University of Southern California Dissertations and Theses

Cyclophilin C is a candidate protein to interact with saposin B using the yeast two-hybrid system

(USC Thesis Other)

Cyclophilin C is a candidate protein to interact with saposin B using the yeast two-hybrid system

PDF

Download a page range

Download transcript

Copy asset link

Request this asset

Transcript (if available)

Content INFORMATION TO USERS This manuscript has been reproduced from the microfilm master. UMI films the text directly from the original or copy submitted. Thus, some thesis and dissertation copies are in typewriter face, while others may be from any type of computer printer. The quality of this reproduction is dependent upon the quality of the copy submitted. Broken or indistinct print, colored or poor quality illustrations and photographs, print bleedthrough, substandard margins, and improper alignment can adversely affect reproduction. In the unlikely event that the author did not send UMI a complete manuscript and there are missing pages, these will be noted. Also, if unauthorized copyright material had to be removed, a note will indicate the deletion. Oversize materials (e.g., maps, drawings, charts) are reproduced by sectioning the original, beginning at the upper left-hand comer and continuing from left to right in equal sections with small overlaps. Photographs included in the original manuscript have been reproduced xerographicaily in this copy. Higher quality 6” x 9" black and white photographic prints are available for any photographs or illustrations appearing in this copy for an additional charge. Contact UMI directly to order. ProQuest Information and Learning 300 North Zeeb Road. Ann Arbor, Ml 48106-1346 USA 800-521-0600 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. CYCLOPHILIN C IS A CANDIDATE PROTEIN TO INTERACT WITH SAPOSIN B USING THE YEAST TWO-HYBRID SYSTEM By Yuhua Yang A Thesis Presented to the FACULTY OF THE GRADUATE SCHOOL UNIVERSITY OF SOUTHERN CALIFORNIA In Partial Fulfillment of the Requirements for the Degree MASTER OF SCIENCE (BIOCHEMISTRY AND MOLECULAR BIOLOGY) August 2000 Copyright 2000 Yuhua Yang Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. UMI Number: 1405258 _ _ _( g ) UMI UMI Microform 1405258 Copyright 2001 by Bell & Howell Information and Learning Company. All rights reserved. This microform edition is protected against unauthorized copying under Title 17, United States Code. Bell & Howell Information and Learning Company 300 North Zeeb Road P.O. Box 1346 Ann Arbor, Ml 48106-1346 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. UNIVERSITY OR SO UTHERN CALIFORNIA T H * ORAOUATS SCHOOL UNivcm m rm um LOS ANOCLSS. C A LIFO R N IA M O OT This thesis, w rittes by Y u h v a Y A N C , under the direction of — Thesis Committee, end approved by e ll its members, has been pre sented to end accepted by the Dean of The Graduate School, in p a rtia l fulfillm ent o f the requirements fo r the degree of Master of Science rue, July 10, 2000 S IS COMMITTEE Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. ACKNOWLEDGMENTS It is my great pleasure to take this opportunity to express my heartful appreciation and gratuities to all the people who have shown great concern and help to obtain my goals here at University o f Southern California. It is the wonderful time in my life to work with Dr. Daniel Broek. I would like to express my great gratitude to him for his kind concern, support, encouragement and help. He has been an inspiration to make my goals accomplished. Thank you! I am very grateful to Dr. Zoltan Tokes. for his understanding, patience, encouragement and mentorship. I would like to thank Dr. Raymond Mosteller for his great guidance and assistance to serve as my thesis committee. I would also appreciate Dr. Wei Wen. for her great care and guidance. I would like to thank Mr. Weicheng Wu for his cooperation and all my colleagues and friends for all the support and assistance they've shown. I would like to express my sincere thanks to my dear parents to encourage me and help me to make my dreams come true. Last but not the least. I would like to appreciate my dear husband. Mr. Jinglin Yang, for his support and inspiration in my career. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Table of Contents Contents Page Acknowledgments ii List o f Figures iv List o f Tables vi Abstract vii Chapter 1. Introduction 1 References 12 Chapter 2. Materials and Methods 16 References 25 Chapter 3. Results 27 Chapter 4. Discussion 48 References 53 Bibliography 55 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. List of Figures Contents Chapter I. Introduction Figure 1. The structure o f the saposin family. Figure 2. Examples of saposin-like proteins and disulfide bridges. Figure 3. NK-lysin strucure. Figure 4. Ring-like structures o f Human Mac2-binding protein. Figure 5. Schematic overview of the principle in the yeast two-hybrid system. Chapter 2. Materials and Methods Figure 1 . The schematic diagram for the yeast two-hvbrid screening. Chapter 3. Results Figure l.The sequence of H12 plasmid (partial). Figure 2. Sequence o f H12 plasmid (partial) cont. Figure 3. PCR product o f H12 plamid. the candidate gene screened from yeast two-hybrid system. Figure 4. Insert (H I2) and vector (pRSET C) preparation. Figure 5. SDS PAGE o f GST-Cyclophilin C protein. Figure 6. SDS-PAGE o f His-Cyclophilin C protein. Figure 7. Western blot analysis o f binding assay o f GST-cyclophilin C and His-saposin B. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Figure 8. Western blot analysis o f binding assay of His-cyclophilin C 36 and GST-saposin B. Figure 9. Schematic diagram of pcDNA3.1(-) /Myc-HisA- HMiBP 38 plasmid construct. Figure 10. Restriction enzyme digestion o f plasmid. 39 Figure 11. pRSET A-HM2BP plasmid digested with EcoRI and Hindlll. 40 Figure 12. The construct pRSET A-HM2BP(-TAG) was verified by 41 restriction enzyme BamHI and EcoRI /Hindlll digestion, respectively. Figure 13. The gel purified fragment o f insert and vector after EcoRI/Hindlll 42 digestion. Figure 14. PCR verification o f the pcDNA3.1(-)/Myc-His A-HM2BP plasmid. 43 Figure 15. Autosequencing o f pcDNA3.1(-)/Myc-His A-HM2BP plasmid. 44 Figure 16. The expression of HM2BP protein on SDS PAGE. 45 Figure 17. Western blot showed the expression o f HM2BP protein after 46 transfecting the DNA into COS7 cell and selecting by G418 selective marker. v Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. List of Tables Contents Chapter 2. Materials and Methods Table 1. Transformants growth on selective plates. Chapter 3. Results Table 1 . His 3 expression o f H12 on SC-Leu-Trp-His plate (His+ nutrition selection). Table 2. P-galactosidase activity (Lac Z function) o f HI 2. Pages 19 27 28 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Abstract Saposin A. B. C. and D are heat-stable sphingolipid activator proteins which derive from the same precursor, prosaposin. They are small glycoprotein with the similar structure. Dr. Parkash G ill's laboratory at USC presented that saposin B was an anti tumor drug with the pore forming structure. It was proposed that saposin B was an inhibitor o f angiogenesis targeting endothelial cells and endothelial progenitors. In the present study, we used the yeast two-hybrid system to screen a candidate gene H12 encoding the protein cyclophilin C to interact with the protein o f our interest 'saposin B \ Though lack o f in vitro binding of cyclophilin C and saposin B was detected, they might bind biologically in vivo. The recent research also confirmed the conclusion. Due to the advanced study o f human Mac-2 binding protein, further investigations w ill be extended to verify the interaction. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Chapter 1 Introduction Saposins are small glycoproteins that derive from the same precursor protein, prosaposin1 . Saposin A, B, C and D o f the saposin family are heat-stable sphingolipid activator proteins containing about 80 amino acids. They play an important role in lysosome hydrolysis. Saposins have similar features o f structures (Figure 1). All o f them have six cysteines, a glycosylation site (saposin B, C. D has one, but saposin A has two), and conserved prolines. However, each protein has different specificity and mode of activation o f sphingolipid hydrolyases2. Saposins are widely distributed. They are also named '"housekeeping proteins*’ due to their presence in nearly every tissue. In spleen, lung, liver and kidney, saposins dominate. In skeletal muscle, heart and brain, precursor forms o f saposins exist. HPLC has been used to purify saposins for several yearsJ. The wide distribution of saposin B. made it possible to purify saoposin B in various ways. Human urine has been a source of saposin B. Saposins are usually rich in carbohydrates. In saposin B. C. and D. there are about 20% carbohydrates and in saposin A about 40%. Sapoin B. C. and D have one N-link chain, and saposin A has two instead. Figure 1. The structure of the saposin family, a) Prosaposin structure shown different saposin domains, b) The conserved structure o f saposin A, B, C. and D. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Jatzkewitz et al. first identified saposin B in 19644. Ho and O’ Bren discovered saposin C in 19715 . The cloning o f a cDNA encoding saposin B led to the discovery of prosaposin6 '7 . Thereafter saposin A and saposin D were isolated. Prosaposin is a 70kDa glycoprotein. It has four domains encoding saposin A, B, C. and D. separately. The gene o f human prosaposin was found to locate at chromosome 108 . The helical wheel model indicated saposin B with a triple helix structure stabilized by disulfide linkage9. Chou-Fasman predicted the secondary structure for saposin B is in (3-sheet for the first N-terminal 24 amino acids and a long COOH-terminal helical region not shown in saposin A. C. and D1 0 . However, the P-sheet structure of saposin B was doubted later. Now saposin B was thought to have the a-helical amphipathic barrel structure as the saposin-like proteins. Saposin B has an N-linked chain. The carbohydrate chain affect the protein folding o f saposin B. Cys4 * Cys7 7 , Cys7 - Cys7 1 . Cvsj6-Cys4 7 , were the three cysteine pairings in saposin B. Recently, chromatographic and electrospray mass spectrometric properties o f saposin B was studied1 1 . With more findings o f saposin structure, more functions can be oriented. Saposin B has been found to participate in many enzymes activities, such as arylsulfatase A. a-galactosidase A and acid P-galactosidase. with their corresponding substrates, cerebroside sulfate, globotriaosylceramide. and GM1 ganglioside. respectively. The mechanism o f the enzyme stimulation in saposin B is with substrate1 2 , not with enzyme itself like other saposins. For example, saposin C binds to gl ucocero brosidase. Saposin B appears to be homodimers in aqueous solution. The disulfide bond makes it stable when boiled. It’s proposed that all saposins bind to lipid1 3 , such as Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. gangliosides and other sphingolipids. The interaction o f saposins with phospholipid membrane is taken into consideration. For example, saposin C and D bind to phospholipid bilayers at high affinity in acid-induced increased hydrophobicity1 4 . The acidic pH was reported to be optimal for the interaction. Saposin B likes a nonspecific natural detergent to solubilize multiple lipid substrates for enzyme hydrolysis1 ''. It has broad specificity’. The physiological significance o f saposins began to be emphasized with the knowledge o f mutations of prosaposin and saposin defects. More and more molecular biologists, pathologists and clinicians have been involved in the relevant research. Saposins were accumulated excessively in lysosomal storage disorders (LSDs). LSDs is a group of more than 40 types o f genetic diseases and present various symptoms, such as mental retardation, skeletal disorder, organ problems, etc. The different concentrations of saposin A. B, C and D were measured in 334 LSD patients' plasma samples and shown increased levels o f saposins (38%. 77%. 23%. and 30%. respectively) compared to the 111 individuals o f the control group. So it was proposed that saposins be used as potential screening markers together with LAMP-1 (lysosome-associated protein- 1) for early diagnosis o f LSDs prior to the advent symptoms1 6 . This w ill benefit newborns and children especially. Metachromatic leukodystophy was detected in saposin B deficiency. Gaucher disease1 7 was observed in saposin C deficiency. Two types of mutations have been detected in saposin B. One is C-T mutation in 23rd codon which makes isoleusine displace threonine1 8 , the other is C-A transition1 9 . There are some sequence related proteins named saposin-like proteins (SAPLIP) (Figure 2). including saposins. surfactant-associated protein B. pore-forming amoeba Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. proteins, and domains o f acid sphingomyelinase, acyloxyacylhydrase, and plant aspartic proteinases, etc. NK-lysin is the first representative o f them to be studied. The disclosure of the NMR structure o f NK-lysin (Figure 3) indicating five amphipathic a-helices folded into a globular domain leads to the folding of saposin-like proteins. The common fold is called 'saposin fold' composed o f three conserved disulfide bridges and several hydrophobic residues2021. It was suggested that saposin-like proteins could interact with lipids. Some of them prefer to bind to negatively-charged phospholipids probably due to their cationic sites. The disulfide bonds appear to be important for their action. A new family member, granulysin was studied recently. It was found to involve in cell-mediated cytotoxicity2 2 . Also, it was studied on the induction of apoptosis o f Jurkat cells by ceramide- and caspase-dependent and independent pathways2 3 . Dr. Parkash G ill's laboratory at USC presented that saposin B was an anti-tumor drug. The pore forming structure o f saposin B was related to some molecules such as the lymphocyte cytotoxins NK-lysin. granulysin. and amoebae cytotoxin ameobapore. T-cell cytotoxin perforin which all have pore-forming activities. Saposin B was observed to inhibit the growth o f solid tumor on mice induced by Lewis lung carcinoma cell injection. In clinic, saposin B has been used to treat several patients suffering from Kaposi's sarcoma and HCG/saposin B therapy was given to some metastatic melanoma patients and indicated promising response. It is proposed that saposin B was an inhibitor of angiogenesis targeting endothelial cells and endothelial progenitors. Saposin B was cytotoxic to proliferating endothelial cells. It inhibited the migration o f the endothelial cells and blocked the vessel formation induced by VEGF and bFGF as well. 4 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. s*» dqpc:qKVT3iQ»*vittimwq)U.’« vro a » tflii—unCKuragrwcjLrnwMgi h i s«pf ,_______________ _ «gvrLvc«w.vicT«rai—in B M iL C A w n a * t< K tm ttm 6 Q > ^ m « S 3 :L a i lU M m r lw L m e M S b P -t n i n r o CW lillALZ]O lX«M O I«Q*UVIM ^CBVrnVVk:i^Q CIAIllT3VTUO NK-lrta- 6tKtaaxngKUDHtf«>onsmrrQ»MQvcoiauuaMKiaMt<rutRu«DUTanyQMCvBnzcKs Figure 2. Examples o f saposin-like proteins and disulfide bridges. Figure 3. NK-lysin strucure. Disulfide bonds were shown in ribbons in a) Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Cyclophilins are in the immunophilin family. Cyclophilin A, B, and C have been identified and shown sequence homology with apoptotic nuclease NUC18. Both denatured and native cyclophilins could degrade DNA. The nuclease activity o f cyclophilins was different from cis-trans-peptidylprolyl isomerase. However, it was similar to the activity of apoptotic nuclease. The potential roles o f cyclophilins were presented. The DNAse activity was stimulated by divalent ions such as Ca++ and Mg++. For cyclophilin C (Cyp C), even in the absence o f divalent ions, the activity was also detected. The optimal condition o f the nuclease activity was pH dependent. For cyclophilin C. the value was at pH 9.5. Cyclophilin C showed the greatest degrading activity o f linear single-stranded or linear double-stranded DNA. Moreover, the endonucleolytic activity o f cyclophilins was demonstrated by degrading supercoiled plasmid. Cyclophilin C was found to express highly in kidney. It is a tissue-restricted protein. Cyclosporin A is an immunosuppressive drug which is detected to inhibit the activation or differentiation o f T cell. Cyclophilin C interacts with cellular proteins. In the absence o f cyclosporin A. it binds to 77kDa protein. In the presence o f cyclosporin A. it binds to 55kDa protein2 4 . Thus, cyclophilin C plays a role in immune system. It was proposed that cyclophilin C acted as chaperones2 ', or stress response protein. It aids in protein folding. It was proposed to be involved in apoptosis2 6 . Cyclophilin C-associated protein (CyCAP) was initially presented as a transmembrane protein. It can bind to peptidylprolyl isomerase cyclophilin C27. The interaction of CyCAP and Cyp C can be suppressed by cyclosporin A. The suppression of 6 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. cyclophilin and CsA was mediated by binding and inhibiting the phosphatase activity of calcineurin. Later on, it was proposed that CyCAP was a secreted protein. Human Mac-2 Binding protein (HMac-2BP) has 69% identical sequence of CyCAP. HMac-2BP is a secreted glycoprotein that expresses in serum, breast milk, saliva and urine. Furthermore, it is a cell-adhesive protein o f the extracellular matrix. It can form into ring-like structures by self-assembling (Figure 4). p i integrins. collagens and fibronectin can adhere to it2 8 . CyCAP/HMac-2BP might have functional homologues. They participate in the defensive response to endotoxin, thus regulate the immune system and affect inflammation as well. iftNtfili Figure 4. Ring-like structures o f Human Mac2-binding protein Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. To detect protein-protein interaction, many methods can be used. The well-known ones such as coimmunoprecipitation, GST-pull down, western blot, are all traditional biochemistry methods. Say if we want to learn more information of a protein, it is better to find whether it has interaction with some other proteins. However, if we have not any clue o f the protein o f our interest, it is hard to design the above experiments. Yeast two-hybrid system2 9 ,3 0 is a novel approach to detect protein-protein interaction. It was presented in 1987 by University o f New York at Stony Brook3 1 . The initial idea is simple. However, it has significant applications. Using two different hybrid proteins, one containing a DNA binding domain, the other containing a transcription activation domain, to detect protein-protein interaction. As we know, many eukaryotic trans-acting transcription factors have different domains, which are physically separate and functionally independent. The transcription factor usually has two domains. One is activation domain (AD) encoding the cDNA library, which is called ’ Prey'; the other is a DNA binding domain (DNA-BD) encoding the protein o f interest, which is named ’Bait'. Only if the gene binds to both AD domain and DB domain can transcription occur. The downstream gene expression can be regulated. Neither the bait protein alone, nor the prey protein alone, cannot activate transcription. The principle o f the yeast two-hvbrid system is shown in Figure 4. Mostly. AD plasmid vectors, not BD vectors, are used to construct libraries for two-hybrid screening on the basis o f the following reasons: to perform minimum levels o f false positives because of the autonomous activation o f the bait protein (AD encoding the protein o f interest). Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. G A L U A S R«pM t«rg*m library protein GALUAS linimal pronwlar Rappftarpm Bait protein Libra ry protein M in im a l p r o m o l a r GAL UAS Figure 5. Schematic overview o f the principle in the yeast two-hybrid system. DNA binding domain (DNA BD) encodes the bait protein, and activation domain (AD) encodes the cDNA library protein. Without the interaction o f the two hybrid proteins, no transcription o f the reporter gene can be activated. Once there is an interaction o f the two hybrid proteins, the reporter gene can be transcribed. There are many advantages o f the yeast two-hybrid system. First o f all. it is a nice way to find a protein partner. If we have not known the protein o f our interest well, via detection o f its partner protein, we can have clue to 9 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. further study the protein. Moreover, the function o f the partner protein, can also give us the hints to the potential function o f the protein. This is the mutual direction study. Secondly, it is easy to perform. Since AD vectors are usually used to screen library, high level o f false positives can be minimized due to autonomous activation o f an insert encoding the bait. Using the yeast two-hybrid system, false positive clones of the candidate genes can be eliminated efficiently via screening the cDNA library and using nutrition markers. Thirdly, it is widely used. More and more investigators realized that the yeast two-hybrid system is a good approach to detect protein-protein interaction. It is a challenging to conventional methods and has been widely accepted. Not only can it be accessed in the studies o f cell cycle, apoptosis. kinases, etc. it can be also used in other areas regarding protein-protein interaction. Last but not the least, it is continuously modified and updated. The prospective of the method is encouraging. In the recent decades, with the advent of the method itself, it has been used flexibly and extensively. Three-hybrid system can be used to detect RNA- protein interaction. Multiple-hybrid system has been presented ,l2). The ideas are updated and extended. It is not limited to be used to protein area alone, but is included in many other fields, such as DNA. RNA. etc. With the findings of protein-protein function and protein-protein regulation, gene expression and RNA level can be further studied, too. Research on saposins has been carried on for decades. Due to the unique features of saposin B in structure and function compared to other saposins, saposin B has attracted 10 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. much more interests for investigators. However, many aspects o f saposin B are still unknown. Except for the lysosomal function, are there any non-lysosomal functions of saposins? Prosaposin was reported to be an intergral membrane protein having non- lysosomal function. Both intracellular and extracellular forms in prosaposin were detected. Prosaposin was isolated from some biological fluids, such as human milk, seminal plasma and cerebrospinal fluid, etc. Saposin B was also purified from milk and seminal plasma. It was found to be extracellular as well. It was indicated that the fragment o f prosaposin could enhance sperm and egg fusion3 2 . It was reported that prosaposin had neurotrophic effect on cerebellar granule neurons and prevented programmed cell deathJJ. The precursor of saposins can activate MAP kinase pathway, how about saposin B? Does it also participate in signal transduction pathway? What are the possible upstream or downstream candidate proteins? MAP kinase signaling can be detected using saposin B treated KS-Yl cell lysate to activate ERK.1 and ERK2 pathway. Pertusis toxin addition to KS-Y1 cell prior to saposin B treatment was further studied to determine the pathway was G-protein dependent. The saposin-like protein such as granulysin was proposed to be cytotoxic and induce apoptosis. Are there any similar functions o f saposin B based on the similar saposin fold structure as granulysin? Besides the well-accepted lipid-saposins binding, are there any other protein partners o f saposin B? If so. what is the regulation o f the interaction? it Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. The central question o f the above all is related to protein-protein interaction. In other words, what is the protein to interact with saposin B? In the present study, we used the yeast two-hybrid system to select the candidate gene encoding the protein interacting with the protein o f our interest ’saposin B \ In this way, the physical connection of saposin B can be detected. The pathway o f saposin B function can be furthered. With the partner protein o f saposin B, further investigations were extended to verify the interaction. After the confirmation, both in vivo and in vitro tests can be used to study the protein-protein interactions. Reference 1 Hiraiwa, M.. O'Brien J.S.. Kishimoto. Y.. et al. Isolation. Characterization, and proteolysis of human prosaposin the precursor of saposins (sphingolipid activator Proteins). Archives o f Biochem and Biophy. 304( 1): 110-116.1993. 2 Kishimoto, Y.. Hiraiwa. M . O'Brien. J.S. Saposins: structure, function, distribution, and molecular genetics. J. Lipid Res. 33:1255-1267.1992. 3 Morimoto. S.. Yamamoto. Y.. O'Brien, J.S.. Kishimoto. Y. Determination of saposin proteins (sphingolipid activator proteins) in human tissues. Analytical Biochem. 190: 154-157.1990. 4 Mhl. E., and Jatzkewitz, H. Eine cerebrosidsulfataseau schweineniere. Hoppe-Seyler's. Z. Physiol. Cltem 339:260-276.1964. ' Ho. M-W., O'Bren, J.S. Gaucher’s disease: deficiency o f "acid" P-glutasidase and reconstitution o f enzyme activity in vitro. Proc. Natl. Acad. ScL USA. 68:2810-2813, 1971. A Dewji, N.N.. Wenger. S. Fujibayashi, M. Donoviel.F. Esch. F. Hill and O'Brien. J.S. Molecular cloning o f the sphingolipidactivatot protein-1 (SAP-1), the sulfatide sulfatase activator. Biochem. Biophys. Res. Commun. 134:989-994,1986. 12 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 7 O’ Brien, J.S., Kretz, K.A.. Dewji, N.N., Wenger, D.A., Esch, F., Fluharty, A.I. Coding o f two sphingolipid activator protein (SAP-1 and SAP-2) by same genetic locus. Science. 241:1098-1101,1988. 8 Kao, F.T., Law, M.L., Hartz, J., Jones. C., Zhang, X-L. Dewji, N.N., O’ Brien, J.S. and Wenger, D.A. Regional localization o f the gene coding for sphingolipid activator protein (SAP-1) on human chromosome 10. Somat. Cell Molec. Genet. 13:685-688,1988. 9 O'Brien, J.S. and Kishimoto, Y. Saposin proteins: structure, function, and role in human lysosomal storage disorders. FASEBJ. 5:301-308,1991. 1 0 Chou, P.Y.. Fasman. G.D. Empirical predictions o f protein conformation. Annu. Rev Cltem. 47:251-276.1978. 1 1 Faull, K.F., Whitelegge. J.P., Higginson. J., To, T., Johnson. J., Krutchinsky. A.N., Standing, K.G., Waring, A.J., Stevens. R.L.. Fluharty, C.B., Fluharty, A.L. Cerebroside sulfate activator protein (Saposin B): chromatographic and electrospray mass spectrometric properties. Journal of Mass Spectrometry. 34(10): 1040-54, 1999. 1 2 Wenger, D.A., and Inui. K. Studies on the sphingolipid activator protein for the enzymatic hydrolysis of GMlganglioside and sulfatide. In Molecular Basis of Lysosomal Storage Disorders. R.O.Bradyand. J.Barranger. editors. Academic Press. New York. 1-18, 1984. 1 3 Vaccaro. A.M. Salvioli. R.. Tatti. M.. Ciaffoni. F. Saposins and their interaction with lipids. Neurochemical Research. 24(2):307-14.1999. 1 4 Vaccaro, A.M., Ciaffoni, F.. Tatti. M.. Salvioli. R.. Barca. A. et al. PH-dependent conformational properties o f saposins and their interactions with phospholipid membranes. J. Biol. Chem. 270:30576-30580.1995. 1 5 Li. S.-C.. Sonnino. S., Tettamanti. G. and Li. Y.-T. Characterization o f a nonspecific activator protein for the enzymatic hydrolysis o f glycolipids. J. Biol. Chem. 263. 6588- 6591,1988. 1 6 Chang. M.H., Bindloss. C.A.. Grabowski, G.A.. Qi, X., Winchester. B.. Hopwood. J.J. Meikle. P.J. Saposins A, B. C. and D in plasma o f patients with lysosomal storage disorders. Clinical Chemistry. 46(2): 167-74, 2000. 1 7 Grabowski. G.A., Horowitz. M. Gaucher's disease: molecular, genetic and enzymological aspects. Baillieres clinical haematology. 10(4):635-56.1997. 1 8 Kretz. K.A.. Carson, G.S.. Morimoto, S.. Kishimoto, Y.. Fluharty. A.L. O'Brien. J.S. Characterization o f a mutation in a family with saposin B deficiency: a glycosylation site defect. Proc. Natl. Acad. ScL USA. 87(7):2541-4, 1990. 13 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 1 9 Zhang, X., Rafi, M.A., DegGala, G., Wenger, D.A. Insertion in the mRNA o f a metachromatic leukodystrophy patient with sphingolipid activator-1 deficiency. Proc. Natl. Acad. Sci. USA 87:1426-1430,1990. 2 0 Zaltash. S., Johansson, J. Expression and characterization o f saposin-like proteins. Journal of Protein Chemistry. 17(6):523-4, 1998. 2 1 Liepinsh, E„ Andersson. M.. Ruysschaert, J.M., Otting, G. Saposin fold revealed by the NMR structure o f NK-lysin. Nature Structural Biology. 4(10):793-5.1997. 2 2 Pena, S.V., Krensky, A.M. Granulysin, a new human cytolytic granule-associated protein with possible involvement in cell-mediated cytotoxicity. Seminars in Immunology. 9(2): 117-25, 1997. 2 3 Gamen. S.. Hanson. D.A., Kaspar. A.. Naval. J.. Krensky, A.M.. Anel. A. Granulysin- induced apoptosis. I. Involvement o f at least two distinct pathways. Journal of Immunology. 161 (4): 175 8-64.1998. 2 4 Friedman, J., Weissman. I. Two cytoplasmic Candidates for immunophilin Action Are Revealed by Affinity for a New Cyclophilin: One in the Presence and one in the Absence ofCsA. Cell. 66:799-806. 1991. 2 : 1 Freskgard. P.O.. Bergenhem, N.. Jonsson, B. Science. 258:466-468.1992. 2 6 Montague. J.W., Hughes, F.M .Jr. Cidlowski. J.A. Native recombinant cyclophilins A. B. and C degrade DNA independently o f peptidylprolyl cis-trans-isomerase activity. Potential roles o f cyclophilins in apoptosis. J. Biol. Chem. 272(10):6677-84, 1997. 2 7 Friedmaan. J.. Weissman I. Two cytoplasmic candidates for immunophilin action are revealed by affinity for a new cyclophilin: one in the presence and one in the absence of CsA. CW/. 66:799-806, 1991. 2 8 Sasaki. T.. Brakebusch. C.. Engel. J.. Timpl, R. Mac-2 binding protein is a cell- adhesive protein o f the extracellular matrix which self-assembles into ring-like structures and binds (3i integrins. collagens and fibronectin. The EMBOJ. 17(6): 1606-1613, 1998. 2 9 Luban, J. Goff, S.P. The yeast two-hybrid system for studying protein-protein intewractions. Curr. Opinion in Biotechnol. 6:59-64. 1995. J° Mendelsohn. A.R.. Brent. R. Biotechnology applications o f interaction traps/two- hybrid systems. Curr. Opinion in Biotechnol. 5:482-486. 1994. jl Bartel, P.L., Fields, S. The yeast two-hybrid system. 1997. Oxford University Press. 14 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. j2 Amann. R.P., Shabanowitz. R.B., Huszar. G., Broder, S.J. Increased in vitro binding of fresh and frozen-thawed human sperm exposed to a synthetic peptide. Journal of Andrology. 20(5):655-60, 1999 3j Tsuboi. K.. Hiraiwa. M.. O'Brien, J.S. Prosaposin prevents programmed cell death of rat cerebellar granule neurons in culture. Brain Research. Developmental Brain Research. 110(2): 249-55. 1998. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Chapter 2 Materials & Methods Materials Human HeLa cDNA library. Saccharomyces cerevisiae CG-1945 and Y190 reporter yeast strains were purchased from CLONTECH (Cat. #K1605 MATCHMAKER Two-Hybrid system). pGBT9-Saposin B bait plasmid was constructed by our laboratory. Library Efficiency ® DH5a ™ Competent Cells and Max Efficiency HB101 competent cells were commercial products from GIBCO-BRL® (Cat. #18263-012 and #18296-012). Either QFX™ Micro Plasmid Prep Kit (Pharmacia Biotech) or QIAprep Spin Miniprep Kit (QIAGEN) was used for plasmid purification. Taq DNA polymerase. PCR buffers, dNTP. etc. used in PCR reaction were obtained from GIBCO-BRL or Promega. A ll primers were ordered from GIBCO-BRL. All the restriction enzymes (BamHI. Xhol. Hindlll. EcoRI. etc), buffers. T4 DNA Ligase. Calf Intestine Phosphotase. etc. used in the cloning were provided by NEW ENGLAND BioLabs. pGEM®-T Easy Vector system I was ordered from Promega (Cat. #A1360). pCDL-SRa296-HM2BP plasmid was ordered from ATCC. Either GENECLEAN II KIT purchased from BIO101 (Cat. #1001-400) or the QIAEX II Gel extraction Kit (150) ordered from QIAGEN (Cat. #20021) was used for gel purification. SuperFect Transfection Reagent (4x1.2mi) was purchased from QIAGEN (Cat. #301307). Prestained SDS-PAGE standards. Broad Range and 1Kb DNA ladder were obtained from by GIBCO-BRL. Cell culture media RPMI 1640 and PBS were provided by cell culture core facility in USC. DMEM with high-glucose. Penecillin/streptomvsin solution. L-Glutamine-200mM and Fetal Bovine Serum (FBS). 16 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. were purchased from GIBCO-BRL (Cat. #11965-092, #15140-122, #25030-081, and # 15561020). Protease inhibitors PMSF, Leupeptin. and Aprotinin were obtained from Sigma. SDS protogel buffer and SDS ultrapure gel. were ordered from Clinical Diagnostics. Methods Yeast two-hybrid system Basically, the protocols in MATCHMAKER Library user manual (CLOTECH) were followed. Some o f the methods were modifted if necessary. The general diagram indicated the procedure was shown in Figure 1 . Construct DNA-BD/bait plasmid 4 Test for autonomous reporter gene activation 4 Check toxicity to veast cells 4 Titer AD/cDNA library 4 Amplify the plasmid library 4 Verify phenotypes of yeast strains ' 4 Cotransform bait plasmid and cDNA plasmid library in veast strain 4 Select on SC-Leu-Trp-His plate (His+ selection) 4 (3-galactosidase assay 4 Eliminate false positives 4 Plasmid isolation from yeast Figure 1. The schematic diagram for the yeast two-hybrid screening1 . 17 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Construction of bait plasmid ('pGBT9-sapB): Primers: 5’- CGGAATTCGGGGACGTTTGCC AGGACTGC-3' (SapB-5’ EcoRI) and 3 '-CCCAAGACACTACTCCACTTTACTCCTAGGCGC-5'(SapB-3*BamHI) were used to amplify sapB plasmid and the gel purified fragment was cloned into pGBT9 vector digested with EcoRl and BamHI. Several yeast strains CG-1945. Y190. and HF7C were tested and compared with each other for selection to check tor autonomous reporter gene activation. Used the bait plasmid to treat the yeast culture in different concentrations and observe the growth status to test for toxicity to yeast cells. Titered the efficiency of the commercial HeLa cDNA library before start. Used the following formula to calculate the titers: Titers=colony # x Dilution times xlO3 xlO3 (cfu/ml). Titers greater that 10s cfu/ml were regarded to be representative to screen the library. Amplified the HeLa cDNA library on YPD plates (20g/L Difco peptone. lOg/L Yeast extract and 20g/L Agar) and incubate at 30°C for 4-5 days. Then scraped the colonies and purified the plasmid from the yeast culture. Cotransformation in veast strain: Transformed bait plasmid. HeLa cDNA plasmid library, and both o f them into a reporter strain (CG-1945). Then selected on SC-Leu. SC- Trp. SC-leu-Trp. and SC-Leu-Trp-His plates respectively. Simutanous cotransformation was preferred using LiAc/ss DNA/PEG method2 ’3'4 \ [PEG/LiAc solution (10ml): 8ml 50%PEG (Heat d.d.HiO first, then add PEG (Polyethylene glycol Sigma #P-3640) 300g, dissolve and make sure volume is 600ml. Aliquot 100ml to each bottle, make a marker on each bottle and autoclave.). 1ml 1M LiAc/TE. 1ml d.d.HiO, mix well.] Added the freshly prepared yeast competent cell (resuspended in LiAc) to the mixture o f plasmid and 18 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. herring trestes carrier DNA (boiled it for 20 min and put it on ice immediately to renature it before use). After incubation at 30°C for 30 min, DMSO was added and heat shock was processed to let DNA tranform into cells. The transformants were assayed for His3 and P-galactosidase activity. Set both positive and negative controls to avoid unevaluabie results. The expected results o f transformants are listed in Table 1 . Table 1. Transformants growth on selective plates SC-Leu SC-Trp SC-Leu-Trp pGBT9-sapB + (Bait plasmid) HeLa library plasmid + (Prey plasmid) pGBT9-sapB+HeLa library plasmid - r - 4 * -j- (Bait plasmid+Prey plasmid) no plasmid (control) *SC medium (plates): Weight out SC pre-mix 7.81g/L from the bottle (Shake well before use) (YNB (without AA and AS) 1.7g/L. Ammonium sulfate 5.0 g/L. L-Arg-HCl 0.02 g/L. L-Tyr 0.03 g/L. L-Ile 0.03 g/L. L-Lys-HCl 0.03 g/L. L-Phe 0.05 g/L. L-Glu 0.1 g/L. L-Asp 0.1 g/L. L-Val 0.15 g/L. L-Thr 0.20 g/L. L-Ser 0.40 g/L). Add 880 ml deioned H2 0. adjust pH to 6.5 with 4N NaOH (600~800pl). Only for the plates, add Bacto-agar 20.O g. Add the following stock lOx DO supplement solution (missing anyone when making new selective media): Adenine sulfate (2mg/'ml) lOml/L. Uracil (2mg/ml) lOml/L. L-Trp (lOOmg/ml) 2ml/L, L-His-HCl (lOmg/ml) 2ml/L. L-Met (lOOmg/ml) 2ml/L. and L-Leu (lOOmg/ml) 3ml/L. Shake well and autoclave for 20 min. After autoclave, add 20% Glucose 100ml to the flask, mix well, and pour the plates. Colony lift B-salaciosidase filter assay6 : The oriented filter lifting out the transformant colonies from the agar plate was frozen into liquid nitrogen pool and thawed at room temperature. Then the filter with the fresh colonies side up was transferred on the presoaked filter with the freshly prepared Z-buffer/X-gal solution [100ml Z-buffer (Na2 HP04-7H2 0 16.1 g/L. NaH2 P04 H2 0 5.5g/L. KC1 0.75g/L. MgS04-7H2 0 0.246g/L. 19 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Adjust pH to 7.0 and autoclave), 0.27ml p-mercaptoethynol (Sigma #M-6250), and 1.67ml X-gal stock solution [Dissolve 5-Bromo-4-Cholro-3-indolyl-P-D- galactopyranoside (X-GAL; #8060-1) in N.N-dimethyformamide (DMF) at 20mg/ml. Store in the dark at -20°C]. Positive colonies were observed to turn blue after several minutes to hours after incubation at 30°C. White colonies were detected to be negative ones. The overgrown colonies that turned to blue were not reliable and needed to be retested once to confirm the results. Eliminate false positivess: Using sterile toothpicks to scratch the transformants from SC- Leu plate and switch to SC-Leu-Trp, and then on SC-Leu plates, respectively, in an ordered grid for later recognition. Those colonies that did not grow on SC-Leu-Trp plate (Trp auxotrophs). but did grow on SC-Leu plate, were defined to be candidate positive clonies. Later verification was to test His3 expression. If the function was positive, or p- galactosidase assay showed positive result, then the colony was saved to further purify the plasmid. Otherwise, it was discarded as false positive. Purified the candidate plasmid o f candidate clones from yeast. Transformed the yeast plasmid into E.Coli to increase the expression yield. The initial chemical transformation using DH5a competent cells selected on LB/amp plates were turned to electroporation9 using HB101 competent cells selected on M9-Leu minimal plates [add 4ml lOmg/ml proline (filter-serilized). I ml 50mg/ml ampicillin. 1M thiamine-HCl to M9 medium (Na2 HP04.7H2 0 64g/L. KH2 P04 15g/L. NaCl 2.5g/L. NH4 C 1 5.0g/L. 20% Glucose 20ml/L) after autoclaving and cooling to 50°C. For plates. 20g/L agar was added to the media before to autoclave. The selective medium can be added as SC selective medium as mentioned above]. Then the plasmid was isolated from the transformants in E.Coli. 20 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Auto-sequencing the DNA was done by the core lab facility in USC using GAL4 Activation Domain Sequencing Primer (Clotech Cat#: 6743-1): 5'- TACCACTACAATGGATG-3'. Then the sequence was analyzed using GeneBank1 0 The alignment between the query sequence and database sequence was performed via BLAST similarity searchingl2 lj I4. Subcloning, protein expression and purification Construct nGEX 4T-1- H I2 plasmid and purify the GST-CvpC protein Cloned H12 PCR product insert into pGEX 4T-1 vector: Use primers G538 (Cyp C-5" end : 5‘-CGCGGATCCATGGGCCCGGGTCCTCGG-3’ ) and G539 (Cyp C-3’ end: 5*- CCGCTCGAGTCACCAATCAGCGATCTCAAC-3’) to amplify H12 plasmid at 94°C 1 min. 57°C 1 min. 72°C 1 min for 25 cycles. Used the restriction enzymes (BamHI and Xhol) to digest pGEX 4T-1 plasmid. Ligated the two fragment and transformed the ligation products to LB/amp plates [Add agar (20g/L) to LB medium (Bacto-tryptone lOg/L bacto-yeast extract. 5g/L NaCl 5g/L. adjust pH to 7.0 with 4N NaOH. Autoclave. Store at room temperature.), autoclave for 20 min. cool to 55°C and add ampicillin to 100|ig/ml. Pour plates and store at 4°C.). Verified the transformants for recombination. Purified the GST-CypC protein: Inoculated one colony from the LB/amp plate to 10ml LB/amp culture and incubated at 37°C with shaking at 250RPM overnight. Transferred the culture to 1000ml LB/amp media and continued to incubate at 37°C with shaking at 250RPM until OD6 o o : 0.5. Added IPTG 0.4 M and continued to grow at 37°C with shaking at 250RPM for 4 hours. Centrifuged the culture at 3000RPM for 20 min to spin down the pellet. Resuspended the pellet at cold lxPBS buffer and centrifuged again at 21 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 3000RPM for 20 min to spin down the pellet. Stored the pellet at -20°C for later use. Resuspended the pellet with 50mM Tris (pH 8.0), 150mM NaCl, 1% triton, protease inhibitors: lpM PMSF, 20pM Leupeptin. 2(.ig/ml Aprotinin and sonicated on ice. Centrifuged at 13.000RPM at 4°C for 30 min. Save the supernatant. Resuspended the pellet as above, centrifuged again and save the supernatant. Resuspended pellet in 10ml 50mM Tris (pH 8.0). 150mM NaCl and 60mM DTT. Sonicated on ice until resuspension completed. While stirring on ice, added NaOH slowly till colour turned from light to dark (pH changes around 10.0). Adjusted pH to 7.5 again by adding 1M Tris (pH 6.8). 150 mM NaCl. and protease inhibitors: lpM PMSF. 20pM Leupeptin. 2pg/ml Aprotinin. Centrifuged at 16.000RPM at 4°C for 30 min. Saved the pellet and supernatant. Added GST-beads to all the above supernatant separately and bound at 4°C overnight. Ran all the samples o f pellet and supernatant binding on beads on 12% SDS PAGE and detected GST-CypC is in the inclusion bodies. Construct pRSET C-CypC and purify the protein His-CwC Cloned the H12 insert (BamHI and Xhol digest) into pRSET C vector (BamhI and Xhol digest) and select the recombinant transformants. Verify the construct via PCR (primers: G538 and G539). His-Cyp C protein was purified on the almost same principle o f the GST-CypC protein, except that His-Cyp C protein was in the cell pellet instead o f inclusion body. So the purification protocol was modified to sonicate the cell pellet only and throw away the supernatant. The binding assay was almost the same as above, except the different binding buffer (lxH is binding buffer: NaCl. imidazole, 0.1% Triton-XlOO. protease inhibitors: lp M PMSF. 20pM Leupeptin. 2ug/ml Aprotinin) and Ix washing buffer 22 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. (Buffer G: 50mM Tris-HCl pH 7.5, 5mM MgC12, mM DTT. 20mM KC1 or Buffer A: 50mM Tris-HCl pH 7.5, 5mM EDTA, ImM DTT, 20mM KC1). Western blot analysis (binding assay in vitro) Prepared the following samples GST-CypC beads +His-SapB, GST empty beads only + His-SapB. and His-SapB using 50% slurry GST-beads binding (lx binding buffer: 150mM NaCl. 50mM Tris-Cl (pH 7.5). Im M MgCb. 2mM CaCH 0.5% triton X-100. BSA) at 4°C overnight. Span down the beads and washed the beads [lx washing buffer: 150mM NaCl. 50mM Tris-Cl (pH 8.0)]. 3 times with 1% Triton-XlOO. 2 times without 1% Triton-XlOO. Ran the above samples on 12% SDS PAGE and transferred the gel to Immuno-Blotu PVDF Membrane (BIO-RAD cat#: 162-0177) in the transfer buffer (Tris Base 6g. Glycine 3g, 10%SDS 3.7ml, CHjOH 200ml. and add d.d.H^O to the total volume 1000ml) at 200 mA current for 1 hour. Blotted the membrane in 5% nonfat milk in IxTTBS solution (Tris base 2.42g/L. NaCl 29.2g/L. Tween-20 lm l/L, pH 7.5) at room temperature for I hour. Added primary antibody anti-saposin (USC 9KD) at 1:1000 dilution in 1% nonfat milk in IxTTBS solution at 4°C overnight. Washed the membrane with IxTTBS. 15 min. 4X. Added the secondary antibody anti-mouse IgG-AP (200pg/0.5ml) (Santa Cruz Biotechnology Cat#: SC-20006) at 1:3000 dilution in nonfat 1% milk in IxTTBS solution at room temperature for 1 hour. Then washed the membrane with IxTTBS. 15 min. 4X. The last wash was using lxTBS (Tris base 2.42g/L. NaCl 29.2g/L. pH 7.5) for 10 min. Rinsed the membrane with Immuno-star substrate (BIO RAD) and developed the X-Ray film in the dark room. 23 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. pcDNA3.1(-)/Myc-His-HM2BP construction and transfection Construction ofTA-H M 2BPl plasmid Gel purified PCR product o f pcDL-SRa296- HM2BP plasmid and cloned it into pGEM®- T Easy Vector. Primers: G547 (5'-CCCAAGCTTGTCCACACCTGAGGAGTT-3') and G545 (5'-TGGAATTCCACACTGTGCC-3') were used to perform PCR reaction at 94°C for 45 sec. 57°C for 45 sec. 72°C 45 for sec with 20 cycles. Construction o f pRSET A-HM2 BP plasmid Restriction enzymes (BamHI & Hindlll) digestion for both pcDL-SRa296- HM2BP plasmid and pRSET A plasmid to prepare for the corresponding HM2BP insert I and pRSET A vector. Then the insert was ligated into vector and transformed to select the recombinants. Confirmed the construct by PCR. Construction o f pRSET A-HM2BP (-TAG) plasmid Restriction enzymes EcoRI and Hindlll were used to digest TA-HM2BP PCR plasmid to prepare for the insert. The insert was cloned into pRSET A-HM2BP vector (cut with EcoRI & Hindlll). Ligation and transformation were done to select the recombinant clones. Confirmed the construct by restriction enzymes digestion. Construct ofDcD NA3.l(-h\Ivc-His A- HM2 BP plasmid Restriction enzymes (BamHI & Hindlll) digestion for both pRSET A-HM2BP2 plasmid and pcDNA3.1(-)/Myc-His A plasmid. The relevant insert and vector were gel purified and then ligated and transformed to screen the recombinant clones. Confirmed the construct by restriction enzymes digestion. Verify the construct by auto sequencing Transfection and sene expression Check the different doses o f G418 on COS7 cells and NIH3T3 cells. 24 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Transfected the pcDNA3.1(-)/Myc-His A-HM 2BP plasmid into COS7 and NIH3T3 cell, respectively, as shown in QIAGEN SuperFect Transfection Reagent Handbook. G418 selective marker was used for selecting the survival for the DNA transfected cells. The expressed protein was secreted into the supernatant o f the culture and the HM2BP protein was purified by picking up the supernatant and binding on His-tagged beads. lxHis-binding buffer and lxHis-washing buffer were the same as before. Then verified the protein on 10% SDS PAGE. Western blot analysis was performed as mentioned above except using 1:1000 anti c-myc antibody (1 mg/ml) as the primary antibody and 1:3000 anti-mouse IgG AP (200ng/0.5ml) as the secondary antibody to detect the HM2BP protein expression. References 1 MATCHMARKER Library User Manual (PT1020-I) 2 Gietz. R.D.. Woods, R.A. High efficiency transformation of yeast with lithium acetate. In J.R. Johnston (ed): Molecular Genetics of Yeast: A practical approach. Oxford University Press. 121-134. 1994. 3 Hill. J.. Donald. Y.A. and Griffiths. D.E. DMSO-enhanced whole cell yeast transformation. Nucleic Acids Res. 19:5791,1991. 4 Schiestl, R.H. and Gietz. R.D. High efficiency transformation o f intact cells using single standed nucleic acids as a carrier. Current. Genet. 16:339-346,1989. 5 Gietz. D.. St. Jean, A., Woods. R.A.. and Schiestl, R.H. Improved method for high efficiency transformation o f intact yeast cell. Nucleic Acids Res. 20:1425.1992. 6 Breeden. L. and Nasmyth. K. Regulation o f the yeast HO Gene. Cold Spring Harbour Symposium Quant. Biol. 50:643-650.1985. 25 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 7 Schneider, S., Buchert, M. and Hovens. C.M. An in vitro assay for p-galactosidase from yeast. BioTechniques. 20:960-962,1996. 8 Finley, R.L., Brent,R. Interaction mating reveals binary and ternary connections between Drosophila cell cycle regulators. Proc. Natl. Acad. Sci. USA. 91:12980- 12984.1994. 9 Sambrook. J.. Fritsch. E.f. and Maniatis, T. Molecular cloning: A Laboratory Mannual (Cold Spring Harbour labrotaries, Cold Spring Harbour, NY). 1989. 1 0 Benson, D.A., Boguski. M.S., Lipman, D.J. et al. Nucleic Acids Res. 26(1): 1-7. 1998. " Benson, D.A.. Boguski. M.S.. Lipman, D.J. et al. GenBank. Nucleic Acids Res. 27(1): 12-17. 1999. 1 2 Altschul. Stephen. F.. Thomas. L. Madden. Alejandro, A. Schaffer. Zhang, J.. Zheng Zhang. Webb Miller, and David J. Lipman. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 25:3389-3402.1997. 1 3 Zhang, Z.. Schaffer. A.A.. Miller. T.L.. Lipman. D.J.. et al. Nucleic Acids Res., 26:3986-3991.1998. 1 4 Zhang. J.. Madden. T.L. Genome Res., 7.649-656. 1997. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Chapter 3 Results H12 interacts with saposin B in the yeast two-hybrid system The DNA-BD bait plasmid (pGEBT-sapB) and AD HeLa cDNA plasmid were transformed into yeast Y190. CG-1945 and HF7C strains, respectively. CG-1945 strain was less leaky for His3. So it was selected in the library screening. H I2 was a true positive gene screened from the yeast two-hybrid system. The DNA-BD bait plasmid pGEBT-sapB was selected to grow on SC-Trp plate. The AD HeLa cDNA library plasmid H I2 was selected to grow on SC-Leu plate. The cotransformants of pGBT9-saposin B and H12 could grow on SC-Leu-Trp plate. If the cotransformants were selected to grow on SC-Leu-Trp-His plate, it was indicated that pGBT9-saposin B and H12 had interaction and thus activated His + expression (Table 1). Also p-galactosidase assay was performed to the cotransformants and positive blue colonies were detected to confirm the LacZ function (Table 2). To make the result convincing, both positive controls and negative controls were set every time. Table 1. His 3 expression of H12 on SC-Leu-Trp-His plate (His-*- nutrition selection) SC-Leu-Trp-His SC-Leu SC-Trp SC-Leu-Trp pGBT9-sapB+H12 plasmid 4 - + + + pGBT9-sapB plasmid - + - H 12 plasmid + - - no plasmid - - - 27 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Table 2. P-galactosidase activity (Lac Z function) of H12 SC-Leu-Trp-His SC-Leu SC-Trp SC-Leu-Trp pGBT9-sapB+H12 plasmid blue white white blue pGBT9-sapB plasmid - - white - H 12 plasmid - white - - The sequence of H12 is aligned to cyclophilin C in BLAST sequence alignment of Genbank. Due to the long length o f H I2 plasmid, it was sequenced twice using the primer from both ends of the AD vector to learn the complete information o f the fragment (Figure 1. 2). To sum up. it was reported that H12 was the 1200 bp length gene. The sequence o f H12 was searched in GenBank to be aligned to cyclophilin C. It showed that H12 encoding the protein identical to cyclophilin C in BLAST program. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. i k I llWtLk 7:c^»C T ^A :A '^77.^A ^lX T *^l^rr\rT ir> w cc^V vW A yC A Tr:^A 'G G <^.vr:A rA 4?c^^*::x:x;A ::A ,^ T n G :,^ r a 3 C jr G G 7 C « r A T G G C C ‘ - iT 0 G « G C . . > :• 4 *■ : 60 70 a- • • ■ . r n o n o A i. -fc te -'iv M i :;•. 0GGa^v:v<VAr*c3rax.\*a*c::*(»w:-'-':.*G'a,:*Gc:AGC3c-::j(rftr*acrA<r{xr:a*':ar:v4,',cr’?.:^:w-:-C03i.V'*c3GGxr*--.'Gtr 'G crrx^w rarorvr": . ••; u c ! 6 * . 130 ‘ . f«o j n 2 10 : . r . 4 ’ U m u < t ,. /I * ■ * lAA i ■ A iM M L l : ( r s x o r • . • . : a x 3 o v : 7 3 : c : t .• t:\~ .t3 0 C C G V 3 v a G 3 % — ' % ~a*AAGc 150 26 0 27C 23G 290 300 w?'GG> .. • .’t” * Cij ’ 0 «\.'ci> ’AAGG ...’. . • C V \ tT'GAGGA .’rGGAi>.\(7v« a u a 0- GG Aii/'.X )V . A /V ■ 1 1 a m ' a j H w i i V r - CJYGA.’ ’ 3 2 ? * C " X C G A A A /.G .” G ?G s»’ V vX G A -lX G rG C 'A w ' \ *". G ’ * 3 1 . ' * <2. A /v A C G A G i" '^ \A G G A !’A G G A A AA A G G A A w i A?* 3 ..« G ' G .'- «v\£3G A iy;vam,v ' V llh W ti [' V\~A :-A— \i~j‘. /W M hA A 3* " 'AAGGAGG- G/v'A " * ■ . . \ \ . GGXGA G O A GGGGGTO' GAO- A ? " ■ * ATGG' 3/* 0 \v " . .,.'*"*ACA.GAGAA ’ " r'AAO>*" fj*v’ O /V . A . OC».A • . GGO- GG^j . •. p X2 A . 1 *>00 923 930 i -\ ' 5 50 5 r ,;. t "■*, v - : 590 6 0 0 6 t o b : • c a a ' c c : - ® < r • r c / c / c - 'A a t g c t : r* .C A < r ? r rr:A rw k c rr r3 A c u \A G r r> > c :- G o rr c G A -’ GOCAa a t a t g r a s r o r r r x . v v w x r : a t t c /c o s g a ?5 v t»otogto-. 1C 6 2 0 •> )': ' . 4 ' • • . : 6 6 0 ‘ X 6 6 0 ► >" "C C r - : * q c \ ^ v A - - j a:*t. :a - a a e rr *ca/gcaav tgatcxb-.t- ■•SA.rsrr\T-?*v:wv.’ rrN r :t3a-^%t»w, c g - 4 ? ' ‘-.I ~90 Figure l.The sequence o f H12 plasmid (partial). 29 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. m r r r t c s c A G a : c c • .:? ' S / e . L 20 7I A A A / C '.A '". ' . ' I A A . A r A A A G A A G A G G A A A G C / C C C T • • G I V A G A A A G A A A 777 \ . A . G A C A " " A r ‘ ‘ ‘‘ ^.‘ A G A T 'T A C A C ta: . t : G A A r . - r r T G r T C O A T A i- iV A A *nv - . a a t a ~ ’ ’ ‘ atr .** C .'' " A f t A 'A A A I CT'.’ ' . A G -’ a 1 'A '.V "A A7«\ rG G G C A . • .*A 7.V «. «3AA 7 7 .'A G iiA ,,. i A 'A > \ . . - . 2 C 0 . . - : M M A - - G 7 . V . . " ? A n A A A . X T A G . v A . 2 6 3 A G " ’ ’ A A A A ’ A G A ’ V A . " 7 G A S G A m C O G G A 1 A HA . ’ t ’ . 'A A .G 7 7 ' 7 w \ A ( J ? ' ? r C T A A 3 T iV J G T G G V 7 7 * C ..• ^ A A v j • '! " « • A G j \ < V - ' . 3 1 0 3 4 0 ? ■ “ ' : 6 \ k J ^ & W u i_' ’ A . X A G G G . G i’v ? O G 77 G A ” *I~T, 7A T n A i " \*7 "* " - T G r G A ! G 3 3 A..1 A G < V \ A - " A A A / ' A G A A / \ G ’ .7' A , V \ A » \ A A A A . V / ►37A A A W r G - \ A A C . \ . ' j ' . •*> » .••."•» A A * A> A . A i A . /» • A ■ 5 7 3 * j -.. ... 4 .-;. J-' 4 ? -: > ll-'u Vll. jJ j [v j * A -." .V A ' * A ' I A . ’ V (J» * 'A A A Q " A . A I N " . T G / ' - ’ I I 7 7 3 3 7 C P ~ G T G T ' A V I " A A ? A G - G A 7 I r A A * . . . V A m A A G G * 3 . . " ' 7' j x . 3 . . A . N t * . 3 " - . » . . C . . G ;»>■ - a ; : . ' 5 3 3 - .V • ’ 5 9 3 : G 7 r o r j i 5 0 C n«t, a ,, h r - A ^ l n i t o a j u . lUliUL'U r j’C T ra a ’ XAcrnc k o g '.^: cr: »:c a g :': s - r . ~ . o g .\c t "!C/■ -« ;a o t a'A;- a ~ a :;,rc"-';ca - C G . ‘ -cv— C 3 % v c v 3 :.v t ~rrc^?rr~.vc-Aa3Tj3Gr:Ts • . : 6 2 0 - : . 6 4 0 6 5 0 • : • . - : • . • " ' •'■ ■ •' 7 0 0 rc * 0 3 3 * 3 * 7 5 * A A A A O 7 G A ^ n :A rc < 7 7 G '’tM ir 3 . ? W C G i * : 3 S 3 T A t K "iG ■ “ ' 7 6 3 ^ A x v i & A I f x A X ‘* a i A Figure 2. Sequence of H12 plasmid (partial) cont. 30 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. H12 encoding the protein cyclophilin C interacts with saposin B in vitro Both the GST-tagged and His-tagged expression system o f H I2 gene were successfully constructed. H12 PCR product was cloned into pGEX 4T-1 vector to construct the GST-tagged expression system (Figure 3). H12 and pRSET C plasmid were digested with BamHI and Hindlll, respectively. The purified insert and vector were ligated to construct the His-tagged expression system (Figure 4). 1 2 .3 4 5 6 800 bp “ ► Figure 3. PCR product o f H12 plamid, the candidate gene screened from yeast two- hybrid system. Lane 1. 2. 3, 4 were the PCR product (about 800bp fragment) of H I2 plasmid. Lane 5 was H12 plasmid. Lane 6 was 1Kb DNA standard marker. 31 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 1 2 3 4 5 2.9 kb 800 bp Figure 4. Insert (H I2) and vector (pRSET C) preparation. Lane 1 was 1Kb DNA standard marker. Lane 2 and 3 were H I2 plasmid and H12 insert after BamHI and Hindlll digestion, respectively. Lane 4 and 5 were pRSET C plasmid and pRSET C vector after BamHI and Hindlll digestion, respectively. Both the GST-tagged and His-tagged Cyclophilin C protein were purified from E.Coli. GST-tagged Cyclophilin C was purified from inclusion body and molecular 32 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. weight was 77KDa (Figure 5). His-tagged Cyclophilin C was isolated from the cell pellets. The molecular weight was 50 KDa (Figure 6). 77KDa Figure 5. SDS PAGE o f GST-Cyclophilin C protein. Cell pellets were shown in Lane 6 (with no IPTG induction), Lane 5 (Im M IPTG induction) and Lane I (final cell pellet). The supernatant 1 and 2 during the purification were loaded on Lane 4 and 3. GST-CypC beads were detected on Lane 2. SDS broad range marker was loaded on Lane 7. ^ ■ * » Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Figure 6. SDS-PAGE o f His-Cyclophilin C protein. Lane 1 was His-CypC protein, lane 2 was soluble GST-saposin B. Lane 3 was SDS broad range marker. The binding assay showed that GST-tagged Cyclophilin C did not bind specifically to soluble His-saposin B (Figure 7). For Flis-tagged Cyclophilin C. no binding band was found in western blot with soluble GST-saposin B (Figure 8). 34 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Though no promising binding was found in vitro, we cannot eliminate the possibility o f the cyclophilin C and saposin B have interaction in vivo. Further test is to be done to verify the hypothesis. Figure 7. Western blot analysis o f binding assay o f GST-cycIophilin C and His-saposin B. Lane 1 and 2 were GST-cyciophilin C beads bound on soluble His-saposin B protein. Lane 3 was GST-beads bound on His-saposin B protein. Lane 4 was His-saposin B soluble protein. Lane 5 was the SDS PAGE broad range standard marker. 35 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 1 2 3 4 5 Figure 8. Western blot analysis o f binding assay of His-cyclophilin C and GST-saposin B. Lane 2 and 3 indicated the binding reaction washing with buffer G. Lane 2 was His- cyclophilin C beads bound on soluable GST-saposin B protein. Lane 3 was His-beads bound on GST-saposin B protein. Lane 4 and 5 indicated the binding reaction washing with buffer G. Lane 4 was His-cyclophilin C beads bound on soluble GST-saposin B protein. Lane 5 was His-beads bound on GST-saposin B protein. Lane 6 was GST- saposin B soluble protein. Lane I was the SDS PAGE broad range standard marker. 36 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Human Mac-2 binding protein is the potential candidate protein to be further studied to interact with saposin B pcDNA3.1(-)/Myc-His A-HM2BP plasmid was successfully constructed. The series o f construction o f pcDNA3.1(-)/Myc-His A-HM2BP plasmid were completed step by step. To get rid o f the stop codon in the full length o f human Mac 2-binding protein (HM2BP) amino acid sequence. PCR product o f pcDL-SRa296-HMiBP was gel purified and cloned into pGEM (T-A vector). HM2BP BamHI/XhoI digested product cloned into pRSET A vector was constructed with the stop codon in the full length o f human Mac 2- binding protein (HM2BP). Finally, cloned the fragment without the stop codon into Mvc- His-tagged expression vector pcDNA3.1(-)/Myc-HisA. The purified plasmid was confirmed by sequencing and got satisfactory result. Details o f the above construction were designed in Figure 9. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. p c O L * S R o 2 9 6 pRSET A plasmid 4 BamHI/Xhol pRSET A vector 4 Ligase pRSET A- HIM;BP plasmid lEcoRI/Hindll! pRSET A- HM2BP vector PCR (EcoRI/Hindlll) pCDL-SRcx296-HM2BP— ► HM2BPCR pGEM-T-Easy vector 4 BamHI/Xhol I ------------------------------- 1 HM2BPinsert 1 4 Ligase --------------1 TA-HM,BP Ligase 4 EcoRI/Hindlll HM2BP insert2 pRSET A- HM2BP(-TAG) 4BamHI/HindIII HMiBP insert3 pcDNA3.1(-)/Myc-HisA plasmid 4 BamHI/Hindlll pcDNA3.l(-)/Myc-HisA vector J pcDNA3.l(-) /Myc-HisA- HM2BP plasmid Figure 9. Schematic diagram o f pcDNA3.1(-) /Myc-HisA- HM2BP plasmid construct. 38 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Step 1: TA-HM2BP PCR plasmid was constructed by cloning the PCR product of pCDL-SRa296-HM2BP plasmid into the pGEM-T- Easy vector (T-A vector). Step 2: construction o f pRSET A-HM2BP plasmid was completed. Restriction enzyme digestion with BamHI and Xhol o f pCDL-SRa296-HM2BP plasmid and pRSET A plasmid to prepare for the relevant HM2BP insert 1 (800bp fragment) and pRSET A vector (2.9 kb fragment) for cloning, respectively (Figure 10). The recombinant plasmid was confirmed by PCR (G65 and G 102 primers). 1 2 3 4 5 6 7 8 9 10 2.9 kb -► Figure 10. Restriction enzyme digestion of plasmid. Lane 1 was the DNA lkb marker. pCDL-SRa296-HM2BP plasmid was shown in Lane 2 and BamHI/Xhol digestion was shown in Lane 3 and 4. pRSET A plasmid was shown in Lane 5 and BamHI/Xhol digestion was shown in Lane 6 and 7. Lane 8 was the constructed plasmid TA-HM2BP. The EcoRI/Hindlll digestion o f the plasmid (HM2BP insert 2) was shown in Lane 9 and 10. 39 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Step 3: further constructed pRSET A-HM2BP(-TAG) plasmid. EcoRI /Hindlll restriction enzyme digestion o f TA-HM2BP plasmid was prepared as HM2BP insert 2(Figure 10). EcoRI /Hindlll restriction enzyme digestion o f pRSET A-HM2BP plasmid was prepared as pRSET A-HM2BP vector (Figure 11). Ligation was performed to screen the recombinants. Restriction enzyme digestion was performed to verify the construct (Figure 12). 5.5 kh Figure 11. pRSET A-HM2BP plasmid digested with EcoRI and Hindlll. Lane 1 was DNA 1 kb ladder marker. Lane 2 was undigested pRSET A-HM2BP plasmid. Lane 3 and 4 were the pRSET A-HM2BP plasmid after EcoRI and Hindlll digestion. 40 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 1 2 3 4 2 3 4 234 Figure 12. The construct pRSET A-HM2BP(-TAG) was verified by restriction enzyme BamHI and EcoRI /Hindlll digestion, respectively. Lane 1 was the DNA 1 kb marker. Lane 2 was the plasmid. Lane 3 was BamHI digestion. Lane 4 was EcoRI /Hindlll digestion. The figure indicated three candidate plasmid confirmed by the restriction enzyme digestion. Step 4: pcDNA3.1(-)/Myc-His A-HM2BP plasmid was constructed. Restriction enzyme digestion with EcoRI & Hindlll for both pRSET A-HM2BP (-TAG) plasmid (HM2BP insert 3) and pcDNA3.1(-)/Myc-His A plasmid (pcDNA3.1(-)/Mvc-His A vector), separately. After ligation and transformant selection, the recombinant plasmid was confirmed by PCR. 41 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 1 2 3 5.46 kb 800 bp Figure 13. The gel purified fragment o f insert and vector after EcoRl/Hindlll digestion. Lane 1 indicated the insert derived from EcoRI /Hindlll digestion of pRSET A-HM2BP (-TAG) plasmid. Lane 2 showed the vector obtained after EcoRI /Hindlll digestion of pcDNA3.1(-)/Myc-His A plasmid. Lane 3 was 1Kb DNA standard marker. 42 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 800 bp 800 bp Figure 14. PCR verification o f the pcDNA3.1(-)/Myc-His A-HM2BP plasmid. Finally, verify the constructed pcDNA3.1(-)/Myc-His A-HM2BP plasmid by sequencing. The report o f the sequencing got the confirmed sequence (Figure 15). Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. T T 7 ^ ? e r ^ m p c / x r i X T ^ A r T ' 7 J C ( ^ 7 ^ r ^ ^ T g r T g r r c ( 7 ^ G G C G C T A r r ^ g > T c c - ? c r 7 c r G ^ G A T T ^ ^ , ! v \ , ' ' u , i , - v ' G G S ^ c r > ^ . ^ T ^ r ^ A ' r ~ < y c G A G r : 3 c 2C v 4 3 50 * c v , s o »: ic o ;;■ ; 1 2 0 ?rCAG<7rAGAAC3GQOrGG^TG^C':CjrGC.*GC?ui,lGCC®‘TGAAC’r<E f.TTtjCGtEGCAGGGGA^GAGGAGGVOG “ CTICGftGCTCr'IGGrGrCCrtGGGCACTCGGfiATCXAX 7 7 'X 3 kG 1 3 0 u o i s o 1 * . i r . ; * : ’9 0 2 :0 ; : ' 2 2 0 •.: .'rrG P A A rcocjra w cr:':: c r :v c gaagac: rc- r ? : <xa a w ra v ^ , 0 3< rrrT (r'rT ra r^G c r'A A 'rG G ^ (y :» ^ :-.’G A G cr(r ^ g a : rTGGixsAcxcoNGGAC^coG a g c ^ ib o 2 6 0 : • - ) : * c , m . *? ;: 3 2 0 M " • ;• : is o * « : 1 • \ > l( G" ""7^ G G A G T A G G A G A /G C 'C .A ffA Iir C A G C A G C T ’.?'. G G A rG G T G G G G A G 'o T A G A -"L A Q 3 G /u A A G G A C A d " <!T» . rO 'V .*'.G G A A G ^ G 3 A A G C T w G G G I 3 . I'G .G G A G . - .G G A /C G / • • ' 3 3 0 • » - $ 4 1 0 s r P 1 4 * 4 * " i r : 4 • ^•rGCTAOS 0C2VGTAT 27 ffTA G77AGAGGGGGC T7G GAAG77A r a G * .XSAATAT rTGfc.' • -AAAG3-* *C T . CTQCAv': GA .ACAv'TACl*: GTS/CI !7C (T G C fC '-V C G A AT "C T •; *•: - s : o S 2 C - .• 4 - s s o 5 6 0 ♦ •c r I.; jT^.-.^AAOKACrco'Jt?:c;(ix:c;\G<rrGu^AX-XC^'T'rc^ic^:xrax;:»cx;:TCAJ*:ccrr'77^rri!33CCAacAACToa.voGcc;cj'^r:cr:3C.\.\rrK:AK: • s l C o M 6 3 0 •>■.-'.■ 6 6 3 - T - 6 8 0 n : ” • • * ’ .'■ • 3 3 0 r \ W r ^ V W ^ o < v G C27G wtM G TCn’BETCTGGA AT/0GCCC TCUTQGC7I i2 7 C ^C M a B lG M 3 Q rrS A X rz ; ■»-»C 7 4 C 7 5 0 7 6 0 7 7 0 7 8 0 FigurelS. Autosequencing o f pcDNA3.1(-)/Myc-His A-HM2BP plasmid. Human Mac-2 binding protein was purified and shown expression after transfecting the DNA into COS7 cells and selected by G418 marker. Human Mac-2 binding protein was verified on 10% SDS PAGE. The molecular weight o f the protein 44 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. was 92 KDa (Figure 16). With Myc/His-tagged, anti-myc antibody was used to detect the expression of HM2BP in mammalian cells. The same 92 KDa band was detected by western blot (Figure 17). 1 2 3 4 92 KDa # * I * Figure 16. The expression o f HM2BP protein on SDS PAGE. Lane 1. 2. 3 were the protein purified from different dose (G418:1000ng/pl. 800ng/pl. and 400ng/,ul. respectively) culture. 45 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 1 2 4 < s r r Figure 17. Western blot showed the expression o f HM2BP protein after transfecting the DNA into COS7 cell and selecting by G418 selective marker. Lane 1. 2. 3 were the results from different doses o f G418 (1000ng/|il. 800ng/pl, and 400ng/pl. respectively). G418 at lOOOpg/pl was detected to have higher expression o f secreted protein. 46 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. The function o f Cyclophilin C-associated protein (Cy-CAP) human Mac-2 binding protein w ill further study the interaction o f Cyclophilin C and saposin B. The similar pore-forming structure o f saposin-like protein and human-Mac2 binding protein, gave us the clue to detect the mechanism o f them. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Chapter 4 Discussion Significance of the finding of the protein partner of saposin B By screening the yeast two-hybrid system, cyclophilin C was identified to interact with saposin B. This is the first finding o f the protein partner o f saposin B. The yeast twro-hybrid system is a novel way to detect the protein-protein interaction in our study. With the deeper understanding o f cyclophilin C. more and more research on saposin B will be oriented. The similar function and related structure o f the two proteins w ill update the knowledge and concepts, thus make contribution to the new field. Also, the tumor suppression mechanism o f saposin B will be further studied experimentally and clinically. Evidence of recent research has shown the potential interaction of saposin B and cyclophilin C. 1) Possible structure connection: saposin fold and pore-forming structure The famous 'saposin fold* gives the similar structure to other saposin like proteins. Cyclophilin C associated protein, human Mac 2-binding protein has the similar pore-forming structure as saposin like protein such as NK-lysin. 2) Function similarities Saposin B participates in protein folding. Saposin binds to lipid. Cvclophilins has been studied on catalyzing protein folding1 . So the hypothesis that cyclophilin C can help saposin B to participate in protein folding was presented. 48 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. "Other new research on apoptosis based on cyclophilin C indicated that the functions o f cyclophilin C were waiting to be studied. 3) Any other factors to be involved in the interaction? As we mentioned above, saposin B stimulates enzyme activity, but it does not interact with enzyme itself. It activates the substrate. If a substrate is required during the activation o f saoposin B-cyclophilin C interaction, we might not test the interaction without the help o f the substrate. If we think about cyclophilin C. cyclosporin A mediates its interaction with cellular proteins. Whether cyclosporin A is a necessary molecule in saoposin B- cyclophilin C interaction is unclear. So we may question 'Is there a substrate for saposin B to interact with cyclophilin C?* or 'Is there active molecule to participate in saoposin B-cyclophilin C interaction'? A lack of binding in vitro reconstitution does not rule out the possibility that the proteins do interact in vivo. Due to the function, mechanism, or interacting conditions, etc. even if we cannot confirm the interaction o f two proteins in vitro, no conclusion could be made that no biological interaction between them in vivo. No detection does not really mean no existence o f the interaction. Though no significant in vitro binding between saposin B and cyclophilin C in our study, we cannot state that saposin B and cyclophilin C have no interaction. It is possible that saposin B and cyclophilin C have interaction in vitro. However, the mechanism is not based on binding to each other alone. Or. the two proteins might interact with each other dependent on some other factors or special 49 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. condition. The protein complex formation may be involved in the interaction as well. Either a direct binding or an indirect binding is possible. Furthermore, it is still possible that cyclophilin C interacts with saposin B in vivo, however, the interaction might not be detected in vitro. There are some proteins can interact with each other. But their interaction cannot be detected by the yeast two-hybrid system. In our study. Gal-4 based yeast two-hybrid system was used to screen the library. It is possible that this system did not work on potential cyclophilin C-saposin B interaction. However, it might be detected on another yeast two-hybrid system, for example. Lex A based system. Any other approaches to test the interaction? The term o f interaction has broad meanings. It could be a kind of regulation between candidate proteins. Immunoprecipitation and western blotting are somewhat tricky. Recently. TNT transcription/translation system2 has been used to detect protein- protein interaction. In the alternative system. DNA with T7 prompter could be downstream transcribed to mRNA and then translated to protein. By 3 ? S labeling, protein- protein interaction can be detected on SDS PAGE. The system avoids the time- consuming step for protein purification and modification. It might also be a good trial in our study, compared to conventional binding assay. However, with less understanding of a protein o f our interest, yeast two-hybrid system is still a nice way to select candidate proteins. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. The better understanding of saposin B’s biological function is a big help to choose the best method to study. More and more research regarding saposin and lipid interaction has been paid attention. The mechanism o f the binding is under study now. Do the transmembrane protein and lipid bilayer have connection with saposin B? How about cyclophilin C? Is it possible that lipid become a participator for both o f cyclophilin C and saposin B to interact with each other? Possible or potential problems of binding assay 1) Set up both positive and negative controls successfully The best positive control is the other protein that has been known to interact with one o f the two test proteins. In our study, by using saposin B itself, we can only test whether the primary antibody anti-saposin works well. The better positive control is the protein that has been known to bind to saposin B. As we know, the study o f saposin B is relatively limited. The partner protein o f saposin B is still an open field to us. Due to the above limitation, the positive control is hard to obtain at present. The negative control is the protein that does not have any binding to any o f the two test proteins. The GST-beads without any bound protein was used in our study. It was supposed to show interaction with neither saposin B nor cyclophilin C. because His-saposin B protein was used. But the similar pattern o f binding band was still detected on GST-beads and His-saposin B binding and GST-cvclophilin C beads and His-saposin B binding, which confused our conclusion o f saposin B and cyclophilin C interaction in the binding assay. 2) Try' specific antibodies to confirm the analysis in various ways 51 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. To detect saposin B and cyclophilin C interaction, specific antibodies to both o f the proteins are essential. By using anti-saposin and anti-cyclophilin C antibodies, respectively, the confirmation test could be done or doubled checked thereafter. Say. we doubted that whether cyclophilin C was the protein partner o f saposin B. we could design another experiment if anti-cyclophilin C antibody is available. Or. we can set alternative controls in the binding assay to verify whether there is binding or not in several ways. 3) Modify the binding and washing buffer conditions in the binding process. Either binding condition or washing condition should be optimized to perfect the binding results. Different proteins have different requirements. A ll the temperature (4°C or room temperature), binding time (1-3 hours or overnight) and buffers depend. So select the proper condition for the binding environment for the specific protein is important for every binding assay. Future study and prospective 1) Further study the function o f cyclophilin C. It is an alternative way to verify whether it is possible to interact with saposin B or not. Not limited on the binding itself, other function study and pathway mechanism are necessary. 2) The construct o f recombinant human Mac-2 binding protein expression system gives us another clue to detect the mechanism o f sapoosin B. Though little has been known about human Mac-2 binding protein, it has the pore-forming structure similar to saposin-like protein. As the cyclophilin-associated 52 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. protein, human Mac-2 binding protein can bind to cyclophilin C. Whether human Mac-2 binding protein is a protein partner o f saposin B or not is still unknown. 3) NK-lysin is also one o f the saposin-like proteins of our interest. If we can express the NK-lysin protein, we can test whether it has interaction with saposin B. After RT-PCR based on the Jekart cell, clone the product into the expression vector, and protein can be isolated later. Binding assay can be tested the interaction of saposin B and NK-lysin in vitro. Moreover, the saposin-like protein family continues to be extended. One of the new members is granulysinJ. which indicated that it involves in apoptosis. 4) Continue to screen the yeast two-hybrid system to select other positive candidate genes encoding the candidate protein to interact with saposin B. 5) The modification of the yeast two-hybrid system provides more opportunities to test the protein and protein interactions. We can use multiple bait proteins4 instead of only one bait protein. For example, we can clone the saposin family members saposin A. B. C. and D. respectively, to construct different baits. This is a "more baits, more prey” event that becomes more efficient ways to screen candidate genes. Therefore more proteins could be checked to interact with the protein o f interest. References 1 Colley. N.J.. Baker. E.K. Stamnes, M.A. Zuker. C. The cyclophilin Homologue ninaA is required in the secreted Pathway. Cel1.67:255-263.1991. 2 Chen, D., Ma. H.. Hong. H.. Stephen. S., et al. Regulation o f transcription by a protein methyltransferase. Science. 284(5423):2174-2177,1999. 53 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 3 Gamen. S., Hanson, D.A., Kaspar, A., Naval, J., ICrensky, A.M.. Anel. A. Granulysin- induced apoptosis. I. Involvement o f at least two distinct pathways. Journal of Immunology. 161 (4): 1758-64.1998. 4 Grossel, M.J.. Wang, H., Gadea, B.. Yeung, W.A Yeast two-hybrid system for discerning differential interactions using multiple baits. Nature Biotechnology. 17:1232- 1233,1999. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. BIOBLIOGRAPHY Altschul, Stephen, F., Thomas, L. Madden, Alejandro, A. Schaffer, Zhang, J., Zheng Zhang, Webb Miller, and David J. Lipman. Gapped BLAST and PSI-BLAST: a new generation o f protein database search programs. Nucleic Acids Res. 25:3389-3402,1997. Amann, R.P., Shabanowitz, R.B., Huszar, G., Broder, S.J. Increased in vitro binding o f fresh and frozen-thawed human sperm exposed to a synthetic peptide. Journal of Andrology. 20(5):655-60, 1999 Bartel. P.L., Fields, S. The yeast two-hybrid system. 1997. Oxford University Press. Benson, D.A., Boguski, M.S., Lipman, D.J. et al. Nucleic Acids Res. 26(1): 1-7, 1998. Benson, D.A., Boguski, M.S., Lipman, D.J. et al. GenBank. Nucleic Acids Res. 27( 1): 12- 17. 1999. Breeden, L. and Nasmyth, K. Regulation of the yeast HO Gene. Cold Spring Harbour Symposium Quant. Biol. 50:643-650,1985. Chang, M.H., Bindloss, C.A.. Grabowski, G.A.. Qi. X., Winchester, B., Hopwood, J.J. Meikle, P.J. Saposins A, B, C. and D in plasma o f patients with lysosomal storage disorders. Clinical Chemistry. 46(2): 167-74, 2000. Chen, D.. Ma, H., Hong, H., Stephen, S., et al. Regulation o f transcription by a protein methyltransferase. Science. 284(5423):2174-2177,1999. Chou, P.Y., Fasman, G.D. Empirical predictions o f protein conformation. Annu. Rev Chem. 47:251-276,1978. Colley, N.J.. Baker, E.K. Stamnes, M.A. Zuker. C. The cyclophilin Homologue ninaA is required in the secreted Pathway. Cell. 67:255-263.1991. Dewji. N.N., Wenger, S. Fujibayashi. M. DonovieLF. Esch, F. Hill and O'Brien, J.S. Molecular cloning o f the sphingolipidactivatot protein-1 (SAP-1), the sulfatide sulfatase activator. Biochem. Biophys. Res. Commun. 134:989-994,1986. Faull, K.F.. Whitelegge, J.P., Higginson, J., To, T „ Johnson, J., Krutchinsky, A.N.. Standing, K.G., Waring, A.J., Stevens, R.L., Fluharty, C.B., Fluharty, A.L. Cerebroside sulfate activator protein (Saposin B): chromatographic and electrospray mass spectrometric properties. Journal of Mass Spectrometry. 34(10): 1040-54. 1999. Finley, R.L., Brent,R. Interaction mating reveals binary and ternary connections between Drosophila cell cycle regulators. Proc. Natl. Acad. ScL USA. 91:12980-12984.1994. 55 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Freskgard, P.O., Bergenhem, N., Jonsson, B. Science. 258:466-468,1992. Friedman, J., Weissman, I. Two cytoplasmic Candidates for immunophilin Action Are Revealed by Affinity for a New Cyclophilin: One in the Presence and one in the Absence ofCsA. Celt. 66:799-806, 1991. Gamen, S., Hanson, D.A., Kaspar, A., Naval, J., Krensky, A.M., Anel, A. Granulysin- induced apoptosis. I. Involvement o f at least two distinct pathways. Journal of Immunology. 161(4): 1758-64,1998. Gietz, D., St. Jean, A., Woods, R.A., and Schiestl, R.H. Improved method for high efficiency transformation o f intact yeast cell. Nucleic Acids Res. 20:1425,1992. Gietz, R.D.. Woods, R.A. High efficiency transformation o f yeast with lithium acetate. In J.R. Johnston (ed); Molecular Genetics of Yeast: A practical approach. Oxford University Press. 121-134, 1994. Grabowski, G.A., Horowitz, M. Gaucher's disease: molecular, genetic and enzymological aspects. Bailtieres clinical haematology. 1 0(4):635-56.1997. Grossel. M.J.. Wang, H., Gadea, B„ Yeung, W.A Yeast two-hybrid system for discerning differential interactions using multiple baits. Nature Biotechnology. 17:1232-1233.1999. Hill, J., Donald, Y.A. and Griffiths, D.E. DMSO-enhanced whole cell yeast transformation. Nucleic Acids Res. 19:5791,1991. Hiraiwa, M., O'Brien J.S., Kishimoto, Y., et al. Isolation. Characterization, and proteolysis o f human prosaposin the precursor of saposins (sphingolipid activator Proteins). Archives of Biochem and Biophy. 304( 1): 110-116.1993. Ho, M-W.. O'Bren. J.S. Gauchers disease: deficiency o f ‘■acid’' (3-glutasidase and reconstitution o f enzyme activity in vitro. Proc. Natl. Acad. Sci. USA. 68:2810-2813. 1971. Kishimoto, Y.. Hiraiwa, M., O'Brien. J.S. Saposins: structure, function, distribution, and molecular genetics. J. Lipid Res. 33:1255-1267.1992. Kao, F.T., Law, M.L.. Hartz, J., Jones, C., Zhang, X-L. Dewji, N.N., O’Brien, J.S. and Wenger, D.A. Regional localization o f the gene coding for sphingolipid activator protein (SAP-1) on human chromosome 10. Somat. CellMolec. Genet. 13:685-688.1988. Kretz, K.A.. Carson, G.S., Morimoto, S., Kishimoto, Y., Fluharty, A.L. O'Brien. J.S. Characterization o f a mutation in a family with saposin B deficiency: a glycosylation site defect. Proc. Natl. Acad. Sci. USA. 87(7):2541-4, 1990. 56 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Li, S.-C., Sonnino, S., Tettamanti, G, and Li, Y.-T. Characterization o f a nonspecific activator protein for the enzymatic hydrolysis o f glycolipids. J. Biol. Chem. 263, 6588- 6591,1988. Liepinsh, E., Andersson, M., Ruysschaert, J.M., Otting, G. Saposin fold revealed by the NMR structure o f NK-lysin. Nature Structural Biology. 4(10):793-5,1997. Luban, J. Goff, S.P. The yeast two-hybrid system for studying protein-protein intewractions. Curr. Opinion in Biotechnol. 6:59-64, 1995. Mendelsohn, A.R., Brent, R. Biotechnology applications o f interaction traps/two-hybrid systems. Curr. Opinion in Biotechnol. 5:482-486. 1994. Mhl, E„ and Jatzkewitz, H. Eine cerebrosidsulfataseau schweineniere. Hoppe-Seyler's. Z. Physiol. Chem. 339:260-276,1964. Montague, J.W., Hughes, F.M .Jr. Cidlowski, J.A. Native recombinant cyclophilins A. B, and C degrade DNA independently of peptidylprolyl cis-trans-isomerase activity. Potential roles o f cyclophilins in apoptosis. J. Biol. Chem. 272(10):6677-84, 1997. Morimoto, S., Yamamoto, Y., O’ Brien, J.S.. Kishimoto. Y. Determination of saposin proteins (sphingolipid activator proteins) in human tissues. Analytical Biocltem. 190: 154-157.1990. O'Brien, J.S. and Kishimoto, Y. Saposin proteins: structure, function, and role in human lysosomal storage disorders. FASEB J. 5:301-308.1991. O’ Brien. J.S., Kretz, K.A., Dewji, N.N., Wenger. D.A.. Esch, F.. Fluharty, A.I. Coding of two sphingolipid activator protein (SAP-1 and SAP-2) by same genetic locus. Science. 241:1098-1101.1988. Pena. S.V., Krensky. A.M. Granulysin, a new human cytolytic granule-associated protein with possible involvement in cell-mediated cytotoxicity. Seminars in Immunology. 9(2): 117-25, 1997. Sambrook, J., Fritsch. E.f. and Maniatis, T. Molecular cloning: A Laboratory Mannual (Cold Spring Harbour labrotaries, Cold Spring Harbour, NY). 1989. Sasaki, T., Brakebusch, C., Engel, J., Timpl, R. Mac-2 binding protein is a cell-adhesive protein o f the extracellular matrix which self-assembles into ring-like structures and binds Pi integrins, collagens and fibronectin. TheEMBOJ. 17(6): 1606-1613, 1998. Schiestl, R.H. and Gietz, R.D. High efficiency transformation o f intact cells using single standed nucleic acids as a carrier. Current. Genet. 16:339-346,1989. 57 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Schneider, S., Buchert, M. and Hovens, C.M. An in vitro assay for P-galactosidase from yeast. BioTechniques. 20:960-962,1996. Tsuboi, K., Hiraiwa, M., O’Brien, J.S. Prosaposin prevents programmed cell death o f rat cerebellar granule neurons in culture. Brain Research. Developmental Brain Research. 110(2): 249-55, 1998. Vaccaro, A.M., Ciaffoni. F., Tatti, M „ Salvioli. R„ Barca, A. et al. PH-dependent conformational properties o f saposins and their interactions with phospholipid membranes. J. Biol. Chem. 270:30576-30580,1995. Vaccaro, A.M. Salvioli, R., Tatti, M., Ciaffoni, F. Saposins and their interaction with lipids. Neurochemical Research. 24(2):307-14,1999. Wenger, D.A., and Inui, K. Studies on the sphingolipid activator protein for the enzymatic hydrolysis o f GMlganglioside and sulfatide. In Molecular Basis of Lysosomal Storage Disorders. R.O.Bradvand, J.Barranger. editors. Academic Press, New York. 1-18, 1984. Zaltash, S.. Johansson, J. Expression and characterization o f saposin-like proteins. Journal o f Protein Chemistry. 17(6):523-4, 1998. Zhang, J., Madden, T.L. Genome Res., 7.649-656. 1997. Zhang, X., Rafi, M.A., DegGala, G.. Wenger. D.A. Insertion in the mRNA of a metachromatic leukodystrophy patient with sphingolipid activator-1 deficiencv. Proc. Natl. Acad. Sci. USA 87:1426-1430.1990. Zhang, Z.. Schaffer, A.A., Miller, T.L., Lipman. D.J., et al. Nucleic Acids Res., 26:3986- 3991,1998. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.

Linked assets

University of Southern California Dissertations and Theses

Conceptually similar

PDF

Construction and characterization of RRP6 deletion in Saccharomyces cerevisiae

PDF

Clathrin associated protein (AP) binding motifs in AD5 penton

PDF

Generation of mutant tissue inhibitor of metalloproteinases-2 (TIMP-2) in the baculovirus expression system

PDF

Functional analysis of single nucleotide polymorphisms (SNPs) in the 5' regulatory region on the SRD5A2 gene

PDF

A model for the mechanism of agonism and antagonism in steroid receptors

PDF

Interactions between vesicular stomatitis virus G protein and the cytoskeletal factor protein 4.1

PDF

Expression of matrix metalloproteinases and their inhibitors in the muscles of amyotrophic lateral sclerosis and control patients

PDF

Biochemical analysis of somatic mutations in steroid 5alpha-reductase type II in prostate cancer

PDF

Establishment and properties of a stable transfected epicardial cell line expressing a dominant negative retinoic acid receptor

PDF

Dual functions of Vav in Ras-related small GTPases signaling regulation

PDF

Amelogenin domains in a self-assembly process

PDF

A TNF alpha-responsive kinase activity may play a key role in IKK activation

PDF

Analysis of the HSD3B2 gene in prostate cancer

PDF

Analysis of the ALOX5 gene in atherosclerosis

PDF

Association between single nucleotide polymorphisms in the 3'untranslated region of the SRD5A2 gene and prostate cancer risk

PDF

A novel candidate ovarian cancer and melanoma tumor suppressor gene on chromosome 6q24.3

PDF

A review of molecular conjugates and their use in gene therapy with the presentation of a model experiment: Gene therapy with novel fusion proteins that target breast cancer cells

PDF

Development and secretions of salivary glands using mouse models

PDF

Detection of anti-Hu antibodies, a possible key to early diagnosis of small cell lung cancer

PDF

A coactivator complex among GRIP1, CARM1, and TIF1alpha contributes to gene activation directed by androgen receptor

Asset Metadata

Creator Yang, Yuhua (author)

Core Title Cyclophilin C is a candidate protein to interact with saposin B using the yeast two-hybrid system

School Graduate School

Degree Master of Science

Degree Program Biochemistry and Molecular Biology

Publisher University of Southern California (original), University of Southern California. Libraries (digital)

Tag biology, molecular,chemistry, biochemistry,OAI-PMH Harvest

Language English

Contributor Digitized by ProQuest (provenance)

Advisor Broek, Daniel (committee chair), Mosteller, Raymond (committee member), Tokes, Zoltan A. (committee member)

Permanent Link (DOI) https://doi.org/10.25549/usctheses-c16-36519

Unique identifier UC11336953

Identifier 1405258.pdf (filename),usctheses-c16-36519 (legacy record id)

Legacy Identifier 1405258.pdf

Dmrecord 36519

Document Type Thesis

Rights Yang, Yuhua

Type texts

Source University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Access Conditions The author retains rights to his/her dissertation, thesis or other graduate work according to U.S. copyright law. Electronic access is being provided by the USC Libraries in agreement with the au...

Repository Name University of Southern California Digital Library

Repository Location USC Digital Library, University of Southern California, University Park Campus, Los Angeles, California 90089, USA