University of Southern California Dissertations and Theses

Sex differences in iron overload

(USC Thesis Other)

Sex differences in iron overload

PDF

Download a page range

Download transcript

Copy asset link

Request this asset

Transcript (if available)

Content
SEX DIFFERENCES IN IRON OVERLOAD

by

Casey John Brewer

A Dissertation Presented to the
FACULTY OF THE USC GRADUATE SCHOOL
UNIVERSITY OF SOUTHERN CALIFORNIA
In Partial Fulfillment of the
Requirements of the Degree
DOCTOR OF PHILOSOPHY
(INTEGRATIVE BIOLOGY OF DISEASE)

May 2014

Copyright 2014 Casey J. Brewer
ii

Table of Contents
Abstract iv
Chapter 1: Introduction
A. Overview of iron biology 1
B. Iron regulation
B.1. Systemic iron regulation 3
B.2. Cellular iron regulation 7
C. Iron overload
C.1. Primary iron overload 10
C.2. Secondary iron overload 11
C.3. Sex differences in iron overload 13
D. Introduction to sex steroids
D.1. Sex steroid biosynthesis 15
D.2. Sex steroid effects – organizational vs. 16
activational
E. Thesis Overview
E.1. Thesis motivation 18
E.2. Hypothesis 19
E.3. Outline 19

Chapter 2: Sex differences and steroid modulation of cardiac iron
in a mouse model of iron overload
Abstract 20
Introduction 21
Methods 24
Results 26
Discussion 34

Chapter 3: mRNA regulation of cardiac iron transporters and ferritin
subunits in a mouse model of iron overload
Abstract 40
Introduction 41
Methods 43
Results 46
Discussion 51

Chapter 4: Progesterone increases liver iron concentration in a mouse
model of primary iron overload
Abstract 56
Introduction 57
Methods 58
iii

Results and Discussion 61

Chapter 5: Overall summary and future directions 66

Bibliography 72

iv

Abstract
Nearly every living organism requires iron due to its roles in DNA synthesis,
cellular respiration and oxygen transport. However, iron’s ability to generate free radicals
makes it toxic at high concentrations. For this reason, the body has an intricate regulatory
system that ensures iron’s availability while also preventing free radical toxicity. Iron
overload can develop when mutations occur to the iron regulatory system, when
ineffective erythropoiesis drives excessive dietary iron absorption, or when severe
anemia requires chronic blood transfusions. Heart failure due to excessive cardiac iron is
the most common cause of lethality in iron overload. The onset of cardiac iron loading
most often occurs during puberty. Females exhibit a survival advantage compared to
males, but the cause of this is unknown. For this reason, we studied sex differences of
iron overload in a mouse model of the disease. We postulated that sex steroids cause an
increase in cardiac iron levels and that testosterone increases cardiac iron loading more
than estrogen. Effects of sex and hormones were studied via gonadectomy and hormone
replacement. Initial experiments found that estrogen increased cardiac iron loading in
males compared to castrates (p<0.05); an effect of estrogen on cardiac iron was not
observed in females. Since testosterone can be converted into estrogen by the aromatase
enzyme, there may be a role for cardiac and/or endothelial aromatase in the generation of
male iron overload. Next, cardiac iron transporters were analyzed by RT-PCR in males
and females. Both sexes showed a positive relationship between cardiac iron and
ferroportin, the only known exporter of cellular iron. However, the relationship was
significantly steeper in females than in males (p<0.05). Females may have lower cardiac
v

iron levels than males because of increased iron export rather than decreased iron import.
Finally, we observed that ovary-intact females trended towards higher liver iron
concentrations than ovariectomized females with estrogen replacement. A follow-up
study was therefore performed that investigated the role of progesterone in female iron
overload. Progesterone-treated females had significantly increased liver iron
concentration compared to ovariectomized females (p<0.05). This could be clinically
relevant to female iron overload patients considering progesterone contraceptives.
Currently, there is little understanding of progesterone’s role in iron homeostasis. Further
elucidation of progesterone’s effects may help explain differences in male and female
iron biology.

1

Chapter 1. Introduction
A. Overview of Iron Biology
Nearly all living organisms are dependent on iron for survival. As a transition
metal, iron can accept and donate electrons, allowing it to play a vital role in biological
processes such as oxygen transport, DNA synthesis, and cellular respiration [1]. Humans
require a daily iron intake of 1 to 2 mg per day to compensate for iron losses from the
sloughing off of skin and mucosal cells, as well as from occasional blood loss [2]. Iron
deficiency causes anemia as well as the arrest of cellular growth and can even be lethal
[3].
While iron is vital to many cellular processes, excess iron is toxic due to its ability
to generate free radicals [4]. During normal cellular processes, oxygen molecules pick up
an extra electron and become super oxide anion (Fig. 1.1). This harmful free radical is
converted into hydrogen peroxide by the endogenous antioxidant superoxide dismutase.
Catalase, another endogenous antioxidant, converts hydrogen peroxide back into oxygen
and water. In the presence of iron, hydrogen peroxide is instead converted into the
hydroxyl radical, a dangerous molecule that can damage lipids, proteins, and nucleic
acids [5].
Because of its ability to cause free radical damage, iron must be tightly controlled
by the body. This is largely accomplished at the duodenum by the limitation of dietary
iron absorption [6]. Once in the body, iron is carefully managed by a system of carrier
and storage proteins so that unbound iron does not accumulate [7]. The liver serves as the
2

body’s main storehouse of iron; large amounts are also contained in macrophages that
recycle senescent red blood cells [2, 8]. When required for processes such as
erythropoiesis, iron is mobilized from storage and transported throughout the body by the
carrier protein transferrin. Cellular iron uptake is carefully regulated by titration of
transferrin receptor expression so that cellular iron toxicity does not develop.
Iron overload occurs when the body’s regulatory systems break down or are
overwhelmed. When this happens, serum levels of non-transferrin bound iron rise and
unregulated iron deposition occurs in organs such as the liver, heart, and endocrine
glands. Symptoms are initially difficult to recognize but can include fatigue and joint
pain. Upon reaching a more advanced stage, iron overload causes organ failure and death,
most often due to cardiomyopathy [9]. In order to prevent toxicity, iron is regulated at the
systemic and cellular levels.

Figure 1.1. Free radical generation by labile iron. SOD, superoxide dismutase.
Unbound, labile iron catalyzes the Fenton reaction, creating dangerous hydroxyl radicals
from hydrogen peroxide.

3

B. Iron Regulation
B.1. Systemic Iron Regulation
Whole body iron levels are regulated at the duodenum through the control of
dietary iron absorption [6]. Iron uptake initially occurs through the divalent metal
transporter 1 (DMT1) at the apical side of the duodenal enterocyte (Fig.1.2). Transport
through DMT1 requires iron to be in the Fe
2+
form (ferrous iron), while dietary iron is
largely in the Fe
3+
form (ferric iron). The necessary reduction is accomplished at the
intestinal brush boarder by duodenal cytochrome-b reductase. Absorbed iron is released
into the bloodstream at the enterocyte’s basolateral side by the only known mammalian
iron exporter, ferroportin (FPN1). As with DMT1, transport via FPN1 requires iron to be
in the ferrous form. Immediately upon exit from the enterocyte, iron is oxidized by the
ferroxidase hephaestin. This oxidation allows ferric iron to be bound by the carrier
protein transferrin, ensuring that toxic unbound iron will not be present in the
bloodstream. Each transferrin protein binds two ferric iron atoms, at which point it is
referred to as holo-transferrin; iron-free transferrin is known as apo-transferrin. Because
of an abundance of transferrin in the bloodstream, unbound serum iron is not normally
present [4].
A second major source of iron comes from the recycling of senescent red blood
cells (RBCs). RBCs are packed with iron-containing hemoglobin, the protein responsible
for oxygen transport. A normal lifespan for circulating RBCs is approximately 4 months,
after which time they are phagocytized by macrophages [10]. RBCs are broken down
4

within macrophages by hydrolytic enzymes, allowing for the release of iron into the
bloodstream. Iron export is again accomplished by FPN1. The ferroxidase ceruloplasmin
oxidizes the exported iron from the ferrous to the ferric form, allowing for transferrin-
binding. It is via the recycling of RBCs that the majority of daily iron needs are met [2].

Figure 1.2. Duodenal iron absorption. Dcytb, duodenal cytochrome-b reductase;
DMT1, divalent metal transporter 1; Heph, hephaestin; Tf, transferrin. Dietary iron must
be reduced at the apical side of the enterocyte by Dcytb before being imported by DMT1.
After export into the bloodstream through ferroportin, iron is oxidized by hephaestin and
bound by transferrin.

A major destination for transferrin-bound iron is the liver, as it is the main depot
for iron storage. In general, the liver is estimated to hold 70% of the body’s iron, making
liver iron concentration a good predictor of whole body iron status [8, 11]. Hepatic iron
uptake is accomplished via transferrin receptor 1 (TFR1), which binds holo-transferrin
and undergoes endocytosis. The resulting vesicle is acidified by proton pumps, causing
iron’s dissociation from transferrin. The newly formed vesicle contains DMT1 in its
plasma membrane, allowing iron’s passage out of the vesicle and into the cytoplasm.
5

Cellular iron can be stored safely inside the cage-like protein ferritin, which is composed
of 24 heavy chain (H) and light chain (L) subunits. When serum iron levels are low,
stored iron can be mobilized from ferritin and exported into the bloodstream via FPN1.
In addition to serving as the body’s main storehouse for iron, the liver plays the
role of iron sensor. How this is accomplished is not entirely understood, but many of the
key players have been identified. When holo-transferrin binds to TFR1 during hepatic
iron uptake, the protein hemochromatosis (HFE) is displaced from TFR1 and forms a
complex with the membrane proteins transferrin receptor 2 (TFR2) and hemojuvelin
(HJV) [12]. The complexed proteins signal to the hepatocyte that liver iron levels have
increased. Though the mechanism is unclear, HFE, TFR2, and HJV appear to facilitate
bone morphogenetic protein (BMP) signaling [13-15]. In vivo work has confirmed that
BMP signaling increases the transcription of the iron regulatory hormone, hepcidin. Once
released into the bloodstream, hepcidin binds to ferroportin in the various tissues of the
body and causes its degradation (Fig. 1.3). Without ferroportin, cellular iron can no
longer be exported into the bloodstream. Hepcidin therefore halts dietary iron absorption
by interrupting the export of dietary iron into the bloodstream by enterocytes. Mutations
to HFE, TFR2, and HJV cause hemochromatosis in humans due to low hepcidin levels
and excessive dietary iron absorption [16].
Because iron is vital to various processes in the body, hepcidin levels are affected
by many different factors. First, as mentioned above, hepcidin is upregulated by high
systemic iron. Second, erythropoietic drive can decrease hepcidin levels, thereby
6

increasing the amount of iron available for new RBCs. Though the mechanism is unclear,
bone marrow-derived GDF15 and erythroblast-derived erythroferrone are suspected of
linking erythropoiesis to hepcidin downregulation [17, 18]. Third, hypoxia can decrease
hepcidin levels via hypoxia inducible factors (HIFs). HIFs are transcription factors with
oxygen-sensitive subunits capable of altering the expression of a wide array of genes. Via
their regulation of EPO production in the kidney, HIFs can increase erythropoiesis and
thus suppress hepcidin production [19]. Fourth, because iron is vital to the growth of
invading pathogens, inflammation is able to increase hepcidin in order to decrease iron
availability. An unfortunate consequence of the inflammatory hepcidin response is
anemia of chronic disease, where patients with chronic inflammation become anemic due
to consistently high hepcidin and low serum iron [20].
Iron overload develops when the body’s regulatory system gets overwhelmed,
either from a mutation to an iron regulatory gene, chronic anemia, or from massive iron
intake (e.g. blood transfusions). As serum iron rises, the iron carrier protein transferrin
becomes increasingly saturated; at approximately 80% transferrin saturation, plasma
levels of non-transferrin bound iron (NTBI) begin to rise. While transferrin bound iron is
nonreactive and its movement into tissues is regulated, unbound iron is toxic and can load
into the various organs in an uncontrolled fashion.

7

Fig. 1.3. Systemic iron regulation via hepcidin. FPN, ferroportin; Tf, transferrin; TFR1,
transferrin receptor 1; HFE, hemochromatosis; HJV, hemojuvelin; TFR2, transferrin
receptor 2. Hepcidin can be upregulated by iron and inflammation, while it can be
downregulated by hypoxia, anemia, and erythropoiesis. Hepcidin limits serum iron levels
by binding to the ferroportin iron exporter, causing its internalization and degradation.

B.2. Cellular Iron Regulation
While systemic iron regulation is controlled by hepcidin, individual cells regulate
their iron stores via the Iron Regulatory Element/Iron Regulatory Protein (IRE/IRP)
system. An IRE is a nucleotide sequence forming a stem-loop conformation in the 5’ or
3’ untranslated region of mRNA. IREs are found in all the major iron transport and
storage genes (e.g. TFR1, DMT1, ferroportin, L- and H- ferritin) as well as some genes
involved in erythropoiesis and hypoxia. IRPs bind to IREs when cellular iron is low,
thereby altering translation of the mRNA to suit an iron deficient state (Fig. 1.4). The
8

binding of an IRP to a 5’ IRE blocks mRNA translation while the binding to a 3’ IRE
promotes mRNA translation. When cellular iron levels rise, iron becomes incorporated
into the structure of IRPs and changes their conformation. IRPs consequently detach from
the IREs, altering translation of the mRNA to suit an iron replete state. Those genes with
5’ IREs are now translated while those with 3’ IREs are degraded. Examples of genes
with 5’ IREs include the iron exporter FPN1 and the iron storage genes L- and H-ferritin;
promotion of their translation when iron levels are high protects the cell against iron
toxicity. Genes with 3’ IREs include the iron importers TFR1 and DMT1; promotion of
their translation during iron deficiency ensures that iron will be available for vital cellular
processes [7].

Figure 1.4. Cellular iron regulation. IRE, iron regulatory element; IRP, iron regulatory
protein. IRPs bind to IREs at low iron concentration. As iron concentration increases,
iron incorporates into the structure of IRPs, causing them to leave the IREs.
Though less well understood, evidence for the transcriptional regulation of iron
genes has emerged that complements the translational regulation provided for by the
9

IRE/IRP system. For example, transcription of ferroportin has been shown to be induced
by heme in macrophages [21, 22]. Other studies in macrophages and lung cells
demonstrate the induction of ferroportin transcription by increases in cellular iron
concentration [23, 24]. Similarly, work in the rat liver has shown the upregulation of L-
ferritin transcription by increased hepatic iron concentration [25]. As new discoveries
continue to made, the transcriptional regulation of iron genes could yield exciting new
possibilities for the treatment of iron overloaded patients.
The methods of cellular iron regulation just described make it impossible for a
cell to become iron overloaded in a non-disease state. However, in iron overload,
systemic iron levels increase to the point that transferrin becomes saturated and non-
transferrin bound iron (NTBI) begins circulating throughout the body. Some forms of
NTBI are able to bypass TFR1 and enter cells in an unregulated manner. The first organ
to become iron overloaded is the liver. Excess iron later begins depositing into extra-
hepatic organs such as the pancreas, pituitary, and heart [26]. The leading cause of death
in patients is iron-mediated cardiomyopathy [9]. However, the pattern of extra-hepatic
iron deposition varies greatly between patients, making it difficult to predict NTBI
accumulation. In addition, it is unclear which ion channels are responsible for cellular
intake of NTBI; it could be that several different channels are responsible. NTBI
transport into the heart is of particular importance, as cardiac iron is the most deadly.
Cardiac ion channels that are suspected to transport NTBI include DMT1, the ZRT/IRT-
like protein 14 (Zip14) zinc channel, and the L-type and T-type voltage gated calcium
10

channels [27-30]. While iron overload can have a variety of causes, it can be classified
into two forms: primary or secondary iron overload.
C. Iron Overload
C.1. Primary Iron Overload
Primary iron overload disorders are autosomal recessive and can be caused by
mutations to a number of different genes. In general, they are characterized by low serum
levels of the iron-regulatory hormone hepcidin, leading to uncontrolled dietary iron
absorption. Disease progression tends to be insidious, with iron depositing in the liver,
heart and pancreas in a largely asymptomatic fashion [31]. Eventually, high tissue iron
concentrations can cause cirrhosis, cancer, endocrine complications, and heart failure.
While most mutations can go unnoticed until mid-life, there are also juvenile forms of the
disease. Treatment options include phlebotomy, which temporarily lowers serum iron
levels but must be performed repeatedly. This is often combined with chelation therapy,
as pharmaceutical agents can bind iron and facilitate excretion in the urine and/or stool.
However, not all patients respond well to chelation therapy and some iron deposits can be
difficult to remove, especially those in the heart [32].
When primary iron overload is caused by a mutation to an iron regulatory gene, it
is known as hemochromatosis. One of the most common genetic disorders,
hemochromatosis affects approximately 0.5% of Caucasians of European descent [33].
Mutations can affect systemic iron sensor proteins (the hemochromatosis protein, HFE,
and hemojuvelin, HJV), the serum iron carrier transferrin, the iron storage protein ferritin,
11

and the iron regulatory hormone hepcidin [16]. The most common hemochromatosis
mutation is HFE C282Y, though its exact role in iron regulation remains to be fully
understood [34].
Primary iron overload can also develop in patients with non-transfusion
dependent anemias, of which thalassemia intermedia is the most common. Thalassemia
intermedia can be caused by various mutations to the globin chains of hemoglobin,
resulting in an imbalance in alpha and beta globin chain production. Patients experience
hemolysis and ineffective erythropoiesis, leading to bone malformation and
hypercoagulability [35]. Due to their ineffective erythropoiesis, patients also experience a
chronic downregulation of the iron regulatory hormone hepcidin. Normally, this is a
healthy physiologic response to erythropoietic drive, allowing for increased dietary iron
absorption and iron availability for red blood cell production. However, in patients
suffering from ineffective erythropoiesis, chronic downregulation of hepcidin results in
primary iron overload [36]. Due to a heterozygous advantage against malaria, the
frequency of thalassemia intermedia is high in Mediterranean localities and is endemic in
Southeast Asia [37].
C.2. Secondary Iron Overload
More serious anemias require chronic blood transfusions; such diseases include β-
thalassemia major and sickle cell disease. These conditions are caused by mutations to
the hemoglobin protein, resulting in hemolysis and anemia. β-thalassemia major patients
present with severe anemia within the first two years of life. Without proper treatment,
12

patients suffer from such symptoms as masses from extramedullary hematopoiesis,
skeletal changes, growth retardation, poor musculature, and jaundice [38]. It is estimated
that 200,000 β-thalassemia major patients are currently receiving treatment around the
world [39]. Sickle cell disease is characterized by malformed red blood cells that take on
a “sickled” shape upon deoxygenation, thereby decreasing their flexibility. The disease
first presents in young children with pain and swelling in the hands or feet. Tissue
ischemia results from vaso-occlusive events, leading to tissue damage and organ failure
[40]. Stroke is the most devastating complication of sickle cell disease, with
approximately 20% of patients requiring blood transfusions for stroke prophylaxis [41,
42]. More than 275,000 people are born with sickle cell disease every year [43].
Patients with β-thalassemia major and sickle cell disease require blood
transfusions every 3 to 4 weeks to treat their anemia. Each transfusion contains 400-600
times the daily dietary absorption of iron, but there is no compensatory mechanism for
upregulating iron excretion [44]. Thus, in the course of treating anemia, chronic blood
transfusions create the disease of secondary iron overload. Phlebotomy is not an option
for these patients, as they are already anemic. Chelation is the standard method of care,
but as in primary iron overload, not all patients respond well to chelation therapy; this is
especially true for patients with high concentrations of extra-hepatic iron [32]. Similar to
thalassemia intermedia, there is a heterozygous advantage against malaria for carriers of
thalassemia major and sickle cell disease [45, 46]. This has resulted in a large incidence
of secondary iron overload around the Mediterranean, Africa, Middle East, India, and
13

Southeast Asia. Due to globalization, secondary iron overload has become a national
health problem as well.
C.3. Sex Differences in Iron Overload
While iron overload can have various manifestations and severities, a pattern has
emerged where female patients tend to fare better than male patients. In a study of 977 β-
thalassemia major patients with secondary iron overload, females had a two-fold greater
survival rate than males with the disease [47]. It was speculated that female patients may
have had improved survival due to better compliance with therapy. However, this seems
unlikely because the males and females had similar levels of serum ferritin, a marker of
whole body iron [47].
Sex differences in disease severity and survival have also been identified in
primary iron overload patients. In general, iron overload is twice as great in male
hemochromatosis patients as in females [48]. Furthermore, it has been seen that male
patients have twice as much mobilizable iron as females [49, 50]. A study of 176 women
and 176 men showed that venesection removed significantly more iron from men then
from women despite similar levels of hepatic iron concentration [51]. Because this
finding could not be explained by differences in liver size, it was postulated that men
have greater extra-hepatic iron deposits.
It has been hypothesized that menses and pregnancy is responsible for protecting
females from iron overload. However, definitive proof for this theory has been elusive. A
study of 485 French and 213 Canadian hemochromatosis patients showed that women
14

were capable of clinical expression of hemochromatosis similar to that seen in males,
with some women exhibiting symptoms as advanced as the most severe male cases. Age
of disease presentation was not different in males and females, with women able to
develop primary iron overload before reaching menopause [51]. Furthermore, in 77
French women, no correlation was found between hepatic iron concentration and number
of pregnancies [51]. In a later study of HFE-hemochromatosis patients, there was no
difference in pregnancies, menstruation, or age between symptomatic and
nonsymptomatic women [52]. These findings were supported by pregnancy studies
performed in Hfe -/- and wildtype mice, which revealed that liver iron concentration was
similar in nulliparous and pluriparous mice. In fact, organ iron content in liver, heart,
spleen, and pancreas was increased in the pluriparous mice [53].
As menstruation and pregnancy are not seen to increase female survival in iron
overload, there is the possibility that sex or hormones affect iron transport within the
body. A study of thalassemia major patients showed that cardiac iron loading is most
common between 10 and 20 years of age, when sex steroid levels are high [54]. As
described earlier, NTBI is suspected of being transported into cardiomyocytes by calcium
channels. Sex steroids have in fact been seen to alter the expression of cardiac calcium
channels and the β-adrenergic receptor [55, 56]. For this reason, it seemed that sex
steroids might increase male cardiac iron levels by increasing cardiac iron influx.
However, it is difficult to study the effects of sex steroids due to the inherent variation in
endogenous hormone levels. Gonadectomy and hormone replacement is a solution to this
problem, providing stable and reproducible amounts of sex hormones over an extended
15

period of time. We therefore sought to study cardiac iron flux in a mouse model of iron
overload using Silastic impants packed with crystalline steroid. To understand the design
of the experimental groups, it is necessary to first address hormone synthesis as well as
the timeline of hormonal effects during rodent development.
D. Introduction to Sex Steroids
D.1. Sex Steroid Biosynthesis
In females, androgens are synthesized from cholesterol in the thecal cells of the
ovary. Androgen production is initiated by lutenizing hormone from the pituitary gland.
Newly produced androgen moves to neighboring granulosa cells where it is converted
into estradiol by the aromatase enzyme. Expression of the aromatase enzyme is
stimulated by follicle stimulating hormone, another pituitary hormone. Production of
estradiol promotes the proliferation of granulosa cells, thereby creating more receptors
for follicle-stimulating hormone [57]. By this mechanism, estrogen production creates a
positive feedback loop, driving the increased production of estrogen from androgen.
In males, the Leydig cells of the testes produce testosterone. As in females,
testosterone production is initiated by the pituitary gland’s lutenizing hormone. Some of
the testosterone moves into neighboring Sertoli cells to maintain spermatogenesis.
Testosterone is also released into the bloodstream, allowing it to move throughout the
body. Interestingly, many male tissues contain the aromatase enzyme, allowing for local
conversion of testosterone into estradiol. It has been found that several of testosterone’s
functions in males are actually performed by estrogen [58, 59]. Therefore, when studying
16

the effects of testosterone in males, it can be difficult to determine whether it is acting as
an androgen or as an estrogen.
One way to distinguish between testosterone’s androgenic and estrogenic effects
is to also study the hormone dihydrotestosterone (DHT). This androgen is created from
testosterone by the 5α-reductase enzyme (Fig. 1.5). Like testosterone, DHT signals via
binding to the androgen receptor. However, because DHT cannot be converted into
estradiol, the effects of DHT are purely androgenic. By comparing experimental groups
exposed to testosterone, estrogen, or DHT, one can distinguish between the estrogenic
and androgenic effects of testosterone.

Figure 1.5. Sex steroid biosynthesis. Cholesterol is converted into testosterone through
a series of steps. Testosterone can then be converted into estradiol by the aromatase
enzyme or into DHT by the 5a-reductase enzyme.

D.2. Sex Steroid Effects – Organizational vs. Activational
As in humans, male rodents experience a postnatal burst in androgen production
that directs the development of male characteristics. Many of these hormone effects are
permanent, such as the shaping of the genitalia and the establishment of sex-specific
neural networks. These are known as organizational effects of steroids and they are
17

characterized by their non-reversible nature [60]. Females do not undergo a postnatal
hormone burst, allowing for the development of female characteristics via default
mechanisms (Fig. 1.6).

Figure 1.6. Timeline for sex steroid production in males and females. Males
experience a postnatal steroid burst that does not occur in females. Both sexes experience
an increase in hormone concentration at puberty. (Adapted from Vandenbergh, J.G.,
American Scientist, 2003)
At puberty, a second burst in hormone production occurs; males experience an
increase in androgens while females experience an increase in estrogens. In mice, this
pubertal increase in hormone production occurs at about 28-40 days of age. Many
hormonal effects after this point are reversible and are known as activational effects [61].
If hormones are later removed, these effects will also disappear. Examples of activational
effects include the muscle building effects of androgens and the bone strengthening
effects of estrogens.
18

When researching the effects of sex steroids, it is important to distinguish
between organizational and activational effects. This can be accomplished using
gonadectomized animals without hormone replacement. If sex differences exist between
male and female animals that have been gonadectomized in adulthood without hormone
replacement, this indicates the presence of organizational effects. If effects of sex steroids
are seen in gonadectomized mice with hormone replacement that are missing in
gonadectomized mice without hormone replacement, this indicates the presence of
activational effects.
E. Thesis Overview
E.1. Thesis Motivation
The number one cause of death for male and female iron overload patients is iron
cardiomyopathy. While a female survival advantage in iron overload is well documented,
the cause is unknown. It is thought that sex steroids may cause an increase in cardiac iron
loading that is greater in males than in females. Clinical studies in humans are
complicated by variations in chelation therapy between patients. Furthermore, serum
levels of sex steroids vary greatly between patients, making it difficult to pinpoint
hormonal effects on iron loading. Using a rodent model of iron overload, it is possible to
study the effects of sex steroids on cardiac iron concentration in vivo. Using RT-PCR, a
wide array of cardiac iron transporters can be monitored for effects of sex steroids;
channel expression can also be compared to cardiac iron concentration. Despite the large
number of patients suffering from iron overload, no research has been done concerning
19

the effects of sex steroids on cardiac iron transport. A better understanding of the effects
of sex and hormones on cardiac iron overload would be beneficial to patient treatment
and preventative care.
E.2. Hypothesis
Sex steroids cause an increase in cardiac iron levels; testosterone increases
cardiac iron loading more than estrogen.
E.3. Outline
First, the effects of sex steroids on cardiac iron concentration are studied in male
and female mice. Experiments are designed to distinguish between organizational and
activational effects of sex steroids. Second, cardiac tissue of the mice is analyzed by RT-
PCR for the expression of iron transporters. Transferrin-bound iron transporters as well
as putative non-transferrin bound iron transporters are examined for effects of sex and
hormone replacement. The regulation of iron transporter mRNA by cardiac iron
concentration is also explored. During these first experiments, data was collected that
implicated progesterone in female iron regulation. Thus, the final experiments explore the
effect of progesterone on whole body iron levels in female mice. The role of progesterone
in iron homeostasis is a little studied topic that could have clinical implications.

20

Chapter 2. Sex Differences and Steroid Modulation of Cardiac Iron in a Mouse
Model of Iron Overload (Brewer, C., et. al. Transl Res. 163(2): 151-9,
2014 Feb. PMID: 24018182)

Abstract
Iron cardiomyopathy is the leading cause of death in transfusional iron overload,
and men have twice the mortality of women. Since the prevalence of cardiac iron
overload increases rapidly in the second decade of life, we postulated that there are
steroid-dependent sex differences in cardiac iron uptake. To test this hypothesis, we
manipulated sex steroids in mice having constitutive iron absorption (homozygous
hemojuvelin knockout); this model mimics the myocyte iron deposition observed in
humans. At four weeks of age, female mice were ovariectomized (OVX) and male mice
were castrated (OrchX). Female mice received an estrogen implant (OVX+E) or a
cholesterol control (OVX), while male mice received an implant containing testosterone
(OrchX+T), dihydrotestosterone (OrchX+DHT), estrogen (OrchX+E), or cholesterol
(OrchX). All animals received a high iron diet for eight weeks. OrchX, OVX and
OVX+E mice all had similar cardiac iron loads. However, OrchX+E males had a
significant increase in cardiac iron concentration compared to OrchX (p<0.01), while
OrchX+T and OrchX+DHT only trended higher (p<0.06 and p<0.15, respectively).
Hormone treatments did not impact liver iron concentration in either sex. When data
were pooled across hormone therapies, liver iron concentration was 25% greater in males
than females (p<0.01). In summary, we found that estrogen increased cardiac iron
21

loading in male mice, but not in females. Male mice loaded 25% more hepatic iron than
female mice, irrespective of the hormone treatment.

Introduction
While the availability of iron is crucial to the body, iron excess can be lethal. For
this reason, plasma iron concentration is tightly regulated by a negative feedback loop
involving the hepatic hormone hepcidin [6, 62]. Several “iron sensor” proteins, including
hemochromatosis (HFE) and hemojuvelin (HJV) [15, 63], regulate hepcidin release
according to transferrin saturation [64]. Hepcidin restricts cellular export of iron into the
blood by binding to and degrading of the iron exporter, ferroportin, the only known iron
exporter in the body [65]. When ferroportin has been degraded, iron can no longer enter
the bloodstream from its main sources, the enterocytes of the duodenum and
macrophages that recycle old red blood cells. Hepcidin controls the flux of iron such that
all labile forms can be safely bound by the carrier protein transferrin [66], preventing
unregulated redox chemistry in the circulation.
Primary iron overload occurs when there is a deleterious mutation in the iron
regulatory system (e.g. HFE or HJV) [67, 68]. This disease is characterized by a blunted
hepcidin response, resulting in high plasma iron and high transferrin saturation [69, 70].
Iron overload can also occur in response to chronic blood transfusions, a condition known
as secondary iron overload [71]. Some patients with hemoglobinopathies (e.g. β-
thalassemia) require chronic blood transfusions every 3 to 4 weeks, with each transfusion
22

containing 400-600 times the daily absorption of iron [44]. Because humans have no
way of up-regulating iron excretion, transfusional iron eventually overwhelms the
hepcidin regulatory system, saturates transferrin binding capacity, and deposits in the
endocrine glands and the heart. Although the exact transporters responsible for extra-
hepatic iron overload are not known, L-type calcium channels, T-type calcium channels,
and Zip14 zinc channels have been implicated in previous animal studies [28-30].
Thalassemia is the most common genetic disease worldwide with a very high
prevalence in Asia [72]. While chronic blood transfusions correct the patients’ anemia,
they produce severe iron overload that can become lethal in the second decade of life
[54]. The leading cause of death in these patients is iron-mediated cardiomyopathy [9].
Women with thalassemia have a 2:1 survival advantage compared to men with the
disease [47]; similar disparities in disease severity have been documented in hereditary
hemochromatosis [73]. In thalassemia, the onset of cardiac iron overload is greatest
during puberty [54]. Thus, we postulated that sex steroids might modulate cardiac iron
loading, with androgens and estrogens acting antagonistically.
Response to sex steroids can be classified as organizational or activational [61,
74]. Organizational effects persist even if steroids are later removed. An example would
be steroidal actions in utero that determine male or female genitalia. Activational effects
can occur throughout the lifespan and are more reversible, such as increased muscle mass
caused by testosterone and the bone-strengthening effects of estrogen. We sought to
determine if sex steroids have organizational effects and/or activational effects with
23

respect to cardiac iron loading. Experiments were performed in gonadectomized mice,
allowing for hormonal regulation by subcutaneous implants. Since testosterone can act
through both androgenic and estrogenic mechanisms, we studied cardiac iron responses
to testosterone, dihydrotestosterone and estrogen.
To evaluate possible sex differences in cardiac iron overload, we used the
hemojuvelin knockout mouse (HJV KO), a model of juvenile hemochromatosis,
supplemented with dietary iron. Our goal was to mimic the cardiac iron exposure found
in transfusional siderosis. Although HFE mutations are more common than HJV
mutations in humans, cardiac iron accumulation does not occur on an experimentally
feasible timescale (many decades). The HJV mice continuously absorb iron from their
diet, overcoming the high spontaneous iron elimination mechanisms found in rodents,
and develop myocyte iron levels similar to that found in human adolescents with
transfusional siderosis or juvenile hemochromatosis [75]. Although high total cardiac
iron levels can also be produced by iron dextran injections in rodents, iron is
preferentially retained in cardiac phagocytic cells (which humans lack) rather than
myocytes [76]. Without a means to separately track changes in myocyte and phagocytic
cell iron burdens, response of iron dextran models to therapies can be difficult to translate
to humans. Thus, we believe that severe hemochromatosis mutants, such as HJV KO,
represent the closest practical mimic to cardiac siderosis experienced in transfusional iron
overload.

24

Methods
Animals. Mice were housed in the Animal Care Facility of Children’s Hospital Los
Angeles. All studies were carried out with approval of the Institutional Animal Care and
Use Committee of Children’s Hospital Los Angeles. Hemojuvelin (HJV) knockout mice
were used in order to induce dietary iron overload; these mice have the background strain
of 129S6/SvEvTac and were obtained from the lab of Dr. Nancy Andrews at Children’s
Hospital Boston [77]. At four weeks of age, female mice were ovariectomized (OVX)
and male mice were castrated (OrchX). Female mice received either an estrogen implant
(OVX+E) or a cholesterol control (OVX); males received an implant containing
testosterone (OrchX+T), dihydrotestosterone (OrchX+DHT), estrogen (OrchX+E), or
cholesterol (OrchX). There were 7 mice per group; OVX and OrchX groups had 12 mice
per group. The mice were placed on a high iron diet for the 8 weeks following
gonadectomy (1400 ppm Fe, Newco Distributors Inc.). A high iron diet was necessary in
order to overcome the rodents’ up regulation of iron excretion during iron overload, a
phenomena that is not seen in humans. Also, a high iron diet allowed for the development
of cardiac iron loading in a short period of time. At 12 weeks of age the mice were
sacrificed and the heart and liver tissue were harvested.
Gonadectomy and hormone implants. All surgeries were performed under Avertin
anesthesia (250 mg/kg). Orchiectomy was performed via mid-line scrotal incision and
ovariectomy was performed through bilateral dorsal flank incisions. Steroids were
replaced at physiologic levels by Silastic implant sc. Males received a 5 mm implant (o.d.
25

2.16 mm, i.d. 1.02 mm, Dow Corning, Midland, MI) filled with crystalline testosterone
(Steraloids, Newport, RI). Females received a similar implant of estradiol (1:1 17β-
estradiol:cholesterol). These implants have been shown to restore normal male and
female phenotypes in numerous previous studies [78-81].
Iron quantification. Heart and liver specimens were digested in 100% nitric acid at 80°C
for 10 minutes; an equal volume of 30% H
2
O
2
was then added and digestion continued at
80°C for an additional 10 minutes or until the tissue was completely dissolved. Digested
samples were diluted with reagent grade water to 2% nitric acid concentration and
analyzed by flame atomic absorption spectrophotometry (Perkin Elmer, Waltham, MA).
RT-PCR. RNA was extracted using the RNeasy Protect Mini Kit (Qiagen, Valencia, CA).
Tissues were excised and submerged in RNA Later solution immediately after sacrificing
the mouse. Tissue samples in RNA Later solution were stored at -20˚C until RNA
extraction was performed. cDNA was synthesized using the SuperScript III First-Strand
Synthesis System (Invitrogen, Carlsbad, CA). RT-PCR reactions were done using the
Power SYBR Green PCR Master Mix (Applied Biosystems, Carlsbad, CA). Samples
were run on a 7900 HT Fast Real-Time PCR System (Applied Biosystems, Carlsbad,
CA). Linearity of amplification was verified for all primers. Hepcidin expression was
reported as percentage of β-actin expression. Cardiac iron transporters were measured as
a percentage of GAPDH expression. Primer sequences were as follows: Hepcidin forward
5-CTGAGCAGCACCACCTATCTC-3, reverse 5-TGGCTCTAGGCTATGTTTTGC-3;
β-actin forward 5-GACGGCCAGGTCATCACTATTG-3, reverse 5-
26

CCACAGGATTCCATACCCAAGA-3 [82]; Zip14 forward 5-
GAGCCAACTGATAATCCATTGCT-3, reverse 5-GTCAACGGCCACATTTTCAA-3
[83]; L-type calcium channel forward 5-
GATGGGATCATGGCTTATGG-3, reverse 5-GGCCAGCTTCTTTCTCTCCT-3 [56];
T-type calcium channel forward 5-ACCCTCCCCAAAGAAAGAT-3, reverse 5-
GCTTACATGGGACTTTTCAG-3 [84]; GAPDH forward 5-
CAATGTGTCCGTCGTGGATCT-3, reverse 5-GTCCTCAGTGTAGCCCAAGATG-3
[85].
Statistical Analysis. All statistical tests were performed using JMP 5.1 (SAS, Cary, North
Carolina). Since hormone treatment groups differed in males and females, steroid effects
were evaluated in each sex separately by one-way analysis of variance (ANOVA). Post-
hoc comparisons using Dunnett’s method were performed using OrchX and OVX as
control populations for males and females, respectively. A two-way ANOVA was
performed to assess for possible interaction between estrogen treatment and sex in
determining cardiac iron concentration. When no treatment group differences were
observed, data were pooled across sex and analyzed using an unpaired t-test.

Results
Hormone replacement had significant effects on heart mass in both sexes (Table
2.1). In females, estrogen reduced heart weight compared with OVX females (p<0.01).
27

In males, OrchX+T males had significantly bigger hearts than OrchX (p<0.01). Body
weight was significantly reduced in OVX+E vs. OVX, as well as in OrchX+E vs. OrchX
(p<0.001 and p<0.01, respectively). The heart/body weight ratio was significantly altered
in OrchX+T compared to OrchX males (p<0.05).

Table 2.1. Effects of steroid treatment on body, heart, and liver weight.
DHT, dihydrotestosterone; E, estrogen; OrchX, castrated male mice; OVX,
ovariectomized female mice; T, testosterone. Values represent mean ± standard error of
the mean. * P < 0.05 (Dunnett’s method, with OrchX as the control for male groups and
OVX as the control for female groups).

Gonadectomized males (OrchX) and females (OVX) exhibited similar cardiac
iron loads of 195.6±19.7 µg/g (mean±SEM) and 165.4±9.8 µg/g, respectively (p>0.05,
Fig 2.1). There was no effect of hormone treatment on cardiac iron in female mice, with
OVX+E having a heart iron concentration of 172.4±8.1 µg/g (Fig. 2.2A). In contrast, a
significant effect of hormone treatment on cardiac iron was revealed in males by
ANOVA (p<0.05). The concentration of cardiac iron in OrchX+E males was 289.6±26.1
Group Body weight
(g)
Heart weight
(g)
Liver weight
(g)
Heart/Body
Weight
(x10^3)
OrchX 26.3 ± 0.9 0.139 ± 0.005 1.59 ± 0.10 5.3 ± 0.1
OrchX+T 27.7 ± 1.1 0.170 ± 0.009 * 1.59 ± 0.08 6.1 ± 0.2 *
OrchX+DHT 27.3 ± 0.7 0.145 ± 0.008 1.55 ± 0.04 5.3 ± 0.2
OrchX+E 21.5 ± 0.5 * 0.121 ± 0.007 1.21 ± 0.04 * 5.6 ± 0.4
OVX 25.4 ± 0.6 0.137 ± 0.005 1.51 ± 0.08 5.3 ± 0.2
OVX+E 22.0 ± 0.6 * 0.113 ± 0.006 * 1.40 ± 0.07 5.2 ± 0.3
28

µg/g, compared to 195.6±19.7 µg/g for OrchX males (p<0.01) (Fig. 2.2B). OrchX+T
cardiac iron concentration was 266.0±18.7 µg/g while OrchX+DHT was 253.7±20.0
µg/g; however, these did not reach statistical significance (p>0.05 vs. OrchX in both
cases). There was an interaction between estrogen treatment and sex as measured by 2-
way ANOVA, as estrogen raised cardiac iron levels in male mice but not in females
(p<0.05). RT-PCR did not reveal any significant effect of sex or hormone treatment on
the mRNA of Zip14, L-type or T-type calcium channels, all of which are putative
transporters of non-transferrin bound iron in the heart. There was also no correlation
found between the expression levels of these channels and cardiac iron (data not shown).

Figure 2.1. Cardiac iron concentrations in gonadectomized male (OrchX) and
female (OVX). HJV knockout mice exposed to a high iron diet for 8 weeks. No
significant difference in cardiac iron was found between OrchX and OVX mice in the
absence of steroid replacement. Black diamonds represent males, grey squares represent
females.
29

Figure 2.2. The effect of sex hormones on cardiac iron concentration in
gonadectomized male (OrchX) and female (OVX) HJV knockout mice exposed to a
high iron diet for 8 weeks. (A) Replacement with estrogen (OVX+E) had no effect on
cardiac iron in female mice. (B) In males, estrogen (Orchx+E) significantly increased
cardiac iron (* P = 0.01).

30

Hormone treatment did not have any significant effect on liver iron concentration
in males or females. Therefore, liver iron data was pooled by sex. Liver iron
concentration in males was 2041.0±77.8 µg/g compared to 1776.5±101.5 µg/g in females
(p<0.01) (Fig. 2.3A). Cardiac and liver iron were weakly correlated in males (R
2
=0.12,
p<0.05), although this relationship appears driven by two outliers. No relationship was
seen in females (R
2
=0.04, p>0.05) (Fig. 2.3B).
All of the mice used in our experiments were homozygous hemojuvelin
knockouts. Compared to wild type mice, they should have very low hepcidin values
despite high dietary iron. In mice, the functional hepcidin protein is coded by the
HAMP1 gene; hepcidin expression can therefore be analyzed by measuring HAMP1
mRNA levels [86]. Our male mice had 7.7% the HAMP1 mRNA of wild type males,
while our female mice had 6.3% the HAMP1 mRNA of wild type females. No
correlation was found between HAMP1 expression and liver Fe concentration in male or
female mice (data not shown). In male mice, there was no effect of steroid treatment on
HAMP1; OVX+E females did have significantly less HAMP1 than OVX (p<0.01) (Fig.
2.4), but the physiologic significance of this difference is unclear.
The location of iron deposits within the heart and liver was revealed via Prussian
blue staining (Fig. 2.5). OrchX+E mice, which had the most cardiac iron as measured by
atomic absorption, showed heart iron primarily within cardiomyocytes. OrchX mice had

31

Figure 2.3. Hepatic iron concentration in pooled samples of male and female HJV
knockout mice exposed to a high iron diet for 8 weeks. (A) Males had 25% more liver
iron than females, indicating greater whole body iron (* P < 0.01). (B) Males showed a
weak correlation between liver iron and cardiac iron (R
2
=0.12, p<0.05, trendline
illustrated) but females did not show any correlation (R
2
=0.04, p>0.05). Black diamonds
represent males, grey squares represent females.

32

fewer cardiac iron deposits than OrchX+E mice, but also largely deposited iron within
cardiomyocytes. While male mice had significantly more liver iron than female mice, the
pattern of liver iron deposition was very similar in males and females. Hepatic iron
deposits tended to cluster around portal triads and largely resided within hepatocytes in
both males and females.

Figure 2.4. Hepcidin (HAMP1) expression relative to β-actin in male and female
HJV knockout mice as well as in male and female wildtype (WT) mice. Male and
female HJV knockout mice had suppressed HAMP1 expression in comparison to their
wildtype counterparts. Male HJV knockout mice did not show any significant differences
in HAMP1 expression due to hormone treatment. In females, OVX did have significantly
more HAMP1 expression than OVX+E (* P < 0.01). Black diamonds represent males,
grey squares represent females.

33

Figure 2.5. Prussian blue iron staining of heart (40x magnification) and liver tissue
(20x magnification). Iron deposits are revealed by their blue color. (A) OrchX+E mice
show iron staining within cardiomyocytes. (B) OrchX mice also show iron staining
within cardiomyocytes, but to a lesser degree. (C and D) Male and female livers showed
similar patterns of iron deposits around portal triads. OrchX and OVX livers are depicted
here as examples. Hepatic iron deposited largely within hepatoctyes.

34

Discussion
We found that estrogen increased cardiac iron concentration selectively in males,
indicating that prenatal steroid exposure primed the males (organizational effect) to
accumulate greater cardiac iron in the presence of estrogen (activational effect). It is true
that estrogen-implanted males had a trend towards smaller heart weight (Table 2.1),
which could conceivably increase cardiac iron through a concentration effect. However,
estrogen lowered heart weights more in females than in males, yet females did not show
an increase in cardiac iron concentration. There was also no correlation found between
heart weight and cardiac iron concentration (data not shown). Therefore, changes in
heart weight do not explain the changes in cardiac iron concentration seen in OrchX+E
mice.
One way estrogen could increase cardiac iron load in males is by modulating the
iron transporters of the heart. Traditional iron transporters such as DMT1 and ferroportin
are tightly regulated so that stable levels of tissue iron are maintained, even during iron
overload [7]. More likely targets include putative, nonspecific labile iron transporters
such as the Zip14 zinc channel or the L-type and T-type calcium channels [28-30].
However, we did not see any effect of sex or hormone treatment on mRNA expression of
these three channels, or any correlation between their expression and heart iron
concentration. We did not have sufficient cardiac tissue to probe for differences at the
protein level. We also cannot exclude possible hormone effects on channel activity. With
35

regards to the L-type calcium channel, several studies suggest that estrogen inhibits its
current, which would counter the observations in the present work [87-89].
Alternatively, estrogen could be increasing cardiac iron load in males by
increasing the amount of labile plasma iron (LPI), the form of iron taken up by cardiac
myocytes. Iron in the plasma is normally bound by transferrin so that it can be shuttled
throughout the body in a safe manner. Once transferrin saturation reaches ~85%, LPI
levels rise quite sharply [90]. If estrogen treatment in males increases iron levels in the
plasma, and transferrin is already nearly saturated, then there would be disproportionately
more LPI available for transport into the heart. Direct validation of this possibility is
challenging because of the lability and lack of validation of transferrin saturation
measurements in animals.
Hormone treatment did not have any significant effect on liver iron concentration
in either sex (no activational effect). However, males had 25% more liver iron than
females overall, indicating organizational differences in iron absorption or elimination.
Further work using metabolic cages and using different controlled diets will be necessary
to better localize the source of these differences. In prior published works, females have
had more hepcidin expression and liver iron than males [91, 92]. However, there are two
key differences between the present study and prior work. First, HJV KOs have no
significant hepcidin upregulation in response to iron load, thus sex differences in
hepcidin expression will be masked. Second, the present study did not address the
potential role of progesterone on iron absorption in females. While the OVX+E females
36

did have physiologic levels of estrogen, they had no exposure to progesterone. Because
progesterone is produced in preparation for and maintenance of pregnancy, it is
conceivable that it enhances iron absorption. Alternatively, normal hormonal cyclicity of
gonad-intact females could cause them to have more liver iron than males.
Initially, the translational relevance of estrogen replacement in males might be
difficult to appreciate. Testosterone is the dominant steroid produced by the testes, and
circulating estrogen levels in males are relatively low. Instead, males produce estrogen
locally by aromatization of testosterone at target tissue sites that also contain estrogen
receptors. The aromatase enzyme has been detected in various tissues of the body
including adipose, bone, vasculature, brain and heart [93-95]. Many studies, particularly
in the central nervous system, have shown that actions of androgens in males are actually
mediated via estrogen. Because testosterone has potential to bind either to androgen
receptors or to estrogen receptors after local aromatization, it is important to distinguish
between its androgenic and estrogenic effects. This is achieved through comparison of
DHT vs. estrogen replacement. That testosterone-treated males in the present study
exhibited cardiac iron levels similar to estrogen-treated males (and higher than DHT-
treated males) argues that testosterone’s effects in males are likely mediated through
estrogen.
One limitation of this study is that we do not have measurements of LPI or
transferrin saturation. These measurements are challenging to perform accurately in
humans, and even more so in mice. Further work is also needed to explore whether
37

increased liver iron resulted from increased iron absorption or decreased iron excretion.
Radiolabelled iron and metabolic cage studies would be required to address this question.
Small group sizes may have limited our ability to detect a significant difference in cardiac
iron between the androgenic mice (OrchX+T and OrchX+DHT) and OrchX. If our
measured means and standard deviations were representative of true cardiac iron
differences, we would have required group sizes of 18 animals for the OrchX+DHT vs.
OrchX comparison, and 12 animals for the OrchX+T vs. OrchX comparison to achieve
80% statistical power to detect these differences; group sizes of this magnitude would
have been difficult to justify to our animal facility and animal use committees.
We also acknowledge that there is no perfect model for mimicing transfusional
iron overload. Hypertransfusion is technically challenging and cannot produce
meaningful cardiac iron loading in rodents during their lifespan (humans require close to
100 transfusions before cardiac iron accumulation occurs). Massive macromolecular iron
injections produce detectable iron overload in the heart, but unlike in humans, most of the
iron is deposited in cardiac macrophages rather than cardiomyocytes [76]. In contrast, the
HJV KO mouse, when given increased dietary iron, produces myocyte histology and iron
levels similar to those found in adolescents with early cardiac iron accumulation [75].
Although mutations in HFE are far more common than those in HJV, HFE knockouts do
not readily load cardiac iron. In fact, humans with the HFE mutation do not develop
cardiac iron overload until the fourth or fifth decade of life.
38

Any mutation that abolishes hepcidin response to iron inherently obscures the
possibility that sex steroids may act through modulation of the BMP-SMAD and hepcidin
pathways. To date, the effects of sex steroids on hepcidin have been mixed: ‘Yang Q et
al. 2012’ and ‘Hou Y et al. 2012’ demonstrated that OVX females had increased
hepcidin, while ‘Ikeda et al., 2012’ reported that OVX females had decreased hepcidin
[96-98]. While our results have important limitations, they do clearly demonstrate
substantive steroid-mediated differences that are independent of hepcidin. This is also
relevant because thalassemia patients tend to have low hepcidin levels due to their
ineffective erythropoiesis. Furthermore, there has been no evidence to date that cardiac
HJV has any effect on cardiac iron flux.
Our animal model also fails to capture functional aspects of cardiac iron overload.
Histology of the HJV KOs revealed no structural damage in the heart and the activity
level and life span of the mice were normal. However, creating functional abnormalities
of iron overload in rodents has been very hard to capture across the field. Rodents may
have a better intrinsic buffering system against iron overload within cardiomyocytes.
Alternatively, the time-scale of practical animal experimentation (weeks to months) is
much shorter than the time-scale for development of cardiac symptoms in humans
(years), so the iron just may not have had sufficient time to produce measureable damage.
Speculations. Men fare worse than women in iron overload syndromes. Iron loss through
menstruation may be one potential explanation for this effect. However, since female
mice do not menstruate, menstrual blood loss cannot account for the sex differences we
39

observed in the present study. Although hepcidin regulation and dysregulation explain
many clinical aspects of iron biology, we demonstrate that sex steroids increase hepatic
and cardiac iron loading through a hepcidin-independent mechanism in a primary
hemochromatosis model. The effect is limited to males, indicating that prenatal steroid
exposure is responsible for postnatal sensitivity. No clear evolutionary basis for this
observation is evident, but there are clinical consequences. For example, it may partially
explain why development of cardiac iron overload is most common between 10 and 20
years of age in secondary hemochromatosis [54]. Increased iron absorption in males
might also contribute to sex differences in hereditary hemochromatosis severity [73].
Sex differences might also be a useful technique to probe for iron transporters and
alternative regulatory pathways.

40

Chapter 3. mRNA Regulation of Cardiac Iron Transporters and Ferritin
Subunits in a Mouse Model of Iron Overload (Brewer, C., et. al. Exp
Hematol. submitted for review)

Abstract
Iron cardiomyopathy is the leading cause of death in iron overload. Men have
twice the mortality rate of women, though the cause is unknown. In hemojuvelin-
knockout mice, a model of the disease, males load more cardiac iron than females. We
postulated that sex differences in the expression of cardiac iron importers cause
differences in cardiac iron concentration. RT-PCR was used to measure mRNA of
cardiac iron transporters in hemojuvelin-knockout mice. No sex differences were
discovered among putative transporters of non-transferrin bound iron (L-type and T-type
calcium channels, ZRT/IRT-like protein 14 zinc channels). Transferrin-bound iron
transporters were also analyzed; these are controlled by the iron regulatory element/iron
regulatory protein (IRE/IRP) system. There was a positive relationship between cardiac
iron and ferroportin mRNA in both sexes, but it was significantly steeper in females
(p<0.05). Transferrin receptor 1 and divalent metal transporter 1 were more highly
expressed in females than males (p<0.01 and p<0.0001, respectively), consistent with
their lower cardiac iron levels, as predicted by IRE/IRP regulatory pathways. Light-chain
(L) ferritin showed a positive correlation with cardiac iron that was nearly identical in
males and females (R
2
=0.41, p<0.01 and R
2
=0.56, p<0.05, respectively), while heavy-
chain (H) ferritin was constitutively expressed in both sexes. This represents the first
report of IRE/IRP regulatory pathways in the heart. Increased cardiac iron levels
41

observed in males might result from delayed upregulation of iron export rather than
increased iron import. Heart failure in iron overload patients may be due to a shift in the
L:H ratio of cardiac ferritin.

Introduction
While iron is essential for many of the body’s processes, excess iron produces
oxidative stress, leading to vascular and organ damage. Iron overload can be caused by
genetic mutations to iron regulatory genes (primary iron overload, i.e. hemochromatosis)
or by chronic blood transfusions during the treatment of hemoglobinopathies such as
thalassemia (secondary iron overload) [67, 71, 99]. Despite current treatments, iron-
mediated cardiomyopathy remains the leading cause of death in thalassemia [9]. Female
thalassemia patients have a two-fold greater survival rate than males [47]; similar
disparities in disease severity have been documented in hereditary hemochromatosis [73].
The reason for this is unknown.
Previously, we explored this sex difference in a hemojuvelin knockout mouse;
this juvenile hemochromatosis model produces cardiac iron levels and distribution similar
to humans [75]. Animals of both sexes were gonadectomized and received Silastic
implants filled with testosterone, dihydrotestosterone, estrogen, or cholesterol (as a
control). Regardless of treatment, males exhibited significantly greater heart iron
concentrations than females. In addition, sex steroid treatment significantly increased
cardiac iron concentration in males, but not in females. In particular, gonadectomized
42

males with estrogen replacement had significantly more heart iron than gonadectomized
males with a control cholesterol implant; estrogen did not cause a similar increase in
female heart iron [100]. We concluded that postnatal steroids, acting through an
activational estrogenic mechanism, were responsible for increasing cardiac iron.
However, prenatal steroid exposure, prior to gonadectomy, must also be producing
organizational changes in iron metabolism because the activational effects were only seen
in males.
The present study pursues potential mechanisms for the sex differences seen in
cardiac iron loading in this model. We analyzed the mRNA of three suspected non-
transferrin bound iron (NTBI) transporters: L-type calcium channels, T-type calcium
channels, and ZRT/IRT-like protein 14 (Zip14) zinc channels [28-30]. We also probed
for evidence of iron regulatory circuits in the heart. Classically, transferrin-bound iron
importers and exporters are regulated via the iron regulatory element/iron regulatory
protein (IRE/IRP) system [7]. These transporters contain IREs in their mRNA that are
bound by IRPs –translation of the mRNA can then be regulated in response to changes in
cellular iron. It is possible that sex differences in the regulation of these transporters
could influence cardiac iron levels; we therefore analyzed the mRNA of the iron exporter
ferroportin, the iron importers transferrin receptor 1 (TFR1) and divalent metal
transporter 1 (DMT1), and the iron storage protein ferritin. Organ iron homeostasis has
been previously examined, most often in the duodenum, liver and macrophages, but this
represents the first description of cardiac iron homeostasis in a mouse model of iron
overload.
43

Methods
Animals. Mice were housed in the Animal Care Facility of Children’s Hospital Los
Angeles. All studies were carried out with approval of the Institutional Animal Care and
Use Committee of Children’s Hospital Los Angeles. Hemojuvelin knockout mice were
used to induce dietary iron overload; these mice have the background strain of
129S6/SvEvTac and were obtained from the lab of Dr. Nancy Andrews at Children’s
Hospital Boston [77].

To probe for hormonal effects, mice were gonadectomized and
received hormone implants. Female mice were ovariectomized (OVX) and male mice
were castrated (OrchX) at 4 weeks of age. Female mice received either an estrogen
implant (OVX + E) or a cholesterol control (OVX); males received an implant containing
testosterone (OrchX + T), DHT (OrchX + DHT), estrogen (OrchX + E), or cholesterol
(OrchX). Intact males and females received a sham gonadectomy and a cholesterol
control implant. There were 7 mice per group; the OVX and OrchX groups had 12 mice
per group. The mice were placed on a high iron diet for the 8 weeks following
gonadectomy (1400 ppm iron; Newco Distributors, Rancho Cucamonga, CA, USA). A
high-iron diet was necessary to overcome the rodents’ upregulation of iron excretion
during iron overload, a phenomena that is not seen in humans. Also, a high-iron diet
allowed for the development of cardiac iron loading in a short period of time. At 12
weeks of age, the mice were sacrificed and the heart and liver tissue were harvested.
44

Gonadectomy and hormone implants. All surgeries were performed under Avertin
anesthesia (250 mg/kg). Orchiectomy was performed via midline scrotal incision and
ovariectomy was performed through bilateral dorsal flank incisions. Steroids were
replaced at physiological levels by Silastic implant subcutaneously. Males and females
received a 5-mm implant (outer diameter, 2.16 mm; inner diameter, 1.02 mm; Dow
Corning, Midland, MI, USA) filled with crystalline steroid (Steraloids, Newport, RI,
USA). Estradiol was first mixed with cholesterol before being loaded into the implant
(1:1 17β-estradiol:cholesterol). These implants have been shown to restore normal male
and female phenotypes in numerous previous studies [78-81].

Iron quantification. Heart and liver specimens were digested in 100% nitric acid at 80°C
for 10 minutes; an equal volume of 30% H
2
O
2
was then added, and digestion continued at
80°C for an additional 10 minutes or until the tissue was dissolved completely. Digested
samples were diluted with reagent-grade water to 2% nitric acid concentration and
analyzed by flame atomic absorption spectrophotometry (Perkin Elmer, Waltham, MA,
USA).
Reverse transcription-polymerase chain reaction. RNA was extracted using the RNeasy
Protect Mini Kit (Qiagen, Valencia, CA, USA). Tissues were excised and submerged in
RNA Later solution immediately after sacrifice. Tissue samples in RNA Later solution
were stored at -20°C until RNA extraction was performed. Complementary DNA was
synthesized using the SuperScript III First-Strand Synthesis System (Invitrogen,
Carlsbad, CA, USA). Reverse transcription-polymerase chain reactions (RT-PCRs) were
done using the Power SYBR Green PCR Master Mix (Applied Biosystems, Carlsbad,
45

CA, USA). Samples were run on a 7900 HT Fast Real-Time PCR System (Applied
Biosystems, Carlsbad, CA, USA). Linearity of amplification was verified for all primers.
Gene expression was reported as percentage of glyceraldehyde-3-phosphate
dehydrogenase (GAPDH) expression. Primer sequences were as follows: Zip14 forward,
5-GAGCCAACTGATAATCCATTGCT-3; Zip14 reverse, 5-
GTCAACGGCCACATTTTCAA-3 [83]; L-type calcium channel forward, 5-
GATGGGATCATGGCTTATGG -3; L-type calcium channel reverse, 5-
GGCCAGCTTCTTTCTCTCCT-3 [56]; T-type calcium channel forward, 5-
ACCCTCCCCAAAGAAAGAT-3; T-type calcium channel reverse, 5-
GCTTACATGGGACTTTTCAG-3 [84]; GAPDH forward, 5-CAATGTGTCCGTCG
TGGATCT-3; GAPDH reverse, 5-GTCCTCAGTGTAGCCCAAGATG-3 [85];
ferroportin forward, 5-TGGATGGGTCCTTACTGTCTGCTAC-3; ferroportin reverse, 5-
TGCTAATCTGCTCCTGTTTTCTCC-3 [101]; TFR1 forward, 5-
TCCCGAGGGTTATGTGGC-3; TFR1 reverse, 5-GGCGGAAACTGAGTATGATTGA-
3 [102]; DMT1 forward, 5-TCAGAGCTCCACCATGACTG-3; DMT1 reverse, 5-
TGTGAACGTGAGGATGGGTA-3 [103]; L-ferritin forward, 5-
TGGCCATGGAGAAGAACCTGAATC-3; L-ferritin reverse, 5-
GGCTTTCCAGGAAGTCACAGAGAT-3 [104]; H-ferritin forward, 5-
GATCAACCTGGAGTTGTATGCC-3, H-ferritin reverse, 5-
CTCCCAGTCATCACGGTCTG-3 [105].
Statistical analysis. All statistical tests were performed using JMP 5.1 (SAS Institute,
Cary, NC, USA). Because hormone treatment groups differed in males and females,
46

hormone effects were evaluated in each sex separately by 1-way analysis of variance
(ANOVA). When no treatment group differences were observed, data were pooled across
sex and analyzed by Student’s t test. Significance of linear correlations was defined as a p
value < 0.05. Discriminant analysis was used to demonstrate the separation of male and
female data in the ferroportin vs. heart iron comparison.

Results
No effect of sex or hormone treatment was observed for mRNA of L-type calcium
channels, T-type calcium channels, or Zip14 zinc channels. Furthermore, no association
was seen between cardiac iron levels and the channels’ mRNA levels (Table 3.1). These
data support the hypothesis that cardiac iron uptake of NTBI is constitutive once
transferrin becomes completely saturated.
However, steady-state cardiac iron concentration reflects a balance between
intake and export. Thus we analyzed the iron exporter ferroportin for possible sex
differences. This channel is the sole known mammalian exporter of tissue iron and has
been shown to regulate intracellular iron levels through the IRE/IRP system [7, 106]. In
males, there was a correlation between heart iron concentration and ferroportin mRNA
expression (R
2
=0.35, p<0.01). Females showed a similar trend, though the correlation did
not reach statistical significance because of a single outlier (R
2
=0.12, p<0.22, outlier by
arrow) (Figure 3.1). Interestingly, ferroportin increased more sharply in females in
response to cardiac iron overload, potentially limiting cardiac iron accumulation. The
separation of the male and female ferroportin response was significant by discriminate
47

Table 3.1. mRNA expression of NTBI transporters and relationship to heart iron
concentration
* = p-value

Fig 3.1. Relationship between heart iron concentration and ferroportin mRNA
expression in males and females. Black diamonds = males; grey squares = females.
Positive correlation in males was significant (R
2
=0.35, p<0.01), while the positive
relationship in females did not reach significance because of one outlier (R
2
=0.12,
p<0.22, outlier indicated by arrow). Steeper relationship in females suggests increased
iron export during iron overload compared to males.
Expression relative to
GAPDH
Hormone
effect
(p-value)
Correlation with heart iron
concentration
male female Ion
channel

male

female

p-
value

male

female
R
2
p* R
2
p*
L-type 5.1*10
3
5.4*10
3
0.60 0.98 0.72 0.10 0.17 <0.01 0.84
T-type 1.6*10
3
1.7*10
3
0.75 0.56 0.42 <0.01 0.75 <0.01 0.98
Zip 14 4.0*10
3
3.7*10
3
0.20 0.18 0.93 <0.01 0.69 0.17 0.21

48

analysis (p<0.05). The observed sex difference could represent a difference in set point
(x-intercept), a difference in strength of response (slope), or both; this study was
underpowered to distinguish among these possibilities. Regardless, it suggests that our
observed sex differences in cardiac iron loading were best explained by regulation of iron
export rather than iron uptake.
Since we saw sex differences in IRE/IRP regulated iron export, it was logical to
probe the IRE/IRP controlled importers, TFR1 and DMT1, for sex differences as well.
The classic model of IRE/IRP regulation predicts that these importers’ mRNA will be
degraded when iron levels are high [7, 107]. In our study, cardiac TFR1 levels were
lower in males than in females relative to GAPDH (3.8*10
-4
vs.

7.3*10
-4
, respectively,
p<0.01) (Figure 3.2A). TFR1 was also negatively correlated with heart iron
concentration (R
2
=0.16, p<0.05) (Figure 3.2B). No significant hormone effects were
observed. Cardiac DMT1 levels were also lower in males than in females relative to
GAPDH (1.1*10
-3
vs. 1.8*10
-3
, respectively, p<0.0001) (Figure 3.3A). Interestingly,
males showed a positive correlation between heart iron concentration and DMT1 mRNA
(R
2
=0.25, p<0.05) (Figure 3.3B). Despite this paradoxical positive correlation, the total
level of DMT1 mRNA in males was quite low. Taken together, these results are
consistent with classical IRE/IRP regulation, with decreased TFR1 and DMT1 mRNA
levels when cellular iron levels are high, thereby limiting cellular iron intake.
To complete the characterization of the cardiac IRE/IRP circuit, we analyzed
mRNA expression of the iron storage genes, light-chain (L) and heavy-chain (H) ferritin,
49

Figure 3.2. TFR1 mRNA expression and its relationship to cardiac iron
concentration in males and females. Black diamonds = males; grey squares = females.
(A) Females had significantly more TFR1 mRNA than males (p<0.01). (B) There was a
negative correlation between TFR1 mRNA and heart iron concentration (R
2
=0.16,
p<0.05).

Fig 3.3. DMT1 mRNA expression and its relationship to cardiac iron concentration
in males and females. Black diamonds = males; grey squares = females. (A) Females
had significantly more DMT1 mRNA than males (p<0.0001). (B) Males showed a
positive correlation between DMT1 and heart iron concentration (R
2
=0.25, p<0.05).
50

relative to GAPDH. Males and females showed very similar positive correlations of L-
ferritin mRNA with heart iron concentration (R
2
=0.41, p<0.01 for males and R
2
=0.56,
p<0.05 for females) (Figure 3.4). H-ferritin mRNA levels were about two to seven fold
higher than those of L-ferritin in both males and females. There was no correlation seen
between heart iron concentration and H-ferritin mRNA; instead, H-ferritin was
constitutively expressed (Figure 3.5A). Interestingly, when normalized to heart iron
concentration, females expressed significantly more H-ferritin than males (0.0023 vs.
0.0014, respectively, p<0.001) (Figure 3.5B).

Figure 3.4. L-ferritin mRNA expression and its relationship to heart iron
concentration. Black diamonds = males; grey squares = females. Males and females
showed very similar correlations between L-ferritin and heart iron concentration
(R
2
=0.41, p<0.01 for males and R
2
=0.56, p<0.05 for females).

51

Fig 3.5. H-ferritin mRNA expression and its relationship to heart iron concentration
in males and females. Black diamonds = males; grey squares = females. (A) No
correlation was found between H-ferritin and heart iron concentration in males or
females. (B) Females had more H-ferritin mRNA when normalized to heart iron
concentration (p<0.001).

Discussion
Most previous research into cardiac iron overload has focused on putative NTBI
import channels. While these importers are important because they represent a potential
therapeutic target, we did not observe any sex differences in their message level. In
contrast, we noted differential regulation of the iron exporter ferroportin consistent with
observed sex differences in cardiac iron. While we could not distinguish whether females
had a lower cardiac iron setpoint for ferroportin upregulation, a steeper slope between
ferroportin message and cardiac iron, or both, our data suggests that regulation of iron
export may be an underappreciated determinant of cardiac iron accumulation.
52

Strong ferroportin induction by cardiac iron may explain several phenomena
observed in mice and in humans. First, cardiac iron overload appears to be self-limiting in
many murine models, such that cardiac iron levels plateau over time [77]. In humans,
there is a long latency between hepatic iron loading and cardiac iron loading. The
mechanism for this latency period is poorly understood, but it is possible that cardiac iron
export is able to balance NTBI influx over certain ranges. However, once cardiac iron
loading begins, it generally proceeds very rapidly [32] suggesting a saturation
phenomenon to the compensatory mechanisms. Additional support for this hypothesis is
the relatively low rate of cardiac iron loading in thalassemia intermedia. Circulating
NTBI levels are increased in thalassemia intermedia but the molar flux of these labile
iron species is significantly lower than in transfusional siderosis. We postulate
ferroportin iron export can successfully balance NTBI uptake over the flux rates observed
in thalassemia intermedia for many years. However, once ferroportin expression is
maximized, cardiac iron accumulation can be quite rapid.
In the classic models, IRE/IRP regulation of ferroportin is translational, not
transcriptional, through binding to the 5’ untranslated region [7]. Translational regulation
has been demonstrated in such tissues as the liver and duodenum [7], but has not been
explored in the heart. In the present study, we observed that ferroportin mRNA increases
with cardiac iron, suggesting transcriptional as well as possible translational control of
ferroportin upregulation in the heart. While the mechanisms of transcriptional control are
not clear, other groups have shown that ferroportin transcription in macrophages can be
regulated by heme [21, 22]; other studies in macrophages and lung cells have shown
53

ferrportin transcription to be increased by high cellular iron concentration [23, 24]. These
mechanisms are of clinical interest because potentiating cardiac ferroportin upregulation
could be a useful therapeutic target.
Since females had lower cardiac iron than males, the IRE/IRP system was
expected to promote stabilization of their DMT1 and TFR1 mRNA, as was observed.
TFR1 also displayed a negative relationship with heart iron in both sexes. While these
responses are intuitive based on classic IRE/IRP regulation, this is the first manuscript to
describe these findings in the heart. The female TFR1 response may have had a steeper
relationship with iron compared to males, similar to the ferroportin, but we did not have
sufficient range of cardiac iron levels in females to explore this hypothesis.
While male DMT1 mRNA was low compared to females, males did show a
paradoxical positive correlation between DMT1 expression and heart iron concentration.
DMT1 exhibits multiple transcripts, some containing an IRE (“IRE-positive”) and some
without (“IRE-negative”) [108]. As cardiac iron levels increase, IRE-positive transcripts
would be degraded but IRE-negative transcripts would be unaffected. Males with
increased constitutive IRE-negative DMT1 expression would potentially take up more
circulating NTBI, creating a positive correlation between heart iron and DMT1.
However, since males have considerably less total DMT1 than females, differences in
IRE-negative DMT1 mRNA are likely to be of secondary importance than the sex
differences observed in ferroportin mRNA with respect to influencing cardiac iron levels.
54

Further evidence of IRE/IRP mediated cardiac iron homeostasis was
demonstrated by the regulation of L-ferritin by cardiac iron. Safe tissue packaging of
cellular iron is accomplished by the ferritin protein, a sphere-like shell composed of 24 H
and L ferritin subunits. The L:H ratio of the ferritin molecule varies according to tissue
type; L-rich ferritin is abundant in iron-storage organs such as the liver and spleen while
H-rich ferritin is found in organs of low iron content such as the heart and brain [109].
While L-rich protein has prolonged turnover time and is more resistant to proteolysis than
H-rich protein [110], it is the H-ferritin subunit that possesses the ferroxidase ability
required for a functional ferritin molecule [111, 112]. In normoxic conditions, the
translational control of L and H-ferritin subunits is similar, with translational repression
occurring when iron concentration is low [113]. Transcriptional control of the two
subunits is not as well studied, but work in the rat liver has shown L-ferritin transcription
increases with iron while H-ferritin transcription does not rise significantly [25].
Examination of the L-ferritin promoter has shown it to be affected by antioxidant
inducers as well as high iron concentrations; the H-ferritin promoter did not show the
same response to high iron [114]. In a separate study, L-ferritin mRNA was found to be
twice as high in old rat hearts compared to young ones, presumably upregulated by age-
related oxidative stress, while H-ferritin levels did not change [115]. Taken together,
these findings coincide with what we saw in the mouse heart, as L-ferritin mRNA
correlated with heart iron concentration while H-ferritin mRNA was constitutively
expressed.
55

However, the constitutive transcription of H-ferritin appears to be limiting at high
iron concentrations. H-ferritin is the only known cytoplasmic ferroxidase capable of
converting Fe2+ to Fe3+, and tight regulation of H-ferritin is believed to be necessary for
quick chelation of labile iron and prevention of oxidative stress [111]. Based on Figure 4,
one would predict that the L:H ratio of cardiac ferritin protein would surpass 1 near
cardiac iron levels of 800 µg/g wet weight, or roughly 4.8 mg/g dry weight [116, 117]. In
humans, cardiac iron levels of this magnitude correspond to a cardiac T2* value of 6.3
milliseconds and are associated with a 50% risk of developing heart failure in one year
[118]. While L-rich ferritin is favorable for long-term iron storage, it is not as well-suited
for quick iron clearance. Our data therefore suggests that heart failure in iron overloaded
patients is linked to a shift in ferritin’s L:H ratio and the resulting loss of rapid iron
detoxification provided by H-rich ferritin. For this reason, the regulatory mechanisms of
cardiac H-ferritin are potentially attractive therapeutic targets.
The primary limitation of this study is the lack of protein work to independently
assess translational and transcriptional regulation. Determination of cardiac iron levels by
atomic absorption required substantial amounts of the ventricle and the rest of the
ventricular tissue was needed for the RT-PCR work. We chose to focus on the RT-PCR
data, because we could analyze a wide range of iron transporters and rapidly screen for
sex differences and interactions with cardiac iron burden. However, we recognize that
further studies probing the mechanisms of cardiac ferroportin and ferritin subunit
regulation through the IRE/IRP system will need protein validation of observed changes
in mRNA levels.
56

Chapter 4. Progesterone increases liver iron concentration in a mouse model of
primary iron overload

Abstract
Primary iron overload is characterized by low serum levels of the iron regulatory
hormone hepcidin, resulting in increased dietary iron absorption. High iron
concentrations develop in organs such as the heart, liver and pancreas, leading to tissue
damage and organ failure. We have previously described sex differences in liver and
heart iron loading in a primary hemochromatosis model with a focus on the role of
estrogen and testosterone. Little is known about the effects of the female hormone
progesterone on the disease. This is particularly important since progestin contraceptives
are widely used in Southeast Asia, where the frequency of primary iron overload is high.
Female hepcidin-deficient (hemojuvelin knockout) mice were ovariectomized prior to
puberty (OVX) and received Silastic implants containing progesterone and estrogen
(OVX+EP), estrogen (OVX+E), progesterone (OVX+P), or an empty control (OVX).
Because expression of the progesterone receptor requires estrogen, OVX+EP females
represent physiologic progesterone replacement. After 10 weeks, liver iron concentration
(LIC) was 29% higher in OVX+EP vs. OVX females (p<0.01). Cardiac iron was 43%
higher in OVX+EP females, but this did not reach significance (p<0.14). There was no
correlation between residual hepcidin levels and LIC. mRNA for duodenal ferroportin,
the cellular iron exporter largely responsible for dietary iron absorption, was unaffected
by hormone replacement. However, protein levels of duodenal ferroportin were
significantly higher in OVX+EP compared to OVX+P females (p<0.05). Progesterone
57

replacement significantly increased LIC by a hepcidin-independent mechanism. This may
be clinically relevant to patients with primary iron overload that are considering
progesterone contraceptives.

Introduction
Iron is required by virtually all mammalian cells because of its roles in cellular
respiration, DNA synthesis, and oxygen transport [1]. However, too much iron can
become toxic due to the generation of dangerous hydroxyl radicals [7]. Regulatory
mechanisms limit how much iron is absorbed from the diet as well as how much iron is
stored by individual cells [106, 107]. However, iron overload can result from increased
gut absorption (i.e. primary iron overload) or from chronic blood transfusions during the
treatment of hemoglobinopathies (i.e. secondary iron overload) [6].
Primary iron overload is caused by low serum levels of the iron regulatory
hormone hepcidin. In healthy individuals, hepcidin levels increase when systemic iron
levels are high, thereby degrading the iron exporter ferroportin on the basolateral
membrane of the enterocyte, and limiting dietary iron absorption. Because iron is vital to
many biological processes, hepcidin is regulated by several additional stimuli [106]. In
particular, erythropoietic drive has been shown to decrease hepcidin expression, allowing
increased dietary iron absorption and incorporation into red blood cells [119]. As a
consequence, anemic patients suffering from hemoglobinopathies such as thalassemia
58

intermedia have chronically low hepcidin levels, causing excessive dietary iron
absorption and primary iron overload [36, 120].
Thalassemia intermedia is a group of non-transfusion dependent anemias caused
by mutations to the globin chain of hemoglobin [121]. Due to a heterozygous advantage
against malaria, the disease is endemic in Southeast Asia [37, 122]. This population also
commonly uses progestin contraceptives, which halt ovulation via the chronic elevation
of plasma progestin levels [123, 124]. However, the effect of progesterone on iron
homeostasis is unknown. During pilot hormone replacement studies in our lab, we
observed that progesterone increased liver iron concentration (LIC) in a hepcidin-
deficient mouse model (unpublished data). Because the majority of the body’s iron is
stored in the liver, LIC is a useful marker of whole body iron content [8, 11]. We have
therefore explored the effect of tonic progesterone replacement on iron homeostasis in a
mouse model of primary iron overload.

Methods
Animals. Hemojuvelin knockout mice (HJV KO) were used to induce dietary iron
overload; these mice have the background strain of 129S6/SvEvTac [77].

Hemojuvelin is
essential for normal hepcidin synthesis and this model mimics the most severe form of
primary hemochromastosis (juvenile hemochromatosis) found in humans. Female mice
(n=7/group) were ovariectomized (OVX) at 4 weeks of age and received an implant
containing progesterone and estrogen (OVX+EP), estrogen (OVX+E), progesterone
59

(OVX+P), or an empty control (OVX). After ovariectomy, mice were placed on a high
iron diet (1400 ppm iron; Newco Distributors, Rancho Cucamonga, CA) for 10 weeks,
and were sacrificed at 14 weeks of age.
Ovariectomy and hormone replacement. Surgeries were performed under Avertin
anesthesia (250 mg/kg). Ovariectomy was performed through bilateral dorsal flank
incisions. Steroids were replaced at physiological levels by Silastic implant
subcutaneously. Implants were filled with crystalline steroid (Steraloids, Newport, RI).
Progesterone implants had a 1 cm effective length (outer diameter, 3.18mm; inner
diameter, 1.57 mm; Dow Corning, Midland, MI). Estrogen implants had a 5-mm
effective length (outer diameter, 2.16 mm; inner diameter, 1.02 mm; Dow Corning), and
were filled with 1:1 17β-estradiol:cholesterol. These implants have been shown to restore
normal ovarian hormone levels in previous studies [79, 125].

Reverse transcription-polymerase chain reaction. RNA was extracted using the RNeasy
Protect Mini Kit (Qiagen, Valencia, CA). Tissues were excised and submerged in RNA
Later solution. Complementary DNA was synthesized using the SuperScript III First-
Strand Synthesis System (Invitrogen, Carlsbad, CA). Reverse transcription-polymerase
chain reactions (RT-PCRs) were done using the Power SYBR Green PCR Master Mix
(Applied Biosystems, Carlsbad, CA). Samples were run on a 7900 HT Fast Real-Time
PCR System (Applied Biosystems, Carlsbad, CA). Hepcidin was reported relative to β-
actin; ferroportin was reported relative to glyceraldehyde-3-phosphate dehydrogenase
(GAPDH). Primer sequences were as follows: GAPDH forward, 5-
CAATGTGTCCGTCG TGGATCT-3; GAPDH reverse, 5-
60

GTCCTCAGTGTAGCCCAAGATG-3 [85]; ferroportin forward, 5-
TGGATGGGTCCTTACTGTCTGCTAC-3; ferroportin reverse, 5-
TGCTAATCTGCTCCTGTTTTCTCC-3 [101]; hepcidin forward, 5-
CTGAGCAGCACCACCTATCTC-3; hepcidin reverse, 5-
TGGCTCTAGGCTATGTTTTGC-3 [82]; β-actin forward, 5-
GACGGCCAGGTCATCACTATTG-3; β-actin reverse, 5-
CCACAGGATTCCATACCCAAGA-3 [82].
Western Blot. Enterocytes were scrapped from the intestinal muscle into PBS. Cells were
pelleted and resuspended in RIPA buffer with protease inhibitor. Protein concentration
was determined using a 2D Protein Quant Assay (GE Healthcare, Piscataway, NJ). All
gels contained one sample from each experimental group; each sample was run in
triplicate. Equal amounts of protein were loaded into each well. Transfer membranes
were stained with ferroportin-1 primary antibody (Thermo Scientific, Rockford, IL) and
horseradish peroxidase secondary antibody (Thermo Scientific, Rockford, IL). Bands
were visualized with an enhanced chemiluminescence kit (Thermo Scientific, Rockford,
IL) and quantified using ImageJ software. Each sample was expressed as a percentage of
total pixels for all samples on the gel to control for variations in protein loading.
Iron quantification. Heart and liver specimens were digested in 100% nitric acid at 80°C
for 10 minutes; an equal volume of 30% H
2
O
2
was then added, and digestion continued at
80°C for an additional 10 minutes or until the tissue was dissolved completely. Digested
samples were diluted with reagent-grade water to 2% nitric acid concentration and
analyzed by flame atomic absorption spectrophotometry (Perkin Elmer, Waltham, MA).
61

Statistical analysis. Statistical tests were performed using JMP 5.1 (SAS Institute, Cary,
NC). Steroid effects were evaluated by 1-way analysis of variance (ANOVA) with Tukey
post-hoc correction. Significance was defined as p<0.05.

Results and Discussion
Body and heart mass were significantly decreased in OVX+E and OVX+EP
compared to OVX females. Liver mass was significantly decreased in OVX+E (Table
4.1). Estrogen replacement has been previously shown to decrease whole body and organ
mass without changing tissue iron concentrations [100]. When liver and heart mass were
normalized to body mass, there were no significant differences among the groups.

Table 4.1. Effects of hormone replacement on body, liver, and heart mass.

* = p<0.05 when compared to OVX

Group Body mass
(g)
Liver mass
(g)

Liver/body
mass (x10
3
)
Heart mass, g Heart/body
mass
(x10
3
)
OVX 27.5 ± 0.9 1.37 ± 0.08 49.7 ± 1.9 0.136 ± 0.002 5.0 ± 0.2
OVX+EP 24.1 ± 0.7 * 1.21 ± 0.05 50.3 ± 1.1 0.116 ± 0.005 * 4.8 ± 0.2
OVX+P 27.4 ± 1.1 1.39 ± 0.09 50.6 ± 1.5 0.131 ± 0.006 4.8 ± 0.2
OVX+E 22.6 ± 0.9 * 1.05 ± 0.06 * 46.7 ± 3.4 0.110 ± 0.005 * 4.9 ± 0.2
62

Hormone replacement had a significant effect on liver iron concentration (LIC) as
revealed by ANOVA (p<0.01). Progesterone was seen to increase LIC, as OVX+EP had
29% higher LIC than OVX mice (p<0.05, Fig. 4.1A). All other pairwise comparisons
were not significant. Effects of progesterone replacement are normally only seen in the
presence of estrogen, as estrogen is required for expression of the progesterone receptor
[126]. Total liver mass of OVX+EP was not significantly different than OVX, indicating
that a change in water content did not cause the change in LIC.

Figure 4.1. Liver and heart iron concentration by hormone replacement group. (A)
There was a significant effect of hormone replacement on liver iron concentration by
ANOVA (p<0.01). * = OVX+EP had significantly higher liver iron concentration than
OVX (p<0.05). (B) Hormone replacement did not have a significant effect on heart iron
concentration, though OVX+EP trended higher than OVX.

63

Unlike LIC, heart iron concentration was not significantly affected by hormone
replacement. However, it did follow a similar trend as LIC, with OVX+EP being 43%
higher than OVX (Fig. 4.1B, p<0.14). OVX+P and OVX+E were not different from
OVX. No correlation was observed between heart and liver iron (R
2
=0.06, p<0.19).
However, our iron loading protocol lasted only 10 weeks and it is not unreasonable to
suspect that OVX+EP mice might develop significantly greater heart iron than OVX with
a longer observation period.
To explore the mechanism causing higher LIC in OVX+EP mice, mRNA
expression of the hepcidin gene (HAMP) was analyzed. Without HJV, hepcidin release in
response to iron is abolished [77]. Despite this, HJV KO mice retain a basal level of
HAMP expression, albeit about 10% of wildtype mice [100]. However, RT-PCR analysis
did not reveal any correlation between HAMP expression and LIC. This fact, combined
with the low levels of HAMP in the mouse model, indicate that progesterone’s effect on
LIC is hepcidin-independent.
To determine whether iron absorption was influenced at the intestinal level,
duodenal enterocytes were isolated and analyzed for ferroportin mRNA and protein. As
the only known mammalian iron exporter, ferroportin is critical to the control of iron
flux. In particular, duodenal ferroportin is the major gateway for dietary iron’s entrance
into the bloodstream [6]. Hormone replacement did not affect ferroportin mRNA levels
(p<0.69, Fig. 4.2A). However, ANOVA revealed an effect of hormone replacement on
ferroportin protein levels (p<0.05), with OVX+EP being significantly increased
64

compared to OVX+P (p<0.05, Fig. 4.2B). All other pairwise comparisons were not
significant. Because estrogen is required for the progesterone receptor’s upregulation, this
suggests that progesterone increases duodenal ferroportin protein via a genomic
mechanism [126].

Figure 4.2. Relative expression of duodenal ferroportin (FPN) mRNA and protein
by hormone replacement group. (A) FPN mRNA was measured relative to the
expression of GAPDH. There was no effect of hormone replacement on ferroportin
mRNA levels. (B) Ferroportin protein was measured as the amount of pixels in an
individual sample relative to all samples on a given Western Blot, as determined by
Image J. There was a significant effect of hormone replacement on ferroportin protein
levels in the duodenum by ANOVA (p<0.05). * = OVX+EP had significantly higher
levels of duodenal ferroportin than OVX+P (p<0.05).

There are biological implications to our findings. Progesterone is secreted during
the luteal phase of the menstrual cycle, as well as during pregnancy. Both of these
periods are marked by endometrial growth, a process that requires increased iron.
65

Pregnancy also requires iron for an increase in blood volume. Progesterone appears to
increase whole body iron to make iron available for these growth processes. These
findings have clinical relevance, as progestin-dominant contraceptives could be
detrimental to patients with primary iron overload syndromes such as thalassemia
intermedia. This is especially true in countries such as Thailand, where alpha and e-beta
thalassemia syndromes are endemic and progestin contraceptives are commonly used
[123, 124, 127]. While contraception is essential, chronic exposure to long-acting
progestagens may have unintended consequences on whole body iron on patients already
prone to iron overload.

66

Chapter 5. Overall summary and future directions
Our work in a mouse model of iron overload uncovered several effects of sex and
steroids on iron homeostasis. First, we found that estrogen had an activational effect of
increasing cardiac iron concentration, but only in males. This implies that sex steroids
also have an organizational effect on cardiac iron loading, sensitizing males to the effects
of estrogen and predisposing them to higher cardiac iron concentrations than females.
This finding is potentially clinically relevant, as it could explain the greater mortality rate
seen in male patients with iron overload. It also suggests a role for cardiac and/or
endothelial aromatase in male iron overload. While little is known about cardiac
aromatase, evidence of its importance is emerging [94, 95]; endothelial aromatase is also
considered a likely source for cardiac estrogen [93, 128]. A logical extension of this work
would be the use of estrogen receptor antagonists such as tamoxifen to see if estrogen’s
effects on cardiac iron can be reversed. In addition, the effect of testostereone on cardiac
iron could be explored with and without the presence of an aromatase inhibitor. Going
forward, estrogen may prove to be an important determinant of cardiac iron overload in
males.
The second phase of research focused on the expression of cardiac iron
transporters. In the field of iron overload, much focus has been placed on identifying
importers of cardiac iron, with several candidates having been reported [28-30].
However, our research indicates that female protection against cardiac iron overload
occurs via increased iron export through ferroportin rather than decreased iron import. An
67

interesting new direction for iron overload research would be to better understand how
cardiac ferroportin is regulated at the mRNA and protein levels, and whether this can be
manipulated in a cardioprotective manner. Iron import may take place via multiple routes,
making it difficult to achieve pharmaceutical blockage. Since mammalian iron export is
thought to only occur through ferroportin, it may be an easier target for therapeutic
intervention.
The third and final phase of research studied the role of progesterone in female
iron overload. These experiments were precipitated by unexpected liver iron data
suggesting that progesterone affected whole body iron levels. We designed a follow-up
study that found progesterone replacement caused a significant increase in liver iron
concentration. This makes teleological sense, as progesterone levels rise during the tissue
synthesis of luteal phase and pregnancy. Since DNA synthesis and cell replication require
iron, progesterone could be providing increased iron availability via increased dietary
iron absorption. While the mechanism was not completely resolved, protein work
suggests that upregulation of duodenal ferroportin plays a role. Furthermore,
progesterone’s action was seen to be hepcidin-independent. Reviews of clinical data from
female primary iron overload patients may help determine if progestin contraceptives
place women at greater risk of disease complications.
As our studies were all performed in a hepcidin-deficient mouse model, our
findings can be considered hepcidin-independent. Ever since its discovery in 2000,
hepcidin and its regulation of systemic iron levels have been a central focus of iron
68

overload research [62]. This has been fruitful, leading to a great expansion of our
understanding of iron biology. However, the focus on macro-circuits may at times
overshadow the importance of local tissue iron regulation. This is especially true in
clinical iron overload, where patients tend to be hepcidin-deficient and exhibit varied
patterns of extra-hepatic iron loading. Our research demonstrated numerous effects that
can occur via hepcidin-independent mechanisms, some of which may have important
clinical implications. Further work in hepcidin-deficient mice could lead to customized
therapies of iron overload designed to address each patient’s unique pattern of organ iron
deposition.
One hepcidin-independent topic that requires further attention is the regulation of
iron-related gene expression. Such regulation can occur at the translational and
transcriptional levels. Translational regulation of iron genes has received the most
attention thus far, owing largely to the discovery of the IRE/IRP system. An
understanding of this system has been well developed, allowing for predictions of iron
gene translation based on cellular iron concentration. However, it has become clear that
alternative splice variants of iron gene mRNA can include transcripts without IREs,
thereby altering their translational regulation in response cellular iron [108, 129]. The
expression of these IRE-negative transcripts can vary by tissue, allowing for tissue-
specific translational control. In fact, we observed evidence of IRE-negative DMT1 in the
male heart, allowing for the continued expression of the DMT1 iron importer even when
cellular iron levels were high. A better understanding of IRE transcript variants and their
69

tissue-specific expression could help explain inter-patient variations in tissue iron
deposition.
Transcriptional regulation of iron genes has received much less attention than
translational control, as most research has focused on the IRE/IRP system. However,
transcriptional regulation also plays a role in tissue-specific regulation of iron genes [21,
24, 25]. In our work, it was seen that cardiac ferroportin and L-ferritin mRNA correlated
with iron concentration in the heart. This helps explain how the heart is able to avoid iron
toxicity during the initial stages of iron overload. It may also explain why mice can have
high systemic iron levels without developing heart disease. An understanding of cardiac-
specific iron regulation could help provide similar benefits to human patients.
Transcriptional research in organs such as the pancreas and liver might also provide
methods for tissue-specific protection against iron toxicity.
Within the area of transcriptional regulation, we saw an interesting relationship
between L-ferritin mRNA, H-ferritin mRNA, and heart iron concentration. L-ferritin
mRNA was seen to increase with heart iron, but H-ferritin was constitutively expressed.
The point where L-ferritin expression surpassed that of H-ferritin was at an iron level
strongly correlated with heart failure in human patients [118]. Functional ferritin protein
is a complex of H and L ferritin subunits, with H-rich ferritin being favored by the heart.
Our results suggest that the inability of H-ferritin transcription to increase with cardiac
iron concentration causes a decrease in H-rich ferritin protein, leading to a loss in the
speed and efficiency of iron storage and an increase in heart failure. For this reason, the
70

study of H-ferritin’s transcriptional regulation would be clinically significant to those
with cardiac iron overload.
Another implication from our H-ferritin data was the potential for an improved
animal model of iron overload. The HJV KO mouse was used for our studies; this model
experiences dietary iron overload accompanied by cardiac iron loading in
cardiomyocytes, as seen in humans. Other rodent models of iron overload exhibit cardiac
iron loading of macrophages and interstitial cells rather than cardiomyocytes, which does
not accurately reflect the human disease. A further drawback for all rodent models is the
difficulty in causing iron-mediated heart disease. Without the generation of cardiac
toxicity, it is impossible to perform proper drug-testing. Since our data indicates that the
saturation of H-ferritin is a precipitating event in cardiac toxicity, an improved model of
iron overload might be achieved by cross-breeding heterozygous H-ferritin mutants with
HJV KOs. While H-ferritin homozygous KOs are embryonic lethal, the heterozygous
mutant would have decreased levels of the H-ferritin subunit. In the face of iron overload
brought on by the HJV KO, decreased amounts of H-ferritin might allow for the
development of cardiac toxicity.
Finally, we concluded our research with a look at progesterone’s role in iron
homeostasis. For a hormone with many systemic effects, little is known about its relation
to iron homeostasis. Our research showed a significant increase in liver iron
concentration in response to progesterone replacement. As liver iron is a marker for
whole body iron stores, it seems likely that progesterone has wide-ranging effects on iron
71

homeostasis. More research of progesterone’s role could go a long way towards
explaining the sex differences observed in iron overload. For instance, it has been
observed that females have less extra-hepatic iron loading than males. It may be that
female progesterone not only increases whole body iron levels, but also directs its
preferential storage in the liver for later use. All strains of mice have been seen to have
greater liver iron loading in females than in males, yet we observed greater cardiac iron in
our males. Unlocking a mechanism that promotes hepatic iron loading rather than cardiac
and endocrine loading could be therapeutic for iron overloaded patients.
Over the past 15 to 20 years, the field of iron biology has grown
exponentially with the discoveries of the hepcidin hormone and the IRE/IRP system.
Despite this, there are still many phenomena that remain to be understood. As our
research has indicated, tissue-specific iron regulation might explain several unresolved
questions. This research could be aided by the further exploration of sex differences in
iron homeostasis, as these differences highlight the role of specific transporters and
pathways in iron overload.

72

Bioliography

[1] Eisenstein RS. Iron regulatory proteins and the molecular control of mammalian
iron metabolism. Annu Rev Nutr. 2000;20:627-662.
[2] Meynard D, Babitt JL, Lin HY. The liver: conductor of systemic iron balance.
Blood. 2014;123:168-176.
[3] Hider RC, Kong X. Iron: effect of overload and deficiency. Met Ions Life Sci.
2013;13:229-294.
[4] Patel M, Ramavataram DV. Non Transferrin Bound Iron: Nature, Manifestations
and Analytical Approaches for Estimation. Indian J Clin Biochem. 2012;27:322-332.
[5] Valko M, Morris H, Cronin MT. Metals, toxicity and oxidative stress. Curr Med
Chem. 2005;12:1161-1208.
[6] Andrews NC. Forging a field: the golden age of iron biology. Blood.
2008;112:219-230.
[7] Muckenthaler MU, Galy B, Hentze MW. Systemic Iron Homeostasis and the
Iron-Responsive Element/Iron-Regulatory Protein (IRE/IRP) Regulatory Network. Annu
Rev Nutr. 2008;28:197-213.
[8] Tziomalos K, Perifanis V. Liver iron content determination by magnetic
resonance imaging. World J Gastroenterol. 2010;16:1587-1597.
[9] Wood JC, Kang BP, Thompson A, et al. The effect of deferasirox on cardiac iron
in thalassemia major: impact of total body iron stores. Blood. 2010;116:537-543.
[10] Ganz T, Nemeth E. Regulation of iron acquisition and iron distribution in
mammals. Biochim Biophys Acta. 2006;1763:690-699.
[11] Batts KP. Iron overload syndromes and the liver. Mod Pathol. 2007;20S:S31-39.
[12] D'Alessio F, Hentze MW, Muckenthaler MU. The hemochromatosis proteins
HFE, TfR2, and HJV form a membrane-associated protein complex for hepcidin
regulation. J Hepatol. 2012;57:1052-1060.
[13] Corradini E, Rozier M, Meynard D, et al. Iron regulation of hepcidin despite
attenuated Smad1,5,8 signaling in mice without transferrin receptor 2 or Hfe.
Gastroenterology. 2011;141:1907-1914.
[14] Corradini E, Schmidt PJ, Meynard D, et al. BMP6 treatment compensates for the
molecular defect and ameliorates hemochromatosis in Hfe knockout mice.
Gastroenterology. 2010;139:1721-1729.
[15] Babitt JL, Huang FW, Wrighting DM, et al. Bone morphogenetic protein
signaling by hemojuvelin regulates hepcidin expression. Nat Genet. 2006;38:531-539.
[16] Siddique A, Kowdley KV. Review article: the iron overload syndromes. Aliment
Pharmacol Ther. 2012;35:876-893.
[17] Jiang F, Yu WJ, Wang XH, Tang YT, Guo L, Jiao XY. Regulation of hepcidin
through GDF-15 in cancer-related anemia. Clin Chim Acta. 2014;428:14-19.
[18] Kautz L, Jung G, Nemeth E, Ganz T. The Erythroid Factor Erythroferrone and Its
Role In Iron Homeostasis New Orleans: 55th ASH Annual Meeting and Exposition;
2013.
73

[19] Liu Q, Davidoff O, Niss K, Haase VH. Hypoxia-inducible factor regulates
hepcidin via erythropoietin-induced erythropoiesis. J Clin Invest. 2012;122:4635-4644.
[20] Gaffney-Stomberg E, McClung JP. Inflammation and diminished iron status:
mechanisms and functional outcomes. Curr Opin Clin Nutr Metab Care. 2012;15:605-
613.
[21] Delaby C, Pilard N, Puy H, Canonne-Hergaux F. Sequential regulation of
ferroportin expression after erythrophagocytosis in murine macrophages: early mRNA
induction by haem, followed by iron-dependent protein expression. Biochem J.
2008;411:123-131.
[22] Marro S, Chiabrando D, Messana E, et al. Heme controls ferroportin1 (FPN1)
transcription involving Bach1, Nrf2 and a MARE/ARE sequence motif at position -7007
of the FPN1 promoter. Haematologica. 2010;95:1261-1268.
[23] Knutson MD, Vafa MR, Haile DJ, Wessling-Resnick M. Iron loading and
erythrophagocytosis increase ferroportin 1 (FPN1) expression in J774 macrophages.
Blood. 2003;102:4191-4197.
[24] Yang F, Wang X, Haile DJ, Piantadosi CA, Ghio AJ. Iron increases expression of
iron-export protein MTP1 in lung cells. Am J Physiol Lung Cell Mol Physiol.
2002;283:L932-939.
[25] White K, Munro HN. Induction of ferritin subunit synthesis by iron is regulated at
both the transcriptional and translational levels. J Biol Chem. 1988;263:8938-8942.
[26] Steinbicker AU, Muckenthaler MU. Out of balance--systemic iron homeostasis in
iron-related disorders. Nutrients. 2013;5:3034-3061.
[27] Ke Y, Chen YY, Chang YZ, et al. Post-transcriptional expression of DMT1 in the
heart of rat. J Cell Physiol. 2003;196:124-130.
[28] Nam H, Wang C, Zhang L, et al. ZIP14 and DMT1 in the liver, pancreas, and
heart are differentially regulated by iron deficiency and overload: implications for tissue
iron uptake in iron-related disorders. Haematologica. 2013;98:1049-1057.
[29] Oudit GY, Sun H, Trivieri MG, et al. L-type Ca(2+) channels provide a major
pathway for iron entry into cardiomyocytes in iron-overload cardiomyopathy. Nat Med.
2003;9:1187-1194.
[30] Kumfu S, Chattipakorn S, Srichairatanakool S, Settakorn J, Fucharoen S,
Chattipakorn N. T-type calcium channel as a portal of iron uptake into cardiomyocytes of
beta-thalassemic mice. Eur J Haematol. 2010;86:156-166.
[31] van Bokhoven MA, van Deursen CT, Swinkels DW. Diagnosis and management
of hereditary haemochromatosis. BMJ. 2011;342:c7251.
[32] Noetzli LJ, Carson SM, Nord AS, Coates TD, Wood JC. Longitudinal analysis of
heart and liver iron in thalassemia major. Blood. 2008;112:2973-2978.
[33] Edwards CQ, Griffen LM, Goldgar D, Drummond C, Skolnick MH, Kushner JP.
Prevalence of hemochromatosis among 11,065 presumably healthy blood donors. N Engl
J Med. 1988;318:1355-1362.
[34] Adams PC, Barton JC. How I treat hemochromatosis. Blood. 2010;116:317-325.
[35] Maakaron JE, Cappellini MD, Taher AT. An update on thalassemia intermedia. J
Med Liban. 2013;61:175-182.
74

[36] Pippard MJ, Callender ST, Warner GT, Weatherall DJ. Iron absorption and
loading in beta-thalassaemia intermedia. Lancet. 1979;2:819-821.
[37] Fucharoen S, Winichagoon P. Haemoglobinopathies in southeast Asia. Indian J
Med Res. 2011;134.
[38] Galanello R, Origa R. Beta-thalassemia. Orphanet J Rare Dis. 2010;5:11.
[39] Cappellini MD, Cohen A, Eleftheriou A, Piga A, Porter J, Taher A. Guidelines for
the clinical management of thalassemia [Internet], 2nd ed. Nicosia (CY): Thalassemia
International Federation; 2008.
[40] Bender MA, Hobbs W. Sickle Cell Disease. In: Pagon RA, Adam MP, Bird TD,
Dolan CR, Fong CT, Stephens K, eds. Gene Reviews [Internet]. Seattle (WA): University
of Washington, Seattle; 2012.
[41] Detterich JA, Sangkatumvong S, Kato R, et al. Patients with sickle cell anemia on
simple chronic transfusion protocol show sex differences for hemodynamic and
hematologic responses to transfusion. Transfusion. 2013;53:1059-1068.
[42] Wang WC, Dwan K. Blood transfusion for preventing primary and secondary
stroke in people with sickle cell disease. Cochrane Database Syst Rev. 2013;11:1-31.
[43] Sheth S, Licursi M, Bhatia M. Sickle cell disease: time for a closer look at
treatment options? Br J Haematol. 2013;162:455-464.
[44] Weatherall DJ, Clegg JB. Thalassemia--a global public health problem. Nat Med.
1996;2:847-849.
[45] Kyrri AR, Kalogerou E, Loizidou D, et al. The changing epidemiology of β-
thalassemia in the Greek-Cypriot population. Hemoglobin. 2013;37:435-443.
[46] Bunn HF. The triumph of good over evil: protection by the sickle gene against
malaria. Blood. 2013;121:20-25.
[47] Borgna-Pignatti C, Rugolotto S, De Stefano P, et al. Survival and complications
in patients with thalassemia major treated with transfusion and deferoxamine.
Haematologica. 2004;89:1187-1193.
[48] Barton JC, Wiener HW, Acton RT, Go RC. HLA haplotype A*03-B*07 in
hemochromatosis probands with HFE C282Y homozygosity: frequency disparity in men
and women and lack of association with severity of iron overload. Blood Cells Mol Dis.
2005;34:38-47.
[49] Barton JC, Harmon L, Rivers C, Acton RT. Hemochromatosis: association of
severity of iron overload with genetic markers. Blood Cells Mol Dis. 1996;22:195-204.
[50] Edwards CQ, Dadone MM, Skolnick MH, Kushner JP. Hereditary
haemochromatosis. Clin Haematol. 1982;11:411-435.
[51] Moirand R, Adams PC, Bicheler V, Brissot P, Deugnier Y. Clinical features of
genetic hemochromatosis in women compared with men. Ann Intern Med. 1997;127:105-
110.
[52] Moirand R, Guyader D, Mendler MH, et al. HFE based re-evaluation of
heterozygous hemochromatosis. Am J Med Genet. 2002;111:356-361.
[53] Neves JV, Olsson IA, Porto G, Rodrigues PN. Hemochromatosis and pregnancy:
iron stores in the Hfe-/- mouse are not reduced by multiple pregnancies. Am J Physiol
Gastrointest Liver Physiol. 2010;298:G525-529.
75

[54] Wood JC, Origa R, Agus A, Matta G, Coates TD, Galanello R. Onset of cardiac
iron loading in pediatric patients with thalassemia major. Haematologica. 2008;93:917-
920.
[55] Johnson BD, Zheng W, Korach KS, Scheuer T, Catterall WA, Rubanyi GM.
Increased expression of the cardiac L-type calcium channel in estrogen receptor-deficient
mice. J Gen Physiol. 1997;110:135-140.
[56] Golden KL, Marsh JD, Jiang Y. Castration reduces mRNA levels for calcium
regulatory proteins in rat heart. Endocrine. 2002;19:339-344.
[57] Tonetta SA, diZerega GS. Intragonadal regulation of follicular maturation. Endocr
Rev. 1989;10:205-229.
[58] Gillies GE, McArthur S. Estrogen actions in the brain and the basis for
differential action in men and women: a case for sex-specific medicines. Pharmacol Rev.
2010;62:155-198.
[59] Czajka-Oraniec I, Simpson ER. Aromatase research and its clinical significance.
Endokrynol Pol. 2010;61:126-134.
[60] Phoenix CH, Goy RW, Gerall AA, Young WC. Organizing action of prenatally
administered testosterone propionate on the tissues mediating mating behavior in the
female guinea pig. Endocrinology. 1959;65:369-382.
[61] McCarthy MM, Wright CL, Schwarz JM. New tricks by an old dogma:
mechanisms of the Organizational/Activational Hypothesis of steroid-mediated sexual
differentiation of brain and behavior. Horm Behav. 2009;55:655-665.
[62] Ganz T. Hepcidin, a key regulator of iron metabolism and mediator of anemia of
inflammation. Blood. 2003;102:783-788.
[63] Bridle KR, Frazer DM, Wilkins SJ, et al. Disrupted hepcidin regulation in HFE-
associated haemochromatosis and the liver as a regulator of body iron homoeostasis.
Lancet. 2003;361:669-673.
[64] Babitt JL, Huang FW, Xia Y, Sidis Y, Andrews NC, Lin HY. Modulation of bone
morphogenetic protein signaling in vivo regulates systemic iron balance. J Clin Invest.
2007;117:1933-1939.
[65] De Domenico I, Ward DM, Langelier C, et al. The molecular mechanism of
hepcidin-mediated ferroportin down-regulation. Mol Biol Cell. 2007;18:2569-2578.
[66] Kaplan J. Mechanisms of Cellular Iron Acquisition: Another Iron in the Fire. Cell.
2002;111:603-606.
[67] Bolondi G, Garuti C, Corradini E, et al. Altered hepatic BMP signaling pathway
in human HFE hemochromatosis. Blood Cells Mol Dis. 2010;45:308-312.
[68] Papanikolaou G, Samuels ME, Ludwig EH, et al. Mutations in HFE2 cause iron
overload in chromosome 1q-linked juvenile hemochromatosis. Nat Genet. 2004;36:77-
82.
[69] Beutler E. Hemochromatosis: Genetics and Pathophysiology. Annu Rev Med.
2006;57:331-347.
[70] Babitt JL, Lin HY. The Molecular Pathogenesis of Hereditary Hemochromatosis.
Semin Liver Dis. 2011;31:280-292.
[71] Porter JB. Pathophysiology of Transfusional Iron Overload: Contrasting Patterns
in Thalassemia Major and Sickle Cell Disease. Hemoglobin. 2009;33:S37-S45.
76

[72] Weatherall D. The Thalassemias: the role of molecular genetics in an evolving
global health problem. Am J Hum Genet. 2004;74:385-392.
[73] Burke W, Thomson E, Khoury M, et al. Hereditary hemochromatosis: Gene
discovery and its implications for population-based screening. JAMA. 1998;280:172-178.
[74] Phoenix CH, Goy RW, Gerall AA, Young WC. Organizing action of prenatally
administered testosterone propionate on the tissues mediating mating behavior in the
female guinea pig. Endocrinology. 1959;65:369-382.
[75] Otto-Duessel M, Brewer C, Wood JC. Interdependence of cardiac iron and
calcium in a murine model of iron overload. Transl Res. 2011;157:92-99.
[76] Otto-Duessel M, Brewer C, Gonzalez I, Nick H, Wood JC. Safety and efficacy of
combined chelation therapy with deferasirox and deferoxamine in a gerbil model of iron
overload. Acta Haematol. 2008;120:123-128.
[77] Huang FW, Pinkus JL, Pinkus GS, Fleming MD, Andrews NC. A mouse model
of juvenile hemochromatosis. J Clin Invest. 2005;115:2187-2191.
[78] Wersinger SR, Sannen K, Villalba C, Lubahn DB, Rissman EF, De Vries GJ.
Masculine sexual behavior is disrupted in male and female mice lacking a functional
estrogen receptor alpha gene. Horm Behav. 1997;32:176-183.
[79] Antzoulatos E, Jakowec MW, Petzinger GM, Wood RI. Sex differences in motor
behavior in the MPTP mouse model of Parkinson's disease. Pharmacol Biochem Behav.
2010;95:466-472.
[80] Jacob DA, Temple JL, Patisaul HB, Young LJ, Rissman EF. Coumestrol
antagonizes neuroendocrine actions of estrogen via the estrogen receptor alpha. Exp Biol
Med. 2001;226:301-306.
[81] Barkley MS, Goldman BD. The effects of castration and Silastic implants of
testosterone on intermale aggression in the mouse. Horm Behav. 1977;9:32-48.
[82] Zhang AS, Gao J, Koeberi DD, Enns CA. The role of hepatocyte hemomjuvelin
in regulation of bone morphogenic protein-6 and hepcidin expression in vivo. J Biol
Chem. 2010;285:16416-16423.
[83] Liuzzi JP, Bobo JA, Lichten LA, Samuelson DA, Cousins RJ. Responsive
transporter genes within the murine intestinal-pancreatic axis form a basis of zinc
homeostasis. Proc Natl Acad Sci U S A. 2004;101:14355-14360.
[84] Mizuta E, Miake J, Yano S, et al. Subtype switching of T-type Ca 2+ channels
from Cav3.2 to Cav3.1 during differentiation of embryonic stem cells to cardiac cell
lineage. Circ J. 2005;69:1284-1289.
[85] Vecchi C, Montosi G, Zhang K, et al. ER stress controls iron metabolism through
induction of hepcidin. Science. 2009;325:877-880.
[86] Krijt J, Niederkofler V, Salie R, et al. Effect of phlebotomy on hepcidin
expression in hemojuvelin-mutant mice. Blood Cells Mol Dis. 2007;39:92-95.
[87] Kam KW, Kravtsov GM, Liu J, Wong TM. Increased PKA activity and its
influence on isoprenaline-stimulated L-type Ca2+ channels in the heart from
ovariectomized rats. Br J Pharmacol. 2005;144:972-981.
[88] Johnson BD, Zheng W, Korach KS, Scheuer T, Catterall WA, Rubanyi GM.
Increased expression of the cardiac L-type calcium channel in estrogen receptor-deficient
mice. J Gen Physiol. 1997;110:135-140.
77

[89] Cairrão E, Alvarez E, Carvas JM, Santos-Silva AJ, Verde I. Non-genomic
vasorelaxant effects of 17β-estradiol and progesterone in rat aorta are mediated by L-type
Ca2+ current inhibition. Acta Pharmacol Sin. 2012;33:615-624.
[90] Piga A, Longo F, Duca L, et al. High nontransferrin bound iron levels and heart
disease in thalassemia major. Am J Hematol. 2009;84:29-33.
[91] Courselaud B, Troadec MB, Fruchon S, et al. Strain and gender modulate hepatic
hepcidin 1 and 2 mRNA expression in mice. Blood Cells Mol Dis. 2004;32:283-289.
[92] Krijt J, Cmejla R, Sýkora V, Vokurka M, Vyoral D, Necas E. Different
expression pattern of hepcidin genes in the liver and pancreas of C57BL/6N and DBA/2N
mice. J Hepatol. 2004;40:891-896.
[93] Simpson ER. Sources of estrogen and their importance. J Steroid Biochem Mol
Biol. 2003;86:225-230.
[94] Bell JR, Mellor KM, Wollermann AC, et al. Aromatase Deficiency Confers
Paradoxical Postischemic Cardioprotection. Endocrinology. 2011;152:4937-4947.
[95] Grohe C, Kahlert S, Lobbert K, Vetter H. Expression of oestrogen receptor alpha
and beta in rat heart: role of local oestrogen synthesis. J Endocrinol. 1998;156:R1-R7.
[96] Yang Q, Jian J, Katz S, Abramson S, Huang X. 17β-Estradiol inhibits iron
hormone hepcidin through an estrogen responsive element half-site. Endocrinology.
2012;153:3170-3178.
[97] Hou Y, Zhang S, Wang L, et al. Estrogen regulates iron homeostasis through
governing hepatic hepcidin expression via an estrogen response element. Gene.
2012;511:398-403.
[98] Ikeda Y, Tajima S, Izawa-Ishizawa Y, et al. Estrogen regulates hepcidin
expression via GPR30-BMP6-dependent signaling in hepatocytes. PLoS One.
2012;7:e40465.
[99] Papanikolaou G, Samuels ME, Ludwig EH, et al. Mutations in HFE2 cause iron
overload in chromosome 1q-linked juvenile hemochromatosis. Nat Genet. 2004;36:77-
82.
[100] Brewer C, Otto-Duessel M, Wood RI, Wood JC. Sex differences and steroid
modulation of cardiac iron in a mouse model of iron overload. Transl Res. 2014;163:151-
159.
[101] Van Zandt KE, Sow FB, Florence WC, et al. The iron export protein ferroportin 1
is differentially expressed in mouse macrophage populations and is present in the
mycobacterial-containing phagosome. J Leukoc Biol. 2008;84:689-700.
[102] Huang ML, Becker EM, Whitnall M, Suryo Rahmanto Y, Ponka P, Richardson
DR. Elucidation of the mechanism of mitochondrial iron loading in Friedreich's ataxia by
analysis of a mouse mutant. Proc Natl Acad Sci U S A. 2009;106:16381-16386.
[103] Ma C, Schneider SN, Miller M, et al. Manganese accumulation in the mouse ear
following systemic exposure. J Biochem Mol Toxicol. 2008;22:305-310.
[104] Picard E, Ranchon-Cole I, Jonet L, et al. Light-induced retinal degeneration
correlates with changes in iron metabolism gene expression, ferritin level, and aging.
Invest Ophthalmol Vis Sci. 2011;52:1261-1274.
78

[105] Zhang KH, Tian HY, Gao X, et al. Ferritin heavy chain-mediated iron
homeostasis and subsequent increased reactive oxygen species production are essential
for epithelial-mesenchymal transition. Cancer Res. 2009;69:5340-5348.
[106] Ganz T. Systemic iron homeostasis. Physiol Rev. 2013;93:1721-1741.
[107] Wang J, Pantopoulos K. Regulation of cellular iron metabolism. Biochem J.
2011;434:365-381.
[108] Garrick MD, Dolan KG, Horbinski C, et al. DMT1: a mammalian transporter for
multiple metals. Biometals. 2003;16:41-54.
[109] López-Castro JD, Delgado JJ, Perez-Omil JA, et al. A new approach to the ferritin
iron core growth: influence of the H/L ratio on the core shape. Dalton Trans.
2012;41:1320-1324.
[110] Bomford A, Conlon-Hollingshead C, Munro HN. Adaptive responses of rat tissue
isoferritins to iron administration. Changes in subunit synthesis, isoferritin abundance,
and capacity for iron storage. J Biol Chem. 1981;256:948-955.
[111] Ferreira C, Bucchini D, Martin ME, et al. Early embryonic lethality of H ferritin
gene deletion in mice. J Biol Chem. 2000;275:3021-3024.
[112] Darshan D, Vanoaica L, Richman L, Beermann F, Kühn LC. Conditional deletion
of ferritin H in mice induces loss of iron storage and liver damage. Hepatology.
2009;50:852-860.
[113] Sammarco MC, Ditch S, Banerjee A, Grabczyk E. Ferritin L and H subunits are
differentially regulated on a post-transcriptional level. J Biol Chem. 2008;283:4578-4587.
[114] Hintze KJ, Theil EC. DNA and mRNA elements with complementary responses
to hemin, antioxidant inducers, and iron control ferritin-L expression. Proc Natl Acad Sci
U S A. 2005;102:15048-15052.
[115] Bulvik B, Grinberg L, Eliashar R, Berenshtein E, Chevion MM. Iron, ferritin and
proteins of the methionine-centered redox cycle in young and old rat hearts. Mech
Ageing Dev. 2009;130:139-144.
[116] Ghugre NR, Enriquez CM, Gonzalez I, Nelson MD, Jr., Coates TD, Wood JC.
MRI detects myocardial iron in the human heart. Magn Reson Med. 2006;56:681-686.
[117] Carpenter JP, He T, Kirk P, et al. On T2* magnetic resonance and cardiac iron.
Circulation. 2011;123:1519-1528.
[118] Kirk P, Roughton M, Porter JB, et al. Cardiac T2* magnetic resonance for
prediction of cardiac complications in thalassemia major. Circulation. 2009;120:1961-
1968.
[119] Camaschella C. Iron and hepcidin: a story of recycling and balance. Hematology
Am Soc Hematol Educ Program. 2013;2013:1-8.
[120] Musallam KM, Cappellini MD, Wood JC, Taher AT. Iron overload in non-
transfusion-dependent thalassemia: a clinical perspective. Blood Rev. 2012;26S:S16-19.
[121] Verma IC, Kleanthous M, Saxena R, et al. Multicenter study of the molecular
basis of thalassemia intermedia in different ethnic populations. Hemoglobin.
2007;31:439-452.
[122] Weatherall DJ. The definition and epidemiology of non-transfusion-dependent
thalassemia. Blood Rev. 2012;26S:S3-6.
79

[123] Taneepanichskul S, Intaraprasert S, Theppisai U, Chaturachinda K. Bone mineral
density in long-term depot medroxyprogesterone acetate acceptors. Contraception.
1997;56:1-3.
[124] Taneepanichskul S, Reinprayoon D, Phaosavadi S. DMPA use above the age of
35 in Thai women. Contraception. 2000;61:281-282.
[125] Brasted M, White CA, Kennedy TG, Salamonsen LA. Mimicking the events of
menstruation in the murine uterus. Biol Reprod. 2003;69:1273-1280.
[126] Graham JD, Clarke CL. Physiological action of progesterone in target tissues.
Endocr Rev. 1997;18:502-519.
[127] Viprakasit V, Vathesathokit P, Chinchang W, et al. Prevalence of HFE mutations
among the Thai population and correlation with iron loading in haemoglobin E disorder.
Eur J Haematol. 2004;73:43-49.
[128] Iwabuchi J, Koshimizu K, Nakagawa T. Expression profile of the aromatase
enzyme in the Xenopus brain and localization of estradiol and estrogen receptors in each
tissue. Gen Comp Endocrinol. 2013;194:286-294.
[129] Darshan D, Wilkins SJ, Frazer DM, Anderson GJ. Reduced expression of
ferroportin-1 mediates hyporesponsiveness of suckling rats to stimuli that reduce iron
absorption. Gastroenterology. 2011;141:300-309.

Abstract (if available)

Abstract Nearly every living organism requires iron due to its roles in DNA synthesis, cellular respiration and oxygen transport. However, iron’s ability to generate free radicals makes it toxic at high concentrations. For this reason, the body has an intricate regulatory system that ensures iron’s availability while also preventing free radical toxicity. Iron overload can develop when mutations occur to the iron regulatory system, when ineffective erythropoiesis drives excessive dietary iron absorption, or when severe anemia requires chronic blood transfusions. Heart failure due to excessive cardiac iron is the most common cause of lethality in iron overload. The onset of cardiac iron loading most often occurs during puberty. Females exhibit a survival advantage compared to males, but the cause of this is unknown. For this reason, we studied sex differences of iron overload in a mouse model of the disease. We postulated that sex steroids cause an increase in cardiac iron levels and that testosterone increases cardiac iron loading more than estrogen. Effects of sex and hormones were studied via gonadectomy and hormone replacement. Initial experiments found that estrogen increased cardiac iron loading in males compared to castrates (p<0.05)

Linked assets

University of Southern California Dissertations and Theses

Conceptually similar

PDF

Effects of vitamin D perturbation on cardiac iron overload

PDF

Sex hormones and atherosclerosis in postmenopausal women

PDF

Transfusional iron, anthracyclines and cardiac outcomes in childhood cancer survivors

PDF

Gonadal steroid hormones promote neuroplasticity in models of health and disease

PDF

Estimating liver iron non-invasively with high-field MRI

PDF

RUNX2 & sex steroids: molecular mechanisms in regulating bone turnover

PDF

Defining intrarenal sexual dimorphisms to obesity and hypertension: understanding the female advantage

PDF

Sex differences in aging and the effects of mitochondria

PDF

Genetic and dietary determinants of nonalcoholic fatty liver disease in Hispanic children

PDF

Ectopic fat and adipose tissue inflammation in overweight and obese African Americans and Hispanics

PDF

Quantity versus quality: how adipose tissue accumulation and immune cell profile associate with risk for type 2 diabetes in minority children and adults

PDF

Immune infiltrates in papillary thyroid carcinomas

PDF

Susceptibility-weighted MRI for the evaluation of brain oxygenation and brain iron in sickle cell disease

PDF

Sex differences in the TgF344-AD rat model: Investigating the behavior, pathology, and neuroanatomical structures

PDF

Long-term treadmill exercise delays the onset of motor dysfunction, cognitive impairments, and mood disturbances in the CAG 140 mouse model of Huntington's disease via restoration of dopamine neu...

PDF

Early childhood health experience & adult phenotype in twins

PDF

Genes and environment in prostate cancer risk and prognosis

PDF

The role of LGR5 in the pathogenesis of Ewing sarcoma: a marker of aggressive disease and a contributor to the malignant phenotype

PDF

Elements of photoreceptor homeostasis: investigating phenotypic manifestations and susceptibility to photoreceptor degeneration in genetic knockout models for retinal disease

PDF

Effects of post-menopausal hormone therapy on arterial stiffness in the ELITE trial

Asset Metadata

Creator Brewer, Casey John (author)

Core Title Sex differences in iron overload

School Keck School of Medicine

Degree Doctor of Philosophy

Degree Program Integrative Biology of Disease

Publication Date 04/15/2014

Defense Date 05/14/2014

Publisher University of Southern California (original), University of Southern California. Libraries (digital)

Tag hemochromatosis,iron overload,OAI-PMH Harvest,sex steroid,thalassemia

Format application/pdf (imt)

Language English

Contributor Electronically uploaded by the author (provenance)

Advisor Meiselman, Herbert J. (committee chair), Coates, Thomas D. (committee member), Farley, Robert A. (committee member), Wood, John C. (committee member), Wood, Ruth I. (committee member)

Creator Email caseybre@usc.edu,mr.casey.brewer@hotmail.com

Permanent Link (DOI) https://doi.org/10.25549/usctheses-c3-377382

Unique identifier UC11295207

Identifier etd-BrewerCase-2354.pdf (filename),usctheses-c3-377382 (legacy record id)

Legacy Identifier etd-BrewerCase-2354.pdf

Dmrecord 377382

Document Type Dissertation

Format application/pdf (imt)

Rights Brewer, Casey John

Type texts

Source University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Access Conditions The author retains rights to his/her dissertation, thesis or other graduate work according to U.S. copyright law. Electronic access is being provided by the USC Libraries in agreement with the a...

Repository Name University of Southern California Digital Library

Repository Location USC Digital Library, University of Southern California, University Park Campus MC 2810, 3434 South Grand Avenue, 2nd Floor, Los Angeles, California 90089-2810, USA