 2008) In this chapter, I will
summarize the regulation of MAO A and MAO B genes in order to get a better understanding of the
tissue specificity and expressions at translation level and to learn the molecular basis of these
mental disorders which are associated with MAO genes regulation.(Cases et al., 1995)

Monoamine oxidase in diseases

As neurotransmitters, it is crucially important for serotonin, norepinephrine and dopamine to be
degraded quickly after they play their roles in the neurotransmission. Monoamine oxidase (MAO) is
playing important roles in the regulation and degradation of these neurotransmitters and therefore
MAO abnormality has been associated with various neurological and psychological diseases
(Bortolato et al., 2008), among which are depression, anxiety, attention deficit hyperactivity
(ADHD), Parkinson’s disease (PD), Alzheimer’s disease, autism, etc.

MAO A genes disorder could result in aggressive behaviors and mental retardation in humans.
Similarly, in mice, MAO A knock-out (KO) mice could lead to aggressive behaviors such as

3
anti-social behaviors.

MAO B genes lead to different disorders. Low platelet MAO B activity with the increased levels of
PEA is related to alcoholism and stress-related disorders (Devor, 1993 Faraj 94 Grimsby 97). In
mice, MAO B KO mice display the behavior disinhibition and reduced anxiety behaviors.
(Bortolato et al., 2008) Moreover, MAO B activity is greatly inhanced in the rats’ and human brains
as they age. This finding indicates that MAO B might play a significant role in the aging process.

Monoamine oxidase (MAO) inhibitors

MAO A inhibitors are often used in treating many neurological disorders. For example, they can be
used as anti-depressant drugs to treat depression. MAO B inhibitors, on the other hand, could be
used to treat Parkinson’s disease (PD).

The function of these inhibitors is to protect neurons by preventing the cell damage from the
neurotoxins, reactive oxygen species (ROS) and apoptosis.

4
Chapter 2: Monoamine oxidase genes regulation

Transcriptional regulation of MAO genes

It is well known that MAO A and B genes are the regulators of many neurological and other
important human/animal functions and behaviors. Therefore, the identification of major factors that
regulate MAO A and B gene expression will be of great importance.

The core promoter region of MAO A and MAO B genes is composed of groups of Sp1 sites. (Chen
et al., 2005; Zhu et al., 1994) The human MAO B promoter region includes two clusters of
overlapping Sp1 sites separated by a CACCC element. (Zhang et al., 2001) Sp1 and Sp4 activate
the MAO B core promoter via Sp1 overlapping sites, and its activation is repressed by Sp3. A
Sp1-like transcription factor, TIEG2, also activates MAO B promoter via Sp1 overlapping sites,
although it represses the promoter activity via CACCC element. (Wong et al., 2001) The human
MAO A core promoter region contains four imperfect tandem repeats, each containing a
Sp1-binding site in reverse orientation. (Zhang et al., 2001; Zhu et al., 1994) A positive correlation
has been found among cellular Sp1 concentration and MAO A promoter and catalytic activity,
which indicates that Sp1 is an activator of MAO A gene expression. (Zhu et al., 1992) However
other controlling factors involved in the regulation of the human MAO A gene are unknown. (Shih

5
et al., 1993)

To investigate transcription factors that might interact with Sp1 sites and regulate MAO promoters,
three copies of Sp1-binding motifs derived from MAO B core promoter were used as the bait to
screen a human cDNA library in the yeast one-hybrid system. (Chen et al., 2011) Two novel
transcription factors have been identified, one of which was named R1 (RAM2/CDCA7L/JPO2).
The other one is still under investigation. (Ou et al., 2004, 2006a)

Transcriptional repressor R1 for MAO A gene
R1 is a novel repressor that could regulate MAO A gene expression. R1 preferentially binds to Sp1
sites in MAO A core promoter and inhibits MAO A promoter and catalytic activities. (Chen et al.,
2005)

R1 is indicated to be a MAO A gene repressor during transcription (Ou et al., 2006b) and it can
repress MAO A promoter activity by competing with Sp1 for binding to Sp1 sites. In the meantime,
R1 is able to interact with Sp1 sites directly. The experiments also showed that R1 over-expression
could down-regulate MAO A enzyme activity, which indicated the potential role of R1 in the
treatment of those neurological disorders and behaviors. (Johnson et al., 2011; Shichida et al., 1988)

6
Hormone regulation, MAO A/B, and cancer

The regulation of MAO is multi-factorial and a lot of research results have shown that hormonal
factors may be playing a role in the regulation of MAO A and B. There is evidence in literature
studies that the regulation of MAO involves estrogens. (Chakravorty and Halbreich, 1997) In the
meantime, the concept that hormones can increase the incidence of cancer in mice provides a good
hypothesis that estrogen and other types of hormones play an important role in causing human
cancers. (Fuhrman et al., 2012; Lumachi et al., 2010)

The hormone replacement therapy, which is commonly used by postmenopausal women, is found to
increase the incidence of breast cancer.(Cerne et al., 2011; Chen and Colditz, 1999; Shapiro et al.,
2011)

In animals, rats for example, it has been investigated in the past that estrogen has regulatory effects
on monoamine oxidase A and B in rats. (Holschneider et al., 1998) In this study, they found that
high dose estrogen significantly decreased MAO B activity in liver, kidney, and uterus, but not
much changes had been seen in heart, adrenal, lung and small intestine. For MAO A activity, it was
only observed a significant MAO A activity decrease in the brain. Therefore, it is suggested that
estrogen may have a tissue-specific effect on MAO A and B regulation.

7
In human beings, estrogen is associated with an increasing risk of breast and uterine cancer.
(Alvarez-Vasquez et al., 2003; Magnusson et al., 2000; Pike and Ross, 2000)
On the other hand, androgen is also indicated to regulate MAO genes expression and male
behaviors. (Hurd et al., 2011) It has been investigated the link between MAO A gene, aggression
and androgen regulation. The androgen receptor proteins are coded by the AR gene (MIM 313700),
located on the X chromosome (Xq11-q12). (Brown et al., 1989) The change in the sensitivity of the
androgen receptor is found to affect the expression of sexually dimorphic traits. (Zitzmann and
Nieschlag, 2003) However, the influence of genetic variation of aggression was only found to be in
the AR polymorphism. No evidence has been found to show variation in MAO A gene.

8
Chapter 3: Monoamine oxidase and cancer

Many studies have already shown the relationship between MAO genes with neurological
conditions such as depression. (Ford, 1986; Gunter et al., 2010; Meyer et al., 2006) However, there
is increasing interest in finding the link between MAO genes and cancer and some studies have
already proved the hypothesis to be validated. Up to the most recent studies on the relation between
MAO A and different types of cancer, there is still no definite answer to clarify the link and
elucidate the mechanism involved in various pathways.

It was shown in abundance that the MAO A expression in prostate cancer is high. More specifically,
the MAO A protein level is associated with the Gleason grades in prostate cancer. (White et al.,
2012) The more MAO A transcripts are, the higher the Gleason grades are found in the prostate
cancer cells. (True et al., 2006) They used immunohistochemical (IHC) analysis to assess the
grade-associated alterations and corresponding changes at protein level. They measured MAO A
protein levels by IHC on panels of tissue microarrays (TMAs). The results showed that MAO A
expression was significantly elevated in Gleason 4 or 5 sample cases compared to Gleason 3
samples (P<0.0001).

This study is providing a possible explanation at genetic level to link the MAO A high expression
with prostate cancer risk. It is known that MAO A expression is regulated by the sequence repeat in

9
the promoter area MAOA-uVNTR, with the full repeat of 30 nucleotides
(ACCGGCACCGGCACCAGTACCCGCACCAGT). 5-repeat (rare) shows much lower prostate
cancer rate than 3-repeat (common).

It’s also been indicated that there is a correlation between Gleason grade and cancer outcome.
Gleason grade 4 and 5 percentage is an important indicator of poor cancer curing rate. (Humphrey,
2004) The higher the grade 4/5 percentage is, the higher failure rate the cancer has. It is thus
important to understand the molecular basis of this phenomenon that high Gleason grade cancer has
poorer prognosis. The difference in the outcome is a reflection of different gene expressions at the
molecular level. It is reasonable to analyze the different gene expressions in high and low grade
cancer. Of all the genes expressed higher in Gleason grade 4/5 prostate cancer than Gleason grade 3,
MAO A is one of the most over-expressed genes. (True et al., 2006). By using the MAO A inhibitor
clorgyline, they have identified the anti-oncogenic and pro-differentiation effects of the inhibitors in
the MAO A gene expression. The inhibitor is promoting the differentiation of high grade prostate
cancer cells by increasing androgen receptor (AR) and prostate-specific antigen (PSA) gene
expression.

Another proposed mechanism is via the down-regulation of EZH2 expression. EZH2 is a polycomb
group protein with the oncogenic function and is often associated with metastatic disease. (Ezhkova
et al., 2009) It also represses the expression of differentiation-related genes. In high grade prostate

10
cancer, EZH2 is usually over-expressed, which can be considered as a risk factor for cancer
progression. Clorgyline is shown to induce differentiation-related gene expression by the EZH2
down-regulation. After treating with clorgyline for 24 hours, EZH2 mRNA was shown to decrease
by 32% . As a result in the high grade prostate cancer, clorgyline will restore the differentiation and
reduce the poorly differentiated aggressive phenotype. One previous study has also confirmed
EZH2’s oncogenic activity as a coactivator for critical transcription factors including androgen
receptor. (Xu et al., 2012b) In cells of castration-resistant prostate cancer (CRPC), EZH2 expression
is often correlated with the cancer progression. EZH2 expression was higher in CRPC than the early
state tumor condition. It also proved that the phosphorylation of EZH2 at the Ser21 position
mediated by PI3K-Akt pathway could switch the function of EZH2 from gene silencing into
coactivating transcription of androgen receptor. The oncogenic function of EZH2 could be further
applied and thus developing inhibitors that specifically targeting EZH2 activation function without
interrupting its gene-repressive function.

On the other hand, MAO A inhibitor is also inducing an anti-oncogenic effect in the high grade
malignant prostate cancer. Of all the genes greatly increased by clorgyline in the Significance
Analysis Microarrays (SAM), many genes are repressed in 7-12 oncogenic pathway signatures.
Many cell signaling pathways and factors may be involved in this effect. APC, a commonly
recognized tumor suppressor gene, is highly upregulated in clorgyline-treated cells. Another
important gene downregulated in prostate cancer, FAS, is also highly upregulated by clorgyline.

11
Besides the increase of these two cancer suppressor genes, the inhibition of the oncogenic pathways
also provides a possible explanation for this anti-oncogenic effect by clorgyline. It is shown that
clorgyline is downegulating oncogene expression such as beta-catenin and ERBB2. Table 1 below
shows the different gene changes.

PATHWAY
GENE
ONCOGENE TUMOR
SUPPRESOR
GENE
PRO-DIFFERENTIATION
GENES
LEVEL OF GENE
EXPRESSION
W/CLORGYLINE
APC Yes Increase
FAS Yes Increase
Beta-catenin Yes Decrease
ERBB2 Yes Decrease
AR YES Increase and
promote
differentiation
PSA YES Increase and
promote
differentiation

12
Table 1: This figure shows the changes in gene expression after clorgyline treatment. APC and
FAS genes had a higher expression while beta-catenin and ERBB2 expressed lower than control.
AR and PSA both showed pro-differentiation effects.

However, some studies on the MAO A regulation of cancer indicate opposite results.
Downregulation of MAO A expression is shown in cancer in various organs and species. (Rybaczyk
et al., 2008) To find the consistent changes in different cancer types, just as p53 mutation is seen in
over half of the cancer cases, they are trying to find some common cancer mechanisms shared in
many organs and species.

From tryptophan (Trp) related gene expression data in cancer, they found that only MOA A showed
decreased expression in multiple of tissues from humans, rodents, and fish. This provided a possible
solution in cancer treatment. The drugs that inhibit MAO A expression may provide a cure for
leukemia and all other cancers. (Abdul et al., 1994) The study, however, does not provide the
possible mechanisms underlying this phenomenon. Moreover, the cancer type in this study includes
malignant melanoma, small cell lung carcinoma, malignant pleural mesothelioma, basal-like cancer,
renal clear cell carcinoma, papillary thyroid cancer, liver cancer, breast tissue cancer, all of which
did not look into the prostate cancer cases. It is thus important to use a wider GEO database for
population and cancer type study.

13
In another study on MAO A expression in human cholangiocarcinoma, it is shown that MAO A
expression is suppressed while serotonin and dopamine levels are increased in cholangiocarcinoma.
(Huang et al., 2012) Even though the mechanism of this correlation is still unclear, it is
hypothesized in this study that the MAO A expression is suppressed via both promoter
hypermethylation and IL-6 signaling in a coordinated manner. They applied a computer-based
analysis using Emboss cpgplot software on MAO A promoter region. The results showed that there
was a significant negtive correlation between the methylation level and the MAO A expression in
the cholangiocarcinoma samples compared to non-malignant controls. However, the correlation
coefficient was low, indicating that it might be other factors influencing the MAO A expression in
the cholangiocarcinoma samples. Therefore, they continued finding more possible ways that could
affect methylation of the MAO A promoter region. It’s known that cholangiocarcinoma cells secrete
high levels of IL-6 (Park et al., 1999; Yokomuro et al., 2000), they assessed in later research about
the IL-6 signaling in MAO A expression. The results suggested that IL-6 signaling did decrease the
MAO A expression in the cancer cases, but not through promoter hypermethylation regulation.
Later study then focused on the balance between Sp-1 and R1 transcriptional activity. It is shown in
early researches that human MAO A promoter region contains 4 Sp-1 sites and the cellular Sp-1
concentration is correlated with MAO A promoter activity, which indicates that Sp-1 is a positive
regulator of MAO A expression (Zhu et al., 1994). On the other hand, R1 also binds to Sp-1 (Chen
et al., 2005), completing with Sp-1 for the same sequence. These results from earlier studies provide
a good suggestion that IL-6 signaling may increase the association of the R1 with the MAO A

14
promoter, thus preventing the access of Sp-1 to its sequence. The mechanism of why IL-6 signaling
is influencing R1 function is not known, but it is shown in early studies that IL-6 can upregulate
c-myc expression in cancer cells. (Shi et al., 2011) IL-6 can increase the c-myc expression and this
can further enhance the colocalizaion of c-myc with R1, thus increasing R1 function.

Based on this study, it is thus very useful if we assess the MAO A promoter region methylation
degree and IL-6 signaling in prostate cancer, the results might provide insight into finding out the
mechanism underlying why the knock down of MAO A gene leads to no prostate cancer.

MAOA and prostate cancer

A study group from School of Medicine in Stanford University has done a lot of research in MAO A
and prostate cancer. (Peehl et al., 2008) They found out that MAO A was highly expressed in
normal basal prostatic epithelium and high-grade (grade 4/5) primary prostate cancer. In contrast,
low expression of MAO A was found in normal secretory prostatic epithelium and low-grade (grade
3) prostate cancer. Experiments were done both in vivo and in vitro. (Zhao et al., 2008) Similarly,
an earlier study in 2006 from Dr. Laurence True’s lab did immunohistochemistry of tissue
microarrays comprising >800 benign and cancerous prostate specimens, indicating the relation
between high levels of MAOA protein expression and grade 4/5 cancer. Therefor, MAO A seems to

15
be a deleterious feature of prostate cancer and can be further used as a promising biomarker for
metastatic prostate cancer.(True et al., 2006)

Serotonin and prostate cancer

5-hydroxytryptamine (5-HT), commonly known as serotonin, is a monoamine neurotransmitter
released by prostate neuroendocrine cells. (Baruk et al., 1958; Pratuangdejkul et al., 2008) 5-HT can
be oxidatevely deaminated by MAOA, modulating normal neuronal conditions. Therefore, the
activity and amount of 5-HT could affect different levels of neurological states and further change
in behavior levels modulated by the activity and amount of monoamine oxidase. (Choudhary et al.,
2013; Mousseau et al., 1996)

Besides its prominent effects in neurological diseases, 5-HT also has a very fundamental role in
tumor growth, differentiation and gene expression. It has been related to many malignant diseases
such as prostate (Dizeyi et al., 2004; Shinka et al., 2011) and breast cancer. (Ashbury et al., 2010;
V on Ah et al., 2012) In the meantime, there are also studies on the investigation of the impact of
neurosecretory products such as 5-HT on the neuroendocrine tumor cells in prostate cancer by some
scientists in Germany. (Heinrich et al., 2011) The neuroendocrine differentiated tumor cells, known
as NETC, are found in most prostate carcinomas. (di Sant'Agnese, 1998, 2001) NETC are observed

16
to increase in high-grade prostate cancers compared to low-grade ones, which provides extra
evidence for previous results that MAO A has high expressions in high-grade prostate cancers.
(True et al., 2006)

5-HT functions are mediated by its specific receptors. (Sonier et al., 2006) (Gartner et al., 2010) or
5-HT transporters (Grassi et al., 2010). According to a study in a urologic research group in Sweden,
5-HT is shown to activate many signaling pathways in some prostate cancer cell lines (Dizeyi et al.,
2011). In some extracellular signal-regulated pathways, 5-HT can activate MAP kinase pathway
(through Erk1/2) and get phosphorylated in PI3K/Akt pathway. These two pathways are known for
cell proliferation and cell migration (Jeng et al., 2000; Jimenez and Montiel, 2005; Shapiro, 2002).
In prostate cancer, the growth and differentiation of prostate cancer cells could be modulated by
these regulatory peptides such as Erk1/2 and Akt, in MAP kinase pathway and PI3K signaling
pathway. The interactions of these peptides in these signaling pathways with specific 5-HT
receptors could lead to pathway activation and thus cell proliferation, which is a bad sign in tumor
growth. To begin this process, 5-HT is initiated by binding to 5-HT receptors (5-HTRs), or through
some certain active transport of 5-HT to specific cells, with the help of 5-HT transporters, known as
5-HTTs. The members of the PI3K family comprise very important regulatory proteins that control
functions such as the growth and survival of prostate cancer cells. It has also been investigated that
hyper-activation of Akt, which is a main downstream effector of PI3K proteins, is a major sign of
advanced prostate cancer. A main factor contributing to stimulation of Akt is the tumor suppressor

17
gene encoding phosphatase and tensin homologue (PTEN), which is frequently mutated in prostate
cancer cells.

However, 5-HT initiated cell signaling events are very complex and only partially understood. In
this study, they found that 5-HT could induce proliferation in two cell lines (PC-3 and Du145), but
there was little or no effect on LNCaP cell lines. Meanwhile, according to their results, only 5-HTR
subtype 1 was reported to activate Erk1/2 and Akt in various cell types. Therefore, it is possible in
the future studies to target 5-HT receptors as a novel target to treat some types of malignant prostate
cancer.

Serotonin receptors include a very complex and big group of receptors. Categorized by the function,
structure and pharmacological properties, these receptors are grouped into seven classes. (Hoyer et
al., 1994) Of these over 15 different receptors, only 5-HT3A and 5-HT3B are working by
ligand-gated ion channels and the rest of which are all G-protein coupled receptors. (Hoyer and
Martin, 1996)

Different types of serotonin receptors are expressed in various stages of prostate cancer and tumor
growth. Overexpression of serotonin receptors is usually related to tumor progression and poor
prognosis. The antagonists such as Quetiapine and Ketanserin (Romero and Artigas, 1997) to these
5-HT receptors (5-HTRs) can therefore inhibit the proliferation of human prostate cancer cell lines.

18
Knowing the importance of 5-HT receptors, research groups have also been focusing on serotonin
receptors in prostate cancer treatment for many years (Siddiqui et al., 2006).

5-HTR subtype 1 is composed of five members and among which 5-HTR1A is the most studied one.
It’s been shown in many investigations in subtype 1 receptors that 5-HTR1A can inhibit the
progression and growth of three prostate tumor cell lines, namely PC-3, DU145, and LNCaP.
(Abdul et al., 1994; Abdul et al., 1995) More prominently, another commonly studied 5-HT type 1
receptor 5-HTR1B has shown even better results in prostate cancer tumor growth. (Siddiqui et al.,
2006) They investigated in the effect of 5-HT and 5-HT antagonists on the growth
of prostate cancer cells and they identified 5-HT receptor expression in PC3 cells and in human
hormone refractory prostate cancer tissue. Their results showed that in prostate cancer cells
PC3, 5-HT1A and 5-HT1B antagonists could greatly inhibit growth and induce cell apoptosis.
Therefore, they believe that the growth inhibition caused by the 5-HT1B antagonist (SB224289 HCl)
is a very novel finding, as is apoptosis caused by the 2 antagonists 5-HT1A and 1B. This effect is
most likely to be mediated via 5-HT1A and 1B receptors. Therefore, these results highly imply
that 5-HT1A and in particular 5-HT1B receptor antagonists worth further investigations as potential
anti-neoplastic agents.

5-HT receptors 2B and 4 are found to express in human hormone refractory prostate cancer (HRPC).
(Dizeyi et al., 2005) 5-HTR2B was expressed in both low-grade and high-grade tumors while

19
5-HTR4 was only observed in high-grade tumors.

However, opposite to these findings above that 5-HT is viewed as a growth factor for some different
cancers and the antagonists of 5-HTRs serve as treatment for some types of cancer, some scientists
have different results about the roles of 5-HT on cancer. 5-HT receptor 1 agonist is proved to inhibit
tumor growth through some vascular restrictive effects in some tumor growing regions supplied by
these vessels. (Baguley et al., 1993) This is also in contradiction to some researches on MAO A and
prostate cancer. (Flamand et al., 2010) One study has shown that the treatment with clorgyline, a
commonly used MAO A inhibitor, can slow down the tumor growth and metastasis in VCaP
prostate cancer cells.

Hydrogen peroxide and cancer

Oxygen radicals are often associated with different steps of carcignogenesis and aging processes.
(Minelli et al., 2009) The reactive oxygen species, commonly known as ROS, are usually formed
endogenously from the normal oxygen-utilizing metabolic processes (Essick and Sam, 2010; Ishii,
2007) and are important mediators of growth and angiogenesis in cancer (Lim et al., 2005). Cell
DNA damage is often decreased by the defence mechanisms by the cells, using enzymes and
non-enzyme anti-oxidants to detoxify the toxic molecules. (Kamodyova et al., 2013; Karpinska and

20
Gromadzka, 2013) However, permanent and non-reverse damage will be caused to cells in many
cases. (Marabini et al., 2011; Moreira et al., 2009; Suo et al., 2011)

Hydrogen peroxide, a natural endogenous product from mitochondria, is functioning to control the
normal cell growth and death processes. Meanwhile, these free radicals will lead to cell damage and
thus the aging process. (Balliet et al., 2011) Hydrogen peroxide is one of the important by-products
in the monoamine oxidase deamination process. It is therefore reasonable to ask the role of
hydrogen peroxide in the link of monoamine oxidase and cancer.

In recent years, it’s been widely acknowledged that hydrogen peroxide plays an important role in
cell proliferation and migration, thus having a huge impact on cancer progression. Hydrogen
peroxide can induce prostate cancer in vitro, specifically in LNCaP cell lines, increasing the cell
proliferation and migration. (Polytarchou et al., 2005) Hydrogen peroxide inhibition is therefore
considered to decrease tumor cells proliferation and migration. This finding is in accordance with
the results indicating that MAO A inhibition could provide a treatment for certain types of cancer.
(Flamand et al., 2010; Peehl et al., 2008)

Oxidative stress and anti-oxidant imbalance is often regarded as a typical biomarker of cancer
patients, prostate cancer patients in particular. The oxidative damage in the prostate cancer patients
is often associated with higher lipid peroxidation and lower antioxidant levels (Kariya et al., 2009),

21
breaking the normal balance of oxidative and anti-oxidant materials.

More specifically, in prostate cancer, it’s been demonstrated that the human prostate cancer had an
increasing level of hydrogen peroxide (Lim et al., 2005), which increased the tumor and metastatic
potential. It might exist many ways to result in over-produced hydrogen peroxide, which in the
previous case the hydrogen peroxide was produced following the production of NOX1 (NADPH
oxidases). This is an interesting finding if we relate this to the monoamine oxidation process.
During the deamination process, hydrogen peroxide level in mitochondria and cell is increasing as
the previous studies have shown. Therefore, in view of similar results that hydrogen peroxide
production would result in prostate cancer, it is important we ask the mechanism underlying this
relation and what pathways are involved in these processes.

On the basis of many hypotheses, some groups and scientists have demonstrated that the
progression of prostate cancer cells is partly contributed to by hydrogen peroxide through the
activation of one protein factor named Activator Protein 1 (AP-1) and the up-regulation of heparin
affin regulatory peptide (HARP) gene (Polytarchou et al., 2005). In most mammals, some signal
transduction pathways are directly or indirectly activated by hydrogen peroxide, including the AP-1
pathway. In the meantime, the HARP is investigated and proved to have many different roles in
tumor angiogenesis, as well as in some carcinomas such as prostate cancer, showing the
proto-oncogene functions (Hatziapostolou et al., 2005; Papadimitriou et al., 2004; Wu et al., 2005).

22
Further investigations into QP-1 and HARP are still needed to validate this pathway and find other
involved pathways in this complex interactions of proteins and transcriptional factors.

Genetics of MAO A and MAO B
Both MAO A and MAO B consist of two subunits of molecular masses of 63 and 60 kilodaltons.
(Lan et al., 1989a)In gene level, MAOA gene is located at the chromosome Xp11.3. An upstream
repeat in MAOA promoter region is often known as MAOA-uVNTR. This uVTR repeat can
normally change MAOA gene expression 2-10 folds, depending on the number of the repeats.

The full repeat (ACCGGCACCGGCACCAGTACCCGCACCAGT) is 30 nucleotides long and
contains smaller repetitive sequence blocks. To our knowledge, no studies examining the
relationship between MAOA polymorphisms and risk of prostate cancer have been published to
date.

The observation of MAOA dysregulation in prostate cancer led to the hypothesis that genetic
polymorphisms affecting MAOA expression and activity might influence risk of developing
prostate cancer and confer a phenotype of more clinically aggressive disease. Further studies on this
link is needed to examine the association between the MAOA promoter repeat polymorphism and
the risk of developing prostate cancer, using a larger number of population-based studies.

23

Some studies have shown that MAOA expression is elevated in malignant prostate cancer.
Meanwhile, MAOA protein levels are examined and shown to be related with higher Gleason
grades. Thus, it is relevant to get the conclusion that MAOA expression is associated with prostate
cancer severity. The genetic mechanisms of the link between MAOA gene expression and prostate
cancer risk have not been established yet. However, population-based studies have been done within
Caucasian populations in a case-control study.

24
Chapter 4: MAO and apoptosis
Cancer and apoptosis

Apoptosis is a normal physiological activity for cell death. (Varghese et al., 2002) The normal
balance of cell proliferation and death is crucially important for the regular development of healthy
cell and body. (Khosraviani et al., 1996; Zheng et al., 2007) Many genes that include oncogenes and
tumor suppressor genes are closely involved in apoptosis control. For instance, in some malignant
cancers, the cause of the tumor growth is the mutation of either oncogenes or tumor suppressor
genes. (Mommers et al., 1999; Peeters et al., 2006) As a result, the apoptosis control is no longer
working in the right way and the tumor cells will proliferate enormously. (Bernini et al., 2002;
Zheng et al., 2009)

Cancer is a very complicated disease caused by the mutations of oncogenes or tumor suppressor
genes. Many cell signaling pathways can lead to cancer if any component in the signaling pathways
goes wrong. Resisting cell death is one of the hallmarks of cancer (Hanahan and Weinberg, 2011)
and the programmed cell death by apoptosis is considered a natural barrier to cancer
development.(Hainaut and Plymoth, 2013) A great deal of research findings have been suggesting
that cancer is highly related to apoptosis, also known as programmed cell death (PCD).(Ouyang et
al., 2012)

25
Apoptosis is the major type of cell death, also known as type one programmed cell death, occurs
when DNA damage is irreparable. (Tan et al., 2009) There are two major pathways that can induce
cell apoptosis. One is the death receptor pathway and the other is the mitochondrial pathway.
(Amelio et al., 2011)

The death receptor pathway, which is also known as the extrinsic pathway, is triggered by the
binding of plasma membrane death receptor such as Fas, or tumor necrosis receptor one with the
extracellular ligand called Fas-L.(Sun, 2011) By the time that a death signal appears, the Fas-L will
combine with Fas to form a death complex. Then the Fas/Fas-L complex will attract the death
domain-containing protein and pro-caspase-8, accumulating together to form the apoptosis-inducing
signaling composite. As a result, the protein composite begins activating its pro-caspase-8, which
immediately triggers pro-caspase-3, the penultimate enzyme for execution of the apoptotic
process.(Kerr et al., 1972) (Bell et al., 2008)

On the other hand, the mitochondria pathway, also known as the intrinsic pathway, can also
contribute to the cell apoptosis. (Kerr et al., 1972)So far, many signaling pathways have been
proved to be involved in the apoptotic regulatory process such as PI3K/Akt cascade, Bcl-2, MAPKs,
NFkB and Atg-related pathways.(Cheng et al., 2009) In either pathway discussed above, there is
abundance of evidence that the alterations or abnormal changes to the major regulatory factors can
result in cancers. Therefore, apoptosis can be related to cancer via many complicated factors and

26
pathways. The apoptotic pathway can be studied as a target for the treatment of cancer by targeting
tumor cells in many anti-cancer therapies. (Liu et al., 2011)

MAOs and apoptosis

In the above discussion about the endogenous and exogenous compounds that play an important
role in either pro-apoptotic or anti-apoptotic regulatory pathway (Jacobson et al., 1993), many
researchers have done investigations into the mitochondria control of cell apoptosis process.
(Kroemer et al., 1997; Leist et al., 1997) It’s been indicated that MAO A is involved in cell
apoptotic signaling pathway. (Ou et al., 2006b) MAO A is playing an important role in apoptosis
and the MAO A inhibitor, clorgyline is shown to protect cell from apoptosis. This was supported by
the studies using PC 12 cells and human neuroblastoma SH-SY5Y cell lines. MAO A inhibitor
N-propargylamine could inhibit the cell apoptotic pathway via the increase of antiapoptotic Bcl-2.
In addition, over-expression of R1 can also inhibit the apoptosis process by repressing the activity
of MAO A.

MAOs can produce cytotoxic metabolites at the mitochondria membranes in the catalytic processes
by producing oxidative products such as hydrogen peroxide, as in the oxidative deamination process
of tyramine, damaging the mitochondria DNA of the normal cells. (Hauptmann et al., 1996) The

27
activation of monoamine oxidases (MAOs) can induce plenty of oxidative stress in both human and
animals. (Xu et al., 2012a) MAOs catalyze the oxidative deamination of a variety of monoamines
and thus resulting in the production of reactive oxygen species (ROS). (Riazantseva et al., 2008)
These ROS play a very important part in the development and progression of cell damage, leading
to apoptosis.

5-HT, one of the major by-products from MAO deamination, is also suggested to have an important
role in the pro-apoptotic pathway.(Bianchi et al., 2005) One study performed on cardiomyocytes
indicates that 5-HT is working as the major pro-apoptotic factor in the apoptosis pathway and takes
effects without the need of receptor stimulation. (Bianchi et al., 2005)

On basis of the relation between MAO and apoptosis process, many studies have been done in
investigating MAO inhibitor’s function in the cell apoptosis pathways.

28
Chapter 5: Conclusion

In view of all the studies and discussions above about the role of monoamine oxidase A/B in cancer
development, it is almost certain that MAO A/B, either through its substrate and by-products (such
as 5-HT and hydrogen peroxide) or by its direct interaction with other important factors and
proteins in carcinogenesis (such as APC, EZH2, FAS, Beta-catenin, ERBB2, AR, IL-6, etc.), is
associated with the progression of cancer.

The purpose of these investigations is to find out the link between monoamine oxidase and cancer
and thus finding new solutions to curing cancer. MAO-A has the potential to be used as an
important indicator of cancer. Targeting MAO-A is thus the next hypothesis in many different
anti-cancer fields and MAO-A inhibitors are expected to be further investigated and developed as
the next generation of anti-cancer drugs. Many recent studies on the relation between MAO A and
prostate cancer has provided increasing evidence that MAO A inhibitors such as clorgyline is
inducing anti-oncogenic effect and pro-differentiation effect on high grade prostate cancer cells.

Important substrate such as 5-HT is involved in the cause of cancer, mediated by different types of
serotonin receptors. However, studies by scientists in different fields sometimes find different
results, or even contradicting evidence indicating that the downregulation of MAO A was found in
multiple organs and species in cancer cases. Therefore, it is even more important in future studies to

29
investigate in various regions and in as many as related pathways to better understand these
complex relations.

30
Bibliography

Abdul, M., Anezinis, P.E., Logothetis, C.J., and Hoosein, N.M. (1994). Growth inhibition of
human prostatic carcinoma cell lines by serotonin antagonists. Anticancer research 14,
1215-1220.

Abdul, M., Logothetis, C.J., and Hoosein, N.M. (1995). Growth-inhibitory effects of serotonin
uptake inhibitors on human prostate carcinoma cell lines. The Journal of urology 154,
247-250.

Alvarez-Vasquez, R.B., Axelrod, D., Frenkel, K., Newman, M.C., Sepkovic, D.W., Bradlow, H.L.,
and Zumoff, B. (2003). Influence of postmenopausal hormone replacement therapy on an
estrogen metabolite biomarker of risk for breast cancer. Hormone and metabolic research
= Hormon- und Stoffwechselforschung = Hormones et metabolisme 35, 358-361.

Amelio, I., Melino, G., and Knight, R.A. (2011). Cell death pathology: cross-talk with
autophagy and its clinical implications. Biochemical and biophysical research
communications 414, 277-281.

31
Ashbury, J.E., Levesque, L.E., Beck, P.A., and Aronson, K.J. (2010). A population-based
case-control study of Selective Serotonin Reuptake Inhibitors (SSRIs) and breast cancer:
the impact of duration of use, cumulative dose and latency. BMC medicine 8, 90.

Bach, A.W., Lan, N.C., Johnson, D.L., Abell, C.W., Bembenek, M.E., Kwan, S.W., Seeburg, P.H.,
and Shih, J.C. (1988). cDNA cloning of human liver monoamine oxidase A and B: molecular
basis of differences in enzymatic properties. Proceedings of the National Academy of
Sciences of the United States of America 85, 4934-4938.

Baguley, B.C., Cole, G., Thomsen, L.L., and Li, Z. (1993). Serotonin involvement in the
antitumour and host effects of flavone-8-acetic acid and 5,6-dimethylxanthenone-4-acetic
acid. Cancer chemotherapy and pharmacology 33, 77-81.

Balliet, R.M., Capparelli, C., Guido, C., Pestell, T.G., Martinez-Outschoorn, U.E., Lin, Z.,
Whitaker-Menezes, D., Chiavarina, B., Pestell, R.G., Howell, A., et al. (2011). Mitochondrial
oxidative stress in cancer-associated fibroblasts drives lactate production, promoting
breast cancer tumor growth: understanding the aging and cancer connection. Cell cycle 10,
4065-4073.

Baruk, H., Launay, J., Berges, J., Perles, R., and Conte, C. (1958). [Neurological &

32
psychological effects of various indole derivatives on animals; serotonin, tryptamine,
beta-indolacetic acid & indole]. Annales medico-psychologiques 116, 115-125; discussion
125-117.

Bell, B.D., Leverrier, S., Weist, B.M., Newton, R.H., Arechiga, A.F., Luhrs, K.A., Morrissette,
N.S., and Walsh, C.M. (2008). FADD and caspase-8 control the outcome of autophagic
signaling in proliferating T cells. Proceedings of the National Academy of Sciences of the
United States of America 105, 16677-16682.

Bernini, G.P., Moretti, A., Viacava, P., Bonadio, A.G., Iacconi, P., Miccoli, P., and Salvetti, A.
(2002). Apoptosis control and proliferation marker in human normal and neoplastic
adrenocortical tissues. British journal of cancer 86, 1561-1565.

Bianchi, P., Kunduzova, O., Masini, E., Cambon, C., Bani, D., Raimondi, L., Seguelas, M.H.,
Nistri, S., Colucci, W., Leducq, N., et al. (2005). Oxidative stress by monoamine oxidase
mediates receptor-independent cardiomyocyte apoptosis by serotonin and postischemic
myocardial injury. Circulation 112, 3297-3305.

Bortolato, M., Chen, K., Godar, S.C., Chen, G., Wu, W., Rebrin, I., Farrell, M.R., Scott, A.L.,
Wellman, C.L., and Shih, J.C. (2011). Social deficits and perseverative behaviors, but not

33
overt aggression, in MAO-A hypomorphic mice. Neuropsychopharmacology : official
publication of the American College of Neuropsychopharmacology 36, 2674-2688.

Bortolato, M., Chen, K., and Shih, J.C. (2008). Monoamine oxidase inactivation: from
pathophysiology to therapeutics. Advanced drug delivery reviews 60, 1527-1533.

Bortolato, M., and Shih, J.C. (2011). Behavioral outcomes of monoamine oxidase deficiency:
preclinical and clinical evidence. International review of neurobiology 100, 13-42.

Brown, C.J., Goss, S.J., Lubahn, D.B., Joseph, D.R., Wilson, E.M., French, F.S., and Willard, H.F.
(1989). Androgen receptor locus on the human X chromosome: regional localization to
Xq11-12 and description of a DNA polymorphism. American journal of human genetics 44,
264-269.

Cases, O., Seif, I., Grimsby, J., Gaspar, P., Chen, K., Pournin, S., Muller, U., Aguet, M., Babinet, C.,
Shih, J.C., et al. (1995). Aggressive behavior and altered amounts of brain serotonin and
norepinephrine in mice lacking MAOA. Science 268, 1763-1766.

Cerne, J.Z., Novakovic, S., Frkovic-Grazio, S., Pohar-Perme, M., Stegel, V., and Gersak, K.
(2011). Estrogen metabolism genotypes, use of long-term hormone replacement therapy

34
and risk of postmenopausal breast cancer. Oncology reports 26, 479-485.

Chakravorty, S.G., and Halbreich, U. (1997). The influence of estrogen on monoamine
oxidase activity. Psychopharmacology bulletin 33, 229-233.

Chen, K., Ou, X.M., Chen, G., Choi, S.H., and Shih, J.C. (2005). R1, a novel repressor of the
human monoamine oxidase A. The Journal of biological chemistry 280, 11552-11559.

Chen, K., Ou, X.M., Wu, J.B., and Shih, J.C. (2011). Transcription factor E2F-associated
phosphoprotein (EAPP), RAM2/CDCA7L/JPO2 (R1), and simian virus 40 promoter factor 1
(Sp1) cooperatively regulate glucocorticoid activation of monoamine oxidase B. Molecular
pharmacology 79, 308-317.

Chen, W.Y., and Colditz, G. (1999). Hormone replacement therapy, selective estrogen
receptor modulators, and breast cancer risk. Menopause 6, 279-281.

Cheng, Y., Qiu, F., Ye, Y.C., Guo, Z.M., Tashiro, S., Onodera, S., and Ikejima, T. (2009).
Autophagy inhibits reactive oxygen species-mediated apoptosis via activating p38-nuclear
factor-kappa B survival pathways in oridonin-treated murine fibrosarcoma L929 cells. The
FEBS journal 276, 1291-1306.

35

Choudhary, K.M., Mishra, A., Poroikov, V.V., and Goel, R.K. (2013). Ameliorative effect of
Curcumin on seizure severity, depression like behavior, learning and memory deficit in
post-pentylenetetrazole-kindled mice. European journal of pharmacology 704, 33-40.

di Sant'Agnese, P.A. (1998). Neuroendocrine differentiation in prostatic carcinoma: an
update. The Prostate Supplement 8, 74-79.

di Sant'Agnese, P.A. (2001). Neuroendocrine differentiation in prostatic carcinoma: an
update on recent developments. Annals of oncology : official journal of the European
Society for Medical Oncology / ESMO 12 Suppl 2, S135-140.

Dizeyi, N., Bjartell, A., Hedlund, P., Tasken, K.A., Gadaleanu, V., and Abrahamsson, P.A.
(2005). Expression of serotonin receptors 2B and 4 in human prostate cancer tissue and
effects of their antagonists on prostate cancer cell lines. European urology 47, 895-900.

Dizeyi, N., Bjartell, A., Nilsson, E., Hansson, J., Gadaleanu, V., Cross, N., and Abrahamsson, P.A.
(2004). Expression of serotonin receptors and role of serotonin in human prostate cancer
tissue and cell lines. The Prostate 59, 328-336.

36
Dizeyi, N., Hedlund, P., Bjartell, A., Tinzl, M., Austild-Tasken, K., and Abrahamsson, P.A.
(2011). Serotonin activates MAP kinase and PI3K/Akt signaling pathways in prostate
cancer cell lines. Urologic oncology 29, 436-445.

Essick, E.E., and Sam, F. (2010). Oxidative stress and autophagy in cardiac disease,
neurological disorders, aging and cancer. Oxidative medicine and cellular longevity 3,
168-177.

Ezhkova, E., Pasolli, H.A., Parker, J.S., Stokes, N., Su, I.H., Hannon, G., Tarakhovsky, A., and
Fuchs, E. (2009). Ezh2 orchestrates gene expression for the stepwise differentiation of
tissue-specific stem cells. Cell 136, 1122-1135.

Flamand, V., Zhao, H., and Peehl, D.M. (2010). Targeting monoamine oxidase A in advanced
prostate cancer. Journal of cancer research and clinical oncology 136, 1761-1771.

Ford, M.F. (1986). Treatment of depression in Huntington's disease with monoamine
oxidase inhibitors. The British journal of psychiatry : the journal of mental science 149,
654-656.

Fuhrman, B.J., Schairer, C., Gail, M.H., Boyd-Morin, J., Xu, X., Sue, L.Y., Buys, S.S., Isaacs, C.,

37
Keefer, L.K., Veenstra, T.D., et al. (2012). Estrogen metabolism and risk of breast cancer in
postmenopausal women. Journal of the National Cancer Institute 104, 326-339.

Gartner, R., Cronin-Fenton, D., Hundborg, H.H., Pedersen, L., Lash, T.L., Sorensen, H.T., and
Kroman, N. (2010). Use of selective serotonin reuptake inhibitors and risk of re-operation
due to post-surgical bleeding in breast cancer patients: a Danish population-based cohort
study. BMC surgery 10, 3.

Grassi, L., Rossi, E., Cobianchi, M., Aguiari, L., Capozzo, M., Martinis, E., Nanni, M.G., Lelli, G.,
Schillani, G., Biancosino, B., et al. (2010). Depression and serotonin transporter (5-HTTLPR)
polymorphism in breast cancer patients. Journal of affective disorders 124, 346-350.

Gunter, T.D., Vaughn, M.G., and Philibert, R.A. (2010). Behavioral genetics in antisocial
spectrum disorders and psychopathy: a review of the recent literature. Behavioral sciences
& the law 28, 148-173.

Hainaut, P., and Plymoth, A. (2013). Targeting the hallmarks of cancer: towards a rational
approach to next-generation cancer therapy. Current opinion in oncology 25, 50-51.

Hanahan, D., and Weinberg, R.A. (2011). Hallmarks of cancer: the next generation. Cell 144,

38
646-674.

Hatziapostolou, M., Delbe, J., Katsoris, P., Polytarchou, C., Courty, J., and Papadimitriou, E.
(2005). Heparin affin regulatory peptide is a key player in prostate cancer cell growth and
angiogenicity. The Prostate 65, 151-158.

Hauptmann, N., Grimsby, J., Shih, J.C., and Cadenas, E. (1996). The metabolism of tyramine
by monoamine oxidase A/B causes oxidative damage to mitochondrial DNA. Archives of
biochemistry and biophysics 335, 295-304.

Heinrich, E., Trojan, L., Friedrich, D., Voss, M., Weiss, C., Michel, M.S., and Grobholz, R.
(2011). Neuroendocrine tumor cells in prostate cancer: evaluation of the neurosecretory
products serotonin, bombesin, and gastrin - impact on angiogenesis and clinical follow-up.
The Prostate 71, 1752-1758.

Holschneider, D.P., Kumazawa, T., Chen, K., and Shih, J.C. (1998). Tissue-specific effects of
estrogen on monoamine oxidase A and B in the rat. Life sciences 63, 155-160.

Hoyer, D., Clarke, D.E., Fozard, J.R., Hartig, P.R., Martin, G.R., Mylecharane, E.J., Saxena, P.R.,
and Humphrey, P.P. (1994). International Union of Pharmacology classification of receptors

39
for 5-hydroxytryptamine (Serotonin). Pharmacological reviews 46, 157-203.

Hoyer, D., and Martin, G.R. (1996). Classification and nomenclature of 5-HT receptors: a
comment on current issues. Behavioural brain research 73, 263-268.

Huang, L., Frampton, G., Rao, A., Zhang, K.S., Chen, W., Lai, J.M., Yin, X.Y., Walker, K.,
Culbreath, B., Leyva-Illades, D., et al. (2012). Monoamine oxidase A expression is
suppressed in human cholangiocarcinoma via coordinated epigenetic and IL-6-driven
events. Laboratory investigation; a journal of technical methods and pathology 92,
1451-1460.

Humphrey, P.A. (2004). Gleason grading and prognostic factors in carcinoma of the
prostate. Modern pathology : an official journal of the United States and Canadian Academy
of Pathology, Inc 17, 292-306.

Hurd, P.L., Vaillancourt, K.L., and Dinsdale, N.L. (2011). Aggression, digit ratio and variation
in androgen receptor and monoamine oxidase a genes in men. Behavior genetics 41,
543-556.

Ishii, N. (2007). Role of oxidative stress from mitochondria on aging and cancer. Cornea 26,

40
S3-9.

Jacobson, M.D., Burne, J.F., King, M.P., Miyashita, T., Reed, J.C., and Raff, M.C. (1993). Bcl-2
blocks apoptosis in cells lacking mitochondrial DNA. Nature 361, 365-369.

Jeng, M.H., Yue, W., Eischeid, A., Wang, J.P., and Santen, R.J. (2000). Role of MAP kinase in
the enhanced cell proliferation of long term estrogen deprived human breast cancer cells.
Breast cancer research and treatment 62, 167-175.

Jimenez, E., and Montiel, M. (2005). Activation of MAP kinase by muscarinic cholinergic
receptors induces cell proliferation and protein synthesis in human breast cancer cells.
Journal of cellular physiology 204, 678-686.

Johnson, S., Stockmeier, C.A., Meyer, J.H., Austin, M.C., Albert, P.R., Wang, J., May, W.L.,
Rajkowska, G., Overholser, J.C., Jurjus, G., et al. (2011). The reduction of R1, a novel
repressor protein for monoamine oxidase A, in major depressive disorder.
Neuropsychopharmacology : official publication of the American College of
Neuropsychopharmacology 36, 2139-2148.

Kamodyova, N., Tothova, L., and Celec, P. (2013). Salivary markers of oxidative stress and

41
antioxidant status: Influence of external factors. Disease markers.

Kariya, S., Sawada, K., Kobayashi, T., Karashima, T., Shuin, T., Nishioka, A., and Ogawa, Y.
(2009). Combination treatment of hydrogen peroxide and X-rays induces apoptosis in
human prostate cancer PC-3 cells. International journal of radiation oncology, biology,
physics 75, 449-454.

Karpinska, A., and Gromadzka, G. (2013). Oxidative stress and natural antioxidant
mechanisms: the role in neurodegeneration. From molecular mechanisms to therapeutic
strategies. Postepy higieny i medycyny doswiadczalnej 67, 43-53.

Kerr, J.F., Wyllie, A.H., and Currie, A.R. (1972). Apoptosis: a basic biological phenomenon
with wide-ranging implications in tissue kinetics. British journal of cancer 26, 239-257.

Khosraviani, K., Williamson, K., and Hamilton, P. (1996). Apoptosis and proliferation: the
balance. Gastroenterology 110, 1323-1324.

Kroemer, G., Zamzami, N., and Susin, S.A. (1997). Mitochondrial control of apoptosis.
Immunology today 18, 44-51.

42
Lan, N.C., Chen, C.H., and Shih, J.C. (1989a). Expression of functional human monoamine
oxidase A and B cDNAs in mammalian cells. Journal of neurochemistry 52, 1652-1654.

Lan, N.C., Heinzmann, C., Gal, A., Klisak, I., Orth, U., Lai, E., Grimsby, J., Sparkes, R.S.,
Mohandas, T., and Shih, J.C. (1989b). Human monoamine oxidase A and B genes map to Xp
11.23 and are deleted in a patient with Norrie disease. Genomics 4, 552-559.

Leist, M., Single, B., Castoldi, A.F., Kuhnle, S., and Nicotera, P. (1997). Intracellular adenosine
triphosphate (ATP) concentration: a switch in the decision between apoptosis and necrosis.
The Journal of experimental medicine 185, 1481-1486.

Lim, S.D., Sun, C., Lambeth, J.D., Marshall, F., Amin, M., Chung, L., Petros, J.A., and Arnold, R.S.
(2005). Increased Nox1 and hydrogen peroxide in prostate cancer. The Prostate 62,
200-207.

Liu, J.J., Lin, M., Yu, J.Y., Liu, B., and Bao, J.K. (2011). Targeting apoptotic and autophagic
pathways for cancer therapeutics. Cancer letters 300, 105-114.

Lumachi, F., Frigo, A.C., Basso, U., Tombolan, V., and Ermani, M. (2010). Estrogen therapy
and risk of breast cancer in postmenopausal women: a case-control study and results of a

43
multivariate analysis. Menopause 17, 524-528.

Magnusson, C., Persson, I., and Adami, H.O. (2000). More about: effect of hormone
replacement therapy on breast cancer risk: estrogen versus estrogen plus progestin.
Journal of the National Cancer Institute 92, 1183-1184.

Marabini, L., Calo, R., and Braga, P.C. (2011). Protective effect of erdosteine metabolite I
against hydrogen peroxide-induced oxidative DNA-damage in lung epithelial cells.
Arzneimittel-Forschung 61, 700-706.

Meyer, J.H., Ginovart, N., Boovariwala, A., Sagrati, S., Hussey, D., Garcia, A., Young, T.,
Praschak-Rieder, N., Wilson, A.A., and Houle, S. (2006). Elevated monoamine oxidase a
levels in the brain: an explanation for the monoamine imbalance of major depression.
Archives of general psychiatry 63, 1209-1216.

Minelli, A., Bellezza, I., Conte, C., and Culig, Z. (2009). Oxidative stress-related aging: A role
for prostate cancer? Biochimica et biophysica acta 1795, 83-91.

Mommers, E.C., van Diest, P.J., Leonhart, A.M., Meijer, C.J., and Baak, J.P. (1999). Balance of
cell proliferation and apoptosis in breast carcinogenesis. Breast cancer research and

44
treatment 58, 163-169.

Moreira, L.R., Miranda-Vilela, A.L., Silva, I.C., Akimoto, A.K., Klautau-Guimaraes, M.N., and
Grisolia, C.K. (2009). Antioxidant effect of haptoglobin phenotypes against DNA damage
induced by hydrogen peroxide in human leukocytes. Genetics and molecular research :
GMR 8, 284-290.

Mousseau, D.D., Rao, V.L., and Butterworth, R.F. (1996). Alterations in serotonin
parameters in brain of thiamine-deficient rats are evident prior to the appearance of
neurological symptoms. Journal of neurochemistry 67, 1113-1123.

Ou, X.M., Chen, K., and Shih, J.C. (2004). Dual functions of transcription factors,
transforming growth factor-beta-inducible early gene (TIEG)2 and Sp3, are mediated by
CACCC element and Sp1 sites of human monoamine oxidase (MAO) B gene. The Journal of
biological chemistry 279, 21021-21028.

Ou, X.M., Chen, K., and Shih, J.C. (2006a). Glucocorticoid and androgen activation of
monoamine oxidase A is regulated differently by R1 and Sp1. The Journal of biological
chemistry 281, 21512-21525.

45
Ou, X.M., Chen, K., and Shih, J.C. (2006b). Monoamine oxidase A and repressor R1 are
involved in apoptotic signaling pathway. Proceedings of the National Academy of Sciences
of the United States of America 103, 10923-10928.

Ouyang, L., Shi, Z., Zhao, S., Wang, F.T., Zhou, T.T., Liu, B., and Bao, J.K. (2012). Programmed
cell death pathways in cancer: a review of apoptosis, autophagy and programmed necrosis.
Cell proliferation 45, 487-498.

Papadimitriou, E., Polykratis, A., Hatziapostolou, M., Parthymou, A., Polytarchou, C., and
Mikelis, C. (2004). Heparin affin regulatory peptide: a new target for tumour therapy?
Current cancer drug targets 4, 471-482.

Park, J., Tadlock, L., Gores, G.J., and Patel, T. (1999). Inhibition of interleukin 6-mediated
mitogen-activated protein kinase activation attenuates growth of a cholangiocarcinoma cell
line. Hepatology 30, 1128-1133.

Peehl, D.M., Coram, M., Khine, H., Reese, S., Nolley, R., and Zhao, H. (2008). The significance
of monoamine oxidase-A expression in high grade prostate cancer. The Journal of urology
180, 2206-2211.

46
Peeters, C.F., de Waal, R.M., Wobbes, T., Westphal, J.R., and Ruers, T.J. (2006). Outgrowth of
human liver metastases after resection of the primary colorectal tumor: a shift in the
balance between apoptosis and proliferation. International journal of cancer Journal
international du cancer 119, 1249-1253.

Pike, M.C., and Ross, R.K. (2000). RESPONSE: re: effect of hormone replacement therapy on
breast cancer risk: estrogen versus estrogen plus progestin. Journal of the National Cancer
Institute 92, 1951-1952.

Polytarchou, C., Hatziapostolou, M., and Papadimitriou, E. (2005). Hydrogen peroxide
stimulates proliferation and migration of human prostate cancer cells through activation of
activator protein-1 and up-regulation of the heparin affin regulatory peptide gene. The
Journal of biological chemistry 280, 40428-40435.

Pratuangdejkul, J., Schneider, B., Launay, J.M., Kellermann, O., and Manivet, P. (2008).
Computational approaches for the study of serotonin and its membrane transporter SERT:
implications for drug design in neurological sciences. Current medicinal chemistry 15,
3214-3227.

Riazantseva, N.V., Novitskii, V.V., Chasovskikh, N., Kaigorodova, E.V., Starikova, E.G., and

47
Starikov Iu, V. (2008). [Redox-dependent regulation of apoptosis as a function of
intracellular reactive oxygen species in oxidative stress]. Rossiiskii fiziologicheskii zhurnal
imeni IM Sechenova / Rossiiskaia akademiia nauk 94, 710-718.

Romero, L., and Artigas, F. (1997). Preferential potentiation of the effects of serotonin
uptake inhibitors by 5-HT1A receptor antagonists in the dorsal raphe pathway: role of
somatodendritic autoreceptors. Journal of neurochemistry 68, 2593-2603.

Rybaczyk, L.A., Bashaw, M.J., Pathak, D.R., and Huang, K. (2008). An indicator of cancer:
downregulation of monoamine oxidase-A in multiple organs and species. BMC genomics 9,
134.

Scott, A.L., Bortolato, M., Chen, K., and Shih, J.C. (2008). Novel monoamine oxidase A knock
out mice with human-like spontaneous mutation. Neuroreport 19, 739-743.

Shapiro, P. (2002). Ras-MAP kinase signaling pathways and control of cell proliferation:
relevance to cancer therapy. Critical reviews in clinical laboratory sciences 39, 285-330.

Shapiro, S., Farmer, R.D., Mueck, A.O., Seaman, H., and Stevenson, J.C. (2011). Does hormone
replacement therapy cause breast cancer? An application of causal principles to three

48
studies: part 2. The Women's Health Initiative: estrogen plus progestogen. The journal of
family planning and reproductive health care / Faculty of Family Planning & Reproductive
Health Care, Royal College of Obstetricians & Gynaecologists 37, 165-172.

Shi, Y., Frost, P., Hoang, B., Benavides, A., Gera, J., and Lichtenstein, A. (2011). IL-6-induced
enhancement of c-Myc translation in multiple myeloma cells: critical role of cytoplasmic
localization of the rna-binding protein hnRNP A1. The Journal of biological chemistry 286,
67-78.

Shichida, K., Tomita, Y., Takashima, S., and Takeshita, K. (1988). Blink reflex in children
with neurological disorders: analysis of ipsilateral early component R1 and late component
R2. Brain & development 10, 289-294.

Shih, J.C., Chen, K., and Ridd, M.J. (1999). Monoamine oxidase: from genes to behavior.
Annual review of neuroscience 22, 197-217.

Shih, J.C., Grimsby, J., Chen, K., and Zhu, Q.S. (1993). Structure and promoter organization of
the human monoamine oxidase A and B genes. Journal of psychiatry & neuroscience : JPN
18, 25-32.

49
Shih, J.C., Wu, J.B., and Chen, K. (2011). Transcriptional regulation and multiple functions of
MAO genes. Journal of neural transmission 118, 979-986.

Shinka, T., Onodera, D., Tanaka, T., Shoji, N., Miyazaki, T., Moriuchi, T., and Fukumoto, T.
(2011). Serotonin synthesis and metabolism-related molecules in a human prostate cancer
cell line. Oncology letters 2, 211-215.

Siddiqui, E.J., Shabbir, M., Mikhailidis, D.P., Thompson, C.S., and Mumtaz, F.H. (2006). The
role of serotonin (5-hydroxytryptamine1A and 1B) receptors in prostate cancer cell
proliferation. The Journal of urology 176, 1648-1653.

Sonier, B., Arseneault, M., Lavigne, C., Ouellette, R.J., and Vaillancourt, C. (2006). The
5-HT2A serotoninergic receptor is expressed in the MCF-7 human breast cancer cell line
and reveals a mitogenic effect of serotonin. Biochemical and biophysical research
communications 343, 1053-1059.

Sun, S.Y. (2011). Understanding the Role of the Death Receptor 5/FADD/caspase-8 Death
Signaling in Cancer Metastasis. Molecular and cellular pharmacology 3, 31-34.

Suo, Q.F., Du, W.T., Yang, M.M., Fan, X.J., and Liu, J. (2011). [The study of hydrogen peroxide

50
induced DNA damage and recovery in normal aging and premature aging human cells].
Sichuan da xue xue bao Yi xue ban = Journal of Sichuan University Medical science edition
42, 610-615.

Tan, M.L., Ooi, J.P., Ismail, N., Moad, A.I., and Muhammad, T.S. (2009). Programmed cell
death pathways and current antitumor targets. Pharmaceutical research 26, 1547-1560.

True, L., Coleman, I., Hawley, S., Huang, C.Y., Gifford, D., Coleman, R., Beer, T.M., Gelmann, E.,
Datta, M., Mostaghel, E., et al. (2006). A molecular correlate to the Gleason grading system
for prostate adenocarcinoma. Proceedings of the National Academy of Sciences of the
United States of America 103, 10991-10996.

Varghese, H.J., Davidson, M.T., MacDonald, I.C., Wilson, S.M., Nadkarni, K.V., Groom, A.C., and
Chambers, A.F. (2002). Activated ras regulates the proliferation/apoptosis balance and
early survival of developing micrometastases. Cancer research 62, 887-891.

Von Ah, D., Skaar, T., Unverzagt, F., Yu, M., Wu, J., Schneider, B., Storniolo, A.M., Moser, L.,
Ryker, K., Milata, J., et al. (2012). Evaluating the role of serotonin on neuropsychological
function after breast cancer using acute tryptophan depletion. Biological research for
nursing 14, 5-15.

51

White, T.A., Kwon, E.M., Fu, R., Lucas, J.M., Ostrander, E.A., Stanford, J.L., and Nelson, P.S.
(2012). The monoamine oxidase A gene promoter repeat and prostate cancer risk. The
Prostate 72, 1622-1627.

Wong, W.K., Chen, K., and Shih, J.C. (2001). Regulation of human monoamine oxidase B gene
by Sp1 and Sp3. Molecular pharmacology 59, 852-859.

Wu, H., Barusevicius, A., Babb, J., Klein-Szanto, A., Godwin, A., Elenitsas, R., Gelfand, J.M.,
Lessin, S., and Seykora, J.T. (2005). Pleiotrophin expression correlates with melanocytic
tumor progression and metastatic potential. Journal of cutaneous pathology 32, 125-130.

Xu, J., Qian, J., Xie, X., Lin, L., Zou, Y., Fu, M., Huang, Z., Zhang, G., Su, Y., and Ge, J. (2012a).
High Density Lipoprotein Protects Mesenchymal Stem Cells from Oxidative Stress-Induced
Apoptosis via Activation of the PI3K/Akt Pathway and Suppression of Reactive Oxygen
Species. International journal of molecular sciences 13, 17104-17120.

Xu, K., Wu, Z.J., Groner, A.C., He, H.H., Cai, C., Lis, R.T., Wu, X., Stack, E.C., Loda, M., Liu, T., et al.
(2012b). EZH2 oncogenic activity in castration-resistant prostate cancer cells is
Polycomb-independent. Science 338, 1465-1469.

52

Yokomuro, S., Tsuji, H., Lunz, J.G., 3rd, Sakamoto, T., Ezure, T., Murase, N., and Demetris, A.J.
(2000). Growth control of human biliary epithelial cells by interleukin 6, hepatocyte
growth factor, transforming growth factor beta1, and activin A: comparison of a
cholangiocarcinoma cell line with primary cultures of non-neoplastic biliary epithelial cells.
Hepatology 32, 26-35.

Zhang, J.S., Moncrieffe, M.C., Kaczynski, J., Ellenrieder, V., Prendergast, F.G., and Urrutia, R.
(2001). A conserved alpha-helical motif mediates the interaction of Sp1-like transcriptional
repressors with the corepressor mSin3A. Molecular and cellular biology 21, 5041-5049.

Zhao, H., Nolley, R., Chen, Z., Reese, S.W., and Peehl, D.M. (2008). Inhibition of monoamine
oxidase A promotes secretory differentiation in basal prostatic epithelial cells.
Differentiation; research in biological diversity 76, 820-830.

Zheng, H., Tsuneyama, K., Takahashi, H., Miwa, S., Nomoto, K., Saito, H., Masuda, S., and
Takano, Y. (2007). Expression of PTEN and FHIT is involved in regulating the balance
between apoptosis and proliferation in lung carcinomas. Anticancer research 27, 575-581.

Zheng, H.C., Nakamura, T., Zheng, Y., Nakanishi, Y., Tabuchi, Y., Uchiyama, A., Takahashi, H.,

53
and Takano, Y. (2009). SV40 T antigen disrupted the cell metabolism and the balance
between proliferation and apoptosis in lens tumors of transgenic mice. Journal of cancer
research and clinical oncology 135, 1521-1532.

Zhu, Q.S., Chen, K., and Shih, J.C. (1994). Bidirectional promoter of human monoamine
oxidase A (MAO A) controlled by transcription factor Sp1. The Journal of neuroscience : the
official journal of the Society for Neuroscience 14, 7393-7403.

Zhu, Q.S., Grimsby, J., Chen, K., and Shih, J.C. (1992). Promoter organization and activity of
human monoamine oxidase (MAO) A and B genes. The Journal of neuroscience : the official
journal of the Society for Neuroscience 12, 4437-4446.

Zitzmann, M., and Nieschlag, E. (2003). The CAG repeat polymorphism within the androgen
receptor gene and maleness. International journal of andrology 26, 76-83.

Abstract (if available)

Abstract Accumulating experimental evidence has indicated that monoamine oxidase A (MAO-A) plays an important role in prostate cancer development. Many researchers have found that the expression of MAO-A is in correlation with the progression of cancer. The knock-down or knock-out of MAO-A gene is seeing results in the decrease in tumor proliferation and thus inhibiting the progression of tumor growth. Despite the contradictory results in some studies, it is still meaningful to look into the roles of MAO A and MAO A inhibitors in the treatment of certain level of cancer such as prostate cancer. In view of all the studies of MAO-A genes and proteins, it is important to have a general summary of the current study of monoamine oxidase in different fields to better figure out its role in the cancer development. This review is based on literatures from early as 1970 until the most recent study of monoamine oxidase, providing information including basic MAO A and B genes, MAO A and B genes regulation, catalytic by-products, and the involvement in different tumor proliferation pathways and at the meantime raising questions about the future studies in finding out the role of monoamine oxidase in a wide range of cancers.

Linked assets

University of Southern California Dissertations and Theses

Conceptually similar

PDF

MAO a deficient mice exhibit an altered immune system in the brain and prostate

PDF

Monoamine oxidase inhibitors regulate tumorigenesis and mitochondrial function in a prostate cancer mouse model

PDF

Monoamine oxidase (MAO) knock-out mouse models: Tools for studying the molecular basis of aggression, anxiety, autism and cancers

PDF

Monoamine oxidase A inhibitors and androgen receptor antagonists regulate mitochondrial function in prostate cancer cells

PDF

Monoamine oxidase deficiency and emotional reactivity: neurochemical and developmental studies

PDF

Potential therapeutic effect of monoamine oxidase (MAO) inhibitor on human neuroblastoma

PDF

Blockade of CXCR2 as a novel approach for cancer chemotherapy

PDF

Co-expression of monoamine oxidase A and prostate cancer stem cell markers in Pten knockout mice

PDF

Bioinformatics analysis of the anti-cancer potency of NMI on non-small cell lung cancer and its potential mechanism

PDF

The role of monoamine oxidase in behavioral plasticity

PDF

Differential regulation of monoamine oxidase A and B genes

PDF

Assessment of theranostic agent for brain cancer

PDF

NMI (near-infrared dye conjugate MAO A inhibitor) outperformed FDA-approved prostate cancer drugs with a unique mechanism based on bioinformatic analysis of NCI60 screening data

PDF

Inhibition of monoamine oxidase A and histone deacetylase inhibitors: computational prediction of ligand binding

PDF

Small molecule modulators of HIF1α signaling

PDF

NMI: a near infrared conjugated MAO-A inhibitor as a novel targeted therapy for colorectal and other cancers

PDF

Study of a novel near-infrared conjugated MAOA inhibitor, NMI, against CNS cancer by NCI60 data analysis

PDF

Physical chemistry and polymeric modification of elastin-like polypeptides

PDF

Role of inflammation in prostate carcinogenesis and prostate cancer growth

PDF

Synthetic small molecules and protein secondary structure mimetics as modulators of hypoxia-inducible transcription and integrin receptors function

Asset Metadata

Creator Chen, Ying (author)

Core Title Monoamine oxidase and cancer

School School of Pharmacy

Degree Master of Science

Degree Program Pharmaceutical Sciences

Publication Date 06/27/2013

Defense Date 03/25/2013

Publisher University of Southern California (original), University of Southern California. Libraries (digital)

Tag cancer,MAO A,MAO B,monoamine oxidase,OAI-PMH Harvest

Format application/pdf (imt)

Language English

Contributor Electronically uploaded by the author (provenance)

Advisor Shih, Jean C. (committee chair), Okamoto, Curtis Toshio (committee member), Olenyuk, Bogdan (committee member)

Creator Email chen743@usc.edu,cherry.yingc@gmail.com

Permanent Link (DOI) https://doi.org/10.25549/usctheses-c3-281048

Unique identifier UC11294012

Identifier etd-ChenYing-1714.pdf (filename),usctheses-c3-281048 (legacy record id)

Legacy Identifier etd-ChenYing-1714-1.pdf

Dmrecord 281048

Document Type Thesis

Format application/pdf (imt)

Rights Chen, Ying

Type texts

Source University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Access Conditions The author retains rights to his/her dissertation, thesis or other graduate work according to U.S. copyright law. Electronic access is being provided by the USC Libraries in agreement with the a...

Repository Name University of Southern California Digital Library

Repository Location USC Digital Library, University of Southern California, University Park Campus MC 2810, 3434 South Grand Avenue, 2nd Floor, Los Angeles, California 90089-2810, USA