University of Southern California Dissertations and Theses

Analysis of the HSD3B2 gene in prostate cancer

(USC Thesis Other)

Analysis of the HSD3B2 gene in prostate cancer

PDF

Download a page range

Download transcript

Copy asset link

Request this asset

Transcript (if available)

Content INFORMATION TO USERS This manuscript has been reproduced from the microfilm master. UMI films the text directly from the original or copy submitted. Thus, some thesis and dissertation copies are in typewriter face, while others may be from any type of computer printer. The quality of this reproduction is dependent upon the quality of the copy submitted. Broken or indistinct print, colored or poor quality illustrations and photographs, print bleedthrough, substandard margins, and improper alignment can adversely affect reproduction. In the unlikely event that the author did not send UMI a complete manuscript and there are missing pages, these will be noted. Also, if unauthorized copyright material had to be removed, a note will indicate the deletion. Oversize materials (e.g., maps, drawings, charts) are reproduced by sectioning the original, beginning at the upper left-hand comer and continuing from left to right in equal sections with small overlaps. Each original is also photographed in one exposure and is included in reduced form at the back of the book. Photographs included in the original manuscript have been reproduced xerographically in this copy. Higher quality 6” x 9” black and white photographic prints are available for any photographs or illustrations appearing in this copy for an additional charge. Contact UMI directly to order. UMI A Bell & Howell Information Company 300 North Zeeb Road, Ann Arbor MI 48106-1346 USA' 313/761-4700 800/521-0600 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. ANALYSIS OF THE HSD3B2 GENE IN PROSTATE CANCER by Jeffrey Jim A Thesis Presented to the FACULTY OF THE GRADUATE SCHOOL UNIVERSITY OF SOUTHERN CALIFORNIA In Partial Fulfillment of the Requirements for the Degree MASTER OF SCIENCE (BIOCHEMISTRY AND MOLECULAR BIOLOGY) May 1999 Copyright 1999 Jeffrey Jim Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. OMI Number: 1395121 UMI Microform 1395121 Copyright 1999, by UMI Company. All rights reserved. This microform edition is protected against unauthorized copying under Title 17, United States Code. UMI 300 North Zeeb Road Ann Arbor, MI 48103 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. UNIVERSITY OF SOUTHERN CALIFORNIA THE GRADUATE SCHOOL UNIVERSITY PARK LOS ANGELES. CALIFORNIA 9 0 0 0 7 This thesis, written by under the direction of — Thesis Com m ittee, and approved by a ll its members, has been pre sented to and accepted by the D ean of The Graduate School, in p a rtia l fu lfillm e n t of the requirements fo r the degree of JEFFREY JIM MASTER OF SCIENCE c tnT rtn tr A p ril 2 3 , 1999 D ta x THESIS COMMI'vTEE r Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. DEDICATION This work is dedicated to my family, for their unconditional love, support and encouragement through the years. I also like to dedicate this to Jennifer Mar, the one that makes everything worthwhile. Thank you for your love, patience, and support. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. ACKNOWLEDGEMENTS I would like to thank my mentor, Dr. Juergen Reichardt, for welcoming me into his lab and for his patience, encouragement and guidance. Also thanks to my committee members, Dr. Zoltan Tokes and Dr. Chih-Lin Hsieh, for their time and effort in helping me prepare this thesis. Everyone in the JR lab (Abebe, Janice, Jonathan, Sriveda, Nick, and Hahn), thanks for the support. I couldn’t have done this without you guys. Finally, to “the boys”, thanks for making the past two years interesting and enjoyable. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. TABLE OF CONTENTS Dedication ii Acknowledgements iii List of tables vi List of figures vii Abstract viii 1 Prostate cancer 1 1.1 Prostate cancer epidemiology 1 1.2 Hereditary prostate cancer 1 1.3 Sporadic prostate cancer 3 1.4 References 6 2 Androgens 10 2.1 Androgen action during fetal development 10 2.2 Androgen metabolic genes 11 2.3 Steroid 5a-reductase type II (SRD5A2) 11 2.4 Prostate disease therapy 12 2.5 References 15 3 3(3 hydroxysteroid dehydrogenase 17 3.1 HSD3B1 and HSD3B2 17 3.2 HSD3B2 protein 18 3.3 HSD3B2 deficiency 19 3.4 Supporting evidence for role of HSD3B2 20 in prostatic diseases 3.5 References 24 4 Specific aims 28 4.1 Introduction 28 4.2 Purpose 29 4.3 Study approach 30 4.4 References 31 iv Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Specific amplification of HSD3B2 32 5.1 Introduction 32 5.2 Materials and methods 32 5.2.1 PCR amplification of HSD3B2 32 5.2.2 Manual sequencing 33 5.3 Results 34 5.4 Conclusions 34 5.5 References 41 Mutational analysis of HSD3B2 42 6.1 Introduction 42 6.2 Materials and methods 42 6.2.1 Patient selection criteria 42 6.2.2 PCR amplification of HSD3B2 43 6.2.3 Automated sequencing 43 6.3 Results 44 6.4 Conclusions 45 6.5 References 57 Discussion 58 7.1 HSD3B2 mutational analysis 58 7.2 Missense mutations 58 7.3 Promoter/5’ UTR/3’ UTR analysis 62 7.4 Substitutions in the 5’ UTR 62 7.5 Silent mutations and intronic substitutions 63 7.6 Summary and conclusion 64 7.7 References 66 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. LIST OF TABLES Table Title Page 5.1 Primers used in the specific amplification of the 35 HSD3B2 gene. 6.1 Japanese individuals with low testosterone level. 47 6.2 Japanese individuals with high testosterone level. 48 6.3 African-American individuals with low testosterone 49 level. 6.4 African-American individuals with high testosterone 50 level. 6.5 Internal primers within exon 4 used during 51 automated sequencing. 6.6 Summary of identified sequence variants of the 52 HSD3B2 gene. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. LIST OF FIGURES Figure 1.1 2.1 3.1 5.1 5.2 5.3 5.4 5.5 6.1 6.2 7.1 Title Page The relationship between prostate, colon 5 and breast cancer incidence and age. Schematic representation of major mammalian 14 steroidogenic pathways. Schematic diagram of the HSD3B2 protein. 23 Schematic diagram illustrating primer location. 36 PCR products from exons 1 and 2, exon 3 and 37 exon 4 of the HSD3B2 gene are of the expected size. Proof of specific amplification of exons 1 and 38 2 of the HSD3B2 gene. Proof of specific amplification of exon 3 of the 39 HSD3B2 gene. Proof of specific amplification of exons 4 of the 40 HSD3B2 gene. Selected electropherograms from automated 53 sequencing of the HSD3B gene. Schematic representation of the location of the 56 sequence variants identified in the HSD3B2 gene. Schematic diagram illustrating primer location 65 (for analysis of promoter/5’ UTR/3’ UTR) of the HSD3B2 gene. vii Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. ABSTRACT Prostate cancer is a significant public health issue in the United States. It is estimated that prostate cancer will be diagnosed in 179,300 men and 37,000 will die of this disease in 1999. Prostate cancer is characterized by a striking ethnic variation in incidence, highest in African Americans and lowest in Asians. Androgens have been proposed to play a role in prostate carcinogenesis. A mutational analysis of HSD3B2 (an androgen metabolic gene which encodes 3(3- hydroxysteroid dehydrogenase type II) has been undertaken. In the analysis of fifty-two genomic DNA samples from a multiethnic cohort study, six DNA sequence variants were identified. These included: two missense substitutions (D74N, which replaces aspartic acid with asparagine at codon 74, and L236S, which replaces leucine with serine at codon 236), one 5’ UTR nucleotide substitution (substituting T with A at position 1296), one intronic substitution (substituting T with G at position 1352), and two silent substitutions (substituting G with A at position 8065 and G with A at position 8377). This is the first report of HSD3B2 genetic variants (in the protein coding region) in asymptomatic individuals. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. CHAPTER 1: PROSTATE CANCER 1.1 Prostate Cancer Epidemiology In the United States, it is estimated that prostate cancer will be diagnosed in 179,300 men and 37,000 will die of this disease in 1999 (1). In fact, prostate cancer has the highest incidence rate among all cancers for men in this country (1). It is known that there are two distinct forms of prostate cancer: cases of hereditary or sporadic disease. Although their etiologies are hypothesized to be different, there is no significant difference in the survival rate between hereditary and sporadic cases of prostate cancer (2). 1.2 Hereditary Prostate Cancer One of the most important risk factor for prostate cancer is a positive family history of this disease. It has been estimated that about 5% to 9% of all prostate cancer cases have a familial component (3,4). Hereditary prostate cancer is characterized by an early age of onset and a family history of multiple affected individuals which demonstrates an autosomal dominance inheritance pattern (4,5). Extensive genome wide linkage analysis of hereditary prostate Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. cancer has led to the identification of four possible prostate cancer susceptibility loci. 1) HPC1 (hereditary prostate cancer 1) on 1q24-25. Genome wide analysis of prostate cancer families provided significant evidence for linkage in this region (6,7). However, the actual existence of a prostate cancer gene in this region has been the subject of great debate as linkage to this locus was confirmed by some studies (8,9), while others have not been able to replicate the results (10,11,12). 2) PCaP (predisposing gene for cancer of the prostate) on 1 q42.2-43. Genome wide search of other prostate cancer families demonstrated moderate linkage to this locus, with a maximum LOD score of 2.7 (12). However, a subsequent study has demonstrated this locus has suggestive evidence of linkage only in families with 5 or more affected individuals, and this region is not involved in a large percentage of hereditary prostate cancer cases (13). 3) HPCX (HPC locus on the X chromosome) on Xq27-28 Linkage to this region has been reported with a maximum LOD score of 4.60. It is estimated that approximately 16% of all hereditary prostate cancer may be attributed to this locus (14). Its localization on the X chromosome suggests 2 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. that an X-linked mode of inheritance is a component of hereditary prostate cancer. 4) CAPB (cancer of the prostate and brain) on 1p36 In 9 prostate cancer families with an accompanying history of primary brain cancer, linkage (with a maximum LOD score of 4.74) was shown to 1p36 (15). Despite the identification of these candidate regions, there has yet to be a “prostate cancer gene” cloned from these loci that is definitively linked to the disease process. 1.3 Sporadic Prostate Cancer In contrast to the hereditary form, sporadic prostate cancer is usually characterized by a later onset of disease and no prior family history of prostate cancer. In the United States, only 2% of prostate cancer in white men occur in those 55 years of age or younger (5). It is well known that prostate cancer incidence rate increase with age is greater than for any other cancer (figure 1.1, 16). This cancer is also characterized by a significant ethnic variation in incidence. In the United States, the estimated prostate cancer incidence rates are as follows (from highest to lowest): African American (224.3 per 100,000), 3 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. White (150.3), Hispanic (104.4), Asian/Pacific Islander (82.2) and American Indian (46.4) (1). Similar ethnic variations have been reported in a study of the Los Angeles population (17). This study demonstrated that African Americans had an incidence rate that is approximately 70% greater than that of non- Hispanic whites, while Asian Americans have even lower rates than non-Hispanic whites (17). Other environmental and life-style factors have also been identified. Among other things, these include diet, smoking, obesity, vasectomy, sexual activity and occupational exposure (18-21). Various models have been proposed to explain the ethnic variation in incidence for the sporadic form of prostate cancer. Among these is the suggestion that there exists an ethnic variation of polymorphic allelic distribution that confer slight individual modification in risk, but poses a large population risk (22). One such model involving androgen metabolic genes had recently been proposed (16). Extensive analysis has also been undertaken to determine the genetic basis of prostate cancer progression. Cytogenetic analysis has revealed a variety of chromosomal abnormalities in the development and metastasis of prostate cancer (reviewed in 23,24). Tumor analysis has also revealed the involvement of several oncogenes and tumor suppressor genes (such as pRB, p53, E-cadherin, MXI1 and c-myc) (25-27). 4 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Prostate 1 0 0 0 Colon Breast 100 1 50 30 40 70 60 Age (years) Figure 1.1 The relationship between prostate, colon and breast cancer incidence and age (reproduction of page 4498 from reference 16). 5 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 1.4 References 1) Landis SH, Murray T, Bolden S, Wingo PA; Cancer Statistics, 1999; CA Cancer J Clin, 49(1), 8-31, 1999. 2) Gronberg H, Damber L, Tavelin B, Damber JE; No difference in survival between sporadic, familial and hereditary prostate cancer; Br J Urol, 82(4), 564-7, 1998. 3) Narod S; Genetic Epidemiology of Prostate Cancer; Biochim Biophys Acta, 1423(1), F1-13, 1999. 4) Carter BS, Beaty TH, Steinberg GD, Childs B, Walsh PC; Mendelian Inheritance of Familial Prostate Cancer; Proc Natl Acad Sci USA, 89(8), 3367-71, 1992. 5) Sciarra A, Casale P, Di Chirio C, Di Nicola S, Di Silverio F; New Aspects on Prostate Cancer: hereditary form, development estrogenization and differentiation therapy; Minerva Urol Nefrol, 50(3), 185-90, 1998. 6) Smith JR, Freije D, Carpten JD, Gronberg H, Xu J, Isaacs SD, Brownstein MJ, Bova GS, Guo H, Bujnovszky P, Nusskern DR, Damber JE, Bergh A, Emanuelsson M, Kallioniemi OP, Walker-Daniels J, Bailey-Wilson JE, Beaty TH, Meyers DA, Walsh PC, Collins FS, Trent JM, Issacs WB; Major susceptibility locus for prostate cancer on chromosome 1 suggested by a genome-wide search; Science, 274(5291), 1371-4,1996. 7) Gronberg H, Xu J, Smith JR, Carpten JD, Issacs SD, Freije D, Bova GS, Danber JE, Bergh A, Walsh PC, Collins FS, Trent JM, Meyers DA, Issacs WB; Early age at diagnosis in families providing evidence of linkage to the hereditary prostate cancer locus (HPC1) on chromosome 1; Cancer Res, 57(21), 4707-9, 1997. 8) Cooney KA, McCarthy JD, Lange E, Huang L, Miesfeldt S, Montie JE, Oesterling JE, Sandler HM, Lange K; Prostate cancer susceptibility locus on chromosome 1q: a confirmatory study; J Natl Cancer Inst, 89(13), 955- 9, 1997. 9) Hsieh CL, Oakley-Girvan I, Gallagher RP, Wu AH, Kolonel LN, Teh CZ, Halpern J, West DW, Paffenbarger RS Jr, Whittemore AS; Re: prostate cancer susceptibility locus on chromosome 1q: a confirmatory study; J Natl Cancer Inst, 89(24), 1893-4, 1997. 6 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 10) Mclndoe RA, Stanford JL, Gibbs M, Jarvik GP, Brandzel S, Neal CL, Li S, Gammack JT, Gay AA, Goode EL, Hood L, Ostrander EA; Linkage analysis of 49 high-risk families does not support a common familial prostate cancer-susceptability gene at 1q24-25; Am J Hum Genet, 61(2), 347-53, 1997. 11) Eeles RA, Durocher F, Edwards S, Teare D, Badzioch M, Hamoudi R, Gill S, Biggs P, Dearnaley D, Ardern-Jones A, Dowe A, Shearer R, McLennan DL, Norman RL, Ghardirian P, Aprikian A, Ford D, Amos C, King TM, Labrie F, Simard J, Narad SA, Easton D, Foulkes WD; Linkage analysis of chromosome 1q markers in 136 prostate cancer families. The Cancer Research Campaign/British Prostate Group U.K. Familial Prostate Cancer Study Collaborators; Am J Hum Genet, 62(3), 653-8, 1998. 12) Berthon P, Valeri A, Cohen-Akenine A, Drelon E, Paiss T, Wohr G, Latil A, Millasseau P, Mellah I, Cohen N, Blanche H, Bellanc-Chantelot C, Demenais F, Teillac P, Le Due A, de Petriconi R, Hautmann R, Chumakov I, Bachner L, Maitland NJ, Lidereau R, Vogel W, Fournier G, Mangin P, Cussenot 0; Predisposing gene for early-onset prostate cancer, localized on chromosome 1q42.2-43; Am J Hum Genet, 62(6), 1416-24, 1998. 13) Gibbs M, Chakrabarti L, Stanford JL, Goode EL, Kolb S, Schuster EF, Buckley VA, Shook M, Hood L, Jarvik GP, Ostrander EA; Analysis of Chromosome 1q42.2-43 in 152 Families with High Risk of Prostate Cancer; Am J Hum Genet, 64(4), 1087-95, 1999. 14) Xu J, Meyers D, Freije D, Issacs S, Wiley K, Nusskern D, Ewing C, Wilkens E, Bujnovszky P, Bova GS, Walsh P, Issacs W, Schleutker J, Matikainen M, Tammela T, Visakorpi T, Kallioniemi OP, Berry R, Schaid D, French A, McDonnell S, Schroeder J, Blute M, Thibodeau S, Trent J; Evidence for a prostate cancer susceptibility locus on the X chromosome; Nat Genet, 20(2), 175-9, 1998. 15) Gibbs M, Stanford JL, Mclndoe RA, Jarvik GP, Kolb S, Goode EL, Chakrabarti L, Schuster EF, Buckley VA, Miller EL, Brandzel S, Li S, Hood L, Ostrander EA; Evidence for a rare prostate cancer-susceptibility locus at chromosome 1p36; Am J Hum Genet, 64(3), 776-87, 1999. 16) Ross RK, Pike MC, Coetzee GA, Reichardt JKV, Yu MC, Feigelson H, Stanczyk FZ, Kolonel LN, Henderson BE; Androgen Metabolism and Prostate Cancer: Establishing a Model of Genetic Susceptibility; Cancer Res, 58(20), 4497-4504, 1998. 7 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 17) Bernstein L, Ross RK; “Cancer in Los Angeles County: A Portrait of Incidence and Mortality.” Los Angeles: University of Southern California, 1991, pp 56-7. 18) Hayes RB, Ziegler RG, Gridley G, Swanson C, Greenberg RS, Swanson GM, Schoenberg JB, Silverman DT, Brown LM, Pottern LM, Liff J, Schwartz AG, Fraumeni JF Jr, Hoover RN; Dietary factors and risks for prostate cancer among blacks and whites in the United States; Cancer Epiemiol Biomarkers Prev, 8(1), 25-34, 1999. 19) Cerhan JR, Tomer JC, Lynch CF, Rubenstein LM, Lemke JH, Cohen MB, Lubaroff DM, Wallace RB; Association of smoking, body mass, and physical activity with risk of prostate cancer in the Iowa 65+ Rural Health Study (United States); Cancer Causes Control, 8(2), 229-38, 1997. 20) Honda GD, Bernstein L, Ross RK, Greenland S, Gerkins V, Henderson BE; Vasectomy, cigarette smoking, and age at first sexual intercourse as risk factors for prostate cancer in middle-aged men; Br J Cancer, 57(3), 326-31, 1988. 21) Krstev S, Baris D, Stewart P, Dosemeci M, Swanson GM, Greenberg RS, Schoenberg JB, Schwartz AG, Liff JM, Hayes RB; Occupational risk factors and prostate cancer in U.S. blacks and whites; Am J Ind Med, 34(5), 421-30, 1998. 22) Shibata A, Whittemore AS; Genetic predisposition to prostate cancer: possible explanations for ethnic differences in risk; Prostate, 32(1), 65-72, 1997. 23) Brothman AR; Cytogenetic studies in prostate cancer: are we making progress?; Cancer Genet Cytogenet, 95(1), 116-121, 1997. 24) Bova GS, Isaacs WB; Review of allelic loss and gain in prostate cancer; World J Urol, 14(5), 338-46, 1996. 25) Crundwell MC, Arkell DG, Gearty J, Phillips SM; Genetic alterations in incidentally diagnosed, transitional zone prostate cancer: a seven year follow-up; J Urol, 158(4), 1568-75, 1997. 26) Prochownik EV, Eagle Grove L, Deubler D, Zhu XL, Stephenson RA, Rohr LR, Yin X, Brothman AR; Commonly occurring loss and mutation of the MXI1 gene in prostate cancer; Genes Chromosomes Cancer, 22(4), 295- 304, 1998. 8 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 27) Qian J, Jenkins RB, Bostwick DG; Detection of chromosomal anomalies and c-myc gene amplification in the cribriform pattern of prostatic intraepithelial neoplasia and carcinoma by fluorescence in situ hybridization; Mod Pathol, 10(11), 1113-9, 1997. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. CHAPTER 2: ANDROGENS 2.1 Androgen action during fetal development During fetal development, the prostate develops from the urogenital sinus. Testosterone is produced by the testes and secreted into the general circulation (1). In blood, testosterone can travel freely or is bound to sex hormone binding globulins or plasma albumin (2). When free testosterone enters the urogenital sinus, it is irreversibly converted to dihydrotestosterone (DHT) by the enzyme steroid 5a-reductase (1). DHT (or testosterone, with less efficiency) then binds to the androgen receptor, an intracellular cytosolic receptor. This complex is translocated into the nucleus and binds to various hormone response elements (or androgen response elements) found in the promoter region of various genes (1). The activation of transcription of these genes is modulated through the recruitment of various transcriptional co-activators by the DHT-receptor complex (3). It has been shown that DHT acts as a growth and differentiation-promoting stimulus that plays an essential role in prostate gland regulation (4). 10 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 2.2 Androgen metabolic genes Since the prostate is an androgen regulated gland, androgen metabolic genes present as attractive functional candidates to study in prostate cancer (figure 2.1) (5). Among the various enzymes involved, one of the more attractive candidates for study in prostate cancer is steroid 5a-reductase, which catalyzes the conversion of testosterone into DHT. 2.3 Steroid 5a-reductase type II (SRD5A2) Since DHT acts as a more active ligand for the androgen receptor, it has been proposed that increased levels of intraprostatic DHT may play a role in the pathogenesis of prostate cancer (6,7). The conversion of testosterone into DHT inside the prostate is catalyzed by the enzyme steroid 5a-reductase type II, encoded by the SRD5A2 gene. This gene has been localized to chromosome 2p23 and is primarily expressed in genital skin and the prostate (8). Various mutations in the SRD5A2 gene have been well characterized and are known to cause a condition known as male pseudohermaphroditism (8). In affected males, the internal urogenital tract develops normally, but the formation of male external genitalia and the prostate is impaired. The affected individual is 11 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. therefore cytogenically male (XY), phenotypically female, has bilateral testes with an underdeveloped prostate (8). An epidemiologic study has led to the discovery of a significant ethnic variation in the allelic distribution of a polymorphic marker in the SRD5A2 gene (9). It was determined that certain alleles of a (TA)n dinucleotide repeat in the 3’ untranslated region (UTR) was specific to African Americans (the ethnic group with the highest prostate cancer risk) (9). Mutational analysis of this gene also led to the identification of mutations that affect enzyme activity (10,11). Once again, it was determined that there was significant ethnic variation in the distribution of these mutations (10, 11). It has, therefore, been proposed that genetic variants of the SRD5A2 gene may play a role in predisposition to prostate cancer and in explaining the substantial ethnic variation in incidence and risk (5). 2.4 Prostate Disease Therapy Therapeutic modalities for prostate diseases also provide additional support for the role of androgens in the pathology of prostate cancer. A commonly utilized strategy for treatment of benign prostatic hyperplasia (BPH) is androgen deprivation. This is usually accomplished with administration of various 12 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 5a-reductase inhibitors (12). Finasteride (Proscar), a steroid analog that is a competitive inhibitor of steroid 5a-reductase, is commonly prescribed for BPH (13). Currently, chemoprevention studies have began to evaluate the possible benefits of finasteride administration in preventing prostate cancer (14). 13 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - f j? AN0R0ST-5-ENE*3(1.17B-<liol ______ I______ 3D-HYDR0XYSTERO1D DEHYDROGENASE / ,\5 - .\4-ISOMERASE 17*OH PROGESTERONE ANOROSTENEOIONE TESTOSTERONE PROGESTERONE P450C21 5«-REDUCTASE n O S DEOXYCORTICOSTERONE OIHYOROTESTOSTERONE ANOROSTANEOIONE It-OEOXYCORTISOL P 4 5 0 « ro 30-HSD P4S0C18 CORTICOSTERONE CORTISOL P450C18 ESTRONE ALDOSTERONE CHOLESTEROL J_____ P450scc PREGNENOLONE ■ I P4S0c17 O t O * DHEA-S JL SULFOTRANSFERASE SULFATASE 170-HSD . o P * * ' 1 . + 17-OH M PREGNENOLONE OEHYOROEP1ANOROSTERONE ^ 1 Figure 2.1 Schematic representation of major mammallian steroidogenic pathways (reproduction of page s190 from reference 15). 14 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 2.5 References 1) Guyton A; Textbook of Medical Physiology, pp. 891-8; Philadelphia: W.B. Saunders, 1991. 2) Pardridge WM; Serum bioavailability of sex steroid hormones; Clin Endocrinol Metab, 15(2), 259-78, 1986. 3) Jenster G; Coactivators and corepressors as mediators of nuclear receptor function: an update; Mol Cell Endocrinol, 143(1-2), 1-7, 1998. 4) Fong CJ, Sherwood ER, Braun EJ, Berg l_A, Lee C, Kozlowski JM; Regulation of prostatic carcinoma cell proliferation and secretory activity by extracellular matrix and stromal secretions; Prostate, 21(2), 121-31, 1992. 5) Ross RK, Pike MC, Coetzee GA, Reichardt JKV, Yu MC, Feigelson H, Stanczyk FZ, Kolonel LN, Henderson BE; Androgen Metabolism and Prostate Cancer: Establishing a Model of Genetic Susceptibility; Cancer Res, 58, 4497-4504, 1998. 6) Wilbert DM, Griffin JE, Wilson JD; Characterization of the cytosol androgen receptor of the human prostate; J Clin Endocrinol Metab, 56(1), 113-20, 1983. 7) Ross RK, Bernstein L, Lobo RA, Shimizu H, Stanczyk FZ, Pike MC, Henderson BE; 5-alpha-reductase activity and risk of prostate cancer among Japanese and US white and black males; Lancet, 339(8798), 887- 9, 1992. 8) Thigpen AE, Davis DL, Milatovich A, Mendonca BB, Imperato-McGinley J, Griffin JE, Francke U, Wilson JD, Russell DW; Molecular genetics of steroid 5 alpha-reductase 2 deficiency; J Clin Invest, 90(3), 799-809, 1992. 9) Reichardt JK, Makridakis N, Henderson BE, Yu MC, Pike MC, Ross RK; Genetic variability of the human SRD5A2 gene: implications for prostate cancer risk; Cancer Res, 55(18), 3973-5, 1995. 10) Makridakis N, Ross RK, Pike MC, Chang L, Stanczyk FZ, Kolonel LN, Shi CY, Yu MC, Henderson BE, Reichardt JK; A prevalent missense substitution that modulates activity of prostatic steroid 5alpha-reductase; Cancer Res, 57(6), 1020-2, 1997. 15 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 11) Reichardt JKV, Makridakis NM, Ross RK, Pike MC, Kolonel LC, Henderson BE; A missense mutation in the SRD5A2 gene with a significant population-attributable risk for clinically apparent prostate cancer through increased dihydrotestosterone biosynthesis; submitted for publication. 12) Schroder FH; 5 alDha-reductase inhibitors and prostatic disease; Clin Endocrinol (Oxf), 41(2), 139-47, 1994. 13) Peters DH, Sorkin EM; Finasteride. A review of its potential in the treatment of benign prostatic hyperplasia; Drugs, 46(1), 177-208,1993. 14) Feigl P, Blumenstein B, Thompson I, Crowley J, Wolf M, Kramer BS, Coltman CA Jr, Brawley OW, Ford LG; Design of the Prostate Cancer Prevention Trial (PCPT); Control Clin Trials, 16(3), 150-63, 1995. 15) Simard J, Durocher F, Mebarki F, Turgeon C, Sanchez R, Labrie Y, Couet J, Trudel C, Rheaume E, Morel Y, Luu-The V, Labrie F; Molecular biology and genetics of the 3 beta-hydroxysteroid dehydrogenase/delta5-delta4 isomerase gene family; J Endocrinol, 150 Suppl, S189-207,1996. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. CHAPTER 3: 3B HYDROXYSTEROID DEHYDROGENASE 3.1 HSD3B1 and HSD3B2 In addition to steroid 5a-reductase, another attractive candidate to consider in prostate carcinogenesis is 3P-hydroxysteroid dehydrogenase. This is a bifunctional enzyme that plays multiple roles in androgen metabolism (figure 2.1): 1) The protein possesses A5 -A4 isomerase activity and is involved in the synthesis of all active steroids, including progesterone, androgens, estrogens, mineralocorticoids and glucocorticoids (1). 2) Along with 3a-hydroxysteroid dehydrogenase, 3(3-hydroxysteroid dehydrogenase initiates the excretion of DHT by converting it into the less active diol form (1). Two human isoforms of this enzyme have been identified, HSD3B1 and HSD3B2 (2,3). The two genes have been cloned and are found to be closely linked on chromosome band 1p13.1 (4). The type I enzyme is encoded by HSD3B1 and is expressed mostly in the placenta, breast and skin (5). The type II enzyme is encoded by HSD3B2 and is primarily expressed in adrenals, testes and ovaries (5). 17 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 3.2 HSD3B2 protein As mentioned in chapter 3.1, the HSD3B2 gene product is a bifunctional enzyme that has a dual role in steroid metabolism. It possesses A5 -A4 isomerase activity and is involved in the synthesis of all classes of steroids. Specifically, this enzyme catalyzes the transformation of pregnenolone to progesterone, 17a- hydroxypregnenolone to 17a-hydroxyprogesterone, dehydroepiandrosterone (DHEA) into 4-androstenedione, and 5-androstene-3p,17p-diol to testosterone (5). The HSD3B2 gene product also possesses 3P-hydroxysteroid dehydrogenase activity and catalyzes the degradation of 5a-androstanes and 5a-pregnanes, such as DHT and dihydroprogesterone (5). Although there is direct evidence that this protein possesses both enzymatic activities, whether there are distinct isomerase and dehydrogenase sites or a bifunctional catalytic site with different conformations for each activity remains unclear (1, 6). The 3PHSD enzyme is a 42 KDa NAD+ dependent membrane-bound protein that is located in the endoplasmic reticulum and in mitochondrial membranes (7). Testicular expression of HSD3B2 is first detected on the 17th day of gestation (8). Localization by immunostaining revealed that this enzyme is expressed in the prostate in both basal epithelial cells and stromal fibroblasts (9). 18 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. The complete structure-function relationship of this enzyme is not fully known. However, various important regions of the protein have been identified (see figure 3.1). Computer analysis of the HSD3B2 amino acid sequence predicts the presence of two transmembrane domains extending from amino acid residue 73 to 90 and from residue 286 to 304 (7). Analysis of the type I 3PHSD protein has led to the identification of two tryptic peptides, Lys-175 (Asn-176 to Arg-186) peptide and Arg-250 (Gly-251 to Lsy-274) peptide, that should contain amino acids involved in substrate binding (10). In addition, analysis of 3P-HSD deficient patients revealed that substitutions at amino acid residues 142, 171, 245, 253, 254 and 259 abolished enzyme activity (5). There is a highly conserved Gly-X-X- Gly-X-X-Gly fingerprint, found in the NH2 -terminal of the protein from residues 9 to 15, that is similar to the common Gly-X-Gly-X-X-Gly sequence found in most NAD(H) binding enzymes (11). Characterization of HSD3B2 mutations indicates that amino acid residues 100, 108 and 186 may also be involved in NAD+ cofactor binding (12,13). 3.3 HSD3B2 deficiency Various mutations in HSD3B2 have been identified and are known to cause steroid metabolic diseases such as congenital adrenal hyperplasia and male pseudohermaphoditism (5, 11-16). As expected, functional analysis of 19 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. these mutations revealed that they all lead to severely impaired 30- hydroxysteroid dehydrogenase/A5 -A4 isomerase activity (5). In affected individuals, there is decreased secretion of all types of steroids. Among other symptoms, 30-HSD deficiency can lead to incomplete masculinization of the external genitalia (i.e. underdeveloped prostate) due to the impairment of androgen synthesis in the testes (5, 11-16). 3.4 Supporting evidence for role of HSD3B2 in prostatic diseases HSD3B2 presents as a logical candidate gene to study for four reasons: 1) role in androgen metabolism; 2) characterized mutations/enzyme variants; 3) role of the enzyme in prostatic diseases and 4) compatibility with proposed model. 1) Role in androgen metabolism. Androgens have long been hypothesized to play a role in prostate cancer development. Current nonsurgical treatments of prostatic disease include administration of steroid analogs (17). Androgen metabolic gene (SRD5A2) mutations have been reported to possibly play a causal role in cancer development by regulating intraprostatic DHT (18,19). Therefore, additional focus should be placed on various enzymes that are involved in DHT synthesis and degradation. HSD3B2 is one of the enzymes directly involved in the inactivation 20 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. of DHT (1). This bifunctional enzyme is also required for the synthesis of all forms of steroids (1). The dual role of the HSD3B2 gene product makes it a very attractive androgen metabolic gene to study. 2) Characterized mutations/enzyme variants. Despite the fact there is no direct correlation between the reported HSD3B2 mutations and prostatic diseases, symptoms of 3P-HSD deficiency include underdevelopment of the prostate (5, 11-16). There is now growing evidence that heterozygotic carriers of HSD3B2 mutations may in fact be symptomatic (with premature pubic hair and hyperandrogenism) (20). This suggests that moderate alteration in HSD3B2 enzyme activity may indeed be phenotypically significant (20). 3) Role of the enzyme in prostatic diseases. Although HSD3B2 mutations has yet to be identified in prostate cancer or BPH, there is ample evidence to indicate that HSD3B2 enzyme activity is altered in prostatic diseases. It has been shown that elevated DHT levels in hyperplastic human prostate tissues can be explained on the basis of significantly decreased 3p-hydroxysteroid dehydrogenase activity (21,22). It has also been demonstrated that in all normal prostate cells, 3P-hydroxysteroid dehydrogenase activity was higher than 5a-reductase activity, while 3p-hydroxysteroid dehydrogenase 21 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. activity was lower in hyperplastic prostate tissues (23). This type of alteration in androgen metabolism (i.e. change in 3p~hydroxysteroid dehydrogenase activity) may also be important in prostate carcinogenesis. 4) Compatibility with proposed model After completion of the mutational analysis of the HSD3B2 gene, it is hypothesized that HSD3B2 enzymatic variants with only slight modification of activity will be identified. Slightly altered enzyme activity will pose a relatively low immediate risk for the affected individual, but a significant risk with increasing age/time with sustained exposure to slightly elevated levels of androgens (i.e. DHT). Utilizing a complex dinucleotide repeat in intron 3 of the HSD3B2 gene, it has already been shown that this gene has a significant variation in allelic frequency among the various ethnic groups (24). 22 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 73-90 $ $ $ $ $ $ $ (Transmembrane domains) $ $$ $ $ $ $ 286-304 NL108W P186L (NAD+binding) 175-186 250-274 (activity) W171X Y253N E142K A245P T259R Y254D Figure 3.1 Schematic diagram of the HSD3B2 protein. The hypothesized transmembrane domain, cofactor binding domain, substrate binding/enzyme activity domain along with mutations identified in patients with 3(3-HSD deficiency are illustrated (5,7,10-13). 23 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 3.5 Reference 1) Luu-The V, Takahashi M, de Launoit Y, Dumont M, Lachance Y, Labrie F; Evidence for distinct dehydrogenase and isomerase sites within a single 3 beta hydroxysteroid dehydrogenase/5-ene-4-ene isomerase protein; Biochemistry, 30(36), 8861-5, 1991. 2) Lachance Y, Luu-The V, Labrie C, Simard J, Dumont M, de Launoit Y, Guerin S, Leblanc G, Labrie F; Characterization of human 3 beta- hydroxysteroid dehydrogenase/delta 5-delta 4-isomerase gene and its expression in mammalian cells; J Biol Chem, 265(33), 20469-75,1990. 3) Lachance Y, Luu-The V, Verreault H, Dumont M, Rheaume E, Leblanc G, Labrie F; Structure of the human type II 3 beta-hydroxysteroid dehydrogenase/delta 5-delta 4 isomerase (3 beta-HSD) gene: adrenal and gonadal specificity; DNACell Biol, 10(10), 701-11, 1991. 4) Morissette J, Rheaume E, Leblanc JF, Luu-The V, Labrie F, Simard J; Genetic linkage mapping of HSD3B1 and HSD3B2 encoding human types I and II 3 beta-hydroxysteroid dehydrogenase/delta 5-delta 4-isomerase close to D1S514 and the centromeric D1Z5 locus; Cytogenet Cell Genet, 69(1-2), 59-62, 1995. 5) Simard J, Durocher F, Mebarki F, Turgeon C, Sanchez R, Labrie Y, Couet J, Trudel C, Rheaume E, Morel Y, Luu-The V, Labrie F; Molecular biology and genetics of the 3 beta-hydroxysteroid dehydrogenase/delta5-delta4 isomerase gene family; J Endocrinol, 150 Suppl, S189-207, 1996. 6) Thomas JL, Strickler RC, Myers RP, Covey DF; Affinity labeling of human placental 3 beta-hydroxy-delta 5-steroid dehydrogenase and steroid delta- isomerase: evidence for bifunctional catalysis by a different conformation of the same protein for each enzyme activity; Biochemistry, 31(24), 5522- 7, 1992. 7) Labrie F, Simard J, Luu-The V, Pelletier G, Belanger A, Lachance Y, Zhao HF, Labrie C, Breton N, de Launoit Y, et al; Structure and tissue-specific expression of 3 beta-hydroxysteroid dehydrogenase/5-ene-4-ene isomerase genes in human and rat classical and peripheral steroidogenic tissues; J Steroid Biochem Mol Biol, 41(3-8), 421-35, 1992. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 8) Dupont E, Labrie F, Luu-The V, Pelletier G; Ontogeny of 3 beta- hydroxysteroid dehydrogenase/delta 5-delta 4 isomerase (3 beta-HSD) in rat testis as studied by immunocytochemistry; Anat Embryol (Berl), 187(6), 583-9, 1993. 9) EI-AIfy M, Luu-The V, Huang XF, Berger L, Labrie F, Pelletier G; Localization of type 5 17beta-hydroxysteroid dehydrogenase, 3beta- hydroxysteroid dehydrogenase, and androgen receptor in the human prostate by in situ hybridization and immunocytochemistry; Endocrinology, 140(3), 1481-91, 1999. 10) Thomas JL, Nash WE, Myers RP, Crankshaw MW, Strickler RC; Affinity radiolabeling identifies peptides and amino acids associated with substrate binding in human placental 3 beta-hydroxy-delta(5)-steroid dehydrogenase; J Biol Chem, 268(25), 18507-12, 1993. 11) Rheaume E, Sanchez R, Mebarki F, Gagnon E, Carel JC, Chaussain JL, Morel Y, Labrie F, Simard J; Identification and characterization of the G15D mutation found in a male patient with 3 beta-hydroxysteroid dehydrogenase (3 beta-HSD) deficiency: alteration of the putative NAD- binding domain of type II 3 beta-HSD; Biochemistry, 34(9), 2893-900, 1995. 12) Mebarki F, Sanchez R, Rheaume E, Laflamme N, Simard J, Forest MG, Bey-Omar F, David M, Labrie F, Morel Y; Nonsalt-losing male pseudohermaphroditism due to the novel homozygous N100S mutation in the type II 3 beta-hydroxysteroid dehydrogenase gene; J Clin Endocrinol Metab, 80(7), 2127-34, 1995. 13) Sanchez R, Mebarki F, Rheaume E, Laflamme N, Forest MG, Bey-Omard F, David M, Morel Y, Labrie F, Simard J; Functional characterization of the novel L108W and P186L mutations detected in the type II 3 beta- hydroxysteroid dehydrogenase gene of a male pseudohermaphrodite with congenital adrenal hyperplasia; Hum Mol Genet, 3(9), 1639-45, 1994. 14) Rheaume E, Simard J, Morel Y, Mebarki F, Zachmann M, Forest MG, New Ml, Labrie F; Congenital adrenal hyperplasia due to point mutations in the type II 3 beta-hydroxysteroid dehydrogenase gene; Nat Genet, 1(4), 239-45, 1992. 25 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 15) Russell AJ, Wallace AM, Forest MG, Donaldson MD, Edwards CR, Sutcliffe RG; Mutation in the human gene for 3 beta-hydroxysteroid dehydrogenase type II leading to male pseudohermaphroditism without salt loss; J Mol Endocrinol, 12(2), 225-37, 1994. 16) Mendonca BB, Russell AJ, Vasconcelos-Leite M, Arnhold I J, Bloise W, Wajchenberg BL, Nicolau W, Sutcliffe RG, Wallace AM; Mutation in 3 beta-hydroxysteroid dehydrogenase type II associated with pseudohermaphroditism in males and premature pubarche or cryptic expression in females; J Mol Endocrinol, 12(1), 119-22, 1994. 17) Schroder FH; 5 alp ha-red uctase inhibitors and prostatic disease; Clin Endocrinol (Oxf), 41(2), 139-47, 1994. 18) Makridakis N, Ross RK, Pike MC, Chang L, Stanczyk FZ, Kolonel LN, Shi CY, Yu MC, Henderson BE, Reichardt JK; A prevalent missense substitution that modulates activity of prostatic steroid 5alpha-reductase; Cancer Res, 57(6), 1020-2, 1997. 19) Reichardt JKV, Makridakis NM, Ross RK, Pike MC, Kolonel LC, Henderson BE; A missense mutation in the SRD5A2 gene with a significant population-attributable risk for clinically apparent prostate cancer through increased dihydrotestosterone biosynthesis; submitted for publication. 20) Nayak S, Lee PA, Witchel SF; Variants of the type II 3beta-hydroxysteroid dehydrogenase gene in children with premature pubic hair and hyperandrogenic adolescents; Mol Genet Metab, 64(3), 184-92,1998. 21) Tunn S, Haumann R, Hey J, Fluchter SH, Krieg M; Effect of aging on kinetic parameters of 3 alpha(beta)-hydroxysteroid oxidoreductases in epithelium and stroma of human normal and hyperplastic prostate; J Clin Endocrinol Metab, 71(3), 732-9,1990 22) Isaacs JT, Brendler CB, Walsh PC; Changes in the metabolism of dihydrotestosterone in the hyperplastic human prostate; J Clin Endocrinol Metab, 56(1), 139-46, 1983. 23) Bruchovsky N, Lieskovsky G; Increased ratio of 5 alpha-reductase:3 alpha (beta)-hydroxysteroid dehydrogenase activities in the hyperplastic human prostate; J Endocrinol, 80(3), 289-301, 1979. 26 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 24) Devgan SA, Henderson BE, Yu MC, Shi CY, Pike MC, Ross RK, Reichardt JK; Genetic variation of 3 beta-hydroxysteroid dehydrogenase type il in three racial/ethnic groups: implications for prostate cancer risk; Prostate, 33(1), 9-12, 1997. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. CHAPTER 4: SPECIFIC AIMS 4.1 Introduction From a public health point of view, prostate cancer is a significant health concern in industrialized nations of the world (1). As noted, prostate cancer has a substantial ethnic variation in incidence, with African Americans having the highest risk and Asians having the lowest risk (2,3). In order to explain this observation, it has been postulated that there exists an ethnic variation in allelic distribution that confer slight individual modification in risk, but poses a large population risk (4). One such model involving androgen metabolic genes had recently been proposed (5). It is postulated that the increased levels of intraprostatic DHT may play a role in the pathogenesis of prostate cancer. Since DHT acts as a potent ligand for the androgen receptor, elevated levels of DHT will lead to the increased activation of gene expression by the DHT-receptor complex (6). This in turn will lead to increased expression of proteins involved in modulating cell division (7). The various androgen metabolic genes present as functional candidates to investigate in prostate carcinogenesis (8). Of these, the genes which encode for enzymes directly involved in the synthesis and degradation of DHT are the most attractive. These include SRD5A2 (which encodes for prostatic 5a- 28 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. reductase type II) and HSD3B2 (which encodes 3p-hydroxysteroid dehydrogenase type II) (8). A mutational analysis of the SRD5A2 gene had already been performed and this led to the identification of a missense mutation, V89L (which replaces valine at codon 89 with leucine), which results in almost 30% reduced activity of the 5a-reductase enzyme (9). The molecular genotype of randomly chosen individuals was then correlated with in vivo androgen levels. It was determined that this allele was especially prevalent among Asians and may explain the reduced risk for prostate cancer in this ethnic population (9). A similar approach will be undertaken to evaluate the role of the HSD3B2 gene. It is hypothesized that mutations in this enzyme may result in altered enzyme activity and therefore, influence the levels of intraprostatic DHT. This may prove to be significant in elevating an individual’s lifetime risk of prostate cancer. 4.2 Purpose As discussed in chapter 3.4, there is ample evidence to indicate that HSD3B2 is an attractive candidate to study in the development of prostate 29 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. cancer. The specific aim of this project is to complete a mutational analysis of the HSD3B2 gene which includes the following: 1) achieve selective amplification of the HSD3B2 gene; 2) complete sequencing of the protein coding region of the HSD3B2 gene from 52 genomic DNA samples available from a multiethnic cohort; 3) identify mutations or polymorphisms of the HSD3B2 gene that may have an effect on enzyme activity (including substrate/cofactor binding, catalytic activity or structural abnormalities). 4.3 Study Approach An epidemiologic approach has been undertaken to assess the possible role of the HSD3B2 gene product in the development of prostate cancer. This study is partly based on the design employed by Makridakis et al. (9). Utilizing genomic DNA samples available from a multiethnic cohort study (described in 9), the complete protein coding region (with additional intronic and UTR sequences) of the HSD3B2 gene will be analyzed by direct sequencing in selected patient samples in hopes of identifying novel mutations or polymorphisms. 30 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 4.4 References 1) Parkin DM, Pisani P, Ferlay J; Global Cancer Statistics; CA Cancer J Clin, 49(1), 33-63, 1999 2) Landis SH, Murray T, Bolden S, Wingo PA; Cancer Statistics, 1999; CA Cancer J Clin, 49(1), 8-31,1999. 3) Bernstein L, Ross RK; “Cancer in Los Angeles County: A Portrait of Incidence and Mortality.” Los Angeles: University of Southern California, 1991, pp 56-7. 4) Shibata A, Whittemore AS; Genetic predisposition to prostate cancer: possible explanations for ethnic differences in risk; Prostate, 32(1), 65-72, 1997. 5) Ross RK, Pike MC, Coetzee GA, Reichardt JKV, Yu MC, Feigelson H, Stanczyk FZ, Kolonel LN, Henderson BE; Androgen Metabolism and Prostate Cancer: Establishing a Model of Genetic Susceptibility; Cancer Res, 58(20), 4497-4504, 1998. 6) Wilbert DM, Griffin JE, Wilson JD; Characterization of the cytosol androgen receptor of the human prostate; J Clin Endocrinol Metab, 56(1), 113-20, 1983. 7) Fong CJ, Sherwood ER, Braun EJ, Berg LA, Lee C, Kozlowski JM; Regulation of prostatic carcinoma cell proliferation and secretory activity by extracellular matrix and stromal secretions; Prostate, 21(2), 121-31, 1992. 8) Simard J, Durocher F, Mebarki F, Turgeon C, Sanchez R, Labrie Y, Couet J, Trudel C, Rheaume E, Morel Y, Luu-The V, Labrie F; Molecular biology and genetics of the 3 beta-hydroxysteroid dehydrogenase/delta5-delta4 isomerase gene family; J Endocrinol, 150 Suppl, S189-207, 1996. 9) Makridakis N, Ross RK, Pike MC, Chang L, Stanczyk FZ, Kolonel LN, Shi C-Y, Yu M, Henderson BE, Reichardt JKV; A Prevalent Missense Substitution That Modulates Activity of Prostatic Steroid 5A-Reductase, Cancer Res, 57(6), 1020-2, 1997. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. CHAPTER 5: SPECIFIC AMPLIFICATION OF HSD3B2 5.1 Introduction One of the technical issues that has to be addressed in the mutational analysis of HSD3B2 is the differential amplification of this gene from the HSD3B1 gene. As described in chapter 3.1, the HSD3B1 gene encodes another isoform of 3(3-hydroxysteroid dehydrogenase. Its expression is detected mainly at the placenta, breast and skin, while HSD3B2 expression is primarily at the adrenals, testes and ovaries (1). The two genes have been shown to be closely linked, both mapping to chromosome 1p13 (2). The structure of both genes are similar with 4 exons each, with the nucleotide sequences showing 77.4, 91.8, 94 and 91% identity in the corresponding exons (3). 5.2 Materials and methods 5.2.1 PCR Amplification of HSD3B2 In order to ensure differential amplification, primer pairs which have been reported by Rheaume et al. to achieve specific amplification were used (table 5.1) (4). The gene was divided into three regions, with the first set of primers flanking exons 1 and 2 (at nucleotide positions 1222 and 1742), the second set 32 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. flanking exon 3 (at nucleotide positions 5452 and 5730), and the third set at the 5’ end of exon 4 (at nucleotide position 7866) and at the 3’ UTR within exon 4 (at nucleotide position 8842) (figure 5.1). PCR reactions were carried out in a Hybaid thermal cycler. They were performed in a 100 ul volume containing 20 mM Tris (pH 8.4), 50 mM KCI, 1.5 mM MgCl2 , 250 uM dNTP, 1 uM of each primer, 2.5 U of Taq polymerase and -200 ng of genomic DNA. The mixture was covered with mineral oil. The reaction was performed with an initial denaturation at 94 °C for 3 minutes, followed by 40 cycles of 94 °C for 1 minute, 60 °C for 1 minute and 72°C for 1 minute. This was followed by 1 cycle of 72°C for 10 minutes. PCR products were then electrophoresed on 2% agarose gels for -1 hour at 139 V. 5.2.2 Manual sequencing PCR products were purified using an agarose gel extraction kit (Qiagen). The purified products were analyzed by electrophoresis on a 2% agarose gel to ensure the quality of the template. Manual sequencing, in both orientations, was performed using a PCR-based kit (Life Technologies, Inc.). Sequencing reactions were denatured and then electrophoresed on a 6% denaturing (7M urea) polyacrylamide gel for 2 hours at 1800V. Gels were then dried and exposed overnight to Kodak BIOMAX autoradiography film. 33 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 5.3 Results As shown in figure 5.2, the PCR conditions described produced bands on 2% agarose gel in the desired size ranges (521 bp for exons 1 and 2, 279 bp for exon 3, and 959 bp for exon 4). As seen in figures 5.3 through 5.5, sequencing of these PCR products revealed that there was selective amplification of the HSD3B2 gene, and not the type I gene, HSD3B1. 5.4 Conclusions The optimal experimental conditions for the primers developed by Rheaume et al. have been confirmed. The analysis has demonstrated the ability to selectively amplify genomic DNA and generate PCR products in the desired size range. With manual sequencing, it was further demonstrated that the PCR products were indeed the correctly amplified products from the HSD3B2 gene. 34 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Primer Name Sequence II.1222u 5' GCATAAAGCTCCAGTCCTTCCTCCA 3' II.1742d 5' TTGCTAGACAAGGTCAACCTCCCCA 3' II.5452u 5' TATCAGAAAACTTCCCAGCCAGATC 3' II.5730d 5' TCTGATCCTCATTTAACCAACTTGT 3' II.7866u 5' TGGGATATTTCCTGACACTGTCATC 3' II.8842d 5' AGGACCTGGGCTTGTGCCCCTGTTC 3' Table 5.1 Primers used in the specific amplification of the HSD3B2 gene. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. III -0 ® lid) fc>IU222u ; IL1742d< i----------- 521 b p ----------1 III ■0" IV h Human type II3B-HSD gene ► IL5452U : WIL7866U ; ~ i PCR fragments IL5730d-< IL882W -< 1 — 27 9 b p — i '------------------ 9 S 9 bp--------------------- 1 Figure 5.1 Schematic diagram illustrating primer location (reproduction of page 241 from reference 4). 36 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 1 2 3 4 5 4 * < - 959 bp 521 bp < - 279 bp Figure 5.2 PCR product from exons 1 and 2, exon 3 and exon 4 of the HSD3B2 gene are of the expected size. (2% agarose gel: lane 1=0X174 DNA H ae III Marker (Promega), lane 2=exon 1 and 2 (521 bp), lane 3=exon 3 (279 bp), lane 4=exon 4 (959 bp), lane 5= blank, H2 O) 37 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. G A T C G/A T/C T/A T/G G/~ A/G Figure 5.3 Proof of specific amplification of exons 1 and 2 of the HSD3B2 gene. Nucleotides highlighting the differences between the sequence of HSD3B1 and HSD3B2 are indicated by arrows (HSD3B2/HSD3B1). ~ represents no corresponding nucleotide in HSD3B1. 38 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. G A T C <- <- <- T/G A/G T/A G/A G/A Figure 5.4 Proof of specific amplification of exon 3 of the HSD3B2 gene. Nucleotides highlighting the differences between the sequence of HSD3B1 and HSD3B2 are indicated by arrows (HSD3B2/HSD3B1). 39 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Figure 5.5 T/G G/A AJG cn C/T Proof of specific amplification of exon 4 of the HSD3B2 gene. Nucleotides highlighting the differences between the sequence of HSD3B1 and HSD3B2 are indicated by arrows (HSD3B2/HSD3B1). 40 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 5.5 References 1) Labrie F, Simard J, Luu-The V, Pelletier G, Belanger A, Lachance Y, Zhao HF, Labrie C, Breton N, de Launoit Y; Structure and tissue-specific expression of 3 beta-hydroxysteroid dehydrogenase/5-ene-4-ene isomerase genes in human and rat classical and peripheral steroidogenic tissues; J Steroid Biochem Mol Biol, 41(3-8), 421-35, 1992. 2) Morissette J, Rheaume E, Leblanc JF, Luu-The V, Labrie F, Simard J; Genetic linkage mapping of HSD3B1 and HSD3B2 encoding human types I and II 3 beta-hydroxysteroid dehydrogenase/delta 5-delta 4-isomerase close to D1S514 and the centromeric D1Z5 locus; Cytogenet Cell Genet, 69(1-2), 59-62, 1995. 3) Lachance Y, Luu-The V, Verreault H, Dumont M, Rheaume E, Leblanc G, Labrie F; Structure of the human type II 3 beta-hydroxysteroid dehydrogenase/delta 5-delta 4 isomerase (3beta-HSD) gene: adrenal and gonadal specificity; DNACell Biol, 10(10), 701-11, 1991. 4) Rheaume E, Simard J, Morel Y, Mebarki F, Zachmann M, Forest MG, New Ml, Labrie F; Congenital adrenal hyperplasia due to point mutations in the type II 3 beta-hydroxysteroid dehydrogenase gene; Nat Genet, 1(4), 239-45, 1992. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. CHAPTER 6: MUTATIONAL ANALYSIS OF THE HSD3B2 GENE 6.1 Introduction As discussed in the chapter 4.2, one of the specific aims of this project is to identify novel HSD3B2 mutations/polymorphisms which may explain the role of this gene in the pathogenesis of prostate cancer. In order to perform a complete analysis, it was determined that direct sequencing will provide the most effective means of completing the study. Radioactive manual sequencing with a cycle- sequencing kit was first attempted. However, despite numerous attempts, optimal sequencing condition could not be developed. Therefore, the use of automated sequencing technology was utilized. 6.2 Materials and methods 6.2.1 Patient selection criteria 52 individuals were selected from a multiethnic cohort study (previously described in 1). The criteria included ethnicity and serum testosterone level. These samples were chosen to represent the two ethnic groups with the greatest and lowest risk for prostate cancer: African American and Japanese (2,3). The samples were further divided into two subgroups with high (between 6.14 and 42 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 11.40 ng/ml) and low (between 0.25 and 3.35 ng/ml) serum testosterone levels. For a complete listing and classification of the 52 samples, refer to tables 6.1 through 6.4. 6.2.2 PCR amplification of HSD3B2 PCR amplification of the 52 samples was performed as described in chapter 5.2.2. 6.2.3 Automated sequencing PCR products were purified using an agarose gel extraction kit (Qiagen). The purified products were analyzed by electrophoresis on a 2% agarose gel to ensure the quality of the template. Sequencing reactions were carried out in a 20 ul volume containing 3.2 pmol of primer, 4 ul (30 to 90 ng) of PCR product, 8 ul of ABI Prism Terminator Big Dye Cycle Sequencing Ready Reaction Mix and 4.8 ul of dHaO. The primers previously described were used (see table 5.1). However, due to the length of the exon 4 PCR product (959 bp), internal primers located within the exon were also utilized (see table 6.5). The reaction was prepared on ice and mixed thoroughly. The mixture was then overlaid with one drop of mineral oil and placed in a Hybaid Thermal cycler. 43 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. The reaction was performed with an initial denaturation step at 96 °C for 30 seconds (ramp 1.0), followed by 33 cycles of 96 °C for 30 seconds (ramp 1.0), 50 °C for 15 seconds (ramp 1.0) and 60°C for 4 minutes (ramp 1.0). The aqueous solution was separated from the mineral oil and was purified with Autoseq G-50 tubes (Pharmacia Biotech). The solution was then dried by placing inside a DNA Speed Vac for 20 minutes. The pellet is then re-suspended with 5 ul of Formamide and 1 ul of loading buffer (Perkin-Elmer). 1.5 ul of the suspension is loaded onto a 5% long ranger gel. Electrophoresis is performed with an ABI Prism 377 DNA sequencer at 1 kV for 3.5 hours. After termination of electrophoresis, nucleotide sequences were processed with ABI Prism Factura Feature Identification Version 2.2.0 (with “identify heterozygote" limit set at 30%). The sequence is then further analyzed with ABI Prism Sequence Navigator Version 1.01. 6.3 Results Automated sequencing in both directions was completed for all 52 samples with the following 3 exceptions: 1) exons 1 and 2 of sample 29 was analyzed in the reverse direction only; 2) the 5’ region of exon 4 of sample 29 was only analyzed in the forward direction; 3) exon 4 of sample 12 was not analyzed due to the inability to generate template via PCR amplification. 44 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. In total, over 160,000 nucleotides were sequenced and analyzed. The analysis demonstrated that 12 of the 52 samples had a sequence variant of the HSD3B2 gene (see table 6.6 and figure 6.1). These included six unique variations: 1) a missense substitution, D74N (which replaces aspartate at codon 74 with asparagine), in exon 3 of sample 46 (allelic frequency ~1 %); 2) a missense substitution, L236S (which replaces leucine at codon 236 with serine), in exon 4 of samples 29, 32 and 37 (allelic frequency ~3%) (4); 3) a substitution in the 5’ UTR, T1296A, in sample 33 (allelic frequency ~1 %); 4) a substitution in intron 1, T1352G, in samples 5 and 7 (allelic frequency ~2%); 5) a silent substitution, G8065A (at codon 125) in exon 4 of sample 52 (allelic frequency -1%); 6) a silent substitution, G8377A (at codon 8377) in exon 4 of samples 28, 31, 34 and 48 (allelic frequency ~4%). All samples were heterozygotes for the variant described. 6.4 Conclusions Automated sequencing proved to be an effective and efficient tool for genetic mutation analysis. Of the 52 samples, 12 demonstrated as being heterozygote for a sequence variation of the HSD3B2 gene. A total of six variations were identified. These included two missense substitutions, one in exon 3 and another in exon 4, a nucleotide substitution in the 5’ UTR, a 45 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. nucleotide substitution in intron 1, and two silent substitutions in exon 4 (see figure 6.2). 46 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Sample Number Patient Number Age Testosterone Level 1 M1232 65+ 2.06 2 M1706 45-54 2.78 3 M1877 45-54 3.28 4 M1884 65+ 2.07 5 M2117 55-64 1.56 6 M2230 65+ 3.31 7 M2461 55-64 3.32 8 M2512 45-54 0.74 9 M2526 65+ 2.22 10 M2850 45-54 3.32 11 M3260 55-64 0.25 12 M3460 65+ 3.35 13 M3940 65+ 3.11 Table 6.1 Japanese individuals with low testosterone level. Testosterone levels are in units of ng/ml. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Sample Number Patient Number Age Testosterone Level 14 M2170 65+ 9.56 15 M2458 55-64 9.88 16 M2627 65+ 9.12 17 M2809 45-54 7.35 18 M2812 55-64 7.56 19 M2817 65+ 6.22 20 M2827 45-54 7.35 21 M2830 65+ 7.38 22 M3331 65+ 9.32 23 M3335 65+ 6.90 24 M3342 55-64 11.40 25 M3464 45-54 8.80 26 M3467 65+ 6.14 Table 6.2 Japanese individuals with high testosterone level. Testosterone levels are in units of ng/ml. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Sample Number Patient Number Age Testosterone Level 27 M0023 45-54 2.43 28 M0225 65+ 2.60 29 M0269 65+ 2.21 30 M0291 65+ 3.19 31 M0302 45-54 0.40 32 M1218 65+ 2.60 33 M1307 55-64 1.68 34 M1501 65+ 2.84 35 M1847 65+ 2.82 36 M2889 55-64 2.93 37 M3078 55-64 2.16 38 M3108 65+ 2.99 39 M3137 55-64 2.80 Table 6.3 A frican-A m erican individuals with low testosterone level. Testosterone levels are in units of ng/ml. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Sample Number Patient Number Age Testosterone Level 40 M0234 45-54 6.90 41 M0277 45-54 8.96 42 M0288 55-64 6.75 43 M0474 65+ 8.92 44 M1507 65+ 9.76 45 M1875 65+ 6.21 46 M2854 55-64 7.15 47 M2857 65+ 8.13 48 M2891 65+ 8.69 49 M3086 65+ 6.21 50 M3087 65+ 6.75 51 M3088 65+ 7.02 52 M3123 45-54 10.60 Table 6.4 A frican-A m erican individuals with high testosterone level. Testosterone levels are in units of ng/ml. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Primer Name Sequence j j ex4up 5' TCCAACACTTGACAGGATCCC 3' j j ex4dn 5' GGAGCCTTCCTTTAACCCTGA 3' Table 6.5 Internal primers within exon 4 used during automated sequencing. ]jex4up is located at nucleotide position 8245 and jjex4dn is at nucleotide position 8447. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Missense substitution in exon 3 Sample # Age [TJ | Ethnicity Nucleotide (AA) change 46 55-64 7.15 | AA G5592A (D74N) Missense substitution in exon 4 Sample # Age m Ethnicity Nucleotide (AA) change 29 65+ 2.21 AA T8307C (L236S) 32 65+ 2.60 AA T8307C (L236S) 37 55-64 2.16 AA T8307C (L236S) Substitution in 5’ UTR Sample # Age m Ethnicity Nucleotide change 33 55-64 1.68 AA T1296A Substitution in intron 1 Sample # Age m Ethnicity Nucleotide change 5 55-64 1.56 JAP T1352G 7 55-64 3.32 JAP T1352G Silent substitutions in exon 4 Sample # Age m Ethnicity Nucleotide change (codon location) 52 45-54 10.60 AA G8065A (125) 28 65+ 2.60 AA G8377A (259) 31 45-54 0.40 AA G8377A (259) 34 65+ 2.84 AA G8377A (259) 48 65+ 8.69 AA G8377A (259) Table 6.6 Summary of identified sequence variants of the HSD3B2 gene. [T] represents testosterone levels in ng/ml. (AA=African American, JAP=Japanese) Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. CAGRACGTCTCGG TGGCCTYGAGGCT (b) CAATCWAAGTTAC Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. TACAAMAATTC TACCCRTACAG ACACRCCTCA Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Figure 6.1 Selected electropherograms from automated sequencing of the HSD3B2 gene. (a) Missense substitution seen in sample #46. A nucleotide substitution at position 5592 from a G to A results in the change of GAC (Asp) to AAC (Asn) in codon 74. R indicates A or G. (b) Missense substitution seen in sample #37. A nucleotide substitution at position 8307 from a T to C results in the change of TTG (Leu) to TCG (Serine) in codon 236. Y indicates C or T. (c) 5’ UTR substitution seen in sample #33. A nucleotide substitution at position 1296 results in a change from T to A. W indicates A or T. (d) Intronic substitution seen in sample #5. Antisense sequencing data is shown. A nucleotide substitution at position 1352 results in a change from T to G in the sense direction. W indicates G or T. (e) Silent substitution seen in sample #52 at codon 125. A nucleotide substitution at position 8065 results in a change from G to A. The proline residue remains unchanged (CCG and CCA). R indicates A or G. (f) Silent substitution seen in sample #28 at codon 259. A nucleotide substitution at position 8377 results in a change from G to A. The threonine residue remains unchanged (ACG to ACA). R indicates A or G. 55 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. ATG D74N L236S TGA 1 T1352G G8065A G8377A T1296A Figure 6.2 Schematic representation of the location of the six sequence variants identified in the HSD3B2 gene. The translation start (ATG) and stop (TGA) codons are also illustrated. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 6.5 References 1) Makridakis N, Ross RK, Pike MC, Chang L, Stanczyk FZ, Kolonel LN, Shi C-Y, Yu M, Henderson BE, Reichardt JKV; A Prevalent Missense Substitution That Modulates Activity of Prostatic Steroid 5A-Reductase; Cancer Res, 57(6), 1020-2, 1997. 2) Landis SH, Murray T, Bolden S, Wingo PA; Cancer Statistics, 1999; CA Cancer J Clin, 49(1), 8-31, 1999. 3) Bernstein L, Ross RK; “Cancer in Los Angeles County: A Portrait of Incidence and Mortality.” Los Angeles: University of Southern California, 1991, pp 56-7. 4) The L236S mutation in samples 42 and 50 was confirmed by restriction digest analysis (Koo J, Reichardt JKV, unpublished data). Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. CHAPTER 7: DISCUSSION 7.1 HSD3B2 mutational analysis Utilizing genomic DNA samples available from a multiethnic cohort study, the protein coding region of the HSD3B2 gene was thoroughly analyzed for mutations and/or polymorphisms. A total of six different sequence variations were identified in 52 samples (see figure 6.2). These included 2 missense substitutions, a substitution at the 5’ UTR, 2 silent substitutions and an intronic substitution. The importance of these substitutions will be discussed below along with comments on future directions. 7.2 Missense substitutions Two different missense substitutions were identified in the HSD3B2 gene. The first substitution, identified in sample 46, results in an amino acid change from aspartate to asparagine at position 74 (D74N). A previously reported substitution resulting in a change from leucine to serine at position 236 (L236S) was identified in samples 29, 32 and 37 (1). Although molecular characterization of these substitutions has yet to be completed, the known structure-function 58 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. relationship of the HSD3B2 protein suggests that these amino acid substitutions will have an effect on the catalytic ability of this protein. Although amino acid 74 is not a conserved residue in the 3(3HSD family of proteins, it is situated within one of the predicted transmembrane domains (from residue 73 to 90) of the protein (see figure 3.1) (2). The change from aspartate to asparagine at codon 74 (D74N) results in the possible loss of a negatively charged amino acid residue. It has been demonstrated previously that the addition of glycerol, a stabilizing agent for several membrane-bound enzymes, is often required for the detection of 3(3-HSD activity in vitro (3). It is, therefore, within reason to hypothesize that the possible loss of a charged amino acid in the transmembrane domain may have an effect on the stability and proper localization of the integral membrane protein, and ultimately affecting the catalytic efficiency of the enzyme. Furthermore, there are examples that indicate a charged amino acid in the transmembrane domain of an enzyme or transporter may be vital in substrates/cofactor binding (4,5). The second missense substitution identified, L236S, has been previously reported to produce a clinical presentation of premature pubic hair and hyperandrogenism in adolescents (1). Although expression studies have not been performed, ACTH stimulation test performed by Nayak et al. suggested 59 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. decreased 3(3-hydroxysteroid dehydrogenase activity in these adolescents (1). It should also be noted that within 25 amino acids on the carboxy terminal side of amino acid residue 236, there are six known mutations of HSD3B2 (6). This region may be an essential region for enzyme function, either serving as the active site or an allosteric site of regulation. The significance of finding the L236S substitution in three African American individuals with low testosterone level (and in no other subgroup) remains to be determined. To clearly assess the effect of these amino acid substitutions on enzyme function, in vitro expression analysis of the altered proteins will need to be performed (as described in 3,7). The full length cDNA insert corresponding to the HSD3B2 gene (generously provided by Dr. Luu-The, CHUL Research Center and Laval University, Quebec, Canada) can be ligated within a pCMV-Script vector (Stratagene) to produce the recombinant plasmid pCMV-type II h3pHSD. The accuracy and efficiency of the ligation reaction will then be evaluated with restriction digest analysis. In order to introduce the desired nucleotide substitutions, site-directed mutagenesis can be performed utilizing the PCR fragment obtained from the patient’s genomic DNA bearing the D74N or the L236S substitutions (3). An alternative technique is to perform site-directed mutagenesis with overlap extension PCR with primers which contain the nucleotide substitutions (3). The DNA sequences of the newly-introduced 60 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. fragments in the recombinant plasmids will then be confirmed with direct sequencing. The recombinant plasmids containing the wild type cDNA and the introduced substitutions will then be transfected into COS-1 cells using calcium phosphate precipitation procedure (3,7). In order to determine the amount of protein generated, immunoblot analysis with antibody to the 3(3-HSD protein (generously provided by Dr. Luu-The, CHUL Research Center and Laval University, Quebec, Canada) will be performed (3,7). To determine the enzyme activity of the proteins, assays will be performed utilizing cell homogenates containing the HSD3B2 protein or with intact transfected cells. The homogenate or transfected cells will be incubated at 37°C for 30 minutes in 50 mM Tris buffer (pH 7.5) with 1 mM cofactor (NAD+ ) in the presence of [3H] steroids (pregnenolone and DHEA for A5 -A4 isomerase activity and DHT for 3|3-hydroxysteroid dehydrogenase activity) (3,7). After incubation and stopping the enzymatic reaction with the addition of diethylether, the steroids can be separated by TLC and quantitated with a phosphoimager. Adjusting for the amount of enzyme present (as determined by immunoblot assay), the Km, V m a x and Vmax/Km ratio for both substrates and cofactor (NAD+) can then be determined. 6 1 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. In addition to molecular characterization of these sequence variants, genotyping of prostate cancer case control samples may also be helpful in ascertaining the significance of these substitutions in prostate cancer. This can be achieved by developing the optimal parameters for SSCP analysis for genotyping the D74N substitution. For the L236S genotyping, this can be achieved with restriction enzyme analysis because the nucleotide substitution generates a novel Aval restriction site (1). 7.3 Promoter/5’ UTR/3’ UTR analysis In order to complete the mutational analysis of HSD3B2, an investigation into the promoter region/5’ UTR and the 3’ UTR will have to be performed in order to identify variants that may alter enzyme concentration. Utilizing primers previously described by Simard et al. (figure 7.1, 3), an additional 500 nucleotides upstream to exon 1 and the remaining nucleotides (~300) of the 3’ UTR will be analyzed with automated sequencing technology. 7.4 Substitutions in the 5’ UTR In sample 33, a nucleotide substitution (T1296A) was detected in the 5’ UTR of the HSD3B2 gene. It may be hypothesized that alterations in the 5’ UTR can affect mRNA stability and thus alter the amount of enzyme present. Utilizing 62 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. an expression vector (such as the pCMV plasmid described in chapter 7.3) with the altered nucleotide sequence, mRNA quantification (by RT-PCR or Northern blotting) coupled with Western blot analysis may be performed to determine if mRNA stability or protein expression is affected by the T1296A substitution. 7.5 Silent substitutions and intronic substitutions Silent substitutions and intronic substitutions may also have an effect on protein expression. Although the amino acid sequence is unchanged, the use of a different codon in silent mutations could lead to altered translation efficiency (8). The intronic substitution could also affect gene expression by alternating regulatory elements often found in intronic sequences. In addition to their role in gene/protein expression, these nucleotide substitutions may serve as useful polymorphic markers for analyzing the HSD3B2 gene. Utilizing a complex dinucleotide repeat in intron 3 of the HSD3B2 gene as a marker, a previous study have demonstrated that there was a significant ethnic variation in allelic distribution (7). It is interesting to note that for one of the silent substitutions identified (G8377A), it was detected in four African American samples but not in any Japanese samples. Furthermore, three of the four individuals are characterized as having low serum testosterone levels. This preliminary data suggests that this marker may have a significant ethnic variation in frequency. 63 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 7.6 Summary and conclusion Mutational analysis of the HSD3B2 gene has led to the discovery of six sequence variants. These included two missense substitutions, a substitution at the 5’ UTR, two silent substitutions and an intronic substitution (figure 6.2). Although numerous mutations have already been identified in this gene, this is the first report of genetic variants (in the protein coding region) in asymptomatic individuals (6). Additional studies into the role of the HSD3B2 gene in prostate cancer should begin with completing the mutational analysis of this gene. This should comprise of extending the analysis to include the promoter region/5’ UTR and the remaining 3’ UTR region of the HSD3B2 gene. This should be followed by enzyme assays of the expressed mutant proteins. Genotype analysis should also be undertaken to determine the frequency of the missense (D74N and L236S) in prostate cancer cases. In addition, analysis of the nucleotide substitutions in the 5’ UTR and intronic sequence can be performed. Furthermore, the silent substitutions that were identified may serve as useful polymorphic markers for molecular investigation into prostate cancer risk. 64 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. IL727u * y / y / A M Human type I! 3B-HS0 gene M U 2 2 2 U WlL54S2u> ► IL7866U 11.13694 -643 b p - 11.17424 ■< 11.57304 -« 3-h PCR fragments -521 Cp- -279 bp - -959 b p - 11.91974 - .707 b p ---------- Figure 7.1 Schematic diagram illustrating primer location (for analysis of promoter/5’ UTR/3' UTR) of the HSD3B2 gene (reproduction of page 718 from reference 3). 65 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 7.7 References 1) Nayak S, Lee PA, Witchel SF; Variants of the type II 3beta-hydroxysteroid dehydrogenase gene in children with premature pubic hair and hyperandrogenic adolescents; Mol Genet Metab, 64(3), 184-92, 1998. 2) Labrie F, Simard J, Luu-The V, Pelletier G, Belanger A, Lachance Y, Zhao HF, Labrie C, Breton N, de Launoit Y, et al; Structure and tissue-specific expression of 3 beta-hydroxysteroid dehydrogenase/5-ene-4-ene isomerase genes in human and rat classical and peripheral steroidogenic tissues; J Steroid Biochem Mol Biol, 41(3-8), 421-35, 1992. 3) Simard J, Rheaume E, Sanchez R, Laflamme N, de Launoit Y, Luu-The V, van Seters AP, Gordon RD, Bettendorf M, Heinrich U, et al; Molecular basis of congenital adrenal hyperplasia due to 3 beta-hydroxysteroid dehydrogenase deficiency; Mol Endocrinol, 7(5), 716-28, 1993. 4) Kuntzweiler TA, Arguello JM, Lingrel JB; Asp804 and Asp808 in the transmembrane domain of the Na,K-ATPase alpha subunit are cation coordinating residues; J Biol Chem, 271(47), 29682-7, 1996. 5) Swarts HG, Klaassen CH, de Boer M, Fransen JA, De Pont JJ; Role of negatively charged residues in the fifth and sixth transmembrane domains of the catalytic subunit of gastric H+,K+-ATPase; J Biol Chem, 271(47), 29764-72, 1996. 6) Simard J, Durocher F, Mebarki F, Turgeon C, Sanchez R, Labrie Y, Couet J, Trudel C, Rheaume E, Morel Y, Luu-The V, Labrie F; Molecular biology and genetics of the 3 beta-hydroxysteroid dehydrogenase/delta5-delta4 isomerase gene family; J Endocrinol, 150 Suppl, S189-207,1996. 7) Rheaume E, Lachance Y, Zhao HF, Breton N, Dumont M, de Launoit Y, Trudel C, Luu-The V, Simard J, Labrie F; Structure and expression of a new complementary DNA encoding the almost exclusive 3 beta- hydroxysteroid dehydrogenase/delta 5-delta 4-isomerase in human adrenals and gonads; Mol Endocrinol, 5(8), 1147-57, 1991. 8) Milland J, Christiansen D, Thorley BR, McKenzie IF, Loveland BE; Translation is enhanced after silent nucleotide substitutions in A+T- rich sequences of the coding region of CD46 cDNA; Eur J Biochem, 238(1), 221-30, 1996. 66 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.

Linked assets

University of Southern California Dissertations and Theses

Conceptually similar

PDF

Association between single nucleotide polymorphisms in the 3'untranslated region of the SRD5A2 gene and prostate cancer risk

PDF

Biochemical analysis of somatic mutations in steroid 5alpha-reductase type II in prostate cancer

PDF

Functional analysis of single nucleotide polymorphisms (SNPs) in the 5' regulatory region on the SRD5A2 gene

PDF

Analysis of the ALOX5 gene in atherosclerosis

PDF

Expression of matrix metalloproteinases and their inhibitors in the muscles of amyotrophic lateral sclerosis and control patients

PDF

Development and secretions of salivary glands using mouse models

PDF

Detection of anti-Hu antibodies, a possible key to early diagnosis of small cell lung cancer

PDF

Dual functions of Vav in Ras-related small GTPases signaling regulation

PDF

A review of molecular conjugates and their use in gene therapy with the presentation of a model experiment: Gene therapy with novel fusion proteins that target breast cancer cells

PDF

Construction and characterization of RRP6 deletion in Saccharomyces cerevisiae

PDF

Clathrin associated protein (AP) binding motifs in AD5 penton

PDF

Glucocorticoids modify signal transducers of bone morphogenetic proteins in osteoblasts: Stimulation of the inhibitory Smad 6 and suppression of the stimulatory Smad 8

PDF

Generation of mutant tissue inhibitor of metalloproteinases-2 (TIMP-2) in the baculovirus expression system

PDF

A model for the mechanism of agonism and antagonism in steroid receptors

PDF

Amelogenin domains in a self-assembly process

PDF

A transgenic mouse model for small cell lung cancer

PDF

The Human 3 Beta-Hydroxysteroid Dehydrogenase Type Ii Gene And Genetic Predisposition To Prostate Cancer

PDF

Cyclophilin C is a candidate protein to interact with saposin B using the yeast two-hybrid system

PDF

Molecular studies of the human galactose-1-phosphate uridyltransferase gene

PDF

A novel candidate ovarian cancer and melanoma tumor suppressor gene on chromosome 6q24.3

Asset Metadata

Creator Jim, Jeffrey (author)

Core Title Analysis of the HSD3B2 gene in prostate cancer

School Graduate School

Degree Master of Science

Degree Program Biochemistry and Molecular Biology

Publisher University of Southern California (original), University of Southern California. Libraries (digital)

Tag biology, genetics,biology, molecular,health sciences, oncology,OAI-PMH Harvest

Language English

Contributor Digitized by ProQuest (provenance)

Advisor Reichardt, Juergen (committee chair), Hsieh, Chih-Lin (committee member), Tokes, Zoltan A. (committee member)

Permanent Link (DOI) https://doi.org/10.25549/usctheses-c16-29921

Unique identifier UC11336707

Identifier 1395121.pdf (filename),usctheses-c16-29921 (legacy record id)

Legacy Identifier 1395121.pdf

Dmrecord 29921

Document Type Thesis

Rights Jim, Jeffrey

Type texts

Source University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Access Conditions The author retains rights to his/her dissertation, thesis or other graduate work according to U.S. copyright law. Electronic access is being provided by the USC Libraries in agreement with the au...

Repository Name University of Southern California Digital Library

Repository Location USC Digital Library, University of Southern California, University Park Campus, Los Angeles, California 90089, USA