University of Southern California Dissertations and Theses

Engineering antibodies and antibody /cytokine fusion proteins for the treatment of human malignancies

(USC Thesis Other)

Engineering antibodies and antibody /cytokine fusion proteins for the treatment of human malignancies

PDF

Download

Open document

Flip pages

Download a page range

Download transcript

Copy asset link

Request this asset

Transcript (if available)

Content NOTE TO USERS
This reproduction is the best copy available.
®
UMI
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
E n g in e e r in g A n t ib o d ie s a n d An t ib o d y /C y t o k in e
Fu s io n P r o t e in s f o r t h e T r e a t m e n t o f H u m a n
M a l ig n a n c ie s
by
Jason Laurence Homick
A Dissertation Presented to the
FACULTY o f t h e g r a d u a t e s c h o o l
UNIVERSITY OF SOUTHERN CALIFORNIA
In Partial Fulfillment of the
Requirements for the Degree
DOCTOR OF PHILOSOPHY
(Pathobiology)
December 1997
© 1997 Jason Laurence Homick
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
UMI Number: 3180775
INFORMATION TO USERS
The quality of this reproduction is dependent upon the quality of the copy
submitted. Broken or indistinct print, colored or poor quality illustrations and
photographs, print bleed-through, substandard margins, and improper
alignment can adversely affect reproduction.
In the unlikely event that the author did not send a complete manuscript
and there are missing pages, these will be noted. Also, if unauthorized
copyright material had to be removed, a note will indicate the deletion.
®
UMI
UMI Microform 3180775
Copyright 2005 by ProQuest Information and Learning Company.
All rights reserved. This microform edition is protected against
unauthorized copying under Title 17, United States Code.
ProQuest Information and Learning Company
300 North Zeeb Road
P.O. Box 1346
Ann Arbor, Ml 48106-1346
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
UNIVERSITY OF SOUTHERN CALIFORNIA
THE GRADUATE SCHOOL
UNIVERSITY PARK
LOS ANGELES, CALIFORNIA 90007
This dissertation, written by
J a s o n L a u r e n c e H o r n i c k
under the direction of h .i f. Dissertation
Committee, and approved by all its members,
has been presented to and accepted by The
Graduate School, in partial fulfillm ent of re
quirements for the degree of
DO CTO R OF PHILOSOPHY
Studies > e a i
D a te (P .zM zX .h
DISSERTATION COMMITTEE
Chaii
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
ACKNOWLEDGMENTS
I am deeply indebted to my mentor and friend Alan L. Epstein, without whose
creativity, inspiration, suggestions, and support this work would not have been
possible. His editorial assistance and insightful critiques of the writing greatly
enhanced the quality of my manuscripts and taught me the artistry of scientific
discourse. For an enjoyable and enriching working environment and for their help
and insights, deepest thanks to my labmates and collaborators, Leslie A. Khawli,
Peisheng Hu, Barbara H. Biela, John Sharifi, Myra M. Mizokami, and Maggie
Yun. Clive R. Taylor, Peter M. Anderson, Maureen Lynch, and Chand Khanna
deserve recognition for their scientific and intellectual contributions to my
manuscripts. I am especially grateful to my friend and colleague Bahman
Saffarinazari, with whom I have traveled the long and winding road through the
M.D./Ph.D. program. For their academic support, special thanks to my
dissertation committee, Michael F. Press, Michael R. Stallcup, Minnie McMillan,
Clive R. Taylor, and Alan L. Epstein. Finally, my wife Harmony H. Wu deserves
editorial recognition for helping me through the frustrating and exhausting process
of formatting this dissertation. But mostly, I would like to thank my dear wife for
her support, love, and companionship through my endless years of graduate and
medical school.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
TABLE OF CONTENTS
LIST OF FIGURES..............................................................................................vi
LIST OF TABLES................................................................................................ ix
CHAPTER 1 . INTRODUCTION....................................................................... 1
REFERENCES.........................................................................................................11
CHAPTER 2 . chTNT-3/B, A NEW CHEMICALLY MODIFIED
CHIMERIC MONOCLONAL ANTIBODY DIRECTED AGAINST DNA
FOR THE TUMOR NECROSIS TREATMENT OF SOLID TUMORS 19
ABSTRACT.............................................................................................................19
INTRODUCTION...................................................................................................20
MATERIALS AND METHODS...........................................................................23
Reagents...............................................................................................................23
Antibodies and cell lines......................................................................................24
Cloning o f TNT-3 variable region genes........................................................... 25
Construction o f expression vectors.................................................................... 26
Expression and purification o f chTNT-3............................................................27
Immunoassays.......................................................................................................28
Biotinylation o f chTNT-3.....................................................................................29
Determination o f avidity......................................................................................30
Immunohistologic studies................................................................................... 31
Pharmacokinetic and biodistribution studies.................................................... 32
Imaging studies....................................................................................................32
RESULTS................................................................................................................33
Construction, expression, and purification o f chTNT-3................................... 33
Immunobiochemical analysis..............................................................................34
Immunohistologic studies................................................................................... 37
In vivo pharmacokinetic and tumor targeting studies.......................................38
DISCUSSION.........................................................................................................48
REFERENCES........................................................................................................53
CHAPTER 3 . PRETREATMENT WITH A CHIMERIC
TNT-3/INTERLEUKIN 2 ANTIBODY FUSION PROTEIN DIRECTED
AGAINST DNA ENHANCES THE DELIVERY OF THERAPEUTIC
MOLECULES TO SOLID TUMORS.............................................................. 59
ABSTRACT............................................................................................................ 59
INTRODUCTION.................................................................................................. 61
MATERIALS AND METHODS.......................................................................... 63
Reagents.............................................................................................................. 63
Antibodies and cell lines..................................................................................... 64
Construction o f expression vectors....................................................................65
iii
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Expression and purification o f antibody fusion protein....................................66
Immunoassays....................................................................................................... 66
Determination o f avidity......................................................................................67
Bioassay.................................................................................................................68
Pharmacokinetic and biodistribution studies.....................................................68
Pretreatment studies.............................................................................................69
Imaging studies..................................................................................................... 70
RESULTS................................................................................................................71
Construction, expression, and purification o f chTNT-3/IL-2........................... 71
Immunobiochemical analysis...............................................................................73
IL-2 bioactivity o f chTNT-3/IL-2.........................................................................73
In vivo pharmacokinetic and tumor targeting studies....................................... 76
Pretreatment studies............................................ ..............................................81
DISCUSSION......................................................................................................... 91
REFERENCES........................................................................................................ 97
CHAPTER 4 . PRETREATMENT WITH CHIMERIC
TNT-3/INTERLEUKIN 2 ANTIBODY FUSION PROTEIN INCREASES
TUMOR UPTAKE OF VARIOUS MONOCLONAL ANTIBODIES IN
DIFFERENT TUMOR MODELS...................................................................103
ABSTRACT...........................................................................................................103
INTRODUCTION.................................................................................................104
MATERIALS AND METHODS.........................................................................105
Antibodies, cell lines, and animals.................................................................. 105
Pretreatment studies.......................................................................................... 106
Imaging studies.................................................................................................. 107
RESULTS AND DISCUSSION..........................................................................107
REFERENCES...................................................................................................... 121
CHAPTER 5 . CHIMERIC CLL-1 ANTIBODY FUSION PROTEINS
CONTAINING GRANULOCYTE-MACROPHAGE COLONY-
STIMULATING FACTOR OR INTERLEUKIN 2 WITH SPECIFICITY
FOR B-CELL MALIGNANCIES EXHIBIT ENHANCED EFFECTOR
FUNCTIONS WHILE RETAINING TUMOR TARGETING
PROPERTIES....................................................................................................124
ABSTRACT.......................................................................................................... 124
INTRODUCTION................................................................................................ 125
MATERIALS AND METHODS.........................................................................127
Reagents............................................................................................................ 127
Antibodies and cell lines................................................................................... 128
Cloning o f variable region cDNAs and construction o f chimeric antibody
genes...................................................................................................................129
Construction o f chCLL-1 expression vector....................................................131
Expression and purification o f chimeric CLL-1..............................................132
Construction o f antibody/cytokine fusion protein expression vectors. 133
iv
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Expression and purification offusion proteins................................................133
Immunoassays.................................................................................................... 135
Determination o f avidity.................................................................................... 136
Isolation o f bone marrow cells......................................................................... 136
Colony assays......................................................................................................137
Bioassay.............................................................................................................. 137
Cytotoxicity assays.............................................................................................138
Pharmacokinetic and biodistribution studies..................................................139
Imaging studies.................................................................................................. 140
RESULTS.............................................................................................................. 140
Construction, expression, and purification o f chCLL-l/GM-CSF and
chCLL-l/IL-2...................................................................................................... 140
Immunobiochemical analysis............................................................................ 142
Colony-forming activity o f chCLL-l/GM-CSF................................................145
Bioactivity o f chCLL-l/IL-2.............................................................................. 145
Cytotoxicity studies............................................................................................147
In vivo pharmacokinetic and tumor targeting studies.....................................151
DISCUSSION........................................................................................................157
REFERENCES...................................................................................................... 162
CHAPTER 6 . SUMMARY AND FUTURE DIRECTIONS........................169
v
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
LIST OF FIGURES
Figure 2-1. Competitive binding radioimmunoassay with chTNT-3..................... 35
Figure 2-2. Indirect ELISA with chTNT-3............................................................. 36
Figure 2-3. Whole body pharmacokinetic clearance of 1 2 5 I-labeled unmodified and
biotinylated chTNT-3 in non tumor-bearing mice..............................................39
Figure 2-4. Tissue biodistribution and tumor uptake of 1 2 5 I-labeled muTNT-3 in
ME-180 human cervical carcinoma tumor-bearing nude mice..........................41
Figure 2-5. Tissue biodistribution and tumor uptake of 1 2 5 I-labeled chTNT-3/B in
ME-180 human cervical carcinoma tumor-bearing nude mice..........................45
Figure 2-6. Imaging of ME-180 human cervical carcinoma tumor-bearing nude
mice injected with 1 3 1 I-labeled chTNT-3 or chTNT-3/B...................................47
Figure 3-1. Electrophoretic identification of chTNT-3/IL-2..................................72
Figure 3-2. Competitive binding radioimmunoassay with chTNT-3/IL-2............74
Figure 3-3. Biologic activity of chTNT-3/EL-2 as determined by the ability to
support the proliferation of IL-2-dependent CTLL-2 cells............................... 75
Figure 3-4. Whole body pharmacokinetic clearance of 1 2 5 I-labeled chTNT-3/IL-2
and chTNT-3 in non tumor-bearing mice...........................................................77
Figure 3-5. Tissue biodistribution and tumor uptake of chTNT-3/IL-2 in LS174T
human colon adenocarcinoma tumor-bearing nude mice.................................. 79
Figure 3-6. Imaging of LS174T colon adenocarcinoma tumor-bearing nude mice
injected with 1 3 1 I-labeled chTNT-3/IL-2............................................................ 80
Figure 3-7. Time and dose dependence of chTNT-3/IL-2 pretreatment on tumor
uptake of B72.3 in LS174T human colon adenocarcinoma tumor-bearing nude
mice.......................................................................................................................83
Figure 3-8. Three day biodistribution of 1 2 5 I-labeled B72.3 under optimal
pretreatment conditions in LS174T human colon adenocarcinoma tumor-
bearing nude mice................................................................................................ 87
Figure 3-9. Effect of A^-methyl-L-arginine (l-NMA) on tumor uptake of 1 2 5 I-
labeled B72.3 following chTNT-3/IL-2 pretreatment in LS174T human colon
adenocarcinoma tumor-bearing nude mice.........................................................88
VI
permission of the copyright owner. Further reproduction prohibited without permission.
Figure 3-10. Imaging of LS174T human colon adenocarcinoma tumor-bearing
nude mice injected with m I-labeled B72.3 with or without pretreatment with
15 tig chTNT-3/IL-2............................................................................................ 90
Figure 4-1. Three day biodistribution of chTNT-3 following pretreatment with
chTNT-3/IL-2 in LS174T human colon adenocarcinoma tumor-bearing nude
mice......................................................................................................................110
Figure 4-2. Dose dependence of chTNT-3/IL-2 pretreatment on tumor uptake of
CYT-351 in LNCaP human prostatic adenocarcinoma tumor-bearing nude
mice......................................................................................................................112
Figure 4-3. Five day biodistribution of CYT-351 under optimal pretreatment
conditions in LNCaP human prostatic adenocarcinoma tumor-bearing nude
mice.................................................................................................................... 114
Figure 4-4. Dose dependence of chTNT-3/IL-2 pretreatment on tumor uptake of
NR-LU-10 in A427 human lung carcinoma tumor-bearing nude mice 116
Figure 4-5. Five day biodistribution of NR-LU-10 under optimal pretreatment
conditions in A427 human lung carcinoma tumor-bearing mice.....................118
Figure 4-6. Imaging of A427 human lung adenocarcinoma tumor-bearing nude
mice injected with 1 3 1 I-labeled NR-LU-10 with or without pretreatment with
chTNT-3/IL-2................................................................................................... 120
Figure 5-1. Schematic diagram depicting the linker containing the Notl cloning
site between the human yl and human GM-CSF or human IL-2 cDNAs in the
chimeric CLL-1 heavy chain/cytokine fusion genes....................................... 141
Figure 5-2. Electrophoretic identification of chCLL-1 /cytokine antibody fusion
proteins..............................................................................................................143
Figure 5-3. Competitive binding radioimmunoassay with chCLL-1/GM-CSF and
chCLL-1/IL-2........................... 144
Figure 5-4. Colony-forming activity of chCLL-1/GM-CSF................................ 146
Figure 5-5. Biologic activity of chCLL-l/IL-2 as determined by the ability to
support the proliferation of CTLL-2 cells.......................................................148
Figure 5-6. ADCC activity of chCLL-1 and antibody fusion proteins................150
Figure 5-7. Whole body pharmacokinetic clearance of 1 2 5 I-labeled chCLL-1,
chCLL-1/GM-CSF, and chCLL-l/IL-2 in non tumor-bearing mice............. 152
vii
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Figure 5-8. Three day biodistribution of chCLL-1, chCLL-1/GM-CSF, and
chCLL-l/IL-2 in ARH-77 human myeloma tumor-bearing nude mice 154
Figure 5-9. Imaging of ARH-77 human myeloma tumor-bearing nude mice
injected with 1 3 1 I-labeled chCLL-1, chCLL-1/GM-CSF, or chCLL-1/IL-2.. 156
viii
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
LIST OF TABLES
Table 2-1. Tissue biodistribution and tumor uptake of 1 2 5 I-labeled unmodified and
biotinylated chTNT-3 in ME-180 human cervical carcinoma tumor-bearing
nude mice.............................................................................................................. 43
Table 3-1. Three day normal tissue biodistribution of 1 2 5 I-labeled B72.3
administered two hours following pretreatment with the indicated doses of
chTNT-3 /EL-2 fusion protein in LS174T human colon adenocarcinoma tumor-
bearing nude mice.................................................................................................84
Table 3-2. Three hour tissue biodistribution and tumor uptake of 1 2 5 IUdR
administered two hours following pretreatment with 15 pg chTNT-3/IL-2
fusion protein in LS174T human colon adenocarcinoma tumor-bearing nude
mice....................................................................................................................... 92
Table 5-1. Oligonucleotide primers used for cloning the variable regions from the
murine Lym-2 hybridoma...................................................................................130
ix
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 1. Introduction
The development of the hybridoma technology by Kohler and Milstein (1)
enabled B lymphocytes secreting immunoglobulins recognizing antigens of interest
to be immortalized and the resulting monoclonal antibodies (MAbs) to be
produced in large quantities. The properties of MAbs, including their exquisite
binding specificity and homogeneity, make them useful tools not only for scientific
inquiry, but also for medical applications, including diagnostic pathology (2). The
advent of MAb technology also stimulated the interest of oncologists, who
anticipated the development of tumor-specific MAbs that might act as tumor-
targeting agents for the detection and treatment of human malignancies (3-7). The
promise of new antibody-based cancer therapies has for the most part remained
unfulfilled (8), as it soon became clear that murine MAbs produced a human anti
mouse antibody (HAMA) response (9-11), which causes rapid clearance, lower
tumor localization, and a reduction in the therapeutic efficacy of these foreign
reagents. The utility of murine MAbs has therefore been limited to applications
that require either a single injection or few injections (12), or limited to patients
whose disease state reduces their ability to mount an immune response, such as
those with hematologic malignancies.
Moreover, the results of early clinical studies using MAbs in the treatment
of human malignancies were discouraging, as few objective clinical responses were
observed after the administration of “naked” antibodies (6). This led investigators
1
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
to consider antibodies not as immunotherapeutic reagents per se, but as vehicles
for the targeted delivery of toxic molecules to tumor sites. The therapeutic
reagents considered for antibody-guided delivery to tumors included radionuclides
(13, 14), bacterial and plant toxins (15, 16), and chemotherapeutic drugs.
Radionuclides are particularly appealing candidates, since they are capable of
effecting tumor cell killing at a distance, causing micro-regional necrosis in the
tumor. This contrasts with other toxic molecules, which must be internalized by
each cell to be destroyed. Since the expression of tumor-associated antigens is
often heterogeneous (17), with some cells completely lacking the target protein,
radioimmunotherapy may offer the greatest opportunity for successful tumor
eradication when MAbs directed against such antigens are used. The majority of
tumor-associated antigens identified to date, however, exhibit low levels of
expression in normal tissues, and cross-reactivity of MAbs with such healthy
tissues increases the toxicity of targeted therapies (18).
Not only is the therapeutic efficacy of murine MAbs in the treatment of
cancer limited by their immunogenicity and by cross-reactivity with normal tissues,
but attributes of the conventional tumor-associated antigens expressed on the
surface of tumor cells make them less than ideal targets for antibody-based tumor
therapies. These include uneven expression and distribution on tumor cells
(antigenic heterogeneity), down-regulation or loss of expression upon exposure to
MAbs (antigenic modulation), and the presence of circulating antigen (antigenic
shedding) (19, 20). Antigenic heterogeneity dictates that regions of tumors free or
2
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
relatively free of antigen will avoid destruction by targeted toxic molecules.
Antigenic modulation allows sub-populations of tumor cells to evade antibody
binding, and shed antigen can act as a sink for injected MAb, which may bind to
circulating antigen within the patient's plasma or within the interstitium, preventing
antibody from reaching tumor cells. Despite these problems, murine MAbs
conjugated to radionuclides (radioimmunoconjugates) have shown promise for the
radioimmunodetection of solid tumors, demonstrating specificity sufficient for
distinguishing tumor from healthy tissues (21-25). These successful imaging
studies have given investigators hope that therapeutic responses may be achieved
using radioimmunoconjugates. Radioimmunotherapy of solid tumors, however,
has yet to yield substantial objective tumor regressions in clinical studies.
Perhaps the single greatest impediment to the clinical success of MAb
therapies of human malignancies is low tumor uptake (26, 27). Although mouse
models have shown levels of tumor uptake from 1-20% of the injected dose per
gram, clinical studies have demonstrated extremely low tumor uptake, at best
approximately 0.1% of the injected dose per gram of tissue (28). Thus, the
majority of the injected dose disperses throughout the body, where it can result in
significant dose-limiting myelosuppression including severe thrombocytopenia (18,
29). Physiological barriers to the delivery of MAbs to solid tumors are believed to
be a major obstacle to efficient tumor targeting (30-32). In addition, because
antibodies directed against cell surface antigens tend to localize to perivascular
tumor cells first encountered by extravasating radiolabeled antibodies (33), the
3
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
majority of the injected dose accumulates within the tumor margin where the
greatest contact to blood vessels occurs, which prevents MAb from penetrating
deeper within solid tumors. Thus, substantial challenges to the efficacy of
antibody-based solid tumor therapies must be faced before successful clinical
results are achieved. Each of the problems delineated above will be addressed in
turn as the work presented in this dissertation is described in the context of these
challenges.
In an attempt to circumvent the problems associated with conventional
antibody-based targeting strategies directed against tumor-associated cell surface
antigens, our laboratory developed a novel approach that targets the necrotic
regions of solid tumors. Designated Tumor Necrosis Treatment (TNT), this
strategy exploits the high proportion of degenerating and necrotic cells that
accumulate within solid tumors by utilizing MAbs directed against intracellular
antigens exposed in abnormally permeable cells (34). In both animal models (35)
and an imaging study in patients (36), proof of principle for this novel approach
has been demonstrated, as a radiolabeled murine MAb with specificity for
nucleosomal determinants (TNT-1) was shown to localize specifically to tumor
sites. Hence, normal tissues whose cells contain intact plasma membranes exclude
MAbs directed against intracellular antigens. Since the accumulation of necrotic
debris is characteristic of solid tumors, Tumor Necrosis Treatment is expected to
have potential applications to most human malignancies. Although radiolabeled
TNT-1 demonstrated tumor localization (35), binding to necrotic regions (33), and
4
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
tumor killing in a nude mouse xenograft model (37), tumor uptake of TNT-1 was
relatively low. Since absolute tumor accretion is a critical determinant of
successful radioimmunotherapy (4), our laboratory sought to identify an
antinuclear antibody that demonstrated higher tumor uptake. In Chapter 2 a new
MAb designated TNT-3 with specificity for single-stranded DNA is described that
displays approximately 3-fold higher tumor localization than TNT-1.
Because a patient's immune response to murine MAbs can limit their
therapeutic potential (11), methods to reduce the immunogenicity of murine MAbs
have been developed. Genetic engineering technology has allowed
immunoglobulin genes to be cloned from hybridomas (38-40), which has facilitated
the generation of recombinant antibodies whose immunogenic murine regions are
replaced by human sequences. One such approach is the construction of human-
mouse chimeric antibodies (41-44), whose murine constant regions are completely
replaced by human domains, resulting in recombinant proteins that are
approximately 65% human and 35% murine in sequence. In clinical studies,
chimeric antibodies have been shown to be less immunogenic than their parent
murine antibodies, although the differences in responses have varied considerably
from one chimeric antibody to the next (11). In the majority of cases, however,
the immune responses to chimeric antibodies have been weaker than those to
murine MAbs, allowing multiple doses to be administered with greater opportunity
for therapeutic success. For this reason, a chimeric TNT-3 (chTNT-3) was
produced using the Glutamine Synthetase Gene Amplification System, as
5
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
presented in Chapter 2. This expression system takes advantage of the inability of
murine myeloma cells to grow in the absence of exogenous glutamine by utilizing
the glutamine synthetase (GS) gene as a selectable marker (45). In addition, the
availability of a specific inhibitor of GS (methionine sulfoximine) enables
amplification of genes of interest along with GS when transfectants are incubated
in the presence of the inhibitor. In this way, high levels of expression of
recombinant antibodies can be achieved sufficient for the development of clinical
trials. This expression system was used for all the recombinant antibodies and
antibody/cytokine fusion proteins described in this dissertation.
Chapter 2 also presents a chemical modification that substantially decreases
the clearance time of chTNT-3 without compromising its tumor targeting ability.
Since thrombocytopenia is a severe dose-limiting toxicity for radioimmunotherapy
(29), strategies that decrease the exposure of bone marrow to radionuclide should
allow higher tumor doses to be achieved while reducing toxic side effects. Our
laboratory has previously shown that chemical modification of MAbs with the
crosslinking reagent SPDP (succinimidyl 3-(2-pyridyldithio)propionate) leads to
faster clearance, lower normal tissue accumulation, and the same or higher tumor
uptake of radiolabeled murine MAbs in nude mouse xenograft models (46). Since
these characteristics were associated with lower isoelectric points of chemically
modified antibodies, it was hypothesized that the non-specific electrostatic
interactions between normally basic, positively charged antibodies and negatively
charged cell surfaces causing high background binding in normal tissues (47) were
6
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
reduced by the lowering of the isoelectric points of the MAbs. In Chapter 2, the
concept of chemical modification has been extended to include biotinylation.
Biotinylation blocks the s-amino groups of lysine residues, reducing the net charge
of the antibody molecule (48). Although biotinylation had no effect on the avidity
of chTNT-3 for its antigen, this chemical modification resulted in a dramatic
decrease in clearance time in normal mice and lower uptake in nontarget organs
without a decrease in tumor localization in tumor-bearing nude mice. Because of
these characteristics, biotinylated chTNT-3 may have broad potential for the
radioimmunotherapy of human cancers.
Chapters 3 and 4 present a strategy to increase the specific tumor uptake of
therapeutic reagents including radiolabeled MAbs. Since physiological barriers are
a major obstacle to the clinical success of developing molecular therapies for solid
tumors (27), our laboratory developed an experimental approach designed to alter
tumor vascular physiology and in turn increase the delivery of therapeutic reagents.
This strategy employs MAbs to direct proteins with vasoactive properties to tumor
sites in order to increase local vascular permeability without affecting normal
tissues (17). The molecule that produced the greatest enhancement of antibody
uptake is interleukin 2 (IL-2) (49, 50). In clinical immunotherapy studies, the
systemic administration of IL-2 has been shown to result in a toxic side effect
called the capillary leak syndrome, with an increase in the permeability of blood
vessels in the lungs and other organs (51-53). We have harnessed this undesirable
property of IL-2 by using MAbs to target IL-2 to tumor sites. Our laboratory has
7
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
demonstrated in animal models that administration of immunoconjugates consisting
of IL-2 and MAbs directed against various tumor antigens increases local tumor
vascular permeability and in turn enhances the tumor uptake of subsequently
administered radiolabeled MAbs (49, 54). Since the magnitude of enhancement
was similar whether the immunoconjugate was directed against tumor-associated
cell-surface antigens (49), fibronectin in the basement membranes of tumor vessels
(54), or an intracellular antigen exposed in the necrotic regions of solid tumors
(50), we chose to develop an antibody/IL-2 fusion protein with chTNT-3 that
might serve as a universal targeting agent, owing to its ability to target
degenerating cells within all solid tumors. Chapter 3 presents the properties of this
fusion protein (chTNT-3/IL-2) and demonstrates its ability to increase the specific
tumor uptake of both a MAb and a chemotherapeutic drug in a tumor xenograft
model. The fusion protein retains the antigen binding properties of its parent
chimeric antibody and the cytokine activity of IL-2. Although chTNT-3/IL-2
clears extremely rapidly from normal mice, it effectively localizes to tumor
xenografts. Increased tumor uptake of a radiolabeled murine MAb directed
against a glycoprotein on the surface of human colon adenocarcinoma cells
following pretreatment with chTNT-3/IL-2 was both time and dose dependent.
Moreover, the effect of pretreatment with the fusion protein on the permeability of
tumor blood vessels is mediated by local generation of nitric oxide, since
administration of an inhibitor of nitric oxide synthase completely blocked the
effect.
8
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 4 extends these observations to multiple tumor models. Because
TNT-3 recognizes a universal nuclear antigen exposed in the degenerating and
necrotic cells within all solid tumors, it has the potential to target the majority of
human cancers. The effects of pretreatment with chTNT-3/IL-2 on the tumor
uptake of radiolabeled MAbs in various stages of clinical development were
examined in 3 different tumor xenograft models. These include cell lines derived
from several of the most common human cancers, namely, colon cancer, prostatic
carcinoma, and lung adenocarcinoma. Pretreatment with the fusion protein
increased the specific tumor uptake of each MAb examined in all the tumor models
investigated. These studies suggest that this strategy may provide clinical benefit
to patients with a wide variety of solid tumors.
Although radioimmunotherapy of solid tumors has produced minor clinical
responses, radioimmunotherapy of hematologic malignancies, in particular relapsed
B-cell non-Hodgkin's lymphoma (NHL) (18), has shown considerable promise in
clinical studies. The efficacy of radioimmunotherapy is restricted, however, either
by dose-limiting myelosuppression (29) or more severely by the presence of bone
marrow disease. In such settings, the use of unconjugated MAbs would be
desirable. In most clinical trials, however, unconjugated MAbs have demonstrated
virtually no clinical responses (6). In order to increase the immunotherapeutic
potential of MAbs, the combination of antibodies and cytokines has been examined
(55-60). The systemic administration of cytokines, as has been mentioned earlier,
can produce significant toxic side effects. For this reason, the targeted delivery of
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
cytokines has been investigated. Many investigators have demonstrated that tumor
cell lines engineered to secrete cytokines stimulate antitumor immunity and
rejection in animal models (61-68), illustrating the utility of localizing cytokines to
tumor sites. At the present time, however, this approach is impractical in the
clinical setting. An alternative and technically more straightforward method is the
use of antibody/cytokine fusion proteins to direct immunologically active
molecules to tumor sites (69-73). Chapter 5 presents MAb/cytokine fusion
proteins containing granulocyte-macrophage colony-stimulating factor (GM-CSF)
or IL-2 and describes both the immune effector functions mediated by these fusion
proteins against human myeloma cells and their tumor targeting abilities in a nude
mouse xenograft model. The parent murine MAb used for the construction of
these fusion proteins is Lym-2, which is directed against a human major
histocompatibility complex (MHC) class II variant and is strongly reactive with the
majority of human B-cell NHL, chronic lymphocytic leukemia, and multiple
myeloma cell lines and biopsy specimens (74). The human-mouse chimeric
derivative of Lym-2 has been designated chCLL-1. Antibody-dependent cellular
cytotoxicity (ADCC) assays demonstrate the improved tumor lysis mediated by
chCLL-1 over muLym-2, and by both fusion proteins over chCLL-1. These
studies suggest that these fusion proteins have potential as immunotherapeutic
reagents for the treatment of B-cell malignancies, either as an adjunct to
radioimmunotherapy, or perhaps in the context of minimal residual disease, to
prevent recurrences of these hematologic malignancies. Although not described in
10
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
this dissertation, these studies have led the way to the generation of
chTNT-3/cytokine fusion proteins which are presently being tested for their anti
tumor effects in appropriate animal models and patients.
REFERENCES
1. Kohler, G. and Milstein, C. Continuous cultures of fused cells secreting
antibody of predefined specificity. Nature, 256: 495-497, 1975.
2. Taylor, C. R. The current role of immunohistochemistry in diagnostic
pathology. Adv. Pathol. Lab. Med., 7: 59-105, 1994.
3. LoBuglio, A. F. and Saleh, M. N. Advances in monoclonal antibody
therapy of cancer. Am. J. Med. Sci., 304: 214-224, 1992.
4. Goldenberg, D. M. Monoclonal antibodies in cancer detection and therapy.
Am. J. Med., 94: 297-312, 1993.
5. Kosmas, C., Linardou, H., and Epenetos, A. A. Review: advances in
monoclonal antibody tumour targeting. J. Drug Target., 1: 81-91, 1993.
6. Dillman, R. 0. Antibodies as cytotoxic therapy. J. Clin. Oncol., 12: 1491 -
1515, 1994.
7. von Mehren, M. and Weiner, L. M. Monoclonal antibody-based therapy.
Curr. Opin. Oncol., 8: 493-498, 1996.
8. Stigbrand, T., Ullen, A., Sandstrom, P., Mirzaie-Joniani, H., Sundstrom,
B., Nillson, B., Arlestig, L., Norrlund, R. R., Ahlstrom, K. R., and Hietala,
S. Twenty years with monoclonal antibodies: state of the art— where do we
go? Acta Oncol., 35: 259-265, 1996.
9. Schroff, R. W., Foon, K. A., Beatty, S. M., Oldham, R. K., and Morgan
Jr., A. C. Human anti-murine immunoglobulin responses in patients
receiving monoclonal antibody therapy. Cancer Res., 45: 879-885, 1985.
11
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
10. Shawler, D. L., Bartholomew, R. M., Smith, L. M., and Dillman, R. O.
Human immune response to multiple injections of murine monoclonal IgG.
J. Immunol., 135: 1530-1535, 1985.
11. Khazaeli, M. B., Conry, R. M., and LoBuglio, A. F. Human immune
response to monoclonal antibodies. J. Immunother., 15: 42-52, 1994.
12. Kuus-Reichel, K., Grauer, L. S., Karavodin, L. M., Knott, C., Krusemeier,
M., and Kay, N. E. Will immunogenicity limit the use, efficacy, and future
development of therapeutic monoclonal antibodies? Clin. Diagn. Lab.
Immunol., 1: 365-372, 1994.
13. Bruland, O. S. Cancer therapy with radiolabeled antibodies. An overview.
Acta Oncol., 34: 1085-1094, 1995.
14. Kairemo, K. J. Radioimmunotherapy of solid cancers: a review. Acta
Oncol., 35: 343-355, 1996.
15. Grossbard, M. L., Freedman, A. S., Ritz, J., Coral, F., Goldmacher, V. S.,
Eliseo, L., Spector, N., Dear, K., Lambert, J. M., Blattler, W. A., Taylor, J.
A., and Nadler, L. M. Serotherapy of B-cell neoplasms with anti-B4-
blocked ricin: a phase I trial of daily bolus infusion. Blood, 79: 576-585,
1992.
16. Frankel, A. E., FitzGerald, D., Siegall, C., and Press, O. W. Advances in
immunotoxin biology and therapy: a summary of the fourth international
symposium on immunotoxins. Cancer Res., 56: 926-932, 1996.
17. Epstein, A. L. New approaches to improved antibody targeting. In: R. E.
Henkin (ed.) Nuclear Medicine, pp. 516-533. St. Louis: Mosby-Year
Book, 1996.
18. Wilder, R. B., DeNardo, G. L., and DeNardo, S. J. Radioimmunotherapy:
recent results and future directions. J. Clin. Oncol., 14: 1383-1400, 1996.
19. Hand, P. M., Nuti, M., Colcher, D., and Schlom, J. Definition of antigenic
heterogeneity and modulation among human mammary carcinoma cell
populations using monoclonal antibodies to tumor associated antigens.
Cancer Res., 43: 728-735, 1983.
20. Reisfeld, R. A., Greene, M. I., and Yacki, A. Monoclonal antibodies-
progress in cancer immunobiology and clinical applications. Cancer Res.,
46: 2193-2196, 1986.
12
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
21. Wahl, R. L., Parker, C. W., and Philpott, G. W. Improved radioimaging
and tumor localization with monoclonal F(ab')2. J. Nucl. Med., 24: 316-
325, 1983.
22. Carrasquillo, J. A., Sugarbaker, P., Colcher, D., Reynolds, J. C., Esteban,
J., Bryant, G., Keenan, A. M., Perentesis, P., Yokoyama, K., Simpson, D.
E., Ferroni, P., Farkas, R., Schlom, J., and Larson, S. M.
Radioimmunoscintigraphy of colon cancer with iodine-131-labeled B72.3
monoclonal antibody. J. Nucl. Med., 29: 1022-1030, 1988.
23. Maguire, R. T., Pascucci, V. L., Maroli, A. N., and Gulfo, J. V.
Immunoscintigraphy in patients with colorectal, ovarian, and prostate
cancer. Cancer, 72: 3453-3462, 1993.
24. Behr, T. M., Becker, W. S., Bair, H.-J., Klein, M. W., Stuhler, C. M.,
Cidlinsky, K. P., Wittekind, C. W., Scheele, J. R , and Wolf, F. G.
Comparison of complete versus fragmented technetium-99m-labeled anti-
CEA monoclonal antibodies for immunoscintigraphy in colorectal cancer. J.
Nucl. Med., 36: 430-441, 1995.
25. Chengazi, V. U., Feneley, M. R., Ellison, D., Stalteri, M., Granowski, A.,
Granowska, M., Nimmon, C. C., Mather, S. J., Kirby, R. S., and Britton,
K. E. Imaging prostate cancer with technetium-99m-7El 1-C5.3 (CYT-
351). J. Nucl. Med., 38: 675-682, 1997.
26. Epenetos, A. A., Snook, D., Durbin, H., Johnson, P. M., and Taylor-
Papadimitriou, J. Limitations of radiolabeled monoclonal antibodies for
localization of human neoplasms. Cancer Res., 46: 3183-3191, 1986.
27. Jain, R. K. Delivery of molecular medicine to solid tumors. Science, 27:
1079-1080, 1996.
28. Buchsbaum, D. J. Experimental approaches to increase radiolabeled
antibody localization in tumors. Cancer Res. (Suppl.), 55: 5729s-5732s,
1995.
29. Vriesendorp, H. M., Quadri, S. M., Andersson, B. S., and Dicke, K. A.
Hematologic side effects of radiolabeled immunoglobulin therapy. Exp.
Hematol., 24: 1183-1190, 1996.
30. Jain, R. K. Physiological barriers to delivery of monoclonal antibodies and
other macromolecules in tumors. Cancer Res. (Suppl.), 50: 814s-819s,
1990.
31. Sands, H. and Jones, P. L. Physiology of monoclonal antibody accretion by
tumors. Cancer Treat. Res., 51: 97-122, 1990.
13
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
32. Dvorak, H. F., Nagy, J. A., and Dvorak, A. M. Structure of solid tumors
and their vasculature: implications for therapy with monoclonal antibodies.
Cancer Cells, 3: 77-85, 1991.
33. Chen, F.-M., Epstein, A. L., Li, Z., and Taylor, C. R. A comparative
autoradiographic study demonstrating differential intratumor localization of
monoclonal antibodies to cell surface (Lym-1) and intracellular (TNT-1)
antigens. J. Nucl. Med., 31: 1059-1066, 1990.
34. Epstein, A. L., Khawli, L. A., Chen, F.-M., Hu, P., Glasky, M. S., and
Taylor, C. R. Tumor necrosis imaging and treatment of solid tumors. In:
V. P. Torchilin (ed.) Handbook of Targeted Delivery of Imaging Agents,
pp. 259-288. Boca Raton, FL: CRC Press, 1995.
35. Epstein, A. L., Chen, F.-M., and Taylor, C. R. A novel method for the
detection of necrotic lesions in human cancers. Cancer Res., 48: 5842-
5848, 1988.
36. Epstein, A. L., Chen, D., Ansari, A., Najafi, A., Siegel, M., Lee, K., Hu,
E., Rosen, P., Watkins, K., Stain, S., Weaver, F., and Taylor, C. R.
Radioimmunodetection of necrotic lesions in human tumors using 1-131
labeled TNT-1 F(ab')2 monoclonal antibody. Antibody Immunoconj.
Radiopharm., 4: 151-161, 1991.
37. Chen, F.-M., Taylor, C. R., and Epstein, A. L. Tumor necrosis treatment of
ME-180 human cervical carcinoma model with 1 3 1 I-labeled TNT-1
monoclonal antibody. Cancer Res., 49: 4578-4585, 1989.
38. Morrison, S. L. In vitro antibodies: strategies for production and
application. Annu. Rev. Immunol., 10: 239-265, 1992.
39. Winter, G. and Milstein, C. Man-made antibodies. Nature, 349: 293-299,
1991.
40. Hozumi, N. and Sandhu, J. S. Recombinant antibody technology: its advent
and advances. Cancer Invest., 11: 714-723, 1993.
41. Boulianne, G. L., Hozumi, N., and Shulman, M. J. Production of functional
chimaeric mouse/human antibody. Nature, 312: 643-646, 1984.
42. Morrison, S. L., Johnson, M. J., Herzenberg, L. A., and Oi, V. T. Chimeric
human antibody molecules: mouse antigen-binding domains with human
constant region domains. Proc. Natl. Acad. Sci. USA, 81: 6851-6855,
1984.
14
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
43. Liu, A. Y., Robinson, R. R., Hellstrom, K. E., E.D., M., Chang, C., and
Hellstrom, I. Chimeric human-mouse IgGl antibody that can mediate lysis
of cancer cells. Proc. Natl. Acad. Sci. USA, 84: 3439-3443, 1987.
44. LoBuglio, A. F., Wheeler, R. H., Trang, J., Haynes, A., Rogers, K.,
Harvey, E. B., Sun, L., Ghrayeb, J., and Khazaeli, M. B. Mouse/human
chimeric monoclonal antibody in man: kinetics and immune response. Proc.
Natl. Acad. Sci. USA, 86: 4220-4224, 1989.
45. Bebbington, C. R., Renner, G., Thomson, S., King, D., Abrams, D., and
Yarranton, G. T. High-level expression of a recombinant antibody from
myeloma cells using a glutamine synthetase gene as an amplifiable
selectable marker. Bio/Technology, 10: 169-175, 1992.
46. Khawli, L. A., Glasky, M. S., Alauddin, M. M., and Epstein, A. L.
Improved tumor localization and radioimaging with chemically modified
monoclonal antibodies. Cancer Biother. Radiopharm., 11: 203-215, 1996.
47. Khaw, B.-A., Klibanov, A., O'Donnell, S. M., Saito, T., Nossiff, N.,
Slinkin, M. A., Newell, J. B., Strauss, H. W., and Torchilin, V. P. Gamma
imaging with negatively charge-modified monoclonal antibody:
modification with synthetic polymers. J. Nucl. Med., 32: 1742-1751, 1991.
48. Wadsley, J. J. and Watt, R. M. The effect of pH on the aggregation of
biotinylated antibodies and on the signal-to-noise observed in
immunoassays utilizing biotinylated antibodies. J. Immunol. Methods, 103:
1-7, 1987.
49. LeBerthon, B., Khawli, L. A., Alauddin, M., Miller, G. K., Charak, B. S.,
Mazumder, A., and Epstein, A. L. Enhanced tumor uptake of
macromolecules induced by a novel vasoactive interleukin 2
immunoconjugate. Cancer Res., 51: 2694-2698, 1991.
50. Khawli, L. A., Miller, G. K., and Epstein, A. L. Effect of seven new
vasoactive immunoconjugates on the enhancement of monoclonal antibody
uptake in tumors. Cancer, 73: 824-831, 1994.
51. Rosenstein, M., Ettinghausen, S. E., and Rosenberg, S. A. Extravasation of
/ intravascular fluid mediated by the systemic administration of recombinant
interleukin 2. Immunology, 137: 1735-1742, 1986.
52. Ettinghausen, S. E., Puri, R. K., and Rosenberg, S. A. Increased vascular
permeability in organs mediated by the systemic administration of
lymphokine-activated killer cells and recombinant interleukin-2 in mice. J.
Natl. Cancer Inst., 80: 177-188, 1988.
15
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
53. Siegel, J. P. and Puri, R. K. Interleukin-2 toxicity. J. Clin. Oncol., 9: 694-
704, 1991.
54. Epstein, A. L., Khawli, L. A., Hornick, J. L., and Taylor, C. R.
Identification of a monoclonal antibody, TV-1, directed against the
basement membrane of tumor vessels, and its use to enhance the delivery of
macromolecules to tumors after conjugation with interleukin 2. Cancer
Res., 55: 2673-2680, 1995.
55. Bianchi, A. C., Heslop, H. E., Veys, P., Macey, M., Holland, M., Prentice,
H. G., and Brenner, M. K. Enhancement of monoclonal antibody
dependent cell mediated cytotoxicity by IL2 and GM-CSF. Br. J.
Haematol., 73: 468-474, 1989.
56. Vuist, W. M. J., Buitenen, F. v., de Rie, M. A., Hekman, A., Riimke, P.,
and Melief, C. J. M. Potentiation by interleukin 2 of Burkitt's lymphoma
therapy with anti-pan B (anti-CD 19) monoclonal antibodies in a mouse
xenotransplantation model. Cancer Res., 49: 3783-3788, 1989.
57. Gill, I., Agah, R., Hu, E., and Mazumder, A. Synergistic antitumor effects
of interleukin 2 and the monoclonal Lym-1 against human Burkitt
lymphoma cells in vitro and in vivo. Cancer Res., 49: 5377-5379, 1989.
58. Biddle, W. C., Pancook, J., Goldrosen, M., Han, T., Foon, K. A., and
Vaickus, L. Antibody-dependent, cell-mediated cytotoxicity by an anti
class II murine monoclonal antibody: effects of recombinant interleukin 2
on human effector cell lysis of human B-cell tumors. Cancer Res., 50:
2991-2996, 1990.
59. Hooijberg, E., Sein, J. J., van den Berk, P. C. M., Hart, A. A. M., van der
Valk, M. A., Kast, W. M., Melief, C. J. M., and Hekman, A. Eradication of
large human B cell tumors in nude mice with unconjugated CD20
monoclonal antibodies and interleukin 2. Cancer Res., 55: 2627-2634,
1995.
60. Ottonello, L., Morone, P., Dapino, P., and Dallegri, F. Monoclonal Lym-1
antibody-dependent lysis of B-lymphoblastoid tumor targets by human
complement and cytokine-exposed mononuclear and neutrophilic
polymorphonuclear leukocytes. Blood, 87: 5171-5178, 1996.
61. Fearon, E. R., Pardoll, D. M., Itaya, T., Golumbek, P., Levitsky, H. I.,
Simons, J. W., Karasuyama, H., Vogelstein, B., and Frost, P. Interleukin-2
production by tumor cells bypasses T helper function in the generation of
an antitumor response. Cell, 60: 397-403, 1990.
16
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
62. Tsai, S.-C. J., Gansbacher, B., Tait, L., Miller, F. R., and Heppner, G. H.
Induction of antitumor immunity by interleukin-2 gene-transduced mouse
mammary tumor cells versus transduced mammary stromal fibroblasts. J.
Natl. Cancer Inst., 85: 546-553, 1993.
63. Porgador, A., Tzehoval, E., Vadai, E., Feldman, M., and Eisenbach, L.
Immunotherapy via gene therapy: comparison of the effects of tumor cells
transduced with the interleukin-2, interleukin-6, or interferon-y genes. J.
Immunother., 14: 191-201, 1993.
64. Cignetti, A., Guarini, A., Carbone, A., Fomi, M., Cronin, K., Fomi, G.,
Gansbacher, B., and Foa, R. Transduction of the IL2 gene into human
acute leukemia cells: induction of tumor rejection without modifying cell
proliferation and IL2 receptor expression. J. Natl. Cancer Inst., 86: 785-
791, 1994.
65. Visseren, M. J. W., Koot, M., van der Voort, E. I. H., Gravestein, L. A.,
Schoenmakers, H. J., Kast, W. M., Zijlstra, M., and Melief, C. J. M.
Production of interleukin-2 by EL4 tumor cells induces natural killer cell-
and T-cell-mediated immunity. J. Immunother., 15: 119-128, 1994.
66. Katsanis, E., Orchard, P. J., Bausero, M. A., Gorden, K. B., Mclvor, R. S.,
and Blazar, B. R. Interleukin-2 gene transfer into murine neuroblastoma
decreases tumorigenicity and enhances systemic immunity causing
regression of preestablished retroperitoneal tumors. J. Immunother., 15:
81-90, 1994.
67. Allione, A., Consalvo, M., Nanni, P., Lollini, P. L., Cavallo, F., Giovarelli,
M., Fomi, M., Gulino, A., Colombo, M. P., Dellabona, P., Hock, H.,
Blankenstein, T., Rosenthal, F. M., Gansbacher, B., Bosco, M. C., Musso,
T., Gusella, L., and Fomi, G. Immunizing and curative potential of
replicating and nonreplicating murine mammary adenocarcinoma cells
engineered with interleukin (IL)-2, EL-4, IL-7, IL-10, tumor necrosis factor
a, granulocyte-macrophage colony-stimulating factor, and y-interferon
gene or admixed with conventional adjuvants. Cancer Res., 54: 6022-6026,
1994.
68. Gunji, Y., Tagawa, M., Matsubara, H., Takenaga, K., Shimada, H.,
Kondo, F., Suzuki, T., Nakajima, K., Aoki, T., Asano, T., Ochiai, T.,
Isono, K., Kageyama, H., Nakamura, Y., and Sakiyama, S. Murine colon
carcinoma cells engineered to produce human interleukin-2 induce tumor-
specific anti-tumor response. Int. J. Cancer, 66: 135-139, 1996.
17
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
69. Gillies, S. D., Reilly, E. B., Lo, K.-M., and Reisfeld, R. A. Antibody-
targeted interleukin 2 stimulates T-cell killing of autologous tumor cells.
Proc. Natl. Acad. Sci. USA, 89: 1428-1432, 1992.
70. Fell, H. P., Gayle, M. A., Grosmaire, L., and Ledbetter, J. A. Genetic
construction and characterization of a fusion protein consisting of a
chimeric F(ab') with specificity for carcinomas and human IL-2. J.
Immunol., 146: 2446-2452, 1991.
71. Sabzevari, H., Gillies, S. D., Mueller, B. M., Pancook, J. D., and Reisfeld,
R. A. A recombinant antibody-interleukin 2 fusion protein suppresses
growth of hepatic human neuroblastoma metastases in severe combined
immunodeficiency mice. Proc. Natl. Acad. Sci. USA, 91: 9626-9630,
1994.
72. Becker, J. C., Varki, N., Gillies, S. D., Furukawa, K., and Reisfeld, R. A.
An antibody-interleukin 2 fusion protein overcomes tumor heterogeneity by
induction of a cellular immune response. Proc. Natl. Acad. Sci. USA, 93:
7826-7831, 1996.
73. Reisfeld, R. A. and Gillies, S. D. Recombinant antibody fusion proteins for
cancer immunotherapy. Curr. Top. Microbiol. Immunol., 213 (Pt 3): 27-
53, 1996.
74. Epstein, A. L., Marder, R. J., Winter, J. N., Stathopoulos, E., Chen, F.-M.,
Parker, J. W., and Taylor, C. R. Two new monoclonal antibodies, Lym-1
and Lym-2, reactive with human B-lymphocytes and derived tumors, with
immunodiagnostic and immunotherapeutic potential. Cancer Res., 47: 830-
840, 1987.
18
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 2 . chTNT-3/B, a New Chemically Modified Chimeric
Monoclonal Antibody Directed Against DNA for the Tumor
Necrosis Treatment of Solid Tumors
ABSTRACT
Despite successes in the treatment of B-cell malignancies,
radioimmunotherapy for solid tumors has proven disappointing. The challenges to
therapy with monoclonal antibodies (MAbs) directed against conventional tumor-
associated cell surface antigens include cross reactivity of antigen expression in
normal tissues leading to unwanted toxicity, the presence of circulating antigen,
low tumor uptake, and short residence time of radionuclide in tumor. In order to
address these problems, we previously developed a novel approach designated
Tumor Necrosis Treatment (TNT) that exploits the presence of degenerating and
necrotic cells within solid tumors by utilizing MAbs directed against universal,
intracellular antigens. The first TNT MAb developed by our laboratory,
designated TNT-1, was directed against nucleosomal determinants consisting of
histone HI and DNA. Investigation of the biological characteristics of this MAb
showed it to localize to tumor xenografts regardless of their cell of origin, bind
necrotic regions of tumors, and induce tumor regressions after multiple injections
of 1311-labeled MAb. Since absolute tumor accretion of MAb is a critical
determinant of antitumor efficacy in radioimmunotherapy, we sought to identify
19
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
new antinuclear antibodies that displayed high tumor localization properties. In
the present study, we describe a murine antinuclear antibody, TNT-3, which
demonstrates a 3-fold higher tumor uptake than murine TNT-1. Because of this
characteristic, a chimeric derivative designated chTNT-3 was developed and
evaluated for antigen binding and tumor targeting. ELISA studies using a series of
nuclear antigens confirmed that TNT-3 is directed against single-stranded DNA,
does not cross react with TNT-1, and gives a predominant nuclear staining
reactivity in human tissues and tumors. Since it was recently shown by our
laboratory that charge modification can significantly improve the pharmacokinetic
performance of monoclonal antibodies, chTNT-3 was chemically modified with
biotin to generate an improved therapeutic reagent designated chTNT-3/B.
Comparative studies with unmodified MAb showed that biotinylation significantly
shortened its clearance time in mice and produced lower normal tissue levels, while
generating an equal amount of uptake in tumor xenografts for up to 10 days.
These in vivo characteristics indicate that chTNT-3/B is a new and improved TNT
reagent which can be used for the radioimmunotherapy of solid tumors.
INTRODUCTION
Despite notable successes in the treatment of B-cell malignancies, in
particular B-cell non-Hodgkin’s lymphomas (1), the radioimmunotherapy of solid
tumors has demonstrated limited success in the clinic (1-3). Challenges to the
efficacy of antibody-based solid tumor therapies include expression of the target
antigen in normal tissues, the presence of circulating antigen (4, 5), antigenic
20
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
modulation, and low tumor uptake (6-8). Conventional approaches have utilized
MAbs that recognize tumor-associated antigens expressed on the surface of tumor
cells (9). In an attempt to address the problems delineated above, we developed a
novel approach to solid tumor therapy which targets the necrotic regions of
tumors. Designated Tumor Necrosis Treatment (TNT), this approach takes
advantage of the high proportion of degenerating and necrotic cells that
accumulate within solid tumors by utilizing MAbs directed against intracellular
antigens exposed in abnormally permeable cells (10). An imaging study in seven
patients bearing different solid tumors demonstrated proof of principle for this
novel approach in which it was shown that the majority of primary and metastatic
lesions were positively imaged with low localization seen in normal tissues (11).
Prior pre-clinical studies in tumor-bearing nude mice showed that TNT-1, directed
against histone HI and DNA (nucleosomes), localized to a variety of tumor
xenografts and had low uptake in normal tissues (12). Autoradiographic studies
demonstrated that unlike IgG directed against cell surface antigens, which tend to
localize to perivascular tumor cells encountered first by extravasating radiolabeled
antibodies, TNT-1 is able to achieve significant penetration deep within the
necrotic core of solid tumors (13). Furthermore, an experimental
radioimmunotherapy study using 1 3 ^-labeled TNT-1 in a mouse model illustrated
the therapeutic potential of Tumor Necrosis Treatment (14). Since it is recognized
that absolute tumor accretion of MAb is a critical determinant of antitumor
efficacy in radioimmunotherapy (4), we sought to identify new antinuclear
21
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
antibodies with higher tumor localization characteristics. In the present study, we
describe a new murine MAb directed against DNA, designated TNT-3, that
demonstrates a three-fold higher improvement in tumor uptake.
In addition to the problems outlined above, immune responses to murine
MAbs administered to patients can severely limit their therapeutic applications,
since the occurrence of human anti-mouse antibodies (HAMA) may reduce serum
MAb levels and hence result in poor localization to the tumor site (4, 15). One
approach to this problem is to produce human-mouse chimeric antibodies (16, 17),
whose murine constant regions are replaced by human sequences, resulting in
recombinant proteins that are approximately 65% human and 35% murine. In
some cases, chimeric antibodies have been shown to be less immunogenic than
their parent murine antibodies in clinical investigations, although the degree to
which patients respond has varied considerably (18). In order to develop a
clinically useful TNT-3 reagent able to be administered multiple times to patients, a
chimeric TNT-3, designated chTNT-3, was produced using genetic engineering
methods. To generate high levels of expression of this chimeric MAb, the
Glutamine Synthetase Gene Amplification System was used in mouse NSO cells
(19).
Finally, since the dose-limiting toxicity for radioimmunotherapy is
thrombocytopenia, which restricts the amount and frequency with which
radiolabeled MAbs may be administered (1, 20), methods that decrease the
clearance time of MAbs without compromising their ability to localize to tumors
22
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
would provide significant therapeutic benefit. Recently, our laboratory and others
have determined that charge modification of antibodies can significantly improve
their pharmacokinetic performance (21-25). As shown by Khawli et al. (24),
chemical modification of murine MAbs lowers their isoelectric points, decreases
clearance times, and in turn improves tumor targeting. We have investigated
simple alternatives to chemical modification of MAbs and have identified
biotinylation as a potential candidate. Since biotin (vitamin H) is a normal
component of the body present in minute amounts in every living cell, it is
nontoxic and nonimmunogenic. In this report, we now demonstrate that a
chemical conjugate of chTNT-3 with biotin, designated chTNT-3/B, exhibits
improved in vivo pharmacokinetics and biodistribution in a nude mouse tumor
xenograft model and is thus a reagent with broad potential applications for the
Tumor Necrosis Treatment of solid tumors.
MATERIALS AND METHODS
Reagents.
The plasmids pEE6hCMV-B and pEE12 were purchased with the
Glutamine Synthetase Gene Amplification System from Celltech Biologies
(Slough, UK). The plasmids pSK-yl, containing the human gamma 1 constant
region, and pSK-x, containing the human kappa constant region, were generously
provided by Dr. Mitchell E. Reff (EDEC Pharmaceuticals, La Jolla, CA).
Restriction endonucleases, T4 DNA ligase, and other molecular biology reagents
23
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
were purchased from New England Biolabs (Beverly, MA) or Boehringer
Mannheim (Indianapolis, IN). RPMI-1640 medium, MEM non-essential amino
acids solution, penicillin-streptomycin solution, dialyzed fetal bovine serum,
double-stranded and single-stranded DNA from calf thymus, nucleohistone,
Dulbecco’s phosphate buffered saline (PBS), chloramine T, sodium metabisulfite,
hydrogen peroxide, ABTS (2,2’-azino-bis(3-ethylbenzthiazoline-6-sulfonic acid)
diammonium salt), protease from Streptomyces griseus, avidin, and HABA (4-
hydroxyazobenzene-2-carboxylic acid) were purchased from Sigma Chemical Co.
(St. Louis, MO). Hybridoma-SFM medium with and without glutamine was
purchased from Life Technologies (Gaithersburg, MD). Fetal bovine serum was
obtained from HyClone Laboratories, Inc. (Logan, UT). Sulfosuccinimidyl-6-
(biotinamido) hexanoate (NHS-LC-biotin) was purchased from Pierce (Rockford,
IL). Iodine-125 and iodine-131 were obtained as sodium iodide in 0.1N sodium
hydroxide from DuPont/New England Nuclear (North Billerica, MA). BALB/c
and athymic nude mice were purchased from Harlan Sprague Dawley
(Indianapolis, IN).
Antibodies and cell lines.
The hybridoma producing muTNT-3 (IgGiic), original clone 121-3, was
established after immunization of BALB/c mice with nuclear extracts prepared
from Raji Burkitt’s lymphoma cells as previously described (26). chTNT-1
(IgGiic), the cDNAs for whose variable regions were cloned from the murine
1415-1 hybridoma (12), was constructed and expressed in the same manner as
24
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
chTNT-3 described in this report. chLym-1 (IgGiic), directed against a human
B-cell surface antigen (27), was produced as previously described (28).
Iodine-125 and iodine-131 labeled MAbs were prepared using a modified
chloramine T method as previously described (28). The NSO murine myeloma cell
line, which was obtained from Celltech Biologies, was grown in non-selective
medium consisting of Hybridoma- SFM supplemented with 10% fetal bovine
serum, L-glutamine, MEM non-essential amino acids solution, penicillin G (100
U/ml), and streptomycin (100 gg/ml). Selective medium consists of Hybridoma-
SFM without glutamine supplemented with 10% dialyzed fetal bovine serum,
glutamic acid, asparagine, nucleosides, penicillin G, and streptomycin, according to
the protocol provided with the Glutamine Synthetase Gene Amplification System
(Celltech Biologies). The Raji cell line, derived from an African Burkitt's
lymphoma (29, 30), was obtained from the American Type Culture Collection
(clone CCL-86; Rockville, MD). The ME-180 human cervical carcinoma cell line
was grown in RPMI-1640 medium supplemented with 10% fetal bovine serum,
L-glutamine, penicillin G, and streptomycin.
Cloning of TNT-3 variable reeion eenes.
Variable region cDNAs were synthesized essentially as previously
described (28). Briefly, total RNA was isolated from approximately 107 TNT-3
hybridoma cells (31), and polyadenylated RNA was purified using the Oligotex
mRNA kit (QIAGEN Inc., Chatsworth, CA). The SUPERSCRIPT Preamplification
System (Life Technologies) was used for first strand cDNA synthesis according to
25
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
the manufacturer’s protocol with a mouse ChI antisense primer (5’ - GGACAGG
GATCCAGAGTTCCA - 3’) and a mouse k antisense primer (5’ - GATGGATCC
AGTTGGTGCAGCATC - 3’), to generate heavy and light chain variable regions,
respectively. The TNT-3 cDNA was amplified by PCR essentially as previously
described (32) using degenerate primers synthesized as published (33). The
TNT-3 light chain variable region was identified after amplification with the
primers 5’ - ACTAAGTCGACATGGTA(G)TCCA(T)CAC(G)CTCAGTTCCTT
G - 3’ and 5’ - GATGGATCC AGTTGGTGCAGCATC - 3’, and the TNT-3
heavy chain variable region was amplified by the primers 5’ - ATGTACTTGGGA
CTGAG(A)CTA(G)T - 3’ and 5’ - AGGGAATTCACCCTTGACCAGGCA - 3’.
The PCR products were digested with restriction endonucleases Sail and EcoRI
for the heavy chain and Sail and BamHI for the light chain prior to ligation into
pBluescript plasmids (SK+ , Invitrogen, San Diego, CA). The sequences of the
variable region cDNAs were determined by automated DNA sequencing.
Construction of expression vectors.
The TNT-3 variable region cDNAs were PCR amplified from the cloning
vectors using primers designed to introduce appropriate restriction endonuclease
sites and a translation initiation sequence (34). The light chain variable region was
introduced into the parent expression vector pEE6hCMV-B, into which the human
k constant region had already been cloned. The heavy chain variable region was
ligated into the parent expression vector pEE12, into which the human yl constant
region had previously been cloned. The final expression vectors were
26
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
pEE6/chTNT-3 LC and pEE12/chTNT-3 HC, containing transcription cassettes
for the chimeric light and heavy chains, respectively, each under the control of the
cytomegalovirus major immediate early promoter. pEE12/chTNT-3 HC also
contains the cDNA sequence for the selectable marker glutamine synthetase, under
the control of the SV40 early promoter.
Expression and purification of chTNT-3.
The chimeric MAb was expressed in NSO murine myeloma cells according
to the manufacturer's protocol (Celltech Biologies). Briefly, both linearized
plasmids were electroporated into NSO cells, which were plated in non-selective
Hybridoma-SFM medium. Selective glutamine-free medium was added 24 h later.
When transfectants appeared approximately 3 weeks later, supernatants were
tested for the presence of chimeric MAb by indirect ELISA, as described below.
The highest producing clone was identified by a 24-h rate of production assay.
After sub-cloning by limiting dilution, the highest producing clone was expanded
and incubated in a 3 liter bioreactor, and chTNT-3 was purified stepwise from cell
culture medium by protein A affinity chromatography and ion-exchange
chromatography, as previously described (28). The purity of the chimeric MAb
was examined by SDS-PAGE according to the method of Laemmli (35) and by
High Performance Liquid Chromatography (HPLC). The antibody was analyzed
with a Beckman HPLC Gold System (Beckman Instruments, Fullerton, CA)
equipped with two 110B solvent pumps, a 210A valve injector, a 166
programmable UV detector, and a 406 analog interface module. Size exclusion
27
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
chromatography was performed on a G4000SW column (TosoHaas,
Montgomeryville, PA) with 0.1 M PBS, pH 7.2 as the solvent system, eluting at a
flow rate of 1 ml/min. The UV absorbance of the HPLC eluate was detected at
280 nm.
Immunoassays.
ELISA.
Chimeric MAb-containing supernatants were initially identified by indirect
ELISA using microtiter plates coated with single-stranded DNA from calf thymus,
essentially as previously described (28). For production rate assays, 106 cells were
plated in 1 ml of selective medium and allowed to incubate for 24 h. ELISA was
then performed as before. Supernatants were serially diluted and applied to wells
of microtiter plates coated with goat anti-human IgG (H+L) (CalTag, So. San
Francisco, CA). Dilutions of a control chimeric MAb were used to generate a
standard curve using 4-parameter fit by an automated ELISA reader (Bio-Tek
Instruments, Winooski, VT), from which concentrations of unknowns were
estimated. Rates of production expressed as pg/ml/106 cells/24 h were compared
to identify the highest producing clones. For a preliminary characterization of the
antigen recognized by chTNT-3, indirect ELISA was performed as above using
microtiter plates coated with single-stranded DNA from calf thymus, double
stranded DNA from calf thymus, or nucleohistone (crude complex of histone and
DNA extracted from calf thymus), each at 100 pg/ml in PBS overnight at 4°C.
Purified chTNT-3 was examined along with chLym-1 as a negative control.
28
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Raji cell competition RIA.
The immunoreactivity of chTNT-3 was also evaluated by a competition
RIA for binding to fixed Raji lymphoma cells. For these studies, 2 x 106 Raji cells
previously fixed in 2% paraformaldehyde (36) were incubated with 20 ng of 1 2 5 I-
labeled muTNT-3 and serial dilutions of cold muTNT-3, chTNT-3, or a MAb
recognizing a different nuclear antigen (chTNT-1). The cells and MAbs were
incubated for 1 h at room temperature with constant mixing. The cells were then
washed twice, and the cell pellet-associated radioactivity was measured in a
gamma counter. Maximal binding was determined from tubes containing no cold
antibodies.
Biotinvlation of chTNT-3.
NHS-LC-biotin (0.4 mg) was added to 20 mg of chTNT-3 (10 mg/ml) in
0.1 M PBS, pH 7.4 containing 30 mM NaCl, and the mixture was incubated for 1
h at room temperature with continuous shaking at low speed. After incubation,
the biotinylated antibody solution was adjusted to pH 6.5 with 5 N NaOH and
loaded onto a SP-Sepharose column equilibrated with 0.1M PBS, pH 6.5
containing 30 mM NaCl. The resulting chTNT-3/B was then eluted with 0.1 M
PBS, pH 7.4 containing 150 mM NaCl. The average number of biotin molecules
coupled to each MAb was determined spectrophotometrically by the method of
Green (37). Briefly, chTNT-3/B was digested with 1% protease at 37°C for 4 h.
Seventy microliters of a 17 pM solution of avidin was added to a solution
containing 800 pi of 100 pM HABA in 5 ml 0.1 M PBS, pH 7.2. The avidin-
29
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
HAB A solution was then titrated with increasing volumes of the digested
chTNT-3/B solution, and the change in absorbance was determined at 500 nm.
From this treatment, the concentration of biotin in the protease-treated MAb
solution was calculated using a biotin standard curve. Approximately 2-3
molecules of biotin were conjugated to each molecule of chTNT-3. The purity of
biotinylated chTNT-3 was evaluated by HPLC as described above, pis for
chTNT-3 and chTNT-3/B were determined by IEF in a BioRad Model 111 Mini
IEF cell as previously described (28).
Determination of avidity.
In order to determine the avidity constants of muTNT-3, chTNT-3, and
chTNT-3/B, a fixed cell RIA was performed using the method of Frankel and
Gerhard (38). Each experimental variable was run in duplicate. Raji lymphoma
cell suspensions containing 106 cells/ml were incubated with 10 to 110 ng of 1 2 5 I-
labeled MAb in 200 to 500 pi PBS for 1 h at room temperature with constant
mixing. The cells were then washed three times with PBS containing 1% bovine
serum albumin to remove unbound antibody and counted in a gamma counter. The
amount of MAb bound was then determined by the remaining cell-bound
radioactivity (cpm) in each tube and the specific activity (cpm/ng) of the
radiolabeled antibody. Scatchard plot analysis was used to obtain the slope. The
equilibrium or avidity constant Ka was calculated by the equation K = -(slope/n),
where n is the valence of the antibody (2 for IgG).
30
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Immunohistologic studies.
Aliquots of muTNT-3 were tested for evidence of binding to a range of
human tissues in both frozen and paraffin sections. TNT-3 was titrated to optimal
concentration (1:2,000) on test sections of both frozen and formalin-fixed paraffin-
embedded tissue, using biotin-avidin immunoperoxidase methods, with antigen
retrieval techniques in the formalin paraffin material (microwave heating at 100°C
for 20 min in citrate buffer, pH 6.0) (39). The intensity of staining was greatest
when the whole of the primary antibody incubation (1 h) was performed at 37°C,
as opposed to room temperature, when it was difficult to discern low levels of
positivity against the background of the hematoxylin nuclear counterstain.
Comparable patterns of nuclear reactivity were observed in both the frozen and
paraffin section environment. As a result, paraffin-embedded tissues were selected
for a comprehensive study of the pattern of reactivity in a wide range of normal
and neoplastic tissues (40). Normal tissues and cell types examined included
salivary gland, thyroid, stomach, small and large intestine, liver, pancreas, kidney,
lung, brain, breast, skin and appendages, testis, ovary, placenta, smooth, striated,
and cardiac muscle, bone marrow elements, lymphocytes, plasma cells, peripheral
nerve, and connective tissue, including fibrocytes, adipose tissue, capillaries, veins,
and arteries. Neoplastic tissues included carcinomas of lung, stomach, colon,
breast, and ovary, with varying degrees of neoplastic cell degeneration and
necrosis, these being five of the principal clinical targets of Tumor Necrosis
Treatment.
31
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Pharmacokinetic and biodistribution studies.
Six-week-old BALB/c mice were used to determine the pharmacokinetic
clearance of chTNT-3 and chTNT-3/B. Groups of mice («=4) were administered
i.p. injections of 1 2 5 I-labeled MAb (30-40 pCi/mouse). The whole body activity at
injection and at selected times thereafter was measured with a CRC-7
microdosimeter (Capintec, Inc., Pittsburgh, PA). The data were analyzed and half-
lives were determined as previously described (41). To examine the tissue
biodistribution of muTNT-3, chTNT-3, and chTNT-3/B, six-week-old female
athymic nude mice were injected with a 0.2 ml inoculum containing 10 ME-180
human cervical carcinoma cells s.c. in the left thigh. The tumors were grown for
four weeks until they reached approximately 1 cm in diameter. Within each group
(n=4), individual mice were injected i.v. with a 0.1 ml inoculum containing 100
pCi/10 pg of 1 2 5 I-labeled MAb. Animals were sacrificed by sodium pentobarbital
overdose at various times post-injection, and organs, blood, and tumors were
removed and weighed. The radioactivity in the samples was then measured in a
gamma counter. For each mouse, data were expressed as %ID/g and tumor/organ
ratio (cpm per gram tumor/cpm per gram organ). From these data, the mean and
SD were calculated for each group. Differences between groups were analyzed by
unpaired Student’s t-test.
Imaging studies.
ME-180 cervical carcinoma tumors were grown in the left thighs of
athymic nude mice as described above. When the tumors had reached
32
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
approximately 1 cm in diameter, the mice were injected i.v. with a 0.1 ml inoculum
containing 200 pCi/10 pg o f 1 3 ^-labeled chTNT-3 or chTNT-3/B. At three days
post-injection, the mice were anesthetized with a s.c. injection of 0.8 mg sodium
pentobarbital. The immobilized mice were then imaged in a prone position with a
Spectrum 91 camera equipped with a pinhole collimator (Raytheon Medical
Systems, Melrose Park, IL) set to record 10,000 counts using the Nuclear MAX
Plus image analysis software package (MEDX Inc., Wood Dale, IL).
RESULTS
Construction, expression, and purification of chTNT-3.
In order to identify TNT-3 variable regions, antisense primers to the k and
ChI constant domains were paired with panels of degenerate primers
corresponding to the signal peptides of all murine immunoglobulin light and heavy
chains, respectively. Variable regions were amplified from cDNAs prepared from
the 121-3 hybridoma. Amplified TNT-3 variable heavy and light regions were then
cloned into pEE12 and pEE6hCMV-B plasmids containing human yl and k
constant domains, respectively, resulting in the expression vectors
pEE12/chTNT-3 HC and pEE6/chTNT-3 LC. The vectors were co-transfected
into NSO murine myeloma cells, and the chimeric MAb was expressed using the
Glutamine Synthetase Gene Amplification System (Celltech Biologies). The
highest chTNT-3-producing subclone secreted approximately 30 pg/ml/106
cells/24 h in static culture, while upon scale-up to a 3 liter bioreactor, greater than
33
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
100 jj,g/ml of chTNT-3 were obtained after purification. Reducing SDS-PAGE
revealed two discrete bands at approximately 55 and 25 kDa, corresponding to the
predicted molecular weights of chimeric immunoglobulin heavy and light chains
(data not shown). Moreover, the purity and proper assembly of the chimeric
antibody were confirmed by HPLC analysis, which demonstrated a single sharp
peak with a retention time of approximately 610 s. As described above,
biotinylation of chTNT-3 resulted in approximately 2-3 molecules of biotin per
antibody as determined by spectrophotometry. chTNT-3/B likewise demonstrated
a single sharp peak by HPLC, with a retention time equivalent to that of
unmodified chTNT-3.
Immunobiochemical analysis.
The immunoreactivity of chTNT-3 was assessed by a competition RIA for
binding to fixed Raji Burkitt’s lymphoma cells. Increasing concentrations of
chTNT-3, muTNT-3, or an irrelevant MAb (chTNT-1) were evaluated for their
ability to inhibit the binding of 1 2 5 I-labeled muTNT-3 to Raji cells (Figure 2-1).
While chTNT-1 was unable to compete with 1 2 5 I-labeled muTNT-3, chTNT-3
inhibited 1 2 5 I-labeled muTNT-3 binding to fixed Raji cells to the same extent as
muTNT-3. This study confirms that chTNT-3 maintains the immunoreactivity of
muTNT-3. The antigenic specificity of chTNT-3 was examined by indirect
ELISA. chTNT-3 displayed reactivity to single-stranded DNA (Figure 2-2), while
the negative control chLym-1 demonstrated none. No binding to double-stranded
DNA or nucleohistone was observed (data not shown).
34
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Figure 2-1. Competitive binding radioimmunoassay with chTNT-3.
Purified chimeric antibody was assayed for its ability to inhibit the binding of 1 2 5 I-
labeled muTNT-3 to fixed Raji human lymphoma cells. muTNT-3 and chTNT-1
served as positive and negative controls, respectively.
8O-1
chTNT-3
muTNT-3
C T >
% 6 0 "
C
in
chTNT-1
O
c 40-
o
sz
c
0 0.1 0.3 0.4 0.6 0.2 0.5
C o n c e n t r a t i o n o f M A b ( |i g / m l )
35
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Figure 2-2. Indirect ELISA with chTNT-3.
Serial dilutions of purified chTNT-3 were applied to a microtiter plate coated with
single-stranded DNA. Chimeric MAb was detected with HRPO-conjugated goat
anti-human IgG (Fc-specific). chLym-1 served as a negative control.
chTNT-3
chLym-1
| 0.8-
m
o
"v t
« °-6 -
< D
O
| 0.4-
o
w
X J
< 0.2 -
2.5 1.5 2 0.5 1 0
C o n c e n t r a t i o n o f M A b (|LLg/ml)
36
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Avidity binding studies were then conducted in which 1 2 5 I-labeled
muTNT-3, chTNT-3, or chTNT-3/B was incubated with fixed Raji cells and the
bound radioactivity used to calculate the avidity constant Ka by Scatchard analysis.
The binding constant of muTNT-3 was determined to be 2.3 x 109 M’1 , while the
avidity constant of chTNT-3 was slightly lower at 1.4 x 109 M'1 . chTNT-3/B had
a similar binding constant of 1.5 x 109 M'1 . This study demonstrates that
biotinylation does not interfere with binding of chTNT-3 to its target antigen.
Isoelectric focusing, however, revealed a downward shift from an extremely high
pi > 9.6 (off the scale of the BioRad IEF standards) for unmodified chTNT-3 to a
lower pi = 8.0-9.6 for chTNT-3/B.
Immunohistoloeic studies.
muTNT-3 was evaluated for binding to a variety of human tissues in both
frozen and paraffin sections. In all tissues examined, a proportion of nuclei was
positive, varying from 10% to more than 70% in different normal tissues, being
highest in the testis and lowest in tissues such as smooth and striated muscle and
loose connective tissue. Glandular tissue showed variable nuclear staining, with no
obvious relationship to cells known to be in various stages of the cell cycle (e.g.,
presumptive stem cells in skin and intestine, follicular center cells in tonsils, lymph
nodes, or spleen, and hematopoietic elements in the bone marrow). In carcinomas,
the proportion of nuclei was not consistently higher than in the corresponding
normal tissues. There appeared to be some enhancement and generalization of
staining outside of recognizable cell membrane boundaries in areas having overt
37
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
features of cellular necrosis. One notable feature was that certain tissues showed
distinct cytoplasmic staining over and above the observed nuclear reactivity. Cells
with positively stained cytoplasm included salivary and pancreatic acinar cells (but
not islet cells), some epithelial cells in breast, kidney, stomach, and intestine,
plasma cells, and trophoblast (the only common feature being a presumed high
content of cytoplasmic messenger and/or ribosomal RNA). Importantly, there was
no evidence of cell surface membrane staining in frozen or paraffin sections in all
the tissues examined.
In vivo pharmacokinetic and tumor targeting studies.
Clearance studies were performed to establish differences in
pharmacokinetics between chTNT-3 and chemically modified chTNT-3/B. Groups
of mice were injected with 1 2 5 I-labeled MAb, and the whole body activity at
injection and selected times thereafter was measured with a microdosimeter.
chTNT-3 cleared slowly with a whole body half-life of 50.2 ± 2.2 h (Figure 2-3).
On the other hand, chTNT-3/B was eliminated significantly more rapidly with a
half-life of 21.7 ± 1.9 h (P < 0.0001).
Tissue biodistribution and tumor uptake of 1 2 5 I-labeled muTNT-3,
chTNT-3, and chTNT-3/B were examined in ME-180 human cervical carcinoma-
bearing athymic nude mice. As illustrated in Figure 2-4A, muTNT-3 cleared
extremely slowly from the blood and highly vascular tissues and had a 2.4% ID/g
in the blood 10 days after injection. muTNT-3, however, demonstrated efficient
38
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Figure 2-3. Whole body pharmacokinetic clearance of 1 2 5 I-labeled
unmodified and biotinylated chTNT-3 in non tumor-bearing mice.
Activity at injection and at selected times thereafter was measured with a
microdosimeter. The data were analyzed and half-lives were determined using the
RSTRIP pharmacokinetic program (MicroMath, Inc., Salt Lake City, UT).
O)
c
'c
'co
E
C D
D C
CD
W
O
o
T5
CD
+-*
O
CD
1
chTNT-3
chTNT-3/B
0.1
40 50 30
T i m e ( h o u r s )
39
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Figure 2-4. Tissue biodistribution and tumor uptake of muTNT-3 in ME-180
human cervical carcinoma tumor-bearing nude mice. (A) Tissue uptake measured
by percent injected dose of 1 2 5 I-labeled MAb per gram of tissue expressed as mean
± SD. (B) Tumor/organ ratios (cpm per gram tumor/cpm per gram organ)
expressed as mean ± SD.
40
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
T u m o r /O r g a n Ratio qj % in jected D o s e / g r a m
Figure 2-4.
A T
12 -
■ 1 day □ 3 days □ 5 days S3 7 days H 10 days
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
tumor uptake and retention with a steady 6% ID/g even after 10 days, while the
amount of antibody in normal tissues gradually declined. This represents
approximately three times the absolute tumor uptake observed for muTNT-1 (24).
These data illustrate the specificity of tumor targeting with TNT-3 and the stability
of its antigen within the tumor. Nevertheless, the highest tumor/blood ratio
achieved with muTNT-3 was only 2.6:1 at 10 days post-injection (Figure 2-4B).
The effect of biotinylation on biodistribution was also examined. One and
three day biodistribution of 1 2 5 I-labeled chTNT-3 and chTNT-3/B was compared in
ME-180 tumor-bearing mice. The faster clearance of chTNT-3/B led to improved
biodistribution as shown in Table 2-1. Approximately half the blood levels of 1 2 5 I-
labeled chTNT-3 was observed for chTNT-3/B. One day after injection,
chTNT-3/B showed 3.3 ± 0.2% ID/g in the blood, compared to 6.0 ± 0.7% for
unmodified chTNT-3. As early as three days post-injection, chTNT-3/B
demonstrated only 1.9 ± 0.5% ID/g in the blood, compared to 3.7 ± 0.4% for
chTNT-3 (P - 0.001). These differences in blood levels are consistent with the
observed difference in half-lives shown in Figure 2-3. Despite its lower normal
tissue uptake, chTNT-3/B maintained the tumor uptake of unmodified chTNT-3 at
day three (4.1 ± 0.1 and 3.8 + 0.3, respectively). The combination of equivalent
tumor uptake and lower normal tissue uptake corresponded to higher tumor/organ
ratios for chTNT-3/B. These studies illustrate the benefit of chemical modification
of chTNT-3 through biotinylation. The biodistribution of chTNT-3/B through day
ten is shown in Figure 2-5. Tumor retention of chTNT-3/B was somewhat less
42
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Reproduced w ith permission o f th e copyright owner. Further reproduction prohibited without permission.
Table 2-1. Tissue biodistribution and tumor uptake of 1 2 5 I-labeled unmodified and biotinylated chTNT-3 in ME-
180 human cervical carcinoma tumor-bearing nude mice (n = 4). Data are expressed as mean (SD).
% Injected Dose/Gram Tumor/Organ Ratio
24 h 72 h 24 h 72 h
Organ chTNT-3 chTNT-3/B chTNT-3 chTNT-3/B chTNT-3 chTNT-3/B chTNT-3 chTNT-3/B
Blood 6.03 (0.70) 3.35 (0.16) 3.66 (0.43) 1.92 (0.51) 0.79 (0.12) 1.37(0.10) 1.05 (0.14) 2.26 (0.72)
Muscle 0.67 (0.05) 0.42 (0.04) 0.43 (0.15) 0.26 (0.10) 7.05 (0.83) 11.11 (1.76) 9.43 (2.52) 17.18(4.78)
Lung 2.54 (0.18) 1.70 (0.09) 1.69 (0.32) 1.14(0.29) 1.85 (0.08) 2.70 (0.15) 2.30 (0.44) 3.76(1.01)
Liver 1.92 (0.07) 1.15 (0.34) 0.94 (0.04) 0.56 (0.15) 2.44 (0.17) 4.31 (1.46) 4.05 (0.33) 7.57(1.74)
Spleen 1.48 (0.11) 0.83 (0.37) 0.98 (0.09) 0.50 (0.13) 3.17(0.12) 6.74 (3.85) 3.92 (0.57) 8.50(2.27)
Kidney 1.43 (0.14) 1.06 (0.15) 0.97 (0.10) 0.52 (0.05) 3.30 (0.44) 4.41 (0.77) 3.95 (0.60) 7.92 (0.65)
Tumor 4.68 (0.20) 4.58 (0.23) 3.79 (0.27) 4.07 (0.12)
Figure 2-5. Tissue biodistribution and tumor uptake of 1 2 5 I-labeled chTNT-3/B in
ME-180 human cervical carcinoma tumor-bearing nude mice. (A) Tissue uptake
measured by percent injected dose per gram of tissue expressed as mean ± SD.
(B) Tumor/organ ratios (cpm per gram tumor/cpm per gram organ) expressed as
mean ± SD.
44
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
T u m o r /O r g a n Ratio C D % Injected D o s e / g r a m
Figure 2-5.
a
V) .c CD
to o c 0
(u CO • c
o
c
E
o
U)
o
* — •
"O
id
CO
C L
« * — »
CO
_ c
100
80-
60-
1 day H 3 days
10 days
I
40-
2 0 -
45
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
than that of muTNT-3, although tumor uptake remained high, at over 3.5% ID/g
seven and ten days after injection, as the amount in all normal tissues steadily
diminished. By day ten the blood level of chTNT-3/B was 0.7 ± 0.1% ID/g,
compared to 2.4 ± 0.2% for muTNT-3 (P < 0.0001). The tumor/organ ratios
therefore improved with time, reaching 5.5:1 for blood, 12.7:1 for lung, and over
20:1 for liver, spleen, and kidney ten days post-injection. We have previously
observed similar decreases in tumor localization of other chimeric MAbs versus
their murine counterparts in nude mouse xenograft models (28), which correlated
with their more rapid elimination from mice. In patients, however, from whom
chimeric MAbs clear more slowly than murine, no decrease in tumor uptake should
be observed.
Imaging studies were also performed to examine the difference between
tumor targeting with chTNT-3 and chTNT-3/B. Tumor-bearing nude mice were
injected with 1 3 ^-labeled chimeric antibody and imaged at three days post-injection
(Figure 2-6). The percent of total body radioactivity in the tumors was determined
using the Nuclear MAX Plus image analysis software. The tumor uptake of
chTNT-3 is clearly visualized, although significant signal remains in the circulation
of normal organs. On the other hand, there is little evidence of signal in the normal
tissues of the mouse injected with chTNT-3/B. The mouse injected with chTNT-3
showed 27% of total body signal in the tumor, compared to 51% for the mouse
with chTNT-3/B.
46
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Figure 2-6. Imaging of ME-180 human cervical carcinoma tumor-bearing
nude mice injected with 1 3 1 I-labeled chTNT-3 or chTNT-3/B.
Mice were imaged in a prone position 3 days post-injection with a Spectrum 91
camera equipped with a pinhole collimator set to record 10,000 counts using the
Nuclear MAX Plus image analysis software package.
chTNT-3 chTNT-3/B
47
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
DISCUSSION
Tumor Necrosis Treatment utilizes MAbs directed against universal
intracellular antigens exposed in abnormally permeable degenerating and necrotic
cells in malignant solid tumors as vehicles for the targeted delivery of therapeutic
molecules (10). This approach is a significant departure from conventional
antibody-based targeting strategies directed against tumor-associated cell surface
antigens. Since the accumulation of necrotic debris is characteristic of solid
tumors, Tumor Necrosis Treatment is expected to have potential applications to
most cancers. We have previously investigated tumor targeting with the murine
TNT-1 MAb (10) directed against nucleosomal determinants consisting of histone
HI and DNA (42). Although radiolabeled TNT-1 demonstrated tumor localization
(12), binding to necrotic regions (13), and killing (14) in a nude mouse xenograft
model, tumor uptake of TNT-1 was relatively low (24). Recognizing that absolute
tumor accretion of antibody is critical to successful radioimmunotherapy (4), we
have investigated other MAbs directed against nuclear antigens in an attempt to
identify candidates that show higher tumor uptake. We identified a murine MAb
designated TNT-3 with specificity for DNA that displays 3-fold higher tumor
accumulation (6% ID/g compared to 2% for TNT-1).
In the present study, a human-mouse chimeric TNT-3 MAb has been
developed as a potential solid tumor targeting agent. The recombinant protein was
expressed in NSO myeloma cells at high levels using the Glutamine Synthetase
Gene Amplification System so that sufficient product can be generated for clinical
48
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
studies. A small scale culture resulted in over 100 mg/L of purified product.
Thus, gram quantities of chTNT-3 can be produced in batch cultures under
optimized conditions. The chimeric antibody maintains the immunoreactivity of
the parent muTNT-3, as shown by radioimmunoassay (Figure 2-1). In addition,
preliminary antigen characterization by ELISA confirmed that chTNT-3 recognizes
single-stranded DNA (Figure 2-2).
Extensive immunohistochemical evaluation of the tissue reactivity of
TNT-3 established that the antibody binds to nuclei in the majority of specimens
studied. Staining was similar in normal tissues and carcinomas. Several tissues,
however, including scattered epithelial cells in breast, kidney, stomach, and
intestine, plasma cells, and salivary and pancreatic acinar cells, revealed
cytoplasmic staining. The reason for such cytoplasmic staining is as yet unclear,
although this reactivity might be explained by binding to RNA. Since TNT-3 binds
to single-stranded DNA in ELISA it may also show reactivity for messenger or
ribosomal RNA species. Comprehensive antigen characterization with purified
RNA fractions as well as individual nucleosides is in progress and will be presented
separately. Although cytoplasmic staining was observed in the aforementioned
tissues, no retention of radiolabeled MAb in those tissues was detected in
biodistribution studies with tumor-bearing nude mice (see below), which is to be
expected since immunohistology revealed no binding to cell surface membranes.
Our laboratory has previously shown that chemical modification of MAbs
using the heterobifunctional crosslinking reagent SPDP (succinimidyl 3-(2-
49
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
pyridyldithio)propionate) results in faster clearance, lower normal tissue
localization, and the same or higher tumor uptake of radiolabeled murine
antibodies in nude mouse xenograft models (24). These in vivo characteristics
were associated with lower isoelectric points of the chemically modified MAbs
while their immunoreactivities were maintained. Other investigators have also
confirmed that charge modification can improve the pharmacokinetics and
specificity of targeting with MAbs. Khaw et al. modified an antimyosin Fab with
negatively charged polymers containing DTPA (diethylenetriaminepenta-acetic
acid) and polylysine and demonstrated that along with a significant reduction in pi,
the modified antibody fragment showed enhanced target localization in a canine
model of acute myocardial infarction (21). Likewise, Narula et al. determined that
in a rabbit atherosclerosis model, chimeric F(ab’)2 similarly modified to carry a
negatively charged polymer showed earlier visualization of lesions and lower non
specific uptake, which the authors attributed to faster blood clearance (23).
Blocking s-amino groups of lysine residues on TNT-1 with fluoroscein
isothiocyanate prior to labeling with technetium-99m significantly decreases liver
uptake while increasing tumor uptake in a murine carcinoma model (22). In the
current study, we have extended the concept of chemical modification of MAbs to
include biotinylation. Biotinylation also serves to block the e-amino groups of
lysine residues, reducing the net charge of the antibody molecule (43). Under our
conjugation conditions, biotinylation of chTNT-3 with NHS-LC-biotin resulted in
2-3 molecules of biotin for each MAb molecule. Although the avidity of the
50
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
antibody was unaffected by chemical modification, biotinylation resulted in a
dramatic decrease in clearance time from normal mice (Figure 2-3). The effect of
biotinylation on the half-life of radiolabeled chTNT-3 is similar to the effect of
modification of murine MAbs with SPDP (24).
In addition to the above effects, chTNT-3/B demonstrated improved
biodistribution in ME-180 cervical carcinoma-bearing nude mice (Table 2-1).
Nontarget organs displayed lower uptake of chTNT-3/B without a decrease in
tumor localization, leading to higher tumor/organ ratios for all normal tissues.
Chemical modification of MAbs by conjugation to biotin or to other reagents
described above appears to be a strategy whereby nonspecific electrostatic
interactions between positively charged native antibodies and negatively charged
cell surfaces of nontarget tissues can be reduced (44), resulting in lower
accumulation of MAbs in normal organs without compromising their targeting
abilities. Since the physicochemical alteration resulting in the observed change in
the charge of the antibody molecule appears markedly to affect the biological
activities of antibodies in vivo, additional studies will be performed to identify
optimal conditions for the use of biotinylated antibodies. Specificity, an
examination of the relationship between the number of biotin molecules per
antibody and the pharmacokinetic and tumor targeting behaviors of such modified
MAbs will be undertaken and will be presented elsewhere. As mentioned
previously, no retention of radiolabeled MAb was observed in tissues that showed
cytoplasmic staining by immunohistochemistry (Figure 2-5), which is to be
51
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
expected since intact cell membranes of viable cells exclude MAbs directed against
intracellular antigens. chTNT-3/B demonstrates efficient tumor localization
through ten days post-injection, while normal tissue levels of radiolabeled MAb
gradually decrease. This contrasts with results using MAbs directed against
conventional cell surface antigens, which show a decrease in tumor uptake with
time. These data indicate that DNA within degenerating and necrotic tumor cells
is a useful antigenic target for antibody-based targeting strategies.
Because the antigen recognized by chTNT-3 is exposed in degenerating
and dead cells but not in viable cells, this MAb is appropriate for the targeted
delivery of therapeutic molecules that can effect tumor cell killing at a distance,
such as radionuclides (1, 2, 4). Experimental radioimmunotherapy with 1 3 1 I-
labeled muTNT-1 in a nude mouse xenograft model demonstrated that repeated
dosing results in increasing amounts of radiolabeled MAb localizing to the tumor
site, producing enhanced imaging and therapeutic responses with each dose (14).
Thus, it is anticipated that Tumor Necrosis Treatment will produce expanding
populations of targets as viable cells adjacent to the original targets are killed.
Because of this "gangrene-like" effect, Tumor Necrosis Treatment may be uniquely
suited to radioimmunotherapy. Because of its ability to target the central necrotic
core of tumors, chTNT-3 may also be used for developing fusion proteins
containing such immunologic mediators as cytokines for localization to tumor sites
(45, 46). Recently, we have developed a fusion protein consisting of chTNT-3 and
interleukin 2 and have demonstrated that pretreatment with this reagent increases
52
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
specific tumor uptake of subsequently administered therapeutic molecules
including MAbs and chemotherapeutic drugs (see Chapter 3). Many investigators
agree that tumor antigen shedding represents a significant impediment to effective
radioimmunotherapy (1, 5). This problem and other challenges facing
radioimmunotherapy directed against conventional cell surface targets (e.g.,
antigenic modulation and antigenic heterogeneity) do not apply to tumor targeting
with chTNT-3, since it recognizes a ubiquitous antigen that is not subject to
modulation or shedding. Because the dose-limiting bone marrow toxicity in
radioimmunotherapy is attributable to circulating radiolabeled MAb (2, 20),
methods to expedite clearance from the blood without compromising tumor
accretion clearly would be beneficial to the successful treatment of solid tumors.
The data presented in this study suggest that biotinylation may lower the potential
toxicity of radiolabeled monoclonal antibodies. Whether such modified antibodies
behave similarly in patients awaits clinical investigation. Finally, clinical studies are
being planned to determine the efficacy of 1 3 1 I-labeled chTNT-3/B in the targeting
and treatment of solid tumors in humans.
REFERENCES
1. Wilder, R. B., DeNardo, G. L., and DeNardo, S. J. Radioimmunotherapy:
recent results and future directions. J. Clin. Oncol., 14: 1383-1400, 1996.
2. Bruland, O. S. Cancer therapy with radiolabeled antibodies. An overview.
Acta Oncol., 34: 1085-1094, 1995.
53
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
3. Kairemo, K. J. Radioimmunotherapy of solid cancers: a review. Acta
Oncol., 35: 343-355, 1996.
4. Goldenberg, D. M. Monoclonal antibodies in cancer detection and therapy.
Am. J. Med., 94: 297-312, 1993.
5. Zhu, H., Baxter, L. T., and Jain, R. K. Potential and limitations of
radioimmunodetection and radioimmunotherapy with monoclonal
antibodies. J. Nucl. Med., 38: 731-741, 1997.
6. Buchsbaum, D. J. Experimental approaches to increase radiolabeled
antibody localization in tumors. Cancer Res. (Suppl.), 55: 5729s-5732s,
1995.
7. von Mehren, M. and Weiner, L. M. Monoclonal antibody-based therapy.
Curr. Opin. Oncol., 8: 493-498, 1996.
8. Jain, R. K. Delivery of molecular medicine to solid tumors. Science, 27:
1079-1080, 1996.
9. Epstein, A. L. New approaches to improved antibody targeting. In: R. E.
Henkin (ed.) Nuclear Medicine, pp. 516-533. St. Louis: Mosby-Year
Book, 1996.
10. Epstein, A. L., Khawli, L. A., Chen, F.-M., Hu, P., Glasky, M. S., and
Taylor, C. R. Tumor necrosis imaging and treatment of solid tumors. In:
V. P. Torchilin (ed.) Handbook of Targeted Delivery of Imaging Agents,
pp. 259-288. Boca Raton, FL: CRC Press, 1995.
11. Epstein, A. L., Chen, D., Ansari, A., Najafi, A., Siegel, M., Lee, K., Hu,
E., Rosen, P., Watkins, K., Stain, S., Weaver, F., and Taylor, C. R.
Radioimmunodetection of necrotic lesions in human tumors using 1-131
labeled TNT-1 F(ab')2 monoclonal antibody. Antibody Immunoconj.
Radiopharm., 4: 151-161, 1991.
12. Epstein, A. L., Chen, F.-M., and Taylor, C. R. A novel method for the
detection of necrotic lesions in human cancers. Cancer Res., 48: 5842-
5848, 1988.
13. Chen, F.-M., Epstein, A. L., Li, Z., and Taylor, C. R. A comparative
autoradiographic study demonstrating differential intratumor localization of
monoclonal antibodies to cell surface (Lym-1) and intracellular (TNT-1)
antigens. J. Nucl. Med., 31: 1059-1066, 1990.
54
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
14. Chen, F.-M., Taylor, C. R., and Epstein, A. L. Tumor necrosis treatment of
ME-180 human cervical carcinoma model with 1 3 ^-labeled TNT-1
monoclonal antibody. Cancer Res., 49: 4578-4585, 1989.
15. Kuus-Reichel, K., Grauer, L. S., Karavodin, L. M., Knott, C., Krusemeier,
M., and Kay, N. E. Will immunogenicity limit the use, efficacy, and future
development of therapeutic monoclonal antibodies? Clin. Diagn. Lab.
Immunol., 1: 365-372, 1994.
16. Morrison, S. L., Johnson, M. J., Herzenberg, L. A., and Oi, V. T. Chimeric
human antibody molecules: mouse antigen-binding domains with human
constant region domains. Proc. Natl. Acad. Sci. USA, 81: 6851-6855,
1984.
17. Boulianne, G. L., Hozumi, N., and Shulman, M. J. Production of functional
chimaeric mouse/human antibody. Nature, 312: 643-646, 1984.
18. Khazaeli, M. B., Corny, R. M., and LoBuglio, A. F. Human immune
response to monoclonal antibodies. J. Immunother., 15: 42-52, 1994.
19. Bebbington, C. R., Renner, G., Thomson, S., King, D., Abrams, D., and
Yarranton, G. T. High-level expression of a recombinant antibody from
myeloma cells using a glutamine synthetase gene as an amplifiable
selectable marker. Bio/Technology, 10: 169-175, 1992.
20. Vriesendorp, H. M., Quadri, S. M., Andersson, B. S., and Dicke, K. A.
Hematologic side effects of radiolabeled immunoglobulin therapy. Exp.
Hematol., 24: 1183-1190, 1996.
21. Khaw, B.-A., Klibanov, A., O'Donnell, S. M., Saito, T., Nossiff, N.,
Slinkin, M. A., Newell, J. B., Strauss, H. W., and Torchilin, V. P. Gamma
imaging with negatively charge-modified monoclonal antibody:
modification with synthetic polymers. J. Nucl. Med., 32: 1742-1751, 1991.
22. John, E., Thakur, M. L., Wilder, S., Alauddin, M. M., and Epstein, A. L.
Technetium-99m-labeled monoclonal antibodies: influence of technetium-
99m binding sites. J. Nucl. Med., 35: 876-881, 1994.
23. Narula, J., Petrov, A., Bianchi, C., Ditlow, C. C., Lister, B. C., Dilley, J.,
Pieslak, I., Chen, F. W., Torchilin, V. P., and Khaw, B.-A. Noninvasive
localization of experimental atherosclerotic lesions with mouse/human
chimeric Z2D3 F(ab')2 specific for the proliferating smooth muscle cells of
human atheroma. Imaging with conventional and negative charge-modified
antibody fragments. Circulation, 92: 474-484, 1995.
55
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
24. Khawli, L. A., Glasky, M. S., Alauddin, M. M., and Epstein, A. L.
Improved tumor localization and radioimaging with chemically modified
monoclonal antibodies. Cancer Biother. Radiopharm., 11: 203-215, 1996.
25. Khawli, L. A. and Epstein, A. L. Exploration of novel strategies to enhance
monoclonal antibodies targeting. Q. J. Nucl. Med., 41: 25-35, 1997.
26. Epstein, A. L. and Clevenger, C. V. Identification of nuclear antigens in
human cells by immunofluorescence, immunoelectron microscopy, and
immunobiochemical methods using monoclonal antibodies. In: I. Bekhor
(ed.) Recent advances in non-histone chromosomal protein research, Vol.
1, pp. 117-137. Boca Raton, FL: CRC Press, 1985.
27. Rose, L. M., Gunasekera, A. H., DeNardo, S. J., DeNardo, G. L., and
Meares, C. F. Lymphoma-selective antibody Lym-1 recognizes a
discontinuous epitope on the light chain of HLA-DR10. Cancer Immunol.
Immunother., 43: 26-30, 1996.
28. Hu, P., Glasky, M. S., Yun, A., Alauddin, M. M., Homick, J. L., Khawli,
L. A., and Epstein, A. L. A human-mouse chimeric Lym-1 monoclonal
antibody with specificity for human lymphomas expressed in a baculovirus
system. Hum. Antibod. Hybridomas, 6: 57-67, 1995.
29. Pulvertaft, R. J. V. Cytology of Burkitt's tumour (African lymphoma).
Lancet, 1: 238-240, 1964.
30. Ohsugi, Y., Gershwin, M. E., Owens, R. B., and Nelson-Rees, W. A.
Tumorigenicity of human malignant lymphoblasts: comparative study with
unmanipulated nude mice, antilymphocyte serum-treated nude mice, and X-
irradiated nude mice. J. Natl. Cancer Inst., 65: 715-718, 1980.
31. Chomczynski, P. and Sacchi, N. Single-step method of RNA isolation by
acid guanidinium thiocyanate-phenol-chloroform extraction. Anal.
Biochem., 162: 156-159, 1987.
32. Orlandi, R., Giissow, D. H., Jones, P. T., and Winter, G. Cloning
immunoglobulin variable domains for expression by the polymerase chain
reaction. Proc. Natl. Acad. Sci. USA 86: 3833-3837, 1989.
33. Jones, S. T. and Bendig, M. M. Rapid PCR-cloning of full-length mouse
immunoglobulin variable regions. Bio/Technology, 9: 88-89, 1991.
34. Kozak, M. At least six nucleotides preceding the AUG initiator codon
enhance translation in mammalian cells. J. Mol. Biol., 196: 947-950, 1987.
56
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
35. Laemmli, U. K. Cleavage of structural proteins during the assembly of the
head of bacteriophage T4. Nature, 227: 680-685, 1970.
36. Epstein, A. L., Marder, R. J., Winter, J. N., and Fox, R. I. Two new
monoclonal antibodies (LN-1, LN-2) reactive in B5 formalin-fixed,
paraffin-embedded tissues with follicular center and mantle zone human B
lymphocytes and derived tumors. J. Immunol., 133: 1028-1036, 1984.
37. Green, N. M. Spectrophotometric determination of avidin and biotin.
Meth. Enzymol., ISA: 418-424, 1970.
38. Frankel, M. E. and Gerhard, W. The rapid determination of binding
constants for antiviral antibodies by a radioimmunoassay: an analysis of the
interaction between hybridoma proteins and influenza virus. Mol.
Immunol., 16: 101-106, 1979.
39. Swanson, P. E. Microwave antigen retrieval in citrate buffer. Lab. Med.,
25: 520-522, 1994.
40. Battifora, H. The multitumor (sausage) tissue block, novel method for
immunohistochemical antibody testing. Lab. Invest., 55: 244-248, 1986.
41. Hornick, J. L., Khawli, L. A., Hu, P., Lynch, M., Anderson, P. M., and
Epstein, A. L. Chimeric CLL-1 antibody fusion proteins containing
granulocyte-macrophage colony-stimulating factor or interleukin-2 with
specificity for B-cell malignancies exhibit enhanced effector functions while
retaining tumor targeting properties. Blood, 89: 4437-4447, 1997.
42. Miller, G. K., Naeve, G. S., Gaffar, S. A., and Epstein, A. L. Immunologic
and biochemical analysis of TNT-1 and TNT-2 monoclonal antibody
binding to histones. Hybridoma, 12: 689-698, 1993.
43. Wadsley, J. J. and Watt, R. M. The effect of pH on the aggregation of
biotinylated antibodies and on the signal-to-noise observed in
immunoassays utilizing biotinylated antibodies. J. Immunol. Methods, 103:
1-7, 1987.
44. Gangopadhyay, A. and Van den Abbeele, A. D. Modification of mouse IgG
isoelectric point following radioiodination. Antibody Immunoconj.
Radiopharm., 7: 171-178, 1994.
45. Reisfeld, R. A. and Gillies, S. D. Recombinant antibody fusion proteins for
cancer immunotherapy. Curr. Top. Microbiol. Immunol., 213 (Pt 3): 27-
53, 1996.
57
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
46. Becker, J. C., Varki, N., Gillies, S. D., Furukawa, K., and Reisfeld, R. A.
An antibody-interleukin 2 fusion protein overcomes tumor heterogeneity by
induction of a cellular immune response. Proc. Natl. Acad. Sci. USA, 93:
7826-7831, 1996.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 3 . Pretreatment with a Chimeric TNT-3/Interleukin 2
Antibody Fusion Protein Directed Against DNA Enhances the
Delivery of Therapeutic Molecules to Solid Tumors
ABSTRACT
The efficacy of molecular therapies for human malignancies is limited by
inadequate accumulation within solid tumor. Our laboratory has focused on
altering tumor vascular physiology as a strategy to improve the delivery of
therapeutic reagents. To this end, we developed a novel approach that employs
monoclonal antibodies (MAbs) to direct vasoactive proteins to tumor sites in order
to increase local vascular permeability. Previously, we demonstrated that
pretreatment with immunoconjugates containing interleukin 2 (IL-2) enhances
specific tumor uptake of radiolabeled MAbs without affecting normal tissues. In
the current study, we describe a fusion protein consisting of a chimeric antinuclear
antibody and IL-2 (chTNT-3/IL-2) and illustrate its potential for improving the
delivery of both MAbs and drugs. The fusion protein was generated by fusing
murine variable regions cloned from the TNT-3 hybridoma, which secretes a MAb
with specificity for single-stranded DNA, to human constant regions and cloning
human IL-2 into the 3’ end of the heavy chain. Antigenic specificity was
confirmed by a competition radioimmunoassay against fixed Raji human Burkitt’s
lymphoma cells, and biologic activity was established by supporting the
59
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
proliferation of an IL-2-dependent T-cell line. Pharmacokinetic analysis in
BALB/c mice demonstrated the rapid whole-body clearance of chTNT-3/IL-2.
Despite its rapid elimination, the fusion protein effectively localizes to LS174T
human colon adenocarcinoma xenografts in nude mice, as indicated by
biodistribution and imaging studies. In addition, the ability of pretreatment with
chTNT-3/IL-2 to increase specific tumor uptake of the MAb B72.3, directed
against the tumor-associated glycoprotein TAG-72, was demonstrated in LS174T
tumor-bearing mice. Enhancement of uptake following pretreatment was both
dose and time dependent. Under optimal conditions, tumor accretion of 1 2 5 I-
labeled B72.3 increased nearly 3-fold, with no changes in normal tissues.
Conversely, pretreatment with a control MAb/IL-2 fusion protein directed against
human B-cell malignancies had no effect on tumor uptake. Furthermore,
abrogation of this effect with l-NMA (A^-methyl-L-arginine), a chemical inhibitor
of nitric oxide synthase, suggests that rapid generation of nitric oxide in the tumor
is responsible for the enhanced uptake. Finally, specific tumor uptake of the
radiolabeled thymidine analog 1 2 5 IUdR (5-[1 2 5 I]Iodo-2’-deoxyuridine) also
increased approximately 3-fold following pretreatment, indicating that this
approach appears to be applicable to smaller molecules such as chemotherapeutic
drugs. Because TNT-3 recognizes a universal nuclear antigen accessible in
degenerating and necrotic cells within all solid tumors, this strategy can be used for
the majority of human cancers.
60
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
INTRODUCTION
Physiological barriers to the delivery of therapeutic reagents to solid
tumors are a major obstacle to the clinical success of developing molecular
therapies (1). For example, the limited clinical responses observed in
radioimmunotherapy of solid tumors (2) can be attributed in large part to low
tumor localization of radiolabeled monoclonal antibody (MAb). Although
xenograft models in nude mice have shown levels of tumor uptake ranging from 1-
20% of the injected dose per gram, patient studies have demonstrated exceedingly
low tumor uptake in the range of 0.1% injected dose per gram of tissue (3). Thus,
an extremely small fraction of antibody delivers radionuclide to tumor sites, while
the majority of the injected dose disperses throughout the body, where it can cause
dose-limiting myelosuppression (4). Recognizing that blood flow and vascular
permeability are key parameters controlling the egress of therapeutic molecules
into tumors (5, 6), our laboratory developed an experimental approach to alter
tumor vascular physiology and in turn increase the delivery of therapeutic reagents.
This strategy utilizes MAbs to direct proteins with vasoactive properties to tumor
sites in order to increase local vascular permeability without affecting normal
tissues (7). We previously developed immunoconjugates containing cytokines and
other vasoactive molecules and examined their ability to increase tumor uptake of
radiolabeled MAbs (8). From these studies, it was determined that the
immunoconjugates that produced the greatest enhancement of antibody uptake
contained interleukin 2 (IL-2).
61
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
IL-2 is a 15 kD protein secreted by activated T-cells that supports the
proliferation and activation of lymphocytes and other immune cells (9). In clinical
studies, IL-2 has shown success in the treatment of several human malignancies, in
particular melanoma and renal cell carcinoma (10). It is well established, however,
that systemic administration of IL-2 leads to increased permeability of blood
vessels in the lungs and other organs resulting in a toxic side effect known as the
capillary leak syndrome (11-13). In this novel approach, the undesirable property
of IL-2 has been harnessed by using MAbs to target IL-2 to the tumor site. Our
laboratory has demonstrated in animal models that administration of
immunoconjugates consisting of IL-2 and MAbs directed against various tumor
antigens increases local tumor vascular permeability and in turn enhances tumor
uptake of radiolabeled MAbs (14, 15). The magnitude of enhancement was similar
whether the immunoconjugate was directed against tumor-associated cell surface
antigens (14), an extracellular matrix protein in the basement membranes of tumor
vessels (15), or an intracellular antigen accessible in the necrotic regions of solid
tumors (8). For this reason, we chose to develop an antibody/IL-2 fusion protein
with specificity for a nuclear antigen that might serve as a universal targeting
agent, owing to its ability to target degenerating cells within all solid tumors.
In the current study, we describe a fusion protein consisting of the chimeric
antinuclear antibody TNT-3 and EL-2 (chTNT-3/IL-2). Because TNT-3
recognizes DNA exposed in the degenerating and necrotic cells within solid
tumors, it has the potential to target the majority of human malignancies. In this
62
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
report, we examine the ability of chTNT-3/IL-2 to increase the specific tumor
uptake of both MAbs and chemotherapeutic drugs in tumor xenograft models in
the hope that such a strategy may represent a general approach to increase the
delivery of therapeutic molecules to solid tumors.
MATERIALS AND METHODS
Reagents.
The plasmid pBC12/HIV/IL-2 containing the human IL-2 cDNA (16) was
obtained from the American Type Culture Collection (clone 67618; Rockville,
MD). The plasmids pEE6hCMV-B and pEE12 were purchased with the
Glutamine Synthetase Gene Amplification System from Celltech Biologies
(Slough, UK). Restriction endonucleases, T4 DNA ligase, and other molecular
biology reagents were purchased from New England Biolabs (Beverly, MA) or
Boehringer Mannheim (Indianapolis, IN). RPMI-1640 medium, MEM non-
essential amino acids solution, penicillin-streptomycin solution, dialyzed fetal
bovine serum, single-stranded DNA from calf thymus, A°-methyl-L-arginine
(l-NMA), Dulbecco’s phosphate buffered saline (PBS), chloramine T, sodium
metabisulfite, hydrogen peroxide, and ABTS (2,2’-azino-bis(3-ethylbenzthiazoline-
6-sulfonic acid) diammonium salt) were purchased from Sigma Chemical Co. (St.
Louis, MO). Hybridoma-SFM medium with and without glutamine was purchased
from Life Technologies (Gaithersburg, MD). Fetal bovine serum was obtained
from HyClone Laboratories, Inc. (Logan, UT). Iodine-125 and iodine-131 were
63
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
obtained as sodium iodide in 0. IN sodium hydroxide from DuPont/New England
Nuclear (North Billerica, MA). 5-[1 2 5 I]Iodo-2'-deoxyuridine (1 2 5 IUdR) was
purchased from Amersham Life Science Inc. (Arlington Heights, IL). BALB/c and
athymic nude mice were purchased from Harlan Sprague Dawley (Indianapolis,
IN).
Antibodies and cell lines.
The chimeric MAb TNT-3 (chTNT-3, IgGiic) was constructed and
expressed as described previously (see preceding chapter). The chimeric MAb
TNT-1 (chTNT-1, IgGiic), the cDNAs for whose variable regions were cloned
from the murine TNT-1 hybridoma (17), was constructed and expressed in the
same manner as chTNT-3. The fusion protein chCLL-l/IL-2, consisting of the
chimeric anti-B-cell MAb CLL-1 with human IL-2 at the C-termini of the chimeric
heavy chains, was produced as described previously (18). The murine MAb B72.3
(IgGi) (19), recognizing the tumor-associated glycoprotein TAG-72, was a gift
from Celltech Biologies. Iodine-125 and iodine-131-labeled MAbs were prepared
using a modified chloramine T method as described previously (20). The NSO
murine myeloma cell line, which was obtained from Celltech Biologies, was grown
in non-selective medium consisting of Hybridoma-SFM supplemented with 10%
fetal bovine serum, L-glutamine, MEM non-essential amino acids solution,
penicillin G (100 U/ml), and streptomycin (100 pg/ml). Selective medium consists
of Hybridoma-SFM without glutamine supplemented with 10% dialyzed fetal
bovine serum, glutamic acid, asparagine, nucleosides, penicillin G, and
64
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
streptomycin, according to the protocol provided with the Glutamine Synthetase
Gene Amplification System (Celltech Biologies). The Raji cell line, derived from
an African Burkitt's lymphoma (21, 22), and the LS174T human colon
adenocarcinoma cell line (23), obtained from the American Type Culture
Collection, were grown in RPMI-1640 medium supplemented with 10% fetal
bovine serum, L-glutamine, penicillin G, and streptomycin.
Construction of expression vectors.
The expression vectors were constructed using standard techniques. The
expression vector for the chTNT-3 heavy chain, pEE12/chTNT-3 HC, was used as
the parent vector. This plasmid contains the cDNA sequence for the human-
mouse chimeric TNT-3 heavy chain, under the control of the cytomegalovirus
major immediate early promoter, and the cDNA sequence for glutamine
synthetase, under the control of the SV40 early promoter. To amplify the human
IL-2 cDNA from the pBC12/HIV/IL-2 plasmid template, two primers, 5’ -
GGT AAAGCGGCCGC AGGAGGTGGT AGCGC ACCT ACTT C AAGTT CT AC A
- 3’ and 5’ - TCATGCGGCCGCTCAAGTTAGTGTTGAGATGATGCT - 3’,
were used. The PCR fragment was inserted into the Notl site of pEE12/chTNT-3
HC, resulting in the expression vector 12/chTNT-3/IL-2 encoding a fusion protein
consisting of the chimeric TNT-3 heavy chain with human IL-2 at its C-terminus.
The expression vector for the chimeric TNT-3 light chain, pEE6/chTNT-3 LC,
was constructed as described previously (see Chapter 2).
65
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Expression and purification of antibody fusion protein.
The antibody fusion protein was expressed in NSO murine myeloma cells
according to the manufacturer's protocol (Celltech Biologies). Briefly, both
linearized plasmids were electroporated into NSO cells, which were plated in non-
selective Hybridoma-SFM medium. Selective glutamine-free medium was added
24 hours later. When transfectants appeared approximately three weeks later,
supernatants were tested for the presence of chimeric antibody fusion protein by
indirect enzyme-linked immunosorbent assay (ELISA). The highest producing
clone was identified by a 24-hour rate of production assay. After sub-cloning by
limiting dilution, the highest producing clone was expanded, incubated in a 10 liter
bioreactor, and chTNT-3/IL-2 was purified stepwise from cell culture medium by
protein A affinity chromatography and ion-exchange chromatography, as described
previously (20). The purity of the fusion protein was examined by SDS-PAGE
according to the method of Laemmli (24).
Immunoassays.
ELISA.
Chimeric fusion protein-containing supernatants were initially identified by
indirect ELISA using microtiter plates coated with single-stranded DNA from calf
thymus, as described previously (see Chapter 2). For production rate assays, 106
cells were plated in 1 ml of selective medium and allowed to incubate for 24 hours.
ELISA was then performed as before. Supernatants were serially diluted and
applied to wells of microtiter plates coated with goat anti-human IgG (H+L)
66
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
(CalTag, So. San Francisco, CA). Dilutions of a control chimeric MAb were used
to generate a standard curve using 4-parameter fit by an automated ELISA reader
(Bio-Tek Instruments, Inc., Winooski, VT), from which concentrations of
unknowns were estimated. Rates of production were compared to identify the
highest producing clones.
Raji cell competition RIA.
The immunoreactivity of chTNT-3/IL-2 was also evaluated by a
competition radioimmunoassay for binding to fixed Raji lymphoma cells. For these
studies, 2 x 106 Raji cells previously fixed in 2% paraformaldehyde (25) were
incubated with 20 ng of 1 2 5 I-labeled muTNT-3 and serial dilutions of cold
chTNT-3, chTNT-3/IL-2, or a MAb recognizing a different nuclear antigen
(chTNT-1). The cells and MAbs were incubated for 1 hour at room temperature
with constant mixing. The cells were then washed twice, and the cell pellet-
associated radioactivity was measured in a gamma counter. Maximal binding was
determined from tubes containing no cold antibodies.
Determination of avidity.
The avidity constant of chTNT-3/IL-2 was determined by a fixed cell
radioimmunoassay using the method of Frankel and Gerhard (26). Raji lymphoma
cell suspensions containing 106 cells/ml were incubated with 10 to 110 ng of 1 2 5 I-
labeled chTNT-3/IL-2 in 200 gl PBS in duplicate for 1 hour at room temperature
with constant mixing. The cells were then washed three times with PBS
containing 1% bovine serum albumin to remove unbound antibody and counted in
67
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
a gamma counter. The amount of fusion protein bound was determined by the
remaining cell-bound radioactivity (cpm) in each tube and the specific activity
(cpm/ng) of the radiolabeled fusion protein. Scatchard plot analysis was
performed to obtain the slope. The equilibrium or avidity constant Ka was
calculated by the equation K = -(slope/n), where n is the valence of the antibody
fusion protein (2 for IgG).
Bioassav.
Biologic activity of chTNT-3/IL-2 was determined by a standard I n
dependent T-cell proliferation assay. Recombinant human IL-2 obtained from
Hoffmann La Roche, Inc. (Nutley, NJ) was used as a standard. Roche IL-2 stock
(specific activity ~1.4 x 107 IU/mg) was diluted to yield a stock solution containing
2 x 106 IU/ml. Growth of the IL-2-dependent murine T-cell line CTLL-2 was used
to determine the bioactivity of IL-2 in a sample. Briefly, serially diluted samples
and standard were incubated with 2 x 104 CTLL-2 cells in triplicate for 20 hours at
37°C. The cells were then pulsed with 3 H-thymidine for 6 hours, and the samples
were harvested and counted. Specific activity of the sample was determined by
regression of the linear portion of a semi-log graph of CPM versus nM IL-2 for the
standard.
Pharmacokinetic and biodistribution studies.
Six-week old BALB/c mice were used to determine the whole-body
clearance of the fusion protein. Groups of mice (n=4) were administered i.p.
injections of 1 2 5 I-labeled chTNT-3/IL-2 (30-40 pCi/mouse). The whole body
68
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
activity at injection and at selected times thereafter was measured with a CRC-7
microdosimeter (Capintec, Inc., Pittsburgh, PA). The data were analyzed and half-
lives were determined as previously described (18). To examine the tissue
biodistribution of chTNT-3/EL-2, six-week old female athymic nude mice were
injected with a 0.2 ml inoculum containing 2 x 107 LS174T colon adenocarcinoma
cells s.c. in the left thigh. The tumors were grown for 10-14 days until they
reached approximately 1 cm in diameter. Within each group («=4), individual mice
were injected i.v. with a 0.1 ml inoculum containing 100 pCi/10 pg of 1 2 5 I-labeled
fusion protein. Animals were sacrificed by sodium pentobarbital overdose at 24 or
72 hours post-injection, and organs, blood, and tumors were removed and
weighed. The radioactivity in the samples was then measured in a gamma counter.
For each mouse, data were expressed as percent injected dose/gram (% ID/g) and
tumor/organ ratio (cpm per gram tumor/cpm per gram organ). From these data,
the mean and SD were calculated for each group.
Pretreatment studies.
LS174T human colon adenocarcinoma tumors were grown in the left thigh
of athymic nude mice as described above. In the time dependence study, groups of
mice («=4) were administered i.v. injections of 30 pg chTNT-3/IL-2 at various
times before, simultaneously, or subsequently to the i.v. injection of 1 2 5 I-labeled
B72.3 (30-40 pCi/mouse). In the dose dependence study, groups of mice were
administered various doses (0, 5, 15, 30, 45, or 60 pg) of chTNT-3/IL-2 two
hours prior to the i.v. injection of 1 2 5 I-labeled B72.3. As a control, a group of mice
69
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
received 15 jL ig chCLL-l/IL-2 two hours prior to 1 2 5 I-labeled B72.3. To examine
the mechanism of vasopermeability enhancement, a group of mice received 20
mg/kg L-NMA (27), an inhibitor of nitric oxide synthase, i.p. 30 min prior to
pretreatment with 15 jug chTNT-3/IL-2. A control group received L-NMA alone
prior to administration of 1 2 5 I-labeled B72.3. In all the preceding groups, animals
were sacrificed 72 hours post-injection, and biodistribution analysis was performed
as described above. To examine whether this pretreatment strategy could be
extended to small molecules such as chemotherapeutic drugs, groups of mice
received 1 2 5 IUdR with or without pretreatment with 15 pg chTNT-3/IL-2.
Because of the rapid clearance of this drug, mice were sacrificed 3 hours post
injection for biodistribution analysis. Statistical significance was determined using
unpaired Student’s r-test for comparison of means. A P value of less than 0.05
was considered to be statistically significant.
Imagine studies.
LS174T colon adenocarcinoma tumors were grown in the left thighs of
athymic nude mice as before. When the tumors had reached approximately 1 cm in
diameter, the mice were injected i.v. with a 0.1 ml inoculum containing 100 pCi/10
pg of 1 3 1 I-labeled chTNT-3/IL-2. An imaging study was also performed on
LS174T colon tumor-bearing mice injected with 1 3 1 I-labeled B72.3 with or without
pretreatment with 15 pg chTNT-3/EL-2. At one, three, and five days post
injection, the mice were anesthetized with a s.c. injection of 0.8 mg sodium
pentobarbital, and the immobilized mice were imaged in a prone position with a
70
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Spectrum 91 gamma camera equipped with a pinhole collimator (Raytheon
Medical Systems, Melrose Park, IL) set to record 10,000 counts using the Nuclear
MAX Plus image analysis software package (MEDX Inc., Wood Dale, IL).
RESULTS
Construction, expression, and purification of chTNT-3/IL-2.
A PCR fragment containing the human IL-2 cDNA preceded by a seven
amino acid linker peptide was inserted into the Notl site previously appended
immediately downstream of the human yl terminal codon, producing a TNT-3
VH/human yl/human IL-2 fusion gene. This resulted in the expression vector
12/chTNT-3 HC/IL-2 encoding a fusion protein consisting of the chimeric TNT-3
heavy chain with human IL-2 at its C-terminus. This expression vector was co
transfected with the expression vector for the chimeric TNT-3 light chain,
pEE6/chTNT-3 LC. The fusion protein was expressed in NSO murine myeloma
cells using the Glutamine Synthetase Gene Amplification System (Celltech
Biologies) and purified from cell culture medium by protein A affinity and ion-
exchange chromatography. The chimeric antibody fusion protein was properly
assembled as demonstrated by reducing SDS-PAGE. Two bands were resolved
for chTNT-3/IL-2 at approximately 25 and 70 kD, corresponding to the molecular
weights of the immunoglobulin light chain and heavy chain plus cytokine,
compared to chTNT-3, whose heavy chain exhibited an apparent molecular weight
of approximately 55 kD (Figure 3-1).
71
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Figure 3-1. Electrophoretic identification of chTNT-3/IL-2.
Coomassie Blue-stained 10% acrylamide reducing gel of purified chTNT-3 (lane 2)
and chTNT-3/IL-2 (lane 3). Lane 1 contains molecular weight standards (kD).
1
72
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Immunobiochemical analysis.
The immunoreactivity of chTNT-3/IL-2 was assessed by determining the
binding to fixed Raji lymphoma cells. In a competition radioimmunoassay, the
fusion protein, chTNT-3, and an isotype-matched control MAb (chTNT-1) were
evaluated for their ability to inhibit the binding of 1 2 5 I-labeled muTNT-3 to Raji
cells (Figure 3-2). Because it recognizes a different nuclear antigen, chTNT-1 was
unable to compete with radiolabeled muTNT-3. chTNT-3/IL-2, however,
inhibited binding of 1 2 5 I-labeled muTNT-3 to a similar extent as chTNT-3. Binding
studies were then conducted in which 1 2 5 I-labeled chTNT-3/IL-2 was incubated
with fixed Raji cells and the bound radioactivity used to calculate the avidity
constant. chTNT-3/IL-2 was found to have a binding constant of 1.6 x 109 M '1 ,
compared to 1.4 x 109 M T1 for chTNT-3. These studies confirm that
chTNT-3/IL-2 maintains the immunoreactivity of chTNT-3 and demonstrate that
the cytokine at the C-terminus of the heavy chain does not interfere with binding to
the antigenic target under physiological conditions.
IL-2 hinactivitv of chTNT-3/IL-2.
Biologic activity of the IL-2 moiety was determined by examining the
ability of the fusion protein to support IL-2-dependent T-cell proliferation. A
bioassay with the murine T-cell line CTLL-2 was performed in which
chTNT-3/IL-2 was assayed along with chTNT-3 and a recombinant EL-2 standard
(Figure 3-3). On a molar basis, the fusion protein displayed roughly 26% of the
73
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Figure 3-2. Competitive binding radioimmunoassay with chTNT-3/IL-2.
Purified fusion protein was assayed for its ability to inhibit the binding of 1 2 5 I-
labeled muTNT-3 to fixed Raji human lymphoma cells. chTNT-3 and chTNT-1
served as positive and negative controls, respectively.
80 -i
chTNT-3
CT> „
c 60-
JD
c
C D
C 4 0 -
o
chTNT-1
1c
c
2 0 -
0.3 0.4 0.5 0.6 0 0.1 0.2
C o n c e n t r a t i o n o f M A b ( f ig / m l )
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Figure 3-3. Biologic activity of chTNT-3/IL-2 as determined by the ability to
support the proliferation of IL-2-dependent CTLL-2 cells.
Dilutions of chTNT-3/IL-2, chTNT-3, or recombinant human IL-2 standard were
incubated with 2 x 104 CTLL-2 cells for 20 hours. The cells were pulsed with 3 H-
thymidine for 6 hours, and the samples were harvested and counted.
30000
Human IL-2
25000
chTNT-3
20000
C L
O
15000
10000
5000
0.001 0.01 0.1 1 10
n M IL -2
75
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
activity of the IL-2 standard, corresponding to a specific activity of approximately
6 x 105 IU/mg chTNT-3/IL-2. As expected, chTNT-3 had no EL-2 activity.
In vivo pharmacokinetic and tumor targeting studies.
Clearance studies were performed to determine pharmacokinetic
differences between chTNT-3/IL-2 and chTNT-3. BALB/c mice were injected
with 1 2 5 I-labeled fusion protein or MAb, and the whole body activity at injection
and selected times thereafter was measured with a microdosimeter. chTNT-3/IL-2
was eliminated rapidly with a ( 3 half-life of approximately 12 hours, compared to a
half-life of 50 hours for chTNT-3 (Figure 3-4).
Despite its rapid elimination, the fusion protein retains the ability to localize
to tumor xenografts, as illustrated in Figures 3-5 and 3-6. The tumor and normal
tissue biodistribution of 1 2 5 I-labeled chTNT-3/IL-2 was examined in LS174T
human colon adenocarcinoma-bearing nude mice. Tumor uptake was
approximately 2% injected dose per gram (ID/g) at both 1 and 3 days post
injection (Figure 3-5 A). At the same time, the rapid clearance of the fusion protein
produced high tumor/normal tissue ratios (Figure 3-5B), illustrating the specificity
of tumor targeting with chTNT-3/IL-2. An imaging study was also performed to
examine tumor targeting with the fusion protein. LS174T tumor-bearing nude
mice were injected with 1 3 1 I-labeled fusion protein and imaged with a gamma
camera at 1 and 3 days post-injection. As early as day 1, tumor localization of
chTNT-3/EL-2 is unequivocal, although some signal remains in the blood pool
(Figure 3-6). By day 3, virtually no signal remains in any tissue except the tumor.
76
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Figure 3-4. Whole body pharmacokinetic clearance of 1 2 5 I-labeled
chTNT-3/IL-2 and chTNT-3 in non tumor-bearing mice.
Activity at injection and at selected times thereafter was measured with a
microdosimeter. The data were analyzed and half-lives were determined using the
RSTRIP pharmacokinetic program (MicroMath, Inc., Salt Lake City, UT).
1
O)
c
‘ c
'c C
E
CD
G C
CD
CO
O
o
T 3
Q )
O
‘E ’
0.1 -
0 10 20 30 40
T i m e ( h o u r s )
chTNT-3
A chTNT-3/IL-2
77
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Figure 3-5. Tissue biodistribution and tumor uptake of chTNT-3/IL-2 in LS174T
human colon adenocarcinoma tumor-bearing nude mice. (A) Tissue uptake
measured by percent injected dose of 1 2 5 I-labeled fusion protein per gram of tissue
expressed as mean ± SD. (B) Tumor/normal organ ratios (cpm per gram
tumor/cpm per gram organ) expressed as mean ± SD.
78
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
A
2.5-.
Figure 3-5.
B
120 - |
100
CO
O C
c
CO
O)
1 day H 3 days
79
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Figure 3-6. Imaging of LS174T colon adenocarcinoma tumor-bearing nude
mice injected with 1 3 1 I-labeIed chTNT-3/IL-2.
Mice were imaged in a prone position at the indicated times post-injection with a
Spectrum 91 camera equipped with a pinhole collimator (Raytheon Medical
Systems, Melrose Park, IL) set to record 10,000 counts using the Nuclear MAX
Plus image analysis software package (MEDX Inc., Wood Dale, IL).
1 day 3 days
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
These data demonstrate that chTNT-3/IL-2 effectively localizes to the LS174T
human colon adenocarcinoma xenograft.
Pretreatment studies.
The effect of chTNT-3/IL-2 administration on tumor uptake of the murine
MAb B72.3 was evaluated in LS174T colon tumor-bearing nude mice.
Biodistribution analyses were performed 72 hours after B72.3 injection. In order
to determine the relationship between timing of treatment and tumor uptake, 30 pg
chTNT-3/IL-2 were injected i.v. at various times relative to 1 2 5 I-labeled B72.3.
The effect of fusion protein administration on increased tumor uptake was clearly
time dependent (Figure 3-7A). The highest tumor accretion of B72.3 occurred
when chTNT-3/IL-2 was injected one to three hours prior to administration of
B72.3. For this reason, a two hour interval between pretreatment and radiolabeled
MAb injection was used for the remainder of the experiments.
The relationship between dose of fusion protein and tumor uptake of B72.3
was then examined. A dose of 15 pg resulted in the greatest increase in tumor
uptake (Figure 3-7B). With higher doses, the magnitude of tumor uptake began to
diminish. At the highest dose studied, several normal tissues revealed higher MAb
uptake (Table 3-1). Most importantly, lung showed a significant increase in
uptake (from 0.89 + 0.21% ID/g with 15 pg chTNT-3/IL-2 to 1.36 ± 0.10% with
60 pg; P < 0.01). This suggests that toxicity to normal tissues can occur with high
doses of fusion protein.
81
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Figure 3-7. Time and dose dependence of chTNT-3/IL-2 pretreatment on tumor
uptake of B72.3 in LS174T human colon adenocarcinoma tumor-bearing nude
mice. (A) Tumor-bearing mice were injected with 30 pg chTNT-3/IL-2 at various
times relative to the administration of 1 2 5 I-labeled B72.3 as indicated. (B) Tumor-
bearing mice were injected with various doses of chTNT-3/IL-2 two hours prior to
administration of 1 2 5 I-labeled B72.3. In each set of experiments, mice were
sacrificed 72 hours post-injection for biodistribution analysis.
82
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
A
Figure 3-7.
12 1
0
E
1 1° -
c o
v_
.0 )
^D
8 8 -
Q
7 D
CO
o
0)
c
-4 1 0 1 ■ 5 -3 2
H o u r s R e la t iv e t o B 7 2 .3 I n je c tio n
B
12
o
E
f ,0-
2
CD
W
O
Q
"D
C D
H — »
o
CD
C
20 30 40 50 60 0 10
| i g o f c h T N T - 3 /I L - 2
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Table 3-1. Three day normal tissue biodistribution of 1 2 5 I-labeled B72.3
administered two hours following pretreatment with the indicated doses of
chTNT-3/IL-2 fusion protein in LS174T human colon adenocarcinoma
tumor-bearing nude mice.
Organ
% Injected Dose/Gram
No
pretreatment
15 Pg
pretreatment
30 pg
pretreatment
60 pg
pretreatment
Blood 1.78 (0.25)“ 1.68 (0.21) 1.62 (0.22) 2.63 (0.42)
Skin 0.67 (0.21) 0.73 (0.08) 0.62 (0.09) 0.83 (0.05)
Muscle 0.24 (0.09) 0.29 (0.13) 0.20 (0.01) 0.39 (0.11)
Bone 0.25 (0.03) 0.23 (0.04) 0.32 (0.05) 0.34 (0.06)
Heart 0.60 (0.16) 0.50 (0.11) 0.54 (0.06) 0.77 (0.10)
Lung 0.88 (0.21) 0.89 (0.21) 0.89 (0.06) 1.36 (0.10)
Liver 0.63 (0.26) 0.51 (0.11) 0.57 (0.05) 0.77 (0.16)
Spleen 0.60 (0.12) 0.45 (0.16) 0.37 (0.05) 0.59 (0.17)
Pancreas 0.25 (0.05) 0.34 (0.12) 0.40 (0.11) 0.76 (0.13)
Stomach 0.63 (0.17) 0.79 (0.11) 0.61 (0.06) 0.73 (0.13)
Intestine 0.23 (0.14) 0.23 (0.09) 0.22 (0.02) 0.45 (0.07)
Kidney 0.53 (0.19) 0.46 (0.13) 0.56 (0.16) 0.64 (0.09)
a Mean (SD).
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Figure 3-8 depicts the tissue biodistribution and tumor uptake of 1 2 5 I-
labeled B72.3 under optimal pretreatment conditions. Tumor uptake increased
significantly from 4.16 ± 0.41% ID/g to 11.10 ± 0.64% following pretreatment
with chTNT-3/IL-2 (P < 0.0001). Under these conditions, there was no change in
radiolabeled MAb uptake in normal tissues, resulting in higher tumor/normal organ
ratios (Figure 3-8B). On the other hand, pretreatment with the control fusion
protein chCLL-l/IL-2 (18), which recognizes B-cell malignancies, had no effect on
tumor uptake. This demonstrates that tumor localization of the fusion protein is
necessary for enhancing specific tumor uptake of radiolabeled MAb.
The nitric oxide synthase inhibitor 7 V G -methyl-L-arginine (l-NMA) was
administered prior to pretreatment with chTNT-3/IL-2 to examine the mechanism
of increased tumor vascular permeability. l-NMA abrogated the effect of fusion
protein pretreatment on tumor uptake of B72.3 (Figure 3-9). The inhibitor alone,
however, did not decrease tumor uptake from baseline levels (data not shown).
These data strongly suggest that nitric oxide generation is responsible for the
enhancement of tumor uptake of MAb.
An imaging study was also performed on LS174T colon adenocarcinoma-
bearing nude mice injected with 1 3 1 I-labeled B72.3 with or without fusion protein
pretreatment. The percent of total body radioactivity in the tumor was determined
using the Nuclear MAX Plus image analysis software. Pretreatment with
chTNT-3/IL-2 enhanced tumor visualization with radiolabeled MAb on each day
the mice were imaged (Figure 3-10). One day after injection, the pretreated mouse
85
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Figure 3-8. Three day biodistribution of 1 2 5 I-labeled B72.3 under optimal
pretreatment conditions in LS174T human colon adenocarcinoma tumor-bearing
nude mice. Tumor-bearing mice were pretreated with 15 pg chTNT-3/IL-2 or
chCLL-l/IL-2 (negative control) two hours prior to administration of 1 2 5 I-labeled
B72.3. (A) Tissue uptake measured by percent injected dose/gram. (B)
Tumor/normal organ ratios.
8 6
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Reproduced w ith permission o f th e copyright owner. Further reproduction prohibited without permission.
T u m o r /O r g a n R a t io
blood'
skin'
muscle'
bone-
heart'
lung'
liver
spleen
pancreas
stomach
intestine
kidney
3 z Z Z Z Z 2-i
- P * .
o
7 Z H
Z Z Z Z Z Z Z J-I
ZZZZZZZZZ 1
2ZZZZZZH
ZZZH
— I
00
6 0 H
8 0 n
CD
% I n j e c t e d D o s e / g r a m
00
L
0
1
blood “
skin-
muscle
heart
spleen
pancreas
stomach ~
intestine
tumor
l\0
j
T 3
Figure 3-8.
Figure 3-9. Effect of A—methyl-L-arginine (l-NMA) on tumor uptake of 1 2 5 I-
labeled B72.3 following chTNT-3/IL-2 pretreatment in LS174T human colon
adenocarcinoma tumor-bearing nude mice.
Tumor-bearing mice were injected with 20 mg/kg l-NMA 30 minutes prior to
pretreatment with 15 pg chTNT-3/IL-2 followed two hours later by 1 2 5 I-labeled
B72.3. Mice were sacrificed 72 hours post-injection for biodistribution analysis.
I no pretreatment
S chTNT-3/IL-2 pretreatment
ES L-NMA + pretreatment
8 8
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Figure 3-10. Imaging of LS174T human colon adenocarcinoma tumor-bearing
nude mice injected with 1 3 ^-labeled B72.3 with or without pretreatment with 15
pig chTNT-3/IL-2. Mice were imaged in a prone position at the indicated times
post-injection with a Spectrum 91 camera equipped with a pinhole collimator
(Raytheon Medical Systems, Melrose Park, IL) set to record 10,000 counts using
the Nuclear MAX Plus image analysis software package (MEDX Inc., Wood Dale,
IL).
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Figure 3-10.
1 day
3 days
5 days
control chTNT-3/IL-2 pretreatment
90
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
demonstrated approximately 48% to total body radioactivity in the tumor,
compared to 35% for the untreated mouse. At three days post-injection, the
difference was 63% versus 56%, and at five days, the pretreated mouse showed
75% of total body signal in the tumor, compared to 64% for the control mouse.
Thus, pretreatment with chTNT-3/IL-2 improved the immunoscintigraphy of the
colon adenocarcinoma xenograft.
Finally, the effect of chTNT-3/IL-2 pretreatment on tumor uptake of
1 2 5 IUdR was examined, to assess whether this approach could be applied to small
molecules such as chemotherapeutic drugs. IUdR was selected as a representative
drug because of the availability of a radioiodinated derivative. Again, 15 (ig of
fusion protein were administered two hours prior to injection of 1 2 5 IUdR in
LS174T colon adenocarcinoma-bearing mice. Because of the short circulation
time of this drug, mice were sacrificed three hours later for biodistribution analysis.
Control tumor uptake was 1.42 ± 0.11 % ID/g, increasing significantly to 4.10 ±
0.21% following pretreatment (P < 0.0001), representing approximately a three
fold increase in tumor uptake with no effect on normal tissues (Table 3-2).
DISCUSSION
In this study, a recombinant fusion protein containing the chimeric MAb
TNT-3 and human IL-2 was generated as a universal pretreatment to enhance the
delivery of therapeutic molecules to solid tumors. The fusion protein was
expressed in mammalian cells using the Glutamine Synthetase Gene Amplification
91
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Table 3-2. Three hour tissue biodistribution and tumor uptake of 1 2 5 IUdR
administered two hours following pretreatment with 15 pg chTNT-3/EL-2
fusion protein in LS174T human colon adenocarcinoma tumor-bearing nude
mice.
Organ
% Injected Dose/Gram Tumor/Organ Ratio
No pretreatment Pretreatment No
pretreatment
Pretreatment
Blood 1.57 (0.42)“ 1.56 (0.17) 0.98 (0.37) 2.65 (0.37)
Skin 1.60 (0.71) 1.40 (0.26) 1.01 (0.38) 2.98 (0.39)
Muscle 0.42 (0.15) 0.43 (0.11) 3.75 (1.30) 10.03 (2.07)
Bone 0.94 (0.25) 0.79 (0.17) 1.59 (0.45) 5.36 (1.13)
Heart 0.56 (0.15) 0.54 (0.10) 2.69 (0.79) 7.74 (1.43)
Lung 1.18 (0.33) 1.00 (0.27) 1.30 (0.46) 4.32 (1.06)
Liver 0.68 (0.17) 0.73 (0.22) 2.23 (0.75) 6.13 (2.18)
Spleen 1.22 (0.26) 1.26 (0.18) 1.21 (0.26) 3.31 (0.57)
Pancreas 1.09 (0.57) 0.79 (0.10) 1.52 (0.56) 5.22 (0.59)
Stomach 10.01 (0.96) 9.92 (1.99) 0.14 (0.02) 0.43 (0.12)
Intestine 1.71 (0.59) 1.11 (0.40) 0.92 (0.36) 4.14 (1.83)
Kidney 1.28 (0.37) 1.18 (0.20) 1.23 (0.55) 3.52 (0.43)
Tumor 1.42 (0.11) 4.10 (0.21)f c
“ Mean (SD).
h Significant increase in uptake (P < 0.0001).
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
System so that large-scale production can yield sufficient recombinant product for
clinical studies (28). Acrylamide gel electrophoresis demonstrated proper
assembly of the fUsion protein (Figure 3-1). As described previously by our
laboratory for other antibody-cytokine fusion proteins (18, 29), the IL-2 cDNA
was inserted downstream of the terminal codon of the chimeric heavy chain,
following a short linker peptide to promote proper folding of the cytokine. The
fusion protein retains the immunoreactivity of the parent antibody, as evidenced by
competition with 1 2 5 I-labeled muTNT-3 for binding to fixed Raji Burkitt’s
lymphoma cells (Figure 3-2). Moreover, chTNT-3/IL-2 maintains the high avidity
constant of chTNT-3. The biologic activity of the IL-2 moiety was demonstrated
by a proliferation assay with a murine IL-2-dependent T-cell line (Figure 3-3).
As our laboratory and others have demonstrated previously, MAb/TL-2
fusion proteins are eliminated rapidly from normal mice (29-31). The half-life of
chTNT-3/IL-2 is 12 hours, much lower than the half-life of the chimeric antibody
(Figure 3-4). The therapeutic potential of MAb/IL-2 fusion proteins for eliciting
tumor rejection has been demonstrated in animal models (32-34). The rapid
clearance of these fusion proteins may prove beneficial in the clinical setting, where
potentially injurious exposure of healthy tissues to the high doses of IL-2 (13, 35,
36) necessary to evoke cellular immune responses against solid tumors (10) may
be minimized as the antibody concentrates the cytokine at the tumor site (37). It
will of course be necessary to evaluate the toxicity of MAb/TL-2 fusion proteins in
patients, since the serum persistence of the fusion protein compared to free
93
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
recombinant IL-2 (38) may still result in toxicities. Despite its rapid elimination,
chTNT-3/IL-2 effectively localizes to tumor xenografts (Figures 3-5 and 3-6).
The efficacy of MAbs in the radioimmunotherapy of human malignancies is
limited by insufficient accumulation within solid tumors (39). Investigators have
shown that interferons can enhance the expression of tumor-associated antigens
leading to increased tumor uptake of MAbs (40, 41). This approach, however, is
limited to MAbs directed against tumor antigens that can be up-regulated by such
treatment. We have focused our efforts on developing an approach to improve the
delivery of antibodies to tumors that might also be applicable to other therapeutic
molecules. Our laboratory was the first to use immunoconjugates containing
vasoactive cytokines to increase vascular permeability (14). Others have shown
that the systemic administration of tumor necrosis factor (42-44), interferon-y (45),
and IL-2 (14, 46) increases tumor uptake of radiolabeled MAbs in mouse models,
but as demonstrated in these studies, pretreatment with free vasoactive cytokines
also results in increased uptake in normal tissues including lung, liver, and spleen.
Hence, the targeted delivery of cytokines to tumor sites using MAbs represents a
significant advancement of this technology. The fusion protein described in the
present study was designed for enhancing tumor uptake of therapeutic molecules
in a wide variety of human cancers, since TNT-3 recognizes a universal nuclear
antigen exposed in the degenerating and necrotic cells present in all solid tumors.
The ability of chTNT-3/IL-2 to increase tumor uptake of both a MAb and a
drug (IUdR) was examined in the LS174T colon adenocarcinoma xenograft
94
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
model. Radiolabeled IUdR has been evaluated in animal tumor models for the
diagnosis and therapy of cancers (47) and was used in our studies to determine if
chemotherapeutic drugs can also be enhanced in tumors in a specific manner. In
this model, increased tumor uptake of 1 2 5 I-labeled B72.3 following pretreatment
with chTNT-3/IL-2 was both time and dose dependent (Figure 3-7). It appears
that normal tissue toxicity at the highest pretreatment dose administered limited the
accumulation of B72.3 in the tumor, as levels in normal tissues began to increase
(Table 3-1). Under optimal conditions, however, pretreatment with chTNT-3/IL-2
resulted in nearly a 3-fold increase in tumor accretion of both 1 2 5 I-labeled B72.3
(Figure 3-8) and 1 2 5 IUdR (Table 3-2) with no effect on normal tissues. These
results are similar to those observed with chemically produced IL-2
immunoconjugates. The necessity for tumor localization of IL-2 was evidenced by
the absence of an effect when mice were pretreated with the control fusion protein
chCLL-l/IL-2 directed against B-cell malignancies. In addition to improving the
delivery of macromolecules, this pretreatment strategy has exciting potential
implications for chemotherapy, as this approach may decrease the systemic toxicity
of anticancer drugs while producing higher tumor killing. From the studies
described in this report, it appears that it will be necessary to optimize the
conditions of pretreatment in the clinical setting for successful application of this
strategy. It is as yet unclear how the much larger vascular volume of patients will
affect the window for optimal dose and timing observed in the mouse model.
Imaging studies also showed the value of chTNT-3/IL-2 pretreatment (Figure
95
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
3-10). Pretreatment with the fusion protein improved immunoscintigraphy of
LS174T colon adenocarcinoma xenografts with 1 3 1 I-labeled B72.3.
Nitric oxide synthase (NOS) has been implicated in the capillary leak
syndrome produced by therapy with IL-2. Hypotension observed after
administration of IL-2 to dogs decreased following administration of an inhibitor
of NOS (27). In addition, NOS inhibitors prevent signs of capillary leak in mice
(48, 49). We hypothesized that local generation of nitric oxide was responsible for
the increased tumor uptake of MAb in our model, especially since the observed
vasopermeability effect was rapid in onset and short-lived. In the present study,
administration of l-NMA completely blocked the transient effect of pretreatment
with chTNT-3/IL-2 (Figure 3-9). It has recently been demonstrated that systemic
inhibition of NOS has no effect on vascular permeability of the LS174T xenograft
(50). In our study, we likewise observed no decrease in tumor uptake of
radiolabeled MAb following administration of L-NMA. Hence, it appears that
even in those tumors in which baseline vascular permeability is not responsive to
NOS inhibition, nitric oxide generation can further increase permeability.
Modifying vascular physiology in the tumor microenvironment represents a
strategy with great possibilities for improving drug delivery. Pretreatment with the
fusion protein described in this report may be applicable to a wide spectrum of
human malignancies, since TNT-3 is expected to localize to any tumor that
contains degenerating cells and necrosis. Moreover, these studies demonstrate the
ability of pretreatment with chTNT-3/IL-2 to increase tumor uptake of both MAbs
96
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
and small molecules such as chemotherapeutic drugs, which should improve the
therapeutic potential of these reagents.
REFERENCES
1. Jain, R. K. Delivery of molecular medicine to solid tumors. Science, 27:
1079-1080, 1996.
2. Wilder, R. B., DeNardo, G. L., and DeNardo, S. J. Radioimmunotherapy:
recent results and future directions. J. Clin. Oncol., 14: 1383-1400, 1996.
3. Buchsbaum, D. J. Experimental approaches to increase radiolabeled
antibody localization in tumors. Cancer Res. (Suppl.), 55: 5729s-5732s,
1995.
4. Vriesendorp, H. M., Quadri, S. M., Andersson, B. S., and Dicke, K. A.
Hematologic side effects of radiolabeled immunoglobulin therapy. Exp.
Hematol., 24: 1183-1190, 1996.
5. Jain, R. K. Physiological barriers to delivery of monoclonal antibodies and
other macromolecules in tumors. Cancer Res. (Suppl.), 50: 814s-819s,
1990.
6. Sands, H. and Jones, P. L. Physiology of monoclonal antibody accretion by
tumors. Cancer Treat. Res., 51: 97-122, 1990.
7. Epstein, A. L. New approaches to improved antibody targeting. In: R. E.
Henkin (ed.) Nuclear Medicine, pp. 516-533. St. Louis: Mosby-Year
Book, 1996.
8. Khawli, L. A., Miller, G. K., and Epstein, A. L. Effect of seven new
vasoactive immunoconjugates on the enhancement of monoclonal antibody
uptake in tumors. Cancer, 73: 824-831, 1994.
9. Smith, K. A. Lowest dose interleukin-2 immunotherapy. Blood, 81: 1414-
1423, 1993.
10. Oppenheim, M. H. and Lotze, M. T. Interleukin-2: solid-tumor therapy.
Oncology, 51: 154-169, 1994.
97
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
11. Rosenstein, M., Ettinghausen, S. E., and Rosenberg, S. A. Extravasation of
intravascular fluid mediated by the systemic administration of recombinant
interleukin 2. Immunology, 137: 1735-1742, 1986.
12. Ettinghausen, S. E., Puri, R. K., and Rosenberg, S. A. Increased vascular
permeability in organs mediated by the systemic administration of
lymphokine-activated killer cells and recombinant interleukin-2 in mice. J.
Natl. Cancer Inst., 80: 177-188, 1988.
13. Siegel, J. P. and Puri, R. K. Interleukin-2 toxicity. J. Clin. Oncol., 9: 694-
704, 1991.
14. LeBerthon, B., Khawli, L. A., Alauddin, M., Miller, G. K., Charak, B. S.,
Mazumder, A., and Epstein, A. L. Enhanced tumor uptake of
macromolecules induced by a novel vasoactive interleukin 2
immunoconjugate. Cancer Res., 51: 2694-2698, 1991.
15. Epstein, A. L., Khawli, L. A., Homick, J. L., and Taylor, C. R.
Identification of a monoclonal antibody, TV-1, directed against the
basement membrane of tumor vessels, and its use to enhance the delivery of
macromolecules to tumors after conjugation with interleukin 2. Cancer
Res., 55: 2673-2680, 1995.
16. Cullen, B. R. Tmra-activation of human immunodeficiency virus occurs via
a bimodal mechanism. Cell, 46: 973-982, 1986.
17. Epstein, A. L., Chen, F.-M., and Taylor, C. R. A novel method for the
detection of necrotic lesions in human cancers. Cancer Res., 48: 5842-
5848, 1988.
18. Homick, J. L., Khawli, L. A., Hu, P., Lynch, M., Anderson, P. M., and
Epstein, A. L. Chimeric CLL-1 antibody fusion proteins containing
granulocyte-macrophage colony-stimulating factor or interleukin-2 with
specificity for B-cell malignancies exhibit enhanced effector functions while
retaining tumor targeting properties. Blood, 89: 4437-4447, 1997.
19. Colcher, D., Hand, P. H., Nuti, M., and Schlom, J. A spectrum of
monoclonal antibodies reactive with human mammary tumor cells. Proc.
Natl. Acad. Sci. USA, 78: 3199-3203, 1981.
20. Hu, P., Glasky, M. S., Yun, A., Alauddin, M. M., Homick, J. L., Khawli,
L. A., and Epstein, A. L. A human-mouse chimeric Lym-1 monoclonal
antibody with specificity for human lymphomas expressed in a baculovirus
system. Hum. Antibod. Hybridomas, 6: 57-67, 1995.
98
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
21. Pulvertaft, R. J. V. Cytology of Burkitt's tumour (African lymphoma).
Lancet, 1: 238-240, 1964.
22. Ohsugi, Y., Gershwin, M. E., Owens, R. B., and Nelson-Rees, W. A.
Tumorigenicity of human malignant lymphoblasts: comparative study with
unmanipulated nude mice, antilymphocyte serum-treated nude mice, and X-
irradiated nude mice. J. Natl. Cancer Inst., 65: 715-718, 1980.
23. Tom, B. H., Rutzky, L. P., Jakstys, M. M., Oyasu, R., Kaye, C. I., and
Kahan, B. D. Human colonic adenocarcinoma cells. I. Establishment and
description of a new line. In Vitro, 12: 180-191, 1976.
24. Laemmli, U. K. Cleavage of structural proteins during the assembly of the
head of bacteriophage T4. Nature, 227: 680-685, 1970.
25. Epstein, A. L., Marder, R. J., Winter, J. N., and Fox, R. I. Two new
monoclonal antibodies (LN-l, LN-2) reactive inB5 formalin-fixed,
paraffin-embedded tissues with follicular center and mantle zone human B
lymphocytes and derived tumors. J. Immunol., 133: 1028-1036, 1984.
26. Frankel, M. E. and Gerhard, W. The rapid determination of binding
constants for antiviral antibodies by a radioimmunoassay: an analysis of the
interaction between hybridoma proteins and influenza virus. Mol.
Immunol., 16: 101-106, 1979.
27. Kilboum, R. G., Owen-Schaub, L. B., Cromeens, D. M., Gross, S. S.,
Flaherty, M. J., Santee, S. M., Alak, A. M., and Griffith, O. W. A^-methyl-
L-arginine, an inhibitor of nitric oxide formation, reverses IL-2-mediated
hypotension in dogs. J. Appl. Physiol., 7 < 5 ; 1130-1137, 1994.
28. Bebbington, C. R., Renner, G., Thomson, S., King, D., Abrams, D., and
Yarranton, G. T. High-level expression of a recombinant antibody from
myeloma cells using a glutamine synthetase gene as an amplifiable
selectable marker. Bio/Technology, 10: 169-175, 1992.
29. Hu, P., Homick, J. L., Glasky, M. S., Yun, A., Milkie, M. N., Khawli, L.
A., Anderson, P. M., and Epstein, A. L. A chimeric Lym-1/interleukin 2
fusion protein for increasing tumor vascular permeability and enhancing
antibody uptake. Cancer Res., 56: 4998-5004, 1996.
30. Gillies, S. D., Young, D., Lo, K.-M., and Roberts, S. Biological activity
and in vivo clearance of antitumor antibody/cytokine fusion proteins.
Bioconjugate Chem., 4: 230-235, 1993.
99
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
31. Harvill, E. T., Fleming, J. M L, and Morrison, S. L. In vivo properties of an
IgG3-IL-2 fusion protein. A general strategy for immune potentiation. J.
Immunol., 157: 3165-3170, 1996.
32. Becker, J. C., Pancook, J. D., Gillies, S. D., Furukawa, K., and Reisfeld, R.
A. T cell-mediated eradication of murine metastatic melanoma induced by
targeted interleukin 2 therapy. J. Exp. Med., 183: 2361-2366, 1996.
33. Becker, J. C., Varki, N., Gillies, S. D., Furukawa, K., and Reisfeld, R. A.
An antibody-interleukin 2 fusion protein overcomes tumor heterogeneity by
induction of a cellular immune response. Proc. Natl. Acad. Sci. USA, 93:
7826-7831, 1996.
34. Becker, J. C., Varki, N., Gillies, S. D., Furukawa, K., and Reisfeld, R. A.
Long-lived and transferable tumor immunity in mice following targeted
interleukin 2 therapy. J. Clin. Inv., 98: 2801-2804, 1996.
35. Lotze, M. T., Matory, Y. L., Rayner, A. A., Ettinghausen, S. E., Vetto, J.
T., Seipp, C. A., and Rosenberg, S. A. Clinical effects and toxicity of
interleukin-2 in patients with cancer. Cancer, 58: 2764-2772, 1986.
36. Margolin, K. A., Rayner, A. A., Hawkins, M. J., Atkins, M. B., Dutcher, J.
P., Fisher, R. I., Weiss, G. R., Doroshow, J. H., Jaffe, H. S., Roper, M.,
Parkinson, D. R., Wiernik, P. H., Creekmore, S. P., and Boldt, D. H.
Interleukin-2 and lymphokine-activated killer cell therapy of solid tumors:
analysis of toxicity and management guidelines. J. Clin. Oncol., 7: 486-498,
1989.
37. Reisfeld, R. A. and Gillies, S. D. Antibody-interleukin 2 fusion proteins: a
new approach to cancer therapy. J. Clin. Lab. Anal., 10: 160-166, 1996.
38. Lotze, M. T., Matory, Y. L., Ettinghausen, S. E., Rayner, A. A., Sharrow,
S. O., Seipp, C. A. Y., Custer, M. C., and Rosenberg, S. A. In vivo
administration of purified human interleukin 2. II. Half life, immunologic
effects, and expansion of peripheral lymphoid cells in vivo with
recombinant IL 2. J. Immunol., 135: 2865-2875, 1985.
39. Goldenberg, D. M. Monoclonal antibodies in cancer detection and therapy.
Am. J. Med., 94: 297-312, 1993.
40. Greiner, J. W., Dansky Ullmann, C., Nieroda, C., Qi, C.-F., Eggensperger,
D., Shimada, S., Steinberg, S. M., and Schlom, J. Improved
radioimmunotherapeutic efficacy of an anticarcinoma monoclonal antibody
(1 3 1 I-CC49) when given in combination with y-interferon. Cancer Res., 53:
600-608, 1993.
100
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
41. Murray, J. L., Macey, D. J., Grant, E. J., Rosenblum, M. G., Kasi, L. P.,
Zhang, H.-Z., Katz, R. L., Rieger, P. T., LeBherz, D., Bhadkamkar, V.,
Greiner, J. W., Schlom, J., and Podoloff, D. A. Enhanced TAG-72
expression and tumor uptake of radiolabeled monoclonal antibody CC49 in
metastatic breast cancer patients following a-interferon treatment. Cancer
Res. (Suppl.), 55: 5925s-5928s, 1995.
42. Russell, S. M., Krauer, K. G., McKenzie, I. F. C., and Pietersz, G. A.
Effect of tumor necrosis factor on the antitumor efficacy and toxicity of
aminopterin-monoclonal antibody conjugates: parameters for optimization
of therapy. Cancer Res., 50: 6028-6033, 1990.
43. Folli, S., Pelegrin, A., Chalandon, Y., Yao, X., Buchegger, F., Lienard, D.,
Lejeune, F., and Mach, J.-P. Tumor-necrosis factor can enhance radio
antibody uptake in human colon carcinoma xenografts by increasing
vascular permeability. Int. J. Cancer, 53: 829-836, 1993.
44. Rowlinson-Busza, G., Maraveyas, A., and Epenetos, A. A. Effect of
tumour necrosis factor on the uptake of specific and control monoclonal
antibodies in a human tumour xenograft model. Br. J. Cancer, 71: 660-665,
1995.
45. Thakur, M. L., DeFulvio, J., Tong, J., John, E., McDevitt, M. R., and
Damjanov, I. Evaluation of biological response modifiers in the
enhancement of tumor uptake of technetium-99m labeled macromolecules.
J. Immunol. Methods, 152: 209-216, 1992.
46. DeNardo, G. L., DeNardo, S. J., Lambom, K. R., Van Hoosear, K. A., and
Kroger, L. A. Enhancement of tumor uptake of monoclonal antibody in
nude mice with PEG-IL-2. Antibody Immunoconj. Radiopharm., 4: 859-
870, 1991.
47. Kassis, A. I. and Adelstein, S. J. Preclinical animal studies with
radioiododeoxyuridine. J. Nucl. Med., 37 (Suppl): 10S-12S, 1996.
48. Samlowski, W. E., Yim, C.-Y., McGregor, J. R., Kwon, O.-D., Gonzales,
S., and J. B. Hibbs, J. Effectiveness and toxicity of protracted nitric oxide
synthesis inhibition during IL-2 treatment of mice. J. Immunother., 18:
166-178, 1995.
49. Orucevic, A. and Lala, P. K. A°-nitro-L-arginine methyl ester, an inhibitor
of nitric oxide synthesis, ameliorates interleukin-2-induced capillary leak
syndrome in healthy mice. J. Immunother., 18: 210-220, 1996.
101
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
50. Fukumura, D., Yuan, F., Endo, M., and Jain, R. K. Role of nitric oxide in
tumor microcirculation. Blood flow, vascular permeability, and leukocyte-
endothelial interactions. Am. J. Pathol., 150: 713-725, 1997.
102
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 4 . Pretreatment with Chimeric TNT-3/Interleukin 2
Antibody Fusion Protein Increases Tumor Uptake of Various
Monoclonal Antibodies in Different Tumor Models
ABSTRACT
The clinical success of radioimmunotherapy of solid tumors is limited by
inadequate tumor uptake. Methods are needed to improve the therapeutic index of
monoclonal antibodies (MAbs) in order to achieve substantial tumor regressions in
patients. Our laboratory has developed a novel approach that employs MAbs to
direct vasoactive proteins to tumor sites in order to increase local vascular
permeability. Previously, we demonstrated that pretreatment with
immunoconjugates containing interleukin 2 (IL-2) enhances specific tumor uptake
of radiolabeled MAbs without affecting normal tissues. We have recently
described a fusion protein consisting of the chimeric antinuclear antibody TNT-3
and IL-2 (chTNT-3/IL-2) and illustrated its potential for improving the delivery of
both MAbs and drugs. Because TNT-3 recognizes a universal nuclear antigen
exposed in degenerating and necrotic cells within all solid tumors, this strategy is
expected to be applicable to the majority of human cancers. In the current study,
we examine the ability of pretreatment with chTNT-3/IL-2 to increase specific
tumor uptake of radiolabeled MAbs in 3 different human tumor xenograft models
in nude mice. These include chTNT-3 in the LS174T colon adenocarcinoma
103
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
model, CYT-351 in the LNCaP prostatic adenocarcinoma model, and NR-LU-10
in the A427 lung adenocarcinoma model. Pretreatment with chTNT-3/IL-2
significantly increased the tumor accretion of 1 2 5 I-labeled MAb in each of these
tumor models. Moreover, fusion protein pretreatment improved the
immunoscintigraphy of the lung tumor xenografts with 1 3 1 I-labeled NR-LU-10.
These findings illustrate the potential of this approach as a universal pretreatment
to enhance the delivery of therapeutic macromolecules to solid tumors.
INTRODUCTION
Despite successes in the treatment of hematologic malignancies (1-3),
radioimmunotherapy of solid tumors has produced minor clinical responses (4-7).
The efficacy of monoclonal antibody (MAb) therapies is limited by extremely low
tumor uptake observed in clinical investigations (8, 9). Physiological barriers to
the delivery of therapeutic molecules to solid tumors are a major obstacle to their
clinical success (10). Our laboratory has focused on altering tumor vascular
physiology as a means of increasing the specific tumor uptake of MAbs. To this
end, we have exploited the side effect of interleukin 2 (IL-2) on vascular
endothelium by directing this vasoactive cytokine to tumor sites using MAbs
(11-13). We have recently described a fusion protein consisting of the chimeric
antinuclear MAb TNT-3 and IL-2 and demonstrated that pretreatment with
chTNT-3/IL-2 increases specific tumor accretion of both a MAb and a
chemotherapeutic drug in a human tumor xenograft model in nude mice (see
Chapter 3). Because TNT-3 recognizes a universal nuclear antigen exposed in
104
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
degenerating and necrotic cells within solid tumors (see Chapter 2), it has the
potential to target the majority of human malignancies. In this report, we examine
the ability of chTNT-3/IL-2 to increase the specific tumor uptake of three MAbs in
different tumor xenograft models, as a basis for developing clinical protocols using
this fusion protein as a universal solid tumor targeting pretreatment.
MATERIALS AND METHODS
Antibodies, cell lines, and animals.
The chimeric MAb TNT-3 (chTNT-3, IgGi), directed against DNA
exposed in the degenerating and necrotic cells within solid tumors, was generated
as described previously (see Chapter 2). The murine MAb CYT-351, also known
as 7E11-C5.3 (IgGi) (14), recognizing a M r 100,000 prostate-specific membrane
glycoprotein (15, 16), was generously provided by CYTOGEN Corp. (Princeton,
NJ). The murine MAb NR-LU-10 (IgGzb) (17), reactive with a Mt 40,000
glycoprotein expressed on many epithelial cell carcinomas, was generously
provided by Dr. Don Axworthy of NeoRx Corp. (Seattle, WA). Iodine-125 and
iodine-131-labeled MAbs were prepared using a modified chloramine T method as
described previously (18). The fusion protein chTNT-3/IL-2, consisting of the
chimeric MAb TNT-3 with human IL-2 at the C-termini of the chimeric heavy
chains, was produced as described previously (see Chapter 3). The LS174T
human colon adenocarcinoma cell line (19), the LNCaP human prostatic
adenocarcinoma cell line (20), and the A427 human lung adenocarcinoma cell line
105
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
(21), obtained from the American Type Culture Collection (Rockville, MD), were
grown in RPMI-1640 medium supplemented with 10% fetal bovine serum
(HyClone Laboratories, Logan, UT), L-glutamine, penicillin G (100 U/ml), and
streptomycin (100 pg/ml). Athymic nude mice were purchased from Harlan
Sprague Dawley (Indianapolis, IN).
Pretreatment studies.
Six-week old female athymic nude mice were injected with a 0.2 ml
inoculum containing approximately 2 x 107 LS174T colon adenocarcinoma cells or
A427 lung adenocarcinoma cells s.c. in the left thigh. Six-week old male athymic
nude mice were injected with LNCaP prostatic adenocarcinoma cells. The tumors
were grown for 10-14 days (LS174T and A427) or approximately 8 weeks
(LNCaP) until they reached 1 cm in diameter. Groups of mice («=3-4) were
administered i.v. injections of various doses of chTNT-3/IL-2 two hours prior to
the i.v. injection of 100 jnCi/10 pig 1 2 5 I-labeled MAb. chTNT-3 was used with the
LS174T tumor model, CYT-351 was used with the LNCaP tumor model, and
NR-LU-10 was used with the A427 tumor model. Animals were sacrificed by
sodium pentobarbital overdose 3 days (chTNT-3) or 5 days (CYT-351 and
NR-LU-10) post-injection, and organs, blood, and tumors were removed and
weighed. The radioactivity in the samples was measured in a gamma counter. For
each mouse, data were expressed as percent of injected dose per gram (%ID/g)
and tumor/normal organ ratio (cpm per gram tumor/cpm per gram organ). From
these data, the mean and SD were calculated for each group. Statistical
106
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
significance was determined using unpaired Student’s /-test for comparison of
means. A P value of less than 0.05 was considered to be statistically significant.
Imaging studies.
A427 human lung adenocarcinoma tumors were established in the left thigh
of athymic nude mice as before. When the tumors had reached approximately 1
cm in diameter, the mice were injected with 1 3 1 I-labeled NR-LU-10 with or
without pretreatment with 15 pg chTNT-3/IL-2. At 3 and 5 days post-injection,
the mice were anesthetized with a s.c. injection of 0.8 mg sodium pentobarbital,
and the immobilized mice were imaged in a prone position with a Spectrum 91
gamma camera equipped with a pinhole collimator (Raytheon Medical Systems,
Melrose Park, IL) set to record 10,000 counts using the Nuclear MAX Plus image
analysis software package (MEDX Inc., Wood Dale, IL).
RESULTS AND DISCUSSION
Low tumor uptake of MAbs in clinical studies has limited the success of
radioimmunotherapy of solid tumors (7-9). We have developed a novel strategy
designed to alter vascular physiology in the tumor microenvironment (11). This
approach utilizes MAbs to direct proteins with vasoactive properties to tumor sites
in order to increase local tumor vascular permeability and enhance the uptake of
radiolabeled MAbs. We have recently described a fusion protein consisting of the
chimeric antinuclear MAb TNT-3 and IL-2 and examined its ability to increase the
specific tumor uptake of therapeutic molecules. The efficacy of pretreatment with
107
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
chTNT-3/IL-2 for enhancing tumor delivery of a representative MAb, murine
B72.3 (22), recognizing the tumor-associated glycoprotein TAG-72, and a
representative chemotherapeutic drug, the thymidine analog 1 2 5 IUdR (5-[1 2 5 I]Iodo-
2'-deoxyuridine), was demonstrated in a human tumor xenograft model in nude
mice (see Chapter 3). The purpose of the present study was to examine whether
this pretreatment strategy for increasing tumor accretion of MAbs could be
extended to other MAbs in different tumor models. For these experiments, three
tumor cell lines derived from common human malignancies were used.
The effect of chTNT-3/IL-2 administration on the tumor uptake of 1 2 5 I-
labeled chTNT-3 was evaluated in the LS174T human colon adenocarcinoma
model. Since chTNT-3 recognizes a nuclear antigen exposed in degenerating cells
and necrosis within solid tumors, it has the potential to target a wide spectrum of
human cancers (see Chapter 2). As determined previously for this colon tumor
model, a dose of 15 pg chTNT-3/IL-2 administered 2 hours prior to the injection
of radiolabeled MAb resulted in the maximum enhancement of tumor uptake. For
this reason, the same conditions were used for 1 2 5 I-labeled chTNT-3. Mice were
sacrificed 3 days post-injection for biodistribution analysis. As depicted in Figure
4-1A pretreatment with the fusion protein resulted in a significant increase in
tumor uptake of radiolabeled chTNT-3, from 4.55 ± 0.17% ID/g to 9.89 ± 0.52%
(P < 0.0001), representing approximately 220% of the control uptake. At the
same time, there was a significant decrease in blood levels of 1 2 5 I-labeled chTNT-3
following pretreatment (from 4.38 ± 0.44% ID/g to 2.72 ± 0.41%, P = 0.0015).
108
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Figure 4-1. Three day biodistribution of chTNT-3 following pretreatment with
chTNT-3/IL-2 in LS174T human colon adenocarcinoma tumor-bearing nude mice.
Tumor-bearing mice were pretreated with 15 |Ltg chTNT-3/IL-2 two hours prior to
administration of 1 2 5 I-labeled chTNT-3. (A) Tissue uptake measured by percent
injected dose of 1 2 5 I-labeled MAb per gram of tissue expressed as mean ± SD. (B)
Tumor/normal organ ratios (cpm per gram tumor/cpm per gram organ) expressed
as mean ± SD.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Figure 4-1.
■
no pretreatment
□ chTNT-3/IL-2 pretreatment I
O)
40
o
• + - *
CO
D C
O 2 0 -
O
E
l -
CD
>
0
C
c
< D
W
CC
0
C
CD
C
0
o
c
■ g
Q -
Q .
110
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
This resulted in higher tumor/organ ratios for all normal tissues (Figure 4-IB).
Thus, pretreatment with chTNT-3/IL-2 can increase the specific tumor uptake of a
MAb that recognizes the same antigen.
Pretreatment with the fusion protein was next evaluated in the LNCaP
human prostatic adenocarcinoma model. The tumor targeting ability of the MAb
CYT-351 reactive with a prostate-specific membrane antigen (15, 16) has been
demonstrated previously in this nude mouse xenograft model (23). Recently, the
potential of CYT-351 for the immunoscintigraphy of patients with prostate cancer
has been illustrated in a clinical study (24). The relationship between dose of
chTNT-3/IL-2 and tumor uptake of 1 2 5 I-labeled CYT-351 was examined in LNCaP
tumor-bearing mice. Mice were sacrificed 5 days post-injection for biodistribution.
A dose of 30 pg resulted in the greatest increase in tumor uptake (Figure 4-2). As
illustrated in Figure 4-3 A, with this dose tumor uptake increased significantly from
18.61 ± 1.92% ID/g to 33.45 ± 0.96% (P < 0.001), constituting approximately
180% of control tumor uptake, with no increase in uptake in normal tissues. On
the contrary, there was a significant decrease in blood levels of radiolabeled MAb
following pretreatment (7.97 ± 0.84% ID/g to 6.20 ± 0.08%, P = 0.02). Again,
this resulted in higher tumor/normal tissue ratios (Figure 4-3B).
Finally, chTNT-3/EL-2 pretreatment was examined in the A427 human lung
adenocarcinoma model. The MAb NR-LU-10 recognizes a membrane
glycoprotein expressed in many carcinomas of epithelial origin. The tumor
targeting ability of this MAb has been demonstrated previously in colon tumor-
111
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Figure 4-2. Dose dependence of chTNT-3/TL-2 pretreatment on tumor
uptake of CYT-351 in LNCaP human prostatic adenocarcinoma tumor-
bearing nude mice.
Tumor-bearing mice were injected with various doses of chTNT-3/EL-2 two hours
prior to administration of 1 2 5 I-labeled CYT-351. Mice were sacrificed five days
post-injection for biodistribution analysis.
35 -|
L .
o
E
a 30-
•£? 25-
c d
W
0
Q
1 20_
• 4 — 1
o
CD
c
15-
10 30 40 50 60 0 20
HQ of chTNT-3/IL-2
112
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Figure 4-3. Five day biodistribution of CYT-351 under optimal pretreatment
conditions in LNCaP human prostatic adenocarcinoma tumor-bearing nude mice.
Tumor-bearing mice were pretreated with 30 pg chTNT-3/IL-2 two hours prior to
administration of 1 2 5 I-labeled CYT-3 51. (A) Tissue uptake measured by percent
injected dose/gram. (B) Tumor/normal organ ratios.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Figure 4-3.
no pretreatment
chTNT-3/IL-2 pretreatment
2 15
(1) ■ e C D
i —
C D
C C D x: 0
c C O C C D C O o C
o C D
3 C D C D C O ' ■ * - »
X I • C
Q . o E
C D
0
-t— < CD c o
c o
C D
C
C L
114
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
bearing mice by both biodistribution and imaging studies (25). Moreover, clinical
studies have illustrated the potential ofNR-LU-10 for the radioimmunotherapy of
ovarian cancer (26). In the present study, the ability of fusion protein pretreatment
to enhance the tumor uptake of radiolabeled NR-LU-10 was evaluated by
biodistribution and imaging studies in nude mice bearing A427 human lung
adenocarcinoma tumors. Various doses of chTNT-3/IL-2 were administered 2
hours prior to injection of 1 2 5 I-labeled NR-LU-10. Mice were sacrificed 5 days
post-injection for biodistribution analysis. As indicated in Figure 4-4, the tumor
uptake of MAb increased with increasing doses of fusion protein. The uptake of
NR-LU-10 was similar following pretreatment with either 30 pg or 60 pg
chTNT-3/IL-2. Figure 4-5 depicts the biodistribution of radiolabeled NR-LU-10
following pretreatment with 60 pg chTNT-3/IL-2. Pretreatment resulted in a
significant increase in specific tumor uptake of 1 2 5 I-labeled NR-LU-10, from 3 .05 ±
0.21% ID/g to 6.69 ± 0.26% (P < 0.0001), representing approximately 220% of
control tumor uptake. Once again, there was a significant decrease in blood levels
of radiolabeled MAb following fusion protein pretreatment (1.69 ± 0.19% ID/g to
1.08 ± 0.29%, P = 0.037), and an increase in tumor/organ ratios for all normal
tissues (Figure 4-5B).
An imaging study was then performed on A427 lung tumor-bearing mice
injected with 1 3 1 I-labeled NR-LU-10 with or without fusion protein pretreatment.
The percent of total body radioactivity in the tumor was determined using the
115
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Figure 4-4. Dose dependence of chTNT-3/IL-2 pretreatment on tumor
uptake of NR-LU-10 in A427 human lung carcinoma tumor-bearing nude
mice.
Tumor-bearing mice were injected with various doses of chTNT-3/IL-2 two hours
prior to administration of 1 2 5 I-labeled NR-LU-10. Mice were sacrificed five days
post-injection for biodistribution analysis.
7-i
6 -
E
c c
5 -
C D
W
O
Q
-O 4 -
C D
■ * — »
O
C D
C
3 -
0 10 20 30 40 50 60
jug of chTNT-3/IL-2
116
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Figure 4-5. Five day biodistribution of NR-LU-10 under optimal pretreatment
conditions in A427 human lung adenocarcinoma tumor-bearing nude mice.
Tumor-bearing mice were pretreated with 60 |ag chTNT-3/IL-2 two hours prior to
administration of 1 2 5 I-labeled NR-LU-10. (A) Tissue uptake measured by percent
injected dose/gram. (B) Tumor/normal organ ratios.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
8-|
E
c o
v—
J3)
' q5
C O
o
Q
■ o
CD
■ * - >
o
©
' c
Figure 4-5.
no pretreatment
chTNT-3/IL-2 pretreatment
c CO sz 0 > 4
CD CO o c 0
CD CD CO '■ 4 — * c
Q .
i_
o E
CO
0
-1 — * CO c o
CO
o
CO
_ c
■ e C O
L .
0
c CO sz CD
CO c CD CO o c
0 3
>
0 0 0 ' - 1 — *
sz
Q . o E
(/)
O
CO c
0
Q .
o
4 — »
0 )
c
118
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
kidney ~ I 1 tumor
Nuclear MAX Plus image analysis software. Pretreatment with chTNT-3/IL-2
improved tumor visualization with radiolabeled MAb on each day the mice were
imaged (Figure 4-6). At 5 days post-injection, for example, the pretreated mouse
showed 67% of total body signal in the tumor, compared to 39% for the control
mouse. Thus, fusion protein pretreatment can improve the immunoscintigraphy of
tumors.
In these studies, we have shown that pretreatment with the fusion protein
chTNT-3/IL-2 increases the specific tumor uptake of radiolabeled MAbs in three
different solid tumor xenograft models. As demonstrated previously for the MAb
B72.3, the effect of fusion protein pretreatment is dose dependent. The optimal
dose of chTNT-3/IL-2 varied somewhat from one tumor model to the next, which
might be attributable to different amounts of fusion protein accumulating at the
tumor site. The biodistribution of chTNT-3/IL-2 in each tumor model was not
determined in these experiments, however. Since TNT-3 recognizes a nuclear
antigen exposed in degenerating and necrotic cells within all solid tumors, this
pretreatment strategy is applicable to the majority of human malignancies. The
findings described in this report provide evidence for the potential of this approach
as a universal pretreatment to enhance the delivery of therapeutic macromolecules
to solid tumors.
119
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Figure 4-6. Imaging of A427 human lung adenocarcinoma tumor-bearing
nude mice injected with 1 3 1 I-labeled NR-LU-10 with or without pretreatment
with chTNT-3/IL-2.
Mice were imaged in a prone position at the indicated times post-injection with a
Spectrum 91 camera equipped with a pinhole collimator (Raytheon Medical
Systems, Melrose Park, IL) set to record 10,000 counts using the Nuclear MAX
Plus image analysis software package (MEDX Inc., Wood Dale, IL).
3 days
5 days
control chTNT-3/IL-2 pretreatment
120
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
REFERENCES
1. Kaminski, M. S., Zasadny, K. R., Francis, I. R., Milik, A. W., Ross, C. W.,
Moon, S. D., Crawford, S. M., Burgess, J. M., Petry, N. A., Butchko, G.
M., Glenn, S. D., and Wahl, R. L. Radioimmunotherapy of B-cell
lymphoma with [1 3 1 I]anti-Bl (anti-CD20) antibody. N. Engl. J. Med., 329:
459-465, 1993.
2. DeNardo, G. L., Lewis, J. P., DeNardo, S. J., and O'Grady, L. F. Effect of
Lym-1 radioimmunoconjugate on refractory chronic lymphocytic leukemia.
Cancer, 73: 1425-1432, 1994.
3. Press, O. W., Eary, J. F., Appelbaum, F. R., Martin, P. J., Nelp, W. B.,
Glenn, S., Fisher, D. R., Porter, B., Matthews, D. C., Gooley, T., and
Bernstein, I. D. Phase II trial of 1 3 1 I-B1 (anti-CD20) antibody therapy with
autologous stem cell transplantation for relapsed B cell lymphomas.
Lancet, 346: 336-340, 1995.
4. Dillman, R. O. Antibodies as cytotoxic therapy. J. Clin. Oncol., 12: 1497-
1515, 1994.
5. Bruland, O. S. Cancer therapy with radiolabeled antibodies. An overview.
Acta Oncol., 34: 1085-1094, 1995.
6. Kairemo, K. J. Radioimmunotherapy of solid cancers: a review. Acta
Oncol., 35: 343-355, 1996.
7. Wilder, R. B., DeNardo, G. L., and DeNardo, S. J. Radioimmunotherapy:
recent results and future directions. J. Clin. Oncol., 14: 1383-1400, 1996.
8. Goldenberg, D. M. Monoclonal antibodies in cancer detection and therapy.
Am. J. Med., 94: 297-312, 1993.
9. Buchsbaum, D. J. Experimental approaches to increase radiolabeled
antibody localization in tumors. Cancer Res. (Suppl.), 55: 5729s-5732s,
1995.
10. Jain, R. K. Delivery of molecular medicine to solid tumors. Science, 27:
1079-1080, 1996.
11. LeBerthon, B., Khawli, L. A., Alauddin, M., Miller, G. K., Charak, B. S.,
Mazumder, A., and Epstein, A. L. Enhanced tumor uptake of
macromolecules induced by a novel vasoactive interleukin 2
immunoconjugate. Cancer Res., 51: 2694-2698, 1991.
121
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
12. Khawli, L. A., Miller, G. K., and Epstein, A. L. Effect of seven new
vasoactive immunoconjugates on the enhancement of monoclonal antibody
uptake in tumors. Cancer, 73: 824-831, 1994.
13. Epstein, A. L., Khawli, L. A., Homick, J. L., and Taylor, C. R.
Identification of a monoclonal antibody, TV-1, directed against the
basement membrane of tumor vessels, and its use to enhance the delivery of
macromolecules to tumors after conjugation with interleukin 2. Cancer
Res., 55: 2673-2680, 1995.
14. Horoszewicz, J. S., Kawinski, E., and Murphy, G. P. Monoclonal
antibodies to a new antigenic marker in epithelial prostatic cells and serum
of prostatic cancer patients. Anticancer Res., 7: 927-936, 1987.
15. Israeli, R. S., Powell, C. T., Fair, W. R , and Heston, W. D. W. Molecular
cloning of a complementary DNA encoding a prostate-specific membrane
antigen. Cancer Res., 53: 227-230, 1993.
16. Israeli, R. S., Powell, C. T., Corr, J. G., Fair, W. R., and Heston, W. D. W.
Expression of the prostate-specific membrane antigen. Cancer Res., 54:
1807-1811, 1994.
17. Varki, N. M., Reisfeld, R. A., and Walker, L. E. Antigens associated with a
human lung adenocarcinoma defined by monoclonal antibodies. Cancer
Res., 44: 681-687, 1984.
18. Hu, P., Glasky, M. S., Yun, A., Alauddin, M. M., Homick, J. L., Khawli,
L. A., and Epstein, A. L. A human-mouse chimeric Lym-1 monoclonal
antibody with specificity for human lymphomas expressed in a baculovirus
system. Hum. Antibod. Hybridomas, 6: 57-67, 1995.
19. Tom, B. H., Rutzky, L. P., Jakstys, M. M., Oyasu, R., Kaye, C. I., and
Kahan, B. D. Human colonic adenocarcinoma cells. I. Establishment and
description of a new line. In Vitro, 12: 180-191, 1976.
20. Horoszewicz, J. S., Leong, S. S., Kawinski, E., Karr, J. P., Rosenthal, H.,
Chu, T. M., Mirand, E. A., and Murphy, G. P. LNCaP model of human
prostatic carcinoma. Cancer Res., 43: 1809-1818, 1983.
21. Giard, D. J., Aaronson, S. A., Todaro, G. J., Amstein, P., Kersey, J. H.,
Dosik, H., and Parks, W. P. In vitro cultivation of human tumors:
establishment of cell lines derived from a series of solid tumors. J. Natl.
Cancer Inst., 57: 1417-1423, 1973.
122
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
22. Colcher, D., Hand, P. H., Nuti, M., and Schlom, J. A spectrum of
monoclonal antibodies reactive with human mammary tumor cells. Proc.
Natl. Acad. Sci. USA, 78: 3199-3203, 1981.
23. Lopes, A. D., Davis, W. L., Rosenstraus, M. J., Uveges, A. J., and Gilman,
S. C. Immunohistochemical and pharmacokinetic characterization of the
site-specific immunoconjugate CYT-356 derived from antiprostate
monoclonal antibody 7E11-C5. Cancer Res., 50: 6423-6429, 1990.
24. Chengazi, V. U., Feneley, M. R., Ellison, D., Stalteri, M., Granowski, A.,
Granowska, M., Nimmon, C. C., Mather, S. J., Kirby, R. S., and Britton,
K. E. Imaging prostate cancer with technetium-99m-7El 1-C5.3 (CYT-
351). J. Nucl. Med., 38: 675-682, 1997.
25. Goldrosen, M. H., Biddle, W. C., Pancook, J., Bakshi, S., Vanderheyden,
J.-L., Fritzberg, A. R., Morgan Jr., A. C., and Foon, K. A. Biodistribution,
pharmacokinetic, and imaging studies with 1 8 6 Re-labeled NR-LU-10 whole
antibody in LS174T colonic tumor-bearing mice. Cancer Res., 50:1913-
7978, 1990.
26. Breitz, H. B., Durham, J. S., Fisher, D. R., and Weiden, P. L. Radiation-
absorbed dose estimates to normal organs following intraperitoneal ^ R e
labeled monoclonal antibody: methods and results. Cancer Res. (Suppl.),
55: 5817s-5822s, 1995.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 5 . Chimeric CLL-1 Antibody Fusion Proteins
Containing Granulocyte-Macrophage Colony-Stimulating Factor
or Interleukin 2 with Specificity for B-Cell Malignancies Exhibit
Enhanced Effector Functions While Retaining Tumor Targeting
Properties
ABSTRACT
Although monoclonal antibody (MAb) therapy of the human malignant
lymphomas has shown success in clinical trials, its full potential for the treatment
of hematologic malignancies has yet to be realized. In order to expand the clinical
potential of a promising human-mouse chimeric anti-human B-cell MAb
(chCLL-1) constructed using the variable domains cloned from the murine Lym-2
(muLym-2) hybridoma, fusion proteins containing GM-CSF (chCLL-1/GM-CSF)
or IL-2 (chCLL-1/IL-2) were generated and evaluated for in vitro cytotoxicity and
in vivo tumor targeting. The glutamine synthetase gene amplification system was
employed for high level expression of the recombinant fusion proteins. Antigenic
specificity was confirmed by a competition radioimmunoassay against ARH-77
human myeloma cells. The activity of chCLL-l/GM-CSF was established by a
colony formation assay, and the bioactivity of chCLL-1/IL-2 was confirmed by
supporting the growth of an IL-2-dependent T-cell line. Antibody-dependent
cellular cytotoxicity against ARH-77 target cells demonstrated that both fusion
124
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
proteins mediate enhanced tumor cell lysis by human mononuclear cells. Finally,
biodistribution and imaging studies in nude mice bearing ARH-77 xenografts
indicated that the fusion proteins specifically target the tumors. These in vitro and
in vivo data suggest that chCLL-l/GM-CSF and chCLL-l/IL-2 have potential as
immunotherapeutic reagents for the treatment of B-cell malignancies.
INTRODUCTION
With the exception of a chimeric anti-CD20 MAb, which has produced
tumor regressions in patients with relapsed B-cell non-Hodgkin’s lymphoma
(NHL) (1), unconjugated MAbs have demonstrated limited therapeutic responses
(2). Radioimmunotherapy, on the other hand, has shown considerable promise in
clinical studies, particularly in the treatment of B-cell NHL (3). The efficacy of
radioimmunotherapy is restricted, however, either by dose-limiting
thrombocytopenia or more severely by the presence of bone marrow disease. In
these settings, effective therapy with unconjugated MAbs would be desirable for
the induction of tumor remission. For this purpose, the combination of MAbs and
biologic response modifiers has been investigated as a means of increasing tumor
lysis. Cytokines including interleukin-2 (IL-2) and granulocyte-macrophage
colony-stimulating factor (GM-CSF) have been shown to enhance both in vitro
cytotoxicity mediated by MAbs against tumor targets and in vivo killing of tumor
xenografts in animal model systems (4-9). Because of the toxicity of systemically
administered cytokines, however, methods are needed to target these biologically
potent immunologic mediators to the tumor site. One approach, gene transfer, has
125
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
demonstrated that tumor cells engineered to secrete cytokines stimulate antitumor
immunity and rejection in animal models (10-17), illustrating the importance of
localizing cytokines to tumors. At the present time, however, this approach is
impractical in the clinical setting. An alternative method is the use of antibody-
cytokine fusion proteins to direct such immunologically active molecules to tumor
sites (18-20). In this way high local concentrations of cytokines within tumors can
be achieved and systemic toxicity is minimized or avoided.
In this report we describe the development of such molecules for the
treatment of hematologic malignancies. Lym-2 is a murine IgGi MAb directed
against a human MHC class II variant that is strongly reactive with a high
percentage of human B-cell NHL, chronic lymphocytic leukemia, and multiple
myeloma cell lines and biopsy specimens (21). Lym-2 has recently been shown to
have a direct inhibitory effect on human lymphoma cell lines in vitro and to
improve the survival of human lymphoma-bearing severe combined
immunodeficiency (SCID) mice by the induction of apoptosis (Funakoshi, S.,
Hirano, A., Beckwith, M., Asai, O., Tian, Z., Homick, J.L., Hu, P., Khawli, L.A.,
Epstein, A.L., Longo, D.L., and Murphy, W.J. Antitumor effects of
nonconjugated murine Lym-2 and human-mouse chimeric CLL-1 monoclonal
antibodies against human B-cell lymphomas, in preparation.). In antibody-
dependent cellular cytotoxicity (ADCC) assays, however, murine Lym-2 mediates
low tumor lysis with human mononuclear effector cells. A human-mouse chimeric
derivative designated chCLL-1 has therefore been constructed to increase its
126
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
effector functions. In order to enhance further the immunotherapeutic potential of
this chimeric antibody for the treatment of B-cell malignancies, antibody fusion
proteins containing human GM-CSF and IL-2 have been generated. In this study
we describe the effector functions mediated by these recombinant molecules and
demonstrate their tumor targeting abilities in a nude mouse xenograft model.
MATERIALS AND METHODS
Reagents.
The plasmid pcD-hGM/Eo-CSF containing the human GM-CSF cDNA
(22) was obtained from the American Type Culture Collection (clone 57594;
Rockville, MD). The plasmid pBC12/HIV/IL-2 containing the human IL-2 cDNA
(23) was obtained from the American Type Culture Collection (clone 67618). The
plasmids pEE6hCMV-B and pEE12 were purchased with the Glutamine
Synthetase Gene Amplification System from Celltech Biologies (Slough, UK).
Restriction endonucleases, T4 DNA ligase, and other molecular biology reagents
were purchased from New England Biolabs (Beverly, MA) or Boehringer
Mannheim (Indianapolis, IN). RPMI-1640 medium, MEM non-essential amino
acids solution, penicillin-streptomycin solution, Dulbecco’s phosphate buffered
saline (PBS), dialyzed fetal bovine serum, Sephadex, buffer salts, and other
reagents such as chloramine T, sodium metabisulfite, hydrogen peroxide, and
ABTS (2,2’-azino-bis(3-ethylbenzthiazoline-6-sulfonic acid) diammonium salt)
were purchased from Sigma Chemical Co. (St. Louis, MO). Hybridoma-SFM
127
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
medium with and without glutamine was purchased from Life Technologies
(Gaithersburg, MD). Fetal bovine serum was obtained from HyClone
Laboratories, Inc. (Logan, UT). Iodine-125 and iodine-131 were obtained as
sodium iodide in 0. IN sodium hydroxide from DuPont/New England Nuclear
(North Billerica, MA). BALB/c and athymic nude mice were purchased from
Harlan Sprague Dawley (Indianapolis, IN).
Antibodies and cell lines.
The murine monoclonal antibody Lym-2 (muLym-2, IgGi), directed against
a B-cell surface antigen (21), was obtained from Techniclone International, Inc.
(Tustin, CA). The human-mouse chimeric monoclonal antibody Lym-1 (chLym-1,
IgGiic) was generated as described previously (24). The chimeric monoclonal
antibody CLL-1 (chCLL-1, IgGiic) was produced as described below. The
chimeric monoclonal antibody TNT-1 (chTNT-1, IgGiic), the cDNAs for whose
variable regions were cloned from the murine TNT-1 hybridoma (25), was
constructed and expressed in the same manner as chCLL-1. The murine Lym-2
anti-idiotype monoclonal antibody (7E2) was generated as previously described for
the anti-idiotype to Lym-1 (1A7) (24). Iodine-125 and iodine-131 labeled
monoclonal antibodies were prepared using a modified chloramine T method as
described previously (24). The NSO murine myeloma cell line, which was obtained
from Celltech Biologies, was grown in non-selective medium consisting of
Hybridoma- SFM supplemented with 10% fetal bovine serum, L-glutamine, MEM
non-essential amino acids solution, penicillin G (100 U/ml), and streptomycin (100
128
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
pg/ml). Selective medium consists of Hybridoma-SFM without glutamine
supplemented with 10% dialyzed fetal bovine serum, glutamic acid, asparagine,
nucleosides, penicillin G, and streptomycin, according to the protocol provided
with the Glutamine Synthetase Gene Amplification System (Celltech Biologies).
The ARH-77 human myeloma cell line (26), obtained from the American Type
Culture Collection, was grown in RPMI-1640 medium supplemented with 10%
fetal bovine serum, L-glutamine, penicillin G, and streptomycin.
Cloning of variable region cDNAs and construction of chimeric antibody
genes.
The variable regions were cloned essentially as described previously(24).
Briefly, total RNA was isolated from murine Lym-2 antibody-producing
hybridoma cells by the single-step method (27), and poly A+ RNA was selected
using the Oligotex mRNA Kit (QIAGEN, Inc., Chatsworth, CA). Complementary
DNA was synthesized from mRNA using the Superscript Preamplification System
(Life Technologies, Grand Island, NY) with a mouse CH 1 antisense
oligonucleotide primer (EP37) and a mouse k antisense primer (EP39). The
sequences of all primers are shown in Table 5-1. The variable heavy (V h) and
variable light (V l) domains were PCR amplified from the cDNAs using a panel of
degenerate primers as described previously (28). The Lym-2 Vh domain was
identified after amplification with primers EP37 and EP144, and the Lym-2 VL
domain was amplified with primers EP40 and EP70. The leader sequence for the
VH domain was appended by PCR using primers EP157 and EP38. The variable
129
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Table 5-1. Oligonucleotide primers used for cloning the variable regions
from the murine Lym-2 hybridoma.
Primer Description DNA sequence
EP37 Mouse CHI primer
for synthesis of Vh
cDNA
5’ GGACAGGGATCCAGAGTTCCA 3’
EP39 Mouse k primer for
synthesis of VL cDNA
5’ CTCACTGGATGGTGGGAAGAT 3’
EP144 5’ Lym-2 VH primer 5’ CAGGTCCAACTGCAGCAGTC 3’
EP70 5’ Lym-2 VL leader
sequence primer
5’ ACTAGTCGACATGGGCA(T)TCAAGAT
GGAGTCACAG(T)A(T)C(T)C(T)CA(T)GG 3 ’
EP40 3’ Lym-2 VL primer 5’ GATGGATCCAGTTGGTGCAGCATC 3’
EP157 5 ’ Lym-2 Vh leader
sequence primer
5’ ATGTACTTGGGACTGAG(A)CTA(G)T 3’
EP38 3’ Lym-2 Vh primer 5’ AGGGAATTCACCCTTGACCAGGCA 3’
130
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
domains were each cloned into pBluescript, and sequences were determined by
automated DNA sequencing. The variable domains were then amplified with
primers designed to introduce appropriate restriction endonuclease sites to
facilitate cloning into the constant region-containing plasmids. The chimeric heavy
and light chain fusion genes were generated by cloning the variable regions into
pSK-yl and pSK-K, respectively.
Construction of chCLL-1 expression vector.
The Glutamine Synthetase Gene Amplification System (Celltech Biologies)
was used for high level expression of recombinant antibody, according to the
protocol of the manufacturer. The basic system has been described by Bebbington
et al. (29). In order to introduce the variable-constant region fusion genes into the
expression vectors, the genes were PCR amplified with primers designed to
introduce appropriate restriction endonuclease sites and the Kozak translation
initiation sequence (30). Each chimeric antibody chain was expressed under the
control of the cytomegalovirus major immediate early promoter. Transcription
cassettes were assembled in series so that both heavy and light chains could be
expressed from the same plasmid. The chimeric heavy chain was cloned into the
polylinker of the pEE12 expression vector containing the glutamine synthetase
selectable marker, while the chimeric light chain was cloned into the polylinker of
the pEE6 cloning vector. The final expression vector, designated 12/chCLL-l/HL,
was constructed by excising the light chain transcription cassette containing the
131
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
promoter, coding region, and polyadenylation signal from pEE6 and cloning it into
a restriction site downstream of the heavy chain transcription cassette.
Expression and purification of chimeric CLL-1.
The 12/chCLL-l/HL expression vector was linearized by restriction
endonuclease digestion prior to transfection into NSO myeloma cells. After
washing in cold PBS, 107 NSO cells were placed in an electroporation cuvette
(BioRad, Richmond, CA) with the plasmid DNA. Electroporation was performed
using a Gene Pulser apparatus (BioRad), according to the instructions of the
manufacturer. The cells were plated in non-selective Hybridoma-SFM medium
and fed 24 hours later with selective glutamine-free medium. Approximately three
weeks later, supernatants from wells containing viable clones were tested for the
production of chimeric antibody by indirect enzyme-linked immunosorbent assay
(ELISA), described below. The highest-producing clone was identified by a
24-hour rate of production assay again using ELISA. In order to enhance the
yield, amplification of vector copy number was achieved by expanding the clone
and incubating the cells in increasing concentrations of methionine sulfoximine, a
specific inhibitor of glutamine synthetase. Three to four weeks later, viable clones
were again assayed for rate of chimeric antibody production. After sub-cloning by
limiting dilution, the highest-producing clone was expanded and incubated in a 10
L bioreactor, and chCLL-1 was purified stepwise from cell culture medium by
protein A affinity chromatography and ion-exchange chromatography, as described
previously (24).
132
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Construction of antibodv/cvtokine fusion protein expression vectors.
The expression vector for chCLL-1, 12/chCLL-l/HL, was used as the
parent vector. This plasmid contains the cDNA sequences for the human-mouse
chimeric CLL-1 heavy and light chains, each under the control of the CMV major
immediate early promoter, and the cDNA sequence for glutamine synthetase,
under the control of the SV40 early promoter. Two oligonucleotide primers, 5’ -
GGT AAAGCGGCCGC AGGAGGT GGT AGCGC ACCCGCCCGCT CGCCC AGC
- 3’ and 5’ - TCAATGCGGCCGCTCACTCCTGGACTGGCTCCCAGCA - 3’,
were used to amplify by PCR the human GM-CSF cDNA from the
pcD-hGM/Eo-CSF plasmid template. To amplify the human IL-2 cDNA from the
pBC12/HIV/IL-2 plasmid template, two primers, 5’ - GGT AAAGCGGCCGC AG
GAGGTGGTAGCGCACCTACTTCAAGTTCTACA - 3’ and 5’ - TCATGCGG
CCGCTC AAGTT AGT GTT GAG AT GAT GCT - 3’, were used. The PCR
fragments were each inserted into the Notl site of 12/chCLL-l/HL, resulting in the
expression vectors 12/chCLL-l/HL/GM-CSF and 12/chCLL-l/HL/IL-2, encoding
the chimeric light chain and a fusion protein consisting of the chimeric CLL-1
heavy chain with human GM-CSF or human IL-2 at its C-terminus.
Expression and purification of fusion proteins.
The fusion proteins were expressed from NSO murine myeloma cells
according to the protocol of the manufacturer (Celltech Biologies). Briefly,
linearized plasmids were electroporated into NSO cells, which were plated in non-
selective Hybridoma-SFM medium. Selective glutamine-free medium was added
133
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
24 hours later. When transfectants appeared approximately three weeks later,
supernatants were tested for the presence of chimeric fusion protein by indirect
enzyme-linked immunosorbent assay (ELISA). The highest-producing clones were
identified by 24-hour rate of production assays. In order to maximize the yield of
chCLL-1/GM-CSF, amplification of vector copy number was achieved by
expanding the clone and incubating the cells in increasing concentrations of
methionine sulfoximine, a specific inhibitor of glutamine synthetase. Three to four
weeks later, viable clones were again assayed for rate of chimeric fusion protein
production. After sub-cloning by limiting dilution, the highest-producing clones
were expanded, incubated in 10 liter bioreactors, and chCLL-1/GM-CSF and
chCLL-1 /IL-2 were purified stepwise from cell culture medium by protein A
affinity chromatography and ion-exchange chromatography, as described
previously (24). The purity of each fusion protein was examined by SDS-PAGE in
a reducing gel according to the method of Laemmli (31) and by High Performance
Liquid Chromatography (HPLC). The samples were filtered through a 0.22 pm
Nalgene disposable filter unit prior to injection. The fusion proteins were analyzed
with a Beckman HPLC Gold System equipped with two 110B solvent pumps, a
210A valve injector, a 166 programmable UV detector, and a 406 analog interface
module. Size exclusion chromatography was performed on a G4000SW column
(TosoHaas; Montgomeryville, PA) with 0.1 M PBS, pH 7.2 as the solvent system,
eluting at a flow rate of 1 ml/min. The UV absorbance of the HPLC eluate was
detected at 280 nm.
134
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Immunoassays.
ELISA.
Chimeric antibody or fusion protein-containing supernatants were initially
identified by indirect ELISA using murine Lym-2 anti-idiotype 7E2 monoclonal
antibody, as described previously (24). For production rate assays, 106 cells were
plated in 1 ml of selective medium and allowed to incubate for 24 hours. ELISA
was then performed as before. Supernatants were serially diluted and applied to
wells of microtiter plates coated with goat anti-human IgG (H+L) (CalTag, So.
San Francisco, CA). Dilutions of a control chimeric antibody were used to
generate a standard curve using 4-parameter fit by an automated ELISA reader
(Bio-Tek Instruments, Inc., Winooski, VT), from which concentrations of
unknowns were estimated. Rates of production expressed as p.g/ml/106 cells/24
hours were compared to identify the highest producing clones.
ARH-77 cell competition R1A.
The antigen-binding activity of chCLL-1/GM-CSF and chCLL-1 UL-2 was
determined by a competition radioimmunoassay for binding to fixed ARH-77
myeloma cells. For these studies, 2 x 106 ARH-77 cells previously fixed in 2%
paraformaldehyde (32) were incubated with 20 ng of 1 2 5 I-labeled muLym-2 and
serial dilutions of cold muLym-2, chCLL-l/GM-CSF, chCLL-l/IL-2, or an
irrelevant MAb (chLym-1). The cells and MAbs or fusion proteins were incubated
for 1 hour at room temperature with constant mixing. The cells were then washed
twice, and the cell pellet-associated radioactivity was measured in a gamma
135
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
counter. Maximal binding was determined from tubes containing no cold
antibodies.
Determination of avidity.
In order to determine the avidity constants of chCLL-1/GM-CSF and
chCLL-1/IL-2, a fixed cell radioimmunoassay was performed using the method of
Frankel and Gerhard (33). Each experimental variable was run in duplicate.
ARH-77 myeloma cell suspensions containing 106 cells/ml were incubated with 10
to 110 ng of 1 2 5 I-labeled chCLL-1 /GM-CSF or chCLL-l/IL-2 in 200 pi PBS for 1
hour at room temperature with constant mixing. The cells were then washed three
times with PBS containing 1% bovine serum albumin to remove unbound antibody
and counted in a gamma counter. The amount of fusion protein bound was then
determined by the remaining cell-bound radioactivity (cpm) in each tube and the
specific activity (cpm/ng) of the radiolabeled fusion protein. Scatchard plot
analysis was used to obtain the slope. The equilibrium or avidity constant Ka was
calculated by the equation K = -(slope/w), where n is the valence of the antibody (2
for IgG).
Isolation of bone marrow cells.
Bone marrow samples were obtained in preservative-free heparin from
normal donors after receiving their informed consent (with the approval of UCLA
Institutional Review Board). Cells were diluted with an equal volume of PBS
containing 0.6% ACD-A (Anticoagulant citrate dextrose solution, Formula A;
Baxter-Fenwal Corp., Deerfield, IL) and mononuclear cells (MNC) were isolated
136
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
by gradient centrifugation on Ficoll-Paque (Pharmacia LKB; Uppsala, Sweden)
followed by two washes with PBS/ACD-A. CD34+ cells were purified from MNC
using a CD34+ Progenitor Cell Isolation Kit (Miltenyi Biotec; Auburn, CA)
without modification of the manufacturer’s instructions.
Colony assays.
Bone marrow MNC (7.5 x 104 cells/well) or CD34+ cells (1 x 104
cells/well) were plated in triplicate in 24-well plates in semi-solid medium
containing 0.3% bacto agar in Iscove’s Modified Dulbecco’s Medium, 20% fetal
bovine serum (Atlanta Biological, Norcross, GA), 50 pg/ml gentamicin, 0.4 mM
L-glutamine. Colony assays were supplemented with either hu-GM-CSF
(generously provided by AmGen; Thousand Oaks, CA), chCLL-l/GM-CSF, or
chCLL-1. Cultures were maintained humidified at 3 7°C in 5% CO2. Colonies
containing more than 30 cells were enumerated after 14-16 days in culture.
Bioassav.
Biologic activity of chCLL-l/IL-2 was determined by a standard IL-2-
dependent T-cell proliferation assay (34). Carrier-free recombinant IL-2 obtained
from Hoffmann La Roche, Inc. (Nutley, NJ) was used as a standard. Roche IL-2
stock (7.8 mg/ml, specific activity -12 x 106 IU/mg) was diluted to yield a stock
solution containing 2 x 106 IU/ml. Growth of the IL-2-dependent murine T-cell
line, CTLL-2, was used to determine the amount of IL-2 bioactivity in a sample.
Briefly, serially diluted samples and standard were incubated with 2 x 104 CTLL-2
cells in triplicate for 20 hours at 37°C in 96-well flat bottom microtiter plates. The
137
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
cells were then pulsed with 0.5 pCi of 3 H-thymidine for 6 hours, and the samples
were harvested and counted.
Cytotoxicity assays.
Antibody-dependent cellular cytotoxicity (ADCC) was performed using the
CytoTox 96 Non-Radioactive Cytotoxicity Assay (Promega, Madison, WI), which
is a colorimetric assay that quantitatively measures lactate dehydrogenase release
(35). Effector cells were peripheral blood MNC or neutrophilic
polymorphonuclear leukocytes (PMN). MNC were isolated from healthy human
donors by Ficoll-Paque gradient centrifugation, and PMN were purified by
centrifugation through a discontinuous percoll gradient (70% and 62%) followed
by hypotonic lysis to remove residual erythrocytes as described previously (36).
ARH-77 myeloma cells were used as target cells. ARH-77 cells were suspended in
Hybridoma-SFM medium supplemented with 2% fetal bovine serum and plated in
96-well V-bottom microtiter plates at 2 x 104 cells/well. Antibody or fUsion
protein preparations (chCLL-l/GM-CSF, chCLL-l/IL-2 , chCLL-1, muLym-2, or
chTNT-1 as an isotype-matched irrelevant control) were added in triplicate to
individual wells at 1 pg/ml, and effector cells were added at various effector:target
cell ratios (12.5:1 to 50:1). The plates were incubated for 4 hours at 37° C, after
which the supernatants were harvested, lactate dehydrogenase release was
determined, and % specific lysis was calculated according to the protocol of the
manufacturer. Data are reported as mean ± standard deviation (SD). Differences
between groups were analyzed by unpaired Student’s /-test.
138
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Pharmacokinetic and biodistribution studies.
Six-week-old BALB/c mice were used to determine the pharmacokinetic
clearance of chCLL-1, chCLL-l/GM-CSF and chCLL-l/IL-2. Groups of mice
(«=5) were administered i.p. injections of 1 2 5 I-labeled fusion proteins (30-40
pCi/mouse). The whole body activity at injection and at selected times thereafter
was measured with a CRC-7 microdosimeter (Capintec, Inc., Pittsburgh, PA). The
data were analyzed and half-lives were determined using the RSTRIP
pharmacokinetic program (MicroMath, Inc., Salt Lake City, UT). To determine
the tissue biodistribution of chCLL-l/GM-CSF and chCLL-l/IL-2, six-week-old
female athymic nude mice were irradiated with 400 rads from a cesium source,
three days after which they were injected with a 0.2 ml inoculum containing 4 x
107 ARH-77 cells and 4 x 106 human fetal lung fibroblast feeder cells s.c. in the left
thigh. The tumors were grown for three weeks until they reached approximately 1
cm in diameter. Within each group («=5), individual mice were injected i.v. with a
0.1 ml inoculum containing 100 pCi/10 pg of 1 2 5 I-labeled fusion protein. Animals
were sacrificed by sodium pentobarbital overdose at 72 hours post-injection, and
various organs, blood, and tumors were removed and weighed. The radioactivity
in the samples was then measured in a gamma counter. For each mouse, data were
expressed as percent injected dose/gram (% ID/g) and tumor:organ ratio (cpm per
gram tumor/cpm per gram organ). From these data, the mean and SD were
calculated for each group.
139
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Imaging studies.
ARH-77 human myeloma tumors were grown in the left thighs of athymic
nude mice as described above. When the tumors had reached approximately 1 cm
in diameter, the mice were injected i.v. with a 0.1 ml inoculum containing 100
pCi/10 gg of 1 3 1 I-labeled chCLL-1, chCLL-l/GM-CSF, or chCLL-l/IL-2. At one,
three, and five days post-injection, the mice were anesthetized with a s.c. injection
of 0.8 mg sodium pentobarbital. The immobilized mice were then imaged in a
prone position with a Spectrum 91 camera equipped with a pinhole collimator
(Raytheon Medical Systems, Melrose Park, IL) set to record 10,000 counts using
the Nuclear MAX Plus image analysis software package (MEDX Inc., Wood Dale,
IL).
RESULTS
Construction, expression, and purification of chCLL-l/GM-CSF and
chCLL-l/EL-2.
A Notl site was previously appended immediately downstream of the
terminal codon of the human yl sequence by PCR. A PCR fragment containing
either the human GM-CSF cDNA or the human IL-2 cDNA preceded by a seven
amino acid linker peptide was then inserted into the Notl site, producing CLL-1
VH/human y 1/human GM-CSF or CLL-1 VH/human y 1/human IL-2 fusion genes
(Figure 5-1). This resulted in the expression vectors 12/chCLL-l/HL/GM-CSF
and 12/chCLL-l/HL/IL-2, encoding the chimeric light chain and a fusion protein
consisting of the chimeric CLL-1 heavy chain with human GM-CSF or human IL-2
140
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Figure 5-1. Schematic diagram depicting the linker containing the N o tl
cloning site between the human yl and human GM-CSF or human IL-2
cDNAs in the chimeric CLL-1 heavy chain/cytokine fusion genes.
GM-CSF
yi
GGT AAA
Gly Lys
Not I IL-2
'GCG GCC GC'A GGA GGT GGT AGC GCA CC '
Ala Ala Ala Gly Gly Gly Ser Ala Pro
linker peptide
Human Cyl
Human GM-CSF
Human IL-2
W ///////////z P r -\
141
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
at its C-terminus. The fusion proteins were expressed from NSO murine myeloma
cells using the glutamine synthetase gene amplification system (Celltech Biologies).
After subjection to vector amplification, the highest chCLL-l/GM-CSF-producing
subclone secreted approximately 26 pg/ml/106 cells/24 hr in static culture. The
highest chCLL-l/IL-2-producing subclone expressed approximately 16 pg/ml/106
cells/24 hr. Upon scale-up, greater than 100 pg/ml of chCLL-1 /GM-CSF were
obtained after purification. When the chCLL-1/EL-2-producing cell line was
grown in a 10 liter bioreactor, approximately 70 pg/ml of fusion protein were
obtained. Both chimeric antibody fusion proteins were properly assembled as
demonstrated by reducing SDS-PAGE; two well-defined bands were resolved for
chCLL-1/GM-CSF at approximately 25 and 66 kDa and for chCLL-1/IL-2 at
approximately 25 and 65 lcDa, corresponding to the molecular weights of the
immunoglobulin light chain and heavy chain plus cytokine (Figure 5-2). Both
fusion proteins appeared as a single peak by HPLC analysis (data not shown).
Immunobiochemical analysis.
The immunoreactivity of purified chCLL-1/GM-CSF and chCLL-1/IL-2
with the target antigen of muLym-2 was assessed by determining the binding to
antigen-bearing ARH-77 myeloma cells. In a radioimmunoassay, increasing
concentrations of chCLL-1/GM-CSF, chCLL-l/IL-2, muLym-2, or an irrelevant
MAb (chLym-1) were evaluated for their ability to inhibit the binding of 1 2 5 I-
labeled muLym-2 to ARH-77 cells (Figure 5-3). Because it binds to a non
overlapping epitope, chLym-1 was unable to compete with 1 2 5 I-labeled muLym-2,
142
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Figure 5-2. Electrophoretic identification of chCLL-l/cytokine antibody
fusion proteins.
Coomassie Blue-stained 4-20% acrylamide gradient tris-glycine reduced gel of
purified chCLL-1 (lane 1), chCLL-1/GM-CSF (lane 2), and chCLL-l/IL-2 (lane
3). Molecular weights are in kD.
143
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Figure 5-3. Competitive binding radioimmunoassay with chCLL-l/GM-CSF
and chCLL-l/IL-2.
Purified antibody fusion proteins were assayed for their ability to inhibit the
binding of 1 2 5 I-labeled muLym-2 to ARH-77 human myeloma cells. muLym-2 and
chLym-1 served as positive and negative controls, respectively.
chCLL-1/GM-CSF
80-
chCLL-1/IL-2
70-
O)
T 3 6 0 “
2 50 -
o
o 4 0 "
M 30-
_c
c
- 2 0 -
10 -
muLym-2
chLym-1
0.6 0.4 0.5 0.3 0 0.1 0.2
C o n c e n t r a t i o n o f M A b (p .g/m l)
144
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
but chCLL-1/GM-CSF and chCLL-l/IL-2 inhibited 1 2 5 I-labeled muLym-2 binding
to ARH-77 cells. These studies confirm that chCLL-1/GM-CSF and
chCLL-1/IL-2 maintain the immunoreactivity of muLym-2.
Avidity binding studies were then conducted in which 1 2 5 I-labeled
chCLL-1/GM-CSF or chCLL-l/EL-2 was incubated with ARH-77 cells and the
bound radioactivity used to calculate the avidity constant Ka by Scatchard analysis
as described in the Materials and Methods. chCLL-1/GM-CSF and chCLL-l/IL-2
had similar binding constants of 3.3 x 108 M"1 and 3.0 x 108 M'1 , respectively. The
binding constant of muLym-2 was determined to be 2.9 x 108 M '1 . These studies
demonstrate that the presence of the cytokines on the C-terminus of the heavy
chain does not affect binding to the antigenic target.
Colony-forming activity of chCLL-l/GM-CSF.
Biologic activity of the GM-CSF moiety was determined by colony assays
using both bone marrow MNC and CD34+ cells. As indicated in Figure 5-4,
chCLL-1/GM-CSF compares favorably with recombinant human GM-CSF in its
ability to stimulate colony formation from the MNC fraction of normal bone
marrow. In addition, the fusion protein is capable of inducing the formation of
colonies from isolated CD34+ progenitor cells (data not shown). No colonies
formed in the presence of chCLL-1.
Bioactivitv of chCLL-1/II ^2.
Biologic activity of the IL-2 moiety was determined by assaying the ability
of chCLL-l/IL-2 to support IL-2-dependent T-cell proliferation. A bioassay with
145
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Figure 5-4. Colony-forming activity of chCLL-l/GM-CSF.
Various concentrations of recombinant human GM-CSF, chCLL-1/GM-CSF, or
chCLL-1 were cultured with 7.5 x 104 bone marrow MNC in triplicate in semi
solid medium for 14-16 days at 37°C until colonies containing more than 30 cells
formed.
30-.
human GM-CSF
chCLL-1/GM-CSF
chCLL-1
Q )
'c
o
o
O
o
C D
f 10-
z
1 0.001 0.01 0.1
n M G M - C S F
146
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
the IL-2-dependent CTLL-2 line was performed in which chCLL-1/IL-2 was
assayed along with chCLL-1 and the IL-2 standard (Figure 5-5). On a molar basis,
chCLL-1/IL-2 had approximately 50% of the activity required to produce 50%
maximum proliferation of the IL-2-dependent cell line compared to the
recombinant IL-2 standard. This corresponds to a specific activity of
approximately 8 x 105 IU/mg of fusion protein. At higher concentrations (e.g., >1
nM), maximum proliferation was achieved as evidenced by the plateau of the
incorporation of 3 H-thymidine into DNA. As expected, chCLL-1 had no activity.
Cytotoxicity studies.
chCLL-1/GM-CSF, chCLL-1/IL-2, chCLL-1, and muLym-2 were
evaluated for their ability to mediate ADCC by colorimetric lactate dehydrogenase
release assays against ARH-77 myeloma target cells. At a concentration of 1
Mg/ml, chCLL-1 mediated 65% cytotoxicity, while muLym-2 mediated only 10%
specific lysis of tumor cells by human MNC at an effector:target cell ratio of 50:1
(Figure 5-6A). At the same effector:target cell ratio, both fusion proteins
mediated approximately 100% specific lysis of target cells (Figures 5-6B and
5-6C). Similar enhancement of specific lysis mediated by both fusion proteins over
chCLL-1 and by chCLL-1 over muLym-2 can be seen at lower effector:target cell
ratios. The isotype-matched irrelevant control (chTNT-1) mediated <5% specific
lysis at all effector:target cell ratios (data not shown). Neither the fusion proteins
nor antibodies mediated specific lysis of target cells by human PMN at an
effector.target cell ratio of 50:1 (<5%, data not shown).
147
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Figure 5-5. Biologic activity of chCLL-l/IL-2 as determined by the ability to
support the proliferation of CTLL-2 cells.
Serial dilutions of chCLL-1/IL-2, chCLL-1, or recombinant IL-2 standard were
incubated with 2 x 104 CTLL-2 cells in triplicate for 20 hr at 37°C. The cells were
pulsed with 0.5 pCi of 3 H-thymidine for 6 hr, and the samples were harvested and
counted.
Human IL-2
200000 -
chCLL-1/IL-2
chCLL-1
160000-
120000 -
2
Q _
O
80000-
40000-
10 1 0.1 0.001 0.01
nM IL-2
148
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Figure 5-6. ADCC activity of chCLL-1 and antibody fusion proteins. MAb or
fusion protein (1 |Ug/ml) was cultured with ARH-77 human myeloma target cells
and human mononuclear effector cells at varying eflfector:target cell ratios as
indicated. (A) Comparison between ADCC mediated by muLym-2 and chCLL-1.
(B) Comparison between ADCC mediated by chCLL-1 and chCLL-1/IL-2. (C)
Comparison between ADCC mediated by chCLL-1 and chCLL-1/GM-CSF.
Specific lysis with the isotype-matched negative control (chTNT-1) was <5% (data
not shown). Expressed as mean ± standard deviation. At each effector:target cell
ratio, the difference between pairs is significant (P < 0.001).
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
A
8 0 -
w
0)
> *
6 0 -
_ l
o
o 4 0 -
0
Q.
C O
^ 0
2 0 -
o -
B
100-1
o
if —
o
0
Q .
C O
Figure 5-6.
E3 muLym-2
■ chCLL-1
12.5 25 50
Effector:Target Cell Ratio
a chCLL-1
S3 chCLL-1/IL-2
12.5 25 50
Effector:Target Cell Ratio
125-1
■ % 100
chCLL-1
chCLL-1/GM-CSF
12.5 25 50
Effector.Target Cell Ratio
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
In vivo pharmacokinetic and tumor targeting studies.
Whole body clearance studies were performed to establish differences in
pharmacokinetics among chCLL-1 /GM-CSF, chCLL-1/IL-2, and chCLL-1. Mice
were injected with I2 5 I-labeled fusion proteins or chimeric antibody, and the whole
body activity at injection and selected times thereafter was measured with a
microdosimeter. chCLL-1/IL-2 cleared rapidly with a whole body half-life of 11
hours (Figure 5-7). chCLL-1/GM-CSF had a half-life of approximately 30 hours,
while chCLL-1 cleared slowly, with a half-life of 100 hours.
The difference among clearance rates was evident when tumor and normal
organ biodistribution was examined in ARH-77 myeloma-bearing nude mice. As
indicated in Figure 5-8 A, tumor uptake of chCLL-1 after 72 hours was 2.54 ±
0.14% injected dose/gram, while tumor uptake of chCLL-l/IL-2 and
chCLL-1/GM-CSF was significantly lower (1.14 ± 0.08 and 1.07 ± 0.10,
respectively; P < 0.001). However, uptake of the fusion proteins in normal tissues
was considerably lower than chCLL-1, which can be attributed to the rapid
clearance of the fusion proteins. This low normal tissue uptake produces higher
tumor/organ ratios, as can be seen in Figure 5-8B.
Imaging studies were also performed to examine tumor targeting with the
fusion proteins. Tumor-bearing nude mice were injected with 1 3 1 I-labeled chimeric
antibody or fusion protein and imaged at one, three, and five days post-injection.
In Figure 5-9 the difference in clearance is manifested by the unambiguous
localization of the fusion proteins to the tumor after 24 hours, while the mouse
151
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Figure 5-7. Whole body pharmacokinetic clearance of 1 2 5 I-labeled chCLL-1,
chCLL-l/GM-CSF, and chCLL-l/IL-2 in non tumor-bearing mice.
Activity at injection and at selected times thereafter was measured with a
microdosimeter. The data were analyzed and half-lives were determined using the
RSTRIP pharmacokinetic program (MicroMath, Inc., Salt Lake City, UT).
O)
c
'c
‘cC
E
CD
cc
C D
C O
O
o
chCLL-1 o
< d
’ c
chCLL-1/GM-CSF
chCLL-1/IL-2
0.01 1 -------------------------------------------1 ------------------------------------------- 1 ------------------------------------------ 1 ------------------------------------------ 1 ------------------------------------------- 1
0 10 20 30 40 50
T i m e ( h o u r s )
152
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Figure 5-8. Tissue biodistribution and tumor uptake of chCLL-1,
chCLL-1/GM-CSF, and chCLL-l/IL-2 at 72 hr post-injection in ARH-77 human
myeloma tumor-bearing nude mice. (A) Tissue uptake measured by percent
injected dose of 1 2 5 I-labeled MAb or fusion protein per gram of tissue expressed as
mean ± SD. (B) Tumor/organ ratios (cpm per gram tumor/cpm per gram organ)
expressed as mean ± SD.
153
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Figure 5-8.
3 1
E
2.5-
C O
CD
C D
2 -
C O
O
n
T3
1.5-
C D
O
C D
1 -
C
0.5-
0 -
chCLL-1/IL-2 chCLL-1 5 3 chCLL-1/GM-CSF
B
c o
D C
c
C O
CD
1 3
I -
154
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Figure 5-9. Imaging of ARH-77 myeloma tumor-bearing nude mice injected with
1 3 ^-labeled chCLL-1 (panel A), chCLL-1 /GM-CSF (panel B), or chCLL-l/IL-2
(panel C). Mice were imaged in a prone position at the indicated times post
injection with a Spectrum 91 camera equipped with a pinhole collimator (Raytheon
Medical Systems, Melrose Park, IL) set to record 10,000 counts using the Nuclear
MAX Plus image analysis software package (MEDX Inc., Wood Dale, IL).
155
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Figure 5-9. Imaging of ARH-77 human myeloma tumor-bearing nude mice
injected with 1 3 1 I-labeIed chCLL-1, chCLL-l/GM-CSF, or chCLL-l/IL-2.
A
1 day 3 days 5 days
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
injected with chCLL-1 demonstrated high signal throughout the body at 1 and 3
days post-injection. Nevertheless, by day 5 localization of chCLL-1 to the tumor
site is clear. In mice that received chCLL-1/GM-CSF or chCLL-l/IL-2, by day 5
no signal remained except in the tumor. These data demonstrate that
chCLL-1/GM-CSF and chCLL-1/IL-2 effectively localize to the ARH-77 human
myeloma xenograft.
DISCUSSION
In this study, recombinant fusion proteins containing the chimeric MAb
CLL-1 and human GM-CSF or IL-2 have been generated which retain both tumor
targeting and cytokine functions. The GS gene amplification system was used for
high level expression of the fusion proteins from myeloma cells so that large-scale
production can yield sufficient products to enable clinical studies to be undertaken.
With this expression system, gram quantities of the fusion proteins can be
produced in batch cultures. Biochemical analysis demonstrates the presence of
two GM-CSF or IL-2 molecules per chimeric antibody molecule (Figure 5-2).
GM-CSF or IL-2 is located at the C-terminus of the heavy chain following a short
linker peptide to facilitate proper folding of the cytokine. The immunoreactivity of
the fusion proteins was retained, as evidenced by competition with 1 2 5 I-labeled
muLym-2 for binding to antigen-bearing ARH-77 myeloma cells (Figure 5-3).
Moreover, the binding affinity of the fusion proteins was unaffected by the
presence of the cytokine molecules. In addition, the biological activity of the
cytokines within the fusion proteins was confirmed by appropriate assays;
157
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
chCLL-1/GM-CSF possesses colony-forming activity (Figure 5-4), while
chCLL-l/IL-2 is able to support the proliferation of an IL-2-dependent T-cell line
(Figure 5-5).
Cytotoxicity studies clearly demonstrate the improved effector functions of
chCLL-1 over muLym-2 and of both fusion proteins over chCLL-1 (Figure 5-6).
Human IgGi constant regions were selected for construction of the chimeric MAb
based upon earlier observations of the enhanced antitumor cytotoxic activity of
chimeric IgGi over chimeric MAbs of other isotypes (37). At each effectortarget
cell ratio, chCLL-l/IL-2 mediates higher specific tumor lysis by human MNC than
the chimeric MAb alone (Figure 5-6B). This is in agreement with previous reports
of augmented MNC ADCC either by free recombinant IL-2 (4-7, 9) or by a
recombinant MAb/IL-2 fusion protein (38, 39). chCLL-l/GM-CSF also mediates
higher specific tumor lysis by human MNC than chCLL-1 (Figure 5-6C).
Ragnhammar et al. have previously shown that short-term pre-incubation of MNC
with GM-CSF enhances ADCC against colorectal carcinoma and lymphoma cell
lines (40). Other investigators have observed no effect of GM-CSF on MNC
ADCC against malignant B-cell lines (9). There is evidence that GM-CSF and
IL-2 can act synergistically in vitro. In this regard, GM-CSF has been shown to
augment the induction of LAK activity by IL-2 against a human Burkitt’s
lymphoma cell line through monocytes (41). In addition, GM-CSF and IL-2
enhance ADCC against a colorectal carcinoma cell line (42), leading the authors to
suggest combination therapy consisting of low dose EL-2, GM-CSF, and MAb.
158
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
No specific lysis of target cells by PMN in ADCC mediated by chCLL-1 or
chCLL-1 /GM-CSF was observed in our studies. It has recently been demonstrated
that antibodies recognizing HLA class II mediate lysis of malignant B-cell lines by
PMN, while antibodies to other B-cell antigens fail to mediate such ADCC (36).
In these studies, Lym-1 and ID 10, both of which recognize HLA class II related
epitopes, did not mediate ADCC by PMN from healthy donors, although both
MAbs mediated ADCC with PMN from patients treated with granulocyte colony-
stimulating factor. Similar results have been observed with Lym-1 in combination
with GM-CSF (9). GM-CSF has also been shown to enhance PMN ADCC against
solid tumor cell line targets, including neuroblastoma, melanoma, and colorectal
carcinoma (40, 43, 44). It is as yet unclear why MAbs directed against particular
antigens on malignant B-cells possess the ability to mediate PMN ADCC, while
those with specificity for other B-cell antigens do not. Based upon in vitro ADCC
data and clinical experience with a murine MAb, a clinical trial using the
combination of the MAb and GM-CSF for the treatment of metastatic colorectal
carcinoma was initiated (45). In this study, complete remissions were achieved in
some patients, providing clinical evidence for the benefit of combination therapy.
In the current study, pharmacokinetic analysis in BALB/c mice
demonstrated the marked difference in whole body clearance among chCLL-1 and
the fusion proteins (Figure 5-7). We have recently shown that a fusion protein
consisting of chLym-1 and IL-2 has a half-life of 11 hours (39), which is identical
to that observed for chCLL-l/IL-2. chCLL-1/GM-CSF has a whole body half-life
159
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
intermediate between the chimeric MAb and the IL-2-containing fusion protein.
The relatively longer half-life of a GM-CSF-containing antibody fusion protein
compared to those containing other cytokines has previously been described for
the anti-ganglioside MAb chl4.18 (46). It has yet to be demonstrated whether
similar differences in clearance between chimeric MAbs and cytokine-containing
antibody fusion proteins exist in patients. Biodistribution and imaging studies in
human myeloma-bearing nude mice illustrate the tumor targeting abilities of
chCLL-l/IL-2 and chCLL-l/GM-CSF (Figures 5-8 and 5-9). Despite their rapid
clearance profiles, they retain the capacity to localize to tumor xenografts
effectively. In fact, such rapid clearance might be beneficial in clinical applications,
wherein potentially injurious cytokine exposure to normal tissues would be
minimized. This is particularly true for IL-2, which induces a capillary leak
syndrome when administered systemically in high doses (47-50).
There is considerable evidence that high local concentrations of cytokines
within tumors can stimulate antitumor immunity and rejection in animal models.
The majority of such efforts have employed gene transfection to engineer tumor
cell lines to secrete cytokines (10-17). Although these studies demonstrate the
utility of delivering cytokines directly to tumors, they are presently impractical in
the clinical setting. A more feasible approach to generating high local
concentrations of cytokines within tumors is targeting cytokines via antibody
fusion proteins (18, 19). This approach combines the cytotoxicity that MAbs can
mediate against tumor targets with the host antitumor immune response which is
160
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
stimulated by high local concentrations of cytokines. Several groups have taken
such an approach to delivering cytokines by engineering fusion proteins consisting
of IL-2 and antibody fragments including F(ab’) (19) and single-chain antibodies
(51-53). Intact MAbs may have greater effectiveness than fragments, however,
because they can mediate ADCC. An alternative approach that also employs
antibody-cytokine fusion proteins is engineering a cancer vaccine using idiotype-
cytokine fusion proteins including IL-2 and GM-CSF (54, 55). In a murine B-cell
lymphoma model such fusion proteins have been shown to induce antitumor
responses. The efficacy of antibody-targeted IL-2 has been elegantly demonstrated
in both a SCID mouse human neuroblastoma model (20, 56) and a syngeneic
murine melanoma model (57, 58). In these studies, the effector cell population
responsible for antitumor responses was identified as CD8+ T-cells. As the fusion
protein retained a therapeutic effect in NK cell-deficient mice, the authors
concluded that tumor eradication was not dependent upon NK cells (59). Whether
such a mechanism of antitumor cytotoxicity holds for other antibody-cytokine
fusion proteins in the treatment of other malignancies remains to be determined.
The chimeric antibody fusion proteins described in the current study have
the potential for producing tumor killing by a number of mechanisms. The parent
muLym-2 is reactive with a majority of human B-cell lymphomas, chronic
lymphocytic leukemias, and multiple myeloma (21), suggesting that this MAb and
derivatives may be of use in treating a variety of B-cell malignancies. Both
muLym-2 and chCLL-1 have a direct inhibitory effect on human lymphoma cell
161
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
lines and can improve the survival of SCID mice injected with human lymphoma
cells (Funakoshi et a l, in preparation). Furthermore, both chCLL-1/GM-CSF and
chCLL-l/IL-2 mediate enhanced ADCC against a human myeloma cell line.
Finally, the combination of GM-CSF and IL-2 targeted to the tumor site may be
sufficient to bring about the induction of effective cytotoxic T-cell responses. As
the antigen recognized by chCLL-1 is not present in animal lymphomas and hence
a syngeneic model is unavailable in which to evaluate immune responses induced
by chCLL-l/GM-CSF and chCLL-l/IL-2, clinical trials will be undertaken to test
the immunotherapeutic efficacy of these novel reagents against human B-cell
malignancies.
REFERENCES
1 . Maloney, D. G., Liles, T. M., Czerwinski, D. K., Waldichuk, C.,
Rosenberg, J., Grillo-Lopez, A., and Levy, R. Phase I clinical trial using
escalating single-dose infusion of chimeric anti-CD20 monoclonal antibody
(IDEC-C2B8) in patients with recurrent B-cell lymphoma. Blood, 84:
2457-2466, 1994.
2. Dillman, R. O. Antibodies as cytotoxic therapy. J. Clin. Oncol., 12: 1497-
1515, 1994.
3. Wilder, R. B., DeNardo, G. L., and DeNardo, S. J. Radioimmunotherapy:
recent results and future directions. J. Clin. Oncol., 14: 1383-1400, 1996.
4. Bianchi, A. C., Heslop, H. E., Veys, P., Macey, M., Holland, M., Prentice,
H. G., and Brenner, M. K. Enhancement of monoclonal antibody
dependent cell mediated cytotoxicity by IL2 and GM-CSF. Br. J.
Haematol., 73: 468-474, 1989.
162
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
5. Vuist, W. M. J., Buitenen, F. v., de Rie, M. A., Hekman, A., Rumke, P.,
and Melief, C. J. M. Potentiation by interleukin 2 of Burkitt's lymphoma
therapy with anti-pan B (anti-CD 19) monoclonal antibodies in a mouse
xenotransplantation model. Cancer Res., 49: 3783-3788, 1989.
6. Gill, I., Agah, R., Hu, E., and Mazumder, A. Synergistic antitumor effects
of interleukin 2 and the monoclonal Lym-1 against human Burkitt
lymphoma cells in vitro and in vivo. Cancer Res., 49: 5377-5379, 1989.
7. Biddle, W. C., Pancook, J., Goldrosen, M., Han, T., Foon, K. A., and
Vaickus, L. Antibody-dependent, cell-mediated cytotoxicity by an anti
class II murine monoclonal antibody: effects of recombinant interleukin 2
on human effector cell lysis of human B-cell tumors. Cancer Res., 50:
2991-2996, 1990.
8. Hooijberg, E., Sein, J. J., van den Berk, P. C. M., Hart, A. A. M., van der
Valk, M. A., Kast, W. M., Melief, C. J. M., and Hekman, A. Eradication of
large human B cell tumors in nude mice with unconjugated CD20
monoclonal antibodies and interleukin 2. Cancer Res., 55: 2627-2634,
1995.
9. Ottonello, L., Morone, P., Dapino, P., and Dallegri, F. Monoclonal Lym-1
antibody-dependent lysis of B-lymphoblastoid tumor targets by human
complement and cytokine-exposed mononuclear and neutrophilic
polymorphonuclear leukocytes. Blood, 87: 5171-5178, 1996.
10. Fearon, E. R., Pardoll, D. M., Itaya, T., Golumbek, P., Levitsky, H. I.,
Simons, J. W., Karasuyama, H., Vogelstein, B., and Frost, P. Interleukin-2
production by tumor cells bypasses T helper function in the generation of
an antitumor response. Cell, 60: 397-403, 1990.
11. Tsai, S.-C. J., Gansbacher, B., Tait, L., Miller, F. R., and Heppner, G. H.
Induction of antitumor immunity by interleukin-2 gene-transduced mouse
mammary tumor cells versus transduced mammary stromal fibroblasts. J.
Natl. Cancer Inst., 85: 546-553, 1993.
12. Porgador, A., Tzehoval, E., Vadai, E., Feldman, M., and Eisenbach, L.
Immunotherapy via gene therapy: comparison of the effects of tumor cells
transduced with the interleukin-2, interleukin-6, or interferon-y genes. J.
Immunother., 14: 191-201, 1993.
13. Cignetti, A., Guarini, A., Carbone, A., Forni, M., Cronin, K., Fomi, G.,
Gansbacher, B., and Foa, R. Transduction of the IL2 gene into human
acute leukemia cells: induction of tumor rejection without modifying cell
proliferation and IL2 receptor expression. J. Natl. Cancer Inst., 86: 785-
791, 1994.
163
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
14. Visseren, M. J. W., Koot, M., van der Voort, E. I. H., Gravestein, L. A.,
Schoenmakers, H. J., Kast, W. M., Zijlstra, M., and Melief, C. J. M.
Production of interleukin-2 by EL4 tumor cells induces natural killer cell-
and T-cell-mediated immunity. J. Immunother., 15: 119-128, 1994.
15. Katsanis, E., Orchard, P. J., Bausero, M. A., Gorden, K. B., Mclvor, R. S.,
and Blazar, B. R. Interleukin-2 gene transfer into murine neuroblastoma
decreases tumorigenicity and enhances systemic immunity causing
regression of preestablished retroperitoneal tumors. J. Immunother., 15:
81-90, 1994.
16. Allione, A., Consalvo, M., Nanni, P., Lollini, P. L., Cavallo, F., Giovarelli,
M., Fomi, M., Gulino, A., Colombo, M. P., Dellabona, P., Hock, H.,
Blankenstein, T., Rosenthal, F. M., Gansbacher, B., Bosco, M. C., Musso,
T., Gusella, L., and Fomi, G. Immunizing and curative potential of
replicating and nonreplicating murine mammary adenocarcinoma cells
engineered with interleukin (IL)-2, IL-4, IL-7, IL-10, tumor necrosis factor
a, granulocyte-macrophage colony-stimulating factor, and y-interferon
gene or admixed with conventional adjuvants. Cancer Res., 54: 6022-6026,
1994.
17. Gunji, Y., Tagawa, M., Matsubara, H., Takenaga, K., Shimada, H.,
Kondo, F., Suzuki, T., Nakajima, K., Aoki, T., Asano, T., Ochiai, T.,
Isono, K., Kageyama, H., Nakamura, Y., and Sakiyama, S. Murine colon
carcinoma cells engineered to produce human interleukin-2 induce tumor-
specific anti-tumor response. Int. J. Cancer, 66: 135-139, 1996.
18. Gillies, S. D., Reilly, E. B., Lo, K.-M., and Reisfeld, R. A. Antibody-
targeted interleukin 2 stimulates T-cell killing of autologous tumor cells.
Proc. Natl. Acad. Sci. USA, 89: 1428-1432, 1992.
19. Fell, H. P., Gayle, M. A., Grosmaire, L., and Ledbetter, J. A. Genetic
construction and characterization of a fusion protein consisting of a
chimeric F(ab') with specificity for carcinomas and human EL-2. J.
Immunol., 146: 2446-2452, 1991.
20. Sabzevari, H., Gillies, S. D., Mueller, B. M., Pancook, J. D., and Reisfeld,
R. A. A recombinant antibody-interleukin 2 fusion protein suppresses
growth of hepatic human neuroblastoma metastases in severe combined
immunodeficiency mice. Proc. Natl. Acad. Sci. USA, 91: 9626-9630,
1994.
164
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
21. Epstein, A. L., Marder, R. J., Winter, J. N., Stathopoulos, E., Chen, F.-M.,
Parker, J. W., and Taylor, C. R. Two new monoclonal antibodies, Lym-1
and Lym-2, reactive with human B-lymphocytes and derived tumors, with
immunodiagnostic and immunotherapeutic potential. Cancer Res., 47: 830-
840, 1987.
22. Lee, F., Yokota, T., Otsuka, T., Gemmell, L., Larson, N., Luh, J., Arai, K.,
and Rennick, D. Isolation of cDNA for a human granulocyte-macrophage
colony-stimulating factor by functional expression in mammalian cells.
Proc. Natl. Acad. Sci. USA, 82: 4360-4364, 1985.
23. Cullen, B. R. Zhmy-activation of human immunodeficiency virus occurs via
a bimodal mechanism. Cell, 46: 973-982, 1986.
24. Hu, P., Glasky, M. S., Yun, A., Alauddin, M. M., Homick, J. L., Khawli,
L. A., and Epstein, A. L. A human-mouse chimeric Lym-1 monoclonal
antibody with specificity for human lymphomas expressed in a baculovirus
system. Hum. Antibod. Hybridomas, 6: 57-67, 1995.
25. Epstein, A. L., Chen, F.-M., and Taylor, C. R. A novel method for the
detection of necrotic lesions in human cancers. Cancer Res., 48: 5842-
5848, 1988.
26. Burk, K. H., Drewinko, B., Trujillo, J. M., and Aheam, M. J.
Establishment of a human plasma cell line in vitro. Cancer Res., 38: 2508-
2513, 1978.
27. Chomczynski, P. and Sacchi, N. Single-step method of RNA isolation by
acid guanidinium thiocyanate-phenol-chloroform extraction. Anal.
Biochem., 162: 156-159, 1987.
28. Jones, S. T. and Bendig, M. M. Rapid PCR-cloning of full-length mouse
immunoglobulin variable regions. Bio/Technology, 9: 88-89, 1991.
29. Bebbington, C. R., Renner, G., Thomson, S., King, D., Abrams, D., and
Yarranton, G. T. High-level expression of a recombinant antibody from
myeloma cells using a glutamine synthetase gene as an amplifiable
selectable marker. Bio/Technology, 10: 169-175, 1992.
30. Kozak, M. At least six nucleotides preceding the AUG initiator codon
enhance translation in mammalian cells. J. Mol. Biol., 196: 947-950, 1987.
31. Laemmli, U. K. Cleavage of structural proteins during the assembly of the
head of bacteriophage T4. Nature, 227: 680-685, 1970.
165
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
32. Epstein, A. L., Marder, R. J., Winter, J. N., and Fox, R. I. Two new
monoclonal antibodies (LN-1, LN-2) reactive in B5 formalin-fixed,
paraffin-embedded tissues with follicular center and mantle zone human B
lymphocytes and derived tumors. J. Immunol., 133: 1028-1036, 1984.
33. Frankel, M. E. and Gerhard, W. The rapid determination of binding
constants for antiviral antibodies by a radioimmunoassay: an analysis of the
interaction between hybridoma proteins and influenza virus. Mol.
Immunol., 16: 101-106, 1979.
34. Anderson, P. M., Rogosheske, J. R., Ramsay, N. K. C., and Weisdorf, D.
J. Biological activity of recombinant interleukin-2 in intravenous
admixtures containing antibiotic, morphine sulfate, or total parenteral
nutrient solution. Am. J. Hosp. Pharm., 49: 608-612, 1992.
35. Korzeniewski, C. and Callewaert, D. M. An enzyme-release assay for
natural cytotoxicity. J. Immunol. Methods, 64: 313-320, 1983.
36. Elsasser, D., Valerius, T., Repp, R., Weiner, G. J., Deo, Y., Kalden, J. R.,
van de Winkel, J. G. J., Stevenson, G. T., Glennie, M. J., and Gramatzki,
M. HLA class II as potential target antigen on malignant B cells for therapy
with bispecific antibodies in combination with granulocyte colony-
stimulating factor. Blood, 87: 3803-3812, 1996.
37. Steplewski, Z., Sun, L. K., Shearman, C. W., Ghrayeb, J., Daddona, P.,
and Koprowski, H. Biological activity of human-mouse IgGl, IgG2, IgG3,
and IgG4 chimeric monoclonal antibodies with antitumor specificity. Proc.
Natl. Acad. Sci. USA, 85: 4852-4856, 1988.
38. Naramura, M., Gillies, S. D., Mendelsohn, J., Reisfeld, R. A., and Mueller,
B. M. Mechanisms of cellular cytotoxicity mediated by a recombinant
antibody-IL2 fusion protein against human melanoma cells. Immunol. Lett.,
39: 91-99, 1994.
39. Hu, P., Homick, J. L., Glasky, M. S., Yun, A., Milkie, M. N., Khawli, L.
A., Anderson, P. M., and Epstein, A. L. A chimeric Lym-1/interleukin 2
fusion protein for increasing tumor vascular permeability and enhancing
antibody uptake. Cancer Res., 56: 4998-5004, 1996.
40. Ragnhammar, P., Frodin, J.-E., Trotta, P. P., and Mellstedt, H.
Cytotoxicity of white blood cells activated by granulocyte-colony-
stimulating factor, granulocyte/macrophage-colony-stimulating factor and
macrophage-colony-stimulating factor against tumor cells in the presence
of various monoclonal antibodies. Cancer Immunol. Immunother., 39: 254-
262, 1994.
166
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
41. Singh, S. M., Sone, S., Inamura, N., and Ogura, T. Up-regulation by
granulocyte-macrophage colony-stimulating factor (GM-CSF) of induction
of lymphokine (IL-2)-activated killer (LAK) cells by human blood
monocytes. Int. J. Cancer, 44: 170-176, 1989.
42. Masucci, G., Ragnhammar, P., Wersall, P., and Mellstedt, H. Granulocyte-
monocyte colony-stimulating-factor augments the interleukin-2-induced
cytotoxic activity of human lymphocytes in the absence and presence of
mouse or chimeric monoclonal antibodies (mAb 17-1A). Cancer Immunol.
Immunother., 31: 231-235, 1990.
43. Baldwin, G. C., Chung, G. Y., Kaslander, C., Esmail, T., Reisfeld, R. A.,
and Golde, D. W. Colony-stimulating factor enhancement of myeloid
effector cell cytotoxicity towards neuroectodermal tumour cells. Br. J.
Haematol., 83: 545-553, 1993.
44. Kushner, B. H. and Cheung, N.-K. V. GM-CSF enhances 3F8 monoclonal
antibody-dependent cellular cytotoxicity against human melanoma and
neuroblastoma. Blood, 73: 1936-1941, 1989.
45. Ragnhammar, P., Fagerberg, J., Frodin, J.-E., Hjelm, A.-L., Lindemalm,
C., Magnusson, I., Masucci, G., and Mellstedt, H. Effect of monoclonal
antibody 17-1A and GM-CSF in patients with advanced colorectal
carcinoma - long-lasting, complete remissions can be induced. Int. J.
Cancer, 53: 751-758, 1993.
46. Gillies, S. D., Young, D., Lo, K.-M., and Roberts, S. Biological activity
and in vivo clearance of antitumor antibody/cytokine fusion proteins.
Bioconjugate Chem., 4: 230-235, 1993.
47. Rosenstein, M., Ettinghausen, S. E., and Rosenberg, S. A. Extravasation of
intravascular fluid mediated by the systemic administration of recombinant
interleukin 2. Immunology, 137: 1735-1742, 1986.
48. Damle, N. K. and Doyle, L. V. IL-2 activated human killer lymphocytes
but not their secreted products mediate increase in albumin flux across
cultured endothelial monolayers. J. Immunol., 142: 2660-2669, 1989.
49. Ohkubo, C., Bigos, D., and Jain, R. K. Interleukin 2-induced leukocyte
adhesion to the normal and tumor microvasculature endothelium in vivo
and its inhibition by dextran sulfate: implications for vascular leak
syndrome. Cancer Res., 51: 1561-1563, 1991.
167
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
50. Edwards, M. J., Miller, F. N., Sims, D. E., Abney, D. L., Schuschke, D.
A., and Corey, T. S. Interleukin 2 acutely induces platelet and neutrophil-
endothelial adherence and macromolecular leakage. Cancer Res., 52: 3425-
3431, 1992.
51. Savage, P., So, A., Spooner, R. A., and Epenetos, A. A. A recombinant
single chain antibody interleukin-2 fusion protein. Br. J. Cancer, 67: 304-
310, 1993.
52. Xiang, J., Liu, E., Moyana, T., and Qi, Y. Single-chain antibody variable
region-targeted interleukin-2 stimulates T cell killing of human colorectal
carcinoma cells. Immunol. Cell Biol., 72: 275-285, 1994.
53. Bei, R., Schlom, J., and Kashmiri, S. V. S. Baculovirus expression of a
functional single-chain immunoglobulin and its IL-2 fusion protein. J.
Immunol. Methods, 186: 245-255, 1995.
54. Tao, M.-H. and Levy, R. Idiotype/granulocyte-macrophage colony-
stimulating factor fusion protein as a vaccine for B-cell lymphoma. Nature,
362: 755-758, 1993.
55. Chen, T. T., Tao, M.-H., and Levy, R. Idiotype-cytokine fusion proteins as
cancer vaccines: relative efficacy of IL-2, IL-4, and granulocyte-
macrophage colony-stimulating factor. J. Immunol., 153: 4775-4787,
1994.
56. Pancook, J. D., Becker, J. C., Gillies, S. D., and Reisfeld, R. A.
Eradication of established hepatic human neuroblastoma metastases in mice
with severe combined immunodeficiency by antibody-targeted interleukin-
2. Cancer Immunol. Immunother., 42: 88-92, 1996.
57. Becker, J. C., Varki, N., Gillies, S. D., Furukawa, K., and Reisfeld, R. A.
An antibody-interleukin 2 fusion protein overcomes tumor heterogeneity by
induction of a cellular immune response. Proc. Natl. Acad. Sci. USA, 93:
7826-7831, 1996.
58. Becker, J. C., Varki, N., Gillies, S. D., Furukawa, K., and Reisfeld, R. A.
Long-lived and transferable tumor immunity in mice following targeted
interleukin 2 therapy. J. Clin. Inv., 98: 2801-2804, 1996.
59. Becker, J. C., Pancook, J. D., Gillies, S. D., Furukawa, K., and Reisfeld, R.
A. T cell-mediated eradication of murine metastatic melanoma induced by
targeted interleukin 2 therapy. J. Exp. Med., 183: 2361-2366, 1996.
168
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 6 . Summary and Future Directions
The promise of antibody-based cancer therapies has for the most part
remained unfulfilled. The challenges to the efficacy of such treatments that must
be faced before substantial clinical successes can be achieved include the
immunogenicity of murine MAbs, antigenic heterogeneity, antigenic modulation,
antigenic shedding, and low tumor uptake. In the preceding chapters, approaches
for potential solutions to these problems have been presented. A new murine MAb
designated TNT-3 with specificity for single-stranded DNA was described, which
may have broad applications for tumor targeting to the majority of human
malignancies, since it recognizes a universal nuclear antigen exposed in the
degenerating and necrotic cells within all solid tumors. A recombinant human-
mouse derivative, whose immunogenic murine constant regions were replaced with
human sequences, has been produced, which may prove to be less immunogenic
than the parent MAb in patients. A chemical modification of chTNT-3 involving
biotinylation was presented that expedites clearance from tumor-bearing mice,
reducing non-specific binding to normal tissues without compromising tumor
delivery. Such chemical modification may improve the pharmacokinetics of other
MAbs with clinical potential for cancer treatment. In order to test the clinical
efficacy of radiolabeled chTNT-3 /B for the radioimmunotherapy of various solid
tumors, this reagent has entered patient trials at the present time.
169
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Physiological barriers to the delivery of MAbs to solid tumors are a major
impediment to successful tumor targeting. A chTNT-3/IL-2 fusion protein was
presented as a universal pretreatment for enhancing the delivery of therapeutic
molecules to solid tumors. Pretreatment with the fusion protein was shown to
increase specific tumor accretion of various radiolabeled MAbs in different solid
tumor models in nude mice without affecting normal tissues. Moreover, the
specific tumor uptake of a representative chemotherapeutic agent (IUdR) was also
demonstrated to increase following pretreatment with chTNT-3/IL-2. These data
suggest that such a strategy may have broad applications to cancer therapy and
may increase the therapeutic index of both current chemotherapeutic regimens and
newly developed recombinant MAbs and other molecular approaches to cancer
treatment. It will be necessary for the timing and dose of chTNT-3/IL-2
pretreatment to be evaluated in patients in order to optimize the enhanced tumor
uptake of therapeutic molecules in clinical trials. Furthermore, chTNT-3/IL-2 may
be useful for the immunotherapy of human cancers such as melanoma and renal
carcinoma that have been shown to respond to IL-2, since the fusion protein is
capable of concentrating EL-2 at the tumor site. Hence, the targeted delivery of
EL-2 may decrease the toxicity of systemic therapy with EL-2 while increasing the
dose of cytokine delivered to tumor sites.
Finally, fusion proteins w ere described consisting of a chimeric MAb
directed against a cell-surface antigen expressed on the majority of human B-cell
malignancies and the cytokines GM-CSF and EL-2. Although radioimmunotherapy
170
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
of hematologic malignancies has shown considerable success in clinical trials, the
dose-limiting myelosuppression induced by such treatments argues for the
development of complementary therapies that produce tumor killing while sparing
the bone marrow. The antibody/cytokine fusion proteins described herein
demonstrate enhanced effector functions against human myeloma cells while
maintaining the tumor-targeting abilities of the parent MAb. It remains to be seen
whether these products will effect tumor killing in vivo. Since the antigen
recognized by chCLL-1 is not present in animal tumors and hence a syngeneic
model is unavailable in which to evaluate immune responses induced by
chCLL-1/GM-CSF and chCLL-l/IL-2, clinical trials will be undertaken to examine
the immunotherapeutic potential of these novel reagents against human B-cell
malignancies.
The experiments presented in this dissertation provide preliminary evidence
for the clinical potential of recombinant antibodies and antibody/cytokine fusion
proteins in the treatment of human cancers. It will be necessary for clinical studies
to be developed in order to determine whether these strategies will have
therapeutic efficacy. The goal of this research therefore is to provide the clinician
with new tools which can enhance the effectiveness of current cancer therapies.
171
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.

Linked assets

University of Southern California Dissertations and Theses

Conceptually similar

PDF

B7.1 fusion proteins for cancer immunotherapy

PDF

Antibody-cytokine/chemokine fusion proteins in the immunotherapy of solid tumors

PDF

Imaging and prodrug -activating derivatives of chTNT-3 (tumor necrosis therapy) monoclonal antibody

PDF

Breast cancer susceptibility gene 1: A role in transcriptional regulation

PDF

Cytokine regulation of retinal pigment epithelial cell function and behavior

PDF

Conjugation of CpG oligodeoxynucleotides to tumor‐targeting antibodies for immunotherapy of solid tumors

PDF

Optimization of genetically engineered monoclonal antibody and antibody /cytokine fusion proteins for the detection and immunotherapy of solid malignancies

PDF

Expression and functional studies of the Notch signaling pathway in feather development

PDF

Different roles of p160 coregulators in myogenesis

PDF

Characterization of the EWS -FLI1 fusion protein in the tumorigenesis of Ewing's family of tumors

PDF

Investigation of the role of epigenetic modification of DNA and chromatin in aberrant gene silencing in cancer cells

PDF

An E2F-independent mechanism in transcriptional control of the hamster histone H3.2 gene expression

PDF

A transgenic mouse model for small cell lung cancer

PDF

Expression of the RGR opsin and its function in the photic visual cycle

PDF

Genetic alterations in nuclear receptor coactivators in breast cancer

PDF

Human myeloid-derived suppressor cells in cancer: Induction, functional characterization, and therapy

PDF

Dual functions of Vav in Ras-related small GTPases signaling regulation

PDF

An intervention and program evaluation to determine the effectiveness of public health reforms on primary prevention practices by chiropractic interns

PDF

Analysis of the pathological characteristics of breast carcinoma in Hispanic BRCA carriers

PDF

Development of replication -competent retroviral vectors for efficient, targeted gene therapy of cancer

Asset Metadata

Creator Hornick, Jason Laurence (author)

Core Title Engineering antibodies and antibody /cytokine fusion proteins for the treatment of human malignancies

School Graduate School

Degree Doctor of Philosophy

Degree Program Pathobiology

Publisher University of Southern California (original), University of Southern California. Libraries (digital)

Tag health sciences, immunology,health sciences, oncology,Health Sciences, Pharmacology,OAI-PMH Harvest

Language English

Contributor Digitized by ProQuest (provenance)

Advisor Epstein, Alan L. (committee chair), McMillan, Minnie (committee member), Press, Michael (committee member), Stallcup, Michael R. (committee member), Taylor, Clive (committee member)

Permanent Link (DOI) https://doi.org/10.25549/usctheses-c16-390507

Unique identifier UC11336628

Identifier 3180775.pdf (filename),usctheses-c16-390507 (legacy record id)

Legacy Identifier 3180775.pdf

Dmrecord 390507

Document Type Dissertation

Rights Hornick, Jason Laurence

Type texts

Source University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Access Conditions The author retains rights to his/her dissertation, thesis or other graduate work according to U.S. copyright law. Electronic access is being provided by the USC Libraries in agreement with the au...

Repository Name University of Southern California Digital Library

Repository Location USC Digital Library, University of Southern California, University Park Campus, Los Angeles, California 90089, USA