University of Southern California Dissertations and Theses

Role of PKC-delta in deferoxamine-induced cell death in salivary epithelial Pa-4 cells

(USC Thesis Other)

Role of PKC-delta in deferoxamine-induced cell death in salivary epithelial Pa-4 cells

PDF

Download

Open document

Flip pages

Download a page range

Download transcript

Copy asset link

Request this asset

Transcript (if available)

Content ROLE OF PKC-DELTA IN DEFEROXAMINE-INDUCED CELL DEATH IN
SALIVARY EPITHELIAL Pa-4 CELLS
by
Carlos Arturo Clavijo
A Dissertation Presented to the
FACULTY OF THE GRADUATE SCHOOL
UNIVERSITY OF SOUTHERN CALIFORNIA
In Partial Fulfillment of the
Requirements for the Degree
DOCTOR OF PHILOSOPHY
MOLECULAR PHARMACOLOGY AND TOXICOLOGY
December 2005
Copyright 2005 Carlos Clavijo
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
UMI Number: 3220098
Copyright 2005 by
Clavijo, Carlos Arturo
All rights reserved.
INFORMATION TO USERS
The quality of this reproduction is dependent upon the quality of the copy
submitted. Broken or indistinct print, colored or poor quality illustrations and
photographs, print bleed-through, substandard margins, and improper
alignment can adversely affect reproduction.
In the unlikely event that the author did not send a complete manuscript
and there are missing pages, these will be noted. Also, if unauthorized
copyright material had to be removed, a note will indicate the deletion.
®
UMI
UMI Microform 3220098
Copyright 2006 by ProQuest Information and Learning Company.
All rights reserved. This microform edition is protected against
unauthorized copying under Title 17, United States Code.
ProQuest Information and Learning Company
300 North Zeeb Road
P.O. Box 1346
Ann Arbor, Ml 48106-1346
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
DEDICATION
To my wonderful and beloved Marcela
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
ACKNOWLEDGEMENTS
I wish to thank to Dr. David Ann for his support and guidance through all these years
of work, Dr. Helen Lin for her invaluable advice in the generation of genetic
constructs, Dr. Judy Gardner for her generous allowance to use her laboratory’s
equipment, Drs. Reyland and Qiu for providing key genetic constructs utilized in this
work, friend and college John Chen for her contribution with cell cycle analysis that
provide important information for this work and to my dear wife Marcela for her
unconditional support, help and love.
In addition I wish to thank to Microscope Facility Core at the Center for Liver
Diseases, USC where all the microscopy images were acquired and my Committee
Members: Dr. Enrique Cadenas, Dr. Roger Duncan, Dr. Sarah Hamm-Alvarez and
Dr. Axel Schonthal for their insightful comments to this work.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
iv
TABLE OF CONTENTS
Dedication ii
Acknowledgements iii
List of Tables and Figures vi
Abstract viii
INTRODUCTION 1
BACKGROUND 3
Iron is important for normal function and critically important for cancer cells 3
Iron chelation as an approach for cancer treatment 5
DFO in vitro, in vivo and clinical trials 6
DFO-induced response 7
DFO and hypoxia 10
PKC-8 11
PKC-5 and apoptosis 13
SIGNIFICANCE 15
HYPOTHESIS 17
MATERIALS AND METHODS 18
RESULTS 27
1. Design, generation and characterization of lentivirus transduced Pa-4 cells
with different PKC-8 genetic background i.e., si-PKC-8, PKC-8-WT-EGFP,
PKCS-KD-EGFP and controls 27
2. PKC-8 is an important component of the signaling pathway activated by
DFO treatment in Pa-4 cells 33
a. PKC-8 gene silencing confers resistance to DFO-induced cell death 33
b. PKC-8-EGFP cells are more sensitive to DFO-induced cell death 35
c. PKC-8 is activated upon DFO treatment 37
d. PKC-8 changes its subcellular localization during DFO treatment 40
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
V
3. Characterization of Pa-4 cells response to DFO treatment 45
a. Members of the DNA-damage response signaling pathway are activated
by DFO treatment 45
b. PKC-5 is necessary for a sustained ATM activation during the response to
DFO treatment 49
c. Cyclins A and D -l are differentially affected by DFO treatment 52
d. PKC-5 can modulate Cyclin A protein levels during DFO-induced response 55
e. PKC-5 can modulate Cyclin D1 protein levels during DFO-induced response 58
f. Both p38 and JNK signaling pathways are activated upon DFO treatment 58
g. PKC-5 is sufficient but not necessary to modulate positively the process of
phosphorylation of p38 and JNK during DFO-induced response 62
h. Caspase 3 cleavage is a late event in response to DFO treatment 65
i. PKC-5 is both sufficient and necessary for the generation of Caspase 3
activation fragment during DFO-induced response 67
j. Akt protein levels and phosphorylation on S473 and T308 are negatively
regulated in response to DFO treatment 69
k. PKC-5 is sufficient but not necessary for the down regulation of Akt
protein levels and its phosphorylation on Serine 473 and Threonine 308
during the response to DFO 72
1 . MG132 fails to prevent Akt protein levels reduction upon DFO treatment
in Pa-4 cells 77
m. Exogenous Akt protein levels are not reduced upon DFO treatment 79
4. Global DFO-induced response 81
DISCUSSION 85
DFO Internalization 86
PKC-5 activation and nuclear translocation 87
PKC-5 and ATM phosphorylation 89
PKC-5 and Caspase 3 activation 94
PKC-5 cell cycle arrest and Cyclin D1 protein levels 97
PKC-5 and p38, JNK and Akt/PKB 103
PKC-5 effectors 106
A model for PKC-5 role in DFO-induced cell death 107
FUTURE PERSPECTIVES 110
BIBLIOGRAPHY 113
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
vi
LIST OF TABLES AND FIGURES
Figure 1: Generation of si-PKC-5-Pa-4 cell line
Figure 2: PKC-5-EGFP exogenous expression. Generation of
PKC-5-WT-EGFP- and -KD-Pa-4 cell lines
Table 1: List of cell lines and transduced cell pools generated for this study
Figure 3: PKC-5 gene silencing increases Pa-4 cell survival to DFO-induced
cell death
Figure 4: Exogenous expression of PKC-5-EGFP sensitizes Pa-4 cells to DFO-
induced cell death
Figure 5: PKC-5 is activated in a dose and time-dependent fashion upon DFO
treatment in Pa-4 cells
Figure 6: There is a direct correlation between PKC-5 catalytic fragment
formation during DFO response and the sensitivity of Pa-4 cells
to this drug
Figure 7: PKC-5 is translocated into the nucleus upon DFO treatment in
Pa-4 cells
Figure 8: PKC-5 kinase function is required for its DFO-induced nuclear
translocation
Figure 9: DNA damage response pathway is activated by DFO treatment
Figure 10: PKC-5 is necessary for a sustained activation of ATM during the
response to DFO
Figure 11: Cyclins A and D -l are differentially affected by DFO treatment
Figure 12: PKC-5 regulates negatively both Cyclin A and Cyclin D1 protein
levels during the response to DFO
Figure 13: Both p38 and JNK signaling pathways are activated upon DFO
treatment
29
31
32
34
36
38
39
42
43
46
51
53
56
60
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
vii
Figure 14: PKC-8 is sufficient but is not necessary for upregulation of p38
phosphorylation during the response to DFO 63
Figure 15: PKC-8 is sufficient but is not necessary for upregulation of JNK
phosphorylation during the response to DFO 64
Figure 16: Caspase 3 cleavage is a late event in response to DFO treatment 66
Figure 17: PKC-8 is both sufficient and necessary for the generation of
Caspase 3 activation fragment during the response to DFO 68
Figure 18: Akt protein levels and phosphorylation on S473 and T308 are
negatively regulated in response to DFO treatment 70
Figure 19: Akt-1 is translocated into the nucleus with a similar time course
that PKC-8 upon DF O treatment 71
Figure 20: PKC-8 is sufficient but not necessary for the down regulation of
Akt protein levels and its phosphorylation on Serine 473 and
Threonine 308 during the response to DFO 74
Figure 21: MG 132 fails to prevent Akt or Akt-1 protein levels reduction upon
DFO treatment in Pa-4 cells 78
Figure 22: Exogenous Akt protein levels are not reduced upon DFO treatment 80
Figure 23: Global effect of DFO treatment in Pa-4 cells 83
Figure 24: Model of PKC-8 role in DFO-induced cell death 109
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
ABSTRACT
Desferoxamine (DFO) is an iron chelator widely used as a therapeutic drug for iron
overload in several diseases. More recently DFO has shown some promising anti
proliferative effects in vitro and in vivo when used for certain types of cancer. Little
is known about the mechanism by which DFO can induce cell cycle arrest and cell
death in both non-transformed and cancer derived cells. In this work we provide
compelling evidence that protein kinase C delta (PKC-5) plays an important role in
DFO-induced cell death in rat salivary gland epithelial (Pa-4) cells. First, PKC-5
gene silencing mediated by lentiviral transduction confers Pa-4 cells resistance to the
cytotoxic effect of DFO when compared with control cells. Second, exogenous
expression of PKC-5-EGFP sensitizes Pa-4 cells to DFO-induced cell death. Third,
PKC-5 is activated in a time and dose dependent manner upon DFO treatment.
Fourth, PKC-5 is translocated from the cytoplasm to the nucleus as part of DFO-
induced response.
The mechanism by which PKC-5 contributes to DFO-induced cell death was
explored in a systematic analysis. DNA-damage response pathway is activated by
DFO treatment as illustrated by ataxia telangiectasia mutated (ATM) and its
downstream substrate Histone H2AX phosphorylation. Once inside the nucleus
PKC-5 seems to play a role in keeping a sustained ATM phosphorylation in response
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
to DFO. Cyclins D1 and A protein levels are down regulated in response to DFO
treatment in a process mediated by PKC-8. Caspase 3 cleavage is a later event during
DFO-induced cell death and PKC-8 is both sufficient and necessary for Caspase 3
cleavage induction. PKC-8 can modulate positively other signaling pathways
activated upon DFO treatment such as p38 and JNK activation at the same time that
can modulate negatively Akt protein levels and phosphorylation. PKC-8 is sufficient
although not necessary for these effects suggesting a redundant role in this process.
Akt protein levels reduction is not blocked by a proteasome inhibitor and exogenous
Akt can escape from this down regulation suggesting that this effect might be at the
transcriptional level.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
1
INTRODUCTION
The genetic alteration of normal apoptotic pathways is a very common characteristic
of tumor cells which often correlates with cancer progression. The study of pro-
apoptotic signaling pathways is essential for a better understanding of the
mechanisms underlying normal and disease related processes. This knowledge is
required for the development of new therapeutic strategies against different types of
cancer. PKC-8 is known to be required for some chemotherapeutic drugs-induced
apoptosis. The central hypothesis of the present work is that PKC-8 is important
for the process of Desferoxamine (DFO) induced cell death. To test this
hypothesis the rat salivary gland epithelial cell line (Pa-4) was utilized as model.
New cell lines derived from Pa-4 were generated with different genetic backgrounds
regarding PKC-5, including PKC-8 gene silencing, exogenous expression of
chimeric PKC-5-EGFP wild type (WT) and kinase-dead (KD). The functional
analysis demonstrates that PKC-8 gene silencing reduces Pa-4 cells sensitivity to
DFO, whereas the exogenous expression of PKC-5-EGFP increases Pa-4 cells
sensitivity to this drug. PKC-8 is activated in a dose and time dependent fashion
upon DFO treatment and its activation acts synergistically with pro-apoptotic
signaling pathways such as sustained DNA-damage response, activation of p38 and
JNK pathways and activation of Caspase 3. On the other hand PKC-8 has an
antagonistic effect on an important prosurvival signaling pathway such as Akt/PKB
as well as on important regulators of cell cycle progression such as Cyclins A and
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
2
D l. Overall this work demonstrates that PKC-5 plays an important role durign DFO
induced cell death through several possible mechanisms.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
3
BACKGROUND
Iron is important for normal function and critically important for
cancer cells
Iron is an essential component or cofactor of a number of enzymes of importance for
the cells in processes as diverse as respiration, proliferation and differentiation. For
example iron is a necessary component of the M2 subunit of the enzyme
Ribonucleotide Reductase (RR) the rate limiting enzyme in DNA synthesis. This
subunit contains a ferrous iron center and a tyrosil radical both necessary for proper
RR function (Dayani et al., 2004). The availability of intracellular iron controls also
the expression of many proteins at the transcriptional and posttranscriptional level,
including Transferrin Receptor (TfR), ferritin, protein kinase C-B, p21, etc. (Dayani
et al., 2004).
Since iron is so important for cell proliferation it has been proposed that it is equally
important for cancer cells growth. Support for this assumption comes from
experimental evidence indicating: first, many tumor cells show up regulated
expression of TfR including those cells that normally do not express this receptor;
second, elevated levels of circulating ferritin are associated with a worse prognosis in
Neuroblastoma; third, some tumor cells in culture present growth inhibition when
antibodies against TfR are added, etc. (Dayani et al., 2004).
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
4
Iron overload has been described in different types of cancer including lung cancer,
hepatocellular carcinoma (HCC), colon adenoma and colorectal cancer. It induces
tissue damage by increasing the generation of reactive oxygen species (ROS) and
therefore oxidative stress (Tam et al., 2003). There are several mechanisms by which
iron overload can generate ROS. Iron can react with reducing agents and initiate
Fenton reactions and can form hydroxyl and peroxyl radicals when reacting with
unsaturated fatty acids and lipid hydroperoxides (Richardson, 2004). ROS can
modify chemically many biological molecules affecting their structure and function,
they can inactivate enzymes, cross-link proteins, depolymerize polysaccharides and
cause single and double strand DNA breaks. It has been postulated that during cancer
conditions the free iron pool that is normally chelated by low molecular weight
molecules (i.e. citrate) is released causing oxidative stress. One of the multiple
targets of oxidative stress is ferritin which then can release even more iron to the
non-chelated pool having a positive feed back for oxidative stress (Dayani et al.,
2004).
Other medical conditions including neurological diseases such as Parkinson’s
disease, Alzheimer’s disease and Friedreich’s ataxia have been also associated with
iron overload which has driven some researchers to explore the possibility of use
iron chelators as an alternative therapeutic approach for these conditions. Due to its
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
5
widespread use the iron chelator Desferoxamine (DFO) was the first candidate to test
some of these putative therapies even though its hydrophilic nature restricts its
ability to permeate the blood-brain barrier (Richardson, 2004).
Iron chelation as an approach for cancer treatment
DFO is a hexadentate hydroxamate siderophore, (microbial iron chelator) (Tam et
al., 2003) naturally produced by the bacteria Streptomyces pilosus that can bind Fe3 +
with high affinity and specificity with 1:1 stoichiometry (Buss et al., 2003), (Dayani
et al., 2004). It seems to mobilize iron slowly (days) from ferritin and hemosiderin
but even more poorly from transferrin and lactoferrin which suggests that DFO
chelation properties are limited to the labile soluble pool from the compartment in
which it is present. DFO is rapidly cleared from blood but inefficiently absorbed by
intestines which forces that DFO must be continuously administered by infusion
(Tam et al., 2003).
DFO is commonly utilized in the treatment of transfusional iron overload typical in
several diseases including beta-Thalassemia and hereditary hemochromatosis
(Richardson, 2004). Its use has been associated with a cardio protective effect
(Hershko et al., 2004) and more recently has shown anti-proliferative activity against
leukemia and neuroblastoma cells in vitro, in vivo and in clinical trials (Hershko et
al., 2004).
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
6
DFO in vitro, in vivo and clinical trials
The ability of DFO to induce apoptosis has been demonstrated in vitro in different
cellular models such as cultured ML-1 (myeloblastic leukemia) cells, Raji (Burkitt’s
lymphoma) cells, leukemic CCRF-CEM cells, promyeloleukemic HL60 cells,
actively proliferating T cells (Hileti et al., 1995), F9 embryonal carcinoma cells
(Tanaka et al., 1999) and neuroblastoma cells (Fan et al., 2001).
Animal studies show less abundant positive results for DFO antitumor effect and in
some cases this effect is only obtained when combined with low iron diet (Buss et
al., 2003).
On the other hand clinical trials show a more promising landscape for DFO use as a
therapeutic approach against certain types of cancer including neuroblastoma and
leukemia (Buss et al., 2003), (Dayani et al., 2004), (Lovejoy and Richardson, 2003).
Surprisingly, when used at non-toxic concentrations DFO can also induce transient
differentiation of certain cell types such as F9 embryonal carcinoma cells (Tanaka et
al., 1999), (Tanaka et al., 1997) and HL60 leukemia cells (Kaplinsky et al., 1987).
Similarly NB4 and U937 leukemic cell lines also endured cell differentiation upon
treatment with DFO in a process that involved H IF-la transient stabilization (Jiang
et al., 2005).
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
7
DFO-induced response
In vitro studies have shown that DFO can induce cell cycle arrest at lower
concentrations and apoptosis at larger doses and these effects are more pronounced
in rapidly proliferating cells than their normal counterparts (Buss et al., 2003). These
studies using neuroblastoma cells have been criticized for the lack of transferrin in
the medium failing to mimic the in vivo conditions in which several sources of iron
can be utilized by cancer cells. Interestingly some authors have proposed that
cytotoxicity induced by DFO may be independent from iron chelation but rather due
to the production of highly reactive hydroxyl radicals (Lee and Wurster, 1995). In
this study the cytotoxic effects of DFO were insensitive to the addition of
stoichiometric doses of iron, but were reduced by the addition of antioxidants and
hydroxyl radical scavengers (Lee and Wurster, 1995).
DFO can effectively inhibit Thymidine incorporation and cell growth (Dayani et al.,
2004) by a mechanism that seems to include iron chelation from an intracellular non
protein bound pool necessary for DNA synthesis (Buss et al., 2003). In this way
DFO induces cell cycle arrest in G l/S phases, increases TfR expression and inhibits
ferritin expression (Dayani et al., 2004). It is still not completely clear how DFO
induces cell cycle arrest although it affects several important proteins for cell cycle
progression. DFO has proven to induce a decrease in Cyclins A, B, D and E in breast
cancer cells (Kulp et al., 1996), (Buss et al., 2003). Cyclin D reduction upon DFO
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
8
treatment has been also seen in neuroblastoma (Gao and Richardson, 2001), Kaposi’s
sarcoma and endothelial cells (Simonart et al., 2000). Other effects of DFO in cell
cycle include a reduction in cdc2 protein levels and activity in neuroblastoma cells
(Brodie et al., 1993), (Buss et al., 2003).
DFO can also inhibit several genes involved with energy production and at the same
time enhance the expression of other genes some involved in cell growth. For
example DFO treatment can increase p53 and p21 expression (Dayani et al., 2004).
Part of the mechanism for regulation of gene expression may be explained by
changes in the interaction o f iron regulatory proteins (IRPs) with their binding
sequences in the iron-responsive elements (IREs) at untranslated regions (UTRs) of
the mRNAs of some of those genes like TfR and ferritin (Dayani et al., 2004),
(Lovejoy and Richardson, 2003).
In some cases DFO effect on gene expression lacks of a known physiological role.
For example DFO has a positive effect on the expression of the protein huntingtin of
unknown function but which knockout in mice causes changes in organelles such as
nucleus, mitochondria, endoplasmic reticulum, Golgi and recycling endosomes
(Richardson, 2004).
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
9
There are several side effects associated with DFO treatment including: ophthalmic,
auditory, pulmonary, and renal toxicity. In children the side effects are more severe
than in older patients and may include growth failure and bone abnormalities,
transient musculoskeletal pains, yersiniosis, mucormycosis, thrombocytopenia,
leukopenia, aplastic anemia, skin rashes, local reactions, allergic and anaphylactic
reactions (Porter and Davis, 2002), (Dayani et al., 2004). The mechanism by which
DFO can cause these side effects is poorly characterized but probably involves
differential sensitivity to the cytotoxic effects to this drug. The molecular mechanism
of DFO-induced cell death is still far from being elucidated but it seems to include
the activation of Caspases 8, 9 (Greene et al., 2002) and 3 (Fan et al., 2001), (Ido et
al., 1999), (Buss et al., 2003). This suggests that DFO induced cell death can at least
in part use initiator and executioner Caspases proper of many apoptotic processes.
In conclusion DFO can induce cell death by at least two major mechanisms, i.e., by
chelation of the iron labile soluble fraction at different intracellular compartments
and by generation of reactive oxygen species. Both mechanisms can induce a series
of physiological alterations that upon accumulation can trigger cell cycle arrest and
programmed cell death. These mechanisms are not mutually exclusive and therefore
a combination of the two of them seems entirely feasible.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
10
DFO and hypoxia
Iron chelators such as DFO can mimic hypoxic conditions probably by chelating the
iron pool necessary for the function of the enzyme HIF-la-prolyl hydroxylase which
under normal conditions can hydroxylate the Hypoxia Inducible Factor 1-alpha
(HIF-la) at proline 564 targeting it for proteasome mediated degradation (Lovejoy
and Richardson, 2003), (Buss et al., 2003). In addition iron chelation can affect the
activity of a number of enzymes that require this element to form heme groups or
iron-sulfur clusters including those in the respiratory chain complexes. As a
consequence iron chelation mediated by subtoxic concentrations of DFO is also
associated with the reduction of total cellular ATP levels and a reduction in the
proportion of cells with active mitochondria revealed by their transmembrane
potential (Yoon et al., 2004). In agreement with this Hypoxia mimicking effect, well
characterized hypoxia-induced events such as vascular endothelial growth factor
(VEGF) expression is up regulated upon DFO treatment and an ever increasing
number of researchers utilize DFO treatment as a method to experimentally simulate
hypoxic conditions (Ijichi, 1995).
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
11
PKC-5
The protein kinase C (PKC) family of serine-threonine kinases is activated by
diverse stimuli and participates in cellular processes such as growth, differentiation,
apoptosis and cellular senescence (Dempsey et al., 2000), (Basu, 2003), (Zhou and
Hershenson, 2003), (Gutcher et al., 2003), (Steinberg, 2004), (Wheaton and
Riabowol, 2004). To date the PKCs comprise 11 isoforms that are grouped based on
structure into three subfamilies: The classical PKCs (a, pi, P2 and y) that are
activated by diacylglycerol (DAG) and calcium, the novel PKCs (8, e, r| and 0) that
are activated by DAG, and the atypical PKCs (£ and A A ) which can be activated in a
DAG or calcium independent manner. All PKC isoforms are composed of an N-
terminal regulatory domain and a C-terminal catalytic domain that are combined at a
third variable region V3 (Brodie, 2003).
PKC-8 is a ubiquitous member of the PKC family activated by DAG/phorbol esters
in a calcium independent manner. According with the current model of activation of
novel PKCs (nPKCs), before any stimulus they are in an inactive form characterized
by a week association with cellular membranes in a closed or inactive conformation
with the auto inhibitory pseudosubstrate domain occluding the substrate-binding
pocket. Upon stimulus with agonist that induces generation of phosphoinositol
triphosphate Ins(l, 4, 5)P3 and DAG, nPKCs can associate to the membranes via
their Cl domain which induces a conformational change that releases the catalytic
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
12
domain from its interaction with the pseudosubstrate domain. In order to be activated
by DAG, PKCs (novel and classical) must be first phosphorylated by 3-
phosphoinositide-dependent kinase (PDK-1) in their conserved turn motif followed
by autophosphorylation on a site in the hydrophobic region (Gutcher et al., 2003). In
this active conformation nPKCs can phosphorylate substrates at the membrane level.
The specificity of action of PKCs is currently attributed to their proper location once
activated which may include several subcellular compartments such as plasma
membrane, mitochondria, nucleus, endoplasmic reticulum and Golgi apparatus
(Brodie, 2003). Specific location would be provided by their interaction with specific
anchoring proteins at membrane microdomains. A number of different types of PKC
anchoring proteins have been characterized, i.e., STICKs (substrates that interact
with C kinase), cytoskeletal proteins such as actin and tubulin, scaffolding proteins
such as Caveolin and AKAPs (A-kinase anchoring proteins), and RACKs (receptors
for activated C kinase) (Steinberg, 2004). Following its activation, PKC-8 undergoes
proteolytic degradation or down regulation via the ubiquitin-proteasome system
(Zhimin et al., 1998) and in certain cases it undergoes Caspase mediated cleavage
releasing its catalytic domain which has a constitutive activity (Denning et al., 1998).
PKC-8 has been reported to play a critical role in the control of cell growth. Loss of
PKC-8 leads to cell transformation in fibroblasts (Lu et al., 1997), whereas its
overexpression results in G2/M arrest of the cell cycle (Watanabe et al., 1992).
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
13
Recently, it was demonstrated that mice lacking PKC-5 show increased proliferation
of B cells and develop autoimmune disease, suggesting that PKC-8 also functions as
a negative regulator of B-cell proliferation (Miyamoto et al., 2002). Surprisingly
PKC-5 is involved in growth-stimulatory responses in certain cancers and elevated
PKC-8 levels correlates with highly aggressive forms of metastatic breast cancer
(Kiley et al., 1999). PKC-5 and other members of PKC family mediate ischaemic
cardiac preconditioning (Zaugg et al., 2003) a source of a lot of scientific interest due
to its potential clinical applications. More recently a new arrange of functions
triggered by tyrosine phosphorylation by Src family kinases (SFK) is emerging
(Steinberg, 2004).
PKC-8 and apoptosis
Studies with PKC-8 -/- mice support the notion that this protein plays pivotal roles in
the regulation of cell proliferation and apoptosis (Basu, 2003), (Steinberg, 2004).
PKC-8 is essential in the response to genotoxic stress leading to apoptosis caused by
DNA-damage agents and its activation and translocation to different subcellular
compartments are induced by many different apoptotic stimuli. These stimuli include
ceramide, TNF-alpha, Fas ligation and by DNA damaging treatments such as UV
radiation, ionizing radiation and etoposide (Brodie, 2003), (Reyland et al., 1999).
The pro-apoptotic function of PKC-8 is further substantiated by evidence showing
that it is necessary for etoposide and UV light induced apoptosis in a process that
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
14
requires tyrosine phosphorylation (Matassa et al., 2001). Other important
characteristic of PKC-5 activation upon etoposide treatment is its nuclear
translocation followed by caspase-3 mediated cleavage (DeVries et al., 2002). This
yields a constitutive active catalytic fragment (CF) which further enhances the
apoptotic process.
In conclusion PKC-5 plays a central role in the regulation of the response to a variety
of apoptotic stimuli and despite the large amount of studies concerning this kinase
we are still far from a complete characterization of the mechanism(s) utilized by
PKC-5 to execute its physiological roles.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
15
SIGNIFICANCE
The broad use of DFO for different conditions including iron overload chelation and
more recently anti-cancer therapeutic approaches contrasts with the relatively poor
characterization of cellular responses to this drug. More importantly none of the
reported characterizations utilizes gene silencing technology and very few uses
knock out gene experimental approach preventing from a clear identification of the
genes that are necessary for DFO anti-proliferative effects. A more comprehensive
knowledge regarding DFO mechanisms of action can allow the design of improved
versions of this drug or at least the identification of those cases in which its use can
have the best therapeutic potential. In some conditions DFO is used in high dosages
and can have important side effects. A better understanding of DFO induced
response in both non-transformed and cancer derived cells could provide clues about
how to enhance the therapeutic pros and simultaneously reduce those adverse effects.
The use of salivary gland Pa-4 cells as a model make this study specially relevant for
pathologic conditions such as carcinomas of the oral cavity and salivary glands. In
addition the results of this study might be applicable to other epithelial cell models
and may be useful for the development of therapies directed against other epithelial
derived tumors such as breast, and prostate carcinomas.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
16
PKC-5 is important in different physiological processes. This kinase is essential for
apoptosis mediated by different types of stimuli and therefore the results of this study
will contribute to a better understanding of PKC-5 mediated signaling. To the extent
of our knowledge this is the first report relating PKC-8 with DFO-induced cell death
providing a new avenue for future research in the development of iron chelator
chemoterapeutic drugs with enhanced anti-tumor effectivity and reduced side effects.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
17
Hypothesis
The present work was designed to test the hypothesis that PKC8 plays a role in DFO-
induced cell death in Pa-4 cells.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
18
MATERIALS AND METHODS
Materials
Desferoxamine-mesylate (DFO) and 3-(4,5-Dimethyl-2-thiazolyl)-2,5-diphenyl-2H-
tetrazolium bromide Methylthiazolyldiphenyl-tetrazolium bromide (MTT) were from
Sigma Chemical Co. (St. Louis, MO, USA).
Cell culture
Rat parotid epithelial Pa-4 cell line and all its variants generated were cultured on
Primaria culture dishes (Falcon) with Dulbecco’s modified Eagle’s/F12
(DMEM/F12) medium supplemented with 2.4% Fetal Bovine Serum, Insulin
(5pg/ml), L-glutamine (2.3mM), Transferrin (5pg/ml), Epidermal growth factor
(25ng/ml), hydrocortisone (1.1 pM), glutamate (5mM), T3 (3,3',5-Triiodo-L-
thyronine) (1.7nM), Kanamycin (94pg/ml) and Fungizone (47pg/ml) maintained at
35°C in a humidified atmosphere of 5% CO2 and 95% air.
Design and Generation of lentiviral constructs
The lentilox 3.7 expression vector (pLL3.7) (Rubinson et al., 2003) was utilized as
the frame for the generation of both the gene silencing and overexpression vectors.
For gene silencing the EGFP encoding sequence was deleted from pLL3.7 by
restriction enzyme digestion and compatible ends re-ligation yielding the so called
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
19
gene silencing empty vector (GS-EV). This empty vector was linearized by digestion
with Hpal and Xhol restriction enzymes and a pre-annealed synthetic short hairpin
(sh) DNA fragment was directionally ligated. In order to facilitate the screening of
positive clones, a BamHI restriction site was included in the sh sequence. The
following are the sequences of the sh constructs utilized: Rat PKC-8 SH-RNA-01-
Sense-1443-1461: 5’-TGACCACCTCTTCTTTGTGATTCAAGAGATCACAAAG
AAGAGGTGGTCTTTTTTGGATCC-3 ’; Rat PKC-8 SH-RNA-01 -Antisense-1443-
1461:5’-TCGAGGATCCAAAAAAGACCACCTCTTCTTTGTGATTCAAGAGA
TCACAAAGAAGAGGTGGTCA-3’; Rat PKC-8 SH-RNA-02-Sense-883-901: 5’-
TGATTCAAGGTCTATAACTATTCAAGAGATAGTTATAGACCTTGAATCTT
TTTTGGATCC-3’; Rat PKC-8 SH-RNA-02-Antisense-883-901: 5’-TCGAGGATC
CAAAAAAGATTCAAGGTCTATAACTATTCAAGAGATAGTTATAGACCTTG
AATCA-3’; Rat PKC-8 SH-RNA-03-Sense-1598-1616: 5’-TGGACCTCAAGCTAG
ACAATTTCAAGAGAATTGTCTAGCTTGAGGTCCTTTTTTGGATCC-3 ’; Rat
PKC-8 SH-RNA-03-Antisense-1598-1616: 5’-TCGAGGATCCAAAAAAGGACCT
CAAGCTAGACAATTCTCTTGAAATTGTCTAGCTTGAGGTCCA-3’; Rat PKC-
8 SH-RNA-04-Sense-2413-2431: 5’-TGAGGGAAACTGTAAATCCTTTCAAGAG
AAGGATTTACAGTTTCCCTCTTTTTTGGATCC-3 ’; Rat PKC-8 SH-RNA-04-
Antisense-2413-2431: 5’-TCGAGGATCCAAAAAAGAGGGAAACTGTAAATCC
TTCTCTTGAAAGGATTTACAGTTTCCCTCA-3 ’; SCRAMBLED SH-RNA-
47%GC-Sense: 5 ’-TGATCTCTCGGTTCTATCACTTCAAGAGAGTGATAGAAC
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
20
CGAGAGATCTTTTTTGGATCC-3’; SCRAMBLED SH-RNA-47%GC-Antisense:
5’-TCGAGGATCCAAAAAAGATCTCTCGGTTCTATCACTCTCTTGAAGTGA
TAGAACCGAGAGATCA-3’. Each one of these constructs were harbored
downstream of the human U6 promoter in the GS-EV.
PKC-8-EGFP constructs in pEGFP-Nl expression vector (wild type (WT) and
kinase-dead (KD) harboring a mutation K376R in the ATP binding site) were kindly
provided by Doctor Reyland (DeVries et al., 2002). For overexpression or exogenous
expression these constructs were sub-cloned downstream the CMV promoter of
pLL3.7 lentiviral expression vector. As negative control the PKC-8-WT-EGFP
sequence was deleted by restriction enzyme digestion and compatible ends re
ligation yielding the so called overexpression empty vector (OE-EV). All constructs
were sequenced.
Lentivirus-mediated transduction
Lentivirus with the corresponding expression constructs were made as previously
described (Chau et al., 2005). Briefly, human 293T cells (80-90% confluence) in
T175 culture flask were co-transfected by the calcium phosphate precipitation
method with a total amount of 106 pg DNA distributed in equal molar quantities of
the corresponding lenti-construct, pCMV-delta-8.7 (encoding Human
Immunodeficiency Virus (HIV) Gag-pol driven by CMV promoter) and pVSV-G
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
21
(encoding vesicular stomatitis virus glycoprotein (VSV-G) for pseudo-typing) for
viral packaging. Virus-containing supernatant medium from the transfected cells
was harvested, concentrated through Centricon Plus-20 with Ultracel PL
Membranes, from Millipore with a Molecular Weigh Cut Off of 30,000 kDa and
stored at -80°C. Titers of viral stocks were determined in 293T cells by serial
dilutions, and were in the range of l-4xl08 transduction units per ml (TUs/ml).
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
22
Transduction of Pa-4 cells
For lentiviral infection, Pa-4 cells were plated one day prior to infection. When the
culture reached 25% confluence, the culture medium was aspirated off, and fresh
medium containing concentrated virus was added and incubated for 24 hours in the
presence of polybrene (9 pg/ml) at a multiplicity of infection (MOI) of 200 to
achieve >90% transduction efficiency indicated by EGFP expression of cells
transduced in parallel with pLL3.7 monitored by fluorescence microscopy.
Cloning and characterization of transduced cell lines derived from
Pa-4 cells
Transduced Pa-4 cells were cloned by serial dilution in order to obtain single cell
derived clones. The obtained clones were characterized biochemically by western
blot and immunodetection with specific antibodies against PKC-6 and EGFP. For
gene silencing those clones expressing the lowest PKC-8 protein levels were used for
functional MTT survival assay. For overexpression or exogenous expression of the
PKC-8-EGFP chimeric constructs, clones were initially screened by fluorescence
microscopy and then further confirmed by western blot. Those clones expressing the
highest exogenous protein levels were used for functional MTT survival assay.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
23
MTT survival assay
In this assay, a number of cells were seeded in order to yield approximately 5%
confluence in 96 well plates. Cells were allowed to recover for 24h and then treated
with culture medium without or with increasing concentrations of DFO during 24h.
Then medium was changed for fresh culture medium and cells were further
incubated until the controls reached <100% confluence (typically two to three
additional days) when cell viability was determined by MTT (3-(4,5-
Dimethylthiazol-2-yl)-2,5-Diphenyltetrazolium Bromide) reduction assay. Data is
expressed as the average fraction of the corresponding control group without drug
treatment plus/less standard deviation. This experiment was repeated at least three
times in quadruplicate.
Biochemical analysis
For western blot analysis cells were seeded in culture Petri dishes and allowed to
recover for 24h. Then cells were treated with culture medium without or with DFO.
For dose-response analysis the range of concentrations utilized was (0, 12.5, 25, 50,
100 and 200pM) and cells were harvested 32h after treatment. For time-course
analysis a concentration of 50pM DFO was utilized and cells were harvested at the
following time points (0, 8, 16, 24, 32, 40 and 48h). Whole cell lysates obtained with
RIPA buffer plus inhibitors (25mM Tris pH 8.0, 125mM NaCl, 1% Nonidet-P-40,
0.5% Sodium Deoxycholate, 0.1% SDS, 0.004% Sodium Azide, Complete Protease
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
24
Inhibitors Cocktail (Roche), lOmM N-ethylmaleimide (NEM), ImM NaF and 2mM
Na3V0 4 ) were subjected to SDS-PAGE followed by immunoblotting with antibodies
for PKC-5 (SC-C17), GFP (B2-SC-9996), ATM (SC-248), Cyclin A (SC-H432),
Cyclin D-l (H-295), |3-Tubulin (D-10) (Santa Cruz Biotechnologies), phospho-Ser-
1981-ATM (05-140), phospho-Ser-139-H2AX (05-636), (Upstate Biotechnology),
HA (H A .ll) (Covance Research Products), p38 (CS-9212), phospho-Thr-180/Tyr-
182-p38 (CS-9211S), JNK (CS-9252), phospho-Thr-183/Tyr-185-JNK (CS-9251),
Caspase 3 (CS-9665), Akt (CS-9272), Akt-1 (2H10), phospho-Ser-473-Akt (CS-
9271S), phospho-Thr-308-Akt (CS-9275S), (Cell Signaling Technology). Blots were
visualized with the enhanced chemiluminiscence detection kit ECL-Plus (Amersham
Pharmacia Biotech) and the Versadoc 5000 Imaging System (Bio-Rad).
Densitometric data was obtained and analyzed with Quantity One Software (Bio-
Rad). In each case at least three independent analyses were performed.
Transient transfection
Vectors encoding variants of Akt were kindly provided by Dr. Qiu (Chen et al.,
2001), (Jiang and Qiu, 2003). Pa-4 cells were transiently transfected using
Lipofectamine-2000 (Invitrogen) following the manufacturer’s instructions with 2pg
DNA of different genetic constructs encoding for mutants of human Akt-1 constructs
(pCMV6-HA-Myr-Akt-1, Akt-l-KD, Akt-1-T308A, Akt-1-S473A, Akt-1-
P424/427/A, or Akt-2) and allowed to recover for 24 hours. Then transfected cells
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
25
were reseeded in two Petri dishes per experimental unit and allowed to recover for
further 24 hours, before treatment with or without 50pM DFO for 32h. Cells were
then harvested and processed for western analysis as described above. These
experiments were performed at least three independent times.
Live-cell imaging
PKC-8-WT-EGFP-Pa-4 and PKC-5-KD-EGFP-Pa-4 cells were seeded in order to
reach 25% confluence in 8-well cell culture chambers Lab-Tek® and allowed to
recover for 24 hours. Cells were then treated without and with 50pM DFO and
images at the following time points were acquired (0, 12, 24, 36, 48h). Exposure
time under UV light radiation was kept as short as possible and cells with no DFO
treatment were registered simultaneously as a control, using an epifluorescence
inverted Nikon microscope. Five randomly selected fields per experimental unit were
acquired per time point with a total magnification of 600x. Acquired images were
processed using the Metamorph Imaging, Corel Photo-paint and LSM 5 Image
Browser Software. For confocal images cells were examined using Nikon PCM 2000
Confocal System equipped with Argon ion and green HeNe lasers attached to a
Nikon TE300 Quantum inverted microscope (Center for Liver Diseases, USC). This
experiment was performed at least three independent times.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
26
Immunocytochemistry
Cells were seeded at 25% confluence in 16-well cell culture chambers Lab-Tek® and
allowed to recover for 24 hours. Cells were then treated with 50pM DFO and
processed for immunofluorescence microscopy at the following time points: (0, 8,
16, 24, 32, 40 and 48h). After DFO treatment cells were rinsed with PBS, fixed with
Paraformaldehyde 2% in PBS, quenched with 50mM Ammonium Chloride in PBS,
permeabilized with 0.5% Triton-X-100 in PBS and blocked with 1% BSA in PBS.
After incubation with the corresponding primary antibody made in mouse or rabbit,
cells were washed with PBS and then the corresponding secondary antibodies were
utilized to obtain multi-color staining. The secondary antibodies utilized were: goat-
anti-mouse conjugated to fluorescein isothiocyanate (FITC) or conjugated to
Tetramethyl-Rhodamine (TMR), goat-anti-mouse conjugated to Tetramethyl-
Rhodamine (Santa Cruz Biotechnologies) and goat-anti-rabbit conjugated to FITC
(ICN Pharmaceuticals, Inc.-Cappel Products). Cells were counterstained with DAPI
(Molecular Probes) for nuclear identification. A total of three independent
experiments were performed.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
27
RESULTS
1. Design, generation and characterization of lentivirus transduced
Pa-4 cells with different PKC-5 genetic background i.e., si-PKC-5,
PKC-5-WT-EGFP, PKC5-KD-EGFP and controls
In order to test our central hypothesis that PKC-5 plays a role in DFO induced cell
death, we first generated a series of genetic construes designed to produce lentivirus
capable of either silence the expression of endogenous PKC-5 or express exogenous
PKC-5-WT or -K D mutant. PKC-5-WT-EGFP and its kinase-dead variant PKC-5-
KD-EGFP, generously provided by Dr. Reyland (DeVries et al., 2002) were sub
cloned downstream the CMV promoter of the construct lenti-Lox-3.7 (Rubinson et
al., 2003) to generate lenti-Lox-3.7-PKC-5-WT-EGFP and its kinase-dead variant
designated pLL3.7-PKC-5-KD-EGFP. For gene silencing four different short hairpin
(sh) sequences specific for PKC-5 were designed and cloned immediately
downstream the U6 promoter from the GS-EV as described in materials and
methods. As control empty vector lacking the EGFP sequence from pLL3.7 was
generated (GS-EV). One additional control for gene silencing was designed by
introducing a scrambled sh-sequence into the GS-EV. All constructs were
sequenced.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
28
Pa-4 cells were transduced in order to generate pools of cells expressing each one of
the constructs above mentioned. The gene silencing effect obtained by the
transduction with individual sh constructs only yield about of 10% reduction of
PKC-5 protein level as confirmed by western blot. A PKC-5 gene silencing of about
40% was obtained by using the four sh constructs in a simultaneous transduction
(Figure 1). This pool of transduced cells was utilized in order to obtain several
individual clones two of them showing a PKC-5 gene silencing higher than 90%
(Clones 5 and 7 in Figure 1).
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
29
L-si-PKC-8 Clones
PKC-5
Tubulin
Figure 1. Generation of si-PKC-5-Pa-4 cell line. Pa-4 cells were transduced as described in materials and
methods with four lenti-viral expression constructs simultaneously in order to obtain a pool o f lenti-si-PKC-8
cells (L-si-PKC-S). Using the pool of transduced cells several clones were generated expanded and screened by
western blot using anti-PKC-8 antibody. Beta-tubulin was immunoblotted as loading control.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
30
Pools of Pa-4 transduced cells were utilized to obtain clones expressing PKC-8-WT-
EGFP or PKC-8-KD-EGFP and then screened both by fluorescence microscopy and
western blot (Figure 2). Those clones expressing the highest protein level of the
PKC-8-EGFP construct were selected and expanded in order to perform the
remaining experiments mentioned in this work. A summary the pools and cell lines
obtained is shown in table 1.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
31
gf L-PKC-5-KD-EGFP
Clones
L-PKC-8-WT-EGFP
Clones
PKC-S-
EGFP
Tubulin
Figure 2. PKC-5-EGFP exogenous expression. Generation of PKC-5-WT-EGFP- and -KD-Pa-4 cell lines. Pa-4
cells were transduced as described in materials and methods with pLL3.7-PKC-5-WT-EGFP or -KD respectively
in order to obtain pools o f cells expressing the exogenous constructs. These pools of transduced cells were
utilized to generate clones screened by fluorescence microscopy. Positive clones were further screened by
western blot using anti-PKC-8 antibody. Beta-tubulin was immunoblotted as loading control.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
32
Table 1. List of cell lines and transduced cell pools generated for this study.
Assigned Name Description Type
si-PKC-5-Pa-4 Pa-4 cells with above 90%
PKC-8 gene silencing
Transduced and
Cloned cell line
GS-EV-Pa-4 Pa-4 cells transduced with
empty vector used for gene
silencing
Transduced pool
PKC-8-WT-EGFP-Pa-
4
Pa-4 cells expressing wild
type version of PKC-8-
EGFP construct
Transduced and
Cloned cell line
PKC-5-KD-EGFP-Pa-4 Pa-4 cells expressing a
kinase-dead mutant
version of PKC-8-EGFP
Transduced and
Cloned cell line
Pa-4-OE-EV Pa-4 cells transduced with
empty vector used for
overexpression of PKC-8-
EGFP variants
Transduced pool
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
33
2. PKC-5 is an important component of the signaling pathway
activated by DFO treatment in Pa-4 cells
Once obtained the different cell lines or pools of transduced cells, they were
screened for their sensitivity to DFO through the survival MTT assay.
a. PKC-S gene silencing confers resistance to D FO -induced cell
death. As can be seen in figure 3, cells with PKC-5 gene silencing (si-PKC-5-Pa-4
cells) show a lower sensitivity to DFO treatment (24h) through a range of
concentrations of this drug when compared with either the parental Pa-4 cell line or
the pool of transduced cells with the corresponding empty vector. This suggests an
antagonistic role of PKC-8 for cell survival in response to DFO.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
34
' W : t
< 3 0.75 -
.2
2
> \
1 \ \
Sensitivity to DFO
- * -s i-P K C - d
GS-EV
Parental
0.0 25.0 50.0 75.0 100.0 125.0
[DFO} UM
150.0 175.0 200.0
B
0.50
2
« 0.25
0.00
S ensitivity to DFO
0 P aren tal
it GS-EV
■ si-PKC-d
[DFO] UM
Figure 3. PKC-8 gene silencing increases Pa-4 cell survival to DFO-induced cell death. MTT survival assay for a
range of DFO concentrations (A) or for a dose of 50pM DFO (B) was performed as described in materials and
methods. Briefly, Pa-4 parental cells or transduced with the empty vector (GS-EV) or si-PKC-8-Pa4 cells were
seeded in 96 well culture plates, allowed to recover before treatment with the indicated concentrations o f DFO
during 24 hours. After change of medium cells were further cultured until the untreated control reached 90%
confluence. At this point surviving cells were detected by MTT assay and the survival index (ratio: experimental
unit / control) was determined using the values o f absorbance at 610nm in quadruplicates. Graphics illustrate a
representative experiment out o f three independent assays. Error bars correspond to standard deviation.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
35
b. PKC-8-EGFP cells are more sensitive to DFO-induced cell
death. In agreement with an anti-survival role of PKC-8 during DFO treatment, Pa-
4 cells expressing exogenous version of PKC-8 show an increased sensitivity to this
drug when compared with either the parental cell line or Pa-4 cells transduced with
the corresponding empty vector. Intriguinly a similar effect is observed when a
kinase-dead variant of this protein is expressed in Pa-4 cells (Figure 4). This might
suggest that the anti-survival effect of exogenous PKC-8 is kinase activity
independent. On the other hand there is the possibility of having a similar
phenotype, i.e., increased sensitivity to DFO, although by different mechanisms as a
deeper study will suggest.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
36
1.50
100
0.75
0.50
0 . 2 S -
S ensitivity to DFO
h
-PKC-d-W T
- PKC-d-KD
- OE-EV
P a r e n ta l
f
0.00
\\ r
0.0 5 0 . C 7 5.0 ICC.C 125.0
[ D f O ]u M
150.0 175.0 200.0
0 .50 •-
0.25
0.00
S ensitivity to DFO
□ Parental
B OE-EV
■ PKC-d-WT
■ PKC-d-KD
I I
B
50.0
[DFO ) UM
Figure 4. Exogenous expression of PKC-5-EGFP sensitizes Pa-4 cells to DFO-induced cell death. MTT survival
assay for a range o f DFO concentrations (A) or for a dose o f 50pM DFO (B) was performed as described in
materials and methods. Briefly, Pa-4 parental cells or transduced with the empty vector (OE-EV) or pLL3.7-
PKC-S-WT-EGFP-Pa-4 or pLL3.7-PKC-8-KD-EGFP-Pa-4 cells were seeded in 96 well culture plates, allowed to
recover before treatment with the indicated concentrations o f DFO during 24 hours. After change o f medium
cells were further cultured until the untreated control reached 90% confluence. At this point surviving cells were
detected by MTT assay and the survival index (ratio: experimental unit / control) was determined using the
values of absorbance at 610nm in quadruplicates. Graphics illustrate a representative experiment out of three
independent assays. Error bars correspond to standard deviation.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
37
c. PKC-5 is activated upon DFO treatment. Since the functional assay
clearly suggests that PKC-5 plays an important role during the response of Pa-4 cells
to DFO treatment, then we decided to further characterize this response from the
point of view of PKC-5. One mechanism of activation reported for PKC-5 is its
proteolytic cleavage by caspases (caspase 3) (Denning et al., 1998) which yields a
~40kDa catalytic fragment (CF) with constitutive kinase activity. The generation of
this catalytic fragment can then be considered as a landmark of one type of PKC-5
activation. PKC-5 is activated in a dose and time dependent fashion upon DFO
treatment as denoted by its catalytic fragment generation in Pa-4 cells (Figure 5).
Furthermore endogenous PKC-5 CF generation reaches its maximum level 8 hours
earlier in Pa-4 cells expressing exogenous PKC-5-WT-EGFP than in parental cells
(Figure 6). Accordingly, the exogenous expression of PKC-5-KD-EGFP delays the
point of maximum production of endogenous PKC-5 CF which suggests that PKC-5
kinase activity has a positive feedback in its own activation during DFO response in
Pa-4 cells. As expected the production of PKC-5 CF is completely nullified in si-
PKC-5 cells at least at the detection level provided by western blot. Altogether this
experimental evidence shows a direct association between the generation and
kinetics of PKC-5 CF during DFO response and the relative sensitivity of Pa-4 cells
to this drug.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
38
Time (h): 0 8 16 24 32 40 48
t m m m m m m
! ^ w s ® r i^UP
^nr
PKC-5
PKC-6-CF
Tubulin
Dose (uM): 0 12.5 25 50 100 200
« » * » * » « »
B
m m mm m m m m
PKC-5
PKC-6-CF
Tubulin
Figure 5. PKC-S is activated in a dose and time-dependent fashion upon DFO treatment in Pa-4 cells. Pa-4 cells
were treated with 50pM DFO and harvested at the indicated time points. Whole cell extracts were used for
western blot and immunodection with anti-PKC-5 antibody or tubulin as loading control. The activation of PKC-
5 indicated by the generation of the catalytic fragment (CF) o f about 40kDa is detected as early as 24h after
treatment (A). Pa-4 cells were treated with increasing concentrations of DFO and harvested 32h later (B). Whole
cell extracts were obtained and probed as indicated in (A). Results of one representative experiment are shown.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
39
Time (h): 0 8 16 24 32 40 48
PKC-5
PKC-8-CF
Tubulin
PKC-8
PKC-8-CF
Tubulin
PKC-8
PKC-6-CF
Tubulin
PKC-5
PKC-5-CF
Tubulin
Figure 6. There is a direct correlation between PKC-5 catalytic fragment formation during DFO response and the
sensitivity of Pa-4 cells to this drug. Parental Pa-4 cells, si-PKC-8-Pa-4, PKC-8-WT-EGFP-Pa-4 and PKC-5-KD-
Pa-4 cells were treated with 50pM DFO and harvested at the indicated time points. Whole cell extracts were used
for western blot and immunodection with anti-PKC-8 antibodies or anti-tubulin as loading control. Results o f one
representative experiment are shown.
Cell Type:
Parental <
KU PP-
r
si-PKC-5 <
PKC-5-WT-EGFP <
* * wm m »
* * w
* * * * " * m m m m m i
PKC-5-KD-EGFP <
m S l fife
m m I P I P PH P 4 H P m m
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
40
d. PKC-5 changes its subcellular localization during DFO
treatment. To further characterize the role of PKC-8 during DFO-induced cell
death we performed immunocytochemical analyses. In steady state, PKC-8 localizes
throughout the cell including cytosol and nucleus (Figure 7). 24h after DFO
treatment PKC-8 displays an enriched nuclear localization which becomes more
marked with time. This behavior was further confirmed by live-cell imaging analysis
performed with Pa-4 cells expressing exogenous PKC-8-EGFP (Figure 8).
Interestingly, these analyses show that the kinase-dead version of PKC-8 fails to
translocate into the nucleus upon DFO treatment suggesting that its kinase activity is
essential for PKC-8 cytoplasm to nucleus translocation during DFO-induced
response. Additionally PKC-8-KD-EGFP shows a pattern associated with membrane
components at the cytoplasmic level at early time points and becomes enriched at the
plasma membrane about 48h after treatment as showed by scanning confocal
analysis followed by orthogonal planes reconstruction (Figure 8B). This suggests
that during DFO response, PKC-8 becomes activated and translocated transiently to a
peripheral cellular localization, probably the plasma membrane, and then it is
translocated into the nucleus in a process that requires PKC-8 kinase activity.
Here we provide compelling evidence that PKC-8 is an important component of the
signaling pathway activated upon DFO treatment. The degree of PKC-8 activation in
response to DFO treatment correlates directly with the sensitivity of the cells to this
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
41
drug. PKC-5 is activated in a dose and time dependent fashion upon DFO insult and
it is translocated into the nucleus from a peripheral subcellular localization in a
process that requires PKC-8 kinase activity.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
42
DFO
treatm ent (h)
24 32 48
PKC-5
DAPI
Tubulin
M erged
Figure 7. PKC-8 is translocated into the nucleus upon DFO treatment in Pa-4 cells. Pa-4 cells were seeded on 16
well cell culture chambers, allowed to recover, treated with 50pM DFO and harvested at the indicated time
points. Then cells were processed for immunocytochemistry as indicated in materials and methods. Panel shows
immunostaining of endogenous PKC-8, DAPI staining for nuclear identification and tubulin as counterstaining.
Images were acquired using an epifluorescence inverted Nikon microscope and processed using the Metamorph
Imaging, Corel Photo-paint and LSM 5 Image Browser Software.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
43
Panel A
PKC-6-WT-EGFP PKC -6-KD-EGFP
DFO 50uM
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
44
Panel B
PKC-8-W T-EGFP PKC-8-KD-EGFP
Control
48b
DFO
50uM
48h
Figure 8. PKC-S kinase function is required for its DFO-induced nuclear translocation. PKC-8-WT-EGFP- or -
KD-EGFP-Pa-4 cells were seeded in an 8 well cell culture chamber allowed to recover and either treated or not
with 50pM DFO in full medium. Live cell images were acquired (Panel A) at the indicated time points using an
epifluorescence inverted Nikon microscope and processed using the Metamorph Imaging, Corel Photo-paint and
LSM 5 Image Browser Software. In panel B cells treated as in A, were fixed with paraformaldehyde 2% and
images were obtained using a Nikon scanning fluorescence confocal microscope. Orthogonal planes were
reconstructed using the C-Imaging, Corel Photo-paint and LSM 5 Image Browser Software. DFO treatment
induces a clear cytoplasm to nucleus translocation in PKC-8-WT-EGFP whereas the kinase-dead variant
accumulates at the plasma membrane. Results o f one representative experiment are shown.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
45
3. Characterization of Pa-4 cells response to DFO treatment.
In an attempt to identify the signaling partners of PKC-8 during DFO-induced
response we perform a biochemical study of different potentially relevant proteins.
a. Members of the DNA-damage response signaling pathway are
activated by DFO treatment. DFO can reportedly cause DNA damage via
production of reactive oxygen species (ROS) (Dendorfer et al., 2005). Since DNA
integrity could be affected by DFO treatment we evaluate the phosphorylation status
of two important components of the DNA-damage signaling pathway such as ataxia
telangiectasia mutated (ATM) and its substrate H2AX. ATM becomes activated as
early as 16 hours after DFO treatment (Figure 9A) and remains active for the entire
extent of the treatment as denoted by its phosphorylation status at Serine-1981. ATM
activation is further supported by the fact that its direct substrate, H2AX, is
phosphorylated at Serine-139 with a very similar kinetics (Figure 9A).
Immunocytochemical analysis shows that the initial nuclear sparkled pattern of
phospho-H2AX becomes more generalized along the entire nucleus with an
increased exposure of the cells to DFO (Figure 9C). Taking together this evidence
suggests that the DNA-damage response signaling pathway and in particular ATM
and its downstream substrate H2AX are activated since an early stage in response to
DFO.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
46
Time (h): 0 8 16 24 32 40 48
A
4— pATM
«— ATM
pH2AX
Tubulin
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
47
DFO
treatment (h)
24 32 48
p-ATM
DAPI
PKC-6
Merged
B
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
48
DFO
treatment (h)
24 32 48
P-H2AX
DAPI
PKC-6
Merged
Figure 9. DNA damage response pathway is activated by DFO treatment. Pa-4 cells were treated with 50pM
DFO and harvested at the indicated time points. Whole cell extracts were used for western blot and
immunodection with anti-ATM, anti-phospho-ATM, anti-phopho-FI2AX antibodies or anti-tubulin as loading
control. The activation of ATM indicated by its phosphorylation at Serine 1981 and by the phosphorylation o f its
substrate F12AX at Serine 139 is detected as early as 16h after treatment (A). (B) Phospho-ATM signal is
concentrated in the nucleus upon DFO treatment in Pa-4 cells. Pa-4 cells were seeded on 16 well cell culture
chambers, allowed to recover, treated with 50pM DFO and harvested at the indicated time points. Then cells
were processed for immunocytochemistry as indicated in materials and methods. Panel shows immunostaining of
endogenous phospho-ATM (Green), PKC-5 (Red) and DAPI (Blue) staining for nuclear identification. Images
were acquired using an epifluorescence inverted Nikon microscope and processed using the Metamorph Imaging,
Corel Photo-paint and LSM 5 Image Browser Software. (C) Phospho-H2AX signal is increased across the entire
nucleus in response to DFO treatment. Cells were treated and analyzed as in (B). Results o f one representative
experiment are shown.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
49
b. PKC-8 is necessary for a sustained ATM activation during the
response to DFO treatment. Previous data demonstrated that PKC-8 is
translocated into the nucleus as part of the response to DFO treatment. Interestingly
there seems to be co-localization between PKC-8 and both phospho-ATM and
phospho-H2AX in the nucleus durign DFO-induced response (Figure 9B & 9C).
Then we test the hypothesis that PKC-8 can have any functional effect on ATM
activation during DFO-induced response. As seen in figure 10 the time course of
both ATM and H2AX phosphorylation shows a different pattern in si-PKC-8 cells
from that observed in Pa-4 parental cells. In the absence of PKC-8 there are two
phases of ATM and H2AX phosphorylation; during the first 32h after DFO treatment
there is a quick activation even relatively faster than that observed in parental cells.
However after 32h there is a second phase in which both the activation of ATM and
the phosphorylation of H2AX decline to at least half its maximum. This suggests that
PKC-8 is not necessary for the initial phase of ATM activaton but it might be
important for a sustained activation of this protein during the second phase. The
pattern observed in the other tree cell types shows an increased and sustained
activation of ATM and phosphorylation of H2AX with the time. Cells expressing
exogenous PKC-8-KD-EGFP have a similar pattern of ATM activation and H2AX
phosphorylation to those expressing PKC-8-WT-EGFP which might be explained by
the fact that the kinase-dead fails to be translocated into the nucleus where ATM and
H2AX are located (See figure 8). This data suggests that PKC-8 can contribute to the
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
50
DNA damage response signaling pathway by a mechanism that requires its
translocation into the nucleus and maintains a sustained activation of ATM after an
initial event of activation which is in itself PKC-5 independent.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
51
Time (h):
Cell Type:
Parental -s
r
0 8 16 24 32 40 48
■ - *
• i
* S W ^ t - v i - W S 4
V
m m -
P I P
j J | b
mm
i
1
1
si-PKC-8 <
m m
liipw w f
« — pATM
pH2AX
Tubulin
i— pATM
pH2AX
r
PKC-8-WT-EGFP <
r
m m m m mm mm mm mm m * * Tubuiin
— pATM
fR Pm pP
PKC-8-KD-EGFP <
v
4 * 4 ia »
pH2AX
Tubulin
i— pATM
pH2AX
Tubulin
Figure 10. PKC-5 is necessary for a sustained activation o f ATM during the response to DFO. Parental Pa-4
cells, si-PKC-8-Pa-4, PKC-5-WT-EGFP-Pa-4 and PKC-8-KD-EGFP-Pa-4 cells were treated with 50pM DFO
and harvested at the indicated time points. Whole cell extracts were used for western blot and immunodection
with anti-ATM, anti-phospho-ATM, anti-phospho-H2AX antibodies or anti-tubulin as loading control. Observe
how the pattern o f phosphorylation of ATM resembles that of H2AX phosphorylation. Results of one
representative experiment are shown.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
52
c. Cyclins A and D-l are differentially affected by DFO treatment.
PKC-8 has been reported to induce cell cycle arrest in some pro-apoptotic scenarios
(Doulias et al., 2003), (Tanaka et al., 1999), (Yoon et al., 2004). Preliminary data
suggests that DFO can induce cell cycle arrest and Pa-4-si-PKC-8 cells can
overcome that arrest (Jolin Chen, Personal Communication) suggesting another
mechanism by which this kinase can contribute to DFO-induced cell death. In order
to explore this possibility we analyzed the protein level status of cyclins A and D1 of
Pa-4 cells during DFO-induced response. These two cyclins are regulated
differentially upon DFO treatment, i.e., cyclin A protein levels increase until they
reach a peak at 24h after treatment followed by a steady decrease reaching
approximately 50% of the original levels obtained at the beginning of the experiment
(Figures 11A and 23) and maintaining a mainly nuclear subcellular localization
through the entire process (Figure 1 IB). On the other hand cyclin D1 protein levels
are dramatically and steadily reduced since as early as 16 hours after treatment
reaching levels bellow detection by western blot at 40 hours after treatment (Figures
11A and 23). Cyclin D1 presents also a mainly nuclear subcellular localization along
the treatment (Figure 11C).
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
53
DFO
0 8 16 24 32 40 48
s S R S S S S B I B ® '
m u m
0 0
24 32
Cvclin A
DAPI
Tubulin
M erged
B
Cyclin A
Cyclin D1
Tubulin
48
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
54
DFO
treatment (h)
Cyclin D1
24 32 48
DAPI
Tubulin
Merged
C
Figure 11. Cyclins A and D -l are differentially affected by DFO treatment. Pa-4 cells were treated with 50pM
DFO and harvested at the indicated time points. Whole cell extracts were used for western blot and
immunodection with anti-Cyclin A, anti-Cyclin D-l antibodies or anti-tubulin as loading control. Reduction in
Cyclin D-l protein levels is detected as early as 16h after treatment whereas Cyclin A protein levels reduction
starts only after 32h treatment (A). Both Cyclin A (B) and Cyclin D-l (C) show nuclear subcellular localization
through DFO treatment although reduction in relative intensity with time is only evident for Cyclin D -l. Pa-4
cells were seeded on 16 well cell culture chambers, allowed to recover, treated with 50pM DFO and harvested at
the indicated time points. Then cells were processed for immunocytochemistry as indicated in materials and
methods. Panel (B) shows immunostaining o f endogenous Cyclin A (Green), Tubulin (Red) and DAPI (Blue)
staining for nuclear identification. Images were acquired using an epifluorescence inverted Nikon microscope and
processed using the Metamorph Imaging, Corel Photo-paint and LSM 5 Image Browser Software. (C) Cyclin D-l
signal is reduced in response to DFO treatment. Cells were treated and analyzed as in (B). Results o f one
representative experiment are shown.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
55
d. PKC-8 can modulate Cyclin A protein levels during DFO-
induced response. In si-PKC-8-Pa-4 cells Cyclin A reaches levels relatively higher
than those observed in parental cells and these levels are maintained at least for 48
hours after treatment suggesting that PKC-8 is important for the process responsible
for the reduccion of Cyclin A after it peaks 24h after DFO treatment (Figure 12A).
Interestingly the pattern of Cyclin A protein levels observed in parental cells is
mimicked by cells expressing exogenous PKC-5-WT-EGFP whereas that observed
in si-PKC-8 cells is resembled by cells expressing exogenous kinase-dead PKC-8-
EGFP (Figure 12A). In general PKC-8 seems to have a constitutive negative effect
on Cyclin A protein levels which is enhanced in the process responsible for its down
regulation observed after 24h of DFO treatment. The mechanism by which PKC-5
contributes to the DFO-induced reduction of Cyclin A protein levels seems to require
its kinase activity since PKC-8-KD-EGFP fails to exert such an effect.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
56
Time (h): 0 8 16 24 32 40 48
Cyclin A
Tubulin
Cyclin A
Tubulin
Cyclin A
Tubulin
Cyclin A
Tubulin
A
Parental
si-PKC-8
PKC-6-WT-EGFP <
« m m m m ***»
PKC-S-KD-EGFP -<
m m m m m m m m . - - " J W r W M '^WBfflPWBre: 'sp^gpwp^*
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
57
Time (h): 0 8 16 24 32 40 48
Cell Type:
Cyclin D1
Tubulin
Cyclin D1
Tubulin
Cyclin D1
Tubulin
Cyclin D1
Tubulin
B
Figure 12. PKC-8 regulates negatively both Cyclin A and Cyclin D1 protein levels during the response to DFO.
Parental Pa-4 cells, si-PKC-8-Pa-4, PKC-5-WT-EGFP-Pa-4 and PKC-5-KD-EGFP-Pa-4 cells were treated with
50pM DFO and harvested at the indicated time points. Whole cell extracts were used for western blot and
immunodection with anti-Cyclin A (Panel A), anti-Cyclin D1 (Panel B) antibodies or anti-tubulin as loading
control. Results o f one representative experiment are shown.
Parental
si-PKC-8
m m m m m m
PKC-8-WT-EGFP A
PKC-8-KD-EGFP -s
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
58
e. PKC-8 can modulate Cyclin D1 protein levels during DFO-
induced response. The basal levels of Cyclin D1 are higher in Pa-4-si-PKC-8 cells
than those in parental cells and they are still detectable by western blot after 40 hours
of DFO treatment. In addition the exogenous expression of kinase-dead PKC-8-
EGFP seems to increase the stability of Cyclin D1 upon DFO exposure whereas the
expression of the wild type version of PKC-8-EGFP accelerates the rate of Cyclin
D1 protein level reduction (Figure 12B). This evidence suggests that PKC-5 has also
a constitutive negative effect on Cyclin D1 protein levels which is further activated
during DFO-induced response by a mechanism that requires PKC-8 kinase activity.
The negative effect exerted by PKC-5 on both Cyclins evaluated (A and D l) seems
to be PKC-8 kinase activity dependent.
f. Both p38 and JNK signaling pathways are activated upon DFO
treatment. As part of the characterization of the DFO-induced response in Pa-4
cells, we evaluated the activation status of two well recognized signaling pathways
that in certain scenarios can regulate apoptotic processes, i.e., p38 (Zarubin T, 2005),
(Roux and Blenis, 2004) and JNK (Liu and Lin, 2005), (Kanda and Miura, 2004).
Interestingly both p38 and JNK are activated with a very similar time course as
denoted by their phosphorylation status (Figure 13A). Phosphorylation of p38 on
Threonine 180 and Tyrosine 182 as well as phosphorylation of Threonine 183 and
Tyrosine 185 on JNK, increases above the steady state level after 24 hours of DFO
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
59
treatment and rapidly peaks at 32 hours followed by a partial decrease afterwards.
Phospho-p38 localizes both in the cytoplasm and in the nucleus throughout the entire
exposure to DFO. However after 32 hours of treatment there is a relatively higher
signal at the cytoplasm than at the nucleus, a pattern that is intensified after 48 hours
of treatment. In addition this cytoplasmic signal is concentrated in specific foci
(Figure 13B).
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
60
Time (h): 0 8 16 24 32 40 48
r n m m m m * » « $ » * * ■
« * . m m m m m ^ +
& • - s * _
1 "L ' .............. - i H p ^ W 1 1 ' 1 1 1 p W lil1
-
m u m - m r n m
m m « m m m m m m
p38
pp38
JN K
pJN K
Tubulin
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
61
DFO
treatment (h)
24 32 48
pp38
DAPI
Tubulin
Merged
B
Figure 13. Both p38 and JNK signaling pathways are activated upon DFO treatment. Pa-4 cells were treated with
50pM DFO and harvested at the indicated time points. Whole cell extracts were used for western blot and
immunodection with anti-p38, anti-phospho-p38, anti-JNK, anti-phospho-JNK antibodies or anti-tubulin as
loading control. Activation o f p38 and JNK follows a similar time course starting at 24h after treatment with a
peak at 32h and declining afterwards (A). Subcellular localization o f phospho-p38 (B) shifts from a relatively
homogeneous distribution throughout the cell to a reduced nuclear signal in combination with perinuclear and
cytoplasmic foci in response to DFO treatment. Pa-4 cells were seeded on 16 well cell culture chambers, allowed
to recover, treated with 50pM DFO and harvested at the indicated time points. Then cells were processed for
immunocytochemistry as indicated in materials and methods. Panel (B) shows immunostaining of endogenous
phospho-p38 (Green), Tubulin (Red) and DAPI (Blue) staining for nuclear identification. Images were acquired
using an epifluorescence inverted Nikon microscope and processed using the Metamorph Imaging, Corel Photo
paint and LSM 5 Image Browser Software. Results o f one representative experiment are shown.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
62
g. PKC-5 is sufficient but not necessary to modulate positively the
process of phosphorylation of p38 and JNK during DFO-induced
response. The transient phosphorylation of p38 and JNK induced by DFO treatment
can be accelerated and prolonged in the case of PKC-8-WT-EGFP-Pa-4 cells
(Figures 14&15). On the other hand Pa-4-PKC-5-KD-EGFP cells present a delayed
phosphorylation of p38 and JNK in response to DFO suggesting that PKC-8 has a
possitive effect on these phosphorylation events by a mechanism that requires its
kinase activity. Surprisingly si-PKC-8-Pa-4 cells show an earlier event of
phosphorylation of p38 and JNK when compared with parental cells which suggests
that PKC-8 is not required for this process eventhough can modulate it positively.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
63
Time (h): 0 8 16 24 32 40 48
p38
pp38
Tubulin
p38
pp38
Tubulin
p38
pp38
Tubulin
p38
pp38
Tubulin
Figure 14. PKC-8 is sufficient but is not necessary for upregulation o f p38 phosphorylation during the response
to DFO. Parental Pa-4 cells, si-PKC-5-Pa-4, PKC-5-WT-EGFP-Pa-4 and PKC-5-KD-EGFP-Pa-4 cells were
treated with 50pM DFO and harvested at the indicated time points. Whole cell extracts were used for western
blot and immunodection with anti-p38, anti-phospho-p38 antibodies or anti-tubulin as loading control. Results of
one representative experiment are shown.
r
Parental <
si- PKC-8 <
m m
idMMMtfWHkiit- .jfr a i 5 .
jg g g g jjjjb .
-^npM P IW
S5-- 1 #
'n y i p p i P - m m
f t. -5
r& tftsM
*
»
* *
r
PKC-8-WT-EGFP <
PKC-5-KD-EGFP <
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
64
Tim e(h): 0 8 16 24 32 40 48
Cell Type:
Parental -s
r
s u * § ? ? 4 ^ m i f m m u ■ * * * ■
.JNK
< > m m "
n#® **
pJNK
V .
m m m m m m m m mm m m
Tubulin
r
si-PKC-8 <
PKC-8-WT-EGFP <
* ■ * » « » * * * » * *
n g . n n ^
^P P P SPM r
PKC-8-KD-EGFP <
v
T
JNK
pJNK
Tubulin
JNK
pJNK
Tubulin
JNK
pJNK
Tubulin
Figure 15. PKC-6 is sufficient but is not necessary for upregulation o f JNK phosphorylation during the response
to DFO. Parental Pa-4 cells, si-PKC-5-Pa-4, PKC-S-WT-EGFP-Pa-4 and PKC-S-KD-EGFP-Pa-4 cells were
treated with 50pM DFO and harvested at the indicated time points. Whole cell extracts were used for western
blot and immunodection with anti-JNK, anti-phospho-JNK antibodies or anti-tubulin as loading control. Results
of one representative experiment are shown.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
65
h. Caspase 3 cleavage is a late event in response to DFO treatment.
Caspase 3 is a key effector component of several apoptotic signaling pathways
(Boyce M, 2004), (Philchenkov, 2004), (Twomey and McCarthy, 2005). We explore
the possibility that Caspase 3 might have a role during DFO-induced cell death. As
shown in figure 16 the characteristic cleavage of Caspase 3 starts only after 32 hours
o f treatment. This locates Caspase 3 cleavage in a relatively late event during DFO-
induced response, downstream to other events such as PKC-5 activation, ATM
activation and Cyclin D1 protein levels reduction.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
66
Time (h): 0 8 16 24 32 40 48
Caspase 3
Cleaved
Caspase 3
Tubulin
Figure 16. Caspase 3 cleavage is a late event in response to DFO treatment. Pa-4 cells were treated with 50pM
DFO and harvested at the indicated time points. Whole cell extracts were used for western blot and
immunodection with anti-Caspase 3 antibody or anti-tubulin as loading control. The proteolytically generated
fragment of about 17 kDa is detected since 32h after treatment. Results of one representative experiment are
shown.
_
« m § » m m m m m m m m
.j & j m & s B & f ,-
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
67
i. PKC-5 is both sufficient and necessary for the generation of
Caspase 3 activation fragment during DFO-induced response. PKC-S has
been implicated in a positive activation loop with Caspase 3 in other apoptotic
contexts (Brodie, 2003). We decided to evaluate the effect of PKC-S expression on
Caspase 3 activation upon DFO treatment. Interestingly the levels of cleaved
Caspase 3 in si-PKC-S-Pa-4 cells are barely detectable by western blot only at 24 and
32 hours after DFO treatment (Figure 17). Unlike parental cells Caspase 3 cleaved
fragment is not sustained with the time suggesting that PKC-8 is necessary for the
process that eventually will generate the cleavage of Caspase 3. Consistent with this
argument cells expressing exogenous PKC-8-WT-EGFP show a proportionally
accelerated rate of Caspase 3 cleaved fragment when compared with parental cells.
Furthermore cells expressing PKC-8-KD-EGFP fail to induce enough levels of
cleaved Caspase 3 to be detectable by western blot which reinforce the conclusion
that PKC-8 is not only sufficient but also necessary to the generation of Caspase 3
cleaved fragment. Furthermore these results indicate that this process seems to
require PKC-8 kinase activity. Intriguingly the phenotype of PKC-8-KD-EGFP-Pa4
cells shows that they are still sensitive to DFO treatment suggesting that at least in
these cells there must be a Caspase 3 independent mechanism for DFO-induced cell
death. An alternative explanation is that the proportion of kinase-dead is insufficient
to block completely endogenous PKC-8 activity causing only a delay in Caspase 3
activation and preventing us from detecting this event within the time frame tested.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
68
Time (h): 0 8 16 24 32 40 48
C ell Type:
Caspase 3
Cleaved
Caspase 3
Tubulin
Caspase 3
C'leaved
Caspase 3
Tubulin
Caspase 3
Cleaved
Caspase 3
Tubulin
Caspase 3
Cleaved
Caspase 3
Tubulin
Figure 17. PKC-5 is both sufficient and necessary for the generation of Caspase 3 activation fragment during the
response to DFO. Parental Pa-4 cells, si-PKC-8-Pa-4, PKC-5-WT-EGFP-Pa-4 and PKC-S-KD-EGFP-Pa-4 cells
were treated with 50pM DFO and harvested at the indicated time points. Whole cell extracts were used for
western blot and immunodection with anti-Caspase 3 antibody or anti-tubulin as loading control. Results of one
representative experiment are shown.
Parental • <
V
- " E g j f e j j f g f p - iiir iiiiiM f c ,j^fM £^.
iP K S B B - . W P P B P P s -
/
asaak. .- s a a k .- /.- _ Ja s s r
si-PKC-5 -<
V
«*► « . m m m m * » « • • *
f
PKC-8-WT-EGFP ■ < -** m t & m m
W m m . m m ' * * m '
^IlSik J ||g |l jg|||ggk
^USHIP 4H R 9H r p B PP fP iipw ps8 ’
PKC-8-KD-EGFP -<
« . * • • • • •
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
69
j. Akt protein levels and phosphorylation on S473 and T308 are
negatively regulated in response to DFO treatment. Akt is an important
prosurvival signaling component and its down regulation might be a mechanism to
favor cell death commitment. We evaluate both the protein levels and
phosphorylation status of Akt during DFO-induced response. Akt protein levels are
reduced since approximately 24 hours after drug treatment, a phenomenon that
appears more evident for Akt-1 (Figures 18 and 23). Interestingly Akt-1 is also
translocated from the cytoplasm into the nucleus as part of the response to DFO in a
process that becomes clear by immunocytochemistry after 32 hours (Figure 19).
Even more apparent than the reduction on protein levels is the reduction of the
phosphorylated forms of Akt (Figures 18 and 23) on Threonine 308 and Serine 473
denoting a down regulation on the prosurvival function of this kinase in response to
DFO.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
70
Time (h): 0 8 16 24 32 40 48
mm < * * ****
Akt
*
A ktl
m m m m - mm m m pS-Akt
m m * m u m m m mm ■ * * * " m m pT-Akt
m m * m m m m Tubulin
Figure 18. Akt protein levels and phosphorylation on S473 and T308 are negatively regulated in response to
DFO treatment. Pa-4 cells were treated with 50pM DFO and harvested at the indicated time points. Whole cell
extracts were used for western blot and immunodection with anti-Akt, anti-Akt-1, anti-phospho-Serine473-Akt,
anti-phospho-Threonine308-Akt antibodies or anti-tubulin as loading control. Results of one representative
experiment are shown.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
71
DFO
treatm ent (h)
24 32 48
Akt-1
DAPI
PKC-5
M erged
Figure 19. Akt-1 is translocated into the nucleus with a similar time course that PKC-8 upon DFO treatment. Pa-
4 cells were seeded on 16 well cell culture chambers, allowed to recover, treated with 50pM DFO and harvested
at the indicated time points. Then cells were processed for immunocytochemistry as indicated in materials and
methods. Panel shows immunostaining o f endogenous PKC-8 (Red), Akt-1 (Green) and DAPI staining for
nuclear identification. Images were acquired using an epifluorescence inverted Nikon microscope and processed
using the Metamorph Imaging, Corel Photo-paint and LSM 5 Image Browser Software.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
72
k. PKC-8 is sufficient but not necessary for the down regulation of
Akt protein levels and its phosphorylation on Serine 473 and Threonine
308 during the response to DFO. In order to test the role of PKC-8 in the
regulation of Akt protein levels and phosphorylation in response to DFO, we
determined these parameters in the context of different PKC-8 genetic background.
In si-PKC-8-Pa-4 cells there is still Akt protein levels reduction although at a lower
rate when compared with parental cells. On the other hand the exogenous expression
of PKC-8-EGFP variants has differential effects on Akt protein levels, i.e., cells
expressing exogenous PKC-8-KD present higher steady state levels of Akt and Akt-1
when compared with cells expressing the kinase-dead variant of PKC-8 (Figure
20B). Wild type PKC-8-EGFP expressing cells show reduction of Akt and Akt-1
protein levels in response to DFO whereas cells expressing the kinase-dead variant
of PKC-8-EGFP show higher Akt and Akt-1 stability and even some increment at the
end of the treatment with DFO. Intriguingly cells expressing wild type PKC-8-EGFP
present clearly higher basal levels of phosphorylated Akt (both on Serine 473 and
Threonine 308) (Figure 20B) than cells expressing the kinase-dead variant
suggesting that PKC-8 might have the ability to promote Akt phosphorylation either
directly or indirectly. Despite these conditions at steady state, upon DFO treatment
PKC-8-WT-EGFP seems to promote Akt dephosphorylation at higher rate than
parental cells whereas PKC-8-KD-EGFP exogenous expression seems to delay or
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
73
even prevent Akt dephosphorylation (20C). Altogether this evidence suggests that
PKC-8 is sufficient to modulate Akt protein levels and phosphorylation status
eventhough is not required for these processes to take place.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
74
Time (h): 0 8 16 24 32 40 48
Akt
Aktl
Tubulin
Akt
Aktl
Tubulin
Akt
Aktl
Tubulin
Akt
Aktl
Tubulin
A
Cell Type:
Parental <
- m m m m
m m rn *
• P m m
m m m -
- m m .
m m
m m
m m m m
'H H P ^
si-PKC'-b <
j m
jj g g ||g g g ^
^ p PHf
msm mm
« i t i A M w .
- ^ i m m m m
ma m
^SiP
m m ■mm
-siSte - s 1
m m
’ ^■ P P ' 1
I
PKC-8-WT-EGFP <
m m
r
PKC-5-KD-EGFP <
m m m m m m
jfttk
^ ) P r
^ I P P P ^
* * * '
' ■ J W - 1 -
m & -
- m m :iH K
* » < **
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
75
Akt
Akt-1
p-T-Akt
p-S-Akt
Tubulin
B
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
76
Time (h): 0 8 16 24 32 40 48
Cell Type:
Parental
r
mm m m m
* H * S L
* * * ' - m m m m . mm m m m m
si-PKC-8 <
pS-Akt
pT-Akt
Tubulin
4M fr
IB H i
i
t
# # * * pS-Akt
m m
- m m m m - -
■ a j& m . $ * pT-Akt
m m m *
Tubulin
r
PKC-8-WT-EGFP <
• m m
m m m m
pS-Akt
pT-Akt
mm 1
«
I
ms m m * *
Tubulin
PKC-8-KD-EGFP <
C
pS-Akt
pT-Akt
Tubulin
Figure 20. PKC-5 is sufficient but not necessary for the down regulation of Akt protein levels and its
phosphorylation on Serine 473 and Threonine 308 during the response to DFO. Parental Pa-4 cells, si-PKC-8-Pa-
4, PKC-5-WT-EGFP-Pa-4 and PKC-8-KD-EGFP-Pa-4 cells were treated with 50pM DFO and harvested at the
indicated time points. Whole cell extracts were used for western blot and immunodection with anti-Akt, anti-Akt-
1 antibody (Panel A), anti-S-473-Akt, anti-T-308-Akt (Panel C) or anti-tubulin as loading control. In panel B the
steady state levels of Akt, Akt-1, phospho-S-473-Akt and phospho-T308-Akt protein levels are shown. Results of
one representative experiment are shown.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
77
1 . MG132 fails to prevent Akt protein levels reduction upon DFO
treatment in Pa-4 cells. Akt protein levels reduction upon DFO treatment could
be promoted by several physiological processes including increased protein
degradation, reduced gene expression or a combination of both. In order to test the
possibility that protein degradation is responsible for DFO-induced Akt protein
levels reduction we tested the effect of the proteasome inhibitor MG132 in this
process. Surprisingly MG132 enhanced the rate of Akt protein levels reduction
obtained after 32 hours of DFO treatment suggesting that the proteasome activity is
not required for Akt protein levels reduction induced by DFO (Figure 21). An
increment in the total ubiquitinated proteins confirmed the effect of MG 132 as
proteasome inhibitor (Data not shown).
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
78
Parental si-PKC-8
PKC-8-WT-
EGFP
PKC-5-KD-
EGFP
a b c a b c a b c a b c
^08%
w & m • ■ • 'S W I W P p R ' .. W K m
m m m m m
awa>' -us**?® .i i& hf
Akt
Akt-1
Tubulin
Figure 21. MG132 fails to prevent Akt or Akt-1 protein levels reduction upon DFO treatment in Pa-4 cells.
Parental Pa-4 cells, si-PKC-8-Pa-4, PKC-8-WT-EGFP-Pa-4 and PKC-8-KD-EGFP-Pa-4 cells were treated with
50pM DFO (b&c) or with full medium (a) during 32h. MG132 (c) or vehicle (b) was added to a final
concentration o f lpM 4 hours before harvesting for western blot and immunodection with anti-Akt, or Akt-1
antibodies or anti-tubulin as loading control. Results of one representative experiment are shown.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
79
m. Exogenous Akt protein levels are not reduced upon DFO
treatment. In order to further characterize the mechanism by which Akt and in
particular Akt-1 protein levels are reduced in response to DFO treatment, we tested
the effect of a series of mutations that reportedly (Jiang and Qiu, 2003), (Chen et al.,
2001) affect Akt activity [constitutively active myristoylated Akt-1 (Myr-Akt-1) or
kinase-dead Akt-1 (Akt-l-KD)], or Akt ability to be activated (Akt-1-T308A or Akt-
1-S473A), or Akt ability to be degraded via ubiquitination and proteasome activity
(Akt-l-P424/427/A). Surprisingly none of these exogenous constructs endured DFO-
induced protein levels reduction, even though endogenous Akt protein levels were
still typically reduced (Figure 22). These results combined with the fact that the
proteasome system does not seem to be required for DFO-induced Akt protein levels
reduction open the possibility that this process is regulated at the transcriptional
level.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
80
Endogenous
Akt-1
Tubulin
DFO + - +
Akt
flippy ‘ U H P ? 1
- m * * *
Mvr-Akt-i
V
Akt-1-KD
Akt-1 -
T308A
HA
I M R # W H U m h' m * m *
Tubulin
P IP "
put
DFO - + - + - +
Akt-1-
S473A
HA
Tubulin
Akt-1-
P424/
427A
idipfc
Akt2
«ni)» ip ®
DFO
+ + +
Figure 22. Exogenous Akt protein levels are not reduced upon DFO treatment. Pa-4 cells were transfected with
different Aktl mutant constructs or Akt-2 wild type having the HA tag. After 24h cells were reseeded and
allowed to recover for 24h. Then cells were treated with or without 50pM DFO for 32h before harvesting for
western blot and immunodection with anti-HA antibody or anti-tubulin as loading control. As a control Pa-4 cells
were mock transfected and treated in exactly the same way as transfected cells. For these cells endogenous Akt,
Akt-1 or tubulin as loading control were immunodetected. Results of one representative experiment are shown.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
81
4. Global DFO-induced response.
The global balance of DFO-induced response indicates that PKC-5 enhances pro-
apoptotic signaling pathways and inhibits pro-survival signaling pathways. As shown
in figure 23, DFO can activate DNA-damage response as early as 16 hours after
treatment as indicated by phosphorylation of ATM and H2AX. Since then this
increasing activation process is maintained throughout the entire response.
Increasing catalytic activation of PKC-5 is also registered since 24 hours of DFO
treatment and cyclin D1 protein levels are dramatically reduced since 16 hours after
drug treatment whereas cyclin A protein levels reduction is much more paused and
starts only 32 hours after treatment. JNK and p38 MAPK are activated
simultaneously and transiently for a period of about 24 hours starting at 24 hours
after treatment and peaking at 32h. Akt and Akt-1 protein levels reduction starts as
early as 16 hours of treatment and is followed for a more accelerated reduction of
phosphorylation on Serine-473 and Threonine-308 starting at 24 hours of treatment.
Among the latest events registered in this study is the activation of Caspase 3
indicated by the detection of its proteolytic product which levels start to increase
only 32 hours after DFO treatment.
In general DFO induces a series of signaling events that down regulate pro-survival
pathways such as Akt/PKB or those that regulate normal cell cycle progression such
as cyclin D1 and cyclin A whereas enhance pro-apoptotic signaling including PKC-
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
82
8, p38, JNK and Caspase 3 activation. The entire series of events are apparently
initiated with DNA-damage which fails to be effectively repaired probably in part as
consequence of PKC-8 mediated signaling.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Normalized protein levels relative t o time 0
83
1.4
1.2
1
0.8
0.6
0.4
0.2
0
8 24 40 48 0 1 6
1.4
1.2
1
0.8
0.6
0.4
0.2
0
8 24 40 48 0 16
pSA kt
PR C -O C F
6.L-6
5.E -6
4.E~6
2.E+6
l.E - 6
C v c lin P l
0.6 -
pp38
p J N K l
300 x C lea v ed C a sp a se 3
250 -
100 -
Time DFO treatment (h)
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
84
Figure 23. Global effect of DFO treatment in Pa-4 cells. Time course of different antigens followed up upon
50pM DFO treatment. Western blot densitometric values o f protein levels were quantified with the software
Quantity One (BioRad) and normalized with tubulin values. Values are plotted relative to density at time zero
which corresponds to a relative value o f 1. Time points were 0, 8, 16, 24, 32, 40 and 48 hours. Experiment was
performed at least three times and one representative western blot was utilized for the corresponding graphic.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
85
DISCUSSION
Iron chelating agents have been postulated as a chemotherapeutical alternative for
certain types of cancer. The general presumption is that iron chelation can have a
more dramatic impact in cell growth of highly proliferative cell populations such as
tumor cells, than in cells from normal tissue. Mainly because of pragmatical reasons
Desferoxamine (DFO) has been the most widely used iron chelator both in the
treatment of secondary iron overload as well as in the treatment of certain cancer
types such as neuroblastoma and leukemia. The mechanisms of anti-proliferative
action induced by DFO have been only partially documented but the signaling
pathway(s) responsible for this phenomenon is not well characterized.
In this work we test the hypothesis that PKC-8 plays a role in the signaling pathway
responsible for DFO-induced cell death in glandular salivary epithelial (Pa-4) cells.
Several lines of experimental evidence indicate that PKC-8 is important for DFO-
induced cell death in Pa-4 cells, namely, PKC-8 gene silencing reduces Pa-4 cells
sensitivity to the cytotoxic effect induced by DFO. Exogenous expression of
chimeric PKC-8-EGFP increases Pa-4 cells sensitivity to this drug. Furthermore
there is a direct correlation between the generation of PKC-8 catalytic fragment, a
landmark of PKC-8 activation under apoptotic stimuli, and the sensitivity of the cells
to DFO. In addition as part of DFO-induced response, PKC-8 was translocated into
the nucleus in a process that requires PKC-8 kinase activity since a kinase-dead
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
86
failed to endure translocation. The results presented here demonstrate unequivocally
that PKC-8 plays an important role in DFO-induced cell death.
We also looked at the signaling pathways upstream and downstream PKC-8 during
DFO-induced response and found that PKC-8 is both necessary and sufficient for
three distinct processes during DFO-induced cell death, namely, first, sustained
activation of ATM and its downstream substrate H2AX phosphorylation; second,
Cyclins D1 and A enhanced protein levels reduction; third, Caspase 3 activation.
Furthermore we found that PKC-8 can enhance p38 MAPK and JNK transient
phosphorylation and can mediate Akt protein levels and phosphorylation reduction
upon DFO treatment. Each one of the major signaling events characterized during
DFO-induced response is discussed in detail in the following paragraphs.
DFO Internalization
Iron-bound DFO is highly hydrophilic and therefore unable to cross plasma
membrane. Its chelating effect of intracellular chelatable iron pool is temperature
dependent which is consistent with an internalization mediated by the endocytic
pathway (Tenopoulou et al., 2005), (Lloyd et ah, 1991), (Ollinger and Brunk, 1995)
and accumulated in the lysosomal compartment (Persson et ah, 2003) via endosomes
as shown in primary hepatocytes (Ollinger and Brunk, 1995) (Hershko et ah, 2004),
HeLa cells (Doulias et ah, 2003), lymphoblastic T cells 1301 (Kurz et ah, 2004) and
Jurkat cells (Tenopoulou et ah, 2005). The first signs of change in any of the
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
87
signaling molecules studied here correspond to an increase in ATM phosphorylation
8-16 hours after DFO treatment. This suggests that the mechanism of internalization
utilized by DFO in Pa-4 cells required several hours before enough chelating agent
was accumulated in order to induce any physiological change. This is compatible
with fluid phase endocytosis mediated internalization.
PKC-5 activation and nuclear translocation
Previous works showing a direct link between DFO signaling events and PKC are
rather scarce and not specific for any particular isotype. DFO had a cardioprotective
action in a study in vivo with ischemia-reperfusion model in rats (Dendorfer et al.,
2005). Interestingly, these authors did not find evidence of HIF protein stabilization
or HIF-mediated transcriptional activation suggesting a mechanism different to
prolyl hydroxylases inhibition during this DFO-mediated cardioprotection. Both a
PKC inhibitor (Chelerythrine) and a radical scavenger ((N-(2-mercaptopropionyl)-
glycine (MPG)) prevented the DFO-induced cardioprotective effect suggesting that
oxygen radicals and PKC signaling are involved in this process. The authors argue
that DFO can actually have a prooxidant effect by preventing Fenton type reactions
and therefore stabilizing superoxide which would be responsible for PKC mediated
preconditioning. The use of a general PKC inhibitor does not allow identifying
which isotype is involved in this process. Although in a different experimental
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
88
context, our work suggests for the first time that a particular isotype of PKC, i.e.,
PKC-8 is important for DFO-induced cell death.
An important characteristic of PKC-8 activation is its change in subcellular
localization. In Pa-4 cells PKC-8 experiences nuclear translocation 24 hours after
DFO treatment in a process that requires PKC-8 kinase activity since a kinase-dead
variant failed to be translocated in response to DFO. The mechanism by which PKC-
8 is translocated into the nucleus was identified as a bipartite nuclear localization
signal at its C-terminus (DeVries et al., 2002). In the case of etoposide-induced cell
death, PKC-8 is translocated into the nucleus followed by Caspase 3 activation and
proteolytic cleavage of PKC-8 yielding the 40kDa catalytic fragment. Proteolytic
activation of PKC-8 depends on phosphorylation of several tyrosine residues in the
vicinity of the Caspase 3 cleavage site (Blass et al., 2002). In the present work the
time course analysis indicates that PKC-8 catalytic activation starts simultaneously
with its nuclear translocation, suggesting that a similar trend of events reported for
etoposide-response is followed during DFO-induced cell death. Further support for
this hypothesis is provided by the fact that cells expressing exogenous PKC-8-KD-
EGFP failed for both nuclear translocation of this mutant kinase and induction of
Caspase 3 cleavage in response to DFO. This suggests that PKC-8 kinase activity is
also necessary for Caspase 3 activation and that this event takes place inside the
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
89
nucleus. Caspase 3 activation via PKC-5 mediated phosphorylation is an interesting
possibility that remains to be evaluated.
PKC-8 and ATM phosphorylation
H2AX phosphorylation in Serine 139 is considered as a landmark of DNA damage
and ATM is the major kinase responsible for this phosphorylation. A current model
postulates that ATM is activated by DNA double strand breaks (DSBs) and recruits
more ATM molecules as well as repair proteins and sensors such as MRN, 53BP1,
and MDC1 to the lesion. Numerous substrates would be then phosphorylated by
ATM and DNA-PKcs including H2AX, and the recruited DNA repair proteins. Then
PI3K kinase activity is reinforced and additional phosphorylation events will take
place. In this way H2AX phosphorylation in regions with DNA DSBs and their
vicinity will provide an enhanced recruitment mechanism for proteins involved in
DNA repair (Femandez-Capetillo et al., 2004). Interestingly enough the present work
indicates that PKC-8 seems to be necessary for a sustained ATM activation after 32h
of DFO treatment reflected by its phosphorylation status as well as phosphorylation
of its downstream substrate H2AX. This hypothesis is supported for the time course
of phosphorylation status of ATM and H2AX in si-PKC-8-Pa-4 cells which fail to
have a sustained ATM activation. In addition PKC-8-KD-EGFP-Pa-4 cells showed a
delayed but sustained ATM and H2AX phosphorylation in response to the drug. The
kinase-dead variant of PKC-5-EGFP therefore failed to block endogenous PKC-8
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
90
effect on ATM activation, probably because it was unable to be translocated into the
nucleus. The role of PKC-8 in ATM sustained phosphorylation could indicate at least
two different scenarios. It could imply that at that time the source of DNA-damage
ceased and PKC-8 is necessary for maintain that source. Alternatively, the source of
DNA-damage is maintained but part of the DNA-damage signaling pathway involves
PKC-8 activity at a secondary stage after the initial activation of ATM coinciding
with the time at which PKC-8 activity reaches its maximum. In any case this role of
PKC-8 seems to be localized in the nucleus. These results suggest that PKC-8 can
play an important role during the modulation of ATM activation at the initial node of
the DNA-damage response signaling pathway.
Other works had shown that at low concentrations and short time-exposures DFO
can have a protective effect to H202-induced DNA-damage (Ollinger and Brunk,
1995), (Kurz et al., 2004), (Tenopoulou et al., 2005), however longer treatments are
associated with cell cytotoxicity (Doulias et al., 2003). In contrast, the present work
shows clear evidence of DNA-damage signaling pathway activation (ATM and
H2AX phosphorylation) starting at an early exposure to DFO. However there is
evidence that DFO can in fact induce the formation of oxygen radicals during its
anti-ischemic cardioprotective effect given the fact that a radical scavenger prevents
DFO from inducing its protective effect (Dendorfer et al., 2005). Furthermore there
is also evidence that PKC-8 mediates the cytotoxic effect of Arsenate-induced cell
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
91
death, a prooxidant reagent whose cytotoxic effect depends on reactive oxygen
species (ROS) production (Li et al., 2004). In this excellent work the authors
demonstrated that PKC-8 and ATM have a pro-apoptotic effect during arsenate-
induced cell death which is abrogated by a ROS blocker (N’acetylcysteine-NAC).
Moreover they demonstrated that both c-Abl and ATM play important and
antagonistic roles in arsenate-induced oxidative stress which are mediated by PKC-8.
The precise mechanism by which ATM or c-Abl can regulate PKC-8 protein levels is
still not clear but it doesn’t seem to involve transcriptional events. Here we show that
PKC-8 is important for ATM sustained activation a process that mediates DFO-
induced cell death probably via ROS production. In our model PKC-8 activation is
later than the initial ATM phosphorylation but it is required to maintain ATM
activation. If this is the case, at early stages of DFO-induced response PKC-8 locates
downstream ATM, then at later stages of the signaling process there is a possitive
feedback loop in which PKC-8 once activated can operate upstream ATM
guarantying a pro-apoptotic outcome. A similar mechanism involving two
temporally separated steps of activation, but in this case for a target of ATM kinase
activity, was proposed for N bsl the defective gene in Nijmegen breakage syndrome
and a key ATM-controlled checkpoint pathway mediator induced by DNA DSBs. In
the first step ATM phosphorylates N bsl at local DNA DSBs however it is necessary
a second round of phosphorylation (ATM-independent) before Nbsl can be
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
92
effectively recruited in the DSBs to form active nuclear foci where DNA repair
elements will join later (Lukas et al., 2003).
The mechanism by which PKC-8 can positively modulate sustained phosphorylation
of ATM and H2AX is still unknown. H2AX can be phosphorylated by ATM but
there is evidence that other kinases such as DNA-PK could also contribute
cooperatively to H2AX phosphorylation (Wang et al., 2005). A direct kinase activity
of PKC-8 over ATM or H2AX remains as a possibility considering that during DFO-
induced response all these proteins converge in the nucleus. Interestingly one of the
substrates identified for both PKC-8 and its CF during DNA-damage response is the
DNA-dependent protein kinase catalytic subunit (DNA-PKcs) an essential member
of DNA-repair machinery. PKC-8 associates constitutively with DNA-PKcs and is
phosphorylated by PKC-8-CF upon ionizing radiation causing DNA DSBs. This
phosphorylation event inhibits DNA-PKcs kinase activity and its DNA binding
ability (Bharti et al., 1998). The capacity of both c-Abl and PKC-8 to inhibit DNA-
PKcs provides a potential model for DFO-induced cell death. In this model DFO
induces ROS formation which activates both c-Abl and PKC-8 and promotes their
translocation into the nucleus. There PKC-8 can activate Caspase 3 which can then
cleave PKC-8 further enhancig PKC-8 activity through the production of its catalytic
fragment. C-Abl and PKC-8 activities inhibit DNA-PKcs function as an important
DNA-repair component, causing an increased probability of accumulation of DNA
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
93
DSBs. As a consequence ATM keeps receiving signals indicating a persistent
presence of DNA DSBs explaining why PKC-5 activity is necessary for a sustained
ATM activation in response to DFO and also why cells expressing exogenous PKC-
5-KD-EGFP by lacking kinase activity and failing to translocate into the nucleus
would have reduced or delayed caspase 3 activation. The effect on ATM
phosphorylation would also be delayed just like is observed in these cells.
Yet another layer to this network regulated by PKC-8 is its recently identified target
hRad9 which is the homologous of Schizosaccharomyces pombe spRad9. In S.
pombe spRad9 expression is necessary for DNA-damage or incomplete DNA
replication-induced cell cycle arrest. hRad9 is a kinase target for PKC-5 in response
to DNA-damaging agents and its phosphorylation prevents hRad9 to form a complex
with hHusl and hRadl. Although the exact mechanism by which this complex works
it seems to contribute to DNA repair (Yoshida et al., 2003). Furthermore hRad9 can
bind to Bc1-2/Bc1-xl proteins and this constitutive interaction requires PKC-5 and c-
Abl mediated phosphorytlation of hRad9. In conclusion PKC-8 regulates possitively
hRad9 mediated apoptosis and G2 cell cycle arrest in response to DNA-damage. The
possibility that a rat homologous to hRad9 mediates DFO induced cell death and/or
cell cycle arrest remains to be evaluated.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
94
The evidence suggesting DNA DSBs formation in response to DFO treatment opens
a warning concern regarding the use of this drug for cancer treatment. Under normal
conditions DFO treatment would induce cell death by mechanisms involving PKC-8
activity. However in those cases in which PKC-8 activity or expression is negatively
regulated, DFO might fail to induce cell death but still cause enough DNA DSBs to
generate genomic instability becoming a potential for tumor development. Even
though this is a merely theoretical possibility it should be part o f the analysis when
considering the use of DFO for cancer treatment.
PKC-8 and Caspase 3 activation
Iron chelation can cause cell death of F9 cells through a mechanism that requires
Caspase 3 activation (Greene et al., 2002), (Ido et al., 1999). Other Caspases (8 and
9) have also been described as taking part of DFO induced cell death (Greene et al.,
2002), however little is known regarding upstream events necessary for Caspases
activation during iron chelation. The kinetics observed in HeLa cells shows that
Caspases 3, 8 and 9 are activated late and simultaneously in response to DFO
(Greene et al., 2002). In a different study Jurkat T-lymphocytes show several
apoptotic markers upon DFO treatment including proteolytic cleavage of poly-ADP-
ribose polymerase (PARP), DNA damage and Caspase 3 activation (Pan et al.,
2004). Caspase activation has also been reported in macrophage-like J774 murine
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
95
cells (Persson et al., 2003), in human promyeloid leukemic HL-60 cells (Choi et al.,
2003) and in HeLa cells treated with DFO (Greene et al., 2002).
Our study suggests that PKC-8 is necessary for Caspase 3 cleavage, a landmark of
Caspase activation during apoptotic processes. In this case both si-PKC-5-Pa-4 and
PKC-8-KD-EGFP-Pa-4 cells showed a similar phenotype corresponding to very little
or not detectable production of cleaved Caspase 3 in response to DFO. This supports
the hypothesis that PKC-8 promotes Caspase 3 cleavage during DFO-induced cell
death in a process that requires is kinase activity. PKC-8 has been implicated in a
positive loop with Caspase 3 activation probably via phosphorylation (Brodie, 2003)
in other models, which allows us to speculate that PKC-8 might be upstream Caspase
3 activation during DFO-induced cell death. Furthermore the time course analysis
shows that PKC-8 catalytic fragment accumulation starts earlier (24h treatment) than
Caspase 3 proteolytic cleavage (32h treatment). This not only supports the
hypothesis that PKC-8 activation lays upstream Caspase 3 signaling during DFO-
induced response but also opens the possibility that PKC-8 can be proteolyticaly
activated by a different protease. In other apoptotic scenarios Caspase 3 is activated
via proteolytic cleavage mediated by initiator Caspases such as Caspase 8, 9 or 10.
The cleavage of procaspase 3 is followed by autocatalytic removal of the prodomain
giving as a result a fully active Caspase 3 (Shi, 2002), (Pelletier et al., 2004). These
series of activation steps are likely to be part of the initial events previous to what we
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
96
detected as Caspase 3 cleavage in response to DFO treatment. It is still matter of
further research to identify which initiator Caspases are necessary for DFO-induced
cell death.
In HeLa cells the use of a Caspase 3 inhibitor failed to completely block apoptotic
morphology suggesting the existence of an additional Caspase-3 mechanism for
DFO-induced cell death (Greene et al., 2002). This possibility is also supported by
the present study in which PKC-8 was shown to be necessary for Caspase-3 cleavage
but cells expressing a kinase-dead mutant of this protein still endure DFO-induced
cell death despite the lack of Caspase-3 cleavage. These results suggest that Caspase
3 cleavage is not necessary to obtain a final outcome of cell death and therefore
DFO-induced cell death might use at least two mechanisms, one that is Caspase 3
dependent and other that is Caspase 3 independent.
PKC-8 has been implicated in oxidative stress induced apoptosis via proteolytic
activation (Kanthasamy et al., 2003), (Kaul et al., 2005). Caspase 3 is the protease
involved in PKC-8 proteolytic activation in response to H2O2 in dopaminergic
neuronal cells in a process that requires phosphorylation of PKC-8 at Tyr-311. It is
possible then that PKC-8 and Caspase 3 are involved in a possitive feedback in
which initial activation of PKC-8 activates Caspase 3 and then it can furhter activate
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
97
PKC-5 via proteolytic cleavage. This possitive activation loop would yield a point of
no return for the cell eventually causing its demise.
PKC-5 cell cycle arrest and Cyclin D1 protein levels
DFO can induce cell cycle arrest in different phases depending on the cell type. DFO
induces cell cycle arrest in HeLa cells in G2/M phases and an antiproliferative effect
in an endocytic pathway dependent manner (Doulias et al., 2003). On the other hand
cell cycle arrest in G l/S phase is also reportedly induced by DFO in F9 embryonal
carcinoma cells (Tanaka et al., 1999). Furthermore in a cell line from hepatocellular
carcinoma (Chang cells) DFO induced cell cycle arrest in G1 phase in a phenomenon
associated with induction of TGF-P-1 and p27Kipl. However the use of specific
antibodies against these two factors failed to prevent G1 arrest, suggesting the
existence of additional mechanisms involved in this irreversible arrest. In this cell
line subtoxic concentrations of DFO can induce G1 cell cycle arrest irreversibly via
disruption of the complex II from the respiratory chain (Yoon et al., 2004). A
reduction in iron-sulfur protein (Ip) a component of the complex II is observed as
early as 6h after DFO treatment preceding total ATP levels reduction, suggesting that
mitochondria activity disruption is an early event upon DFO treatment.
In a different study DFO induced upregulation of only one gene out of an 192 gene
array involved in cell cycle progression and p53 tumor suppressor pathway (Le and
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
98
Richardson, 2004). This gene termed N-myc downstream regulated gene 1 (Ndrgl)
was transcriptionally up-regulated in different cell types in a p53-independent
manner but using both HIF-la-dependent and -independent mechanisms. The
kinetics of this process showed that Ndrgl mRNA levels up-regulation (3h after
DFO treatment) preceded that of Transferrin receptor-1 (TfRl) (6h after DFO
treatment) making it an early event during iron chelation-induced response. Even
though Ndrgl has been described as a metastasis suppressor gene its function
remains to be elucidated. Gene silencing or knockout experimental approaches with
this gene are still necessary to both confirm its importance and to elucidate its
function in the process of cell cycle arrest induced by iron deprivation. On the other
hand N-myc gene expression was down regulated in neuroblastoma cells upon DFO
treatment, (Fan et al., 2001) which suggest that Ndrgl expression can also be N-myc
independent in different cell types or that N-myc can activate Ndrgl early after iron
chelation followed by its degradation.
Yet another level of cell cycle regulation induced by DFO includes the down
regulation of the universal cdk-inhibitor p2 i C IP 1 /W A F 1 . Surprisingly iron chelation
inhibits p21 protein expression and its nuclear accumulation in cells under DNA-
damage insult, despite the fact that also stabilizes p21 mRNA levels (Le and
Richardson, 2003). This shows a complex series of events probably antagonizing
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
99
during the transition phase in which iron deprivation initially arrest the cells in G l/S
phase and the point in which the cell is committed to undergo cell death.
Le and Richardson in 2003 proposed that p21 down regulation could prevent Cyclin
D nuclear translocation during DFO induced response that is required for pRb
phosphorylation and cell cycle progression which could contribute to G l/S arrest.
According with our work Cyclin D1 protein levels are down regulated in response to
DFO but even at lower levels when it still can be detected it localizes inside the
nucleus. Therefore in this case it would be the absence of enough levels of Cyclin D1
rather than its subcellular localization, what would prevent retinoblastoma
susceptibility gene product (pRb) phosphorylation and cell cycle progression.
Cyclins D l-3, A and B1 all were down regulated by DFO treatment in human SK-N-
MC neuroepithelioma cells (Gao and Richardson, 2001) which also correlated with a
reduction in levels of cdk2 and hyperphosphorylated pRb. According with our work
PKC-8 seems to be necessary for a constitutive downregulation of Cyclins A and D l,
in a process that is enhanced during DFO-induced cell death. Cyclin A is cyclically
down regulated with an apparent periodicity of approximately 48h during DFO-
induced response. On the other hand Cyclin D l is clearly down regulated since 16
hours of DFO treatment. This process is accelerated in cells expressing PKC-8-WT-
EGFP and delayed in both si-PKC-8-Pa-4 and PKC-8-KD-EGFP-Pa-4 cells which
suggest that PKC-8 kinase activity is required for DFO induced Cyclin D l protein
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
100
levels down regulation. Further support for an important role of PKC-5 in regulation
of cell cycle progression comes from cell cycle analyses that show that Parental Pa-4
cells endure S/Gl cell cycle arrest (Data not shown). Si-PKC-8-Pa-4 cells escape
from this cell cycle arrest, whereas both PKC-S-EGFP-Pa-4 cell variants endure the
same arrest as parental cells. Taking together this evidence suggests that PKC-8 is
suffcient and necessary to deregulate cell cycle progression during DFO-induced
response through its antagonistic effect on Cyclin D l and in a lesser extent in Cyclin
A.
PKC-8 has been involved in a negative effect of factors important for cell cycle
progression such as cyclin D l and cyclin E in association with up regulation of
p27K ipl in vascular smooth muscle and endothelial cells (Fukumoto et al., 1997),
(Ashton et al., 1999). PKC-8 overexpression induced cell cycle arrest in G1 phase
probably through cyclins D l and E transcriptional down regulation, inhibiting in this
way the formation of active cyclin D/cdk4 and cyclin E/cdk2 which are necessary for
pRb phosphorylation and therefore cell cycle progression. Even though we did not
measure pRb phosphorylation during DFO-induced response, cyclin D l down
regulation mediated by PKC-8 appears as a feasable scenario for cell cycle arrest.
More importantly our results clearly suggest that PKC-8 exerts a constitutive
negative effect on cyclin D l protein levels and PKC-5 plays an important role by
enhancing this effect during DFO-induced response.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
101
At least part of the antagonistic effect that PKC-8 has on cyclin D l may be at the
transcriptional level as is the case in airway smooth muscle (Page et al., 2002). In
these cells PKC-5 negatively regulates platelet-derived growth factor (PDGF)-
induced cyclin D l expression. This negative regulatory effect might be via
attenuation of cyclin D l promoter activity in three promoter elements. As mentioned
above the kinase-dead variant of PKC-8-EGFP was sufficient to inhibit cyclin D l
down regulation despite its inhability to be translocated into the nucleus which
would argue against a direct transcriptional effect mediated by PKC-5. It is possible
though that the negative effect of PKC-8 on cyclin D l caused by DFO is
transcriptional but via a transcription factor that is direct or indirect target for PKC-5
mediated phosphorylation.
Cyclin D and cyclin A reduction induced by DFO treatment has been previously
described in breast cancer (Kulp et al., 1996), (Buss et al., 2003), in neuroblastoma
(Gao and Richardson, 2001) and in endothelial cells (Simonart et al., 2000).
However the mechanism by which DFO can exert this effect is not fully understood.
The present work provides evidence for the first time that PKC-8 is important for
cyclin D l and cyclin A downregulation induced during DFO treatment.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
102
In conclusion PKC-5 can and is necessary to modulate at least three independent
processes during DFO-induced response, i.e., sustained ATM activation, Caspase 3
cleavage and Cyclins Dl and A down regulation. Every one of these effects seems to
take place inside the nucleus linking PKC-8 function with its subcellular
redistribution during DFO-induced response.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
103
PKC-8 and p38, JNK and Akt/PKB
DFO induced upregulation of p38 associated with IL-8 secretion by human intestinal
epithelial cells (IECs) (Choi et al., 2004). The authors of this work report an absence
of cell death induced by DFO measured by MTT assay 24 hours after treatment.
Flowever the present work shows that the real extent of DFO-induced cell death can
be detected only two or three days after removal of the treatment. IL-8 secretion
increases with time reaching a maximum after 8-16 hours treatment. DFO induced an
inflammatory response including IL-8 secretion, activation of p38 and ERK 1/2
signaling pathways. Furthermore a number of genes related with inflammatory
response were up-regulated as suggested by a microarray analysis indicating that a
sustained inflammatory response can eventually induce cell death. Interestingly our
work provides evidence that PKC-5 can modulate p38 activation during DFO-
induced response. This role however seems to be redundant since it can take place
also in cells with PKC-5 silenced gene. This also suggests that p38 and JNK
activation although part of the response to DFO probably is a signaling component
not necessary for DFO-induced cell death. This result contrasts with a previous work
in human promyeloid leukemic HL-60 cells treated with DFO that indicated an
important role of p38 but not ERK or JNK in DFO-induced cell death as indicated by
a p38 inhibitor (Choi et al., 2003). This apparent discrepancy might be related with a
possible delay in the induction in cell death rather than a complete inhibition since
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
104
the authors in that work evaluated cell death only 24h after DFO treatment.
Alternatively p38 role in DFO-induced cell death might be cell type specific.
PKC-8 overexpression has been reported to up regulate JNK and p38 MAPK and to
induce apoptosis in cardiomyocytes (Heidkamp, 2001). Like in the case of DFO this
activation is also late in the apoptotic process which might imply that the role of JNK
and p38 is rather a consequence than the cause of the signaling leading to cell death.
PKC-8 was involved in KbCVinduced apoptosis in keratinocytes by activating p388
and inhibiting extracellular regulated kinase 1/2 (ERK1/2) (Efimova et al., 2004).
PKC-8 can also play a redundant but important role in modulating opposite signaling
pathways during DFO-induced cell death. Interestingly PKC-8 seems to be able to
modulate possitively pro-apoptotic pathways such as p38 and JNK and negatively a
pro-survival pathway such as Akt/PKB. The antagonistic effect between p38 and
Akt/PKB pathways has been previously documented (Tanaka et al., 2003). Phorbol
esters induce apoptosis in androgen-dependent LNCaP prostate cancer cells by a
mechanism that requires both PKC-a and PKC-8. In these cells PKC-a is responsible
of p38 MAPK up regulation and reduction in Akt phosphorylation during PMA
induced cell death (Tanaka et al., 2003). This model shows that Akt phosphorylation
down regulation can effectively reduce cell survival during apoptosis and that
members of the PKC family can modulate this effect. It seems possible to speculate
that Akt/PKB down regulation by PKC-8 is obtained through up regulation of p38
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
105
pathway. In addition the time course of the activation of p38 inverselly mimics the
down regulation of both Akt protein levels and phosphorylation. Furthermore by the
time Akt down regulation starts to become more evident (32h DFO treatment), this
protein has been translocated into the nucleus where active PKC-8 is already present.
The results in this study suggest that PKC-8 mediated down regulation of Akt and
Akt-1 protein levels in response to DFO treatment might be at the transcriptional
level since the proteasome inhibitor MG 132 failed to prevent it and exogenous Akt
failed to be down regulated. This putative transcriptional effect mediated by PKC-8
is still matter of further research.
In a slightly different scenario, novel PKC proteins were identified as the responsible
for Akt phosphorylation down regulation in response to recombinant Pasteuralla
multocida toxin (rPMT), a Gq coupled G-protein coupled receptor (GPCR) agonist,
that in low concentrations induces cardiomyocytes hypertrophy but in larger
exposures causes apoptosis. Interestingly this effect was also associated with a slight
stimulation of JNK and p38 signaling pathways (Sabri et al., 2002). Akt
phosphorylation down regulation would render cardiomyocytes more vulnerable to
stress induced apoptosis contributing to the transition from cardiac hypertrophy to
cardiac failure. In this sense Akt protein levels and phosphorylation down regulation
mediated by PKC-8 could render Pa-4 cells more suceptible to the cytotoxic effect
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
106
induced by DFO providing yet another mechanism by which PKC-8 can mediate
DFO-induced cell death.
PKC-5 effectors
PKC-5 has a number of downstream effectors that could potentially be part of the
signaling pathway activated in response to DFO and therefore they are worth to
mention as candidates for further study in a comprehensive characterization of DFO-
induced cell death.
Some of the downstream components of the signaling pathways mediated by PKC-8
have been identified. For example serum response factor (SRF) is phosphorylated by
PKC-8 in senescent human fibroblast causing reduced DNA binding and therefore
contributing to the senescent phenotype (Wheaton and Riabowol, 2004). Signal
transducer and activator of transcription (STAT)1 is a downstream target of PKC-5
during etoposide induced cell death enhancing STAT1 nuclear localization and
probably STAT1-regulated gene expression (DeVries, 2004). PKC-8 down
regulation associates with a reduction in basal transcription of p53 tumor supressor
gene suggesting that PKC-5 enhances p53 synthesis as part of its pro-apoptotic role
(Abbas, 2004). In this regard, DFO increases protein levels of p53 transcription
factor and subsequently p21 gene product inhibits cyclin-dependent kinases
preventing cell cycle progression. Both p53 and p21 are translocated into the nucleus
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
107
in response to DFO, even though in some cases p21 protein levels are down
regulated by this iron chelator (Le and Richardson, 2003).
A model for PKC-5 role in DFO-induced cell death
The role of PKC-8 in DFO-induced cell death seems to involve several
complementary mechanisms (Figure 24). From a chronological perspective, early
after DFO treatment (8-16h) ATM phosphorylation and its substrate FI2AX
phosphorylation indicates DNA damage probably caused by DFO-mediated ROS
production which is sustained throughout the entire process of DFO-induced cell
death. Cyclin D l and cyclin A protein levels is down regulated (starting at 16h and
24h treatment, respectively) in a process that is enhanced by activated PKC-5 which
is translocated into the nucleus (24h). PKC-8 mediates activation of Caspase 3 which
in turn can cleave PKC-8 releasing its catalytic fragment. Active PKC-5 and its
catalytic fragment can then phosphorylate multiple nuclear targets and can mantain
ATM activation after its initial response to DNA-damage. One potential target is
DNA-PKcs which after PKC-8 mediated phosphorylation becomes functionally
inhibited impairing the DNA-damage repair capacity of the cell and therefore
increasing the possibility of accumulation of DNA DSBs. In this way PKC-8 would
contribute to a sustained DNA-damage response activation reflected in ATM and
H2AX phosphorylation. PKC-5 can also contribute to p38 and JNK transient
activation which takes place between 24 and 40h with a peak at 32h. Akt and Akt-1
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
108
protein levels are steadily reduced since 16 hours after DFO treatment and PKC-8
can modulate positively this process by a mechanism that does not involve protein
degradation via proteasome. Akt activity is also down regulated starting 24 hours
after treatment probably via p38 and JNK activation in a process that PKC-8 can
modulate positively. In this way cells receive increased pro-apoptotic signals and
reduced pro-survival signals probably committing them to programmed cell death in
a complex process mediated in large part by PKC-8. Even though PKC-8 is
necessary for a complete response to DFO, most of the signaling events can still take
place at least partially in absence o f this protein which indicates that there are other
factors involved in processes such as cyclin D l down regulation, p38 and JNK
activation and Akt down regulation.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
109
DFO
Cytoplasm
)
Nucleus
PKC-8
activation
CUD
DNA damage Caspase 3
response
pATM
PKC-5- PKC-5
" CF
Cyclins
D l, A
Akt p38
pH2AX
( ) ( ) ( ) ( ) ( )
Global
Effect
Cell Death
Figure 24. Model o f PKC-5 role in DFO-induced cell death. DFO treatment induces DNA-damage signaling
pathway activation as early as 8-16h reflected by phosphorylation o f ATM and its downstream substrate H2AX.
At the same time Cyclin D l protein levels are down regulated in a process enhanced by PKC-5. After 24h of
DFO treatment PKC-5 is translocated into the nucleus where it can phosphorylate multiple targets and mediate
Caspase 3 activation. Active Caspase 3 then can mediate PKC-8 proteolytic activation further enhancing PKC-5
kinase activity. Increased PKC-5 activation is necessary and coincides with a sustained ATM phosphorylation.
Then PKC-5 can enhance p38 and JNK transient activation in parallel with Akt/PKB protein levels and
phosphorylation down regulation. Some signaling events can also take place at least partially in absence of PKC-
5 via other signaling components denoted in the model as (?). The global signaling balance in the cell after a
prolonged exposure to DFO favors pro-apoptotic over pro-survival signals eventually committing it to its demise.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
110
FUTURE PERSPECTIVES
This work provides experimental evidence that PKC-8 is important for DFO-induced
cell death and that this protein is necessary for certain events that are normally
induced in response to this drug including ATM sustained activation, Cyclins D l and
A protein levels down regulation and Caspase 3 activation. The next question to
solve in order to systematically elucidate the entire mechanism(s) by which DFO can
induce cell death is whether these signaling components (ATM, Cyclin D l, Cyclin A
and Caspase 3) are necessary for DFO-induced cell death. A gene knockout or
silencing approach would be again ideal for answering these questions although an
inducible system might be necessary in the case of Cyclin D l or Cyclin A. The
putative role of PKC-8 in keeping a sustained DNA-damage response via ATM
phosphorylation opens several questions regarding the mechanism that accounts for
this effect. PKC-8 nuclear localization upon DFO treatment opens the possibility of
protein-protein interactions with a number of proteins including obviously ATM. A
very interesting potential kinase-substrate relationship can not be discarded between
PKC-8 and ATM.
Yet another open question is what is the mechanism(s) that PKC-8 deploys to down
regulate Cyclin D l and Cyclin A protein levels and whether this process is restricted
to DFO-induced cell death or applies to other physiological scenarios.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
I l l
PKC-8 showed a redundant but important opposite effect on p38, JNK and Akt/PKB
signaling pathways in the context of DFO-induced cell death. It is intriguing whether
this mechanism mediated by PKC-8 is exclusive for DFO-induced response or can be
applied to other contexts in which p38, Akt antagonism has been reported.
PKC-8-KD-EGFP shows a very particular membrane association pattern in which
several vesicle-like structures distribute throughout the cytoplasm. Upon DFO
treatment that vesicle-like signal eventually gave rise to a plasma membrane labeling
whereas in untreated cells the pattern remained relatively unchanged (Figure 8A).
The wild type version of PKC-8-EGFP showed a very restricted vesicle-like signal
accompanied by plasma membrane and finally nuclear labeling, upon DFO
treatment. These differential patterns suggest that PKC-8 is initially targetted to a
vesicle-like compartment followed by its plasma membrane translocation and finally
nuclear localization. Furthermore the movilization towards the plasma membrane
does not require PKC-8 kinase activity unlike its translocation to the nucleus. It
would be interesting to identify the PKC-anchoring proteins that mediate these
differential subcellular distributions, probably through a proteomic approach.
PKC-8 has multiple tyrosine phosphorylation sites which are involved in a variety of
effects on its kinase activity as well as its putative function (Steinberg, 2004). It
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
112
would be worth to explore the role of either Ser/Thr or Tyr phosphorylation during
DFO-induced cell death.
Finally a number of iron chelators with higher effectivity than DFO as anti
neoplastic agents are being designed and tested (Lovejoy and Richardson, 2003).
Whether some of the general effects of iron chelation are meditated by PKC-8 still
remains to be explored through a similar approach than the followed here, but using
some of the most promissing iron chelators for cancer treatment.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
113
BIBLIOGRAPHY
Abbas, T., White, D., Hui, L., Yoshida, K., Foster, D.A. and Bargonetti, J. 2004.
Inhibition of Human p53 Basal Transcription by Down-regulation of Protein
Kinase C-delta. The Journal o f Biological Chemistry. 279:9970-9977.
Ashton, A.W., G. Watanabe, C. Albanese, E.O. Harrington, J.A. Ware, and R.G.
Pestell. 1999. Protein Kinase Cdelta Inhibition of S-Phase Transition in
Capillary Endothelial Cells Involves the Cyclin-dependent Kinase Inhibitor
p27K ipl.J. Biol. Chem. 274:20805-20811.
Basu, A. 2003. Involvement of protein kinase C-delta in DNA damage-induced
apoptosis. J. Cell Mol Med. 7:341-50.
Bharti, A., S.-K. Kraeft, M. Gounder, P. Pandey, S. Jin, Z.-M. Yuan, S.P. Lees-
Miller, R. Weichselbaum, D. Weaver, L.B. Chen, D. Kufe, and S. Kharbanda.
1998. Inactivation of DNA-Dependent Protein Kinase by Protein Kinase
Cdelta : Implications for Apoptosis. Mol. Cell. Biol. 18:6719-6728.
Blass, M., I. Kronfeld, G. Kazimirsky, P.M. Blumberg, and C. Brodie. 2002.
Tyrosine phosphorylation of protein kinase Cdelta is essential for its
apoptotic effect in response to etoposide. Molecular and Cellular Biology.
22:182-95.
Boyce M, D.A., Yuan J. 2004. Caspases: an ancient cellular sword of Damocles. Cell
Death Differ. 11:29-37.
Brodie, C., Blumberg, P.M. 2003. Regulation of cell apoptosis by protein kinase c
delta. Apoptosis. 8:19-27.
Brodie, C., G. Siriwardana, J. Lucas, R. Schleicher, N. Terada, A. Szepesi, E.
Gelfand, and P. Seligman. 1993. Neuroblastoma sensitivity to growth
inhibition by deferrioxamine: evidence for a block in G1 phase of the cell
cycle. Cancer Res. 53:3968-3975.
Buss, J.L., F.M. Torti, and S.V. Torti. 2003. The Role of Iron Chelation in Cancer
Therapy. Current Medicinal Chemistry. 10:1021.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
114
Chau, C.H., C.A. Clavijo, H.-T. Deng, Q. Zhang, K.-J. Kim, Y. Qiu, A.D. Le, and
D.K. Ann. 2005. Etk/Bmx mediates expression of stress-induced adaptive
genes VEGF, PAI-1, and iNOS via multiple signaling cascades in different
cell systems. Am J Physiol Cell Physiol. 289:C444-454.
Chen, R., O. Kim, J. Yang, K. Sato, K.M. Eisenmann, J. McCarthy, H. Chen, and Y.
Qiu. 2001. Regulation of Akt/PKB Activation by Tyrosine Phosphorylation.
J. Biol. Chem. 276:31858-31862.
Choi, E.-Y., E.-C. Kim, H.-M. Oh, S. Kim, H.-J. Lee, E.-Y. Cho, K.-H. Yoon, E.-A.
Kim, W.-C. Han, S.-C. Choi, J.-Y. Hwang, C. Park, B.-S. Oh, Y. Kim, K.-C.
Kimm, K.-I. Park, H.-T. Chung, and C.-D. Jun. 2004. Iron Chelator Triggers
Inflammatory Signals in Human Intestinal Epithelial Cells: Involvement of
p38 and Extracellular Signal-Regulated Kinase Signaling Pathways. J
Immunol. 172:7069-7077.
Choi, S.-C., B.-S. Kim, M.-Y. Song, E.-Y. Choi, H.-M. Oh, J.-H. Lyou, W.-C. Han,
H.-B. Moon, T.-H. Kim, and J.-M. Oh. 2003. Downregulation of p38 kinase
pathway by cAMP response element-binding protein protects HL-60 cells
from iron chelator-induced apoptosis. Free Radical Biology and Medicine.
35:1171-1184.
Dayani, P.N., M.C. Bishop, K. Black, and P.M. Zeltzer. 2004. Desferoxamine (DFO)
- Mediated Iron Chelation: Rationale for a Novel Approach to Therapy for
Brain Cancer. Journal o f Neuro-Oncology. 67:367-377.
Dempsey, E.C., A.C. Newton, D. Mochly-Rosen, A.P. Fields, M.E. Reyland, P.A.
Insel, and R.O. Messing. 2000. Protein kinase C isozymes and the regulation
of diverse cell responses. Am J Physiol Lung Cell Mol Physiol. 279:L429-
438.
Dendorfer, A., M. Heidbreder, T. Hellwig-Burgel, O. Johren, F. Qadri, and P.
Dominiak. 2005. Deferoxamine induces prolonged cardiac preconditioning
via accumulation of oxygen radicals. Free Radical Biology and Medicine.
38:117-124.
Denning, M.F., Y. Wang, B.J. Nickoloff, and T. Wrone-Smith. 1998. Protein Kinase
Cdelta Is Activated by Caspase-dependent Proteolysis during Ultraviolet
Radiation-induced Apoptosis of Human Keratinocytes. J. Biol. Chem.
273:29995-30002.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
115
DeVries, T.A., Kalkofen, R.L., Matassa, A.A. and M.E. Reyland. 2004. PKC-delta
Regulates Apoptosis Via Activation Of STAT1. The Journal o f Biological
Chemistry. 279:45603-45612.
DeVries, T.A., M.C. Neville, and M.E. Reyland. 2002. Nuclear import of PKC-delta
is required for apoptosis: identification of a novel nuclear import sequence.
EMBOJ. 21:6050-6060.
Doulias, P.-T., S. Christoforidis, U.T. Brunk, and D. Galaris. 2003. Endosomal and
lysosomal effects of desferrioxamine: protection of HeLa cells from
hydrogen peroxide-induced DNA damage and induction of cell-cycle arrest.
Free Radical Biology and Medicine. 35:719-728.
Efimova, T., A. Broome, and R. Eckert. 2004. Protein Kinase C-delta Regulates
Keratinocyte Death and Survival by Regulating Activity and Subcellular
Localization of a p38-delta-Extracellular Signal-Regulated Kinase 1/2
Complex. Molecular and Cellular Biology. 24:8167-8183.
Fan, L., J. Iyer, S. Zhu, K.K. Frick, R.K. Wada, A.E. Eskenazi, P.E. Berg, N.
Ikegaki, R.H. Kennett, and C.N. Frantz. 2001. Inhibition of N-myc
Expression and Induction of Apoptosis by Iron Chelation in Human
Neuroblastoma Cells. Cancer Res. 61:1073-1079.
Femandez-Capetillo, O., A. Lee, M. Nussenzweig, and A. Nussenzweig. 2004.
H2AX: the histone guardian of the genome. DNA Repair. 3:959-967.
Fukumoto, S., Y. Nishizawa, M. Hosoi, H. Koyama, K. Yamakawa, S. Ohno, and H.
Morii. 1997. Protein Kinase C delta Inhibits the Proliferation of Vascular
Smooth Muscle Cells by Suppressing G1 Cyclin Expression. J. Biol. Chem.
272:13816-13822.
Gao, J., and D.R. Richardson. 2001. The potential of iron chelators of the pyridoxal
isonicotinoyl hydrazone class as effective antiproliferative agents, IV: the
mechanisms involved in inhibiting cell-cycle progression. Blood. 98:842-850.
Greene, B.T., J. Thorbum, M.C. Willingham, A. Thorbum, R.P. Planalp, M.W.
Brechbiel, J. Jennings-Gee, J. Wilkinson, IV, F.M. Torti, and S.V. Torti.
2002. Activation of Caspase Pathways during Iron Chelator-mediated
A poptosis./. Biol. Chem. 277:25568-25575.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
116
Gutcher, I., P.R. Webb, and N.G. Anderson. 2003. The isoform-specific regulation of
apoptosis by protein kinase C. Cellular and Molecular Life Sciences (CMLS).
60:1061-1070.
Heidkamp, M.C., Bayer, A. L., Martin, J. L. and Samarel, A. M. 2001. Differential
activation of mitogen-activated protein kinase cascades and apoptosis by
protein kinase C epsiolon and delta in neonatal rat ventricular myocytes.
Circulation Research. 89:882-890.
Hershko, C., M.D. Cappellini, R. Galanello, A. Piga, G. Tognoni, and G. Masera.
2004. Purging iron from the heart. British Journal o f Haematology. 125:545-
551.
Hileti, D., P. Panayiotidis, and A.V. Hoffbrand. 1995. Iron chelators induce
apoptosis in proliferating cells. British Journal o f Haematology. 89:181-187.
Ido, Y., N. Muto, A. Inada, J. Kohroki, M. Mano, T. Odani, N. Itoh, K. Yamamoto,
and K. Tanaka. 1999. Induction of apoptosis by hinokitiol, a potent iron
chelator, in teratocarcinoma F9 cells is mediated through the activation of
caspase-3. Cell Proliferation. 32:63-73.
Ijichi, A., Sakuma, S. and Tofilon, P.J. 1995. Hypoxia-induced vascular endothelial
growth factor expression in normal rat astrocyte cultures. Glia. 14:87-93.
Jiang, T., and Y. Qiu. 2003. Interaction between Src and a C-terminal Proline-rich
M otif of Akt Is Required for Akt Activation. J. Biol. Chem. 278:15789-
15793.
Jiang, Y., Z.-H. Xue, W.-Z. Shen, K.-M. Du, H. Yan, Y. Yu, Z.-G. Peng, M.-G.
Song, J.-H. Tong, Z. Chen, Y. Huang, M. Lubbert, and G.-Q. Chen. 2005.
Desferrioxamine induces leukemic cell differentiation potentially by hypoxia-
inducible factor-1 [alpha] that augments transcriptional activity of
CCAATV/enhancer-binding protein-[alpha]. 19:1239-1247.
Kanda, H., and M. Miura. 2004. Regulatory Roles of JNK in Programmed Cell
Death. J Biochem (Tokyo). 136:1-6.
Kanthasamy, A., M. Kitazawa, A. Kanthasamy, and V. Anantharam. 2003. Role of
proteolytic activation of protein kinase Cdelta in oxidative stress-induced
apoptosis. AntioxidRedox Signal. 5:609-620.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
117
Kaplinsky, C., Z. Estrov, M. Freedman, E. Gelfand, and C. A. 1987. Effect of
deferoxamine on DNA synthesis, DNA repair, cell proliferation, and
differentiation of HL-60 cells. Leukemia. 1:437-41.
Kaul, S., V. Anantharam, Y. Yang, C.J. Choi, A. Kanthasamy, and A.G.
Kanthasamy. 2005. Tyrosine Phosphorylation Regulates the Proteolytic
Activation of Protein Kinase C {delta} in Dopaminergic Neuronal Cells. J.
Biol Chem. 280:28721-28730.
Kiley, S.C., K.J. Clark, S.K. Duddy, D.R. Welch, and S. Jaken. 1999. Increased
protein kinase Ca in mammary tumor cells: relationship to transformation and
metastatic progression. Oncogene. 18:6748-6757.
Kulp, K.S., S.L. Green, and P.R. Vulliet. 1996. Iron Deprivation Inhibits Cyclin-
Dependent Kinase Activity and Decreases Cyclin D/CDK4 Protein Levels in
Asynchronous MDA-MB-453 Human Breast Cancer Cells. Experimental
Cell Research. 229:60-68.
Kurz, T., A. Leake, T. Von Zglinicki, and B. UT. 2004. Relocalized redox-active
lysosomal iron is an important mediator of oxidative-stress-induced DNA
damage. Biochem J. 378:1039-45.
Le, N.T.V., and D.R. Richardson. 2003. Potent iron chelators increase the mRNA
levels of the universal cyclin-dependent kinase inhibitor p21CIPl/W AFl, but
paradoxically inhibit its translation: a potential mechanism of cell cycle
dysregulation. Carcinogenesis. 24:1045-1058.
Le, N.T.V., and D.R. Richardson. 2004. Iron chelators with high antiproliferative
activity up-regulate the expression of a growth inhibitory and metastasis
suppressor gene: a link between iron metabolism and proliferation. Blood.
104:2967-2975.
Lee, Y.S., and R.D. Wurster. 1995. Deferoxamine-induced cytotoxicity in human
neuronal cell lines: protection by free radical scavengers. Toxicology Letters.
78:67-71.
Li, B., X. Wang, N. Rasheed, Y. Hu, S. Boast, T. Ishii, K. Nakayama, K.I.
Nakayama, and S.P. Goff. 2004. Distinct roles o f c-Abl and Atm in oxidative
stress response are mediated by protein kinase C {delta}. Genes Dev.
18:1824-1837.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
118
Liu, J., and A. Lin. 2005. Role of JNK activation in apoptosis: a double-edged
sword. Cell Research. 15:36-42.
Lloyd, J.B., H. Cable, and C. Rice-Evans. 1991. Evidence that desferrioxamine
cannot enter cells by passive diffusion. Biochemical Pharmacology. 41:1361-
1363.
Lovejoy, D.B., and D.R. Richardson. 2003. Iron Chelators as Anti-Neoplastic
Agents: Current Developments and Promise of the PIH Class of Chelators.
Current Medicinal Chemistry. 10:1035-49.
Lu, Z., A. Homia, Y. Jiang, O. Zang, S. Ohno, and F. DA. 1997. Tumor promotion
by depleting cells of protein kinase C-delta. Mol. Cell Biol. 17:3418-3428.
Lukas, C., J. Falck, J. Bartkova, J. Bartek, and J. Lukas. 2003. Distinct
spatiotemporal dynamics of mammalian checkpoint regulators induced by
DNA damage. 5:255-260.
Matassa, A.A., L. Carpenter, T.J. Biden, M.J. Humphries, and M.E. Reyland. 2001.
PKCdelta Is Required for Mitochondrial-dependent Apoptosis in Salivary
Epithelial Cells. J. Biol. Chem. 276:29719-29728.
Miyamoto, A., K. Nakayama, H. Imaki, and e. al. 2002. Increased proliferation of B
cells and auto-immunity in mice lacking protein kinase C-delta. Nature. 416.
Ollinger, K., and U.T. Brunk. 1995. Cellular injury induced by oxidative stress is
mediated through lysosomal damage. Free Radical Biology and Medicine.
19:565-574.
Page, K., J. Li, K.C. Corbit, K.M. Rumilla, J.-W. Soh, I.B. Weinstein, C. Albanese,
R.G. Pestell, M.R. Rosner, and M.B. Hershenson. 2002. Regulation of
Airway Smooth Muscle Cyclin D1 Transcription by Protein Kinase C-
{delta}. Am. J. Respir. Cell Mol. Biol. 27:204-213.
Pan, Y.-J., R.G. Hopkins, and G. Loo. 2004. Increased GADDI53 gene expression
during iron chelation-induced apoptosis in Jurkat T-lymphocytes. Biochimica
et Biophysica Acta (BBA) - Molecular Cell Research. 1691:41-50.
Pelletier, M., P.-F. Cartron, F. Delaval, K. Meflah, F.M. Vallette, and L. Oliver.
2004. Caspase 3 activation is controlled by a sequence located in the N-
terminus of its large subunit. Biochemical and Biophysical Research
Communications. 316:93-99.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
119
Persson, H.L., Z. Yu, 0 . Tirosh, J.W. Eaton, and U.T. Brunk. 2003. Prevention of
oxidant-induced cell death by lysosomotropic iron chelators. Free Radical
Biology and Medicine. 34:1295-1305.
Philchenkov, A. 2004. Caspases: potential targets for regulating cell death. J Cell
Mol Med. 8:432-444.
Porter, J.B., and B.A. Davis. 2002. Monitoring chelation therapy to achieve optimal
outcome in the treatment of thalassaemia. Best Practice & Research Clinical
Haematology. 15:329-368.
Reyland, M.E., S.M. Anderson, A.A. Matassa, K.A. Barzen, and D.O. Quissell.
1999. Protein kinase C delta is essential for etoposide-induced apoptosis in
salivary gland acinar cells. The Journal o f Biological Chemistry. 274:19115-
23.
Richardson, D.R. 2004. Novel Chelators for Central Nervous System Disorders That
Involve Alterations in the Metabolism of Iron and Other Metal Ions. Ann N Y
AcadSci. 1012:326-341.
Roux, P.P., and J. Blenis. 2004. ERK and p38 MAPK-Activated Protein Kinases: a
Family of Protein Kinases with Diverse Biological Functions. Microbiol.
Mol. Biol. Rev. 68:320-344.
Rubinson, D.A., C.P. Dillon, A.V. Kwiatkowski, C. Sievers, L. Yang, J. Kopinja, M.
Zhang, M.T. McManus, F.B. Gertler, M.L. Scott, and L. Van Parijs. 2003. A
lentivirus-based system to functionally silence genes in primary mammalian
cells, stem cells and transgenic mice by RNA interference. Nature Genetics.
33:401 -406.
Sabri, A., B.A. Wilson, and S.F. Steinberg. 2002. Dual Actions of the G{alpha}q
Agonist Pasteurella multocida Toxin to Promote Cardiomyocyte Hypertrophy
and Enhance Apoptosis Susceptibility. Circ Res. 90:850-857.
Shi, Y. 2002. Mechanisms of Caspase Activation and Inhibition during Apoptosis.
Molecular Cell. 9:459-470.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
120
Simonart, T., C. Degraef, G. Andrei, R. Mosselmans, P. Hermans, J.-P. Van Vooren,
J.-C. Noel, J.R. Boelaert, R. Snoeck, and M. Heenen. 2000. Iron Chelators
Inhibit the Growth and Induce the Apoptosis of Kaposi's Sarcoma Cells and
of their Putative Endothelial Precursors. Journal o f Investigative
Dermatology. 115:893-900.
Steinberg, S. 2004. Distinctive activation mechanisms and functions for protein
kinase Cdelta. Biochem Journal. 384:449-59.
Tam, T.F., R. Leung-Toung, R. Wanren Li, R. Yingsheng Wang, K. Karimian, and
K. Micheal Spino. 2003. Iron Chelator Research: Past, Present, and Future.
Current Medicinal Chemistry. 10:983.
Tanaka, T., N. Muto, Y. Ido, N. Itoh, and K. Tanaka. 1997. Induction of embryonal
carcinoma cell differentiation by deferoxamine, a potent therapeutic iron
chelator. Biochimica et Biophysica Acta (BBA) - Molecular Cell Research.
1357:91-97.
Tanaka, T., T. Satoh, Y. Onozawa, J. Kohroki, N. Itoh, J. Ishidate, Motoi, N. Muto,
and K. Tanaka. 1999. Apoptosis During Iron Chelator-Induced
Differentiation In F9 Embryonal Carcinoma Cells. Cell Biology
International. 23:541-550.
Tanaka, Y., M.V. Gavrielides, Y. Mitsuuchi, T. Fujii, and M.G. Kazanietz. 2003.
Protein Kinase C Promotes Apoptosis in LNCaP Prostate Cancer Cells
through Activation of p38 MAPK and Inhibition of the Akt Survival
Pathway. J. Biol. Chem. 278:33753-33762.
Tenopoulou, M., P. Doulias, A. Barbouti, U. Brunk, and G. D. 2005. Role of
compartmentalized redox-active iron in hydrogen peroxide-induced DNA
damage and apoptosis. Biochem J. 387:703-10.
Twomey, C., and J.V. McCarthy. 2005. Pathways of apoptosis and importance in
development. J Cell Mol Med. 9:345-359.
Wang, H., M. Wang, H. Wang, W. Bocker, and G. Iliakis. 2005. Complex H2AX
Phosphorylation Patterns by Multiple Kinases Including ATM and DNA-PK
in Human Cells Exposed to Ionizing Radiation and Treated With Kinase
Inhibitors. Journal o f Cellular Physiology. 202:492-502.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
121
Watanabe, T., Y. Ono, Y. Taniyama, and e. al. 1992. Cell division arrest induced by
phorbol ester in CHO cells overexpressing protein kinase C-delta subspecies
1992; 89:. Proc Natl Acad Sci USA. 89:10159-10163.
Wheaton, K., and K. Riabowol. 2004. Protein Kinase C-delta Blocks Immediate-
Early Gene Expression in Senescent Cells by Inactivating Serum Response
Factor. Molecular and Cellular Biology. 24:7298-7311.
Yoon, Y.-S., H. Cho, J.-H. Lee, and G. Yoon. 2004. Mitochondrial Dysfunction via
Disruption of Complex II Activity during Iron Chelation— Induced
Senescence-like Growth Arrest of Chang Cells. Ann N Y Acad Sci. 1011:123-
132.
Yoshida, K., H. Wang, Y. Miki, and D. Kufe. 2003. Protein kinase Cdelta is
responsible for constitutive and DNA damage-induced phosphorylation of
Rad9.EM BO J. 22:1431-1441.
Zarubin T, H.J. 2005. Activation and signaling of the p38 MAP kinase pathway. Cell
Research. 15:11-18.
Zaugg, M., E. Lucchinetti, M. Uecker, T. Pasch, and M. Schaub. 2003. Anaesthetics
and cardiac preconditioning. Part I. Signalling and cytoprotective
mechanisms. British Journal o f Anaesthesia,. 91:551-65.
Zhimin, L., D. Liu, A. Homia, W. Devonish, M. Pagano, and D. Foster. 1998.
Activation of protein kinase C triggers its ubiquitination and degradation.
Mol. Cell Biol. 18:839-845.
Zhou, L., and M.B. Hershenson. 2003. Mitogenic signaling pathways in airway
smooth muscle. Respiratory Physiology & Neurobiology. 137:295-308.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.

Linked assets

University of Southern California Dissertations and Theses

Conceptually similar

PDF

The role of tumor-associated and normal human brain endothelial cells in angiogenesis

PDF

The effect of cyclooxygenase inhibitors on cell cycle regulation and proliferation of glioblastoma and lymphoma cell lines

$Molecular and cellular characterization of nickel -induced C3H/10T½ Cl 8 cell transformation$

PDF

Molecular and cellular characterization of nickel -induced C3H/10T½ Cl 8 cell transformation

PDF

Studies on the regulation of p53 and investigation of functional significance of interactions between p53 and its binding proteins

PDF

The androgen receptor: Its role in the development and progression of cancers of the prostate and breast

PDF

The interactions of host cell proteins with mouse hepatitis virus RNA

PDF

Leukemia cell vaccine generation using lentiviral vectors

PDF

Wnt factors: Genes, functions and cooperative signaling in mammary cell transformation

PDF

Rational design of DNA epitope vaccines

PDF

Studies of hepatitis B virus and hepatitis C virus infection

PDF

The effects of progesterone on cell cycle and differentiation status of human ovarian cancer cells

PDF

The effect of interleukin-7 and C-Kit signaling throughout the ontogeny of naive CD4+ lymphocytes from hematopoietic stem cells to maturity

PDF

Maturation of dendritic cells induced with IFN-gamma, huCD40LT, and IM862

PDF

Regulation of the I kappa B kinase complex

PDF

Structure and functions of hepatitis C virus core protein

PDF

A new model for hepatitis delta virus transcription and replication

PDF

Mechanistic study of RAG -mediated initiation of V(D)J recombination

PDF

Immunogenicity of acute lymphoblastic leukemia: In vivo and in vitro studies of Bcr -Abl specific immune responses

PDF

Identification of oncogenes cooperating in murine mammary tumorigenesis and transgenic mouse models of breast cancer

PDF

RNA viruses and cell membrane: Hepatitis C virus and coronavirus

Asset Metadata

Creator Clavijo, Carlos Arturo (author)

Core Title Role of PKC-delta in deferoxamine-induced cell death in salivary epithelial Pa-4 cells

Contributor Digitized by ProQuest (provenance)

Degree Doctor of Philosophy

Degree Program Molecular Microbiology and Immunology

Publisher University of Southern California (original), University of Southern California. Libraries (digital)

Tag biology, cell,Health Sciences, Pharmacology,OAI-PMH Harvest

Language English

Permanent Link (DOI) https://doi.org/10.25549/usctheses-c16-605628

Unique identifier UC11336539

Identifier 3220098.pdf (filename),usctheses-c16-605628 (legacy record id)

Legacy Identifier 3220098.pdf

Dmrecord 605628

Document Type Dissertation

Rights Clavijo, Carlos Arturo

Type texts

Source University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Access Conditions The author retains rights to his/her dissertation, thesis or other graduate work according to U.S. copyright law. Electronic access is being provided by the USC Libraries in agreement with the au...

Repository Name University of Southern California Digital Library

Repository Location USC Digital Library, University of Southern California, University Park Campus, Los Angeles, California 90089, USA