University of Southern California Dissertations and Theses

Human papillomavirus type 16 entry via the annexin A2 heterotetramer leads to infection and immune evasion

(USC Thesis Other)

Human papillomavirus type 16 entry via the annexin A2 heterotetramer leads to infection and immune evasion

PDF

Download a page range

Download transcript

Copy asset link

Request this asset

Transcript (if available)

Content

HUMAN PAPILLOMAVIRUS TYPE 16 ENTRY VIA THE ANNEXIN A2
HETEROTETRAMER LEADS TO INFECTION AND IMMUNE EVASION

by

Andrew Wallace Woodham

________________________________________________

A Dissertation Presented to the
FACULTY OF THE USC GRADUATE SCHOOL
UNIVERSITY OF SOUTHERN CALIFORNIA
In Partial Fulfilment of the Requirements of the Degree
DOCTOR OF PHILOSOPHY
(GENETICS, MOLECULAR and CELLULAR BIOLOGY)

May 2015

Copyright 2015 Andrew Woodham
ii
Dedication

This dissertation is dedicated to my wife, Lindsey Woodham, and my parents Mark
Woodham and Patricia Hillius. Lindsey, you are my best friend, companion, and now the
mother of my child, and none of this would be possible without you. Mom and Dad,
thanks for always believing in me.

iii
Acknowledgments

To my mentor W. Martin Kast, PhD: I have received nothing but the best guidance and
support from you. You have led me through every aspect of my doctoral education, and
even more than that, you have been my biggest advocate for success. Your
sponsorship was vital for me to win numerous scholarships and awards that will propel
me to the next stage of my career, and all of these successes would never have
happened without you. Thank you.

To Diane Da Silva, PhD: Thank you for always lending an open ear and open mind. Our
5+ years of troubleshooting and discussions have been invaluable.

I would also like to thank my committee members Ralf Langen, PhD and Yvonne Lin,
MD for their continued contribution and constructive criticism.

I would like to thank the Norris Cancer Center for support through NIH Grant award
number 5P30CA014089-37 for which I was awarded the Norris Comprehensive Cancer
Center Heidelberger Award.

I would like to thank the Southern California Clinical and Translational Science Institute
(SC CTSI), for which I was supported in part as a TL1 Scholar through
(NIH/NCRR/NCATS) award Grant # TL1TR000132.

Additional support from the ARCS Foundation from which I was awarded the John and
Edith Leonis Award is greatly appreciated.

I would also like to extend a sincere thank you to my lab mate and friend Joseph Skeate
and classmate, Thomas Schmidt who have been there as a source of support,
entertainment, and ideas.

iv
List of Abbreviations
A2 Annexin A2
A2t Annexin A2/S100A10 Heterotetramer
ATCC American Type Culture Collection
APC Antigen Presenting Cell
BPV Bovine Papillomavirus
cDNA Complimentary Deoxyribonucleic Acid
cVLP Chimeric Virus-Like Particle
CCR5 C-C chemokine receptor type 5
CCR7 C-C chemokine receptor type 7
CD Cluster of Differentiation
(CD1a, CD4, CD8, CD34, CD40, CD63, CD80, CD83, CD86, or CD151)
CFDA-SE Carboxyfluorescein Diacetate Succinimidyl Ester
CMV Cytomegalovirus
CyPB Cyclophilin B
DC Dendritic Cell
DMSO Dimethyl Sulfoxide
DNA Deoxyribonucleic Acid
dsRNA Double-Stranded RNA
EDTA Edetic Acid
EGF Epidermal Growth Factor
EGFR Epidermal Growth Factor Receptor
ELISA Enzyme Linked Immunosorbant Assay
ELISpot Enzyme-linked ImmunoSpot
FACS Fluorescence-Activated Cell Sorting
FAK Focal Adhesion Kinase
FITC Fluorescein isothiocyanate
FBS Fetal Bovine Serum
GFP Green Fluorescent Protein
GFR Growth Factor Receptor
GMCSF Granulocyte-Macrophage Colony-Stimulating Factor
HIV Human Immunodeficiency Virus
HPV Human Papillomavirus
HPV16 Human Papillomavirus type 16
(additionally HPV5, HPV11, HPV18, HPV31, HPV33, and HPV45)
hr-HPV High-risk Human Papillomavirus
HRP Horse Radish Peroxidase
HSPG Heparan Sulfate Proteoglycans
HSV Herpes Simplex Virus
IFN Interferon
IFN-γ Interferon Gamma
IL Interleukin (here: IL-4, IL-6, IL-8, IL-10, or IL-12)
IMDM Iscove’s Modified Dulbecco’s Medium
IP-10 IFN-γ-inducible protein 10
v
kDa KiloDalton
KSFM Keratinocyte Serum-Free Media
L1 HPV Major Capsid Protein
L2 HPV Minor Capsid Protein
LC Langerhans Cell
MCP-1 Monocyte Chemotactic Protein 1
MIP Macrophage Inflammatory Proteins (either 1α or 1β)
MFI Mean Fluorescent Intensity
MHC Major Histocompatibility Complex
MOI Multiplicity of Infection
mRNA Messenger Ribonucleic Acid
PAMP Pathogen Associated Molecular Patterns
PBMC Peripheral Blood Mononuclear Cells
PBS Phosphate Buffered Saline
PBST Phosphate Buffered Saline with Tween
PCR Polymerase Chain Reaction
PE Phycoerythrin
PIP
2
Phosphatidylinositol (4,5)-Bisphosphate
PIP5K Phosphatidylinositol 4-Phosphate, 5-Kinase
Poly-I:C Polyinosinic-polycytidilic acid
Poly-ICR Poly I:C stabilized with poly-aRginine
Poly-ICLC Poly I:C stabilized with poly-Lysine and Carboxymethylcellulose
PsV Pseudovirus
qRT-PCR Quantitative Real-Time Polymerase Chain Reaction
RANTES Regulated on Activation, Normal T cell Expressed and Secreted
RNA Ribonucleic Acid
RSV Respiratory Syncytial Virus
S100A10 S100 Family Protein A10
SDS-PAGE Sodium Dodecyl Sulfate Polyacrylamide Gel Electrophoresis
SFK Src-Family Kinases
SLPI Secretory Leukocyte Protease Inhibitor
TGF-β Transforming Growth Factor Beta
TLR Toll-Like Receptor (i.e. TLR3, TLR4, TLR7, or TLR8)
TNF-α Tumor Necrosis Factor Alpha
VLP Virus-Like Particle

vi
List of Tables and Figures
Chapter 2
Figure 2.1 ……………………………………………………………………………29
Figure 2.2 ……………………………………………………………………………30
Figure 2.3 ……………………………………………………………………………31
Figure 2.4 ……………………………………………………………………………33
Figure 2.5 ……………………………………………………………………………36
Figure 2.6 ……………………………………………………………………………39
Figure 2.6 ……………………………………………………………………………39
Figure 2.7 ……………………………………………………………………………41
Chapter 3
Figure 3.1 ……………………………………………………………………………64
Figure 3.2 ……………………………………………………………………………65
Chapter 4
Table 4.1 ….………………………………………………………………………….81
Figure 4.1 ……………………………………………………………………………73
Figure 4.2 ……………………………………………………………………………75
Figure 4.3 ……………………………………………………………………………76
Figure 4.4 ……………………………………………………………………………78
Figure 4.5 ……………………………………………………………………………80
Figure 4.6 ……………………………………………………………………………83
Chapter 5
Table 5.1 ….…………………………………………………………………………101
Table 5.2 ….…………………………………………………………………………106
Figure 5.1 …………………………………………………………………………...103
Figure 5.2 …………………………………………………………………………...104
Figure 5.3 …………………………………………………………………………...107
Figure 5.4 …………………………………………………………………………...109
Figure 5.5 …………………………………………………………………………...111
Figure 5.6 …………………………………………………………………………...112
Chapter 6
Figure 6.1 …………………………………………………………………………...126

vii
Table of Contents

DEDICATION ................................................................................................................... II
ACKNOWLEDGMENTS ................................................................................................. III
LIST OF ABBREVIATIONS ............................................................................................ IV
LIST OF TABLES AND FIGURES ................................................................................. VI
THESIS NARRATIVE ...................................................................................................... 9
CHAPTER 1. INTRODUCTION ..................................................................................... 12
1.1 HPV16 STRUCTURE AND PRODUCTION SYSTEMS ..................................................... 14
1.2 THE CURRENT PARADIGM OF HPV16 BINDING AND ENTRY IS INCOMPLETE. .................. 17
1.3 LANGERHANS CELLS AND HPV IMMUNE EVASION ...................................................... 22
CHAPTER 2. THE S100A10 SUBUNIT OF THE ANNEXIN A2 HETEROTETRAMER
FACILITATES L2-MEDIATED HUMAN PAPILLOMAVIRUS INFECTION ................... 24
2.1 INTRODUCTION ........................................................................................................ 24
2.2 RESULTS ................................................................................................................ 28
2.3 DISCUSSION ............................................................................................................ 44
2.4 MATERIALS AND METHODS ....................................................................................... 51
CHAPTER 3. ANNEXIN A2 HETEROTETRAMER SMALL MOLECULE INHIBITORS
PREVENT HUMAN PAPILLOMAVIRUS TYPE 16 INFECTION ................................... 63
3.1 INTRODUCTION ........................................................................................................ 63
3.2 RESULTS ................................................................................................................ 64
3.3 DISCUSSION ............................................................................................................ 66
viii
3.4 MATERIALS AND METHODS ....................................................................................... 67
CHAPTER 4. INHIBITION OF LANGERHANS CELL MATURATION BY HUMAN
PAPILLOMAVIRUS TYPE 16: A NOVEL ROLE FOR THE ANNEXIN A2
HETEROTETRAMER IN IMMUNE SUPPRESSION ..................................................... 69
4.1 INTRODUCTION ........................................................................................................ 69
4.2 RESULTS ................................................................................................................ 72
4.3 DISCUSSION ............................................................................................................ 84
4.4 MATERIALS AND METHODS ....................................................................................... 89
CHAPTER 5. HUMAN PAPILLOMAVIRUS-MEDIATED SUPPRESSION OF
LANGERHANS CELL FUNCTION IN WOMEN WITH CERVICAL PRECANCEROUS
LESIONS IS REVERSED WITH STABILIZED POLY-I:C ............................................. 98
5.1 INTRODUCTION ........................................................................................................ 98
5.2 RESULTS .............................................................................................................. 100
5.3 DISCUSSION .......................................................................................................... 114
5.4 MATERIALS AND METHODS ..................................................................................... 119
CHAPTER 6. DISCUSSION AND FUTURE DIRECTIONS ......................................... 125
REFERENCES CITED ................................................................................................. 131

9
Thesis Narrative

High-risk human papillomavirus (HPV) infection leads to the development of
several human cancers including cervical, anogenital, and head and neck cancers that
cause significant morbidity and mortality worldwide. HPV type 16 (HPV16) is the most
common of the cancer causing high-risk genotypes, yet the entire mechanism of how
HPV16 enters human cells and evades the immune system is still not defined. During its
natural life cycle, HPV must gain entry into the basal cells of the cervical epithelium
through an unknown non-canonical endocytic pathway. When I first joined Dr. Kast's
lab, my thesis project was on the forefront of basic science discovery; novel HPV entry
receptor identification. We were able to identify the annexin A2/S100A10 heterotetramer
(A2t) as an HPV16 entry receptor on host epithelial cells, and A2t-mediated entry may
represent a previously unknown type of endocytosis. A2t is composed of two annexin
A2 monomers bound non-covalently to an S100A10 dimer, and we have demonstrated
that the binding site for HPV16 is on S100A10. This discovery was part of the first arm
of my thesis project, and led to investigating A2t small molecule inhibitors (A2ti) for their
potential to prevent HPV infection. Our data demonstrated that A2ti effectively block
HPV16 infection in vitro 100% at non-toxic concentrations, and represent the first time
that an HPV receptor has been targeted to block infection. These inhibitors could
potentially be used as anti-viral compounds, and this option would have broad anti-viral
implications as A2t has also been implicated in HIV infection of macrophages.
The HPV family of viruses establishes persistent infections for ongoing gene
expression, which is accomplished through of evolved mechanisms that allow HPV to
10
evade the human immune system. As mentioned, HPV targets cells in the epithelium
where it also comes into contact with Langerhans cells (LCs), the resident antigen
presenting cells of the mucosal epithelial layer that account for one in every twenty
nucleated cells (APC) of the epithelium. LC are responsible for initiating immune
responses against viruses entering the mucosa. However, studies from our laboratory
have identified HPV-mediated suppression of LC immune function as a key mechanism
through which HPV evades immune surveillance, which in turn leads to viral persistence
and oncogenesis. The characterization of this immunosuppressive pathway is
paramount in our understanding of HPV immune responses. These studies has served
as the second part of my thesis project and has demonstrated that A2t-mediated entry
of HPV16 into LC is a key component to HPV16-induced immune suppression.
Specifically, I have shown that entry of HPV16 into LC via A2t, causes alterations in
intracellular signaling leading to reduced cell surface T cell co-stimulatory marker
expression on LC, reduced cytokine release of inflammatory cytokines needed to
stimulate T cells, and hence the LC are unable to induce an adaptive T cell response.
Toll-like receptors (TLR), including TLR3, are also present on the surface of LC
and recognize pathogens to stimulate an LC-mediated immune response. Polyinosinic-
polycytidilic acid (Poly-I:C) is a TLR3 agonist that has the ability to enhance APC
expression of T cell co-stimulatory molecules and inflammatory cytokine production
necessary for the activation of T cells, as well as the ability to induce a type I interferon
response. Our current data show that LC treatment with stabilized Poly-I:C compounds
(s-Poly-I:C) induces their activation and the induction of HPV-specific T cells in women
with high grade cervical intraepithelial neoplasia even after their LC function is
11
suppressed by pre-exposure to HPV16. This data strongly suggests that s-Poly-I:C may
be able to establish an adaptive immune response against HPV in patients leading to
regression of their pre-cancerous cervical lesions. Taken together, these discoveries
may reduce the risk of HPV-related cancer by blocking HPV infections with A2ti and by
promoting HPV clearance with s-Poly-I:C.

12
Chapter 1. Introduction

Human papillomavirus (HPV) is the most prevalent sexually transmitted virus,
and persistent high-risk HPV (hr-HPV) infections are causally associated with the
development of cervical cancer [1,2], which is the second most common cancer among
women and is responsible for >274,000 deaths each year worldwide [3,4]. Of the 15
different cancer-causing high-risk HPV genotypes, HPV16 is the most common, leading
to approximately 50% of all cervical cancers [5]. In addition to cervical cancer, hr-HPV
infections are increasingly being linked to the development of vaginal, vulvar, anal, and
head and neck cancers that cause significant morbidity and mortality worldwide [3,4,6].
HPV16 is an obligatory intracellular virus that must gain entry and deliver its circular
double-stranded DNA to the nucleus of basal epithelium host cells for viral replication,
and the capsid proteins play vital roles in these steps [7,8,9]. During infection of the
epithelium, HPV16 also interacts with Langerhans cells (LC), the resident antigen
presenting cells (APC) within the epithelia [10], which are responsible for initiating
immune responses against pathogens entering the superficial layers of the skin [11].
However, 15% of women with hr-HPV infections do not produce an effective immune
response against the virus [10], which suggests that HPV16 has developed methods to
evade immune detection, and LC may be critical in this process.
Since the discovery of HPVs, the virology field has sought to identify the
mechanism by which these viruses enter host cells. Despite ongoing research that has
identified many possible receptors, a clearly defined description of HPVs' cellular entry
has remained controversial. In many cases of viral infections, our understanding of
13
simple binding and uptake through a singular mechanism has given way to a more
complex interaction between several specific receptors, co-receptors, and co-factors
[12,13,14]. As an introduction to this thesis, a brief synthesis of the known data
regarding HPV16 binding proteins at the cell surface and their associated molecules will
be provided, which will lay the groundwork for the hypotheses presented herein.
While the family of HPVs is a diverse group of over 150 viruses, this introduction
will focus on the most common of the cancer causing genotypes, HPV16, and make it
clear when non-HPV16 genotypes are mentioned. Additionally, the development of
several HPV particle production systems has allowed researchers to begin delineating
the mechanisms behind viral entry. However important differences among particles
developed in vitro have made direct comparisons between the results of previous
studies challenging. Therefore, the structure of HPV16 and the multiple forms the virus
structure takes on in the laboratory will be introduced as a stepping off point for the
research presented. Additionally, due to the tropism of HPV16 for human epithelial cells
during a natural infection, and the current presented work done on LC, this introduction
will focus on studies that employ human epithelial cell lines, and will make specific
mention when non-human or non-epithelial cells are discussed. Lastly, an introduction
to LC, their role in epithelial immunity, and their manipulation by HPV will be introduced.
14
1.1 HPV16 Structure and Production Systems
Human Papillomavirus type 16 (HPV16) is a small, non-enveloped virus with
circular double-stranded DNA. The 7.9 kb genome contains 9 different genes, which are
divided into early (E) and late (L) based on the timing of their expression during infection
of keratinocytes [2,15]. The E6 and E7 gene products are known to be oncogenic; E6
inhibits negative regulators of the cell-cycle and p53, a protein that controls apoptosis,
and E7 can bind to tumor suppressing protein retinoblastoma [2]. Both E6 and E7 can
be expressed during persistent latent infections and can lead to keratinocyte
transformation [10]. Additionally, E5 has oncogenic properties by enhancing cellular
immortalization [2]. The late genes, L1 and L2, encode for structural proteins that make
up the viral capsid and their expression is dependent on cellular RNA factors in
response to the differentiation of host keratinocytes [15].
The HPV16 virion is approximately 55 nm in diameter, and consists of a T = 7
icosahedral capsid composed of two structural proteins: the major capsid protein L1,
and the minor capsid protein L2 [16,17]. The primary structure of the capsid is formed
by 360 molecules of L1 organized into 72 pentamers [18]. In different HPV16 viral
particle production systems, between 12 and 72 molecules of L2 are incorporated into
the capsid, which are located in the central internal cavity of the L1 pentamer, while
naturally produced HPV16 virions average approximately 30 L2 molecules [17]. The
majority of L2 is hidden from the capsid surface, except for some residues within the N-
terminus, which are exposed on the viral capsid surface [19]. The proline-rich C-
terminus of L2 binds directly to L1 primarily through hydrophobic interactions [20].
15
Although not strictly required for capsid formation, L2 was first shown to be
essential for infection in HPV33 [21] and later in HPV16 [22]. L2 is needed for efficient
DNA encapsidation in some papillomaviruses, such as bovine papillomavirus (BPV) 1
and HPV18, and although not essential, L2 appears to play an important role in DNA
encapsidation in other papillomaviruses, such as HPV16 and HPV31 [23,24,25,26].
Further functions of L2 include, but are not limited to: facilitation of endosomal escape of
the viral genome after infection [27], possibly assisted through the L2 GxxxG
transmembrane domain [28] and/or interaction with sorting nexin 17 [29]; binding of the
virion to the cytoskeleton and transport within the cytoplasm [30]; interaction with dynein
light chain for transport to the nucleus [31]; chaperoning of packaged DNA to the host
cell nucleus [32]; and assistance in capsomere assembly [33].
Because the production of HPV virions are dependent on host RNA factors
expressed during the differentiation of basal cells into keratinocytes, they can be
challenging to produce in vitro. Therefore, as an alternative to native virions, virus-like
particles (VLP) were developed. There are two types of VLP that are currently being
utilized by the field: L1 VLP and L1L2 VLP. When the major capsid protein L1 is
expressed alone it can self-assemble into an L1 VLP with icosahedral structure, and if
both L1 and the minor capsid protein L2 are simultaneously expressed, the proteins
assemble into L1L2 VLP [34,35,36,37]. These VLPs can be made in yeast, insect cells,
and mammalian cells [34,35,38]. While there is general structure similarity of VLP to
native virions, they do not contain the viral genome, rendering them non-infectious. The
subsequent development of particles containing reporter DNA plasmids, termed
pseudovirions (PsV), allowed for verification and quantification of host cell infection
16
through reporter plasmid gene transduction, and also the investigation of possible DNA-
induced capsid structural changes [24,39,40,41,42,43]. Finally, the development of
organotypic (raft) culture systems has allowed for epithelial cell differentiation in vitro
and yielded virions, such as HPV31, HPV18, and HPV16, which have been shown to
have infectious potential [44,45,46,47,48].
While these systems provide invaluable resources towards the study of
papillomavirus binding and entry, they have subtle structural and functional differences.
For example, O-linked heparan sulfates were shown to be sufficient for HPV33 L1L2
VLP binding to COS-7 cells (monkey kidney fibroblast cell line) whereas HPV33 PsV
infection also required N-linked heparan sulfates, indicating there may be differences in
VLP versus PsV interactions with heparin sulfate proteoglycans (HSPG) [49]. Selinka et
al. suggest that the observed differences in HSPG sulfation requirements between VLP
and PsV may due to structural changes from DNA encapsidation. The presence of L2
within the particle also affects L1 structure, as demonstrated by virions from raft cultures
with chimeric HPV16 L2 proteins that alter the structure of wild-type HPV16 L1 proteins
sufficiently such that HPV16 L1 specific conformational antibodies (H16.7E, H16.V5)
cannot neutralize the virions [50]. Despite these differences, research has shown there
are also consistencies between different particle types. For instance, HPV16 L1L2 VLP
compete with BPV1 virions for binding to C127 cells (murine mammary tumor line), and
likewise HPV16 L1 VLP colocalize with BPV1 virions in C127 cells [51,52], which
indicates that different papillomavirus genotypes made in different viral particle
production systems have similar binding/entry mechanisms and converge on the same
endocytic pathways.
17
1.2 The current paradigm of HPV16 binding and entry is incomplete.
In general, non-enveloped viruses hijack existing host cellular proteins and
endocytic pathways, typically clathrin- or caveolin-mediated, to bind to and enter cells.
This process usually consists of multiple steps including membrane docking and
receptor engagement, membrane invagination, pinching off of vesicles, and finally,
endosomal escape. However, the HPV16 entry mechanism is unique in that this virus
has been reported to enter HaCaT and HeLa cells through a previously undefined
clathrin-, caveolin-, lipid raft-, flotillin-, cholesterol-, dynamin-independent endocytosis
pathway [53]. These findings coincide with previous results from our lab that indicate
that HPV16 VLP entry into human Langerhans cells occurs via a non-clathrin, non-
caveolin, macropinocytic-related pathway [54]. Additionally, most viruses are
internalized rapidly, whereas the overall kinetics for HPV16 internalization is among the
slowest viral entry pathways described. For instance, it was demonstrated that the
infectious process of HPV16 PsV occurs asynchronously in epithelial cells, with an
average half-time of 12 hours [53], which coincides with earlier studies conducted with
HPV16 PsV and HPV18 PsV [40,55]. While it has been suggested that these unique
caveats may describe a novel, ligand-induced receptor-mediated and previously
undescribed endocytic pathway, the conglomeration of proteins involved have not been
identified and the complete pathway has remained undefined.
The current accepted model of HPV16 viral entry involves HPV16 L1 binding to
HSPG, such as syndecan 1, either on the epithelial cell surface or basement membrane
through interactions with L1 [40,56,57]. This has been shown for cell surface binding
using HPV16 PsV on HaCaT cells (HPV-negative keratinocyte cell line derived from
18
adult skin [58]), or for basement membrane binding using HPV16 PsV in an in vivo
mouse vaginal challenge model [57,59,60]. HSPGs were first described as HPV binding
receptors using HPV11 L1 VLP on HaCaT cells [8] and later shown to be essential for
infection using HPV16 PsV and HPV33 PsV on COS-7 cells (monkey kidney fibroblasts
transformed by SV40 large T antigen) [40]. HPVs may also initially bind to laminin-332
on the extracellular matrix before transfer to the cell surface as shown using HPV11
virions from human xenografts on HaCaT cells [61]. The binding of HPV capsids to
HSPGs also leads to initial conformational changes in L1 as demonstrated through
differences in pre- and post-attachment monoclonal antibody neutralization (H33.J3) of
HPV33 [49],
Following HSPG binding and consequential conformational changes, subsequent
capsid protein isomerization by peptidyl-prolyl cis/trans isomerase cyclophilin B (CyPB)
[62,63] and furin/proprotein convertase-mediated L2 cleavage increases L2 N-terminus
exposure [64,65]. Specifically, it was shown that if a putative CyPB binding site on
HPV16 L2 (97-PVGPLDP-103) is mutated, the L2 N-terminus becomes permanently
exposed and CyPB is no longer required for HPV16 PsV conformational changes that
facilitate internalization into HaCaT cells [62]. A subsequent study demonstrated that
CyPs actually facilitate the dissociation of HPV16 L1 from the L2/DNA complex
following HPV16 PsV internalization in HaCaT cells and acidification of endocytic
vesicles [63]. Interestingly, CyPB was found in viral genome-containing vesicles,
suggesting that it may be co-internalized with HPV16 PsV particles [63]. The
HSPG/CyPB-mediated conformational change in the HPV16 PsV capsid exposes a
highly conserved consensus furin convertase site (9-RTKR-12) on the HPV16 L2 N-
19
terminus, which can lead to proprotein convertase (PC) -mediated cleavage of L2, via
furin or PC 5/6 [64,65,66]. Furin cleavage of L2 in HPV16 PsV exposes the 17-36 aa
region of L2, which is required for endosomal escape [66]. Interestingly, furin/PC
cleavage resistant HPV16 PsV mutants are still able to enter and traffic normally in
HPSG-positive cells, but the particles accumulate in late endosomes, supporting a
model wherein furin/PC cleavage is required for L2-mediated endosome escape rather
than a prerequisite for binding and entry [65].
The binding of HPV16 to HSPGs/CyPB does not mediate infectious HPV16
endocytosis, and hence a separate secondary receptor or co-receptor may be involved
in the infectious internalization of HPV16 into epithelial cells [55,64]. One of the
secondary receptors hypothesized to be involved in HPV16 binding and entry is the cell
adhesion molecule α
6
integrin [59,67]. α
6
integrin was first identified as a candidate
receptor using HPV6 L1 VLP on HaCaT cells [7]. It has been demonstrated that the
level of HPV16 PsV binding correlates with the levels of α
6
/β
4
integrin, as decreasing α
6

integrin expression through siRNA significantly reduces HPV16 PsV infection [59], and
HPV16 PsV reporter gene transduction in β
4
integrin knockout mice was significantly
reduced [56]. Further, activation of focal adhesion kinase (FAK) by HPV16 PsV is
important for infection of HaCaT cells, and since this activation can be blocked through
an α
6
integrin blocking antibody in mouse embryonic fibroblasts, it may suggest that
HPV16 PsV signals through α
6
integrin to activate FAK [59]. Until a direct interaction
between integrins and HPV16 can be demonstrated, these signaling events indicate
that, at the very least, integrins act as co-receptors for HPV16 binding and entry.
20
A recent study has reported that growth factor receptors (GFRs), such as
epidermal GFR (EGFR), may also become activated through the formation of
HSPGs/growth factor/HPV16 complexes that initiate signaling cascades during early
virion-host cell interactions [68], and activation may be related to the active transport of
HPV16 along filopodia. It was demonstrated that HPV16 PsV can bind to
HSPGs/growth factor complexes and subsequently activate signaling through these
GFRs on HaCaT cells [68]. However, it is not clear whether this observation represents
an alternative mechanism of HPV16 entry via GFRs, or rather encourages viral infection
in proliferating cells. Though a study by Surviladze et al. provided no direct evidence of
an interaction between HPV16/HSPGs/GF complexes and GFRs at the cell surface,
GFR activation was suggested by an observed activation of ERK1/2 [68]. A recent study
by the same group showed that early binding of HPV16 PsV to HaCaT cells leads to
activation of the PI3K/Akt/mTOR pathway through EGFR stimulation and that this
signaling plays an important role in infection [69]. Interestingly, the early activation of
PI3K has been shown to be mediated by both integrins and GFR, suggesting a possible
additive effect; however, this attractive hypothesis may need to be further substantiated.
Additionally, these early signaling events leave a number of open questions, such as
whether the observed activation is directly connected to entry or internalization. An
important consideration may be that the kinetics of signaling activation and
internalization do not coincide, i.e. signal activation appears to be early whereas
internalization occurs at a later event.
Tetraspanins, specifically CD63 and CD151, have also been shown to be
involved in HPV16 infection [70]. The expression of CD151 was recently demonstrated
21
to be localized to the basal cells of human cervical epithelium matching the tropism of
HPV16 infection, and depletion of CD151 reduces HPV16 PsV endocytosis in HeLa
cells but does not affect cell-surface binding [71]. It has been hypothesized that
tetraspanins are involved in forming enriched membrane microdomains containing
HPV16-associated receptor molecules, such as HSPG, integrins, GFRs, and other
proteins that have been shown to interact directly with tetraspanins [71].
Until recently, there was no direct evidence that the HPV16 minor capsid protein
L2 possessed any function at the cell membrane. Previously, several studies suggested
that L2 was not involved in cell surface binding, including work by Volpers et al. which
demonstrated that HPV33 L1 VLP and L1L2 VLP bind equally well to HeLa cells [72],
and studies by Roden et al. which showed that BPV1 virions are competitively inhibited
from binding to C127 cells by either BPV1 L1 VLP or L1L2 VLP [51]. However, in the
context of subsequent HSPG research, it appears that those studies may have simply
highlighted the significant role of HSPGs in binding the L1 protein. The L2 protein has
been indirectly linked to HPV16 infectious entry, as demonstrated by PsV with low
average levels of L2 having less infectivity that those with higher average levels [17].
Further, HPV16 L1L2 VLP are twice as efficient in cell entry as HPV16 L1 VLP into
HeLa cells [73], and pre-incubation of COS-1 cells (monkey kidney fibroblast cell line)
with the HPV16 L2 peptide 108-126 decreased infectivity of HPV16 PsV [74].
Additionally, this L2 peptide was shown to interact directly with the epithelial cell surface
in the absence of L1 on human cervical cancer cell lines (HeLa, SiHa, and CaSki),
indicating the presence of an unidentified L2-specific binding molecule on host cells
[74]. Despite these previous studies, and evidence of an L2-specific receptor, the
22
identity of a molecule(s) capable of inducing membrane curvature that actively mediates
HPV16 endocytosis remained unknown.

1.3 Langerhans Cells and HPV Immune Evasion
Persistent HPV16 infection is a major risk factor for cervical cancer [10], and
while the majority of woman eventually clear the virus, the time required to do so can
vary from months to years [75]. This slow clearance rate along with established
persistent infections suggests that HPV16 does not initiate an effective immune
response. Langerhans cells (LC) are the local antigen presenting cells (APC) of the
cervical epithelium and mucosa, making them not only the first immune cells to come
into contact with HPV, but also the cells responsible for initiating an immune response
against it [11]. Upon proper pathogenic stimulation, LC undergo phenotypic and
functional changes including the activation of an internal signaling cascade that results
in the up-regulation of co-stimulatory molecules and the release of inflammatory
cytokines. Activated LC then migrate to lymph nodes where they interact with antigen-
specific T cells and initiate an adaptive T cell response. However, HPV16 does not
activate LC, preventing the induction of an HPV-specific adaptive immune response,
and implicating an HPV immune escape mechanism that targets human LC [76].
Our lab has previously demonstrated that HPV16 manipulates LC as a
mechanism for immune evasion. Specifically, HPV16 L1L2 VLP-exposed LC do not
become mature APC and are therefore unable to initiate an HPV16-specific cytotoxic T
cell response when compared to positive toll-like receptor (TLR) agonist controls such
as LPS [77,78]. TLRs are located on the extracellular surface of LC and recognize
23
pathogen associated molecular patterns (PAMPs). Furthermore, the mechanism for
immune evasion has been shown to be dependent on the L2 minor capsid protein, i.e.
LC exposed to HPV16 L1-only VLP mature and initiate a T cell response whereas LC
that are exposed to HPV16 L1L2 VLP do not [78]. LC also internalize HPV16 L1L2 VLP
in a clathrin-, caveolae-, and actin-independent pathway [54], whereas LC internalize
HPV6b L1 VLP through a caveolae dependent pathway [79] and HPV16 L1 VLP
through a clathrin dependent pathway [80]. These endocytic differences may likely be
due to the presence or absence of the L2 minor capsid protein within the VLP used in
the different studies. Moreover, we have shown that HPV16 L1L2 VLP enter LC at twice
the rate of HPV16 L1 VLP. Taken together, these findings suggest that there is an L2-
specific receptor on LC that increases the efficiency of binding and internalization of
HPV16, and also leads to a lack of LC activation. Despite the importance of LC in
HPV16 infection and the implications of an L2-specific receptor on LC, an HPV16 L2
receptor had yet to be identified.

24
CHAPTER 2. The S100A10 subunit of the annexin A2 heterotetramer facilitates L2-
mediated human papillomavirus infection
1

2.1 Introduction
Human papillomaviruses (HPV) are one of the most common sexually
transmitted viruses, and persistent high-risk HPV infections are causally associated with
the development of cervical cancers, which are responsible for the deaths of
approximately a quarter of a million women each year worldwide [1,2]. Of the 15
different cancer-causing high-risk HPV genotypes, HPV16 is the most common, leading
to approximately 50% of all cervical cancers [5]. Despite these statistics and rigorous
efforts in understanding the first steps in HPV16 infection, the entire mechanism of how
HPV16 enters and infects human cells is yet to be defined. HPV16 is an obligatory
intracellular virus that must gain entry and deliver its circular double stranded DNA to
the nucleus of basal epithelium host cells for viral replication, and the capsid proteins
play vital roles in these steps [7,8,9].
The timing and expression of HPV16 viral genes along with the production of
infectious virions is contingent on the differentiation of basal epithelial cells into mature
keratinocytes [15]. This contingency has led the majority of the field interested in
papillomavirus receptors to use pseudovirions (PsV) and/or virus-like particles (VLP) to
study specific aspects of viral internalization and infection. When expressed alone in

1
This work has been published in PLoS One (Vol. 7(8), pp. e43519) and is reproduced here with
permission in accordance with the Creative Commons Attribution License. Copyright 2012. PLoS
25
vitro, 360 copies of the major capsid protein L1 can self-assemble into L1 VLP, and
when expressed concurrently with the minor capsid protein L2, between 12 and 72 L2
proteins are incorporated per capsid [17,34]. Although L1 is sufficient to form a VLP, L2
has essential functions for the HPV16 life cycle including DNA incorporation into the
viral capsid [25]. HPV16 L1L2 PsV can therefore incorporate DNA within the capsid,
making them a useful tool for studying pseudoinfection with reporter genes. To date, it
has been demonstrated that HPV infection of epithelial cells is initiated upon viral capsid
binding to multiple cell surface receptors, most notably through an initial interaction
between L1 and heparan sulfate proteoglycans (HSPG) [40] as well as numerous other
potential cell surface receptors such as α
6
β
1/4
integrin, cyclophilin B, growth factors and
growth factor receptors (GF and GFR), and various tetraspanins [7,62,68,81]. However,
the entry of HPV16 into cells has been shown to be clathrin-, caveolin-, cholesterol-,
and dynamin-independent implying a non-canonical and possibly novel ligand-induced
internalization pathway related to macropinocytosis [53,54].
Though the interaction between L1 and HSPG appears to be the primary initiator
of epithelial cell infection, the electrostatic interaction to the negatively charged
polysaccharides is generally thought to be non-specific [82], and may lead to a cascade
of subsequent capsid conformational changes. The capsid changes that result include
furin-mediated proteolytic cleavage of the L2 protein and isomerization by cyclophilins,
resulting in decreased affinity of the capsid for primary receptors and increased
exposure of the L2 N-terminus to suggested secondary cell surface receptors sites
[62,65,83]. Additionally, it has been shown that initial binding to HSPG does not mediate
HPV uptake and infection, and possible L1 or L2-specific secondary receptors or co-
26
receptors may be involved in the infectious internalization of HPV into host cells [55,64].
Antibodies against the N-terminus of HPV16 L2 have consistently been shown to inhibit
HPV16 infection and several neutralizing epitopes have been described, which may
indicate the presence of an L2-specific receptor [19,84,85,86,87]. Antibodies against L2
amino acids 17-36 are highly conserved and cross-neutralizing against several high risk
papillomavirus genotypes [87]. Additionally, antibodies against amino acids 108-126
and 107-122 effectively neutralize HPV16 infection [19,88]. One of these previously
established HPV16 N-terminal L2 neutralizing epitopes has been shown to facilitate
HPV16 binding to epithelial cells through an interaction between the L2 protein (aa 108-
126) and an unknown cell surface receptor [74,89]. This region was demonstrated to
bind to the surface of the human cervical cancer cell lines HeLa, SiHa, and CaSki, and
was additionally shown to facilitate infection on COS-1 cells. Pre-incubation of COS-1
cells with an L2
108-120
peptide reduced infection by approx. 60% compared to control
peptides. Additionally, specific substitutions at aa 108-111 abolished GFP-L2
108-126

fusion peptide binding to HeLa cells and also reduced PsV infectivity of COS-1 cells
[74]. Understanding HPV16-epithelial cell interaction and identifying HPV16 L1- and L2-
specific receptors and cofactors involved in internalization and infection on host cells is
critical to delineating the events that occur during an active HPV16 infection in vivo.
However, until now, a specific L2 secondary receptor for HPV16 has not been identified.
A particular local immune event that has been well studied in the context of HPV
infection is mucosal co-infection with herpes simplex virus (HSV). Historically, in the
1960s and 1970s, HSV-2 infection was thought to be a possible causative agent for
cervical cancer [90,91]. However, the role of HSV-2 in cervical cancer began to be
27
questioned when HSV-2 DNA was not consistently found in cervical cancer tissues [92].
Subsequently, HPV DNA was detected in the overwhelming majority of cervical cancer
tissue and determined to be the causative agent. Nonetheless, the link between HSV
and HPV persisted. Recently, it was demonstrated that exposure of human cervical
epithelial cells to HSV results in a reduction in the expression of secretory leukocyte
protease inhibitor (SLPI), a mediator of mucosal immunity that has been shown to inhibit
HSV infection as well as infection by HIV [93]. Mechanistically, SLPI has been shown to
inhibit HIV-1 infection of macrophages by binding to and blocking cell surface annexin
A2 [94]. Annexin A2 is found at the cell surface as the annexin A2 heterotetramer (A2t)
consisting of two annexin A2 monomers and an S100A10 dimer [95,96], which are co-
expressed by basal epithelial cells [97]. Interestingly, the previously mentioned L2
108-126

peptide was shown to bind significantly less to the A2t-deficient human HepG2 cell line
as compared to cervical cancer cell lines that express A2t [74]. Therefore, due to the
historical relationship between HSV and cervical cancer, the down regulation of an
inhibitory ligand of annexin A2 by HSV, and annexin A2’s implication in different viral
entry pathways such as HIV, we hypothesized that the infection of HPV16 is also
mediated through A2t. To explore this possibility, we examined the role of A2t in HPV16
infection of epithelial cells as well as the biochemical interactions between A2t and
HPV16 capsid proteins. In the process we uncovered a novel role for A2t as an HPV16
L2 specific receptor on epithelial cells and that the specific site of L2 interaction is on
the S100A10 subunit of A2t.

28
2.2 Results
HPV16 PsV infection decreases following SLPI treatment or anti-annexin A2 antibody
inhibition of A2t.
It was previously demonstrated that SLPI inhibits the infection of HIV-1 through
extracellular annexin A2 [94], and HSV causes a sustained down-regulation of SLPI
[93]. Therefore, due to the high prevalence of coinfection of HPV and HSV, we
predicted that SLPI would inhibit HPV16 internalization if it also utilizes a similar
pathway. Additionally, we hypothesized that similar inhibition would be seen with an
anti-annexin A2 antibody if SLPI inhibition of HPV16 occurs through A2t. To test this
hypothesis, the effect of SLPI and antibody inhibition of A2t on HPV16 infection of
epithelial cells was examined via HPV16 pseudoinfection of HaCaT cells where reporter
gene transduction was used as a measure of HPV16 infectivity. HaCaT cells were
incubated with increasing amounts of SLPI or BSA as a control in serum free conditions,
and subsequently exposed to PsV containing an expression vector coding for Green
Fluorescence Protein (GFP). A significant decrease in pseudo-infection was observed
using 25 µg/mL of SLPI, and pseudo-infection further decreased with 50 µg/mL of SLPI
compared to negative and BSA controls (approximately 60-80% decrease in pseudo-
infection with 25-50 µg/mL SLPI compared to untreated HaCaT cells) (Figure 2.1A).
Similar results were seen on HeLa cells only when PsV infections were done in the
absence of FBS, but the presence of FBS during SLPI incubation and PsV infection
eliminated the blocking effect of SLPI completely (data not shown), confirming the data
of others [98]. It is possible that unidentified FBS proteins either act as competitive
substrates of SLPI or block binding of SLPI to A2t.
29
Next, HaCaT cells were incubated with increasing concentrations (20-40 µg/mL)
of an anti-annexin A2 antibody or isotype control before exposure to GFP-vector
containing HPV16 PsV. Pseudo-infection of HaCaT cells was significantly reduced at
the concentrations of anti-annexin A2 Ab tested compared to PsV only, though some
reduction in pseudo-infection was also observed in the isotype control groups (Figure
2.1B). However, when the 40 µg/mL anti-annexin A2 group is compared to the 40
µg/mL isotype control group, the infectivity in the anti-annexin A2 group was significantly
decreased compared to the isotype control. Similar effects of annexin 2 antibody
Figure 2.1. HPV16 PsV infection decreases following SLPI treatment or anti-annexin
A2 antibody inhibition of A2t. HaCaT cells were infected with HPV16 pseudovirions
containing a GFP plasmid. Infectivity was scored at 48 h post infection by
enumerating GFP-positive cells by flow cytometry. (A) Cells were preincubated with
increasing amounts of SLPI or BSA for one hour at 4u prior to PsV infection. The
mean percentage of HPV16 PsV infected cells (GFP-positive) normalized to the PsV
only group 6 SD are presented. (**P,0.01 as determined by a two-tailed, unpaired t-
test, as compared to the PsV only group). (B) Cells were incubated with increasing
amounts of an anti-annexin A2 Ab or isotype control (mouse IgG1) for one hour prior
to PsV infection The mean percentage of HPV16 PsV infected cells (GFP-positive)
normalized to the PsV only group 6 SD are presented (**P,0.01 as determined by a
two-tailed, unpaired t-test, as compared to PsV only except where otherwise noted).
Each graph is representative of at least two independent experiments.
30
blocking were observed on HeLa cells, verifying our results in another HPV-permissive
epithelial cell line (data not shown). The maximum reduction in infectivity due to
antibody inhibition of annexin A2 appeared to mirror the maximum decrease due to
SLPI inhibition, suggesting the blocking effect of SLPI was due to its affinity for A2t.

Epithelial cells express A2t on the extracellular membrane.
A2t is a calcium-binding protein, which can be found on the inner leaflet of the
plasma membrane but can translocate to the outer leaflet under certain conditions [99].
To determine whether A2t is found on the extracellular membrane of HaCaT and HeLa
Figure 2.2. Surface expression of A2t on HaCaT and HeLa human epithelial cell
lines. (A) HaCaT and HeLa cells were incubated with an anti- S100A10 antibody,
then incubated with fluorophore-conjugated secondary antibodies, and mounted with
DAPI containing media. For control staining, cells were either stained with a mouse
or rabbit IgG isotype control followed by secondary antibody staining. Images were
acquired using an upright confocal fluorescent microscope. (B) HeLa and HaCaT
cells were incubated with PBS supplemented with Ca2+ or PBS with increasing
concentration of EDTA for 45 min. The supernatants were collected and the presence
of ANXA2 and S100A10 were analyzed via Western blot.
31
cell lines, we visualized the extracellular A2t complex with immunofluorescence
microscopy on non-permeabilized cells. The presence of S100A10 was detected as
diffuse staining on the surface of HaCaT cells and more punctate staining on the
surface of HeLa cells (Figure 2.2A). Since S100A10 binding to the cell surface is
mediated through heterotetramer complex formation with its phospholipid binding
partner annexin A2 (reviewed in [96]), positive staining for S100A10 indicates that A2t is
found at the cell surface. To further demonstrate A2t cell surface localization, cells were
incubated with the Ca
2+
chelating agent ethylenediaminetetraacetic acid (EDTA) for 45
min, which releases extracellular A2t from membranes. The supernatants were
collected and the presence of A2t was analyzed via Western blot. In HaCaT and HeLa
cells, both extracellular A2t components, annexin A2 and S100A10, were detected in
the supernatants of EDTA-treated cells (Figure 2.2B). Collectively, these data indicate
that extracellular A2t is found in abundance on the surface of both epithelial cell types.
Figure 2.3. HPV16 binds to A2t on the cell surface of HeLa cells. HeLa cells were
incubated with HPV16 L1L2 VLP, HPV16 PsV or HPV16 L1 VLP for 1 hour at 37uC.
The cells were washed and surface proteins cross-linked. HPV16 VLP and PsV were
precipitated out of cell lysates with an anti-L1 antibody (H16.V5) conjugated to
magnetic beads. Elutions were analyzed via Western blot for the presence of ANXA2
and S100A10. Band density was determined by Licor Odyssey imaging software.
HPV L1 western blot shows equivalent amounts of HPV16 particles were precipitated
in lanes 3–5. The table below the figure indicates which components were included in
each treatment. Data are representative of at least three independent experiments.
32

HPV16 binds to A2t on the cell surface of HeLa cells
After epithelial cell surface expression of A2t was demonstrated, we then tested
whether HPV16 interacts with A2t at the cell surface through extracellular co-
immunoprecipitation (Co-IP). HeLa cells were incubated with HPV16 PsV, HPV16 L1L2
VLP, or HPV16 L1 VLP followed by incubation with an extracellular cross-linking agent.
The cells were then lysed and HPV16 was precipitated out of solution with an anti-L1
conformational antibody, and the co-immunoprecipitation of HPV16 particles and A2t
was visualized by Western blot (Figure 2.3). Western blot images and band density
quantitation show that both A2t components, annexin A2 and S100A10, were greatly
enriched in the presence of HPV16L1L2 VLP (Figure 3, Lane 3) compared to HPV16 L1
VLP (Figure 3, Lane 5) or negative controls (Figure 3, Lanes 1-2). DNA-induced virus
particle structural changes have been previously reported, and minor differences
between VLP and PsV internalization have been observed [43,49]. However, here we
show that both HPV16 L1L2 VLP and L2-containing HPV16 PsV (Figure 2.3, Lane 4)
showed similar increased interactions with A2t, indicating that any minor structural
changes induced by incorporation of DNA in PsV does not affect accessibility of the
exposed L2 portion on the particle surface. These findings suggest that HPV16 is
binding to A2t or an A2t-containing complex at the cell surface of epithelial cells and this
interaction is dependent on the presence of L2 since A2t did not enrich with L1 VLP.

33

HPV16 L2
108-126
is exposed on L1L2 VLP and PsV
It has been demonstrated that a
previously described neutralizing
epitope of the minor capsid protein
(L2
108-126
) can bind to the surface of
several human cell lines including
HeLa, SiHa, and CaSki, all of human
cervical cancer origin [74,85]. This
same region of HPV16 L2 has also
been shown to be involved in infection
of COS-1 cells [74], and homologous
regions of L2 from other
papillomaviruses (PV) have been
suggested to be exposed on PV
particles that are required for infection
[89]. Therefore we investigated if L2
108-
126
was exposed on HPV16 VLP and PsV with an enzyme-linked immunosorbent assay
(ELISA). ELISA plate wells were coated with HPV16 L1 VLP, HPV16 L1L2 VLP, or
HPV16 PsV and subsequently stained with an antibody specific to L2
108-120
(clone
16L2.4B4) which has previously been shown to neutralize HPV virus [88]). Similarly, it
has been shown that polyclonal antibodies against aa 107-122 effectively neutralize
HPV16 infection [19,86]. We observed antibody binding to HPV16 L1L2 VLP and
Figure 2.4. HPV16 L2108–126 is exposed
on HPV16 L1L2 VLP and HPV16 PsV.
ELISA plate wells were coated with 500 ng
of HPV16 L1 VLP, HPV16 L1L2 VLP or
HPV16 PsV and subsequently incubated
with anti-L1 H16.V5 or anti L2108–126
16L2.4B4 antibodies. Secondary HRP-
conjugated secondary antibodies were
added prior to the substrate. In control
experiments, no VLP were used. The
graph represents the mean absorbance
measured at 490 nm 6 SD of triplicate
wells. Data was repeated in three
independent experiments.
34
HPV16 PsV, and minimal antibody binding observed with L1 VLP, suggesting that this
particular region of L2 is exposed on mature HPV16 particles (Figure 2.4). The
observed absorbance was greater with PsV, which could be attributed to an increased
number of L2 proteins incorporated into the PsV capsid, as it has been shown that PsV
can be produced with up to 72 molecules of L2, whereas 12 L2 molecules are generally
associated with L1L2 VLP [17,72]. All particles were equally detected with the
conformation-dependent and neutralizing L1 antibody, H16.V5, indicating that the
capsid structures were intact.

HPV16 L2
108-126
binds specifically to the S100A10 subunit of A2t
Next, we wanted to determine if there was a specific interaction between the
L2
108-126
peptide and A2t using electron paramagnetic resonance (EPR) spectroscopy.
EPR is a method of magnetic resonance spectroscopy measuring unpaired electrons
whose underlying basic concepts are not unlike the more widely used technique of
nuclear magnetic resonance (NMR) (reviewed in [100]). When coupled with site-
directed paramagnetic-labeling, such as the attachment of a moiety with an unpaired
electron to a cysteine residue, EPR can be used to obtain structural information within a
small vicinity of the paramagnetic-label’s positions along the protein sequence. As a
paramagnetic-label becomes locally constrained, such as when bound to another
protein, its spectra will drastically change as visualized by a decrease in line amplitude
and increased line-broadening. Therefore, EPR provides an in vitro biochemical method
that measures protein-protein interactions by monitoring changes in the spectra
recorded for a labeled protein in different experimental settings.
35
For our purposes, an N-terminal cysteine (with a 3 native aa spacer) contained in
the L2
108-126
peptide (C-IVS-LVEETSFIDAGAPTSVPSI) was paramagnetic-labeled (an
unpaired-electron-containing small molecule was cross-linked via a disulfide bond to the
peptide), and its spectra were analyzed after incubation with and without purified human
recombinant A2t or controls. The spectrum of the paramagnetic-labeled L2
108-126
peptide
alone displayed sharp, high amplitude lines indicative of a non-constrained
paramagnetic label (Figure 2.5A), whereas the spectrum of L2
108-126
incubated with A2t
resulted in characteristic line-broadening and a decrease in amplitude (Figure 2.5B),
which is an indication of a constrained paramagnetic label suggesting strong protein-
protein binding (78.0% of L2
108-126
bound to A2t). To examine sequence specificity of
the L2
108-126
peptide binding to A2t, a scrambled version of the L2
108-126
peptide (ScrL2)
labeled with a non-paramagnetic and chemically similar analog (C-IVS-
IESPVSDTALGTPEIFVSA) was examined for its ability to compete for the interaction
between A2t and the wild type-paramagnetic-labeled L2
108-126
(WT L2
108-126
) peptide
using a 5:1 molar ratio of ScrL2 to WT L2
108-126
. No significant changes in spectra signal
were observed, suggesting that the interaction is sequence specific (75.8% WT L2
108-126

bound to A2t with ScrL2 at 5:1 molar ratio) (Figure 2.5C). Relative percent binding was
calculated by measuring the amount of bound and unbound labeled peptide in each
experiment through subtraction of the bound and unbound spectra (see materials and
methods for details) (spectra Figure 2.5D, quantified Figure 2.5L), and this data was
used to calculate a relative binding constant (K) of 10
5
M
-1
for the L2 peptide and A2t
using the formula K=[AB]/[A][B] where [AB] is the concentration of L2
108-126
bound to A2t
based on the percent bound and the initial concentration (i.e. 20mM x 78.0%), and [A]
36
and [B] are the concentrations of unbound L2
108-126
and A2t respectively. These results
demonstrate that a specific interaction exists between HPV16 L2
108-126
and A2t. As a
negative control to test for protein binding specificity, the L2
108-126
peptide was mixed
with Bovine Serum Albumin (BSA). The EPR spectra displayed sharp, non-broadened
lines with high-amplitudes indicating that L2
108-126
does not bind BSA in a significant
manner (Figure 2.5E).

37

Similar EPR assays were then performed with the annexin A2 and S100A10
subunits of A2t to determine the site of interaction between L2
108-126
and A2t. When the
L2 peptide was mixed with annexin A2 alone, only 23.6% peptide binding was observed
(spectra Figure 2.5F and quantified in Figure 2.5L). This interaction was partially
competed off in the presence of the paramagnetic-analogue labeled ScrL2 peptide
(17.7% L2
108-126
binding) (spectra Figure 2.5G and quantified in Figure 2.5L). When the
L2 peptide was mixed with S100A10, there was an observed binding of 92.5% (Figure
2.5H) that was minimally competed off in the presence of the ScrL2 peptide (91.0%
L2
108-126
binding) (spectra Figure 2.5I and quantified in Figure 2.5L). This data was
used to calculate a relative binding constant (K) of 1.5 x 10
5
M
-1
between L2
108-126
and
S100A10. As an additional control, the paramagnetic-labeled ScrL2 peptide was
analyzed for direct interaction with S100A10 to further test for sequence specificity.
Figure 2.5. HPV16 L2108–126 peptide binds to the S100A10 subunit of A2t protein
with sequence specificity. HPV16 L2 peptide was paramagnetic-labeled (*denotes
the attachment of the paramagnetic-label) and analyzed for binding to purified A2t,
S100A10 and ANXA2 protein in vitro by electron paramagnetic resonance. (A) The
first derivative spectrum of L2108–126 peptide free from ligands in solution. (B) The
first derivative spectrum of L2108–126 combined with A2t. (C) The first derivative
spectrum of L2108–126 combined with A2t in the presence of the control peptide
(5:1). (D) The result of subtraction of spectrum A from spectrum B representing the
bound spectrum of the labeled peptide. (E) The first derivative spectrum of L2108–
126 combined with BSA. (F) The first derivative spectrum of L2108–126 combined
with ANXA2. (G) The first derivative spectrum of L2108–126 combined with ANXA2
in the presence of the scrambled peptide (5:1). (H) The first derivative spectrum of
L2108–126 combined with S100A10. (I) The first derivative spectrum of L2108–126
combined with S100A10 in the presence of the scrambled peptide (5:1). (J) The first
derivative spectrum of S100A10 Subunit of A2t Facilitates HPV InfectionL2108–126
combined with cysteine-blocked S100A10 (aCys-S100A10). (K) The first derivative
spectrum of the paramagnetic-labeled scrambled peptide combined with cysteine-
blocked S100A10. (L) Quantification of relative % bound of all treatments as
measured through spectra subtraction and double integration expressed as the mean
of three separate experiments 6 SD.
38
S100A10 was treated with a cysteine-blocking agent to prevent non-specific disulfide
bond interactions, followed by incubation with the paramagnetic-labeled WT L2
108-126
or
paramagnetic-labeled ScrL2. Under these conditions, a significant interaction with the
WT L2
108-126
was observed but the ScrL2 peptide did not show any significant direct
binding to S100A10 (73.1% compared to 6.3%, respectively) (spectra Figure 2.5J-K
and quantified in Figure 2.5L). The cysteine block prevents non-specific interactions
due to the presence of surface cysteines, and was found to denature annexin A2
making it unfeasible to test direct ScrL2 binding to annexin A2 or A2t. Taken together
these results indicate that L2
108-126
specifically interacts with the S100A10 subunit of A2t
with sequence specificity.

Specific mutations in HPV16 L2
108-111
decrease HPV16 binding to A2t and HPV16 PsV
infectivity
It has been previously reported that substitutions in aa 108-111 (LVEE to GGDD)
of HPV16 L2 decrease the binding of the L2
108-126
peptide binding to HeLa cells and
reduce infectivity of HPV16 pseudovirus on COS-1 cells [74]. Therefore to test whether
this region is involved in A2t bindng, we generated HPV16 PsV incorporating these
mutations in the L2 binding site and investigated if these substitutions affected the
interaction between HPV16 and A2t using an ELISA assay (Figure 2.6A). ELISA plate
wells were either coated with A2t or left untreated before the wells were blocked with
casein and subsequently exposed to HPV16 PsV or mutant HPV16 L1-L2(GGDD) PsV.

39

We found that the binding of the mutant PsV to A2t was significantly reduced compared
to the non-mutated WT PsV, and that the measured absorbance was not significantly
different than negative controls that were incubated in the absence of HPV16 particles.
As a positive control, A2t coated wells were incubated with SLPI and significant binding
was observed. Thus by mutational analysis, our data suggest that in an intact virus
particle, the region L2
108-111
is involved in direct A2t binding.
Figure 2.6. Mutations in HPV16 L2108–111 reduce PsV binding to A2t and PsV
infectivity. (A) ELISA plate wells were coated with 500 ng of A2t prior to overnight
incubation with 400 ng HPV16 PsV or HPV16 L1–L2(GGDD) mutant PsV and
subsequently incubated with mouse anti-L1 H16.V5 or goat anti-SLPI antibodies.
Anti-mouse and anti-goat HRP-conjugated secondary antibodies were added prior to
the substrate. In control experiments, no ligands were used. The graph represents
the mean absorbance measured at 490 nm 6 SD (***P,0.001 as determined by a
two- tailed, unpaired t-test between WT and mutant PsV). (B) HaCaT cells were
infected with wild type (WT) or mutant (L2108–111 LVEE to GGDD) HPV16
pseudovirions containing a GFP plasmid. Infectivity was scored at 48 h post infection
by enumerating GFP-positive cells by flow cytometry. The mean percentage of
HPV16 PsV infected cells (GFP-positive) normalized to the WT PsV group 6 SD are
presented of two combined independent experiments. Inset shows the L1 band of a
coomassie blue stained SDS-PAGE gel loaded with an equivalent amount of WT and
mutant PsV used in the infectivity assays. (***P,0.001 as determined by a two-tailed,
unpaired t-test between WT and mutant PsV group).
40
Next, the effect of the mutations on HPV16 infectivity was examined. HaCaT
cells were either treated with an equal amount of PsV infectious units of GFP-plasmid
containing wild-type HPV16 PsV or mutant HPV16 L1-L2(GGDD) PsV. The mutation in
L2 caused a significant (>10-fold) reduction in the percent of GFP-positive HaCaT cells
compared to the group treated with the wild-type PsV (Figure 2.6B). To ensure that the
WT PsV and mutant PsV did not differ in their capsid:infectious unit ratios, a Coomassie
Blue stain was used to quantify L1 in each PsV preparation and showed that equivalent
numbers of particles were used in the wild-type and mutant groups (Figure 2.6B).
Immunoblot analysis confirmed that mutation of L2 did not affect incorporation of the L2
protein into the pseudovirion compared to WT PsV (data not shown). Furthermore, to
test that the L2 mutation did not adversely affect encapsidation of the reporter plasmid,
the number of reporter plasmid copies/ng of capsid proteins was quantified by qPCR
and showed that the mutation did not decrease DNA packaging (3.3 x 10
6
copies/ng of
the WT PsV and 5.6 x 10
6
copies/ng of the mutant PsV). Together with the EPR data,
this suggests that there is a specific interaction between L2
108-126
and the S100A10
subunit of A2t that is associated with HPV16 infectivity.

shRNA knockdown of A2t reduces internalization of HPV16 L1L2 VLP and infectivity of
HPV16 PsV
To investigate the contribution of L2 to HPV16 capsid internalization, an
internalization assay was performed with carboxyfluorescein diacetate, succinimidyl
ester (CFDA-SE) labeled L1 and L1L2 VLP (Figure 2.7A) measured via FACS on HeLa
cells. Fluorescence of CFDA-SE occurs when acetate groups are cleaved by
41

Figure 2.7. Knockdown of A2t reduces internalization of HPV16 L1L2 VLP and
infectivity of HPV16 PsV. (A) HPV16 VLP were fluorescently labeled with CFDA-SE,
and the % of infected cells was measured. To control for false positives, cells were
treated with VLP pre-incubated with an anti-L1 Ab (H16.V5). Histograms are
representatives of two triplicate experiments. (B) HeLa cells were left untreated or
transduced with a doxycycline inducible lentiviral vector containing an shRNA against
ANXA2. Cells treated w/ or w/o doxycycline were incubated with labeled HPV16 VLP
for 3 hours and assessed by FACS. The mean % of uptake normalized to the WT
group of three independent experiments is presented. (C) Protein was collected from
cell populations for analysis of ANXA2 and S100A10 via Western blot. (D) mRNA
was collected from cell populations in the uptake assay for quantitative RT-PCR
analysis of ANXA2 and S100A10 expression. The mRNA expression levels were
normalized to GAPDH and the graph is a representative example of an experiment
performed in triplicate 6 SD. (E) WT HeLa cells or HeLa cells stably transduced with
the inducible vector containing shRNA against ANXA2 or control non-target vector
were infected with GFP plasmid containing HPV16 pseudovirus. Infection was scored
48 h later by flow cytometry. The mean percentage of HPV16 PsV infected cells
(GFP-positive) normalized to the no doxycycline treated groups 6 SD are presented.
(*P,0.05 and **P,0.01 as determined by a two-tailed, unpaired t-test, as compared to
the no doxycycline-treated groups). Figure represents two independent experiments.
(F) Protein was collected from cells used in the infection assay for analysis of ANXA2
and S100A10 via Western blot. GAPDH served as a loading control.
42
intracellular esterases, therefore only VLP that have been internalized are detected. The
percent of CFDA-SE positive cells was significantly greater after exposure to L1L2 VLP
(66% CFDA-SE positive after 1 hour) compared to L1 VLP (19% CFDA-SE positive
after 1 hour), which shows that L2 increases the efficiency and/or rate at which the
particles enter these cells. These findings suggest that there may be alternate pathways
associated with the L2 protein, and coincide with findings previously reported for HPV
type 31 [26].
Next we wanted to determine the effect of down-regulating A2t on both L1 and
L1L2 VLP internalization. It has been previously demonstrated that A2t light chain
S100A10 is post-transcriptionally modified by annexin A2, and protein knockdown of
annexin A2 leads to degradation of S100A10 [101,102]. Therefore, in order to down
regulate A2t expression in epithelial cells, we transduced HeLa cells with a lentiviral
vector encoding a short hairpin (sh) RNA against annexin A2 mRNA (shANXA2) whose
expression was doxycycline inducible. HPV16 L1 VLP and L1L2 VLP uptake was tested
in transduced cells that were either treated with doxycycline or left untreated. We found
that shRNA knockdown of A2t reduced internalization of L1L2 VLP by 75% compared to
wild type cells in the doxycycline treated transduced group compared to only 15% in the
non-treated control group (p<0.05; Students t-test comparing doxycycline to non-
doxycycline control) (Figure 2.7B). L1 VLP internalization was not decreased in
doxycycline treated transduced cells. Knockdown of annexin A2 and S100A10 protein
levels was confirmed by Western blot where we found significant reductions of both
proteins in the doxycycline-treated group (Figure 2.7C). We also confirmed previous
findings by quantitative RT-PCR that downregulation of ANXA2 mRNA does not
43
negatively affect S100A10 mRNA levels (Figure 2.7D) [101]. These results show that
shRNA against ANXA2 is sufficient and effective in reducing both components of A2t at
the protein level while reducing the potential off-target effects of using shRNA against
both targets. These data also indicate that knockdown of A2t does not affect general
endocytosis or intracellular trafficking because L1 VLP internalization was unaffected.
Together with the preliminary internalization (Figure 2.7A) these data support the
hypothesis that A2t facilitates L2-mediated HPV16 internalization.
Lastly, we tested the effects of stable shRNA mediated knockdown of A2t on the
pseudo-infection of epithelial cells. HeLa cells were transduced with a lentiviral vector
coding for an shRNA against ANXA2 as previously mentioned, or a non-silencing
analog. The cells were then either treated with doxycycline or left untreated before
exposure to GFP plasmid containing HPV16 PsV. A significant reduction in pseudo-
infection was observed in the anti-ANXA2 shRNA group that was treated with
doxycycline compared to its non-doxycycline control group (Figure 2.7E). The wild type
and non-silencing transduced HeLa cells showed no decrease in HPV16 pseudo-
infection when treated with doxycycline. A Western blot confirmed that the doxycycline-
treated shANXA2 group showed a marked decrease in A2t compared to all other groups
(Figure 2.7F). Taken together, these results indicate that HPV infection is decreased in
epithelial cells when A2t is either blocked by external ligands or antibodies directed
towards A2t or when the complex is genetically knocked down in HPV16 susceptible
cell lines.

44
2.3 Discussion
The concept of viruses binding to a single receptor and subsequently entering
cells through a single uptake mechanism has been challenged [13,14]. Instead, a more
complex picture is forming where specific co-receptors and multiple attachment sites
lead eventually to viral entry by one or multiple uptake mechanisms. Numerous binding
receptors and cofactors for HPV16 L1 are now recognized, building a complex and
cooperative paradigm of HPV16 infection, but the identity of an L2-specific receptor has
remained elusive despite the identity of known L2 neutralizing epitopes. The highly
conserved HPV16 neutralizing L2
108-126
epitope has been shown to be associated in the
binding of HPV16 to several cervical cancer cell lines, but a cell surface receptor was
never identified [74]. To explore the role of A2t as an HPV16 receptor on epithelial cells,
both HaCaT and HeLa cells were used, as they are two common human cell lines used
in HPV entry and life cycle research. To stay consistent within systems in our study,
HaCaT cells were used primarily for infection experiments and results were then verified
on HeLa cells. HeLa cells were used for knockdown and Co-IP assays where lentiviral
transduction and expansion of high numbers of cells was more efficient. Collectively,
our results identify A2t as a novel receptor complex for HPV16 and support the
hypothesis that HPV16 L2 binds to the S100A10 subunit of A2t and facilitates HPV16
infection of epithelial cells.
The use of VLP and PsV to study HPV binding, entry, and infectivity has been
widely employed [52,54,65,70,89,98]. The primary difference between L1 VLP and L1L2
VLP is the presence of the L2 protein, making L1L2 VLP the preferred particle type to
study the role of L2 in binding and internalization. In this regard, VLP were utilized to
45
highlight differences in binding and internalization between VLP containing L2 and those
that do not in order to establish an association between L2 and A2t. Additionally, our
data showed that DNA-containing HPV16 PsV bound similarly to the A2t complex as
HPV16 L1L2 VLP, indicating that any DNA-induced structural changes do not impact
association with A2t, and that the cell surface-binding motif L2
108-126
is exposed on both
HPV16 L1L2 VLP and PsV. Here, HPV16 PsV containing a reporter plasmid coding for
GFP were used to demonstrate that A2t facilitates infection, and mutations in L2 were
used to demonstrate a dependence on a specific region of the L2 protein that is
exposed on the surface of mature capsids.
Annexin A2 is found in the cytoplasm as a 36 kDa monomer and at the cell
surface as a 90 kDa heterotetramer (A2t), which consists of two annexin A2 monomers
bridged non-covalently to an S100A10 dimer [95]. S100A10, also known as p11 or
annexin A2 light chain, is a member of the S100 family of phospholipid-binding proteins
[96]. The S100A10 protein is post-translationally stabilized by annexin A2 [101,103],
and in a majority of cells, A2t is the predominant form [95]. This was confirmed in our
own experiments where it was found that shRNA against ANXA2 mRNA was sufficient
to down regulate the entire A2t complex, whereas the mRNA of S100A10 was
increased, which may have been a cellular response to the knockdown of annexin A2.
In normal epithelium, annexin A2 expression is confined to the basal and suprabasal
cells and the protein’s cellular location is consistently observed at the cell membrane in
these cells [97]. More specifically, an immunohistochemical study investigating the
differential expression of annexins found that annexin A2 was expressed on basal cells
46
of the cervix [104]. These observations demonstrate that the expression of A2t mirrors
the tropism of HPV16 infection in vivo.
Annexin A2 has been proposed to function in exocytosis, endocytosis, cell
adhesion, membrane fusion and membrane trafficking [105]. Of particular interest to us,
annexin A2 has been shown to play a key role in the binding and uptake of a variety of
different viruses. Annexin A2 has been shown to bind directly to cytomegalovirus (CMV)
virions [106] and enhance CMV-membrane fusion [106,107]. In addition to CMV, it was
shown that annexin A2 is a receptor for respiratory syncytial virus (RSV) and that this
binding can be inhibited by an antagonist, suggesting a potential for inhibitors of
annexin A2 as treatments for RSV infections [108]. Most recently, annexin A2 was
shown to bind to the capsid of enterovirus 71, which was associated with an increase in
viral infectivity [109]. As previously stated, annexin A2 was shown to be a cofactor for
HIV-1 infection in macrophages [94], but until now, annexin A2 has never been
associated with HPV16. Our Co-IP data indicate that HPV16 interacts with A2t at the
cell surface, fulfilling the definition of a receptor molecule, though we cannot exclude the
possibility that additional proteins are present within a larger complex. However, we
believe it is unlikely that HPV16 binding to A2t is mediated indirectly by association with
other cell surface binding proteins or heparin sulfate, since our EPR data show a direct
physical interaction between the L2
108-126
peptide and A2t, and specifically with the
S100A10 subunit of A2t, in the absence of other cellular proteins. Furthermore, our
ELISA data indicates that HPV16 PsV can bind directly to A2t in the absence of other
cellular components. However, binding of HPV particles to heparin sulfate in vivo may
47
increase the overall avidity of A2t binding, since A2t has also been shown to interact
with heparin in a Ca
+2
dependent manner [110].
It has been previously reported by us that HPV16 entry into human Langerhans
cells occurs via a non-clathrin, non-caveolin, macropinocytic-related pathway [54]. More
recently it has been shown that entry into HaCaT and HeLa epithelial cell lines occurs
by a clathrin-, caveolin-, cholesterol-, and dynamin-independent pathway which is
suggested to be a novel ligand-induced internalization pathway related to
macropinocytosis [53]. Our current study identifies A2t as a novel L2-specific HPV16
receptor that is involved in internalization and infection of epithelial cells, but future
studies are needed to determine where A2t may fit in this proposed ligand-induced
macropinocytosis related pathway and whether previously identified HPV receptors and
cofactors such as HSPG, integrins, growth factors and growth factor receptors,
tetraspanins and cyclophilins actively interact with A2t during HPV internalization and
infection. There remains a possibility that these molecules work together in a complex
that initiates a novel HPV16 endocytic pathway. Other viruses associated with annexin
A2 also utilize similar molecules during infection. For instance, CMV uses HSPG for
tethering and β1 integrins for fusion and internalization (reviewed in [111]). Moreover,
HIV-1 binding to macrophages is associated with HSPG and integrins in addition to
annexin A2 before transfer to CD4 and CCR5 [94,112]. This fits with the emerging
concept that viruses use multiple specific receptors and co-receptors that work
simultaneously to lead to viral entry, either via a single or multiple pathways, and
provides a strong rationale to study how these receptors and pathways either work
together or independently. The predominant protein exposed on the capsid surface is
48
the L1 major capsid protein, against which most HPV neutralizing antibodies are
generated. While there is some evidence to suggest that furin-cleavage of L2 causes a
conformational change within L1 that may expose a secondary receptor binding epitope
(reviewed in [113]), there is no requirement that this putative secondary receptor binds
to the L1 protein. L1 only-containing PV are neither infectious nor occur in nature, but
are rather a tool used by scientists as a result of the self-assembling properties of L1
capsomers. Additionally, the N-terminal region of L2 is highly conserved among PV
types, and can induce broadly cross-neutralizing antibodies that are capable of
preventing capsid binding to the cell surface post HSPG binding and furin cleavage
[114], which also suggests that the L2 protein could be a potential receptor binding
protein. However our data do not exclude the possibility that additional L1 secondary
receptors also exist.
Tetraspanins (CD63/CD151), α
6
β
1/4
integrins, GF and GFR, and cyclophilin B are
all cell surface associated proteins that have been implicated in HPV entry into epithelial
cells [7,62,68,70]. It is tempting to speculate that the recruitment of A2t to the cell
membrane and subsequent translocation to the cell surface is linked to the binding of
HPV16 to integrins and subsequent activation of focal adhesion kinases and src-family
kinases and their respective signaling cascades, which notably have been shown to
cause translocation of A2t to the cell surface [59,99,115,116,117]. Consequently, early
binding of HPV16 to integrins has the potential to recruit A2t to the specific site of cell
membrane interaction. Though currently inferential, these relationships lead to the idea
that a signal transduction cascade may be in place where the binding of HPV16 through
primary receptors leads to the local recruitment and subsequent translocation of
49
additional A2t to the cell surface where they act as secondary binding and
internalization receptors, and gives further reason to investigate the synergy between
A2t and other HPV16 receptors. Future studies will aim to elucidate a direct role for A2t
in the specific endocytosis of HPV as endocytosis has already been proposed as a
function of A2t.
In this study, we used a unique method to determine whether a conserved region
of HPV16 L2 binds directly to A2t in vitro, and more specifically to the S100A10 subunit
of the heterotetramer. Site-directed paramagnetic-labeling coupled with EPR is a
powerful well-established biochemical technique that measures structural changes in
proteins by observing energy absorbed by a paramagnetic system in a magnetic field
(reviewed in [100]). This technique is particularly useful in studying protein-protein
interactions, especially peptide sequences devoid of cysteines and paramagnetic
centers such as the N-terminal L2
108-126
peptide. While this technique has been used to
measure other viral protein interactions with ligands and/or protein partners [100], it had
not yet been employed for HPV research, and can now provide another tool to study
HPV-receptor interactions. Based on our data, the HPV16 L2
108-126
peptide and A2t
interacted strongly with a calculated relative binding constant (K) of 10
5
M
-1
in the
absence of other proteins. To put this in perspective, a soluble analogue of HSV
glycoprotein D has been shown to bind to a soluble analogue of its well-established
receptor HVEM within the same order of magnitude (measured with surface plasmon
resonance) [118]. Furthermore, our data indicate that this peptide had a minimal
interaction with the annexin A2 subunit of A2t, but had a very strong interaction with the
S100A10 subunit suggesting that S100A10 is the site of interaction for L2 on A2t.
50
Future EPR analysis and mutational studies will aim to address the exact site where
HPV16 binds to the S100A10 portion of A2t.
We demonstrate that SLPI, a ligand of annexin A2, can inhibit HPV16 infection of
HaCaT cells. SLPI has shown anti-bacterial and anti-fungal activity aside from its noted
anti-protease activity (reviewed in [119]). Human epithelial and myeloid cells
constitutively secrete SLPI, and cellular production can be significantly upregulated in
response to various stimuli [120]. Concentrations in cervical mucosal fluids are
commonly reported at 1 µg/ml [121], but are likely to be more concentrated at the cell
surface. In addition, SLPI levels in cervical mucus have been measured midcyclic as
high as 78 µg/mL [122]. Thus, the concentrations of SLPI used in our blocking studies
fall within physiological levels found in vivo. Interestingly, SLPI has been reported at its
highest concentrations in saliva and upper airway (25-100 µg/mL) [123,124], which has
implications in HPV-related head and neck cancers where SLPI has already been
reported to be significantly reduced [125]. A previous report in which the authors
screened a selection of antimicrobial peptides and proteins for inhibition of PsV
infectivity on HeLa cells showed no reduction in HPV16 infection by SLPI [98]. However,
those studies were performed in the presence of FBS, which had the potential to mask
any inhibitory effects due to the presence of potential SLPI substrates in the serum. In
this regard, we also observed no reduced infection when SLPI was used in the
presence of FBS (data not shown).
Infection of human cervical epithelial cells with HSV results in a significant and
sustained reduction in SLPI levels [93]. In the context of our results demonstrating that
SLPI may play a role in HPV16 infection by inhibiting entry into epithelial cells, the
51
evidence showing that HSV down-regulates SLPI may explain the epidemiological
association between HSV and HPV induced cervical cancer. HSV infection may actually
increase the likelihood of HPV entry, infection and/or persistence by suppressing a
mucosal ligand of the HPV receptor A2t. While further studies need to be conducted to
test this hypothesis, this is an exciting and important connection that has the potential to
cohesively link decades’ worth of epidemiological data, and show a potential protective
role for SLPI against HPV16 infection based on its interaction with A2t, making these
findings significant across multiple disciplines.

2.4 Materials and Methods
Cell Cultures, Antibodies, and recombinant proteins
HeLa cells (ATCC, Manassas, VA) are human epithelial cells derived from
cervical cancer, and were maintained in complete media (IMDM, 10% FBS, 1X
PenStrep) at 37°C with 5% CO
2
(Lonza, Walkersville, MD). HaCaT cells (Cell Lines
Service, Eppelheim, Germany) are in vitro spontaneously transformed human
keratinocytes derived from histologically normal skin [58] and were maintained in
Defined Keratinocyte Serum-Free Media (KSFM) (Invitrogen, Carlsbad, CA) with
manufacturer provided KSFM growth supplement (including insulin, EGF, and FGF) at
37°C with 5% CO
2
.
The following antibodies were used in this study: mouse-anti-annexin A2 (BD
Biosciences, San Jose, CA); mouse-anti-S100A10 (BD Biosciences); rabbit anti-
GAPDH (Cell Signaling, Danvers, MA); H16.V5 mouse-anti-L1 (a gift from Neil
Christensen, Penn State); H16.E70 mouse anti-HPV16 L1 (a gift from Neil Christensen);
52
mouse anti HPV16 L1 (Camvir-1; BD Biosciences); 16L2.4B4 mouse-anti-L2
108-120
(a gift
from Neil Christensen); rabbit anti-HPV16 L1 polyclonal antibody (a gift from Martin
Müller, DKFZ, Germany); rabbit anti-HPV16 L2 polyclonal antibody (a gift from John
Schiller, NIH); rabbit-anti-mouse HRP (Promega, Madison, WI); rabbit anti-goat HRP
(Promega); goat anti-human SLPI (R&D Systems, Minneapolis, MN); AlexaFluor 680
goat-anti-rabbit IgG (Invitrogen) and IRDye 800 donkey-anti-mouse IgG (Rockland,
Gilbertsville, PA). Recombinant human (rhu)-SLPI was purchased from R&D Systems.
Recombinant annexin A2 was expressed in BL21(DE3) Escherichia coli cells and
purified using reversible Ca
2+
-dependent binding to negatively charged phospholipid
vesicles followed by size exclusion chromatography [126]. A pET23A vector containing
the S100A10 sequence (a gift from Volker Gerke) was expressed in BL21(DE3) cells as
previously described [127]. Both proteins were stored at 4°C in 20mM HEPES buffer at
pH 7.4, containing 100mM NaCl with the addition of 1mM dithiothreitol. Concentrations
of all proteins and peptides, including the A2t complex, were determined using
bicinchoninic acid assays (Pierce Thermo Scientific, Rockford, IL) compared to
measured absorbance of albumin standards at 562nm. Purified annexin A2 and
S100A10 were combined at a molar ratio of 1:1 and concentrated to over 8µg/µl. The
mixture was incubated overnight at 4°C, and then loaded onto a superdex 200 10/300
GL (GE Healthcare USA) column equilibrated in the previously mentioned HEPES
buffer. The eluted A2t peak was collected and subjected to peptide binding assays.
Peptides were purchased and synthesized by Synthetic Biomolecules (San Diego, CA)
or Biomer Technology (San Francisco, CA) and HPLC purified to > 95% purity.

53
Pseudovirions and Virus-Like Particles
Wildtype HPV16 pseudovirions containing GFP reporter were produced by
cotransfection of 293TT cells with plasmids encoding codon-optimized HPV16 L1 and
L2 and a GFP reporter plasmid (pCIneoGFP) following published procedures [128]. The
infectious titer of PsV preparations (in infectious units/mL) was determined by flow
cytometric analysis of 293TT cells treated with varying doses of PsV vector stock.
Neutralization of PsV were validated in infection assays via pre-incubation with H16.V5
or H16.E70 prior to cellular exposure, and minimal infection rates of less than 1% were
observed. To produce pseudovirions with a mutated L2 (108-126) region [74], site-
directed mutagenesis was performed using overlapping mutated primers on the
bicistronic packaging HPV16 pseudovirion plasmid p16sheLL as a template [128].
Forward primer 5’-
AGCGACCCCAGCATCGTGAGCGGTGGTGATGATACCAGCTTCATCGACGCCGGC
GCCCCC-3’ and reverse primer 5’-
GGGGGCGCCGGCGTCGATGAAGCTGGTATCATCACCACCGCTCACGATGCTGGG
GTCGCT-3’ encoding the amino acid substitution of GGDD for LVEE in the L2 capsid
region aa 108-111 were used with the QuikChange II XL Site-Directed Mutagenesis Kit
(Stratagene, Cedar Creek, TX) according to manufacturer’s instructions. The entire L1
and L2 ORFs of the resulting plasmid were sequenced to confirm mutagenesis of the
108-111 aa L2 region and that no other unexpected mutations were introduced. HPV16
L1-L2(GGDD) PsV containing GFP reporter plasmid were produced as described above
for wildtype HPV16 PsV. Confirmation and quantitation of reporter plasmid DNA
encapsidation was performed using quantitative real-time PCR following plasmid DNA
54
isolation from pseudovirion preparations by phenol chloroform extraction and ethanol
precipitation. L1 content was quantitated by Coomassie Blue staining next to BSA
standards following SDS-PAGE. The infectious titer of L2 mutant PsV were determined
on 293TT cells as described above for WT PsV. HPV16L1 VLP and HPV16L1L2 VLP
were produced using a recombinant baculovirus expression system in insect cells as
previously described [129]. Western blot analyses confirmed the presence of L1 and
either the presence or absence of L2, while a neutralizing antibody ELISA and
transmission electron microscopy confirmed the presence of intact particles. Coomassie
Blue staining following SDS-PAGE was performed to determine protein purity and
standardize the concentration of L1 content of the VLP preparations. VLP were
validated in internalization assays via pre-incubation with H16.V5 neutralizing antibody
prior to cellular exposure, and minimal internalized virus of less than 5% was observed.

HPV16 PsV infection assays
HaCaT cells seeded at 3 x 10
4
cells/well or HeLa cells seeded at 2 x 10
4

cells/well were incubated overnight in 24-well plates at 37° C. The cells were
subsequently incubated with wildtype HPV16 PsV containing a pCIneo-GFP vector at
an MOI 100 for HaCaT or MOI of 1 for HeLa. The MOIs were chosen for each cell type
that achieved 15-25% GFP-positive cells. Infectivity was scored 48 h post infection by
enumerating GFP+ cells by flow cytometry. Cells treated with PsV alone were set to
100% infection and all other treatments were normalized to this value unless otherwise
noted. For SLPI blocking experiments, the cells were incubated with increasing amounts
of rhu SLPI or BSA (Bio-Rad, Hercules, CA) in PBS for 1 h at 4° C prior to addition of
55
PsV. For antibody blocking experiments, cells were incubated with increasing amounts
of an anti- annexin A2 Ab or isotype control (mouse IgG1) for 1 h at 4° C prior to
addition of PsV. In each experiment, PsV were mixed with H16.V5 or H16.E70
neutralizing antibody (1/1000 dilution) as a positive control. Infection assays with HPV16
L1-L2(GGDD) mutant PsV containing pCIneoGFP reporter plasmid were carried out on
HaCaT cells using an equivalent amount of L1 content as wildtype PsV and an MOI of
100. Data are representative of three or four replicate wells from at least two
independent experiments.

Immunocytochemical staining and fluorescence microscopy
HaCaT and HeLa cells were seeded at 1 x 10
4
cells/well on 8 well permanox
chamber slides (Thermo Scientific) and incubated at 37° C overnight. Cells were
washed and blocked with PBST (0.1% tween 20) containing 5% goat and donkey serum
at room temperature (RT). Cells were then incubated with an S100A10 antibody,
washed extensively, fixed with 2% paraformaldehyde, and after additional washes were
incubated with fluorophore-conjugated secondary antibodies. Lastly, coverslips were
applied using Vecta Shield hard mounting media with DAPI (Vector Labs, Bermingham,
CA). For control staining, cells were either stained with a mouse or rabbit IgG isotype
control (Abcam) followed by fluorophore staining, or the fluorophore-conjugated
secondary antibody was used alone. In both cases there was minimal to no
fluorescence observed. Images were acquired using an Axio Imager upright confocal
microscope using the Axio Imager Bio II software (Zeiss).

56
Co-Immunoprecipitation
HeLa cells were grown in 175 cm
2
culture flasks to 80% confluency (approx. 20 x
10
6
cells), then incubated with 125 µg HPV16 PsV, HPV16 L1L2 VLP, or HPV16 L1
VLP in 10 mL PBS (approx. 1.9 x 10
5
particles/cell) for 1 hour at 37° C or left untreated.
The cells were washed, collected with a cell scraper and spun down at 800 g at 4° C.
The cells were then re-suspended with extracellular cross-linking agent DTSSP (3,3’-
dithiobis(sulfosuccinimidylproprionate)) (Thermo Scientific) at a concentration of 1.5 mM
in PBS for 2 hours at 4° C with rotation. Cells were then washed, and re-suspended in
an IP compatible lysis buffer (25 mM Tris-HCl pH 7.4, 150 mM NaCl, 1% NP-40, 1 mM
EDTA, 5% Glycerol). HPV16 VLP and PsV were precipitated out of solution with H16.V5
antibody conjugated to magnetic Protein-G Dynabeads (Life Technologies). The
precipitated proteins were eluted off Ab-bead complexes under denaturing conditions to
monomer form, and the co-immunoprecipitation of annexin A2, S100A10, and L1
protein were analyzed via Western blot. L1 protein was detected with a rabbit polyclonal
antibody to prevent cross reactivity with the mouse H16.V5 antibody used to
immunoprecipitate the capsids.

Western blotting
All samples were electrophoresed on NuPage Novex Bis-Tris gels (Life
Technologies), transferred to nitrocellulose membranes and blocked with StartingBlock
blocking buffer (Thermo Scientific). Membranes were probed then with anti- annexin A2,
S100A10, HPV16 L1 (Camvir-1), HPV16 L2 (DK44214) or GAPDH antibodies. Blots
were subsequently incubated with infrared-labeled secondary antibodies. Blots were
57
imaged and bands quantified using the Licor Odyssey Infrared imaging system. For
detection of extracellular A2t with EDTA treatment, HaCaT and HeLa cells were grown
to 80% confluency in 12-well plates in normal growth media. Cells were washed with
PBS followed by incubation with PBS supplemented with Ca
2+
or PBS with increasing
concentration of Ca
2+
chelating agent EDTA for 45 min to release calcium dependent
membrane bound proteins. The supernatants were collected and the presence of A2t
was analyzed via immunostaining against annexin A2 and S100A10. For shRNA
knockdown experiments, cellular extracts were prepared using Mammalian Protein
Extraction Reagent (Pierce) containing Halt Protease Inhibitor Cocktail (Thermo
Scientific). Samples were normalized prior to immunostaining via a Bradford protein
assay (BioRad) and GAPDH served as a loading control.

ELISA assays
For assays to determine accessibility of L2
108-120
epitope on capsid surface, 96-
well Microlon ELISA plates (USA Scientific, Ocala, FL) were incubated with 500 ng of
HPV16 L1 VLP, HPV16 L1L2 VLP or HPV16 PsV in 100 µL PBS overnight at 4°C. The
plate was washed with PBST (X% Tween-20) and blocked with 200 µL of PBS
containing 3% BSA for 2 h at RT. The plate was washed with PBST and incubated with
1:1000 16L2.4B4 (anti-L2
108-120
) or 1:5000 H16.V5 (anti-L1) in PBST with 1% BSA for 2
h at RT. The plate was washed and incubated with 1:5000 rabbit-anti-mouse HRP in
PBST with 1% BSA for 1 h at RT. The plate was washed, and 100 µL of the HRP
substrate (o-phenylenediamine) was added. The absorbance was measured at 490nm
with a Hidex Chameleon plate reader. In control experiments, no VLP or PsV were
58
added, and stained with primary, secondary, or both antibodies and minimal
absorbance was seen. For assays to determine in vitro binding capacity of HPV16
capsids to purified A2t protein, 500 ng of purified A2t was coated separately on ELISA
plates overnight at 4°C. Plates were washed and blocked with 10% casein blocking
buffer (Thermo Scientific) for 2 h at RT. Plates were washed, then incubated with 400
ng of WT HPV16 PsV, HPV16 L1-L2(GGDD) mutant PsV, no PsV, or rhu SLPI as a
positive control for A2t binding. Bound PsV were detected with conformational anti-L1
H16.V5 antibody, followed by anti-mouse IgG HRP antibody conjugate. Bound SLPI
was detected with goat anti-SLPI antibody, followed by anti-goat IgG HRP antibody
conjugate and addition of substrate.

Electron Paramagnetic Resonance
The L2
108-126
peptides used in our EPR studies were synthesized with a cysteine
at the N-terminus, and followed by a spacer of 3 physiological amino acids (C-IVS)
preceding the canonical L2
108-126
and L2 scrambled sequences (C-IVS-
LVEETSFIDAGAPTSVPSI and C-IVS-IESPVSDTALGTPEIFVSA respectively).
Peptides were combined with 8x molar excess paramagnetic label (1-oxyl-2, 2, 5, 5-
tetramethyl-Δ3-pyrroline-3-methyl) (R1) methanethiosulfonate (MTSL), (Toronto
Research Chemicals, Canada) and left to react overnight at 4°C. Free label was
removed by gel filtration (PD10 GE, United Kingdom). All peptides were solubilized into
HEPES buffer. For competition assays, the scrambled peptide was non-paramagnetic
labeled with an N-acetylated MTSL paramagnetic-label analog (1-acetyl-2,2,5,5-
tetramethyl-Δ3-pyrroline-3-methyl) (R1’) at an 8x molar excess to emulate the
59
paramagnetic label on control peptides. Binding interactions were examined by
combining paramagnetically-labeled L2 peptide with A2t, BSA, ANXA2, or S100A10
(20µM, 100µM, 100 µM, 100 µM, and 100µM respectively) in 10µL volumes of the
HEPES buffer, confined by glass capillaries, and measured at room temperature over a
period of 24 hours using a Bruker EMX X-band EPR spectrometer. For the cysteine
blocked S100A10, S100A10 was treated with R1’ and excess label was removed via gel
filtration (see above) before the addition of paramagnetic labeled peptides. The
experiments were done in triplicate with measurements taken at 12db, in 5 scan
intervals. All spectra were normalized to the same number of scans. To quantify the
amount of bound peptide spectra of all tested proteins in combination with the L2
108-126
or ScrL2 peptides were compared to the spectra of L2
108-126
or ScrL2 peptides alone in
solution using a spectra analyzing software (EPR 130, University of California, Los
Angeles). By subtracting the alone peptide spectra from that of the combined samples
we derive the spectra of the bound spectra, and based on double integration, relate this
spectra to a concentration of the peptide that bound to the target protein.

VLP Internalization Assays
HPV16L1 VLP and HPV16L1L2 VLP were labeled with CFDA-SE using Vybrant
CFDA-SE cell tracer kit (Life Technologies) as directed by the manufacturer’s
instructions. After labeling the HPV16 VLP were column filtered with 2% agarose beads
size standard 50-150 µm (Agarose Bead Technologies, Tampa, FL) to remove excess
free label. HeLa cells were seeded at a concentration of 2 x 10
5
cells/well in 12 well
plates and incubated at 37° C overnight. Next, CFDA-SE labeled HPV16L1L2 VLP or
60
HPV16L1 VLP were incubated with the cells at 37°C for 3 h at a concentration of 1
µg/10
6
cells (approx. 3 x 10
4
particles/cell). The cells were then analyzed via flow
cytometry, and the mean fluorescent intensity (MFI) of the CFDA-SE signals was
recorded. In control experiments, HeLa cells were incubated with virus neutralizing
antibodies H16.V5 or H16.E70 (1:1000) pre-treated CFDA-SE labeled VLP to ensure
VLP integrity and lack of residual free CFDA-SE label, and minimal CFDA-SE signals
were observed (<10%). Following 3 h incubation, the cells were washed with PBS and
harvested with trypsin-EDTA, washed, fixed with 2% paraformaldehyde and analyzed
by flow cytometry. For SLPI blocking experiments, cells were either left untreated or
incubated with increasing concentrations of rhu-SLPI in 0.5 mL PBS for 30 min at 4°C
prior to addition of CFDA-SE labeled VLPs. Data were normalized to untreated groups.

Quantitative RT-PCR
Total RNA was isolated from HeLa cell populations using an RNeasy Mini kit
(Qiagen) according to the manufacturer’s instructions. The iScript cDNA Synthesis Kit
(Bio-Rad) was used for reverse transcription of total isolated RNA to cDNA. An iQ
SYBR Green Supermix (Bio-Rad) was used for quantitative real-time PCR with the
following primer sequences: ANXA2, 5’-TCGGACACATCTGGTGACTTCC-3’ (sense),
5’-CCTCTTCACTCCAGCGTCATAG-3’ (antisense); S100A10, 5’-
AACAAAGGAGGACCTGAGAGTAC-3’ (sense), 5’-CTTTGCCATCTCTACACTGGTCC-
3’ (antisense); GAPDH, 5’-TGGGCTACACTGAGCACCAG-3’ (sense), 5’-
GAGGAGGTGGAAACTGCGAC-3’ (antisense). Samples were run on a CFX96 real-
time PCR system (Bio-Rad) operated by CFX Manager software (version 1.5). Melt
61
curve analysis for each primer pair was performed after cycling and data capture to
ensure primer specificity. Relative ANXA2 and S100A10 gene expression was analyzed
with CFX Manager software with normalization to the GAPDH reference gene (ΔΔCq).
For real-time PCR measurement of encapsidated GFP reporter DNA from PsV preps,
plasmid DNA containing the GFP reporter was purified from 50 µL of WT or mutant PsV
preps using phenol chloroform extraction and ethanol precipitation. Reporter plasmid
DNA was also isolated using the QIAamp MinElute Virus Spin Kit (Qiagen) with similar
results. Real-time PCR reactions were performed in triplicate using 5 µL of extracted
DNA template with iQ SYBR Green Supermix and 500 nM each of forward (5’-
AACTACAACGCCCACAATGTGT-3’) and reverse (5’-
CGGATCTTGAAGTTCACCTTGAT-3’) primers for GFP. Quantitation was performed
against a standard curve generated with purified pCIneoGFP plasmid template ranging
from 10
7
copies to 10
3
copies per reaction.

shRNA-mediated down regulation of A2t
HeLa cells were transduced at MOI 1 with doxycycline-inducible pTRIPZ
Lentiviral construct encoding a Human anti-ANXA2 shRNA (OpenBiosystems; mature
sense GCAAGTCCCTGTACTATTA/mature antisense TAATAGTACAGGGACTTGC) or
a non-silencing pTRIPZ Tet-On analog Lentiviral control following the manufacturer’s
protocol. Both pTRIPZ vectors express red fluorescent protein when induced, allowing
for visual confirmation of transduction. Stably transduced cells were selected by using
puromycin. Clones were expanded from a single transduced cell by limiting dilution and
either treated with doxycycline (1 µg/mL) for a minimum of one week to induce shRNA
62
expression and ANXA2 knockdown or left untreated to control for vector integration
effects.

Statistical Analysis
All statistical analyses were performed using GraphPad Prism (GraphPad
Software Inc., San Diego, CA).

63
CHAPTER 3. Annexin A2 heterotetramer small molecule inhibitors prevent human
papillomavirus type 16 infection
2

3.1 Introduction
High-risk human papillomavirus (hr-HPV) infection leads to the development of
several infection-related cancers including cervical, anogenital, and head and neck
cancers that are a significant health burden worldwide.[3,4,6,130] HPV type 16
(HPV16), the most common of the hr-HPV genotypes, is an obligatory intracellular non-
enveloped virus that must gain entry into host basal cells of the epithelium to deliver its
double-stranded DNA to the nucleus, and the HPV16 capsid proteins play a vital role in
these steps.[131] We have previously reported that the annexin A2/S100A10
heterotetramer (A2t) facilitates infectious entry of HPV16 into epithelial cells through a
direct protein-protein interaction (PPI) between the S100A10 subunit of A2t and the
HPV16 L2 minor capsid protein.[73] PPIs are increasingly being explored for small
molecule drug discovery, and the identification of A2t as an HPV16 receptor makes it a
promising target for inhibition. Annexin A2 (A2) is found cytoplasmically as a monomer,
or at the cell surface as a heterotetramer consisting of two A2 monomers bridged non-
covalently to an S100A10 dimer.[132] The dimeric S100A10 structure yields two binding
pockets that accommodate the N-terminus of A2,[133] and it is this interaction that
preliminary drug discovery studies have targeted.[134] Recently, inhibitors of A2t (A2ti)

2
This work is currently under review by The Journal of Antimicrobial Chemotherapy, Oxford University
Press (OUP). This article is provided here with permission as part of the OUP pre-print policy.
64
that specifically disrupt the PPI between A2
and S100A10 have been identified,[135]
but have not been explored in the context
of HPV infection. Here, we investigated the
ability of A2ti to inhibit HPV16 entry and
infection of epithelial cells in vitro.

3.2 Results
In the current study we examined the ability of two A2t inhibitors to block HPV16
entry and infection in vitro. The first of these inhibitors (A2ti-1) has a reported half
maximal inhibitory concentration (IC
50
) of 24µM,[135] and it was hypothesized that A2ti-
1 would block HPV16 PsV infection within a reasonable range of this value. The second
of the tested inhibitors (A2ti-2) is similar in chemical structure, but the deletion of an
ethyl group results in an increased IC
50
of 230µM (Figure 3.1A), and was therefore
predicted to be less effective in blocking HPV16 infection while having similar, if any,
off-target effects. A2ti-1, A2ti-2, and DMSO matched to the concentration of A2ti
delivery were found to be non-toxic at maximum concentrations tested (Figure 3.1B).
Next, we sought to determine the effect of A2ti on HPV16 PsV infection. We found that
the higher-affinity A2ti-1 reduced HPV16 PsV infection in a dose-dependent manner
with 100% inhibition of infection observed at 100µM (Figure 3.2A). As predicted, lower-
affinity A2ti-2 was less effective with less than 50% reduction in HPV16 PsV infection
Figure 3.1. A2ti do not affect cell growth and
are non-toxic to HeLa cells. (A) Chemical
structures and IC
50
values of A2ti-1 and A2ti-2.
HeLa cells were left untreated or treated with
A2ti-1, A2ti-2 or DMSO. (B) After 72 h, viability
was measured via trypan blue exclusion. The
mean+SD percentage viability is presented
(n=6). The graph is representative of three
independent experiments.
65

achieved at 100µM while DMSO vehicle had no effect. To determine if the reduction in
infection was due to a decrease in capsid entry, we next evaluated the ability of A2ti to
block internalization of HPV16 into cells using PsV labeled with a pH-dependent dye
Figure 3.2. A2ti block HPV16 infection and entry into HeLa cells. (A) HeLa cells were
treated with increasing concentrations of A2ti-1, A2ti-2 or DMSO control. The
following day cells were infected with GFP-plasmid-containing HPV16 PsV. GFP-
positive cells were measured after 48 h by flow cytometry. The mean+SD percentage
of infected cells normalized to the PsV-only group is presented. (B) HeLa cells were
incubated with increasing concentrations of A2ti-1, A2ti-2 or DMSO control. The next
day, pHrodo-labelled HPV16 PsV were added to the cells for 6 h and the MFI of cells
was analysed by flow cytometry. The mean+SD fold change in MFI normalized to the
untreated group is presented (n1⁄44). Each graph is representative of three
independent experiments (*P,0.05, **P,0.01 and ***P,0.001 as determined by a two-
tailed, unpaired t-test compared with PsV only).
66
that fluoresces only in acidified late endosomes indicating HPV16 endocytosis. A2ti-1
significantly decreased HPV16 entry in a dose-dependent manner with a 65% reduction
at 100µM, whereas only a 20% reduction was observed with A2ti-2, and no effect on
HPV16 internalization was observed with DMSO alone, indicating that the observed
block in HPV16 infection with A2ti is due in part to a block in entry (Figure 3.2B).
Additionally, this indicates that non-infectious entry occurs in the absence of A2t, which
suggests that A2t is also required for downstream steps in HPV16 infection beyond
virus entry.

3.3 Discussion
Our group previously identified A2t as an HPV16 uptake receptor using a
combination of cellular, molecular and biochemical techniques including shRNA
knockdown, antibody (Ab) neutralization, and electron paramagnetic resonance
(EPR).[73] Specifically, we demonstrated that the S100A10 subunit of A2t binds to
amino acids 108-126 of HPV16 L2; A2t co-immunoprecipitates with HPV16 at the cell
surface; A2t mediates HPV16 entry and infection in an L2-dependent manner; and that
a previously identified natural A2t ligand, secretory leukocyte protease inhibitor
(SLPI),[94] reduced HPV16 PsV infection of epithelial cells.[73] Dziduszko and Ozbun
independently confirmed the role of A2t in HPV16 entry and infection by showing that
early HPV16 binding results in the translocation of A2t to the extra-cellular surface; A2t
co-internalizes with HPV16 and mediates intracellular trafficking; and anti-A2 and anti-
S100A10 Abs block HPV16 PsV infection at different stages of HPV16 infection both
pre- and post-entry.[136] In the current study, we show a significant decrease in HPV16
67
PsV internalization and a complete reduction in HPV16 PsV infection in epithelial cells
treated with a high-affinity A2ti (A2ti-1). Taken together, these results highlight the
importance of A2t in HPV16 infection, and demonstrate the potential for targeting A2t to
block HPV16 infection. Additionally, A2t has been implicated in infection by other
viruses including CMV, RSV, Enterovirus-71 and HIV infection of
macrophages.[94,106,108,109] Consequently, A2t inhibition has broad appeal as an
anti-viral strategy.

3.4 Materials and Methods
Cells, reagents, and HPV16 pseudovirions
HeLa cells (ATCC, Manassas, VA) were maintained in complete media (IMDM,
10% FBS, 1X PenStrep) (Lonza, Walkersville, MD) at 37°C with 5% CO
2
. A2t inhibitors
(A2ti-1: 2-[4-(2-Ethylphenyl)-5-o-tolyloxymethyl-4H-[1,2,4]triazol-3-ylsulfanyl]acetamide
and A2ti-2: 2-(4-Phenyl-5-o-tolyloxymethyl-4H-[1,2,4]triazol-3-ylsulfanyl)acetamide)
were purchased from Asinex (Moscow, Russia) and reconstituted in DMSO. HPV16
pseudovirions (PsV) were produced by co-transfection of 293TT cells with plasmids
encoding codon-optimized HPV16 L1 and L2 following published procedures.[128]

Toxicity assay
HeLa cells were incubated at 37°C, 5% CO
2
with increasing concentrations of
A2ti-1 or A2ti-2 for 72hrs. Cell viability was then measured by trypan blue exclusion. In
control experiments, cells were left untreated, or treated with DMSO at matched
concentrations to A2ti delivery.
68

HPV16 PsV Infection Assay with A2ti
HeLa cells seeded at 2x10
4
cells/well were incubated overnight in 24-well plates
at 37°C with increasing concentrations of A2ti-1 or A2ti-2. The following day cells were
incubated with HPV16 PsV containing a GFP reporter plasmid using an MOI of 50.
Using flow cytometry, infection was measured 48hrs post HPV16 PsV treatment as the
percent of GFP-positive cells. In control experiments, cells were left untreated, or
treated with DMSO.

HPV16 PsV Internalization Assay with A2ti
HPV16 PsV were labeled with a pH-dependent rhodamine fluorophore (pHrodo,
Life Technologies, Carlsbad, CA). HeLa cells seeded at 2x10
5
cells/well were incubated
overnight with increasing concentrations of A2ti-1 or A2ti-2. The next day, pHrodo
labeled HPV16 PsV were added at 1 µg/10
6
cells and incubated at 37°C for 6hrs. The
mean fluorescent intensity (MFI) of the cells was analyzed by flow cytometry. In control
experiments, cells were left untreated, or treated with DMSO.

69
CHAPTER 4. Inhibition of langerhans cell maturation by human papillomavirus
type 16: a novel role for the annexin A2 heterotetramer in immune suppression
3

4.1 Introduction
Cervical cancer is the second most common cancer among women worldwide
with >500,000 new cases reported and >274,000 associated deaths each year [3,4].
Persistent high-risk human papillomavirus (HPV) infection is causally associated with
several cancers, including cervical cancer [1,137,138]. Over half of all cervical cancer
cases are associated with HPV16, the most common of the cancer-causing high-risk
genotypes [5]. During the natural life cycle of HPV16, the virus infects the basal cells of
the epithelium and interacts with Langerhans cells (LC), the resident antigen presenting
cells (APC) within the epithelia [10], which are responsible for initiating immune
responses against pathogens entering the epithelium [11]. However, 15% of women
with high-risk HPV infections do not produce an effective immune response against the
virus [10], and therefore represent a critical population of women particularly susceptible
for developing invasive cervical cancer. In contrast to the extensive body of research
defining the mechanism of infection within epithelial cells, limited studies actually focus
on identifying and characterizing the HPV16 internalization pathway in LC and how
these pathways affect LC immune responses.

3
This work was originally published in The Journal of Immunology (Vol. 192(10), pp.4748-4758, 2014)
and is provided here with permission from The American Association of Immunologists, Inc (AAI) as part
of the AAI copyright transfer agreement for use by the author in a dissertation.
70
HPV16 is a non-enveloped double stranded DNA virus whose 55 nm-diameter
capsid is composed of two proteins: the L1 (late protein 1) major capsid protein and the
L2 (late protein 2) minor capsid protein [16], each of which has unique functions during
the infectious process. Infectious HPV16 virion production depends on the
differentiation of basal epithelial cells into mature keratinocytes as the expression of late
genes is contingent on host RNA factors [15]. Therefore the majority of the literature
concerning receptors uses HPV pseudovirions (PsV) and/or virus-like particles (VLP) to
report specific aspects of viral uptake. When expressed in vitro, the major capsid protein
L1 self-assembles into L1 VLP, which possesses a 72-pentamer-icosahedral structure
[34,139,140]. If L1 is expressed at the same time as the minor capsid protein L2, they
assemble into L1L2 VLP with up to 72 L2 proteins per particle [17,34]. The L2 minor
capsid protein plays an important role in efficient encapsidation of DNA within HPV16
[23,24], allowing for the production of HPV16 L1L2 PsV that incorporate DNA within the
capsid.
In epithelial cells, HPV16 infection is initiated upon viral capsid binding through
an initial interaction between L1 and heparan sulfate proteoglycans (HSPG) [40], as well
as other interactions with α
6
β
1/4
integrins, cyclophilin B, growth factors and growth factor
receptors (GF and GFR), and various tetraspanins [7,62,68,81]. The eventual uptake of
HPV16 into epithelial cells has been shown to be clathrin-, caveolin-, cholesterol-, and
dynamin-independent, which points to a non-canonical and possibly novel ligand-
induced internalization pathway related to macropinocytosis [53]. Similarly, it was
previously demonstrated that HPV16 entry into LC occurred via a clathrin- and caveolin-
71
independent pathway [54] implicating a related HPV16 entry pathway into both epithelial
and Langerhans cells.
Many functions aside from DNA encapsidation have been identified for L2 in the
context of HPV16 infection of epithelial cells [reviewed in [141]] including endosomal
escape [27,29,142,143], cytoskeletal interaction and cytoplasmic trafficking [30], and
chaperoning of packaged DNA to the host cell nucleus [32]. Historically, the role of L2 in
HPV16 internalization into epithelial cells was implicated by studies demonstrating the
existence of L2-neutralizing epitopes [19,84,85,86,87,144]. Additionally an L2 peptide
(L2
108-126
) was shown to bind to the cell surface and blocked HPV16 pseudo-infection of
multiple cell lines [74]. We recently identified and characterized the role/mechanism of
the annexin A2 heterotetramer (A2t) as an HPV16 L2-specific entry receptor [73]. We
demonstrated that A2t specifically binds to L2
108-126
, co-localizes with HPV16 at the cell
surface, and mediates HPV16 VLP entry and HPV16 pseudo-infection in an L2-
dependent manner [73]. The role of A2t in HPV16 entry was confirmed by an
independent group, and A2t was further shown to co-internalize with HPV16 and
mediate intracellular trafficking [136].
Interestingly, the presence of L2 in the viral capsid has been shown to double the
rate of HPV16 entry into LC, and is responsible for HPV16-induced suppression of LC
immune function [78]. To date, no specific L2 receptor on LC has been identified. Thus
far, it has been demonstrated that LC internalize HPV16L1L2 VLP via a clathrin- and
caveolae-independent mechanism [54], whereas LC internalize HPV6bL1 VLP through
a caveolae dependent pathway [79] and HPV16L1 VLP through a clathrin dependent
pathway [80]. While these results may seem contradictory, it is likely due to the
72
presence or absence of the L2 minor capsid protein within the VLP used for these
studies. Collectively, these studies suggest that a specific L2 receptor and receptor-
specific mechanism exist for HPV16 uptake into LC. [54,78], and our previous report
points to A2t as a potential candidate as it is the only identified L2-specific receptor [73].
A2t is found at the cell surface as a heterotetramer consisting of two annexin A2
(anxA2) monomers and an S100A10 dimer [95,96,99,105], which are co-expressed by
LC [145]. Understanding HPV16-LC interactions and identifying HPV16 receptors on LC
involved in internalization are critical to delineating the local immune events in the
mucosa during an active HPV16 infection. Therefore, due to the previous identification
of A2t as an L2-specific receptor on epithelial cells and the role of L2 in HPV16
internalization and immune escape in LC, we hypothesized that internalization of
HPV16 into LC is mediated through A2t in an L2-dependent manner and that entry via
A2t suppresses LC maturation. To explore this possibility, we examined the interactions
between A2t and HPV16 in LC and the role of A2t in LC maturation. In the current
study, we expanded the role for A2t as an HPV16 L2-specific receptor in epithelial cells
to include LC, and additionally reveal a novel role for A2t as an immune modulator of LC
maturation.

4.2 Results
The HPV16 L2
108-126
peptide reduces binding of HPV16 L1L2 VLP to LC
We recently reported that the N-terminal L2
108-126
peptide binds to the S100A10
subunit of A2t and is exposed on the capsid surface of HPV16 VLP and PsV, and
through a competition assay showed that a scrambled version of the same peptide had
73
no effect on L2
108-126
binding to A2t in
ten-fold excess [73]. Interestingly, it
was demonstrated that this A2t-binding
peptide bound to A2t-expressing
cervical epithelial cell lines (HeLa,
SiHa, and CaSki) as much as four
times more than A2t-negative cell lines
(Alexander and Hep G2 cells), however
no immune cells were tested [74]. To
determine whether this same A2t-
binding L2 peptide facilitates
attachment to LC, we incubated LC
with either L2
108-126
, a scrambled
version of the same peptide, or no
peptide, and subsequently exposed
the cells to HPV16L1L2 VLP. We
then assessed the amount of bound
HPV16 L1L2 VLP on the surface of
LC with flow cytometry. When LC
were pre-incubated with the L2
108-126

peptide (50 µg/mL), there was a
significant decrease (approx. 50%
with p<0.05) in the amount of
Figure 4.1 The HPV16 L2108–126 peptide
reduces binding of HPV16 L1L2 VLP and
binds to A2t on LC. (A) LC were left untreated
or were treated with the L2108–126 or
scrambled peptide and subsequently incu-
bated with HPV16 L1L2 VLP. After washing,
HPV16 L1L2 VLP remaining on the surface of
LC were detected using an L1-specific con-
formational Ab (H16.V5). Binding was
assessed by flow cytometry. These data are
expressed as the means of three separate
experiments 6 SEM (*p , 0.05 as determined
by a two-tailed, unpaired t test, as compared
with untreated LC). (B) LC were incubated with
either no peptide or (63)His-L2108–126
peptide and subsequently cross-linked with
DTSSP. Cells were then lysed and mixed with
a Ni-NTA agarose slurry overnight and eluted.
Eluates were then electrophoresed,
transferred to nitrocellu- lose, and probed with
either an anti-anxA2 or an anti-S100A10 Ab.
One representative experiment of three is
shown.
74
HPV16 L1L2 VLP bound to the LC surface compared to the scrambled peptide or
untreated control (Figure 4.1A), suggesting that the N-terminus of L2 facilitates HPV16
binding to LC, similar to epithelial cells. Titration experiments determined that the IC
50

value of the peptide is 20µg/mL (data not shown).

HPV16 L2
108-126
binds to LC cell surface A2t
Next, we wanted to determine if there was a direct interaction between the L2
108-
126
peptide and A2t on the LC cell surface to evaluate its potential as an L2-specific
HPV16 internalization receptor on LC. Therefore, LC were either incubated with a
(6x)His-L2
108-126
peptide or left untreated, and subsequently exposed to the extracellular
cross-linking agent DTSSP. After cross-linking L2
108-126
to cell surface proteins, LC were
lysed and the lysates were incubated in a Ni-NTA affinity column followed by elution
with the Ni-binding competitor imidazole. Eluates were subsequently separated by gel
electrophoresis for immuno-blot analysis. We found that both A2t subunits, anxA2 and
S100A10, were present in the L2
108-126
peptide pulldown eluate and not in the untreated
control (Figure 4.1B) demonstrating that A2t interacts with the L2
108-126
peptide on the
surface of LC. A reduced silver stain gel showed the annexin A2 subunit of A2t as a
unique band (confirmed with mass spectrometry) in the L2
108-126
peptide treated
pulldown eluate compared to the untreated control (data not shown)

SLPI reduces the uptake of HPV16L1L2 VLP by LC
We next sought to assess whether A2t plays a role in the internalization of
HPV16 VLP into LC. SLPI is an anxA2 ligand that has been shown to inhibit HPV16
75
PsV infection of epithelial cells, which
mimicked the effects of an anti-anxA2
antibody [73]. Moreover, SLPI has
been shown to block HIV-1 infection
through its interaction with anxA2 [94],
and HIV-1 is another virus that
specifically targets LC during initial
infection [146,147]. Therefore, LC were
pretreated with SLPI prior to exposure
to CFDA-SE-labeled HPV16 L1L2 VLP
and internalization was analyzed via
flow cytometry. Fluorescence of CFDA-
SE occurs when acetate groups are
cleaved by intracellular esterases, and
consequently only VLP that have been
internalized by cells are detected [148].
LC exposed to SLPI showed a
significant decrease in the
internalization of HPV16 L1L2 VLP
(Figure 4.2). To examine if the decrease in uptake was dependent on the presence of
the L2 protein, LC were pretreated with SLPI and similarly exposed to CFDA-SE-labeled
HPV16 L1 VLP. Notably, no reduction in HPV16 L1 VLP internalization by LC treated
Figure 4.2. SLPI reduces the uptake of
HPV16 L1L2 VLP by LC. (A) LC were left
untreated (gray line) or treated with SLPI
(30 mg/ml), then incubated with CFSE-
labeled HPV16 L1 or HPV16 L1L2 VLP
(black lines) for 15 min and internalization
was assessed via flow cytometry. (B) LC
were incubated with SLPI (30 mg/ml), then
incubated with CFSE-la- beled HPV16 L1,
HPV16 L1L2, or H16.V5 neutralized HPV16
L1 or HPV16 L1L2 VLP for 15 min. Uptake
of CFSE-labeled VLP by LC was assessed
by flow cytometry and normalized to
untreated LC. The mean percentage of
uptake 6 SEM of three separate
experiments is presented (*p , 0.05 by a
two-tailed, unpaired t test, as compared
with the untreated LC).
76
with SLPI was observed (Figure 4.2), indicating that SLPI inhibition of VLP uptake is L2
dependent. Similar to what we have previously observed on epithelial cells, L1 VLP
enter LC at a significantly slower rate than L1L2 VLP (Figure 4.2A) [73,78]. Notably,
similar internalization rates were
observed between baseline L1 VLP
internalization and SLPI-blocked L1L2
VLP internalization, suggesting that
when A2t is blocked, the L1L2 VLP may
default to a pathway utilized by L1 VLP.
To evaluate the effect of overall SLPI
on internalization of either L1 or L1L2
VLP, the fluorescence of the SLPI-
treated groups were normalized to the
untreated groups independently for L1
and L1L2 VLP (Figure 4.2B).

Figure 4.3. Downregulation of anxA2 reduces uptake of HPV16 L1L2 VLP. (A) LC
were transfected without siRNA (untreated) or with control siRNA or an anti-anxA2
siRNA SMARTpool. The cells were incubated for 5 d before analysis of anxA2 protein
expression by Western blot. b-actin served as the loading control. One representative
experiment of four is shown. (B) LC were transfected without siRNA (untreated), with
non-target siRNA, or with an anti-anxA2 siRNA SMARTpool. The cells were
incubated for 5 d and exposed to CFSE-labeled HPV16 L1L2 VLP or HPV16 L2
mutant VLP for 45 min. Uptake was assessed by flow cytometry normalized to
untreated LC. These data are representative examples of three experiments
performed in triplicate shown as the mean 6 SD (**p , 0.01 as determined by a two-
tailed, unpaired t test, as compared with untreated LC).
77
To confirm that the CFDA-SE signals observed were not due to free CFDA-SE label,
and to verify VLP integrity, HPV16 L1 and HPV16 L1L2 VLP were pre-incubated with
H16.V5 (an anti-L1 Ab) for neutralization. Under these conditions, no significant
internalization was observed (Figure 4.2B).

siRNA-mediated knockdown of anxA2 in LC reduces HPV16 L1L2 VLP internalization
To further establish the role of A2t in HPV16 uptake into LC, we examined the
effect of A2t siRNA knockdown in LC on HPV16 internalization. S100A10 is post-
transcriptionally stabilized by annexin A2 (anxA2) and therefore it is sufficient to only
target annexin A2 for knockdown of A2t [73]. There was a significant reduction in anxA2
protein in LC treated with anxA2 siRNA compared to both mock-transfected untreated
and control siRNA-treated LC (Figure 4.3A). To specifically determine the effect of
anxA2 knockdown on HPV16 L2-mediated uptake in LC, untreated and siRNA-
transfected LC were exposed to CFDA-SE labeled-HPV16 L1L2 VLP or HPV16 VLP
with a mutation in the A2t-binding region of L2 [a previously described substitution of
GGDD for LVEE of L2 108-111 [74]] (Figure 4.3B). This mutation in L2 significantly
reduces HPV16 VLP binding to A2t and HPV16 PsV infectivity of epithelial cells [73].
Knockdown of anxA2 resulted in a significant reduction in the uptake of HPV16 L1L2
VLP into LC compared to the untreated control. Importantly, no decrease in HPV16 L2
mutant VLP uptake was detected, demonstrating N-terminal L2 specificity for uptake
through A2t. LC treated with non-target control siRNA showed no reduction in the
expression of anxA2 protein (Figure 4.3A), resulting in no change in HPV16 L1L2 or
HPV16 L2 mutant VLP internalization (Figure 4.3B). Similar to the experiments
78
described above for SLPI-blocking, L2 mutant VLP enter slower than L1L2 VLP,
therefore uptake was normalized to untreated controls independently. Collectively, the
results from Figures 4.1-4.3 strongly indicate that A2t interacts with the L2 protein and
is involved in the binding and internalization of HPV16 by LC.

Specific mutations in HPV16 L2
108-111
increase HPV16 immunogenicity in LC
We have shown that LC exposed to HPV16 L1L2 VLP are not activated,
implicating an HPV immune escape mechanism targeting LC [76,77], and we further
established that L2 is responsible for the suppression of LC immune function when LC
are exposed to HPV16 VLP [78]. Therefore, we next sought to determine the role of the
A2t-binding region of L2 (L2
108-126
) in LC immune responses. To determine the effects of
Figure 4.4. Expression of MHC II on LC treated with wild-type (WT) HPV16 or L2
mutant HPV16 PsV. (A) LC were either left untreated (gray lines) or treated with LPS,
HPV16 WT PsV, or HPV16 L2 mutant PsV (black lines). After 48 h, the cell surface
expression of MHC II was and analyzed by flow cytometry. The HPV16 L2 mutant
PsV and LPS caused phenotypic activation of LC compared with untreated cells
whereas there was a slight decrease in MHC II expression in WT HPV16 PsV-treated
LC. Isotype controls are shown as gray dotted lines. (B) The mean fluorescent
intensity (MFI) of MHC II- FITC–stained cells was 624 for WT PsV and 837 for
HPV16 L2 mutant PsV with p = 0.04 as determined by a two-tailed, unpaired t test,
for the means of three independent experiments. (C) LC were either left untreated or
treated with LPS, HPV16 WT PsV, or HPV16 L2 mutant PsV. After 48 h, the cell
surface expression of CD86 was and analyzed by flow cytometry. The HPV16 L2
mutant PsV caused a significantly greater expression of CD86 compared with WT
HPV16 VLP (p , 0.05 as determined by a two-tailed, unpaired t test, for the means of
three independent experiments).
79
L2
108-126
on the level of phenotypic activation of LC, the expression of cell surface MHC
II and CD86 on LC after exposure to either wild type HPV16 PsV or HPV16 L2 mutant
PsV was assessed. The MHC II profile of LC exposed to HPV16 L2 mutant PsV more
closely resembled that of activated LC treated with LPS (Figure 4.4A middle and right),
whereas the MHC II profile of LC exposed to wild type HPV16 PsV closely mirrored that
of untreated LC (Figure 4.4A left). Furthermore, there was a statistically significant
increase in MHC II and CD86 expression of LC treated with HPV16 L2 mutant PsV
compared to wild type HPV16 PsV (Figure 4.4B-C). These results show that altering
the capsid's interaction with A2t through mutation of the A2t binding region of L2 results
in the phenotypic maturation of LC. While the L2 mutated PsV did not activate as
strongly as LPS, the statistically significant increase in immunogenicity highlights the
importance of L2 in LC immune responses, and specifically, the A2t-interacting region of
L2. Though indirect, these results indicate that there is a role for A2t in HPV16-induced
suppression of LC immune function.

Exogenous A2t induces suppression of LC immune function
While the results above suggest a role for A2t in suppression of LC maturation by
HPV16, we next sought to characterize the precise contribution of A2t in LC activation in
the absence of HPV16. Exogenous A2t was found to activate murine macrophages
[149]; and HPV16 was also shown to cause increased translocation and accumulation
of A2t to the outer leaflet, which we hypothesized can be mimicked without HPV16
through the addition of excess exogenous A2t. Therefore we studied the effect of
externally provided purified A2t on LC activation. To test this, LC were left untreated or
80
treated with purified A2t or its individual subunits anxA2 and S100A10 to determine if
the subunits or the heterotetramer form are associated with LC immune responses. The
expression of cell surface MHC II and CD86 on LC after treatment with purified proteins
was then assessed via flow cytometry. There was a significant reduction in the surface
expression of MHC II on LC treated with A2t compared to untreated, anxA2 treated, or
S100A10 treated LC (Figure 4.5A). Since CD86 expression on immature LC is low, we
were not able to detect any decrease in protein expression below baseline levels (data
not shown). However, MHC II is normally expressed by immature LC and indeed a
decrease in extracellular MHC II was observed in A2t treated LC. These results indicate
a suppressive role for A2t in LC immune responses, and that the tetramer form of the
receptor is required to induce a suppressed LC phenotype. Furthermore, we analyzed
cytokine and chemokine secretion by LC that were exposed to purified A2t, and found
Figure 4.5. Exogenous A2t suppresses LC immune function. (A) LC exposed to A2t
show reduced surface expression of MHC II compared with untreated LC and LC
exposed to anxA2 or S100A10. LC were left un- treated (Unt.) or incubated with LPS,
A2t, anxA2, or S100A10 and subsequently analyzed via flow cytometry for the
change in expression of MHC II. The mean of three experiments 6 SD is presented
(*p , 0.05 as determined by a two-tailed, unpaired t test, as com- pared with untreated
LC). (B) A2t induces an immune suppressive signal transduction cascade in LC. LC
were left untreated (Unt.) or incubated with LPS or A2t for 15 min. Cellular lysates
were isolated and subjected to immunoblot analysis demonstrating a reduction in
pAKT in the A2t-treated cells. One representative ex- ample of three is shown.
81
that LC exposed to A2t showed a significant and pronounced decrease in the release of
many pro-inflammatory cytokines and chemokines (Table 4.1) indicative of a Th1 cell-
mediated immune response [78]. Specifically, there was a statistically significant
decrease in the secretion of MCP-1, MIP-1α, IP10, and RANTES. There was no
significant change observed in the secretion of MIP-1β or TNF-α, and the secreted
levels of IL-6 and IL-12 were below measurable levels for untreated and A2t treated LC.
While there was a statistically significant increase in the secretion of IL-8 in A2t treated
LC compared to untreated LC, the levels were much lower than LC treated with LPS.

A2t induces an immune suppressive signal cascade in LC
We have previously reported that HPV16 L2 induces an immune suppressive
signal transduction cascade within LC that is hallmarked by a reduction in p-Akt in LC
Table 4.1 LC exposed to A2t show reduced secretion of Th1-associated cytokines
compared with controls. LC were left untreated or incubated with LPS or A2t.
Supernatants were collected at 48 h and analyzed in triplicate for the presence of
cytokines and chemokines. Data are representative of an experiment performed
three times and expressed as the mean concentration 6 SD. **p , 0.01, ***p , 0.001
as determined by a two-tailed, unpaired t test, as compared with untreated LC.

82
treated with HPV16 L2-containing VLP [78]. To determine if A2t is associated with this
suppressive signal transduction cascade, LC were treated with purified A2t prior to
analysis of Akt and p-Akt levels via an immuno-blot assay. Cellular levels of p-Akt were
reduced to 64% with p=0.008 (95% CI, 51-77%) in LC exposed to A2t compared to
untreated (95% CI, 78-122%) and LPS-treated (95% CI, 94-136%) controls
(representative example shown in Figure 4.5B). These results indicate that exogenous
A2t causes the same suppressive signaling events that are associated with HPV16 L2,
further implicating a role for A2t in the suppression of LC immune function.

Small molecule inhibition of A2t prevents HPV16-induced immune suppression of LC.
Recently, small molecule inhibitors of A2t (A2ti) have been identified that can
disrupt the A2t tetramer by blocking the binding between anxA2 and S100A10 [135]. As
shown above, the role for A2t in the suppression of LC immune function is dependent
on the tetramer form, and not on the individual subunits. In this manner, A2ti has the
potential to disrupt the immune-suppressive properties of A2t in LC without affecting
other cellular roles for either anxA2 or S100A10. Hence the effect of A2ti on LC
activation with and without the addition of HPV16 L1L2 PsV was examined. Increasing
concentrations of A2ti led to an increase in the surface expression of MHC II and the
activation-associated surface marker CD86 on LC (Figure 4.6A). At all concentrations
of A2ti tested, there was not a significant increase in MHC II expression compared to LC
treated with HPV16 alone, but there was a significant increase in MHC II expression on
LC treated with 25 µM and 50 µM of A2ti with the addition of HPV16. Additionally, at 10
µM and 25 µM of A2ti, which are well below and near the reported IC
50
value of 24 µM
83

respectively, there was not a statistically significant increase in CD86 in the A2ti-treated
groups compared to those treated with HPV16 alone. However, when HPV16 PsV were
added to these groups (i.e. LC pre-treated with 10 µM or 25 µM A2ti), there was a
significant increase in the surface expression of CD86 showing that the L2-containing
PsV were no longer able to suppress the maturation of LC. At 50 µM of A2ti, LC were
phenotypically activated as indicated by a significant increase in CD86 without HPV16
Figure 4.6. Inhibition of A2t prevents HPV16-induced immune suppression of LC.
(A) Inhibition of A2t increases immunogenicity of HPV16 PsV. LC were left untreated
(Unt.) or treated with LPS, HPV16 PsV, or with increasing concentrations of A2ti
alone or A2ti prior to exposure to HPV16 PsV and subsequently analyzed via flow
cytometry for the change in expression of MHC II and CD86. (B) LC exposed to A2ti
and HPV16 PsV show increased secretion of Th1-associated chemokines compared
with LC treated with HPV16 PsV alone. LC were left untreated (Unt.) or treated with
LPS, HPV16 PsV, A2ti (25 mM), or A2ti plus HPV16 PsV. Supernatants were
collected at 48 h and analyzed in triplicate for the presence of cytokines and
chemokines. Data are representative of an experiment performed three times and
expressed as the mean concentration 6 SD (**p , 0.01, ***p , 0.001 as determined by
a two-tailed, unpaired t test, as compared with HPV16 PsV only–treated LC).
84
PsV, but were even further activated in the presence of HPV16 PsV, indicating a
significant increase in the LC activating potential of HPV16 when A2t is disrupted.
In addition to cellular phenotype, the secretion of inflammatory cytokines and
chemokines by LC pre-treated with A2ti was examined with and without the addition of
HPV16 PsV. It was found that LC treated with 25 µM A2ti prior to exposure to HPV16
PsV showed a significant increase in the secretion of IL-8, MIP-1α, MIP-1β, and
RANTES compared to both HPV16 only and A2ti only treated LC. There was a subtle
yet non-significant increase observed in the secretion of TNF- α in LC treated with A2ti
prior to exposure to HPV16 PsV compared to HPV16 only and A2ti only treated LC, and
no change seen in the secretion of IL-10. The secreted levels of IL-6 and IL-12 were
found to be below measurable levels while MCP-1 levels were at saturated levels for all
treatment groups. Taken together, these data demonstrate that targeted small-molecule
disruption of A2t reverses HPV16-induced LC-targeted immune suppression, and
strongly suggest that HPV16 entry via A2t leads to the suppression of LC maturation.

4.3 Discussion
The HPV16 life cycle is strictly intraepithelial, and as a result HPV16 antigens
should be processed and presented by LC, the professional APC that reside in the
parabasal and lower suprabasal layers of squamous epithelium [150]. Various studies
have found that HPV L1 VLP and HPV L1L2 VLP can bind to and stimulate activation of
human dendritic cells (DC) [77,151,152,153,154], providing evidence that the capsids of
HPV can induce the maturation of APC. However, HPV16 has evolved over time using
a mechanism in which internalization of capsids of HPV16 into LC results in suppressive
Figure 4.6. Inhibition of A2t prevents HPV16-induced immune suppression of LC.
(A) Inhibition of A2t increases immunogenicity of HPV16 PsV. LC were left untreated
(Unt.) or treated with LPS, HPV16 PsV, or with increasing concentrations of A2ti
alone or A2ti prior to exposure to HPV16 PsV and subsequently analyzed via flow
cytometry for the change in expression of MHC II and CD86. (B) LC exposed to A2ti
and HPV16 PsV show increased secretion of Th1-associated chemokines compared
with LC treated with HPV16 PsV alone. LC were left untreated (Unt.) or treated with
LPS, HPV16 PsV, A2ti (25 mM), or A2ti plus HPV16 PsV. Supernatants were
collected at 48 h and analyzed in triplicate for the presence of cytokines and
chemokines. Data are representative of an experiment performed three times and
expressed as the mean concentration 6 SD (**p , 0.01, ***p , 0.001 as determined by
a two-tailed, unpaired t test, as compared with HPV16 PsV only–treated LC).
85
signaling and defective activation [76,77]. In this sense, LC that are normally targeted
by HPV16 during a natural infection, may be uniquely manipulated by HPV compared to
other immune cells or DC subsets through A2t, though future research is needed to
determine if A2t plays a role in immune responses of other DC types.
We have shown that internalization of HPV16 by human LC indicated the
presence of a specific L2 receptor and internalization mechanism that results in the
suppression of LC maturation [78]. The highly evolutionarily conserved HPV16 L2
108-126

epitope has been shown to be vital in the binding and infectivity of HPV16 in different
cell types [74], and it binds specifically to the recently identified HPV16 uptake receptor
A2t on epithelial cells [73]. In the current study, we demonstrate that this conserved A2t
binding region of L2 is associated with HPV16 binding to LC, and interacts with A2t on
the LC surface. We further show that mutations in this region increase HPV16
immunogenicity, highlighting the importance of this region in the suppression of LC
maturation. Through uptake assays we demonstrate that internalization of HPV16 L1L2
VLP by LC is facilitated by A2t, which can be inhibited by SLPI- or siRNA-mediated
knockdown of A2t in LC. A2t was shown to suppress LC immune function, and small
molecule disruption of A2t prevented HPV16-induced LC-targeted immune suppression.
Collectively, these data demonstrate that A2t is involved in the binding and
internalization of HPV16 into LC through an L2-dependent mechanism, and that this
entry mechanism is associated with suppression of LC immune function.
It is conventional to use VLP and PsV to study HPV receptor binding and entry,
especially with primary immune cells [54,76,78,79,80,151,155]. Here, L1 and L1L2 VLP,
as well as L2 mutated PsV, were used to examine the significance of the interaction
86
between the L2 protein and A2t in HPV16 uptake in LC, where the primary difference
was the absence or presence of the wild-type or mutated L2 protein. A noteworthy
observation from the present assays is that HPV16 L1L2 VLP binding and
internalization was never completely inhibited on LC with down-regulation or inhibition of
A2t. Additionally, while A2t-mediated entry was shown to be dependent on L2, L1-only
VLP still entered LC, and this type of entry has been shown to induce LC activation [77].
This implies that there may be multiple and/or redundant uptake pathways for HPV16
that differentially activate LC. For these reasons, it is attractive to hypothesize a model
where L1-mediated entry leads to LC activation, and conversely that L2/A2t-mediated
entry suppresses LC immune responses. This model would further imply that inhibiting
the L2/A2t-mediated pathway would not completely block entry, but would rather lead to
HPV entry via an L1-mediated activating pathway thus preventing HPV16-induced
immune suppression, which fully fits with the data presented herein. Future studies will
aim to investigate such a model and determine all necessary cellular factors for each
entry mechanism. Our current study identifies A2t as a novel HPV16 receptor on LC,
but other studies are needed to determine if previously identified HPV receptors and
cofactors of keratinocytes such as HSPG, integrins, cyclophilins, growth factors and
growth factor receptors, and tetraspanins [reviewed in [131]] are also used for HPV16
internalization by LC.
Our data clearly show that A2t plays a role in suppressing the maturation of LC in
experiments where purified A2t was added to LC in vitro, and this is the first study to
identify a function for A2t in suppression of LC maturation. In contrast, exogenous A2t
was previously shown to activate murine macrophages, which is in stark opposition to
87
the suppressive role A2t plays on human LC [149]. This may indicate a unique function
for A2t in LC-mediated immune suppression that HPV16 has evolved to take advantage
of. A recent report that confirmed A2t is an HPV16 receptor on epithelial cells provided
evidence that initial HPV16 binding increases recruitment and translocation of A2t to the
extracellular surface [136]. Therefore, we hypothesized that the addition of A2t would
bind to the outer leaflet of LC in culture simulating the reported increase in A2t on the
cell surface on HPV16 treated cells. Though no mechanism has yet been delineated,
evidence in the literature suggests that the early binding of HPV16 to α6 integrins prior
to A2t binding and internalization can be linked to the local recruitment of A2t to the cell
membrane. For example, it has been shown that binding and clustering of α6β1/4
integrins cause the recruitment of talin and facilitate the activation of focal adhesion
kinase (FAK) [115], which plays an important role in HPV16 infection [59]. Talin directly
interacts with and activates phosphatidylinositol 4-phosphate, 5-kinase (PIP5K)
[156,157], which then catalyzes the focal production of phosphatidylinositol (4,5)-
bisphosphate (PIP
2
) [158]. Of note, it was demonstrated that PIP
2
actively recruits A2t to
specific regions of the cell membrane [117,159]. As mentioned above, early HPV16-
integrin binding activates FAK, which in turn activates src-family kinases (SFK)
[115,160]. Importantly, it was shown that SFK regulates the translocation of the A2t to
the cell surface both in vitro and in vivo [99]. Now, we can begin to see a hypothetical
signal cascade in which the binding of HPV16 to the cell surface leads to the local
recruitment and subsequent translocation of A2t to the cell surface to which HPV16 can
then bind. This HPV16-induced local recruitment of A2t may lead to the suppression of
LC maturation observed in our exogenous A2t experiments and perhaps initiates
88
clathrin-, caveolin-, lipid raft-, flotillin-, cholesterol-, dynamin-independent endocytosis of
HPV16.
Protein-protein interactions are key players in cellular processes, and are
increasingly targets for small molecule discovery. The interaction between anxA2 and
S100A10 has been well characterized by mutagenesis and crystallography [127,133]. In
the current study, we show that LC derived from primary human PBMC express both
proteins, and it has previously been reported that S100A10 is highly expressed by LC
derived from umbilical blood CD34+ progenitor cells (47), and the S100 family of
proteins is commonly used as an LC marker in vivo [161,162], indicating similarities in
the expression of A2t in LC from tissue in vivo and cellular progenitors in vitro. The 14
residue N-terminal region of two separate anxA2 molecules bind, primarily through
hydrophobic interactions, to two binding pockets created by S100A10 dimerization.
Recently, a group used a ligand-guided method and information about the topological
arrangement of chemical features of the anxA2 N-terminus to successfully identify
compounds that are able to compete with the binding of the anxA2 N-terminus to
S100A10 [135]. The most efficient of these A2t small molecule inhibitors (A2ti) was
used to disrupt A2t on LC and was shown to effectively prevent HPV16-induced
immune suppression.
Aside from HPV16, anxA2 has been shown to play a role in the binding and
uptake of a variety of different viruses including human cytomegalovirus, respiratory
syncytial virus, enterovirus 71, and was shown to be a cofactor for HIV-1 infection
[106,108,109,146,163]. Like HPV16, HIV is another virus that specifically targets LC
during infection [147], which may have implications in HIV-HPV co-infections through
89
targeting of the same receptor and cell type. Though unknown for other viruses, it is
unlikely that HPV16 binding to A2t is mediated indirectly by association with other cell
surface binding proteins, because we have previously reported a strong direct
interaction exists between the L2 protein and A2t in the absence of other cellular
proteins [73]. Our findings herein are the first to identify A2t as an HPV16 receptor on
LC, and represent the first demonstration of specifically targeting A2t to overcome
HPV16-induced immune suppression. Interestingly, our lab has recently demonstrated
that LC exposed to capsids of HPV types 18, 31, 45, 11, and HPV5 similarly suppress
LC activation [164], and future research will aim to determine if A2t is involved. The
targeted inhibition of A2t in viral studies is both exciting and promising, and ongoing
studies are currently underway to test the ability of A2ti to prevent HPV16 infection of
epithelial cells, and in the future, the targeted inhibition of A2t may have broad anti-viral
implications.

4.4 Materials and Methods
LC generation.
Human peripheral blood monocytes (PBMC) from healthy donors were obtained
by leukapheresis [76]. LC were generated from human PBMC as previously described
[77], and incubated in complete media (RPMI 1640 supplemented with 10% FBS, 1X
Pen/Strep, 1X Non-essential amino acids, and 1X 2-mercaptoethanol) with the addition
of 1000 U/mL (~180 ng/mL) GM-CSF, 1000 U/mL (~200 ng/mL) IL-4, and 10 ng/ml
TGF-β for 7 days. All studies were approved by USC’s IRB and informed consent was
obtained from donors.
90

Antibodies.
The following antibodies were used in this study: mouse-anti-anxA2, mouse-anti-
anxA2 light chain, mouse-CD86-FITC, mouse-HLA-DR, DP, DQ-FITC, isotype controls
(BD Biosciences, San Jose, CA); H16.V5 mouse-anti-L1 (gift from Neil Christensen,
Ph.D.); rabbit-anti-beta actin (Cell Signaling, Danvers, MA); rabbit-anti-pAKT (ser 473),
rabbit-anti-Akt (Santa Cruz Biotechnology); rabbit-anti-GAPDH (Cell Signaling, Danvers,
MA); Alexa Fluor 680 goat-anti-rabbit (Invitrogen, Carlsbad, CA) and IRDye 800
donkey-anti-mouse (Rockland, Gilbertsville, PA).

Virus-like particles and pseudovirions.
HPV16L1 VLP and HPV16L1L2 VLP were produced as previously described
[129]. Western blot analyses confirmed the presence of L1 and L2 while an ELISA and
transmission electron microscopy confirmed the presence of intact particles. An E-
toxate kit (Sigma-Aldrich, Carlsbad, CA) was used to semi-quantitate endotoxin. The
endotoxin level in the preparations was less than 0.06 endotoxin units/ml and this level
does not activate LC [76]. Baculovirus DNA used in VLP production procedure does not
activate LC [76]. VLP were validated in binding assays via pre-incubation with heparin,
a component of heparan sulfate proteoglycans (HSPG) that binds positively charged
residues of HPV16, or with H16.V5 neutralizing antibody [82], prior to cellular exposure,
which inhibits intact capsids from binding with cell surface receptors, and minimal
binding of less than 20% was observed. To produce VLP with a mutated L2
108-126
region
(aa substitution of GGDD for LVEE in the L2 capsid region aa 108-111) [74], site-
91
directed mutagenesis was performed as previously described [73]. HPV16
pseudovirions were produced by cotransfection of 293TT cells with plasmids encoding
codon-optimized HPV16 L1 and L2 following published procedures [128]. To produce
pseudovirions with a mutated L2
108-111
region (GGDD for LVEE), site-directed
mutagenesis was performed following published procedures [73]. L1 content was
quantitated by Coomassie Blue staining next to BSA standards following SDS-PAGE.

Recombinant protein expression and purification.
Recombinant anxA2 and S100A10 was produced as previously described [73].
Concentrations of all proteins and peptides, including the A2t complex, were determined
using bicinchoninic acid assays (Pierce, Rockford, IL) compared to measured
absorbance of albumin standards at 562nm. Purified A2t was produced by and purified
by combining S100A10 and anxA2 at a molar ratio of 1:1 as previously described [73],
and used in exogenous A2t activation assays.

HPV16 L1L2 VLP binding assay with L2
108-126
.
LC were incubated with increasing concentrations of the HPV16 L2
108-126
peptide
(LVEETSFIDAGAPTSVPSI) [74], or a scrambled analog of the same peptide
(IESPVSDTALGTPEIFVSA) with a maximum concentration of 50 µg/mL (0.5x10
6
cells)
for 1 h at 4° C. Subsequently, the LC were incubated with 0.25µg of HPV16L1L2
VLP/treatment for 1h at 4° C and then incubated with an anti-L1 (H16.V5) Ab at a
dilution of 1:25,000 for 30 min at 4° C. The cells were then incubated with biotinylated
anti-mouse-IgG2b for 30 min at 4° C. Next, the HPV16L1L2 VLP/anti-L1/biotin treated
92
cells were stained with streptavidin-FITC for 30 min. In control experiments, cells were
left untreated or probed with either peptide/anti-L1/biotin-strepavidin-FITC (no VLP),
VLP/anti-L1/biotin-strepavidin-FITC (no peptide), or peptide/Heparin-VLP/anti-L1/biotin-
strepavidin-FITC (VLP incubated with 2.5µg Heparin for neutralization). Finally,
HPV16L1L2 VLP binding to LC was assessed by flow cytometry with neutralization
controls mentioned under VLP preparation. Data were normalized to the untreated
groups.

L2
108-126
peptide pulldown assay.
LC were harvested, washed with PBS, and aliquoted into 1.5 ml microcentrifuge
tubes in PBS. Then (6x)His-L2
108-126
peptide was added to the LC, at a concentration of
50 µg/0.5 x10
6
cells, and incubated for 1hr. In control experiments, LC were left
untreated (no peptide added) but exposed to each condition thereafter. Following the
incubation, the extracellular cross-linking agent, 3,3’-Dithiobis-
(sulfosuccinimidylpropionate) (DTSSP) was added at a concentration of 1.5 mM to the
LC and incubated for 2 hr to cross-link the peptide to the receptor. After the cross-
linking reaction was quenched with 1 M Tris, LC were washed with PBS to remove
excess unbound peptide, and resuspended in and incubated with a bursting solution [10
mM Hepes, 2 mM MgCl, 10 mM KCl2, 0.05% Tween-20, and Halt Protease Inhibitor
Cocktail (Thermo Scientific, Rockford, IL)] for 20 min. Next, the cells were centrifuged
for 30 min at 13000 RCF. The supernatants were decanted and LC were resuspended
in lysis buffer (50 mM NaH2PO4, 300 mM NaCl, 50 mM imidazole, 0.05% Tween-20,
and Halt Protease Inhibitor Cocktail, pH 8.0). The cells were snap frozen, allowed to
93
thaw, incubated on ice for 30 min, and sonicated for 10 sec. Subsequently, the lysates
were centrifuged for 30 min at 10000 RCF. The lysate supernatants were decanted,
mixed with 50% Ni-NTA agarose slurry (Qiagen, Valencia, CA) and incubated overnight.
The following day an affinity column (Thermo Scientific) was assembled to elute the
proteins from the Ni-NTA agarose slurry. Once the column was assembled, the lysate-
Ni-NTA agarose slurry was washed twice with wash buffer (50 mM NaH
2
PO
4
, 300 mM
NaCl, 50 mM imidazole, and 0.05% Tween-20, pH 8.0). The proteins associated with
the Ni-NTA agarose were eluted with imidazole containing elution buffer (50 mM
NaH
2
PO
4
, 300 mM NaCl, 250 mM imidazole, and 0.05% Tween-20, pH 8.0). All steps
were performed at 4° C. The eluates then were separated via gel electrophoresis on
10% Bis-Tris gels using the NuPAGE Electrophoresis System (Invitrogen, Carlsbad,
CA) according to manufacturer’s instructions and transferred to nitrocellulose
membranes for immunoblot analysis. The membranes were then probed for anxA2 and
S100A10, and stained with secondary infrared Abs. Protein bands were visualized and
quantified with the Odyssey Imaging System (LI-COR Biosciences, Lincoln, NE).
Furthermore, the eluates were separated via gel electrophoresis on 10% Tris-HCL gels
(Bio-Rad)under reducing conditions for silver stain analysis.

HPV16 VLP uptake assay with SLPI.
HPV16L1 VLP and HPV16L1L2 VLP were labeled with carboxyfluorescein
diacetate, succinimidyl ester (CFDA-SE) (Invitrogen) as directed by the manufacturer’s
instructions. After labeling the HPV16 VLP were column filtered with 2% agarose beads
size standard 50-150 µm (Agarose Bead Technologies, Tampa, FL) with DPBS/0.5 M
94
NaCl to remove excess free label. LC were harvested, washed with PBS, and aliquoted
at a concentration of 10
6
cells/200 µl cold PBS into 1.5 ml amber tubes. Subsequently
the cells were either left untreated or incubated with 30 µg/ml of rhu-SLPI (R&D
Systems, Minneapolis, MN) for 1 h at 4° C (optimal concentration was determined
through titration). Following the incubation the cells were washed with 500 µl cold PBS
and spun down at 800 RCF for 5 min at 4° C. The supernatant was removed and the LC
were resuspended in 400 µl of room temperature FACS buffer. Next, CFDA-SE labeled
HPV16L1L2 VLP or HPV16L1 VLP (1 µg/1x10
6
) were incubated with the LC at 37° C. In
control experiments, LC were treated with H16.V5 (1:1500) neutralized CFDA-SE
labeled VLP to ensure VLP integrity and lack of residual free CFDA-SE label. After 15
min, LC were harvested and fixed in 2% paraformaldehyde. Finally, HPV16 VLP
internalization by LC was assessed via flow cytometry and data was normalized to
untreated groups.

siRNA knockdown of anxA2 in LC and HPV16 VLP uptake assay.
The S100A10 subunit of A2t is post-transcriptionally stabilized by anxA2
[101,102], and knockdown of anxA2 has been shown to be sufficient for successful
reduction in both subunits of A2t [73]. A Human anti-anxA2 siRNA SMARTpool was
synthesized (Thermo Scientific Rockford, IL) with the following sequences: #1
(AUACUAACUUUGAUGCUUGA); #2 (CGACGAGGACUCUCUCAUU); #3
(CUGUCAAAGCCUAUACUAA); #4 (AGACCAAAGGUGUGGAUGA). Control non-
target siRNA (Thermo Scientific) was against no known protein. Anti-anxA2 or Control
siRNA was transfected into LC using Lipofectamine 2000 (Invitrogen) as directed by the
95
manufacturer’s instructions (20 pmol siRNA/2x10
5
cells). Protein from transfected cells
was collected for 7 consecutive days and assessed via Western blot determining that
minimal (approx. 50%) anxA2 levels were achieved 5 days post-transfection (data not
shown). LC were then incubated for 5 days post-siRNA transfection before use in an
HPV16 VLP uptake assay. HPV VLP were labeled with CFDA-SE as described above.
CFDA-SE labeled, HPV16L1L2 VLP, or HPV16 L2 mutant VLP [74] (1 µg/2x10
5
cells)
were incubated with the anti-anxA2 siRNA transfected, control siRNA transfected, or
untreated LC at 37° C. After 45 min, LC were harvested and fixed in 2%
paraformaldehyde. In control experiments LC were treated with H16.V5 neutralized VLP
as described above. Finally, HPV16 VLP internalization by LC was assessed via flow
cytometry and the data were normalized to the untreated groups. For anxA2
quantification, protein was collected from LC five days post-siRNA transfection with
Mammalian Protein Extraction Reagent (Pierce), and reduced samples were run on
10% Bis-Tris gels using NuPAGE Electrophoresis System (Invitrogen) according to
manufacturer’s instructions and transferred to nitrocellulose membranes for immunoblot
analysis. The membranes were then probed for anxA2 and beta-actin, and stained with
secondary infrared Abs. Protein bands were visualized and quantified with the Odyssey
Imaging System.

LC activation assay with HPV16 wild type or L2 mutant PsV.
10
6
LC were seeded in a 6-well plate and either left untreated, treated with 10 µg
lipopolysaccharide (LPS) (Sigma-Aldrich), 10 µg HPV16 PsV, or 10 µg HPV16 L2
mutant PsV. The toll-like receptor 4 (TLR4) agonist LPS was chosen as a positive
96
control as it has been shown to elicit strong immune responses in LC [165]. The cells
were then incubated at 37°C for 48 hr in 2 ml complete medium with periodic mixing for
the first 1 hr. After 48 hr, the cells were harvested, washed, stained for surface MHC II
(mouse-HLA-DR, DP, DQ-FITC) and CD86 or isotype controls, and analyzed by flow
cytometry.

LC activation assay with recombinant proteins.
10
6
LC were seeded in a 6-well plate and either left untreated, treated with 10 µg
LPS (Sigma-Aldrich), 10 µg A2t, 10 µg anxA2, or 10 µg S100A10. The cells were then
incubated at 37° C for 48 hr in 2 ml complete medium with periodic mixing for the first 1
hr. After 48 hr, supernatants were collected and cells were harvested, washed, stained
for surface MHC II (mouse-HLA-DR, DP, DQ-FITC) or isotype controls, and analyzed by
flow cytometry. Supernatants of selected groups were analyzed using the MILLIPLEX
MAP Human Cytokine Kit (EMD Millipore).

LC signaling assay with recombinant A2t.
LC were treated with as described above in the activation assay with recombinant
proteins at 37° C for 15 min. Cellular extracts were prepared using the Mammalian
Protein Extraction Reagent (Pierce). Normalized aliquots of cell lysates were
electrophoresed on 10% NuPage Novex Bis-Tris gels (Invitrogen) under reducing
conditions and transferred to nitrocellulose membranes. Immunoblotting was performed
using Akt, pAkt, or GAPDH Abs followed by secondary infrared Abs. Protein bands were
visualized and quantified with the Odyssey Imaging System.
97

LC activation assay with A2t inhibitor.
10
6
LC were seeded in a 6-well plate and either left untreated, treated with 10 µg
LPS (Sigma-Aldrich), or treated with increasing concentrations of a previously identified
A2t inhibitor (A2ti: 2-[4-(2-Ethylphenyl)-5-o-tolyloxymethyl-4H-[1,2,4]triazol-3-
ylsulfanyl]acetamide) [135] alone or A2ti for 1 hr prior to exposure to 10 µg HPV16 PsV.
The half maximal inhibitory concentration (IC
50
) value of the A2ti was reported to be 24
µM [135]. The cells were then incubated at 37°C for 48 hr in 2 ml complete medium with
periodic mixing for the first 1 hr. After 48 hr, supernatants were collected and cells were
harvested, washed, stained for surface MHC II and CD86 or isotype controls, and
analyzed by flow cytometry. Supernatants were analyzed using the MILLIPLEX MAP
Human Cytokine Kit (EMD Millipore).

Statistical analysis.
All statistical analyses were performed using GraphPad Prism (GraphPad
Software Inc., San Diego, CA).

98
CHAPTER 5. Human papillomavirus-mediated suppression of Langerhans cell
function in women with cervical precancerous lesions is reversed with stabilized
Poly-I:C
4

5.1 Introduction
High-risk human papillomavirus (hrHPV) infection leads to the development of
several human cancers including cervical, vaginal, vulvar, anal, and head and neck
cancers that cause significant morbidity and mortality worldwide [130]. Prospective well-
controlled trials of the prophylactic HPV vaccines Gardasil® and Cervarix® have
demonstrated effective prevention of high-grade cervical lesions associated with
infection by hrHPV types 16 and 18 [166], which account for approximately 50% and
20% of all cervical cancers, respectively. Despite this, widespread adoption and uptake
of HPV vaccinations is poor. While the percentage of girls aged 13-17 receiving at least
one dose improved from 25.1% to 57.3% from 2007 to 2013 in the United States, the
percentage receiving the recommended 3 doses was still only 37.6% in 2013 [167].
Additionally, these vaccines only partially aid in preventing infection by other hrHPV
genotypes and have no effect in preventing disease for the hundreds of millions of
people that are currently infected with HPV. More than 15% of women that have hrHPV
infections cannot initiate an effective immune response against HPV, and among those

4
This work is currently under review by The Journal of Immunology and is provided here with permission
from The American Association of Immunologists, Inc (AAI) as part of the AAI copyright transfer
agreement for use by the author in a dissertation.
99
that do, viral clearance is very slow [10,168]. This suggests that HPV is escaping
immune detection and warrants the investigation of therapeutic treatments that
stimulate the immune system to clear HPV infections, especially in patients with
consecutive positive hrHPV DNA tests or in patients with ongoing hrHPV infections such
as those with mild dysplasia or low grade cervical intraepithelial neoplasia (CIN) lesions.
We have previously implicated HPV-mediated suppression of Langerhans cell
(LC) immune function as a key mechanism in which HPV evades immune surveillance
[169,170,171]. LC are the local APC of the epithelial and mucosal layers, making them
responsible for initiating immune responses against epithelium invading viruses [11].
Upon proper pathogenic stimulation, LC undergo phenotypic and functional changes
including the activation of signaling cascades, the up-regulation of co-stimulatory
molecules, and the release of pro-inflammatory cytokines. Activated LC then travel to
lymph nodes via chemokine-directed migration where they interact with antigen specific
T cells and initiate an adaptive T cell response (reviewed in [172]). However, LC
exposed to hrHPV type 16 (HPV16) do not become functionally mature APC, exhibit
dysregulated cellular signaling, and are therefore unable to initiate HPV16-specific
cytotoxic T cell responses [169,170].
Toll-like receptors (TLRs) are expressed by APC and recognize pathogen
associated molecular patterns (PAMPs). We have previously demonstrated that
treatment with a TLR8 agonist can activate LC, whereas a TLR7 agonist does not [77],
suggesting that the specific TLR molecule engaged on LC has a profound effect on the
resulting immune response. However, our previous studies did not analyze the LC
response in women with clinical evidence of hrHPV persistence and preneoplastic
100
disease, which could further impact the anti-HPV response. TLR3 is responsible for the
detection of viral dsRNA, and TLR3 signaling pathways initiate antiviral and
inflammatory responses [173]. TLR3 is found primarily in the endosomes of APC
including LC as well as on the surface of epithelial cells [174,175]. Both natural and
synthetic dsRNAs provide warning signals through TLR3, inducing the production of
type I IFNs and other cytokines. The synthetic dsRNA viral analog polyinosinic-
polycytidylic acid (Poly-I:C) has long been known as the strongest type I IFN inducer
recognized by TLR3 [176], and furthermore, can induce LC maturation via TLR3
stimulation [177]. Poly-I:C is a broad inducer of innate immunity and has been
investigated clinically for its adjuvant and anti-viral activity [178]. Despite its long-known
potential, Poly-I:C is rapidly inactivated by enzymes in blood, and is therefore not ideal
for clinical applications [179]. However, Poly-I:C can be stabilized with polypeptides (s-
Poly-I:C) thereby promoting its use in the clinic [180]; Poly-I:C stabilized with poly-
arginine is known as Poly-ICR whereas Poly-I:C stabilized with poly-lysine and
carboxymethylcellulose is known as Poly-ICLC. The primary objective of this study was
to investigate whether s-Poly-I:C can overcome HPV-induced immune suppression by
functionally activating LC exposed to HPV16, and inducing activation of HPV16-specific
T cells ex vivo from both healthy donors and, more importantly, from women with HPV-
induced precancerous cervical lesions, the latter being indicative of persistent hrHPV
infection.
5.2 Results
Ten patients with histologically confirmed high grade CIN2/3 (average age, 34 ±
9.8 yrs), and ten healthy donors (average age, 29 ± 5.7 yrs) gave consent to participate
101
Table 5.1. Baseline characteristics of healthy donors and patients included in this study.
Subject
Age
(yr)
Staging of
cervical
lesion(s)
Type of
neoplasia
HPV
type(s)
HLA-A2
genotype
HIV
status
CIN 01 35 CIN3, CIN1 Multifocal 16,31 A*0201 Neg
CIN 02 59 CIN3 Multifocal 58 A*0201 Neg
CIN 03 30 CIN2 Multifocal 58 Neg Neg
CIN 04 27 CIN2, CIN1 Multifocal 16 Neg Neg
CIN 05 24 CIN3 Unifocal 52 A*0206 Pos
CIN 06 27 CIN3 Multifocal 16 Neg Neg
CIN 07 33 CIN2, CIN1 Multifocal 18 A*0201 Pos
CIN 08 39 CIN3 Unifocal 16 A*0201, A*0206 Neg
CIN 09 35 CIN3 Multifocal 16,82 Neg Neg
CIN 10 35 CIN3, CIN2 Multifocal 31,52,53 A*0201 Pos

Healthy 01 27 NA
a
NA ND A*0201 Neg
Healthy 02 33 NA NA ND A*0201 Neg
Healthy 03 25 NA NA ND A*0201 Neg
Healthy 04 40 NA NA ND A*0201 Neg
Healthy 05 24 NA NA ND A*0217 Neg
Healthy 06 28 NA NA ND Neg Neg
Healthy 07 24 NA NA ND Neg Neg
Healthy 08 25 NA NA ND Neg Neg
Healthy 09 37 NA NA ND A*0201 Neg
Healthy 10 30 NA NA ND A*0201 Neg
a
NA, not applicable; ND, not determined
in this study. There was no statistically significant difference between the mean age of
CIN2/3 patients and healthy donors (p=0.17). Subjects were tested for the presence of
the HLA-A*0201 MHC allele, which allows for the examination of HPV16 specific CD8
+

T cell responses derived from the HPV16 E7 protein [181]. A subset of CIN2/3 patients
102
(n=3) were seropositive for HIV; allowing examination of an important patient
population, due to the higher prevalence, incidence, and persistence of HPV infection
despite the impact of highly active antiretroviral therapy in HIV patients [182]. lists the
baseline characteristics of study participants. Seven of ten CIN patients were diagnosed
with CIN3 lesions, the remaining patients were diagnosed with CIN2. Several cases
were multi-focal, having more than one area of dysplasia. Similar to what has been
described for the distribution of hrHPV types in high-grade lesions [183], HPV16 was
found in 50% of the CIN2/3 cases.

s-Poly-I:C (Poly-ICR) induces upregulation of MHC and costimulatory molecules on
HPV16-exposed LC
The phenotype of LC generated from PBMC was defined as high expression of
CD1a, Langerin, and TLR3 (Figure 5.1A), similar to what has been shown for LC
isolated from skin in vivo [174]. LC from CIN2/3 patients or healthy donors were
exposed to HPV16, followed by treatment with s-Poly-I:C (Poly-ICR). LC were analyzed
for the expression of MHC and T cell co-stimulatory molecules. Immature LC express
MHC class I and class II, but show little to no expression of the costimulatory molecules
CD40, CD80, CD86, or the maturation marker CD83 (Figure 5.1B, untreated).
Importantly, expression of these markers did not change when LC from CIN2/3 patients
were exposed to HPV16, similar to what has been described in healthy individuals,
confirming HPV16-mediated suppression of LC immune function in patients. In contrast,
LC that were pre-exposed to HPV16, then subsequently activated with s-Poly-I:C,
showed increased expression of MHC and costimulatory molecules (Figure 5.1B).
103

Figure 5.1. Poly-ICR induces
upregulation of MHC and
costimulatory molecules on LC.
Immature LC from healthy donors
(N=10) or CIN patients (N=9) were
left untreated or exposed to HPV16
VLP. Subsequently, cells were
treated with s-Poly-I:C (5 µg/mL Poly-
ICR) for 48h. Controls were left
untreated or were exposed to HPV16
VLP alone. (A) Phenotype of
immature LC expressing CD1a,
langerin, and TLR3 by flow
cytometry; isotype control in gray. (B)
Representative data from a CIN
patient’s untreated or HPV16-
exposed LC followed by s-Poly-I:C.
Expression of indicated surface
marker is shown in black histograms,
and isotype control in gray. (C) Fold
increase in LC surface marker
expression from healthy donors
(N=10; white bars) and CIN2/3
patients (N=10; black bars). Data
represent mean fold increase in
surface marker expression (± SEM)
relative to untreated LC based on
mean fluorescence intensity (MFI)
*p<0.05, **p<0.01, ***p<0.001 (one-
way ANOVA, Tukey’s post-test).

104
Quantification of activation-associated markers from all CIN2/3 patients and
healthy donors indicated that treatment of LCs with s-Poly-I:C after pre-exposure to
HPV16 caused a significant upregulation of all surface markers analyzed (Figure 5.1C).
These results suggest a potential reversal of the immune suppression caused by
HPV16 as demonstrated by phenotypic activation of LC.
Poly-ICR induces HPV16-exposed LC to migrate to CCL21 ex vivo
LC chemokine-directed migration to regional lymph nodes after receiving
maturation signals in the periphery is required for successful interaction with naïve T
cells [184]. As an ex vivo correlate of LC migration in vivo, a transwell chemotaxis assay
to CCL21 was used to assess the migratory capacity of LC after exposure to HPV16
followed by treatment with s-Poly-I:C (Poly-ICR). CCL21 is a chemokine that is
Figure 5.1
Figure 5.2. Poly-ICR induces HPV16-
exposed LC to upregulate CCR7 and
migrate to CCL21 ex vivo. LC were
exposed to HPV16 prior to s-Poly-I:C
(Poly-ICR) treatment as described. (A)
CCR7 expression was analyzed by flow
cytometry. Data represent mean fold
increase in CCR7 expression (± SEM)
relative to untreated LC based on MFI
from healthy donors (N=10; white bars)
and CIN2/3 patients (N=10; black bars).
(B and C) In vitro migration assay. LC
were analyzed for migration through a
transwell insert to CCL21 or medium
alone. Shown is the mean number of LC
migrating to CCL21 (black bars)
compared to spontaneous migration
(white bars) (± SEM) of six individual
healthy donors (panel B) and ten
CIN2/3 patients (panel C) relative to
untreated LC. **p<0.01, ***p<0.001
compared to untreated LC (one-way
ANOVA, Tukey’s post-test).

105
expressed in lymphoid organs and signals through the maturation-induced CCR7
receptor on LC during migration to lymph nodes [184]. Treatment of LC from both
healthy donors and CIN2/3 patients with s-Poly-I:C resulted in a significant increase in
CCR7 expression (Figure 5.2A) and a significant increase in migration capacity towards
CCL21 compared to untreated LC or LC exposed to HPV16 alone (Figure 5.2B-C).
Individual migration indices for all CIN2/3 patients are shown in Table 5.2, indicating
that the majority of women with a history of persistent hrHPV infection have LC that
retain their capacity for chemokine-directed migration.

Poly-ICR induces HPV16-exposed LC to produce high levels of inflammatory cytokines
and chemokines
Induction of T cell responses against virus-infected cells requires APC to produce
Th1 inducing cytokines and chemokines to prime CD8
+
T cells against viral antigens
and recruit innate immune cells to participate in eradication of virus-infected cells. Poly-
I:C is well known for inducing a type I interferon response through activation of
transcription factors that leads to the production of additional inflammatory cytokines
and chemokines [173,176]. Therefore, LC were tested for the ability to secrete a wide
variety of cytokines and chemokines after exposure to HPV16 followed by treatment
with s-Poly-I:C (Poly-ICR). Only treatment of HPV16-exposed LC with s-Poly-I:C
resulted in a significant increase in the magnitude of cytokines and chemokines
produced (Figure 5.3), most notably TNFα IFNα, IL-1β, IL-6, IL-12p70, IFN-γ-inducible
protein 10 (IP-10), MCP-1, MIP-1α, MIP-1β, and RANTES. These results demonstrate
that HPV16-exposed LC of CIN2/3 patients are able to secrete inflammatory cytokines
106
Table 5.2. Summary of analysis of LC function and induction of HPV16 specific CD8
+
T
cell responses in CIN patients.
Subject
LC
activation
marker
increase
a

LC
Migration
Index
b

MLR
Proliferation
Index
c

LC
cytokine
secretion
d

HPV16 E7 epitope
specific T cell
response
e

E7
(11-
19)
E7
(82-
90)
E7
(86-
93)
CIN 01 + 4.5 1.0 + 215 0 143
CIN 02 + 6.0 1.3 + 0 12 0
CIN 03 + 44.5 1.3 +
ND
f
ND ND
CIN 04 + 11.8 1.8 +
ND ND ND
CIN 05 + 32.6 1.8 + 0 1091 0
CIN 06 + 14.8 0.9 +
ND ND ND
CIN 07 + 12.0 1.1 + 774 0 101
CIN 08 + 15.0 1.5 + 32 0 0
CIN 09 + 13.1 1.6 +
ND ND ND
CIN 10 + 49.7 ND + 0 274 104
a
Positive response defined by at least 2-fold increase in MFI in majority of activation
markers analyzed.
b
Migration index, average number of CCL21 chemokine directed migrating cells divided
by spontaneous number of migrating cells. Shown is migration index of LC in HPV16 +
s-Poly-I:C group. Migration index of untreated LC was always ≤ 2.0.
c
Proliferation index, average proliferation of wells of HPV16 VLP + s-Poly-I:C group
divided by the average proliferation of untreated LC group.
d
Positive cytokine response defined by at least 10-fold increase the secretion of pro-
inflammatory cytokines and chemokines (TNFα, IFNα, IL-1β, IL-6, IL-12p70, IP-10,
MCP-1, MIP-1α, MIP-1β, RANTES) in HPV16 VLP + s-Poly-I:C group compared to
untreated LC group.
e
Number of peptide specific IFNγ producing CD8
+
T cells induced by stimulation of
autologous T cells with HPV16 cVLP + s-Poly-I:C treated LC in HLA-A*0201 positive
patients. Average number of spots from untreated LC wells has been subtracted to
display number of peptide-specific T cells induced by s-Poly-I:C treatment.
f
ND, not determined
107
and chemokines that can activate and attract T cells to the site of antigen priming after
treatment with s-Poly-I:C.
Figure 5.3. Poly-
ICR induces HPV16-
exposed LC to
produce high levels
of inflammatory cyto-
kines and chemo-
kines. LC from
healthy donors (N=7,
white bars) or CIN
patients (N=9, black
bars) were exposed
to HPV16 prior to
treatment with s-Poly-
I:C (Poly-ICR). Cell
supernatants were
analyzed for a panel
of 10 cytokines and
chemokines using a
Bio-Plex Suspension
Array System. Data
represent the mean
(± SEM) analyte
concentration.
*p<0.05, ***p<0.001,
****p<0.0001 comp-
ared to untreated LC
(one-way ANOVA,
Tukey’s post-test).

108
HPV16-exposed LC treated with Poly-ICR induce HPV16-specific CD8
+
T cell
responses
Activated LC are potent stimulators of T cell proliferation [185]. To determine
whether s-Poly-I:C (Poly-ICR) treated HPV16-exposed LC demonstrate an increased
ability to stimulate naïve T cell proliferation, an in vitro MLR assay was performed.
Untreated, HPV16-exposed, or HPV16-exposed and then s-Poly-I:C treated LC were
co-cultured with allogeneic T cells. LC from both healthy donors and CIN2/3 patients
treated with s-Poly-I:C demonstrated a significant enhancement of T cell stimulatory
capacity compared to untreated LC alone (data not shown). Individual proliferation
indices for all CIN2/3 patients are shown in Table 5.2, demonstrating that the majority of
patients had LC that induced increased T cell proliferation. To analyze the ability of LC
to induce antigen-specific T cells, we next tested whether LC pre-incubated with HPV16
and then treated with Poly-ICR induced an HPV16-specific CD8
+
T cell response in
HLA-A2
+
donors after an in vitro immunization assay followed by an IFNγ ELISPOT
assay. In these experiments, HPV16 L1L2-E7 cVLP containing the E7 protein were
used [186]. cVLP contain a fusion protein of L2-E7, which encapsidates the E7 protein
inside the VLP and is delivered to LC as a viral antigen. Defined HLA-A*0201 binding
E7 peptides [181] were used to detect the breadth and magnitude of HPV16 E7-specific
CD8
+
T cell reactivity induced. In healthy donors, LC exposed to HPV16 cVLP and
subsequently treated with s-Poly-I:C were able to induce IFNγ secreting E7 peptide-
specific CD8
+
T cells specific for all three epitopes, E7
11-20
, E7
82-90
, and E7
86-93
, when
compared to untreated LC or LC exposed to HPV16 cVLP alone (Figure 5.4, top
panels). In CIN2/3 patients, LC exposed to HPV16 cVLP and subsequently s-Poly-I:C
109
induced a more limited E7 peptide-specific CD8
+
T cell response, generally recognizing
one or two, but not all three HLA-A2 binding peptides (Figure 5.4, bottom panels).
Peptide E7
11-19
was used as a readout in CIN2/3 patients since it has been suggested
that only this conserved peptide is correctly processed and presented by HLA-A*0201
+

Figure 5.4. HPV16-exposed LC treated with Poly-ICR induce an HPV16-specific
CD8
+
T cell response. CD8
+
T cells were co-cultured with s-Poly-I:C (5 µg/mL Poly-
ICR) treated or untreated autologous LC for 4 weeks with weekly restimulations in an
in vitro immunization assay. LC were loaded with HPV16 L1L2-E7 cVLP, then treated
with s-Poly-I:C or left untreated. T cells were then tested for IFN-γ secretion in
response to HLA-A*0201 binding peptides by ELISPOT analysis. The number of
spots representing IFNγ secreting cells were averaged over eight replicate wells.
Data show two representative HLA-A*0201
+
healthy donors and two representative
CIN patients with positive responses following s-Poly-I:C treatment of LC.

110
HPV16-transformed tumor cells [187]. Four out of six evaluated CIN2/3 patients (CIN
01, 05, 07, and 10) demonstrated significant E7 peptide-specific T cell responses after
s-Poly-I:C treatment compared to responses using untreated LC with lesser responses
detected in CIN patients 02 and 08 (Table 5.2). Three of the four responding CIN2/3
patients were also HIV
+
, indicating that both LC and T cell functionality are intact in HPV
and HIV co-infected women. Interestingly, one CIN patient who was HLA-A*0206
+
rather
than A*0201
+
demonstrated strong CD8
+
T cell responses to peptide E7
82-90
. Peptides
binding strongly to A*0201 bind heterogeneously to A*0206 [188], and in this patient,
E7
82-90
seemed to bind sufficiently to the A*0206 MHC I molecule to induce peptide-
specific CD8
+
T cells. Collectively, these results demonstrate that LC from CIN2/3
patients, when exposed to HPV16 particles and subsequently to s-Poly-I:C, were able to
become functionally active and capable of inducing T cell proliferation and an HPV16-
specific CD8
+
T cell response ex vivo.

Poly-ICR and Poly-ICLC induce similar activated phenotypes in HPV16-exposed LC
The above results show that s-Poly-I:C stabilized with poly-arginine (Poly-ICR)
induces phenotypically and functionally activated LC that were pre-exposed to HPV16.
Poly-I:C stabilized with poly-lysine (poly-ICLC, Hiltonol), is an investigational dsRNA
compound that has been used in several past and present clinical trials as a vaccine
adjuvant [189,190,191]. Since Poly-ICLC can be more rapidly translated to clinical
studies in HPV
+
women, we wanted to determine its activity on HPV16-exposed LC and
we hypothesized that LC treatment with Poly-ICLC would similarly activate LC
compared to Poly-ICR. To examine this, healthy donor LC were either left untreated or
111
exposed to HPV16 prior to treatment with Poly-ICR or Poly-ICLC and then analyzed for
cell-surface expression of costimulatory molecules. The results demonstrate that LC
treated with either Poly-ICR or Poly-ICLC after HPV16 exposure had significantly
increased expression of the costimulatory molecules CD40, CD80, CD83, and CD86
compared to untreated and HPV16 only groups (Figure 5.5). Notably, the level of
expression induced by Poly-ICR and Poly-ICLC was similar for all markers tested when
using the optimal concentration of each s-Poly-I:C compound as determined by a dose
titration (5 µg/mL Poly-ICR and 50 µg/mL Poly-ICLC). These results demonstrate that
both s-Poly-I:C compounds induce a similar phenotype in HPV16-exposed LC, which
suggests that the two compounds have the same mechanism of action.
Figure 5.5. Poly-ICLC induces
upregulation of costimulatory
molecules on LC similar to
Poly-ICR. Immature LC from
healthy donors or CIN patients
were left untreated or exposed
to HPV16 VLP prior to
treatment with s-Poly-I:C (Poly-
ICR or Poly-ICLC). Control
cells were left untreated or
were exposed to HPV16.
Expression of CD40, CD80,
CD83, and CD86 and was then
analyzed by flow cytometry.
The average fold increase in
LC surface marker expression
from healthy donor 10 is
presented as representative of
two independent donors. Data
shown is the mean fold
increase in surface marker
expression (± SD) of triplicate
values relative to untreated LC
based on MFI. **p<0.01, ***
p<0.001 (Student’s t test).

112

Figure 5.6. Poly-ICLC induces LC activation in HPV16-exposed LC. (A) Poly-ICLC
induces upregulation of MHC and costimulatory molecules on LC. LC from a healthy
donor or CIN patient were left untreated or exposed to HPV16 prior to treatment with
s-Poly-I:C (50 µg/mL Poly-ICLC), then analyzed by flow cytometry for indicated
surface markers. Control cells were left untreated or exposed to HPV16 alone.
Representative data from a healthy donor (Healthy 02) and CIN patient (CIN 06) is
presented. Data shown is the mean fold increase in surface marker expression (±
SD) of replicate values relative to untreated LC based on MFI. **p<0.01, ***p<0.001
(Student’s t test). (B) Poly-ICLC induces HPV16-exposed LC to migrate to
chemokine CCL21 ex vivo. LC from healthy donors or CIN patients were exposed to
HPV16 prior to s-Poly-I:C (50 µg/mL Poly-ICLC). LC were analyzed for migration to
medium or medium supplemented with CCL21. Shown is the mean number (± SD) of
LC migrating to CCL21 (black bars) compared to spontaneous migration (white bars)
of three healthy donors and two CIN patients performed in triplicate relative to
untreated LC. ***p<0.001 compared to HPV16 only LC (Student’s t test).

113
Poly-ICLC induces LC activation in HPV16-exposed LC
Since Poly-ICR and Poly-ICLC induced similar increases in the expression of
costimulatory molecules, we next sought to determine if Poly-ICLC could induce
functionally activated LC from CIN2/3 patients in a comparable manner to what was
observed for Poly-ICR. Therefore, LC from CIN2/3 patients and healthy donors were
treated with Poly-ICLC after pre-exposure to HPV16, and LC activation was evaluated
as the upregulation of MHC and costimulatory molecules, in vitro chemokine-directed
migration, and secretion of inflammatory cytokines and chemokines.
Similar to LC from healthy donors, Poly-ICLC was able to activate LC from
CIN2/3 patients that had been pre-exposed to HPV16 such that expression of the MHC
I, MHC II, CD40, CD80, CD83, and CD86 were significantly increased (Figure 5.6A-
5.6B.). Treatment of HPV16-exposed LC from both healthy donors and CIN2/3 patients
with Poly-ICLC resulted in a significant increase in migration capacity towards CCL21
compared to untreated LC or LC exposed to HPV16 alone (Figure 5.6C.). Similar to
Poly-ICR, treatment of HPV16-exposed LC with Poly-ICLC resulted in a significant
increase in the amount of cytokines and chemokines secreted (data not shown). Taken
together these results indicate that Poly-ICLC can induce the functional activation of
HPV16-exposed LC from healthy donors and CIN2/3 patients alike, providing a strong
rationale for testing Poly-ICLC in future clinical trials in persistent HPV-infected patients.

114
5.3 Discussion
The life cycle of hrHPV is strictly intraepithelial, and consequently viral antigens
should be processed and presented by LC, the professional APC that reside in the
epithelium [150]. Various studies have found that HPV16 VLP can bind to and stimulate
the activation of human dendritic cells (DC) [152,153], providing evidence that HPV16
can induce the maturation of APC. However, HPV16 VLP internalization into LC results
in dysregulated cellular signaling and defective activation, which we have determined to
be HPV16 L2 minor capsid protein dependent [192,193]. In this regard, LC may be
uniquely manipulated by HPV compared to other immune cells or DC subsets. Beyond
HPV16, we have shown that other HPV genotypes such as high-risk (HPV18, HPV31,
and HPV45), low-risk (HPV11), and a cutaneous (HPV5) genotype, also suppress LC
activation through a similar mechanism [171], thus an immune modulating treatment
such as s-Poly-I:C shown for HPV16 is likely to have efficacy against other hrHPV types
as well.
Here we demonstrate that TLR3 is expressed by monocyte-derived LC. Likewise,
it has been demonstrated that LC freshly isolated from human skin also express TLR3
and are capable of responding to dsRNA [174]. Highly-purified LC freshly isolated from
human epidermis are strongly activated by Poly-I:C as indicated by marked increases in
the expression of CD40, CD80, and CD86 [177]. Furthermore, Poly-I:C treatment
commits LC to induce CD8
+
T cell responses more effectively than dermal DC [194].
Another study by Renn et al. demonstrated that LC derived from CD34
+
umbilical cord
progenitor cells responded better to Poly-I:C than do monocyte derived DC [165]. While
these previous in vitro reports indicate that Poly-I:C may be promising in inducing
115
human LC-mediated immune responses, these studies do not consider the rapid
degradation of non-stabilized Poly-I:C by serum nucleases present in humans and non-
human primates [179], limiting their applicability to clinical research, which is why only
stabilized Poly-I:C compounds were chosen for the current investigations.
The results of the current study show that LC of CIN2/3 patients are not activated
by and do not induce an adaptive immune response to HPV16 alone, similar to healthy
donors. Despite this, LC from all CIN2/3 patients were able to become functionally
active APC, upregulating MHC and costimulatory molecules, undergoing chemokine-
directed migration, secreting inflammatory cytokines and chemokines, and inducing
CD8
+
T cell responses after treatment with s-Poly-I:C (either Poly-ICR or Poly-ICLC) ex
vivo. This observation is important because it highlights that the LC of women with
persistent hrHPV infection are not functionally impaired, and are capable of inducing an
adaptive anti-viral immune response when a proper stimulus such as a TLR agonist is
applied.
Our study has limitations in that the LC are blood-derived rather than isolated
from the cervical mucosa. Despite this, the aforementioned LC studies of others
suggest that freshly isolated epidermal LC and LC derived from monocytes or CD34+
progenitors share the same phenotype and respond similarly to Poly-I:C. Additionally,
our culture system does not replicate the complex interactions that take place in vivo
between epithelial cells, LC, and lymphocytes along with cytokine cross-talk.
Observational studies have shown that LC numbers are reduced in HPV infected
tissues indicating other effects on LC dysfunction associated with HPV infection
[195,196,197]. While these findings may suggest that TLR3 agonists may not be
116
effective in viral clearance of HPV infected tissue, it is worth noting that a study of the
TLR transcriptome in the HPV-positive cervical cancer microenvironment revealed an
increase in TLR3 expression in HPV-positive dysplastic and carcinoma epithelium
tissue compared to other TLRs [198]. Therefore, even if the number of LC in HPV-
infected tissues is reduced, s-Poly I:C molecules may still have potent
immunomodulatory activity at the cervix through epithelial-expressed TLR3. In vivo, s-
Poly I:C has the potential to act not only on hematopoietic cells but also non-
hematopoietic cells, which are the main source of anti-viral type I IFNs. Interestingly,
higher TLR3 expression detected from cervical cytobrush samples from HPV-positive
patients was correlated to HPV16 clearance, demonstrating a link between TLR3 and
HPV clearance in vivo [199,200]. The association between TLR3 expression and HPV
clearance is somewhat surprising considering HPV is a DNA virus with no dsRNA
genome intermediates and is therefore unlikely to signal through TLR3 directly.
However, it highlights the important role of the TLR3 signaling pathway in anti-viral
immunity even in the absence of direct virus engagement of these intracellular PAMP
receptors.
Two studies have demonstrated the utility of using Poly-I:C in the adjuvant
setting for HPV-related disease. Intravaginal treatment with Poly-I:C after systemic
vaccination has been shown to increase mucosally associated E7-specific CD8
+
T cell
responses in mice [201]. Increased mucosal trafficking of T cells in that model is likely
the result of chemokine upregulation, as it has been shown in this study and by others
that Poly-I:C is a strong inducer of chemokine secretion. A dose-dependent increase in
the secretion of the chemokine IL-8/CXCL8 was observed when human endocervical,
117
ectocervical, and vaginal epithelial cells were treated with Poly-I:C in vitro, indicating
that cells at the cervical transformation zone, which is highly susceptible to hrHPV
infection, would be responsive to TLR3 agonists [202]. Poly-ICLC has also been used to
enhance the systemic Th1 immune responses against a HPV16 capsomer vaccine in
rhesus macaques, supporting the induction of strong anti-HPV16 L1 antibody responses
[203]. Taken together, these studies suggest that TLR3 activation may act through
multiple mechanisms of action to stimulate both innate and adaptive immunity to
promote HPV clearance if applied in the right context.
In the current study, we demonstrated that LC responded strongly to two different
poly-peptide stabilized forms of poly-I:C. Poly-ICR induced robust responses in LC from
all CIN patients and healthy donors tested, and these results were then confirmed with
clinical grade Poly-ICLC. Effective concentrations for LC activation by unstabilized Poly-
I:C in in vitro studies has been reported between 10-25 µg/mL [177,194], which is
similar to concentrations used for Poly-ICR and Poly-ICLC in the current study. The
differences in the optimal concentrations for Poly-ICR and Poly-ICLC could be due to
variations in manufacturing practices, the latter being a cGMP-produced compound, or
the use of poly-arginine versus poly-lysine as a stabilization component. In vitro, the
mechanism of action of either Poly-I:C or stabilized Poly-I:C (Poly-ICLC) appears to
result in similar gene expression and transcriptional profiles after stimulation of PBMC,
suggesting that the improved in vivo activity of Poly-ICLC may be related to the
stabilization effect rather than differences in TLR3 ligation [204]. While both stabilized
compounds demonstrate the capability of initiating potent LC-mediated immune
responses through the same mechanism of action, Poly-ICLC, which is produced in
118
clinical grade batches by Oncovir under the name Hiltonol, is currently being used in
clinical trials including studies to stimulate immunity against solid tumors and in dendritic
cells vaccines [189,190,191].
Recently, the FDA approved the first HPV DNA test as a front-line primary
screening method for cervical cancer based on the results of the large ATHENA
(Addressing THE Need for Advanced HPV Diagnostics) prospective clinical trial, which
evaluated hrHPV DNA testing against current clinical procedures for screening
[205,206]. The results of the ATHENA trial showed that an HPV DNA test can identify
women at risk for developing high-grade cervical disease better than a conventional
cytology test (Papanicolaou test). As HPV testing becomes widely implemented and is
used in conjunction with cytological review, there will be a larger number of women who
test positive for infection with hrHPV genotypes, potentially with no abnormal cytology or
with low-grade CIN lesions, for which standard care involves re-testing at set intervals.
There is no definitive treatment for such cases creating a clinical need for non-HPV
genotype specific treatment options such as s-Poly-I:C that can induce HPV clearance
through LC-mediated immune responses and by activation of innate anti-viral immunity.
Collectively our observations suggest that the TLR3 agonist s-Poly-I:C is a
promising therapeutic molecule that can overcome HPV-induced suppression of LC
immune function, and result in LC capable of stimulating anti-HPV CD8
+
T cell-mediated
immune responses. Looking forward, due to its pharmaceutical grade availability, good
safety profile in human clinical studies, and current results reported herein, the use of
Poly-ICLC to reverse HPV-induced suppression of LC activation in vivo should be
119
explored further clinically in order to induce anti-HPV immunity and enhance viral
clearance.

5.4 Materials and Methods
Patients and healthy donor material
Twenty subjects were enrolled into this prospective tissue and blood collection
study. Eligibility criteria included ability to give informed consent, immune competence
for leukapheresis collection, nonpregnant status, and for CIN patients, a biopsy-
confirmed diagnosis of CIN2/3. Written informed consent for blood and tissue sampling
was obtained from all individuals under an approved Institutional Review Board
protocol. Healthy donor volunteers (n=10) were recruited from the USC Health Sciences
Campus, and were enrolled into the study after a brief physical and completing a short
medical history questionnaire. CIN patients (n=10) were recruited from gynecology
clinics at USC-affiliated hospitals. Cervical cells were collected via cervical swab using
the Digene Cervical sampler (Qiagen, Valencia, CA) prior to DNA extraction using the
QIAamp MinElute Media Kit. Tissue specimens were obtained prior to cervical excision
of high-grade lesions per the standard of gynecologic practice. Pathologic findings were
confirmed on surgically excised cervical tissue. HIV status was determined by a HIV-
1/HIV-2/HIV-0 multiplex antibody-screening test. HPV genotyping was performed using
the INNO-LiPA HPV Genotyping Extra kit (Innogenetics, Seguin, TX). Low resolution
HLA-A2 determination was performed for all participants using standard endpoint PCR
and confirmed by flow cytometry using an anti-HLA-A2 antibody on isolated leukocytes.
For HLA-A2 positive donors, high resolution HLA-A2 genotyping was performed using
120
the A*02 SSP UniTray Kit (Life Technologies, Carlsbad, CA) to provide allele level
typing at the HLA-A2 locus. Blood samples were obtained by leukapheresis to enrich
PBMC. Leukocytes were purified immediately after collection using Lymphocyte
Separation Media (Corning, Manassas, VA) by density gradient centrifugation, and
cryopreserved in liquid nitrogen.

Antibodies, reagents and HPV16 viral particles
HLA-A BC FITC, HLA-DP,DQ,DR-FITC, CD80 FITC, CD86 FITC, CD83 PE,
CD1a PE, purified anti-human CCR7, Langerin PE, TLR3 PE were purchased from BD
Biosciences (San Jose, CA). CD40 PE, purified rat IgG2a, goat anti-rat IgG PE, mouse
IgG1 FITC, mouse IgG1 PE were purchased from Biolegend (San Diego, CA).
Recombinant human (rhu)-CCL21 was purchased from R&D Systems (Minneapolis,
MN). Rhu-GM-CSF was manufactured by Berlex (Seattle, WA) while rhu-TGFβ1 and
rhu-IL-4 were purchased from Biosource (Carlsbad, CA). Poly-ICR was provided by
Nventa Biopharmaceuticals/Akela Pharma (Austin, TX). Poly-ICLC was provided by
Oncovir, Inc. (Washington, D.C.) HPV16L1L2 virus-like particles (VLP) and chimeric
HPV16L1L2-E7 VLP (HPV16 cVLP) were produced in insect cells and purified as
previously described [186]. Endotoxin levels in VLP preparations were found to be
below 0.06 EU using an E-toxate kit (Sigma-Aldrich).

121
Langerhans cell generation
LC were generated from human PBMC as previously described [77]. Briefly,
PBMC and incubated in complete RPMI media with the addition of 1000 U/mL GM-CSF,
1000 U/mL IL-4, and 10 ng/ml TGFβ for 7 days. LC phenotype was confirmed by flow
cytometry as CD1a
+
Langerin
+
TLR3
+
.

LC activation assay and flow cytometry
LC were treated with HPV16 VLP prior to stimulation with TLR agonists, and
surface markers were detected by flow cytometry as previously described [207]. Briefly,
10
6
LC were seeded in a 6-well plate and either left untreated, treated with 10 µg
HPV16 VLP, or 10 µg HPV16 VLP for 4 h prior to treatment with s-Poly-I:C. After 48 h,
the cells were harvested, washed, stained for surface MHC I, MHC II, CD80, CD83,
CD86, CD40, CCR7 or isotype controls, and analyzed by flow cytometry. LC were gated
on size (large cells) based on forward and side scatter.

In Vitro Migration of LC
Chemokine directed migration towards CCL21 of LC was carried out using
transwell plates (Costar, Cambridge, MA) as previously described [208]. Briefly, 2 × 10
5

LC, untreated or treated with HPV16 VLP and/or s-Poly-I:C as indicated above, were
added to the upper chamber in triplicate wells and incubated for 4 h at 37°C. After 4 h,
cells that migrated to the lower chamber containing CCL21 or media alone were
counted using a Z1 Beckman Coulter particle counter. Where indicated, a migration
122
index was calculated as the number of cells migrating to CCL21 over spontaneous
migration for each treatment group.

Cytokine and chemokine analysis
Supernatants from 72 h cultures were assayed in triplicate using the Bio-Plex
Suspension Array System (Bio-Rad, Hercules, CA) [207]. Cytokines and chemokines
analyzed included IFNα, IL-1β, IL-6, IL-12p70, IP-10, TNFα, MCP-1, MIP-1α, MIP-1β,
and RANTES using a custom MilliPlex MAP Human Cytokine/Chemokine Panel per
manufacturer’s instructions (Millipore, Billerica, MA).

Mixed lymphocyte reaction assay
The MLR assay was performed as previously described [153,169,209]. HLA-
A*0201 LC were left untreated or treated with HPV16 VLP and s-Poly-I:C and co-
cultured with untreated, allogeneic, HLA-mismatched CD4
+
and CD8
+
T cells purified
from different donor PBMC by negative magnetic separation (Miltenyi, San Diego, CA).
Responder (R) T cells and irradiated stimulator (S) LC were cultured at R:S ratio of 20:1
in a 96-well round bottom plate in replicates of six per treatment for 5 days. T cells and
LC, each cultured alone, and T cells cultured with autologous PBMC were used as
negative controls, while T cells cultured with phytohaemagglutinin (PHA, Sigma-Aldrich)
serve as a positive control.
3
H-thymidine was added after 5 days to measure T cell
proliferation. After an additional 18 h, radioactive
3
H-thymidine-pulsed cells were
harvested and radioactivity counted on a TopCount microplate liquid scintillation counter
123
(Perkin Elmer, Waltham, MA). Proliferation indices were calculated as (mean
radioactive cpm experimental/mean cpm of T cells alone).

In vitro immunization with HPV16 E7
Autologous T cells and LC from HLA-A*0201
+
healthy donors or CIN patients
were co-cultured ex vivo over several weeks to elicit primary CD8
+
T cell responses
against HPV16 E7 using a previously described protocol [169,208]. LC were left
untreated or exposed to HPV16-L1/L2-E7 cVLP, then left untreated or treated with s-
Poly-I:C. As a positive control, other LC treated with s-Poly-I:C and were exogenously
loaded with HLA-A*0201 binding peptides (E7
11-19
or

E7
11-20
,

E7
82-90
and

E7
86-93
).
Autologous CD8
+
naïve T cells were co-cultured with irradiated LC at a 20:1 (R:S) ratio
for 7 days at 37 °C. Cultures were restimulated with untreated or treated LC at days 7,
14 and 21. After 28 days T cells were harvested and tested for peptide-specific IFN-γ
production by ELISPOT.

IFN-γ ELISPOT assay
The ELISPOT assay was performed according to an established laboratory
protocol. 96-well multiscreen-HTS plates (Millipore) were coated with 10µg/mL anti-
human IFNγ (clone 1-D1K, Mabtech, Mariemont, OH) in PBS overnight at 4ºC, washed
with PBS, and blocked for 2 h with complete media at 37°C. T cells collected after in
vitro immunization assays were plated at 2 × 10
5
cells/well in six replicate wells in the
presence or absence of the HLA-A*0201 restricted peptides for 18 h at 37°C, 5% CO
2
124
[208]. Wells were washed with PBS/0.5% Tween-20 and incubated with 1µg/mL
biotinylated anti-human IFNγ antibody (clone 7-B6-1, Mabtech), for 2 h followed by
incubation for 1 h with streptavidin-HRP (Sigma, St. Louis, MO). Spot development was
carried out with 3-amino-9-ethyl-carbazole substrate (Sigma). Spots were counted using
the video-imaging KS ELISPOT analysis system (Carl Zeiss, Thornwood, NY). The
number of spots in the medium control wells were subtracted from spots detected in
antigen-specific stimulation wells and was subsequently calculated as number of HPV
peptide-specific T cells per million PBMC.

Statistical analysis
Statistical analysis was performed using GraphPad Prism 6 (San Diego, CA).
Statistical significance of the different assays (activation assay, cytokine and chemokine
analysis, migration assay, MLR assay, and in vitro immunization assay) was determined
by a one-way ANOVA for overall significance followed by a Tukey’s multiple
comparisons test comparing all columns for pooled experiments from individual healthy
donor or patient samples, or a two-tailed Student’s t test for representative experiments
of technical replicates of single donors performed in triplicate. Results with P-values
<0.05 were considered significant.
125
CHAPTER 6. Discussion and Future Directions

A2t-mediated entry may represent a previously undescribed form of ligand-
induced endocytosis. It also appears that this process is exploited by many other
viruses to gain entry into cells, as demonstrated by previous investigations on different
viral infections. For example, in addition to its ability to inhibit HPV16 infection, it was
shown that SLPI has anti-human immunodeficiency virus type 1 (HIV-1) properties
[123,210]. More specifically, it was demonstrated that SPLI inhibits HIV-1 infection of
macrophages by binding to and blocking A2t [94]. Similarly, it was demonstrated that
SLPI results in reduced herpes simplex virus (HSV) infection [211], and furthermore,
that HSV infection causes a sustained downregulation of SLPI [93], which we recently
demonstrated promotes viral entry of HPV16 through A2t (Skeate et al, submitted
manuscript). These latest results provide the first mechanism for the historic link
between HSV and cervical cancer, and highlight the impact that A2t-mediated
endocytosis may have. In addition to HIV and HSV, A2t has been implicated in the
infections of cytomegalovirus (CMV), respiratory syncytial virus, and Enterovirus 71
[106,108,109]. Interestingly, CMV uses A2t for infection along with other molecules
mentioned for HPV16 such as HSPGs, EGFR, and integrins [111], which may implicate
these in the A2t-mediated endocytic pathway. Despite these identified associations, the
virology literature regarding A2t has primarily utilized anti-A2 Abs that inhibit infection or
traditional co-IP assays. No studies on A2t and viral entry have investigated how A2t
facilitates membrane curvature and viral endocytosis, which is an intriguing future
126
direction that would have broad implications for A2t-utilizing viruses and for A2t cell
biology in general.
For these reasons, a primary future direction is to structurally and functionally
characterize the novel A2t-mediated endocytic pathway. Viruses have evolved to exploit
multiple endocytic pathways, and ligand-induced A2t-mediated entry may be one of
these pathways. Based on the data presented in Chapter 2-4, we have developed a
working model of A2t-mediated HPV16 entry as a surrogate for A2t-mediated
Figure 6.1. Our proposed model for HPV16 binding and entry into host
epithelial cells. L2 can bind directly to A2t, suggesting it is a site of lipid membrane
docking together with previously identified proteins involved with HPV16 infection.
Using this model as a framework, we will test the hypotheses that 1) L2 binding to
A2t is responsible for initial membrane invaginations based on structural properties of
A2t; 2) A2t-mediated endocytosis represents a new type of endocytic pathway that is
clathrin-, caveolin-, cholesterol-, and dynamin-independent and which is utilized by
HPV and other viruses; and 3) the ability of A2t to change its structure at acidic pH
permits endosomal membrane disruption and viral genome endosomal escape.
Figure adapted from our recent publication.

127
endocytosis in general that incorporates most of the current molecules that have been
well studied in HPV16 entry, bringing together years of disparate data (Figure 6.1)
[131]. Although we now know that A2t is involved in infectious HPV16 endocytosis, the
remaining unanswered questions are the molecular details of how A2t mediates
endocytosis, what other proteins are involved, and how the structure of the complex
contributes to its function. As highlighted by the proposed model, and opposed to a
sequential handoff of HPV16 from one molecule to another, we hypothesize that a
receptor complex coalesces and may incorporate some or all of the mentioned
molecules including HSPGs, CyPB, integrins, tetraspanins, GFRs, and importantly A2t.
Future directions to investigate aspects of this model specifically include: 1) structural
atomistic mapping of the relevant membrane-bound receptor form of A2t and A2t bound
to HPV16 using EPR and x-ray crystallography methods, 2) defining the receptor
complex involved in HPV16 entry via Single Molecule Pulldown (SiMPull) techniques,
and 3) defining how the structure of A2t contributes to membrane invagination of HPV16
at neutral pH and endosomal escape at acidic pH using synthetic vesicles. Answering
these questions would lay the foundation for defining the molecular mechanisms that
control the initial steps of HPV infection, and would guide future efforts to prevent A2t-
utilizing viral infections.
The data presented in Chapter 2 and 4 show that SLPI, a known ligand of A2t,
inhibits HPV16 entry into epithelial cells and LC in vitro [73,192]. SLPI is a mediator of
mucosal immunity, and we have demonstrated that there is a decrease of SLPI in HPV-
positive head and neck cancers in vivo, implicating that reduced levels of SLPI are
associated HPV susceptibility, and conversely that high SLPI levels provide HPV
128
protection [6,125]. Similarly, high mucosal SLPI levels are also associated with
protection from HIV-1 infection of macrophages, particularly in the oral mucosa [212],
and the anti-HIV-1 activity of SLPI is independent of its anti-protease activity
[210,213,214]. Macrophages are abundant in cervical epithelium and their presence is
increased during an active sexually transmitted infection [215], making macrophages
initial targets for HIV infection [216]. Ma et al. demonstrated that the anti-HIV-1 activity
of SLPI on macrophages was mediated through an interaction with A2t [94], and
findings by Ryzhova et al. demonstrated that the interaction between A2 and the HIV-1
Gag protein is essential for proper HIV assembly in monocyte-derived macrophages
[217]. Therefore, a future direction is to structurally map the physiologically relevant
SLPI binding site(s) to A2t that has been shown to be important for both HPV16 and
HIV-1. Mapping the site of SLPI binding to A2t may also guide the development of
different classes of small molecules that can bind to the same site, thus preventing HPV
infection [122].
A preliminary study by Reddy et al. used computational and pharmacophore
modeling techniques to identify several triazole compounds that inhibit the interaction of
the N-terminus of A2 with S100A10, which was the impetus for the work presented in
Chapter 3. Our results clearly indicate that these first-generation A2t inhibitors (A2ti-1°)
effectively block HPV16 infection of epithelial cells in vitro. However, we also observed
off-target effects such as reduced mitosis in A2ti treated cells (data not shown), limiting
the interpretation of these results as nuclear envelope breakdown during mitosis is
required for HPV infection. More recently, Reddy et al. published a follow-up study in
which they optimized a particular subset of these triazoles with greatly improved affinity
129
and increased A2t inhibitory potency [218]. Therefore, due the work in Chapter 3 that
showed the viral blocking capacity of A2ti-1°, a future direction is to investigate the
ability of the newly optimized second-generation A2t inhibitors (A2ti-2°) to block HPV16
infection of epithelial cells. Additionally, A2ti-2° could be tested for their ability to inhibit
HIV-1 infection of macrophages.
The work presented on Langerhans cells and HPV infection in Chapters 4 and 5
has opened the door for several future directions. Chapter 4 concludes that A2t-
mediated entry into LC is part of a mechanism employed by HPV16 to evade immune
detection, and our previous work indicates that this mechanism is unique to LC
compared to other APC. Birbeck granules are tennis racquet shaped organelles that are
also unique to LC, but whose function is still under question [219]. Birbeck granules
have been described as having central linear disks of two limiting membranes,
separated by leaflets with periodic "zipperlike" striations. Interestingly, the Langen lab
has demonstrated that tubules induced by A2 on synthetic phospholipid bilayer vesicles
have a remarkably similar structure to the tubular rod-like striated “handles” of the tennis
racquets seen on Birbeck granules (data not shown). Therefore, a future direction is to
investigate if Birbeck granules are formed in part by A2t-stabilized tubules, and if they
are involved in the A2t-mediated endocytosis pathway in LC.
Finally, Chapter 5 laid the groundwork for future clinical trials utilizing Poly-ICLC
in the treatment of precancerous cervical lesions. We initially utilized Poly-ICR as a
proof-of-concept for using a TLR3 agonist to activate LC and overcome HPV16-induced
immune suppression with extremely promising results. We then confirmed these results
using the pharmaceutical grade compound Poly-ICLC, which is marketed under the
130
name Hiltonol by Oncovir, and is currently being used in several ongoing clinical trials.
Though it has demonstrated high immunostimulatory potency, one of the important
results from these clinical trials is the noted safety of Poly-ICLC [220]. Therefore, due to
its pharmaceutical grade availability, good safety profile in human clinical studies, and
current results reported herein, the use of Poly-ICLC should be explored in a clinical
setting to clear HPV-induced precancerous lesions, and in the future could also be used
to treat low-grade lesions where currently no treatments exist.
The findings presented in this dissertation are novel and have important
implications in potential prevention and treatment strategies of multiple cancers that
cause significant morbidity and mortality worldwide. These results are the first to identify
and describe an L2-specific receptor for HPV16 that mediates both infectious entry of
epithelial cells and suppression of LC immune function. The use of newly designed
drugs that target this receptor were shown to prevent HPV infection and promote LC
activation. We further describe the novel use of a TLR3 agonist as a potential
immunotherapeutic strategy to treat hrHPV infections. Taken together these studies are
of major impact as they describe an HPV entry mechanism responsible for establishing
and maintaining a persistent HPV infection and they test novel compounds that can
prevent and or treat HPV infection, which are in line with the ultimate goal of eradicating
HPV-related cancers.

131

References Cited

1. Walboomers JMM, Jacobs MV, Manos MM, Bosch FX, Kummer JA, et al. (1999)
Human papillomavirus is a necessary cause of invasive cervical cancer
worldwide. The Journal of Pathology 189: 12-19.
2. Faridi R, Zahra A, Khan K, Idrees M (2011) Oncogenic potential of Human
Papillomavirus (HPV) and its relation with cervical cancer. Virology Journal 8:
269-277.
3. Arbyn M, Castellsague X, de Sanjose S, Bruni L, Saraiya M, et al. (2011) Worldwide
burden of cervical cancer in 2008. Ann Oncol 22: 2675-2686.
4. Haedicke J, Iftner T (2013) Human papillomaviruses and cancer. Radiotherapy and
oncology : journal of the European Society for Therapeutic Radiology and
Oncology.
5. Bosch F MM, Munoz N, Sherman M, Jansen A, Peto J, Schiffman M, Moreno V,
Kurman R, Shah K (1995) Prevalence of human papillomavirus in cervical
cancer: a worldwide perspective. International biological study on servical cancer
(IBSCC) Study Group. J Natl Cancer Inst 87: 796-802.
6. Hoffmann M, Quabius ES, Tribius S, Hebebrand L, Gorogh T, et al. (2013) Human
papillomavirus infection in head and neck cancer: the role of the secretory
leukocyte protease inhibitor. Oncology reports 29: 1962-1968.
7. Evander MF, I.H.; Payne, E.; Qi, Y.M.; Hengst, K.; et al. (1997) Identification of the
alpha6 integrin as a candidate receptor for papillomaviruses. Journal of virology
71: 2449-2456.
8. Joyce JGT, J.S.; Przysiecki, C.T.; Cook, J.C.; Lehman, E.D.; et al. (1999) The L1
major capsid protein of human papillomavirus type 11 recombinant virus-like
particles interacts with heparin and cell-surface glycosaminoglycans on human
keratinocytes. J Biol Chem 274: 5810-5822.
9. Richards RM LD, Schiller JT, Day PM (2006) Cleavage of the papillomavirus minor
capsid protein, L2, at a furin consensus site is necessary for infection. Proc Natl
Acad Sci USA 103: 1522-1527.
10. Stanley MAP, M.R.; Coleman, N. (2007) HPV: from infection to cancer. Biochemical
Society Transactions 35: 1456-1460.
11. Merad M, Ginhoux F, Collin M (2008) Origin, homeostasis and function of
Langerhans cells and other langerin-expressing dendritic cells. Nature reviews
Immunology 8: 935-947.
12. Marsh M, Helenius A (2006) Virus entry: open sesame. Cell 124: 729-740.
13. Mercer J, Schelhaas M, Helenius A (2010) Virus entry by endocytosis. Annual
review of biochemistry 79: 803-833.
14. Sieczkarski SB, Whittaker GR (2005) Viral entry. Current topics in microbiology and
immunology 285: 1-23.
132
15. Cumming SC-I, T.; Milligan, S.; Graham S.V. (2008) Human Papillomavirus type 16
late gene expression is regulated by cellular RNA processing factors in response
to epithelial differentiation. Biochemical Society Transactions 36: 522-524.
16. Modis Y, Trus BL, Harrison SC (2002) Atomic model of the papillomavirus capsid.
The EMBO journal 21: 4754-4762.
17. Buck CB, Cheng N, Thompson CD, Lowy DR, Steven AC, et al. (2008) Arrangement
of L2 within the papillomavirus capsid. Journal of virology 82: 5190-5197.
18. Baker TS, Newcomb WW, Olson NH, Cowsert LM, Olson C, et al. (1991) Structures
of bovine and human papillomaviruses. Analysis by cryoelectron microscopy and
three-dimensional image reconstruction. Biophysical journal 60: 1445-1456.
19. Kondo K, Ishii Y, Ochi H, Matsumoto T, Yoshikawa H, et al. (2007) Neutralization of
HPV16, 18, 31, and 58 pseudovirions with antisera induced by immunizing
rabbits with synthetic peptides representing segments of the HPV16 minor capsid
protein L2 surface region. Virology 358: 266-272.
20. Finnen RL, Erickson KD, Chen XS, Garcea RL (2003) Interactions between
papillomavirus L1 and L2 capsid proteins. Journal of virology 77: 4818-4826.
21. Unckell F, Streeck RE, Sapp M (1997) Generation and neutralization of
pseudovirions of human papillomavirus type 33. Journal of virology 71: 2934-
2939.
22. Kawana K, Yoshikawa H, Taketani Y, Yoshiike K, Kanda T (1998) In vitro
construction of pseudovirions of human papillomavirus type 16: incorporation of
plasmid DNA into reassembled L1/L2 capsids. Journal of virology 72: 10298-
10300.
23. Zhou JS, X.Y.; Louis, K.; Frazer, H. (1994 ) Interaction of human papillomavirus
(HPV) type 16 capsid proteins with HPV DNA requires an intact L2 N-terminal
sequence. Journal of virology 68: 619-625.
24. Zhao KN, Sun XY, Frazer IH, Zhou J (1998) DNA packaging by L1 and L2 capsid
proteins of bovine papillomavirus type 1. Virology 243: 482-491.
25. Buck CB, Thompson CD, Pang YY, Lowy DR, Schiller JT (2005) Maturation of
papillomavirus capsids. Journal of virology 79: 2839-2846.
26. Holmgren SC, Patterson NA, Ozbun MA, Lambert PF (2005) The minor capsid
protein L2 contributes to two steps in the human papillomavirus type 31 life cycle.
Journal of virology 79: 3938-3948.
27. Kämper ND, P.M.; Nowak, T.; Selinka, H.; Florin, L.; et al. (2006) A membrane-
destabilizing peptide in capsid protein L2 is required for egress of papillomavirus
genomes from endosomes. Journal of virology 80: 759-768.
28. Bronnimann MP, Chapman JA, Park CK, Campos SK (2013) A transmembrane
domain and GxxxG motifs within L2 are essential for papillomavirus infection.
Journal of virology 87: 464-473.
29. Bergant Marusic M, Ozbun MA, Campos SK, Myers MP, Banks L (2012) Human
papillomavirus L2 facilitates viral escape from late endosomes via sorting nexin
17. Traffic 13: 455-467.
30. Yang R, Yutzy WHt, Viscidi RP, Roden RB (2003) Interaction of L2 with beta-actin
directs intracellular transport of papillomavirus and infection. The Journal of
biological chemistry 278: 12546-12553.
133
31. Schneider MA, Spoden GA, Florin L, Lambert C (2011) Identification of the dynein
light chains required for human papillomavirus infection. Cellular microbiology 13:
32-46.
32. Day PM, Baker CC, Lowy DR, Schiller JT (2004) Establishment of papillomavirus
infection is enhanced by promyelocytic leukemia protein (PML) expression.
Proceedings of the National Academy of Sciences of the United States of
America 101: 14252-14257.
33. Ishii Y, Ozaki S, Tanaka K, Kanda T (2005) Human papillomavirus 16 minor capsid
protein L2 helps capsomeres assemble independently of intercapsomeric
disulfide bonding. Virus genes 31: 321-328.
34. Kirnbauer R, Booy F, Cheng N, Lowy DR, Schiller JT (1992) Papillomavirus L1
major capsid protein self-assembles into virus-like particles that are highly
immunogenic. Proceedings of the National Academy of Sciences of the United
States of America 89: 12180-12184.
35. Zhou J, Sun XY, Stenzel DJ, Frazer IH (1991) Expression of vaccinia recombinant
HPV 16 L1 and L2 ORF proteins in epithelial cells is sufficient for assembly of
HPV virion-like particles. Virology 185: 251-257.
36. Hagensee ME, Yaegashi N, Galloway DA (1993) Self-assembly of human
papillomavirus type 1 capsids by expression of the L1 protein alone or by
coexpression of the L1 and L2 capsid proteins. Journal of virology 67: 315-322.
37. Kirnbauer R, Taub J, Greenstone H, Roden R, Durst M, et al. (1993) Efficient self-
assembly of human papillomavirus type 16 L1 and L1-L2 into virus-like particles.
Journal of virology 67: 6929-6936.
38. Hofmann KJ, Cook JC, Joyce JG, Brown DR, Schultz LD, et al. (1995) Sequence
determination of human papillomavirus type 6a and assembly of virus-like
particles in Saccharomyces cerevisiae. Virology 209: 506-518.
39. Roden RB, Greenstone HL, Kirnbauer R, Booy FP, Jessie J, et al. (1996) In vitro
generation and type-specific neutralization of a human papillomavirus type 16
virion pseudotype. Journal of virology 70: 5875-5883.
40. Giroglou T, Florin L, Schafer F, Streeck RE, Sapp M (2001) Human papillomavirus
infection requires cell surface heparan sulfate. Journal of virology 75: 1565-1570.
41. Buck CB, Pastrana DV, Lowy DR, Schiller JT (2004) Efficient intracellular assembly
of papillomaviral vectors. Journal of virology 78: 751-757.
42. Pyeon D, Lambert PF, Ahlquist P (2005) Production of infectious human
papillomavirus independently of viral replication and epithelial cell differentiation.
Proceedings of the National Academy of Sciences of the United States of
America 102: 9311-9316.
43. Fligge C, Schafer F, Selinka HC, Sapp C, Sapp M (2001) DNA-induced structural
changes in the papillomavirus capsid. Journal of virology 75: 7727-7731.
44. Meyers C, Frattini MG, Hudson JB, Laimins LA (1992) Biosynthesis of human
papillomavirus from a continuous cell line upon epithelial differentiation. Science
257: 971-973.
45. Meyers C, Mayer TJ, Ozbun MA (1997) Synthesis of infectious human
papillomavirus type 18 in differentiating epithelium transfected with viral DNA.
Journal of virology 71: 7381-7386.
134
46. Frattini MG, Lim HB, Doorbar J, Laimins LA (1997) Induction of human
papillomavirus type 18 late gene expression and genomic amplification in
organotypic cultures from transfected DNA templates. Journal of virology 71:
7068-7072.
47. Ozbun MA (2002) Infectious human papillomavirus type 31b: purification and
infection of an immortalized human keratinocyte cell line. The Journal of general
virology 83: 2753-2763.
48. Conway MJ, Alam S, Ryndock EJ, Cruz L, Christensen ND, et al. (2009) Tissue-
spanning redox gradient-dependent assembly of native human papillomavirus
type 16 virions. Journal of virology 83: 10515-10526.
49. Selinka HC, Giroglou T, Nowak T, Christensen ND, Sapp M (2003) Further evidence
that papillomavirus capsids exist in two distinct conformations. Journal of virology
77: 12961-12967.
50. Chen HS, Conway MJ, Christensen ND, Alam S, Meyers C (2011) Papillomavirus
capsid proteins mutually impact structure. Virology 412: 378-383.
51. Roden RBK, R.; Jenson, A.B.; Lowy, D.R.; Schiller J.T. (1994) Interaction of
papillomaviruses with the cell surface. Journal of virology 68: 7260-7266.
52. Day PM, Lowy DR, Schiller JT (2003) Papillomaviruses infect cells via a clathrin-
dependent pathway. Virology 307: 1-11.
53. Schelhaas M, Shah B, Holzer M, Blattmann P, Kuhling L, et al. (2012) Entry of
human papillomavirus type 16 by actin-dependent, clathrin- and lipid raft-
independent endocytosis. PLoS Pathogens 8: e1002657.
54. Fausch SC DSD, Kast WM (2003) Differential uptake and cross-presentation of
human papillomavirus virus-like particles by dendritic cells and Langerhans cells.
Cancer Research 63: 3478-3482.
55. Selinka H FL, Patel HD, Freitag K, Schmidtke M, et al. (2007) Inhibition of transfer to
secondary receptors by heparan sulfate-binding drug or antibody induces
noninfectious uptake of human papillomavirus. Journal of virology 81: 10970-
10980.
56. Huang HS, Lambert PF (2012) Use of an in vivo animal model for assessing the role
of integrin alpha(6)beta(4) and Syndecan-1 in early steps in papillomavirus
infection. Virology 433: 395-400.
57. Kines RC, Thompson CD, Lowy DR, Schiller JT, Day PM (2009) The initial steps
leading to papillomavirus infection occur on the basement membrane prior to cell
surface binding. Proceedings of the National Academy of Sciences of the United
States of America 106: 20458-20463.
58. Boukamp P, Petrussevska RT, Breitkreutz D, Hornung J, Markham A, et al. (1988)
Normal keratinization in a spontaneously immortalized aneuploid human
keratinocyte cell line. The Journal of cell biology 106: 761-771.
59. Abban CY, Meneses PI (2010) Usage of heparan sulfate, integrins, and FAK in
HPV16 infection. Virology 403: 1-16.
60. Johnson KM, Kines RC, Roberts JN, Lowy DR, Schiller JT, et al. (2009) Role of
heparan sulfate in attachment to and infection of the murine female genital tract
by human papillomavirus. Journal of virology 83: 2067-2074.
61. Culp TDB, L.R.; Marinkovich, M.P.; Meneguzzi, G.; Christensen, N.D. (2006)
Keratinocyte-secreted laminin 5 can function as a transient receptor for human
135
papillomaviruses by binding virions and transferring them to adjacent cells.
Journal of virology 80: 8940-8950.
62. Bienkowska-Haba MP, H.D.; Sapp, M. (2009) Target cell cyclophilins facilitate
human papillomavirus type 16 infection. PLoS Pathogens 5: e1000524.
63. Bienkowska-Haba M, Williams C, Kim SM, Garcea RL, Sapp M (2012) Cyclophilins
Facilitate Dissociation of the HPV16 Capsid Protein L1 from the L2/DNA
Complex Following Virus Entry. Journal of virology 88: 9875-9887.
64. Day PM LD, Schiller JT (2008) Heparan sulfate-independent cell binding and
infection with furin-precleaved papillomavirus capsids. Journal of virology 82:
12565-12568.
65. Richards RM, Lowy DR, Schiller JT, Day PM (2006) Cleavage of the papillomavirus
minor capsid protein, L2, at a furin consensus site is necessary for infection.
Proceedings of the National Academy of Sciences of the United States of
America 103: 1522-1527.
66. Day PM, Gambhira R, Roden RB, Lowy DR, Schiller JT (2008) Mechanisms of
human papillomavirus type 16 neutralization by l2 cross-neutralizing and l1 type-
specific antibodies. Journal of virology 82: 4638-4646.
67. Yoon CS, Kim KD, Park SN, Cheong SW (2001) alpha(6) Integrin is the main
receptor of human papillomavirus type 16 VLP. Biochemical and biophysical
research communications 283: 668-673.
68. Surviladze Z, Dziduszko A, Ozbun MA (2012) Essential roles for soluble virion-
associated heparan sulfonated proteoglycans and growth factors in human
papillomavirus infections. PLoS Pathogens 8: e1002519.
69. Surviladze Z, Sterk RT, Deharo SA, Ozbun MA (2012) Cellular Entry of Human
Papillomavirus Type 16 Involves Activation of the PI3K/Akt/mTOR Pathway and
Inhibition of Autophagy. Journal of virology 87: 2508-2517.
70. Spoden G, Freitag K, Husmann M, Boller K, Sapp M, et al. (2008) Clathrin- and
caveolin-independent entry of human papillomavirus type 16--involvement of
tetraspanin-enriched microdomains (TEMs). PLoS ONE 3: e3313.
71. Scheffer KD, Gawlitza A, Spoden GA, Zhang XA, Lambert C, et al. (2013)
Tetraspanin CD151 mediates papillomavirus type 16 endocytosis. Journal of
virology 87: 3435-3446.
72. Volpers C, Schirmacher P, Streeck RE, Sapp M (1994) Assembly of the major and
the minor capsid protein of human papillomavirus type 33 into virus-like particles
and tubular structures in insect cells. Virology 200: 504-512.
73. Woodham AW, Da Silva DM, Skeate JG, Raff AB, Ambroso MR, et al. (2012) The
S100A10 subunit of the annexin A2 heterotetramer facilitates L2-mediated
human papillomavirus infection. PLoS ONE 7: e43519.
74. Kawana Y, Kawana K, Yoshikawa H, Taketani Y, Yoshiike K, et al. (2001) Human
papillomavirus type 16 minor capsid protein l2 N-terminal region containing a
common neutralization epitope binds to the cell surface and enters the
cytoplasm. Journal of virology 75: 2331-2336.
75. Legatt GRF, I.H. (2007) HPV vaccines: the beginning of the end for cervical cancer.
Biochemical Society Transactions 35: 232-238.
76. Fausch SC, Da Silva DM, Rudolf MP, Kast WM (2002) Human papillomavirus virus-
like particles do not activate Langerhans cells: a possible immune escape
136
mechanism used by human papillomaviruses. Journal of immunology 169: 3242-
3249.
77. Fahey LM, Raff AB, Da Silva DM, Kast WM (2009) Reversal of human
papillomavirus-specific T cell immune suppression through TLR agonist
treatment of Langerhans cells exposed to human papillomavirus type 16. Journal
of immunology 182: 2919-2928.
78. Fahey LM, Raff AB, Da Silva DM, Kast WM (2009) A major role for the minor capsid
protein of human papillomavirus type 16 in immune escape. Journal of
immunology 183: 6151-6156.
79. Yan M, Peng J, Jabbar IA, Liu X, Filgueira L, et al. (2004) Despite differences
between dendritic cells and Langerhans cells in the mechanism of
papillomavirus-like particle antigen uptake, both cells cross-prime T cells.
Virology 324: 297-310.
80. Bousarghin L, Hubert P, Franzen E, Jacobs N, Boniver J, et al. (2005) Human
papillomavirus 16 virus-like particles use heparan sulfates to bind dendritic cells
and colocalize with langerin in Langerhans cells. The Journal of general virology
86: 1297-1305.
81. Spoden GF, K.; Husmann, M.; Boller, K.; Sapp, M.; et al. (2008) Clathrin- and
caveolin-independent entry of human papillomavirus type 16--involvement of
tetraspanin-enriched microdomains (TEMs). PLoS ONE 3: e3313.
82. Dasgupta J, Bienkowska-Haba M, Ortega ME, Patel HD, Bodevin S, et al. (2011)
Structural basis of oligosaccharide receptor recognition by human papillomavirus.
The Journal of biological chemistry 286: 2617-2624.
83. Pereira R, Hitzeroth, II, Rybicki EP (2009) Insights into the role and function of L2,
the minor capsid protein of papillomaviruses. Archives of virology 154: 187-197.
84. Slupetzky K, Gambhira R, Culp TD, Shafti-Keramat S, Schellenbacher C, et al.
(2007) A papillomavirus-like particle (VLP) vaccine displaying HPV16 L2 epitopes
induces cross-neutralizing antibodies to HPV11. Vaccine 25: 2001-2010.
85. Kawana K, Yoshikawa H, Taketani Y, Yoshiike K, Kanda T (1999) Common
neutralization epitope in minor capsid protein L2 of human papillomavirus types
16 and 6. Journal of virology 73: 6188-6190.
86. Conway MJ, Cruz L, Alam S, Christensen ND, Meyers C (2011) Cross-neutralization
potential of native human papillomavirus N-terminal L2 epitopes. PLoS ONE 6:
e16405.
87. Gambhira R, Karanam B, Jagu S, Roberts JN, Buck CB, et al. (2007) A protective
and broadly cross-neutralizing epitope of human papillomavirus L2. Journal of
virology 81: 13927-13931.
88. Embers ME, Budgeon LR, Culp TD, Reed CA, Pickel MD, et al. (2004) Differential
antibody responses to a distinct region of human papillomavirus minor capsid
proteins. Vaccine 22: 670-680.
89. Yang R, Day PM, Yutzy WH, Lin KY, Hung CF, et al. (2003) Cell Surface-Binding
Motifs of L2 That Facilitate Papillomavirus Infection. Journal of virology 77: 3531-
3541.
90. Rawls WE TW, Figueroa ME, Melnick JL (1968) Herpesvirus type 2: association
with carcinoma of the cervix. Science 161: 1255-1256.
137
91. Simon JW (1976) The association of Herpes simplex virus and cervical cancer: a
review. Gynecologic oncology 4: 108-116.
92. Park M, Kitchener HC, Macnab JC (1983) Detection of herpes simplex virus type-2
DNA restriction fragments in human cervical carcinoma tissue. The EMBO
journal 2: 1029-1034.
93. Fakioglu E, Wilson SS, Mesquita PM, Hazrati E, Cheshenko N, et al. (2008) Herpes
simplex virus downregulates secretory leukocyte protease inhibitor: a novel
immune evasion mechanism. Journal of virology 82: 9337-9344.
94. Ma G, Greenwell-Wild T, Lei K, Jin W, Swisher J, et al. (2004) Secretory leukocyte
protease inhibitor binds to annexin II, a cofactor for macrophage HIV-1 infection.
The Journal of experimental medicine 200: 1337-1346.
95. Waisman DM (1995) Annexin II tetramer: structure and function. Molecular and
Cellular Biochemistry 149/150: 301-322.
96. Rescher U, Gerke V (2008) S100A10/p11: family, friends and functions. Pflugers
Archiv : European journal of physiology 455: 575-582.
97. Pena-Alonso E, Rodrigo JP, Parra IC, Pedrero JM, Meana MV, et al. (2008)
Annexin A2 localizes to the basal epithelial layer and is down-regulated in
dysplasia and head and neck squamous cell carcinoma. Cancer letters 263: 89-
98.
98. Buck CB, Day PM, Thompson CD, Lubkowski J, Lu W, et al. (2006) Human alpha-
defensins block papillomavirus infection. Proceedings of the National Academy of
Sciences of the United States of America 103: 1516-1521.
99. Deora AB, Kreitzer G, Jacovina AT, Hajjar KA (2004) An annexin 2 phosphorylation
switch mediates p11-dependent translocation of annexin 2 to the cell surface.
The Journal of biological chemistry 279: 43411-43418.
100. Longhi S, Belle V, Fournel A, Guigliarelli B, Carriere F (2011) Probing structural
transitions in both structured and disordered proteins using site-directed spin-
labeling EPR spectroscopy. Journal of peptide science : an official publication of
the European Peptide Society 17: 315-328.
101. Puisieux A, Ji J, Ozturk M (1996) Annexin II up-regulates cellular levels of p11
protein by a post-translational mechanisms. The Biochemical journal 313 ( Pt 1):
51-55.
102. He KL, Deora AB, Xiong H, Ling Q, Weksler BB, et al. (2008) Endothelial cell
annexin A2 regulates polyubiquitination and degradation of its binding partner
S100A10/p11. The Journal of biological chemistry 283: 19192-19200.
103. Zhang J, Guo B, Zhang Y, Cao J, Chen T (2010) Silencing of the annexin II gene
down-regulates the levels of S100A10, c-Myc, and plasmin and inhibits breast
cancer cell proliferation and invasion. Saudi medical journal 31: 374-381.
104. Dreier R, Schmid KW, Gerke V, Riehemann K (1998) Differential expression of
annexins I, II and IV in human tissues: an immunohistochemical study.
Histochemistry and cell biology 110: 137-148.
105. Gerke V, Creutz CE, Moss SE (2005) Annexins: linking Ca2+ signalling to
membrane dynamics. Nature reviews Molecular cell biology 6: 449-461.
106. Wright JF, Kurosky A, Wasi S (1994) An endothelial cell-surface form of annexin II
binds human cytomegalovirus. Biochemical and biophysical research
communications 198: 983-989.
138
107. Raynor CM, Wright JF, Waisman DM, Pryzdial EL (1999) Annexin II enhances
cytomegalovirus binding and fusion to phospholipid membranes. Biochemistry
38: 5089-5095.
108. Malhotra R, Ward M, Bright H, Priest R, Foster MR, et al. (2003) Isolation and
characterisation of potential respiratory syncytial virus receptor(s) on epithelial
cells. Microbes and infection / Institut Pasteur 5: 123-133.
109. Yang SL, Chou YT, Wu CN, Ho MS (2011) Annexin II Binds to Capsid Protein VP1
of Enterovirus 71 and Enhances Viral Infectivity. Journal of virology 85: 11809-
11820.
110. Shao C, Zhang F, Kemp MM, Linhardt RJ, Waisman DM, et al. (2006)
Crystallographic analysis of calcium-dependent heparin binding to annexin A2.
The Journal of biological chemistry 281: 31689-31695.
111. Compton T (2004) Receptors and immune sensors: the complex entry path of
human cytomegalovirus. Trends in cell biology 14: 5-8.
112. Duncan CJ, Sattentau QJ (2011) Viral determinants of HIV-1 macrophage tropism.
Viruses 3: 2255-2279.
113. Schiller JT, Day PM, Kines RC (2010) Current understanding of the mechanism of
HPV infection. Gynecol Oncol 118: S12-17.
114. Day PM, Gambhira R, Roden RB, Lowy DR, Schiller JT (2008) Mechanisms of
human papillomavirus type 16 neutralization by l2 cross-neutralizing and l1 type-
specific antibodies. J Virol 82: 4638-4646.
115. Mitra SKS, D.D. (2006) Integrin-regulated FAK-Src signaling in normal and cancer
cells. Curren Opinion in Cell Biology 18: 516-523.
116. Serrels B, Frame MC (2012) FAK and talin: who is taking whom to the integrin
engagement party? The Journal of cell biology 196: 185-187.
117. Hayes M, J.; Shao, D.; Grieve, A.; Levine, T.; Bailly, M.; et al. (2009) Annexin A2 at
the interface between F-actin and membranes enriched in phosphatidylinositol
4,5,-bisphosphate. Biochim Biophys Acta 1793: 1086-1095.
118. Willis SH, Rux AH, Peng C, Whitbeck JC, Nicola AV, et al. (1998) Examination of
the kinetics of herpes simplex virus glycoprotein D binding to the herpesvirus
entry mediator, using surface plasmon resonance. Journal of virology 72: 5937-
5947.
119. Moreau T, Baranger K, Dade S, Dallet-Choisy S, Guyot N, et al. (2008)
Multifaceted roles of human elafin and secretory leukocyte proteinase inhibitor
(SLPI), two serine protease inhibitors of the chelonianin family. Biochimie 90:
284-295.
120. Williams SE, Brown TI, Roghanian A, Sallenave JM (2006) SLPI and elafin: one
glove, many fingers. Clinical science 110: 21-35.
121. Moriyama A, Shimoya K, Ogata I, Kimura T, Nakamura T, et al. (1999) Secretory
leukocyte protease inhibitor (SLPI) concentrations in cervical mucus of women
with normal menstrual cycle. Molecular human reproduction 5: 656-661.
122. Kramps JA, Franken C, Dijkman JH (1984) ELISA for quantitative measurement of
low-molecular-weight bronchial protease inhibitor in human sputum. The
American review of respiratory disease 129: 959-963.
123. McNeely TB, Dealy M, Dripps DJ, Orenstein JM, Eisenberg SP, et al. (1995)
Secretory leukocyte protease inhibitor: a human saliva protein exhibiting anti-
139
human immunodeficiency virus 1 activity in vitro. The Journal of clinical
investigation 96: 456-464.
124. Vogelmeier C, Hubbard RC, Fells GA, Schnebli HP, Thompson RC, et al. (1991)
Anti-neutrophil elastase defense of the normal human respiratory epithelial
surface provided by the secretory leukoprotease inhibitor. The Journal of clinical
investigation 87: 482-488.
125. Cordes C, Hasler R, Werner C, Gorogh T, Rocken C, et al. (2011) The level of
secretory leukocyte protease inhibitor is decreased in metastatic head and neck
squamous cell carcinoma. International journal of oncology 39: 185-191.
126. Langen R, Isas JM, Luecke H, Haigler HT, Hubbell WL (1998) Membrane-
mediated assembly of annexins studied by site-directed spin labeling. The
Journal of biological chemistry 273: 22453-22457.
127. Rety S, Sopkova J, Renouard M, Osterloh D, Gerke V, et al. (1999) The crystal
structure of a complex of p11 with the annexin II N-terminal peptide. Nature
structural biology 6: 89-95.
128. Buck CB, Thompson CD (2007) Production of papillomavirus-based gene transfer
vectors. Current protocols in cell biology / editorial board, Juan S Bonifacino [et
al] Chapter 26: Unit 26 21.
129. Kirnbauer RB, F.; Cheng, N.; Lowy, D.R.; Schiller J.T. (1992) Papillomavirus L1
major capsid protein self-assembles into virus-like particles that are highly
immunogenic. Proc Natl Acad Sci U S A 89: 12180-12184.
130. Forman D, de Martel C, Lacey CJ, Soerjomataram I, Lortet-Tieulent J, et al. (2012)
Global burden of human papillomavirus and related diseases. Vaccine 30 Suppl
5: F12-23.
131. Raff AB, Woodham AW, Raff LM, Skeate JG, Yan L, et al. (2013) The evolving
field of human papillomavirus receptor research: a review of binding and entry.
Journal of virology 87: 6062-6072.
132. Gerke V, Moss SE (2002) Annexins: from structure to function. Physiological
reviews 82: 331-371.
133. Becker T, Weber K, Johnsson N (1990) Protein-protein recognition via short
amphiphilic helices; a mutational analysis of the binding site of annexin II for p11.
The EMBO journal 9: 4207-4213.
134. Reddy TR, Li C, Guo X, Myrvang HK, Fischer PM, et al. (2011) Design, synthesis,
and structure-activity relationship exploration of 1-substituted 4-aroyl-3-hydroxy-
5-phenyl-1H-pyrrol-2(5H)-one analogues as inhibitors of the annexin A2-
S100A10 protein interaction. Journal of medicinal chemistry 54: 2080-2094.
135. Reddy TR, Li C, Fischer PM, Dekker LV (2012) Three-Dimensional
Pharmacophore Design and Biochemical Screening Identifies Substituted 1,2,4-
Triazoles as Inhibitors of the Annexin A2-S100A10 Protein Interaction.
ChemMedChem 7: 1435-1446.
136. Dziduszko A, Ozbun MA (2013) Annexin A2 and S100A10 Regulate Human
Papillomavirus Type 16 Entry and Intracellular Trafficking in Human
Keratinocytes. Journal of virology.
137. Munoz N, Bosch FX, de Sanjos S, Herrero R, Castellsagu X, et al. (2003)
Epidemiologic Classification of Human Papillomavirus Types Associated with
Cervical Cancer. New England Journal of Medicine 348: 518-527.
140
138. Harald zH (1991) Human papillomaviruses in the pathogenesis of anogenital
cancer. Virology 184: 9-13.
139. Parkin DM (2006) The global health burden of infection-associated cancers in the
year 2002. International journal of cancer Journal international du cancer 118:
3030-3044.
140. Buck CB, Day PM, Trus BL (2013) The papillomavirus major capsid protein L1.
Virology.
141. Wang JW, Roden RB (2013) L2, the minor capsid protein of papillomavirus.
Virology.
142. Bronnimann MP, Chapman JA, Park CK, Campos SK (2012) A Transmembrane
Domain and GxxxG Motifs Within L2 are Essential for Papillomavirus Infection.
Journal of virology.
143. Day PM, Schiller JT (2009) The role of furin in papillomavirus infection. Future
microbiology 4: 1255-1262.
144. Yang R, Day PM, Yutzy WHt, Lin KY, Hung CF, et al. (2003) Cell surface-binding
motifs of L2 that facilitate papillomavirus infection. Journal of virology 77: 3531-
3541.
145. Rust R, Kluiver J, Visser L, Harms G, Blokzijl T, et al. (2006) Gene expression
analysis of dendritic/Langerhans cells and Langerhans cell histiocytosis. The
Journal of Pathology 209: 474-483.
146. Kawamura T, Kurtz SE, Blauvelt A, Shimada S (2005) The role of Langerhans cells
in the sexual transmission of HIV. Journal of dermatological science 40: 147-155.
147. de Jong MA, Geijtenbeek TB (2009) Human immunodeficiency virus-1 acquisition
in genital mucosa: Langerhans cells as key-players. Journal of internal medicine
265: 18-28.
148. Drobni P, Mistry N, McMillan N, Evander M (2003) Carboxy-fluorescein diacetate,
succinimidyl ester labeled papillomavirus virus-like particles fluoresce after
internalization and interact with heparan sulfate for binding and entry. Virology
310: 163-172.
149. Swisher JF, Burton N, Bacot SM, Vogel SN, Feldman GM (2010) Annexin A2
tetramer activates human and murine macrophages through TLR4. Blood 115:
549-558.
150. Stanley MA (2012) Epithelial cell responses to infection with human papillomavirus.
Clinical microbiology reviews 25: 215-222.
151. Lenz P, Lowy DR, Schiller JT (2005) Papillomavirus virus-like particles induce
cytokines characteristic of innate immune responses in plasmacytoid dendritic
cells. European journal of immunology 35: 1548-1556.
152. Lenz P, Day PM, Pang YY, Frye SA, Jensen PN, et al. (2001) Papillomavirus-like
particles induce acute activation of dendritic cells. Journal of immunology 166:
5346-5355.
153. Rudolf MP, Fausch SC, Da Silva DM, Kast WM (2001) Human dendritic cells are
activated by chimeric human papillomavirus type-16 virus-like particles and
induce epitope-specific human T cell responses in vitro. Journal of immunology
166: 5917-5924.
154. Da Silva DM, Fausch SC, Verbeek JS, Kast WM (2007) Uptake of human
papillomavirus virus-like particles by dendritic cells is mediated by Fcgamma
141
receptors and contributes to acquisition of T cell immunity. Journal of
immunology 178: 7587-7597.
155. Renoux VM, Bisig B, Langers I, Dortu E, Clemenceau B, et al. (2011) Human
papillomavirus entry into NK cells requires CD16 expression and triggers
cytotoxic activity and cytokine secretion. European journal of immunology 41:
3240-3252.
156. Ling KD, R.L.; Firestone, A.J.; Bunce, M.W.; Anderson, R.A. (2002) Type I gamma
phosphatidylinositol phosphate kinase targets and regulates focal adhesions.
Nature 420: 89-93.
157. Di Paolo G, Pellegrini L, Letinic K, Cestra G, Zoncu R, et al. (2002) Recruitment
and regulation of phosphatidylinositol phosphate kinase type 1 gamma by the
FERM domain of talin. Nature 420: 85-89.
158. van den Bout I; Divecha N (2009) PIP5K-driven PtdIns(4,5)P2 synthesis: regulation
and cellular functions. Journal of Cell Science 122: 3837-3850.
159. Rescher UR, D.; Ludwig, C.; Zobiack, N.; Gerke, V. (2004) Annexin 2 is a
phosphatidylinositol (4,5)-bisphosphate binding protein recruited to actin
assembly sites at cellular membranes. Journal of Cell Science 117: 3473-3480.
160. Schlaepfer DDM, S.K.; Ilic, D. (2004) Control of motile and invasive cell
phenotypes by focal adhesion kinase. Biochimica et Biophysica Acta (BBA) -
Molecular Cell Research 1692: 77-102.
161. Miyagi J, Kinjo T, Tsuhako K, Higa M, Iwamasa T, et al. (2001) Extremely high
Langerhans cell infiltration contributes to the favourable prognosis of HPV-
infected squamous cell carcinoma and adenocarcinoma of the lung.
Histopathology 38: 355-367.
162. Muderspach L, Wilczynski S, Roman L, Bade L, Felix J, et al. (2000) A phase I trial
of a human papillomavirus (HPV) peptide vaccine for women with high-grade
cervical and vulvar intraepithelial neoplasia who are HPV 16 positive. Clinical
cancer research : an official journal of the American Association for Cancer
Research 6: 3406-3416.
163. Buchbinder SP (2011) HIV epidemiology and breakthroughs in prevention 30 years
into the AIDS epidemic. Topics in antiviral medicine 19: 38-46.
164. Silva DMD, Movius CA, Raff AB, Brand HE, Skeate JG, et al. (2014) Suppression
of Langerhans cell activation is conserved amongst human papillomavirus alpha
and beta genotypes, but not a mu genotype. Virology In Press.
165. Renn CN, Sanchez DJ, Ochoa MT, Legaspi AJ, Oh CK, et al. (2006) TLR
activation of Langerhans cell-like dendritic cells triggers an antiviral immune
response. Journal of immunology 177: 298-305.
166. Schiller JT, Castellsague X, Garland SM (2012) A review of clinical trials of human
papillomavirus prophylactic vaccines. Vaccine 30 Suppl 5: F123-138.
167. Stokley S, Jeyarajah J, Yankey D, Cano M, Gee J, et al. (2014) Human
papillomavirus vaccination coverage among adolescents, 2007-2013, and
postlicensure vaccine safety monitoring, 2006-2014--United States. MMWR
Morbidity and mortality weekly report 63: 620-624.
168. Giuliano AR, Harris R, Sedjo RL, Baldwin S, Roe D, et al. (2002) Incidence,
prevalence, and clearance of type-specific human papillomavirus infections: The
Young Women's Health Study. The Journal of infectious diseases 186: 462-469.
142
169. Fausch SC, Da Silva DM, Rudolf MP, Kast WM (2002) Human papillomavirus
virus-like particles do not activate Langerhans cells: a possible immune escape
mechanism used by human papillomaviruses. JImmunol 169: 3242-3249.
170. Fausch SC, Fahey LM, Da Silva DM, Kast WM (2005) Human papillomavirus can
escape immune recognition through Langerhans cell phosphoinositide 3-kinase
activation. JImmunol 174: 7172-7178.
171. Da Silva D, Movius C, Raff A, Brand H, Skeate J, et al. (2014) Suppression of
Langerhans cell activation is conserved amongst human papillomavirus α and β
genotypes, but not a µ genotype. Virology 452-453: 279-286.
172. Malissen B, Tamoutounour S, Henri S (2014) The origins and functions of dendritic
cells and macrophages in the skin. Nature reviews Immunology 14: 417-428.
173. Cheng YS, Xu F (2010) Anticancer function of polyinosinic-polycytidylic acid.
Cancer biology & therapy 10: 1219-1223.
174. Flacher V, Bouschbacher M, Verronese E, Massacrier C, Sisirak V, et al. (2006)
Human Langerhans cells express a specific TLR profile and differentially respond
to viruses and Gram-positive bacteria. Journal of immunology 177: 7959-7967.
175. Kawai T, Akira S (2008) Toll-like receptor and RIG-I-like receptor signaling. Ann N
Y Acad Sci 1143: 1-20.
176. Matsumoto M, Seya T (2008) TLR3: interferon induction by double-stranded RNA
including poly(I:C). Advanced drug delivery reviews 60: 805-812.
177. Furio L, Billard H, Valladeau J, Peguet-Navarro J, Berthier-Vergnes O (2009)
Poly(I:C)-Treated human langerhans cells promote the differentiation of CD4+ T
cells producing IFN-gamma and IL-10. The Journal of investigative dermatology
129: 1963-1971.
178. Vercammen E, Staal J, Beyaert R (2008) Sensing of viral infection and activation
of innate immunity by toll-like receptor 3. Clin Microbiol Rev 21: 13-25.
179. de Clercq E (1979) Degradation of poly(inosinic acid) - poly(cytidylic acid) [(I)n -
(C)n] by human plasma. European journal of biochemistry / FEBS 93: 165-172.
180. Levy HB, Baer G, Baron S, Buckler CE, Gibbs CJ, et al. (1975) A modified
polyriboinosinic-polyribocytidylic acid complex that induces interferon in primates.
The Journal of infectious diseases 132: 434-439.
181. Kast WM, Brandt RM, Sidney J, Drijfhout JW, Kubo RT, et al. (1994) Role of HLA-
A motifs in identification of potential CTL epitopes in human papillomavirus type
16 E6 and E7 proteins. J Immunol 152: 3904-3912.
182. De Vuyst H, Lillo F, Broutet N, Smith JS (2008) HIV, human papillomavirus, and
cervical neoplasia and cancer in the era of highly active antiretroviral therapy.
Eur J Cancer Prev 17: 545-554.
183. Smith JS, Lindsay L, Hoots B, Keys J, Franceschi S, et al. (2007) Human
papillomavirus type distribution in invasive cervical cancer and high-grade
cervical lesions: a meta-analysis update. Int J Cancer 121: 621-632.
184. Randolph GJ, Ochando J, Partida-Sanchez S (2008) Migration of dendritic cell
subsets and their precursors. Annual review of immunology 26: 293-316.
185. Stingl G, Katz SI, Clement L, Green I, Shevach EM (1978) Immunologic functions
of Ia-bearing epidermal Langerhans cells. Journal of immunology 121: 2005-
2013.
143
186. Greenstone HL, J. D. Nieland, K. E. de Visser, M. L. De Bruijn, R. Zkirnbauer, R.
B. S. Roden, D. R. Lowy, W. M. Kast and J. T. Schiller (1998) Chimeric
papillomavirus virus-like particles elicit antitumor immunity against E7
oncoprotein in an HPV16 tumor model. Proceedings of the National Academy of
Sciences USA 95: 1800-1805.
187. Riemer AB, Keskin DB, Zhang G, Handley M, Anderson KS, et al. (2010) A
conserved E7-derived cytotoxic T lymphocyte epitope expressed on human
papillomavirus 16-transformed HLA-A2+ epithelial cancers. J Biol Chem 285:
29608-29622.
188. Ressing ME, de Jong JH, Brandt RM, Drijfhout JW, Benckhuijsen WE, et al. (1999)
Differential binding of viral peptides to HLA-A2 alleles. Implications for human
papillomavirus type 16 E7 peptide-based vaccination against cervical carcinoma.
Eur J Immunol 29: 1292-1303.
189. Prins RM, Soto H, Konkankit V, Odesa SK, Eskin A, et al. (2011) Gene expression
profile correlates with T-cell infiltration and relative survival in glioblastoma
patients vaccinated with dendritic cell immunotherapy. Clinical cancer research :
an official journal of the American Association for Cancer Research 17: 1603-
1615.
190. Okada H, Kalinski P, Ueda R, Hoji A, Kohanbash G, et al. (2011) Induction of
CD8+ T-cell responses against novel glioma-associated antigen peptides and
clinical activity by vaccinations with {alpha}-type 1 polarized dendritic cells and
polyinosinic-polycytidylic acid stabilized by lysine and carboxymethylcellulose in
patients with recurrent malignant glioma. Journal of clinical oncology : official
journal of the American Society of Clinical Oncology 29: 330-336.
191. Salazar AM, Erlich RB, Mark A, Bhardwaj N, Herberman RB (2014) Therapeutic in
situ autovaccination against solid cancers with intratumoral poly-ICLC: case
report, hypothesis, and clinical trial. Cancer immunology research 2: 720-724.
192. Woodham AW, Raff AB, Raff LM, Da Silva DM, Yan L, et al. (2014) Inhibition of
langerhans cell maturation by human papillomavirus type 16: a novel role for the
annexin A2 heterotetramer in immune suppression. Journal of immunology 192:
4748-4757.
193. Fahey LM, Raff AB, Da Silva DM, Kast WM (2009) A major role for the minor
capsid protein of human papillomavirus type 16 in immune escape. J Immunol
183: 6151-6156.
194. van der Aar AM, de Groot R, Sanchez-Hernandez M, Taanman EW, van Lier RA,
et al. (2011) Cutting edge: virus selectively primes human langerhans cells for
CD70 expression promoting CD8+ T cell responses. Journal of immunology 187:
3488-3492.
195. Leong CM, Doorbar J, Nindl I, Yoon HS, Hibma MH (2010) Loss of epidermal
Langerhans cells occurs in human papillomavirus alpha, gamma, and mu but not
beta genus infections. The Journal of investigative dermatology 130: 472-480.
196. Leong CM, Doorbar J, Nindl I, Yoon HS, Hibma MH (2010) Deregulation of E-
cadherin by human papillomavirus is not confined to high-risk, cancer-causing
types. The British journal of dermatology 163: 1253-1263.
197. Jimenez-Flores R, Mendez-Cruz R, Ojeda-Ortiz J, Munoz-Molina R, Balderas-
Carrillo O, et al. (2006) High-risk human papilloma virus infection decreases the
144
frequency of dendritic Langerhans' cells in the human female genital tract.
Immunology 117: 220-228.
198. DeCarlo CA, Rosa B, Jackson R, Niccoli S, Escott NG, et al. (2012) Toll-like
receptor transcriptome in the HPV-positive cervical cancer microenvironment.
Clinical & developmental immunology 2012: 785825.
199. Daud, II, Scott ME, Ma Y, Shiboski S, Farhat S, et al. (2011) Association between
toll-like receptor expression and human papillomavirus type 16 persistence.
International journal of cancer Journal international du cancer 128: 879-886.
200. Scott ME, Ma Y, Farhat S, Moscicki AB (2014) Expression of nucleic acid-sensing
Toll-like receptors predicts HPV16 clearance associated with an E6-directed cell-
mediated response. International journal of cancer Journal international du
cancer.
201. Domingos-Pereira S, Decrausaz L, Derre L, Bobst M, Romero P, et al. (2013)
Intravaginal TLR agonists increase local vaccine-specific CD8 T cells and human
papillomavirus-associated genital-tumor regression in mice. Mucosal immunology
6: 393-404.
202. Andersen JM, Al-Khairy D, Ingalls RR (2006) Innate immunity at the mucosal
surface: role of toll-like receptor 3 and toll-like receptor 9 in cervical epithelial cell
responses to microbial pathogens. Biology of reproduction 74: 824-831.
203. Stahl-Hennig C, Eisenblatter M, Jasny E, Rzehak T, Tenner-Racz K, et al. (2009)
Synthetic double-stranded RNAs are adjuvants for the induction of T helper 1
and humoral immune responses to human papillomavirus in rhesus macaques.
PLoS Pathogens 5: e1000373.
204. Caskey M, Lefebvre F, Filali-Mouhim A, Cameron MJ, Goulet JP, et al. (2011)
Synthetic double-stranded RNA induces innate immune responses similar to a
live viral vaccine in humans. The Journal of experimental medicine 208: 2357-
2366.
205. Abraham J, Stenger M (2014) Cobas HPV test for first-line screening for cervical
cancer. The Journal of community and supportive oncology 12: 156-157.
206. Stoler MH, Wright TC, Jr., Sharma A, Apple R, Gutekunst K, et al. (2011) High-risk
human papillomavirus testing in women with ASC-US cytology: results from the
ATHENA HPV study. Am J Clin Pathol 135: 468-475.
207. Woodham AW, Raff AB, Da Silva DM, Kast WM (2015) Molecular analysis of
human papillomavirus virus-like particle activated langerhans cells in vitro.
Methods in molecular biology 1249: 135-149.
208. Yan L, Woodham AW, Da Silva DM, Kast WM (2015) Functional Analysis of HPV-
Like Particle-Activated Langerhans Cells In Vitro. Methods in molecular biology
1249: 333-350.
209. Muul LM, Silvin C, James SP, Candotti F (2008) Measurement of proliferative
responses of cultured lymphocytes. Current protocols in immunology / edited by
John E Coligan [et al] Chapter 7: Unit 7 10 11-17 10 24.
210. McNeely TB, Shugars DC, Rosendahl M, Tucker C, Eisenberg SP, et al. (1997)
Inhibition of human immunodeficiency virus type 1 infectivity by secretory
leukocyte protease inhibitor occurs prior to viral reverse transcription. Blood 90:
1141-1149.
145
211. John M, Keller MJ, Fam EH, Cheshenko N, Hogarty K, et al. (2005) Cervicovaginal
secretions contribute to innate resistance to herpes simplex virus infection. The
Journal of infectious diseases 192: 1731-1740.
212. Kazmi SH, Naglik JR, Sweet SP, Evans RW, O'Shea S, et al. (2006) Comparison
of human immunodeficiency virus type 1-specific inhibitory activities in saliva and
other human mucosal fluids. Clinical and vaccine immunology : CVI 13: 1111-
1118.
213. Bingle CD, Vyakarnam A (2008) Novel innate immune functions of the whey acidic
protein family. Trends in immunology 29: 444-453.
214. Wahl SM, McNeely TB, Janoff EN, Shugars D, Worley P, et al. (1997) Secretory
leukocyte protease inhibitor (SLPI) in mucosal fluids inhibits HIV-I. Oral diseases
3 Suppl 1: S64-69.
215. Prakash M, Patterson S, Kapembwa MS (2001) Macrophages are increased in
cervical epithelium of women with cervicitis. Sexually transmitted infections 77:
366-369.
216. Naif HM (2013) Pathogenesis of HIV Infection. Infectious disease reports 5: e6.
217. Ryzhova EV, Vos RM, Albright AV, Harrist AV, Harvey T, et al. (2006) Annexin 2: a
novel human immunodeficiency virus type 1 Gag binding protein involved in
replication in monocyte-derived macrophages. Journal of virology 80: 2694-2704.
218. Reddy TR, Li C, Guo X, Fischer PM, Dekker LV (2014) Design, synthesis and SAR
exploration of tri-substituted 1,2,4-triazoles as inhibitors of the annexin A2-
S100A10 protein interaction. Bioorganic & medicinal chemistry 22: 5378-5391.
219. Valladeau J, Dezutter-Dambuyant C, Saeland S (2003) Langerin/CD207 sheds
light on formation of birbeck granules and their possible function in Langerhans
cells. Immunologic research 28: 93-107.
220. Rosenfeld MR, Chamberlain MC, Grossman SA, Peereboom DM, Lesser GJ, et al.
(2010) A multi-institution phase II study of poly-ICLC and radiotherapy with
concurrent and adjuvant temozolomide in adults with newly diagnosed
glioblastoma. Neuro-oncology 12: 1071-1077.

Abstract (if available)

Abstract High‐risk human papillomavirus (HPV) infection leads to the development of several human cancers including cervical, anogenital, and head and neck cancers that cause significant morbidity and mortality worldwide. HPV type 16 (HPV16) is the most common of the cancer causing high‐risk genotypes, yet the entire mechanism of how HPV16 enters human cells and evades the immune system is still not defined. During its natural life cycle, HPV must gain entry into the basal cells of the cervical epithelium through an unknown non‐canonical endocytic pathway. When I first joined Dr. Kast's lab, my thesis project was on the forefront of basic science discovery: novel HPV entry receptor identification. We were able to identify the annexin A2/S100A10 heterotetramer (A2t) as an HPV16 entry receptor on host epithelial cells, and A2t‐mediated entry may represent a previously unknown type of endocytosis. A2t is composed of two annexin A2 monomers bound non‐covalently to an S100A10 dimer, and we have demonstrated that the binding site for HPV16 is on S100A10. This discovery was part of the first arm of my thesis project, and led to investigating A2t small molecule inhibitors (A2ti) for their potential to prevent HPV infection. Our data demonstrated that A2ti effectively block HPV16 infection in vitro 100% at non‐toxic concentrations, and represent the first time that an HPV receptor has been targeted to block infection. These inhibitors could potentially be used as anti‐viral compounds, and this option would have broad anti‐viral implications as A2t has also been implicated in HIV infection of macrophages. ❧ The HPV family of viruses establishes persistent infections for ongoing gene expression, which is accomplished through of evolved mechanisms that allow HPV to evade the human immune system. As mentioned, HPV targets cells in the epithelium where it also comes into contact with Langerhans cells (LCs), the resident antigen presenting cells of the mucosal epithelial layer that account for one in every twenty nucleated cells (APC) of the epithelium. LC are responsible for initiating immune responses against viruses entering the mucosa. However, studies from our laboratory have identified HPV‐mediated suppression of LC immune function as a key mechanism through which HPV evades immune surveillance, which in turn leads to viral persistence and oncogenesis. The characterization of this immunosuppressive pathway is paramount in our understanding of HPV immune responses. These studies has served as the second part of my thesis project and has demonstrated that A2t‐mediated entry of HPV16 into LC is a key component to HPV16‐induced immune suppression. Specifically, I have shown that entry of HPV16 into LC via A2t, causes alterations in intracellular signaling leading to reduced cell surface T cell co‐stimulatory marker expression on LC, reduced cytokine release of inflammatory cytokines needed to stimulate T cells, and hence the LC are unable to induce an adaptive T cell response. ❧ Toll‐like receptors (TLR), including TLR3, are also present on the surface of LC and recognize pathogens to stimulate an LC‐mediated immune response. Polyinosinic‐ polycytidilic acid (Poly-I:C) is a TLR3 agonist that has the ability to enhance APC expression of T cell co‐stimulatory molecules and inflammatory cytokine production necessary for the activation of T cells, as well as the ability to induce a type I interferon response. Our current data show that LC treatment with stabilized Poly-I:C compounds (s-Poly-I:C) induces their activation and the induction of HPV‐specific T cells in women with high grade cervical intraepithelial neoplasia even after their LC function is suppressed by pre‐exposure to HPV16. This data strongly suggests that s-Poly-I:C may be able to establish an adaptive immune response against HPV in patients leading to regression of their pre‐cancerous cervical lesions. Taken together, these discoveries may reduce the risk of HPV‐related cancer by blocking HPV infections with A2ti and by promoting HPV clearance with s-Poly-I:C.

Linked assets

University of Southern California Dissertations and Theses

Conceptually similar

PDF

Infection by herpes simplex virus type 1 increases human papillomavirus type 16 uptake and infection through the annexin A2/S100A10 heterotetramer

PDF

The annexin A2 heterotetramer as a host cell cofactor in human papillomavirus infection

PDF

Targeting Langerhans cells: a human papillomavirus type 16 immune evasion mechanism

PDF

The silenced sentinel: a human papillomavirus type 16 immune evasion mechanism targeting Langerhans cells

PDF

Contribution of herpes simplex virus type 2 in the aquisition of human papillomavirus infection

PDF

Investigating immune escape mechanisms between high & low risk mucosal human papillomavirus genotypes and cutaneous human papillomavirus genotypes

PDF

Studying the relationship of annexin A2, langerin, and Birbeck granules

PDF

Theta defensins inhibit high-risk human papillomavirus infection through charge-driven capsid clustering

PDF

The role of WAVE proteins in the macropinocytosis-like entry of human papillomavirus

PDF

WAVE1 is a novel mediator of HPV trafficking to the Golgi apparatus

PDF

Study of protein deamidation in innate immune signaling

PDF

Kaposi's sarcoma associated herpes-virus induces cellular proxi expression to modulate host gene expression that benefits viral infection and oncogenesis

PDF

Protein phosphatase 2A and annexin A5: modulators of cellular functions

PDF

Investigation into the use of repurposed influenza vaccines for immunotherapy of HPV-induced tumors

PDF

Roles of epithelial-mesenchymal transition and niche in tumorigenesis of tumor-initiating cells

PDF

LIGHT-ing up prostate cancer: remodeling the tumor microenvironment and enhancing therapeutic vaccine efficacy through forced LIGHT expression in prostate cancer

PDF

Integrative genomic and epigenomic analysis of human cancer

PDF

The effects of hepatitis C virus infection on host immune response and signaling pathways

PDF

Developing peptide and antibody-mimetic ligands for the cell surface receptors β2AR and DC-SIGN

PDF

The histone H2A deubiquitinase MYSM1 regulates CCR9 expression on CD4⁺ T cells and thymocytes

Asset Metadata

Creator Woodham, Andrew Wallace (author)

Core Title Human papillomavirus type 16 entry via the annexin A2 heterotetramer leads to infection and immune evasion

School Keck School of Medicine

Degree Doctor of Philosophy

Degree Program Genetic, Molecular and Cellular Biology

Publication Date 04/23/2015

Defense Date 03/19/2015

Publisher University of Southern California (original), University of Southern California. Libraries (digital)

Tag annexin A2 heterotetramer,human papillomavirus,immunology,Langerhans cells,OAI-PMH Harvest,virology

Format application/pdf (imt)

Language English

Contributor Electronically uploaded by the author (provenance)

Advisor Kast, W. Martin (committee chair), Langen, Ralf (committee member), Lin, Yvonne (committee member)

Creator Email andywoody24@yahoo.com,woodham@usc.edu

Permanent Link (DOI) https://doi.org/10.25549/usctheses-c3-559651

Unique identifier UC11302025

Identifier etd-WoodhamAnd-3384.pdf (filename),usctheses-c3-559651 (legacy record id)

Legacy Identifier etd-WoodhamAnd-3384.pdf

Dmrecord 559651

Document Type Dissertation

Format application/pdf (imt)

Rights Woodham, Andrew Wallace

Type texts

Source University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Access Conditions The author retains rights to his/her dissertation, thesis or other graduate work according to U.S. copyright law. Electronic access is being provided by the USC Libraries in agreement with the a...

Repository Name University of Southern California Digital Library

Repository Location USC Digital Library, University of Southern California, University Park Campus MC 2810, 3434 South Grand Avenue, 2nd Floor, Los Angeles, California 90089-2810, USA