University of Southern California Dissertations and Theses

Molecular and cellular characterization of nickel -induced C3H/10T½ Cl 8 cell transformation

(USC Thesis Other)

Molecular and cellular characterization of nickel -induced C3H/10T½ Cl 8 cell transformation

PDF

Download

Open document

Flip pages

Download a page range

Download transcript

Copy asset link

Request this asset

Transcript (if available)

Content MOLECULAR AND CELLULAR CHARACTERIZATION OF NICKEL-
INDUCED C3H/10TV2 CL 8 CELL TRANSFORMATION
by
Farr ah Marie Clemens
A Dissertation Presented to the
FACULTY OF THE GRADUATE SCHOOL
UNIVERSITY OF SOUTHERN CALIFORNIA
In Partial Fulfillment of the
Requirements for the Degree
DOCTOR OF PHILOSOPHY
(MOLECULAR MICROBIOLOGY AND IMMUNOLOGY)
August 2003
Copyright 2003 Farrah Marie Clemens
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
UMI Number: 3116682
INFORMATION TO USERS
The quality of this reproduction is dependent upon the quality of the copy
submitted. Broken or indistinct print, colored or poor quality illustrations and
photographs, print bleed-through, substandard margins, and improper
alignment can adversely affect reproduction.
In the unlikely event that the author did not send a complete manuscript
and there are missing pages, these will be noted. Also, if unauthorized
copyright material had to be removed, a note will indicate the deletion.
®
UMI
UMI Microform 3116682
Copyright 2004 by ProQuest Information and Learning Company.
All rights reserved. This microform edition is protected against
unauthorized copying under Title 17, United States Code.
ProQuest Information and Learning Company
300 North Zeeb Road
P.O. Box 1346
Ann Arbor, Ml 48106-1346
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
UNIVERSITY OF SOUTHERN CALIFORNIA
The Graduate School
University Park
LOS ANGELES, CALIFORNIA 90089-1695
This dissertation, written by
Farrah Marie Clemens
Under the direction of her Dissertation
Committee, and approved by all its members,
has been presented to and accepted by The
Graduate School, in partial fulfillment of
requirements for the degree of
OR OF PHILOSOPHY
Dean of Graduate Studies
Date August 12, 2003
DISSERTATION COMMITTEE
7* Chairperson
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Dedication
This is dedicated to my grandparents, John and Colleen Clemens, and my
dad, Bill Clemens for all their love and support. Without their encouragement, I
would not have been able to come this far.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Acknowledgments
First, I would like to thank my advisor, Dr. Joseph Landolph for his guidance
and encouragement throughout my research. His support, countless ARA, paper, and
thesis revisions, as well as, useful discussions are greatly appreciated. I would also
like to thank my thesis committee, Dr. Minnie McMillan and Dr. Robert Stellwagen,
for the continued guidance and helpful suggestions.
Many thanks to Dr. Jamuna Ramnath for teaching me the techniques required
for my research, as well as, the helpful suggestions. Many thanks also to Dr. Rini
Verma for her friendship and scientific, as well as, non-scientific guidance, and for
providing the best example of how to be a great scientist and manager.
I would also like to acknowledge Dr. Adriana Oiler, for supporting the work
done on the individual nickel samples for NiPERA, Dr. John Duffus and Dr. Milton
Parks for providing me the Clydach samples, and Dr. Fred Sunderman for providing
me the pine form of orcelite.
111
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Table of Contents
ABSTRACT......................................................................................................................x
General Overview.............................................................................................................1
Chapter 1: Genetic toxicology of nickel compounds................................................ 5
ABSTRACT....................................................................................................................5
INTRODUCTION.......................................................................................................... 7
MATERIALS AND METHODS................................................................................ 12
RESULTS......................................................................................................................21
DISCUSSION................................................................................................................51
Chapter 2: Molecular toxicology/genotoxicity of dust samples from the INCO
nickel refinery in Clydach, South Wales (UK), in reference to the component
orcelite.*........................... 55
ABSTRACT..................................................................................................................55
INTRODUCTION........................................................................................................ 57
MATERIALS AND METHODS................................................................................63
RESULTS......................................................................................................................70
DISCUSSION................................................................................................................98
Chapter 3: Molecular Biology of deregulated gene expression in transformed
IO TV 2 cell lines induced by insoluble nickel compounds.......................................108
ABSTRACT................................................................................................................108
INTRODUCTION...................................................................................................... 110
iv
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
MATERIALS AND METHODS.............................................................................. 114
RESULTS.................................................................................................................... 119
DISCUSSION..............................................................................................................143
Chapter 4: Increased expression of the Ect2 oncogene in nickel-induced
transformed cell lines..................................................................................................148
ABSTRACT................................................................................................................148
INTRODUCTION...................................................................................................... 149
MATERIALS AND METHODS.............................................................................. 153
RESULTS.................................................................................................................... 163
DISCUSSION..............................................................................................................183
Summary and Conclusions........................................................................................ 186
REFERENCES............................................................................................................ 190
v
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Table 1-1:
Table 1-2:
Table 1-3:
Table 1-4:
Table 1-5:
Table 2-1:
Table 2-2:
Table 2-3:
Table 2-4:
Table 2-5
Table 2-6:
Table 3-1:
Table 3-2:
Table 3-3:
Table 3-4:
List of Tables
Summary of physical and chemical characteristics of the samples... 15
Assays to detect phagocytic uptake of particles of elemental nickel
and nickel compounds............................................................................25
Assays to detect cytotoxicity by particles of elemental nickel and
nickel compounds................................................................................... 31
Assays to detect chromosome aberrations by particles of elemental
nickel and nickel compounds................................................................38
Assays to detect morphological transformation by particles of
elemental nickel and nickel compounds..............................................45
Components of CLYD3 (1920) and CLYD23 (1929)........................62
Assays to detect the phagocytic uptake of the two nickel refinery
samples and the orcelite........................................................................ 73
Assays to detect cytotoxicity caused by the two nickel refinery
samples and the orcelite........................................................................ 78
Detection and visualization of apoptosis.............................................. 82
Induction of Chromosomal Aberrations in 1O T V 2 Cells by nickel
refinery samples and orcelite................................................................ 87
Induction of Morphological Cell Transformation by Nickel-
Containing Refinery Samples and Orcelite..........................................92
Biological characterization of cell lines used (Miura, 1989)............121
Biological characterization of ten transformed cell lines induced by
green (HT)NiO.................................................................................... 123
Expression patterns of differentially expressed gene fragments
isolated by differential display............................................................126
Sequence homology data......................................................................139
VI
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Table 4-1: Average steady-state levels of Ect2 mRNA....................................... 172
Table 4-2: Average steady-state levels of Ect2 DNA.......................................... 177
Table 4-3: Average steady-state levels of Ect2 protein....................................... 182
v ii
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
List of Figures
Figure 1 -1: Cellular Uptake of Insoluble Ni Compounds........................................10
Figure 1 -2: Possible mechanism of DNA damage caused by Ni .........................11
Figure 1 -3: Photographs of phagocytic uptake........................................................ 24
Figure 1 -4: Plot of Phagocytosis Assays...................................................................28
Figure 1 -5: Plot of Cytotoxicity Assays....................................................................34
Figure 1 -6 : Photographs of Chromosome Aberrations............................................37
Figure 1 -7: Photographs of transformed foci........................................................... 44
Figure 1 -8 : Plot of transformation assays.................................................................50
Figure 2-1: Photographs of Phagocytosis.................................................................72
Figure 2-2: Plot of Phagocytosis Assays...................................................................75
Figure 2-3: Plot of Cytotoxicity Assays....................................................................80
Figure 2-4: Photographs of Chromosome Aberrations............................................8 6
Figure 2-5: Photographs of Transformed foci......................................................... 96
Figure 2-6: Plot of Transformation Assays...............................................................97
Figure 3-3: PCR amplification of differential display fragments......................... 127
Figure 3-4: Reverse Northern analysis of DD fragments......................................131
Figure 3-5: Subcloned Inserts.................................................................................. 133
Figure 3-6: Sequence data........................................................................................ 137
Figure 3-7: Original Differential display of R3-1.................................................. 141
Figure 3 -8 : Northern Analysis of R3-1...................................................................142
Figure 4-1: Ect2 as a GTP exchange factor............................................................151
Figure 4-2: Primers generated for amplification of Ect2.......................................156
Figure 4-3: Original Differential display of R2-5.................................................. 164
Figure 4-4: RT-PCR amplification of Ect2.............................................................166
Figure 4-5: RT-PCR seqencing of R2-5................................................................. 167
Figure 4-6: Northern analysis of R2-5.................................................................... 170
Figure 4-7: Repeat Northern analysis of R2-5........................................................171
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Figure 4-8: Southern analysis of R2-5.................................................................... 175
Figure 4-9: Repeat Southern analysis of R2-5........................................................176
Figure 4-10: Western analysis of Ect2.......................................................................180
Figure 4-11: Repeat Western analysis of Ect2..........................................................181
ix
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
ABSTRACT
Nickel, a naturally occurring metal, is useful, particularly, as a component in
alloys. However, long-term inhalation exposures to mixtures of specific insoluble
and soluble nickel compounds in specific nickel refinery operations have been
associated with lung and nasal cancers. Short-term in vitro assays in C3 H/1 0 TV 2 Cl
8 (IOTV2) cells were used to study the genotoxicities of four nickel-containing
samples The results showed the compounds tested can be ranked according to their
carcinogenic potential as follows: Ni° (1.5pm)> 2 NiC0 3 «3 Ni(OH)2«4 H2 0 >
Ni(OH)3 (powder) > Ni(OH)3 (dried slurry).
The in vitro assays were next used to study two dust samples from the 1920’s
from the INCO nickel refinery in Clydach, Whales, U.K. Prior to 1923, the
incidence of lung and nasal cancers at the refinery was high. The INCO refinery
changed the process of nickel refining in 1923, eliminating the orcelite (NisAs2)
component. A dust sample was archived in 1920. The cancer incidence was
subsequently reduced from 1925-1930, and a second sample was archived in 1929.
Both samples contain primarily green (HT) nickel oxide. The main difference
between the two dust samples is the presence of orcelite in the 1920 sample. Pure
orcelite was studied for comparison. The 1920 sample induced morphological
transformation, but the 1929 sample did not, consistent with induction of cancers in
the refinery workers before 1923, and with the decrease in cancers after elimination
of orcelite in 1923.
x
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
The molecular mechanisms of carcinogenicity and cellular transformation
induced by nickel compounds are not well understood. Therefore, to characterize
molecular events associated with carcinogenesis induced by insoluble nickel
compounds, RNA was isolated from transformed cell lines derived from nickel-
compound induced morphological transformation of 10T14 cells, and analyzed by
mRNA differential display. Fragments containing differentially expressed genes
were isolated, sequenced, and their sequences compared to known genes by nBLAST
analysis. One fragment, R2-5 was conducted. It is part of the coding region of the
Ect2 gene, a proto-oncogene that encodes a GDP-GTP- exchange factor. The results
show that over-expression of this gene is caused by gene amplification.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
General Overview
Nickel is a naturally occurring metallic element that exists in nature as
sulfides in sulfidic ores, as oxides in oxidic ores, and in silicate minerals. Nickel is
used in many industrial processes, such as in the production of alloys, the most
important of which is stainless steel, in electroplating, in foundries, in catalysts, in
battery manufacturing, and also in coinage (Sunderman, 1998; Oiler, 1997).
Unfortunately, epidemiological studies have shown that exposures of workers
employed in nickel refining operations to mixtures of soluble and insoluble nickel
compounds by long-term inhalation in nickel refineries in the past have been
associated with excess lung cancer and nasal sinus cancer (reviewed in Sunderman,
1998; Oiler, 1997; IARC, 1976; ICNCM, 1990). Simultaneous exposures of humans
in the workplace to high concentrations of mixtures of nickel compounds and to
other toxic and carcinogenic substances, such as arsenic, polycyclic aromatic
hydrocarbons, sulfuric acid mists, and cigarette smoking, makes evaluation of the
carcinogenic potential of individual nickel compounds in humans difficult using
epidemiological data alone (reviewed in Sunderman, 1998; Oiler, 1997; IARC, 1976;
ICNCM, 1990).
In animal carcinogenicity bioassays, Ottolenghi et al.. (1974) showed that
nickel subsulfide (Ni3S2) induced adenomas and adenocarcinomas in the lungs of
male and female F344 rats when administered by inhalation (Ottolenghi et al.. 1974).
Intramuscular (i.m.) injection of nickel compounds into male F344 rats induced
1
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
sarcomas at the injection site (Sunderman, 1976). Kasprzak et.al., (1983) also
showed that M 3S2 was carcinogenic when injected into Wistar rats. Recently, the
U.S. National Toxicology Program (NTP) conducted animal carcinogenesis studies
by the inhalation route, which is most relevant to human carcinogenesis, by the most
modem protocols. The NTP showed that insoluble M 3 S 2 and insoluble nickel oxide
(NiO) induce lung tumors in rats and mice, but soluble nickel sulfate (NiS0 4 ) did not
(U.S. NTP Reports, 1994a; 1994a, b; 1994a, b).
Consistent with the toxicity and carcinogenicity of insoluble nickel
compounds in animals, short-term in vitro studies in cultured cells have shown that
specific nickel compounds are cytotoxic and genotoxic. Treatment of diploid human
fibroblasts (Biedermann, et. al. 1987), CSH/IOUA Cl 8 (IOTV2) mouse embryo cells
(Verma, et.al., in prep; Miura, et.al., 1989), and Syrian hamster embryo (SHE) cells
(Costa et al.., 1982; Heck and Costa, 1983) in culture with particles of specific
insoluble nickel compounds such as Ni3S2, crystalline nickel monosulfide (NiS),
green (high temperature) NiO, and black (low temperature) NiO causes the particles
to be phagocytized into the cells (reviewed in Costa, 1996; Sunderman, 1981;
Landolph, 1989; Landolph, 1990; Landolph, 1994; Landolph, et.al., 1996; Landolph,
1999; Landolph, 2000). Intracellular dissolution of the particles generates
intracellular Ni2 + ions, which bind to nucleic acids, nuclear proteins, and chromatin
(Ciccarelli and Wetterhahn, 1984), strengthen DNA-protein binding, and induce
changes in DNA conformation (Andersen, 1985). These intracellular Ni2 + ions also
2
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
induce depurination of DNA (Andersen, 1985), DNA strand breaks (Ciccarelli and
Wetterhahn, 1984; 1982), chromosomal contraction (Andersen, 1985), and
chromosomal aberrations, including deletions, rearrangements, gaps and breaks
(Verma, et.al, in prep; Nishimura and Umeda, 1979; reviewed in Costa, 1996;
Sunderman, 1981; Landolph, 1989; Landolph, 1990; Landolph, 1994; Landolph, et.al.,
1996; Landolph, 1999; Landolph, 2000). Intracellular Ni2 + ions also bind to histone
proteins, generating active oxygen species, which cause oxidative damage,
preferentially in the heterochromatic region of mammalian cells (Landolph, 1994;
Andersen, 1985), including enhanced oxidation, hydroxylation, and deglycosylation
of DNA bases (reviewed in Oiler, et.al, 1997; Costa, 1996; Sunderman, 1981;
Landolph, 1989; Landolph, 1990; Landolph, 1994; Landolph, et.al., 1996; Landolph,
1999; Landolph, 2000). Intracellular Ni2 + ions also interfere with the nucleotide
excision repair pathway (Sunderman, 1981) and induce methylation of genes
controlling senescence (Klein, et.al., 1991).
As a result of some or all of these molecular events, cells treated with specific
insoluble nickel compounds undergo delayed cytotoxicity (Biedermann, et.al., 1987;
Miura, et.al., 1989; Verma, et.al., in prep; reviewed in Costa, 1996; Sunderman, 1981;
Landolph, 1989; Landolph, 1990; Landolph, 1994; Landolph, et.al., 1996; Landolph,
1999; Landolph, 2000) and morphological and neoplastic transformation (reviewed in
Costa, 1996; Sunderman, 1981; Landolph, 1989; Landolph, 1990; Landolph, 1994;
Landolph, et.al., 1996; Landolph, 1999; Landolph, 2000). Binding of nickel ions,
3
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
derived from specific insoluble nickel compounds, to certain nuclear RNA and gene
regulatory proteins might also contribute to abnormal gene expression in cells treated
with specific carcinogenic insoluble nickel compounds. The mechanisms of nickel
carcinogenesis need to be investigated further to determine which genotoxic and
epigenetic effects observed in cells treated with specific insoluble nickel compounds
are mechanistically linked to the induction of neoplastic cell transformation and
carcinogenesis induced by specific insoluble nickel compounds.
The overall goal of this thesis is to characterize the mechanisms of nickel
carcinogenesis. To do this, first the cytotoxicity and genotoxicity of individual
nickel compounds in their pure form were studied. Secondly, samples taken from a
nickel refinery in the form of complex mixtures that the workers are exposed to
during nickel refining operations were investigated. Once specific compounds that
were able to induce morphological transformation were identified, these compounds
were then used in the third part, to induce permanent transformed cell lines and to
study the mechanisms of nickel carcinogenesis on a molecular basis by identifying
and characterizing genes that were aberrantly expressed in the transformed cell lines,
compared to the levels of expression in the nontransformed 10T14 mouse embryo
fibroblast cell lines.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 1: Genetic toxicology of nickel compounds
ABSTRACT
Nickel is a naturally occurring metal. It is primarily found in the form of
sulfide, oxide, and silicate minerals. Nickel is extremely useful because it possesses
many beneficial properties for a wide range of applications, particularly as a
component in alloys, such as stainless steel. Long-term inhalation exposures of
workers to mixtures of some insoluble and soluble nickel compounds in specific
nickel refinery operations in the past were associated with lung and nasal cancers.
The genotoxicities of nickel-containing samples were investigated in short-term in
vitro assays. This data was then used to rank the samples for their predicted
carcinogenic potentials and to prioritize them for further carcinogenicity testing in
whole animals.
For this study, the following compounds were studied: spherical particles of
elemental nickel sample, [Ni° (1.5 pm)], nickel carbonate hydroxide,
[2 NiC0 3 «3 Ni(0 H)2«4 H2 0 ], and two forms of nickelic hydroxide, Ni(OH)3 (powder)
and Ni(OH)3 (dried slurry). To study these samples, the following assays were
conducted in C3H/10TV2 mouse embryo cells: (A) phagocytic uptake, (B)
cytotoxicity, (C) induction of chromosomal aberrations, and (D) morphological
transformation. The results of these studies allow the samples to be ranked
according to their predicted carcinogenic potential and prioritize them for further in
vivo testing.
5
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Our results showed that all of the samples were taken up into the cells by
phagocytosis, with the order of effectiveness of phagocytic uptake being: Ni°
(1.5pm) > Ni(OH)3 (powder) > Ni(OH)3 (dried slurry) > 2NiCC>3«3Ni(0H)2»4H20 .
The order of cytotoxic potency of the samples (LC50 values in parentheses) was: Ni°
(1.5pm) [(0.45 + 0.3 pg/ml)] > Ni(OH)3 (powder) [(2.96 ± 2.4 pg/ml)] >
2NiC03 *3Ni(0H)2*4H2 0 [(4.08 ± 3.8 pg/ml)] > Ni(OH)3 (dried slurry) [(18.0 ± 9.0
pg/ml)]. The ability to induce chromosomal damage of the four compounds tested
can be ranked in the following order: Ni° (1.5pm)> 2 NiC0 3 «3 Ni(0 H)2«4 H20 >
Ni(OH)3 (powder) > Ni(OH)3 (dried slimy). Finally, the four compounds tested can
be ranked according to their carcinogenic potential as follows: Ni° (1.5pm)>
2 NiC0 3 «3 Ni(0 H)2*4 H20 > Ni(OH)3 (powder) > Ni(OH)3 (dried slurry).
Therefore, we predict that particles of spherical elemental nickel, Ni° (1.5
pm), will be carcinogenic in whole animal carcinogenicity studies, based on the
strong yield of morphological transformation this sample caused in IOTV 2 cells.
2 NiC0 3 «3 Ni(0 H)2«4 H20 is predicted to be either weakly carcinogenic or non-
carcinogenic. The two nickelic hydroxide samples are also projected to be non-
carcinogenic based on their weak, irreproducible, cell transformation results.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
INTRODUCTION
Nickel is a naturally occurring metal. It is primarily found in the form of
sulfide, oxide, and silicate minerals. Nickel is extremely useful because it possesses
many beneficial properties for a wide range of applications. It is used as a
component in alloys, such as stainless steel, in nickel batteries, and in nickel plating
(IARC, 1976; NIOSH, 1977). Nickel compounds are also used as catalysts in the
hydrogenation of fats and oils, in ceramic glazes, and as pigments in paints (IARC,
1976; NIOSH, 1977). Nickel is very useful in alloys because of its strength,
corrosive resistance, high ductility, conductivity, magnetic characteristics, and
catalytic properties. Nickel-containing alloys, such as stainless steels are
economically valuable in hospitals, commercial and domestic kitchens, and in jet
engines. Annual worldwide production of nickel metal is in excess of 900 kilotons
(NiPERA, 2002). Of this 900 kilotons of primary nickel, greater than 80 percent is
used in 3,000 different alloys, including stainless steels, alloy steels, and non-ferrous
alloys. Approximately 60 percent of the total nickel produced is used in the
production stainless steels alone (NiPERA, 2002).
In nickel productions industries, the main exposure paths by which workers
are exposed occupationally to nickel are by inhalation, ingestion, and, to a lesser
extent, skin contact. Workers in nickel production industries, include mining,
milling, concentrating, smelting, refining, and other operations, are exposed to a
variety of nickel minerals and compounds depending upon the type of ore mined and
7
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
the processes used to produce intermediate and primary nickel products (IARC,
1976; NIOSH, 1977). Human exposure to nickel can also occur through air, water,
food, soil, skin contact with nickel-containing articles, and through tobacco smoke
(IARC, 1976; NIOSH, 1977).
Long-term inhalation exposures of humans to nickel compounds in the
occupational setting have been associated with excess lung and nasal sinus cancers
(IARC, 1990). The presence of concurrent exposures and other confounders, such as
cigarette smoking, have made evaluation of the carcinogenic potential of individual
nickel compounds very difficult using epidemiological data alone. Many individual
nickel compounds have been found to be carcinogenic. Of the studies done, the most
convincing support comes from the epidemiological data of workers in the smelting
and refining industries. Exposure of workers in the occupational setting to nickel
metal and nickel compounds occurs by inhalation of nickel-containing mist, dust, or
fumes (IARC, 1990). It has been estimated that in nickel refineries, occupational
exposures for nickel metals and insoluble nickel compounds is ~1 mg/m3 in the air
(IARC, 1990).
Nickel compounds can exist in either soluble or insoluble forms. It has been
shown that cellular uptake of nickel compounds occur by phagocytosis of insoluble
particles (Miura, et.al., 1989; Biedermann and Landolph, 1987; Costa, 1996;
Sunderman, 1981; Landolph, 1989; Landolph, 1990; Landolph, 1994; Landolph,
1999; Landolph, et.al, 1996; Landolph, 2000). Once inside the cell, the compound is
8
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
'y I
solubilized into ions. Ni is released and can bind to proteins in the cytoplasm, and
9 +
then carried to the nucleus to bind to DNA. Ni can also bind to proteins that are
already bound to DNA. In either case, the result is cellular transformation. In a
Fenton-like reaction, Ni2 + , with hydrogen peroxide, can produce oxygen radicals that
can then cause damage to the DNA (Landolph, 1999; Landolph, et.al., 2002). This
mechanism is described in Figures 1-1 and 1-2.
After the nickel ions cause DNA damage, cytotoxicity can occur, in which
the cells are no longer able to survive the damage. On the other hand, if the damage
is not severe enough to cause death, the resulting effects may lead to morphological
cellular transformation. Dr. Landolph’s laboratory has been studying nickel-
containing compounds to determine exactly which compounds are carcinogenic.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Figure 1-1: Cellular Uptake of Insoluble Ni Compounds
Nickel compounds are taken in by phagocytosis. Once inside the cell,
the compound is broken down into ions. Ni2 + is released and can bind
to proteins in the cytoplasm, and then carried to the nucleus to bind to
DNA, or Ni2 + can bind to proteins that are already bound to DNA. In
either case, the result in cellular transformation (Landolph, et.al.,
2002).
cytoplasm
nucleus
Cell Transformation
10
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Figure 1-2: Possible mechanism of DNA damage caused by Ni
' y .
Once inside the cell, in a Fenton-like reaction, Ni with hydrogen
peroxide can produce oxygen radicals that can then cause damage to
the DNA. Damage to DNA can lead to SS DNA breaks, altered
DNA-protein binding, chromosomal aberrations, or altered DNA
methylation (Landolph, et.al., 2002).
O,- + O,- + SOD
OH'
Fenton like reaction:
Nl2++ HjOj-* - Ni3++ OH- + OH*
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
MATERIALS AND METHODS
Samples used
The Nickel Producers Environmental Research Association (NiPERA) is an
organization that studies the different nickel compounds to provide information on
the use and toxicological properties of the compounds and the safe use of nickel in
the workplace. Four compounds were obtained from NiPERA for testing (Research
Triangle Park, NC). The samples were characterized by a number of analytical
physical chemical methods conducted by Particle Technology, Inc. (Chicago, II). A
summary of the physical and chemical characteristics of the samples is reported in
Table 1-1.
The first compound studied consisted of spherical particles of elemental
nickel, Ni° (1.5pm). This sample of nickel powder was purchased from Vacuum
Metallurgical Co., Ltd., (Japan) by the International Nickel Company (INCO),
United Kingdom, and provided to us through NiPERA. Its reported mean particle
size range was 1.5 pm.
The second compound tested was nickel carbonate hydroxide
[2 NiC0 3 *3 Ni(0 H)2*4 H2 0 ], in the form of particles with a distribution of particle
diameter that ranged from 0.322-555.7pm, and a mean particle diameter of 9.65 ±
2.54 pm (Particle Technology Labs. Ltd). The sample was supplied by Particle
Technology Labs. Ltd for NiPERA.
12
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Two samples of nickel hydroxide [Ni(OH)3] were studied. One in the form
of a slurry, and the other in the form of a dry powder, were also tested. The mean
particle diameter for the powder sample was 99.02 ± 7.78 pm (Particle Technology
Labs. Ltd). The slurry sample was dried by heating it in a drying oven at 100°C for
24 hours. The mean particle size was not known for the dried slurry samples of
Ni(OH)3. The two samples are distinguished by the following designations:
Ni(OH)3 (powder) and Ni(OH)3 (dried slurry).
For nickel carbonate hydroxide and nickelic hydroxide, prior to starting any
experiments, we conducted solubility studies. A 1M solution of nickel carbonate
was suspended in water, phosphate buffered saline (PBS), and acetone. These tubes
were shaken and kept at room temperature for 48 hr. The suspension was observed
every 12 hr. All three tubes initially showed a cloudy supernatant upon shaking,
after which the solid particles settled to the bottom of the tube and the supernatant
became clear. Next, suspensions were made at lower concentrations: 20.0, 10.0, 5.0,
2.0, 0.2 pg/ml of water. The tubes were placed in 37 °C shaking water-bath and
examined over a 48 hr. period. Based on appearance, nickel carbonate particles did
not dissolve in water, PBS, or acetone under these conditions.
For nickelic hydroxide, initially lgm of sample (present in a hydrated form
rather than powder) was added to 10 ml of water, 10 ml of PBS, or 10 ml of Basal
Eagles M edium (BM E) cell culture medium. The tubes were shaken at room
temperature and observed for 6, 12, 24 and 48 hr. At first, the suspension turned
13
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
black in color. Thirty minutes post-shaking, the supernatant turned clear, and
particles settled at the bottom of the tubes. 1 g of the samples were then suspended in
10 ml of water, PBS, or BME cell culture medium, placed in a 37 °C shaking water
bath, and observed as before. After removing the tubes from the water bath, it was
observed that all of the insoluble particles settled to the bottom, but the supernatant
remained black for a longer period of time, in all three tubes. Lastly, the solubility of
nickelic hydroxide (suspended in all three solvents) at a lower pH (6.6) was
examined. Particles settled to the bottom of the tubes and the supernatant became
clear. Therefore, nickelic hydroxide was not considered soluble under these
conditions.
14
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Table 1-1: Summary of physical and chemical characteristics of the samples
These samples were characterized by a number of analytical physical
chemical methods conducted by Particle Technology, Inc. (Chicago,
111).
Compound
(Source and reported
particle size) “
Mean
particle
diameter in
pm
%Ni (bulk
analysis)
Release of Ni2 +
after 48 hrs
(as % of Ni
content)
Specific
Surface
area (m2 /g)
BET
% Ni/O/C
on surface
Ni° (1.5pm) 1.5“ 98.3 0.5 1.67 13.5/32/5
Ni(OH)3 (powder)
99.02 ± 7.78 b
41.6 4.78
5.21
21/43/26/
7 (Na)
2NiC03 *3Ni(0H)2«4H2 0 9.65 +2.54 b 41.2 4.81 3.93 18/43.5/38
a The particle sizes indicated in this column are those given by the providers of the
compounds.
b The particle sizes shown in this column are those measured in this study. Particle
size distributions were obtained with a ‘mass’ method.
c Particle size distributions were obtained with a ‘frequency-based’ method (Elzone).
d Diameter is volume-based. Bias towards smaller particles.
15
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Cells and Cell Culture
CSH/IOT1 /^ Cl 8 (IOTV2) cells, a permanent line of mouse embryo fibroblast
cells (ICNCM, 1990), were grown in Eagles Basal Medium (BME) supplemented
with 10 % heat inactivated fetal calf serum (FCS) (Omega Scientific Company, Inc.,
Tarzana, CA). Lots of fetal calf serum (FCS) were pre-screened to identify those
that supported a plating efficiency of approximately 30 % and a cell transformation
yield greater than five foci/twenty dishes when cells were treated with 1 pg/ml of the
carcinogen, 3-methyl-cholanthrene (MCA), for forty-eight hours. These lots of FCS
were purchased and used in these studies. 1O T V 2 cells were used before passage 10,
'y
to minimize the yield of spontaneous transformation. Cells were grown in 75 cm
tissue culture flasks (VWR, San Francisco, CA), were maintained in logarithmic
phase of growth in incubators containing 5% CO2 and were maintained at 37°C in a
humidified atmosphere as described (Reznikoff et al.., 1973 a, b; Landolph and
Heidelberger, 1979; reviewed in Landolph, 1985).
Assays to detect phagocytic uptake of particles of elemental nickel and nickel
compounds
Two thousand cells were seeded into each 60 mm dish, and two dishes were
used for each treatment condition. Twenty-four hours after the cells were seeded, the
nickel-containing samples were suspended in acetone and added to the cells.
Twenty-five pi of the sample suspension were added to each 60 mm cell culture dish
16
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
containing five ml of medium plus 10 % fetal calf serum (the final concentration of
acetone in the medium was 0.5 % v/v). After treatment of the cells with sample for
forty-eight hours, the medium was removed, and the cells were rinsed once with
isotonic saline (0.9 %), fixed for 20 minutes with 100 % ethanol, and then stained for
20 minutes with 1 % crystal violet. The cells were then examined with a light
microscope, and those cells with one or more vacuoles containing one or more
particles in the cytoplasm were scored as phagocytosing cells. The data is reported
as the percent of cells containing at least one vacuole with a phagocytosed particle.
Assays to detect cytotoxicity by particles of elemental nickel and nickel
compounds
These assays were performed as described previously (Landolph and
Heidelberger, 1979; Miura, et al.. 1989; Patiemo, et al.. , 1988; Verma, et.al. 2000;
reviewed in Landolph, 1985). Briefly, two hundred cells were seeded into each 60
mm dish in five ml of Eagles Basal Medium (BME) containing 10 % FCS. Five
dishes were seeded for each concentration of each sample. Twenty-four hours after
the cells were seeded, the samples were suspended in acetone and added to the cells
(the final concentration of acetone in the medium was 0.5 % v/v). Twenty-five pi of
the sample suspension was added to each dish containing five ml of medium. Two
separate negative controls, medium alone and medium plus acetone 0.5 % (v/v),
were used in each experiment. After forty-eight hours of treatment of cells with
17
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
samples, the medium was removed and replaced with fresh medium containing 1 0 %
FCS. Cells were then cultured for an additional five to seven days. Eight to ten days
after the cells were initially seeded, when living colonies were clearly visible by
microscopic examination, the medium was removed, and the cells were rinsed once
with isotonic saline (0.9 %), fixed for twenty minutes with 100 % methanol, and
stained for 20 minutes with filtered 10 % Giemsa stain.
Colonies containing twenty or more cells in each dish were then scored under
the dissecting microscope. The plating efficiency (PE) is the number of colonies
(containing twenty or more cells) on the dishes eight days post seeding, divided by
the total number of cells seeded (200 cells) multiplied by 100 %. The average
survival fraction (PE of treated cells/PE of acetone-treated control cells) was
calculated for each set of five dishes, used to obtain average survival fractions for
each treatment, and reported as mean ± standard deviation. This average survival
fraction, which was calculated from each experiment, was plotted on a semi
logarithmic scale (log concentrations vs. dose) to calculate the LC50 (the
concentration at which 50 % of the cells failed to form colonies).
Assays to detect chromosome aberrations by particles of elemental nickel and
nickel compounds
The method used to detect chromosomal aberrations was that of Tshidate, et
al.. (1977, 1981). Fifty thousand 10T/12 cells were seeded into each 60 mm dish,
18
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
and two dishes were utilized to determine the induction of chromosomal aberrations
by each concentration of sample studied. Twenty-four hours after the cells were
seeded, the samples were suspended in acetone and added to the cells. Twenty-five
pi of the sample suspension were added to each dish containing five ml of medium
plus 10 % FCS (the final concentration of acetone was 0.5 % v/v in the medium).
Cells were treated with nickel samples for forty-eight hours, then cells were arrested
in the metaphase stage by treating them with 0.02 pg/ml colcemid for eighteen hours
prior to termination of nickel sample treatment. After treatment with nickel samples,
cells were then incubated with hypotonic solution (0.075 M KCL) for 20 minutes,
then fixed in cold Camoy’s fixative (3:1 v/v methanol: acetic acid). Fixed cells were
then dropped onto slides, air-dried, and then stained with 10% Giemsa stain.
Chromosomes from 100 cells for each concentration of nickel sample studied were
scored for various chromosomal aberrations. The data is presented in a chart,
indicating the different types of aberrations observed.
Assays to detect morphological transformation by particles of elemental nickel
and nickel compounds
These assays were conducted according to the original methods described by
Reznikoff, et. al. (1973 b) with modifications developed that have been used in our
laboratory (Landolph and Heidelberger, 1979; Patiemo et al.., 1988; Miura et al..,
1989; reviewed in Landolph, 1985). Two thousand cells were seeded into each 60
19
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
mm dish, and twenty dishes were used to determine the induction of morphological
cell transformation by each concentration of each nickel sample studied. Twenty-
four hours after cells were seeded, the nickel samples were suspended in acetone and
added to the cells. Twenty-five pi of the sample suspension were added to each dish
containing five ml of medium (the final concentration of acetone was 0.5 % v/v in
the medium). 1 pg/ml of MCA was used as a positive control as a known inducer of
morphological transformation (Landolph and Heidelberger, 1979; Patiemo, et al..,
1988; Miura et al.., 1989; reviewed in Landolph, 1985). Medium alone and medium
plus acetone (0.5 % v/v in the medium) were used as negative controls. After forty-
eight hours of treatment, the medium was removed and replaced with fresh medium,
and the medium was then replaced twice per week until cells became confluent, then
once per week. The cells were then cultured for a total of six weeks from the time
they were seeded. Six weeks after the cells were initially seeded, the medium was
removed, and the cells were rinsed once with isotonic saline (0.9 %), then fixed for
20 minutes with 100 % methanol, and then stained for 20 minutes with filtered 10%
Giemsa stain. Type II and type III foci were scored and tabulated as described
(Reznikoff, et.al., 1973 b) with our more recent modifications for scoring
heterogeneous foci and foci on the borderline between type I and type II and between
type II and type III (Landolph and Heidelberger, 1979; Miura, et al., 1989; Patiemo,
et al., 1988; reviewed in Landolph, 1985).
2 0
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
RESULTS
Assays to detect phagocytic uptake of particles of elemental nickel and nickel
compounds
We first studied phagocytic uptake of the nickel-containing compounds.
These assays were done both 1) to determine whether the compounds were taken up
into cells, and also 2 ) to determine the concentrations to use to accomplish maximum
uptake to use in the following genotoxicity studies. It was important to determine
the conditions of maximum uptake in order to optimize the sensitivity of the assay to
detect morphological transformation induced by various nickel samples.
For the first sample tested, particles of metallic nickel with a mean particle
diameter of 1.5 pm, the concentration range used was from 0.25 pg/ml to 5.0 pg/ml.
One or more vacuoles containing phagocytosed particles were easily visible with
crystal violet staining, as seen in Figure 1-3C. Figure 1-3C is also a good example of
cells containing multiple vacuoles with phagocytosed particles. Particles of ultra
fine metallic nickel were phagocytosed in a reproducible and dose-dependent manner
in two separate experiments (Table 1-2A). In cells treated with the lowest
concentration, 0.25 pg/ml, 19.0 ± 4.0 % of the cells contained phagocytic vacuoles
with particles. At 2.5 pg/ml, 46 % of the cells were phagocytosed, and at the highest
concentration of 5.0 pg/ml, 60.5 % of the cells contained vacuoles containing
particles. The results of ultra fine metallic nickel phagocytosis is given in Table 1-
2A and in Figure 1-4.
21
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
The particle size of the second compound tested, nickel carbonate hydroxide
{ 2 NiC0 3 «3 Ni(OH)2«4 H2 0 ], was extremely variable, from 0.322-555.7 pm, with a
mean particle diameter of (9.7 ± 2.5pm). The concentration ranges tested were from
1.0 pg/ml to 20 pg/ml. Nickel carbonate was taken up by cells by phagocytosis
(Figure 1-3A). Phagocytic uptake of 2 NiC0 3 »3 Ni(0 H)2»4 H2 0 occurred in a dose-
dependent manner, but to a lesser extent than that of the positive control, Ni3S2. At
the highest concentration, 2 0 pg/ml, 2 1 % of cells contained phagocytosed particles.
Table 1-2B gives the values for the two experiments conducted, while Figure 1-4
shows the plot of the results in comparison to the other samples tested.
For the two nickelic hydroxide compounds, the concentration range tested
was from 0.5 pg/ml to 10.0 pg/ml. The nickelic hydroxides were received in two
different forms. One, as previously described, was in a powdered form, and the
other was in a form of a slurry. The slurry sample was dried and this dried material
was used to determine whether the dried slurry would be as effectively phagocytosed
as the powdered sample. Both compounds were taken up by the lOT'/i cells by
phagocytosis (Figure 1-3B). The powdered form was phagocytized to a greater
extent than the dried slurry (Table 1-2C & D, Figure 1-4). The uptake of particles
was in a dose-dependent manner for both forms of Ni(OH)3. Treatment of lOT'A
cells with nickelic hydroxide (powder) at 0.5 pg/ml, the lowest concentration used,
caused 32.5 % of the cells containing phagocytic vacuoles with particles. The uptake
of particles was in a dose-dependent manner. At the highest concentration, 10
22
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
pg/ml, 46.5 % of the cells contained vacuoles with particles. Phagocytic uptake of
nickelic hydroxide was reproducible and dose-dependent in both experiments up to a
concentration of 5 pg/ml. The positive control, nickel subsulfide at 1.0 pg/ml caused
46.5 % of the cells to contain vacuoles with particles.
Uptake of the dried slurry by 10T'/2 cells was also dose-dependent and
reproducible between the two experiments. However, the dried slurry sample was
not as effectively phagocytosed as the powdered sample (Table 1-2C, D; Figure 1-4).
At the lowest treatment concentration, 1.0 pg/ml, only 5 % of the cells treated with
the dried slurry contained phagocytic vacuoles, compared with 31 % for cells treated
with the powdered sample. The phagocytic uptake was in a dose-dependent manner.
Comparing both samples at the highest treatment concentration used, 10.0 pg/ml,
showed that treatment with nickelic hydroxide (powder) caused 46.5 % of the cells
and with nickelic hydroxide (dried slurry), 32.5 % of the cells to contain phagocytic
vacuoles with particles.
The compounds were compared and ranked based on their phagocytic uptake.
The order in which the particles were taken up was: Ni° (1.5pm) > Ni(OH) 3
(powder) > Ni(OH) 3 (dried slurry) > N1CO3.
23
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Figure 1-3: Photographs of phagocytic uptake
A) Phagocytosis of 2 NiC0 3 *3 Ni(0 H)2«4 H2 0
B) Phagocytosis of Ni(OH)3 (powder)
C) Phagocytosis of Metallic Nickel [Ni° (1.5 pm)]
i ~ * *
A
B
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Table 1-2: Assays to detect phagocytic uptake of particles of elemental nickel
and nickel compounds
For these experiments, 2000 cells were seeded into each 60mm dish,
using two dishes per concentration. 24 hours after seeding, 25 pi of
treatment concentrations were added to the dishes. The dished were
fixed and stained with Crystal Violet after 48 hours. The dishes were
then scored for cells containing vacuoles with particles. Two
experiments were done for each compound tested. A) Ni° (1.5pm);
B) 2NiC03»3Ni(0H)2«4H20 ; C) Ni(OH) 3 (powder); D) Ni(OH) 3
(dried)
A) Ni° (1.5pm)
Concentration
(pg/ml)
% Phagocytosing cells
Average + SD
Expt. I Expt. II
0 (media) 0.0 0.0 0.0 + 0
0.0 0.0 0.0 0.0 + 0
0.25 21.0 17.0 19.0 ± 2
0.5 29.0 23.0 26.0 ± 3
1.0 34.0 37.0 35.5 ± 2
2.5 44.0 48.0 46.0 + 2
5.0 56.0 65.0 60.5 ± 5
25
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Table 1-2: Continued
B) 2NiC03 *3Ni(0H)2*4H2 0
Concentration
(pg/ml)
% Phagocytosing cells
Average + SD
Expt. I Expt. II
0 (media) 0.0 0.0 0.0 ± 0
0.0 1.0 0.0 0.5 ± 0
1.0 5.0 0.0 2.5 + 3
2.5 8.0 6.0 7.0 ± 1
5.0 12.0 11.0 11.5 ± 1
10.0 17.0 16.0 16.5 ± 1
20.0 20.0 22.0 21.0 ± 1
C) Ni(OH)3 (powder)
Concentration
(pg/ml)
% Phagocytosing cells
Average + SD
Expt. I Expt. II
0 (media) 0.0 0.0 0.0 ± 0
0.0 1.0 0.0 0.5 ± 0
0.5 41.0 24.0 32.5 ± 9
1.0 28.0 34.0 31.0 + 3
2.5 41.0 37.0 39.0 ± 2
5.0 60.0 49.0 54.5 ± 6
10.0 43.0 50.0 46.5 ± 4
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Table 1-2: Continued
D) Ni(OH) 3 (dried slurry)
Concentration
(pg/ml)
% Phagocytosing cells
Average + SD
Expt. I Expt. II
0 (media) 0.0 0.0 0.0 ± 0
0.0 0.0 0.0 0.0 + 0
1.0 4.0 6.0 5.0 ± 1
2.5 11.0 8.0 9.5 ± 2
5.0 18.0 18.0 18.0 + 0
7.5 39.0 23.0 31.0 ± 8
10.0 36.0 29.0 32.5 ± 4
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
% o f phagocytosing cells
Figure 1-4: Plot of Phagocytosis Assays
A comparison of phagocytic uptake of the four compounds tested.
The four compounds can be ranked according to their phagocytic
uptake as follows: Ni° (1.5pm) > Ni(OH)3 (powder) > Ni(OH)3
(dried slurry) > 2 NiC0 3 »3 Ni(OH)2»4 H2 0
70.0
60.0
50.0
40.0
NitOH^ (dried slurry)
30.0
20.0
2NiC 03-3Ni(OH)24H2 O
10.0
0.0 2.0 4.0 6.0 8.0 10.0 12.0 14.0 16.0 18.0 20.0
Concentration (pg/ml)
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Assays to detect cytotoxicity by particles of elemental nickel and nickel
compounds
Cytotoxicity of 10Tl A cells treated with particles of the spherical metallic
nickel, [Ni° (1.5 pm)], occurred at concentrations ranging from 0.25 pg/ml to 8.0
pg/ml and was dose-dependent. The survival fraction was reduced from 100 % to 0
% at the highest concentration of 8.0 pg/ml. These results were reproducible over
the six experiments conducted. The LC50 was calculated to be 2.3 ± 0.6 pg/ml
(Table 1-3 A). Figure 1-5 shows the cytotoxicity of the ultra fine metallic nickel, in
comparison to the other samples studied.
The cytotoxicity experiments with IOTI/2 cells treated with
2 NiC0 3 »3 Ni(0 H)2»4 H2 0 were conducted over a wide range of concentrations, from
0.18 pg/ml to 80 pg/ml. In each of the five individual experiments, cytotoxicity
occurred in a dose-dependent manner. However, there was a significant amount of
variability observed among the experiments (Table 1-3B). Reproducibility was
difficult, most likely caused by the variability in the particulate nature of this
material and difficulties in pipetting and delivering the exact same amount. The size
distribution of particles of this sample was determined to be 0.322-555.7 pm, with a
mean particle diameter of (9.7 ± 2.5) pm. The LC50 was calculated to be 6.2 ± 2.7
pg/ml (Figure 1-5).
29
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
The survival of IOTV 2 cells treated with Ni(OH)3 (powder) was reduced from
100 % to 0 % over a range from 0.25 pg/ml to 60 pg/ml (Table 1-3C). Cytotoxicity
occurred in a dose-dependent manner in all six separate experiments. However, the
extent of the cytotoxicity induced varied among the six experiments. The survival
curves for each of the six individual experiments were sufficiently similar, however,
all six experiments were used to calculate the L C 5 0 , which was determined to be 2.4 ±
1.8 pg/ml. Treatment of IOTV 2 cells with Ni(OH)3 (dried slurry) at a similar
concentration range reduced the survival from 1 0 0 % to only 31 % at the highest
concentration tested, 40 pg/ml (Table 1-3D). Ni(OH)3 (dried slurry) was
approximately 10-fold less cytotoxic to IOTV 2 cells as the powdered form. The L C 5 0
from the dried slurry of Ni(OH)3 was calculated from five independent experiments
to be 23.4 ± 9.7 pg/ml.
A comparison of the survival curves of all four compounds tested is given in
Figure 1-5. The order in which these nickel-containing samples caused cytotoxicity
to IOTV 2 cells was: Ni° (1.5 pm) > Ni(OH) 3 (powder) > 2 NiC0 3 *3 Ni(0 H)2«4 H20 >
Ni(OH)3 (dried slurry).
30
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Table 1-3: Assays to detect cytotoxicity by particles of elemental nickel and
nickel compounds
For these experiments, 200 cells were seeded into each 60 mm dish,
using five dishes per concentration. 24 hours after seeding, 25 pi of
treatment concentrations were added to the dishes. After 48 hours of
treatment, the medium in the dishes was replaced. The dished were
fixed and stained with Giemsa stain 8-10 days post-seeding. The
dishes were then scored for colonies containing 20 or more cells. The
plating efficiencies were calculated and the survival fraction
determined. Multiple experiments were done for each compound
tested. A) Ni° (1.5 pm); B) 2NiC03*3Ni(0H)2«4H20 ; C) Ni(OH) 3
(powder); D) Ni(OH) 3 (dried slurry)
A) Ni° (1.5pm)
Concentration
(pg/ml)
Survival Fraction (%)
Average
± SD 1 II
III
(TAI)
IV
V
(TAII)
0 (media) 108.3 99.6 100.0 105.0 99.1 102.4 ± 3.4
0.0 100.0 100.0 100.0 100.0 100.0 100.0 ± 0.0
0.25 81.2 82.7 81.9 ± 0.8
0.5 83.0 75.3 72.2 76.8 ± 4.1
1.0 51.5 53.2 56.1 62.9 63.0 57.3 ± 4.5
2.5 48.3 50.9 51.8 52.2 50.8 ± 1.
5.0 23.7 35.3 35.4 40.3 37.6 34.5 + 4.3
6.0
29.0 29.5 26.2 28.2 ± 1.4
7.0 21.6 22.2 12.9 18.9 + 4.0
8.0
0.0 0.0 ± 0.0
31
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Table 1-3: Continued
B) 2NiC03«3Ni(0H)2«4H2 0
Concentration
(l^g/ml)
Survival Fraction (%)
Average
± SD
1 II
III
(TAI)
IV
V
(TAII)
0 (media) 93.3 93.2 111.0 96.5 100.0 98.8 ± 5.4
0.0 100.0 100.0 100.0 100.0 100.0 100.0 + 0.0
0.18 86.0 93.8 100.0 93.3 ± 4.8
0.37 81.0 88.4 84.7 ± 3.7
0.75 78.1 86.5 82.3 ±4.2
1.0 98.7 72.3 87.5 86.2 ± 9.3
1.5 77.6 85.4 81.5 ± 3.9
2.5 35.2 64.7 56.7 52.2 ± 11.3
3.0 73.5 81.6 77.5 ± 4.1
5.0 21.6 60.7 57.0 46.4 ± 16.6
6.0 70.0 78.4 74.2 + 4.2
10.0 11.0 46.2 42.7 33.3 ± 14.9
20.0 2.2 29.2 19.6 17.0 ± 9.9
40.0 0.4 0.4 ± 0.0
80.0 0.0 0.0 ± 0.0
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Table 1-3: Continued
C) Ni(OH)3 (powder)
Concentration
(pg/ml)
Survival Fraction (%)
Average
± SD
I II III IV
V
(TAI)
VI
(TAII)
0 (media) 98.8 100.0 110.4 98.8 100.0 98.7 101.1 ± 4.6
0.0 100.0 100.0 100.0 100.0 100.0 100.0 100.0 ± 0.0
0.25 77.4 69.6 65.7 70.9 ± 5.9
0.5 65.2 52.7 59.0 55.6 58.1 ± 5.4
1.0 54.3 41.6 51.6 47.0 48.6 ± 5.6
2.5 58.1 62.7 45.2 35.5 40.3 41.1 47.2 ± 10.8
5.0 43.4 55.8 27.8 20.2 39.6 32.5 36.5 ± 12.5
10.0 21.7 31.8 25.7 9.0 17.7 13.2 19.8 ± 8.3
20.0 2.6 5.8 0.0 0.6 2.2 ± 2.6
40.0 0.0 0.6 0.3 ± 0.4
60.0 0.0 0.0 0.0 ± 0.0
D) Ni(OH> 3 (dried slurry)
Concentration
(pg/ml)
Survival Fraction (%)
Average ±
SD I II III
IV
(TAI)
V
(TA II)
0 (media) 114.1 105.1 91.6 98.7 99.7 101.8 ± 8.4
0.0 100.0 100.0 100.0 100.0 100.0 100.0 ± 0.0
1.0 88.6 93.7 93.6 92.9 89.2 91.6 ± 2.5
2.5 106.6 77.7 77.6 75.0 84.2 ± 15.0
5.0 68.1 96.0 66.2 68.9 63.5 72.5 ± 13.3
10.0 73.2 80.8 64.2 58.0 58.4 66.9 ± 9.9
20.0 72.5 61.4 30.7 33.3 36.5 46.9 ± 18.8
40.0 22.5 48.2 23.3 31.3 ± 14.6
33
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Survival F raction (%)
Figure 1-5: Plot of Cytotoxicity Assays
A comparison of cytotoxicity to 1OT/2 cells caused by treatment with
the four compounds tested, plotted on a semi-logarithmic scale. The
four compounds can be ranked according to their cytotoxic ability as
follows: Ni° (1.5 pm) [LCso-2.3 ± 0.6 pg/ml] > Ni(OH)3 (powder)
[LC5 0 -2.4 ± 1.8 pg/ml] > 2NiC03«3Ni(0H)2«4H2 0 [LC5 0 =6.2 ± 2.7
pg/ml] > Ni(OH)3 (dried slurry) [LCso-23.4 ± 9.7 pg/ml]
100.0
IB fO H fefdniea fluiry)
L C s < 5 =
LCso=
! & ■ > a * M * 1 * )
LCscp 2.3±C.6|**i»l
10.0 -
21fiC03-31fi(0H)l2 4H 20
L Cs5= 6.2±2.7
0.0 5.0 10.0 15.0 20.0 25.0 30.0 35.0 40.0
Concentration (Mg/ml)
34
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Assays to detect chromosome aberrations by particles of elemental nickel and
nickel compounds
Treatment of IOTV 2 cells with particles of the spherical metallic nickel, [Ni°
(1.5 pm)], induced chromosomal aberrations. Breaks and fragments were more
frequently induced than the other aberrations (Table 1-4A). At the highest
concentration, 17.8 % aberrations were induced, as compared to the positive control,
1.0 pg/ml of Mitomycin C, which yielded 14.4 % of aberrations (Table 1-4A).
In the chromosomal aberration studies for 2 NiC0 3 *3 Ni(0 H)2»4 H2 0 , it was
observed that this compound is able to induce some chromosomal aberrations. The
aberrations seen were breaks, fragments, and a few satellite associations. The
highest percentage of aberrations observed was at 1 0 pg/ml, in which 18.6%
aberrations were induced. This is similar to that of the positive control, 1.0 pg/ml of
Mitomycin C, which yielded 17.7% of aberrations (Table 1-4B).
Ni(OH)3 (powder) did not effectively induce chromosomal aberrations (Table
1-4C). There were a few breaks, fragments and satellite associations, however, the
highest observe percentage of aberrations was seen at 0.5 pg/ml, the lowest
concentration, with only 10 % aberrations being induced. This is compared with the
17.7 % aberrations yielded by the positive control, 1.0 pg/ml of Mitomycin C. The
Ni(OH)3 (dried slurry) was even less effective in the induction of chromosomal
aberrations (Table 1-4D). There were a few breaks and fragments; however, the
highest observe percentage of aberrations was seen at the highest concentration of
35
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
10.0 pg/ml, with only 4.6 % aberrations. This is compared with the 36 % aberrations
yielded by the positive control: 1 pg/ml of Mitomycin C.
The order in which these nickel-containing samples caused the induction of
chromosome aberrations was: Ni° (1.5 pm) > 2 NiC0 3 «3 Ni(OH)2«4 H2 0 » Ni(OH)3
(powder) > Ni(OH)3 (dried slurry).
36
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Figure 1-6: Photographs of Chromosome Aberrations
A) Normal Chromosomal spread
B) Example of a Translocation
C) Example of Chromosome fragmentation
B
> a
% %
f?
¥ %
&
%
I 1
I
* *#
^Si
m * •
- % *
w
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Table 1-4: Assays to detect chromosome aberrations by particles of
elemental nickel and nickel compounds
For these experiments, 50,000 cells were seeded into each 60 mm
dish, using two dishes per concentration. 24 hours after seeding, 25
pi of treatment concentrations were added to the dishes. After 48
hours, the cells were arrested in metaphase, fixed, dropped onto slides
and stained with Giemsa stain. 100 cells were then scored for
chromosomes with aberrations. Two experiments were done for each
compound tested. A) Ni° (1.5 pm); B) 2 NiC0 3 »3 Ni(0 H)2«4 H2 0 ; C)
Ni(OH)3 (powder); D) Ni(OH)3 (dried slurry)
A) Ni° (1.5pm)
Concentration
(pg/ml)
Breaks
Gaps
Fragments
Dicentrics
Translocations
Satellite associations
Rings
Total # aberrations
Total # examined
% Aberrations
0 (media) 4 1 2 1 8 101 7.9
0 1 1 88 1.1
0.25 2 2 7 28.6
0.5 3 1 1 5 16 31.3
1.0 7 2 1 1 11 63 17.5
2.5 2 1 3 1 7 82 8.5
5.0 12 5 3 4 24 135 17.8
MMC (1 pg/ml) 9 4 13 90 14.4
38
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Table 1-4: Continued
B) 2NiC03«3Ni(0H)2«4H20
Concentration
(pg/ml)
Breaks
Gaps
Fragments
Dicentrics
Translocations
Satellite associations
Rings
Total # aberrations
Total # examined
% Aberrations
0 (media) 1 1 2 80 2.5
0 5 1 1 7 132 5.3
1 1 1 4 6 92 6.5
2.5 4 5 9 55 16.4
5 5 2 4 4 15 95 15.8
10 5 5 1 1 1 13 70 18.6
20 2 2 82 2.4
MMC
12 3 9 2 8 1 35 198 17.7
(lUg/ml)
39
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Table 1-4: Continued
C)Ni(OH)3 (powder)
Concentration
(Hg/ml)
Breaks
Gaps
Fragments
Dicentrics
Translocations
Satellite associations
Rings
Total # aberrations
Total # examined
% Aberrations
0 (media) 1 1 2 80 2.5
0 5 1 1 7 132 5.3
0.5 1 2 6 1 10 100 10.0
1.0 2 1 2 5 100 5.0
2.5 0 0
5.0 1 1 19 5.3
10 0 27 0.0
MMC
12 3 9 2 8 1 35 198 17.7
(lpg/ml)
40
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Table 1-4: Continued
D) Ni(OH)3 (dried slurry)
Concentration
(Mg/ml)
Breaks
Gaps
Fragments
Dicentrics
Translocations
Satellite associations
Rings
Total # aberrations
Total # examined
% Aberrations
0 (media) 3 3 85 3.5
0 1 3 1 5 80 6.3
1 1 1 100 1.0
2.5 2 1 3 82 3.7
5 2 2 57 3.5
7.5 3 3 100 3.0
10 1 1 2 4 87 4.6
MMC
11 5 20 36 100 36.0
(1 Mg/ml)
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Assays to detect morphological transformation by particles of elemental nickel
and nickel compounds
Particles of the spherical metallic nickel, Ni° (1.5 pm), were effective at
inducing morphological transformation. For this assay, the concentrations used,
ranged from 1.0 pg/ml to 7.0 pg/ml (Table 1-5 A). At the lowest concentration of 1.0
pg/ml, there were five type II foci. As the concentration increased, there was an
increase in the number of type II, as well as, type III foci. At the highest
concentration of 7.0 pg/ml, there were 19 type III and 34 type II foci, which is a very
strong yield of cell transformation, stronger than that of the positive control: 1 pg/ml
MCA (Figure 1-8). The second experiment to detect morphological transformation
showed and even stronger response than the first. There were a total of 6 6 type II
and III foci at the lowest treatment concentration of 1.0 pg/ml and a total of 103 type
II and III foci at the highest treatment concentration of 6.0 pg/ml. Therefore, the Ni°
(1.5 pm) was a strong inducer of morphological transformation, with the slope of the
dose-response curve equal to 4.3. Previously studied compounds of metallic nickel
were not effective inducers of morphological transformation, most likely due to the
fact that these samples were much larger in size (Verma, et.al. NiPERA report).
In the first transformation assay conducted, treatment of IOTV 2 cells with
2 NiC0 3 «3 Ni(0 H)2»4 H2 0 , induced a few weak type II foci and a total of two type III
foci for all treatments. In the second transformation assay for this compound, no
42
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
type II or type III foci formed. Nickel carbonate hydroxide therefore, was not
efficient and at best weak, at inducing focus formation, with a slope of only 0.04
(Table 1-5B and Figure 1-8).
Similar results were seen for the Ni(OH) 3 compounds. Neither form of
Ni(OH) 3 was efficient at inducing morphological transformation (Table 1-5C, D,
Figure 1-8). Ni(OH) 3 (powder) induced a total of nine type II foci in the first
experiment, with almost half of those occurring at the highest concentration of 1 0
pg/ml, and no foci in the second experiment. The slope of the line is 0.21. No foci
at all were induced by Ni(OH) 3 (dried slurry) in two separate experiments.
A comparison of the survival curves of all four compounds tested is given in
Figure 1-8. The order in which these nickel-containing samples caused the induction
of morphological transformation was: Ni° (1.5 pm) » > Ni(OH) 3 (powder) > NiC0 3
> Ni(OH) 3 (dried slurry).
43
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Figure 1-7: Photographs of transformed foci
Photographs were taken of the cells at the end of the transformation
assays to illustrate the characteristics of the non-transformed
monolayer, Type II and III foci.
A) non-transformed mono layer
B) Type II focus
D) Type III focus
44
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Table 1-5: Assays to detect morphological transformation by particles of
elemental nickel and nickel compounds
For these experiments, 2000 cells were seeded into each 60 mm dish,
using 20 dishes per concentration. 24 hours after seeding, 25 pi of
treatment concentrations were added to the dishes. After 48 hours of
treatment, the medium in the dishes was replaced; thereafter the
medium was replaced every week. The dishes were fixed and stained
with Giemsa stain 6-7 weeks post-seeding. The dishes were then
scored for Type II and Type III foci. 2-3 experiments were done for
each compound tested. A) Ni° (1.5pm); B)
2NiC03*3Ni(0H)2*4H20 ; C) Ni(OH) 3 (powder); D) Ni(OH) 3 (dried
slurry)
45
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Table 1-5: Continued
A) Ni° (1.5 pm)
Expt. I
Concentration
(pg/ml)
Survival
Fraction (%)
Total # of foci / # of dishes
scored (Foci/20 dishes)
# of dishes with foci /
# of dishes scored
Type III Type II + III Type III Type II + III
0 (medium only) 100 0(0) 0(0) 0/20 0/20
Acetone (0.5%) 100 0(0) 0(0) 0/20 0/20
1.0 56.1 0(0) 5(5) 0/20 4/20
2.5 50.9 10(10) 13(13) 3/20 8/20
5.0 35.4 7(7) 26 (26) 6/20 14/20
6.0 29.5 17(17) 47 (47) 10/20 18/20
7.0 22.2 19(19) 53 (53) 11/20 15/20
NiO (3.75 pg/ml) 5(5) 14 (14) 5/20 10/20
MCA (1 pg/ml) 79.5
1(1)
14 (14) 1/20 6/20
ixpt. II
Concentration
(pg/ml)
Survival
Fraction (%)
Total # of foci / # of dishes
scored (Foci/20 dishes)
# of dishes with foci /
# of dishes scored
Type III Type II + III Type III Type II + III
0 (medium only) 96.2 0(0) 0(0) 0/20 0/20
Acetone (0.5%) 100.0 0(0) 2(2) 0/20 2/20
1.0 77.9 39 (39) 66 (66) 17/20 17/20
2.5 64.0 66 (66) 107 (107) 20/20 20/20
5.0 48.1 44 (44) 90 (90) 20/20 20/20
6.0 29.8 58 (58) 99 (99) 20/20 20/20
7.0 24.6 58 (58) 103 (103) 20/20 20/20
NiO (3.75 pg/ml) 60.6 27 (27) 39 (39) 19/20 20/20
MCA (1 pg/ml) 88.6 13(13) 24 (24) 12/20 20/20
46
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Table 1-5: Continued
B) 2NiC03«3Ni(0H)2«4H20
Expt. I
Concentration
(pg/ml)
Survival
Fraction (%)
Total # of foci / # of dishes
scored (Foci/20 dishes)
# of dishes with foci /
# of dishes scored
Type III Type II + III Type III Type II + III
0 (medium only) 96.5 0/20 (0) 0/20 (0) 0/20 (0) 0/20 (0)
Acetone (0.5%) 100.0 0/20 (0) 0/20 (0) 0/20 (0) 0/20 (0)
1.0 72.3 1/19(1) 2/19(2) 1/19(1) 2/19 (2)
2.5 64.7 0/15 (0) 6/15(8) 0/15 (0) 6/15 (8)
5.0 60.7 0/18(0) 5/18(6) 0/18(0) 5/18(6)
10.0 46.2 1/19(1) 5/19(5) 1/19(1) 5/19 (5)
20.0 29.2 0/10 (0) 2/10 (4) 0/10 (0) 2/10 (4)
MCA (1 pg/ml) 2/18 (2) 13/18(14) 2/18 (2) 10/18(11)
ixpt. II
Concentration
(pg/ml)
Survival
Fraction (%)
Total # of foci / # of dishes
scored (Foci/20 dishes)
# of dishes with foci /
# of dishes scored
Type III Type II + III Type III Type II + III
0 (medium only) 99.4 0/20 (0) 0/20 (0) 0/20 (0) 0/20 (0)
Acetone (0.5%) 100.0 0/20 (0) 0/20 (0) 0/20 (0) 0/20 (0)
1.0 87.5 0/20 (0) 0/20 (0) 0/20 (0) 0/20 (0)
2.5 56.7 0/20 (0) 0/20 (0) 0/20 (0) 0/20 (0)
5.0 57.0 0/20 (0) 0/20 (0) 0/20 (0) 0/20 (0)
10.0 42.7 0/20 (0) 0/20 (0) 0/20 (0) 0/20 (0)
20.0 19.6 0/20 (0) 0/20 (0) 0/20 (0) 0/20 (0)
MCA (1 pg/ml) 49.8
47
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Table 1-5: Continued
C) Ni(OH)3 (powder)
ixpt. I
Concentration
(pg/ml)
Survival
Fraction (%)
Total # of foci / # of dishes
scored (Foci/20 dishes)
# of dishes with foci /
# of dishes scored
Type III Type II + III Type III Type II + III
0 (medium only) 100.0 0/15 (0) 0/15 (0) 0/15 (0) 0/15 (0)
Acetone (0.5%) 100.0 0/16 (0) 0/16(0) 0/16 (0) 0/16 (0)
0.25 65.7 0/14 (0) 0/14 (0) 0/14 (0) 0/14 (0)
0.5 59.0 0/16 (0) 1/16(1) 0/16 (0) 1/16(1)
1.0 51.6 0/19 (0) 0/19 (0) 0/19 (0) 0/19 (0)
2.5 40.3 0/16 (0) 1/16(1) 0/16 (0) 1/16(1)
5.0 39.6 0/16 (0) 2/16 (3) 0/16 (0) 2/16(3)
10.0 17.7 0/14 (0) 3/14(4) 0/14 (0) 3/14 (4)
MCA (1 pg/ml) 1/12 (2) 2/12 (4) 1/12 (2) 2/12 (4)
ixpt. II
Concentration
(pg/ml)
Survival
Fraction (%)
Total # of foci / # of dishes
scored (Foci/20 dishes)
# of dishes with foci /
# of dishes scored
Type III Type II + III Type III Type II + III
0 (medium only) 98.7 0/20 (0) 0/20 (0) 0/20 (0) 0/20 (0)
Acetone (0.5%) 100.0 0/19 (0) 0/19 (0) 0/19 (0) 0/19 (0)
0.5 55.6 0/20 (0) 0/20 (0) 0/20 (0) 0/20 (0)
1.0 47.0 0/20 (0) 0/20 (0) 0/20 (0) 0/20 (0)
2.5 41.1 0/20 (0) 0/20 (0) 0/20 (0) 0/20 (0)
5.0 32.5 0/20 (0) 0/20 (0) 0/20 (0) 0/20 (0)
10.0 13.2 0/19 (0) 0/19 (0) 0/19(0) 0/19(0)
MCA (1 pg/ml) 5/20 (5) 12/20 (12) 3/20 (3) 7/20 (7)
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Table 1-5: Continued
D) Ni(OH) 3 (dried slurry)
Expt. I_________________
Concentration
(pg/ml)
Survival
Fraction (%)
Total # of foci / # of dishes
scored (Foci/20 dishes)
# of dishes with foci /
# of dishes scored
Type III Type II + III Type III Type II + III
0 (medium only) 98.7 0/20 (0) 0/20 (0) 0/20 (0) 0/20 (0)
Acetone (0.5%) 100.0 0/19 (0) 0/19(0) 0/19 (0) 0/19 (0)
1.0 92.9 0/17 (0) 0/17 (0) 0/17 (0) 0/17 (0)
2.5 77.6 0/20 (0) 0/20 (0) 0/20 (0) 0/20 (0)
5.0 68.9 0/19 (0) 0/19(0) 0/19 (0) 0/19 (0)
7.5 58.0 0/19 (0) 0/19 (0) 0/19 (0) 0/19 (0)
10.0 33.3 0/20 (0) 0/20 (0) 0/20 (0) 0/20 (0)
MCA (1 pg/ml) 0/18(0) 6/18(7) 0/18(0) 5/18 (6)
ixpt. II
Concentration
(pg/ml)
Survival
Fraction (%)
Total # of foci / # of dishes
scored (Foci/20 dishes)
# of dishes with foci /
# of dishes scored
Type III Type II + III Type III Type II + III
0 (medium only) 99.7 0/20 (0) 0/20 (0) 0/20 (0) 0/20 (0)
Acetone (0.5%) 100.0 0/20 (0) 0/20 (0) 0/20 (0) 0/20 (0)
1.0 89.2 0/20 (0) 0/20 (0) 0/20 (0) 0/20 (0)
2.5 75.0 0/20 (0) 0/20 (0) 0/20 (0) 0/20 (0)
5.0 63.5 0/20 (0) 0/20 (0) 0/20 (0) 0/20 (0)
7.5 58.4 0/20 (0) 0/20 (0) 0/20 (0) 0/20 (0)
10.0 36.5 0/20 (0) 0/20 (0) 0/20 (0) 0/20 (0)
MCA (1 pg/ml) 10/20 (10) 26/20 (26) 8/20 (8) 15/20(15)
49
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Figure 1-8: Plot of transformation assays
A comparison of the transformation assays of the four compounds
tested, plotted on a linear scale. The four compounds can be ranked
according to their carcinogenic potential as follows: Ni° (1.5 pm) >
2NiC03«3Ni(0H)2*4H20 > Ni(OH)3 (powder) > Ni(OH)3 (dried
slurry)
50
40
30
20
10
2NiCO, 3NKQHV4H2 O
m(OIty,yjuwilei) —
Ni(OH> 3 (driiej. slurry)
i t )
0
0 5 1 5 20
Concentration (Mg/ml)
50
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
DISCUSSION
For the spherical elemental metallic nickel, studies of phagocytic uptake of
the compounds were first determined. Phagocytosis was shown to occur in a dose-
dependent manner. There were many cells containing multiple vacuoles with
phagocytosed particles. The results of metallic nickel phagocytosis is given in Table
1-2A. Next, the cytotoxicity of IOTV 2 cells treated with metallic nickel was
determined, and found to be dose-dependent, with a high degree of reproducibility.
The LC50 was calculated to be 2.3 ± 0.6 pg/ml (Table 1-3A, Figure 1-4).
Chromosomal aberration studies showed that the metallic nickel induced
chromosomal aberrations (Table 1-4A). Results from the transformation assays with
the metallic nickel, showed that this compound was very effective for inducing
morphological transformation. Previously studied compounds of metallic nickel
were not effective inducers of morphological transformation, most likely due to the
fact that these samples were much larger in size. This phagocytic uptake data should
also be taken into consideration since this nickel sample was taken up to a greater
extent than the other samples of metallic nickel (comparison data not shown,
however, a photograph of the amount of Ni° (1.5 pm) taken up is shown in Figure 1-
3C). Therefore, it can be predicted that the Ni° (1.5 pm) particles are likely to be
carcinogenic in animals. The strong phagocytic uptake for this sample likely
deposits a large amount of elemental nickel in cells for this sample, which likely
contributes to its cytotoxicity and induction of cell transformation.
51
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
The particle size of the second compound tested, 2 NiC0 3 »3 Ni(0 H)2»4 H2 0 ,
was extremely variable, from 0.322-555.7 pm. This is the most likely cause of the
variability and lack of reproducibility of results for nickel carbonate hydroxide
sample. Phagocytic uptake of 2 NiC0 3 «3 Ni(0 H)2« 4 H2 0 occurred in a dose-
dependent manner, but occurred to a lesser extent than that of the positive control.
Table 1-2B gives the values for the experiments conducted. The cytotoxicity
experiments with 10T14 cells treated with 2 NiC0 3 »3 Ni(0 H)2«4 H2 0 occurred in a
dose-dependent manner, however there was quite a bit of variability observed (Table
1-3B). The LC50 was calculated to be 6.2 ± 2.7 pg/ml. In the chromosomal
aberration studies for 2 NiC0 3 «3 Ni(0 H)2*4 H2 0 , it was seen that this compound is
able to induce some chromosomal aberrations, but only 17 % at 5.0 pg/ml. The
aberrations seen were breaks, fragments, and a few satellite associations (Table 1-
4B). 2 NiC0 3 «3 Ni(0 H)2«4 H20 was not efficient at focus formation (Table 1-5B and
Figure 1-5), and is projected to be at best weakly carcinogenic, and likely non-
carcinogenic in animals.
For the two nickelic hydroxide compounds, both compounds were taken up
by the IOTV 2 cells, with the powdered form at higher levels of uptake than the dried
slurry (Table 1-2C & D). The uptake of particles was in a dose-dependent manner
for both forms of Ni(OH)3. Survival of 10TX A cells treated with Ni(OH)3 (powder)
in a dose-dependent manner, but was not reproducible. The LC50 was calculated to
52
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
be 2.4 ± 1.8 pg/ml. Ni(OH)3 (dried slurry) was not as cytotoxic to IOTV 2 cells as the
powdered form. The LC50 was calculated from five independent experiments to be
23.4 ± 9.7 pg/ml, therefore, the dried slurry was 10 times less cytotoxic than the
powdered form. Ni(OH)3 (powder) did not effectively induce chromosomal
aberrations (Table 1-4C). There were only a few breaks, fragments and satellite
associations. The Ni(OH)3 (dried slurry) was the least effective at inducing
chromosomal aberrations, in that, at the highest treatment concentration (10 pg/ml),
only 4.6 % of the cells contained aberrations. Neither form of Ni(OH)3 was efficient
at inducing morphological transformation (Table 1-5C, D, Figure 1-5).
The four compounds studied can be compared and ranked according to their
properties. The ranking based on phagocytic uptake was as follows: Ni° (1.5 pm) >
Ni(OH)3 (powder) > Ni(OH)3 (dried slurry) > 2NiC03 *3Ni(0H)2«4H20 (Figure 1-
4). A comparison of the survival curves of all four compounds tested is given in
Figure 1-5. The four compounds tested can be ranked according to their cytotoxic
ability as follows: Ni° (1.5 pm) [LC5o=2.3 ± 0.6 pg/ml] > Ni(OH)3 (powder)
[LC5 0 =2.4 ± 1.8 pg/ml] > 2NiC03 »3Ni(0H)2»4H2 0 [LC5 0 =6.2 ± 2.7 pg/ml] >
Ni(OH)3 (dried slurry) [LC5 o =23.4 ± 9.7 pg/ml]. The ability to induce chromosomal
damage of the four compounds tested can be ranked in the following order: Ni° (1.5
pm) > 2NiC03*3Ni(0H)2*4H20 > Ni(OH)3 (powder) > Ni(OH)3 (dried slurry)
(Table 1-4). The four compounds tested can be ranked according to their
53
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
carcinogenic potential as follows: Ni° (1.5 pm) > 2 NiC0 3 «3 Ni(0 H)2»4 H2 0 >
Ni(OH)3 (powder) > Ni(OH)3 (dried slurry). A comparison of the transformation
curves of all four compounds tested is given in Figure 1-6.
Therefore, predictions can be made that particles of spherical elemental
nickel, Ni° (1.5 pm), will be carcinogenic in whole animal carcinogenicity assays,
based on the strong yield of morphological transformation this sample caused in
IOTV 2 cells. 2NiC03 «3Ni(0H)2*4H20 is predicted to be either weakly carcinogenic
or non-carcinogenic. The two nickelic hydroxide samples are also projected to be
non-carcinogenic based on their weak, irreproducible, cell transformation results.
54
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 2: Molecular toxicology/genotoxicity of dust samples from the INCO
nickel refinery in Clydach, South Wales (UK), in reference to the component
orcelite.*
ABSTRACT
The INCO nickel refinery in Clydach, Whales, U.K., has been active in
operation since 1901. There have been a total of 365 cases of cancers reported in the
workers of this refinery since the 1920’s, including 85 nasal cancers and 280 lung
cancers. From 1901 to 1923, the incidence of these cancers was very high. The
INCO refinery then changed the process of nickel refining after 1923 (Draper, 1994,
ETP). The change in the refining process eliminated the orcelite component
(Ni5 As2). The incidences of cancers were subsequently reported to be greatly
reduced from 1925-1930. A refinery dust sample was obtained in 1920 and another
in 1929, and both samples were archived. Both samples contain primarily green
(high temperature) nickel oxide (NiO). The main difference between the two dust
samples is the presence of a nickel arsenide (Orcelite) in the 1920 sample. The
orcelite content in the 1920 sample is -10 % and in the 1929 sample is only ~1 %. It
is hypothesized that it is the nickel arsenide component of the 1920 sample that was
responsible for the nasal and respiratory cancers in the refinery workers. Portions of
the 1920 and 1929 samples were obtained and studied to determine their cytotoxic
and genotoxic properties. A pure sample of the nickel arsenide (orcelite) was
therefore obtained and used for comparison.
55
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
The objectives of this study were: a) to use short-term in vitro assays to
determine the relative genotoxicities of the two nickel refinery samples and b) to
determine whether the in vitro genotoxicities of these nickel refinery samples
correlate with their carcinogenicities in humans. For this purpose, the following
assays were conducted in C3H/10TV2 Cl 8 (IOTV2) mouse embryo cells: 1)
phagocytic uptake, 2) cytotoxicity, 3) induction of chromosomal aberrations, 4)
induction of apoptosis, and 5) induction of morphological transformation.
Our results showed that all of the samples were taken up by the cells by
phagocytosis to similar extents. Both the 1920 and the 1929 samples and the pure
orcelite sample, were cytotoxic to 10T Vi mouse embryo cells. The LC50 values are
(2.4 ± 0.3) pg/ml for the 1920 sample, (1.7 ± 0.4) pg/ml for the 1929 sample, and
(2.4 ± 0.2) pg/ml for the pure sample of orcelite. In support of our hypothesis, we
found that the 1920 sample was able to induce morphological transformation in a
dose-dependent manner, with 9 foci per 20 dishes treated with the highest
concentration of 7.5 pg/ml. The results show that the 1929 sample did not induce
morphological transformation. Therefore, the data provides evidence that the 1920
sample has carcinogenic potential, consistent with induction of nasal and respiratory
cancers in the refinery workers before 1923. The 1929 sample did not induce
cellular transformation, consistent with the decrease in human lung and nasal tumors
at this plant after 1923.
* The work in this chapter has been published. Clemens, F., and Landolph, J.R.
Genotoxicity of Samples of Nickel Refinery Dust. J. Tox. Sci., in Press, 2003
56
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
INTRODUCTION
Nickel has many economically important applications. It is found as a
component in alloys, such as stainless steel, in nickel cadmium batteries, and in
nickel plating (IARC, 1976; NIOSH). Nickel compounds are also used as catalysts
in the hydrogenation of fats and oils, in ceramic glazes, and as pigments in paints
(IARC, 1976; NIOSH).
However, exposure to mixtures of certain soluble and insoluble nickel
compounds have been found to cause cancers in humans. Of the studies done, the
most convincing support comes from the epidemiological data of workers in the
industries that smelt and refine nickel ores (IARC, 1990). Exposure to nickel
compounds in the occupational setting occurs by inhalation of nickel-containing
mist, dust, or fumes (IARC, 1990). It has been estimated that in nickel refineries,
occupational exposures for nickel metals and insoluble nickel compounds is ~1
mg/m3 in the air (IARC, 1990).
The INCO nickel refinery at Clydach, Wales has been actively in operation
since 1901. Prior to 1930, this refinery imported nickel ore from their Canadian
parent company and processed it. The material that was processed was a matte,
consisting primarily of nickel and copper sulfides, metallic nickel and copper, a
small amount of cobalt sulfide, and a commercially significant amount of the
precious metals silver, platinum, palladium, selenium and tellurium (Draper, et.al.,
1994b). The matte was processed, first by crushing it, and then it was fed into
57
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
moving bed calciners, where it was oxidized at temperatures up to 780°C. From
there, the oxidized material was transported in wheel barrows to a second shed and
treated in vats of hot sulfuric acid (~12 %) to remove copper and some nickel. The
resultant material was then filtered and dried. It was then transferred to a series of
reactors, in which it was reduced with hydrogen gas, and then reacted with carbon
monoxide gas, eventually forming highly volatile, highly toxic nickel carbonyl. This
nickel carbonyl was passed over nucleating pellets of nickel at high temperatures to
decompose the nickel carbonyl, resulting in metallic nickel and carbon monoxide
gas. These processes were repeated up to seven times, until most of the
commercially important elements could be extracted (Draper, et.al., 1994b).
There have been a total of 365 cases of cancers reported at the Clydach
Nickel Refinery since the 1920’s, including 85 nasal cancers and 280 lung cancers
(Draper, et.al., 1994a). The INCO refinery modified the process of nickel refining at
this refinery after 1923. The changes in the refining process eliminated the nickel
arsenide (orcelite) component. The incidences of cancers were subsequently
reported to be greatly reduced from 1925-1930 (Draper, et.al., 1994b, Gurley, et.al.,
1986, NIOSH, Sunderman and McCully, 1983). A sample of the refinery dust was
taken from this plant in 1920 and another in 1929, and both samples were archived.
The 1920 and 1929 samples have a similar range of particle sizes, with mean
equivalent diameters of 3.0 pm and 1.5 pm, respectively (Draper, et.al., 1994a).
58
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Sample 91 CLYD3, taken in 1920, is a concentrate containing 37.4% nickel,
with the major components being bunsenite nickel oxide, (NiO) or the isomorphous
(Cuo.2*Nio.8)0 , and the minor components being a spinel structure Fe2 0 3 or Fe3 0 4 , a
copper nickel oxide (NiO»CuO) and orcelite (Ni5 »As2) (Draper, et.al. 1994a) (Table
2-1). Arsenic, which contaminated the sulfuric acid until 1923, became concentrated
in the refinery processes, was found to constitute 10% of the 1920 sample (Draper,
et.al., 1994a). The arsenic was in the form of a nickel arsenide, M 5AS2, called
orcelite, which would make up a total of 25% of the 1920 sample (Draper, et.al.,
1994a). It is postulated that the orcelite component was an important compound
responsible for causing the increased incidences of lung and nasal cancers in the
workers at this nickel refinery.
Sample 91 CLYD23, taken in 1929, is a concentrate containing 26.6 %
nickel, with the major components being bunsenite (NiO) or the isomorphous
(Cuo.2*Nio.8)0), and the minor components being tenorite (CuO) and a copper nickel
oxide (NiOCuO), plus smaller amounts of other materials. This sample contains
only about 1 % of arsenic (Table 2-1).
Both samples contain green (high temperature, HT) NiO as their major
component. The main difference between the two is the presence of significant
amounts of the nickel arsenide in the 1920 sample. The arsenic content in the 1920
sample is - 1 0 % and in the 1929 sample is ~1 %. It is hypothesized that the nickel
arsenide component of the 1920 sample is responsible for inducing the cancers of the
59
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
refinery workers, either alone or in combination with the green (HT) NiO in the
sample. A pure sample of the nickel arsenide (orcelite) was therefore obtained and
used as a positive control.
Since there are epidemiological studies that show that there was a high
incidence of cancer in 1920, but a substantially decreased incidence of cancer by
1929, after the refining process was changed, these samples provide a unique
opportunity to correlate the results of epidemiological studies with the results of
model system based assays to detect chromosomal aberrations and morphological
transformation.
To test this hypothesis, the following characteristics were studied: the ability
of these nickel samples to be phagocytosed into, and to induce cytotoxicity,
chromosomal aberrations, and morphological cell transformation in, C3H/10T1/2 Cl
8 (10T1/2) cells, a mouse fibroblastic cell line derived from C3H mouse embryos
(Reznikoff, et al., 1973a). Carcinogenic insoluble nickel compounds (Miura, et al.,
1989), lead chromate (Patiemo, et al., 1988), aflatoxin B1 (Billings et al., 1979),
polycyclic aromatic hydrocarbons (Reznikoff, et al., 1973b), Landolph and
Heidelberger, 1979) and aromatic amines (Landolph and Heidelberger, 1979) all
induce morphological and neoplastic transformation in 10T1/2 cells.
Insoluble nickel subsulfide, crystalline nickel monosulfide, and green (high
temperature) and black (low temperature) nickel oxides, are phagocytized into, and
induce cytotoxicity, chromosomal aberrations, and morphological transformation in,
60
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
SHE cells (Costa et al., 1982; Heck and Costa, 1983; Costa et al., 1994) and in 10T1/2
cells (Miura et al., 1989; Landolph, 1989, 1990; 1999; Landolph et al., 2002) and
cytotoxicity and anchorage independence in diploid human fibroblasts (Biedermann
and Landolph, 1987). Insoluble nickel compounds generate oxygen radicals in
mammalian cells, which likely contribute to induction of morphological
transformation and the 130 changes in gene expression observed in nickel
compound-induced, transformed 10T1/2 cell lines (Landolph, 1999; Landolph et al.,
2002, Verma, et.al., 2003).
61
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Table 2-1: Components of CLYD3 (1920) and CLYD23 (1929)
Comparison of the components of the refinery dust samples from the
INCO refinery, CLYD3 (1920) and CLYD23 (1929). Both dust
samples contain green (HT) NiO as the major component. The main
difference between the two samples is the presence of a significant
amount of nickel arsenide (orcelite) in the 1920 sample.
CLYD3 (1920) CLYD23 (1929)
Percent Nickel 37.4 % 26.6 %
Major
NiO NiO
Components
Cuo.2Nio.8O Cuo.2Nio.8O
Minor
Fe203/Fe304 CuO
Components
NiOCuO NiOCuO
As(~10 %) As(~l %)
62
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
MATERIALS AND METHODS
Samples used
Two dust samples taken from the Clydach refinery were obtained through the
courtesy of Dr. John Duffus, University of Edinburgh, Scotland, United Kingdom
and through the courtesy of Dr. Milton Parks and Dr. Sallie Williams of the nickel
refinery at Clydach, Wales, United Kingdom. The sample, CLYD3, was taken from
the refinery in 1920, and the sample, CLYD23, was taken in 1929, and both samples
were archived. Table 2-1 shows the percentage of nickel and the other components
in each sample. The 1920 sample contains a nickel arsenide compound, orcelite, in
the stoichiometry of Nis.x As2. Pure nickel arsenide, NI5AS2, was obtained through
the courtesy of Dr. William F. Sunderman, Jr., previously of the University of
Connecticut, Storrs, CT (Sunderman and McCully, 1983), now of Middlebury
University, Vermont.
The archived samples were stored by Dr. Morrell H. Draper at the Univeristy
of Edinburgh, Consultant in Toxicology, 10 West Mayfield, Edingurgh, Scotland,
United Kingdom. Dr. Draper stored these samples in sterile, airtight containers free
from contaminants. These samples were obtained from Dr. Draper, courtesy of Dr.
John Duffus, University of Edinburgh. The samples were stored in sterile, airtight
containers free from contaminants in the same manner as Dr. Draper. For each
experiment, a fresh stock of the samples was weighed on the day of the experiment,
then the samples were suspended in acetone to sterilize them, and the samples were
63
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
then used immediately. After weighing out the samples and suspending them in
acetone, the sample suspensions were vortexed to homogenize them, and then they
were serially diluted from the stock. Immediately prior to adding the samples in
acetone to the cell cultures, the samples were again vortexed to ensure homogeneity
of the suspensions.
Cells and Cell Culture
C3H/10T!/2 Cl 8 (IOTV2) cells were grown in Basal Medium Eagles (BME)
supplemented with 10 % heat inactivated fetal calf serum (FCS) (Omega Scientific
Company, Inc., Tarzana, CA). Lots of fetal calf serum (FCS) were pre-screened to
identify those that supported a plating efficiency of approximately 30 % and a yield
of morphological cell transformation greater than five foci/twenty dishes when cells
were treated with 1 pg/ml of the carcinogen, 3-methylcholanthrene (MCA). These
lots of FCS were purchased and used in these studies. IOTV 2 cells were used
between passages five and ten, to minimize the yield of spontaneous morphological
■ y
transformation. Cells were grown in 75 cm tissue culture flasks (VWR Company,
San Francisco, CA) and were maintained in logarithmic phase of growth in
incubators containing 5 % CO2 and 95 % air (v/v) and maintained at a temperature of
37°C in a humidified atmosphere, as described (Reznikoff et al., 1973 a, b; Landolph
and Heidelberger, 1979; reviewed in Landolph, 1985; Patiemo et al., 1988; Mima et
al., 1989).
64
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Assays to detect phagocytosis of nickel refinery samples and orcelite
Two thousand IOTV 2 cells were seeded into each 60 mm dish, and two dishes
were seeded and used for each treatment condition. Twenty-four hours after the cells
were seeded, the samples were suspended in acetone and added to the cells. Twenty-
five pi of the sample suspension was added to each dish containing five ml of BME
medium plus 10 % (v/v) fetal calf serum (the final concentration of acetone in the
medium was 0.5 % v/v). After treatment of cells with sample for forty-eight hours,
the medium was removed, and the cells were rinsed once with isotonic saline (0.9
%), then fixed for 20 minutes with 100 % ethanol, and then stained with 1 % crystal
violet. The cells were then examined with a light microscope, and those cells with
one or more vacuoles containing one or more particles of nickel sample in the
cytoplasm were scored as phagocytosing cells. The data is reported as the
percentage of cells containing at least one vacuole with a phagocytosed particle.
Assays to detect cytotoxicity by nickel refinery samples and orcelite
These assays were performed as previously described (Landolph and
Heidelberger, 1979; Miura, et al. 1989; Patiemo, et al., 1988; Verma, et.al. 2000;
reviewed in Landolph, 1985). Briefly, two hundred 10TV4 cells were seeded into
each 60 mm dish in five ml of BME containing 10 % FCS (v/v). Five dishes were
seeded for each concentration of each sample to be studied. Twenty-four hours after
cells were seeded, the samples were suspended in acetone and added to the cells (the
65
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
final concentration of acetone in the medium was 0.5 %, v/v). Twenty-five j o . 1 of the
sample suspension was then added to each dish containing five ml of BME with 10%
FCS. Two negative controls, medium alone and medium plus 0.5 % (v/v) acetone,
were used in each experiment. After forty-eight hours of treatment of cells with
samples, the medium was removed and replaced with fresh medium containing 10 %
FCS. Cells were then cultured for an additional five to seven days, until colonies
became visible under the dissecting microscope. Eight to ten days after the cells
were initially seeded, when living colonies were clearly visible by examination of the
dishes under a dissecting microscope, the medium was removed, and the cells were
rinsed once with isotonic saline (0.9 %), fixed for twenty minutes with 100 %
methanol, and then stained for 20 minutes with filtered 10 % Giemsa stain. Colonies
containing twenty or more cells in each dish were then scored under the dissecting
microscope.
The plating efficiency (PE) is the number of colonies (containing twenty or
more cells) on the dishes eight days post seeding, divided by the total number of
cells seeded (200 cells), multiplied by 100 %. The average survival fraction (PE of
treated cells/PE of acetone control cells) was calculated for each set of five dishes for
each treatment, and reported as mean ± standard deviation. Utilizing the
relationship, S = exp(-kc), were S is the survival fraction, c is the concentration of
the sample tested, and k is the slope of the dose-response curve, the average survival
fractions for each treatment were plotted on a semi-logarithmic scale (log
66
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
concentrations vs. dose) to determine the LC50 value (the concentration at which the
survival fraction is reduced to 50 %) for each sample in IOTV 2 cells.
Detection and visualization of apoptosis
To detect apoptosis induced by insoluble nickel compounds, 20,000 cells
were seeded onto one cover slip in each 100 mm dish. Twenty-four hours after the
cells were seeded, the samples were suspended in acetone and added to the cells.
Seventy-five pi of the sample suspension was added to each 100 mm dish containing
15 ml of medium plus 10 % FCS (final concentration of acetone in the medium was
0.5 % v/v). After forty-eight hours of treatment of cells with sample, the medium
was removed, and the cells were fixed for 1 hour at 37°C with 15 ml of magnesium
ethanol solution (15 mM MgC^ + 25 % ethanol) and 0.1 volume of 1 mg/ml of
ribonuclease A (RNase A). The solution was aspirated, and the cells were then
stained with 15 ml of 500 ng/ml of propidium iodide for 1 hour at 37°C. The
coverslips were removed from the dishes and then mounted onto glass slides using
50 % glycerol in phosphate buffered saline, pH 7.2 (mounting solution). The cells
were examined with a fluorescent microscope (using 536 nm for fluorescence
excitation and 620 nm for fluorescence emission), and cells undergoing apoptosis
were scored. The propidium iodide stains the nucleus, and in cells undergoing
apoptosis, the cells are smaller, and they have fragmented nuclei with condensed
chromatin. The data was reported as percent apoptotic cells.
67
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Induction of Chromosomal Aberrations in IO TV 2 Cells by nickel refinery
samples and orcelite
The method used to detect chromosomal aberrations was that of Ishidate, et
al. (1977, 1981). Fifty thousand IOTV 2 cells were seeded into each 60 mm dish, and
two dishes were utilized to determine the induction chromosomal aberrations by each
concentration of sample studied. Twenty-four hours after the cells were seeded, the
samples were suspended in acetone and added to the cells. Twenty-five pi of the
sample suspension were added to each dish containing five ml of BME containing 10
% FCS (the final concentration of acetone was 0.5 % v/v in the medium). Cells were
treated with nickel samples for forty-eight hours, then cells were arrested in the
metaphase stage by treating them with 0.02 pg/ml colcemid for eighteen hours prior
to termination of nickel sample treatment. After treatment with nickel samples, cells
were then incubated with hypotonic solution (0.075 M KC1) for 20 minutes, then
fixed in cold Camoy’s fixative (3:1 v/v methanol: acetic acid). Fixed cells were then
dropped onto slides, air-dried, and then stained with 10 % Giemsa stain. For each
concentration of nickel sample studied, chromosomes from 100 cells treated with the
nickel sample were examined by microscope and scored for various chromosomal
aberrations.
68
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Induction of Morphological Cell Transformation by Nickel-Containing Refinery
Samples and Orcelite
These assays were conducted according to methods described by Reznikoff,
et.al., (1973b) with modifications developed and used in our laboratory (Landolph
and Heidelberger, 1979; Patiemo et al., 1988; Miura et al., 1989; reviewed in
Landolph, 1985). Two thousand cells were seeded into each 60 mm dish, and twenty
dishes were used to determine the induction of morphological cell transformation by
each concentration of each nickel sample studied. Twenty-four hours after cells
were seeded, the nickel samples were suspended in acetone and added to the cells
(the final concentration of acetone was 0.5 % v/v in the medium). Twenty-five pi of
the sample suspension were added to each dish containing five ml of BME
containing 10 % FCS. 1 pg/ml of MCA was used as a positive control as a known
inducer of morphological transformation (Reznikoff et al., 1973b; Landolph and
Heidelberger, 1979; Patiemo, et al., 1988; Miura et al., 1989; reviewed in Landolph,
1985). Medium alone and medium plus acetone (0.5 % v/v in the medium) were used
as negative controls. After forty-eight hours of treatment of cells with samples, the
medium was removed and replaced with fresh medium not containing samples, and
the medium was then replaced twice per week until cells became confluent, then
once per week. The cells were cultured for a total of six weeks from the time they
were seeded. Six weeks after the cells were initially seeded, the medium was
removed, and the cells were rinsed once with isotonic saline (0.9 %), then fixed for
69
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
20 minutes with 100 % methanol, and next stained for 20 minutes with filtered 10 %
Giemsa stain. Type II and type III foci were scored and tabulated as described
(Reznikoff, et.al., 1973b) with our more recent modifications for scoring
heterogeneous foci and foci on the borderline between type I and type II and between
type II and type III (Landolph and Heidelberger, 1979; Miura, et al., 1989; Patiemo,
et al., 1988; reviewed in Landolph, 1985).
RESULTS
Assays to detect phagocytosis of nickel refinery samples and orcelite
Since insoluble nickel compounds need to be phagocytosed by cells in order
to manifest their cytotoxic and genotoxic properties (Costa et al., 1982; Miura et al.,
1989; reviewed in Landolph, 1990), first it was determined whether these insoluble
nickel refinery samples were phagocytosed by 10T/4 cells. To do this, the 10T/4 cells
were treated with doses of the nickel samples ranging from 0.5 pg/ml to 7.5 pg/ml.
When 10T72 cells were treated with from 0.5 pg/ml to 7.5 pg/ml of nickel samples,
they phagocytosed all three samples, CLYD3 (1920), CLYD23 (1929), and Ni5 As2
(orcelite) (Table 2-2). The phagocytosis of these three samples was reproducible in
two separate experiments, so the results of both experiments were averaged and
plotted in Figure 2-2. Over concentrations ranging from 0.5 pg/ml to 2.5 pg/ml,
there was a dose-dependent uptake of particles from the 1920 sample. At
concentrations ranging from 2.5 pg/ml to 7.5 pg/ml, there was no further increase in
70
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
uptake of this sample, but a significant, dose-related decrease in phagocytic uptake.
Uptake of the 1929 sample increased linearly with concentration, from 0.5 pg/ml
until 1 .0 pg/ml, and then a more gradual increase in uptake with a lesser slope
occurred from 2.5 pg/ml to 7.5 pg/ml. Phagocytic uptake of the M 5AS2 sample
occurred in a dose-dependent manner over the entire dose range from 0.5 pg/ml to
7.5 pg/ml. The slope for uptake was greatest from 0 - 0.5 pg/ml, and then a lesser
slope for uptake occurred from 0.5 to 7.5 pg/ml (Figure 2-2).
To compare uptake among these three samples, we compared the phagocytic
uptake we determined for all three samples at 1.0 pg/ml and at 5.0 pg/ml, shown in
Figure 2-2. In cells treated with the 1920 sample, at a concentration of 1.0 pg/ml,
5% of the cells contained vesicles with phagocytosed particles, and at 5.0 pg/ml,
8.0% of the cells contained phagocytosed particles. In cells treated with 1.0 pg/ml
and 5.0 pg/ml concentrations of the 1929 sample, 7% and 7.5% of cells contained
vesicles with phagocytosed particles, respectively. In cells treated with 1.0 jig/ml
and 5.0 pg/ml of orcelite, 11%, and 19% of cells, respectively, contained
phagocytosed particles. Hence, the relative abilities of these nickel-containing
samples to be taken up by phagocytosis into 1O T V 2 cells, when the entire curves for
phagocytic uptake were considered for concentrations less than 5 pg/ml were
considered, was orcelite > 1929 sample ~ 1920 sample (Figure 2-2).
71
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Figure 2-1: Photographs of Phagocytosis
A) Phagocytosis of the 1920 sample
B) Phagocytosis of the 1929 sample
C) Phagocytosis of Ni5 As2
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Table 2-2: Assays to detect the phagocytic uptake of the two nickel refinery
samples and the orcelite
For these experiments, 2,000 cells were seeded into each 60 mm dish,
using two dishes per concentration. 24 hours after seeding, 25 pi of
treatment concentrations were added to the dishes. The dished were
fixed and stained with Crystal Violet after 48 hours. The dishes were
then scored for cells containing vacuoles with particles. Two
experiments were done for each compound tested. A) CLYD3
(1920); B) CLYD23 (1929); C) Ni5 As2 (orcelite)
A) CLYD3 (1920)
Concentration
(pg/ml)
% Phagocytosing cells
Average + SD
Expt. I Expt. II
0 (medium only) 0.0 0.0 0.0 ± 0.0
0.0 0.0 0.0 0.0 ± 0.0
0.5 3.0 4.0 3.5 ± 0.7
1.0 5.0 5.0 5.0 ± 0.0
2.5 10.0 9.0 9.5 ± 0.7
5.0 8.0 8.0 8.0 ± 0.0
7.5 0.0 2.0 1.0 ± 1.4
73
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Table 2-2: Continued
B) CLYD23 (1929)
Concentration
(pg/ml)
% Phagocytosing cells
Average + SD
Expt. I Expt. II
0 (medium only) 0.0 0.0 0.0 ± 0.0
0.0 0.0 0.0 0.0 ± 0.0
0.5 3.0 4.0 3.5 + 0.7
1.0 6.0 8.0 7.0 +1.4
2.5 6.0 5.0 5.5 ± 0.7
5.0 7.0 8.0 7.5 ± 0.7
7.5 11.0 9.0 10.0 + 1.4
C) Ni5 As2
Concentration
(pg/ml)
% Phagocytosing cells
Average + SD
Expt. I Expt. II
0 (medium only) 0.0 0.0 0.0 ± 0.0
0.0 0.0 0.0 0.0 + 0.0
0.5 10.0 11.0 10.5 + 0.7
1.0 11.0 11.0 11.0 ± 0.0
2.5 13.0 12.0 12.5 ± 0.7
5.0 19.0 18.0 18.5 ± 0.7
7.5 23.0 21.0 22.0 ± 1.4
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Figure 2-2: Plot of Phagocytosis Assays
A comparison of phagocytic uptake of the three samples tested. The
samples can be ranked according to their phagocytic uptake as
follows: Ni5 As2 (orcelite) > CLYD3 (1920) > CLYD23 (1929)
M
f= t
0 )
u
bfl
.a
M
o
f t
u
o
h o
(0
A
0 H
ft
0 )
u
(1
P h
30
25
20
15
1929
10
5
1920
0
0.0 1.0 2.0 3.0 4.p 5.0 6.0
Concentration (|ig/ml)
7.0 8.0
75
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Assays to detect cytotoxicity by nickel refinery samples and orcelite
The three nickel-containing samples - CLYD3 (1920), CLYD23 (1929), and
M 5AS2 - all independently caused a dose-dependent cytotoxicity to lOT'A cells when
the cells were treated with concentrations of the samples ranging from 0 .1 pg/ml to
7.5 pg/ml (Table 2-3), a similar concentration range that these samples were
phagocytosed by IOTV 2 cells (Table 2-2). The results of four separate cytotoxicity
experiments were reproducible for each separate nickel-containing sample, so the
results of the four experiments were averaged separately for each of the three
samples and plotted (Figure 2-3). When 1O T V 2 cells were treated with concentrations
of the 1920 sample ranging from 0 pg/ml to 7.5 pg/ml, the survival of the treated
cells was reduced from 100 % to 31 % (Figure 2-3). The 1920 sample had a similar
cytotoxicity to the other two samples in the concentration range from 0 .1 pg/ml to
2 . 0 pg/ml, but was found to be less cytotoxic than the other two samples studied at
concentrations of 5.0 pg/ml and 7.5 pg/ml. The LC50 value for the survival of 10T/4
cells treated with the 1920 sample was found to be (2.4 ± 0.3) pg/ml. Since the
cytotoxicity curves in cells treated with the 1920 sample was curvilinear, both the
overall shape of the curves and the LC50 values were utilized in evaluating the
relative cytotoxic potencies among these samples.
Treatment of IOTV 2 cells with concentrations of the 1929 sample, ranging
from 0 pg/ml to 7.5 pg/ml, reduced the survival fraction of IOTV 2 cells from 100 %
76
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
to 13 %. The highest concentration of the 1929 sample used, 7.5 pg/ml, reduced the
survival of 10Tl/ 2 substantially, down to 15 %, compared to the treatment of cells
with the 1920 sample at the same dose, which only reduced the survival of the cells
to 30 %. The shape of this survival curve of IOTV 2 cells treated with the 1929 sample
was exponential (a straight line in a semi-logarithmic plot of In (s) vs. concentration).
The LC50 value for the 1929 sample, derived from the survival curve for the 1929
sample, was (1.7 ± 0.4) pg/ml.
The survival curve of IOTV 2 cells treated with from 0.5 pg/ml to 7.5 pg/ml of
orcelite was similar to that of cells treated with the 1929 sample, and was also
crudely exponential. The survival of IOTV 2 cells was reduced from 100 % to 11 % as
the cells were treated with concentrations of orcelite ranging from 0 pg/ml to 7.5
pg/ml (Figure 2-3). The LC50 value derived from the orcelite survival curve,
however, is closer in value to that of the 1920 sample, in that it was determined to be
(2.4 ± 0.2) pg/ml. Treatment of IOTV 2 cells with orcelite and the 1929 sample
resulted in roughly semi-logarithmic survival curves. The slopes of these survival
curves, calculated as if the curves were all exponential, were -6.7 for the 1920
sample, -10.0 for the 1929 sample, and -11.0 for the orcelite sample. Hence, the
relative cytotoxic potential of these samples, based on the overall shape of the
survival curves, were 1929 sample (slope = -1 0 .0 , LC50 =1.7 pg/ml) > M 5AS2 (slope
= - 1 1 .0 , LC50 = 2.4 pg/ml) > 1920 sample (slope = -6.7, LC50 = 2.4 pg/ml).
77
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Table 2-3: Assays to detect cytotoxicity caused by the two nickel refinery
samples and the orcelite
For these experiments, 200 cells were seeded into each 60 mm dish,
using five dishes per concentration. 24 hours after seeding, 25 pi of
treatment concentrations were added to the dishes. After 48 hours of
treatment, the medium in the dishes was replaced. The dished were
fixed and stained with Giemsa stain 8-10 days post-seeding. The
dishes were then scored for colonies containing 20 or more cells. The
plating efficiencies were calculated and the survival fraction
determined. Multiple experiments were done for each compound
tested. A) CLYD3 (1920); B) CLYD23 (1929); C) Ni5As2 (orcelite)
A) CLYD3 (1920)
Concentration
(pg/ml)
Survival Fraction (%)
Average +
SD I II
III
(TA I)
IV
(TA II)
0 (medium only) 92.2 87.2 92.2 98.1 92.5 ± 4.5
0.0 100.0 100.0 100.0 100.0 100.0 ± 0.0
0.1 67.9 67.9 67.9 ± 0.0
0.5 69.6 74.8 60.1 58.0 65.6 ± 7.9
1.0 63.2 55.9 55.4 47.8 55.6 ± 6.3
2.5 52.4 49.5 47.0 42.9 47.9 ± 4.0
5.0 34.1 45.0 37.2 30.2 36.6 ± 6.3
7.5 33.9 29.1 18.2 27.0 + 8.0
78
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Table 2-3: Continued
B) CLYD23 (1929)
Concentration
(pg/ml)
Survival Fraction (%)
Average ±
SD
I II
III
(TA I)
IV
(TA II)
0 (medium only) 92.2 87.2 92.2 97.6 92.3 ± 4.3
0.0 100.0 100.0 100.0 100.0 100.0 + 0.0
0.1 81.8 81.8 ± 0.0
0.5 70.9
75.7 79.1 75.2 + 4.1
1.0 72.6 65.2 45.6 59.1 60.6111.4
2.5 42.6 44.1 28.4 35.5 37.6 ± 7.2
5.0 32.1 30.0 26.0
30.7 29.7 ± 2.6
7.5 15.7 5.1 18.9 13.2 ± 7.2
C) Ni5As2
Concentration
(pg/ml)
Survival Fraction (%)
Average +
SD
I II
III
(TA I)
IV
(TA II)
0 (medium only) 99.7 108.3 99.4 98.7 101.5 ± 4.5
0.0 100.0 100.0 100.0 100.0 100.0 ± 0.0
0.5 82.1 83.8 83.2 85.1 83.6 ± 1.2
1.0 69.7 71.7 71.3 69.2 70.5 ± 1.2
2.5 52.4 47.5 48.7 43.4 48.0 ± 3.7
5.0 29.4 30.2 31.9 29.8 30.3 ± 1.1
7.5 10.4 12.1 11.9 11.6 11.5 + 0.8
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Figure 2-3: Plot of Cytotoxicity Assays
A comparison of cytotoxicity to lOPA cells caused by treatment with
the three samples tested, plotted on a semi-logarithmic scale. The
samples can be ranked according to their cytotoxic ability as follows:
CLYD23 (1929) [LC5 0 = 1 .7+0.4 pg/ml] > Ni5As2 (orcelite) [LC5 0 =
2.4+0.2 pg/ml] > CLYD3 (1920) [LC5 0 = 2.4+0.3 pg/ml]
100 J O
1920
LCsoF24±0.3|tyMl
• I
1929
L CscFl .7+0.4tigAni
IMfs
LC9f=2.4±0.2|*Artl
10.0
00 10 30 40 50 60 70 80 10.0 11.0
Concent ration (pg/ml)
80
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Detection and visualization of apoptosis
In IOTV 2 cells treated with the 1929 sample, there was a slight increase in the
percentage of cells undergoing apoptosis, from 0 to 5 %, as the concentration of
sample used to treat cells increased from 0 to 7.5 pg/ml (Table 2-4). In cells treated
with the 1929 sample, the percentage of cells undergoing apoptosis increased from 0
to 2 % as the concentration of sample increased from 0 to 7.5 pg/ml. Similarly, in
cells treated with orcelite, the percentage of cells undergoing apoptosis increased
from 0 to 2 % as the concentration of orcelite used to treat cells increased from 0 to
7.5 pg/ml (Table 2-4). The results indicate that these three samples caused a small
induction of apoptosis in IOTV 2 treated with these samples. The increases in
apoptosis were small and not dose-dependent.
81
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Table 2-4: Detection and visualization of apoptosis
For these experiments, 20,000 cells were seeded into each 100 mm
dish, using one dish per concentration. 24 hours after seeding, 75 pi
of treatment concentrations were added to the dishes. After 48 hours
of treatment, the medium in the dishes was removed. The dished
were fixed with magnesium ethanol solution and stained with
propidium iodide. The dishes were then scored for cells undergoing
apoptosis. Two experiments were conducted for each sample tested,
and the data was reported as percent apoptotic cells.
Concentration
(pg/ml)
1920 1929 M 5AS2
0 . 0 0 . 0 ± 0 0 . 0 ± 0 0 . 0 ± 0
0.5 2 . 0 ± 2 1 . 0 ± 1 1 . 0 ± 0
1 . 0 1 . 0 + 1 4.0 + 2 1 . 0 + 1
2.5 3.0 ± 3 1 . 0 ± 1 1 . 0 ± 1
5.0 5.0 ± 1 1 . 0 ± 0 2 . 0 ± 1
7.5 4.0 ± 1 2 . 0 ± 1 2 . 0 ± 1
8 2
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Induction of Chromosomal Aberrations in IO T V 2 Cells by nickel refinery
samples and orcelite
In IOTV 2 cells treated with the negative control conditions, medium only or
with 0.5 % acetone, the percentage with chromosomal aberrations was 2 % and 3 %,
respectively. The positive control, Mitomycin C (MMC) at a concentration of 1
pg/ml, caused a strong yield of chromosomal aberrations, including breaks,
fragments, dicentrics, translocations, and satellite associations (Table 2-5). In cells
treated with 1 pg/ml of MMC, 20 % of the cells had chromosomal aberrations, which
was an eight-fold increase in the percentage of cells bearing chromosomal
aberrations over that in the average of the two control groups (2.5 %).
Treatment of IOTV 2 cells separately with all three samples, CLYD3 (1920),
CLYD23 (1929), and M 5AS2, over the concentration range from 0.5 pg/ml to 7.5
pg/ml, increased the frequency of chromosomal aberrations in these cells over the
frequency of chromosomal aberrations in control (medium or acetone-treated) cells
(Table 2-5). Breaks, fragments, dicentrics, translocations, satellite associations, and
rings were all induced in IOTV 2 cells treated with these nickel-containing samples.
Breaks, fragments, and satellite associations, were the most common types of
chromosomal aberrations induced, and dicentrics and translocations were induced,
but less frequently (Table 2-5). In KfPA cells treated with 0.5 pg/ml, 1.0 pg/ml,
2.5 pg/ml, 5.0 pg/ml, and 7.5 pg/ml of the 1920 sample, the percentage of cells
bearing chromosomal aberrations was 4 %, 1 %, 6 %, 8 %, and 7 %, respectively
83
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
(Table 2-4). The greatest amount of chromosomal aberrations occurred in cells
treated with concentrations of 2.5 pg/ml, 5.0 pg/ml, and 7.5 pg/ml, in which 6 %, 8
% and 7 % of the cells contained aberrations, which represents increases of 2.4-fold,
2.9-fold, and 3.2-fold, respectively (Table 2-5). There was no dose-dependence to
the induction of chromosomal aberrations in cells treated with the 1920 sample.
Chromosomal aberrations were also induced in IOTV 2 cells treated with the
1929 sample. The percent of cells with chromosomal aberrations increased from 2 %
and 3 % in control (medium only or acetone only treated) cells to 3 %, 4 %, 4 %, 4
%, 4 %, and 6 % in cells treated with 0.5 pg/ml, 1.0 pg/ml, 2.5 pg/ml, 5.0 pg/ml, and
7.5 pg/ml of the 1929 sample, respectively (Table 2-5). In cells treated with from 0.5
pg/ml to 5.0 pg/ml, this represented a 1.6-fold increase, and in cells treated with the
highest concentration, 7.5 pg/ml, and a 2.4-fold increase, in the percentage of cells
with chromosomal aberrations. While the percentage of cells with chromosomal
aberrations was higher in cells treated with the 1929 sample, the induction of
chromosomal aberrations was, however, not dose-dependent (Table 2-5).
No increase in the percentage of cells with chromosomal aberrations was
detected in lOT1 /- cells treated with 0.5 pg/ml of orcelite (Table 2-5). In cells treated
with Ni5As2 at concentrations of 1.0 pg/ml, 2.5 pg/ml, 5.0 pg/ml, and 7.5 pg/ml,
small increases in chromosomal aberrations was observed, 4 %, 7 %, 6 %, and 8 %,
respectively, similar to the small increases in chromosomal aberrations detected in
10T/4 cells treated with the 1920 or 1929 samples (Table 2-5). These increases
84
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
represented 1 .6 -fold, 2.8-fold, 2.4-fold, and 3.2-fold increases in the percentage of
cells with chromosomal aberrations, and again, these increases were not strictly
dose-dependent.
85
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Figure 2-4: Photographs of Chromosome Aberrations
A) Normal Chromosomal spread
B) Example of a Dicentric chromosome
C) Example of Translocation
# %
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Table 2-5 Induction of Chromosomal Aberrations in 10T% Cells by nickel
refinery samples and orcelite
For these experiments, 50,000 cells were seeded into each 60 mm
dish, using two dishes per concentration. 24 hours after seeding, 25
pi of treatment concentrations were added to the dishes. After 48
hours, the cells were arrested in metaphase, fixed, dropped onto slides
and stained with Giemsa stain. 100 cells were then scored for
chromosomes with aberrations. Two experiments were done for each
compound tested. A) CLYD3 (1920); B) CLYD23 (1929); C) Ni5As2
(orcelite)
A) CLYD3 (1920)
Concentration
(pg/ml)
Breaks
Gaps
Fragments
Dicentrics
Translocations
Satellite associations
Rings
Total # aberrations
Total # examined
% Aberrations
0 (media) 3 3 2 0 0 2
0 (acetone) 3 1 2 6 2 0 0 3
0.5 1 4 1 2 8 2 0 0 4
1 . 0 1 1 2 2 0 0 1
2.5 6 4 1 1 1 2 0 0 6
5.0 3 7 1 4 15 2 0 0 8
7.5 4 6 1 1 1 2 162 7
MMC
9 2 0 2 1 8 40 2 0 0 2 0
( 1 Pg/ml)
87
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Table 2-5: Continued
B) CLYD23 (1929)
Concentration
Gig/ml)
Breaks
Gaps
Fragments
Dicentrics
Translocations
Satellite associations
Rings
Total # aberrations
Total # examined
% Aberrations
0 (media) 3 3 2 0 0 2
0 (acetone) 3 1 2 6 2 0 0 3
0.5 3 2 2 7 2 0 0 4
1 . 0 6 2 8 2 0 0 4
2.5 1 3 3 8 2 0 0 4
5.0 3 2 2 7 2 0 0 4
7.5 2 4 3 1 1 0 171 6
MMC
9 2 0 2 1 8 40 2 0 0 2 0
(lpg/ml)
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Table 2-5: Continued
C) Ni5 As2
Concentration
(Hg/ml)
Breaks
Gaps
Fragments
Dicentrics
Translocations
Satellite associations
Rings
Total # aberrations
Total # examined
% Aberrations
0 (media) 3 3 2 0 0 2
0 (acetone) 3 1 2 6 2 0 0 3
0.5 2 1 3 2 0 0 2
1 . 0 3 1 3 1 8 2 0 0 4
2.5 3 6 1 1 3 14 2 0 0 7
5.0 1 3 1 2 3 1 0 180 6
7.5 4 5 3 3 15 189 8
MMC
9 2 0 2 1 8 40 2 0 0 2 0
(l^g/ml)
89
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Induction of Morphological Cell Transformation by Nickel-Containing Refinery
Samples and Orcelite
Interestingly, the 1920 sample induced strong morphological transformation
in IOTV 2 cells in the form of both type II and type III foci (Table 2-6, Figure 2-6).
The yield of total type II plus type III foci increased in a dose-dependent manner in
cells treated with from 0.1 pg/ml to 1.0 pg/ml of the 1920 sample, and this portion of
the curve had a slope of 4.5 (calculated from the linear portion of the curve). This
curve then plateaued when cells were treated with concentrations from 1 .0 pg/ml to
5.0 pg/ml, and then increased again slightly when cells treated with 7.5 pg/ml of this
sample (Figure 2-6). The second slope of this curve, from 5.0 pg/ml to 7.5 pg/ml,
was 1.60. An overall slope for this curve, assuming linearity, would be 0.75.
Surprisingly, the 1929 sample did not induce any focus formation at all in
IOTV 2 cells. This was consistent with the epidemiological data, which indicated a
substantial reduction in human nasal and respiratory cancer after 1929 in the nickel
refinery workers at Clydach.
No foci were induced when IOTV2 cells were treated with 0.5 pg/ml or with
1 .0 pg/ml of the nickel arsenide, orcelite, which was used as a positive control
(Table 2-6, Figure 2-6). Orcelite, however, did induce a high yield of morphological
transformation in IOTV 2 cells at high concentrations (Figure 2-6). The induction of
foci did occur in a dose-dependent manner in cells treated with orcelite over the
concentration range from 2.5 pg/ml to 7.5 pg/ml (Figure 2-6). The overall slope of
90
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
this curve was 3.41, assuming linearity of the dose-response curve. The yield of foci
in cells treated with the highest concentration of 7.5 pg/ml of orcelite was 26 foci/20
dishes, which included the detection of 13 type III foci (Figure 2-6, Table 2-6).
Therefore, the potency of these samples in inducing morphological cell
transformation was orcelite (slope = 3.40) > 1920 sample (slope = 0.75) » > 1929
sample (slope = 0, did not induce cell transformation), although the 1920 sample was
more strongly transforming at the lower concentrations, from 0.5 pg/ml to 2.0 pg/ml
(Figure 2-6).
91
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Table 2-6: Induction of Morphological Cell Transformation by Nickel-
Containing Refinery Samples and Orcelite
For these experiments, 2,000 cells were seeded into each 60 mm dish,
using 20 dishes per concentration. 24 hours after seeding, treatment
concentrations were added to the dishes. After 48 hours of treatment,
the medium in the dishes was replaced, thereafter the medium was
replaced every week. The dished were fixed and stained with Giemsa
stain 6-7 weeks post-seeding. The dishes were then scored for Type
II and Type III foci. 2-3 experiments were done for each compound
tested. A) CLYD3 (1920); B) CLYD23 (1929); C) Ni5As2 (orcelite)
92
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Table 2-6: Continued
A) CLYD3 (1920)
Expt. I
Concentration
(pg/ml)
Survival
Fraction (%)
Total # of foci / # of dishes
scored (Foci/20 dishes)
# of dishes with foci /
# of dishes scored
Type III Type II + III Type III Type II + III
0 (medium only) 92.2 0/20 (0) 0/20 (0) 0/20 0/20
Acetone (0.5%) 100 0/20 (0) 0/20 (0) 0/20 0/20
0.1 67.9 0/20 (0) 2/20 (2) 0/20 2/20
0.5 60.1 1/20 (1) 4/20 (4) 1/20 4/20
1.0 55.4 3/20 (3) 5/20 (5) 3/20 5/20
2.5 47 0/20 (0) 5/20 (5) 0/20 5/20
5.0 37.2 1/20 (1) 4/20 (4) 1/20 4/20
7.5 29.1 1/20 (1) 9/20 (9) 1/20 9/20
NiO (3.75pg/ml) 54.7 18/20(18) 42/20 (42) 18/20 42/20
Expt. II
Concentration
(pg/ml)
Survival
Fraction (%)
Total # of foci / # of dishes
scored (Foci/20 dishes)
# of dishes with foci /
# of dishes scored
Type III Type II + III Type III Type II + III
0 (medium only) 98.1 0/20 (0) 0/20 (0) 0/20 0/20
Acetone (0.5%) 100.0 0/20 (0) 0/20 (0) 0/20 0/20
0.5 58.0 0/20 (0) 4/20 (4) 0/20 4/20
1.0 47.8 3/20 (3) 7/20 (7) 2/20 6/20
2.5 42.9 1/20 (1) 4/20 (4) 1/20 4/20
5.0 30.2 2/20 (2) 8/20 (8) 0/20 5/20
7.5 18.2 2/20 (2) 8/20 (8) 2/20 8/20
MCA (1 pg/ml) 75.3 11/20(11) 29/20 (29) 11/20 19/20
93
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Table 2-6: Continued
B) CLYD23 (1929)
Expt. I
Concentration
(pg/ml)
Survival
Fraction (%)
Total # of foci / # of dishes
scored (Foci/20 dishes)
# of dishes with foci /
# of dishes scored
Type III Type II + III Type III Type II + III
0 (medium only) 92.2 0/20 (0) 0/20 (0) 0/20 0/20
Acetone (0.5%) 100.0 0/20 (0) 0/20 (0) 0/20 0/20
0.5 0.0 0/20 (0) 0/20 (0) 0/20 0/20
1.0 45.6 0/20 (0) 0/20 (0) 0/20 0/20
2.5 28.4 0/20 (0) 0/20 (0) 0/20 0/20
5.0 26.0 0/20 (0) 0/20 (0) 0/20 0/20
7.5 5.1 0/20 (0) 0/20 (0) 0/20 0/20
MCA (1 pg/ml) 70.3 3/20 (3) 5/20 (5) 3/20 5/20
Expt. II
Concentration
(pg/ml)
Survival
Fraction (%)
Total # of foci / # of dishes
scored (Foci/20 dishes)
# of dishes with foci /
# of dishes scored
Type III Type II + III Type III Type II + III
0 (medium only) 97.6 0/20 (0) 0/20 (0) 0/20 0/20
Acetone (0.5%) 100.0 0/20 (0) 0/20 (0) 0/20 0/20
0.5 79.1 0/20 (0) 0/20 (0) 0/20 0/20
1.0 59.1 0/20 (0) 0/20 (0) 0/20 0/20
2.5 35.5 0/20 (0) 0/20 (0) 0/20 0/20
5.0 30.7 0/20 (0) 0/20 (0) 0/20 0/20
7.5 18.9 0/20 (0) 0/20 (0) 0/20 0/20
MCA (1 pg/ml) 5/20 (5) 10/20 (10) 5/20 10/20
94
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Table 2-6: Continued
C) Ni5As2
ixpt. I
Concentration Survival
Total # of foci / # of dishes
scored (Foci/20 dishes)
# of dishes with foci /
# of dishes scored
(pg/ml) Fraction (%)
Type III
Type II +
III
Type III Type II + III
0 (medium only) 99.4 0/20 (0) 0/20 (0) 0/20 0/20
Acetone (0.5%) 100.0 0/20 (0) 0/20 (0) 0/20 0/20
0.5 83.2 0/20 (0) 0/20 (0) 0/20 0/20
1.0 71.3 0/20 (0) 0/20 (0) 0/20 0/20
2.5 48.7 1/20 (1) 3/20 (3) 1/20 3/20
5.0 31.9 3/20 (3) 8/20 (8) 3/20 7/20
7.5 11.9 9/19 (9) 19/19 (19) 6/19 11/19
NiO (2 pg/ml) 48.4 4/18(5) 13/18(14) 4/18 10/18
MCA (1 pg/ml) 89.0 21/18(22) 67/18(68) 12/18 28/18
Expt. II
Concentration
(pg/ml)
Survival
Fraction (%)
Total # of foci / # of dishes
scored (Foci/20 dishes)
# of dishes with foci /
# of dishes scored
Type III Type II + III Type III Type II + III
0 (medium only) 98.7 0/20 (0) 0/20 (0) 0/20 0/20
Acetone (0.5%) 100.0 0/20 (0) 0/20 (0) 0/20 0/20
0.5 85.1 0/20 (0) 0/20 (0) 0/20 0/20
1.0 69.2 0/20 (0) 0/20 (0) 0/20 0/20
2.5 43.4 0/20 (0) 0/20 (0) 0/20 0/20
5.0 29.8 0/20 (0) 14/20 (14) 0/20 9/20
7.5 11.6 4/20 (4) 33/20 (33) 4/20 16/20
NiO (2pg/ml) 41.1 0/20 (0) 5/20 (5) 0/20 4/20
MCA (1 pg/ml) 91.4 6/20 (6) 18/2 0 ( 18) 5/20 12/20
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Figure 2-5: Photographs of Transformed foci
A) A dish treated with 7.5 pg/ml of the 1920 sample. A type II focus
is shown.
B) A dish treated with 7.5 pg/ml of the 1929 sample. The non
transformed monolayers is shown
C) A dish treated with 7.5 pg/ml of the M 5AS2 sample. A type II
focus and a type III focus are shown.
¥
A
B
96
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Figure 2-6: Plot of Transformation Assays
A comparison of the transformation assays of the three samples
tested, plotted on a linear scale. The samples tested can be ranked
according to their carcinogenic potential as follows: Ni5 As2 > 1920
sample » > 1929 sample.
3 0 1
M
J
■ i
e
s
I
( H
e
H
V
z
1920
1929
fJO 8 JO OJO 2 JO 4 J0 7 J0
Concentratbn (pg/ml)
97
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
DISCUSSION
The results of the phagocytosis assays show that the 1920 sample was taken
up by phagocytosis into 10T !/2 cells. Phagocytosis of this sample was linear at doses
ranging from 0.5 pg/ml to 2.5 pg/ml. Then, at 2.5 pg/ml and higher concentrations,
there was no further increase, but instead a decrease, in uptake. There were few cells
containing phagocytosed particles at the highest dose tested: 7.5 pg/ml. This
indicates, that while 30 % of the cells survive after treatment with 7.5 pg/ml, most of
these do not phagocytose the 1920 sample. The results from the four cytotoxicity
experiments show that the 1920 sample caused a dose-dependent cytotoxicity with
an LC50 value of 2.4 pg/ml and a slope of - 6 .6 . Since the cytotoxicity curves in cells
treated with the 1920 sample was curvilinear, both the overall shape of the curves and
the LC50 values were utilized in evaluating the relative cytotoxic potencies among
these samples. Results from the chromosomal aberrations experiments indicate that
the 1920 sample also induced chromosomal aberrations, mostly breaks, fragments
and satellite associations, along with a few of the less common aberrations,
dicentrics and translocations. The frequency of these chromosomal aberrations
increased as 10T/4 cells were treated with increasing concentrations of the 1920
sample, but the increases were not dose-dependent, nor were there large differences
in the yield of chromosomal aberrations in cells treated with the different treatments.
Based on the history of cancer induction in the nickel refinery workers, it was
98
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
hypothesized that the 1920 sample would be able to induce morphological cell
transformation, while the 1929 sample would not. However, on the other hand,
previous studies in our laboratory have shown that that major component of both
samples, green (high temperature) NiO, is also an efficient inducer of morphological
transformation in IOTV 2 cells (Landolph, 1985; Miura, et.al., 1989). Interestingly,
our results here show that the 1920 sample is capable of inducing strong (type II and
type III foci) and dose-dependent morphological transformation in IOTV 2 cells, and
the results were reproducible in separate experiments.
IOTV 2 cells also phagocytosed particles of the 1929 sample in a dose-
dependent manner. Phagocytic uptake of these particles increased with the largest
slope up from 0 pg/ml up until 1.0 pg/ml. At concentrations from 1.0 pg/ml to 7.5
pg/ml, phagocytic uptake of particles still increased, but the slope of this increase
was smaller than that from 0 pg/ml to 1.0 pg/ml. Over concentrations at which the
cells phagocytosed the 1929 sample, this sample also caused a dose-dependent
cytotoxicity to IOTV 2 cells, with a slope o f -10.0 and an LC50 value of 1.7 pg/ml.
The contents of both the 1920 and the 1929 refinery samples are clearly cytotoxic to
IOTV 2 cells, consistent with the fact that green (high temperature) NiO is the main
component in both the 1920 and 1929 samples. The cytotoxicity of the 1929 sample
was similar to that of the 1920 sample in the dose range from 0.1 pg/ml to 2.0 pg/ml.
At concentrations of 5.0 pg/ml and 7.5 pg/ml, the 1929 sample was actually more
cytotoxic than the 1920 sample. The 1929 sample also induced a small amount of
99
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
chromosomal aberrations, including fragments, translocations, satellite associations,
and a few dicentric chromosomes. The frequency of these chromosomal aberrations
increased in \OTV2 cells treated separately with all three nickel-containing samples,
but the increases in chromosomal aberrations were not dose-dependent. However,
there was not a significant difference between the ability of the 1920 or 1929
samples to induce chromosomal aberrations in IOTV 2 cells. Consistent with the
epidemiological data, the 1929 sample did not induce any morphological
transformation at all in IOTV 2 cells. This would confirm our hypothesis that the
orcelite component of the 1920 sample is one cause of the cancers observed in the
refinery workers prior to 1923.
Orcelite was also phagocytosed into 10T/4 cells in a dose-dependent manner.
The percentage of 10T14 cells phagocytosing orcelite particles increased from 0 % at
0 pg/ml to 23 % at the highest dose of 7.5 pg/ml. Orcelite caused a dose-dependent
cytotoxicity to IOTV 2 cells that was similar to the cytotoxicity caused by the 1929
sample. The LC50 derived from the survival curve of IOT/2 cells treated with
orcelite, 2.4 pg/ml, was identical to that of the 1920 sample, but the shapes of the
survival curves were different, and orcelite was more cytotoxic to 1O T V 2 cells with a
slope o f-11.0 compared to the survival curve for the 1920 sample, which was overall
less cytotoxic and had a slope of -6.60 Results from the chromosomal aberrations
experiments indicate that orcelite induced chromosomal aberrations. There was an
increase in the induction of chromosomal aberrations, but not in a dose-dependent
100
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
manner, from 0 pg/ml to 7.5 pg/ml. Orcelite also induced strong (type II and type
III) and dose-dependent morphological transformation of 1 0 T ‘ /2 cells, suggesting that
the orcelite in the 1920 sample is partially responsible for the induction of nasal
cancer and lung cancer in the workers in the Clydach refinery that were exposed to
the refinery dust prior to 1923.
The mechanisms by which orcelite induces morphological transformation are
not known at this time and require further investigation. Orcelite is a unique
0 4 - ^
carcinogen, containing both Ni cations and As' anions together on an insoluble
particle. It was hypothesize that both nickel cations and arsenide anions play a role
in the mechanisms by which orcelite induces morphological transformation. There
could be a synergism between the transforming activity of nickel cations and
arsenide anions in the induction of morphological cell transformation. Studies
adding nickel compounds, and arsenide compounds with other cations, to cell
cultures and measuring the resultant yield of cell transformation should answer this
question. One can speculate that phagocytosis of orcelite by 10T/4 cells and
consequent dissolution of orcelite to generate intracellular nickel ions could generate
intracellular nickel ions. The binding of nickel ions to cellular protein followed by
reaction with endogenous hydrogen peroxide formed by cellular metabolism could
lead to oxygen radical generation and chromosome breakage, which could cause
mutation in and activation of proto-oncogenes into activated oncogenes.(reviewed in
Landolph, 1989; 1990; 1999; Landolph et al., 2002). Intracellular generation of
101
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
nickel ions also likely leads to conformation changes in chromatin (Costa et al.,
1994), which can lead to methylation of tumor suppressor genes (Costa et al., 1994).
Ni2 + ion-induced chromosome breakage could also lead to chromosome breakage,
leading to deletion of chromosomes or their fragments bearing tumor suppressor
genes (Landolph, 1989; 1990; 1999; Landolph et al., 2002). It is probably that As' 5
anions also contribute to the cell transforming ability of orcelite, by as of yet
unknown mechanisms. Ni2 + ions and arsenide anions could be co-mutagens or co
carcinogens, or could act synergistically to induce cell transformation and
carcinogenesis. This could provide a strong carcinogenic potential to the orcelite
particles. Further research is needed to answer these questions and in particular to
determine the importance of the arsenic moiety in the orcelite in the induction of
morphological cell transformation by orcelite.
Since both refinery samples are taken up into IOTV 2 cells by phagocytosis,
induce cytotoxicity in the cells, and also induce similar levels of chromosomal
aberrations in the cells, but exposure to only the 1920 sample correlates with an
increased risk of nasal and lung cancers in the refinery workers, the data from the
transformation assays are clearly more important to the issue of human cancer
induction. The induction of morphological transformation in our standard
transformation assay in IOTI/2 cells by the 1920 sample but not by the 1929 sample
provided the most concrete support to our hypothesis that the 1920 sample contained
carcinogenic potential. Therefore, the 1920 sample is likely to be carcinogenic and
102
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
the 1929 sample is likely not to be carcinogenic, based on the results of our studies
demonstrating induction of morphological transformation in 10T!/2 cells by the 1920
sample but not by the 1929 sample. There was no correlation between induction of
chromosomal aberrations and transforming abilities of these compounds.
Chromosome aberrations might therefore be necessary, but not sufficient on their
own, to induce morphological transformation in IOTV 2 cells.
The induction of morphological transformation in IOTV 2 cells by the 1920
sample and by orcelite was dose-dependent. The shape of the dose-response curve
for induction of morphological transformation by the 1929 sample, however, was
very complex. We believe that the green (high temperature) NiO present in the 1920
sample may cause much of the initial increase in foci in cells treated with the 1920
sample over the concentration range from 0 .1 pg/ml to 1 .0 pg/ml, while the M 5AS2
contributes an increasing amount to the induction of morphological transformation
over the concentration range from 1.0 pg/ml to 7.5 pg/ml. However, these nickel
refinery samples are very complex. The 1920 sample consists of green (high
temperature) NiO and a copper-nickel oxide as major components, and orcelite, iron
oxides, and a second nickel oxide-copper oxide as minor components. There could
be complex interactions among the green (HT) NiO, the copper-nickel oxide, the
iron oxides, the nickel oxide-copper oxide, and the orcelite in the induction of cell
transformation, both in terms o f their physical interactions in the sample itself and in
terms of the genetic damage they could cause to IOTV 2 cells. It is possible that the
103
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
copper-nickel oxide, the iron oxides, and the nickel oxide-copper oxide components
of this sample also contribute to the induction of morphological transformation.
Experiments mixing various components of these samples together to attempt to
reproduce the complex dose-response curve of the 1920 sample are in progress in our
laboratory.
The dose-dependent increase of morphological transformation in IOTI/2 cells
treated with the 1920 sample does correlate with the epidemiological data indicating
that there was an increased incidence of nasal tumors and lung tumors in refinery
workers exposed to refinery dust prior to 1923. Apparently, the ability of the 1920
sample to induce morphological transformation in IOTV 2 cells is stable over many
years. The inability of the 1929 sample to induce foci in 10T/4 cells correlates with
the substantial decrease in the incidence of cancers in the refinery workers after
1929. No one knows why the NiO in the 1929 sample did not induce either
morphological transformation of IOTI/2 cells in vitro or tumors in the workers at the
Clydach refinery after 1923. It is possible that the NiO within the 1929 sample alone
is not present in a sufficiently high amount to induce cell transformation, and/or that
the complex matrix of the 1929 sample suppresses the cell transforming effect of the
green (HT) NiO in the 1929 sample. Further studies to address this question are in
progress. These studies indicate that the assay for morphological transformation in
1 0 T 1 /2 cells can be used to predict the carcinogenicity of pure insoluble nickel
compounds and the carcinogenicity of complex nickel-containing samples.
104
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Induction of morphological transformation in fibroblastic cells is one of the
early steps in the overall mechanism by which the control mechanisms of normal
cells are degraded, and they are converted into tumor cells. In fibroblastic cell
systems, chemical carcinogens and ionizing radiation usually induce morphological
transformation first. A further step that occurs in transformed cell lines derived
from foci of morphologically transformed cells induced by chemical carcinogens is
anchorage independence, or ability of the cells to grow in soft agar or agarose
(reviewed in Landolph, 1985). If primary cell cultures are used, such as Syrian
hamster embryo (SHE) cells, then the cells will senesce, but some will escape from
senescence. In spontaneously immortalized cells such as C3H/10T1/2 cells, focus
formation is followed by anchorage independence. The development of
tumorigenicity in fibroblastic cell systems, such as C3H/10T1/2 cells, SHE cells, and
Balb/c 3T3 cells, is the last step in overall neoplastic cell transformation, (reviewed
in Landolph, 1985; 1989; 1990; 1999; Landolph et al., 2002).
C3H/10T1/2 Cl 8 (IOTV 2) mouse embryo cells were used for these studies for
a number of reasons: firstly, IOT/2 cells are spontaneously immortalized, but not
otherwise transformed, allowing the cells to be frozen and thawed to use as
necessary, which is convenient (Reznikoff et al., 1973a). Secondly, the cloning and
preservation of these cells in large amounts allows the investigator to utilize cell
stocks that are uniform, making the experiments for chemically induced
morphological transformation reproducible (Reznikoff et al., 1973a,b; Landolph and
105
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Heidelberger, 1979). Thirdly, these cells have a very low frequency of spontaneous
transformation, and a reproducible and dose-dependent frequency of morphological
transformation when treated with chemical carcinogens or ionizing radiations
(reviewed in Landolph, 1985). Transformed foci are very easy to score in this cell
system, since they are very definitive and stain a dark blue or purplish color against a
weakly staining, contact-inhibited monolayer (Reznikoff et al., 1973a,b: Landolph
and Heidelberger, 1979; reviewed in Landolph, 1985, 1989, 1990, 1999; Landolph et
al., 2002). When chemically induced foci of transformed cells are cloned in the
living state and expanded into transformed cell lines, many of these transformed cell
lines are able to form tumors when injected into immunosupressed or nude mice
(Reznikoff et al., 1973a,b; Patiemo et al., 1988; Miura et al., 1989; reviewed in
Landolph, 1985). In addition, our laboratory has shown that various insoluble nickel
compounds, such as green nickel oxide, black nickel oxide, crystalline nickel
monosulfide, and nickel subsulfide, all induce a dose-dependent and reproducible
yield of type II and type III foci of transformed cells (Miura et al., 1989; Verma et al.,
2003: reviewed in Landolph, 1989; 1990,1999; Landolph et al., 2002). For all these
reasons, C3H/10T/4 Cl 8 mouse embryo fibroblasts were used for these studies.
It is noted that both the 1920 sample and orcelite induced not only type II foci
but also type III foci. Both type II and type II foci give rise to transformed cell lines,
a fraction of which can form tumors when injected into Balb/c nude mice (reviewed
in Landolph, 1985; Miura et al., 1989). Type III foci are the most aberrant of
106
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
transformed foci in terms of growth patterns and ability to grow in soft agar, and
they give rise to transformed cell lines that frequently form tumors when injected
into Balb/c nude mice (reviewed in Landolph, 1985). Future work will report a more
detailed characterization of the biological properties of the transformed cell lines
induced by the 1920 sample and by orcelite, including a determination of their
tumorigenicity.
107
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 3: Molecular Biology of deregulated gene expression in transformed
10T V i cell lines induced by insoluble nickel compounds
ABSTRACT
Epidemiological studies have shown a higher incidence of lung, sinus and
pharyngeal cancers in humans exposed to insoluble nickel compounds. The
molecular mechanisms of carcinogenicity and cellular transformation caused by
nickel compounds are not well understood. The molecular mechanisms of cell
transformation induced by nickel compounds were studied in the model system of
C3H/10T'/2 Cl 8 (IOTV2) mouse embryo fibroblast cells. Therefore, to characterize
the molecular events associated with carcinogenesis induced by insoluble nickel
compounds, nickel compound induced transformed cell lines are needed. Ten
nickel-induced transformed cell lines were generated by treating 1 OTVi cells with
green (high temperature, HT) nickel oxide. Type II and III foci were then ring-
cloned and expanded. Several of the cell lines showed altered growth rates, formed
foci when co-cultured with non-transformed 10T!/2 cells, and formed colonies in soft
agar, indicating a transformed phenotype. The objective in this study was to develop
stably transformed nickel-induced transformed cell lines, using green (HT) nickel
oxide. For this purpose, the following assays were conducted for the
characterization of the cell lines generated: (1) plating efficiency, (2) reconstruction
of focus formation, (3) anchorage-independent growth assays.
To characterize the molecular events associated with nickel-induced
carcinogenesis, RNA was isolated from several cell lines derived from nickel
108
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
compound induced morphological transformation of IOTV 2 cells. The RNA species
were then analyzed using the mRNA differential display technique. Fragments
containing differentially expressed genes were isolated by subcloning, identified by
Reverse Northern Analysis, and sequenced. The sequences were then subjected to
nBLAST analysis for comparison with known gene sequences.
Several fragments were expressed at higher levels in nickel-transformed cell
lines than in 1 OT'A cells. One fragment, R2-5, shared a 100 % sequence identity
with part of the coding region of the Ect2 gene (Miki, et.al, 1993), a mouse proto
oncogene of the Rho family which encodes a GTP-GDP exchange factor. Another
fragment, R3-1, shared a 98 % identity with a sequence in the coding region of the
WDR1 gene (Adler, et.al., 1999). Several fragments could not be detected in nickel-
transformed cell lines but were present in 10T14 cells. One such fragment, Rl-2,
shared a 90.7 % identity with part of the vitamin D receptor interacting
protein/thyroid hormone receptor activating protein 80 (DRIP/TRAP80) gene (Ito,
et.al., 1999). Two fragments that were detected only in non-transformed cells, R2-2
and R2-3, showed no similarity to gene sequences in the GenBank database. Further
characterization of these fragments is in progress to determine whether they are
fragments of novel genes.
109
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
INTRODUCTION
Nickel has a wide variety of applications. It is particularly useful as a
component in various alloys, such as stainless steel, in nickel-cadmium batteries, and
in nickel plating (IARC, 1976; NIOSH, 1977). Nickel compounds are also used as
catalysts in the hydrogenation of fats and oils, in ceramic glazes, and as pigments in
paints (IARC, 1976; NIOSH, 1977). Certain nickel compounds have been shown to
be carcinogenic in animals (Sunderman and McCulley, 1983; Sunderman, 1989;
Saxholm, et.al., 1981; Oiler, et.al., 1997; Ottolenghi, et.al., 1976; Sunderman and
Maenza, 1976; Kasprzak, et.al., 1983; NTP, 1994 a, b, c) and humans (Doll, 1977;
Doll, et.al., 1977; Draper, et.al., 1994a; Draper, et.al., 1994b; Duffus, 1996).
However, the mechanisms leading to nickel compound carcinogenesis remain
unclear.
Tumorigenesis is a multistep process involving the accumulation of
mutations in several genes, proto-oncogenes and tumor suppressor genes (Verma,
et.al. in press; Landolph, et.al., 2002). One hypotheses or nickel compound
carcinogenesis is that nickel ions may bind to proteins, and these Ni-protein
complexes may translocate to the nucleus, then bind to DNA, or nickel ions may get
transported to the nucleus and bind to proteins that are already bound to DNA. This
may then cause gene rearrangements or mutations in proto-oncogenes, large or small
deletions in tumor suppressor genes, or loss of the chromosomes that contain these
genes (reviewed in Landolph, 1989; Landolph, 1990; Landolph 1994; Landolph
110
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
et.al., 1996; Landolph, 1999; Landolph, 2000; Landolph, et.ai., 2002). A second
hypothesis is that nickel is involved in carcinogenesis at the transcription level and
may enhance the transcription rates of proto-oncogenes or may increase the stability
of the proto-oncogenes’ mRNAs (Landolph, 1989; Landolph, 1990; Landolph 1994;
Landolph et.al., 1996; Landolph, 1999; Landolph, 2000; Landolph, et.al., 2002). A
third, and less studied, hypothesis is that nickel may alter the methylation state of
DNA (Landolph, 1989; Landolph, 1990; Landolph 1994; Landolph et.al., 1996;
Landolph, 1999; Landolph, 2000; Landolph, et.al., 2002).
Since the mechanisms of the carcinogenicity of specific nickel compounds to
humans are not clearly understood, it is important to utilize model cell culture
transformation systems to study and begin to understand the mechanisms of the
carcinogenicity of specific nickel compounds. Dr. Landolph’s laboratory has been
using C3H/10T’ /2 Cl 8 (lOT'A) mouse embryo fibroblasts as a model system to study
the molecular and cellular mechanisms of carcinogenesis. Organic carcinogens such
as polycyclic aromatic hydrocarbons (Landolph, 1979; Reznikoff, et.al., 1973 a, b)
and carcinogenic metal salts (Miura, et.al., 1989; Saxholm, et.al., 1981; Verma,
et.al., submitted) have been shown to induce morphological and neoplastic
transformation in IOTV 2 cells (Landolph, 1989; Landolph, 1990; Landolph 1994;
Landolph et.al., 1996; Landolph, 1999; Landolph, 2000; Landolph, et.al., 2002). The
IOTV 2 cell line was derived from C3H mouse embryo fibroblasts and it is a
permanent cell line, which is immortal, contact-inhibited, non-tumorigenic, and has a
111
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
low frequency of spontaneous transformation (Reznikoff, et.al., 1973 a, b; Landolph,
1979; reviewed in: Landolph, 1989; Landolph, 1990; Landolph 1994; Landolph
et.al., 1996; Landolph, 1999; Landolph, 2000; Landolph, et.al., 2002).
Oncogenic transformation and cell lysis by crystalline nickel subsulfide in
IOTV 2 cells have also been observed by Saxholm, et.al., (1981). Previously, Dr.
Landolph’s laboratory also demonstrated that crystalline nickel subsulfide induces
focus formation, anchorage independence, and neoplastic transformation in 1O T V 2
cells (Miura, et.al., 1989). Our laboratory has reported that certain nickel
compounds, particularly green nickel oxide, induce morphological transformation in
IOTV 2 cells (Miura, et.al., 1989; Verma, et.al., submitted); cell lines derived from
foci induced by green (HT) nickel oxide also induced sarcomas in nude mice (Miura,
et.al., 1989).
The first objective in this study was to develop stably transformed nickel-
induced transformed cell lines, using green (high temperature) nickel oxide (NiO).
For this purpose, the following assays were conducted for the characterization of the
cell lines generated: (1) plating efficiency, (2) reconstruction assays to detect focus
formation, and (3) anchorage-independent growth assays. Ten new cell lines were
generated by treating 1O T V 2 cells with green (HT) NiO. Type II and III foci were
then ring-cloned and expanded. Several of the cell lines showed altered growth
rates, formed foci when co-cultured with non-transformed IOTV 2 cells, and formed
colonies in soft agar, indicating a transformed phenotype. These will be used to
112
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
confirm the specificity of the observed gene expression changes for nickel
transformation.
The second objective of this study was to characterize the molecular events
associated with nickel-induced morphological transformation. For this purpose,
RNA was isolated from several cell lines derived from nickel-induced transformation
of lOT'A mouse embryo fibroblast cells. The RNA species were then analyzed using
the mRNA differential display technique (Liang and Pardee, 1995; Liang, et.al.,
1995; McClelland and Welsh, 1994; Welsh, et.al., 1995). Fragments containing
differentially expressed genes were isolated by subcloning, identified by Reverse
Northern Analysis, and sequenced. The sequences were then subjected to nBLAST
analysis for comparison with known gene sequences.
Several fragments were over-expressed in nickel-transformed cell lines than
in lOT'A cells. One fragment, R2-5, shared a 100% sequence identity with part of
the coding region of the Ect2 gene (Miki, et.al., 1993), proto-oncogene of the Rho
family which encodes a GTP-GDP exchange factor. Another fragment, R3-1, shared
a 98% identity with a sequence in the coding region of the WDR1 gene (Adler, et.al.,
1999). Several fragments could not be detected in nickel-transformed cell lines but
were present in IOTV 2 cells. One such fragment, Rl-2, shared a 90.7% identity with
part of the Vitamin D receptor interacting protein/ thyroid hormone receptor
activating protein 80 (DRIP/TRAP80) gene (Ito, et.al., 1999). Two fragments that
were detected only in non-transformed lOT'A cells, R2-2 and R2-3, showed no
113
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
similarity to gene sequences in the GenBank database. It is possible that these
sequences are part of unidentified genes.
MATERIALS AND METHODS
Cells and Cell Culture
C3H/10Tl /2 Cl 8 (IOTV2) cells (Reznikoff, et.al., 1973a), four nickel-induced
transformed 10T * / 2 cell lines (NiS 3A1, NiS 3B1, NiS 7A, and NiO 2C3) (Miura,
et.al., 1989), and two 3-methylcholanthrene (MCA)-induced transformed IOTV2 cell
lines (Cl 15 and Cl 16) (Reznikoff, et.al., 1973b), were grown in Basal Medium
Eagles (BME) supplemented with 10 % heat inactivated fetal calf serum (FCS)
(Omega Scientific Company, Inc., Tarzana, CA). Several lots of fetal calf serum
(FCS) from various companies were pre-screened to identify those that supported a
plating efficiency of approximately 30 % and a yield of morphological cell
transformation greater than five foci/twenty dishes when cells were treated with 1
pg/ml of the carcinogen, 3-methylcholanthrene (MCA). The lots of FCS that
fulfilled these requirements were purchased and used in these studies. 10T'/2 cells
were used between passages five and ten, to minimize the yield of spontaneous
morphological transformation. Cells were grown in 75 cm2 tissue culture flasks
(VWR Company, San Francisco, CA) and were maintained in logarithmic phase of
growth in incubators containing 5 % C 02 and 95 % air (v/v) and maintained at a
temperature of 37°C in a humidified atmosphere, as described (Reznikoff et al.,
114
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
1973a,b; Landolph and Heidelberger, 1979; reviewed in Landolph, 1985; Patiemo et
al., 1988; Miura et al., 1989).
Generation of cell lines by exposure of C3H10TVz cells to green nickel oxide
C3H10TI/2 mouse embryo fibroblasts (Reznikoff, et.al., 1973 a, b) from
passages five to ten were seeded in 60-mm cell culture dishes at 2000 per dish. 24
hours later, cells were treated with 3.75 pg/ml green (HT) nickel oxide in culture
(Miura, et.al., 1989) for 48 hours. The nickel compounds were removed by
replacing the cell medium, and the cells were maintained in culture for 6 weeks
thereafter. At the end of six weeks, foci were isolated from the surrounding cell
monolayers by ring cloning with glass cylinders (Miura, et.al., 1989; Reznikoff,
et.al., 1973 a, b), and expanded by replating. Foci formed in these cultures were in
turn isolated by ring cloning a second time, and then expanded into permanently
transformed cell lines and characterized as described below.
Characterization of the green (HT) nickel oxide induced transformed 10T14 cell
lines
Plating efficiency: Cells were seeded in 60 mm tissue culture dishes at 200 per dish,
and grown for 8 days. Five dishes were seeded for each cell line. The cells were
then fixed with methanol and stained with Giemsa, and colonies of greater than 20
cells counted. Plating efficiency is equal to the number of colonies per dish / number
115
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
of cells seeded per dish multiplied by 100 % [PE = (# colonies per dish / # cells
seeded per dish) x 100 %].
Reconstruction assays to detect focus formation: For this assay, two hundred cells
per dish were seeded into 60 mm cell culture dishes at 200 transformed cells per
dish, along with 1OT'A cells seeded at 2,000 per dish. After three weeks, the cells
were fixed with methanol for 20 minutes, and the numbers of Type II and Type III
foci were scored.
Anchorage-independent growth. These assays were conducted by standard methods
in used in Dr. Landolph’s laboratory (Miura, et.al., 1989; Landolph, 1979). Cells
were seeded at 200, 2,000, 20,000, and 200,000 into 60 mm dishes, in a layer of
BME + 10 % FBS + 0.25 % agarose, and plated atop a layer of BME + 10 % FBS +
0.4 % agarose. Five dishes were seeded for each cell line studied. Four weeks later,
colonies were stained with 1% iodonitrotetrazolium violet, and colonies of greater
than 20 cells counted under a microscope.
PCR amplification of differentially displayed fragments
The fragments were amplified by the polymerase chain reaction (PCR). A
100 pi reaction mixture containing 10 pi of the fragment, 12.5 pmol of each
oligonucleotide primer, 0.2 mM of each dATP, dTTP, dGTP, and dCTP, 1.5 mM
magnesium chloride, lOx PCR buffer, and 1 unit of HotStarTaq DNA polymerase
(Qiagen, In., Valencia CA). The samples were overlaid with 100 pi of mineral oil to
116
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
prevent evaporation. The samples were subjected to 25 cycles of amplification in a
Thermal Cycler, model 480 (Perkin Elmer Company, Norwalk, CT). The thermal
cycling parameters were 2 minutes at 95 °C followed by 25 cycles of 1 minute at 95
°C, for denaturation, 1 minute at 55 °C for annealing, and 1 minute at 72 °C for
extension.
Subcloning and reverse Northern hybridizations
Differentially displayed PCR products that were reamplified were ligated into
a pNoTA/TN vector (5’ prime - 3’ prime, Inc., Boulder, CO) as per manufacturers
instructions. The transformants were transferred onto Nytran plus membranes
(Scheiher & Schell) and UV crosslinked. Membranes were screened by colony
hybridization using P labeled cDNA probes generated from the total RNA from the
non-transformed lOTVi cells and from one of the nickel induced transformed cell
lines, NiS 3A1 (Liang and Pardee, 1995). Positive clones were selected, and the
inserts were confirmed by plasmid preparations.
Sequencing of subclones and analysis
Subclones were sent to the Microchemical Core Facility (Norris
Comprehensive Cancer CenterAJSC, Los Angeles, CA) for automatic sequencing.
All sequence data were entered into and analyzed by the NCBI BLAST search and
aligned with known gene sequences available in the Genbank database.
117
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Northern Hybridization
Northern blots were prepared, as described by Sambrook, et.al. (1990), using
10 pg of total RNA or 5 pg of Poly A+ RNA, which was then separated by
electrophoresis on a 1 % agarose and 0.86 M formaldehyde gels for three hours at
105 V. The electrophoresis was run in a chemical fume hood to avoid
contamination. After the three hours, the gels were rinsed with RNase-free water
and then transferred onto nylon membranes (Hybond, Amersham, CA) overnight.
The RNA was bound to the membranes by UV cross-linking, using a Stratalinker
(Stratagene Inc., La Jolla, CA).
Membranes were pre-hybridized at 42 °C for 1 hour in pre-hybridization
' t 'y
buffer. Probes were labeled with P dCTP by using a random prime kit (Boeringher
Mannheim). Unincorporated labeled nucleotides were removed using a G-50
sephadex spin column. The probes were added to hybridization buffer and incubated
with the membranes overnight at 42 °C. If required, hybridizations were carried out
with lower and higher stringencies (ie: 37 °C, 50 °C, or 65 °C). Membranes were
washed at RT in lx SSC, 0.1 SDS twice, if necessary at 42 °C for 20 minutes, or at
65 °C for 10 minutes. Membranes were exposed overnight at -80 °C to Kodak X-
MR film (Eastman Kodak Company, Rochester, NY), and developed using a Kodak
RP X-OMAT processor (Eastman Kodak Company, Rochester, NY).
118
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
RESULTS
Biological characterization of nickel-induced transformed IO TV 2 cell lines used
for this study
In this study, four nickel-induced transformed cell lines were used; three
transformed cell lines induced by crystalline nickel monosulfide (NiS 3A1, NiS 3B1,
NiS 7A) and one transformed cell line induced by nickel oxide (NiO 2C3) (Miura,
et.al., 1989). Two transformed IOTV 2 cell lines induced by 3-methylcholanthrene
(MCA) (MCA Cl 15 and MCA Cl 16) were also used as control cell lines
(Reznikoff, et.al., 1973b). Earlier studies from our laboratory have shown the ability
of certain insoluble nickel compounds to induce dose-dependent morphological
transformation in IOTV 2 cells. (Miura, et.al., 1989; Verma, et.al., in preparation)
The biological characterization of these nickel induced transformed cell lines
are shown in Table 3-1. It was previously shown that the insoluble nickel
compounds induce morphological transformation and cytotoxicity in a dose-
dependent manner (Miura, et.al., 1989; Verma, et.al., in preparation). The NiS 3A1
and NiS 3B1 cell lines had saturation densities seven-fold and four-fold times that of
10T1/2 cells, formed type II foci in reconstruction experiments with 45 % and 8 %
focus-forming efficiencies, and grew in soft agarose with 30 % and 12 % colony-
forming efficiencies, respectively (Table 3-1). A third transformed cell line, NiS7A,
had a four-fold greater saturation density than 1O T V 2 cells, and formed type II and
type III foci in reconstruction experiments with a 5 % focus-forming efficiency, and
119
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
formed colonies in soft agarose with a 25 % efficiency (Table 3-1). The
transformed 10T!4 cell line induced by green (HT) NiO, Ni02C3 had a saturation
density 2.2-fold times that of IOTV 2 cells, formed type III foci in reconstruction
experiments with a 7 % focus-forming efficiency, formed colonies in soft agarose
with a 1 % efficiency, and induced tumors in all four Balb/c nude mice into which it
was injected. MCA Cl 16 cells (used as a positive control) form type II and type III
foci in reconstruction experiments with a 45 % focus-forming efficiency, grow in
soft agarose with a 60 % colony-forming efficiency, and formed tumors in all four
Balb/c nude mice into which they were injected. A second MCA-induced
transformed cell line, MCA Cl 15, also forms foci, colonies in soft agarose, and
tumors in nude mice (Miura, et.al., 1989; Reznikoff, et.al., 1973 b).
These cell lines, generated by Miura, et al.. (1989), have been used to
investigate the changes in gene expression at the level of mRNA in the nickel
induced transformed cell lines as compared to the non-transformed IOTV 2 cells, as
shown later in this chapter.
1 2 0
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Table 3-1: Biological characterization of cell lines used (Miura, 1989)
The cell lines were generated by Miura, et. al. (1989) They were used
to study differential gene expression. They are NiS 3A, NiS 3B, NiS
7A, and NiO 2C3. Two MCA-induced cell lines, MAC Cl 15 and Cl
16 were also used. Reprinted by permission of Wiley-Liss, Inc., a
subsidiary of John Wiley and Sons, Inc. Copyright © 1989. (Miura,
et. al. 1989)
Cell line
Plating
efficiency
(% )a
Saturation
densityb
Focus
forming
efficiency
(%)c
Focus
morphology
in
reconstruction
Efficiency
of colony
formation
in soft
agar (%)d
Tumorigenicity
(# mice with
tumors/ total #
mice)6
10T72 Cl
8
25 ±1 1.2 xlO 6 0 None <.001 0/4
NiS 3A1 41 ± 3 8.6 x 106 45 Type II & III 30 0/4
NiS 3B1 36 ± 2 5.2 x 106 8 Type II 12 0/4
NiS 7A 42 ± 3 4.6 x 106 5 Type II & III 25 0/4
NiO 2C3 15 ± 2 2.7 x 106 7 Type II 1 4/4
MCA
C116
31 ± 2 12.0 x 106 45 Type III 60 4/4
Reprinted by permission of Wi ey-Liss, Inc., a subsidiary of John Wiley and Sons,
Inc. Copyright © 1989. (Miura, et. al. 1989)
aNo. of colonies per 200 cells seeded.
b Determined from the growth curve.
cNo. of foci formed per viable cell (# of foci/# of clonable cells).
d No. of colonies per cells seeded. For dishes for each cell line were seeded with
200, 1,000,or 10,000 cells per dish, stained with INT on day 28, and counted using
light microscopy.
e Each tumor-bearing mouse had only one tumor at the site of injection. All tumors
were diagnosed as fibrosarcomas. The latent period for tumor detection was 13 days
for MCA Cl 16 and 41 days for NiO 2C3.
121
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Biological characterization of transformed 10T% cell lines induced by green
(HT) nickel oxide
Green (HT) nickel oxide is a high temperature form of nickel oxide, produced
above 1,100 °C. Green NiO has been shown to be the most potent at transforming
10T14 cells. Transformed cell lined induced by green (HT) NiO have been shown to
be tumorigenic in mice (Miura, et.al., 1989). We have generated ten transformed
cell lines induced by green (HT) NiO by treating IOTV 2 cells for 48 hours with 3.75
pg/ml of this compound. After six weeks, ten foci from the treated cells were
isolated and cloned by the standard glass cylinder ring-cloning technique (Miura,
et.al., 1989; Reznikoff, et.al., 1973 a, b; Landolph, 1976; Landolph, 1979). Each of
the cloned foci was expanded further to generate permanently transformed cell lines.
The plating efficiencies, focus formation in reconstruction assays, and anchorage
independence were determined for these ten cell lines. The biological
characterization of these transformed cell lines can be seen in Table 3-2. All ten cell
lines are efficient at forming foci in reconstruction experiments when plated with
non-transformed IOTV 2 cells. Their focus-forming efficiencies vary from 100 % to
45 %. Each transformed cell line also has the ability to grow in soft agarose. The
efficiencies of colony formation in soft agar ranged from 1 % to 29 %, and were
therefore, 1 x 103 to 29 x 103 fold higher than that of the non-transformed IOTV 2
cells.
122
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Table 3-2: Biological characterization of ten transformed cell lines induced
by green (HT) NiO
The objective in this study was to develop stably transformed nickel-
induced transformed cell lines, using green nickel oxide. For this
purpose, the following assays were conducted for the characterization
of the cell lines generated: (1) plating efficiency, (2) reconstruction
of focus formation, (3) anchorage-independent growth assays.
Cell line
Plating efficiency
(%)’
Focus forming
efficiency (%)b
Efficiency of
colony formation
in soft agar (%)c
10T '/2 25 ± 1 0 <0.001
MCA Cl 16 48 + 2 4 5 + 4 60
NiO (G) 1.1 39 + 2 16 ± 3 1.0 ±0.5
NiO (G) 1.2 22 ±1 33 ± 6 29.0 ± 2
NiO (G) 2.1 9 ± 2 16+1 18.0 + 4
NiO (G) 2.2 34 ± 2 23 ± 4 4.0+1
NiO (G) 3.1 61 ±1 24 ± 5 5.0+ 1
NiO (G) 3.2 43 ± 2 34 ± 1 28.0 ± 3
NiO (G) 5.1 13 ±1 15 + 1 14.0+1
NiO (G) 6.1 43 ± 3 29 + 3 22.0 + 3
NiO (G) 7.1 48 ± 1 12+1 27.0 ± 3
NiO (G) 7.2 18 ± 1 11 ± 1 29.0 ± 5
aNo. of colonies per 200 cells seeded.
bNo. of foci formed per viable cell (# of foci/# of clonable cells).
0 No. of colonies per cells seeded. For dishes for each cell line were seeded with
200, 1,000,or 10,000 cells per dish, stained with INT on day 28, and counted using
light microscopy.
123
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Identification of differentially expressed genes by differential display
Earlier in our laboratory, the mRNA differential display was performed to
identify genes whose expression is altered between non-transformed IOTV 2 cells and
the transformed cell lines induced by nickel compounds. The original technique of
Liang and Pardee utilized 3’ anchored primers seven bases in length to screen
mRNA populations for differential expression (reviewed in Liang and Pardee, 1995).
Subsequently, several researchers adapted other primer designs, PCR conditions, and
approaches to screen mRNA populations for genes of interest. Initially, we adapted
the method of Liang and Pardee and used 21-mer anchored 3' primers (1995). We
then found that the RAP-PCR protocol, developed by McCleland and Welsh (1994),
using 3' and 5' arbitrary primers and a PCR amplification with an initial low
stringency cycle followed by a high-stringency cycle, resulted in fewer bands in
differential display gels. Hence, identification of differentially expressed gene
fragments was more efficient using RAP-PCR (McCleland and Welsh, 1994).
Therefore, we combined the best features of both the original mRNA differential
display (Liang and Pardee, 1995) and the RAP-PCR methodologies (McCleland and
Welsh, 1994) to yield a higher frequency of differentially expressed genes. After
many modifications with primers and adaptations to the protocols, Verma, et al..
used the RAP-PCR version of the mRNA differential display (Landolph, et.al., 2002,
Verma, et.al., submitted). From the original differential display gels, ten candidate
fragments were identified showing differential expression between the non
124
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
transformed and the transformed cell lines. Table 3-3 shows the differential
expression patterns of the ten fragments initially identified. The fragments were then
isolated from the gels and amplified by PCR. Seven of the fragments were selected
for confirming the differential expression patterns and for further characterization.
The seven PCR amplified fragments can be seen in Figure 3-3.
125
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Table 3-3: Expression patterns of differentially expressed gene fragments
isolated by differential display
Ten fragments were isolated by differential display. The gene
identities of the differentially expressed cDNA fragments from the
mRNA differential display gels, with their corresponding mRNA
expression patterns of either present or absent in nickel and MCA
transformed cell lines.
Differential Expression of Gene Fragments
CDNA
fragment
Size
(bp)a
10T y* NiS3A NiS3B NiS 7A
MCA
Cl 15
MCA
Cl 16
Rl-1 133 Present Absent Absent Absent Present Present
Rl-2 186 Present Absent Absent Absent Present Present
R2-1 436 Absent Absent Absent Absent Present Absent
R2-2 354 Present Absent Absent Absent Absent Absent
R2-3 291 Present Absent Absent Absent Absent Absent
R2-4 271 Present Absent Absent Absent Absent Absent
R2-5 293 Absent Present Present Present Present Present
R3-1 345 Absent Present Present Present Present Present
R3-2 324 Absent Present Present Present Present Present
R3-3 309 Present Under X Under X Under X Present Present
Adapted from Verma, et.al. (2003)
a Determined by agarose gel and sequence analysis
126
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Figure 3-3: PCR amplification of differential display fragments
PCR amplification of seven of the ten candidate cDNA fragments
obtained from the Differential Display (DD) gels were resolved on a 1
% agarose gel electrophoresis. The fragments from the DD gels were
excised from the dried gels and re-amplified using the same 5’
primers used for the DD gels.
500 bp
400 bp
300 bp
200 bp
127
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Subcloning and screening of seven DD fragments
There have been frequent previous reports of false positive identifications of
differentially expressed fragments, and amplification of mixtures of fragments rather
than a single species (Liang and Pardee, 1995; Verma, et.al., submitted). To confirm
the pattern of differential expression of the cDNA fragments that were observed in
differential display gels, the cDNAs of interest were next screened stringently by
three different strategies. First, to address the problem of possible co-migrating,
contaminating cDNA, the fragments were screened the clones by colony
hybridization and reverse Northern analysis (Verma, et.al., submitted). With this
method of differential screening, multiple filters representing cDNA fragments can
be screened simultaneously with two different sets of probes. In this way, the same
clone with differential expression can be identified.
Seven differentially displayed fragments were subcloned into a pNoT/T7
PCR vector, and the recombinants were selected based on blue/white screening.
Since only those clones that showed truly differential expression were desired, an
additional screening step was performed. Differential screening by reverse Northern
analysis was performed by growing the white colonies (recombinants) onto duplicate
nylon membrane filters. The membranes were then hybridized with 3 2 P labeled
cDNA probes generated from the total RNA of the non-transformed cells (IOTV 2)
and the total RNA from nickel induced transformed cells (NiS 3A1). Only those
clones that showed the expression patterns similar to what was seen in the original
128
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
differential display gels were selected for further analysis. Reverse Northern
analysis of four representative cDNA clones is shown in Figure 3-4.
For each of the seven fragments, two to four clones were identified as being
truly differentially expressed and authenticated by plasmid preparations for the
presence of the inserts. The bacteria containing the plasmid were grown overnight
and the plasmid DNA was extracted. The plasmid DNA was digested with BamHI
endonuclease to release the inserts. The digested samples, along with the uncut
plasmids, were analyzed on a 1% agarose gel to verify the presence of the inserts,
and to make sure that the sizes of the inserts corresponded to the PCR fragments.
Figure 3-5 is representative of four of the subcloned inserts. The size of each insert
corresponds to expected size of the differential display cDNA fragments. The sizes
range from 200 bp to 500 bp. The inserts were isolated from the gel and purified to
be sequenced and to be used as probes for northern analysis.
The second method of screening that was performed to eliminate false
positives used a strategy based on direct sequencing (Verma, et.al., submitted).
When a band fragment is cut, eluted from the differential display gel, then amplified
by PCR, there is always a high probability of amplifying contaminating cDNAs.
This can yield spurious results when the amplified band fragment is used as a probe
in Northern blotting analysis. The direct-sequencing strategy is based on initially
screening the differential display bands by directly sequencing those cDNA
fragments that were eluted from the differential display gels and reamplified.
129
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Following verification of the sequence of these cDNA fragment in the BLAST
database, various strategies were used next, as described below. The blot was
analyzed, containing total RNA from IOTV 2 cells and nickel compound-induced and
MCA-induced transformed cell lines by Northern blotting, using the PCR-amplified
fragment as a labeled probe to confirm differential expression of the genes of
interest. Based on their pattern of expression on the differential display, nine gene
fragments were selected for further study.
130
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Figure 3-4: Reverse Northern analysis of DD fragments
To eliminate the problem of possible co-migrating, contaminating
cDNA, the clones were screened by colony hybridization and Reverse
Northern analysis. With this method of differential screening,
multiple filters representing cDNA fragments can be screened
simultaneously with two different sets of probes. In this way, the
same clone with differential expression can be identified. Colony
hybridization of the duplicate filters using cDNA probes from lOT'A
and NiS 3A cell lines. Selected positive clones after reverse Northern
hybridization are circled.
131
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
R l-2
R2-2
5 *
R2-3
o
o
o
R2-4
132
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Figure 3-5: Subcloned Inserts
Subclones identified by reverse Northern analysis as having the same
expression patterns as the original differential display gels were
isolated and the subcloned insert was excised with restriction enzymes
to be used as probes for further studies.
R2-2-13
U C
R2-3-23
U C
R2-4-4
U C
R3-3-15
U C
Relaxed plasmid
Plasmid w /o insert
Sup ere oiled plasmid
354lip
I 2 8 7 ^
I 271 lip
| 210 lip
133
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Sequencing and homology search of DD fragments
Following isolation of the plasmids the cloned inserts were sequenced using
vector primers. Automated sequencing was performed in the Microchemical Core
Facility, and the results are shown in Figure 3-6. The sequences were then entered
into the NCBI BLAST and analyzed for the sequence homologies in Genbank
nucleotide database. Out of seven fragments, five cDNA inserts corresponding to
Rl-2, R2-4, R2-5, R3-1, and R3-3 showed homologies to sequences of known genes,
while the other two, R2-2 and R2-3 showed no sequence homologies to any known
genes available in the Genbank database. Table 3-4 shows the homologies of each
fragment and the number of bases sequenced that matched to the known sequences.
One fragment, designated Rl-2, is a 186 base pair fragment has an expression
pattern that is present in the non-transformed 10T!/2 cells but is absent in the nickel
compound induced transformed cell lines. The subclone Rl-2-4 shows a homology
to the human vitamin D receptor interacting protein/thyroid hormone receptor
activating protein 80 (DRIP/TRAP80) protein (Ito, et.al., 1999). The sequences
matched 107 bases out of 118 bases, giving a homology of 91%. The e-value, or the
probability of this sequence matching only by chance, was 1.5 x 10'1 4 .
DRIP/TRAP80 was recently identified by Ito, et al.. as being a component in the
DRIP/TRAP complex that is involved in the binding of the Vitamin D receptor and
the Thyroid receptor to DNA (1999). The precise function of DRIP/TRAP80 is
unknown (Ito, et.al., 1999). The complete cDNA corresponding to 1.8 kb was
134
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
obtained from Ito, et al.. (1999). The complete cDNA will be used as a probe for
further northern analysis. Vitamin D binds to the vitamin D receptor, and this
complex then binds to the DRIP protein. Similarly, thyroid hormone binds to the
thyroid hormone receptor, and then this complex binds to many proteins, including
the TRAP-80 protein. These complexes are then recruited to their respective nuclear
receptors by co-activators, and then the complexes bind directly to their respective
DNA target sites in the promoters of specific genes, in a ligand-dependent manner.
This binding then triggers and modulates transactivational transcription of linked
genes (Ito, et.al., 1999). DRIP and TRAP complexes are two receptor-interacting
complexes that appear to be associated with components of the transcriptional pre
initiation complex and/or alter chromatin structure (Ito, et.al., 1999). Ablation of
DRIP gene expression in the nickel-induced, transformed cell lines could lead to
inhibition of transcriptional activation in the signal transduction pathways mediated
by vitamin D, which could contribute to cell transformation induced by specific
carcinogenic insoluble nickel compounds.
A second fragment, designated as R2-5, is a 293 base pair fragment, with an
expression pattern that is absent in the non-transformed IOTV 2 cells, but is present in
the nickel induced transformed cell lines. The subclone for R2-5 shares a 100%
sequence identity with part of the coding region of the Mus musculus Ect2 gene, an
oncogene that encodes a GDP-GTP-exchange factor (Miki, et.al., 1993). The
complete cDNA corresponding to 4.0 kb was obtained from Miki, et al.. (1993), to
135
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
be used as a probe for further Northern analysis and studied further in depth, as
detailed further in Chapter 4.
Two fragments that were sequenced, are designated R2-2 and R2-3. The
expression of R2-2 and R2-3 is that they are present in the non-transformed cells,
and are ablated in expression in the nickel-induced and MCA-induced transformed
cell lines. These fragments did not show sequence homologies to known genes
within the Genbank database. It is possible that these fragments are part of
unidentified gene sequences.
Another fragment, designated R3-1, is a 345 base pair fragment with an
e x p r e s s i o n p a t t e r n t h a t i s a b s e n t i n t h e non-transformed IOTV 2 cells, but is up-
regulated in the nickel induced transformed c e l l lines. T h e subclone R 3 - 1 - 9 h a s
s h o w n a 97 % h o m o l o g y t o t h e m o u s e Wdrl g e n e ( A d l e r , e t . a l , , 1 9 9 9 ) . 243 bases
o u t o f 2 5 0 b a s e s m a t c h e d b e t w e e n t h e s u b c l o n e R 3 - 1 - 9 a n d t h e W d r l g e n e , w i t h a n
e - v a l u e of 0 , 0 , T h e W d r l g e n e h a s b e e n r e c e n t l y i d e n t i f i e d i n t h e a c o u s t i c a l l y
d a m a g e d e a r s o f c h i c k s , b u t i t s f u n c t i o n h a s n o t b e e n e l u c i d a t e d ( A d l e r , e t . a l , , 1 9 9 9 ) .
A l a r g e r c D N A f r a g m e n t corresponding t o 8 4 3 b a s e p a i r s w a s o b t a i n e d f r o m A d l e r ,
et. al, ( 1 9 9 9 ) . I t a p p e a r s to b e u p r e g u l a t e d i n r e s p o n s e to s t r e s s a n d m a y also b e u p
r e g u l a t e d i n r e s p o n s e t o n i c k e l c o m p o u n d s .
136
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Figure 3-6: Sequence data
The Differential Display (DD) fragments were excised and sent to the
Microchemical Core Facility for sequencing. Sequences of six of the
DD fragments are shown:
A) Rl-2, B) R2-2, C) R2-3, D) R2-4, E) R2-5, F) R3-3
A) Rl-2
CGGGAAGCTCACCGGAGAGACGAGGAGGGGTTGGTAAAATTCCAACCTT
CTTTGTGGCCTTGGG ACTCTGTGAGGAAC AATTTGCGAAGTGCCCTT AC A
GAGATGTGTGTTCTCTATGATGTCCTCAGTATTGTCAGGGACAAAAAGTT
CATGACTCTGGAGCCCGTCTCTCCGGTGAGCTTCCCG
B) R2-2
CGGGAAGCTCCACCGGAGAGATAAGGATCAGTGAGATATCAGTGAGAAA
GCTNACCCGAGGGAC AAGGATC AGT GAGATTTC AGTGAGA AAGCTC ACC
CGAAGNACAAGGATCAGNGAGCAAGCTCCCCACCGGGACAAGGATCAT
GTGAGAAAGCTTGCCCNCAGCACAAGTATCAGTGAGATNTCAGTGACGA
A A G T T C G C C C A C N G G A C A T G G A T A G T G A G A A A G C T G G C C C C A C G C A C A A
G T A T C A G T G A G A A A G C T C G C C C A T G G G A G G C A G A C C C T C T G C T G C G C A G
T T C C A T C A C C T T C N G T N G C T T T G C T G A G G N N G T T T T T G T G G T C T C T C C G N T
G G A G C T T C C C C G
C) R2-3
C G G G A A G C T N C A C C G G A G A G A C C A G C T T T G A T C T G G G G A A G G N G A A G G
G T T C T N T G G A C T A A T G C G G C T C T C ' T G A G A G A T A G G G A T T T G G T C G C A C C T
A G A G G T A G G C A T G G A G C A A A C A A T G T A G N A A A G A G A C T G G C A G N A A G C
A G G T A G G G C T G T G G A G A A T G A A G G G A G C C A N A G C A C G C C C T C A G T C T C T
N C G G 1 G 1 1 G C I 1 C C C G
137
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Figure 3-6: Continued
D) R2-4
CGGGAAGCTCCCCCGGAGAGACCAAGCCCCTGAGCACATCAGCAAAGTA
AGATGACCTTCCCTTTCCCCCTTAAAAAGAAGGAATAGCAGCAAAGGAA
CCCGTAGTGATTGCTCCAGCAGGGTCCTAAGTGTTGAATGCGTGTTCTCA
TTGTCCTTGTTGTGCACTGAGGTCTCGTCTCTCCGGTGGAGCTTCCCG
E) R2-5
CGGGAAGCTCCACCGGAGAGACTATGTATTTGTATGAAAAGGCTAATAC
TCCTGAGCTCAAGAAATCGGTGTCTCTGCTTTCTCTAAGTACTCCAAACA
GCAACCGCAAGAGACGGAGATTGAAAGAGACCCTGGCTCAGCTCTCCAG
GGAGACTGACCTCTCTCCGGTGGGAGCTTCCCG
F) R3-3
CGGGAAGCTCTACCGGAGAGACGAAGTTGGAGGCGCTGCAGCCCAGCTT
CTCAGCCTCGTGGTTGCAGCTGTGGATATCGATGCGGTACAGAGTGAAA
GGCCGGAGTTGGAGATGACAGTCCTCTCCTTGTTATCCACTCTGCTCTCA
AAGAAAGGGTACTCTGTCTCGAACTCCTCCGGGTCTGTCATATTGTAGGT
GTCAGCTACCGTGGTGTTCCTGCTTCGGCTGGACATGGTCGTGTTGGCCA
CTTGCATGACGTCTCTCCGGTGAGCTTCCCG
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Table 3-4: Sequence homology data
The gene identities of the differentially expressed cDNA fragments
from the mRNA differential display gels in nickel and MCA
transformed cell lines.
Fragment Homology of Sequence % Homology e value
Rl-2
H. sapiens
DRIP/TRAP 80
107/118 (91%) 1.5 x 10 1 4
R2-2 None
R2-3 None
R2-4
H. sapiens small
nuclear RNA activation
complex
28/28 (100%) 7.5 x 10 3
R2-5
Mus musculus Ect2
oncogene
152/152
(100%)
5.4 x 10 3 5
R3-1 Mus musculus Wdrl 345/349 (99%) 0
R3-3
Mus musculus Insulin
like growth factor I
receptor
243/250 (97%) 1.3 x 10 5 7
Adapted from Verma, et. al. (2003)
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Northern Analysis of R3-1
Further studies of R3-1 have been done to confirm the differential expression
of the fragment that was seen on the original mRNA differential display gel. A
Northern blot hybridization was performed using the 345 bp R3-1 fragment as a
probe. The Northern blot results showed a distinct 3.0 kb transcript, indicating that
the Wdrl gene is up regulated in O k nickel induced transformed cell lines. The
transcript size of 3.0 kb correlates with the results reported by Adler, et al.. (1999).
The northern results confirm the expression pattern o f the original differential
display gel. Figure 3-7 shows the magnified image o f the differential expression of
R3-1 on the original differential display gel and Figure 3-8 shows the Northern blot
analysis probed with the original fragment R3-1.
140
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Figure 3-7: Original Differential display of R3-1
R3-1 - >
mRNA differential display gel, showing a comparison between non
transformed 10T14, nickel-induced and MCA-induced transformed
cell lines. Total RNA was extracted from each of the cell lines and
differential analysis was performed as described in the Materials and
Methods section. Each set o f cDNA obtained from individual cell
lines was run separately in 2-3 lanes to eliminate any errors of
selection. R3-1, which was originally isolated by Differential
Display, is a 345bp cDNA fragment. It’s observed expression pattern
is that it is over-expressed in nickel and MCA-induced transformed
cell lines, but is not detected in the non-transformed lOT’ A cells.
10T V i NiS 3A1 MS SB MS 7A MCA 15 MCA 16
t 1 * 1
*
#4
U r n t M k
m
141
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Figure 3-8: Northern Analysis of R3-1
R3-1 was used as a probe against blots of Total RNA isolated from
die non-transformed and transformed cell lines. An actin probe was
also used as an internal control.
142
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
DISCUSSION
In this study, IOTV 2 mouse embryo fibroblasts were used to study the
carcinogenic effects o f nickel compounds. The 10Tl A cell line has the characteristics
of being immortal; contact-inhibited, and has a low frequency of spontaneous
transformation (Landolph, 1979). They are used as a model cell system to study the
morphological and neoplastic transformation induced by chemical carcinogens.
10T/4 cells have been used as an in vitro model system to study the molecular
mechanisms of cell transformation induced by nickel compounds.
Miura, et. al. demonstrated the ability of nickel compounds, particularly
crystalline nickel monosulfide and nickel oxide, to induce morphological
transformation of IOTV 2 cells (Miura, et.al., 1989). They generated four permanently
transformed cell lines that were induced by insoluble nickel compounds. The cell
lines are used to study the molecular mechanisms of nickel induced cell
transformation, three nickel monosulfide cell lines (NiS 3A1, NiS 3B, NiS 7A) and
one nickel oxide cell line (NiO 2C3). These cell lines were characterized based on
their plating efficiencies, focus forming efficiencies in reconstruction assays and
their abi lity to grow in soft agar. The biological characterization of these cell lines is
given in Table 3-1. These four cell lines have been used to identify fragments that
were differentially expressed between the nickel-induced transformed cell lines and
the non-transformed lOT’ A cells bv the RAP-PCR mRNA differential disnlnv
- - - - j tL ' y
M l
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Concurrently, ten permanent transformed cell lines were generated and
characterized according to the protocols used by Miura, et. al. (1989) These cell
lines were generated from expanded foci induced by green nickel oxide. The
biological characterization o f these ten cell lines can be serai in Table 3-2. Green
nickel oxide was used because of its high potency and its ability to form tumors
when injected into mice. These ten cell lines are to be used in future studies in order
to expand the horizon o f molecular biology of nickel-induced carcinogenicity. For
instance, to evaluate the frequency of differential expression o f the genes obtained
from the differential display.
The cell lines were analyzed by RAP-PCR mRNA differential display, which
was used to identity genes whose expressions are altered between the non-
transformed lOTVi cells and the transformed cell lines induced by nickel compounds
(Liang and Pardee, 1995; McCleland and Welsh, 1994). Originally ten fragments
w e r e identified that were differentially expressed between the non-transformed and
the transformed cell lines. Table 3-3 shows the expression patterns of the ten
candidate fragments initially isolated.
Seven o f the ten fragments were PCR amplified, as seen in Figure 3-3, with
sizes ranging between 200 bp to 500 bp. From the gel of the PCR amplified
fragments, each appears to be a single species. However, it is possible that there is
m o r e than one fragment with the same molecular weight in each band observed.
This would be due to the fact that during the isolation of the cDNA fragments from
144
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
the gels, more than one co-migrating fragment may also have been isolated, and
amplified in the PCR step. This can lead to spurious bands and false positives;
therefore, it was necessary to subclone and screen the inserts that were truly
differentially expressed. Only the subclones that show the differential expression
pattern as seen in the original gel are chosen for further studies.
For further studies, seven fragments were subcloned into PCR vectors, and in
the first screening step, recombinants were selected based cm their ability to form
blue or white colonies, using ampicillin as a selection marker. About sixty
recombinants were grown on duplicate membrane filters, f or differential screening
and colony hybridization, the duplicate membranes were hybridized with cDNA
probes. Clones whose expression patterns corresponded to the original differential
display patterns were selected for further analysis. Figure 3-4 shows the results from
four reverse northern experiments.
For each of the seven fragments, clones were selected and a plasmid
preparation was done to be sure that the insert is of the same molecular weight as the
fragment. The samples were analyzed on an agarose gel, shown in Figure 3-5. The
inserts were isolated from the gel and purified to be used as probes for northern
analysis to verify their differential expression.
The clones corresponding to fragments Rl-2, R2-2, R2-3, R2-4, R2-5, R3-1
and R3-3 were sequenced (Figure 3-6) and analyzed in the NCBI BLAST search for
sequence homologies. Five cDNA inserts showed homologies to sequences of
145
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
known genes, while two did not show sequence homologies to known genes (Table
3-4). Rl-2 is a 186 bp fragment, whose expression is present in the non-transformed
10Tl /2 cells, but is ablated in the nickel induced transformed cell lines showed a 91 %
homology to the H. sapiens DRIP/TRAP80 gene, which is involved in the Vitamin D
and Thyroid Hormone responses. R2-4 is homologous to a small portion of the H.
sapiens small nuclear RNA activating complex. R2-5 is homologous to the Mus
musculus Ect2 gene, which is a known oncogene. R3-1 shows a homology to the
Mus musculus Wdrl gene, which has been identified as being up regulated in the
acoustically damaged ears o f chicks, and appears to be a stress related gene. R3-3 is
homologous to the Mus musculus insulin-like growth factor 1 receptor. Both R2-2
and R2-3 do not show homologies to known genes.
Further studies were focused on characterizing the gene fragments. First is
Rl-2, that is present in the non-transformed 10T*/2 cells, but is absent in the nickel
induced transformed cell lines, and is homologous to the DRIP/TRAP80 gene.
Second is R2-5, that is absent in expression in the non-transformed lOT'A cells, but is
up regulated in the nickel induced transformed cell lines which is homologous to the
Ect2 gene. Last is R2-2, that is present in the non-transformed lOT'/z cells, but is
absent in the nickel induced transformed cell lines which does not show sequence
homologies to known genes. R3-1 was also studied. It is absent in expression in the
non-transformed IOTV2 cells, bid is up regulated in the nickel induced transformed
cell lines, and is homologous to the Wdrl gene.
146
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
One of the gene fragments, R3-1, was expressed in non-transformed 1O T V 2
cells, but was expressed at higher steady-state levels in MCA and Ni compound-
induced, transformed IOTV 2 cell lines. Northern blotting analysis was performed by
hybridizing this cDNA fragment with the blot prepared using Poly A+ RNA from
IOTV 2 and from the nickel-induced transformed cell lines. The 345 bp R3-1
fragment was used as a probe. Northern hybridization confirmed the expression
pattern of R3-1 that is absent in the non-transformed 10T V z cells and present in the
transformed cells. This cDNA fragment detected a 3.0 Kb transcript in Northern gel
analysis. The size of the observed transcript size correlated with the results reported
by Adler, et al.. (1999). Figure 3-7 and Figure 3-8 show the original differential
display gel and the northern analysis of the R3-1 fragment, using the original
fragment as a probe. This appears to be the Mus musculus Wdrl gene, as reported in
the literature (Adler, 1999). Wdrl has been shown to be up regulated in the
acoustically damaged ears o f chicks, indicating that it could be a stress related gene.
It is interesting to study this up regulated gene and its involvement in nickel
carcinogenesis. Our laboratory is studying the structure o f die Wdrl gene in the
transformed cell lines and the molecular events that have led to higher steady-state
levels o f expression of this gene.
147
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 4: Increased expression of the Ect2 oncogene in nickel-induced
transformed cell lines
ABSTRACT
Epidemiological studies have shown a higher incidence of lung, sinus and
pharyngeal cancers in humans exposed to insoluble nickel compounds. To
characterize the molecular events associated with nickel-induced carcinogenesis,
mRNA was isolated from several cell lines derived from nickel-induced
transformation of C3H/10T/4 Cl 8 (10T/4) mouse embryo fibroblast cells. The RNA
species were then analyzed using the mRNA differential display technique.
Fragments containing differentially expressed genes were isolated by subcloning,
identified by reverse Northern analysis, and sequenced. The sequences were then
subjected to nBLAST analysis for comparison with known gene sequences.
Several fragments were expressed at higher levels in nickel-transformed cell
lines than in 1O T V 2 cells, including one fragment, R2-5. R2-5 shared a 100%
sequence identity with part o f the coding region o f the Ect2 gene (Miki, et.al. 1993,
Tatsumoto, et.al., 1999), a mouse oncogene that encodes a GDP-GTP- exchange
factor.
148
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
INTRODUCTION
Nickel has a wide variety of applications. It is particularly useful as a
component in various alloys, such as stainless steel, in nickel-cadmium batteries, and
in nickel plating (IARC, 1976; NIOSH, 1977). Nickel compounds are also used as
catalysts in the hydrogenation of fats and oils, in ceramic glazes, and as pigments in
paints (IARC, 1976; NIOSH, 1977). Certain nickel compounds have been shown to
be carcinogenic in animals and humans, however the mechanisms leading to this
carcinogenesis remain unclear.
Tumorigenesis is a multistep process involving the accumulation of
mutations in several genes, proto-oncogenes and tumor suppressor genes (Verma,
et.al. submitted; Landolph, et.al., 2002). One hypotheses is that nickel may bind to
proteins, and that these Ni-protein complexes translocate to the nucleus, then bind to
DNA, or that nickel ions may get transported to the nucleus and bind to proteins that
are already bound to DNA (Klein, et.al., 1991; Landolph, 1989; Landolph, 1990;
Landolph, 1994; Landolph, et.al., 1996; Landolph, 1999; Landolph 2000; Landolph
et.al., 2002). This may then cause gene rearrangements or mutations in proto
oncogenes, large or small deletions in tumor suppressor genes or loss of the
chromosomes that contain these genes. A second hypothesis is that nickel is
involved at the transcription level in that it may enhance the transcription rates of
proto-oncogenes or may increase the stability of the proto-oncogenes’ mRNA (Klein,
et.al., 1991; Landolph, 1989; Landolph, 1990; Landolph, 1994; Landolph, et.al.,
149
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
1996; Landolph, 1999; Landolph 2000; Landolph et.al., 2002). A third, and less
studied hypothesis is that nickel may alter the methylation state of DNA (Klein,
et.al., 1991; Landolph, 1989; Landolph, 1990; Landolph, 1994; Landolph, et.al.,
1996; Landolph, 1999; Landolph 2000; Landolph et.al., 2002).
The purpose of this study is to characterize the molecular events associated
with nickel-induced carcinogenesis. For this purpose, mRNA was isolated from
several cell lines derived from nickel-induced transformation of C3H/10P/2 Cl 8
(lOT'A) mouse embryo fibroblast cells. The RNA species were then analyzed using
the mRNA differential display technique (Liang and Pardee, 1995; Liang, et.al.,
1995; McClelland and Welsh, 1994; Welsh, et.al., 1995) . Fragments containing
differentially expressed genes were isolated by subcloning, identified by Reverse
Northern Analysis, and sequenced. The sequences were then subjected to nBLAST
analysis for comparison with known gene sequences.
Several fragments were over-expressed in nickel-transformed cell lines than
in IOTV 2 cells. One fragment, R2-5, shared a 100 % sequence identity with part of
the coding region of the Ect2 gene (Miki, et.al., 1993, Tatsumoto, et.al., 1999), a
mouse oncogene which encodes a GTP- exchange factor. Specifically, Ect2 acts as a
Guanine Exchange Factor (GEF) for the Rho family of guanosine-triphosphatase
(GTP-ase) proteins, which are involved in actin remodeling and cytokinesis (Figure
4-1). If over-expressed, Ect2 keeps the Rho proteins constitutively active, leading to
cell transformation. This gene was selected for further study.
150
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Figure 4-1: Ect2 as a GTP exchange factor
Ect2 Pathway - Ect2 acts as a Guanine Exchange Factor (GEF) for
the Rho family of GTP-ase proteins, which are involved in actin
remodeling and cytokinesis. If over-expressed, Ect2 keeps the Rho
proteins constitutively active, leading to transformation. Adapted
from Current Biology, vol. 11 (20), Peter Hollenbeck, Cytoskeleton:
Microtubules get the Signal, pg R820-R823, Copyright (2001), with
permission from Elsevier
151
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
U P A receptor
mtCAP
mtCAP
M icro tubule
mtCAP
C A P iiu M k n
sndmunriiiltnAe
d a M in d iim
152
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
MATERIALS AND METHODS
Total RNA Isolation
Each cell line was grown to log phase, and the total RNA from all the cell
lines were isolated with RNAzol™ B reagent (Iso-Tex Diagnostics, Friendswood,
TX) according to the manufacturers protocol. The concentration of RNA in each
sample was quantified by measuring the OD at 260 nm and the purity determined by
the 260/280 ratio. The RNA was separated by 1 % agarose gel electrophoresis to
check the integrity of the RNA.
Poly A+ RNA Isolation
The mRNA was isolated from total RNA using the mRNA ST AT™
procedure (Iso-Tex Diagnostics, Friendswood, TX). The mRNA was then quantified
by measuring the OD at 260 nm and the purity determined by the 260/280 ratio. 1 -5
|4g were used for the Northern Hybridization.
Gene specific primers used for amplifying selected gene fragments
Oligonucleotide primers used for all PCR based procedures were synthesized
by the Microchemical Core Facility at the University of Southern California, Norris
Comprehensive Cancer Center, Los Angeles, CA.
153
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
The following primers were used for obtaining the Ect2 gene:
LD87 5’ GGG GAA GCA TTC AGA TGG ACG 3’
LD86 5’ GCA CCA GGC TCC GAT GAG AAG 3’
LD116 5’ GCA CCC ACC AAC TGT TTA CTG 3’
LD94 5’ GAA TCG GAG GCG GCA GCC TCT 3’
LD95 5’ GCT TCC CCA GAA CCA CTC TTG 3’
RT-PCR amplification using gene specific primers
RNA was extracted from lOT'A, NiS 3A, NiS 3B, NiS 7A, NiO 2C3, MCA
Cl 15 and MCA Cl 16 and used to generate cDNAs using the Omniscript™ Reverse
Transcriptase kit (Qiagen, Inc., Valenci, CA). A 20 pi reaction mixture containing 2
pg of the RNA, 12.5 pmol of random oligonucleotide primer, 5 mM of each dATP,
dTTP, dGTP, and dCTP, one unit of Rnase inhibitor, lOx RT buffer, and 1 unit of
Omniscript Reverse Transcriptase (Qiagen, Inc., Valencia, CA) was incubated for 60
minutes at 37 °C.
The fragments were amplified by the polymerase chain reaction (PCR). A
100 pi reaction mixture containing 5 pi of the cDNA, 12.5 pmol of each gene
specific oligonucleotide primer, 5 mM of each dATP, dTTP, dGTP, and dCTP, lOx
PCR buffer (containing 1.5 mM Magnesium Chloride), and 1 unit of HotStarTaq
D N A polymerase (Qiagen, Inc., Valencia, CA). The samples were overlaid with
lOOpl of mineral oil to prevent evaporation, and then subjected to amplification in a
154
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Thermal Cycler, model 480 (Perkin Elmer Company, Norwalk, CT). The thermal
cycling parameters were 15 minutes at 95 °C followed by 25 cycles of 1 minute at 95
°C, for denaturation, 1 minute at 60 °C for annealing, and 1 minute at 72 °C for
extension.
155
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Figure 4-2: Primers generated for amplification of Ect2
Schematic representation of the primers that were used to amplify the
Ect2 gene. The following primers were used for obtaining the Ect2
gene:
LD87 5’ GGG GAA GCA TTC AGA TGG ACG 3’
LD86 5’ GCA CCA GGC TCC GAT GAG AAG 3’
LD116 5’ GCA CCC ACC AAC TGT TTA CTG 3’
LD94 5’ GAA TCG GAG GCG GCA GCC TCT 3’
LD95 5’ GCT TCC CCA GAA CCA CTC TTG 3’
3900
Ect2
1 0 4 7 1 1 9 0
R2-5
1 W >
LD94 L D 9 5
2 Id)
lldi
LD87 L D 0 6
3 Id.
L D 1 16
156
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Northern Hybridization
Northern blots were prepared, as described by Sambrook, et.al. (1990) using
10 pg of total RNA or 5 pg of Poly A+ RNA, which was then separated by
electrophoresis on a 1 % agarose and 0.86 M formaldehyde gels for 3 hours at 105V.
Electrophoresis was run in a chemical fume hood. After the 3 hours, the gels were
rinsed with DEPC-treated water and then transferred onto nylon membranes
(Hybond, Amersham, CA) overnight. The RNA was bound to the membranes by
UV cross-linking, using a Stratalinker (Stratagene Inc., La Jolla, CA).
Membranes were pre-hybridized at 42 °C for 1 hour in pre-hybridization
buffer. Probes were labeled with P dCTP by using a random prime kit (Boeringher
Mannheim). Unincorporated labeled nucleotides were removed using a G-50
sephadex spin column. The probes were added to hybridization buffer and incubated
with the membranes overnight at 42 °C. If required, hybridizations were carried out
with lower and higher stringencies (ie: 37 °C, 50 °C, or 65 °C). Membranes were
washed at RT in lxSSC, 0.1 SDS twice, if necessary at 42 °C for 20 minutes, or at 65
°C for 10 minutes. Membranes were exposed overnight at -80 °C to Kodak X-MR
film (Eastman Kodak Company, Rochester, NY), and developed using a Kodak RP
X-OMAT processor (Eastman Kodak Company, Rochester, NY).
Quantitation of the Northern blots was done using a quantitative densitometry
scan using Bio-Rad Ultra scan laser densitometer (Bio-Rad Laboratories, Hercules,
CA), and the Quantity One software program was used to quantitate the expression
157
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
levels. This quantitative determination was obtained by normalizing the (5-actin
expression levels on the same blot.
Genomic DNA Isolation
The genomic DNA from all seven cell lines were isolated using a Puregene
DNA Isolation Kit (Gentra Systems, Minneapolis, MN). Cells were grown in 75 cm2
tissue culture flasks to approximately 80 % confluency. The medium was aspirated,
and the cells were rinsed in a lx phosphate buffered saline (PBS: 0.0015 M
potassium phosphate, monobasic, 0.15 M sodium chloride, 0.0016 M sodium
phosphate, dibasic heptahydrate). Three ml of 0.1 % trypsin was added to the flasks
for 5 minutes or until the cells released from the bottom of the flasks. Seven ml of
BME medium was added, and the cell suspension was transferred to 50 ml conical
tubes. The tubes were centrifuged for 5 minutes to pellet the cells, and the
supernatant was aspirated away, leaving a small amount of residual medium. The
cells were resuspended in 300 pi of Cell Lysis Solution and transferred to
microcentrifuge tubes. 1.5 pi of Rnase A solution was added to the cell lysate, and
this solution was incubated for 15 minutes at 37 °C. After cooling the samples to
room temperature, 100 pi Protein Precipitation Solution was added to each tube,
followed by vortexing for 20 seconds.
The precipitated proteins were pelleted in a microcentrifuge and the
supernatants were transferred to fresh microcentrifuge tubes containing 300 pi of
158
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
100 % isopropanol, mixed gently and the precipitated DNA was pelleted in a
microcentrifuge for 5 minutes. The supernatant was removed and the pellets were
washed with 70% ethanol, centrifuged, the supernatant removed and the pellets were
allowed to air dry for 15 minutes. The DNA was re-hydrated in 50 pi of sterile,
double distilled water. The DNA was then separated by 1 % agarose gel
electrophoresis to check the integrity of the DNA.
Southern Hybridization
Southern blots were prepared, as described by Southern (1975), using 10 pg
of genomic DNA from the IOTV 2, five nickel transformed, and two MCA
transformed cell lines. These DNAs were digested with restriction enzymes (EcoRI,
BamHI, EcoRI/BamHI, Hindlll), then the digested DNA samples were separated by
electrophoresis on a 0.7 % agarose for 14 hours at 35 V. After the 14 hours, the gels
were rinsed with double distilled water, soaked for 20 minutes each at room
temperature in depurination buffer, denaturation buffer (0.3 M sodium hydroxide,
1.5 M sodium, and neutralization buffer (1.5 M sodium chloride, 1.0 M Tris-HCl, pH
7.2. The DNA was then transferred onto nylon membranes (Hybond, Amersham,
CA) overnight. The DNA was fixed to the membranes by UV cross-linking, using a
Stratalinker (Stratagene Inc., La Jolla, CA).
Membranes were pre-hybridized at 65 °C for 1 hour in pre-hybridization
buffer. Probes were labeled with 3 2 P dCTP by using a random prime kit (Boeringher
159
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Mannheim). Unicorporated labeled nucleotides were removed using a spin column.
The probes were added to hybridization buffer and incubated with the membranes
overnight at 65 °C. Membranes were washed at RT in lxSSC, 0.1 SDS twice, if
necessary at 42 °C for 20 minutes, or at 65 °C for 10 minutes. Membranes were
exposed overnight at -80 °C to Kodak Biomax MR film (Eastman Kodak Company,
Rochester, NY), and developed using a Kodak RP X-OMAT processor (Eastman
Kodak Company, Rochester, NY).
Quantitation of the Northern blots was done using a quantitative densitometry
scan using Bio-Rad Ultra scan laser densitometer (Bio-Rad Laboratories, Hercules,
CA), and the Quantity One software program was used to quantitate the expression
levels. This quantitative determination was obtained by normalizing the p-actin
expression levels on the same blot.
Preparation of Whole Cell Lysates
Western blots were prepared using whole cell lysates extracted from non-
transformed 10T1/2 and Nickel monosulfide induced cell lines NiS 3A1, NiS 3B1,
NiS 7A, nickel oxide induced transformed cell line NiO 2C3, NiO Gl-2, and MCA
induced transformed cell lines MCA Cl 15 and MCA Cl 16 grown to logarithmic
phase. Cells were grown in 10 cm dishes in Eagles Basal Medium (BME) medium
supplemented with 10 % heat inactivated FCS (Omega Scientific Company, CA), in
incubators supplied with 5 % CO2 at 37 °C in a humidified atmosphere.
160
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Whole cell lysate extractions were carried out on ice. To extract the whole
cell lysates, the media was removed and then dish was rinsed twice with ice-cold
Phosphate Buffered Saline (PBS). 200 pi of ice-cold RIPA buffer (20 mM Tris-
HCL, pH 7.8, 5 mM EDTA, 0.5 % Np-40, 150 mM NaCl), containing a protease
inhibitor cocktail (Roche), was added to the dish and the cells were scraped with
disposable cell scrapers, then transferred to a micro centrifuge tube. The lysates
were incubated on ice for 10 minutes, then centrifuged at 12,000 x g at 4 °C for 10
minutes to pellet cellular debris. The supernatants were transferred to new micro
centrifuge tubes and the pellets were discarded. Protein concentrations were
determined using the Bradford protein assay reagent (Bio-Rad Laboratories,
Hercules, CA) according to the protocol of Bradford (1976). Samples were stored at
-80 °C.
SDS-PAGE and Western blotting analysis
For the Western blot analysis, 100 pg of total cellular protein were used, and
resolved by SDS-PAGE. The protein samples were denatured by heating at 95 °C for
5 minutes. An equal volume of 2x SDS sample buffer was added containing 2 %
SDS, 10 % glycerol, 5 % (1-mercaptoethanol, and 62.5 mM Tris-HCL, pH 6.8, and
bromophenol blue dye was added and the samples were loaded onto polyacrylamide
gels. Low range prestained protein standards (Bio-Rad Laboratories, Hercules, CA)
were used as molecular weight markers. Proteins were resolved by SDS-PAGE on
161
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
10 % polyacrylamide gels, as described by Laemmli (1970). After electrophoresis,
the proteins were electrophoretically transferred to a nitrocellulose membrane (Bio-
Rad Laboratories, Hercules, CA).
A standard Western blotting procedure was followed, as described by Harlow
and Lane (1988). The membrane was blocked for 1 hour in 5 % non-fat dairy milk
in TBST (TBS, containing 0.1 % Tween 20) and incubated with a primary antibody
(1:500) overnight at 4°C. The blot was rinsed in TBST three times for 5 minutes
each, then incubated in a horseradish peroxidase (HRP) conjugated secondary
antibody (1:1000) for 1 hour. The blots were subsequently rinsed again three times
for five minutes each. Detection was performed using enhanced chemiluminescence
(ECL detection kit, Amersham).
Quantitation of the Northern blots was done using a quantitative densitometry
scan using Bio-Rad Ultra scan laser densitometer (Bio-Rad Laboratories, Hercules,
CA), and the Quantity One software program was used to quantitate the expression
levels. This quantitative determination was obtained by normalizing the p-actin
expression levels on the same blot.
1 6 2
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
RESULTS
Original differential expression of R2-5
A 293 bp fragment was identified by RT-PCR and mRNA differential display
(DD), and labeled as fragment R2-5 (Figure 4-3). This fragment was found to be
expressed at higher steady-state levels in nickel induced, transformed lOT'A cell
lines, as well as, in two MCA induced, transformed cell lines. Expression of R2-5
was undetectable in the non-transformed IOTV 2 cells by this method. The cDNA
fragment was isolated from the DD gel and re-amplified by PCR, using the DD
primers. The PCR amplified fragment was sequenced, and the sequence data was
subjected to an nBLAST homology search, in which it was found to be highly
homologous to a portion of the Ect2 gene (P= 3e'8 0 , GenBank search, 1999).
In addition, the cDNA fragment was subcloned into a PCR vector, using
reverse Northern analysis to select clones that were truly differentially expressed
between the non-transformed cells and the transformed cell lines.
163
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Figure 4-3: Original Differential display of R2-5
mRNA differential display gel, showing a comparison between non-
transformed IOTV 2, nickel-induced and MCA-induced transformed
cell lines. Total RNA was extracted from each of the cell lines and
differential analysis was performed as described in the Materials and
Methods section. Each set of cDNA obtained from individual cell
lines was run separately in 2-3 lanes to eliminate any errors of
selection. R2-5, which was originally isolated by Differential
Display, is a 293 bp cDNA fragment. It’s observed expression pattern
is that it is over-expressed in nickel and MCA-induced transformed
cell lines, but is not detected in the non-transformed 10T/4 cells.
10TW NiS3A NiS3B HiS 7A MCA 15 MCA 16
♦
R2-5 ►
164
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
RT-PCR amplification using gene specific primers
Gene specific primers were generated based on the known sequences of the
DRIP/TRAP80, Ect-2 genes; GAPDH was also amplified as an internal control. RT-
PCR amplification was used to lengthen the fragments Rl-2 and R2-5, respectively
to 1 kb. By using cDNA from \0TV2 , NiS 3A, NiS 3B, NiS 7A, NiO 2C3, MCA Cl
15 and MCA Cl 16, the expression patterns can also be compared to the original
expression patterns seen in the differential display gels. The results from the RT-
PCR amplification of the Ect-2 gene show that a 1 kb fragment was amplified in the
reactions with all cell lines (lOT'A, NiS 3A, NiS 3B, NiS 7A, NiO 2C3, MCA Cl 15
and MCA Cl 16 cDNA), as seen in Figure 4-4. The 1 kb fragments were then
isolated, purified and sequenced (Figure 4-5). The sequences were then entered into
the BLAST search to confirm the identity as the Ect-2 gene. The BLAST search
results show that in each reaction, the fragment that was amplified was indeed part of
the Ect2 gene. This non-quantitative RT-PCR gel also showed that the Ect2 proto
oncogene was also expressed in non-transformed IOTV 2 cells (Figure 4-4), apparently
at low levels (Figure 4-3).
165
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Figure 4-4: RT-PCR amplification of Ect2
lkb, 2kb, and 3kb fragments were amplified using Ect2 gene specific
primers. Sequence analysis of the 1 kb fragment shows no mutations
among the non-transformed and transformed cell lines. These
fragments were used as probes for Northern and Southern
hybridization. The 1 kb fragment is pictured.
1KB
GAPDH
166
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Figure 4-5: RT-PCR seqencing of R2-5
R2-5 was extended by RT-PCR to form 1 kb, 2 kb, and 3 kb
fragments, using Ect2 gene specific primers. Sequence analysis of the
lkb fragment shows no mutations among the non-transformed and
transformed cell lines. These fragments were used as probes for
Northern and Southern hybridization. The sequence of the lkb
fragment amplified from 10T54 cells is pictured as representative data.
it/1 l'l A,' . l'l
---- ----.....---------------------------- n ----i m — "T ..—--11'—: ----------
'■ i I ’1 -' . « , ;V
J A '. jJ u j'/i ,1 ..- a / A - n > . V U
:.........................:.......................■ ■■“ r: ..- . .. -
A / W ; .. L i\:Ar 'A
.
1 ’ j - 'i.11 ■ ( r< * i ■ | '| A | ;•
,.i_ j f v . j i l L \ J i i v .\< . I.1 . , .;.U y
J 'V .'v _ . . ..ill, L i V . l i A a . ..
Il i1' j ! , j 1 ! i” , i: i \ ’ 1
y.-O-' W-.. ■ . .A V . . > ! ■ .. /J.Aj-V A '\'A ,,L v * * '. 'l -v.
: y-r -"j-"
167
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Northern Analysis of R2-5
Northern blotting analysis was utilized to determine the expression of Ect2
mRNA in mouse 10T14 and in nickel-induced and MCA-induced transformed cell
lines. For these assays, total RNA was extracted from the non-transformed and
transformed cell lines, as described in the Materials and Methods section. Total RNA
and the poly (A*) mRNA blots were extracted from lOT'A non-transformed cells and
nickel-induced transformed cell lines, NiS 3A1, 3B1, 7A and NiO 2C3, and MCA-
induced transformed cell lines, MCA Cl 15 and MCA Cl 16. 30 pg of total RNA
was run on a formaldehyde-agarose gel and blotted onto nitrocellulose membrane.
The blots were probed with [a-3 2 P] dCTP labeled a 1.0 kb probe amplified by RT-
PCR. p-actin was used as control probes to quantify the levels of expression.
A single transcript of 3.9 kb was detected in the morphologically transformed
cell lines, but was not detected in the non-transformed 1O TV 2 cells, which is
consistent with the size detected by Miki, et.al. (1999). This suggests a higher
steady-state increased level of expression of Ect2 mRNA present in the transformed
cell lines (Figure 4-6, Figure 4-7). To confirm these results, the Northern analysis
was repeated, using Northern blots of total and Poly (A+ ) RNA generated from the
non-transformed and nickel-induced and MCA induced cell lines gene using the 3.9
kb full length Ect2 probe prepared from the plasmid obtained from Dr. Miki (1999).
The results obtained confirmed that 3.9 kb transcript was expressed in all the nickel-
168
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
induced morphologically transformed cell lines, and the signal transcript was
undetectable in the non-transformed IOTV 2 cells.
The quantitative analysis of the signal intensities of the blots indicated a 2.4 ±
0.5 fold increase of Ect2 expression in the nickel monosulfide (NiS) induced
transformed cell line NiS 3A, a 3.6 ± 1 .7 fold increase in NiS 3B, a 3.5 ± 2.5 fold
increase in NiS 7A, a 1.6 + 0.6 fold increase in the nickel oxide (NiO) induced
transformed cell line NiO 2C3, a 2.0 ± 0.0 fold increase in NiO Gl-2. There was
approximately a 2.5 fold increase in both of the MCA-induced transformed cell lines,
MCA Cl 15 and MCA Cl 16. This data is represented in Table 4-1.
169
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Figure 4-6: Northern analysis of R2-5
Ect2 was used as a probe against blots of Total RNA isolated from the
non-transformed and transformed cell lines. An actin probe was also
used as an internal control. Relative densitometric readings were
determined using a laser densitometer. The value for 10T14 cells was
arbitrarily set at 1.0.
f f e p-actin
Ect2__________ 1.0 1.9 4.8 1.5 1.2 3.1 2.0
B-actin 1.0 0.7 1.0 0.9 1.1 0.9 0.6
Ect2/p-actin 1.0 2.7 4.8 1.7 1.1 3.4 3.3
170
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Figure 4-7: Repeat Northern analysis of R2-5
Repeat experiment to confirm results. Ect2 was used as a probe
against blots of Total RNA isolated from the non-transformed and
transformed cell lines. An actin probe was also used as an internal
control. Relative densitometric readings were determined using a laser
densitometer. The value for lOT'A cells was arbitrarily set at 1.0.
p-actin
Ect2______________ 1.0 2.0 1.2 1.6 2.0 2.0 2.8 2.1
B-actin 1.0 1.0 0.5 0.3 1.0 1.0 1.6 1.6
Ect2/p-actin 1.0 2.0 2.4 5.3 2.0 2.0 1.8 1.3
171
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Table 4-1: Average steady-state levels of Ect2 mRNA
Relative densitometric readings were determined using a laser
densitometer for each experiment and averaged with standard error.
The steady-state levels of Ect2 mRNA were normalized to p-actin.
The value for lOT'A cells was arbitrarily set at 1.0.
Cell line Experiment 1 Experiment 2 Average ± SD
10T54 1.0 1.0 1.0 ±0.0
NiS 3A 2.7 2.0 2.4 ± 0.5
NiS 3B 4.8 2.4 3.6 ±1.7
NiS 7A 1.7 5.3 3.5 ±2.5
NiO 2C3 1.1 2.0 1.6 ±0.6
NiO Gl-2 ND 2.0 2.0 ± 0.0
MCA Cl 15 3.4 1.8 2.6 ±1.1
MCA Cl 16 3.3 1.3 2.3 ±1.4
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Southern Analysis of R2-5
Southern blot analysis was used to determine the amount of the Ect2 gene in
the genomes of the nickel-induced transformed cell lines, as well as, to determine
whether any mutations were present in the transformed cell lines. For these assays
Genomic DNA was extracted from 1O T V 2 non-transformed cells and nickel-induced
transformed cell lines, NiS 3A1, 3B1, 7A and NiO 2C3, NiO Gl-2 and MCA-
induced transformed cell lines, MCA Cl 15 and MCA Cl 16, as described in the
Materials and Methods section. For each blot, 10 pg of gDNA was digested with a
restriction enzyme, and was run on an agarose gel and blotted onto nitrocellulose
membrane. The blots were probed with [a-3 2 P] dCTP labeled a 1.0 kb probe
amplified by RT-PCR. P-actin was used as control probes to quantify the levels of
expression.
A single gene was detected in the morphologically transformed cell lines, and
was barely detected in the non-transformed lOT'A cells, indicating a lack of
mutations in the transformed cell lines. However, the results from two separate
experiments show a higher level of the Ect2 gene present in the transformed cell
lines, caused by gene amplification (Figure 4-8, Figure 4-9). These results were
confirmed by confirming repeating the Southern blot analysis results using the 3.9
Kb full length Ect2 probe prepared from the plasmid obtained from Dr. Miki (1999).
173
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
The quantitative analysis of the signal intensities of the blots is represented in
Table 4-2. The data indicated that there was a 6.8 ± 2.0 fold increase of the Ect2
gene in nickel monosulfide (NiS) induced transformed cell line NiS 3A, a 3.5 ± 2.2
fold increase in NiS 3B, a 6.3 ± 0.4 fold increase in NiS 7A. There was a 10.1 ±2.1
fold increase in the nickel oxide (NiO) induced transformed cell line, NiO 2C3.
There was also a 11.2 ± 5.0 and a 9.3 ± 2.1 fold increase in the MCA-induced
transformed cell lines, MCA Cl 15 and MCA Cl 16, respectively (Table 4-2).
174
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Figure 4-8: Southern analysis of R2-5
Ect2 was used as a probe against blots of genomic DNA isolated from
the non-transformed and transformed cell lines. An actin probe was
also used as an internal control. Results from these experiments show
the possibility of gene amplification in the transformed cell lines.
Relative densitometric readings were determined using a laser
densitometer. The value for 10T54 cells was arbitrarily set at 1.0.
Ect2
GAPDH
Ect2
GAPDH_________________ 1.0 1.0 1.0 1.0 0.8 1.0 1.0
Ect2/GAPDH 1.0 8.2 5.0 6.5 8.6 7.6 7.8
175
♦
1.0 8.2 5.0 6.5 6.9 7.6 7.8
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Figure 4-9: Repeat Southern analysis of R2-5
Repeat experiment to confirm results. Ect2 was used as a probe
against blots of genomic DNA isolated from the non-transformed and
transformed cell lines. An actin probe was also used as an internal
control. Results from these experiments show the possibility of gene
amplification in the transformed cell lines. Relative densitometric
readings were determined using a laser densitometer. The value for
1O T V 2 cells was arbitrarily set at 1.0.
*< vvvvv->
Ect2
ft*
P-actin
Ect2_______ 1.0 9.2 3.0 6.0 5.8 14.0 16.2
B-actin 1.0 1.7 1.6 1.0 0.5 0.95 1.5
Ect2/p-actin 1.0 5.4 1.9 6.0 11.6 14.7 10.8
176
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Table 4-2: Average steady-state levels of Ect2 DNA
Relative densitometric readings were determined using a laser
densitometer for each experiment and averaged with standard error.
The steady-state levels of Ect2 DNA were normalized to p-actin. The
value for IOTV 2 cells was arbitrarily set at 1.0.
Cell line Experiment 1 Experiment 2 Average ± SD
10T‘ /2 1.0 1.0 1.0 ±0.0
NiS 3A 8.2 5.4 6.8 ± 2.0
NiS 3B 5.0 1.9 3.5 ±2.2
NiS 7A 6.5 6.0 6.3 ± 0.4
NiO 2C3 8.6 11.6 10.1 ±2.1
MCA Cl 15 7.6 14.7 11.2 ±5.0
MCA Cl 16 7.8 10.8 9.3 ±2.1
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Western Analysis of R2-5
Western analysis was performed using an anti-Ect2 antibody against whole
cell lysates extracted from the non-transformed IOTV 2 cells and the transformed cell
lines to compare the expression patterns of the Ect2 protein among non-transformed
and nickel-induced transformed cell lines. Whole cell extracts were prepared, as
described in the Materials and Methods section, from the non-transformed IOTV 2
cells and from nickel-induced transformed cell lines, NiS 3A1, 3B1, 7A and NiO
2C3, NiO Gl-2 and MCA-induced transformed cell lines, MCA Cl 15 and MCA Cl
16. 100 pg of protein from each sample was resolved on by SDS-PAGE and then
blotted onto nitrocellulose membranes by Western blotting. The blots were
hybridized with an anti-Ect2 antibody, then stripped and probed with an anti-actin
antibody for an internal control.
Analysis from the Western blots showed that Ect2 protein was detected in the
non-transformed cells, but at a low steady state level. There were higher steady-state
levels of the Ect2 protein in the transformed cells over the non-transformed cells
(Figure 4-10, Figure 4-11).
The quantitative analysisof the signal intensities of the Western blots, as seen
in Table 4-3, indicated approximately a 3.7 ± 0.0 fold increase in Ect2 protein levels
in nickel monosulfide (NiS) induced transformed cell line NiS 3A, a 4.6 ±1.3 fold
increase in N iS 3B, a 5.8 ± 2.5 fold increase in N iS 7A, and a 4.7 ±2.1 fold increase
in the nickel oxide (NiO) induced transformed cell line, NiO 2C3. There was also a
178
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
5.3 ± 0.0 and a 4.8 + 2.0 fold increase in the MCA-induced transformed cell lines,
MCA Cl 15 and MCA Cl 16, respectively (Table 4-3).
179
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Figure 4-10: Western analysis of Ect2
Anti-Ect2 antibodies were used against blots of whole cell lysates
isolated from the non-transformed and transformed cell lines. An
anti-actin antibody was also used as an internal control. Results from
these experiments show that Ect2 is present at higher steady state
levels in the transformed cells than in the non-transformed cells.
Relative densitometric readings were determined using a laser
densitometer. The value for IOTV 2 cells was arbitrarily set at 1.0.
a — Ect2
& &
& eft?
JP ^ J?
&
116
80
60
35
a - Actin
Ect2 1.0 ND 3.6 3.6 3.2 3.4
B-actin_____________________ 1.0 0.2 1.0 0.9 1.0 1.0
Ect2/p-actin 1.0 ND 3.6 4.0 3.2 3.4
4— 116
4— 80
4— 60
4— 35
180
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Figure 4-11: Repeat Western analysis of Ect2
Repeat experiment to confirm results. Anti-Ect2 antibodies were used
against blots of whole cell lysates isolated from the non-transformed
and transformed cell lines. An anti-actin antibody was also used as an
internal control. Results from these experiments show that Ect2 is
present at higher steady state levels in the transformed cells than in
the non-transformed cells. Relative densitometric readings were
determined using a laser densitometer. The value for 1O T V 2 cells was
arbitrarily set at 1.0.
a -E ct2
a - Actin
60
80
60
Ect2_____________________ 1.0 5.6 6.0 6.0 6.7 6.3 6.2
B-actin 1.0 1.5 1.1 0.8 1.1 1.2 1.0
Ect2/(3-actin 1.0 3.7 5.5 7.5 6.1 5.3 6.2
181
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Table 4-3: Average steady-state levels of Ect2 protein
Relative densitometric readings were determined using a laser
densitometer for each experiment and averaged with standard error.
The steady-state levels of Ect2 protein were normalized to P-actin.
The value for 10T‘ A cells was arbitrarily set at 1.0.
Cell line Experiment 1 Experiment 2 Average ± SD
IOP/2 1.0 1.0 1.010.0
NiS 3A ND 3.7 3.710.0
NiS 3B 3.6 5.5 4.611.3
NiS 7A 4.0 7.5 5.812.5
NiO 2C3 3.2 6.1 4.712.1
MCA Cl 15 ND 5.3 5.310.0
MCA Cl 16 3.4 6.2 4.812.0
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
DISCUSSION
R2-5, a 293 bp fragment, was identified by RT-PCR and mRNA differential
display (DD). This fragment was found to be expressed at higher steady-state levels
in nickel-induced transformed 1O T V 2 cell lines, as well as, in MCA-induced,
transformed cell lines. Expression of R2-5 was not detectable in the non-
transformed cells by the differential display method. The cDNA fragment was
isolated from the DD gel and re-amplified by PCR, using the DD primers. The PCR
amplified fragment was sequenced, and the sequence data was subjected to an
nBLAST homology search, in which it was found to be homologous to a portion of
the Ect2 gene. (P= 3e'8 0 , GenBank search, 1999).
In addition, the cDNA fragment was subcloned into a PCR vector, using
Reverse Northern analysis to select clones that were truly differentially expressed
between the non-transformed cells and the transformed cell lines to eliminate any
false positives, as described in the previous chapter.
By using the known sequences of the Ect2 gene, gene specific primers were
generated for RT-PCR amplification, to lengthen the fragments R2-5, to 1.0 kb. The
expression patterns were also compared to the original expression patterns seen in
the differential display gels. The results from the RT-PCR amplification of the Ect2
gene show that a 1.0 kb fragment was amplified in the reactions containing IOTV 2,
NiS 3A, NiS 3B, NiS 7A, NiO 2C3, MCA Cl 15 and MCA Cl 16 cDNA. This
differs from the original differential display gel, in which the original differential
183
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
display gel shows expression in the transformed cell lines, but not in the non-
transformed 10T!4 cells. It is likely that the Ect2 gene is present in the non-
transformed cells at very low levels, since we can detect it by the highly sensitive
RT-PCR method, and because it is undetectable by Northern analysis. The 1.0 kb
fragment was then isolated, purified and sequenced. The sequences were then
entered into the BLAST search, which confirmed the identity of this fragment as part
of the Ect2 gene.
Northern blotting analysis was used to determine the expression of Ect2
RNA. The Northern Blots were hybridized with the Ect2 probe, p-actin was used as
an internal control. The results from these experiments show an increased level of
Ect2 RNA present in the transformed cell lines. The gene fragment was not
expressed at detectable levels in non-transformed lOT'A cells by Northern analysis
but was expressed at significantly higher steady-state levels in Ni-compound and in
MCA transformed cell lines.
Northern gel analysis using R2-5 as a probe detected a 3.9 kb transcript.
Since we detected the correctly sized transcript for Ect2, at 3.9 kb, it is likely that we
are detecting higher steady-state levels of expression of the Ect2 proto-oncogene in
the Ni compound and MCA transformed cell lines. RT-PCR analysis has shown that
the Ect2 gene is expressed, although at very low steady-state levels, in non-
transformed 10T1/2 cells, and that there are higher steady-state levels of Ect2 protein
in the transformed cell lines. Since the Ect2 gene is mutated in specific human
184
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
tumors (Miki, T., et.al, 1993), we believe that higher steady-state levels of
expression of this gene in the MCA and Ni compound, transformed cell lines
contributes to induction and maintenance of the transformed phenotype.
Southern blotting analysis was used to determine the relative amounts of the
Ect2 gene in the genomic DNA of the non-transformed vs. the transformed cell lines,
as well as, to indicate any mutations that may be present in the transformed cell lines.
The results from these experiments showed a higher level of the Ect2 gene present in
the transformed cell lines, caused by gene amplification. This is the first
demonstration of amplification of the Ect-2 gene in nickel-induced, transformed cell
lines.
Western analysis was performed using an anti-Ect2 antibody against whole
cell lysates extracted from the non-transformed 10T‘ /2 cells and the transformed cell
lines to compare the expression patterns of the Ect2 protein. Analysis from the
Western blots showed that there were higher steady-state levels of Ect2 protein in the
transformed cells over the non-transformed cells. Protein was detected in the non-
transformed cells, but at a very low steady state level.
185
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Summary and Conclusions
The overall goal was to understand the mechanisms of nickel carcinogenesis.
To do this, individual nickel compounds in their pure form were first studied. For
this study, the following compounds were tested: spherical elemental nickel sample
[Ni° (1.5 pm)], nickel carbonate [2 NiC0 3 «3 Ni(0 H)2*4 H2 0 ], and two forms of
nickelic hydroxide, Ni(OH)3 (powder) and Ni(OH)3 (dried slurry). The results show
that all of the samples were taken up by the cells by phagocytosis, with the order of
phagocytic uptake: Ni° (1.5 pm) > Ni(OH)3 (powder) > Ni(OH)3 (dried slurry) >
2 NiC0 3 »3 Ni(0 H)2»4 H2 0 . The order of cytotoxic potency of the samples ( L C 5 0
values in parentheses) was: Ni° (1.5 pm) (0.45 ± 0.3 pg/ml) > Ni(OH)3 (powder)
(2.96 ± 2.4 pg/ml) > 2NiC03 *3Ni(0H)2«4H2 0 (4.08 + 3.8 pg/ml) > Ni(OH)3 (dried
slurry) (18.0 ± 9.0 pg/ml). The ability to induce chromosomal damage of the four
compounds tested can be ranked in the following order: Ni° (1.5 pm) >
2NiC03 «3Ni(0H)2 *4H2 0 > Ni(OH)3 (powder) > Ni(OH)3 (dried slurry). Finally, the
four compounds tested can be ranked according to their carcinogenic potential as
follows: Ni° (1.5 pm) > 2NiC03 *3Ni(OH)2*4H2 0 > Ni(OH)3 (powder) > Ni(OH)3
(dried slurry).
The next step was to study the actual samples taken from a nickel refinery in
the form of complex mixtures that the workers are exposed to during nickel refining
operations. Two refinery dust samples were obtained from the INCO nickel refinery
in Clydach, Whales, U.K., where there have been a total of 365 cases of cancers
186
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
reported in the workers of this refinery since the 1920’s, including 85 nasal cancers
and 280 lung cancers. After changing the refining process in 1923, they eliminated
the orcelite component (Ni5 As2). From 1901 to 1923, the incidence of these cancers
was very high, and was subsequently greatly reduced from 1925-1930. The refinery
dust samples obtained were from 1920 and another from 1929. Both samples
contain primarily green (HT) NiO. The main difference between the two dust
samples is the presence of a nickel arsenide (orcelite) in the 1920 sample. We
hypothesized that it is the nickel arsenide component of the 1920 sample that was
responsible for the nasal and respiratory cancers in the refinery workers. A pure
sample of the nickel arsenide (orcelite) was therefore used for comparison. Hence, it
is believe we have shown that orcelite, and likely also, NiO (green) contribute to
lung and nasal cancers in humans. It is important to control exposure of workers to
NiO and orcelite by engineering controls, such as enclosures with air-tight seals.
In this study short-term in vitro assays were used to determine the relative
genotoxicities of the two nickel refinery samples and were able to determine that the
in vitro genotoxicities of these nickel refinery samples correlated with their
carcinogenicities in humans. In support of our hypothesis, we found that the 1920
sample was able to induce morphological transformation, and that the 1929 sample
did not.
Once specific compounds that were able to induce morphological
transformation were identified, they were used to induce permanent transformed cell
187
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
lines and to study the mechanisms of nickel carcinogenesis on a molecular basis by
identifying and characterizing genes that were aberrantly expressed in the
transformed cell lines, compared to the levels of expression in the nontransformed
1O T V 2 mouse embryo fibroblast cell lines.
Lastly, to characterize the molecular events associated with nickel-induced
carcinogenesis, RNA was isolated from several cell lines derived from nickel
compound induced morphological transformation of IOTV 2 cells. The RNA species
were then analyzed using the mRNA differential display technique. Fragments
containing differentially expressed genes were isolated for further study.
The current working model in Dr. Landolph’s laboratory is that induction of
morphological and neoplastic transformation by insoluble, carcinogenic nickel
compounds leads to aberrant expression of approximately 115 genes in the
transformed cell lines. It is hypothesized that aberrantly higher steady-state levels of
approximately 60 of these genes would be driven by activation of a small number of
activated oncogenes, on the order of five oncogenes. Hence, each activated
oncogene would cause higher steady-state levels of expression of approximately 12
genes downstream of it in the signal transduction pathway in which this protein
product functions in cellular physiology. It is further postulated that aberrantly low
steady-state levels of expression of approximately another 60 genes would be due to
inactivation of approximately five tumor suppressor genes, due to mutational
inactivation, or DNA methylation of the promoters. This would lead to silencing of
188
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
these tumor suppressor genes and of the genes whose expression they control. In this
model, each tumor suppressor gene would control on average transactivation of
approximately 12 genes downstream. This model has been extensively described
and discussed in a recent publication from our laboratory (Landolph, et.al., 2002),
and work is in progress in our laboratory to test these hypotheses.
Since it would be difficult to identify and characterize 115 genes with altered
expression, Dr. Landolph’s laboratory has been studying a few of the genes to find
genes that are globally altered in many of the transformed cell lines. The Ect2 proto
oncogene was studied and found to be over-expressed in nickel-transformed cell
lines as compared to expression levels in non-transformed \OTV2 cells. The results
from the experiments showed a higher level of the Ect2 gene present in the
transformed cell lines, caused by gene amplification, in all of the transformed cell
lines, which lead to higher steady-state levels of Ect2 protein in the transformed cells
than in the non-transformed cells. This is the first example of amplification of any
gene in nickel-induced transformation. This gene may provide a genetic marker for
further clinical research in early detection of cancers among refinery workers.
189
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
REFERENCES
1. Adler, HJ., Winnicki, RS., Gong, TL., and Lomax, MI. (1999) A gene
upregulated in the acoustically damaged chick basilar papilla encodes a novel
WD40 repeat protein. Genomics 56: 59-69.
2. Andersen, O. (1985) Evaluation of the spindle-inhibiting effect of Ni2 + by
quantitation of chromosomal super-contraction. Res. Commun. Chem.,
Pathol., and Phamacol. 500: 379-386.
3. Biedermann, KA. and Landolph, JR. (1987) Induction of anchorage
independence in human diploid foreskin fibroblasts by carcinogenic metal
salts. Cancer Research, 47: 3815-3823.
4. Billings, PC, Shuin, T, Lillihaug, J, Miura, T, Roy-Burman, P, and Landolph,
JR. (1987) Enhanced expression and state of the c-myc oncogene in
chemically and X-ray-transformed C3H/10T1/2 Cl 8 mouse embryo
fibroblasts. Cancer Res. Jul 15; 47(14):3643-9.
5. Bradford, M.M. (1976) A rapid and sensitive method for the quantitation of
microgram quantities of protein utilizing the principle of protein-dye binding,
Anal Biochem 72,248-254.
6. Ciccarelli, RB, and Wetterhahn, KE. (1982) Nickel distribution and DNA
leasions induced in rat tissue by the carcinogenic nickel carbonate. Cancer
Res., 42: 3544-3549.
7. Ciccarelli, RB, and Wetterhahn, KE. (1984) Nickel bound to chromatin,
nucleic acids, and nuclear proteins from kidney and liver of rats trated with
nickel carbonate in vivo. Cancer Res., 44: 3892-3897.
8. Costa, M. (1996) Mechanisms of nickel genotoxicity and carcinogenicity.
In, Toxicology of Metals, Chapter 15, pp. 245-251. Eds. L. W. Chang, L.
Magos, and T. Suzuki. CRC Lewis Publishers Press, Boca Raton, Florida.
9. Degen, E., and Williams, DB. (1991) Participation of a novel 88-kd protein in
the biogenesis of murine class I histocompatibilty molecules. J. Cell Biol.,
112(6): 1099-1115.
10. Doll, R. (1977) Strategy for detection of cancer hazards to man. Nature, 265:
589-596.
190
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
11. Doll, R., Matthews, JD., and Morgan, LG. (1977) Cancers of the lung and
nasal sinuses in nickel workers: a reassessment of the period or risk. Br. J.
Ind. Med., 34:102-105.
12. Diachenko, LB., Ledesma, J. Chenckik, AA., and Siebert, PD. (1996)
Combining the technique of RNA fingerprinting and differential display to
obtain differentially expressed mRNA. Biochem. and Biophys. Res.
Communications, 219: 824-828.
13. Draper, MH., Duffus, J.H., John, P., Metcalf, L., Morgan, L., Park, MV., and
Weitzner, MI. (1994 a) Characterization of historical samples of nickel
refinery dusts from the Clydach refinery. Exp. Toxicol. Pathol., 46 (2): 111-
113.
14. Draper, MH., Duffus, JH., John, P., Metcalf, L., Morgan, L., Park, MV., and
Weitzner, MI. (1994 b) Analysis of nickel refinery dusts. Sci. Total
Environ., 148 (2-3): 263-273.
15. Duffus, JH. (1996) Epidemiology and the identification of metals as human
carcinogens. Sci. Prog. 79 (pt 4): 311-326.
16. Gurley LR, Valdez JG, Miglio JJ, Cox SH, Tobey RA. (1986) Biological
availability of nickel arsenides: cellular response to soluble NisAs2. J
Toxicol Environ Health. 17(1):101-117.
17. Gurley LR, Tobey RA, Valdez JG, Halleck MS, Barham SS (1983)
Biological availability of nickel arsenides: toxic effects of particulate Ni5 As2.
Sci Total Environ. 28:415-32.
18. Harlow, E., and Lane, D. (1988) Antibodies. A laboratory manual, pp. 440-
447. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.
19. Hollenbeck, P. (2001) Cytoskeleton: Microtubules get the Signal Current
Biology, 11 (20): R822.
20. International Agency for Research on Cancer. (1976) LARC monographs on
the evaluation of the carcinogenic risk of chemicals to humans, Vol II,
Cadmium, nickel, some epoxides, miscellaneous industrial chemicals, and
general considerations on volatile anesthetics. Lyon.
191
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
21. International Agency for Research on Cancer. (1990) IARC monographs on
the evaluation of the carcinogenic risks to humans: Chromium, Nickel, and
welding. 49:1-214.
22. Ishidate, M., and Odasima, S. (1977) Chromosome tests with 134 compounds
with Chinese hamster cells in vitro - a screening system for chemical
carcinogens. Mutation Res., 48: 337.
23. Ishidate, M., Sofuni, T., and Yosikawa, K. (1981) Chromosome aberration
tests in vitro as primary screening tool for environmental mutagens and/or
carcinogens. GANN Monographs, 27: 95-102.
24. Ito, M., Yuan, C., Malik, S., Gu, W., Fondell, JD., Yamamura, S., Fu, Z.,
Zhang, X., Qin, J., and Roeder, RG. (1999) Identity between TRAP and
SMCC complexes indicates novel pathways for the function of nuclear
receptors and diverse mammalian activators. Molecular Cell, 3: 361-370.
25. Kasprzak, K., Gabryel, P., and Jarczewska, K. (1983) Carcinogenicity of
nickel(EI)hydroxides and nickel(II)sulfate in Wistar rats and its relation to the
in vitro dissolution rates. Carcinogenesis 4:275-279.
26. Klein, CB., Conway, K., Wang, X. W., Bhamra, R., Lin, X., Cohen, MD.,
Annab, L., Barrett, JC., and Costa, M. (1991) Senescence of nickel-
transformed cells by an X chromosome: Possible epigenetic control.
Science, 251: 796-799.
27. Laemmli, U.K. (1970) Cleavage of structural proteins during the assembly of
the head of bacteriophage T4. Nature (London) 227:680-685.
28. Landolph, JR. (1979) Chemical carcinogens produce mutations to ouabain
resistance in transformable C3H/10TV2 Cl 8 mouse fibroblasts. Proc. Natl.
Acad. Sci. USA, 76: 930-934.
29. Landolph, JR. (1976) Chemical transformation in C3H//10T!4 Cl 8 mouse
embryo fibroblasts: Historical background, Assessment of the transformation
assay protocol, and evolution and optimization of the transformation assay
protocol. In, Transformation Assay of Established Cell Lines: Mechanisms
and Application. IARC Scientific Publication No. 67, pp. 185-198, T.
Kakunaga and H. Yamasaki, Eds. International Agency for Cancer Research,
Lyon, France.
192
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
30. Landolph, JR. (1989) Molecular and cellular mechanisms of transformation
of C3H/10TV2 Cl 8 and diploid human fibroblasts by unique carcinogenic,
nonmutagenic metal compounds: A review. Biological Trace Element
Research, 21: 459-467.
31. Landolph, JR. (1990) Neoplastic transformation of mammalian cells by
carcinogenic metal compounds: Cellular and molecular mechanisms. In,
Biological Effects of Heavy Metals, Vol. II: Carcinogenesis. Chapter 1, pp.
1-18. Ed. E. C. Foulkes. CRC Press, Boca Raton, Florida.
32. Landolph, JR. (1994) Molecular mechanisms of transformation of C3H/10T/4
Cl 8 mouse embryo cells and diploid human fibroblasts by carcinogenic
metal compounds. Environmental Health Perspectives, 102 (Suppl. 3): 119-
125.
33. Landolph, JR., Dews, M., Ozbun, L., and Evans, DP. (1996) Metal-induced
gene expression and neoplastic transformation. In, Toxicology of Metals,
Chapter 19, pp. 321-329. Eds. L. W. Chang, L. Magos, T. Suzuki. CRC
Lewis Publishers, Boca Raton, Florida.
34. Landolph, JR. (1999) Role of free radicals in metal-induced carcinogenesis.
Chapter 14, pp. 445-484. In, Metal Ions in Biological Systems, Volume 36:
Interrelations Between Free Radicals and Metal Ions in Life Processes. Eds.
A Sigel and H. Sigel.
35. Landolph, JR. (2000) The role of free radicals in chemical carcinogenesis.
In, Toxicology of the Human Environmnent. The Critical Role of Free
Radicals. Chapter 17, pp. 339-362. Ed. C. J. Rhodes, Taylor and Francis,
London and New York.
36. Landolph, JR., Verma, A., Ramnath, J., and Clemens, F. (2002) Molecular
Biology of Deregulated Gene Expression in Transformed C3H/10TV2 Mouse
Embryo Cell Lines Induced by Specific Insoluble Carcinogenic Nickel
Compounds. Environmental Health Perspectives, 110 (Suppl 5): 845-850.
37. Liang, P., and Pardee, AB. (1995). Recent advances in differential display.
Current Opinion in Immunology, 7: 274-280.
38. Liang, P., Bauer, D., Averboukh, L., Warthoe, P., Rohrwild, M., Muller, H.,
Strauss, M., and Pardee, AB. (1995) Analysis of altered gene expression by
differential display. Methods in Immunology, 254: 304-321.
193
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
39. McClelland, M. and Welsh, J. (1994) RNA fingerprinting by arbitrarily
primed PCR. In, PCR Methods and Applications, 4: S66-S81. Cold Spring
Harbor Laboratory.
40. Miki, T., Smith, CL., Long, JE., Eva, A., and Fleming, TP. (1993) Oncogene
ect2 is related to regulators of small GTP-binding proteins. Nature, 362: 462-
465.
41.Miura, T., Patiemo, S., Sakuramoto, T., and Landolph, JR. (1989).
Morphological and Neoplastic Transformation of CSHIOPA Cl 8 Mouse
Embryo Cells by Insoluble Carcinogenic Nickel Compounds. Environ.
Mutagen. 14: 65-78.
42. Morgan, LG., and Rouge, PJ. (1984) Biological monitoring in nickel refinery
workers. IARC Sci. Publ. 53: 507-520.
43. Morgan, LG., and Usher, V. (1994) Health problems associated with nickel
refining and use. Ann. Occup. Hyg. 38(2):189-198.
44. National Institute for Occupational Safety and Health. (1977) Criteria for a
Recommended Standard. Occupational exposure to inorganic Nickel,
Washington, DC. US Dept, of Health Education and Welfare [DHEW
(NIOSH) Publication No: 77-164].
45. Nickel Producers Environmental Research Association (NiPERA). (2002)
The Nickel Page. 1 Dec. 2002. http://www.nipera.org/.
46. Nishimura, M. and Umeda., M. (1979) Induction of chromosomal aberrations
in cultured mammalian cells by nickel compounds. Mutation Res., 68: 337-
349.
47. NTP (National Toxicology Program) (1994 a): Toxicology and
carcinogenesis studies of nickel subsulfide in F 344/N rats and B6C3F1 mice.
Draft Technical Report, NTR TR 453, NIH Publication No. 94-3369,
Bethesda, Maryland.
48. NTP (National Toxicology Program) (1994 b): Toxicology and
carcinogenesis studies of nickel subsulfide in F 344/N rats and B6C3F1 mice.
Draft Technical Report, NTR TR 451, NIH Publication No. 94-3363,
Bethesda, Maryland.
194
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
49. NTP (National Toxicology Program) (1994 c): Toxicology and
carcinogenesis studies of nickel subsulfide in F 344/N rats and B6C3F1 mice.
Draft Technical Report, NTR TR 454, NIH Publication No. 94-3370,
Bethesda, Maryland.
50. Oiler, AR., Costa, M., and Oberdorster, G. (1997) Carcinogenicity
assessment of selected nickel compounds. Tox. and Applied Pharmacol., 143,
152-166.
51. Ottolenghi, AD., Haseman, JK., Payne, WW., Falk, HL., and MacFarland, H.
N. (1974) Inhalation studies of nickel sulfide in pulmonary carciongenesis or
rats. Journal of the National Cancer Institute, 54: 1165-1172.
52. Patiemo, SR., Bahn, D., and Landolph, JR. (1988) Transformation of
C3H/10TV2 mouse embryo cells to focus formation and anchorage
independence by insoluble lead chromate but not soluble calcium chromate:
relationship to mutagenesis and internalization of lead chromate particles.
Cancer Research, 48: 5280-5288.
53. Sambrook, J., Fritsch, E.F., and Maniatis, T.J. (1990) Molecular cloning: A
laboratory manual, Ed. 2. Cold Spring Harbor, NY: Cold Spring Harbor
Laboratory.
54. Southern, E.M. (1975) Detection of specific sequences among DNA
fragments separated by gel electrophoresis. J. Mol. Biol., 98: 503-517.
55. Rachez, C., Suldan, Z., Ward, J., Chang, CB., Burakov, D., Edijument-
Bromage, H., Tempst, P., and Freedman, LP. (1998) A novel protein
complex that interacts with the vitamin D3 receptor in a ligand-dependent
manner and enhances VDR transactivation in a cell-free system. Genes and
Development, 12: 1787-1800.
56. Rachez, C., Lemon, BD., Suldan, Z., Bromleigh, V., Gamble, M., Naar, A.
M., Erdjument-Bromage, H., Tempst, P., and Freedman, LP. (1999) Ligand-
dependent transcription activation by nuclear receptors requires the DRIP
complex. Nature, 398: 824-827.
57. Report of the International Committee on Nickel Carcinogenesis in Man
(ICNCM). (1990) Scandinavian J. Work Environ. Health, 16(1), 1-82.
195
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
58. Reznikoff, CA, Brankow, DW, Heidelberger, C. (1973 a) Establishment and
characterization of a cloned line of C3H mouse embryo cells sensitive to
post-confluence inhibition of division. Cancer Research, 33: 3231-3238.
59. Reznikoff, CA, Bertram, JS., Brankow, DW, Heidelberger, C. (1973 b)
Quantitative and qualitative studies of chemical transformation of cloned
C3H mouse cells sensitive to postconfluence of cell division. Cancer
Research, 33: 3239-3249.
60. Saxholm, HJK., Reith, A., & Brogger, A. (1981). Oncogenic transformation
and cell lysis in C3H10T'/2 cells and increased sister chromatid exchange in
human lymphocytes by nickel subsulfide. Cancer res. 41: 4136-4139.
61. Sunderman, FW., Jr., and Maenza, RM. (1976) Comparisons of
carcinogenicities of nickel compounds in rats. Research Communications in
Chemical Pathology and Pharmacology, 14: 319-330.
62. Sunderman, FW. (1981) Recent research on nickel carcinogenesis. J.
Environ. Health Perspectives, 40: 131-141.
63. Sunderman, FW Jr., and McCully, KS (1983) Carcinogenesis tests of nickel
arsenides, nickel antimonide, and nickel telluride in rats. Cancer Invest.
l(6):469-74.
64. Sunderman, FW., Jr. (1989) Mechanisms of nickel carcinogenesis. Environ.
Health, 15,1-15.
65. Tatsumoto, T., Xie, X., Blumenthal, R., Okamoto, I., and Miki, T. (1999)
Human ECT2 is an exchange factor for Rho GTPases, phosphorylated in
G2/M phases, and involved in cytokinesis. Journal of Cell Biology, 147 (5):
921-927
66. Welsh, J., Rampino, N., McClelland, M., and Perucho, M. (1995) Nucleic
acid fingerprinting by PCR-based methods: Application to problems in aging
and mutagenesis. Mutation Res., 338: 215-229.
67. Verma, A., Ramnath, J., Clemens, F., Kaspin, L, and Landolph, JR. (2003)
Molecular Biology of Nickel Carcinogenesis: Identification of Differentially
Expressed Genes in Morphologically Transformed C3H10T'/2 Cl 8 Mouse
Embryo Fibroblast Cell Lines Induced by Specific Insoluble Nickel
Compounds, (in Press).
196
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
68. Verma, A., Ohshima, S., Ramnath, J., Kaspin, L., and Landolph, JR.
Determination of relative in vitro genotoxicities of insoluble nickel cmpounds
in C3H/10T1/2 mouse embryo fibroblasts: Correlations with carcinogenicity,
prediction of carcinogenic potentials, and implications for molecular
mechanisms of nickel carcinogenesis, Manuscript in Preparation.
69. Verma, A., Thakore, KN., Kaspin, L., and Landolph, JR. (2000) Relative in
vitro genotoxicities of metallic nickel, soluble and insoluble nickel
compounds and nickel-containing alloys in C3H/10T‘ /2 mouse embryo
fibroblasts: predictions of carcinogenic potentials, and implications for
molecular mechanisms of nickel carcinogenesis. NiPERA II Report.
70. Vogelstein, B., and Kinzler, KW. (1993) The multistep nature of cancer.
Trends in Genet. 9:138-141.
71. Zhou, D., Salnikow, K., and Costa, M. (1998) Cap43, a novel gene
specifically induced by Ni2+compounds. Cancer Res., 58: 2182-2189.
197
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.

Linked assets

University of Southern California Dissertations and Theses

Conceptually similar

PDF

Role of PKC-delta in deferoxamine-induced cell death in salivary epithelial Pa-4 cells

PDF

Studies on the regulation of p53 and investigation of functional significance of interactions between p53 and its binding proteins

PDF

Studies of hepatitis B virus and hepatitis C virus infection

PDF

Wnt factors: Genes, functions and cooperative signaling in mammary cell transformation

PDF

The role of tumor-associated and normal human brain endothelial cells in angiogenesis

PDF

Leukemia cell vaccine generation using lentiviral vectors

PDF

The effect of cyclooxygenase inhibitors on cell cycle regulation and proliferation of glioblastoma and lymphoma cell lines

PDF

The interactions of host cell proteins with mouse hepatitis virus RNA

PDF

Structure and functions of hepatitis C virus core protein

PDF

Rational design of DNA epitope vaccines

PDF

The effect of interleukin-7 and C-Kit signaling throughout the ontogeny of naive CD4+ lymphocytes from hematopoietic stem cells to maturity

PDF

The cellular proteins that regulate hepatitis C virus RNA replication

PDF

RNA viruses and cell membrane: Hepatitis C virus and coronavirus

PDF

Mechanistic study of RAG -mediated initiation of V(D)J recombination

PDF

Maturation of dendritic cells induced with IFN-gamma, huCD40LT, and IM862

PDF

Regulation of RNA polymerase I transcription by CK2 and TAF1

PDF

Identification of oncogenes cooperating in murine mammary tumorigenesis and transgenic mouse models of breast cancer

PDF

The androgen receptor: Its role in the development and progression of cancers of the prostate and breast

PDF

Regulation of the I kappa B kinase complex

PDF

The biochemical characterization of activation induced cytidine deaminase

Asset Metadata

Creator Clemens, Farrah Marie (author)

Core Title Molecular and cellular characterization of nickel -induced C3H/10T½ Cl 8 cell transformation

Contributor Digitized by ProQuest (provenance)

Degree Doctor of Philosophy

Degree Program Molecular Microbiology and Immunology

Publisher University of Southern California (original), University of Southern California. Libraries (digital)

Tag biology, cell,biology, molecular,Health Sciences, Toxicology,OAI-PMH Harvest

Language English

Permanent Link (DOI) https://doi.org/10.25549/usctheses-c16-630830

Unique identifier UC11340069

Identifier 3116682.pdf (filename),usctheses-c16-630830 (legacy record id)

Legacy Identifier 3116682.pdf

Dmrecord 630830

Document Type Dissertation

Rights Clemens, Farrah Marie

Type texts

Source University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Access Conditions The author retains rights to his/her dissertation, thesis or other graduate work according to U.S. copyright law. Electronic access is being provided by the USC Libraries in agreement with the au...

Repository Name University of Southern California Digital Library

Repository Location USC Digital Library, University of Southern California, University Park Campus, Los Angeles, California 90089, USA

Molecular and cellular characterization of nickel -induced C3H/10T&frac12; Cl 8 cell transformation

Molecular and cellular characterization of nickel -induced C3H/10T&frac12; Cl 8 cell transformation

Molecular and cellular characterization of nickel -induced C3H/10T½ Cl 8 cell transformation

Molecular and cellular characterization of nickel -induced C3H/10T½ Cl 8 cell transformation