University of Southern California Dissertations and Theses

An in vivo study of G protein coupled receptor mediated signaling

(USC Thesis Other)

An in vivo study of G protein coupled receptor mediated signaling

PDF

Download

Open document

Flip pages

Download a page range

Download transcript

Copy asset link

Request this asset

Transcript (if available)

Content AN IN VIVO STUDY OF G PROTEIN COUPLED RECEPTOR MEDIATED SIGNALING by Guang Shi A Dissertation Presented to the FACULTY OF THE GRADUATE SCHOOL UNIVERSITY OF SOUTHERN CALIFORNIA In Partial Fulfillment of the Requirement for the Degree DOCTOR OF PHILOSOPHY (BIOCHEMISTRY AND MOLECULAR BIOLOGY) August 2005 Copyright 2005 Guang Shi Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. UMI Number: 3219884 INFORMATION TO USERS The quality of this reproduction is dependent upon the quality of the copy submitted. Broken or indistinct print, colored or poor quality illustrations and photographs, print bleed-through, substandard margins, and improper alignment can adversely affect reproduction. In the unlikely event that the author did not send a complete manuscript and there are missing pages, these will be noted. Also, if unauthorized copyright material had to be removed, a note will indicate the deletion. ® UMI UMI Microform 3219884 Copyright 2006 by ProQuest Information and Learning Company. All rights reserved. This microform edition is protected against unauthorized copying under Title 17, United States Code. ProQuest Information and Learning Company 300 North Zeeb Road P.O. Box 1346 Ann Arbor, Ml 48106-1346 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. DEDICATIONS To my dearest parents Keyi Shi, Peiying Wang and my beloved husband Shengzhan Luo Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. ACKNOWLEDGMENTS I am deeply grateful to my thesis advisors Dr. Jeannie Chen and Dr. Ralf Langen for their excellent mentorship for my PhD research over the past six years. I would like to thank my thesis committee member Dr. Michael Stallcup, Dr. Robert Stellwagen and Dr. Ian Haworth for their time, advice, encouragement and continuing support. Their guidance and constructive critics are an important integral part of this thesis and will certainly be beneficial to my future academic development. Dr. Vladimir Kefalov at John’s Hopkins University contributed to part of the work described in chapter III of this thesis. He also patiently answered my many questions on electrophysiology. This thesis has greatly benefited from his collaboration for my PhD project. I would like to express my appreciation to present and past members of Chen’s and Langen’s laboratory. They make my PhD experience truly enjoyable by sharing my accomplishments and frustrations, discussing project directions, and providing indispensable technical assistance. Nancy Wu and Youzhen Yang at USC transgenic core facility deserved many thanks for the generation of transgenic mouse lines used in thesis work. Finally, I owe too many thanks to my husband, Shengzhan Luo for him always being there when I need anything. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. TABLE OF CONTENTS DEDICATIONS............................................................................................................ii ACKNOWLEDGEMENTS ........................................................................................ iii LIST OF TABLES.......................................................................................................vii LIST OF FIGURES ................................................................................................... viii ABSTRACT................................................................................................................. xi CHAPTER 1. OVERVIEW OF G-PROTEIN COUPLED RECEPTOR SIGNALING IN PH OTORECEPTORS.................................................................1 1.1 G-protein Coupled Receptors Mediated Signaling......................................1 1.2 Visual Pigment - Light Sensitive G PCR.....................................................4 1.3 Photoreceptors in Retina Neural Circuit...................................................... 9 1.4 Amplification and Termination of Phototransduction Cascade............... 13 1.5 Light and Dark Adaptation .......................................................................22 1.6 Comparison of Rods and Cones ...............................................................26 1.7 Thesis Outline ............................................................................................. 29 CHAPTER 2. CHARACTERIZATION OF MOUSE CONE S-OPSIN TRANSGENIC MICE TO STUDY CONE VISUAL PIGMENT PROPERTIES IN V IV O ..........................................................................................31 2.1 Introduction.................................................................................................. 31 2.2 Materials and M ethods................................................................................ 37 2.2.1 Generation of S-opsin Transgenic M ice...........................................37 2.2.2 Generation of S-opsin-lD4 Transgenic M ice.................................. 37 2.2.3 Genotype analysis.............................................................................. 38 2.2.4 Immunohistochemistry.......................................................................39 2.2.5 Morphology ........................................................................................39 2.2.6 Western B lo t.......................................................................................40 2.2.7 Measurement of Rhodopsin Amount by Differential Absorption at 500 ran.......................................................................................................... 40 2.2.8 Northern B lo t..................................................................................... 41 2.2.9 Separation of Rhodopsin and S-opsin Using Con A Sepharose .. ..42 2.2.10 Visual Pigment Phosphorylation Assay.......................................... 42 2.3 Results.......................................................................................................... 43 2.3.1 Expression of S-opsin in Rod Photoreceptors.................................43 2.3.2 Targeting of Mouse Cone S-opsin to Rod Outer Segment.............47 2.3.3 Morphology of S-opsin Transgenic M ouse..................................... 49 2.3.4 Phosphorylation of Ectopical S-opsin with UV Light Exposure ....51 2.4 Discussion.................................................................................................... 53 iv Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. CHAPTER 3. PHOTOTRANSDUCTION PROPERTIES OF MOUSE CONE S-OPSIN IN ROD PHOTORECEPTORS........................................................... 60 3.1 Introduction.................................................................................................. 60 3.2 Materials and M ethods................................................................................ 67 3.2.1 S-opsin Trangenic Lines....................................................................67 3.2.2 1D4 Peptide.........................................................................................67 3.2.3 Preparation of 1D4 mAh Coupled Sepharose..................................67 3.2.4 S-opsin-lD4 Visual Pigment Purification with lD4-sepharose Affinity Beads..............................................................................................68 3.2.5 Spectroscopy.......................................................................................68 3.2.6 Single Cell Recording........................................................................69 3.2.7 Electroretinography ........................................................................... 70 3.2.8 Generation of Cone-transducin Transgenic M ice........................... 70 3.2.9 Genotype Analysis............................................................................. 71 3.3 Results...........................................................................................................71 3.2.1 Absorption Spectrum of S-opsin-lD4 Visual Pigment................... 72 3.3.2 ERG Response of S-opsin Transgenic Lines...................................72 3.3.3 Flash Responses of S-opsin Transgenic M ice.................................77 3.3.4 Flash Sensitivity of S-opsin/S-opsin-lD4+ rho-/- R od.................. 79 3.3.5 Estimation of S-opsin/S-opsin-lD4 Pigment Expression Level in S-opsin/S-opsin-lD4+ rho+/- Rods by Spectral Sensitivity................ 81 3.3.6 Properties of Single Photon Responses of S-opsin Transgenic Rods ........................................................................................................................ 83 3.3.7 S-opsin Meta-II Decay R ate............................................................. 85 3.3.8 Dark N oise.......................................................................................... 88 3.3.9 Expression of Cone Transducin a Subunit in Mouse R ods............89 3.3.10 Rod ERG Response of CTD Transgenic L ines.............................90 3.4 Discussion....................................................................................................92 CHAPTER 4. DEMONSTRATION OF VISUAL PIGMENT TRANSPHOSPHORYLATION IN VIV O ........................................................... 97 4.1 Introduction.................................................................................................. 97 4.2 Materials and M ethods.............................................................................. 101 4.2.1 S-opsin and K296E Transgenic Mouse Lines................................ 101 4.2.2 Standard Peptides............................................................................. 102 4.2.3 Light Stimulation and Sample Preparation.................................... 102 4.2.4 LC-MS............................................................................................... 104 4.2.5 Sample Preparation for Isoelectric Focusing................................. 104 4.2.6 Mathematical Stimulation fo Trans-phosphorylation....................106 4.3 Results.........................................................................................................107 4.3.1 Detection of Rhodopsin and S-opsin Phosphorylation ................ 107 4.3.2 Phosphorylation of Rhodopsin and S-opsin following Stimulation by Short (360-420 nm) Wavelength Light...............................................110 v Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 4.3.3 S-opsin Becomes Trans-phosphorylated following Activation of Rhodopsin by Long (515-620 nm) Wavelength Light.............................113 4.3.4 Trans-phosphorylation Results in Multiply Phosphorylated S- opsin............................................................................................................. 118 4.3.Demonstration of Trans-phosphorylation in Transgenic Mice that Express Human K296E Opsin...................................................................120 4.4 Discussion............................................................................................ 122 BIBLIOGRAPHY....................................................................................................128 APPENDIX. PURIFICATION AND MEMBRANE ASSOCIATION OF HUMAN ESTROGEN RECEPTOR HORMONE BINDING DOMAIN (HER- HBD) .........................................................................................................................142 A.l Introduction............................................................................................... 142 A.2 Materials and M ethods............................................................................. 146 A.2.1 Constructs ........................................................................................146 A.2.2 Spin Labeled Ligands......................................................................147 A.2.3 Primers ............................................................................................ 147 A.2.4 HBD Cysless and Single Cysteine M utant................................... 148 A.2.5 HBD Expression and Purification..................................................148 A.2.6 Spin Labeling of Protein.................................................................150 A.2.7 Protein-Phospholipid Binding A ssay.............................................150 A.2.8 EPR Measurements......................................................................... 151 A.2.9 Purification of Annexin Fusion Proteins........................................151 A.3 Result .........................................................................................................152 A.3.1 Construction of HBD Cysless and Single Cysteine M utants 152 A.3.2 Expression and Purification of MBP-HBDCysless Fusion Protein..........................................................................................................154 A.3.3 pH-dependent Association of MBP-HBDCysless with Vesicles of Different Lipid Compositions...................................................................156 ABA Ligand Binding Properties of Soluble and Membrane Associated MBP-HBDCysless.....................................................................................158 A.3.5 Design of Alternative hER-HBD Expression Vectors................. 162. A.4 Summary................................................................................................... 173 A. 5 Reference .................................................................................................. 174 vi Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. LIST OF TABLES Table 1.1 Comparison of mouse rod and cone components involved in phototransduction regulation.......................................................................................28 Table 2.1 A comparison of C-terminal sequence of rhodopsins and cone opsins among different vertebrate species.............................................................................. 55 Table 2.2 Proteins with [Cn]-VXPX motif at C-terminus in human protein database.......................................................................................................................... 56 Table 3.1 Parameters of flash responses recorded from transgenic and control rod .80 Table A.l List of MBP-HBD single cysteine m utants.............................................155 vii Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. LIST OF FIGURES Figure 1.1 GTP-GDP exchange cycle of G protein activation and deactivation 2 Figure 1.2 Photobleaching cycle of rhodopsin............................................................. 7 Figure 1.3 Subcellular compartments of rod and cone photoreceptors .....................10 Figure 1.4 Layered organization of retina ................................................................... 12 Figure 1.5 Activation and deactivation of phototransduction cascade in vertebrate photoreceptors................................................................................................................ 15 Figure 1.6 single photon response ............................................................................... 21 Figure 1.7 Ca2 + -dependent light adaptation mechanism ........................................... 23 Figure 2.1 S-opsin and S-opsin-lD4 transgenic lines................................................44 Figure 2.2 The relative protein expression level of transgenic S-opsins to endogenous rhodopsins ................................................................................................46 Figure 2.3 Mouse S-opsin localization in S-opsin-lD4 and S-opsin retinas by ICC...................................................................................................................................48 Figure 2.4 Retina morphology of S-opsin-lD4 and S-opsin lines ............................50 Figure 2.5 Phosphorylation of S-opsin in response to UV light................................52 Figure 3.1 Absorption spectrum of S-opsin-lD4 pigment .........................................73 Figure 3.2 ERG responses of S-opsin+ rho+/- mice and rho+/- controls................. 75 Figure 3.3 ERG responses of S-opsin+ rho-/- mice and rho-/- controls................... 76 Figure 3.4 Families of flash responses.........................................................................78 Figure 3.5 Spectral sensitivity of S-opsin/S-opsin-lD4+ rho+/- and rho+/- rods ...82 Figure 3.6 S-opsin meta-II decay measured by the recovery phase of dim flash responses in arrestin knockout background................................................................87 Figure 3.7 Cone transducin a (CTD) transgenic lines ............................................. 91 viii Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Figure 4.1 Ion chromatograms of Eluted Peptides Synthesized According to C- terminal Sequences of Rhodopsin and S-opsin........................................................109 Figure 4.2 Phosphorylation of rhodopsins and S-opsins following Exposrue to 360- 420 nm light................................................................................................................ I l l Figure 4.3 Trans-phosphorylation of S-opsins following Generation of R* by 515- 620 nm light................................................................................................................ 114 Figure 4.4 Rhodopsin Phosphorylation and S-opsin Trans-phosphorylation Level as a Function of Dark Incubation Time after Exposure to Different Intensities of Light............................................................................................................................. 115 Figure 4.5 Detection of Rhodopsin and S-opsin Phosphorylated Species by Isoelectric Focusing....................................................................................................119 Figure 4.6 Trans-phosphorylation of Endogenous Mouse Rhodopsin in Dark- Adpated K296E Transgenic Mouse R etina..............................................................121 Figure A.l ER domain structure and hypothesized HBD membrane insertion scheme..........................................................................................................................143 Figure A.2 Expression of MBP-HBD mutant with each of the native cysteine (CSAS), 417 (SCAS), 447 (SSAC), and 531 (SSCS) restored on the MBP- HBDCysless fusion protein....................................................................................... 153 Figure A.3 Purification of MBP-HBDCysless.........................................................157 Figure A.4 Membrane binding properties of MBP-HBDCysless protein..............159 Figure A.5 Structure of spin labeled compounds....................................................160 Figure A.6 Binding of spin labeled ligands with MBP-HBD fusion protein in solution measured by EPR..........................................................................................161 Figure A.7 Binding of spin labeled ligands with MBP-HBD fusion protein on phospholipids vesicles measured by EPR................................................................. 163 Figure A.8 Construction and purification of Anx2-HBD fusion protein................165 Figure A.9 Insertion scheme of linker sequences containing protease cleavage site ...............................................................................................................................166 Figure A. 10 Design of the linker sequence to insert multiple copies of 10 glycine peptides before thrombin cleavage site.................................................................... 168 ix Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Figure A. 11 Construction of pSE420-HBD-Anx2 vector..........................................171 Figure A. 12 Introduction of linkers with protease cleavage sites and the expression ofFIBD-Anx2 fusion protein......................................................................................172 x Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. ABSTRACT In first half of the thesis, to investigate whether distinct molecular properties of rhodopsin and cone opsin contribute to different photoresponses of rods and cones, transgenic mouse that expressed mouse cone shortwave-sensitive opsin (S-opsin) in rod photoreceptors was produced. The ecotopically expressed S-opsin was transported properly to rod outer segment, had maximal absorption at 360 nm, and was functionally coupled to rod phototransduction cascade. Dim flash responses of S-opsinrh o + /" rod triggered by 360 nm or 500 nm light were recorded by single cell recording. No significant differences in amplitude and kinetics were observed between dim flash responses recorded from S-opsinlh o + /' rod at 360 nm and 500 nm, indicating that rhodopsin and S-opsin give rise to identical single photon response in same photoreceptor cells. In addition, the meta-II thermal decay rates of S-opsin and rhodopsin in intact rod were compared. We found that S-opsin meta-II decayed 42- fold faster than rhodopsin meta-II. Our results suggest that under dim illumination, different intrinsic molecular properties of visual pigments do not affect gain and kinetics of phototransduction. However, under bright light condition, faster decay of cone opsin meta-II might accelerate cone opsin deactivation and mediate rapid recovery of cone photoresponses. The second half of the thesis tested whether trans-phosphorylation, whereby rhodopsin kinase, upon phosphorylating the activated receptor, continues to phosphorylate nearby non-activated rhodopsin, occurs in intact photoreceptor cell using two different transgenic mouse models. The first transgenic model expressed S-opsin together with the endogenous rhodopsin in rod cell. We have shown that xi Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. selective stimulation of rhodopsin led to phosphorylation of S-opsin. The second mouse model expressed the constitutively active human rhodopsin mutant, K296E. We showed that K296E in the arrestin -/- background led to phosphorylation of endogenous mouse rhodopsin in the dark-adapted retina. Both mouse models provide strong support of trans-phosphorylation as an underlying mechanism of high-gain phosphorylation. Our data show that trans-phosphorylation can lead to phosphorylation of a substantial fraction of non-activated visual pigments. Since light-stimulated, phosphorylated receptors exhibit decreased catalytic activity, our results suggest that dephosphorylation may be a rate-limiting step in the full recovery of visual sensitivity during dark adaptation. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Chapter 1 Overview of G-protein Coupled Receptor Signaling in Photoreceptors 1.1 G-protein Coupled Receptor Mediated Signaling G-protein coupled receptors (GPCR) constitute a large family of membrane receptors that respond to a variety of diverse stimuli including lights, odorants, taste modalities, hormones, and neural transmitters. The ability of GPCR family members to detect and transduce these large collections of external signals underlies their important physiological functions from sensory recognition to metabolism regulation. In the past two decades, much progress has been made towards the understanding of molecular mechanisms underling GPCR signaling events. Many universal characteristics regarding to conduction and regulation of signal transductions mediated by different GPCR family members have been revealed. All members of GPCR family share the common structural motif composed of seven-transmembrane a helices connected by six intervening intracellular and extracellular loops, the N-terminal extracellular and the C-terminal intracellular tail. After activation by specific signals, GPCR undergoes conformational changes such that its second and third cytoplasmic loop will bind with downstream GTP binding protein (G-protein) consisting of three subunits - Ga, Gp, and Gy (Hamm and Gilchrist, 1996) (Fig. 1.1). The a subunit contains the GTP/GDP binding site, and py 1 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Figure 1.1. GTP-GDP exchange cycle of G protein activation and deactivation. G protein consists of three subunits - Ga, Gp, and Gy. In rest state (at left), Ga is associated with GDP (gray circle) The active G-protein coupled receptor (GPCR*) binds with trimeric G protein, which leads to the GDP dissociation and GTP (black circle) association on Ga subunit followed by dissociation of Gpy and GPCR* from Ga. Ga-GTP then activates downstream effector proteins (E). The activated effectors (E*) are capable of carrying out a variety of physiological acitivities. Over the time, the intrinsic GTPase activity of Ga-GTP hydrolyzes the bound GTP to GDP. Finally, Ga-GDP recombines with GpY dimer to re-form the original trimeric G protein so the GTP-GDP exchange cycle is completed. 2 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. subunits form a tight dimer complex. In the dormant state, Ga is associated with GDP and Py subunits. The binding of activated GPCR with G-protein triggers G protein conformational changes, thereby results in a GTP-GDP exchange reaction including the dissociation of GDP from Ga and the association of GTP to Ga. Then activated subunit GTP-Ga dissociates from Gpy dimer to activate the downstream effectors such as enzymes and ion channels (Wickman and Clapham, 1995). Finally, the GTP-GDP exchange cycle is completed by the hydrolysis of GTP-Ga to GDP-Ga by Ga intrinsic GTPase activity that is sometimes enhanced by member of Regulator of GTP Signaling protein (RGS) family and its effector (Dohlman and Thomer, 1997). A single activated GPCR molecule is able to activate hundreds of G-proteins, which provides a significant factor to the remarkable amplification effect of G- protein signaling cascade. On the other hand, to truly reflect the state of external environment in a timely manner, the activated GPCR needs to be deactivated rapidly once stimuli are removed (Bohm et al., 1997). Furthermore, to prevent response saturation under prolonged exposure, which can abolish cell’s responsiveness to any further environmental changes, the catalytic activity of GPCR is down-regulated by desensitization processes over time. The deactivation and desensitization of GPCR typically involve similar molecular events - receptor phosphorylation and arrestin binding. The active conformation of GPCR not only can stimulate G proteins, but can also be recognized by members of GPCR kinases (GRKs) family, which catalyzes the phosphorylation of Ser/Thr on the carboxyl-terminal domain of GPCR (Pitcher et al., 1998). The phosphorylated GPCR further recruits arrestin, which 3 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. recognizes the active conformation of GPCR and phosphorylated GPCR C-terminal domain. Usually, the catalytic activity of GPCR is greatly reduced by GPCR phosphorylation and completely quenched after arrestin binding. In addition to the GRK-mediated phosphorylation, GPCR can also be phosphorylated by feedback reactions catalyzed by downstream kinases (protein kinase A and protein kinase C) activated by GPCR signaling pathway. Unlike GRKs, which only act on specific GPCRs, protein kinase A/C usually does not discriminate either the type of GPCR or whether its activation state. In this situation, the activation of one type of GPCR can lead to cross-deactivation of other types of GPCRs and non-activated GPCRs. Furthermore, in some systems, the GPCR-arrestin complexes can be endocytosed into clathrin-coated pits and internalized into endosomes, resulting in a temporary reduction in the number of GPCRs on the membrane surface, which further reduces the cell’s responsiveness (Goodman et al., 1996). The internalized receptors are finally recycled back to the cell surfaces in a resensitization process. 1.2 Visual Pigment - Light Sensitive GPCR The visual pigment is a light-sensitive GPCR expressed specifically in retinal photoreceptors. Visual pigments differ in their wavelength of maximum absorbance and are classifed into rhodopsin (expressed in rods) and several subtypes of cone opsins (expressed in cones) including long-, middle-, and short-wavelength sensitive cone opsins. Because most vertebrates have more abundant rhodopsins than any cone opsins, most of the knowledge on visual pigments is drawn from studies on 4 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. rhodopsins. Thus, most of this section will focus on functional properties of rhodopsin as a representation of other types of visual pigments. In vertebrates, rhodopsins and cone opsins contain conserved sequences and shared many biochemical properties. Nevertheless, I also discussed important differences between rhodopsins and cone opsins. As a prototypical member of GPCR family, bovine rhodopsin was extensively investigated in the past, and these studies have pioneered our understanding on structure and function of all the GPCR family members. For example, bovine rhodospin is both the first GPCR to be cloned, sequenced (Nathans and Hogness, 1983) and crystallized (Okada et al., 2000; Palczewski et al., 2000). Bovine rhodopsin (and other vertebrate rhodopsin) is composed of an opsin protein and a light-capturing chromophore - 11-cis retinal. In the dark state, the opsin is covalently bonded to 11-cis retinal through a protonated Schiff base linkage at a conserved lysine side chain of transmembrane helix 7 (K296) (Bownds, 1967). The protonated Schiff base is positively charged and stabilized by the negatively charged side chain of glutamate (El 13) counter ion via a salt bridge (Sakmar et al., 1989). This salt bridge between El 13 and K296 is necessary to hold the visual pigment in an non-activated conformation in darkness, inasmuch as the K296E mutant, which cannot form salt bridge with El 13, is constitutively active (Cohen et al., 1992; Robinson et al., 1994; Robinson et al., 1992). In addition, the stable interaction between 11-cis-retinal and opsin is necessary for maintaining an extremely low 5 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. photocurrent fluctuation in dark arising from spontaneous isomerization of rhodopsin. Although the light absorption ability of visual pigment originates from 11-cis retinal, the absorption spectrum of visual pigment is determined by the specific interactions between 11 -cis retinal and opsin residues around chromophore-binding pocket. It has been shown that the protonation status of chromophore, which affect chromophore-opsin interactions, modulates the maximum absorption wavelength of the pigment. For example, rhodopsin El 13Q mutant, which contained a deprotonated Schiff base at neutral pH, has a blue-shifted maximum absorption wavelength from 500 nm (wild type rhodopsin) to 380 nm (Sakmar et al., 1991). In addition, revealed by site directed mutagenesis, several residues on opsin around the chromophore- opsin interaction sites were capable of tuning the absorption spectrum of rhodopsin (Shichida and Imai, 1998). Upon photon absorption, 11-cis retinal isomerizes to all-trans retinal, which induces opsin conformational changes indicated by the formation a sequence of thermal intermediates - photorhodopsin, bathorhodopsin, lumirhodopsin and metarhodopsin I - III (Fig 1.2). These intermediates were identified by their specific spectrum measured by low temperature or time-resolved laser spectroscopy (Lewis and Kliger, 2000; Wald, 1968; Wang et al., 1994). At the transition from meta rhodopsin I to II, the Schiff base linkage becomes deprotonated and, duing meta-II decay, it is hydrolyzed to releases free opsin and all-trans retinal. Meta-II intermediate is the competent intermediate to activate G protein transducin, and 6 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Dark Rhodopsin Isomerized rhodopsin hv ► Isomerization Lys H 6 11-cis retinal A m eta-I (4t0nm) Opsin m eta-II (380 nm) OH -Gil! 1 m eta-III (450 n ^ OH A ll-trans retinal Figure 1.2. Photobleaching cycle of rhodopsin. Dark rhodopsin contains a protonated Schiff base between 11-cis retinal and Lys 296. The Schiff base is stabilized by Glu 113 counter ion. After light exposure, 11-cis retinal isomerizes to all-trans retinal followed by formation of a series of rhodopsin thermal intermediates (from photo to meta-III). The maximum absorption wavelength of each intermediate and time elapsed between successive intermediates are indicated (on the right). The Schiff base is deprotonated during meta-II state. Then Schiff base is hydrolyzed to give rise to free opsin and all trans retinal. All trans retinal is reduced to all-trans retinol in outer segment, transported to RPE, converted to 11-cis retinal in RPE and transported back to outer segment. Finally, 11-cis retinal is reconstituted with opsin to form dark rhodopsin. 7 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. thereby, the phototransduction cascade is initiated (Stryer et al., 1983). It is also worthwhile to note that the quantum efficiency of photoisomerization - the propability of realizing an isomerization by each absorbed photon is 0.67. Compared to ligand-GPCR interactions of other types of GPCR, this is an impressively high success rate of GPCR activation. Although the catalytic active meta-II undergoes thermal decay over time, its deactivation is accelerated by phosphorylation (Kuhn et al., 1973; Kuhn and Dreyer, 1972; Wilden, 1995) and completed by arrestin binding (Wilden et al., 1986) in vivo. After Schiff base hydrolysis, the released all-trans retinal is reduced to all-trans retinol by NADH dehydrogenase in outer segments. Then all-trans-retinol is transported into RPE and converted back to 11-cis retinal by several chemical reactions of retinoid cycle. Finally, the opsin is dephosphorylated and reconstituted with resynthesized 11-cis retinal to form rhodopsin, ready for next round of light excitation (Hofmann et al., 1992). Cone opsins step through similar photobleaching intermediates (Shichida and Imai, 1998). For most rhodopsin and cone opsins, their maximum absorption wavelengths are red-shifted to the maximum absorption wavelength of free portonated Schiff base (440 nm), and their Schiff base is protonated in darkness. However, mouse short-wave opsin (S-opsin), belongs to a special class since it absorbs maximally at 360 nm, which is blue-shifted to 440 nm. Accordingly, FTIR has shown that S-opsin contained a deprotonated Schiff base in the dark (Dukkipati et al., 2002). Its Schiff base, however, becomes protonated subsequently during lumi 8 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. formation and meta I state (Kusnetzow et al., 2004). In addition, the comparative analysis of dark currents recorded from Salamander rods and L-cones revealed that the spontaneous isomerization rate of L-opsin is higher than that of rhodopsin (Rieke and Baylor, 2000). This high isomerization rate of L-opsin attributes to the higher spontaneous fluctuations of dark currents, known as dark noise, observed in L-cones. Dark noise affect photoresponse property of photoreceptors because the spontaneous activity occurred in the darkness could act as “background light”, which can effectively adapt the cell and lead to a smaller and faster response. 1.3 Photoreceptors in Retina Neural Circuit The photoreceptors are highly specialized for transducing photon hits to graded hyperpolarization through a cascade of G-protein mediated biochemical steps known as phototransduction (Stryer et al., 1983). All photoreceptor cells display an elongated polarized structure composed of the outer segment, followed by a thin connecting cilium to the inner segment, and the synaptic termini (Fig. 1.3). The inner segment houses the metabolic organelles of the photoreceptor cell, including mitochondria, endoplasmic reticulum and golgi apparatus, to synthesize all the proteins, whereas the outer segment is consisted of many densly packed membrane disks containing all the components necessary for conducting phototransduction. Newly synthesized proteins targeted for outer segment are transported from inner segment through the connecting cilium. Radioactive labeling of newly synthesized proteins revealed that the membrane components within the outer segment are 9 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. IfiV . ’or" \ Y O uter S egm ent C onnecting Cilium Inner S egm ent N u cleu s o A ‘ : > o . . a-x o o ^ o i " :> / ) ( 0 ° Rod Synapse v -£ L ) ’" f ° Cone .o Figure 1.3. Subcellular compartments o f rod and cone photoreceptors. Rods and cone differ mainly on the structures of outer segments (See text for details). 10 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. constantly renewed (Young, 1971). Newly-formed discs displace the older discs apically, and the oldest discs at the apical tip of the outer segment are continuously shed and phagocytosed by the retinal pigmented epithelium. It takes about two weeks for a single disc to migrate along the rod outer segment before being shed at the apical tip. The sub-cellular compartments between neighboring photoreceptor cells are precisely aligned to give rise to the intricately layered structure of the retina. As shown by a stained transverse section of mouse retina (Fig 1.4), the invariant boundaries between the cellular sub-compartments and different cell types divide the section vertically into eight distinct layers: retinal pigment epithelium (RPE), outer segment, inner segment, outer nuclear layer, outer synaptic layer, inner nuclear layer, inner synaptic layer and ganglion cell layer. Outer segment, inner segment and outer nuclear layer are subcellular compartments belonging to photoreceptor cell. Outer synaptic layer contains synaptic contacts between photoreceptors and bipolar or horizontal cells. The nuclei of bipolar, horizontal and amacrine cells are located in inner nuclear layer. Inner synaptic layer is where the biopolar cells make contacts with ganglion and other cells. Visual signals are first registered by light-sensitive chromophore on the outer segments of photoreceptors. Then through phototransduction cascade, membrane hyperpolarization is generated, resulting in a decrease in the rate of neurotransmitter glutamate release by the synaptic termini of photoreceptor. The neural signal is then relayed postsynaptically to bipolar cells. Bipolar cells interact with horizontal and 11 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. INL ISL GCL * T * r ,;r:T 7 ' mMm^Wfl v;v J A -: • .■ • - V-.. ' Boycott an d Dowling, 1969 Tartuferi, 1887 Figure 1.4. Layered organization of retina. (Left) Transverse section of human retina by light microscopy. From top to bottom, there are eight distinct layers. RPE: retinal pigment epithelium; OS: outer segment; IS: inner segment; ONL: outer nuclear layer; OSL: outer synaptic layer; INL: inner nuclear layer; ISL: inner synaptic layer; GCL: ganglion cell layer. (Right) Schematic drawing o f retina layered structure. 12 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. amacrine cells, which provide the spatial encoding of visual information by comparing and contrasting different light intensities in the retina image. The response is subsequently modulated and integrated by horizontal cells and amacrine cells laterally across the middle layers of retina. Finally, the processed signals are collected by the last output neurons of retina - ganglion cells, where the visual information was encoded into action potentials to be transmitted onto brain visual cortex through the optic nerve (Rodieck, 1998). 1.4 Amplification and Termination of Phototransduction Cascade Vision involves absorption of light and subsequent encoding and processing of visual signals in the form of neural impulses. The generation of an electrical signal, as a result of visual transduction cascade, in response to light excitation, constitutes the first step in visual perception. Characteristics of this transduction process confer or constrain many important features of visual perception. For example, visual threshold is set by the ability of transduction cascade to amplify the signals from dimmest light and produce a reliable photoresponse that is clearly distinguished from dark noise events. The temporal resolution of dynamically evolved visual scenes depends on the kinetics of transduction cascade to give rise to rapidly activated and timely deactivated responses. In addition, the upper limit of visual perception is constrained by mechanisms in the transduction process to extend its operating range and prevent response saturation caused by closure of all cGMP- gated channels. 13 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. As early as in 1980s, it was demonstrated that photoreceptor hyperpolarization, as the output signal generated by photoreceptors, was induced as a consequence of the closure of light-sensitive, cGMP-gated cation channels on the outer segment membrane (Fesenko et al., 1985; Zimmerman et al., 1985). In darkness, about 1% of cGMP-gated channel are held open by a cytoplasmic concentration of free cGMP at -50 pM. These channels are permeable to cations, I 2-(- enabling a steady inward current carried by Na (85-90%), Ca (10-15%) and small 2 _j_ amounts of Mg driven by the concentration gradients of these ions across plasma membrane in darkness (Nakatani and Yau, 1988b; Yau and Nakatani, 1984). The steady intracellular concentrations of Ca2 + and Na+ are maintained by Ca2 + and Na+ outflow through Na+, K+ /Ca2 + exchanger and Na+ /K+ pump, respectively. In addition, the influx of photocurrent is balanced by a K+ current efflux from inner segment, creating a loop of current flow known as circulating current. It was found that, in light exposed photoreceptor, the continuous inward current was suppressed in graded fashion, due to the closure of cGMP-gated channels caused by the removal of cGMP. Parallel biochemical studies have illustrated that this physiological behavior actually arose from the hydrolysis of cGMP induced by a light-activated biochemistry cascade (Fig. 1.5) (Stryer et al., 1983). In more detail, photon absorption by 11 -cis retinal of rhodopsin causes its photoisomerization to all-trans retinal (Wald, 1968), which subsequently induces conformational changes of opsin apoprotein and the formation of catalytically active rhodopsin (R*). Then R* activates the G protein transducin by triggering the GTP-GDP exchange reaction on 14 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Figure 1.5. Activation and deactivation of phototransduction cascade in vertebrate photoreceptors. The closed gray disks on the left illustrate the disk membranes, and the gray strip on the right represents plasma membrane. (Dark) The major phototransductive and regulatory proteins in photoreceptor outer segment in darkness. (From left to right) Ga, Gp, GY - trimeric G protein transducin; PDEap, PDEy - tetrameric inactive phosphodiesterase with inhibitory y subunit binding with ap subunits to hide the catalytic sites on the latter; Arr - arrestin; RGS-GP5 - the stable complex of regulator of G-protein signaling 9 (RGS) and G-protein P subunit (Gp5); Rec-RK — the complex o f Ca2 + bound; recoverin (Rec) and rhodopsin kinase (RK), where rhodopsin kinase is kept inactive; GCAP- Ca2+-bound, inactive, guanylyl cyclase activating protein (GCAP); Rh - dark rhodopsin bonded with 11-cis retinal (brown); GC - guanylyl cyclase. 1% of the cGMP-gated channels on plasma membrane are held open by cGMP (cG) binding, conducting an inward current carried by Na+ , Ca2 + and Mg2+. The Ca2 + is extruded out of cell continuously by Na2 + /Ca2 + K+ exchanger (NCKX). The inflow and outflow of Ca2 + maintains a steady intracellular Ca2 + concentration. The cGMP-gated channel is associated with Ca2 + -bound calmodulin (CM). (Activation) The activation steps of phototransduction cascade. After photoexcitation, 11-cis retinal (bent symbol) of rhodopsin is isomerized to all-trans retinal (straight symbol), leading to the formation of catalytic active rhodopsin (Rh*). Rh* catalyzes GTP (black dot) -G D P (gray dot) exchange on transducin a subunit (Ga). GTP-Ga then binds with PDEy subnuit on disk membrane. Thereby the catalytic sites on PDE ap subunits are exposed to catalyze cGMP hydrolysis to GMP. As a result of a fall of intracellular cGMP concentration, the cGMP is removed from cGMP-gated channel, causing channel to close. Ultimately, the inward current is suppressed and photoreceptor cell hyperpolizes. (Deactivation) Deactivation of phototransduction cascade. The drop of intracellular Ca2 + level, as a consequence of closure of cGMP-gated channels and continued Ca2 + extrusion by NCKX, activates three recovery processes mediated by three calcium binding proteins: GCAP, Rec and CM. First, Ca2 + -bound GCAPs bind and activate GC accelerate cGMP synthesis. Second, recoverin is dissociated from RK and the latter bind and phosphorylate rhodopsin, which reduces the catalytic activity of rhodopsin and promotes arrestin binding, therefore rhodopsin activity is completely quenched. Third, CM increases the affinity of cGMP to cGMP-gated channel. So channel reopens at a lower cGMP concentration. In addition, transducin is deactivated after hydrolysis of GTP-Gtt to GDP- Ga by intrinsic GTPase activity o f GTP-Ga. The GTPase activity is enhanced by RGS-GP5 and PDEy. Furthermore, all-trans retinal dissociates from opsin following Schiff base hydrolysis. All-trans retinal is converted back to 11-cis retinal by retinoid cycle reactions in both outer segment and RPE. The opsin is dephosphorylated by protein phasphases and reconstituted with 11-cis retinal to form regenerated rhodopsin. 1 5 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. e ^ - j« | l i I j / ' ■ ! ■ — I :, £ • •, i * A *S* f\ m G D ° e<?°yYT~7 ' j ° % W o * 9 Na+ a Ca2 + o Mg2 * Deactivation ,f . p p p 0 ce 'A s •-|^1 Na* ■ Ca2+ o . M g 2 * . © * o Ca2* , oka j u 16 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. transducin a subunit (Ta). Now the activated Ta binds with the inhibitory y subunit of phosphodiesterase (PDE) so that the catalytic sites on PDE a and ( 3 subunits are exposed to catalyze the hydrolysis of cGMP to 5’GMP. Therefore, the intracellular cGMP concentration drops, cGMP is removed from the cGMP-gated channel and the cGMP gated channels on the membrane close. Recently, the biochemical measurements are reconciled quantitatively with waveforms of photoresponses recorded from a single rod by electrophysiological techniques. Quantitative analysis revealed that the activation steps during the activation phase of phototransduction multiplicatively led to a greatly amplified electrical signal (Pugh and Lamb, 1993). This amplification factor is also referred as transduction gain, which comprises factors from catalytic activity of one rhodopsin to activate hundreds of transducins, ability of a single PDE to hydrolyze thousands of cGMPs, and cooperative binding of cGMP with cGMP-gated channels. Furthermore, the rate-limiting step of activation was investigated. It appeas that the encounter rate between photoexcited rhodopsin and transducin limits the speed of activation, because rho+/- rod, which expressed half of rhodopsin amount of a wild-type rod, and hence providing more free space on the outer segment membrane to allow faster diffusion of rhodopsin and transducin, produced photoreseponse with a faster rising phase (Calvert et al., 2001). The termination of the phototransduction cascade requires the quench of the catalytic activity of phototransductive enzymes and final restoration of cGMP concentration to dark level (Fig. 1.5). So far, molecular mechanisms that speed up the deactivation of rhodopsin and transducin, re-synthesis of intracellular cGMP, and 17 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. re-opening of the channels are well understood. The Rho* activity is down-regulated by phosphorylation at multiple Ser/Thr sites on its carboxyl terminal end by rhodopsin kinase (RK) and completely quenched by arrestin binding (Chen et al., 1999; Chen et al., 1995b; Wilden, 1995; Wilden et al., 1986; Wilden and Kuhn, 1982; Xu et al., 1997). Second, transducin is shut off by the intrinsic GTPase activity of Ga enhanced by concerted actions of GTPase accelerator protein RGS9-1 and its effector enzyme - y subunit of PDE (Arshavsky and Bownds, 1992; Chen et al., 2000). The requirement of PDEy in transducin shut off ensures that transducin to be inactivated has already interacted with PDEy, thereby preventing futile activation/deactivation cycles of transducin. Light not only induces the drop of 2d- intracellular cGMP concentration, but also that of Ca . As a result of channel closure, the inflow of Ca2 + decreases while Ca2 + is continued to be extruded out of cell by Na+, K+ /Ca2 + exchanger, which leads to a fall in the intracellular Ca2 + concentration (Yau and Nakatani, 1985). A number of studies have demonstrated that Ca2 + concentration plays an important role in response recovery. The final restoration of cGMP levels and re-opening of cGMP-gated channel was accelerated by two mechanisms activated by decreased intracellular Ca2 + concentration after 2 + 2 d - light exposure. First, lowered Ca concentration causes the activation of Ca binding protein - guanylyl cyclase activator proteins (GCAPs) which in turn bind and activate guanyl cyclase (GC) - the enzyme that synthesizes cGMP from GMP (Gorczyca et al., 1994; Gorczyca et al., 1995; Palczewski et al., 1994). Thus, GC can restore cGMP level more rapidly. Second, the affinity of cGMP with cGMP-gated 18 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. channels is increased by another Ca2 + binding protein - calmodulin, which enables the re-opening of channels at lower cGMP concentrations (Bauer, 1996; Hsu and Molday, 1993). Since several parallel molecular events (R* deactivation, transducin deactivation and cGMP concentration recovery regulating response termination occurred at overlapping time, the onset and functional role of each mechanism in determining sensitivity and response recovery kinetics is difficult to dissect. Recently, availability of genetically engineered mouse models, in which any one of the above mechanisms was abolished selectively by a lack of expression of functional molecules required for the specific mechanism, has greatly facilitated such studies. The dynamic regulation of rhodopsin catalytic activity by phosphorylation have been probed by transgenic lines that expressed rhodopsin mutants lacking either all or some of the phosphorylation sites (Chen et al., 1995b; Mendez et al., 2000). These studies revealed that a minimum of three phosphorylation sites was required for response deactivation and all six phosphorylation sites were needed for recovery with normal kinetics. Furthermore, incorporation of the first phosphate occurred during the rising phase of the response, and that it limits the amplitude of the response. The functional role of rhodopsin phosphorylation for limiting response amplitude and accelerating response recovery was confirmed by recordings from rhodopsin kinase knockout mouse, which also showed an abnormally larger response with prolonged deactivation phase (Chen et al., 1999). In addition, the physiological function of arrestin in deactivation has been studied by arrestin knockout mouse, 19 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. which produced photoresponse with normal amplitude yet a prolonged recovery phase, suggesting that arrestin binding occurred around the time when responses had reached the maximum amplitude (Xu et al., 1997). Moreover, the effect of increased 'j I cGMP synthesis rate by Ca feedback on the size and duration of single photo response was studied by GCAP knockout that did not express GCAP1 and 2 proteins. Compared to that of wild-type rod, single photon response from GCAP rod had a four-fold higher amplitude and a 2.7-fold longer integration time (Mendez et al., 2001). This indicates that GCAP functioning began at relatively early rising phase of the response because only a feedback action at early time could have such large affect on response amplitude. To determine whether the shut off of rhodopsin or transducin constituted the rate-limiting step in deactivation kinetics, photoresponse recorded from RGS9 knockout mice was compared to those recorded from RK knockout mice. The response of RGS knockout rods peeled off from the normal recovery phase near the peak of the waveform, indicating that GTPase activity started later than rhodopsin phosphorylation (Chen et al., 2000). This result supports that transducin deactivation is slower and the rate-limiting step during response recovery phase. The key parameters of a response waveform include maximum amplitude, time to peak, and integration time (Fig. 1.6), which reflect the integrated activity of all molecular steps in the amplification and deactivation phases of phototransduction cascade. The sensitivity and kinetics of photoresponse regulated by these molecular mechanisms are tightly interwined. Faster deactivation reactions would inevitably 20 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. single photon response 0 .8-1 t1 - I 0.Q, “‘ T T I 0.0 01 C 2 0.4 0.5 time isj Figure 1.6. Single photon response. A single photon response measured by transient suppression of photocurrent by the a single photoisomerization event. It contains a rising phase (activation) and a falling phase (deactivation). Three parameters were used to characterize a single photon response. Amplitude: the maximum photocurrent reached during the rising phase. Time to peak (tl): time taken from light stimulation to when maximum response is reached. Integration time (t2/amplitude): t2 is the time taken from light stimulation to when photocurrent recovers to dark level. 21 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. antagonize the activation events and hence decrease the response amplitude and time to peak. So faster responses, with a better time resolution will be accompanied with a compromised, lower sensitivity. 1.5 Light and Dark Adaptation In a diurnal cycle, ambient illumination intensity changes over a range of eleven decades (Rodieck, 1998). In order to continue functioning over such a broad range of intensity, photoreceptors have developed effective means to rapidly scale down the response as steady background intensity increases (Fain et al., 2001; Matthews et al., 1990)s. This process, termed light adaptation, prevents response saturation and extends the operating ranges of photoreceptors to signal changes across a wide range of illumination levels. The molecular mechanisms underlying light adaptation were sought after as more progresses were made in our understanding of phototransduction. The adaptational behavior of photoreceptors under background light 2_|_ disappear when Ca concentration was prevented to change, suggesting that feedback reactions activated by lowered Ca concentration play a central role in light adaptation (Matthews et al., 1990; Nakatani and Yau, 1988a; Nakatani and Yau, 2_j_ 1989; Tamura et al., 1989). To date, three Ca binding proteins - recoverin, GCAP 2_|_ and calmodulin have been characterized to mediate their respective Ca -dependent light adaptation mechanism (Fig. 1.7). First, lifetime of active rhodopsin is regulated 2_|_ by Ca concentration through recoverin, which can bind and inhibit RK under high 22 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. L ig h t 1 PDE a c tiv ity - 1 [c G M P ]' i C h a n n e ls c lo s e GC a c tiv ity j GCAP 1 [C a2+] ’ o C t * W o C L Recoverin [cGM P] A cG M P a ffin ity t o c h a n n e l S o m e c h a n n e ls r e o p e n L ig h t a d a p ta tio n p- R ho* a c tiv ity PDE a c tiv ity ■ + ■ [cGM P] Figure 1.7. Ca + -dependent light adaptation mechanism. The fall of intracellular Ca2 + concentration (Middle), as a result of light illumination, removes Ca2 + from three Ca2 + binding protein: GCAP, Recoverin and Calmodulin. Under low Ca2 + conditions: (Left) GCAP activates guanylyl cyclase, which accelerated cGMP resynthesis; (Right) recoverin promotes rhodopsin phosphorylation by dissociating from rhodopsin kinase, so catalytic activities of rhodopsin and PDE decrease; Together, these two (left and right) events elevated the cGMP levels to antagonize the light-induced PDE activation. (Bottom) Calmodulin increases the cGMP affinity with the channel to allow the channel to open at lower cGMP concentrations. Thus, some cGMP channels reopen to result in light adaptation. 23 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Ca2 + concentration (Kawamura, 1993; Klenchin et al., 1995). The fall in Ca2 + concentration promotes the dissociation of recoverin form RK and hence accerlerates and enhances the rhodopsin phosphorylation by RK. Since phosphorylated rhodopsins have reduced activity in stimulating transducin and are rapidly shut off by arrestin binding (Gibson et al., 2000; Wilden, 1995), as a consequence of enhanced rhodopsin phosphorylation, the photoresponse will have a lower amplitude 2 d - and faster deactivation kinetics. Second, the light-induced decrease in Ca concentration activates GCAPs, which then binds and activates GC, resulting in an increased rate of cGMP synthesis (Koutalos et al., 1995a; Koutalos et al., 1995b; Koutalos and Yau, 1996). This counteracts the increase in the rate of cGMP 2_|_ hydrolysis by light activated PDE. Both of the above two Ca -dependent events result in an elevation of intracellular cGMP concentration and re-opening of some cGMP-gated channels. Third, under lowered Ca2 + concentration, the binding affinity of cGMP with cGMP-gated channel increases by the action of calmodulin that interacts with the channel (Bauer, 1996; Hsu and Molday, 1993), which also facilitates the reopening of some channel at lower cGMP concentrations. 2 + 2+ Apart from these Ca -dependent mechanisms, several other Ca - independent mechanisms are also involved in mediating light adaptation. Strong background light could bleach a large amount of visual pigment, leading to a reduction in the number of pigments such that the response sensitivity can be reduced (Burkhardt, 1994). In addition, massive translocation of transducin from outer segment to inner segment was shown to occur in parallel with the reduction of 24 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. response sensitivity under background illumination (Sokolov et al., 2002). The removal of transducin from outer segment - the subcellular compartments conducting phototransduction cascade resulted in fewer number of transducins available to couple with active rhodopsins. Therefore, the gain of the transduction cascade decreases as observed in light adaptation. Effects of all possible molecular events that might cause adapted light response have been quantitatively analyzed. Among those, higher steady state PDE activity (Nikonov et al., 2000) and response compression caused by fewer open channels under light illumination are two most important factors to affect the response amplitude and kinetics under light illumination. Following exposure to strong light, photoreceptors exhibits diminished sensitivity. The responsiveness of photoreceptors recovers slowly in a subsequent dark period. This recovery process is termed- dark adaptation (Fain et al., 1996). Because intense light bleaches a large amount of rhodopsins, the rate of rhodopsin deactivation and regeneration are key factors in determining time needed to restore photoreceptor sensitivity. Indeed, the kinetics of rhodopsin phosphorylation, dephosphorylaton and regeneration with 11-cis retinal, showed close correlations with the time course of sensitivity recovery during dark adaptation . Furthermore, it was found that the main factor underlying desensitization during dark adaptation arises from constitutive activity of opsins generated by intense bleaching as mentioned in section 1.2 (Cornwall and Fain, 1994; Cornwall et al., 1995; Matthews et al., 1996). Although opsin exhibits smaller activity than activated rhodopsin, its 25 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. large quantities could still effectively adapt the cell, through the same mechanisms as if background light existed (Jones et al., 1996). 1.6 Comparison of Rods and Cones Most mammals have two morphologically distinct photoreceptors - rods and cones. Cones are further classified into L-, M-, and S- cones by their spectral sensitivity to light of long-, middle- and short- wavelength, respectively. To date, differences between rods and cones on their anatomies, molecular compositions and physiological functions have been revealed. First, rods and cones have significantly different outer segment structures. The disk membrane of cones folds continuously with plasma membrane while the infoldings of disk membrane of rods pinch off, fuse onto themselves and disconnect from plasma membrane. Although cones have shorter outer segment length than rods, the surface area of cones is larger than that of rods, due to the large area arisen from the highly convoluted surface membranes of cones. The organization and size of outer segments could affect the rate of longitudinal diffusion of cGMP messenger and the speed of the spreading of electrical activities resulted from channel closure. Although the cGMP longitudinal diffusion rate has been derived and simulated theoretically (Holcman and Korenbrot, 2004), careful analysis incorporating its role in attributing to different electrical responses and dark noises between rods and cones is still awaited. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Second, the set of phototransductive molecules and some of the regulatory proteins expressed in rods and cone are encoded by different genes (Table 1.1). Distinct isoforms of visual pigments, transducin, PDE, cGMP-gated channel, Na+ , K+ / Ca2 + exchanger, and arrestin in rods and cones have been cloned. The biochemical properties of rod components were usually better understood than their cone counterparts, due to difficulties in obtaining sufficient amount of cone components in biochemical preparations. Recently, several different properties between rod and cone visual pigments have been identified (Imai et al., 1995; Imai et al., 1997a; Tachibanaki et al., 2001). However, their functional significances in shaping different photoresponse waveforms of rods and cone were unknown. Third, electrophysiological recordings revealed that rods and cones generate photoresponses with profoundly different sensitivity and kinetics. Rods are 50-100 times more sensitive than cones while responses of cones are several times faster than those of rods (Baylor et al., 1984; Schnapf et al., 1990). Corresponding to their different response properties, rods and cone are specialized to function under different illumination conditions. The extreme sensitivity of rods allows them to reliably signal one photoisomerization event - the least possible input, from dimmest environment. On the other hand, cones can continue signaling under bright light, the conditions that would saturate rods. Moreover, cones can respond to rapid changes in light, due to their better time resolution conferred by the faster response. From an evolutionary point of view, it appears that, by a switch of labor between the dim and 27 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Rod Transduction Proteins Cone Transduction Proteins Homology (a.a) (a. a) (%) Visual 348 359 (M-opsin) 42.3 Pigment 346 (S-opsin) 44.0 Transducin a 350 354 79.9 PDEy 87 83 94.2 CGMP-gated Channel u 684 631 71.5 Na7Ca2tK+ Exchanger 663 666 62.5 Arrestin 403 381 51.6 Rhodopsin Kinase 564 same RGS9/GJ35 675/395 same GCAP1 202 same Recoverin 202 same Table 1.1. Comparison of mouse rod and cone components involved in photo transduction. Note: Na+ /Ca2 + ,K+ data is from rat. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. bright light, rods and cones evolved to satisfy conflicting demands of visual perception such as sensitivity and speed under different conditions. 1.7 Thesis outline This thesis investigates molecular mechanisms underlying physiological and functional properties of rod and cone photoreceptors employing a combination of biochemical, genetical, electrophysiological and biophysical techniques. The first part of this work has centered on the role of visual pigment - a prototypical GPCR family member, in mediating the photoresponses of rod and cone photoreceptor cells. First, I created a transgenic mouse line that expressed a mouse shortwave-sensitive opsin, S-opsin, in rod photoreceptors. The characterization of the expression and trafficking of transgenic S-opsin was covered in chapter 2. In chapter 3, we analyzed the sensitivity, kinetics and noise of photoresponses triggered by ectopically expressed S-opsin using electrophysiological techniques such as ERG and single cell recording. The photoresponses originated from rhodopsins and S- opsins in the same rods were compared to illustrate the role of visual pigment in shaping the response waveform. The single cell recordings were performed by Dr. Vladimir Kefalov in Dr. King-Wai Yau’s laboratory at John’s Hopkins University, Chapter 4 presents the second part of the thesis, where I examined cross desensitization mechanism of visual pigment by rhodopsin kinase mediated phosphorylation of non-activated pigments. The characteristics of this process, called trans-phosphorylation, could contribute to photoreceptor light and dark adaptation. 29 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. The unique spectral properties of the S-opsin transgenic mice were utilized to detect the phosphorylation of non-activated pigments under light exposure. 30 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Chapter 2 Characterization of Mouse Cone S-opsin Transgenic Mice to Study Cone Visual Pigment Properties in vivo 2.1 Introduction Visual pigment is a light-sensitive G-protein coupled receptor composed of the light-absorbing chromophore (i.e., 11-cis retinal in vertebrates) covalently attached to the opsin apo-protein via the Schiff base linkage through a conserved lysine residue (296 in mammalian rhodopsin) (Bownds, 1967; Wald, 1968). Visual pigments are expressed in rod and cone photoreceptors, where they are synthesized in the endoplasmic reticulum of inner segments and transported to outer segments by post-Golgi vesicles (Deretic and Papermaster, 1991). A number of studies have revealed that the rhodopsin distal C-terminus, in particular, the QVAPA motif consisting of the last five residues, acts as an indispensable targeting signal for the proper vectorial transport of rhodopsin to the outer segment in vertebrate retina (Concepcion et al., 2002; Deretic et al., 1996; Deretic et al., 1998; Green et al., 2000; Li et al., 1996; Li et al., 1998; Sung et al., 1994; Tam et al., 2000). On the outer segment, the visual pigments constitute the most abundant proteins and provide structural support for the outer segment, inasmuch as rhodopsin -/- mice fail to elaborate outer segments (Lem et al., 1999). Light excitation of visual pigment causes the photo-isomerization of covalently bounded 11 -cis-retinal to all- 31 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. trans-retinal (Wald, 1968), followed by the rapid formation of a series of thermally unstable opsin-chromophore intermediates until the catalytically active meta-II intermediate is formed (Birge, 1990). Meta-II is capable of binding G-protein transducin (Bennett et al., 1982; Emeis et al., 1982; Fukada and Yoshizawa, 1981), thereby initiates the photo-transduction cascade (Fung et al., 1981; Matthews et al., 1963; Stryer et al., 1983). The bleached visual pigment needs to be regenerated to restore the photoreceptor sensitivity via a sequence of reactions. First, the catalytically active meta-II is deactivated by phosphorylation of opsin C-terminal Ser/Thr sites, catalyzed by GPCR specific kinase (Chen et al., 1999; Chen et al., 1995b; Wilden, 1995) and subsequent association of arrestin to phosphorylated meta- II (Wilden et al., 1986; Xu et al., 1997). Second, all-trans retinal detaches from meta- II intermediates following the hydrolysis of Schiff base. Free all-trans retinal is reduced to all-trans-retinol, which enters the retinal epithelium (RPE). Finally, in RPE, all-trans-retinol is converted back to 11-cis retinal, then it diffuses back to the outer segment to reconstitute with opsin and form the dark-state visual pigment for the next round of photo-excitation (Crouch et al., 1996). To date, many kinds of visual pigments from different species and photoreceptor cell types have been cloned and sequenced. Different vertebrate visual pigments show closely related sequences and structures, suggesting that all the visual pigments are diverged from a common ancestor through course of evolution. Yet different visual pigments exhibit distinct wavelength of maximal absorption (A ,m a x ). It is believed that A ,m a x is tuned by the interactions between chromophore and opsin 32 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. residues around the chromophore-binding pocket (Birge et al., 1988). The absorption spectrum of the visual pigment selectively expressed in an individual photoreceptor completely specifies its spectral sensitivity. Most rodents (i.e., mouse) express rhodopsins (km a x = ~ 500 nm), M- (km ax= ~ 510 nm), and S-opsins (km a x = ~ 360 nm) predominantly in rod, M-, and S- cone photoreceptors, respectively (Nathans et al., 1986). Interestingly, mixed expressions of different visual pigments in a single photoreceptor type were detected in various species recently (Applebury et al., 2000; Lukats et al., 2002; Lyubarsky et al., 1999; Ma et al., 2001). Nevertheless, the visual functions that result from the pigment co-expression apart from broadening the spectral sensitivity were still unclear. As discussed in section 1.6, rods and cones, which operate at complementary ranges of light intensities, exhibit photo-response waveforms different in size and kinetics (Yau, 1994). The molecular components of rod and cone phototransduction are homologous but not identical. Because different visual pigments was expressed in rods and cones, distinct molecular properties of visual pigments could contribute to the difference in light responses of rods and cones. The molecular properties of rhodopsin have been characterized extensively by biochemical, spectroscopical, and structural techniques after its cDNA and amino acid sequence were determined. Most of those studies relied on the sophisticated methods developed to purify large amounts of rhodopsins from bovine rod outer segments or transfected COS1 cells in scalable quantities. One of the commonly used methods is based on the high affinity of rhodopsin with concanavalin A (Con A) 33 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. sepharose as rhodopsin is highly glycosylated (Litman, 1982). Rhodopsin can also be efficiently purified by immuno-affinity method using mouse monoclonal 1D4 antibody, which recognized the last eight to nine C-terminal residues of rhodopsin (Hodges et al., 1988; MacKenzie et al., 1984; Molday and MacKenzie, 1983; Oprian et al., 1987). Combined with site-directed mutagenesis, a number of studies using in vitro purified rhodopsin and its mutants have revealed key amino acids involved in chromophore binding (Bownds, 1967; Hargrave et al., 1983; Jager et al., 1994; Sakmar et al., 1989), spectral tuning (Nathans, 1990; Zhukovsky and Oprian, 1989), and its interactions with other proteins (i.e. transducin, rhodopsin kinase and arrestin) (Fahmy and Sakmar, 1993; Fahmy et al., 2000; Zhukovsky et al., 1991). Molecular models to visualize the conformational changes of rhodopsin following its photo excitation have been proposed according to known functions of individual residues. Furthermore, the crystal structure of rhodopsin in darkness was solved recently (Palczewski et al., 2000), which constituted a big step toward understanding the molecular mechanisms underlying rhodopsin activation. In contrast, knowledge on cone opsins have not been advanced at the same pace with that on rhodopsins, in part due to difficulties in obtaining cone visual pigments in sufficient amounts since retinas of most experimentally accessible animals such as mice are rod-dominant. In spite of the afore-mentioned difficulties, some properties of cone opsins, for example, the spectral tuning and structure dynamics near the Schiff base and counter ion regions (Babu et al., 2001; Dukkipati et al., 2002; Kusnetzow et al., 2004) during photo-bleaching, were studied using either Con A sepharose enriched pigments from 34 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. chicken retina (Okano et al., 1989) or 1D4 antibody purified lD4-tagged cone pigments expressed in cultured cells. Photobleaching intermediates of cone opsins showed similar spectral shift as rhodopsins (Imai et al., 1997b; Kusnetzow et al., 2001; Shichida et al., 1993). In addition, rod and cone opsins appear to adopt similar conformation in activating transducin as Xenopus violet cone opsin expressed in COS1 cells was capable of activating rod transducin in vitro with similar affinity and kinetics as rhodopsin (Starace and Knox, 1997). However, several difference between rod and cone visual pigments have also been revealed (Imai et al., 2001; Imai et al., 1995; Imai et al., 2000; Shichida et al., 1994). For example, meta-II of cone visual pigment decayed much faster compared to that of rhodopsins. The cone opsin apoprotein also regenerates faster with 11-cis-retinal than rod opsin. In cone membranes purified from carp retina, cone visual pigments exhibit lower amplification in stimulating transducin and faster phosphorylation (Tachibanaki et al., 2001). Furthermore, key residues setting rod and cone molecular properties were identified by mutants of chicken green-opsin and rhodopsin (Imai et al., 1997a; Kuwayama et al., 2002; Kuwayama et al., 2005). It was hypothesized that these different properties of cone pigments from rhodopsins can account for, at least in part, the less sensitive, more rapid and highly adaptive photo-responses exhibited by cone photoreceptors. However, it has never been demonstrated whether properties of visual pigments could indeed shape photoresponses under physiological conditions. In parallel with in vitro studies of visual pigment properties, the availability of genetically engineered mouse models has greatly facilitated the investigation of 35 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. visual pigments in shaping photo-response waveform in vivo. For example, suction pipett recordings of genetically engineered rods with abolished rhodopsin phosphorylation and arrestin binding have revealed the indispensable roles of pigment phosphorylation and its interaction with arrestin in response termination (Chen et al., 1995b; Xu et al., 1997). Furthermore, the combination of mouse genetics and electrophysiological techniques has advanced our understanding of phototransduction at a quantitative level. However, it was technically challenging to extend this approach to study cone photo-transduction because cones only comprise ~ 3% of total photoreceptors in mouse retina. To develop an animal model to investigate the properties of cone visual pigment using both biochemical and electrophysiological techniques, we created transgenic mouse lines to express mouse cone short-wave opsin (S-opsin) in rod photoreceptors. The 4.4 kb rhodopsin promoter was used to drive the transgene S- opsin expression specifically in rod cells (Lem et al., 1991). In this chapter, the characterization of the expression, localization, effect on retina morphology, and phosphorylation of ectopically expressed S-opsin in the rod cells is presented. The photo-transduction properties of S-opsin in vivo, studied by single cell recordings and electroretinagraphy, will be presented in chapter 3. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 2.2 Materials and Methods 2.2.1 Generation of S-opsin Transgenic Mice The 1.2 kb S-opsin cDNA coding sequence was synthesized by RT-PCR with primer SopsinFl: 5 ’ CCGCTCG AGGGT GAT AGC AG A AG A AT CGT C 3’ and Sopsin R l: 5’ GAAGATCTCACCAGAGTGCCACCAC 3’s using mRNA prepared from mouse retinas. The PCR product encoding S-opsin was cloned into pBluescript KS vector with EcoR V site (pBlopsin) and sequenced. All the following cloning steps were performed on the pBluescript KS vector using three-piece ligation involving three restriction sites. S-opsin coding sequence was ligated with a 0.6 kb mpl fragment for polyadenylation site at 3’ end (Xho I, Bgl II, and BamH I site; pBlopsin-mpl) and a 4.4 kb fragment of rhodopsin promoter region (Lem et al., 1991) at 5’ end (Kpn I, Xho I, and Xba I sites; pRhMBO). The pRhoMBO plasmid was purified by CsCl2 and digested with Kpn I and Xba I to yield the 6.2 kb fragment, which is then purified by QIAEXII gel extraction kit (Qiagen) and Elutip- D column. The 6.2 kb fragment was microinjected into FI hybrid zygotes from C57BI/6J and DBA/2J strains according to standard procedures. 2.2.2 Generation of S-opsin-lD4 Transgenic Mice The DNA sequence encoding for rhodopsin 1D4 epitope (ETSQVAPA) was inserted immediately before S-opsin stop codon by two-step PCR. First, using pBlopsin construct as the template, two PCR fragments were synthesized by two 37 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. pairs of primers: MBOTFl: 5 ’ GG AGGT G AGT CAT AT GGT GGTGG3 ’ and MBOTRl: 5 ’ GGCTGGAGCCACCTGGCTGGTCTCGTGAGGGCCAACTTTGCTAGAAG 3 ’ were used to amplify the PCR product of 5’ portion of S-opsin with 1D4 DNA sequence overhang at 3’. MBOT F2 and Sopsin_R2 primers were used to amplify the PCR product of 3’ portion of S-opsin cDNA sequence with 1D4 DNA sequence overhang at 5’. Then these two PCR products were purified with QIAEXII kit and used as template in the third PCR reaction using MBOT Fl and MBOT R2 primers to obtain the PCR fragment with inserted 1D4 sequence before the S-opsin stop codon. The orginal fragment in pBlopsin construct was then replaced with the 1D4- inserted fragment to obtain pRhoMBT construct. The sequence of S-opsin-1D4 insertion fragments was verified. The next procedures are the same as described in section 2.2.1. 2.2.3 Genotype Analysis S-opsin transgene positive mice in both S-opsin and S-opsin- 1D4 lines were identified by transgene-selective PCR amplification with primers MBO-SCREENR (5’ GT A AT GC AGT GT GGCC ACC AGC ACT AT G 3’) and Rhl.l (5’ GTGCCTGGAGTTGCGCTGTGGGA 3’). S-opsin transgenic mice were bred to rhodopsin or arrestin knock out mice to obtain various backgrounds. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 2.2.4 Immunohistochemistry All experimental procedures involving mice were performed in accordance to ARVO and USC LACUC guidelines. Mice were euthanized by CO2 inhalation followed by cervical dissociation. The superior pole was marked by cauterization before enucleation. Eyecups were immersed in fixative (4.0% paraformaldehyde, 0.5% glutaraldehyde with 0.1 M cacodylate buffer pH 7.2) for 1 hr at 4°C and cryoprotected in 30% sucrose with 0.1 M cacodylate buffer (pH 7.2) overnight. The eyecups were embedded in O.C.T. (Tissue Tek) and frozen immediately over liquid nitrogen. Tissues were sectioned into 10 pm thickness using cryostat (Leica). Sections were incubated with 1:100 dilution of antibody made against S-opsin N-terminal sequence H2N- SGEDDFYLFQNISSV-COOH (MBON) or C-terminal sequence H2 N- GSQKTEVSTVSSSKVGPH-COOH peptides (MBO C) (QCB Biosources) for 1 hr and 1:500 dilution of goat anti rabbit IgG conjugated with FITC or Texas Red (Vector Labs). Prepared sections were viewed using a Zeiss LSM 510 confocal microscope. 2.2.5 Morphology The superior pole was marked by cauterization before enucleation. Eyecups were fixed overnight in 1/2 Kamovsky buffer (2.5% glutaraldehyde, 2% paraformaldehyde, and 0.1 M cacodylate buffer, pH 7.2) and embedded into epon as described (reffrancis). The epon-embedded eyes were sectioned into 1 pm thickness 39 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. and stained with Richardson’s stain (0.5% methlene blue, 0.5% Borax, and 0.5% Azure II). 2.2.6 Western Blot Retinas were dissected under infrared light in cold PBS at age ~ 1 month. Each retina was homogenized in 100 pi western homogenization buffer (80 mM Tris-HCl, 4 mM MgCl2, 1 mM CaCfr, and protease inhibitor cocktail (Boehringer Mannheim), pH 8.0) and incubated with 2 pi DNasel (10 U/ pi; Boehringer Mannheim) for 30 min at RT. An equal volume of SDS-loading buffer was added to each sample and the indicated amounts were separated on 12% Tris-Glycine polyacrylamide gel (Invitrogen Corp.). The proteins were transferred O/N onto a nitrocellulose membrane, which was incubated with mAb 1D4 (1:10000), mAb 4D2 (1:10000), rAb MB O N (1:1000), or rAb MBOC (1:1000) for 1 hr and then with goat anti-mouse or anti-rabbit IgG conjugated to horseradish peroxidase for 30 min. The ECL system (Amersham Pharmacia) was used for immuno-detection. 2.2.7 Measurement of Rhodopsin Amount by Differential Absorption at 500 nm Mice are dark-adapted O/N and the retinas were dissected under infrared light. Retinas were solubilized for 2 hrs at 4°C in solubilization buffer (10 mM Hepes, 2 mM MgCb, 2 mM CaCfr, 1% dodecyl matltoside (DM), and 150 mM NaCl, pH 7.5) and centrifuged at 15,000 x g for 30 min at 4°C. The supernatant was taken for either OD reading at 500 nm or wavelength scanning from 280 to 600 nm 40 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. before and after the complete rhodopsin bleaching with white light. The concentration of rhodopsins were calculated by differential absorption at 500 nm (OD5oo[dark]- OD5 0 o[light]) divided by extinction coefficient of 41, 000 (L moles' W 1 ). 2.2.8 Northern Blot RNA was extracted using Trizol reagent (Invitrogen). The RNA pellet was dissolved in 10 pi RNA buffer (67% formamide, 3 mM Tris-HCl, 0.3 mM EDTA, pH 8.0), boiled for 5 m at 95°C, and chilled on ice for 2 m. After running the RNA sample on a denaturing 1% agarose gel made with 1 x RNA buffer (20 mM MOPS, 5 mM sodium acetate, 1 mM EDTA, 2.2 M formaldehyde, pH 7.0), the gel was transferred to nitrocellulose membrane in 20 x SSC. The membrane was washed in 6 x SSC, UV crosslinked and prehybridized with prehybridization buffer (50% fromamide, 5 x SSC, 20 mM Na2P 0 4, 7% SDS, 0.5% milk, 1% 10K PEG, pH 7.4) at 42°C for 1 hr. The 1 kb S-opsin cDNA sequence was digested from pBlopsin construct to use as a template for making the 3 2 P probe. The probe (minimum 106 cpm/ml) was purified by Elutip-D column, boiled at 95°C for 5 m, chilled on ice for 2 m, and incubated with membrane containing pre-hybridization buffer with 100 pg/ml salmon sperm DNA O/N at 42°C. The membrane was washed twice with 2 x SSC, 1% SDS and twice with 0.5 x SSC, 1% SDS for 15 m each time at 42°C. The membrane was exposed to Kodak film at -70°C O/N. 41 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 2.2.9 Separation of Rhodopsin and S-opsin Using Con A Sepharose Supernatant of solubilized retina membrane was incubated with 50 pi Con A sepharose 4B (Sigma) equilibrated in the solubilization buffer with 10 mM methylmannoside. The ConA sepharose beads with bound rhodopsins were centrifuged at 1,000 x g for 5 min and the supernatant was recovered with most S- opsins unbound with Con A sephaorse. To obtain rhodopsin, the rhodopsin bound Con A sepharose beads were washed three times with solubilization buffer, and 150 pi elution buffer (10 mM Hepes, 2 mM MgCl2, 2 mM CaCl2, 0.1% DM, 150 mM NaCl, and 0.2 M methylmannoside, pH 7.5) was mixed with the Con A separose for 30 min. Elution buffer with Con A sepharose was transferred to GlassMAX spin catridges (GibcoBRL) and the flow through was collected after centrifugation of the spin catridges at 1000 x g, 5 min. 2.2.10 Visual Pigment Phosphorylation Assay S-opsin-lD4/S-opsin+ rho +/- retina was dissected under infrared light and incubated with 100 pi Krebs buffer (100 mM Hepes, 120 mM NaCl, 4.8 mM KC1, 1 mM MgSOzj, 10 mM glucose, and 1 mM CaC^) with 1 mCi/ml 3 2 P-orthophosphate for 1 hr. The excess P-orthophosphate was removed by washing the retina three times with Krebs buffer. The retina was either kept in the dark or exposed to a calibrated flash and immediately homogenized in 150 pi urea buffer (8 M urea, 20 mM Tris-HCl, 5 mM EDTA, pH 7.4). The retina homogenate was centrifuged at 13,500 x g for 10 min, and the membrane pellet was washed with 20 mM Tris-HCl 42 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. (pH 7.4) 3 times and solubilized with 50-100 pi solubilization buffer with 10 mM methylmannoside for 3 hr. The sample was centrifuged at 13,500 x g for 10 min, and the supernatant was recovered for Con A sepharose purification to separate rhodopsin and S-opsin. The unbound (S-opsin) and bound (rhodopsin) fractions of Con A sepharose were loaded onto SDS-PAGE, transferred to nitrocellulose membrane. The membrane was exposed for P radioactivity on film. 2.3 Results 2.3.1 Expression of S-opsin in Rod Photoreceptors We have constructed two transgene fragments, S-opsin-lD4 and S-opsin, encoding mouse S-opsin with and without 1D4 epitope (last eight amino acids of rhodopsin sequence: ETSQVAPA) at the C-terminus, respectively (Fig. 2.1 A). Transgenic mouse lines expressing S-opsin-1D4 or S-opsin specifically in rod photoreceptors, were produced. The reason to create S-opsin-1D4 transgenic line in addition to S-opsin transgenic line is of the concern that whether S-opsin could traffick to rod outer segment with a varied C-terminal sequence from rhodopsin C- terminus, which was considered as an indispensable targeting signal for rhodopsin trafficking to rod outer segment. In the following sessions, “S-opsin/S-opsin-lD4” was used to mean S-opsin or S-opsin-1D4. The S-opsin/S-opsin-lD4 trangene expressions were first assessed by Northern Blot using a lkb probe complementary to MBO cDNA sequence (Fig. 2.1 B). A positive band at ~1.2 kb was observed in transgene positive and control 43 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. A S -opsin S-opsin -1D4 4.4 kb rhodopsin prom oter S-opsin cDNA mp1 4.4 kb rhodopsin promoter S-opsin cDNA 1D4 epitope: ETSQVAPA o B c L Q - S-opsin -► 4 Figure 2.1. S-opsin and S-opsin-lD4 transgenic lines. (A) Transgene constructs of S-opsin and S-opsin-1D4 transgenic mice. The 1.2 kb S-opsin or S-opsin- 1D4 coding sequence was ligated with 4.4 kb mouse rhodopsin promoter and 0.6 kb m pl sequence, the latter to supply a splicing site and polyadenylation signal. Compared to S-opsin, S-opsin-lD4 construct contains an additional nucleotide sequence encoding ETSQVAPA (the last eight amino acids of rhodopsin) at 3’ end of S-opsin conding sequence immediately before the stop codon. (B) Northern Blot comparing S-opsin mRNA expression level (per retina) between transgenic S-opsin or S-opsin-lD4 rho+/- lines and rho+/- controls. The probe used was an 1 kb fragment of S-opsin cDNA sequence. (C) Western Blot to quantify S-opsin protein expression level between transgenic lines and rho+/- controls using MB O N antibody. Different amounts of retina homogenates were loaded as indicated by the fraction of one retina. 44 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. samples. In rho+/- control, the hybridization signal came from the expression of endogenous S-opsin mRNA in native S-cones. Compared with the control, both S- opsin and S-opsin- 1D4 transgenic lines showed significant higher expression levels of S-opsin mRNA, suggesting that the transgene indeed was over-expressed in rod cells. The expression levels of S-opsin in trangenic lines were also quantified by western blot (Fig. 2.1 C). As shown with MBO_N antibody, which recognizes N- terminal region of S-opsin, S-opsin levels in both S-opsin+ rho+/- and S-opsin-lD4+ rho+/- mouse were 20 times of that in rho+/- controls. In order to compare the phototransductive functions of rhodopsin and S-opsin quantitatively in future experiments, it is necessary to know the composition of rhodopsin and S-opsin in S- opsin+ rho+/- mouse. We thus estimated the relative amount of transgenic S-opsin to endogenous rhodopsin in S-opsin-lD4 or S-opsin lines under rho+/- backgrounds. For S-opsin-lD4, we used 1D4 antibody, which is raised against rhodopsin C- terminus, to label rhodopsin in rho +/- retinas, transgenic S-opsin-1D4 protein in S- opsin-lD4+ rho-/- retinas or both rhodopsin and transgenic S-opsin-lD4 in S-opsing- 1D4+ rho+/- retians. Expression level of S-opsin-lD4 in S-opsin-lD4+ rho-/- retina is ~ 10% of rhodopsin level in rho+/- retina (Fig. 2.2 A). Then MBO N antibody was used to compare the expression level of S-opsin in S-opsin+ rho+/- retina to that of S-opsin-lD4 in S-opsin-lD4+ rho+/- retina (Fig. 2.2 B). The transgene expression in the S-opsin-1D4 line is a little higher than that of S-opsin line, but the difference is less than two fold. In addition, we also compared rhodopsin expression levels 45 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. S -o p s in -1 D 4 t,rhot|- rts o t/- S -o p s ii)-1 D 4 +,fa'- o o o o o o o o o o o o o o o o o o (N'OOOfN'OOOOCN'O O O O on*— oo'tf-rn*— B S-opsiEi+, rtio+/- S-opsin-1D4+, rho+/- o o o o o o o o o o OOOOfNvOO OOO > — 00 ■ '3 'm •— oo rhodopsin m S-opsin rhodopsin-► D 0.14. 0.1 2 . o 0.10. o ^ 0.08 O O 0.06 — 0.04. 0.0 2 . 0. +,+/- Figure 2.2. The relative protein expression level of transgenic S-opsins to endogenous rhodopsins. (A) Western blot using 1D4 antibody (against rhodopsin and S-opsin-lD4 C-terminus) to compare S- opsin-lD4 (S-opsin-lD4+, rho-/-) with rhodopsin (rho+/-) or both rhodopsin and S-opsin-lD4 (S- opsin-lD4+, rho+/-) expression levels. (B) Western blot using MBO_N antibody (against S-opsin N terminus) to compare the transgene S- opsin expression level between S-opsin-lD4 and S-opsin lines. (C) Western blot using 4D2 antibody (against rhodopsin N-terminus) to compare the rhodopsin expression level between S-opsin-lD4+, rho+/- (+, +/-) and negative control (-, +/-). (D) Rhodopsin expression level between S-opsin-lD4+, rho+/- (+, +/-) and negative control (-, +/-) measured by differential OD reading at 500 nm before and after complete bleaching. 46 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. between S-opsin-lD4+ rho+/- and rho +/- control. Surprisingly, by the western blot using 4D2 antibody, which recognizes rhodopsin N-terminus, we found that, the rhodopsin expression in S-opsin-lD4+ rho+/- line is only half of rho +/- controls (Fig. 2.2 C). This result is also consistent with the comparison of rhodopsin amount by differential (before and after bleaching) OD5 o o n m of solubilized S-opsin- 1D4 retinas (Fig. 2.2 D). In conclusion, we have obtained two transgenic mouse lines - S-opsin and S- opsin-lD4 that expressed S-opsin visual pigment in rod photoreceptors, and the ectopically expressed S-opsin comprised -10% of total amount of S-opsin and endogenous rhodopsin in S-opsin/S-opsin-lD4+ rho+/- lines. 2.3.2 Targeting of Mouse Cone S-opsin to Rod Outer Segment In order to use S-opsin transgenic mice for functional studies of cone visual pigment, the ectopically expressed S-opsin needs to be targeted to the rod outer segment in the absence of endogenous rhodopsin. Mice carrying S-opsin or S-opsin- 1D4 transgene were bred into rhodopsin +/- and -/- backgrounds, and localization of the ectopically expressed S-opsin in retinal sections was performed using MBO_N antibody raised against the N-terminal region of S-opsin. In control retinal sections, S-opsin reactivity was observed in a subset of cones that were more numerous at the inferior pole of the retina (Fig. 2.3 A). For the S-opsin-1D4 or S-opsin transgenic line, retinal rods that expressed the S-opsin transgene and rhodopsin showed S-opsin localization exclusively in the ROS (Fig. 2.3 B and D), indicating that the transgene 47 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Figure 2.3. Mouse S-opsin localization in S-opsin-lD4 and S-opsin retinas. All sections were probed with MBO N antibody followed by secondary antibody conjugated with FITC. For genotype in B, the sections were also stained with 1D4 antibody followed by secondary antibody conjugated with Texas Red and the merged picture was shown. 10 pm frozen retinal sections were prepared from mice at ~1 month old. (A) Inferior region of rho +/- control retina showed S-opsin immunostaining (green) at the S-cone outer segment. (B and D) S -opsin expressed ectopically in rod cells of rho+/- retina of S-opsin-1D4 (B) and S-opsin (D) mice. (C and E) S-opsin expressed in the absence of rhodopsin in rho-/- retinas o f S-opsin-lD4 (C) and S- opsin (E) mice. 48 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. was indeed over-expressed in rod cells. Remarkably, in both S-opsin-1D4 and S- opsin retinas, ectopically expressed S-opsin was able to traffic to the ROS and reconstitute ROS-like structures, even in the absence of rhodopsin (Fig. 2.3 C and E). Overall, these results indicate that the C-terminal sequence of S-opsin contains a targeting signal strong enough to direct the pigment to the outer segment not only in cones, but in rods as well. 2.3.3 Morphology of S-opsin Transgenic Mouse Retina The retinal morphology of S-opsin/S-opsin-lD4+ rho+/- or S-opsin/S-opsin- 1D4+ rho-/- mouse was examined on retinal sections by light microscopy. With rho+/- background, the retinal morphology of S-opsin/S-opsin-lD4 trangenic mouse was indistinguishable from that of normal negative controls at both 3 weeks (Fig. 2.4 A, upper panels) and 7 weeks (Fig. 2.4 B, upper panels). With rho-/- background, we observed retinal degeneration in both lines indicated by reduced thickness of outer nuclear layer and disrupted outer segment structure in mice at age of 3 and 7 weeks (Fig. 2.4 A and B, lower panels ). Nevertheless, S-opsin-i- rho-/- mouse did from outer segment structure and had thicker outer nuclear layer than the age-matched rho-/- controls (Fig. 2.4 A and B, lower panels), allowing us to perform single cell recording from its rod cell. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. rho f / S op sin -1 D 4 + ih o i/- S-opsin t rho >/- 5 opsin t rhot/ S opsin 1D4t rhotV S opsin-1 D4+ rfio7J S o p .i p - rho*/- Figure 2.4. Morphology of S-opsin-lD4 and S-opsin retinas. (A) Comparison of retinal morphology between transgene positive (S-opsin and S-opsin-lD4) and negative mice under rho+/- or rho-/- backgrounds at age o f 3 weeks. (B) The same as in (A) except that the mice were of age 7 weeks. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 2.3.4 Phosphorylation of Ectopical S-opsin with UV light Exposure To date, rhodopsin kinase is the only identified visual pigment kinase in mouse photoreceptors. It is believed that both mouse rhodopsins and cone opsins are native substrate of rhodopsin kinase in vivo. We tested whether ectopically expressed S-opsin could undergo light dependent phosphorylation in S-opsin- 1D4+ rho+/- retinas. Because rhodopsin and S-opsin have similar molecular weights, it is necessary to separate rhodopsin from S-opsin in order to visualize the incorporation of 3 2 P into S-opsin by autoradiography on SDS-PAGE. Rhodopsin was removed from solubilized retinas by specific binding of rhodopsin to Con A sepharose with 10 mM methyl-mannoside. Under this methyl-mannoside concentration, some S-opsin also bound with Con A sepharose but the majority remained in the supernatants (Fig. 32 2.5 A). Retinal proteins in the supernatants were separated on SDS-PAGE. P labeled proteins were visualized by auroradiogrphy. We found that S-opsin-lD4 became phosphorylated following UV light stimulation (Fig. 2.5 B). The rhodopsins were also phosphorylated upon light exposure (Fig. 2.5 C). As expected, no rhodopsin phosphorylation was observed in rhodopsin kinase knock out retinas (Fig. 2.5 D). In conclusion, this data indicates that S-opsin undergo UV light-dependent phosphorylation. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Lysate FT Wash Elution « i 4 S-opsin 4RHodopsin B 1 2 3 4 5 6 7 8 * • 4 S -opsin 4 S-opsin 1 2 3 4 5 6 7 8 ik t cc § 0 * * m 4Rhodopsin 1 i ............. 4Rhodopsin Figure 2.5. Phosphorylation o f transgenic S-opsin in response to UV light. For panel (B) and (C), the samples are numbered as: 1, 3, 5, 7 - rho+/-; 2, 4, 6, 8 - S-opsin- 1D4+ rho+/-; 1,2- UV 10m; 3, 4 — UV 15s; 5, 6 - UV 3s; 7, 8 - dark. (A) Separation of S-opsins from rhodopsins in dark S-opsin-lD4+ rho+/- retinas using Con A sepharose. (Upper) Western blot showing S-opsin amount (by MBO_N antibody) of each Con A purification fraction. (Lower) Western blot showing rhodopsin amount (by 4D2 antibody) of each Con A purification fraction. (B) (Upper) 3 2 P activity autoradiograph of Con A sepharose flow through after binding with solubilized retina. S-opsin-lD4 location was indicated. (Lower) Western Blot to confirm S-opsin-lD4 location using MBO N antibody. (C) 3 2 P activity autoradiograph of Con A sepharose elution after binding with solubilized retina. Rhodopsin location was indicated (D) 3 2 P activity autoradiograph of ConA sepharose elution after binding with retina homogenates from RK-/- and WT mice. 52 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 2.4 Discussion Transgene expression of exogenous proteins is a widely employed approach to manipulate the expression of endogenous or exogenous proteins in specific retinal cell types (Akimoto et ah, 2004; Chen et ah, 1994; Janz and Farrens, 2001; Knox et al., 1998). Recently, many transgenic mouse models have been produced to dissect the specific functions of molecules involved in retinal physiology and disease. In this study, we created transgenic mouse lines that expressed mouse cone pigments - S- opsins in the rod cells. The expression level of S-opsin in both lines were estimated to be -10% of that of both rhodopsin and S-opsin under rho+/- background. The ectopically expressed S-opsin translocates properly to the rod outer segment, reconstitutes a ROS like structure in the absence of rhodopsin, and undergoes phosphorylation when excited by UV light. When starting this project, we are concerned about one possible risk for S- opsin mouse model since S-opsin may not be transported correctly to the outer segment in the rod cells. Recently created in vivo animal models have revealed the importance of rhodopsin’s C-terminus in its polarized transport to the rod outer segment. In addition, research conducted in our own laboratory showed that transgenic mouse lines that expressing S334ter or Q344ter that lacked the last 15 or 5 amino acids of rhodopsin, respectively, failed to elaborate an outer segment under the rhodopsin -/- background, presumably due to their defects in trafficking (Concepcion et al., 2002; Shi, 2004). The QVAPA motif at the distal carboxyl terminus of rhodopsin is highly conserved among diversed vertebrate species (Table 53 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 2.1). A comparison of this motif with cone pigments shows V345 and P347 to be conserved between these two classes of visual pigments. Other residues, such as Q344, A346, and A348, are less conserved between the rod and cone pigments (Table 2.1). To account for the possible mis-trafficking of ectopically expressed S- opsins with an intact sequence, we produced two transgenic lines, one (S-opsin) expressed the intact S-opsin whereas the other (S-opsin-1D4) expressed the S-opsin appended the 1D4 epitope containing the last eight residues of rhodopsin. In this chapter, it was shown that S-opsin, when ectopically expressed in murine rods, localized correctly to the rod outer segment in the presence or absence of endogenous rhodopsin, suggesting that molecular mechanisms underlying targeting of visual pigments in rod and cone photoreceptors are highly conserved. The fact that ectopically expressed cone S-opsin could be transported to the ROS implicates that distal C-terminal VXPX motif constitutes the most important “ROS address” to direct visual pigments to ROS. Beyond the scope of visual pigments, we performed a search on human protein databases using ScanProsite (http://us.expasv.org/tools/scanprosite/') to find other proteins that contain -VXPX motifs. Twenty-six proteins fulfilled these criteria (Table 2.2), which included rhodopsin, blue opsin, green opsin and red opsin, the proteins known to localize to photoreceptor outer segments. For other proteins in the table, it would be interesting to see whether all-trans retinol dehydrogenase, a known photoreceptor protein, will localize to ROS. Whether the rest of other proteins on this list are expressed in the 54 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. rod opsins Mouse rho E T S Q V A P A Bovine rho E T S Q V A P A Rabbit rho E T s Q V A P A Human rho E T s Q V A p A Xenopus rho S S s Q V S p A Rana temporaria rho S T s Q V S P A Bufo marinus rho s S s Q V S P A Bufo bufo rho s S s Q V S p A Salamander rho s S s Q V S P A Alligator rho s T s Q V S p A cone opsins Mouse M-opsin S V s s V S P A Mouse S-opsin S s s K V G P H Bovine blue S s s Q V G P N Xenopus violet s s s Q V S P A Human red s V s S V S p A Human green s V s S V S P A Human blue s s T Q V G P N Table 2.1. A comparison of C-terminal sequence of rhodopsins and cone opsins among different vertebrate species. The last eight amino acids are included. All the visual pigments shown share the conserved proline and valine residues at the same positions. Residues at other positions show variations among different visual pigments. 55 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. P ro te in s C -:e m i n al s e a u e n c e s 1 Protein A OG13 .-HFCLOKFlSTvHPI 2 Cbotecystokmin typeA receptor ... FPCCP fJPG FFurt RG E/GEE EEGGTT 6A SLSRFSYEHfflSASV PPG 2 T Ivm ohocvte adfvatrarr antia sn CDS® precursor . ..VICCLTTCF^FRCRERRRf JERLRRESVRPY 4 Chloride intra-cel luiar channel protein 3 . ..TVCA HFROAPIP.A ELRGVRRYLD SA.MQEKEFKYTCPH S A BUI AYRPAVHFR 5 Cdlaqervfi brinoqen domai tk: ontaini nq prate) n 1 . J, DCHA 5NLNGLYIMGRHE5YA NGMAfSAA KGYKYSYKVSBfh RPA 6 Collao&ivfi brinooen dorciaj i>c ontaini no G rata n 2 . „KMCHV5MLNGRYLRGTHG 5F ANG W iK 5GKGY f JYSY KtfS Bi K Wh 7 Blue-sens itive oos in .-IYCFM rtfQQraaHHMVCGKftHTDESCirC S S-GKT E S 7 .SW 5 -STG'vG P N a Rhodoossn: . J3HCU LTTIOCGKT-IPLGDDEA SATVSKTETSG AF H a Red-sensitive opsin ...RIICIU3LRjKK}.CI[}GSB.5SASKrEVSSVSS, SPA 1 0 Qreervsensithre cesin ... RNCILGLFGKKVC CG S ELS S A S KIEV S SV 5 S V SF A 11 PCS and L IM i domain protein 1 . JECYVCrOOGTNLKQHGHFFVEDQI YCEKHA RERVTPPEGYEWTV FPK 12 Vtneaun . ..QQCD DGMR/GV SR RTGKF GTF PG NY V A FV 13 Guqu alpha .J^ECPGFAQHASPLVLPP 14 forty B-cel I factor . „P TCTSTNGN5LQR 15GM WPPM 15 Beta - 2-al vc g o to ! e in I . .FFCKTJKB<KCSYTEDAOCIDGTI EVPKCFKEHSSLA P^iKT DASDVKFC Iff Hepatocyte qrovAh fectsracthator .. .DG CG RUHKPG VYTRVA NYLTAMNDRIRPPRRLVA P 5 17 IL1 JRhom . „G SCKADLGCRSYT DELHAVA PL i t Lam befci-crystal! in . . m CUKyPDDPEHLAA RRWRDECLM RLA KLKSO\QPG I S Phot orec set or oute r secimeritall-traiis retinol debvdroasnase . .FRCFRLLMLGLCCLS CGCL FTRFRPR 2# CG147' protein . ..QQCSLFSVW E LA RLKS R/FPG 21 Al cha 1 E >a drenorecertor .-VLCWUFPFFP/LPL 22 IL-17RD . -GSCKADLGCRSYT DELHA V A FL 23 VSGP/F-soondtni .-SECTKLCC^BBWfjrr/KKRFKSSCFTSCKDKKEIRACH HFC :24 Phosphatidy l inositol cjlycan class I precursor .J/ICLTCT^/AraGSFYNLLTRTFHlEEFRrGGUKRUNLIRRA RG PPL 25 Se 1 -1 -1 ike protein . ..PRCTS SSLP SFLdGHRLFUVHTGNKH SRYVLPT Folate trail soorter ...PVCPS E/CPS Table 2.2. Proteins with [Cn]-VXPX motif at C-terminus in human protein database. 56 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. photoreceptor cells is less clear. Because they also contain the “ROS address”, they may be targeted to the apical membrane if they are expressed in polarized epithelia. Furthermore, the S-opsin transgenic lines have great values in several future areas. First, they provide a rich source of naturally scarce cone visual pigments for biochemical experimentation. We showed that the over-expressed S-opsin can be separated from rhodopsin by Con A sepharose. Moreover, 1D4 immuno-affinity purification can be applied to the S-opsin-1D4 line to obtain pure S-opsins. Second, because the S-opsins are expressed under physiological environments of intact photoreceptors, the S-opsin mice could be used for studying the processes involving the interaction of S-opsins with other molecular components in photoreceptors, such as the biochemical process of regeneration and photo-transduction. Third, we can take advantage of mouse S-opsin spectral properties, which is insensitive to middle- long wavelength light (>515 nm). This unique spectral property has been employed to demonstrate the trans-phosphorylation of dark visual pigments in studies described in chapter 4. In addition, S-opsin mice could be used to measure the 2 ~ F 9 + intracellular Ca concentration of photoreceptor at dark state by [Ca ]-sensitive fluor dyes without the interferences from changes in [Ca2 + ] as a result of visual pigment activation elicited by light to excite the fluor dyes. Several other mouse models have been recently employed to evaluate cone functions such as rhodopsin -/- mouse at a young age (Jaissle et al., 2001), transducin -/- and arrestin -/- (Lyubarsky et al., 2002). The rhodopsin -/- model did not develop 57 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. functional rods due to its lack of rhodopsin expression yet its retina contained viable cones before 3 weeks of age, therefore light response recorded from rhodopsin knockout mouse was purely from cones. In arrestin knockouts, rod photoresponse saturates under very dim background light below cone response threshold, because arrestin is necessary to shut off transduction cascade. So cone response from arrestin -/- mouse could be isolated under such light conditions. Transducin knockout model lacks G-protein transducin, which is indespensible for transducing light signals in rods, therefore, light response can only arise from cone phototransduction cascade. In addition, Nrl -/- mouse, which lacked the transcription factor Nrl required for the rod development, only developed cones in the retina (Mears et al., 2001). Using Nrl - /- retinas, it was shown that mouse S-opsin and M-opsins undergo light-dependent phosphorylation by rhodopsin kinase (Zhu et al., 2003), which is consistent with our results. However, the retinal morphology and single cell recording of Nrl -/- cones exhibit a rod-like waveform, suggesting that properties cones may not be fully represented in this mouse model. Compared to the above mouse models, S-opsin mouse model offers the advantage of the direct comparison of the rod and cone components in shaping the light response since they reside in the same cellular environment. The successful expression of S-opsin in the foreign photoreceptor type made the first step for the future attempts to reconstitute other cone phototransductive molecules into rods. Furthermore, many phototransductive and regulatory molecules have been knocked out including rhodopsin (Lem et al., 1999), arrestin (Xu et al., 1997), rhodopsin kinase (Chen et al., 1999), transducin (Calvert et 58 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. al., 2000), GC-1 (Yang et al., 1999), GCAP (Mendez et al., 2001) and recoverin (Makino et al., 2004). So the selective expression of either rod or cone molecules can be easily manipulated by mouse breeding into different knockout genetic backgrounds. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Chapter 3 Phototransductive Properties of Mouse Cone S-opsin in Rod Photoreceptors 3.1 Introduction This chapter presents the investigations on the molecular mechanisms underlying functional differences between rods and cones. As discussed in section 1.6, rods and cones generate photoresponses with vastly different amplitudes and kinetics. In primates, rods are 100-fold more sensitive than cones whereas cones are kinetically faster than rods (Baylor et al., 1984; Schnapf et al., 1990). The distinct photoresponses produced by rods and cones corresponds well to their complementary visual functions. For example, rods operates under dim light and can reliably signal a single photoisomerization while cones functions at day light and never saturate under the lighting conditions of natural environment (Rodieck, 1998). However, further understandings of the rod-cone functional differences at molecular level have been hindered by the fact that most experimental animal models are rod- dominant. Phototransduction cascade in photoreceptor cells refers to a series of biochemical reactions by which visual signals in the form of photonic stimulus are converted to changes electrical current on outer segment membrane. The proteins involved in phototransduction pathway are highly concentrated on the outer 60 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. segments - the specialized compartment that can be easily detached from other compartments of the photoreceptor cell. This have offered great advantages for the functional studies of molecular components mediating visual transduction in biochemical experiments using purified proteins from isolated rod outer segments (Pugh and Lamb, 2000). The biochemical reactions mediating the phototransduction cascade have been extensively investigated and understood in great details (Fung et al., 1981; Stryer et al., 1983). First, light absorption of 11-cis-retinal causes its isomerization to all-trans retinal, which induces a series of conformational changes of opsin covalently bonded to the chromophore and leads to the formation of the catalytically active meta-II visual pigment intermediate (Menon et al., 2001). Second, the meta-II intermediate binds to the G-protein transducin and catalyzes the GDP dissociation and GTP association on the a subunit of transducin, therefore the transducin a subunit is activated and released from Py subunits. Third, the GTP-bound transducin a subunit activates the downstream effector phosphodiesterase (PDE) by binding with the inhibitory PDE y subunit to expose the catalytic sites on the PDE aP subunits. Finally, the activated PDE catalyzes the hydrolysis of cytoplasmic cGMP to 5’GMP, which results in a drop of cytoplamic cGMP concentration. Then the cGMP-gated cation channel on the outer segment membranes closes, which causes the reduction of the steady inward current carried by Na and Ca ions and hence photoreceptor hyperpolarization. 61 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. The suppression of the membrane current on outer segment can be recorded using a suction electrode from a single cell (Baylor et al., 1979a). This technique, known as single cell recording, has been used extensively as a powerful electrophysiology method to evaluate the sensitivity and kinetics of the light-evoked electrical responses (photoresponses) in intact photoreceptors. Furthermore, the parameters of photoresponse waveforms such as amplitude, time to peak and integration time (see section 1.4), reflect some important photoresponse features including senstitivity and speed, which are set by the nature of biochemical reactions in phototransduction cascade. The remarkable detection capability of the suction electrode recording and the quantum nature of photon stimulus and pigment activation have allowed the derivation of the response elicited by the activation of a single visual pigment, known as single photon response, by Poisson statistics from dim flash responses (Baylor et al., 1979b). Since the characterization of key biochemical events involved in visual transduction and the development of suction electrode recording technique, there have been many efforts to correlate the relationship between the biochemical measurements and response waveforms to elucidate the molecular mechanisms underlying the visual transduction (Lamb and Pugh, 1992; Pugh and Lamb, 1993). Moreover, parameters of biochemical reactions such as substrate concentrations, enzyme catalytic activity, rate constants of reactions, and life times of active molecules obtained from biochemical assays, were incorporated into differential equations that describe the amplification and kinetics of the photoresponses under 62 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. certain assumptions (Pugh and Lamb, 2000). The theoretical photoresponses derived from these mathematical equations can be fitted with experimentally recorded responses to modify the initial assumptions of the mathematical analysis or extract useful biochemical parameters from response waveforms. For example, the quantitative analysis of phototransduction amplification stages corresponding to the early rising phase of dim flash response have been used to extract the gain of the biochemical cascade from empirical response curves, in terms of an amplification constant determined by coupling efficiency among phototransductive molecules (visual pigment, transducin, PDE) and Hill coefficient of cGMP-gated channel activation (Pugh and Lamb, 2000). To date, the mathematical models of phototransduction have provided predictions of the photoresponses consistent with responses recorded experimentally under intact or altered physiological conditions. Moreover, the deactivation phase of the photoresponse was modeled based on the reactions to down-regulate the catalytic activities or life times of phototransductive molecules (rhodopsins, transducins, PDEs) and the re-synthesis of cGMP by guanylyl cyclase (GC) (Pugh and Lamb, 2000). It seems that the declining phase is more complicated to analyze than the rising phase, due to the interwined activities from a variety of regulatory proteins such as rhodopsin kinase, arrestin, RGS-9 and GCAP and the integration of feedback reactions regulated by Ca2 + with other parallel reactions. Recently available transgenic and knockout mouse models have greatly facilitated the functional dissection of contributions of each branch of deactivation mechanisms and provided the experimental verification of computationally 63 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. simulated photoresponses using mathematical models (Chen et al., 2000; Chen et al., 1999; Chen et al., 1995b; Mendez et al., 2000; Mendez et al., 2001; Xu et al., 1997). Another useful electrophysiological technique to examine photoreceptor activity is via the electroretinogram (ERG) recorded at the comeal surface of eye in response to a flash of light. ERG response typically consists of a negative a-wave going downward followed by a positive b-wave going upward. The leading edge of the a-wave reflects activity originating from photoreceptors while b-wave is produced by the action of other retinal cell types. Compared to photocurrent recordings, the ERG provides a noninvasive procedure to examine the photoreceptor functions. In addition, it is more suitable to study the photoreceptor adaptation by ERG than single cell recordings because adaptation involves the visual pigment regeneration that requires an intact contact between retinal pigment epithelium and photoreceptors. It has been shown that the leading edge of rod ERG a-wave can be quantitatively described by the amplification stages of phototransduction and successfully fitted with theoretically derived parameters consistent with the early rising phase of dim flash responses by single cell recordings. However, compared to single cell recording, ERG method also has two disadvantages that limited its application to study the photoreceptor physiology. First, since ERG is produced by the combined actions of both photoreceptors and other retinal cell types such as bipolar and Muller cells, the analysis of response recovery was not straightforward due to the intrusion of ERG b-wave and oscillatory potentials at the same time of response recovery, attributed by activities of other cell types. Nevertheless, novel 64 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. ERG procedures such as paired-flash protocols have emerged recently and seemed promising to analyze photoreceptor recovery kinetics following a saturating flash. Second, since both rod and cone photoreceptors contribute to the ERG responses, additional subtractions were needed to isolate rod or cone responses from the total ERG responses. It has been demonstrated that the molecular mechanisms underlying the phototransduction cascade were qualitatively similar from rods to cones. For example, both rods and cones transduce light signals via regulating the activity of cGMP-gated channels by the same molecular machinery composed of visual pigment, transducin, and PDE. Most phototransductive and regulatory proteins identified in rods have their isoforms expressed in cones. However, phototransductive and most regulatory proteins identified in rods and cones are encoded by different genes. The different molecular properties of these different rod and cone molecules could endow phototransduction reaction with different quantitative features, and therefore, give rise to electrical responses differing in size and kinetics. Here, we focused on one such candidate - visual pigment, because several distinct molecular properties have been identified between rod and cone visual pigments. For example, the meta-II intermediate of cone visual pigment decayed much faster than rod pigment in vitro (Imai et al., 1995; Imai et al., 1997b). In addition, the cone visual pigment showed faster regeneration (Shichida and Imai, 1998) and phosphorylation than rhodopsin (Tachibanaki et al., 2001). However, 65 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. whether these different visual pigment properties indeed could mediate the different rod and cone photoresponses in vivo and the extent of their effects are unknown. Previously, we have produced transgenic mouse lines that express mouse S- opsins comprising -10% of total visual pigment level in S-opsin or S-opsin-lD4 rod under rhodopsin +/- background (chapter 2). In this study, we examined the coupling of the ectopically expressed S-opsin with downstream phototransduction cascade in rods and investigated whether the unique intrinsic molecular properties of S-opsin could contribute to the shape of cone photoresponse waveforms. Although rods and cones express different isoforms of a, p, and y subunits of transducin (Fung et al., 1992; Lee et al., 1992; Lerea et al., 1989; Lerea et al., 1986; Ong et al., 1995; Peng et al., 1992), it was also shown, however, that purified Xenopus violet cone opsin was able to activate bovine rod transducin in vitro (Starace and Knox, 1997). In the following sections in this chapter, I described results obtained from electrophysiological recordings of both S-opsin and S-opsin-lD4 rods. Most of these results are similar between the two S-opsin lines, I used “S-opsin/S-opsin-lD4” to refer to either one of them. In addition, we measured the spectral sensitivities of S- opsin/S-opsin-lD4+ rho+/-, S-opsin/S-opsin-lD4+ rho-/- and rho+/- rod, which also provided an alternative method apart from western blot (chapter 2), to estimate the percent of S-opsin/S-opsin-lD4 amount with regard to the total visual pigment level in S-opsin/S-opsin+ rho+/- rod. Furthermore, flash responses elicited by the photoisomerizations of rhodopsins or cone opsins expressed in the same rods were compared, and single photon responses derived from dim flash photoresponses were 66 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. analyzed to illustrate the role of visual pigment properties in shaping response waveforms. 3.2 Materials and Methods 3.2.1 S-opsin transgenic lines The generation and characterization of S-opsin and S-opsin-1D4 transgenic lines were described in chapter 2. 3.2.2 1D4 peptide The 1D4 peptide H2 N-KTETSQVAPA-COOH was synthesized at 95% purity level by Biomer Tech Inc. 3.2.3 Preparation of 1D4 mAb coupled sepharose The CNBr-activated Sepharose 4B powder (Amersham) (lg -> 3.5 ml) was suspended in 1 mM HC1, washed with 1 mM HC1 and equilibrated in coupling buffer (0.5 M NaCl, and 0.1 M NaHC03 , pH 8.3). The monoclonal 1D4 mAh was incubated with the swollen CNBr-activated sepharose in coupling buffer at 4°C O/N with 4 mg 1D4 antibody per ml sepharose. The excess antibody was removed by washing lD4-coupled sepharose with coupling buffer. The remaining groups on sepharose beads were blocked by 0.1 M Tris-HCl (pH 8.0) for 3 hr. The 1D4- coupled beads were washed with 3 cycles of low pH (0.5 M NaCl, and 0.1 M acetic 67 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. acid, pH 4.0) and high pH (0.5 M NaCl, and 0.1 M Tris-HCl, pH 8.0) buffer. Finally, the lD4-coupled sepharose was washed and stored in PBS buffer. 3.2.4 S-opsin-lD4 visual pigment purification with lD4-sepharose affinity beads All the following steps were performed under infrared lights. Retinas from dark-adapted (O/N) S-opsin-1D4 + rho -/- mice were solubilized for 4 hr at RT in 1D4 solubilization buffer (20 mM Hepes, 150 mM NaCl, 3 mM MgCh, 1% dodecyl maltoside (DM), and protease inhibitor cocktail, pH 7.4). The solubilized retinas were centrifuged at 15,000 x g for 20 min. The supernatant was incubated with 1D4- sepharose equilibrated with 1D4 solubilization buffer (50 [il lD4-sepharose per retina) at 4°C O/N, and the S-opsin-1D4 bound lD4-sepharose was washed twice with 1D4 solubilization buffer with 0.02% DM and low salt buffer (5 mM Hepes, and 0.02% DM, pH 7.4). The bound S-opsin-1D4 pigment was eluted by incubating the sepharose beads with 100 |xM 1D4 peptide (biomer Inc.) in elution buffer (5 mM Mes, 0.02% DM, pH 6.0) for 2 hr. 3.2.5 Spectroscopy UV-Vis absorption spectrum of purified unbleached S-opsin-lD4 was scanned on a Beckman spectrophotometer. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 3.2.6 Single Cell Recording Mice were dark-adapted overnight before experiment. Tissue preparation and recording techniques followed procedures described elsewhere (Bums et al., 2002). Briefly, an animal was euthanized by CO2 asphyxiation/cervical dislocation and the eyes were removed under dim red light. All further manipulations were performed under infrared light. The eyes were hemisected and the retinas removed from the pigment epithelium and chopped into small pieces with a razor blade. Small pieces of the retina were placed in the experimental chamber on the stage of an inverted microscope and perfused with bicarbonate-buffered solution (112.5 mM NaCl, 3.6 mM KC1, 2.4 mM MgCl2, 1.2 mM CaCl2 , 10 mM Hepes, 20 mM NaHCCE, 3 mM Na succinate, 0.5 mM Na glutamate, 0.02 mM EDTA, and 10 mM glucose, pH 7.4). The solution was bubbled with 95% 0 2 /5% C 02, and warmed to 36-38 °C in a flow heater before it entered the experimental chamber (Mathews, 1999). Membrane current was recorded with a suction electrode from an ROS projecting from a piece of retina. The recording electrode was filled with 140 mM NaCl, 3.6 mM KC1, 2.4 mM MgCl2, 1.2 mM CaCl2 , 3 mM Hepes (pH 7.4), 0.02 mM EDTA, and 10 mM glucose. 20-msec flashes were delivered from a calibrated light source via computer-controlled shutters. Light intensity and wavelength were changed by using calibrated neutral-density and interference filters. The current was amplified, low-pass filtered at 30Hz, digitized at 1 kHz and stored on a computer for subsequent analysis. 69 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 3.2.7 Electroretinography Mice at 1 month age were dark-adapted overnight and anesthetized with 100 mg ketamine and 10 mg xylazine per kg body weight. A platinum electrode was placed in contact with mouse comeal surface by 1% methylcellulose layer, and a steel needle was inserted subcutaneously near the eye as a reference electrode. Flashes of 500 or 360 nm light with 10 ms duration were generated by a Xenon Arc lamp. A series of neutral density fdters and filters to select wavelength were used to control light intensity and wavelength. ERG responses were amplified, digitized and acquired using pClamp software system. 3.2.8 Generation of Cone-transducin Transgenic Mice The 1.3 kb cDNA encoding cone transducin a subunit was synthesized by reverse transcription and a two-round PCR reaction. The first round of PCR was performed to obtain the cDNA sequences encoding the N-terminal portion of cone transducin a with primers CTDF: 5’ CCGCTCGAGTCTCAAGGCAAGGTAGGC 3’ and CTD M R: 5’ CGAAGCAGTGGATCCATTTCTTCCTCTCTG 3’ and that encodig the C-terminal portion of cone transducin a with primers CTD M F: 5’ C AG AG AGG AAG A A AT GG ATCC ACT GCTTCG 3’ and CTDR: 5’ G A AG AT CT CT AT C ACC A AC AGG AT GGG 3’. The two PCR products were gel purified by QIAEX II kit and used as template (20 ng each) for the second round of PCR using CTD F and CTD R primers to obtain the PCR product of cDNA sequence encoding full-length cone transducin a, which was then ligated with a 4.4 70 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. kb fragment of rhodopsin promoter at 5’ end and a 0.6 kb mpl fragment for polyadenylation site at 3’ end. The 6.3 kb ligation product was subsequently cloned into pBluscript KS+ vector to obtain the KS-CTD plasmid. The KS-CTD was purified by CsCfr and digested with Xhol and Xbal to yield the 6.3 kb fragment for microinjection. The next procedures are the same as described in section 2.2.1. 3.2.9 Genotype analysis Cone transducin a (CTD) transgene positive mice were identified by transgene-selective PCR amplification with primers CTDscreen: 5’ CTTCCTT GT C AGC AT CCT CCT GC AGC 3’ and Rhl.l: 5’ GTGCCTGGAGTTGCGCTGTGGGA 3’. 3.3 Results The characterization of S-opsin and S-opsin-1D4 transgenic lines were described in chapter 2. Briefly, the amount of S-opsin or S-opsin-lD4 ectopically expressed in the rod cells was about 10% of the total visual pigment level under rho+/- backgrounds, estimated by western blot. The transgenic lines displayed normal retina morphology with rho+/- backgrounds and some retina degeneration with rho-/- backgrounds. The S-opsin/S-opsin-lD4 trafficked properly to the rod outer segment in the presence and absence of rhodopsin. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 3.3.1 Absorption Spectrum of S-opsin-lD4 Visual Pigment To determine the absorption spectrum of the ectopically expressed S-opsin visual pigment, S-opsin-lD4 pigment was purified from the S-opsin-lD4+ rho-/- mouse by immuno-affmity method using 1D4 mAh coupled sepharose (Oprian et al., 1987). The absorption spectrum (300 - 600 nm) of purified S-opsin-lD4 pigment was recorded on a Beckman spectrometer. The S-opsin-1D4 absorbed maximally at -360 nm and the absorption was negligible with >500 nm light (Fig. 3.1), which was in agreement with previous measurements of purified S-opsin heterlogously expressed in cultured cells (Fasick et al., 2002) or the spectral sensitivity determined by ERG response of mouse S-cones (Lyubarsky et al., 1999). Because the only difference in protein sequences of S-opsin and S-opsin-1D4 visual pigment was the appendage of the short 1D4 epitope ETAQVAPA at the C-terminal end of S-opsin- 1D4 pigment and the S-opsin C-terminus is not involved in the spectral tuning of the S-opsin pigment, we believe that the absorption spectrum of S-opsin-1D4 pigment can also represent that of S-opsin pigment. Furthermore, the correct absorption spectrum of ectopically expressed S-opsins indicated that S-opsin was properly folded in rod photoreceptor. 3.3.2 ERG Response of S-opsin Transgenic Lines Since the light-evoked a-wave of ERG is believed to originate from the photoreceptor activity, we recorded the electroretinagraphic responses of S-opsin 72 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 0.16 - 0.14- 0 . 1 2 - 0 . 1 0 - 0 0.0 3 - 0,05- 0,04 - 0.02 o.oo - S-opsin-1 D4 400 X (nm ) Figure 3.1. Absorption spectrum of purified S-opsin-lD4. 73 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. transgenic mice to flashes at 546 and 360 nm to test whether the ectopically expressed S-opsin could couple normally with transducin in the rod cells. Because the absorption of S-opsins at 546 nm is near zero, ERG responses at 546 nm reflect the photo transduction triggered by rhodopsin excitation (rho+/- background) and a small amount of contribution from M-opsins in M-cones. Both S- opsin+ rho+/- and rho+/- control mice showed normal amplitude of a-wave at 546 nm (Fig 3.2 A), mostly attributed to rhodopsin activation in rod cells. On the other hand, greatly reduced ERG responses were observed in S-opsin+ rho-/- and rho-/- control mice, which were elicited by the activity of M-cones. There were no significant differences in the a-wave activity of ERG responses between S-opsin+ rho-/- and rho-/- controls (Fig 3.3 A), indicating the S-opsin did not participate in the transduction evoked by 546 nm light. Next, we examined the ERG responses of S-opsin mice triggered by 360 nm flashes. The S-opsin+ rho+/- and rho+/- showed robust ERG responses originated from rhodopsin and transgenic S-opsin activations in the rods and the endogenous S- opsin activation in small population of S-cones (Fig 3.2 B). The a-wave amplitudes of ERG responses from S-opsin+ rho+/- and rho+/- controls were similar, presumably due to the insensitivity of ERG method to detect a slight increase in UV- sensitivity provided by -10% S-opsin in the rods. It should be mentioned that the higher photosensitivity of S-opsin+ rho+/- at UV range than that of rho+/- mice has been detected and quantified by single cell recordings. (See section 3.3.5). Importantly, the participation of S-opsin to the rod phototransduction in 74 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. A 546 nm rho+/- " ! ' i ' — -OD 0" .. "OD 1" ■ "OD 2" 0 .8 .... "OD 3" "OD 4" "OD 5" 0.6 nOD 6” G 5 ~ 0 .4 ® Q.3 1 2 2 a. £ o i < o c •0.1 -0.3 -0.4 ISO iOO 300 « 0 Time (ms) S-opsin+ rho+/- "OD 0" "OD 1" "OD 2" 'O D 3" "OD 4" 'O D 5" 100 200 Time (m s) 360 nm rho+/- 1 0 0 Time (ms) — i — 3 00 - "OD 0 “ "OD 1” "OD 2" "OD 3" "OD 4" "OD 5" "OD 6" S-opsin+ rho+/- .O T V .... 'I l " v "ODO" "OD 1" "OD 2" "OD 3" "OD 4" "OD 5" "OD 8" 0 100 2 Time (m s) Figure 3.2. ERG responses of S-opsin+ rho+/- mice and rho+/- controls. (A) Comparison of ERG response waveforms between S-opsin+ rho+/- and rho+/- mice, triggered by 546 nm flashes. “OD 0” represents a flash intensity of 3.34 X 107 photons/pm2. Each unit of OD value indicates lighte intensity at 1 log-unit lower. (B) Same as in (A) except that the ERG responses were triggered by 360 nm flashes. “OD 0” represents a flash intensity of 6.93 X 106 photons/pm2. Each unit of OD value indicates light intensity at 1 log-unit lower. 75 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. A 546 nm 20 - i rho-/- > 0 .1 0 8 360 nm / " M 1 0 0 Time (ms) — i— 300 - ”0D 0" ■ "OD T "OD 2" - "OD 3" "OD 4" "OD 5’ ; "OD 6" ! rho-/- 0 .2 0 - > 0 .1 0 - 0 .0 0 - -0.0 5 - -100 0 100 400 B QD 0 ” ”o d r "OD 2" ■■"O D 3" "OD 4" "OD 5" S-opsin+ rho-/- ' v ' v -v V i—i —'— T T 100 200 Time (m s) 0 .4 0 0 .3 5 0 30 0 .2 5 0 20 0 1 2 0.10 0.C5 0 .0 0 - 0 .0 5 ■ 0 1 0 -0.15 S-opsin+ rho-/- - ’OD 0” “ OD 1" ■OD 2" - "OD 3" "OD 4" "OD 5" Time (ms) 100 I Time (ms) Figure 3.3. ERG responses of S-opsin+ rho-/- mice and rho-/- controls. (A) Comparison of ERG response waveforms between S-opsin+ rho-/- and rho-/- mice, triggered by 546 nm flashes. “OD 0” represents a flash intensity of 3.34 x 107 photons/pm2. Each unit of OD value indicates lighte intensity at 1 log-unit lower. (B) Same as in (A) except that the ERG responses were triggered by 360 nm flashes. “OD 0” represents a flash intensity of 6.93 x 10° photons/pm2. Each unit of OD value indicates light intensity at 1 log-unit lower. 76 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. transgenic mice was clearly demonstrated by the comparison of ERG responses of S- opsin+ rho-/- mice with that of rho-/- mice at 360 nm (Fig 3.3 B). The maximum a- wave amplitude of S-opsin+ rho-/- mice was 3-4 fold higher than that of rho-/- controls. These ERG responses of S-opsin transgenic lines indicate that the S-opsin expressed in the rod photoreceptors conduct normal phototransduction functions in response to the UV light. 3.3.3 Flash Responses of S-opsin Transgenic Mice In this and following sections, all the single cell recordings were performed by Dr. Vladimir Kefalov in King-Wai Yau’s laboratory of John’s Hopkins University. To analyze the fundamental phototransductive properties of S-opsin in rod phototransduction cascade at the single cell level, a family of flash responses to a series of increasing light intensities was recorded from S-opsin+ rho-/- or rho+/- rod by suction pipette, as the suppression of outer segment membrane current, following the flash stimulus (Fig 3.4). The S-opsin+ rho-/- rod was stimulated with 360 nm light (Fig. 3.4 B) whereas rho+/- rod was stimulated with 500 nm light (Fig. 3.4 A). As commonly observed in recordings from wild-type rods, the peak amplitude of the photocurrent increased monotonically as a function of flash intensity until the photocurrent reached zero, indicating the response saturation by the closure of all cGMP gated channels on the outer segment membrane. The response waveforms of 77 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. A < CL Rho+/~ mouse rod - 5 - O O - 1 0 - \W -20 3 0 1 2 4 < CL -*-» c m rs u o CL -10 -15- t( S) S-opsin+, Rho-/- mouse rod M \ I w * » 4 * 2 m Figure 3.4. Families of flash responses (experiments performed by Vladimir Kefalov). (A) Responses to 500 nm flashes o f rho+/- rod. Flash strengths used were (in photons per flash): 25, 85, 327,1101,7123,23977. (B) Responses to 400 nm flashes of S-opsin+ rho-/- rod. Flash strengths used were (in photons per flash): 76, 452,1554, 6643, 22832, 78481. 78 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. S-opsin+ rho-/- rod were very similar to the control rho+/- rod (Fig. 3.4 A and B), with respect to their maximum excitation wavelength (360 nm for S-opsin+ rho-/- and 500 nm for rho+/-). In conclusion, the dose-dependent increase in photocurrent suppression of S- opsin+ rho-/- rod in response to increasing light intensity confirmed that S-opsin coupled efficiently to rod photo transduction cascade, consistent with ERG results. 3.3.4 Flash Sensitivity of S-opsin/S-opsin-lD4+ rho-/- Rod The absolute macroscopic sensitivities of S-opsin and S-opsin-lD4+, rho-/- lines at 360 nm were very similar, suggesting their S-opsin transgene expression levels were comparable. Moreover, the sensitivity of S-opsin/S-opsin-lD4 rods under rho+/- backgrounds at 360 nm were ~ 8% / ~ 5% of that of the control rho+/- rod at 500 nm (Table 3.1). Although the rho-/- background caused a reduction in the outer segment size in S-opsin/S-opsin-lD4+ rho-/- cells, we believe the main reason of the reduced light sensitivity in S-opsin/S-opsin-lD4+ rho-/- rod came from the less amount of the S-opsin pigment expressed in the rod cells, which is only 10 — 12% of the rhodopsin amount in rho+/- rods. The smaller outer segment size would account for the sensitivity difference of less than two-fold. This estimation was supported by a more straightforward quantification of transgene expression level under rho+/- backgrounds (See section 3.3.5). Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. rtio+t- (n = 24) 8-opsin+ rho-/- (n = 20) S-opsin-104+ rto-f- {n = 20) S-opsin+ rho+i- in = 13) S-opsin-1 D4+ rto+i- (n : 1, idA) 19.1+1.1 16.6+1.8 15.6+1.2 15.7+0.9 19.1+1.5 S ,.j, fpA photo'1 it) 6.8+0.0007 5.1+0.0001 35+0.00004 4.2+0.0003 5.7±0.0006 8 , (PA) 0.031+0.002 0.023+0.003 0.015+0001 0.027+0.002 0.039+0.004 tP s o c (ms) 158+5 122+5 137+2 tpjjt (ms! 153+8 155+9 122+7 137+2 tb, (msj) 254+16 200+12 224+18 t i n (ms) 221+16 204+17 190+14 216+16 noise (pA;) 0.11+0.01 (n = 14) 0.10+0.01 (n = 14) 0.08+0 005 (n= 14) 0.10+0.01 (n = 11) 0.11+0.01 (e = 13) meta-ll deacay (si 49.5+4.3(11 = 7) 1.35+0.1 1.19+0.1 (n = 18) Table 3.1. Parameters of flash responses recorded from transgenic and control rod (experiments performed by Vladimir Kefalov). Values are mean ± s.e.m. The number of cells recorded was indicated as n in the first row except otherwise noted in individual cell. Id - dark current; Sunax ^ photosensitivity at maximum excitation wavelength; S0 - amplitude of single photon response; tp5 0 o - time to peak of the dim flash response at 5 0 0 nm; tP36o — time to peak of the dim flash response at 3 6 0 nm; t i5oo — integration time o f the dim flash response at 5 0 0 nm; ti3 6 o — integration time of the dim flash response at 3 6 0 nm; 80 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 3.3.5 Estimation of S-opsin/S-opsin-lD4 pigment Expression Level in S-opsin/S- opsin-lD4+ rho+/- Rods by Spectral Sensitivity Because the ERG responses of S-opsin+ rho+/- mice did not reveal significant difference in photoreceptor acitivity triggered by 360 nm flashes from rho+/- controls, we measured the spectral sensitivities of S-opsin+ rho+/- rods at UV range by the more sensitive suction electrode recording. The action spectra of S- opsin/S-opsin-lD4+ rho+/- and control rho+/- rods were fitted by Al pigment template with > .m a x = 500 nm (Fig. 3.5 A). The photosensitivities at seven different wavelengths (340 - 550 nm) were normalized using the sensitivity at 550 nm. For the rho+/- rod, the Al pigment template provided a good fit at longer wavelengths such as 450, 500, and 550 nm. At shorter wavelengths of UV range, the rho+/- sensitivities were higher than the template, due to the P peak of rhodopsin absorption spectrum at 360 nm, which was not accounted for by the template. An increase in UV light (340 - 400 nm) sensitivity was observed in S- opsin/S-opsin-lD4+ rho+/- rod, compared to control rho+/- rod (Fig 3.5 A), indicating the participation of ectopically expressed S-opsin/S-opsin pigment in generating the responses to UV light. The increased UV light sensitivities were comparable between S-opsin and S-opsin-1D4 lines, which again indicated similar S- opsin transgene expression levels between these two lines. Because the photosensitivity of photoreceptor is proportional to the number of visual pigment molecules in the cell times the amplitude of the response generated by a single pigment (single photon response), assuming S-opsin/S-opsin-1D4 pigment and 81 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. A rho+/- S-opsin+ rho+/' S-opsin-1D4+ rho+/- 500 nm Template ----2 ---r 500 320 340 360 400 420 440 460 480 (n m ) rho+A S -o p sin + rho+A 88% rhodopsin + 12% S-opsin c o C O " 320 340 360 380 400 420 440 460 480 500 520 540 560 r . (nm) rho+A S-opsin-1 D4+ rho+/- 86% rhodopsin + 14% S-opsin 20 340 360 380 400 420 440 460 480 500 520 540 560 > . (nm) Figure 3.5. Spectral sensitivity of S-opsin/S-opsin-lD4+ rho+/- and rho+/- rods (experiments performed by Vladimir Kefalov). (A) Action spectra of S-opsin+ rho+/- or S-opsin-lD4+ rho+/- and rho+/- rods. Each data point was the averaged photosensitivities of 20 rods with dim flashes. The data were fitted with a curve representing the absorption spectrum of modified A l pigment template with X m a x = 500 nm. (B) Measurements of spectral sensitivity of S-opsin+ rho+/- rods were best fitted with theoretical sensitivities produced by a mixture of 88% rhodopsin and 12% S-opsin. The theoretical curve was calculated based on the spectral sensitivity of rho+/- and S-opsin+ rho-/- rods. (C) The same as in (B) except that the spectral sensitivity of S-opsin-1D4+ rho+/- rods were fitted. 82 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. rhodopsin generate single photon responses of equal amplitudes (See section 3.3.6), the spectral sensitivities of S-opsin/S-opsin-lD4+ rho-/-, S-opsin/S-opsin-lD4+ rho+/- and rho+/- rods at different wavelengths should directly correspond to the pigment expression level in the rods. Following this reasoning, we estimated the S- opsin/S-opsin-lD4 expression level under the rho+/- background. The action spectra of S-opsin/S-opsin-1D4+ rho+/- rod were fitted with the mixed spectra contributed from the fractional combinations of the rho+/- and S-opsin/S-opsin-1D4+ rho-/- action spectra. The fraction of S-opsin/S-opsin-1D4 required to best fit the spectra represents its expression level in the S-opsin/S-opsin-1D4+ rho+/- rod. After trying with different percentages of S-opsin/S-opsin-1D4 levels, the S-opsin or S-opsin- 1D4 pigment expression level was estimated to be -12% or ~14 % of the total visual pigmet level under rho+/- backgrounds, respectively (Fig 3.5 B and C). This corresponds well with estimates derived from western blot in chapter 2. 3.3.6 Properties of Single Photon Responses of S-opsin Transgenic Rods As summarized in table 3.1, the single photon responses of S-opsin/S-opsin- 1D4 rods with rho+/- and rho-/- backgrounds were derived from a series of 30 identical dim flash responses of for each genotype and represented the response triggered by a single pigment molecule. The amplitude of single photon response was calculated from the ensemble variance to mean ratio of the amplitude of the dim flash response (Baylor et al., 1979b). For rho+/- and S-opsin/S-opsin- 1D4+ rho-/- rods, the mean of the single 83 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. photon response amplitudes was calculated at their maximal excitation wavelength - 500 nm and 360 nm, respectively. The S-opsin/S-opsin-lD4+ rho-/- rod showed a smaller size of single photon response than rho+/- control. This could be attributed to either of these two factors - the different amplitudes of single photon responses and the morphological changes due to retina degemation with rho-/- backgrounds. To determine whether S-opsin and rhodopsin give rise to single photon responses with different amplitudes, we adopted a different analysis, which compares the single photon responses in the same rods triggered by 360 nm light with that triggered by 500 nm light. At 500 nm, the single photon response was generated almost exclusively by rhodopsin since the absorption of the S-opsin/S- opsin-1D4 visual pigment at 500 nm was negligible. On the other hand, both rhodopsin and S-opsin/S-opsin-1D4 pigment produced responses at 360 nm, so the calculated amplitude of “single photon response” at this wavelength in fact represent the “mixed” response generated by both rhodopsin and S-opsin. Because the absorption of rhodopsin at 360 nm was -17% of that of S-opsin and S-opsin comprised - 10% of the total visual pigment expression level (See section 2.3.1), it was estimated that S-opsin/S-opsin-1D4 participated in 27-49% of the photoresponses generated by S-opsin/S-opsin-1D4+ rho+/- rod at 360 nm. If S- opsin/S-opsin-lD4 had different single photon responses from rhodopsin, we would expect to observe different amplitudes at 500 and 360 nm caused by differential contributions from S-opsin/S-opsin-lD4 at these two wavelengths. However, the amplitudes of single photon response of S-opsin/S-opsin-1D4+ rho+/- rod at 500 nm 84 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. and 360 nm were almost identical, indicating that the S-opsin produced single photon responses of similar amplitudes with rhodopsin. The response kinetics, measured by time to peak and integration time, were aslo compared among S-opsin/S-opsin-1D4 lines with rho+/- and rho-/- backgrounds. The response kinetics of S-opsin/S-opsin-1D4+ rho-/- rod or S- opsin/S-opsin-lD4+ rho+/- rod was similar to that of control rho+/- rod. In addition, the kinetics (time to peak and intergration time) of single photon responses recorded from S-opsin/S-opsin-1D4+ rho+/- rods excited by 500 nm and 360 nm light were almost identical, suggesting that the S-opsin and rhodopsin produces responses with similar kinetics in addition to the same amplitudes. Based on the comparison of amplitude and kinetics of single photon response generated by 360 nm flashs with those generated by 500 nm ones in the same rod cell, we conclude that there are no significant differences in the properties of single photon responses generated by S-opsin and rhodopsin. 3.3.7 S-opsin Meta-II Decay Rate Using purified visual pigments and low temperature/time-resolved spectroscopy, it has been demonstrated that cone opsins had a ~50-fold faster decay rate of the catalytic active meta-II intermediates than rhodopsins, which might attibute to the photoresponse sensitivity and kinetics because meta-II decay rate could limit the lifetime of active visual pigment that determines the activity of downstream cascade giving rise to photoresponse. To examine whether the 85 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. ectopically expressed S-opsin in rods retained the same meta II life time as the in vitro cone-opsins and to determine conclusively whether the life time of meta-II contributed to photoresponse properties, we evaluated the S-opsin meta-II decay rate in intact rods using an alternative method based on the recovery phase of the photoresponses recorded in S-opsin+ rho-/- rods with arrestin null background (S- opsin+ rho-/- arr-/-). Previous recordings have shown that the recovery phase of flash response of arr-/- rod exhibited two phases - the initial rapid decline phase representing the decreased meta-II catalytic activity caused by rhodopsin phosphorylation and the second prolonged phase corresponding to meta-II thermal decay in the absence of arrestin binding to phosphorylated rhodopsin. In this experiment, we calculated the decay rate of S-opsin meta-II indicated by the time constant of the second falling phase of S-opsin+ rho-/- arr-/- rod. The average time constant of meta-II decay phase of rhodopsin and S-opsin was 49.5 ± 4.3 (n = 7) and 1.35 ± 0.1 (n = 20), respectively (Fig. 3.6 A and B, Table 3.1). Furthermore, since the short-lived S-opsin meta-II greatly accelerated the response recovery such that even saturating responses recover within a few seconds under arr-/- background, we were able to paractically obtain a family of reposnses with increasing flash intensities from S-opsin+ rho-/- arr-/- rods within a short period of time (Fig. 3.6 C). Of the series of flash responses, their recovery remained biphasic. The second slow phases of response recovery became more dominant with increasing photointensities, presumably due to the local saturation of rhodopsin kinase in the presence of large amounts of activated S-opsins. 86 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. A B 2 0 40 8 0 100 S-opsin + rho-/- arr-/- a > C O c o a 1 0 C D £ £ 0 .0 - 4 6 8 10 Time(s) Tim e(s) Series of flash respon se s of D S-opsin + Rho-/- Arr-/- m ouse rod -10 -16 -18 -20 T n ~ r 4 T 360 nm 550 nm S-opsin+ rho+/- arr-/- T im e (s) 40 60 Time (s) Figure 3.6. S-opsin meta-II decay measured by the recovery phase of dim flash responses in arrestin knockout background (experiments performed by Vladimir Kefalov). (A) Averaged dim flash responses from rho+/- arr-/- rods. The second decline phase of response recovery represents the rhodopsin meta-II decay. (B) Averaged dim flash responses from S-opsin+ rho-/- arr-/- rods. The second decline phase of response recovery represents the S-opsin meta-II decay. (C) Flash response family of S-opsin+ rho-/- arr-/- rods with increasing flash intensities. (D) Comparison of the meta-II decay phases of S-opsin+ rho+/- arr-/- dim flash responses elicited by 360 and 550 nm light. 87 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. In addition, the second recovery phase of photoresponses triggered by 360 nm and 550 nm dim flashes were compared by recordings of S-opsin+ rho+/- arr-/- rod. Because only rhodopsin was activated at 550 nm, the second recovery phase respresented the meta-II decay of rhodopsin only. On the other hand, since both S- opsin and rhodopsin were activated at 360 nm and S-opsin meta-II decayed much faster than rhodopsin meta-II, compared to the responses at 550 nm, the responses at 360 nm showed an increased recovery at early time of the second recovery phase before the slow rhodopsin meta-II decay dominated at later time (Fig. 3.6 D), indicating again the participation of S-opsin in the photoresponse at 360 nm. 3.3.8 Dark Noise The continuous membrane current flowing into photoreceptor in the darkness, called dark current, was recorded in S-opsin/S-opsin-lD4 transgenic lines under rho+/- and rho-/- backgrounds (Table 3.1). Among different genotypes, the dark currents were quite similar. Although total surface area of S-opsin/S-opsin- 1D4+ rho-/- rod was reduced by retinal degeneration, no difference in its dark current that reflected the cGMP-channel activity on surface membrane spanning the outer segment was observed, compared to control rho+/-. It would be interesting to examine whether the dark current was compensated by an increased density of cGMP-gated channels on the rho-/- rod. It has been demonstrated that the fluctuations of dark currents in the 4 darkness, known as dark noise, consisted of two components: discrete events arisen 88 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. from spontaneous activation of visual pigment and continuous event caused by spontaneous activation of PDE (Baylor et al., 1980). Because these two components occurred at different frequencies, the discrete event can be isolated by power density spectrum of recorded dark current and its frequency reflect the rate of spontaneous activation of the expressed pigment. The power density spectrum of dark current was computed for S-opin+ rho+/- and rho+/- control rods. The average spontaneous isomerization rates for rhodopsins and S-opsins were similar (Table 3.1), suggesting that the thermal stability of S-opsin and rhodopsin were comparable. 3.3.9 Expression of Cone Transducin a Subunit in Mouse Rods Although the S-opsin+ rho-/- rod was useful in analyzing the photoresponse properties generated exclusively by S-opsin, it had a reduced outer segment size due to retinal degeneration, which might complicate interpretation of the results. To obtain a better mouse model to analyze S-opsin photoresponses electrophysiologically, we created mouse lines (CTD) that express cone transducin a subunit in the rod cells as GTPyS loading experiments has suggested that the cone transducin a did not couple with rhodopsin while cone transducin a should couple with S-opsins (personal communication). Thus, we expected that the substitution of rod transducin a with cone transducin a in S-opsin+ CTD+ transducin -/- rods will produce light-evoked electrical responses originated only from S-opsin activation even in the presence of rhodopsin. If true, this will allow us to obain pure 89 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. photoresponses generated by S-opsin using single cell recordings of S-opsin+ CTD+ transducin -/- rods that contains normal rhodopsin expression and hence have normal retina morphology. The CTD construct had similar DNA components as the S-opsin construct, with a 4.4 kb rhodopsin promoter at 5’ end and mpl at 3’ end (Fig. 3.7 A). Two lines (CTD A and CTDB) were produced and their expression levels were quantified by western blot using antibody against cone transducin a subunit (Gat2). Compared to wild type controls, CTDA and CTDB lines showed 20-fold higher expression level of cone transducin a (Fig 3.7 B). 3.3.10 Rod ERG Response of CTD Transgenic Lines To evaluate whether cone transducin a indeed could not couple with rhodopsin, the CTD transgenic lines were bred into transducin -/- backgrounds. The scotopic rod ERG responses were recorded from mouse corneas. Unexpectedly, both CTD lines showed strong ERG responses to light stimulus, indicating that the cone transducin a could couple with rhodopsin. Although the rod thresholds of CTD transducin-/- lines were 10-fold lower than transducin +/- controls, the photoresponses under normal light regime were considered largely normal. So we were not able to use CTD lines to analyze S-opsin photoresponse properties in the presence of rhodopsins. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. A C T D 4.4 kb rhodopsin promoter cone transducin a mpl B C Q j — p s e s c b Figure 3.7. Cone transducin a (CTD) transgenic lines. (A) Transgene constructs to generate CTD transgenic mice. The cone transducin a cDNA sequence was ligated with 4.4 kb mouse rhodopsin promoter and 0.6 kb m pl sequence, the latter to supply a splicing site and polyadenylation signal. (B) Western Blot to quantify cone transducin a protein expression level between two CTD transgenic lines (CTD A and CTD B) and wild-type (WT) controls using Gat2 antibody, which recognizes cone transducin a. Homogenates of l/20th retina were loaded from transgenic and control mice. 91 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 3.4 Discussion Although many quantitative aspects of phototransduction in rod photoreceptors have been extensively investigated at the molecular level, much less progress have been made towards the understanding of the molecular mechanisms underlying cone phototransducion and the functional differences between rod and cone physiology. This is however, in contrast to the significant visual functions provided by cones in our daily activities because under daylight, rods are saturated and only cones are able to transduce the visual signals and generate visual perception. In this work, we have focused on studying the role of visual pigment properties in determining the parameters of photoresponses using ERG and single cell recordings. As shown by the a-wave activity of ERG and the suppression of photocurrent recorded by suction electrodes from S-opsin transgenic mice in response to flash stimulus, the ectopically expressed S-opsin coupled with the rod phototransduction cascade normally. Both purified S-opsin and transgenic rods expressing S-opsin showed unique spectral sensitivity to UV light. By the measurments of photosensitivity under dim-flashes in S-opsin/S-opsin+ rho+/- rods, we estimated that the S-opsin/S-opsin-lD4 comprised ~14%/12% of the total pigment in transgenic rods, which is also in general agreement with the estimation by western blot (section 2.3.1). To confirm that the previsously measured meta II decay rate of cone opsin was faster than that of rhodopsin in vivo, we calculated life time of S-opsin meta-II 92 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. intermediates based on the exponential time constant of the second falling phase of reposnse recovery under arr-/- backgrounds (Xu et al., 1997). We find that time constant of S-opsin meta-II decay (1.2 s) is indeed much faster than that of rhodopsin meta-II decay (50 s), which is in agreement with the fact that cone opsins decayed much faster than rhodopsin in vitro (Imai et al., 1997b). This is the first measurement of S-opsin meta-II decay rate under physiological conditions. In addition, this method can be applied to measure rate of meta-II decay of other visual pigments in vivo. We compared the parameters of single photon response triggered by 500 nm and 360 nm flashes derived from dim flash responses recorded from S-opsin+ rho+/- rods, corresponding to the photoisomerization of rhodopsin (500 nm) and both rhodopsin and S-opsin (360 nm), respectively. No significant differences in the gain and kinetics of the rising phase of single photon responses at 500 nm and 360 nm were observed, suggesting that rod and cone visual pigments exhibit similar signaling capacities to downstream cascades. This further suggests that the coupling of visual pigments with transducins was highly conserved from rods to cones. However, it remains to be known whether the interaction of visual pigments with different downstream regulators such as transducin/cone transducin, arrestin/cone arrestin could lead to different photoresponses. A more quantitative comparison of the amplification factors of rhodopsin and S-opsin triggered transduction can be obtained by the Lamb-Pugh fitting of leading edge of ERG a-wave, which requires a more accurate measurement at the ERG early time points than the one presented in 93 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. this chapter. In the future, it would also be interesting to examine the S-opsin regeneration kinetics and photoreceptor recovery and adaptation using newly developed paired-flash ERG protocols. Although S-opsin exhibits a much shorter meta-II lifetime, the response amplitude and recovery kinetics were almost identical in single photon response generated by rhodopsin and S-opsin. Because transducins are continuously being activated as long as the catalytically active pigment meta-II intermediates persist, the invariant termination phase of responses originated from rhodopsin and S-opsin activation suggest that the visual pigment phosphorylation and arrestin binding play a dominant role in setting the life time of the catalytic active meta-II intermediates, and hence the size and duration of the elicited photoresponse by dim flashes. Our conclusion was also supported by other recent studies showing that thermal decay of meta-II intermediates did not affect the properties of photoresponses in transgenic xenopus rods expressing human/salamander red cone pigments and knock-in mouse rods expressing rhodopsin E122Q mutants that have 10-fold faster decay of the meta-II intermediates (Imai et al., 1997a; Kefalov et al., 2003). Nevertheless, since the cones normally function under bright light, rhodopsin kinase could become concentration-limiting to deactivate the S-opsins rapidly. In this case, faster decay of large amounts of unphosphorylated meta-II intermediates could attribute to the timely termination of photoresponses, and hence mediating the high temporal resolution of cone visual perception under day light. 94 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. We did not observe an increased dark noise originated from the spontaneous photoisomerization of S-opsin. This is in contrast to the high spontaneous activity recorded from Xenopus rods expressing human or salamander red cone pigments, which effectively adapted the photoreceptor cell so as to result in the less sensitive and kinetically faster photoresponses. Thus, it appears that the intrinsic thermal stability of cone opsins was not a universal factor in shaping the cone photoresponses. However, the spontaneous activity of cone transducin and cone PDE could still contribute to higher dark noise in native cones and act as “background light” to adapt the cells. It should be noted that the functional differences between rods and cones can be mediated not only at molecular level, but also at cellular level. For example, the size of the outer segment would determine the concentration and the diffusion rate of the phototransductive molecules, which might affect the response kinetics as demonstrated by rho+/- and transducin +/- mice. Mechanisms operating at different levels should be integrated to achieve a complete understanding in order to explain and predict the response properties. To overcome the difficulties in interpreting recordings from rho-/- backgrounds due to retina degeneration, the cone transducin a transgenic mice were produced in an effort to isolate S-opsin triggered flash response from rods expressing endogenous rhodopsin. This is based on the assumption that cone transducin a could only couple with S-opsin but not rhodopsin. However, preliminary ERG responses recorded from CTD+ tr-/- mice showed efficient coupling between cone transducin 95 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. with rhodopsin. Thus, we were not able to isolate photoresponse generated by S- opsin in S-opsin+ CTD+ tr-/- rods. Nontheless, the CTD lines can be used to study the biochemical properties of cone transducin, cone transducin interactions with visual pigments and PDE, light-dependent translocation of cone transducin functional differences between cone transducin and rod transducin. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Chapter 4 Light Causes Phosphorylation of Non-Activated Visual Pigments in Intact Mouse Rod Photoreceptor Cells 4.1 Introduction Visual pigments, such as rhodopsin and cone opsins, belong to a family of G- protein-coupled receptors (GPCRs) that contain a cluster of Ser/Thr sites at their carboxyl termini. Visual pigments initiate G-protein signaling upon photon absorption. As with other GPCRs, phosphorylation of the carboxyl-terminal Ser/Thr sites, followed by arrestin binding, are required steps in signal deactivation (Bums and Baylor, 2001). Rhodopsin phosphorylation is catalyzed by rhodopsin kinase (GRK1, or RK), which is activated upon association with light-activated rhodopsin (R*) in the Mil conformation (Palczewski et al., 1991; Palczewski et al., 1988a). In vitro and in vivo evidence shows that phosphorylated rhodopsin exhibits diminished catalytic activity (Chen et al., 1999; Chen et al., 1995b; Mendez et al., 2000; Wilden et al., 1986), and that arrestin binding is required to fully terminate R* signaling (Wilden et al., 1986; Xu et al., 1997). Since the discovery of light-activated rhodopsin phosphorylation, a number of studies have reported that, in isolated rod outer segments, several hundred-fold molar excess of phosphates are incorporated into the rhodopsin pool per mole of R* (Aton, 1986; Binder et al., 1990; Binder et al., 1996; Chen et al., 1995a). Given that 97 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. each rhodopsin has been observed to incorporate only up to nine phosphates (Wilden and Kuhn, 1982), the straightforward interpretation is that non-activated rhodopsin molecules, which we designate here as R, are phosphorylated as well as R*. This phenomenon has been termed high-gain phosphorylation (Binder et al., 1990). High- gain phosphorylation has also been reported in isolated frog retinas and in living frogs (Binder et al., 1996). In this system, -1% of R become phosphorylated following a 3% bleach (i.e., photon absorption by 3% of rhodopsin), and, when living frogs are exposed to prolonged dim light, a higher fraction of R (3%) becomes phosphorylated (Binder et al., 1996). The mechanism by which R becomes phosphorylated in vivo is not known. One possibility is that the phosphorylated Mil decays to opsin and is reconstituted with the 11-cis retinal to regenerate a visual pigment prior to dephosphorylation (Biembaum et al., 1991). Another possibility is trans-phosphorylation, which was termed to describe a putative mechanism whereby rhodopsin kinase (RK), once activated by associating with R*, phosphorylates a nearby R (Rim et al., 1997). Evidence in support of this model includes the observation that Reactivated RK is capable of phosphorylating an exogenously added peptide substrate (Brown et al., 1993; Dean and Akhtar, 1996; Palczewski et al., 1989; Palczewski et al., 1988b). In addition, structural studies on the carboxyl terminus of rhodopsin, using site-directed spin labeling, revealed that it is disordered and highly mobile (Langen et al., 1999). Therefore, given the high density of rhodopsin and its high diffusion rate on disk membranes (Calvert et al., 2001; Kaplan, 1984; Wey et al., 1981), it is plausible that 98 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. carboxyl termini from neighboring R molecules would be accessible to Reactivated RK. A major challenge in attempting to demonstrate the presence of trans phosphorylation is the difficulty in unambiguously distinguishing between phosphorylated R* and phosphorylated R in the same reaction mixture. As a direct test of trans-phosphorylation, Rim and colleagues designed experimental protocols based on a recombinantly expressed split receptor mutant of rhodopsin that was assembled from two separately expressed fragments (Rim et al., 1997). This “split rhodopsin” exhibits light-dependent phosphorylation. Importantly, it can be distinguished from full-length rhodopsin in the same phosphorylation mixture by virtue of its distinct electrophoretic mobility on a denaturing gel. Therefore, the split rhodopsin can be exposed to light and mixed with the non-bleached full-length rhodopsin, or vice versa, to test for the presence of phosphorylated R in the same mixture that contains RK. However, despite numerous attempts using different experimental configurations, this system was unable to provide evidence that dark rhodopsin is trans-phosphorylated (Rim et al., 1997). The experiments described above were performed using solubilized receptors and receptors reconstituted into lipid vesicles. However, if the activated kinase needs to be physically associated with R*, or if it can diffuse only a short distance prior to phosphorylating nearby non-activated R, then trans-phosphorylation may proceed efficiently only on native disk membranes that contain high concentrations of freely diffusible receptor molecules. To test this hypothesis, we generated 99 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. transgenic mice that expressed a shortwave-sensitive cone pigment in rod photoreceptors. This cone pigment, called S-opsin, showed maximal absorption at 357 nm, but little or no absorption at 500 nm, which is the absorption maximum of rhodopsin (Jacobs et al., 1991; Lyubarsky et al., 1999). Therefore, rhodopsin can be preferentially activated by long wavelength light when the two pigments are co expressed in the native rod disks, and phosphorylation of S-opsin would arise only as a result of trans-phosphorylation. Importantly, S-opsin is a native substrate for RK in murine cones (Weiss et al., 2001). Using co-expression of rhodopsin and S-opsin in transgenic rod photoreceptors, we provide direct evidence of trans phosphorylation of S-opsin following generation of R* by long wavelength light. Furthermore, we used the rhodopsin K296E transgenic mouse model, expressing human rhodopsin mutant K296E in mouse rod photoreceptors, to provide additional evidence of the presence of trans-phosphorylation. K296E is a naturally occurring mutation in the rod opsin gene that leads to autosomal dominant retinitis pigmentosa (Keen et al., 1991). In wild-type rhodopsin, the 11-cis retinal is covalently attached to the lysine residue at position 296 of rhodopsin (Bownds, 1967). Mutation at this position renders the opsin protein incapable of binding 11 -cis retinal, and also leads to constitutive activity of the opsin protein in biochemical assays (Robinson et al., 1992; Zhukovsky et al., 1991). When expressed in transgenic mice, however, K296E apparently is inactivated by phosphorylation and arrestin binding and shows no evidence of constitutive activity (Li et al., 1995). We have shown that, in the 100 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. absence of arrestin, endogenous mouse rhodopsin became phosphorylated in dark- adapted K296E retinas as a result of constitutive activity of K296E. Our data therefore provide strong support for the presence of trans phosphorylation of non-activated R in native rods. Inasmuch as phosphorylated R* exhibits decreased catalytic activity, the presence of phosphorylated R in the intact photoreceptor is expected to have physiological consequences for subsequent photoisomerization events. 4.2 Materials and Methods 4.2.1 S-opsin and K296E Transgenic Mouse Lines All mice were treated in accordance with the ARVO Statement for the Use of Animals in Ophthalmic and Visual Research, as well as with USC IACUC guidelines. S-opsin transgenic mice were mated with rhodopsin knockout mice (Lem et al., 1999) to generate S-opsinlh o + /- and S-opsin*0 - 7 ' mice. K296E transgenic mice (kindly provided by Dr. Tiansen Li of Harvard University) were bred with arrestin knockout mice to obtain K296Ean-/" mice (Li et al., 1995; Xu et al., 1997). The S-opsin transgenic lines were bom and raised in a 12 hr/12 hr light/dark cycle. K296Ea rr-/" and arr-/- mice were bom and raised in constant darkness to prevent retinal degeneration resulting from constitutive signaling (Xu et al., 1997). Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 4.2.2 Standard Peptides The non-phosphorylated and monophosphorylated peptides corresponding to rhodopsin and S-opsin C-terminal sequences released by Asp-N cleavage were synthesized by Biomer Technology (Concord, CA). The monophosphorylated S- opsin C-terminal peptides contained 1 5 N at the amino-N of residues V335 and V338. The monophosophorylated rhodopsin C-terminal peptides had 1 5 N at the amino-N of A337 and A346 sites. Peptides were dissolved in 10 mM ammonium biocarbonate (pH 8.0) and acidified with formic acid to pH < 2. All four peptides were loaded onto a C l8 column (Thermo Finnigan, San Jose, CA), separated by a 5% - 30% acetonitrile gradient at 5 pl/min in 0.08% heptafluorobutyric acid (HFBA), and delivered to a UV-vis spectrometer, then to a mass spectrometer (Thermo Finnigan Deca XP). The detection efficiency of each eluted peptide species was determined by integrating the area under each peak on the mass chromatogram, normalized against peptide quantity measured by its OD 205 nm absorbance from the UV-vis chromatogram. 4.2.3 Light Stimulation and Sample Preparation The light source was a 100 W quartz tungsten halogen lamp connected to a liquid light guide (Oriel Instruments, Stratford, CT). Light stimulation was controlled by neutral density filters, interference filters (Oriel Instruments), and an electromagnetic shutter (Vincent Associates, Rochester, NY). Light intensity was measured using a calibrated photodiode (United Detector Technology Sensors, Inc., 102 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Hawthorne, CA) positioned at an equal distance to the retina. The current was measured using a current amplifier (SR570 current preamplifier; Stanford Research Systems, Sunnyvale, CA). The sample preparation procedure was a modification of published protocols (Kennedy et al., 2001). Mice were dark-adapted overnight, and were euthanized by C 02 asphyxiation followed by cervical dislocation. Retinas were dissected under infrared illumination. Individual retinas were placed into 150 pi of Locke’s buffer (140 mM NaCl, 0.6 mM KC1, 1.2 mM CaCl2, 2.4 mM MgCl2, 2 mM Hepes [pH 7.4], 10 mM glucose) at room temperature, and either kept in darkness or exposed to calibrated light for 30 sec and incubated in darkness for a period of time. The retinas were homogenized in 700 pi urea buffer (7 M urea, 5 mM EDTA, 20 mM Tris-HCl [pH 7.4]). Membranes were collected by centrifuging the homogenized samples at 50,000 rpm for 30 min in a Beckman TLA-100 rotor. The membranes were washed twice with urea buffer, once with water and once with 10 mM ammonium bicarbonate (pH 8.0), and digested with 50 pi of 10 pg/ml Asp-N protease (Roche, Inc.) in 10 mM ammonim bicarbonate (pH 8.0) at room temperature overnight. The peptides were collected in the supernatant fraction after centrifuging the digested membrane samples at 55,000 rpm for 30 min. Samples were then acidified with formic acid to pH < 2 and stored at -20°C. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 4.2.4 LC-MS Twenty pi peptide samples were loaded onto a C l8 capillary column (Thermo Finnigan) in 0.08% HFBA at a flow rate of 5 pl/min. The peptides were separated by a 5% - 30% acetonitrile gradient. The eluent was delivered to an LCQ Deca XP Mass Spectrometer (Thermo Finnigan) to record the full MS and MS/MS spectra. The fragmentation parameters used to break the parent ions by collision- induced dissociation (CID) were: activation amplitude of 35%, activation Q of 0.25, and activation time of 50 ms. Rhodopsin or S-opsin C-terminal peptides were monitored in the mass detector with an isolation width of 1.5 centered on the predicted m/z values of rhodopsin or S-opsin C-terminal peptides released by Asp-N digestion. Identities of ion peaks on the mass chromatogram were confirmed by their MS/MS spectra, and the area under each peak was integrated. After correcting for the detection efficiency of each peptide species, the amount of peptide was quantified. 4.2.5 Sample Preparation for Isoelectric Focusing Mice were dark-adapted overnight. Individual retinas were dissected under infrared light and placed into a tube with 150 pi of Locke’s buffer, exposed to a calibrated light for 30 sec followed by dark incubation for a period of time, snap- frozen in liquid nitrogen, wrapped in aluminum and stored for future use. Each frozen retina was homogenized in 400 pi of homogenization buffer (25 mM Hepes [pH 7.5], 100 mM EDTA, 50 mM NaF, 5 mM adenosine, 1 mM PMSF, and 0.5 104 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. mg/ml protease inhibitor cocktail [Roche, Inc.]). The homogenized sample was centrifuged at 19,000 x g for 15 min to collect the membrane fraction, which was washed three times with 10 mM Hepes (pH 7.5). The membrane was resuspended in, and mixed, with 1 ml of regeneration buffer (10 mM Hepes [pH 7.5], 0.1 mM EDTA, 50 mM NaF, 5 mM adenosine, 1 mM PMSF, 1 mM MgCl2, 2% BSA, 100 pM 11-cis retinal, and 0.5 mg/ml protease inhibitor cocktail [Roche, Inc.]) at 4°C overnight. After regeneration with 11 -cis retinal, membrane fractions were collected by centrifugation at 19,000 x g for 20 min and solubilized in 100 pi solubilization buffer (20 mM Hepes [pH 7.5], 0.1 mM EDTA, 50 mM NaF, 5 mM adenosine, 1 mM PMSF, 1 mM MgCl2 , 10 mM NaCl, 1% dodecyl-maltoside [Calbiochem], 1 mM DTT, and 0.5 mg/ml protease inhibitor cocktail [Roche, Inc.]) at 4°C for 3 hr. The solubilized sample was centrifuged at 19,000 x g for 20 min prior to loading it onto an isoelectric focusing (IEF) gel. The IEF gel electrophoresis to separate phosphorylated rhodopsin species was performed as described previously (Adamus et al., 1993). After separation on the IEF gel, the proteins were transferred to a nitrocellulose membrane by capillary forces. Rhodopsin species were detected by Western blot using mAb 4D2, which recognizes the N-terminal domain of rhodopsin (Laird and Molday, 1988). Procedures used in separating phosphorylated S-opsin species were similar to those used for rhodopsin, except that the pH gradient of IEF gel used to resolve phosphorylated S-opsins was pH 3-10, instead of pH 3-8, as was the case for rhodopsin. After transferring the proteins to nitrocellulose membrane, S-opsins were 105 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. detected by Western blot using MBO N antibody, which was raised against the N- terminus of S-opsin (Shi, 2004). 4.2.6 Mathematical Simulations of Trans-phosphorylation We simulated a 200 x 200 square array of visual pigment molecules. These molecules were arranged as if on a grid, each having four neighbors (to the north, south, east and west). Initially, a random proportion, p , of the rhodopsin, was chosen to become phosphorylated. Given the particular value of p used for this iteration, the exact proportion of rhodopsin that would become phosphorylated was chosen by randomly sampling from the entire population of rhodopsin molecules. We denoted this set by P. Each iteration had a different p value chosen at random such that it fell between 0 and 1. Subsequently, we chose a random subset of molecules and labeled them S, corresponding to the proportion of S-opsin. These were chosen such that the final proportion of S equaled 0.14. There was no overlap between subsets P and S. Next, we simulated a process wherein each member of P randomly selected just one of its neighboring molecules. If the chosen molecule was type S, it became phosphorylated (designated here as SIP). We recorded the total number of molecules in S that underwent this latter conversion process and became SIP. We repeated this simulation process 2,500 times for each value of p in order to obtain an accurate estimate of the average number of S molecules that were converted to SIP status. If the mean proportion of such molecules over the course of these 2,500 replicates came close to the target proportion of SIP’s, denoted by sp, 106 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. estimated experimentally, we recorded the value of p that generated this data set. The entire procedure was repeated 5,000 times, which led to a set of accepted p values, and yielded a report on the mean of these p's. Subsequently, we used this value to calculate the number of rhodopsin molecules that became RIP. 4.3 Results We sought to investigate whether rhodopsin kinase, once activated by R*, would phosphorylate neighboring unbleached visual pigments in native disk membrane by a trans-phosphorylation mechanism. To address this question, transgenic mice were generated that expressed S-opsin (a mouse cone pigment) in rod photoreceptors expressing endogenous rhodopsin. Characterization of these mice showed that ectopically expressed S-opsin localized exclusively to the rod outer segment (Shi, 2004), produced light responses (see chapter 2 and 3), and was capable of undergoing light-stimulated phosphorylation (see below). Therefore, S-opsin appears to be correctly folded and functional in transgenic rods. 4.3.1 Detection of Rhodopsin and S-opsin Phosphorylation To detect phosphorylation of S-opsin and rhodopsin at their carboxyl termini, we adopted a mass spectrometry-based method described by Kennedy et al. (Kennedy et al., 2001). Briefly, treatment of urea-washed retinal membranes with endo-proteinase Asp-N released the carboxyl-terminal peptide that contains all (6/6) or most (8/9) of the Ser/Thr phosphorylation sites on rhodopsin and S-opsin, 107 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. respectively, from the disk membranes. The solubilized peptide mixture, including non-phosphorylated and phosphorylated peptides, was separated by reverse-phase chromatography and detected by a nanospray ionization ion trap mass spectrometer (Thermo Finnigan DECA XP) at their specific mass-to-charge (m/z) ratios. Initially, we used synthetic peptides derived from rhodopsin and S-opsin carboxyl-terminal sequences to determine their HPLC elution profiles. These peptides also served as standards for ion intensity, which is proportional to their concentration (non-phosphorylated peptides, rhodopsin S343 phosphorylated and S- opsin S328 phosphorylated peptides). Figure 4.1 shows the traces derived from equal amounts of loaded peptides. All four peptides (ROP, RIP, SOP, SIP) were separately eluted from a C l8 reverse-phase column by an acetonitrile gradient, and their sequence identities were confirmed by MS/MS spectra generated by collision- induced dissociation (CID, data not shown). The integrated area under the peak (Figure 4.1, shaded area) is proportional to the quantity of each ion species. When an equal amount of peptide was loaded, the area reflected the sensitivity of the mass spectrometer to each of the peptides. We estimated the relative detection efficiency of each peptide, when normalized to SOP, to be 0.41/0.6/0.34/1 for R1P/R0P/S1 P/SOP, respectively. These ratios were used to calculate the amounts of each peptide in the retinal samples. Transgenic mice expressing S-opsin were crossed into rhodopsin +/- or rhodopsin -/- genetic backgrounds (Lem et al., 1999) to obtain S-opsinrh o + /' or S- opsin'h o ‘" genotypes. To estimate the relative proportions of S-opsin to rhodopsin in 108 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 8.98 E 9 DDDASATASKTETS(P03)QVAPA m/z = 974.0 R 1 P 1.31 E10 DDDASATASKTETSQVAPA m/z = 933.1 ROP DVS(P03)GSQKTEVSTVSSSKVGPH m/z =1099.90 g ^ p 7.45 E9 DVSGSQKTEVSTVSSSKVGPH m/z = 706.3 SOP 2.19 El G r f .....i.... t — r r — r~ ----- r — i--r ~ .....i— r “ h 0 10 20 30 40 50 60 70 80 90 100 110 120 Time (min) Figure 4.1. Ion Chromatograms of Eluted Peptides Synthesized According to C-terminal Sequences of Rhodopsin and S-opsin. The following peptides were synthesized, separated by C l 8 reverse-phase chromatography, and detected by mass spectrometry: R IP (rhodopsin C-terminal peptide monophosphorylated at site 343; doubly charged; m/z = 974.0); ROP (non-phosphorylated rhodopsin C-terminal peptide; doubly charged; m/z = 933.1); SIP (S-opsin C-terminal peptide monophosphorylated at site 328; doubly charged; m/z = 1099.9); and SOP (non-phosphorylated S- opsin C-terminal peptide; triply charged; m/z = 706.3). O f each type of peptide, the most abundant ion with specific charge and m/z was monitored in a narrow mass window of 1.5 D. The x-axis is time course of HPLC elution; the y-axis is ion intensity. The area of integrated peak was normalized against a loaded peptide amount measured by its absorption at 205 nm to derive the relative detection efficiency of each peptide. R IP synthetic peptide contains 1 5 N isotopes at amino-N of A337 and A346 sites, and SIP synthetic peptide contains 1 5 N isotopes at amino-N of V335 and V338 sites. Therefore, their m/z values are 1 a.m.u./e greater than those of wild-type peptides obtained from retinal samples (in Figure 2 and 3). ROP and SOP synthetic peptides have the same m/z as wild-type peptides. The numbers beside each shaded peak represent the number of ions detected prior to normalization for ionization efficiency. 109 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. S-opsinrh o + /' rods, retinal membranes were prepared from dark-adapted mice wherein non-phosphorylated peptides predominated. Figure 4.2A shows the elution profiles of peptides released from Asp-N cleavage of retinal membranes obtained from dark- adapted mice. Identities of the peptides were confirmed by MS/MS. After correcting for their differences in ionization efficiency, we estimated the proportion of S-opsin to be 14 ± 1 % (SD, N=3) of total pigment molecules. 4.3.2 Phosphorylation of Rhodopsin and S-opsin following Stimulation by Short (360-420 nm) Wavelength Light Murine S-opsin has maximum absorbance in the ultraviolet range (357 nm (Jacobs et al., 1991; Lyubarsky et al., 1999)). At longer wavelengths, its absorbance falls precipitously, and, at A , 515 nm, photon absorption by S-opsin is 104-fold less efficient than rhodopsin (Jacobs et al., 1991; Lyubarsky et al., 1999). On the other hand, at the peak absorption of S-opsin, rhodopsin can be readily activated, albeit at -25% of its maximum sensitivity at 500 nm (Lyubarsky et al., 1999). We utilized the large separation of spectral sensitivity at long wavelengths to selectively stimulate rhodopsin, and sought to determine whether S-opsin becomes phosphorylated as a consequence of rhodopsin activation. We first tested to see whether S-opsin would undergo light-activated phosphorylation in rod photoreceptors. As mentioned above, little or no phosphorylated species were detected in dark-adapted retinas from S-opsinlh o + /" mice (Figure 4.2 A). After exposure to short wavelength light (360-420 nm) that caused 110 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. A Dark . rh o + /- S-opsin B 360-420 nm S-opsin*1 1 0 ^ 1.03 E8 R1P R1P j 7.12 E8 2.65 £8 ROP ROP m S1P S1P i i r 1.61 E8 9.9 E7 j | SOP SOP i I i i i i i i i t i i i i l l 0 10 20 30 40 50 60 70 80 90 100110120 0 10 20 [ 30 40 50 60 70 80 90 100110120 Time (min) Time (min) C D 360-420 nm 360-420 nm 0 . rho-/- S-opsin rho+/- 4.40 E8 . . | 3.49 £7 S1P R1P 1.05 E9 2.28 E8 | SOP i R 0 P 0 10 20 30 40 50 60 70 80 90 100110120 0 10 20 30 40 50 60 70 80 90 100110120 Time (min) Time (min) Figure 4.2. Phosphorylation of Rhodopsins and S-opsins following Exposure to 360-420 nm Light. Retinas were incubated in the dark or exposed to 360-420 nm light for 30 sec, which bleached -100% rhodopsins; they were incubated in the dark for an additional 10 min before being homogenized in urea buffer. Membranes were digested with AspN to isolate C-terminal peptides of rhodopsin and S- opsin. This figure shows the ion chromatograms of R IP (monophosphorylated rhodopsin C-terminal peptide; m/z = 973.0), ROP (non-phosphorylated rhodopsin C-terminal peptide; m/z = 933.1), SIP (monophosphorylated S-opsin C-terminal peptide; m/z = 1098.9), and SOP (non-phosphorylated S- opsin C-terminal peptide; m/z = 706.3), released from retinal membranes to represent the phosphorylation status of rhodopsin and S-opsin in each sample. Peptide identities of gray-shaded peaks were confirmed by MS/MS spectra. Phosphorylation of rhodopsin and S-opsin in dark-adapted (A) and 360-420 nm exposed (B) S-opsinrh o + /" retinas were compared. Phosphorylation of S-opsin and rhodopsin in S-opsinrh o /" (C) and rho+/- (D) retina, respectively, following 360-420 nm illumination, are also shown. I l l Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. an estimated ~ 100% bleach, followed by 10 min of dark incubation, peptides corresponding to monophosphorylated rhodopsin and S-opsin were readily detected (Figure 4.2 B), indicating that both S-opsin and rhodopsin were phosphorylated following UV light stimulation. As reported previously (Kennedy et al., 2001), we found that rhodopsin carboxyl-terminal peptides singly phosphorylated at different sites had similar hydrophobicity and eluted as overlapping peaks under our conditions. Of the peptides extracted from retinal membranes, peptides monophosphorylated at all possible sites were included in our detection and quantification. In the experiments involving mass spectrometry, we chose to monitor only singly phosphorylated species as readout for rhodopsin and S-opsin phosphorylation because they had been shown to be a highly abundant species after light exposure (Kennedy et al., 2001), and because of the relatively high sensitivity for their detection by the mass spectrometer. The sequence identities of the shaded peaks were confirmed by CID; both RIP and SIP ion peaks contained a mixture of peptides singly phosphorylated at different sites. Whereas different species of RIP eluted as one peak, SIP ions displayed two peaks, arising from two groups of monophosphorylated peptides with slightly different hydrophobicities. In the absence of rhodopsin (S-opsinl h C H /'), S-opsin also became phosphorylated in response to stimulation by short wavelength light (Figure 4.2 C). As predicted, rhodopsin by itself also became phosphorylated following exposure to short wavelength light (Figure 4.2 D). These data indicate that the ectopically expressed S-opsin is correctly folded and is a substrate for rhodopsin kinase in native rod disk membrane. 112 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 4.3.3 S-opsin Becomes Trans-phosphorylated following Activation of Rhodopsin by Long (515-620 nm) Wavelength Light S-opsinrh o + /' retinas were exposed to long wavelength (515-650 nm) light, causing an estimated -100% bleach of rhodopsin, and incubated in darkness for 10 min, in order to examine whether trans-phosphorylation of S-opsin occurred as a consequence of rhodopsin activation (Figure 4.3). As expected, long wavelength light exposure led to efficient phosphorylation of rhodopsin (Figure 4.3 A). When S- opsin was expressed in the absence of endogenous rhodopsin, it did not become phosphorylated after exposure to 515-620 nm light (Figure 4.3 B), verifying our expectation that S-opsin would not be efficiently activated by long wavelength light under our experimental settings. Interestingly, when retinas co-expressing S-opsin and rhodopsin were exposed to long wavelength light, a substantial fraction of S- opsin’s carboxyl terminus became phosphorylated (Figure 4.3 C), indicating that non-photolyzed pigments can serve as substrate for activated rhodopsin kinase. The extent of S-opsin that becomes indirectly phosphorylated (trans phosphorylation) was examined at different times after bright light exposure that was sufficient to bleach 100% of rhodopsin (Figure 4.4 A). Under this condition, the concentration of rhodopsin kinase became rate limiting such that rhodopsin phosphorylation continued to increase as a function of time in dark incubation (Kennedy et al., 2001; Laitko and Hofmann, 1998). Figure 4.4 A illustrates the proportion of phosphorylated peptides normalized to the amount of each pigment population. Whereas the level of singly phosphorylated rhodopsin reached a steady 113 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 515-620 nm rho+/- B 515-620 nm rho /- S-opsin R1P 1.67 E8 S1P I 1.14 E9 RO P | 0 10 20 30 40 50 60 70 80 90 100110120 Time (min) 9.99 E7 SOP , --------f -,— — t ,----- 1 —- |-----1 -----,-----1 -----1 -----1 " T I 0 10 20 30 40 50 60 70 80 90 100110120 Time (min) R1P 515-620 nm S-opsm i 7.32 E7 R0P 3.88 E8 S1P 1.45 E7 1.5 E8 SOP I T “1 I T I I I T I r “^ 1 0 10 20 30 40 50 60 70 80 90 100110120 Time (min) Figure 4.3. Trans-phosphorylation of S-opsins following Generation of R* by 515-620 nm Light. The samples were prepared in the same manner as is shown in Figure 2, except that they were exposed to 515-620 nm instead of 360-420 nm light. This figure shows ion chromatograms of R0P, R IP, SOP and SIP from S-opsinrh o + /" (A), S-opsinrh o _ /' (B), and rho+/- (C) retinas after 515-620 nm exposure. 114 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Time (min) 0.50 0 ,4 5 - 0.40- O 0-35- 0.30- X > 0.25- 4 ) N = 0 .2 0 - * } § 0,15- O Z 0.10- 0.05- 0 . 100% bleach □ r i p □ s i p n 2 m in 5 m in 1,2% bleach C 0.100 0.075 m 0.050 0.025 2 min 5 m in Figure 4.4. Rhodopsin Phosphorylation and S-opsin Trans-phosphorylation Level as a Function of Dark Incubation Time after Exposure to Different Intensities of Light. Each data point represents the average of at least three independent experiments. (A) Kinetics of rhodopsin and S-opsin phosphorylation following light exposure. S-opsinrh o + /" retinas were illuminated with 515-620 nm light for 30 sec, which caused an estimated full bleach to rhodopsin. Retinas were then incubated in darkness for 10 sec, 2 min, 5 min or 10 min. At each time point, phosphorylation levels of rhodopsin and S-opsin were quantified as a normalized fraction of R IP to the total amount of R IP and ROP, and SIP to the total amount of SOP and SIP, respectively. (B) S-opsinrh o + /" retinas were exposed to 515-620 nm light, which bleached -100% , and (C) -1.2 % rhodopsin. Phosphorylation levels of rhodopsin and S-opsin at 2 min and 5 min after bleach were quantified as in (A). 115 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. state at 2 min, the level of S-opsin phosphorylation continued to increase thereafter, and, at 10 min, the proportion of monophosphorylated S-opsin reached the same relative level as rhodopsin. The lag of S-opsin phosphorylation behind R* phosphorylation suggests that R* is the preferred substrate for rhodopsin kinase; as all available R* is phosphorylated, rhodopsin kinase becomes available to phosphorylate neighboring R. If R* is the preferred substrate, then the relative amount of trans phosphorylation would likely be higher under low bleach conditions that generate fewer R*. This notion was tested by comparing the levels of S-opsin phosphorylation under different light intensities. As shown in Figure 4B, the level of S-opsin phosphorylation was minimal shortly following >100% bleach of rhodopsin. This fraction increased two-fold following a longer period of dark incubation as more R* deactivated. When the retina was exposed to 1.2% bleach, the relative amount of trans-phosphorylation was substantially higher at the earlier time point and remained stable over time (Figure 4.4 C). Together, these data provide strong evidence that trans-phosphorylation occurs in living photoreceptor cells under low light conditions. We used mathematical simulations to estimate the fraction of rhodopsin (R) that becomes trans-phosphorylated. Simulations were based on the experimentally derived value of S-opsin expression level and the amount of S-opsin that became trans-phosphorylated following light stimulation that beached -1.2% of rhodopsin. The simulations were performed on a 200 x 200 square array of rhodopsin. These 116 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. rhodopsin molecules were arranged as if on a grid, each having four neighbors (to the north, south, east and west). The array assumed a random distribution composed of 86% rhodopsin and 14% S-opsin. Using mass spectrometry, we determined that the amount of trans-phosphorylated S-opsin was -7.5% of total S-opsin after 1.2% bleach of rhodopsin (Figure 4.4 C). Based on our simulations (see Materials and Methods), we estimated that 4.9% of R would be trans-phosphorylated, assuming that rhodopsins and S-opsins were equally good trans-phosphorylation substrates. This value was in close agreement with the experimentally assessed value (7.1 ± 2.9%) of the total pool of monophosphorylated rhodopsin; this included directly phosphorylated R* and trans-phosphorylated R (1.2% and 4.9%, respectively). It should be noted that these values underestimated the total number of phosphorylated pigments because only monophosphorylated species were monitored. Nevertheless, these values represented an approximation of the underlying process since monophosphorylated pigment appeared to be the most abundant phosphorylated species under this light condition (see below). We also simulated the amount of R* required to obtain the experimentally derived value for phosphorylated S-opsin, if each R* was allowed to phosphorylate one, two, or three neighbors. The simulation estimated the values to be 4.9%, 2.45% and 1.2% R*, respectively. A comparison of these values with our estimated 1.2% bleach, based on the calibrated light source, suggests that at least three R’s become trans-phosphorylated for each R* generated. 117 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 4.3.4 Trans-phosphorylation Results in Multiply Phosphorylated S-opsin The sensitivity of mass spectrometric detection of peptides decreases as the number of phosphate modifications increases. Although mass spectrometry offers higher sensitivity and better quantification of low levels of singly phosphorylated peptides, isoelectric focusing (IEF), followed by Western blotting, provides an alternative means by which to visualize multiply phosphorylated rhodopsins and S- opsins. Murine rhodopsin contains six phosphorylatable sites on its carboxyl terminus, and all six differentially phosphorylated species were clearly resolved by IEF (Figure 4.5 A). Rhodopsin species incorporating up to four phosphates were clearly detected ten seconds after 100% bleach, and species with five and six phosphates appeared with increasing dark incubation time after the bleach. A visual comparison of signals from these species indicates that they are present at approximately equal molar ratios. These data also show that phosphorylation reaches a steady state about 2 min after the 100% bleach, similar to the results presented in Figure 4.4. Multiply phosphorylated rhodopsins incorporating up to three phosphates were also observed after 1.2% bleach (Figure 4.5 A). IEF followed by Western blotting, using an amino-terminal antibody against S-opsin, was employed to detect phosphorylated species of S-opsin (Figure 4.5 B). Exposure of S-opsinrho/" retina to 360-420 nm light led to S-opsin species that incorporated up to nine phosphates (lane 1). Selective stimulation of rhodopsin in S-opsinrh o + /~ retinas by intense 515-620 nm light also led to multiply phosphorylated S-opsin, particularly after a period in dark incubation (lanes 3-5). Results from the 118 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Figure 4.5. Detection of Rhodopsin and S-opsin Phosphorylated Species by Isoelectric Focusing. (A) S-opsinrh o + /" was exposed to 515-620 nm light, which caused the indicated rhodopsin bleaching levels; it was incubated in darkness for the indicated period of time. Dk, dark-adapted control retina. Rhodopsin species incorporating zero to six phosphates (numbers marked on right side) were resolved on a pH 3-8 IEF gel and detected by Western blot using mAb 4D2 antibody against the rhodopsin N- terminus. (B) Trans-phosphorylation results in multiply phosphorylated S-opsin. Lane 1, S-opsin*0 - 7 - retina exposed to 360-420 nm light, causing -100% bleach, followed by 10 min of dark incubation. Lanes 2-7, S-opsinrh o + /" retinas incubated in the dark (Dk), or exposed to 515-620 nm light for the indicated bleach, followed by the indicated time in dark incubation. Lane 8, rho+/- retina exposed to 515-620 nm light, causing -100% bleach of rhodopsin. Lane 9, S-opsin*0 - 7 " retina exposed to intense 515-620 nm light and incubated in the dark for 10 min. Lane 10, S-opsin*0 -7 -’R K -7 - retina exposed to intense 360-420 nm light, followed by 10 min in dark incubation. S-opsin carrying zero to nine phosphates were separated on pH 3-10 IEF gel and detected by Western blot using MBO N antibody against the S-opsin N-terminus. Numerals on the right represent the number of phosphates of each S-opsin phosphorylated species. On the band at the upper edge of each lane is the trace of loading position; it overlaps with the band that represents S-opsin containing nine phosphates (lane 1). * is a non specific band unrelated to S-opsin. 119 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. trans-phosphorylated S-opsin indicate a different pattern of phosphorylation when compared with direct stimulation (lane 1). After 1.2% bleach, monophosphorylated species appeared to be most abundant (lanes 6, 7). As expected, phosphorylation of S-opsin did not occur when S-opsin1 *0 '7 ' retinas were stimulated with 515-620 nm light (lane 9), or in the absence of RK (lane 10). Thus, trans-phosphorylation gives rise to multiply phosphorylated, non-activated visual pigment molecules. 4.3.5 Demonstration of Trans-phosphorylation in Transgenic Mice that Express Human K296E Opsin We utilized the rhodopsin K296E transgenic mouse that expressed human K296E in rod photoreceptor cells as another model to demonstrate the presence of trans-phosphorylation in vivo (Li et al., 1995). Since K296E is capable of activating rhodopsin kinase in the dark while the endogenous wild-type rhodopsin is unbleached, trans-phosphorylation would result in phosphorylated mouse rhodopsin in the dark-adapted K296E retinas. The carboxyl-terminal peptide of mouse rhodopsin has an m/z value different from that of human rhodopsin; thus, phosphorylation of human and mouse rhodopsin could be unequivocally determined by LC-MS detection of the respective carboxyl-terminal phosphopeptides. As shown in Figure 4.6 A, no differences in endogenous mouse rhodopsin phosphorylation were observed when comparing dark-adapted retinas obtained from K296E transgenics and wild-type mice (Figure 4.6 A). This result is consistent with the observation that K296E is stably inactivated by arrestin binding. To unmask the 120 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. B a 0.06 < D C /3 3 1 0.05 .2 0.04- E 0.05 Control K296E arr+/+ Control K296E arr-/- Figure 4.6. Trans-phosphorylation of Endogenous Mouse Rhodopsin in Dark-Adapted K296E Transgenic Mouse Retina. Dark-adapted retinas from K296E transgenic mouse and transgene negative controls were prepared under infrared light. The fraction of monophosphorylated C- terminal peptide of endogenous mouse rhodopsin to the total amount of mouse rhodopsin was compared between K296E and control retinas in the arr +/+ (A) and arr -/- (B) backgrounds. 1 2 1 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. constitutive activity of K296E, this transgene was crossed into the arrestin knockout background. Indeed, in the absence of arrestin, the constitutive activity of K296E led to readily detectable phosphorylation of endogenous mouse rhodopsin (Figure 4.6 B). As expected, rhodopsin phosphorylation in the dark was not affected by the absence of arrestin (Figure 4.6 B). These results provide independent evidence of the presence of a trans-phosphorylation mechanism in vivo. 4.4 Discussion The phenomenon of high-gain phosphorylation has been observed in isolated rod outer segment preparations, as well as in living frogs (Aton, 1986; Binder et al., 1990; Binder et al., 1996; Chen et ah, 1995a). However, the mechanism by which inactive rhodopsin becomes phosphorylated, and the extent by which this happens in intact photoreceptor cells of mammals, have not been addressed. In this study, we sought to investigate whether unbleached visual pigments would become phosphorylated by RK through a trans-phosphorylation mechanism. We utilized two transgenic mouse models: one that expressed a cone shortwave pigment, and one that expressed a constitutively active human rhodopsin mutant (K296E) in the rod photoreceptors. These mouse models enabled us to specifically monitor the phosphorylation of unbleached visual pigment, as well as R* molecules, in their native environment, and each model provided independent evidence in strong support of trans-phosphorylation as a mechanism for high-gain phosphorylation. In the case of K296E, trans-phosphorylation was unmasked in the arrestin knockout 122 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. background. This result is consistent with a previous finding that K296E, in its active conformation, is phosphorylated and persistently bound to arrestin and, therefore, is incapable of further activating RK (Li et al., 1995). Thus, although this model provided us with a means to observe the presence of trans-phosphorylation, it apparently did not occur to any appreciable extent in dark-adapted retinas wherein K296E was expressed. To detect the phosphorylation of visual pigments at their carboxyl termini, a mass spectrometry method was employed. We chose to monitor monophosphorylated peptides in order to report the presence of phosphorylation events, since the levels of monophosphorylated species were more readily detectable and quantifiable in our experiments as compared with multiply phosphorylated peptides. Thus, the values we obtained from this method represented an underestimation of the total number of phosphorylated pigment molecules, especially under the condition of times after 1 0 0 % bleach; in such instances, the results from IEF showed that monophosphorylated species arising from phosphorylated R and R* may represent only 1/6 of all of the phosphorylated R*/R molecules. At lower bleach ( 1 .2 %), however, monophosphorylated species appeared to be the more abundant species. Therefore, the estimates derived at this light level may be more accurate. The IEF results also provide evidence that trans-phosphorylation produces highly phosphorylated R that, upon photoisomerization, will give rise to a diminished response. 123 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. The degree of trans-phosphorylation appears to correlate with the amount of R*: very little was observed immediately following 1 0 0 % bleach; thereafter, the level of phosphorylated R increased with dark incubation time as the number of R* decreased. Similarly, a relatively higher level of trans-phosphorylation was observed following low light exposure, during which time fewer R*’s were generated. These data are consistent with previous findings where the highest phosphorylation gain reported was for an exceedingly low bleach where one R* was generated per disk. When multiple R*’s are generated per disk, the gain decreases (Binder et al., 1990; Binder et al., 1996). One likely explanation for this observation, as stated by Binder et al., is that R* may be the preferred substrate for RK; at high bleach, R* would efficiently compete with R for interactions with RK, which is at limiting concentration in the rod outer segment. We used mathematical simulations to estimate the level of rhodopsin that would become trans-phosphorylated following dim light exposure. Although the modeling made several assumptions, including the random distribution of rhodopsin and S-opsin as well as their geometric relationship in the array, the results suggest that multiple non-activated rhodopsin molecules become trans-phosphorylated for each R* generated. Again, because we utilized data obtained for monophosphorylated species, these values underestimated the total number of phosphorylated pigments and, therefore, the gain of the trans-phosphorylation reaction. Our finding is consistent with previous studies that used isolated outer segment preparations, indicating that multiple non-activated pigments are being 124 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. phosphorylated for each R* generated. Given the high diffusion rate of rhodopsin along the lipid bilayer (Calvert et al., 2001; Kaplan, 1984; Wey et al., 1981), one can envision the R*/RK complex making contact with several non-activated rhodopsin molecules and phosphorylating their flexible carboxyl termini. Another possibility is that, once activated by associating with an R*, RK may be able to diffuse some distance away and phosphorylate R. The dependency of the gain of the phosphorylation reaction on the integrity of the rod outer segment preparation, as well as the inability of Rim and colleagues to observe trans-phosphorylation in solubilized proteins, are two lines of evidence against freely diffusible, active RK (Binder et al., 1990; Rim et al., 1997). This does not, however, rule out the possibility that active RK may be able to diffuse short distances alone. Future experiments would be required to clearly distinguish between these possibilities. The highest level of trans-phosphorylation under our experimental conditions, as indicated by S-opsin phosphorylation, was seen after 10 min of dark incubation following exposure to intense light that caused 100% of rhodopsin. In this instance, up to 20% of the entire population of S-opsin became phosphorylated. Although we did not explore the lighting condition that caused the highest level of trans-phosphorylation, our results suggest that a substantial fraction of non-activated visual pigments can be phosphorylated by this mechanism. Besides trans phosphorylation, another source of light-responsive, phosphorylated rhodopsin may be from regeneration of phosphor-opsin that has not yet been dephosphorylated. This is not unlikely, given the apparent slow rate of dephosphorylation (Ohguro et 125 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. al., 1995). Inasmuch as S-opsin was not activated in our assay, our system did not report phosphorylated R from this additional pathway. What may be the physiological consequence of photoactive, phosphorylated visual pigment? It should be noted that, in a fully dark-adapted rod cell, suction electrode recordings have shown that amplitude saturation was reached upon a flash of light that excited -80 rhodopsin molecules, as well as upon -400 R*/sec under steady background light (Baylor et al., 1984). Under the latter condition, up to 5% R* can accumulate in 10 min given the lag of the phosphatase activity. It is plausible, therefore, that, under certain steady-state lighting conditions, trans phosphorylation may have an impact on decreasing transduction gain and thereby extending the range of rod response. Another process by which trans-phosphorylation may have a profound impact takes place when the retina switches from photopic (cone) vision to scotopic (rod) vision. The switch between photopic and scotopic vision is a process crucial to our ability to detect visual cues within the wide variation of environmental illumination. During the switch from cones to rods, a period of dark adaptation is required for the rod cell to recover maximal sensitivity after a high bleach. Our data indicate that the trans-phosphorylation reaction continues long after light exposure. Since phosphorylated R* catalyzes transducin activation less efficiently, but is deactivated more efficiently, photoisomerization of these phosphorylated R’s is expected to give rise to a response with a slowed rising phase, a decreased amplitude, and a shorter duration; and, hence, decreased sensitivity during the period of dark adaptation. It is 126 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. also important to consider that the presence of phosphorylated R would be expected to affect the reproducibility of the single photon response. It is well documented that the invariant shape and size of the elementary light response are salient features of rods that underlie their ability to encode our visual scene under dim light (Rieke and Baylor, 1998). In this situation, dephosphorylation of R may be a limiting step in fully restoring visual sensitivity during dark adaptation. In light of the recent discovery that other G-protein-coupled receptors exist as dimers, or even as higher- structure oligomers (Angers et al., 2002), trans-phosphorylation of non-activated receptors in close proximity to activated receptors may also have an impact on other signaling pathways. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Bibliography Adamus, G., Arendt, A., Hargrave, P. A., Heyduk, T., and Palczewski, K. (1993). The kinetics of multiphosphorylation of rhodopsin. Arch Biochem Biophys 304, 443-447. Akimoto, M., Filippova, E., Gage, P. J., Zhu, X., Craft, C. M., and Swaroop, A. (2004). Transgenic mice expressing Cre-recombinase specifically in M- or S-cone photoreceptors. Invest Ophthalmol Vis Sci 45, 42-47. Angers, S., Salahpour, A., and Bouvier, M. (2002). Dimerization: an emerging concept for G protein-coupled receptor ontogeny and function. Annu Rev Pharmacol Toxicol 42, 409-435. Applebury, M. L., Antoch, M. P., Baxter, L. C., Chun, L. L., Falk, J. D., Farhangfar, F., Kage, K., Krzystolik, M. G., Lyass, L. A., and Robbins, J. T. (2000). The murine cone photoreceptor: a single cone type expresses both S and M opsins with retinal spatial patterning. Neuron 27, 513-523. Arshavsky, V., and Bownds, M. D. (1992). Regulation of deactivation of photoreceptor G protein by its target enzyme and cGMP. Nature 357, 416-417. Aton, B. R. (1986). Illumination of bovine photoreceptor membranes causes phosphorylation of both bleached and unbleached rhodopsin molecules. Biochemistry 25, 677-680. Babu, K. R., Dukkipati, A., Birge, R. R., and Knox, B. E. (2001). Regulation of phototransduction in short-wavelength cone visual pigments via the retinylidene Schiffbase counterion. Biochemistry 40, 13760-13766. Bauer, P. J. (1996). Cyclic GMP-gated channels of bovine rod photoreceptors: affinity, density and stoichiometry of Ca(2+)-calmodulin binding sites. J Physiol 494 ( Pt 3), 675-685. Baylor, D. A., Lamb, T. D., and Yau, K. W. (1979a). The membrane current of single rod outer segments. J Physiol 288, 589-611. Baylor, D. A., Lamb, T. D., and Yau, K. W. (1979b). Responses of retinal rods to single photons. J Physiol 288, 613-634. Baylor, D. A., Matthews, G., and Yau, K. W. (1980). Two components of electrical dark noise in toad retinal rod outer segments. J Physiol 309, 591-621. Baylor, D. A., Nunn, B. J., and Schnapf, J. L. (1984). The photocurrent, noise and spectral sensitivity of rods of the monkey Macaca fascicularis. J Physiol 357, 575- 607. Bennett, N., Michel-Villaz, M., and Kuhn, H. (1982). Light-induced interaction between rhodopsin and the GTP-binding protein. Metarhodopsin II is the major photoproduct involved. Eur J Biochem 127, 97-103. 128 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Biembaum, M. S., Binder, B. M., and Bownds, M. D. (1991). Dim background light and Cerenkov radiation from 32P block reversal of rhodopsin phosphorylation in intact frog retinal rods. Vis Neurosci 7, 499-503. Binder, B. M., Biembaum, M. S., and Bownds, M. D. (1990). Light activation of one rhodopsin molecule causes the phosphorylation of hundreds of others. A reaction observed in electropermeabilized frog rod outer segments exposed to dim illumination. J Biol Chem 265, 15333-15340. Binder, B. M., O'Connor, T. M., Bownds, M. D., and Arshavsky, V. Y. (1996). Phosphorylation of non-bleached rhodopsin in intact retinas and living frogs. J Biol Chem 271, 19826-19830. Birge, R. R. (1990). Nature of the primary photochemical events in rhodopsin and bacteriorhodopsin. Biochim Biophys Acta 1016, 293-321. Birge, R. R., Einterz, C. M., Knapp, H. M., and Murray, L. P. (1988). The nature of the primary photochemical events in rhodopsin and isorhodopsin. Biophys J 55, 367- 385. Bohm, S. K., Grady, E. F., and Bunnett, N. W. (1997). Regulatory mechanisms that modulate signalling by G-protein-coupled receptors. Biochem J 322 ( Pt 1), 1-18. Bownds, D. (1967). Site of attachment of retinal in rhodopsin. Nature 216, 1178- 1181. Brown, N. G., Fowles, C., Sharma, R., and Akhtar, M. (1993). Mechanistic studies on rhodopsin kinase. Light-dependent phosphorylation of C-terminal peptides of rhodopsin. Eur J Biochem 212, 840. Burkhardt, D. A. (1994). Light adaptation and photopigment bleaching in cone photoreceptors in situ in the retina of the turtle. J Neurosci 14, 1091-1105. Bums, M. E., and Baylor, D. A. (2001). Activation, deactivation, and adaptation in vertebrate photoreceptor cells. Annu Rev Neurosci 24, 779-805. Calvert, P. D., Govardovskii, V. I., Krasnoperova, N., Anderson, R. E., Lem, J., and Makino, C. L. (2001). Membrane protein diffusion sets the speed of rod phototransduction. Nature 411, 90-94. Calvert, P. D., Krasnoperova, N. V., Lyubarsky, A. L., Isayama, T., Nicolo, M., Kosaras, B., Wong, G., Gannon, K. S., Margolskee, R. F., Sidman, R. L., et al. (2000). Phototransduction in transgenic mice after targeted deletion of the rod transducin alpha -subunit. Proc Natl Acad Sci U S A 91, 13913-13918. Chen, C. K., Bums, M. E., He, W., Wensel, T. G., Baylor, D. A., and Simon, M. I. (2000). Slowed recovery of rod photoresponse in mice lacking the GTPase accelerating protein RGS9-1. Nature 403, 557-560. Chen, C. K., Bums, M. E., Spencer, M., Niemi, G. A., Chen, J., Hurley, J. B., Baylor, D. A., and Simon, M. I. (1999). Abnormal photoresponses and light-induced 129 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. apoptosis in rods lacking rhodopsin kinase. Proc Natl Acad Sci U S A 96, 3718- 3722. Chen, C. K., Inglese, J., Lefkowitz, R. J., and Hurley, J. B. (1995a). Ca(2 +)- dependent interaction of recoverin with rhodopsin kinase. J Biol Chem 270, 18060- 18066. Chen, J., Makino, C. L., Peachey, N. S., Baylor, D. A., and Simon, M. I. (1995b). Mechanisms of rhodopsin inactivation in vivo as revealed by a COOH-terminal truncation mutant. Science 267, 374-377. Chen, J., Tucker, C. L., Woodford, B., Szel, A., Lem, J., Gianella-Borradori, A., Simon, M. I., and Bogenmann, E. (1994). The human blue opsin promoter directs transgene expression in short-wave cones and bipolar cells in the mouse retina. Proc Natl Acad Sci U S A 91, 2611-2615. Cohen, G. B., Oprian, D. D., and Robinson, P. R. (1992). Mechanism of activation and inactivation of opsin: role of Glul 13 and Lys296. Biochemistry 31, 12592- 12601. Concepcion, F., Mendez, A., and Chen, J. (2002). The carboxyl-terminal domain is essential for rhodopsin transport in rod photoreceptors. Vision Res 42, 417-426. Cornwall, M. C., and Fain, G. L. (1994). Bleached pigment activates transduction in isolated rods of the salamander retina. J Physiol 480 ( Pt 2), 261-279. Cornwall, M. C., Matthews, H. R., Crouch, R. K., and Fain, G. L. (1995). Bleached pigment activates transduction in salamander cones. J Gen Physiol 106, 543-557. Crouch, R. K., Chader, G. J., Wiggert, B., and Pepperberg, D. R. (1996). Retinoids and the visual process. Photochem Photobiol 64, 613-621. Dean, K. R., and Akhtar, M. (1996). Novel mechanism for the activation of rhodopsin kinase: implications for other G protein-coupled receptor kinases (GRK's). Biochemistry 35, 6164-6172. Deretic, D., and Papermaster, D. S. (1991). Polarized sorting of rhodopsin on post- Golgi membranes in frog retinal photoreceptor cells. J Cell Biol 113, 1281-1293. Deretic, D., Puleo-Scheppke, B., and Trippe, C. (1996). Cytoplasmic domain of rhodopsin is essential for post-Golgi vesicle formation in a retinal cell-free system. J Biol Chem 271, 2279-2286. Deretic, D., Schmerl, S., Hargrave, P. A., Arendt, A., and McDowell, J. H. (1998). Regulation of sorting and post-Golgi trafficking of rhodopsin by its C-terminal sequence QVS(A)PA. Proc Natl Acad Sci U S A 95, 10620-10625. Dohlman, H. G., and Thomer, J. (1997). RGS proteins and signaling by heterotrimeric G proteins. J Biol Chem 272, 3871-3874. Dukkipati, A., Kusnetzow, A., Babu, K. R., Ramos, L., Singh, D., Knox, B. E., and Birge, R. R. (2002). Phototransduction by vertebrate ultraviolet visual pigments: 130 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. protonation of the retinylidene Schiff base following photobleaching. Biochemistry 41, 9842-9851. Emeis, D., Kuhn, H., Reichert, J., and Hofmann, K. P. (1982). Complex formation between metarhodopsin II and GTP-binding protein in bovine photoreceptor membranes leads to a shift of the photoproduct equilibrium. FEBS Lett 143, 29-34. Fahmy, K., and Sakmar, T. P. (1993). Regulation of the rhodopsin-transducin interaction by a highly conserved carboxylic acid group. Biochemistry 32, 7229- 7236. Fahmy, K., Sakmar, T. P., and Siebert, F. (2000). Structural determinants of active state conformation of rhodopsin: molecular biophysics approaches. Methods Enzymol 315, 178-196. Fain, G. L., Matthews, H. R., and Cornwall, M. C. (1996). Dark adaptation in vertebrate photoreceptors. Trends Neurosci 19, 502-507. Fain, G. L., Matthews, H. R., Cornwall, M. C., and Koutalos, Y. (2001). Adaptation in vertebrate photoreceptors. Physiol Rev 81, 117-151. Fasick, J. I., Applebury, M. L., and Oprian, D. D. (2002). Spectral tuning in the mammalian short-wavelength sensitive cone pigments. Biochemistry 41, 6860-6865. Fesenko, E. E., Kolesnikov, S. S., and Lyubarsky, A. L. (1985). Induction by cyclic GMP of cationic conductance in plasma membrane of retinal rod outer segment. Nature 313, 310-313. Fukada, Y., and Yoshizawa, T. (1981). Activation of phosphodiesterase in frog rod outer segment by an intermediate of rhodopsin photolysis. II. Biochim Biophys Acta 675, 195-200. Fung, B. K., Hurley, J. B., and Stryer, L. (1981). Flow of information in the light- triggered cyclic nucleotide cascade of vision. Proc Natl Acad Sci U S A 78, 152-156. Fung, B. K., Lieberman, B. S., and Lee, R. H. (1992). A third form of the G protein beta subunit. 2. Purification and biochemical properties. J Biol Chem 267, 24782- 24788. Gibson, S. K., Parkes, J. H., and Liebman, P. A. (2000). Phosphorylation modulates the affinity of light-activated rhodopsin for G protein and arrestin. Biochemistry 39, 5738-5749. Goodman, O. B., Jr., Krupnick, J. G., Santini, F., Gurevich, V. V., Penn, R. B., Gagnon, A. W., Keen, J. H., and Benovic, J. L. (1996). Beta-arrestin acts as a clathrin adaptor in endocytosis of the beta2-adrenergic receptor. Nature 383, 447- 450. Gorczyca, W. A., Gray-Keller, M. P., Detwiler, P. B., and Palczewski, K. (1994). Purification and physiological evaluation of a guanylate cyclase activating protein from retinal rods. Proc Natl Acad Sci U S A 91, 4014-4018. 131 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Gorczyca, W. A., Polans, A. S., Surgucheva, I. G., Subbaraya, I., Baehr, W., and Palczewski, K. (1995). Guanylyl cyclase activating protein. A calcium-sensitive regulator of phototransduction. J Biol Chem 270, 22029-22036. Green, E. S., Menz, M. D., LaVail, M. M., and Flannery, J. G. (2000). Characterization of rhodopsin mis-sorting and constitutive activation in a transgenic rat model of retinitis pigmentosa. Invest Ophthalmol Vis Sci 41, 1546-1553. Hamm, H. E., and Gilchrist, A. (1996). Heterotrimeric G proteins. Curr Opin Cell Biol 8, 189-196. Hargrave, P. A., McDowell, J. H., Curtis, D. R., Wang, J. K., Juszczak, E., Fong, S. L., Rao, J. K., and Argos, P. (1983). The structure of bovine rhodopsin. Biophys Struct Mech 9, 235-244. Hodges, R. S., Heaton, R. J., Parker, J. M., Molday, L., and Molday, R. S. (1988). Antigen-antibody interaction. Synthetic peptides define linear antigenic determinants recognized by monoclonal antibodies directed to the cytoplasmic carboxyl terminus of rhodopsin. J Biol Chem 263, 11768-11775. Hofmann, K. P., Pulvermuller, A., Buczylko, J., Van Hooser, P., and Palczewski, K. (1992). The role of arrestin and retinoids in the regeneration pathway of rhodopsin. J Biol Chem 267, 15701-15706. Holcman, D., and Korenbrot, J. I. (2004). Longitudinal diffusion in retinal rod and cone outer segment cytoplasm: the consequence of cell structure. Biophys J 86, 2566-2582. Hsu, Y. T., and Molday, R. S. (1993). Modulation of the cGMP-gated channel of rod photoreceptor cells by calmodulin. Nature 361, 76-79. Imai, H., Hirano, T., Kandori, H., Terakita, A., and Shichida, Y. (2001). Difference in molecular structure of rod and cone visual pigments studied by Fourier transform infrared spectroscopy. Biochemistry 40, 2879-2886. Imai, H., Imamoto, Y., Yoshizawa, T., and Shichida, Y. (1995). Difference in molecular properties between chicken green and rhodopsin as related to the functional difference between cone and rod photoreceptor cells. Biochemistry 34, 10525-10531. Imai, H., Kojima, D., Oura, T., Tachibanaki, S., Terakita, A., and Shichida, Y. (1997a). Single amino acid residue as a functional determinant of rod and cone visual pigments. Proc Natl Acad Sci U S A 94, 2322-2326. Imai, H., Terakita, A., and Shichida, Y. (2000). Analysis of amino acid residues in rhodopsin and cone visual pigments that determine their molecular properties. Methods Enzymol 315, 293-312. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Imai, H., Terakita, A., Tachibanaki, S., Imamoto, Y., Yoshizawa, T., and Shichida, Y. (1997b). Photochemical and biochemical properties of chicken blue-sensitive cone visual pigment. Biochemistry 36, 12773-12779. Jacobs, G. H., Neitz, J., and Deegan, J. F., 2nd (1991). Retinal receptors in rodents maximally sensitive to ultraviolet light. Nature 353, 655-656. Jager, F., Fahmy, K., Sakmar, T. P., and Siebert, F. (1994). Identification of glutamic acid 113 as the Schiff base proton acceptor in the metarhodopsin II photointermediate of rhodopsin. Biochemistry 33, 10878-10882. Jaissle, G. B., May, C. A., Reinhard, J., Kohler, K., Fauser, S., Lutjen-Drecoll, E., Zrenner, E., and Seeliger, M. W. (2001). Evaluation of the rhodopsin knockout mouse as a model of pure cone function. Invest Ophthalmol Vis Sci 42, 506-513. Janz, J. M., and Farrens, D. L. (2001). Engineering a functional blue-wavelength- shifted rhodopsin mutant. Biochemistry 40, 7219-7227. Jones, G. J., Cornwall, M. C., and Fain, G. L. (1996). Equivalence of background and bleaching desensitization in isolated rod photoreceptors of the larval tiger salamander. J Gen Physiol 108, 333-340. Kaplan, M. W. (1984). Rhodopsin lateral diffusion as a function of rod outer segment disk membrane axial position. Biophys J 45, 851-853. Kawamura, S. (1993). Rhodopsin phosphorylation as a mechanism of cyclic GMP phosphodiesterase regulation by S-modulin. Nature 362, 855-857. Keen, T. J., Ingleheam, C. F., Lester, D. H., Bashir, R., Jay, M., Bird, A. C., Jay, B., and Bhattacharya, S. S. (1991). Autosomal dominant retinitis pigmentosa: four new mutations in rhodopsin, one of them in the retinal attachment site. Genomics 11, 199-205. Kefalov, V., Fu, Y., Marsh-Armstrong, N., and Yau, K. W. (2003). Role of visual pigment properties in rod and cone phototransduction. Nature 425, 526-531. Kennedy, M. J., Lee, K. A., Niemi, G. A., Craven, K. B., Garwin, G. G., Saari, J. C., and Hurley, J. B. (2001). Multiple phosphorylation of rhodopsin and the in vivo chemistry underlying rod photoreceptor dark adaptation. Neuron 31, 87-101. Klenchin, V. A., Calvert, P. D., and Bownds, M. D. (1995). Inhibition of rhodopsin kinase by recoverin. Further evidence for a negative feedback system in phototransduction. J Biol Chem 270, 16147-16152. Knox, B. E., Schlueter, C., Sanger, B. M., Green, C. B., and Besharse, J. C. (1998). Transgene expression in Xenopus rods. FEBS Lett 423, 117-121. Koutalos, Y., Nakatani, K., Tamura, T., and Yau, K. W. (1995a). Characterization of guanylate cyclase activity in single retinal rod outer segments. J Gen Physiol 106, 863-890. 133 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Koutalos, Y., Nakatani, K., and Yau, K. W. (1995b). The cGMP-phosphodiesterase and its contribution to sensitivity regulation in retinal rods. J Gen Physiol 106, 891 - 921. Koutalos, Y., and Yau, K. W. (1996). Regulation of sensitivity in vertebrate rod photoreceptors by calcium. Trends Neurosci 19, 73-81. Kuhn, H., Cook, J. H., and Dreyer, W. J. (1973). Phosphorylation of rhodopsin in bovine photoreceptor membranes. A dark reaction after illumination. Biochemistry 12, 2495-2502. Kuhn, H., and Dreyer, W. J. (1972). Light dependent phosphorylation of rhodopsin by ATP. FEBS Lett 20, 1-6. Kusnetzow, A., Dukkipati, A., Babu, K. R., Singh, D., Vought, B. W., Knox, B. E., Birge, R. R., Imai, EL, Hirano, T., Kandori, E L, et al. (2001). The photobleaching sequence of a short-wavelength visual pigment Difference in molecular structure of rod and cone visual pigments studied by Fourier transform infrared spectroscopy Analysis of amino acid residues in rhodopsin and cone visual pigments that determine their molecular properties. Biochemistry 40, 7832-7844. Kusnetzow, A. K., Dukkipati, A., Babu, K. R., Ramos, L., Knox, B. E., and Birge, R. R. (2004). Vertebrate ultraviolet visual pigments: protonation of the retinylidene Schiff base and a counterion switch during photoactivation. Proc Natl Acad Sci U S A 101, 941-946. Kuwayama, S., Imai, EL, Hirano, T., Terakita, A., and Shichida, Y. (2002). Conserved proline residue at position 189 in cone visual pigments as a determinant of molecular properties different from rhodopsins. Biochemistry 41, 15245-15252. Kuwayama, S., Imai, H., Morizumi, T., and Shichida, Y. (2005). Amino Acid Residues Responsible for the Meta-III Decay Rates in Rod and Cone Visual Pigments. Biochemistry 44, 2208-2215. Laird, D. W., and Molday, R. S. (1988). Evidence against the role of rhodopsin in rod outer segment binding to RPE cells. Invest Ophthalmol Vis Sci 29, 419-428. Laitko, U., and Hofmann, K. P. (1998). A model for the recovery kinetics of rod phototransduction, based on the enzymatic deactivation of rhodopsin. Biophys J 74, 803-815. Lamb, T. D., and Pugh, E. N., Jr. (1992). A quantitative account of the activation steps involved in phototransduction in amphibian photoreceptors. J Physiol 449, 719- 758. Langen, R., Cai, K., Altenbach, C., Khorana, H. G., and Hubbell, W. L. (1999). Structural features of the C-terminal domain of bovine rhodopsin: a site-directed spin-labeling study. Biochemistry 38, 7918-7924. 134 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Lee, R. H., Lieberman, B. S., Yamane, H. K., Bok, D., and Fung, B. K. (1992). A third form of the G protein beta subunit. 1. Immunochemical identification and localization to cone photoreceptors. J Biol Chem 267, 24776-24781. Lem, J., Applebury, M. L., Falk, J. D., Flannery, J. G., and Simon, M. I. (1991). Tissue-specific and developmental regulation of rod opsin chimeric genes in transgenic mice. Neuron 6, 201-210. Lem, J., Krasnoperova, N. V., Calvert, P. D., Kosaras, B., Cameron, D. A., Nicolo, M., Makino, C. L., and Sidman, R. L. (1999). Morphological, physiological, and biochemical changes in rhodopsin knockout mice. Proc Natl Acad Sci U S A 96, 736-741. Lerea, C. L., Bunt-Milam, A. H., and Flurley, J. B. (1989). Alpha transducin is present in blue-, green-, and red-sensitive cone photoreceptors in the human retina. Neuron 3, 367-376. Lerea, C. L., Somers, D. E., Hurley, J. B., Klock, I. B., and Bunt-Milam, A. H. (1986). Identification of specific transducin alpha subunits in retinal rod and cone photoreceptors. Science 234, 77-80. Lewis, J. W., and Kliger, D. S. (2000). Absorption spectroscopy in studies of visual pigments: spectral and kinetic characterization of intermediates. Methods Enzymol 315, 164-178. Li, T., Franson, W. K., Gordon, J. W., Berson, E. L., and Dryja, T. P. (1995). Constitutive activation of phototransduction by K296E opsin is not a cause of photoreceptor degeneration. Proc Natl Acad Sci U S A 92, 3551-3555. Li, T., Snyder, W. K., Olsson, J. E., and Dryja, T. P. (1996). Transgenic mice carrying the dominant rhodopsin mutation P347S: evidence for defective vectorial transport of rhodopsin to the outer segments. Proc Natl Acad Sci U S A 93, 14176- 14181. Li, Z. Y., Wong, F., Chang, J. H., Possin, D. E., Hao, Y., Petters, R. M., and Milam, A. H. (1998). Rhodopsin transgenic pigs as a model for human retinitis pigmentosa. Invest Ophthalmol Vis Sci 39, 808-819. Litman, B. J. (1982). Purification of rhodopsin by concanavalin A affinity chromatography. Methods Enzymol 81, 150-153. Lukats, A., Dkhissi-Benyahya, O., Szepessy, Z., Rohlich, P., Vigh, B., Bennett, N. C., Cooper, H. M., and Szel, A. (2002). Visual pigment coexpression in all cones of two rodents, the Siberian hamster, and the pouched mouse. Invest Ophthalmol Vis Sci 43, 2468-2473. Lyubarsky, A. L., Falsini, B., Pennesi, M. E., Valentini, P., and Pugh, E. N., Jr. (1999). UV- and midwave-sensitive cone-driven retinal responses of the mouse: a possible phenotype for coexpression of cone photopigments. J Neurosci 19, 442-455. 135 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Lyubarsky, A. L., Lem, J., Chen, J., Falsini, B., Iannaccone, A., and Pugh, E. N., Jr. (2002). Functionally rodless mice: transgenic models for the investigation of cone function in retinal disease and therapy. Vision Res 42, 401-415. Ma, J., Znoiko, S., Othersen, K. L., Ryan, J. C., Das, J., Isayama, T., Kono, M., Oprian, D. D., Corson, D. W., Cornwall, M. C., et al. (2001). A visual pigment expressed in both rod and cone photoreceptors. Neuron 32, 451-461. MacKenzie, D., Arendt, A., Hargrave, P., McDowell, J. H., and Molday, R. S. (1984). Localization of binding sites for carboxyl terminal specific anti-rhodopsin monoclonal antibodies using synthetic peptides. Biochemistry 23, 6544-6549. Makino, C. L., Dodd, R. L., Chen, J., Bums, M. E., Roca, A., Simon, M. I., and Baylor, D. A. (2004). Recoverin regulates light-dependent phosphodiesterase activity in retinal rods. J Gen Physiol 123, 729-741. Matthews, H. R., Cornwall, M. C., and Fain, G. L. (1996). Persistent activation of transducin by bleached rhodopsin in salamander rods. J Gen Physiol 108, 557-563. Matthews, H. R., Fain, G. L., Murphy, R. L., and Lamb, T. D. (1990). Light adaptation in cone photoreceptors of the salamander: a role for cytoplasmic calcium. J Physiol 420, 447-469. Matthews, R. G., Hubbard, R., Brown, P. K., and Wald, G. (1963). Tautomeric Forms of Metarhodopsin. J Gen Physiol 47, 215-240. Mears, A. J., Kondo, M., Swain, P. K., Takada, Y., Bush, R. A., Saunders, T. L., Sieving, P. A., and Swaroop, A. (2001). Nrl is required for rod photoreceptor development. Nat Genet 29, 447-452. Mendez, A., Bums, M. E., Roca, A., Lem, J., Wu, L. W., Simon, M. I., Baylor, D. A., and Chen, J. (2000). Rapid and reproducible deactivation of rhodopsin requires multiple phosphorylation sites. Neuron 28, 153-164. Mendez, A., Bums, M. E., Sokal, I., Dizhoor, A. M., Baehr, W., Palczewski, K., Baylor, D. A., and Chen, J. (2001). Role of guanylate cyclase-activating proteins (GCAPs) in setting the flash sensitivity of rod photoreceptors. Proc Natl Acad Sci U S A 95, 9948-9953. Menon, S. T., Han, M., and Sakmar, T. P. (2001). Rhodopsin: structural basis of molecular physiology. Physiol Rev 81, 1659-1688. Molday, R. S., and MacKenzie, D. (1983). Monoclonal antibodies to rhodopsin: characterization, cross-reactivity, and application as structural probes. Biochemistry 22, 653-660. Nakatani, K., and Yau, K. W. (1988a). Calcium and light adaptation in retinal rods and cones. Nature 334, 69-71. Nakatani, K., and Yau, K. W. (1988b). Calcium and magnesium fluxes across the plasma membrane of the toad rod outer segment. J Physiol 395, 695-729. 136 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Nakatani, K., and Yau, K. W. (1989). Sodium-dependent calcium extrusion and sensitivity regulation in retinal cones of the salamander. J Physiol 409, 525-548. Nathans, J. (1990). Determinants of visual pigment absorbance: identification of the retinylidene Schiff s base counterion in bovine rhodopsin. Biochemistry 29, 9746- 9752. Nathans, J., and Hogness, D. S. (1983). Isolation, sequence analysis, and intron-exon arrangement of the gene encoding bovine rhodopsin. Cell 34, 807-814. Nathans, J., Thomas, D., and Hogness, D. S. (1986). Molecular genetics of human color vision: the genes encoding blue, green, and red pigments. Science 232, 193- 202. Nikonov, S., Lamb, T. D., and Pugh, E. N., Jr. (2000). The role of steady phosphodiesterase activity in the kinetics and sensitivity of the light-adapted salamander rod photoresponse. J Gen Physiol 116, 795-824. Ohguro, H., Van Hooser, J. P., Milam, A. H., and Palczewski, K. (1995). Rhodopsin phosphorylation and dephosphorylation in vivo. J Biol Chem 270, 14259-14262. Okada, T., Le Trong, I., Fox, B. A., Behnke, C. A., Stenkamp, R. E., and Palczewski, K. (2000). X-Ray diffraction analysis of three-dimensional crystals of bovine rhodopsin obtained from mixed micelles. J Struct Biol 130, 73-80. Okano, T., Fukada, Y., Artamonov, I. D., and Yoshizawa, T. (1989). Purification of cone visual pigments from chicken retina. Biochemistry 28, 8848-8856. Ong, O. C., Yamane, H. K., Phan, K. B., Fong, H. K., Bok, D., Lee, R. H., and Fung, B. K. (1995). Molecular cloning and characterization of the G protein gamma subunit of cone photoreceptors. J Biol Chem 270, 8495-8500. Oprian, D. D., Molday, R. S., Kaufman, R. J., and Khorana, H. G. (1987). Expression of a synthetic bovine rhodopsin gene in monkey kidney cells. Proc Natl Acad Sci U S A 84, 8874-8878. Palczewski, K., Arendt, A., McDowell, J. H., and Hargrave, P. A. (1989). Substrate recognition determinants for rhodopsin kinase: studies with synthetic peptides, polyanions, and polycations. Biochemistry 28, 8764-8770. Palczewski, K., Buczylko, J., Kaplan, M. W., Polans, A. S., and Crabb, J. W. (1991). Mechanism of rhodopsin kinase activation. J Biol Chem 266, 12949-12955. Palczewski, K., Kumasaka, T., Hori, T., Behnke, C. A., Motoshima, H., Fox, B. A., Le Trong, I., Teller, D. C., Okada, T., Stenkamp, R. E., et al. (2000). Crystal structure of rhodopsin: A G protein-coupled receptor. Science 289, 739-745. Palczewski, K., McDowell, J. H., and Hargrave, P. A. (1988a). Purification and characterization of rhodopsin kinase. J Biol Chem 263, 14067-14073. Palczewski, K., McDowell, J. H., and Hargrave, P. A. (1988b). Rhodopsin kinase: substrate specificity and factors that influence activity. Biochemistry 27, 2306-2313. 137 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Palczewski, K., Subbaraya, I., Gorczyca, W. A., Helekar, B. S., Ruiz, C. C., Ohguro, H., Huang, J., Zhao, X., Crabb, J. W., Johnson, R. S., and et al. (1994). Molecular cloning and characterization of retinal photoreceptor guanylyl cyclase-activating protein. Neuron 13, 395-404. Peng, Y. W., Robishaw, J. D., Levine, M. A., and Yau, K. W. (1992). Retinal rods and cones have distinct G protein beta and gamma subunits. Proc Natl Acad Sci U S A 89, 10882-10886. Pitcher, J. A., Freedman, N. J., and Lefkowitz, R. J. (1998). G protein-coupled receptor kinases. Annu Rev Biochem 67, 653-692. Pugh, E. N., Jr., and Lamb, T. D. (1993). Amplification and kinetics of the activation steps in phototransduction. Biochim Biophys Acta 1141, 111-149. Pugh, E. N., and Lamb, T. D. (2000). Phototransduction in vertebrate rods and cones: molecular mechanisms of amplification, recovery and light adaptation. In Handbook of Biological Physics, E. N. Pugh, ed. (Amsterdam, Elsevier Science), pp. 183-255. Rieke, F., and Baylor, D. A. (1998). Origin of reproducibility in the responses of retinal rods to single photons. Biophys J 75, 1836-1857. Rieke, F., and Baylor, D. A. (2000). Origin and functional impact of dark noise in retinal cones. Neuron 26, 181-186. Rim, J., Faurobert, E., Hurley, J. B., and Oprian, D. D. (1997). In vitro assay for trans-phosphorylation of rhodopsin by rhodopsin kinase. Biochemistry 36, 7064- 7070. Robinson, P. R., Buczylko, J., Ohguro, H., and Palczewski, K. (1994). Opsins with mutations at the site of chromophore attachment constitutively activate transducin but are not phosphorylated by rhodopsin kinase. Proc Natl Acad Sci U S A 91, 5411 - 5415. Robinson, P. R., Cohen, G. B., Zhukovsky, E. A., and Oprian, D. D. (1992). Constitutively active mutants of rhodopsin. Neuron 9, 719-725. Rodieck, R. W. (1998). The First Steps in Seeing (Sunderland, Sinauer Associates, Inc.). Sakmar, T. P., Franke, R. R., and Khorana, H. G. (1989). Glutamic acid-113 serves as the retinylidene Schiff base counterion in bovine rhodopsin. Proc Natl Acad Sci U S A 86, 8309-8313. Sakmar, T. P., Franke, R. R., and Khorana, H. G. (1991). The role of the retinylidene Schiff base counterion in rhodopsin in determining wavelength absorbance and Schiff base pKa. Proc Natl Acad Sci U S A 88, 3079-3083. Schnapf, J. L., Nunn, B. J., Meister, M., and Baylor, D. A. (1990). Visual transduction in cones of the monkey Macaca fascicularis. J Physiol 427, 681-713. 138 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Shi, G., Concepcion, F.A., and Chen, J. (2004). Targeting of Visual Pigments to Rod Outer Segment in Rhodopsin Knockout Mice. In Photoreceptor Cell Biology and Inherited Retinal Degenerations, D. S. Williams, ed. (Singapore, World Scientific), pp. 93-107. Shichida, Y., and Imai, H. (1998). Visual pigment: G-protein-coupled receptor for light signals. Cell Mol Life Sci 54, 1299-1315. Shichida, Y., Imai, H., Imamoto, Y., Fukada, Y., and Yoshizawa, T. (1994). Is chicken green-sensitive cone visual pigment a rhodopsin-like pigment? A comparative study of the molecular properties between chicken green and rhodopsin. Biochemistry 33, 9040-9044. Shichida, Y., Okada, T., Kandori, H., Fukada, Y., and Yoshizawa, T. (1993). Nanosecond laser photolysis of iodopsin, a chicken red-sensitive cone visual pigment. Biochemistry 32, 10832-10838. Sokolov, M., Lyubarsky, A. L., Strissel, K. J., Savchenko, A. B., Govardovskii, V. I., Pugh, E. N., Jr., and Arshavsky, V. Y. (2002). Massive light-driven translocation of transducin between the two major compartments of rod cells: a novel mechanism of light adaptation. Neuron 34, 95-106. Starace, D. M., and Knox, B. E. (1997). Activation of transducin by a Xenopus short wavelength visual pigment. J Biol Chem 272, 1095-1100. Stryer, L., Hurley, J. B., and Fung, B. K. (1983). Transducin and the cyclic GMP phosphodiesterase of retinal rod outer segments. Methods Enzymol 96, 617-627. Sung, C. H., Makino, C., Baylor, D., and Nathans, J. (1994). A rhodopsin gene mutation responsible for autosomal dominant retinitis pigmentosa results in a protein that is defective in localization to the photoreceptor outer segment. J Neurosci 14, 5818-5833. Tachibanaki, S., Tsushima, S., and Kawamura, S. (2001). Low amplification and fast visual pigment phosphorylation as mechanisms characterizing cone photoresponses. Proc Natl Acad Sci U S A 98, 14044-14049. Tam, B. M., Moritz, O. L., Hurd, L. B., and Papermaster, D. S. (2000). Identification of an outer segment targeting signal in the COOH terminus of rhodopsin using transgenic Xenopus laevis. J Cell Biol 151, 1369-1380. Tamura, T., Nakatani, K., and Yau, K. W. (1989). Light adaptation in cat retinal rods. Science 245, 755-758. Wald, G. (1968). The molecular basis of visual excitation. Nature 219, 800-807. Wang, Q., Schoenlein, R. W., Peteanu, L. A., Mathies, R. A., and Shank, C. V. (1994). Vibrationally coherent photochemistry in the femtosecond primary event of vision. Science 266, 422-424. 139 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Weiss, E. R., Ducceschi, M. H., Homer, T. J., Li, A., Craft, C. M., and Osawa, S. (2001). Species-specific differences in expression of G-protein-coupled receptor kinase (GRK) 7 and GRK1 in mammalian cone photoreceptor cells: implications for cone cell phototransduction. J Neurosci 21, 9175-9184. Wey, C. L., Cone, R. A., and Edidin, M. A. (1981). Lateral diffusion of rhodopsin in photoreceptor cells measured by fluorescence photobleaching and recovery. Biophys J 33, 225-232. Wickman, K., and Clapham, D. E. (1995). Ion channel regulation by G proteins. Physiol Rev 75, 865-885. Wilden, U. (1995). Duration and amplitude of the light-induced cGMP hydrolysis in vertebrate photoreceptors are regulated by multiple phosphorylation of rhodopsin and by arrestin binding. Biochemistry 34, 1446-1454. Wilden, U., Hall, S. W., and Kuhn, H. (1986). Phosphodiesterase activation by photoexcited rhodopsin is quenched when rhodopsin is phosphorylated and binds the intrinsic 48-kDa protein of rod outer segments. Proc Natl Acad Sci U S A 83, 1174- 1178. Wilden, U., and Kuhn, H. (1982). Light-dependent phosphorylation of rhodopsin: number of phosphorylation sites. Biochemistry 21, 3014-3022. Xu, J., Dodd, R. L., Makino, C. L., Simon, M. I., Baylor, D. A., and Chen, J. (1997). Prolonged photoresponses in transgenic mouse rods lacking arrestin. Nature 389, 505-509. Yang, R. B., Robinson, S. W., Xiong, W. H., Yau, K. W., Birch, D. G., and Garbers, D. L. (1999). Disruption of a retinal guanylyl cyclase gene leads to cone-specific dystrophy and paradoxical rod behavior. J Neurosci 19, 5889-5897. Yau, K. W. (1994). Phototransduction mechanism in retinal rods and cones. The Friedenwald Lecture. Invest Ophthalmol Vis Sci 35, 9-32. Yau, K. W., and Nakatani, K. (1984). Cation selectivity of light-sensitive conductance in retinal rods. Nature 309, 352-354. Yau, K. W., and Nakatani, K. (1985). Light-induced reduction of cytoplasmic free calcium in retinal rod outer segment. Nature 313, 579-582. Young, R. W. (1971). Shedding of discs from rod outer segments in the rhesus monkey. J Ultrastruct Res 34, 190-203. Zhu, X., Brown, B., Li, A., Mears, A. J., Swaroop, A., and Craft, C. M. (2003). GRK 1-dependent phosphorylation of S and M opsins and their binding to cone arrestin during cone phototransduction in the mouse retina. J Neurosci 23, 6152- 6160. Zhukovsky, E. A., and Oprian, D. D. (1989). Effect of carboxylic acid side chains on the absorption maximum of visual pigments. Science 246, 928-930. 140 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Zhukovsky, E. A., Robinson, P. R., and Oprian, D. D. (1991). Transducin activation by rhodopsin without a covalent bond to the 11-cis-retinal chromophore. Science 251, 558-560. Zimmerman, A. L., Yamanaka, G., Eckstein, F., Baylor, D. A., and Stryer, L. (1985). Interaction of hydrolysis-resistant analogs of cyclic GMP with the phosphodiesterase and light-sensitive channel of retinal rod outer segments. Proc Natl Acad Sci U S A 82, 8813-8817. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Appendix Purification and Membrane Association of Human Estrogen Receptor Hormone Binding Domain (hER-HBD) A.l Introduction This appendix presents the efforts to express and purify HBD in vitro for its future structure studies by SDSL. In addition, the membrane association and ligand binding properties of HBD fused with maltose binding protein (MBP) were investigated. The estrogen receptor (ER) a regulates a variety of cellular processes on binding with ligands through the C-terminal hormone binding domain (HBD) (Tsai and O'Malley, 1994) (Fig. A.l A). Aberrant control of ER functions results in human diseases. Three classes of HBD specific ligands have been defined. These include agonists such as endogenous estrogen, 17P-estrodiol, antagonist such as ICI-164 or selective estrogen receptor modulators (SERMS) represented by tamoxifen and raloxifene, which function as antagonist only in specific tissues (Grese et al., 1997). ER a HBD has been demonstrated to be capable of adopting different conformations when complexed with different ligands, which is an important feature that underlies its diverse actions. Furthermore, transcriptional activation by ER a involves activation function (AF) that lies within the hormone binding domain called AF-2 (Kumar et al., 1987). The AF-2 domain responds to hormones via ligand induced 142 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. spin labeled side chain R 1 -Protein J. N* I O Figure A .l. ER domain structure and hypothesized HBD membrane insertion scheme. (A) Modular organization of ERa. DBD represents the DNA binding domain, HBD represents the portion of the hormone binding domain that is part of the expression construct. (B) Model of HBD membrane insertion based on sequence analysis in comparison to annexin XII. The conformational reorganization is expected to occur on the hormone-binding domain of the estrogen receptor to result in the indicated transmembrane helical regions. (C) The structure of side chain R1 used to spin label cysteines within a protein. 143 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. structure alteration of HBD and it is postulated to be mediated by coactivator recruitment in regions including helix 3, 5 and 12 in the presence of agonist (Danielian et al., 1992; Feng et al., 1998; Moras and Gronemeyer, 1998). Previous studies on crystal structures of the HBD in the presence of 17|3-estrodiol or raloxifene indicate that each class of ligand induces a distinct movement of helix 1 2 , the last helix at the C-terminus of HBD. Specifically, in antagonist-induced conformational changes, helix 1 2 is located in a hydrophobic groove, which contains residues from helix 3 and 5 necessary for AF-2 activity in the groove (Brzozowski et al., 1997). Furthermore, it is reported that selective antagonist, 4-hydroxytamoxifen forms a complex with ER a HBD in which helix 12 buries the coactivator recognition site, thus abolishing the AF-2 functional surface (Shiau et al., 1998). In order to understand conformational switching, knowing the structure in ligand-free form is necessary. However, no structural information is available for this form. As to the ligand bound form, it would be particularly interesting to investigate those conformational transitions in solutions in addition to crystallographic analysis, since lattice energies inherent in X-ray crystallographic methods could obscure real conformation states in living environments. NMR technique is not suitable for the above studies because the molecular weight of ER a HBD is too large. Therefore, we are employing SDSL, a recently developed method that can be used to look at these conformational changes under physiological conditions. According to the traditional theory of steroid hormone action, steroid receptors mainly serve as transcription factors to affect mRNA transcription and 144 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. protein synthesis. However, over the past decades, many researchers have observed rapid steroid effects in a variety of cell types. Those biological events happen on a time course too fast to be accountable by the classical genomic action of estrogen. The rapid action of estrogen often leads to alterations in the levels of intracellular second messengers including cAMP and calcium or activation of protein kinases and phospholipase (Brubaker and Gay, 1999; Wehling, 1997). Existence of a membrane receptor that binds estrogen is postulated to mediate the underlying signaling pathways although questions remain as to its identity and how it is associated with cell membrane (Nemere and Farach-Carson, 1998). Based on previous work on annexin XII, we hypothesize that estrogen receptor in the plasma membrane represents a new, transmembrane conformation of the nuclear receptor ER a. Detected by SDSL, annexin is discovered to reorganize several helical hairpin structures in solution into continuous transmembrane helices and insert into lipid bilayers triggered by factors including pH, lipid composition and other small molecules (Langen et al., 1998a; Langen et al., 1998b). Sequence analysis of ER a HBD predicts the existence of membrane insertion motifs that might form potential transmembrane helices (Fig. A.l B). In a manner reminiscent of annexins, some transmembrane regions form helical hairpins shown by X-ray crystallography and transitions between the helical and the loop regions are marked by negatively charged residues like Asp and Glu residues. SDSL and EPR techniques are well suited to above tasks since it is applicable over a wide range of molecular weights. 145 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Another key advantage of the spin labeling approach is its unique ease to work with membrane proteins (Hubbell et al., 1998; Hubbell et al., 1996). The basic strategy of SDSL involves the single-site substitution of a native residue for cysteine, followed by modification of the reactive sulfhydryl group with a selective nitroxide reagent. One of the commonly used reagents is a methanethioslfonate derivative (I) that generates the disulfide-linked nitroxide side chain, R1 (Fig. A.l C) Analysis of the EPR spectrum of R1 in a protein can readily identify a given site as exposed, buried or in tertiary contact. Sequence correlated data provided by nitroxide scanning experiments can identify regular secondary structure by the periodic variation in the main EPR parameters, accessibility and mobility (Hubbell et al., 1996). Introduction of two paramagnetic centers in a protein, either a metal ion and a nitroxide (Voss et al., 1995) or a pair of nitroxides (Rabenstein and Shin, 1995; Steinhoff et al., 1997), provides a means of estimating inter-residue distances through magnetic interactions between the centers. Taking all the features together, we have sufficient constraints to model a protein at the backbone level and evaluate conformational changes. A.2 Materials and Methods A.2.1 Constructs The expression vector pMAL-HBD (-7.36 kb) encoding MBP-HBD - the wild type HBD fusion protein with maltose binding protein (MBP), was kindly 146 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. provided by Mark Brandt (Brandt and Vickery, 1997). Of this vector, The HBD was fused after the coding region of MBP separated by a linker peptide (Asn)i4-Gly-Arg, which can be cleaved by hydroxylamine to release HBD peptide. The HBD Ser305 was mutated to Glu to prevent the hydroxylamine cleavage between Asn304 and Ser305 within the HBD sequence. The annexin expression vector pSE420-Anx2Cysless (~5.3 kb), encoding the human annexin 2 cysless mutant, was obtained from Harry Haigler of University of California, Irvine. A.2.2 Spin Labeled Ligands The spin labeled estrogen derivatives (H02447, H02453), and tamoxifen derivatives (H02873, HO2880) were synthesized by Kalman Hideg group in Hungaria. A.2.3 Primers Primers were synthesized from either Sigma Genosys or USC Norris microchemical core facility. The primers used for engineering various the expression vectors encoding annexin fusion proteins were phosphorylated by T4 kinase prior to PCR and ligation. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. A.2.4 HBD Cysless and Single Cysteine Mutant The wild type HBD contains four native cysteines at position C381, C417, C447 and C530. These four cysteines were substituted by amino acids non-reactive to spin labels (C381->S, C417->S, C447->V, C530->S) to obtain PMAL- HBDCysless construct using mutagenesis kit (Clontech). The single cysteine mutation was introduced at the interested positions on the PMAL-HBDCysless construct using QuikChange kit (Stragegene). The HBD coding regions of cysless and all the single cysteine mutants were sequenced after PCR mutagenesis and sub cloned to the pMAL vector for expressing MBP-HBD fusion proteins. A.2.5 HBD Expression and Purification The procedure was modified from published protocol (Brandt and Vickery, 1997). The Topp2 cells (Stratagene) were transformed with pMAL-HBDCysless plasmid encoding MBP-HBDCysless fusion protein. Transformed cells were grown in TB media until OD600 = 1.8-2.0 at 27 -30 °C. The protein expression was induced by 0.25 mM isopropyl-1 -thio-p-D-galactopyranosidc at 25°C overnight. Cells were harvested by centrifugation at 4,000 x g for 15 min and resuspended in lysis buffer (50 mM Tris-HCl, 10 mM EDTA, 2 mM DTT, 1 mM AEBSF (Roche), and 1 mg lysozyme / g cells, pH 8.0) at 2 ml / g cells. After lysing for 3 hr at RT, DNase and RNase were added to digest nucleic acids in lysis buffer with 120 mM MgCl2. The cell lysates were centrifuged at 40,000 x g for 30 min. To recover expressed protein associated with membrane, for 3 times, the pellet was resuspended in column buffer 148 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. (CB; 20 mM Tris-HCl, 1 mM EDTA, and 1 mM DTT, pH 7.4), homogenized using a glass homogenizer (Teflon) and centrifuged at 40,000 x g for 30 min. All the supernatants from centrifuged lysates and resuspensions were combined, diluted to a final volume of 10 ml / g cells in CB and loaded onto a DEAE-cellulose column equilibrated in CB. The flow through from the DEAE-cellulose column was applied to an Amylose (New England Biolabs) affinity column equilibrated in CB. After washing with 3 column volumes of CB, the MBP-HBDCysless protein was eluted by the same buffer with 10 mM maltose. The amylose eluent was filtered and loaded onto an ANX-Sepharose column (Amersham) in CB. The proteins were eluted in a 0-1 M NaCl gradient. The fractions containing MBP-HBDCysless protein were collected and concentrated to 20 mg/ml by Centriprep-30 (Amicon). The MBP-HBDCysless fusion protein was digested by incubation with an equal volume of hydroxylamine solution (4 M Hydroxylamine-HCl, and 0.4 M Tris- HCl, pH 9.0) in the dark at RT for 72 hr. To separate HBDCysless from MBP, the digested sample was dialyzed against CB and loaded onto a HiTrap ANX column (CB) or a Superdex-100 column (CB with 200 mM NaCl). Finally, the purified HBDCysless proteins can be frozen over liquid nitrogen and stored at -80°C with a concentration of 1-2 mg/ml. The concentrations of the proteins were determined by the 280 nm absorption. The extinction coefficienct of MBP-HBDCysless 8 2 8 0 = 89 (mM cm)'1 , MBP S 280 = 65.6 (mM cm)'1 and HBDCysless S 280 = 23.7 (mM cm)'1 . The overall yield of MBP-HBDCysless was ~20 mg/1 culture and HBDCysless was ~2 mg/1 culture. 1 4 9 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. A.2.6 Spin Labeling of Protein Immediately before spin labeling, DTT was removed from purified MBP- HBDCysless by PD-10 column (Pharmacia) in 20 mM Tris-HCl, 1 mM EDTA, 100 mM NaCl buffer. A 5-fold molar excess of the MTSL spin label [(1-oxyl-2,2,5,5- tetramethylpyrroline-3-methyl)-methanethiosulfonate] was incubated with MBP- HBDCysless at RT for 1 hr. The un-reacted spin labels were removed by buffer exchange using PD-10 column. The protein concentration was remained at 1-2 mg/ml after spin labeling. A.2.7 Protein-Phospholipid Binding Assay Large unilammelar vesicles were prepared according to the methods of Reeves and Dowben (Reeves and Dowben, 1969). Phosphatidylserine (PS, Avanti Polar Lipids) and phosphatidylcholine (PC, Avanti Polar Lipids) were mixed at different molar ratios. The chloroform in PS/PC mixture was evaporated over nitrogen gas and completely dehydrated in a dessicator for 24 hr. The dry lipids were resuspended in 0.5 ml sucrose (240 mM) and underwent three freeze-thaw cycles using liquid nitrogen. The sucrose was removed from the phospholipid vesicles by centrifugation at 14,000 x g for 5 min. Finally the phospholipids were equilibrated and stored in Hepes buffer (20 mM Hepes, and 100 mM NaCl, pH 7.4) at a concentration of 30 mg/ml. The MBP-HBDCysless was incubated with PS/PC vesicles in 1 ml buffers at different pHs for 15 min at RT. The molar ratio of protein to phospholipid molecules 150 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. is 1:3000. The protein-lipid mixture was centrifuged at 14,000 x g for 5 min. The pellet containing membrane bound MBP-HBDCysless were loaded onto SDS-PAGE. A.2.8 EPR Measurements Spin labeled samples were loaded into a sealed glass capillary. EPR spectra were measured on the Bruker EMX spectrometer (Billerica, MA) with a loop-gap resonator at RT. A field modulation of 1.5 Gauss and 2 mW incident microwave power were applied to EPR scanning. The EPR spectra typically were the accumulation of 20-40 scans depending on the signal intensity and noise. A.2.9 Purification of Annexin Fusion Proteins 2 _ j_ The purification was based on the reversible Ca dependent binding to phospholipid vesicles according to published protocols (Schlaepfer et al., 1992). The expression vectors encoding fusion proteins of annexin 2 and HBD were transformed into DH5a cells. The expression of annexin fusion protein was induced by IPTG (0.5 mM), and the cells were harvested by centrifugation at 4,000 x g for 15 min. The bacteria pellet was resuspended in HBS buffer (20 mM Hepes, 100 mM NaCl, 1 mM EDTA) with 1 mM PMSF, lysed with lysozyme (5 mg/L culture cells) and sonication, and centrifuged at 40,000 x g for 30 min. The supernatant was collected and CaCl2 was added to a final concentration of 2 mM. Crude PC lipids (80 mg/ml) equilibrated in the binding buffer (HBS with 2 mM CaCf) were added to the cell lysate at 4 ml per liter culture to bind with annexin fusion proteins. The protein- 151 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. membrane complexes were centrifuged at 8,000 x g for 15 min and the membrane pellet was washed three times with binding buffer. The annexin fusion proteins were eluted from the membrane pellet by resuspending the membrane pellet in 1 ml elution buffer (HBS with 6 mM EDTA) followed by centrifugatio at 8,000 x g for 15 min. The supernatant containing the pure annexin fusion proteins was collected and stored. A.3 Results A.3.1 Construction of HBD Cysless and Single Cysteine Mutants Wild type HBD contains four cysteines (C381, C417, C447, C530). In order to probe the protein structure using SDSL, it is necessary to replace these native cysteines with residues non-reactive to spin label so that the EPR signals arises exclusively from spin labeling of intended residues. At first, C381, C417, and C530 were replaced by serine, while the C447 was mutated to alanine (SSAS) since the crystal structure near C447 location appears highly hydrophobic. Unfortunately the SSAS cysless mutant did not express in bacterial cells. It was likely that mutaions at one or more of the four native cysteine sites caused protein degradation by disturbing its structure. To determine which cystein mutation might be responsible for the expression failure, I restored the native cysteine at each of the four positions, and found that the C447 is the critical residue required for expression (Fig. A. 2). A closer examination of the HBD-17(3-estrodiol complex crystal structure revealed that C447 occupies a large space (Brzozowski et al., 1997). Thus, the replacement of 152 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. M U L W E MU L W E CSAS A SCAS SSAC SSCS 4 MBP-HBD m utant U LM W E U M L W E Figure A.2. Expression of MBP-HBD mutant with each of the native cysteine 381 (CSAS), 417 (SCAS), 447 (SSAC), and 531 (SSCS) restored on the MBP-HBDCysless fusion protein. O f each single cysteine mutant, the cell lysate was applied onto Amylose column. MBP-HBD mutant fusion protein was eluted with 10 mM maltose. Fractions in the purification procedure were shown. M: protein marker; U: flow through after Amylose column binding; L: cell lysate; W: washed fraction of Amylose column; E: elution from Amylose column. 153 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. cysteine by alanine at 447 may not satisfy the spatial requirements to maintain a stable three-dimensional structure of HBD. So I made a second HBD cysless mutant (SSVS) where C447 was mutated to valine, the amino acid with a larger side chain. SSVS was expressed and purified normally, and thereafter, the construct was named pMAL-HBDCysless that encoded HBD cysless mutant fused with MBP (MBP- HBDCysless). To introduce cysteine at interested positions on pMAL-HBDCysless, the DNA fragment (-800 bp) containing the HBDCysless coding sequence was sub cloned into PUC18 plasmid (-2.7 kb) via Sac I and EcoR I to obtain PUC18- HBDCysless construct, because the pMAL-HBDCysless construct (-7.36 kb) was too big for PCR mutagenesis. All site directed mutagenesis for producing single cysteine mutants were performed on PUC18-HBDCysless vector and the HBD coding regions were sequenced to ensure no other mutations have occured during PCR reaction. After mutagenesis, the fragment was sub-cloned back into its expression vector PMAL by Sac I and EcoR 1.1 have constructed a number of single cysteine mutants spanning the proposed helical regions 304-323, 376-392, 417-435, and the helical-loop transition region 528-531 (Fig A.l B and Table A.l). A.3.2 Expression and Purification of MBP-HBDCysless Fusion Protein The expression vector pMAL-HBDCysless encodes the HBD cysless mutant (301-551) (Fig. A.l A) fusion protein with MBP (MBP-HBDCysless) on pMAL vector. Since all the four cysteins on HBD have been mutated and there are no 154 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. VlAL s>ite ]tx o ressio n c o n stru ct PUC18 C onstruct Mo PCR Product Helical Site PMAL E xpression PMAL Construct PU C 18 C onstruct Mo PC R P roduct Helscal Site PMAL E xpression PMAL C onstruct PU C 18 C onstruct Mo PC R Product Loop Site PMAL Expression PMAL C onstruct PIJC18 C onstruct 1,0 PC R P roduct 376 417 528 Unknown 305 377 418 529 Unknown 306 378 419 530 Unknown 307 379 420 531 Unknown -> i 308 380 421 .! ' 309 381 422 \ ' 310 x 382 423 ; 311 383 424 ' 312 384 425 y 313 Unknown 385 x V 426 314 386 427 315 .387 ", 428 316 388 422 317 389 430 318 390 431 Unknown 319 391 432 392 433 321 434 x 322 435 323 Table A .l. List of MBP-HBD single cysteine mutants. PMAL constructs are the expression vectors that express MBP-HBD fusion proteins. PUC18 constructs are the intermediate vectors used to introduce cysteine mutations at interested positions. PMAL constructs with were stored both in plasmid solution and Topp2 cell glycerol stock. PMAL constructs with * were stored in plasmid solution only. PUC18 constructs with were stored in plasmid solution. All obtained constructs were sequenced. 155 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. cysteines on MBP, the protein does not contain any cysteines therefore should not give EPR signals after spin labeling. The expression level of MBP-HBDCysless was ~3 fold less than the original wild type MBP-HBD protein. Nevertheless, the cysless mutant could be purified by the same procedures. After Amylose affinity column, the MBP-HBDCysless comprised the majority (>80%) of the total proteins (Fig A.3 A). Some contaminating proteins at lower molecular weight could be removed by the subsequent ANX sepharose anion exchange column. After elution at -22% NaCl on ANX sepharose column, MBP-HBDCysless appeared as the most dominant band (-95%) on the SDS-PAGE (Fig A.3 B). However, spin labeling of the MBP- HBDCysless resulted in an EPR spectrum containing signals from immobilized elements, which was not suitable for the structural studies of HBD using SDSL. The source of the background EPR signals was unclear, presumably due to the small amount of impurities in the purified protein. Despite many efforts to improve the purity of the MBP-HBDCysless, trace amounts of contaminants still coexist with the purified proteins. It is very likely that these contaminating proteins interact with the MBP-HBDCysless tightly. A.3.3 pH-dependent Association of MBP-HBDCysless with Vesicles of Different Lipid Compositions To determine the conditions under which the HBD bind with membranes, we quantified the amount of membrane associated MBP-HBDCysless at different pH and lipid compositions using membrane copelleting assay. The MBP-HBDCysless 156 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. A A m ylose 10 m M Lysate 0 m M m a lto se m a lto se ANX S e p h a ro se •4 MBP-HBDCysless 6 0 kD 22% NaCl Figure A.3. Purification of MBP-HBDCysless. (A) Commassie blue staining show each fraction of fusion protein MBP-HBDCysless purification. The lysate was bound with Amylose column, and the fusion protein was eluted with 10 mM maltose. (B) MBP-HBDCysless protein was further purified by ion exchange column ANX-Sepharose. The majority of MBP-HBDCysless was eluted with 22 % NaCl. 157 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. bind preferentially to PS-rich vesicles and no binding to 100% PC vesicles was observed across all pHs (Fig. A.4). The maximal binding pH for MBP-HBDCysless with PS-rich vesicles was around 5 -5 .5 . A.3.4 Ligand Binding Properties of Soluble and Membrane Associated MBP- HBDCysless The functional studies of HBD rely on the intact properties of cysless mutant compared to wild type protein. Therefore, we tested whether the cysless mutant retained the intact binding specificity of HBD ligands. We used synthetic spin labeled derivatives of estrogen and tamoxifen (Fig. A.5) to examine the specific interaction between MBP-HBDCysless and spin labeled ligands by EPR scanning. In solution, the EPR spectra of free spin labeled estrogen H02453 showed three sharp peaks whereas after adding MBP-HBDCysless protein, those sharp peaks became immobilized and the spectra broadened (Fig. A.6 A), indicating the spin labeled ligand was bound with MBP-HBDCysless. The immobilization peaks as a consequence of HBD binding with spin labeled estrogen disappeared when 10-fold non-spin labeled agonist estrogen or tamoxifen to the spin labeled ligands was added to the mixture to compete with spin labeled ligands (Fig. A.6 B). The restore of the spectra to the ones like free spin labeled ligands in the presence of unlabeled ligand competitors indicated that the MBP-HBDCysless mutant bound with ligands specifically as the wild type receptor. 158 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. A PS:PC = 1:1 No Vesicle PS:PC =I;7 P5:Pt = 1:3 MBP-HBDCysless PH 5.0 5.5 6.0 6.5 7.0 7.4 S.O 5.5 6.0 6.5 7.4 L 5.0 5.5 6,0 6.5 7.0 7.4 L SO 5.5 6.0 6.5 7.4 ^•M B P -H B D C y sless I t H A H f t j j | | Figure A.4. Membrane binding properties o f MBP-HBDCysless protein (A) The commassie staining of SDS-PAGE loaded with membrane associated fraction of Fcysless at indicated pH and lipid compositions. The same amount o f proteins was loaded in each lane. The membrane associated Fcysless migrated slower than soluble Fcysless because the protein-membrane complex is larger. L: loading control of Fcysless without adding vesicles. (B) Quantification o f band intensity of each gel in (A). ERF-Cysless is the same as MBP-HBDCysless protein. 159 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. H 02873 ,< H O 2880 7~ - v > * O — / . / y X.....\ i 7 V -J. ' 'N' ' ' 'N H 02453 H 02447 Figure A.5 Structure of spin labeled compounds. H02873 and HO2880 are spin labeled tamoxifen derivatives. H 02447 and H02453 are spin labeled estrogen derivatives. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. A B iJ, ' I H 02447 only H 02447 + MBP-HBDCysless HG2447 + MBP-HBD H 02453 only H 02453 + MBP-HBD H 02447 + MBP-HBDCysless+ e stro g en H 02447 + MBP-HBDCysless+ tam oxifen Figure A.6. Binding of spin labeled ligands with MBP-HBD fusion protein in solution measured by EPR. H 02447, H02453: two spin labeled estrogen derivatives. (A) EPR spectra of spin-labeled estrogen in free and MBP-HBD bound form. (B) EPR spectra of spin-labeled estrogen in the presence of un-spin-labeled agonist competitor estrogen and tamoxifen. 161 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Furthermore, we tested whether the membrane associated HBD at low pH, also retained the specific ligand binding ability. Again, more immobilized peaks and broadened spectra of membrane associated spin labeled estrogen (H02447, H02453) were observed after HBD, MBP-HBDCysless, or MBP-HBD (wild type HBD fused with MBP) proteins were mixed with spin labeled ligands, compared to EPR signals from the membrane bound H02447 or H02453 in the absence of any proteins (Fig. A.7 A. B, C, D, E and F). The spectra immobilization was resulted from the specific binding of spin labeled estrogen to MBP-HBDCysless because it was not observed when annexin, another membrane-associated protein that did not bind with estrogen, was added (Fig. A.7 F). In addition, like in solution, the spectra of spin labeled estrogen mixed with HBD/MBP-HBD/MBP-HBDCysless appeared more close to the ones of membrane bound free spin labeled ligand in the presence of 10 fold excess non spin labeled estrogen competitor (Fig. A.7 C, D and E). A.3.5 Design of Alternative hER-HBD Expression Vectors A.3.5.1 Annexin-HBD Fusion Protein Construct and Its Expression Our lab practices a simple, efficient, inexpensive annexin purification protocol taking advantage of the Ca2 + dependent, reversible membrane binding properties of annexin. This purification method yields homogeneous annexin proteins of high purity suited for site directed spin labeling without background contamination. Given the difficulties of purifying ER-HBD and other interested proteins with known methods, I am motivated to construct an annexin fusion protein expression vector to 162 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. ■ H 02M 7 Only H02447!FCysjess [ ) H02453 Only H02453 + FCysfess H02453 t-FCysless t-estrogen Figure A.7. Binding of spin labeled ligands with MBP-HBD fusion protein on phospholipids vesicles measured by EPR. All the experiments were performed at pH 5.3 using phospholipid vesicles at PS:PC = 2:1. HBD: cleaved HBD; FWT: MBP-HBD fusion protein; FCysless: MBP-HBDCysless fusion protein; H02447, H02453: two spin labeled estrogen derivatives. (A) Dose dependent immobilization and broadening of EPR signals from H 02453 when binding with increasing amount of HBD on vesicles. (B-E) Comparison of EPR spectra of H02453 or H02447 on phospholipid vesicles in the absence and presence of MBP-HBD fusion proteins and un-spin-labeled agonist estrogen. (F) Comparison of EPR spectra of H02453 mixed with Fcysless or annexin II on vesicles. 163 A H024S3 Only H02453+40ug HBD i ....... HO2453+160pg HBD ; HO2453+320ugHBD u 1 ^ } fj .....: |j : If ( 2 H02453 Only H02453+FWT H02453 t-F V V T .estrogen Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. direct the expression and purification of HBD. The original annexin 2 cysless expression vector pSE420-Anx2Cysless was used to fuse HBD after annexin 2 coding region. Because the pSE420-Anx2Cysless construct lacks any useful restriction site, first Sac I and EcoR I sites were introduced before the last codon of annexin 2 to obtain plasmid pSE420-Anx2Cysless/SE for inserting HBD coding sequence (Fig. A.8 A). The pMAL-HBDCysless expression vector was digested with Sac I and EcoR I, which yielded a DNA fragment consisted of the complete HBD coding regions and the 5’ linker region containing a hydroxylamine cleavage site. This fragment was ligated into the pSE420-Anx2Cysless/SE vector by Sac I and EcoR I to obtain the pSE420-Anx2-HBD that expresses the HBD fused with annexin 2 at C-terminus (Anx2-HBD) (Fig. A.8 B). Using pSE420-Anx2-HBD expression vector and the same protocols for annexin purification, I obtained reasonably pure Anx2-HBD fusion proteins (Fig. A.8 C). However, I experience difficulties in cleaving the HBD off from the fusion protein by hydroxylamine. To solve the cleavage problem, I decided to design a new linker region between Anx 2 and HBD on pSE420-Anx2-HBD vector to insert various protease cleavage sites. To ligate the linker sequence between Anx 2 and HBD coding sequence, a BamH I site was added after Sac I site before the HBD start codon to obtain the construct pSE420-Anx2-HBD/SB (Fig. A.9 A). Then a series of different linker sequences containing thrombin or TEV cleavage sites and the Sac I./BamH I overhang ends were synthesized to insert into pSE420-Anx2-HBD/SB vector in frame between Sac I and BamH I sites (Fig. A.9 B and C). After linker sequence 164 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. A N X I L S A C L 8 3'C ATG GAC CGA CCA CCT CTA CTG1 3' < j^O G C T T G G CTGTTTTGG CGG ATG AG3'„ w g * T ANXII.END.EcoRI1 A nx II c o d in g region pSE420-Anx2Cys!es$ ~ 5.3 kb B A nx II e n d s HBD e n d s HBD s ta rts (A sn )u linker A nx I i-------- GGT GG A GAT GAC TCGAGCTCG A AC --— _ Sac I -------------- AA^GGA A G G TCT A A G----------HBD- h y droxylam ine c le a v a g e site -GCGTGA ATTCC GCT EcoR. p5E420-Anx2-HBD ~ 6 .1 k b C lysate w ash elution cleavage Figure A.8. Construction and purification o f Anx2-HBD fusion protein. (A) Introduction of Sac I and EcoR I restriction sites immediately before the Anx2 stop codon. (B) HBD coding region with the 5’ hydroxylamine linker from Fcysless construct was sub-cloned after Anx2 coding region to obtain pSE420-Anx2-HBD construct. (C) SDS-PAGE showed fractions during the purification of Anx2-HBD fusion protein by reversible Ca2 + dependent membrane binding. The cleavage is performed by hydroxylamine. 165 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Anx II ends 3'C ATG GAC CGA CCA CCT CTA CTG AGC TCG AG ^ ^ > \^ T C T AAG AAG AAC GAA CTGGCCT HBD starts pSE420-Anx2-HBD 6 .1 k b 5'A nx II--------GGT GGA GAT GAC TCG AGCT 3'Anx II------- CCA CCT CTA CTG AGC TCG — HBD3’ GAGATTC— HBD5’ sy n th etic linker contain in g p ro te a se cleav ag e site th ro m b in recognition site . D S S G G G L V P R G S t h r o m b i n s t g ga t a g c t c c g g c g g t g g c c t g g t g c c g c g c G3’ 3TCGAAC CTA TCG AGG CCG CCA CCG GAC CAC GGC GCG C a A G 5 ‘ th ro m b in recognition site D P P K S D L V P R G S P G I S G G G G t h r o m b i n a l v s t g g a t c c t c c a a a a t c g g a t c t g g t t c c g c g t g g a t c c c c g g g a a t t t c c g g t g g a g g t g g a G3- 3 ' 3 TCG A AC CTA GGA GGTTTT AGC CTA GAC CAA GGC GCA CCT AGG GGC CCTTAA AGG CCA CCT CCA CCT CCTAG5' th ro m b in recognition site D P P K S D L S G G G G G L V P R G S a l y t h r o m b i n s t g g a t c c t c c a a a a t c g g a t c t g t c t g g t g g a g g t g g a g g t c t g g t t c c g c g t g g a t c c c c g g 3 ' 3 3'TCCAAC CTA GGA GGT TTT AGC CTA GAC AGA CCA CCT CCA CCT CCA GAC CAA GGC GCA CCT AGG GGC CCTAG5' TEV recognition site TEV cleava g e site T F V D Y D I P T T E N LYF G STG GATTAC GAT ATC CCA ACG ACC GAA AAC CTG TAT TTT CAG GGC G3' 3 TCG AAC CTA ATG CTA TAG GGT TGCTGG CTTTTG GAC ATA AAA GTC CCG CC’AG 5’ Figure A.9. Insertion scheme of linker sequences containing protease cleavage site. (A) Introduction of Sac I and BamH I restriction sites between Anx2 and HBD coding region to obtain pSE420-Anx2-HBD/SB construct. (B) The unified ligation scheme to insert linker sequences into pSE-Anx2-HBD/SB vector using Sac I and BamH I restriction sites. The Sac I and BamH I digested ends on the pSE420-Anx2-HBD/SB were highlighted. The complementary ends of the linker sequences were highlighted. (C) The various synthetic linker sequences containing corresponding protease cleavage site. All of them contain Sac I and BamH I compatible overhang ends that can ligate with the Sac I and BamH I digested pSE420-Anx2-HBD/SB. For these four linkers, the Sac I site was abolished and the BamH I site was retained after ligation. 166 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. ligation, the introduced Sac I site was abolished, which is useful for screening the ligated construct. Unfortunately, despite many efforts with different linker sequences, it is still difficult to cleave HBD off from the Anx2-HBD fusion protein. One possible reason that those linker regions for cleaving Anx2-HBD did not work was that the length of linker sequence might not be sufficient. It is impractical to synthesize linkers with very long sequences. To introduce longer linker sequences, two approaches were applied. The first approach was to insert a sequence that would self-ligate to form n tandem repeats, which could increase the length of the linker by n times. For this purpose, the lOgly linker encoding 10 glycines and containing self- adhesive ends derived from Spe I and Nhe I digested overhangs, was synthesized (Fig. A. 10 C). In addition, the Nhe I and Spe I sites were introduced into pSE420- Anx2-HBD vector by inserting the throm flip linker sequence containing the Nhel and Spe I sites and the thromin cleavage site between Anx2 and HBD coding sequences using the same strategy as in Fig. A.9 B (Fig. A. 10 A and B). The resulting vector was name pSE-Anx2-HBD/SBSN (Fig. A. 10 B). The multiple copies of 1 Ogly_linker were finally inserted between Nhe I and Spe I sites before the thrombin cleavage site on pSE-Anx2-HBD/SBSN (Fig. A. 10 D). The Spe I and Nhe I sites are ligation compatible, and the ligation between Spe I and Nhe I sites resulted in a sequence that was not digestible by either Spe I or Nhe I. This property is very useful to ensure that the final ligation product gave rise to correctly translated Anx2- HBD fusion protein, because the self ligation of lOgly linker and the ligation between 10gly_linker tandem repeats and the pSE-Anx2-HBD/SBSN vector were 167 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Anx H ends HBp starts A ii — — CiOr GGA GAT GAC TC6AGCT q a T C C T C T - AA G ---------HBOS' 1 n I CCA CCT CTA C \ 'Q AGC TCGAI............... :.l - „ ; T Z 3 t T A f t G AGATTC ---------HBOS' stop th P 5 'C T C C A gct agc ccc cac tag tqatct ggt gcc gcg C G 3 ’ 3"CC,AGA GGT CCA TCG GGG G "G ATC ACT AGA CCA CGG CGC GCCrAGS’ N h e ! S p eI 10q lv lin k e r s'u i m r gga ggc gga c,c;k gc gga w u w w 1 A „CA CCT CCG CCT CCA CCG CCT CCA CCA 0 < « , th r o m flip + IX 1 0 g ly _ lin k e r th r o m bin re c o g n itio n site S G G G G G G G G C . A S P L V P R G S VCT CCA C > CT ACT GGT GGA GGC GGA GGT GGC GGA GGT GGT G Cl AGT GAT C IG G1C. f C 'C > CGC G C 3' . .“AGA GGT CGATC A CCA CCT CCG CCTCCA CCG O. T CCA CCA Ct.A 'C A CTA GAC CAC GGC GCG C - C T..V 2X lOgtyJinker I j V r AlVT SG I 'GGA GGC GGA G Gl GGC GGA GGT GGT G I T TGT'GGT' GGA GGC GGA GCT GGG GGA 'GGT GGT G J XA CCA CCT CCC CCT CCA CCG CCT CCA CCA LUf, SC A CCA CCT CCG C O CCA CCG CCT CCA CCA C G l'- "C5‘ throm ..flip + 2X 1 0 g !y „ lin ke r V O CCA G CT AGT GGT GGA GGC GGA GGT GGC GGA GGT GGTG : T A :?r S tiT GCA GGC Q C% A CiST GfcC CrfiA GGT GOT G ■ : 1 AC."' CAT CTO G T0 CCG C C;C G T i > G A G G T CCA TC A CCA CCT CCG CCTCCA CCG CCT CCACCA C .ct i'C ACTA CCT CCG CCT CCA CCG CCT CCA CCA CCC *T. A CTA GAC CAt: GGC C-CC: t : i »V .5 t h r o m _ f l i p + n X l O g l y J i n k e r { T T r ^ r r . A * T r r jrt,CGTGGf;OGAOGTGGTG “I C U V Ti ft f A CC T « r c 1 C f r ft C C G CCT CCA C C A c c a ■ C J * p iAT C'TG C T G e x t . CG C <SV FA GAC C At: GCiC C X C t i. d Figure A.10. Design of the linker sequence to insert multiple copies of 10 glycine peptides before thrombin cleavage site. (A) The ligation scheme to insert throm flip (see B) into pSE420-Anx2-HBD/SB vector to obtain pSE420-Anx2-HBD/SBSC construct. It is the same as in Figure A.9 B. (B) Synthetic throm flip sequence to introduce Nhe I and Spe I sties (highlighted in blue), throm flip contains the Sac I and BamH I compatible overhang ends to ligate with Sac I and BamH I digested pSE420-Anx2-HBD/SB vector. Both Sac I and BamH I sites were intact after ligation. (C) Synthetic lOgly linker sequence encoding 10 glycines. It contains Spe I and Nhe I compatible overhang ends to ligate with Spe I and Nhe I digested pSE420-Anx2-HBD/SBSC vector. In addition, since Spe I and Nhe I have compatible overhang sequence, they can anneal to each other to self-ligate. (D) Sequence of ligation products as a result of self-ligation of lOgly linker and ligation between n lOgly linker and Nhel and Spe I digested pSE420-Anx2-HBD/SBSC vector. The ligation reactions were forced to occur in the indicated direction only between Nhe I and Spe I to ensure correct translation because the ligations were performed in the presence of Nhe I and Spe I to eliminate Nhe I - Nhe I or Spe I - Spe I ligation. 168 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. only allowed to occur in one direction between Spe I and Nhe I sites in the presence of Nhe I and Spe I enzyme. Any ligations between Spe I and Spe I or between Nhe I and Nhe I were eliminated because they can be re-digested by Nhe I and Spe I enzyme, thus unable to form circular constructs to transform the cells. It was also worthwhile to note that a stop codon was engineered onto the throm flip sequence. This stop condon will be abolished if correct insertion of (1 - n) x lOgly linker has occurred. Thus, the expression vector with inserted 1 Ogly_linker sequence could be easily screened by examining protein expression profiles from transformed cell lysates on a SDS-PAGE. The second approach to introduce a longer linker region was to insert the DNA sequences encoding the highly unstructured C-terminal 40 aa of a synuclein. The C-terminal 40 aa of a synuclein was synthesized by PCR with primers synuclCF (5 ’ GGGAGCTC AGGA ATTCT GGA AG AT AT GCCT3 ’) and synuclCR (5 ’ GG ACT AGT GGCTT C AGGTTCGT AGT CTT GAT ACC 3 ’) and ligated between Sac I and Spe I site on pSE420-Anx2-HBD/SBSN. Although all the expression vectors containing a longer linker sequence designed as above were capable of expressing Anx2-HBD fusion proteins, the fusion proteins still could not be cleaved by thrombin protease. The protease inaccessibility could be caused by the hydrophobicity of the annexin C-terminus region since this region was capable of docking onto the phospholipids. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. A.3.5.2 HBD-Annexin Fusion Protein Construct and Its Expression Since many efforts to cleave the HBD from Annexin-HBD fusion protein failed to yield the cleaved HBD protein, it is possible that the C-terminal region of annexin 2 is inaccessible for the protease due to its structural constraints. So I designed another construct to fuse the HBD at the N-terminus of Annexin 2 protein. First, A EcoR I and a BamH I site were introduced before the annexin 2 start codon to obtain pSE420-Anx2Cysless/ESB (Fig. A. 11 A). The ligation of the primer overhang sequence created an additional Sac I site between EcoR I and BamH I site (Fig. A. 11 B). The HBD coding region was amplified by PCR using ER F EcoRI and ER R SacI primers (Fig. A. 11 C) and sub-cloned before annexin 2 coding region by EcoR I and Sac I to obtain construct pSE420-HBD-Anx2/ESB (Fig A .ll D). Apart from providing restriction sites, the other purpose of engineering the Sac I and BamH I site into HBD-Anx2 fusion protein expression vector was to reuse the previously designed linker sequences containing protease cleavage sites with Sac I/BamH I overhang sequence at the ends. All the linker sequences and schemes designed for Anx2-HBD expression vector can be applied again on pSE420-HBD- Anx2/ESB vector to cleave HBD off from HBD-Anx2 fusion protein (Fig A. 12 A). The pSE420-HBD-Anx2/ESB expression vector is capable of expressing the HBD- Anx2 fusion proteins. However, it appears that majority of the HBD-Anx2 proteins were insoluble and localized to the inclusion bodies that prevented further purification from soluble fractions (Fig. A. 12 B). 170 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. p S E v e c to r b e fo re N c o I AXll_FRONT_EcoRl A n x I I c o d in g r e g io n 3 'G C T A A T T T A T T C C T C C T T A T T T S ' 3 ' -5' X < V 0A C T G T T C A C G A A A T C C T G T C C 3 '. A X I I .F R O N T B a m H i & * C T G T C C 3 ' A n x I I s ta rts pSE420-Anx2Cysless - 5.3 kb B A n x I I s ta rts C G A T T A A A T A A G G A G G A A T A A A G A A T T C T G A G C T C T G G A T C C A C T G T T C A C G A A A T C C T G T C C E c o R I S a c I B a m H c E R _ R _ S a c l 3 'C T G C G G G G T G G C G G A T G T A C G * X j T C T A A G A A G A A C G A A C T G G C C T 3 ; E R „ F _ E c o R i pMAL-HBDCysless ~ 7.36 kb H B D s ta rts H B D e n d s A n x I I s ta rts 5 'C G A T T A A A T A A G G A G G A A T A A A G A A T T C A T G T C T A A G H B D — C A T G C G A G C l 'C T G G A T C C A C T G T T C A C 3 ' Figure A .ll. Construction of pSE420-HBD-Anx2 vector. (A) EcoR I and BamH I restriction sites were introduced by PCR before the Anx2 start codon to obtain pSE420-Anx2/ESB construct. (B) An additional Sac I site was created by the overhang sequence of primers used in (A). The sequences and all available restriction sites before the Anx 2 start codon were shown. (C) The HBD cysless coding sequence with EcoR I and Sac I site at the ends was PCR amplified using construct pMAL-HBDCysless as the template. (D) The PCR fragment of HBD cysless coding sequence was sub-cloned between EcoR I and Sac I sites on pSE420-Anx2/ESB location. The locations of HBD coding sequence and the restriction sites were shown. 171 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. HBD e n d s Anx II starts 5'HBD— CATGCG^AGCT I I c A c c ACT GTT— A nx 113' 3'HBD— - GTACGC................TCG A I ..............................I ,, U C T f ; ." i G TGA CAA— -Anx 115’ 4 sy n th e tic linker containing p ro te a se c lea v ag e site th ro m b in reco gnition site . . D S S G G G L V P R G S t h r o m b i n s t g g at a g c t c c g g c g g t gg c ctg gtg ccg cg c g t 3TCGAAC CTA TCG AGG CCG CCA CCG GAC CAC GGC GCG CC'IAGS' th ro m b in recognition site DP PK S D I V PR G S PG I SG G G G th ro m b in q tv s t g g a t c c t c c a a a a t c g g a t c t g g t t c c g c g t g g a t c c c c g g g a a t t t c c g g t g g a g g t g g a G3' 3 3TCGAAC CTA GGA GGTTTT AGC CTA GAC CAA GGC GCA CCT AGG GGC CCTTAA AGG CCA CCT CCA CCT CC TAGS' th ro m b in recognition site D P P K 5 D L S G G G G G L V P R G S q lv th rom bi n s t g g a t c c t c c a a a a t c g g a t c t g t c t g g t g g a g g t g g a g g t ctg g t t c c g c g t g g a t c c c c g G3' 3 3'TCGAAC CTA GGA GGTTTT AGC CTA GAC AGA CCA CCT CCA CCT CCA GAC CAA GGC GCA CCT AGG GGC CCTAGS' TEV recognition site TEV cleava g e site TEV , D Y D I P T T E N L Y F^Q throm _flip + nX 10giy_linker S’ CTCCAG f-'- T GGT GGA GGC GGA GGT GGC GGA CGT GGT G 1 CTA( 3'"C. -'.G A G G T CGATcK ACCACCT CCG CCTCCA C CG CCT C C A C C A CA T. V P A G S A G T G A T C TG G T G C CG C GC G J " ' : C AC G G C GCG O . i p elle t ly sate e lu tio n c le a v a g e w a sh Figure A. 12. Introduction of linkers with protease cleavage sites and the expression of HBD-Anx2 fusion protein. (A) All previously designed linker sequences (shown in Figure A.9 and A. 10) can be re-used and ligated with Sac I and BamH I sites between HBD and Anx2 coding sequence. (B) The expression and purification of HBD-Anx2 protein by reversible Ca2 + dependent membrane binding. The cleavage is performed by thrombin. 172 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. A.4 Summary This work was aimed at studying the membrane association properties and structures of ER-HBD purified in vitro by SDSL. HBD was expressed as a fusion protein with MBP in most experiments since the cleavage caused loss of majority of proteins. MBP-HBDCysless mutant and a number of MBP-HBD single cysteine mutants were constructed (Table A.l). The purification protocol of MBP- HBDCysless fusion protein has been troubleshooted exhaustively with many different ion exchange columns and binding/washing/eluting conditions on both Amylose and ion exchange columns. Although the purified MBP-HBDCysless appeared quite pure on the SDS-PAGE (Fig. A.3), it still gave background signals upon spin labeling, due to the trace amounts of contaminants. To improve the purity of HBD proteins, the alternative HBD expression vectors encoding fusion proteins of Anx2 and HBD were designed. The Anx2-HBD fusion proteins containing various linker regions with protease cleavage sites were expressed and purified (Fig. A.8). However, the HBD was not cleaved off the Anx2-HBD with any of the expression constructs. The HBD-Anx2 fusion proteins appeared insoluble after cell lysis, presumably caused by the highly hydrophobic nature of HBD (Fig. A.12). The purified MBP-HBDCysless was partitioned into the vesicles in the presence of PS-rich phospholipid vesicles at low pH (5-5.5) (Fig. A.4). Furthermore, illustrated by EPR spectra from spin labeled estrogen, MBP-HBDCysless is capable of binding with ER-HBD ligands specifically either in solution or on membranes (Fig. A.6 and A.7). 173 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. A.5 References: Brandt, M. E., and Vickery, L. E. (1997). Cooperativity and dimerization of recombinant human estrogen receptor hormone-binding domain. J Biol Chem 272, 4843-4849. Brubaker, K. D., and Gay, C. V. (1999). Evidence for plasma membrane-mediated effects of estrogen. Calcif Tissue Int 64, 459-462. Brzozowski, A. M., Pike, A. C., Dauter, Z., Hubbard, R. E., Bonn, T., Engstrom, O., Ohman, L., Greene, G. L., Gustafsson, J. A., and Carlquist, M. (1997). Molecular basis of agonism and antagonism in the oestrogen receptor. Nature 389, 753-758. Danielian, P. S., White, R., Lees, J. A., and Parker, M. G. (1992). Identification of a conserved region required for hormone dependent transcriptional activation by steroid hormone receptors. Embo J 11, 1025-1033. Feng, W., Ribeiro, R. C., Wagner, R. L., Nguyen, H., Apriletti, J. W., Fletterick, R. J., Baxter, J. D., Kushner, P. J., and West, B. L. (1998). Hormone-dependent coactivator binding to a hydrophobic cleft on nuclear receptors. Science 280, 1747- 1749. Grese, T. A., Sluka, J. P., Bryant, H. U., Cullinan, G. J., Glasebrook, A. L., Jones, C. D., Matsumoto, K., Palkowitz, A. D., Sato, M., Termine, J. D., et al. (1997). Molecular determinants of tissue selectivity in estrogen receptor modulators. Proc Natl Acad Sci U S A 94, 14105-14110. Hubbell, W. L., Gross, A., Langen, R., and Lietzow, M. A. (1998). Recent advances in site-directed spin labeling of proteins. Curr Opin Struct Biol 8, 649-656. Hubbell, W. L., McHaourab, H. S., Altenbach, C., and Lietzow, M. A. (1996). Watching proteins move using site-directed spin labeling. Structure 4, 779-783. Kumar, V., Green, S., Stack, G., Berry, M., Jin, J. R., and Chambon, P. (1987). Functional domains of the human estrogen receptor. Cell 51, 941-951. Langen, R., Isas, J. M., Hubbell, W. L., and Haigler, H. T. (1998a). A transmembrane form of annexin XII detected by site-directed spin labeling. Proc Natl Acad Sci U S A 95, 14060-14065. Langen, R., Isas, J. M., Luecke, H., Haigler, H. T., and Hubbell, W. L. (1998b). Membrane-mediated assembly of annexins studied by site-directed spin labeling. J Biol Chem 273, 22453-22457. 174 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Moras, D., and Gronemeyer, H. (1998). The nuclear receptor ligand-binding domain: structure and function. Curr Opin Cell Biol 10, 384-391. Nemere, I., and Farach-Carson, M. C. (1998). Membrane receptors for steroid hormones: a case for specific cell surface binding sites for vitamin D metabolites and estrogens. Biochem Biophys Res Commun 248, 443-449. Rabenstein, M. D., and Shin, Y. K. (1995). Determination of the distance between two spin labels attached to a macromolecule. Proc Natl Acad Sci U S A 92, 8239- 8243. Reeves, J. P., and Dowben, R. M. (1969). Formation and properties of thin-walled phospholipid vesicles. J Cell Physiol 73, 49-60. Schlaepfer, D. D., Fisher, D. A., Brandt, M. E., Bode, H. R., Jones, J. M., and Haigler, H. T. (1992). Identification of a novel annexin in Hydra vulgaris. Characterization, cDNA cloning, and protein kinase C phosphorylation of annexin XII. J Biol Chem 267, 9529-9539. Shiau, A. K., Barstad, D., Loria, P. M., Cheng, L., Kushner, P. J., Agard, D. A., and Greene, G. L. (1998). The structural basis of estrogen receptor/co activator recognition and the antagonism of this interaction by tamoxifen. Cell 95, 921-931. Steinhoff, H. J., Radzwill, N., Thevis, W., Lenz, V., Brandenburg, D., Antson, A., Dodson, G., and Wollmer, A. (1997). Determination of interspin distances between spin labels attached to insulin: comparison of electron paramagnetic resonance data with the X-ray structure. Biophys J 73, 3287-3298. Tsai, M. J., and O'Malley, B. W. (1994). Molecular mechanisms of action of steroid/thyroid receptor superfamily members. Annu Rev Biochem 63, 451-486. Voss, J., Salwinski, L., Kaback, H. R., and Hubbell, W. L. (1995). A method for distance determination in proteins using a designed metal ion binding site and site- directed spin labeling: evaluation with T4 lysozyme. Proc Natl Acad Sci U S A 92, 12295-12299. Wehling, M. (1997). Specific, nongenomic actions of steroid hormones. Annu Rev Physiol 59, 365-393. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.

Linked assets

University of Southern California Dissertations and Theses

Conceptually similar

PDF

EPR analysis of soluble and membrane -bound annexin A2

PDF

A coactivator complex among GRIP1, CARM1, and TIF1alpha contributes to gene activation directed by androgen receptor

PDF

A model for the mechanism of agonism and antagonism in steroid receptors

PDF

An E2F-independent mechanism in transcriptional control of the hamster histone H3.2 gene expression

PDF

Different roles of p160 coregulators in myogenesis

PDF

Anomalies at NGX6 locus: Potential involvement in feline lymphomas

PDF

Development and secretions of salivary glands using mouse models

PDF

Fidelity of DNA polymerase holoenzymes

PDF

Characterization of new factors involved in feline leukemia virus (FELV)-mediated leukemogenesis

PDF

Coactivator synergy for nuclear receptors: Regulatory roles of arginine methyltransferase activity in transcription

PDF

Characterizing the function of murine epididymal secretory protein 1 (ME1) in hematopoietic stem cells

PDF

Expression and functional studies of the Notch signaling pathway in feather development

PDF

Biochemistry of nonhomologous DNA end joining (NHEJ) and its role in V(D)J recombination

PDF

Dual functions of Vav in Ras-related small GTPases signaling regulation

PDF

Development of HA -pseudotyped retroviral vectors for cell -specific gene delivery

PDF

Identification of the biochemical pathways affected by the anticancer agents Motexafin Gadolinium and Sapphyrin through gene expression profiling

PDF

DNA structures associated with the Fragile X triplet repeat sequences

PDF

A transgenic mouse model for small cell lung cancer

PDF

A novel reaction of mismatched cytosine-cytosine pairs associated with Fragile X

PDF

Investigation of the role of epigenetic modification of DNA and chromatin in aberrant gene silencing in cancer cells

Asset Metadata

Creator Shi, Guang (author)

Core Title An in vivo study of G protein coupled receptor mediated signaling

School Graduate School

Degree Doctor of Philosophy

Degree Program Biochemistry and Molecular Biology

Publisher University of Southern California (original), University of Southern California. Libraries (digital)

Tag biology, molecular,chemistry, biochemistry,OAI-PMH Harvest

Language English

Contributor Digitized by ProQuest (provenance)

Advisor Chen, Jeannie (committee chair), Langen, Ralph (committee chair), Haworth, Ian S. (committee member), Stallcup, Michael R. (committee member), Stellwagen, Robert H. (committee member)

Permanent Link (DOI) https://doi.org/10.25549/usctheses-c16-600773

Unique identifier UC11336689

Identifier 3219884.pdf (filename),usctheses-c16-600773 (legacy record id)

Legacy Identifier 3219884.pdf

Dmrecord 600773

Document Type Dissertation

Rights Shi, Guang

Type texts

Source University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Access Conditions The author retains rights to his/her dissertation, thesis or other graduate work according to U.S. copyright law. Electronic access is being provided by the USC Libraries in agreement with the au...

Repository Name University of Southern California Digital Library

Repository Location USC Digital Library, University of Southern California, University Park Campus, Los Angeles, California 90089, USA