University of Southern California Dissertations and Theses

Expression of the RGR opsin and its function in the photic visual cycle

(USC Thesis Other)

Expression of the RGR opsin and its function in the photic visual cycle

PDF

Download a page range

Download transcript

Copy asset link

Request this asset

Transcript (if available)

Content EXPRESSION OF THE RGR OPSIN AND ITS FUNCTION IN THE PHOTIC VISUAL CYCLE by Mao Yang A Dissertation Presented to the FACULTY OF THE GRADUATE SCHOOL UNIVERSITY OF SOUTHERN CALIFORNIA In Partial Fulfillment of the Requirements of the Degree DOCTOR OF PHILOSOPHY (MOLECULAR MICROBIOLOGY AND IMMUNOLOGY) August 2002 Copyright 2002 Mao Yang Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. UMI Number: 3094391 UMI UMI Microform 3094391 Copyright 2003 by ProQuest Information and Learning Company. All rights reserved. This microform edition is protected against unauthorized copying under Title 17, United States Code. ProQuest Information and Learning Company 300 North Zeeb Road P.O. Box 1346 Ann Arbor, Ml 48106-1346 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. UNIVERSITY OF SOUTHERN CALIFORNIA THE GRADUATE SCHOOL UNIVERSITY PARK LOS ANGELES, CALIFORNIA 90089-1695 This dissertation, written by /V ? Q U O ____________________ under the direction o f h Ld dissertation committee, and approved by all its members, has been presented to and accepted by the Director o f Graduate and Professional Programs, in partial fulfillment o f the requirements fo r the degree o f DOCTOR OF PHILOSOPHY Director A u gu st 6 , 2002 Date_______________________ Dissertation Committee Chair Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Acknowledgements I would like to thank my mentor, Dr. Henry K. W. Fong, for his support and guidance to finish my dissertation. It is fortunate of me to have Dr. Fong guide me into the world of scientific research and scientific writing. I also would like to thank my dissertation advisory committee, Drs. Michael Lai, Michael Lieber, Michael Stallcup, and Stanley Tahara, for their time and efforts to help me through the graduate study. My special thanks go to all my teachers whose knowledge and dedication are indispensable to my achievements. I also appreciate the support and sharing from all the members in Dr. Fong’s laboratory and friends in the University of Southern California. I am most grateful to all of my family for their support and encouragement. All of my achievements would be meaningless and impossible without their participation and satisfaction. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Table of Contents Acknowledgement................................................................................................................ii List of Tables......................................................................................................................viii List of Figures....................................................................................................................... ix Abstract.................................................................................................................................xii Chapter 1. Introduction to Vertebrate Eye and the Visual Process................................1 1-1. Anatomy of the Human Eye..........................................................................1 1-2. The Retina....................................................................................................... 1 1-3. TheR PE ..........................................................................................................7 1-4. Phototransduction and the Visual Cycle.....................................................8 1-5. The RGR Opsin............................................................................................ 17 1-6. The Goals of the Project..............................................................................21 Chapter 2 Development of Cell Culture Model for the Visual Cycle...........................25 2-1. Introduction.................................................................................................. 25 2-2. Experimental Procedures............................................................................27 2-2-1. Plasmid Constructs....................................................................... 27 2-2-2. Cell Culture................................................................................... 27 2-2-3. DNA Transfection in Cultured Cells..........................................28 2-2-4. Preparation of Lentivirus..............................................................30 2-2-5. Transduction of Cells with Lentivirus........................................30 2-2-6. Immunohistochemistry..................................................................31 iii Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 2-2-7. Preparation of Cell Membranes...................................................31 2-2-8. Western Blot Assay....................................................................... 32 2-2-9. Preparation of [3 H]all-trara,-Retinal............................................ 33 2-2-10. Binding of [3 H]all-Znms,-Retinal to RGR................................. 33 2-2-11. Light-absorbing Properties of the Recombinant RGR Protein.................................................................................. 34 2-3. Results............................................................................................................ 35 2-3-1. Expression of RGR by DNA Transfection................................ 35 2-3-2. Expression of RGR by Lentivirus Transduction....................... 36 2-3-3. Binding of all-trans-Retinal to the Recombinant RGR.............39 2-3-4. Light-absorbing Properties of the Recombinant RGR Protein................................................................................. 40 2-4. Discussion.................................................................................................... 41 Chapter 3 The Photic Visual Cycle in the RPE Cells.....................................................46 3-1. Introduction.................................................................................................. 46 3-2. Experimental Procedures............................................................................ 48 3-2-1. Materials..........................................................................................48 3-2-2. Cell Culture.................................................................................... 49 3-2-3. Incubation of Cultured Cells with [^HJall-trans-Retinol and Analysis of Radiolabeled Proteins......................................49 3-2-4. Isolation of Bovine RPE Cells and Incubation with [^EQall-trans-Retinol.......................................................... 50 3-2-5. Extraction of Retinoids from RPE Cells or Membranes.......... 51 3-2-6. HPLC Analysis of Retinoids........................................................ 52 iv Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 3-2-7. Preparation of Cell Membranes...................................................54 3-2-8. Retinol Dehydrogenase Assay.....................................................55 3-2-9. Cell-free Synthesis and Binding of all-trans-Retinal to RGR in vitro.............................................................................56 3-2-10. Western Blot Assay..................................................................... 56 3-2-11. (3,P-Carotene-15’,15’-dioxygenase Assay............................... 57 3-2-12. Photoisomerization of RGR-bound all-trans-Retinal in ARPE-hRGR Cells..................................................................57 3-2-13. Photoisomerization of RGR-bound all-trans-Retinal in the Freshly isolated Bovine RPE Cells................................. 58 3-2-14. Reduction of the Endogenous RGR-bound 11-cis-Retinal by the Bovine RPE Membranes........................59 3-3. Results............................................................................................................ 60 3-3-1. Uptake and Binding of [3H]Retinoid to RGR in ARPE-hRGR Cells..................................................................60 3-3-2. Synthesis of all-trans-Retinal in Cultured ARPE-hRGR Cells...................................................................... 63 3-3-3. Photoisomerization of all-trans-Retinal Bound to RGR in ARPE-hRGR Cells.......................................67 3-3-4. all-trans-Retinol Dehydrogenase Activity in ARPE-hRGR Cells...................................................................... 68 3-3-5. Uptake and Binding of [3 H]Retinoid to RGR in Isolated Bovine RPE Cells.....................................................71 3-3-6. P,P-Carotene as the Source of all-trans-Retinal.........................71 3-3-7. Cell-free Synthesis and Binding of all-trans-Retinal to RGR in vitro.............................................................................73 V Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 3-3-8. Photoisimerization of RGR-bound all-trans-Retinal in the Bovine RPE Cells..............................................................75 3-3-9. Reduction of 11-cis-Retinal after Generation from RGR-mediated Photoisomerization................................. 75 3-3-10. Transfer of 11-cis-Retinal from RGR to CRALBP after Photoisomerization........................................... 78 3-4. Discussion......................................................................................................82 Chapter 4 The RGR-d Protein in the Pathogenesis of RPE........................................... 90 4-1. Introduction.....................................................................................................90 4-2. Experimental Procedures............................................................................... 91 4-2-1. RNA Extraction..............................................................................91 4-2-2. Reverse Transcription and Polymerase-chain Reaction........... 91 4-2-3. Western Blot to Detect RGR-d in Human Donor Retina 91 4-2-4. Plasmid Constructs........................................................................ 93 4-2-5. Transfection of pcDNA3-hRGR and pcDNA3-RGRd in Mammalian Cells..................................................................... 93 4-2-6. A Transgenic Mouse Expressing RGR-d................................... 93 4-3. Results............................................................................................................. 95 4-3-1. Alternative Splicing of the Mouse RGR Gene Transcription...................................................................... 95 4-3-2. Prevalence of the RGR-d Variant in Human Retina.................95 4-3-3. RGR-d Protein in Cultured Cells................................................ 97 4-3-4. The Experimental Mouse Models to Study the Pathogenesis of RGR-d................................................................99 4-4. Discussion.....................................................................................................100 vi Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Chapter 5 The Promoter of RGR Gene...........................................................................103 5-1. Introduction...................................................................................................103 5-2. Experimental Procedures............................................................................. 104 5-2-1. Cell Culture and Induction of RGR Expression in ARPE-19 Cells.......................................................................104 5-2-2. DNA Sequencing and Analysis..................................................104 5-2-3. Transgenic Mouse A , 13-2............................................................104 5-2-4. Western Blot................................................................................ 105 5-3. Results............................................................................................................105 5-3-1. Induction of RGR Expression in ARPE-19 Cells................... 105 5-3-2. Analysis of the Proximal Promoter Region of Human and Mouse RGR Genes.......................................... 107 5-3-3. Transgenic Mouse Expression................................................... 107 5-4. Discussion..................................................................................................... 110 Chapter 6 Conclusion....................................................................................................... 113 References..........................................................................................................................119 vii Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. List of Tables TABLE 2-1. Transduction efficiency of human RGR lentiviral vector toward ARPE-19 and COS-7 cells.....................................................................................38 Table 3-1. The all-/r<mv-retinol dehydrogenase activities in ARPE-19, ARPE- hRGR, and the RGR protein complex purified from bovine RPE cells......... 69 viii Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. List of Figures FIG. 1-1. Anatomy of the human eye................................................................................ 2 FIG. 1-2. The multi-layered structure of human retina....................................................4 FIG. 1-3. Diagram of the human rod photoreceptor cell.................................................6 FIG. 1-4. Human retinal pigment epithelium (RPE)....................................................... 6 FIG. 1-5. The phototransduction cascade........................................................................10 FIG. 1-6. The chromophore of the visual pigments and its derivatives in the vision process................................................................................................11 FIG. 1-7. Models of the visual cycle............................................................................... 15 FIG. 1-8. Human RGR gene, transcription, and protein products................................18 FIG. 2-1. HIV pro virus and the three-plasmid expression system used to generate the pseudotyped HIV-based recombinant lentivirus..................... 26 FIG. 2-2. Diagrammatic structure of the constructs used for the expression of human RGR, RGR-d or bovine RGR.............................29 FIG. 2-3. Expression of RGR protein in COS-7 and ARPE-19 cells..........................35 FIG. 2-4. Time course of the expression of human RGR protein in COS-7, ARPE-19, and primary mouse RPE cells in culture....................... 37 FIG. 2-5. Immunohistochemical staining of lentivirus-transduced ARPE-19 and COS-7 cells.................................................................................... 38 FIG. 2-6. Binding of [3 H]all-trans-retinal to the recombinant human RGR...............39 FIG. 2-7. Absorption spectra of the transduced and non-transduced ARPE-19 cells.................................................................................... 40 FIG 3-1. The retinoid standards........................................................................................53 FIG 3-2. Uptake and incorporation of [3 H]all-trans-retinol into the chromophore of RGR.......................................................................................61 ix Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. FIG 3-3. Specific binding of [3 H]retinoid to RGR in cultured ARPE-hRGR cells..............................................................................62 FIG. 3-4. Labeling of RGR in ARPE-hRGR cells incubated with [3H]all-trans-retinol.......................................................................................62 FIG. 3-5. [3 H]-Retinoids extracted from cultured ARPE-hRGR and ARPE-19 cells................................................................................................. 64 FIG. 3-6. Endogenous all-trans-retinal in cultured ARPE-hRGR cells...................... 65 FIG. 3-7. Photoisomerization of the all-trans-retinal bound to RGR in ARPE-hRGR cells................................................................................................. 66 FIG. 3-8. all-trans-Retinol dehydrogenase activity in ARPE-hRGR microsomal membranes................................................................68 FIG. 3-9. Incorporation of precursor [3H]all-trans-retinol into the chromophore of RGR in bovine RPE cells...................................................70 FIG 3-10. Utilization of (3,p-carotene by ARPE-hRGR cells to generate all-trans-retinal........................................................................................72 FIG. 3-11. Linkage of synthesis and binding of all-trans-retinal to RGR in vitro.. .73 FIG. 3-12. Photoisomerization of all-trans-retinal to 11 -cis-retinal in the freshly-isolated bovine RPE cells..............................................................74 FIG. 3-13: Retinal and retinol contents in bovine RPE cells after blue light illumination.................................................................................. 76 FIG. 3-14. Retinyl ester contents in bovine RPE cells after blue light illumination.................................................................................. 79 FIG. 3-15. NADH promoted the reduction of 11-cis-retinal in bovine RPE membrane......................................................................................80 FIG. 3-16. Distribution of retinals between the membrane fraction and the soluble fraction o f the bovine RPE cells............................................................81 FIG. 3-17. Proposed model of the photic visual cycle and interaction of retinol dehydrogenases with the chromophore of RGR.............................. 89 FIG. 4-1. The antibodies used to detect human RGR and RGR-d..............................92 x Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. FIG. 4-2. The pCAT-RGRd construct used to generate the RGR-d transgenic mouse................................................................94 FIG. 4-3. The detection of mouse RGR-d mRNA........................................................96 FIG. 4-4. RGR-d protein in human donor retina..........................................................97 FIG. 4-5. Expression of RGR-d in COS-7 cells by transient transfection................ 98 FIG. 4-6. Kinetics of RGR and RGR-d expression in COS-7 cells........................... 99 FIG. 5-1. The 7,13-2 clone of human RGR gene........................................................ 105 FIG. 5-2. No expression of RGR in the ARPE-19 cells after induction with all-trans-retinol or bovine retina homogenate......................................... 106 FIG. 5-3. The conserved sequences of the human and mouse RGR promoters.... 108 FIG. 5-4. Expression of human RGR in the transgenic mouse containing the RGR genomic clone 7,13-2...................................................... 109 xi Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Abstract The retinal pigment epithelium (RPE) expresses an abundant opsin, the RPE retinal G protein-coupled receptor (RGR). RGR is involved in the visual cycle under photic conditions. We transduced ARPE-19 cells with recombinant lentivirus containing human RGR cDNA under the control of CMV promoter to generate a human RPE cell line, ARPE-hRGR. ARPE-hRGR cells permanently expressed human RGR. The recombinant RGR comigrated with native RGR in SDS-PAGE and bound all-/ram-retinal in vitro. ARPE-hRGR cells incorporated all-trara-retinol from culture medium. Intact ARPE-hRGR cells and the isolated microsomal membranes oxidized all-fram-retinol to all-Pvms-retinal. The synthesized all-trara-retinal specifically bound RGR. Oxidation was catalyzed by a proposed novel membrane-bound all-fr<mv-retinol dehydrogenase. This all-/ram-retinol dehydrogenase preferred NADP cofactor and catalyzed oxidation of all-traw-retinol but not 1 l-c/.v-retinol. Oxidation of all-trans- retinol and subsequent binding of all-trara-retinal to RGR were also demonstrated in intact freshly-isolated bovine RPE cells and the purified microsomal membranes. RGR-bound all-fnms'-retinal was specifically isomerized to 11 -c/.v-retinal upon illumination in intact ARPE-hRGR cells and bovine RPE cells. Under experimental conditions, 11 -cis-retinal was not further reduced to 11 -c/.s-retinol or esterified to 11-cA-retinyl palmitate. 1 l-cfs-Retinal was not transferred from RGR to cellular retinaldehyde-binding protein (CRALBP). NADH stimulated reduction of xii Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 11 -cis -retinal in membranes of the bovine RPE cells, indicating that freshly-isolated bovine RPE cells might lack certain factors, including NADH. Transcription of human RGR gene produces full-length RGR mRNA and RGR-d mRNA that lacks sequences encoding exon 6. We failed to detect RGR-d protein in human retina by Western blot due to tissue degradation and poor antibody specificity. RGR-d protein was expressed in COS-7 cells using DNA transfection. Expression o f RGR-d negatively affected the viability of COS-7 cells. We failed to express RGR-d in a transgenic mouse despite high copy number of the transgene. The 5’ upstream regions of human and mouse RGR genes were sequenced to identify homologous regions. A 0.5-kb 5’-upstream fragment of the human RGR gene directed RPE-specific expression of human RGR in a transgenic mouse. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. CHAPTER 1 INTRODUCTION TO VERTEBRATE EYE AND THE VISUAL PROCESS 1 -1. ANATOMY OF THE HUMAN EYE The human eye is a multi-chambered, nearly spherical structure (Fig. 1-1). The globe of the eye has three main layers. The outer supporting layer consists of transparent cornea in the anterior, and opaque, collagenous sclera in the posterior five sixths of the eye. The middle layer, also called uvea, consists of choroids, ciliary body, and the iris, which contains a central opening called pupil. The inner layer is the retina, which includes sensory retina and the retinal pigment epithelium. The eye encloses three chambers: the vitreous chamber, the posterior chamber, and the anterior chamber. Light goes into the eye through transparent cornea, passes the aqueous humor in the anterior and posterior chambers, the lens and the vitreous body in the vitreous chamber, and reaches the sensory retina (Newell 1986). 1-2. THE RETINA The retina consists of outer layer, the retinal pigment epithelium (RPE), and inner layer, the sensory retina (Newell 1986, Roof 1994). RPE is a monolayer of cells while the sensory retina is stratified into several layers (Fig. 1-2). From Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. FIG. 1-1. Anatomy of the human eye. The human eye is a three-layer, three- chamber globe. Light passes through the cornea, the pupil, the lens, and the vitreous body before it reaches retina. The visual signal formed in the retina upon light stimulation is transmitted to the brain through optic nerve (modified from Newell, 1986). Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. the outside inward, these layers of the sensory retina are: 1) the outer segment layer of photoreceptors, 2) the inner segment layer of photoreceptors, 3) the external limiting membrane, 4) the outer nuclear layer, 5) the outer plexiform layer, 6) the inner nuclear layer, 7) the inner plexiform layer, 8) the ganglion cell layer, 9) the optic fiber layer, and 10) the inner limiting membrane. Different types of cells, including at least six types of neurons and two types of glial elements, form the layers of sensory retina. These cells include photoreceptors in the outer nuclear layer; modulator (including horizontal, bipolar, and amacrine cells) and interplexiform cells in the inner nuclear layer; and ganglion cells in the ganglion cell layer. Synapses between photoreceptor, horizontal, and bipolar cells form the outer plexiform layer. Synapses between bipolar, amacrine and ganglion cells form the inner plexiform layer. Interplexiform cells provide a pathway to transfer signals from the outer to the inner plexiform layer. The axons of the ganglion cells leave the retina to form optic nerve fibers (Newell 1986). Muller cells and other types of cells in the retina could mechanically support the retina, and modulate neuronal activities within the retina by regulating the extracellular concentration of neuronactive substances such as K+, H+, and glutamate (Newman 1996). The photoreceptors, including rods and cones, are the light-sensitive cells of the retina (Fig. 1-3). Rods and cones have different sensitivities to light. The rods function for the perception of motion and monochromatic vision at low levels of illumination. The cones function at medium and high levels of illumination, and mediate color vision. Three types of cones, the red, green, and blue cones, are 3 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. present in human retina. Human retina contains about 5 million cones and 100 million rods per eye (Masland 1994). Cones are the only photoreceptors in the fovea at the near center o f the retina (100,000-234,000 cones/mm2 ), which is responsible for the maximal visual resolution due to the highest density of cones and the modulator cells. The density of cones decreases gradually from the center to the periphery retina, where rods become the major photoreceptors (Masland 1994). U i VI ILM OFL G IPL OPL SM B m m m -MONL ■^ELM Fig. 1-2. The multi-layered structure of human retina. Choroids (CH) and vitreous (VI) are also shown. The arrows represent the incoming light. RPE, retinal pigment epithelium; OS, the outer segments of photoreceptors; IS, the inner segments of photoreceptors; ELM, external limiting membrane; ONL, outer nuclear layer; OPL, outer plexiform layer; INL, inner nuclear layer; IPL, inner plexiform layer; G, ganglion cell layer; OFL, optic fiber layer; and ILM, inner limiting membrane. (Modified from Newell, 1986). 4 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. The cones and rods are elongated and can be divided into outer segment and inner segment. The rod outer segment (ROS) and cone outer segment (COS) consist of a dense vertical stack of about 700-1,000 flattened sacs or disks that originate from the plasma membrane. Although ROS and COS differ in shape and disc arrangement, both contain high concentrations of the light-capturing proteins called the visual pigments (Newell 1986). The outer segment of the photoreceptors is continuously renewed. This process involves the synthesis and assembly of the new proteins into the well-organized stacks of disks, and the degradation of the older disk membranes at the tip of the outer segment (Roof 1994). The inner segment layer of the photoreceptors contains the ellipsoid (mainly mitochondria) near the outer segment, the myoid (mainly endoplasmic reticulum and the Golgi body) close to the nucleus, the nucleus, and the inner fiber that forms synapses with the modulator cells (Fig. 1-3). The visual pigments in human retina include rhodopsin in the rods and the red, green, and blue opsins in the cones. All rods contain rhodopsin, and each cone cell contains one of the three cone opsins (red, green, and blue), thus determining the types of cones. The visual pigments contain 11-cA-retinal as the light-absorbing molecule (chromophore) and respective apoproteins (opsin) (Saari 1994). The opsins belong to the family of G protein-coupled receptors with seven transmembrane domains, and are the major proteins in the outer segments. Rhodopsin comprises more than 50% of the total protein in the ROS and 90% in the discs (Hargrave 1992). It binds to 11-cA-retinal via a protonated Schiff base bond 5 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. between the aldehyde group of the retinal and the s-amino group of lysine2 9 6 that is buried in the hydrophobic portion of the lipid bilayer (Hargrave 1992). 8 b O < o t/a U t & 3 o -Discs ! f > — ~ "» 8 a t/a J - H (-/ ^ -Nucleus I f * Synaptic . term[na| Outer segments i.i - i f r - » M icrovilli i f i S r Bruch layer Choriocapillaries s jM . y Fig. 1-3. Diagram of the human rod photoreceptor cell. The light- capturing visual pigments are located in the discs of the outer segment. The cellular organelles and nucleus are in the inner segment. The synaptic terminal transmits the visual signal to the modulator cells (modified from Roof, 1994). Fig. 1-4. Human retinal pigment epithelium (RPE). RPE cells contain abundant melanins. The apical side of the RPE has specialized plasma membrane called microvili embedding the tip of the outer segments of photoreceptors. The basal side of the RPE is in contact with the choroidal circulation through Bruch layer (Modified from Newell, 1986). 6 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 1-3. THE RPE The retinal pigment epithelium (RPE) is a monolayer of hexagonal-shaped cells adjacent to the sensory retina (Newell 1986). On the basal side of the RPE, the plasma membrane is firmly attached to the Bruch membrane of the choroid. On the apical side, the RPE membrane forms special microvilli that enmesh the outer segments of the photoreceptors (Fig. 1-4). The RPE monolayer segregates the retina from the choroids, thus constitutes part of the blood-retina barrier by regulating the transport of substances between retina and the choroidal circulation. RPE is essential in the function and survival of the retina more than just as blood-retina barrier. The outer segments of the photoreceptors are continuously renewed (Roof 1994). For example, human rod outer segments of photoreceptors are completely replaced about every 10 days. RPE participates in the photoreceptor renewal process by phagocytosing the debris and metabolic waste of the photoreceptors. Defects in phagocytosis, such as caused by a receptor tyrosine kinase (mertk) gene mutation in the RPE of the RCS rat, result in retinal degeneration (D’Cruz 2000). The RPE cells contain varying amount of melanin, which absorbs the scattered light. RPE is also the place where alf/ram -retinal is converted into 1 l-c/s-retinal. This conversion is an essential step in regeneration of 11-cw-retinal and visual pigments in the visual cycle (Roof 1994). RPE cells have been cultured to study the function of RPE and for transplantation to treat several retinal dystrophies (Flannery 1990, Timmers 1990, 7 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Lund 2001). Primary RPE cultures have been shown to retain many physiological properties of the RPE cells, including the ability to transport retinoids, phagocytose the rod outer segment, and synthesize melanin pigment (Dunn 1996, and references therein). However, primary RPE cultures are usually heterogeneous and vary from preparation to preparation. After multiple passages, RPE cells often lose the highly differentiated properties (Dunn 1996). A few RPE cell lines are available. One of them, ARPE-19, is a spontaneously arisen human RPE cell line with normal karyotype. The ARPE-19 cells can form polarized epithelium monolayer on porous filter support. These cells synthesize visible amounts of melanins if left as stationary cell culture in confluence for weeks. ARPE-19 cell culture also keeps the typical “cobblestone-like” RPE morphology as seen in vivo and in primary cell cultures. Expression of two RPE-specific genes, RPE65 and CRALBP was demonstrated by Northern blot assay (Dunn 1996). 1-4. PHOTOTRANSDUCTION AND THE VISUAL CYCLE The visual process is initiated in the outer segments of the photoreceptors (Stryer 1995). The rods are very sensitive to dim flashes of light. Even a single photon per cell can trigger the rod response. Upon illumination, rods and cones follow a similar, although not identical phototransduction pathway to convert the light into electrical signal (Saari 1994). The rod response in mammalian species has 8 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. been extensively studied and many of the proteins involved in the rod phototransduction have been identified (Sarri 1994, McBee 2001). The phototransduction is initiated by the excitation of the visual pigments (Fig. 1-5). Upon absorption of a single photon, the 11 -cis-retinal chromophore of the rhodopsin (Rho) undergoes a conformational change to all-tram-retinal (Fig. 1-6). Isomerization of the chromophore triggers a sequence of changes in the secondary and tertiary structures of the rhodopsin. The activated rhodopsin (Rho*) then binds and activates the transducin (T). The activation of transducin consists of the exchange of GDP for GTP binding to transducin, which is catalyzed by Rho*. The binding of GTP to transducin releases its a subunit (Ta) from the inhibitory Py subunits (Tpy ). The Ta in return activates the cGMP phosphodiesterase (PDE) by removing the two inhibitory y subunits of the PDE from the a p catalytic subunits. The activation of PDE results in rapid hydrolysis of the intracellular cGMP messenger. The intracellular concentration of cGMP within the ROS regulates the activity of cGMP-gated ion channel, which is an integral membrane protein in the plasma membrane of the ROS. Under dark conditions, the cGMP-gated ion channel remains open, while the Na+ /Ca2+ -K+ exchanger is active. After illumination, the decrease of the concentration of cGMP leads to closure of the cGMP-gated channel, thus stopping the influx of extracellular cations (mainly Na+ and Ca2+ ) into the ROS. Photoisomerization of a single rhodopsin molecule can result in the closure of about 300 cGMP-gated channels (Roof 1994). On the other hand, the Na+ /Ca2+ -K+ exchanger remains active in the illuminated conditions, which continuously pumps 9 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 2* f • out the Ca ion. The closure of the cGMP-gated ion channel thus leads to the hyperpolarization of the ROS plasma membrane. This hyperpolarization represents the initial electrical response to the light stimulus (Roof 1994, Stryer 1995). Rho Rho kinase Rho*-P T-GDP \ PDEi-TcrGDP cGMP l ^ P GDP PDE*-Ta-GTP GTP \ Rho*-T-GTP 5'-GMP PDEi Ta-GTP Tpy FIG. 1-5. The phototransduction cascade. Light activates the rhodopsin (Rho) and triggers the phototransduction cascade. The activated rhodopsin (Rho*) binds and activates transducin (T) by promoting the exchange of GDP for GTP to bind to the a subunit of transducin (Ta). Ta activates the cGMP phosphodiesterase (PDE) from the inhibited state (PDEi) to activated state (PDE*). PDE* catalyzes the hydrolysis of the cGMP. Decrease of the intracellular cGMP concentration closes the cGMP-gated channel. The phototransduction cascade is deactivated through the following mechanisms: 1) the deactivation of Rho* by the Rho kinase-catalyzed phosphorylation and binding to arrestin; 2) the intrinsic GTPase activity of Ta; and 3) synthesis of cGMP by guanylate cyclase (G-cyclase). The flow of retinoids in the phototransduction is not shown here (Modified from Stryer, 1995). The desensitization of the photoactivated visual system is achieved by several mechanisms (Fig. 1-5). First, the activated rhodopsin is phosphorylated in the carboxyl terminal by the rhodopsin kinase. Phosphorylation inactivates the rhodopsin and facilitates the binding of the inhibitory arrestin. Second, the a subunit 10 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. of transducin, like other G-proteins, has intrinsic GTPase activity. The hydrolysis of GTP to GDP on the a subunit restores the binding to the py subunits and inactivates Ta. The GTPase activity of the T a can be enhanced by the RGS9-1, which is a member of the family o f the regulators of G protein signaling. The deactivation of T a returns the activated PDE (PDE*) to its inactive state (PDEi). Third, the intracellular cGMP level is restored by guanylate cyclase (G-cyclase), probably through the calcium-dependent feedback regulation (Roof 1994, Stryer 1995). Fig. 1-6. The chromophore of the visual pigments and its derivatives in the vision process. Visual pigments in the retina utilize 11-cz.v-retinal as the light- absorbing molecule. Light stimulates the isomerization of 11-cw-retinal to the all- trans-retinal. The all-fr<ms'-rctinal is reduced to all-tram-retinol and transported to the adjacent RPE for processing (the visual cycle). (Modified from Roof, 1994) 11 -civ-retinal H,C c H . 3 CH , C ✓ \ O H all-fram-retinal all-mms-retinol HjC Cl I, CH, CH, 11 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Returning the photoreceptors to preillumination state also requires regeneration of the visual pigments (Fig. 1-7). This so-called visual cycle or retinoid cycle involves both photoreceptors and RPE, and occurs with a time constant of about 400 seconds in human (Saari 1994, McBee 2001). While little is known about the regeneration of cone pigments, rhodopsin regeneration has been subject to extensive studies and will be reviewed here. In ROS, photoactivation of the rhodopsin generates all-fram-retinal from 11- c/s-retinal. all-fram- -Retinal is first reduced to all-/r<mv-retinol by the photoreceptor retinol dehydrogenase (prRDH) (Rattner 2000). It is unclear whether the prRDH acts on the rhodopsin-bound all-tram-retinal thus facilitating its release from the opsin, or the all-P'cms-retinal is released by a yet unknown mechanism and then reduced by prRDH (McBee 2001). The trafficking of all-/r<mv-retinol within the rod outer segment is poorly understood and could be a passive diffusion process or carrier-mediated involving the ABCR/Rim protein. The ABCR/Rim protein belongs to the ATP-binding cassette (ABC) transporter family (Weng 1999). Most of the ABC transporters are involved in the ATP-dependent translocation of specific substrate across cellular membranes. The ABCR/Rim protein could function as a “flippase” to transport all-/ram-retinal from the intradiscal space to the cytosol of ROS (Weng 1999). The all-/r<mv-retinol is then transported to the RPE, possibly through diffusion or the interphotoreceptor retinoid-binding protein (IRBP)-mediated trafficking in intercellular space between ROS and RPE (McBee 2001). 12 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Isomerization of all-/r<mv-retinol in the RPE is the key reaction in the visual cycle. The first breakthrough came 15 years ago when Rando and colleagues identified an isomerization activity in extracts from frog RPE that produced 11 -cis- retinol from the added all-frara-retinol precursor in the dark (Bernstein 1987). Further studies led up to an isomerohydrolase model (Fig. 1-7), in which all-trans- retinol is first esterified to form retinyl ester, catalyzed by lecithin:retinol acyltransferase (LRAT) (Saari 1988, Saari 1989, Shi 1993). The ester is then hydrolyzed and isomerized to produce 11-cw-retinol by the proposed isomerohydrolase. The coupling of the hydrolysis and isomerization supposedly provides energy for the energetically unfavorable isomerization reaction (Rando 1992). The 11-m-retinol is then oxidized to 11 -cz'v-retinal by 11-c/.v-retinol dehydrogenase (McBee 2001). This isomerohydrolase model, however, has been challenged recently, especially because the putative isomerohydrolase has not been purified nor has its gene been cloned (Stecher 1999, McBee 2001). A second model was proposed in which the isomerization occurs through an anhydro-like carbocation intermediate from all-tnms-retinol to 11 -c/.v-retinol (McBee 2000). It is not clear which enzyme catalyzes this process in vivo. Removal of 11-cE-retinol by cellular retinaldehyde-binding protein (CRALBP) was proposed to drive the isomerization by mass action (McBee 2000). The problems with both models include the failure to purify the enzymatic activity or to identify the responsible gene, and the low activity to produce enough 11 -cw-retinal for the regeneration of rhodopsin in vivo. 13 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Many questions remain unanswered as to the final stages in the visual cycle, that is, the transfer of the 1 l-czT-retinoid back to the photoreceptor and binding to respective opsins to form visual pigments. First, is it the 1 l-c/.y-retinal or 11 -c/.v- retinol that is transported to the photoreceptors? It is generally accepted that 11-cis- retinal is released from the RPE to regenerate rhodopsin in mammalian rods. Evidence supporting this notion include: (1) mammalian rods cannot utilize exogenous 1 1-czT-retinol to regenerate rhodopsin (Saari 1994, and references therein); (2) cultured bovine RPE cells can release 11-cw-retinal (Carlson 1992); and (3) no 11 -c/T-retinol dehydrogenase has been identified in mammalian rods, thus making 11-ds-retinol useless. However, it is noteworthy that mammalian cones and amphibian rods can utilize 11-cw-retinol to regenerate visual pigments (Saari 1994). Second, similar to the transport of all-/r<mv-retinol from the photoreceptors to the RPE, how is the 11-c/y-retinoid (retinal or retinol) transported from RPE to the photoreceptors? Is it a process mediated by IRBP or just a diffusion-limited process as driven by mass action? Is there a specific receptor involved on the cell surface? Third, how does the 11-cw-retinal recombine with the opsin to regenerate functional visual pigments? To bind to 11 -cw-retinal, the opsin must be dephosphorylated from its inactive, phosphorylated form. The presence of 11-cw-retinal could be a likely signal to trigger this dephosphorylation, as suggested in a recent observation (Krzysztof Palczewski, personal communication). Regardless of the models proposed in the past, many proteins in the RPE have been shown to play essential roles in the isomerization and metabolism of all- 14 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. ^ _ p 0| Carbocation intermediate t-RE c-Ral c-RAL t-RAL FIG. 1-7. Models of the visual cycle. Light triggers the isomerization of the rhodopsin-bound 1 l-cA-retinal (c-Ral) to all-/nms-retinal (t-Ral) in the photoreceptors. t-Ral dissociates from rhodopsin and is reduced to all-/r<ms-retinol (t-Rol), catalyzed by the photoreceptor retinol dehydrogenase (prRDH). In RPE, t- Rol could form all-iram-retinyl ester (t-RE), catalyzed by the potent lecithin:retinol acyltransferase (LRAT). t-RE could be hydrolyzed to t-Rol, catalyzed by the retinyl ester hydrolase (REH), or be hydrolyzed and simultaneously isomerized to 11-cis- retinol (c-Rol), catalyzed by the proposed isomerohydrolase. Alternatively, t-Rol could be isomerized to c-Rol through a carbocation intermediate. The c-Rol product could be stored as 11 -cA-retinyl ester (c-RE), or oxidized to c-Ral catalyzed by the 11-cis-retinol dehydrogenase (cRDH). c-Ral is then transported to then photoreceptors to bind opsin. tram'-retinol in the RPE. These proteins include cellular retinol-binding proteins (CRBP), cellular retinaldehyde-binding protein (CRALBP), lecithin:retinol acyltransferase (LRAT), 11 -cA-retinol dehydrogenase (cRDH), RPE65, as well as the RGR opsin (Saari 1994, McBee 2001). 15 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. CRBP type I is a 15 kDa soluble protein expressed in RPE and Muller cells (CRBP type II is expressed mainly in intestinal mucosa, not in the visual system) (Napoli 2000, McBee 2001). CRBP has high affinity for all-/r<my-retinol (Kd = 0.1 nM), and lower affinity for all-fraw-retinal (Kd = 10 nM). CRBP could function as the chaperone of all-!r<mv-retinol. It enables carrier-mediated transport of the water- insoluble retinol in the aqueous cellular environment. All-tram-retinol within the binding pocket of CRBP is protected from non-specific oxidation (Napoli 2000). CRALBP is a soluble protein of about 36 kDa. Its expression in the retina is confined to RPE and Muller cells, and is also found in tissues outside of retina (Crabb 1988). This protein binds 11 -cis- or 9-clv-retinal, but not all-trans- nor 13- cA-retinal. The binding property of CRALBP suggests that it could drive the isomerization reaction by removing the 11 -cis product, or function as the carrier of 11-cA-retinoids in the RPE (McBee 2001). LRAT is a membrane protein of about 25 kDa found in many tissues including RPE (Ruiz 1999). LRAT can esterify both all-trans- and 11-cA-retinol, and all-trara-retinol bound to CRBP could be the physiological substrate for LRAT (Napoli 2000). The esterification and hydrolysis could maintain the equilibrium between retinyl ester and retinol, and thus readily mobilize retinol from ester storage (McBee 2001). A retinyl ester hydrolase activity (REH) might exist independently of LRAT to catalyze the retinyl ester hydrolysis (McBee 2001). The 11-cA-retinol dehydrogenase activity (cRDH) is associated with membranes in RPE (Lion 1975, Zimmerman 1975, Zimmerman 1976). This enzyme 16 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. activity is 1 0 times more active in oxidizing 11 -cA-retinol than all-/nmv-retinol (Lion 1975). It uses either NAD or NADP as cofactor. A later study indicated that several genes encode proteins that have 1 1 -cw-retinol dehydrogenase activity in the RPE (McBee 2001). One such gene, RDH5, encodes a 35 kDa membrane protein which belongs to the short-chain alcohol dehydrogenase family and uses only NAD as cofactor (Simon 1995). RPE65 is an abundant RPE membrane protein with a molecular mass of about 65 kDa. RPE65 plays an essential role in the retinoid metabolism of the RPE, although its function remains unknown (Redmond 1998). Mutations in RPE65 gene have been identified in patients with Leber congenital amaurosis, autosomal recessive childhood-onset severe retinal dystrophy, and autosomal recessive retinitis pigmentosa (McBee 2001). Mouse with RPE65 gene knockout over-accumulates the all-/r<mv-retinyl esters, and lacks the ability to produce 1 l-c/.v-retinoids for rod functioning (Redmond 1998). 1-5. THE RGR OPSIN The RPE-retina G protein-coupled receptor (RGR) is an RPE and Muller cell- specific protein (Jiang 1993). The gene that encodes RGR protein is located on chromosome 10q23 in human (Chen 1996). Both human and mouse RGR genes are split into seven exons (Fig. 1-8 A), each of which contains part of the protein-coding region (Shen 1994, Tao 1998). 17 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Transcription of human RGR gene gives rise to two major transcripts (Figs. 1-8B, 1-8C). The dominant transcript is about 1.5-kb in length and contains all the seven exons. A second transcript, designated RGR-d, contains a deletion of 114 nucleotides that corresponds precisely to exon 6 of the human RGR gene (Jiang 1995). In a human retinal cDNA library, about 44% of the clones hybridized with the RGR probe were found to be RGR-d. By reverse-transcription polymerase chain reaction (RT-PCR), RGR-d variant was detected in all retina mRNA samples from eight donors (Jiang 1995). A B C c u n D NH.2 A /fv.A NH2 B V 7 D E 777 COOH B \7 c COOH D V 7 E D V F[G. 1-8. Human RGR gene, transcription, and protein products. (A) The structure of human RGR gene. The exons are represented as solid boxes. The transcription initiation site is marked by an arrow. (B) and (C): RGR mRNA transcripts in human RPE. RGR mRNA (B) contains all the seven exons, while RGR-d (C) lacks exon 6 . The shadowed region represents the coding sequence. (D) Schematic representation of RGR and RGR-d proteins. The putative transmembrane domains are depicted by the rectangles A-G. Arrows indicates the approximate boundary of domain F, which is encoded by exon 6 (Shen 1994, Jiang 1995). 18 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. The full-length, 1.5-kb RGR transcript encodes the 32-kd RGR protein in human, bovine, and mouse (Jiang 1993, Shen 1994). The protein is homologous in amino acid sequence to the G protein-coupled receptors with seven transmembrane domains (Fig. 1-8D). The putative seven domains in RGR protein correspond to the seven exons of the RGR gene. The RGR-d transcript of human RGR gene encodes a 28-kDa protein (Fig. 1- 8 D). The deletion of exon 6 results in an in-frame deletion of the entire putative sixth transmembrane domain (Jiang 1995). While RGR-d mRNA has been identified in almost all the donor retina mRNA samples, RGR-d protein is less abundant and not every one of the donor RPE samples contains RGR-d protein (Jiang 1995). Because of the drastic deletion of the sixth transmembrane domain, the RGR-d protein is predicted to have a different transmembrane arrangement from that of RGR (Fig. 1-8D). RGR protein has been routinely purified from bovine RPE for biochemical study (Hao 2000). RGR protein sediments with the microsomal membrane fraction by ultracentrifugation. It is readily solublized in a buffer containing the mild detergent digitonin and purified by immunoaffinity chromatography (Hao 2000). RGR protein purified from bovine RPE is capable of binding to exogenous all-trans- retinal (Shen 1994). The all-tnmy-retinal was identified as the endogenous chromophore of RGR protein (Hao 1999). All-tram-retinal binds through a covalent Schiff-base bond, putatively to Lys255 in the seventh transmembrane domain of RGR (Shen 1994). The conjugation to the all-trara-retinal chromophore is unique in that 19 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. most other opsins bind to 11 -cA-retinal as the chromophore instead (Saari 1994). Binding to all-frans-retinal gives the RGR absorption maxima at 469 nm and 370 nm (Hao 1996). The extinction coefficient at 469 nm (8469) of RGR bound to all-trans- retinal in aqueous buffer is 7540 cnf'VT1 (Hao, 1999). RGR is believed to be a photoisomerase in the visual cycle. It is most similar in amino acid sequence to the retinochrome, a photoisomerase that catalyzes the conversion of all-fnms-retinal to 11 -c/.v-retinal in squid photoreceptors (Ozaki 1983, Hara-Nishimura 1990, Jiang 1993). The sequence homology between squid retinochrome and RGR suggests a possible photoisomerase activity of RGR. Indeed, irradiation of the purified RGR with 470-nm monochromatic or near-UV light resulted in stereo-specific isomerization of the RGR-bound all-fram-retinal to the 1 \-cis isomer (Hao 1999). The study of experimental mouse with RGR gene knockout shed further light on the function of RGR protein (Chen 2001a). The dark- adapted RGR knockout mice and wild-type mice contained similar levels of total retinal and rhodopsin per eye. However, after a period of light adaptation, RGR knockout mice had significantly lower levels of total retinal and rhodopsin. Accumulation of all-fr<mv-retinyl ester was observed in the RGR-knockout mouse. Electroretinograms (ERG) of the mouse reveal lower rod sensitivity in the light- adapted RGR-knockout mice than that of the wild-type counterparts, as expected from the lowered rhodopsin level. The phenotype of RGR-knockout mouse indicates that RGR has an essential role in the regeneration of rhodopsin. Under the illumination conditions used in experiments, RGR may contribute to up to 98% of 20 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. the total 1 l-cw-retinal production in the RPE (Chen 2001a). The importance of RGR to the health and viability of the retina is supported by mutations in the human RGR gene that segregate with retinitis pigmentosa (RP) in patients with autosomal dominant or recessive RP (Morimura 1999). The function of RGR in the visual cycle is further supported by the interaction between 11 -cis retinol dehydrogenase (cRDH) and RGR (Chen 2001b). For the RGR to function as a photoisomerase, the 11 -cA-retinal produced from photoisomerization needs to be removed continuously in the light condition. The cRDH has been consistently copurified with RGR. The cRDH did not reduce the RGR-bound all-frara-retinal. Instead, cRDH was shown to reduce the RGR-bound 11-cA-retinal, which is the photoisomerization product from all-fram-retinal (Chen 2001b). The reduction disrupts the Schiff base bond between retinal and the RGR opsin, and thus could help remove the isomerized chromophore from RGR. 1-6. THE GOALS OF THE PROJECT The past decade saw great progress in the study of RGR opsin and the visual cycle within the RPE. Since cloning of the RGR gene in 1993 (Jiang 1993), our lab has successfully purified the RGR protein from bovine eyes and demonstrated its ability to preferentially bind a\\-trans-retinal (Shen 1994), characterized the light- absorbing properties of the RGR opsin (Hao 1996), and identified all-fram-retinal as the endogenous chromophore of RGR (Hao 1999). More importantly, RGR opsin 21 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. has been found to specifically isomerize RGR-bound all-/nmv-retinal to 11 -cis isomer in vitro (Hao 1999), and to be essential in the production of 11-cA-retinal and regeneration of rhodopsin in vivo (Chen 2001a). The photoisomerization efficiency of RGR-bound all-tram-retinal could be enhanced by the association of RGR with 1 1-cA-retinol dehydrogenase (cRDH) (Chen 2001b). The findings of RGR-d alternative splicing variant in human (Jiang 1995) and RGR gene mutations in human RP patients (Morimura 1999) underscore the clinical importance of the RGR. Several key questions remain unsolved. First of all, where and how does the RGR obtain the all-fram-retinal substrate if RGR functions as a photoisomerase? Second, if RGR per se is the photoisomerase, what is the reaction rate for photoisomerization? Is RGR sufficient for the in vivo production of 11 -cA-retinal and regeneration of rhodopsin? Third, how is the 11-cw-retinal processed in the RPE downstream of the photoisomerization reaction? Fourth, is the photoisomerase activity of RGR regulated in vivol If so, how is it regulated to achieve the production of 1l-c/.v-retinal on demand? In this project, we would answer some of the above questions using the RPE cell culture system. The first objective was to generate a human RPE cell line that stably expresses human RGR protein. The human RPE cell line, ARPE-19, maintains many characteristics of RPE cells in vivo, but does not express RGR. A lentivirus-derived gene transfer vector was used to deliver human RGR cDNA under the control of a CMV immediate early promoter. Secondly, we characterized the recombinant human RGR, and compared it to the characteristics of bovine RGR 22 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. purified from the RPE cells. This study corroborated the previously identified properties of RGR opsin (Shen 1994, Hao 1996, Hao 1999). Thirdly, we studied how the all-Znms'-retinal is produced for the substrate of RGR from all-/ram-retinol or p,P-carotene. RPE cells synthesize 11 -c/.s-retinoid in vivo from all-/rau.v-retinol obtained from the ROS, while p,p-carotene as well as all-/r<mv-retinol is available to the RPE from choroidal circulation. Fourth, the RPE cell culture system was used to study the RGR-dependent production of 11-cw-retinal. The photoisomerization of RGR-bound all-frara'-retinal to 11 -elv-retinal was tested. The processing of 11 -cis- retinal was also studied in the RPE cell culture system and compared to the previous experimental results from in vitro biochemical and in vivo knockout mouse studies (Chen 2001a, Chen 2001b). The RPE cell culture system could have unique advantages over the in vitro purified RGR protein system and the in vivo RGR gene knockout mouse model. Cultured RPE cells have proved to be useful tool to study retinoid metabolism and the visual cycle (Das 1988, Flannery 1990, Timmers 1990, Carlson 1992, Carlson 1999). Unlike the purified RGR protein system, cultured RPE cells could provide necessary proteins and the intracellular environment (such as the membrane system, physiological concentrations of cofactors, energy supply, etc.) for the dynamic flow of retinoids in the visual cycle. Compared with the whole animal model, the cell culture provides a well-defined and dissected system. It is of great difficulty to study individual reactions of the visual cycle in the whole animal, due to the complexity of retinoid metabolism and the contamination from the sensory retina. On the other 23 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. hand, the cell culture system has its own limitation, including the loss of certain properties of the normal RPE cells, and artifacts resulting from non-physiological cell culture conditions, and so on. Thus, combination of the purified protein system, the cell culture system, and the knockout mouse system should provide reliable insight into the function of RGR in the visual cycle. More questions remained unanswered concerning the significance of RGR gene mutations, especially the alternative splicing product RGR-d, in the pathogenesis of RPE-related ocular diseases. In the second part of my study, the first question to answer is whether RGR-d protein is involved in the pathogenesis of certain ocular diseases, particularly the age-related macular degeneration (ARMD). We attempted to establish statistical correlation between the presence of RGR-d protein in human donor RPE and the occurrence of ARMD. The second question is whether RGR-d acts as a dominant negative mutant to interfere with the normal function of RGR. We expressed RGR-d protein in cultured cells for biochemical study, and in transgenic mouse to study the possible long-term effects on the functions of RPE in vivo. In the third part of my study, the main objective was to identify the promoter region that is responsible for the RPE and Muller cell-specific expression of RGR. An RPE-specific promoter is required to express RGR-d protein specifically in the RPE of transgenic mouse carrying human RGR-d cDNA transgene (see the above paragraph). This work could also lay the ground for RPE-specific intervention of the expressions of RGR and RGR-d using gene therapy method. 24 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. CHAPTER 2 DEVELOPMENT OF CELL CULTURE MODEL FOR THE VISUAL CYCLE 2-1. INTRODUCTION The study of human RGR and its mutant is hindered by the absence of an appropriate cell culture model. Cultured human RPE cells show a dramatic loss in their ability to produce RGR in vitro, and the RGR protein is available only in small quantities from any species. A gene delivery system capable of efficient and stable expression is desirable to study the functions of RGR and RGR-d in cell culture and experimental animal models. DNA transfection methods offer transient expression in mammalian cells. A lentivirus-derived vector has been used to achieve efficient gene delivery and long term gene expression in RPE in vivo and in cell culture (Naldini 1996a, Miyoshi 1997). The three-plasmid expression system includes a packaging plasmid, an env- coding plasmid and a transfer plasmid (Fig. 2-1). The packaging plasmid contains viral genes encoding viral proteins necessary for the packaging of viable infectious virus. The env-coding plasmid contains the G glycoprotein of vesicular stomatitis virus (VSV G protein). The VSV G protein interacts with a phospholipid component of the cell membrane to mediate viral entry by membrane fusion (Burns 1993). The recombinant virus has a broad host-cell range since the VSV G protein-mediated viral entry does not require a specific receptor (Burns 1993). The transfer plasmid 25 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. contains the c/.v-acting sequences for packaging, reverse transcription, and integration, as well as the cloning site for the foreign gene under the control of CMV promoter. The replication-defective recombinant lentivirus is generated in 293T cells by cotransfection of the three plasmids. The lentivirus vector has the advantages of efficient transduction (up to 100% of cultured cells), stable gene integration and expression, capability to transduce quiescent non-proliferating cells (such as RPE in vivo) with broad tropism. Packaging plasmid (p€MVAR8.91) CMV poly A Env-coding plasmid (pMD.G) CMV VSV G poly A Transfer plasmid (pHR,> LTR | r iJ L J H H i Zx SD ¥ CMV Transgene LTR Fig. 2-1. HIV provirus and the three-plasmid expression system used to generate the pseudotyped HIV-based recombinant lentivirus (Naldini, 1996a). Only relevant portion of each plasmid is shown. The packaging plasmid contains coding regions for viral proteins essential to viral particle assembly, except that the env protein region and the packaging signal (i|j) are blocked (X). The env-coding plasmid contains VSV G coding region under the control of CMV immediate early promoter. The transfer plasmid contains the packaging signal (\p) and a cloning site for target gene cDNA. The Gag-coding region in the transfer plasmid is truncated and out of frame (X). SD, splicing donor site; i|/, the packaging signal; LTR, long terminal repeats. Black rectangles represent protein-coding sequences in the HIV pro virus. 2 6 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. In this chapter, I report the successful expression o f a recombinant human RGR opsin that is capable of binding all-/nmv-retinal. The establishment o f the stably-transformed ARPE-19 cells offers a potential model system for biochemical and functional studies of RGR and protein variants. 2-2. EXPERIMENTAL PROCEDURES 2-2-1. Plasmid constructs - The pHR'-CMV-lacZ plasmid, an HIV-based lentiviral vector with the human cytomegalovirus (CMV) immediate early promoter and E. coli P-galactosidase gene (Naldini 1996a), was digested with BamUl and Xhol to excise the lacZ reporter gene and generate pHR'-CMV. Full-length 1.4-kb human RGR cDNA fragment and 1.3-kb human RGR-d cDNA fragment were inserted into pHR'-CMV by blunt-end ligation to create pHR'-CMV-hRGR and pHR’-CMV-hRGRd, respectively (Fig. 2-2). The pHR'-CMV-hRGR and pHR’- CMV-hRGRd plasmids were propagated in the Epicurian Coli SURE strain (Stratagene, La Jolla, CA) and purified using EndoFree Plasmid Maxi Kit (Qiagen Inc., Valencia, CA). Plasmids pcDNA3-hRGR and pcDNA3-bRGR (Fig. 2-2) were constructed by insertion of the 1.4-kb human RGR or bovine RGR cDNA into the cloning site of the pcDNA3 vector generated by EcoRI restriction enzyme digestion (Invitrogen, Carlsbad, CA). 2-2-2. Cell culture - The ARPE-19 and COS-7 cell lines were maintained in DME/F12 (1:1) medium (Life Technologies, Gaithersburg, MD) supplemented with 10% fetal bovine serum (FBS, Hyclone, Logan, UT) and 1% Glutamine-Penicillin- 27 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Streptomycin (final concentrations: 2 mM glutamine, 100 units/ml penicillin, and 100 units/ml streptomycin, Irvine Scientific, Santa Ana, CA) at 37 °C in a 5% CO2 incubator. Human kidney 293 T and mouse RPE cells were cultured with DME instead of DME/F12 medium. Adult 129SV X C57BL/6 mice were euthanized, and RPE cell cultures were prepared as follows. Whole eyes were enucleated and bisected posterior to the limbus. The lens was removed, and the retina was peeled away from eyecup. The eyecup was placed in 2% dispase (Life Technologies) for 50 min at 37 °C. RPE cells were detached by brushing, and sedimented by centrifugation. The pigmented RPE cells were plated on laminin-coated 6-well plates in DME 10% FBS culture medium. All animals were treated, maintained, and euthanized in accordance with the Association for Research in Vision and Ophthalmology (ARVO) resolutions on the use of animals in research, the guidelines of the Institutional Animal Care and Use Committee (IACUC) of the University of Southern California, and the guidelines of the U.S. Public Health Service, as delineated in its Public Health Service Policy on Humane Care and Use of Laboratory Animals. 2-2-3. DNA transfection in cultured cells - COS-7 and ARPE-19 cells were cultured as described above. All cells were maintained at 50-60% confluency and washed with PBS before transfection. Plasmids pcDNA3-hRGR and pcDNA3- bRGR were transfected into cells using either calcium phosphate-based CellPhect Transfection Kit (Pharmacia Biotech) or LlPOFECTAMINE PLUS reagent (Life Technologies), according to manufacturers’ protocols. For transfections using 28 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. CellPhect Transfection kit, the cells were maintained in DME/F12 (1:1) supplemented with 10% FBS without antibiotics before transfection. Plasmid DNA (3 pg per T25 flask of cells) was added to the culture medium after forming DNA- calcium phosphate complex. The medium was removed after 12 h, and the cells were washed twice with DME/F12 (1:1) and then incubated with 15% glycerol in isotonic HEPES buffer (pH 7.5) for 3 min. The cells were washed again with DME/F12 (1:1) and cultured pHR’-CMV-hRGR and pHR'-CMV-RGRd , ^ human RGR or RGR-d cDNA RRE 1 * ......- ............. ED S D V pcDNA3-bRGR, hRGR and RGRd • cDNA FIG. 2-2. Diagrammatic structure of the constructs used for the expression of human RGR, RGR-d or bovine RGR. The lentiviral transfer plasmids pHR'-CMV- hRGR and pHR’-CMV-RGRd provide the vector genome packaged into the viral particle and includes a human RGR and RGR-d cDNA, respectively, under control of the CMV promoter. The pcDNA3-bRGR, pcDNA3-hRGR, and pcDNA3-RGRd plasmids were constructed by cohesive end ligation of the linearized vector with bovine RGR cDNA (Jiang 1993), human RGR cDNA (Shen 1994), and RGR-d cDNA (Jiang 1995), respectively. The pcDNA3-RGRd plasmid is for RGR-d expression, as discussed in Chapter 4. LTR, long terminal repeat; Ga, truncated Gag gene; RRE, rev responsive element; SD, splicing donor site; vp, packaging signal (Naldini, 1996a). 29 pcDNA3 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. with DME/F12 (1:1) supplemented with 10% FBS and 1% glutamine-penicillin- streptomycin. For transfections with LlPOFECTAMINE PLUS reagent, plasmid DNA (2 pg per T25 flask of cells) formed complex with the LipofectAMINE PLUS reagent and was incubated with cells for 3 h in 37 °C before adding DME/F12 (1:1) supplemented with FBS and 1% glutamine-penicillin-streptomycin to the cell culture. After 48 h or at specified times, the cells were subcultured by trypsinization in chamber slides for immunohistochemistry, or collected in PBS containing 0.1% SDS at specified times for Western blot assay, as described below. 2-2-4. Preparation of lentivirus - VSV-G-pseudotyped recombinant HIV- based virus was produced by three-plasmid co-transfection of 293T cells with pHR'- CMV-hRGR (15 pig), the envelope protein-coding plasmid, pMD.G (3 pg), and the packaging construct, pCMVAR8.91 (15 pg), using the calcium phosphate DNA precipitation method. The pMD.G construct provides the VSV G protein to pseudotype the vector, and the packaging construct, pCMVAR8.91, provides all required vector proteins. High titer stocks of recombinant HIV were prepared, as described previously (Naldini 1996b). Virus titers of 0.3 to 1 xlO9 transduction units (TU)/ml were usually obtained and were determined by transduction of confluent ARPE-19 cells, as described below. The absence of replication-competent virus was determined by the marker rescue assay and measurement of p24 Gag antigen levels by enzyme-linked immunosorbent assay, as described previously (Naldini 1996a). 2-2-5. Transduction of cells with lentivirus - To determine the titer of a virus preparation, confluent ARPE-19 cells in chamber slides were cultured with serial 30 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. dilutions of the pHR'-CMV-hRGR recombinant virus overnight. After removal of the virus solution, cells were maintained for 2 more days before fixation and immunohistochemical staining. Transduced ARPE-19 or COS-7 cells were detected by immunohistochemical staining with DE-7 antibody, which is directed against the carboxyl terminus of human RGR (Jiang 1995). To establish cells that stably expressed human RGR, 1 xlO6 ARPE-19 or COS-7 cells were incubated overnight with 1 xlO7 TU pHR'-CMV-hRGR recombinant viral particles and then maintained in fresh culture medium. 2-2-6. Immunohistochemistry - Cultured cells were fixed in cold methanol for 5 min and incubated at room temperature for 30 min with blocking buffer containing 5% bovine serum albumin, 3% normal goat serum, and 0.1% Triton X- 100 in phosphate-buffered saline (PBS). The cells were incubated with DE-7 antibody, and immunohistochemical staining was performed with a peroxidase-based enzyme detection system, Vectastain ABC, using the Vector VIP substrate (Vector Laboratories, Burlingame, CA). 2-2-7. Preparation of cell membranes - Total cell membranes from ARPE-19, COS-7, and mouse RPE cells were prepared after homogenization of the cultured cells in a Dounce glass homogenizer. The homogenization buffer contained 67 mM phosphate, pH 6.6, 250 mM sucrose, and 100 pg/ml phenylmethylsulfonyl fluoride. The homogenates were centrifuged at 300x g for 10 min at room temperature, and the supernatants were then centrifuged at 150,000x g for 1.5 h at 4 °C. The membranes were collected and stored at -80 °C. Bovine RPE microsomal 31 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. membranes were prepared from fresh eyes, as described previously (Shen 1994). Bovine eyes were obtained from a local abattoir. The isolation of RPE cells and preparation of RPE microsomes were performed under dim yellow light. The anterior segments, lens, vitreous and neural retina were removed, and the eyecups were rinsed with PBS. The RPE cells were removed by gently scraping the cell monolayer with a spatula. The cells were sedimented by low-speed centrifugation, resuspended and washed twice in 5-8 ml of ice-cold homogenization buffer containing 30 mM sodium phosphate, pH 6.6, and 250 mM sucrose. The cells were homogenized using a Dounce glass homogenizer, and the homogenate was centrifuged at 700x g at 4 °C to remove nuclei and unbroken cells. The pellet was resuspended, and the homogenization and centrifugation steps were repeated four times. The supernatants from the homogenization steps were pooled and centrifuged in a Sorvall SS-34 rotor at 15,000x g for 20 min at 4 °C. The 15,000x g supernatant was removed and centrifuged in a Beckman 70 Ti rotor at 150,000x g for 1 h at 4 °C. The membrane pellet was then stored at -80 °C. 2-2-8. Western blot assay - Cell membranes were resuspended in PBS, and protein concentration was measured by Bio-Rad protein assay (Bio-Rad Laboratories, Hercules, CA). Samples were separated by 12% SDS-PAGE and then electro-transferred to Immobilon-P membrane (Millipore, Bedford, MA). The protein molecular weight standard markers used in the SDS-PAGE were ovalbumin (43 kDa), carbonic anhydrase (29 kDa), and P-lactoglobumin (18.4 Kda) obtained from Life Technologies. The DE-7 antibody was used to detect human RGR protein, 32 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. and the R1 antibody for bovine RGR protein using ECL Western blot detection reagents (Amersham, Arlington Heights, IL). 2-2-9. Preparation of [3 H]all-trans-retinal - [3 H]all-/ran.s-retinal (250 pCi) was produced in the dark by oxidation of [3H]all-fr<mv-retinol (NEN Life Science Products, Boston, MA) in the presence of 2.4 mg of M n02 in hexane solution saturated with retinoic acid, as previously described (Shen 1994). The product was purified by normal phase high performance liquid chromatography (HPLC) using a LiChrosorb RT Si60 silica column (4 x 250 mm, 5 pm; E. Merck, Darmstadt, Germany) and a Beckman Model 126 HPLC system (Beckman Instruments, Fullerton, CA). The running buffer was hexane with 2% dioxane. The [3 H]all-rrans- retinal was dried and stored under nitrogen in -80 °C. An all-fram-retinal standard was purchased from Sigma (St. Louis, MO). 2-2-10. Binding of [3 H]all-trans-retinal to RGR - The [3H]all-tram-retinal binding assay was performed, as described previously (Shen 1994). Briefly, cell membranes were resuspended in 67 mM phosphate, pH 6.6, and 250 mM sucrose, ^ c and incubated with [ HJall-rrans-retinal (2x10 cpm, 30-60 Ci/mmol) in the dark for 3 h at room temperature. After adjustment of the pH to 8.0 with 1 N NaOH, 38 mg/ml NaBH4 was added to the suspension to reduce the Schiff base bond. The membranes were centrifuged at 150,000x g for 1 h at 4 °C. The pellet was then dissolved in 0.1% SDS in PBS. After separation with 12% SDS-PAGE, the proteins were fixed, and the gel was soaked in ENLIGHTNING Rapid Autoradiography 33 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Enhancer (NEN Life Science Products). The gel was dried and exposed to Kodak X- omat AR 5 autoradiographic film (Eastman Kodak Co., Rochester, NY). 2-2-11. Light-absorbing properties of the recombinant RGR protein - Transduced ARPE-19 and non-transduced ARPE-19 control cells were incubated with DME:F-12 medium containing 10% FBS, 1% glutamine-penicillin- streptomycin, and 10 pM all-fnmv-retinol for 4 hr in the dark at 37 °C and 5% CO2.. The cells were then washed with PBS and collected by scraping in the dark. Cell membranes were prepared as described above in this chapter. The membranes were then solubilized with the buffer containing 10 mM sodium phosphate, pH 6.7, 150 mM NaCl, 0.5 mM EDTA, and 1.2% digitonin, which is a mild detergent for the solubilization of RGR (Hao, 1996). The insoluble particles were removed by centrifugation at 150,000x g for 30 min at 4 °C. The supernatants were diluted to final concentration of 0.1% digitonin with 10 mM sodium phosphate, pH 6.7, 150 mM NaCl, 0.5 mM EDTA. The UV-visible light absorption spectra were recorded with a Hitachi U-3000 scanning spectrophotometer on samples of 1.0 cm path length at room temperature. The reference sample contained 10 mM sodium phosphate, pH 6.7, 150 mM NaCl, 0.5 mM EDTA, and 0.1% digitonin. The spectra were plotted from data files using Microsoft Excel 2000 software. 3 4 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 2-3. RESULTS 2-3-1. Expression of RGR by DNA transfection - Study o f the function of RGR could be greatly facilitated by the expression of RGR in cell culture. Human RGR was expressed in ARPE-19 and COS-7 cells by transfection with pcDNA3- hRGR plasmid containing the human RGR cDNA under the control of CMV promoter. Cell membranes were analyzed by Western blot assay two days after transfection, and the results showed that transfected ARPE-19 and COS-7 cells produced comparable amounts of human RGR protein. A single -30 kDa recombinant RGR A DNA transfection Vims transduction + + + + B o s 43 kDa— 29 — 18.4— C /5 8 2 9 - as o 2 9 - < Q c. COS-7 ARPE-19 COS-7 ARPE-19 FIG. 2-3. Expression of RGR protein in COS-7 and ARPE-19 cells. (A) COS-7 and ARPE-19 cells were transfected with pcDNA3-hRGR (2 mg DNA/1 xlO6 cells) using the Lipofectamine Plus agent (Life Technologies), according to the manufacturer's instructions. Alternatively, confluent cells were transduced with the pHR'-CMV-hRGR recombinant lentivirus at equal transduction units (TU)/ml. Control cells were subjected to mock transfection or incubated without the lentivirus. Each lane was loaded with 2 pg of total membrane protein. Human RGR protein was detected by Western blot with DE-7 antibody. (B) In this experiment, the transduction efficiencies of the COS-7 and ARPE-19 cells were 10% and 30%, respectively. The transduction efficiency was scored by immunohistochemical staining of transduced cells, and Western blot assays were performed with DE-7 antibody. (C) COS-7 cells were transfected with pcDNA3-bRGR to express bovine RGR protein. Bovine RGR was detected by Western blot with R1 antibody. 35 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. protein was detected (Fig. 2-3 A). The untreated control cells showed no expression of RGR. Bovine RGR was expressed in COS-7 cells after transfection of pcDNA3- bRGR plasmid containing the bovine RGR cDNA under the control of CMV promoter (Fig 2-3C). The expressed bovine RGR protein, as recognized by the R1 antibody, was slightly smaller in molecular weight than that of the native bovine RGR protein obtained from bovine RPE. 2-3-2. Expression of RGR by lentivirus transduction - The transient transfection in ARPE-19 and COS-7 cells was time-consuming and inefficient (Fig. 2-3 A). A lentiviral vector was used to express human RGR stably and efficiently. The lentiviral vector contained the human RGR cDNA again under the control of the CMV promoter (Fig. 2-2). ARPE-19 and COS-7 cells both expressed human RGR by day 3 after transduction with the recombinant lentivirus (Fig. 2-3 A). The amount of RGR protein from transduced ARPE-19 cells was much higher than that from transduced COS-7 cells. The /ezftz'vzVus-transduced COS-7 cells produced only the same amount of RGR as did ARPE-19 and COS-7 cells that were transfected with pcDNA3-hRGR DNA (Fig. 2-3A). A time course for the production of human RGR protein in COS-7, ARPE- 19, and cultured mouse RPE cells was determined over a 10-day period after transduction with recombinant virus (Fig. 2-4). In each cell type, human RGR protein was detectable 1-2 days after transduction. In COS-7 cells, the expression of RGR reached a maximal level approximately 6 days after transduction. In ARPE-19 36 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. COS-7 ARPE-19 mouse RPE Day 0 1 2 3 6 10 0 1 2 3 6 10 lOmth 1 2 3 6 10 FlG. 2-4. Time course of the expression of human RGR protein in COS-7, ARPE-19, and primary mouse RPE cells in culture. Each cell type was inoculated with 106 TUs of recombinant lentivirus. Human RGR protein was assayed at different time points after transduction. Aliquots of total cell protein from COS-7 (35 fig ), ARPE-19 (14 |ig ) and primary mouse RPE cells (6 fig ) were loaded in each group of lanes, except that 35 fig of total cell protein was loaded in the 10 months sample in ARPE-19 group. Human RGR protein was detected by Western blot using DE-7 antibody. and mouse RPE cells, the amount of human RGR increased steadily up to 10 days after transduction. After up to 10 months of continuous passage, the transduced ARPE-19 cells continued to express the transgene in high amount (Fig. 2-4). The large difference in the amount of RGR produced by transduced ARPE-19 and COS-7 cells was investigated by comparison of transduction efficiencies for each cell type. ARPE-19 and COS-7 cells were transduced with the recombinant virus at three different concentrations, or transduction unit per cell (TU/cell), and transduced cells containing RGR were identified by immunohistochemical staining. As indicated in Fig. 2-5 and Table 2-1, the ARPE-19 cells were more efficiently transduced than COS-7 cells at each concentration of recombinant virus. In addition, other results suggested that the amount of human RGR protein produced per cell was higher in transduced ARPE-19 cells than in COS-7 cells. The level of RGR 3 7 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. \ Virus Amount (TU/cell) Cell T ype' 1 0 1 0 .1 ARPE-19 (98±7.6)% (56±3.4)% (10±1.5)% 1 COS-7 (29±4.6)% (7±4.5)% ( 2 ± 1 . 0 ) % TABLE 2-1. Transduction efficiency of human RGR lentiviral vector toward ARPE-19 and COS-7 cells. The cells were treated with equivalent amounts of recombinant lentivirus at the indicated transduction units (TU)/cell. The transduction frequency, after 2 days of incubation with lentivirus, was scored by immunocytochemical staining with the DE-7 antibody. The results are presented as the mean percentage (± standard deviation) of total cells that were transduced with the lentiviral vector in three different fields. ARPE-19 cells were transduced more efficiently than COS-7 cells at each TU/cell. ■ ..." ( --Iv-N.— ;* V -vi £ !A * ?'*'*' j * * "' f > : • .♦ I f . v * a - ■ • * * i» * \K. ' .• w •/ ^ *'*V * v * * :>-vV. • . . ■ • < * . .i .-./.'■y-v iV ‘ ■ -r J • " J . , * ■ * . " -V - w - ... • S * fiv / *' ■ V ': ; ■ V - * V s*- i . ' . ' * i '* '* ♦ • r ^ ■ ■ • y t ~ . , V T V i * a ifr. * > > ,'. i * . * * . _ i - / . * V i " • i '■ .v? ~ " 4 ’- ' * * / . ‘ S *.v . V*- * /r* \ •./ r - r '*y~K f -f > . ■ Vt" V W t ‘0 . FIG. 2-5. Immimohistochemical staining of lentivirus-transduced ARPE-19 and COS-7 cells. ARPE-19 (A-C) and COS-7 cells (D-F) were transduced with the following different concentrations of recombinant lentivirus: (A and D) 0.1 TU/cell; (B and E) 1 TU/cell; and (C and F) 10 TU/cell. After 2 days of incubation with lentivirus, human RGR opsin was detected by immunohistochemical staining with the DE-7 antibody (Jiang 1995). Immunoreactivity was developed with the Vector VIP substrate, and the cells were counterstained with Mayer's hematoxylin. 38 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. expression was compared in a population of ARPE-19 cells containing -30% transduced cells and a population of COS-7 cells containing -10% transduced cells. Immunoblots showed that the amount of RGR protein from these cells was ~100x higher in ARPE-19 than in COS-7 cells (Fig. 2-3B). 2-3-3. Binding of all-trans-retinal to the recombinant RGR - To determine whether recombinant human RGR is capable of binding all-tram-retinal, cell membranes were prepared from transduced ARPE-19 cells and incubated with [3H] all-tram-retinal. Results from fluorography demonstrated a single major radiolabeled band from the transduced ARPE-19 cells, but not from the nontransduced ARPE-19 cells (Fig. 2-6). The position of this band in SDS-PAGE coincided with the position of radiolabeled bovine RGR from freshly isolated bovine RPE cells. A B C 43 kDa- 29- : — FIG. 2-6. Binding of [3 H]all-trans-retinal to the recombinant human RGR. Bovine RPE microsomal fraction (A) and total cell membranes from nontransduced ARPE-19 cells (B) and ARPE-19 cells transduced with recombinant lentivirus containing human RGR cDNA under the control of CMV promoter (C) were incubated with [3 H]all-tram-retinal. The reaction products were reduced by NaBFE, then separated by SDS-PAGE and analyzed by fluorography with 1-week exposure to autoradiographic film. 39 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 2-3-4. Light-absorbing properties of the recombinant RGR protein - The recombinant RGR protein expressed in the transduced APRE-19 cells was able to bind all-fnms-retinal in vitro, as shown in Fig. 2-6. To determine the absorption spectra of the recombinant RGR protein, the transduced ARPE-19 cells were cultured with all-tram-retinol to bind RGR with all-frans-retinal (see Chapter 3 for the validation of this method). RGR purified from bovine RPE cells has characteristic absorption maxima at 469 nm and 370 nm (Hao 1996). However, no significant absorption peak was detected at either 469 nm or 370 nm in the transduced ARPE-19 cells when compared with the non-transduced control ARPE- 19 cells (Fig. 2-7). Non-transduced 4 3 1 0 260 360 460 560 w avelength (nm ) v Transduced Fig. 2-7. Absorption spectra of the transduced and non-transduced ARPE-19 cells. For each assay, about 3 x 107 cells were incubated with serum- containing medium. The microsomal membranes were prepared and solubilized in 1.2% digitonin. The solubilized proteins were then diluted to 0.1% digitonin to record the absorption spectrum. Native bovine RGR binding to all-/ram'-retinal has absorption maxima at 469 nm and 370 nm (Hao 1996). The absorptions from 260 nm to 360 nm presumably represented the proteins and other light-absorbing contents in cells that were incubated with all-tnms-retinol. 4 0 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Transduction with recombinant lentivirus at high ratio of recombinant lentivirus to ARPE-19 cells resulted in a cell population which nearly 100% of the cells were permanently express human RGR protein. This ARPE-19 cells-derived cell population, termed ARPE-hRGR, was to be further explored to study the function of RGR in the visual cycle. 2-4. DISCUSSION RPE cells in culture can be used to study complex mechanisms of retinoid metabolism and the role of the RPE in the visual cycle (Das 1988, Das 1990, Timmers 1990, Timmers 1991, Carlson 1992, Davis 1995, Carlson, 1999). Lipids and retinoid-binding proteins assist in the delivery of all-fram-retinol as a complex to the cultured RPE cells, and intracellular processing of all-fram-retinol has been • 2 analyzed using tracer [ H]all-/r<mv-retinol (Das 1988, Flannery 1990, Timmers 1991). Often, RPE cells in culture undergo biochemical changes, such as loss of pigmentation, decreased ability to metabolize and store retinoids, and depletion of the cellular retinol-binding protein (CRBP), cellular retinaldehyde-binding protein (CRALBP), and RPE65 (Flood 1983, Bridges 1986, Pfeffer 1986, Hamel 1993). This lab has cultured human and bovine RPE cells in Dulbecco's modified Eagle's medium (DMEM) containing 10% fetal bovine serum and analyzed the expression of RGR mRNA in these cells by Northern blot hybridization. RGR mRNA was undetectable in these cultured human and bovine RPE cells, including ARPE-19 41 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. cells (Yutian Zhan, unpublished results). These findings indicate that an erstwhile active RGR gene promoter is dramatically repressed in cultured RPE cells. To investigate RGR opsin in ARPE-19 cells, which retain unique characteristics of normal RPE cells, DNA transfection methods and a lentivirus- derived gene delivery system were used to produce high levels of recombinant human RGR opsin in ARPE-19 cells. The efficiency of DNA transfection in ARPE- 19 cells was very low, possibly due to the robust phagocytosis and DNA degradation in RPE cells. On the other hand, lentivirus-derived vectors have been demonstrated to achieve an efficient and stable gene transfer in nondividing cells (Naldini 1996a, Naldini 1996b). The efficient gene transfer is attributed to the VSV-G protein, which also enables broad cell type tropism of the recombinant virus. Integration of the transgene into the host cell genome leads to the stable transduction of cells. The long-term expression of human RGR in transduced ARPE-19 cells is consistent with previous results in which transgene expression was maintained for more than 6 months after transduction by the lentivirus-derived vector (Kafri 1997, Miyoshi 1997). Consequently, the lentiviral vector should also prove effective for in vivo transduction of quiescent RPE cells and potentially may be used to rescue the RGR- deficient mutant mouse (Chen 2000). Interestingly, the ARPE-19 cells were transduced more efficiently than COS- 7 cells, and the amount of RGR per transduced cell was greater in ARPE-19 than in COS-7 cells. The results suggest that the ARPE-19 cells, like normal RPE cells in vivo, provide efficient synthesis, or stabilization of a functional human RGR protein. 42 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. The CMV promoter in the lentiviral vector is not RPE-specific. The expression levels of RGR under the control of CMV promoter in COS-7 cells and ARPE-19 cells were similar when DNA transfection method was used (Fig. 2-3A). Thus the higher amount of human RGR protein found in ARPE-19 cells versus COS-7 cells cannot be explained solely by promoter activity. The ARPE-19 cells have been found to express endogenous RPE proteins (Dunn 1996), such as 11 -cis retinyl ester hydrolase, CRALBP, and RPE65. Since RGR is also found in microsomal membranes, the presence of other RPE proteins and a specialized smooth endoplasmic reticulum may enable interaction, stabilization and accumulation of the RGR protein. Cultured mouse RPE cells also produced a high amount of recombinant RGR. The higher transduction efficiency of ARPE-19 epithelial cells in comparison to that of COS-7 fibroblast-like kidney cells may be due to the interaction of VSV-G protein with distinct cell types. The recombinant lentivirus is pseudotyped with VSV-G protein, which may cause cell fusion and some interference with cell growth when attached to cell surfaces (Burns 1993). Polarized epithelial cells, and perhaps ARPE-19 cells, are relatively resistant to this fusogenic property of the VSV-G protein (Bums 1993). An important result of this study is that the expressed protein is capable of binding to all-/ram'-retinal, the endogenous chromophore of RGR purified from bovine RPE cells. This suggests that the recombinant RGR protein is able to fold into a proper conformation and may have functions of the native RGR protein. In 43 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. contrast to RGR from ARPE-19 cells, recombinant bovine RGR that this lab has over-expressed in Sf9 cells of the baculovirus expression system failed consistently to bind all-tram'-retinal (Pu Chen, personal communication). We failed to detect the characteristic absorption spectrum of RGR with maxima at 370 nm and 469 nm in the transduced ARPE-19 cells. It is possibly due to the low sensitivity of the spectrophotometer used in the experiments. Our later results (Fig. 3-6 D, Chapter 3) indicated that one T150 flask of the transduced ARPE-19 cells (termed ARPE-hRGR in the later experiments) contain about 3 picomole of all-frara-retinal. This amount represents the amount of recombinant RGR bound to all-frara-retinal chromophore in one T150 flask of cells. Even with 100% recovery from all the four flasks of cells as used in the experiments, the amount of RGR protein would have an A469n m of 0.9 x 10'5 AU (A469n m = sbC, where the extinction coefficient (e) for RGR is 7540 cm’ ’M '1 , the length of the cuvette (b) is 1 cm, the concentration of RGR (C, 4 flasks of cells were solubilized into 1 ml digitonin buffer) is 12 pmol/ml). The spectrophotometer used in the experiments can only reproducibly detect samples of 0.001 AU and above. The bovine RGR was expressed in this study by transfection of the pcDNA3- bRGR plasmid into COS-7 cells. The recombinant RGR protein runs faster in SDS- PAGE than the native protein obtained from bovine RPE (Fig 2-3C), as also observed with recombinant bovine RGR expressed in Sf9 cells using baculovirus expression system (Pu Chen, personal communication). Reasons for this discrepancy could be insufficient or excessive modifications of the RGR protein, or 44 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. utilization of different translation starting codon in the transfected cells. Since the recombinant bovine RGR protein expressed using the baculovirus expression system seems aberrant and not functional, we did not pursue the bovine RGR protein expressed in COS-7 cells. The successful expression of functional RGR protein in ARPE-19 cells by lentivirus transduction generated a new RPE cell line, ARPE-hRGR. This cell culture model enables cell-based assays to study the function of RGR and the reactions in the photic visual cycle upstream and downstream of RGR photoisomerization. 4 5 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. CHAPTER 3 THE PHOTIC VISUAL CYCLE IN THE RPE CELLS 3-1. INTRODUCTION The retinal pigment epithelial (RPE) cells are highly active in the metabolism of retinoids and are essential for the synthesis of the 11-cA-retinal chromophore of visual pigments (McBee 2001). Many specialized enzymes and retinoid-binding proteins are involved in the production of 11-cA-retinal from all-fram-retinol. Lecithin:retinol acyltransferase (LRAT) is among the most active enzymes in retinoid processing and acts early in the retinoid cycle by catalyzing the esterification of all-tram-retinol soon after uptake into the RPE cells (Saari 1988, Saaril989, Shi 1993). The retinyl esters are normally the predominant retinoids, even while the content and distribution of retinoids in the RPE may vary under different light and dark conditions (Zimmerman 1974, Bridges 1976, Saari 1998, Palczewski 1999, Qtaishat 1999). Other enzymes that affect the content and distribution of retinoids include retinyl ester hydrolase (Blaner 1987, Mata 1992), 11-cA-retinol dehydrogenases (Lion 1975, Zimmerman 1975, Zimmerman 1976, Chai 1997, Jang 2000), and a putative isomerohydrolase or isomerase (Law 1988, Deigner 1989, Canada 1990, McBee 2000). RGR has been shown to be the major all-tram-retinal-binding protein in the RPE (Shen 1994), and is proposed to function as a photoisomerase in the visual cycle 46 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. (Hao 1999, Chen 2001a). However, it is unclear how the all-/nmv-retinal chromophore is generated in RPE and Muller cells. Only low amounts of all-trans- retinal, if any, have been reported to be in the RPE (Zimmerman 1974, Bridges 1976, Saari 1998, Palczewski 1999, Qtaishat 1999), yet the RPE must be able to synthesize the chromophore of RGR. Indeed, the role of RGR in a photic visual cycle may require continual synthesis of the all-frara-retinal chromophore directly from all- trans-retinol. These considerations suggest that a novel all-tnmv-retinol dehydrogenase exists in the RPE to provide the chromophore of RGR. On the other hand, p,(3-carotene could provide a supplementary source for the chromophore of RGR. The oxidative cleavage of p,p-carotene, catalyzed by the P,p-carotene- 15’, 15’-dioxygenase (Bcdo), gives rise to two molecules of all-inmy-retinal in the RPE (Redmond 2001, Yan 2001). RGR could function as a photoisomerase in the photic visual cycle in RPE, catalyzing the photoisomerization of alWnmv-retinal to 1 l-cA-retinal. Alternatively, RGR could also function as a G protein-coupled receptor, while light activates RGR through all-irans-retinal isomerization. Activated RGR could then stimulate other visual cycle enzymes for 11-cA-retinal production. Currently, experimental evidence does not substantiate nor invalidate either hypothesis (Chen 2001a, Hao 1999, Yang 2002). On the other hand, the 11 -cA-retinal produced from RGR-mediated photoisomerization is subject to further processing in RPE cells. In vitro studies using purified RGR protein demonstrated that 11-cA-retinal could be reduced to 11 - 4 7 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. c/.y-retinol by the 11-d.v-retinol dehydrogenase, or transferred from RGR to the cellular retinaldehyde binding protein (CRALBP) (Pu Chen, unpublished data). As described in this chapter, we tested whether all-/ram-retinal could be synthesized in RPE cells and become physiologically bound to RGR. All-trans- retinol and (3,P-carotene were tested as the possible precursor for all-fram-retinal. We also presented evidence for a novel all-/7 <mv-retinol dehydrogenase in both cultured ARPE-hRGR and isolated bovine RPE cells. Furthermore, the RPE cell culture system was utilized to study the process of 11-cw-retinal in RPE cells after generation from RGR-mediated photoisomerization. 3-2. EXPERIMENTAL PROCEDURES 3-2-1. Materials - al\-trans-[l l,12-3H(N)]Retinol (50 Ci/mmol) was obtained from NEN Life Science Products. NADP and NAD were from Sigma. Organic solvents were HPLC grade. Dichloromethane and hexane were obtained from Fisher. Diethyl ether and methanol were from J. T. Baker Inc. Ethanol was from Gold Shield Chemical Company. The all-fram-retinol, all-fram-retinal, 13-cw-retinal, and all-/ram-retinyl palmitate standards were purchased from Sigma. 11-cA-Retinal was provided by Dr. Rosalie Crouch (Medical University of South Carolina, Charleston, SC). 11-cA- Retinol and 13-cA-retinol were prepared by the reduction of 11-cA-retinal in the presence of NaBH4, as described previously (Landers 1990). 1 l-c/.y-Retinyl 48 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. palmitate and 13-czs-retinyl palmitate were synthesized as described before (Landers 1990). Briefly, about 10 nmol of 11-c/.v-retinol or 13-ei.y-retinol was dissolved in 100 pi Na2S C > 4-dried CH2CI2. Palmityol chloride (Sigma) was dissolved in Na2SC > 4- dried CH2CI2 to prepare a ImM solution. The esterification reaction was started by mixing 100 pi of retinol solution with 100 pi of 1 raM palmityol chloride. After incubation in the room temperature for 1 0 min in the dark, the reaction was stopped by incubation on ice. The reaction was mixed with 200 pi of H2O and 200 pi of methanol, and extracted with 200 pi of hexane for 3 times. The pooled hexane solution was dried under nitrogen flow and stored at -80 °C. 3-2-2. Cell culture - ARPE-19 cells, a human RPE cell line, maintain many characteristics of normal RPE cells, but do not express detectable levels of RGR opsin (Dunn 1996). ARPE-hRGR cells, which stably express human RGR, were obtained by transduction of ARPE-19 cells with a recombinant lentivirus (Yang 2000a, Yang 2000b). The ARPE-19 and ARPE-hRGR cell lines were cultured in DME/F12 (1:1) medium (Life Technologies) supplemented with 10% fetal bovine serum (FBS) (Hyclone) and 1% Glutamine-Penicillin-Streptomycin (Irvine Scientific) at 37 °C in a 5% CO2 incubator. Cells at passage no. 15-25 were grown and maintained at confluency 1 - 2 weeks before use in each experiment. 3-2-3. Incubation of cultured cells with [3El]all-trans-retinol and analysis of radiolabeled proteins — ARPE-hRGR and ARPE-19 cells were preincubated overnight with serum-free (retinol-free) RPMI1640 medium (Life Technologies) at 37 °C in 5% CO2 . The cells were then washed with RPMI1640 medium and 49 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. incubated in the dark with a mixture of [3 H]all-/ram'-retinol (0.25 LiCi/ml, 50 Ci/mmol), 500 pg/ml fatty acid-free bovine serum albumin (BSA), and 0.5% sucrose in RPMI1640 medium. After incubation for various lengths of time at 37 °C in 5% CO2, the cells were washed with phosphate-buffered saline (PBS), collected by scraping into 2 ml 67 mM sodium phosphate buffer, pH 6 .6 , and homogenized in a Dounce glass homogenizer (tight pestle). After adjustment of the pH to 8.0 with 1 N NaOH, 38 mg/ml NaBH4 was added to the suspension. The membranes were centrifuged at 150,000x g for 1 h at 4 °C. [3H]-Labeled proteins were analyzed by gel electrophoresis and fluorography. After separation by 12% SDS-PAGE, the proteins were fixed, and the gel was soaked in ENLIGHTNING Rapid Autoradiography Enhancer (NEN Life Science Products). The gel was dried and exposed to Kodak X-omat AR 5 autoradiographic film (Eastman Kodak Co.). The autoradiographic films were scanned, and relative band densities were determined using Scion Image 1.62c software (Scion Corp., Frederick, MD). 3-2-4. Isolation of bovine RPE cells and incubation with [3H]all-trans-retinol - Bovine eyes were obtained from a local abattoir. The RPE cells were isolated under ambient illumination 2-3 h after enucleation. The anterior segments, lens, vitreous and neural retina were removed, and the eyecups were washed twice with ice-cold PBS to remove retina debris. The RPE cells were scraped off gently with a metal spatula and collected in ice-cold PBS. The cells were then centrifuged at 800x g for 5 min at 4 °C. The pellet was washed once with ice-cold PBS and centrifuge again. The majority of the cells isolated by this method are RPE, as they remain 50 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. hexagon-shaped, pigmented, and confluent for at least one month in cell culture. The following procedures were performed in the dark. The RPE cells were resuspended in 10 ml DME/F12 (1:1) medium supplemented with [3H]all-fram- retinol (1.0 pCi/ml, 50 Ci/mmol), 500 pg/ml fatty acid-free BSA, and 0.5% sucrose and incubated in a culture flask for 3 h at 37 °C in 5% CO2 . After incubation, the cells were collected with a cell scraper, centrifuged and washed with PBS once. The cells were resuspended in 600 pi of PBS and homogenized with a Dounce glass homogenizer. The sample was treated with NaBH4, as described above. The membranes were then centrifuged at 150,000x g for 1 h at 4 °C and analyzed by gel electrophoresis and fluorography to detect [3H]-labeled proteins. Alternatively, part of the cell homogenate was saved for Western blot assay, or the retinoids were extracted in the presence of hydroxylamine, as described below. 3-2-5. Extraction of retinoids from RPE cells or membranes - All procedures were performed under dim red light. Retinal isomers were extracted by the method of hydroxylamine derivatization, as described previously (Groenendijk 1979, Groenendijk 1980). Cultured ARPE-hRGR, ARPE-19 or bovine RPE cells were washed with PBS and homogenized in 300 pi of PBS using a Potter-Elvehjem micro tissue grinder. The whole homogenate or membranes were mixed with 300 pi of methanol and then 30 pi of 2 M NH2OH. After incubation at room temperature for 5 min, 300 pi of CH2C12 was added and mixed by vortexing for 30 s. The organic and aqueous phases were separated by centrifuge at 14,000x g for 1 min. The aqueous phase was extracted twice more with CH2C12. The pooled CH2C12 solution was dried 51 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. under nitrogen gas flow, dissolved in 600 jal of hexane, filtered through glass wool, dried again, and then stored at -80 °C until analyzed later. 3-2-6. HPLC Analysis of Retinoids - The isomers of retinaloximes were analyzed by HPLC, as described previously (Ozaki 1986, Hao 2000). The extracted retinaloximes were dissolved in hexane and separated on a Resolve Silica column (3.9 x 150 mm, 5 pm) (Waters Corp.) using a Waters 2690 HPLC module. The running buffer consisted of hexane supplemented with 8% diethyl ether and 0.33% ethanol and was pumped at a flow rate of 0.3 ml/min. Absorbance was measured at 360 nm and 320 nm with a Waters 2487 Dual Wavelength Absorbance Detector. The absorbance peaks were analyzed with the Millennium 32 Chromatography Manager software, version 3.20 (Waters Corp.). The HPLC column was calibrated before each run using all-trans- and 11-cA-retinaloxime, and all-trans- and 11 -cis- retinol standards (Fig. 3-1). Identification of the retinaloxime isomers was based on the retention times of the known retinaloxime products. The proportion of each isomer in the loading sample was determined from the total peak areas of both its syn- and anti-retinaloxime and was based on the following extinction coefficients (S36o, in hexane): all-trans syn = 54,900, all-trans anti = 51,600, 1 l-cis syn = 35,000, 1 l-cis anti = 29,600, 13-cis syn = 49,000 and 13-cis anti = 52,100 (Groenendijk 1980, Ozaki 1986). The HPLC system was calibrated with 9.1-0.91 pmol of syn-all-fram-retinaloxime standard. The all-lrara-retinyl palmitate standard was eluted in running buffer composed of hexane supplemented with 8% diethyl ether and 0.33% ethanol, or hexane supplemented with 0.3% ethyl acetate. 52 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. A B C tR o l cR o l 16 20 24 syn A T R a l anti syn cR al anti J L r — tR E ll c R E 1 3 cR E 8 12 16 20 24 10 15 20 25 Elution time (min) F ig 3-1. The retinoid standards. The retinols (A) and retinaloximes (both syn and anti forms) (B) were separated with a Resolve Silica column (3.9 x 150 mm, 5 pm) and detected at 320 nm and 360 nm. The running buffer consisted of hexane supplemented with 8 % diethyl ether and 0.33% ethanol and was pumped at a flow rate of 0.3 ml/min. The retinyl palmitates (C) were separated with a LiChrosorb RT Si60 silica column (4 x 250 mm, 5 pm) and detected at 325 nm. The running buffer is hexane supplemented with 0.3% ethyl acetate at the flow rate of 1 ml/min. tRol, all-/r<mv-retinol; cRol, 1 l-cis-retinol; ATRal, all-tnms'-retinal; cRal, 11-cfv-retinal; tRE, all-/ram-retinyl palmitate; llcR E , 11 -c/.v-retinyl palmitate; 13cRE, 13-cz.v- retinyl palmitate. 53 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. The [ H]-labeled retinoids were separated as described above. Four drops of the HPLC eluate were collected manually per fraction and were mixed with 10 ml of ScintiVerse BD scintillation cocktail (Fisher Scientific). The amount of radioactivity was measured with a Beckman LS 6000IC counter. Identification of [3H]-retinoids was based on the retention times of known standards. To analyze the retinyl ester contents in the RPE cells, the [3H]-labeled retinoids were separated using the hexane:diethyl ether:ethanol system, as described above. The fractions containing retinyl esters (eluted between 4 to 6 min in the particular separation condition) were collected. One tenth of the pooled retinyl ester fractions were mixed with 5 ml of ScintiVerse BD scintillation cocktail to count radioactivity. The rest of the retinyl ester fractions were dried under nitrogen gas flow and separated by HPLC with a LiChrosorb RT Si60 silica column (4 x 250 mm, 5 pm; E. Merck, Darmstdt, Germany). The running buffer was hexane supplemented with 0.3% ethyl acetate at the flow rate of 1 ml/min. The separation was monitored at 325 nm with a Beckman 166 Detector (Beckman Instruments, Fullerton, CA). Ten drops of the HPLC eluate from 11 min to 26 min were collected manually per fraction and were mixed with 5 ml of ScintiVerse BD scintillation cocktail (Fisher Scientific). The amount of radioactivity was measured with a Beckman LS 6000IC counter. Identification of [3H]-labeled retinyl palmitates was based on the retention times of known standards (Fig. 3-1). 3-2-7. Preparation of cell membranes - ARPE-hRGR and ARPE-19 cells were pre-incubated overnight in serum-free RPMI1640 medium at 37 °C in 5% CO2 . 54 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Total cell membranes were prepared from bovine RPE, ARPE-hRGR and ARPE-19 cells. The cells were homogenized in buffer containing 67 mM sodium phosphate, pH 6 .6 , and 250 mM sucrose. The homogenate was centrifuged at 300x g. Thereafter, the supernatant was centrifuged at 150,000x g for 1.5 h at 4 °C. The membrane pellets were saved and stored at -80 °C. Microsomal membranes were prepared as described previously (Shen 1994, Yang 2000b). 3-2-8. Retinol dehydrogenase assay - The following procedures were performed in darkness or under dim red light. Microsomal membranes were washed and resuspended in buffer containing 50 mM Tris-HCl, pH 7.5, and 0.1% BSA. The reactions were initiated by addition of the membranes to 50 mM Tris-HCl, pH 7.5, 0.1% BSA, NADP or NAD, and 1 pM [3H]all-/rcm.v-retinol (reaction vol. = 300 pi). The specific radioactivity of [3H]all-/r<mv-retinol was made 5 Ci/mmol by dilution with unlabeled all-/nmv-retinol. Solutions of 10 mM NADP or NAD were made fresh and added to give the indicated final concentrations. After incubation at 37 °C for the specified amount of time, the reactions were terminated by addition of 300 pi of methanol and then 30 pi of 2 M NH2OH. The retinaloximes were extracted and analyzed by HPLC, as described previously. The HPLC fractions were collected, and the amount of radioactivity was determined. When nonradioactive substrates were used, retinol dehydrogenase activity was assayed with 5 pM exogenous all- trans-retinol or 11 -cA-retinol in the presence of 200 pM NADP. Retinals were extracted by hydroxylamine derivatization and analyzed by HPLC. The extraction efficiency was monitored by the addition of [3H]all-/r<ms-retinol to the methanol- 55 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. denatured samples. Under the experimental conditions, the reaction rate for production of all-frara'-retinal was linear within the initial 1 0 min. 3-2-9. Cell-free synthesis and binding of all-trans-retinal to RGR in vitro - Microsomal membranes from bovine RPE, ARPE-hRGR and ARPE-19 cells were washed and resuspended in buffer containing 50 mM Tris-HCl, pH 7.5, and 0.1% BSA. The reactions were initiated in the dark by addition of the membranes to 50 mM Tris-HCl, pH 7.5, 0.1% BSA, 200 pM NADP or none, and 0.2 pM [3H]all- trans-retinol (10 pCi/ml, 50 Ci/mmol). After incubation at 37 °C for 30 min, the membranes were sedimented by centrifugation at 150,000x g for 1 h at 4 °C. The pellet was washed, resuspended in 1 ml of PBS and mixed with 38 mg NaBH4 . The membranes were then centrifuged, resuspended in PBS containing 0.1% SDS and analyzed by gel electrophoresis and fluorography, as described previously. 3-2-10. Western blot assay - The membranes were resuspended in PBS, and protein concentration was measured by the Bio-Rad protein assay (Bio-Rad Laboratories). The samples were separated by 12% SDS-PAGE and then electro transferred to an Immobilon-P membrane (Millipore). An affinity-purified anti peptide antibody (Jiang 1993, Pandey 1994), that is directed against the carboxyl terminus of bovine RGR, and the ECL detection reagents (Amersham) were used to detect RGR. The protein molecular weight standard markers used in the SDS-PAGE were obtained from Life Technologies as follows: ovalbumin (43 kDa), carbonic anhydrase (29 kDa), and p-lactoglobulin (18.4 kDa). 56 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 3-2-11. p,P-Carotene-15\15’-dioxygenase assay - Confluent ARPE-hRGR cells were preincubated with serum-free DME/F-12 (1:1) for 16 h. The concentration of p,P-carotene was determined by spectrometry based on the extinction coefficient (8452, in ethanol) of 2620 dl/(g-cm) (MacCrehan 1990). p ,p - Carotene (1 nmol) was dissolved in 100 pi tetrohydrofuran (THF) and mixed with 20 ml DME/F-12 (1:1) supplemented with 500 pg/ml fatty acid-free BSA and 0.5% sucrose. ARPE-hRGR cells (1.5 xlO7 ) were incubated with the P,p-carotene medium for 4 h in the dark, and the retinals were extracted by hydroxylamine derivatization, as described above. Alternatively, microsomal membrane proteins from ARPE-hRGR cells were tested for p,P-carotene dioxygenase activity as described previously (Redmond 2001, Yan 2001). The microsomal membrane proteins were resuspended in a buffer containing 10 mM sodium phosphate, pH 6.5, 150 mM sodium chloride, 0.5 pM EDTA, and 20% glycerol. p,p-Carotene (2 nmol) dissolved in 10 pi THF was mixed with the membrane protein suspension. FeCB (10 mM) was added to a final concentration of 10 pM in the total reaction volume of 300 pi. The reaction was carried out in 37 °C for 2 h in the dark and the retinals were extracted by hydroxylamine derivatization, as described above. The retinoids were analyzed by HPLC, as described above. 3-2-12. Photoisomerization of RGR-bound all-trans-retinal in ARPE-hRGR cells - ARPE-hRGR and ARPE-19 cells were cultured in DME/F12 (1:1) medium supplemented with 10% FBS and 1% Glutamine-Penicillin-Streptomycin. To avoid 57 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. light, the cells were maintained overnight in aluminum foil-wrapped cell culture flask. The cells were washed with PBS and collected with a cell-scraper and resuspended into 300 pi of PBS. For the first control, an aliquot of ARPE-hRGR cells was denatured by adding 10% SDS stock solution to a final concentration of 1%. For the second control, 5 pmol of all-fram-retinal, dissolved in 5 pi ethanol, was mixed with ARPE-19 cell suspension. For the last control, 1 nmol all-trans- retinal, dissolved in 10 pi hexane, was mixed with 300 pi PBS. The samples were illuminated with a 470 nm monochromatic light beam at room temperature for 5 minutes. The light source was an Oriel light source equipped with a 150 watt Xenon arc lamp. Monochromatic light beam at 470-nm was formed by passing the light through both a 470-nm interference filter and a 455-nm long pass filter (Hao 1999). The samples were held in a quartz cuvette positioned 60 cm from the light source at the room temperature. An aliquot of ARPE-hRGR cell suspension was kept in dark as a control. Total retinoids were then extracted and analyzed by HPLC, as described above in this chapter. 3-2-13. Photoisomerization of RGR-bound all-trans-retinal in the freshly isolated bovine RPE cells - Freshly isolated bovine RPE cells were obtained as described above in this chapter. The cells were resuspended in 20 ml DME/F12 (1:1) medium supplemented with [3FI]all-/ram-retinol (1.0 pCi/ml, 50 Ci/mmol), 500 pg/ml fatty acid-free BSA, and 0.5% sucrose and incubated in a culture flask for 4 h at 37 °C in 5% CO2. After incubation, the cells were collected by pipette and spun down with a clinical centrifuge. The cell pellets were resuspended in 20 ml 58 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. DME/F12 (1:1) medium supplemented with 500 pg/ml fatty acid-free BSA and 0.5% sucrose, and aliquoted into two culture plates. One plate was floated on the 37 °C water bath and illuminated with a monochromatic blue light at 470 nm for 30 minutes. The plate was placed 50 cm from the light source. As the control, another plate was wrapped with aluminum foil and incubated at 37 °C in 5% CO2 for 30 min. The cells were then sedimented with a clinical centrifuge. About 1/30 of the cell culture supernatants (300 pi out of 10 ml) were collected and the retinoids were extracted in the presence of hydroxylamine, as described above in this chapter. The cell pellets were homogenized in 300 pi of PBS using a Potter-Elvehjem micro tissue grinder. The retinoids were extracted in the presence of hydroxylamine, as described above in this chapter. Alternatively, the cell pellets were homogenized in 1 ml of PBS using a Dounce glass homogenizer. O f the resulting whole cell homogenates, 300 pi of which was used for immediate retinoid extraction in the presence of hydroxylamine as described above, while 600 pi of which were fractionated by ultracentrifugation at 150,000x g at 4 °C for 1 hr. The supernatants (soluble fraction) and pellets (membrane fraction) were collected and used for retinoid extraction in the presence of hydroxylamine, as described above in this chapter. 3-2-14. Reduction of the endogenous RGR-bound 11-cis-retinal by the bovine RPE membranes -. The freshly-isolated bovine RPE cells were incubated with [3H]all-tr<mv-retinol as described above. After 3 hr of incubation, the cells were illuminated with blue light as described above. The cells were then homogenized in 5 ml of PBS with a Dounce glass homogenizer and fractionated into soluble fraction 59 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. and membrane fraction by centrifugation at 150,000x g at 4 °C for 1 hr. The membrane fraction was resuspended in 600 pi of 10 mM sodium phosphate, pH 6 .6 . The reduction reaction contained 0.1 M sodium acetate, pH 5.0, 500 pM freshly- prepared NADH in 10 mM sodium phosphate, pH. 6 .6 , or no NADH in the control. The reaction was started by mixing the membrane suspension with the reaction buffer and incubated for 10 min at 37 °C. The reaction was terminated with 300 pi of methanol and 30 pi of 2 M NH2OH. The retinoids were extracted with CH2CI2 and analyzed with HPLC as described above. 3-3. RESULTS 3-3-1. Uptake and binding of [3H]retinoid to RGR in ARPE-hRGR cells - The RPE cells produce 11-m-retinoid from all-/ra«.v-retinol in vivo, which is either transported from the outer segment of the photoreceptors or from the choroidal blood circulation. ARPE-hRGR cells and the non-transduced parental ARPE-19 cells were incubated with [3H]all-/nmv-retinol in serum-free RPMI1640 medium. Proteins from both cells were analyzed by gel electrophoresis and fluorography. A single major radioactively-labeled band about ~30-kDa in molecular weight was detected in ARPE-hRGR but not in control ARPE-19 cells (Fig. 3-2). The protein co-migrated with RGR in SDS-PAGE. Under the experimental conditions, no other membrane protein in the ARPE-hRGR cells bound the radiolabeled retinoids. RGR has been shown to be the only membrane protein bound to all-trans- or 11 -c/.v-retinal in the 60 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. RPE as detected by the SDS-PAGE and fluorography after NaBFE reduction (Shen 1994). We concluded that RGR protein in the ARPE-hRGR cells bound the radiolabeled retinol-derivative (the [3H]retinoid). A B * 43 kD a 18.4 Fig 3-2. Uptake and incorporation of [3H]all-tram--retinol into the chromophore of RGR. Normal (A) and lentivirus- transduced (B) ARPE-19 cells were preincubated overnight in serum-free RPMI1640 medium to reduce the endogenous retinoid background. The cells were then incubated for 3 h with [3H]all-tmm'-retinol (10 pCi, 50 Ci/mmol) in RPMI1640. Total membrane proteins (-15 pg per lane) were prepared and reduced by NaBFE. Membrane proteins were analyzed by gel electrophoresis and fluorography. The autoradiographic film was exposed for 1 0 days. The binding of [3FI]retinoid to RGR in ARPE-hRGR cells was dependent on the time of incubation. Binding occurred within 20 min and reached the highest level by 2 h of incubation with [ Hjall-/ram-retinol (Fig. 3-3). Subsequently, the amount of [3H]retinoid bound to the RGR opsin remained relatively steady for up to 6 h of incubation in the dark (Fig. 3-3B). 61 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. A B 20 min 1 hr 3 hr 60 JkDa- 39.2- 28- j u mmm 18.3- Fig 3-3. Specific binding of [3H]retinoid to RGR in cultured ARPE-hRGR cells. (A) Incorporation of precursor [3H]all-trara-retinol into the chromophore of RGR. ARPE-hRGR cells were pre-incubated overnight in serum-free RPMI1640 medium and then incubated with [ H]all-/r<my-retinol (0.25 pCi/ml, 50 Ci/mmol) in RPMI1640 for various lengths of time, as indicated. Total membrane proteins (50 pg per lane) were prepared and reduced with NaBFE. The membranes were analyzed by gel electrophoresis and fluorography. The autoradiographic film was exposed for 15 days. (B) Time course of the binding of [3H]-retinoid to RGR. ARPE-hRGR cells were incubated with [3H]all-/ram-retinol for various lengths of time. The protein bands were analyzed by scanning the autoradiographic films and using Scion Image 1.62c software to determine the relative band density. The results from two separate experiments were averaged and normalized with respect to band density at 1 h. 1 0.5- Time (hr) FIG. 3-4. Labeling of RGR in ARPE-hRGR cells incubated with [3H]all- trans-retinol. About 1.5xl07 ARPE-hRGR cells were incubated with 23 pmol/ml (lane 1), 4.6 pmol/ml (lane 2), 0.92 pmol/ml (lane 3), and 0.18 pmol/ml (lane 4) of [3H]all-/r<mv-retinol, respectively, for 3 h in the dark. The total proteins from each sample were reduced with NaBFE and analyzed with SDS-PAGE and flurography. Each lane contains about 3 pg proteins. 62 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. The labeling of RGR in the ARPE-hRGR cells was also dependent on the concentration of [3H]all-tr<mv-retinol. At the concentrations from 0.18 pmol [3H]all- trans-retinol per ml medium to 23 pmol/ml, the labeling of RGR increased proportionally. This indicates that the highest concentration used in the study did not saturate the labeling of RGR (Fig. 3-4). 3-3-2. Synthesis of all-trans-retinal in cultured ARPE-hRGR cells - The specific binding of [3H]retinoid to RGR suggests that all-tram-retinal is produced in ARPE-hRGR cells as a chromophore for the opsin. To verify that all-fnmv-retinal is synthesized in ARPE-hRGR cells, we extracted [3H]-labeled retinals after incubation of the cells in the presence of [3H]all-tram -retinol. The distribution of [3H]retinoids extracted from the ARPE-hRGR cells included a significant pool of retinyl esters (44%), all-fram-retinal (16%) and all-fram-retinol (40%) (Fig. 3-5, upper panel). The specific radioactivity of [3H]all-P*ara,-retinal from the cells was ~51 Ci/mmol, as determined from the amount of radioactivity and the corresponding absorbance peak of all-trara'-retinal in the HPLC chromatogram. This specific radioactivity was virtually identical to that of the added exogenous [3H]all-/ram,-retinol. The control ARPE-19 cells had a distinct profile of [3H]retinoids and contained retinyl esters (6 6 %), all-/r<mv-retinal (3%) and all-Zram-retinol (31%) (Fig. 3-5, lower panel). Neither type of cell contained significant amounts of 11-cA-retinal or 1 l-c/.v-retinol. The results indicate that the retinal isomer bound to RGR in ARPE-hRGR cells is solely all-tram-retinal. 6 3 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 25000- RE ARPE-hRGR ^ 20000 - Q . 3 , x > 15000- o c § 10000- ( t-ROL :-RAL .... x co 5000- 0 50 100 150 Fraction number 25000- RE ARPE-19 ■g- 20000- Q . •Si s 15000 - 0 £ a: ioooo - 1 t-ROL t-RAL x C O 5000- 0 - 50 100 150 0 Fraction number FIG. 3-5. [3 FI]-Retinoids extracted from cultured ARPE-hRGR and ARPE-19 cells. ARPE-hRGR and control ARPE-19 cells were preincubated overnight in serum-free RPMI1640 medium. Subsequently, the cells were incubated with [3H]all- trara-retinol (0.25 pCi/ml, 50 Ci/mmol) in RPMI1640 for 3 h. The [3 H]-retinoids were then extracted from the cells in the presence of hydroxylamine and separated by HPLC. Four drops of eluate were collected per fraction from 4 to 27.5 min and the radioactivities were counted. RE, retinyl ester; t-RAL, syn-all-tram-retinaloxime; t- ROL, all-/ram'-retinol. 6 4 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 10 - t-RAL t o X I o C D C O 10 12 14 16 18 20 22 C D O C C O 40 i— o (f) 40 < 2 - A B i i i i i i i * "T"'" *p t i 1 i 1 1 1 i 1 1 % r * * 1 1 1 i' 10 12 14 16 18 20 22 2 - I 0 i T 1 I I "" I ■ ■ ■ I ’ ■ ■ I ■ 1 ’ I 1 1 - I ■ ’ - I 1 10 12 14 16 18 20 22 Elution time (min) FIG. 3-6. Endogenous all-Zram-retinal in cultured ARPE-hRGR cells. ARPE- hRGR and non-transduced control ARPE-19 cells were cultured in serum-containing or serum-free DME/F12 (1:1) medium. all-frvms-Retinal was extracted by hydroxylamine derivatization and separated by HPLC. (A) ARPE-hRGR and (B) control ARPE-19 cells cultured in serum-containing medium. (C) ARPE-hRGR cells cultured in serum-containing medium and subsequently incubated in serum-free medium for 16 h. t-RAL, syn all-fnms-retinaloxime. 6 5 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. o 16 12 >< g' | ) < 4 ()J A P i o J n T ------1 ----- r~ 8 10 12 B 8 10 12 c *9 ? v v * IA, 8 10 12 16 12 - O x 8- 0 « 5 p4 D 8 10 12 E ? * WW W \^ t i r~ 8 10 12 a P i V . t ------1 ------r- 8 10 12 Fig. 3-7. Photoisomerization of the all-fram-retinal bound to RGR in ARPE- hRGR cells. ARPE-hRGR cells (1.5 xlO7 ) cultured in the dark were collected in 0.3 ml PBS. Monochromatic light at 470 nm was used to illuminate the cell suspension (A) or cell suspension mixed with 1% SDS (B). Aliquots of ARPE-hRGR cell suspension (D), or cell suspension mixed with 1% SDS (E), were kept in the dark as control. Control ARPE-19 cells (1.5 xlO7 ) mixed with 5 pmol of all-tr(ms-retinal (C), or the free all-tnms-retinal (1 nmol) dissolved in 10 pi hexane and dispersed in PBS (F) were illuminated with 470 nm monochromatic light. Retinal isomers were extracted by the method of hydroxylamine derivatization and analyzed by HPLC. The X axis represents elution time in minutes. tRal, syn all-/r<ms-retinaloxime; cRal, syn 1 l-cE-retinaloxime; *, syn 13-cz.v-retinaloxime; ?, unidentified peak. 66 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. ARPE-hRGR cells cultured in growth medium also synthesize the all-trans- retinal chromophore from a precursor in serum (Fig. 3-6). The fresh culture medium supplemented with 10% FBS contains at least 30 pmol/ml of all-fram-retinol. all- trara'-Retinal was found in ARPE-hRGR cells (Fig. 3-6A), but not in control ARPE- 19 cells that were maintained in serum-containing medium (Fig. 3-6B). When the ARPE-hRGR cells were incubated in serum-free medium for 16 h, all-/r<mv-retinal fell to an undetectable level (Fig. 3-6C). 3-3-3. Photoisomerization of all-trans-retinal bound to RGR in ARPE-hRGR cells - all-tram-Retinal bound to RGR purified from bovine RPE and solubilized in buffer containing 0.1% digitonin could be isomerized to 11-ei.v-isomer upon illumination with 470 nm light beam (Hao 1999). Recombinant RGR protein expressed in ARPE-hRGR was capable of binding all-frara'-retinal in vitro and did bind to alE/rara-retinal in cultured cells. The physiological relevance of the binding was further tested by photoisomerization of the RGR-bound all-/nmv-retinal in ARPE-hRGR cells (Fig. 3-7). ARPE-hRGR cells were illuminated with 470 nm monochromatic beam of light in PBS buffer. The amounts of all-trans and 1 l-cis retinals in the ARPE-hRGR cells before illumination (Fig. 3-7D) were 2.60 pmol and 0 pmol, respectively. After blue light illumination, the amounts of all-trans and 11- cis retinals changed to 1.12 pmol to 0.55 pmol, respectively (Fig. 3-7A). 13-cA- Retinal, a non-specific thermal isomerization product from all-/r<mv-retinal, was not detected. The ARPE-hRGR cells denatured with SDS did not undergo specific photoisomerization from all-frara'-retinal to 11 -cis isomer (Fig. 3-7, B and E). The 67 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. non-specific thermal isomerization product, 13-cw-retinal, was detectable in one sample. all-frara-Retinal, either mixed with ARPE-19 cells or free in PBS buffer, was not specifically isomerized to 1 l-cis isomer with illumination under the experimental conditions (Fig. 3-7, C and F, respectively). A B 121 NADP 40- «---- 200 Time (min) Cofactor (fiM) FIG. 3-8. all-Pvmy-Retinol dehydrogenase activity in ARPE-hRGR microsomal membranes. (A) all-trans-Retinol dehydrogenase activity in the presence of NADP or NAD. ARPE-hRGR membranes (0.2 mg protein/ml) were incubated for 10 min with [3 H]all-/r<ms-retinol in the presence of various concentrations of NADP or NAD. The reaction products were extracted by hydroxylamine derivatization and analyzed by HPLC. The results are expressed as the percentage of precursor [3H]all-/ra«.y-retinol converted to [3 H]all-/ram--retinal. (B) NADPH-dependent retinol dehydrogenase activity with all-fram’ -retinol or 11- cw-retinol substrate. ARPE-hRGR membranes (0.5 mg protein/ml) were incubated with 5 uM exogenous all-/ram-retinol or 11-cw-retinol in the presence of 200 pM NADP. Retinals were extracted by hydroxylamine derivatization and analyzed by HPLC. The extraction efficiency was monitored by the addition of [3H]all-trans- retinol after reaction but before extraction as an internal standard. 3-3-4. all-trans-Retinol dehydrogenase activity in ARPE-hRGR cells - The production of the all-trans-retinal chromophore from all-/r<mv-retinol requires an oxidation reaction. The proposed enzymatic reaction may be catalyzed by a previously uncharacterized all-/r<mv-retinol dehydrogenase in the RPE. We tested 68 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. microsomal membranes from ARPE-hRGR cells for all-fram-retinol dehydrogenase activity in presence of nicotinamide dinucleotide cofactors. The membranes were capable of producing all-Pvmy-retinal from all-fnms-retinol in the presence of NADP but not NAD (Fig. 3-8A). At concentrations of NADP >8 pM, the synthesis of all- p-arcs-retinal increased 5-fold in comparison to activity without cofactor or with NAD. The putative NADPH-dependent retinol dehydrogenase strongly preferred the all-trans isomer of retinol and did not react with 11-cA-retinol (Fig. 3-8B). Enzyme Source NADP (pM) Product/Substrate Membrane proteins from ARPE-19 200 18.31 ±0.12% 0 3.56 ±0.60% Membrane proteins from ARPE-hRGR 200 49.09 ± 0.96% 0 5.28 ±0.58% Purified RGR protein complex 200 4.89 ± 0.43% 0 3.17 ±0.39% Table 3-1. The all-fram-retinol dehydrogenase activities in ARPE-19, ARPE-hRGR, and the RGR protein complex purified from bovine RPE cells. Each reaction contained 45 pg of membrane proteins, except for the RGR complex, where 10 pi of the sample were used in each reaction. The membranes were incubated with [3H]all-/ram-retinol in the presence or absence of NADP cofactor. The product was extracted in the presence of NH2OH and analyzed by HPLC. The results were presented as the mean percentage ( ± standard deviation) of conversion from substrate (all-/r<mv-retinol) to product (all-tran.v-retinal), as determined by radioactivity counting. Duplicate experiments were performed. The microsomal membranes from control ARPE-19 cells were also capable of catalyzing the oxidation of all-/ram-retinol to all-fr<mv-retinal in the presence of NADP (Table 3-1). The putative NADP-dependent all-/r<mv-retinol dehydrogenase activity in ARPE-19 cells was much lower than that of the ARPE-hRGR cells. We 69 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. further tested the all-fram-retinol dehydrogenase activity in a sample containing bovine RGR and some other proteins that were presumably co-purified with bovine RGR from bovine RPE (sample provided by Pu Chen). This mixture contained 11- cw-retinol dehydrogenase, which utilizes NADH to catalyze the oxidation/reduction of 11-cA-retino 1/retinal, and possibly RPE65 (Chen 2001b). However, no NADP- dependent all-/r<mv-retinol dehydrogenase activity was detected in this mixture of RGR and co-purified proteins (Table 3-1). A B C D 50 kDa- 37 - 25- W M RE 30000 syn 20000 anti 10000 0 150 Fraction number FIG. 3-9. Incorporation of precursor [3 H]all-/r<ms-retinol into the chromophore of RGR in bovine RPE cells. (A) [3 H]retinoid-bound proteins in bovine RPE membranes. Total membrane proteins (240 pg) were reduced by NaBH 4 and analyzed by gel electrophoresis and fluorography. The autoradiographic film was exposed for 22 days. (B) Immunoblot analysis of membrane proteins (40 pg) indicating immunoreactivity to an anti-bovine RGR antibody. R1 antibody was used to detect bovine RGR. (C) Immunoblot analysis of the membrane proteins from fresh bovine RPE cells (20 pg) and the bovine RPE cells cultured for 5 days (4 pg). The protein molecular weight standard markers used in A, B, and C were commercial recombinant proteins obtained from Bio-Rad (Hercules, CA). R1 antibody was used to detect bovine RGR. (D) [3 H]Retinoids from bovine RPE cells isolated from six eyes and incubated with [3 H]all-tnmv-retinol for 3 h. The [3 H]retinoids were extracted in the presence of hydroxylamine and separated by HPLC. Four drops of eluate were collected per fraction from 4 to 29.5 min. RE, retinyl ester; t-RAL, all-/ram'-retinaloxime; c-RAL, 11-m-retinaloxime; t-ROL, all- trans-retinol; c-ROL, 11-cA-retinol. 70 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 3-3-5. Uptake and binding of [3 H]retinoid to RGR in isolated bovine RPE cells - Although the parental ARPE-19 cells maintain many characteristics of RPE cells, they are highly deficient in the expression of several RPE proteins, including RGR, and may not function normally. To demonstrate that the synthesis of all-trans- retinal and specific binding of the chromophore to RGR are physiological properties of normal RPE cells, we incubated freshly isolated bovine RPE cells with precursor [3H]all-/ram’ -retinol (Fig. 3-9). The uptake of [3H]all-/nms-retinol resulted in radiolabeling of a specific protein band that was equal in size to the RGR opsin (Fig. 3-9A). RGR was detectable in bovine RPE primary culture by Western blot assay after the short-term incubation (Fig. 3-9B), but not after 5 days of culture (Fig. 3- 9C). After 3 h of incubation, the cells synthesized retinyl esters (62%), a\\-trans- retinal (23%), 11-cA-retinal (2%), and 11-cA-retinol (2%) (Fig. 3-9D). dX\-trans- Retinol (7%) and a small amount of 13-cA-retinal (3%) were also extracted from the bovine RPE cells. 3-3-6. (1,(3-Carotene as the source of all-trans-retinal - Cleavage of P,P- carotene by a newly-identified p,p-carotene-15’,15’-dioxygenase (Bcdo) in RPE gives two molecules of all-trara-retinal (Redmond 2001, Yan 2001) and could provide the chromophore for RGR. We tested whether the ARPE-hRGR cells could utilize the P,P-carotene supplemented in the culture medium. Retinals were extracted by hydroxylamine derivatization and analyzed by HPLC. No all-trans- retinal was detected inside the ARPE-hRGR cells after 4 h of incubation (Fig. 3-10). 71 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. We further tested whether the microsomal membrane proteins, prepared from ARPE- hRGR cells, have the P,P-carotene-15’,15’-dioxygenase activity. No all-tram-retinal was detected from the cleavage of P,p-carotene in the reaction system after 2 h of incubation (Fig. 3-10). 0.06 0.04 0.02 0 0.0008 0.0004 0 0 C Q 1 A cd P i i ic. c 0 P Q 1 I n . , ^ , , --- B cd P i D 4 8 12 16 min 4 8 12 16 min F ig 3-10. Utilization of p,p-carotene by ARPE-hRGR cells to generate all tram-retinal. ARPE-hRGR cells (A and C) or the membranes from ARPE-hRGR cells (B and D) were incubated with (A and B) or without (C and D) P,P-carotene. Retinoids were extracted by hydroxylamine derivatization and analyzed by HPLC. Note that ARPE-hRGR cells pre-incubated with serum-free (thus retinol free) medium did not contain detectable all-tram-retinal (see Fig. 3-6). The X axis represents elution time in HPLC, and Y axis represents the absorbance (AU). BC, p- carotene; tRal, all-tram-retinal. 7 2 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 3-3-7. Cell-free synthesis and binding of all-trans-retinal to RGR in vitro - Since the accumulation of alL/ram-retinal in ARPE-hRGR and ARPE-19 cells was dependent on the presence of RGR (Figs. 3-5 and 3-6), the synthesis or stability of all-/r<ms’ -retinal may be connected with its binding to the opsin. To investigate chromophore synthesis and binding to RGR in an in vitro system, we incubated A 1 B 2 1 50 kDa - 37 25 Fig. 3-11. Linkage of synthesis and binding of all-fram-retinal to RGR in vitro. (A) ARPE-19 (lane 1) and ARPE-hRGR (lane 2) microsomal membranes (88 pg protein each) incubated with [ H] all-trans-retinol in the presence of 200 pM NADP. (B) Synthesis and binding of all-trans-retinal to bovine RGR. Bovine microsomal membranes (54 pg protein each) were washed 3 times with PBS and incubated with [3 H]all-trans-retinol in the absence (lane 1) or in the presence (lane 2) of 200 pM NADP. The membrane proteins were reduced with NaBH4 after incubation and analyzed by SDS-PAGE and fluorography. The autoradiographic films were exposed for 13 and 15 days in A and B, respectively. 73 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. isolated RPE membranes with [3 H]all-/ram- -retinol in the presence of NADP and analyzed the binding of [3 H]retinoid to RGR. The results indicated that [3 H]all- frara'-retinal was synthesized in membranes and bound directly to RGR with high specificity (Fig. 3-11). Nontransduced ARPE-19 cells did not contain the radiolabeled ~30-kDa protein band (Fig. 3-11 A). The binding of [3H]retinoid to RGR in bovine RPE microsomes was stimulated 3.1 fold by addition of NADP (Fig. 3-1 IB). The results indicate that all-trans-retinal, which is synthesized by the membrane-associated all-trans-retinol dehydrogenase, can be channeled to the binding site of RGR in the cell-free system. 2500 cx 2000 - 2000 1500- 1500 1000 - 1000 500- 500 A B Fig. 3-12. Photoisomerization of all-trans-retinal to 11-cis-retinal in the freshly-isolated bovine RPE cells. RPE cells from 10 bovine eyes were incubated with [3 H] all-trans-retinol for 3 hr in 37 °C in the dark. An aliquot of the culture was then illuminated with 470 nm light for 30 min (A), while another aliquot in the dark (B). The retinoids were extracted in the presence of NH 2OH and analyzed by HPLC. The HPLC eluates were collected 4 drops per fraction and radioactivities were counted. X axis represents the fraction numbers, while Y axis represents the radioactivity of each fraction. 11 -ds-retinal, syn-11 -c/s-retinaloxime; all-trans- retinal, syn-all-trans-retinaloxime. 74 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 3-3-8. Photoisimerization of RGR-bound all-trans-retinal in the bovine RPE cells - Bovine RPE cells were isolated from bovine eyes and immediately incubated with [3 H]all-trans-retinol. Fig. 3-9 demonstrated that the freshly-isolated bovine RPE cells were able to uptake the all-trans-retinol, oxidize it to generate all-trans- retinal for the chromophore of RGR. We further tested whether blue light illumination could photoisomerize the newly-formed all-trans-retinal that bound to RGR. The bovine RPE cell culture was illuminated with 470 nm light for 30 min. 11-cA-Retinal was generated after blue light illumination (Fig. 3-12). In a typical photoisomerization reaction, the ratio of all-trans- to 1 l-c/.v-retinal in the bovine RPE cells was 1:0.2 (4557 cpm to 928 cpm) before blue light illumination, and 1:1.03 (3385 cpm to 3507 cpm) after illumination (Fig. 3-12). 3-3-9. Reduction of 11-cis-retinal after generation from RGR-mediated photoisomerization - Illumination of the RGR-bound all-/r<ms-retinal generated 11- c/,v-retinal with purified RGR protein (Hao 1999), with ARPE-hRGR cells (Fig. 3-7, see above in this chapter), and with bovine RPE cells (Fig. 3-12, see above). The possible fate of the 11 -e/.v-retinal product may include (1) reduction to 11-cz.v-retinol by 11 -cA-retinol dehydrogenase, and further esterification to 11 -c/.v-retinyl palmitate; (2) transfer to cellular retinaldehyde-binding protein (CRALBP); (3) oxidation to retinoic acid and further degradation. The first two possibilities were supported by in vitro study with purified RGR protein (Chen 2001b, and Pu Chen, unpublished data). The RPE cell culture system was utilized to test whether RGR 75 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Dark 60001 4000- 2 0 0 0 - 60001 Light 4000- 2 0 0 0 - llcR al (syn) ATRal (syn) Uniden tified llcR al (anti) Uniden tified llcR ol ATRal or (anti) ATRol Light (cpm) 3862 5137 2756 1501 2426 136 130 1003 Dark (cpm) 1586 8698 2905 723 2684 988 263 1567 Fig. 3-13: Retinal and retinol contents in bovine RPE cells after blue light • • • ^ . illumination. RPE cells were incubated with 1.0 pCi/ml [ H]all-//'<mv-retinol for 3 hr and then illuminated with 470 nm monochromatic light for 30 minutes. The retinol and retinal isomers were extracted in the presence of NH2OH and analyzed by HPLC. The HPLC eluates were collected 4 drops per fraction and radioactivities were counted. The radioactive retinoids were identified by comparing the retention time with the known standards, as shown in Fig. 3-1, A and B. 1l-cfs-Retinol and all-tram-retinaloxime (anti) were not separated clearly. X axis represents the fraction number, while Y axis represents the radioactivity of each fraction. The total radioactivity of each peak, as shown in the table, was obtained by adding up the radioactive counts of all the fractions in that peak. 1 lcRal (syn), syn-11 -cis- retinaloxime; ATRal (syn), syn-all-trara-retinaloxime; llcR al (anti), anti-1 \-cis- retinaloxime; ATRal (anti), anti-aIl-/r<mv-retinaloxime; llcR ol, 11-cA-retinol; ATRol, all-trara-retinol. 7 6 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. photoisomerization product, 11-m-retinal, could be reduced to 1l-m -retinol, or transferred to CRALBP in live cells. In bovine RPE cells with or without illumination, the ratio of all-trans- to 11- c/.v-retina! was 1:0.18 (8698 cpm to 1586 cpm) before blue light illumination, and 1:0.54 (5137 cpm to 2756 cpm) after illumination (Fig. 3-13). The amount of 1 l-cA- retinol in the blue light-illuminated RPE cells was similar to that of the control cells kept in the dark (Fig. 3-13). Since 11-c/s-retinol could form 11-c/.v-retinyl esters, about 70% of which is 11-cA-retinyl palmitate in the RPE cells (Biesalski 1990), we analyzed the retinyl ester contents in the bovine RPE cells before and after illumination. Blue light did not cause significant change in the amount of 11 -c/.s- retinyl palmitate (2899 cpm), as compared with the control cells (2788 cpm) kept in the dark (Fig. 3-14). The freshly-isolated RPE cells could be abnormal in the intracellular concentrations of ATP/ADP, NADH/NAD, and/or NADPH/NADP (Timmers 1991). Lack of NADH in the RPE cells could result in the failure to reduce 11-c/x-retinal to 11-cA-retinol by the NADH-dependent 1 l-c/.v-retinol dehydrogenase. We tested whether exogenous NADH could facilitate the reduction of 1 l-c/.v-retinal to 11 -c/,v- retinol in vitro. Membranes of the bovine RPE cells were capable of reducing 11- cA-retinal to 11-cA-retinol in the presence of 500 pM of NADH (Fig. 3-15). The total amount of 11-c/s-retinal and 11-cA-retinol (8886 cpm) after incubation with NADH did not change from that of the 11-c/v-retinal and 1 l-c/.v-retinol (8040 cpm) without NADH treatment (Fig. 3-15). Surprisingly, all-/ran.v-retinal was also 77 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. reduced in the presence of NADH. However, the amount of all-fram-retinal and all- trans-retinol (6329 cpm) after NADH treatment was only about half of that (12595 cpm) before NADH treatment. This indicates that all-/r<mv-retinol was further processed, likely to form all-tram'-retinyl esters. 3-3-10. Transfer of 11-cis-retinal from RGR to CRALBP after photoisomerization -. The possible fate of 11-cw-retinal generated by RGR- mediated photoisomerization also includes a direct transfer from RGR to the cellular retinaldehyde-binding protein (CRALBP). Since RGR is associated with the membrane fraction while CRALBP is a soluble protein (Saari 1994), we should be able to detect the transfer of [ H] 11-cA-retinal from RGR to CRALBP by measuring the radioactivities in the aqueous fraction and membrane fraction of the RPE cells. The cellular contents of the bovine RPE cells were fractionated into soluble fraction and membrane fraction by ultracentrifugation at 150,000x g for 1 hr. The radioactive 1 l-c/.v-retinal and all-tr<ms-retinal were identified only in the membrane fraction but not in the soluble fraction (Fig. 3-16). 7 8 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 4000 4000- 2000 - Light m cd s? w cd o pq 2000h 2 % ,1 h t\ A U \ 0 4 » Dark U 4 cd a w cd o CO 1\ 11 Q [ - * J . * * * * * * . * » ^ * * * * « 4 V * j i i 13cRE llcR E Unidentified ATRE Light (cpm) 5100 2899 3416 20686 Dark (cpm) 5468 2788 3181 18215 Fig. 3-14. Retinyl ester contents in bovine RPE cells after blue light illumination. RPE cells isolated from 10 bovine eyes were incubated with 1.0 pCi/ml [ H]all-/r<mv-retinol for 3 hr and then illuminated with 470 nm monochromatic light for 30 minutes. The retinyl esters were co-extracted with retinol and retinal isomers. The retinyl ester fraction was collected during the analysis of retinol and retinal isomers with HPLC, and analyzed with a second HPLC separation. The radioactive retinyl palmitates were identified by comparing the retention time with the known standards, as shown in Fig. 3-1, C. The total radioactivity of each peak, as shown in the table, was obtained by adding up the radioactive counts of all the fractions in that peak. 13cRE, 13-cis-retinyl palmitate; 1 lcRE, 11 -c/.s-retinyl palmitate; ATRE, all-/ram-retinyl palmitate. 7 9 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 5000 4000 3000 2000 1000 0 5000 4000 3000 2000 1000 0 NADH i NADH % < 3 O 5 2 [\ -'//■ - Elution time (min) Q C C A llcR al ATRal llcR ol ATRol With NADH 1690 cpm 2476 cpm 7196 cpm 3853 cpm Without NADH 4785 cpm 10074 cpm 3255 cpm 2521 cpm Fig. 3-15. NADH promoted the reduction of 11-cA-retinal in bovine RPE membrane. The membranes were collected from bovine RPE cells after 3 hr of incubation with [3H]all-;r<mv-retinol and 30 min of blue light illumination. The membranes were incubated either with or without 500 pM NADH in 100 mM NaAc, pH 5.0 for 10 min. The retinoids were extracted in the presence of NH 2OH and analyzed by HPLC. The HPLC eluates were collected 4 drops per fraction and radioactivities were counted. The radioactive retinoids were identified by comparing the retention time with the known standards, as shown in Fig. 3-1, A and B. The total radioactivity of each peak, as shown in the table, was obtained by adding up the radioactive counts of all the fractions in that peak. 1 lcRal, syn-11-cA-retinaloxime; ATRal, syn-all-/ram-retinaloxime; llcR ol, 11-cA-retinol; ATRol, all-/ram-retinol. 8 0 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 5000 4000 3000 2000 1000 Time Dark Light Membrane fraction 11-cA-retinal 891 cpm 2389 cpm all-/r<mv-retinal 7379 cpm 5998 cpm Soluble fraction 11 -cw-retinal 0 0 all-fraus-retinal 0 0 Fig. 3-16. Distribution of retinals between the membrane fraction and the soluble fraction of the bovine RPE cells. The Bovine RPE cells were incubated with [3FI] all -tram-retinol for 3 hr then illuminated with blue light for 30 min. The cells were collected and homogenized. The homogenates were fractionated by ultracentrifugation at 150,000x g for 1 hr. The retinoids from the membrane fraction and soluble fraction were extracted and analyzed by HPLC. Only radioactive syn-11- cz.y-retinaloxime and syn-all-fram'-retinaloxime were counted. The radioactive retinoids were identified by comparing the retention time with the known standards, as shown in Fig. 3-1, B. The total radioactivity of each peak, as shown in the table, was obtained by adding up the radioactive counts of all the fractions in that peak. llcR al, syn-11-cw-retinaloxime; ATRal, syn-all-/nmy-retinaloxime. Line 1, membranes without illumination; Line 2, membranes with blue light illumination; Line 3, soluble fraction without illumination; and Line 4, soluble fraction with blue light illumination. 81 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 3-4. DISCUSSION Little was known about the synthesis of all-/ra«s-retinal as a chromophore for the RGR opsin in RPE cells. The endogenous all-tram-retinal bound to RGR may be synthesized directly from all-fram-retinol that is generated upon phototransduction, or from serum all-fram-retinol. This reaction would require a novel all-fram-retinol dehydrogenase in the RPE. In this chapter, we demonstrated further evidence for the oxidation of precursor all-tram-retinol in RPE cells and its physiological incorporation into the chromophore of RGR in the dark. After its uptake into RPE cells, all-tram-retinol is converted rapidly into retinyl esters. The esterification of retinol is catalyzed by LRAT, the activity of which is higher than is known for most other visual cycle enzymes. In addition to esterification, our results indicate that retinol is oxidized efficiently and that significant amounts of all-trans-retinal accumulate in ARPE-hRGR and bovine RPE cells in the absence of light. Despite the high LRAT activity, the ratio of all-trans- retinal to retinyl esters formed after 3 h of incubation with precursor all-trans-retinol is 1:2.8 and 1:2.7 in ARPE-hRGR and bovine RPE cells, respectively. Since the specific activity of [3H]all-trans-retinal in the ARPE-hRGR cells was close to that of the precursor [3 H]all-trans-retinol, all-trans-retinol can be converted directly into all- trans-retinal without entering the pool of endogenous retinyl esters. The results suggest that retinol esterification by LRAT and oxidation by an all-trans-retinol dehydrogenase represent an early and important bifurcation point in the processing of retinol after uptake into RPE cells. The esterification and oxidation are both 82 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. critical reactions for continuance of the visual cycle in that they catalyze formation of the substrate for a putative isomerohydrolase (Law 1988, Deigner 1989, Canada 1990) and the chromophore for RGR, respectively. The difference in steady-state levels of all-trans-retinal in ARPE-hRGR and ARPE-19 cells indicates that the accumulation of all-trans-retinal is highly dependent on the presence of RGR. Although the membranes from ARPE-19 and other cells contain constitutive NADPH-dependent all-trans-retinol dehydrogenase activity and are capable of synthesizing all-trans-retinal from all-trans-retinol, all- trans-retinal generally does not accumulate in these cells (McCormick 1982, Williams 1984, Napoli 1986). Normal RPE and cultured ARPE-hRGR cells have uniquely elevated levels of all-trans-retinal, which may be stabilized by covalent binding to RGR. The sequestration of all-trans-retinal to RGR would block the retinoid from reversible reduction, oxidation to retinoic acid, formation of non specific Schiff bases, and possible generation of harmful 6/s-retinoid, A -retinylidene- A'-retinylethanolamine compounds within the RPE (Parish 1998). The irradiation of ARPE-hRGR cells resulted in stereospecific isomerization of all-trans-retinal to 11-c/s-retinal. As consistently observed with RGR purified from bovine RPE, the stereospecific photoisomerization indicates a functional recombinant RGR and the physiological activity of the endogenous all-trans-retinal. The absence of non-specific isomerization product (13-c/s-retinal) indicates that the majority, if not all, of all-trans-retinal is bound to RGR in ARPE-hRGR cells. 83 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Our finding of all-trans-retinal synthesis and accumulation in RPE cells is not inconsistent with data from previous studies. Timmers et al. have demonstrated a slow constant increase in the synthesis of all-trans-retinal in isolated bovine RPE cells (Timmers 1991). Others have reported NADPH-dependent all-trans-retinol dehydrogenase activity in RPE membranes. As early as 1975, Zimmerman et al. noted that RPE microsomes contain a relatively high amount of all-trans-retinol dehydrogenase activity in membrane vesicles that fractionate separately from contaminant membranes with the photoreceptor all-trans-retinol dehydrogenase (Zimmerman 1975). These interesting findings further support the notion that the all-trans-retinal chromophore is synthesized by a novel all-trans-retinol dehydrogenase in the RPE. We hypothesize that this enzyme is responsible for chromophore synthesis in ARPE-hRGR cells. Nevertheless, the putative RPE all-trans-retinol dehydrogenase has not been identified unequivocally. Our results indicate that the retinol dehydrogenase in ARPE-hRGR cells is membrane-bound, prefers NADP as the cofactor in oxidation, and has high substrate stereospecificity for all-trans-retinol versus the 11 -c/s isomer. Preliminary results indicated that although 11-c/s-retinol dehydrogenase has been consistently copurified with RGR, the putative all-trans-retinol dehydrogenase was not present in the same protein copurification complex, as determined by the absence of the all-trans-retinol dehydrogenase activity (Table 3-1). Since it is not clear whether the putative tRDH activity is in the plasma membrane or in the endoplasmic membrane where RGR resides, the physical association of RGR and tRDH is still 84 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. speculative. Further characterization of the all-trcm-retinol dehydrogenase in ARPE-hRGR and isolated RPE cells is required. To investigate the coupling between chromophore synthesis and its binding to RGR, we examined the reactions in vitro. In a cell-free membrane system, RGR had apparent and specific access to the newly synthesized all-/rara-retinal. The microsomal membranes of both the human ARPE-hRGR cell line and bovine RPE cells were sufficient for the synthesis of all-/nmv-retinal and its channeling to the binding site of RGR. The results indicate that both cells contain a membrane-bound all-frara-retinol dehydrogenase and may have a highly conserved system of providing the chromophore of RGR. The binding of [3H]all-/ram-retinal to RGR was enhanced in the presence of NADP, although RGR was also radiolabeled in the absence of added cofactor. Like preparations of various dehydrogenases (Kato 1973), it is likely that the washed membranes still contained a significant amount of endogenous enzyme-bound NADP that allowed background synthesis of [3 H]all- trans-retinal. The all-fram-retinal chromophore of RGR may be synthesized also from precursor P,P-carotene by the oxidative cleavage activity of an enzyme, p,p- carotene-15,15'-dioxygenase (Bcdo) that has been found in the RPE (Redmond 2001, Yan 2001). The oxidative cleavage of P,P-carotene by Bcdo would directly generate all-trara'-retinal under dark or photic conditions. The all-lr<mv-retinal synthesized from p,P-carotene may then bind to RGR physiologically. In humans, P,p-carotene and vitamin A are available to the RPE at plasma levels of 0.171-0.216 and 0.548- 85 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 0.587 (ig/ml, respectively (Schtinermann 2001). In our preliminary experiments we failed to demonstrate the oxidative cleavage of (3,p-carotene by ARPE-hRGR cells, indicating a possible shut-down of Bcdo gene expression in ARPE-hRGR cells. On the other hand, only all-fnmy-retinol is transported from the photoreceptors to the RPE as an intermediate in the visual cycle. Consequently, the RPE all-fAms-retinol dehydrogenase would be required to process all-/r<mv-retinol rapidly in a continuous photic visual cycle. The indispensable role of RGR in the photic visual cycle has been established with evidence from in vitro biochemical study, in vivo study of the RGR gene knockout mouse, and the study with cultured RPE cells (Chen 2001b, Hao 1999, Yang 2002). However, it still remains unclear as to the precise function of RGR in the photic visual cycle. On one hand, RGR could be a photoisomerase per se that catalyzes the isomerization of all-fram-retinal to 1 l-c/.v-retinal in the RPE, using light as the energy source. Alternatively, RGR could function as a G protein-coupled receptor that activates a yet-unknown mechanism to produce 11 -c/.v-retinoids in the RPE, while light serves as the signal to activate RGR. In the photoisomerase model, it is needed to demonstrate the enzymology properties of RGR, especially high reaction rate to account for rhodopsin regeneration in vivo. It is also needed to identify the steps by which the product of this photoisomerization reaction, 11 -cis- retinal, is transferred from the RGR in the RPE to the rhodopsin in the photoreceptors. In the G-protein model, it is needed to identify the G-protein that is coupled with RGR, as well as the reactions that are stimulated by RGR activation. In 86 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. this scenario, the processing of the receptor activation product, 11-cz.y-retinal, might be related to the deactivation and regeneration of the RGR receptor. Understanding how 11 -cry-retinal is further processed in the RPE cells could shed light on the function of RGR in the photic visual cycle. Preliminary results indicated that under the cell culture conditions used in our experiments, 11 -c/.y-retinal was neither reduced to 1 l-c/.s-retinol and further esterified to 11 -cz'y-retinyl palmitate, nor transferred to the soluble CRALBP carrier protein. The failure to detect any processing of the 11-c/y-retinal in the cultured RPE cells could be due to the unfavorable conditions of the cell culture environment. As reported previously, the intracellular concentrations of ATP versus ADP in the freshly-isolated RPE cells differ from those of the healthy RPE (Timmers 1991). Specifically, lack of NADE1 cofactor could result in the failure to reduce 11 -cis- retinal by the NADH-dependent 11-cz'y-retinol dehydrogenase in cultured cells. Supportive to this notion, addition of NADH cofactor to the membranes promoted the reduction of 11-cA-retinal (Fig. 3-15). On the other hand, the intracellular processing of 11-cA-retinal could be a complicated and highly regulated process (McBee 2001). Lack of a large pool of non-chromophoric 1 l-c/,v-retinal (meaning not bound to opsins as the chromophore) or its immediate precursor 11-cA-retinol tends to argue that 11 -c/.y-retinal is synthesized on demand in the RPE (McBee 2001). The intracellular condition as well as the interactions between RPE and the photoreceptors or the choroidal circulation could play important roles in determining the production of 11-cz.v-retinal. In the in vivo conditions, interphotoreceptor 87 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. retinoid-binding protein (IRBP) and ultimately the opsins in the photoreceptors could provide a molecular sink for the 11-cw-retinal, promoting the generation and transportation of 1 1-cA-retinal in the RPE by mass action (Saari, 1994). Lack of such a molecular sink in the cell culture conditions could also result in our failure to observe further processing of the 1 l-c/.v-retinal in the cultured RPE cells. A corollary for such speculations is that the cultured RPE cells could be manipulated to mimic the in vivo conditions for the study of 11-cis-retinal processing. Like rhodopsin, the RGR opsin relies on retinol dehydrogenases for the processing of its retinal chromophore in biochemical pathways that lie upstream and downstream of photoisomerization. In contrast to the two-cell rhodopsin system, the a\\-trans-retinal chromophore of RGR is synthesized by a proximal retinol dehydrogenase within membranes of the RPE itself. After irradiation of RGR, the bound 11-cA-retinal is dissociated and converted to the alcohol by 11-cA-retinol dehydrogenase (Chen 2001b). RGR and the 11-uA-retinol dehydrogenase co-purify consistently and may be tightly associated in a protein complex. The evidence for functional interaction of all-/r<mv-retinol dehydrogenase, RGR opsin, and 11 -cis- retinol dehydrogenase suggests a model for the flow of retinoids in the photic visual cycle (Fig. 3-17). In this model, alL/rans-retinal is converted to 11 -c/.v-retinal by rapid photoisomerization and the overall rate of conversion of all-irans retinoids to the 11 -cis isomer is limited by binding kinetics and the enzymatic reactions catalyzed by the retinol dehydrogenases. The ARPE-hRGR and isolated RPE cells 88 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. provide a promising approach to compare and analyze the biochemistry and kinetics of retinoid processing in the RGR system. RGR W RAL Light RGR c-RAL t-Ral G* o ii D t-Ro) Carbocation intermediate ( q . o Rol c-Ral t-RE N < b c-RE L U a. a: t-Rol % ♦ t-Ral \ t-RAL c-Ral Light c-RAL (^Rhodopslp) (^Rhodopsj^) a a > a £ o •H O sz CL FIG. 3-17. Proposed model of the photic visual cycle and interaction of retinol dehydrogenases with the chromophore of RGR. A light-dependent pathway of the visual cycle and regeneration of rhodopsin is dependent on RGR. See text for details. t-RAL, all-fram-retinal; t-ROL, all-/r<mv-retinol; t-RE, all-Zram'-retinyl ester; c-RAL, 11-cA-retinal; c-ROL, 11-cw-retinol; c-RE, 11-cA-retinyl ester; prRDH, photoreceptor retinol dehydrogenase; LRAT, lecithimretinol acyltransferase; REH, retinyl ester hydrolase; t-RDH; all-rnmy-retinol dehydrogenase; c-RDH, 11- cxs-retinol dehydrogenase. 8 9 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. CHAPTER 4 THE RGR-D PROTEIN IN THE PATHOGENESIS OF RPE 4-1. INTRODUCTION RGR is essential for maintaining normal levels of 11 -cA-retinal and rhodopsin in the retina. Impairment of RGR function leads to loss of up to 98% of the total 11-cA-retinal production in RGR gene knockout mouse (Chen 2001a). Mutations in RGR gene are correlated with autosomal dominant or recessive retinitis pigmentosa in human (Morimura 1999). The human RGR-d mRNA lacks the sixth exon due to exon skipping during splicing, which results in deletion of the whole sixth transmembrane domain from the protein product (Jiang 1995). The presence and accumulation of RGR-d protein in the RPE could interfere with normal functioning of RGR and lead to certain human eye diseases. In this chapter, we report our efforts to study the prevalence of RGR-d protein in human donors and the hypothesized pathogenic effect of RGR-d protein in cell culture and in experimental mouse. We also characterized the splicing patterns of mouse RGR gene. 9 0 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 4-2. EXPERIMENTAL PROCEDURES 4-2-1. RNA extraction - Whole eyes from adult 129SV X C57BL/6 mice (both male and female) were enucleated. The eyes were either immediately frozen in liquid nitrogen and stored at -80 °C for later use, or immediately homogenized with Dounce glass homogenizer for RNA extraction as described below. Total RNAs from mouse eyes were extracted using the acid guanidinium thiocyanate-phenol- chloroform-based method and stored at -80 °C (Chomczynski 1987). 4-2-2. Reverse transcription and polymerase-chain reaction - First strand complementary DNA (cDNA) was synthesized with Superscript RNase H'Reverse Transcriptase (Life Technologies, Gaithersburg, MD) and oliogo(dT) primer at 37 °C for 1 h, according to the manufacturer’s protocol. The GeneAmp PCR Reagent Kit (Perkin Elmer Cetus, Norwlk, CT) was used for polymerase-chain reaction (PCR), according to the manufacturer’s protocol. The PCR was conducted with a GeneAmp PCR System 9600 (Norwalk, CT) in a cycle of 91 °C for 1 min, 54 °C for 1 min, 72 °C for 2 min, for 30 cycles. The primer set used was: Mo-Rgr-c848A (TTGTGGAGACAGACACTGCCA) and Mus-Rgr-KS(+) (CCCTGTTCATCACACACACTT) to amplify mouse exons 5, 6, and 7. 4-2-3. Western blot to detect RGR-d in human donor retina - In addition to the previous collection of postmortem retinas from human donors, more than 50 pairs of human eyes were collected from Doheny Eye Bank (Los Angeles, CA). RPE and sensory retina were homogenized with a Dounce glass homogenizer in a 91 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. buffer containing 30 mM sodium phosphate, pH 6.5, and 250 mM sucrose. The homogenate was centrifuged at 500x g for 5 min at 4 °C. The supernatant was then sedimented down at 150,000x g for 90 min at 4 °C. The resulting total membrane pellet was then resuspended in 30 mM sodium phosphate, pH 6.5. The protein concentration was determined by Bio-Rad Protein assay (Bio-Rad). The proteins were separated in SDS-PAGE and transferred to Immobilon P membrane (Millipore, Bedford, MA). DE-7 was used to detect human RGR and RGR-d. DE-17 or DE-18 antibodies were used to detect human RGR-d. DE-7 antibody was directed against the common carboxyl terminal sequence (CLSPQKREKDRTK) of human RGR and RGR-d (Jiang 1995). DE-17 and DE-18 antibodies were produced against the unique junction sequence of RGR-d (GKSGHLQVPALIAK) created by the conjoining of exons 5 and 7 (Fig. 4-1). The ECL detection reagents (Amersham) were used to detect antibody-antigen binding. DE- 7 human RGR I t 1 2 1 3 1 4 T ~s | human RGR-d 1 1 1 2 1 3 1 4 1 5 1 ? 1 t DE-17/18 FIG. 4-1. The antibodies used to detect human RGR and RGR-d. The polyclonal anti-peptide DE-7 antibody was directed against a carboxyl terminal sequence of human RGR protein. The polyclonal DE-17 and DE-18 antibodies were against the unique junction between domain 5 and domain 7 created after the deletion of domain 6 in RGR-d protein. 92 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 4-2-4. Plasmid constructs - pcDNA3 (Invitrogen, Carlsbad, CA), an expression vector in mammalian cells, was digested with EcoKl. A full-length 1.4- kb human RGR cDNA fragment with AcoRI-created cohesive termini was inserted into pcDNA3 vector after ligation to create pcDNA3-hRGR. The pcDNA3-RGRd plasmid was constructed by insertion of the 1.3 kb human RGR-d cDNA into the -EcoRI cloning site o f the pcDNA3 (see Fig. 2-2 in Chapter 2). 4-2-5. Transfection of pcDNA3-hRGR and pcDNA3-RGRd in mammalian cells - COS-7 and ARPE-19 cells were cultured as described above. All cells were maintained at 50-60% confluency and washed with PBS before transfection. Plasmids pcDNA3-hRGR and pcDNA3-RGRd were transfected into cells using either calcium phosphate-based CellPhect Transfection Kit (Pharmacia Biotech) or LlPOFECTAMINE PLUS reagent (Life Technologies), according to manufacturers’ protocols and as described in Chapter 2. After 48 h or at specified times, the cells were subcultured by trypsinization in chamber slides for immunohistochemistry, or collected in PBS with 0.1% SDS at specified times for Western blot assay, as described above. 4-2-6. A transgenic mouse expressing RGR-d - Human RGR-d cDNA was linked downstream to the 2-kb human RGR 5’ promoter fragment, and followed by an SV40 polyA sequence to create the RGR-d cDNA minigene (Li Tao, unpublished result). The RGR-d minigene was cloned into pCAT vector (Promega, Madison, WI) to generate a transgenic mouse line containing the pCAT-RGRd transgene following standard procedure (Li Tao, unpublished results). The mouse colony was 93 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. maintained daily in a 12 h light and 12 h dark cycle. Mice were euthanized and tissues (brain, heart, lung, and eyes) from transgenic and wild-type littermate mice were collected. The tissues were either immediately frozen in liquid nitrogen and stored at -80 °C, or homogenized in PBS with a Dounce glass homogenizer for Western blot assay. human RGR 5' sequence RGR-d cDNA polyA pCA T FIG. 4-2. The pCAT-RGRd construct used to generate the RGR-d transgenic mouse. The RGR-d cDNA was under the control of a 2-kb fragment of the 5’ promoter region of the human RGR gene and contained an SV40 polyA tail. The pCAT vector has no promoter sequence upstream of the transgene insertion site. 9 4 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 4-3. RESULTS 4-3-1. Alternative splicing of the mouse RGR gene transcription - To test whether the mouse RGR gene transcription has a similar alternative splicing pattern to that in human to produce RGR and RGR-d mRNA, total RNAs from mouse eye were reverse transcribed and amplified. A single DNA fragment of about 290 bp, representing the amplification product of mRNA containing exon 6 with expected length of 286 bp, was detected in mouse sample. A shorter amplification product, the amplification product from the mRNA template with exon 6 deletion with expected length of 172 bp, was not detected (Fig. 4-3). We concluded that the deletion of exon 6, resulting in the RGR-d mRNA, occurred in the splicing of only human but not mouse RGR pre-mRNA. 4-3-2. Prevalence of the RGR-d variant in human retina - Translation of RGR-d mRNA should produce a protein with a calculated molecular weight of 28 kDa, compared to that of 32 kDa for human RGR protein. The junction between domain 5 and domain 7 also gives RGR-d protein a unique sequence not present in RGR (Fig. 1-8D). We were able to distinguish RGR and RGR-d in Western blot by molecular weight and different immunoreactivities to DE-17/DE-18 antibodies. Fig. 4-4 shows a representative Western blot result. When DE-7 was used to probe human retina membrane proteins, all samples contained the -32 kDa band, representing the RGR protein (Fig. 4-4A). Most samples also contained several 95 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. bands or a smear which ran faster than the RGR band in SDS-PAGE. Although not further identified, some * RGR cDNA k.s t 8 4 8 a A I 1 1 2 1 3 . 1 4 1 5 1 6 I 7 I M 1 2 3 B 400 b p 300 200 100 FIG. 4-3. The detection of mouse RGR-d mRNA. (A) The primers mus-Rgr- KS(+) (KS) and Mo-Rgr-c848A (848A) are designed to amplified the 286 bp fragment of mouse RGR cDNA including partial sequences of exons 5 and 7, and the whole exon 6. (B) Agrose gel electrophoresis of the PCR products. M, lOObp ladder DNA marker; 1, PCR product amplified from the single-stranded cDNA reverse transcribed from mouse total RNA, using the primers in (A); 2, control PCR, using identical conditions to that in 1, except no mouse RNAs were added in reverse transcription; 3, control PCR, using identical conditions to that in 1, except no reverse transcriptase was added in reverse transcription. of these bands or smear probably reflected postmortem degradation of RGR protein during the tissue collection process. When DE-18 was used to specifically detect the RGR-d protein, only samples #1 and #6 contained a lower band with a molecular weight of about 28 kDa (Fig. 4-4B). The DE-18 antibody also demonstrated cross reaction with the RGR protein under the experimental conditions. Notably, not all the bands and smear that were immunoreactive to DE-7 antibody were recognized by DE-18, indicating a certain extent of antibody specificity. 96 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. B l 2 3 29 kDa—* * « M » —- Fig. 4-4. RGR-d protein in human donor retina. Human donor retina, including the RPE and sensory retina, were separated in SDS-PAGE. (A) DE-7 antibody to detect the human RGR. (B) DE-18 antibody to detect RGR-d. (B) was the result from the same PVDF immunoblot used in (A), which was strip-washed with 2% SDS, 100 mM p-mercaptomethanol in 66 mM Tris, pH 6.6, after DE-7 detection in (A). Each lane contains 4 pg of proteins. 4-3-3. RGR-d protein in cultured cells - RGR-d was expressed in COS-7 cells by DNA transfection with pcDNA3-RGRd plasmid (see Fig. 2-2 in Chapter 2). A single band of about 28 kDa was present in transfected COS-7 cells, as recognized by DE-7 antibody in the Western blot (Fig. 4-5). Transfection of the pcDNA3- hRGR produced a protein of about 30 kDa. In the mock-transfected control cells, no band was detected immunoreactive to DE-7 antibody. In most of the transfection experiments, we also observed weaker band of RGR-d than that of RGR as detected by DE-7 antibody. This indicated that the amount of RGR-d protein was lower than that of RGR, assuming that DE-7 antibody 97 4 5 6 7 8 m Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. COS-7 hRGR liRGRd FIG. 4-5. Expression of RGR-d in COS-7 cells by 5 0 k D a — transient transfection. DE-7 antibody was used to detect both 4 0 - human RGR and RGR-d. COS- 7, mock transfection of COS-7 cells; hRGR, COS-7 cells transfected with pcDNA3-hRGR plasmid; hRGRd, COS-7 cells transfected with pcDNA3- hRGRd plasmid. 3 0 — 20 had equal affinity to both proteins in the Western blot. Differences in transfection efficiency or the protein amount of each transfected cell (expression efficiency) could contribute to the lower expression of RGR-d. COS-7 cells expressing RGR or RGR-d after transfection were counted to obtain transfection efficiency. At 12 h after transfection, the number of cells immunoreactive to DE-7 in pcDNA3-hRGR transfection was twice of the pcDNA3- hRGRd transfection. At 37 h after transfection, the number of cells immunoreactive to DE-7 in pcDNA3-hRGR transfection was 10 times of the pcDNA3-hRGRd transfection (Fig. 4-6). More notably, the number of cells immunoreactive to DE-7 in pcDNA3-hRGR transfection increased about twice from 12 h to 37 h. During the same period of time, however, the number of cells immunoreactive to DE-7 in pcDNA3-hRGRd transfection decreased 2.5 folds. 98 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 4-3-4. The experimental mouse models to study the pathogenesis of RGR-d - Wild type mouse does not produce RGR-d mRNA by alternative splicing (Fig. 4-3). An experimental mouse model was generated carrying the human RGR-d cDNA under the control of 2.0-kb human RGR 5’ promoter sequence (Li Tao, unpublished data). Western blot assay and immunohistochemistry staining showed no immunoreactivity to DE-7 antibody in the eye, brain, liver, and lung of the transgenic mouse. Q > nJ c .2 * 5 5 C / 3 22 a , W 300! RGR (n=5) RGRd (n=4) 200 100 37 12 Time (hr) FIG. 4-6. Kinetics of RGR and RGR-d expression in COS-7 cells. Average value for each data point was obtained from 5 and 4 independent DNA transfection experiments for RGR and RGR-d, respectively. Expression level refers to positively stained cells per cm2. All the values were normalized with regard to the number of RGR expression at 12 h as 100. The error bar indicates the standard deviation. 99 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 4-4. DISCUSSION The alternative splicing of human RGR pre-mRNA results in a truncated form of RGR, the RGR-d, as well as the full length RGR transcript. The presence of RGR-d in human RPE is of great interest to us in that the RGR-d protein could act as a dominant negative mutant and interfere with the normal function of RGR. Alternative splicing is commonly observed in many human genes (Dredge 2001). In many cases, alternative splicing serves as a mechanism to regulate many aspects of protein structure and function by governing the inclusion or exclusion of exons that encode protein interaction domains, regulatory signals, localization signals, ligand-binding domains, or translation initiation or termination sites (Hou 2001). On the other hand, aberrant splicing results in numerous diseases. For example, the aberrant splicing of tau protein in neurons results in missense or deletion mutations, and is linked with inherited frontotemporal dementia and Parkinsonism (Dredge 2001). Deletion of exon 7 in SMN gene gives rise to non functional protein product and has been linked to spinal muscular atrophy (Dredge 2001). As to RGR-d, since RGR-d retains the retinal-binding residue in domain 7, it could seclude the chromophore from RGR for normal processing in the visual cycle. It is also possible that RGR-d interferes the function of RGR by interacting with proteins normally associated with RGR. The visual cycle could be hindered if RGR-d protein disrupts the retinosome, a protein complex putatively including RGR, RPE65, cRDH, and the putative tRDH in RPE. 100 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. A striking finding in this study is that RGR-d seems to be inhibitory or even toxic to cell growth. The expression level of RGR-d in cultured cells was consistently much lower than that of RGR. In cells transfected with pcDNA3- hRGRd, the number of cells expressing RGR-d decreases much faster than that of the RGR transfection control. The cells should not be able to discriminate RGR plasmid from RGR-d plasmid in uptake, processing, and degradation. And RGR-d mRNA stability and its translation seemed similar to that of RGR, because 293T cells transfected with pHR'-CMV-hRGRd plasmid were able to produce high amount of RGR-d protein. On the other hand, the RGR-d protein was drastically different from RGR. Loss of the sixth transmembrane domain could lead to abnormal distribution and/or conformation, and render RGR-d inhibitory or toxic effect to the host cells. It might actively kill cells when accumulated to certain levels. High amount of RGR-d protein could aggregate and form deposits inside the cell, and/or disrupt the cellular membrane system. Indeed, 293T cells cotransfected with plasmids pHR’-CMV-hRGRd, pMD.G, and pCMVAR8.91 failed to produce recombinant lentivirus. High amount of RGR-d protein was detected in the transfected 293T cells, which could disrupt the packaging process of lentivirus particle. However, it is still possible that RGR-d, but not RGR, could be specifically targeted for degradation, although it is unknown how cells discriminate RGR from RGR-d, both exogenous to the host cells. The underlying mechanism for exon-skipping in human RGR splicing is not known yet. Interestingly, splicing of mouse and bovine RGR pre-mRNA doesn’t 101 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. have such an alternative splicing pattern. The human RGR gene might contain a weak or cryptic splicing site that is not in mouse RGR gene. Or, the human RGR gene might have a mutated exon splicing enhancer that leads to the skipping of exon 6, as in the case of SMN gene splicing (Lorson 2000). The failure in the transgenic mouse containing pCAT-RGRd transgene to express RGR-d protein curtailed our attempt to understand the proposed pathogenic effect of RGR-d protein. The failure of the transgene could result from lack of intron in the transgene construct, or failure in the promoter region. The presence of intron might be essential for the processing and stability of RGR-d pre-mRNA in mouse, as demonstrated in XI3-2 transgenic mouse (see Chapter 5). 102 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. CHAPTER 5 THE PROMOTER OF RGR GENE 5-1. INTRODUCTION RPE remains highly differentiated and quiescent in vivo. Many proteins have been identified to be specifically and abundantly expressed in the RPE, including RPE65, RGR, and CRALBP (Jiang 1993, Kennedy 1998, Nicoletti 1998). RPE can be stimulated to proliferate in vivo in response to pathological events or during complications associated with retina detachment surgery (Gelfman 1998). Primary RPE cell culture can proliferate and maintain certain differentiation characteristics, including the ability to transport retinoids and phagocytose rod outer segments (Dunn 1996). Cell differentiation is also maintained in human RPE cell line ARPE- 19. ARPE-19 cell line has been shown to express RPE-specific genes, such as ZO-1, p-catenin, cytokeratins 5, 8, and 18, RPE65 and CRALBP, and exhibit morphological polarity (Dunn 1996, Lund 2001). Expression of some other genes, however, is affected by the differentiation and proliferation state of RPE cells (Gelfman 1998, Boulanger 2000). Expression of RGR in primary bovine RPE cell culture and ARPE-19 is totally shut down. In this chapter, we report our attempts to understand the shutdown of RGR expression in cell culture and the promoter of RGR gene in human and mouse. 103 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 5 -2 . E X P E R I M E N T A L P R O C E D U R E S 5-2-1. Cell culture and induction of RGR expression in ARPE-19 cells - The ARPE-19 cells were maintained confluent as described above. all-trara'-Retinol was dissolved in ethanol in the dark and mixed with DME/F-12 (1:1) immediately before experiments. The concentration of the all-fram-retinol was determined spectrometrically, as described above. Bovine retina, including sensory retina and the RPE, was homogenized in PBS with a Dounce glass homogenizer and passed through a 0.2 pm filter. 5-2-2. DNA sequencing and analysis - DNA sequencing was performed by University of Southern California Norris Cancer Center core facility (Los Angeles, CA). The primers for DNA sequence and PCR were synthesized by Sigma-Genosys (Woodlands, TX). The sequences were analyzed with MacVector 4.5.3 software (Scientific Imaging Systems, New Haven, CT). 5-2-3. Transgenic mouse XI3-2 - The human RGR genomic DNA clone XI3- 2 contains all seven exons of human RGR gene (Shen 1994). This clone also contains a 0.5-kb fragment of the promoter sequence of the human RGR gene (Fig. 5-1). The transgenic mouse containing the human X13-2 genomic fragment, termed XI3-2 mouse, was generated following standard procedures (Li Tao, unpublished results). The m ouse colony was maintained in daily 12 h light and 12 h dark cycle. Mice were euthanized and tissues from transgenic and wild-type littermate mice were collected. The tissues were either immediately frozen in liquid nitrogen and 104 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. stored in -80 °C, or immediately homogenized in PBS with a Dounce glass homogenizer for Western blot assay. 5-2-4. Western blot - The proteins were separated by 12% SDS-PAGE and the presence of human RGR was detected by DE-7 antibody using ECL detection reagents (Amersham), as described above. 0.5 kb promoter FIG. 5-1. The A.13-2 clone of human RGR gene. The seven exons are indicated by solid boxes and numbered below. The arrow represents the transcription initiation site. The 0.5-kb promoter region 5’ upstream of the first exon is indicated. The restriction enzyme recognition sites are as marked. B, BamHl; E, £coRI; S, S a d (Shen 1994). 5-3. RESULTS 5-3-1. Induction of RGR expression in ARPE-19 cells - RGR protein was not detected by Western blot assay in the ARPE-19 cells maintained confluent for at least two weeks in DME/F-12 (1:1) medium supplemented with 10% FBS and 1% Glutamine-Penicillin-Streptomycin. To test whether this shutdown of gene expression is reversible by certain retina factors, confluent ARPE-19 cells were cultured with medium supplemented with all-Zr<mv-retinol or the crude bovine retina homogenate. Incubation with medium containing 0.1, 1, or 10 nM of all-trans- S E E S B E B S B E S S I -------- ■ II 2 3 4 # - i J 1 1 ■ ' 1 1 5 6 7 105 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. retinol for 2 days did not induce detectable RGR protein expression in ARPE-19 cells (Fig. 5-2). all-trans-Retinol was toxic to ARPE-19 cells at concentrations greater than 10 pM. A 40 kDa 30 20 B 40 kDa 30 20 Fig. 5-2. No expression of RGR in the ARPE-19 cells after induction with all-Zram-retinol or bovine retina homogenate. Confluent ARPE-19 cell culture was incubated with bovine retina homogenate (A) or all-fram-retinol (B). DE-7 antibody was used to detect RGR protein. Lane 1 and lane 2 in both (A) and (B), recombinant RGR and RGR-d, respectively, expressed in COS7 cells, served as positive control (see Fig. 4-5 in chapter 4); (A) lane 3, 4, 5, and 6, ARPE-19 cells incubated with 0%, 0.3%, 1.6%, and 3.3% (v/v), respectively, of bovine retina homogenate for 24 hr. Lane 7, 8, 9, and 10, ARPE-19 cells incubated with 0%, 0.3%, 1.6%, and 3.3% (v/v), respectively, of bovine retina homogenate for 52 hr. (B) lane 3, 4, 5, and 6, ARPE- 19 cells incubated with 0 nM, 0.1 nM, 1 nM, and 10 nM, respectively, of all-trans- retinol for 48 hr. Each lane contained about 1/25 of total proteins from one well of confluent ARPE-19 cells. The 10 kDa protein marker ladders were obtained from Life Technologies. The bovine retina was hom ogenized to produce a crude tissue extract. The purpose was to test whether factors present in the retina could maintain RGR expression in vivo, and ARPE-19 cells lost RGR expression due to the absence of 106 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. such factors in cell culture. Confluent ARPE-19 cells cultured with medium supplemented with 0.3%, 1.6%, or 3.3% (volume to volume) o f retina extract for 24 h did not express detectable amount of RGR, as demonstrated by Western blot assay (Fig. 5-2). 5-3-2. Analysis of the proximal promoter region of human and mouse RGR genes - Sequences of human 5’ flanking region -2398 to +81, and mouse 5’ flanking region -1343 to 195 of the RGR gene were obtained by sequencing individual genomic clones. Conserved sequences were identified within the -896 to +67 in human sequence and -948 to +75 in the mouse sequence (Fig. 5-3). The -31 to -23 region in human and -22 to -14 region in mouse (TTTAAAAGG in both) were homologous to the TATA box. A putative photoreceptor consensus element, PCE-1 (Kennedy 1998), was observed in the -265 region in human and -249 region in mouse. A dinucleotide repetitive sequence was observed in the mouse RGR gene proximal promoter region. This dinucleotide repeat, (CA)n(GA)n(CA)n, spans 120 nucleotides long (Fig. 5-3). A less obvious repetitive CA-rich sequence exists in the same region of human RGR gene proximal promoter region. 5-3-3. Transgenic mouse expression - The A T 3-2 transgenic mouse contained the human RGR genomic DNA clone AT3-2. The A T 3-2 clone contains the 0.5 kb fragment upstream to the transcription initiation site of the human RGR gene (Fig. 5- 1). This region contains highly conserved sequences between mouse and human RGR genes (Fig. 5-3). 107 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. (-898) TTGCT GAT AGT GCTCT GG AGCTT GGTTTCTTT ATCTG A A A AT (-857) (-951) TTGCTAATAACCCTCTGGGATTTGGTTTCTCCATCTGAAAAT(=910) (-759) GTAGCAGCCAAAGCTCTTAGTGGG (-736) (-807) GT AG A AGCCG A AGTT CTT AGT GGG (-784) (-636) GCTCT AT GGG AG AC AGGA A AT GC AGCCCT (-608) (-709) GCTGTCTGTGAGACAGGAAGTGAAGCCCT (-680) (-487) T AGT GGC AGATT C AG A (-466) / / .......................................................// (-588) CAGAGTCAGTACCAGA (-573) //(-499) (CA)n(GA)n(CA)n (-433)11 (-330) TTGGGAACAGCTGCGGCTCAAATCCCTCCTCCTGCTCCCCTCCCC (-314) TCGGGGACAGCTGCAGCTCAAATCCTTTCTTCCACTTCCCTCCCT T GGTT AT GC A ACT CTTTTCC A ATT AGGCTCTC AGCC AC AC AC C ATTT GG A T AGTT AT GC AACCCTT ACCC AATTC AGCTTTC ACTC AC AC ACC ATTT GGA (PCE-1) TTCCCCGACCTTAATCCTGTGCAATGGGGCTGAAATGAATGAGACAG T -C C AAGACCTT AATCCTGCCTAGT GGG -CTGGAATGAACAAGACAG GGCTCCATTCTGGCTTCACAAAGGCTGCATTGTCCAACTCGTGAATGGGT AGCT C -ATTCC AGCTT C AC A AA AGCTGC ACT ATCC AT CT ACTG A AT GGAT TCCTTCTGCTTGGGCCAAGAGGA (-116)// T CTTTCT AT GT G AGCC AAG AGGA (-103)// (-70) T A AT A AC CTGC ATGTGCC (-53) // (-31) TTTAAAAGG (-23) (-57) TAATAATCTCCACATGCC (-40) // (-22) TTTAAAAGG (-14) (initiator) FIG. 5-3. The conserved sequences of the human and mouse RGR promoters. The sequence of the mouse RGR promoter was aligned with that of the human RGR promoter. The transcription initiation site (+1) was determined previously (Shen 1994). Human sequence is the upper line and mouse sequence is the lower line. The numbers before and after each sequence fragment indicate the position with regard to transcription initiation site as +1. The putative PCE-1 element and initiator are as indicated. The sequences were analyzed with MacVector 4.5.3 (Scientific Imaging Systems). 108 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. The expression of human RGR protein, which could be distinguished from mouse RGR using DE-7 antibody, was tested in Western blot assay. The eye, brain, liver, and lung from 7,13-2 transgenic mouse and a littermate wild type control mouse were homogenized and separated by SDS-PAGE. A strong band was detected in the eye sample of 7,13-2 transgenic mouse, which was about 30 kDa and co-migrated with the recombinant RGR protein expressed in COS-7 cells (Fig. 5-4). No other specific band was detected in the brain, liver, or lung of the 7,13-2 transgenic mouse, nor in any tissue of the control wild-type mouse. Wild-type iU3-2 hRGR E B LR LG ~E B LR LG Fig. 5-4. Expression of human RGR in the transgenic mouse containing the RGR genomic clone 713-2. About 5 pig of total proteins were loaded in each lane except for the eye of wild-type mouse and the eye of 713-2 mouse, where protein amount was determined and normalized by absorbance at 280 nm. The protein amount in the positive control COS-7-hRGR was not determined. DE-7 antibody was used in the Western blot assay. hRGR, human RGR protein expressed in COS-7 cells by transient transfection of pcDNA3-hRGR; E, eye; B, brain; LR, liver; LG, lung. 109 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 5-4. DISCUSSION RGR is one of the major RPE and Muller cell-specific proteins believed to function in the visual cycle. The expression of RGR seems to be regulated developmentally in vivo. Mouse RPE exhibits RGR immunoreactivity at postnatal day 2 (P2), starting from the center of RPE monolayer. At PI 6, RGR protein is expressed in the entire region of RPE (Tao 1998). Once explanted, RPE ceases to express RGR. RGR expression falls to undetectable levels by Western blot in primary bovine RPE culture 5 days after explantation (see Fig. 3-9C in Chapter 3). ARPE-19, although expressing some RPE-specific genes such as CRALBP and RPE65, does not express detectable amount of RGR. To test whether the expression of RGR can be induced in ARPE-19 cells, all- trans-retinol or crude bovine retina homogenate was supplemented in RPE cell culture medium. RGR expression may need specific transcriptional factor that is responsive to certain retina factors, including protein factors and retinoids. Our preliminary results indicate that neither all~/r<mv-retinol nor crude retina homogenate was sufficient to induce the expression of RGR in ARPE-19 cells. It is also unclear whether RGR promoter undergoes irreversible modifications in ARPE-19 cells such as methylation of CpG islands (Antequera 1990). To understand the tissue-specific expression of RGR, the 0.5-kb 5’ flanking region upstream of the transcriptional initiation site in human RGR A13-2 genomic fragment was used to direct the expression of human RGR in mouse. Human RGR 110 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. was specifically expressed in the eyes of transgenic mouse, but not in any other tissues of the transgenic mouse, nor in the tissues of wild-type littermate control (Fig. 5-4). This result indicates that the 0.5-kb flanking region in X13-2 fragment contains sufficient information to direct RPE-specific expression of RGR. Interestingly, the 5’ region -655 to +52 from the transcription initiation site of RPE65 gene has been shown to be sufficient to direct RPE-specific gene expression (Boulanger 2000). The RPE65 gene promoter contains sequences resembling to known transcription factor-binding sites, such as AP-1, AP-4, as well as the TATA-box (Nicoletti 1998, Boulanger 2000). Consensus sequences were identified in the 5’ flanking regions o f the human and mouse RGR genes. Besides the putative TATA box, mouse and human RGR promoter regions both contain a sequence similar to PCE-1. PCE-1 has been implicated in regulation of photoreceptor-specific gene expression, and is also found in CRALBP and RPE65 proximal promoter regions (Kennedy, 1998, Nicoletti 1998). Similar to RGR, CRALBP and RPE65 are also abundantly expressed in RPE and Muller cells and believed to play important roles in retinoid processing. The PCE-1 identified in CRALBP promoter was found to interact with proteins specific to RPE and retina, that is, putative tissue-specific transcriptional factors. Whether the putative PCE-1 element is sufficient to direct the RPE-specific expression of RGR, as observed in X.13-2 transgenic mouse, remains unclear. No long fragment of homogenous sequences was identified among the proximal promoter regions of the RGR, RPE65, and CRALBP genes (Intres 1994, Nicoletti 1998). I l l Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Another interesting aspect of RGR promoter is the dinucleotide repetitive sequence. Repetitive sequences have been implicated in genetic instability and certain diseases (Kunzler 1995, Claij 1999). Repetitive sequences in the promoter region could affect the promoter activity and thus gene expression. It is not clear whether the dinucleotide repetitive sequence in RGR promoter region affects the expression of RGR. It would be informative to sequence the bovine RGR gene promoter and compare to the mouse and human counterparts. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. CHAPTER 6 CONCLUSION RGR has been demonstrated to be an essential protein in the visual cycle through in vitro biochemical study and in vivo gene knockout mouse study (Hao 1999, Chen 2001a). The RGR-mediated photic visual cycle is responsible for 98% of the total production o f 11-cA-retinal from all-/ram--retinol in the RPE under light conditions. RGR could function as a photoisomerase per se, or as a classic G protein-coupled receptor to stimulate pathways involving the proposed isomerohydrolase or the putative pathway through a carbocation intermediate to produce 11 -cA-retinal in the RPE. In this study, the function of RGR was studied in the RPE cell culture system. Previous RPE cell culture systems failed to demonstrate RGR functioning because of the rapid shutdown of RGR gene expression in cultured RPE. We restored RGR expression in a human RPE cell line, ARPE-19, using a lentiviral vector containing human RGR cDNA under control of the CMV promoter (Yang 2000a, Yang 2000b). The resulting cell line, ARPE-hRGR, expressed RGR for at least 6 months. RGR was more efficiently expressed in ARPE-19 cells than in COS-7 cells, and recombinant lentivirus vector transduction was more efficient than DNA transfection in all tested cell types. Functional RGR was expressed in ARPE-hRGR, as the recombinant human RGR protein was capable of binding to exogenous a\\-trans- retinal in vitro (Yang 2000b, Yang 2002). 113 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. The RGR-mediated production of 11 -cA-retinal was studied in ARPE-hRGR cells (Yang 2001, Yang 2002). RGR protein has been shown to bind to all-trans- retinal chromophore in the ARPE-hRGR cells, corroborating the previous finding that all-fram-retinal is the endogenous chromophore of RGR (Hao 1999). Radioactive tracer study proved that the all-fram'-retinal chromophore was derived from alT/nrnv-retinol precursor in the culture medium. In a separate experiment, fetal bovine serum in the culture medium provided precursors for the synthesis of all- fnmy-retinal. Serum retinol, instead of p,p-15,15-carotene, was the likely precursor of all-frara-retinal since the ARPE-hRGR cells failed to use exogenous P,p-15,15- carotene. Results from short-term incubation of bovine RPE explants, which maintained a certain level of RGR protein, corroborated that RGR bound to all-/ram- retinal and obtained the chromophore from all-fnms-retinol in the medium. Blue light illumination of the live ARPE-hRGR cells stimulated a stereospecific isomerization of all-trans-retinal to the 11 -cis isomer, as observed with purified bovine RGR protein (Hao 1999). The oxidation reaction, as required to produce all-/ram-retinal from all-trans- retinol precursor, was proposed to be carried out by a putative all-/ram-retinol dehydrogenase (tRDH) activity in the RPE (Yang 2002). Indeed, a tRDH activity was detected to be associated with the membrane fractions of the ARPE-hRGR cells. This tRDH activity is distinctive from the known dehydrogenase activities in the RPE, in that it requires NDAP as cofactor but not NAD, and prefers all-fnms-retinol as substrate but not 11-cA-retinol. This tRDH activity could be directly associated 114 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. with RGR protein. In the in vitro channeling experiment, all-fram-retinol was first oxidized by the tRDH to all-/r<ms-retinal, then presented to RGR for physiological binding (Chapter 3). In the future, purification of the tRDH activity and identification of the gene encoding the enzyme should fill in the missing important link in the photic visual cycle. RGR could form a protein complex with tRDH, RPE65, and 11-cA-retinol dehydrogenase (cRDH). This protein complex, termed retinosome, could form a hydrophobic pocket where all-fram-retinol could be oxidized by tRDH, then immediately presented to RGR, and isomerized to 11 -c/.v-retinal upon illumination. The 1 1-cA-retinal could either be reduced to 1 l-c/'.v-retinol by cRDH, or directly removed from RGR through still unknown mechanism. One of the advantages of the putative retinosome could be the efficient processing of retinoids by coupling reactions in the hydrophobic milieu. RPE65 could function to stabilize the retinosome, form the hydrophobic compartment, or facilitate and direct the flow of retinoids within the retinosome. The concept of retinosome as the retinoid-processing center in the RPE evolves as new experimental evidence accumulates. Recent data indicate that CRALBP, the protein specifically binds to 11-cA-retinal and 11 -c/.v-retinol, may specifically interact with RGR and remove 11-cA-retinal from RGR (Pu Chen, unpublished data). Although we have not been able to demonstrate in the intact RPE cells the interaction of RGR and CRALBP nor the interaction between RGR and 11 - c/.v-retinol dehydrogenase, a study using membrane proteins confirmed the 115 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. interaction of RGR and 11-cis-retinol dehydrogenase observed in studies using purified RGR protein (Fig. 3-15, Chen 2001b). The RPE cell culture system developed in this study proved to be of great value in the study of the visual cycle. By using the ARPE-19 and ARPE-hRGR cell lines, we were able to eliminate photoreceptor contamination, a major hurdle for the study of RPE enzymes. The presence of an all-fram-retinol dehydrogenase activity (Chapter 3) was indisputably demonstrated using this “pure” system. Successful expression of functional RGR in the ARPE-hRGR cells enabled us to illustrate any RGR-dependent activity by comparing results obtained from ARPE-hRGR and ARPE-19 cells. For example, we demonstrated that the presence of all-frara-retinal depends on RGR (Chapter 3). Recognizing the limitation of the established cell line (e.g. loss of differentiation), we also took advantage of freshly-isolated RPE cell culture. The freshly-isolated cells were assumed to contain all the endogenous proteins, thus closely mimicking the in vivo intracellular environment. The cell culture system has its own limitations compared with in vitro study using purified proteins or whole membrane proteins, and the in vivo study using live animals. In this project, we tried to use experimental results obtained from in vitro studies as guidance for the cell culture study. Due to the complexity and our inadequate knowledge of the visual cycle, we were not able to confirm some of the results obtained from in vitro studies. As explained in chapter 3, we failed to detect processing of 11-cw-retinal in the cultured cells. Future efforts could focus on conditions that can stimulate 11-cA-retinal processing in the cultured cells. 116 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Presumably, these conditions could also be important for 11 -c/s-retinal processing in the RPE in vivo. A significant portion of my project was devoted to the study of RGR-d protein in the pathogenesis of RPE in humans (Chapter 4). The exon-skipping mutant of RGR, the RGR-d, was expressed by DNA transfection in COS-7 cells. Preliminary results suggested a detrimental or inhibitory effect of RGR-d protein on cell viability. Accumulation of RGR-d protein in human retina, if confirmed, could have similar effect in the health of RPE. It remains unknown whether the putatively pathogenic RGR-d protein is responsible for certain age-related eye diseases in human. We detected no exon-skipping alternative splicing pattern of the mouse RGR gene. RGR-d cDNA was inserted into the mouse genome to study the putative pathogenic effect of RGR-d protein in experimental mouse model. Despite enormous efforts, we failed to express appreciable level of RGR-d protein in the transgenic mouse. The main reason for our failure, in retrospect, is the lack of a reproducible and convenient method to detect RGR-d protein from human RPE and retina samples. As explained in Chapter 4, we were not able to obtain specific, high titer, and reliable antibody against human RGR-d protein for Western blot and immunohistology. Protein degradation in the postmortem human tissues is also problematic. In the attempt to express RGR-d protein in transgenic mouse and RGR protein in the ARPE-19 cell line, we sequenced the 5’ upstream flanking region of mouse and human RGR gene. A putative PCE- element was identified in both 117 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. mouse and human promoter region and could be responsible for the tissue-specificity of RGR expression. The 0.5-kb fragment upstream of the human RGR coding region was demonstrated to be able to direct tissue-specific expression of RGR in transgenic mouse. Not surprisingly, mouse and human RGR promoter regions share homology in this 0.5 kb region. Whether there are other c/.s-acting elements to regulate RGR expression in vivo, and inhibit RGR expression in cell culture, remains unclear. Our initial attempt to induce RGR expression in the ARPE-19 cells indicates that all- trans-retinol alone or the retina homogenate is not sufficient to re-activate the promoter of human RGR gene. Although the promoter study was of low priority in my project, these results provided useful information about RGR gene expression and the RPE-specific promoter. The success of this project is a demonstration of the power to combine in vitro biochemical experiment, the cell culture experiment, and the in vivo animal model experiment. Understanding complicated biological processes such as the regeneration of rhodopsin requires a systematic view, in addition to detailed information of all the players in the process. The cell culture model should be able to provide more information on the photic visual cycle in the future. 118 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. References: Antequera, F., Boyes, J., and Bird, A. (1990) High levels of de novo methylation and altered chromatin structure at CpG islands in cell lines. Cell, 62, 503-514 Bernstein, P. S., Law, W. C., and Rando, R. R. (1987) Biochemical characterization of the retinoid isomerase system of the eye. J. Biol. Chem. 262, 16848-16857 Biesalski, H. K. (1990) Separation of retinyl esters and their geometric isomers by isocratic adorption hight-performance liquid chromatography. Methods Enzymol. 189, 181-189. Blaner, W. S., Das, S. R., Gouras, P., and Flood, M. T. (1987) Hydrolysis of 11-cis- and all- trans-retinyl palmitate by homogenates of human retinal epithelial cells. J. Biol. Chem. 262, 53-58 Boulanger, A., Liu, S., Henningsgaard, A. A., Yu, S., Redmond, T. M. (2000) The upstream region of the rpe65 gene confers retinal pigment epithelium-specific expression in vivo and in vitro and contains critical octamer and E-box binding sites. J. Biol. Chem. 275, 31274- 31282 Bridges, C. D. (1976) Vitamin A and the role of the pigment epithelium during bleaching and regeneration of rhodopsin in the frog eye. Exp. Eye Res. 22, 435-455 Bridges, C. D., Oka, M. S., Fong, S. L., Liou, G. I., Alvarez, R. A. (1986) Retinoid-binding proteins and retinol esterification in cultured retinal pigment epithelium cells. Neurochem. Int. 8, 527-534 Burns, J. C., Friedmann, T., Driever, W., Burrascano, M., and Yee, J. K. (1993) Vesicular stomatitis virus G glycoprotein pseudotyped retroviral vectors: concentration to very high titer and efficient gene transfer into mammalian and nonmammalian cells. Proc. Natl. Acad. Sci. 90, 8033-8037 Canada, F. J., Law, W. C., and Rando, R. R. (1990) Substrate specificities and mechanism in the enzymatic processing o f vitamin A into 11-cis-retinol. Biochemistry 29, 9690-9697 Carlson, A., and Bok, D. (1992) Promotion of the release of 11-cis-retinal from cultured retinal pigment epithelium by interphotoreceptor retinoid-binding protein. Biochemistry 31, 9056-9062 Carlson, A., and Bok, D. (1999) Polarity of 11-cis retinal release from cultured retinal pigment epithelium. Investig. Ophthalmol. Vis. Res. 40, 533-537 Chai, X., Zhai, Y., and Napoli, J. L. (1997) cDNA cloning and characterization of a cis- retinol/3a-hydroxysterol short-chain dehydrogenase. J. Biol. Chem. 272, 33125-33131 119 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Chen, P., Hao, W., Rife, L., Wang, X., van Boemel, G. B., Ogden, T., Wu, L., Chen, J., Shen, D., Fong, H. K. W. (2000) A photic regeneration cycle for visual pigments in mammals. Invest. Ophthalmol. Vis. Sci. 41, S617 Chen, P., Hao, W., Rife, L., Wang, X. P., Shen, D., Chen, J., Ogden, T., Van Boemel G. B., Wu, L., Yang, M., and Fong, H. K. W. (2001a) A photic visual cycle of rhodopsin regeneration is dependent on Rgr. Nat. Genet. 28, 256-260 Chen, P., Lee, T. D., and Fong, H. K. W. (2001b) Interaction of 11-cis-retinol dehydrogenase with the chromophore of retinal G protein-coupled receptor opsin. J. Biol. Chem. 276,21098-21104 Chen, X.-N., Korenberg, J. R., Jiang, M., Shen, D., Fong, H. K. W. (1996) Localization of the human RGR opsin gene to chromosome 10q23. Hum. Genet. 97, 720-722 Chomczynski, P., and Sacchi, N. (1987) Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 162, 156-159 Claij, N., and te Riele, H. (1999) Microsatellite instability in human cancer: a prognostic marker for chemotherapy? Exp. Cell Res. 246, 1-10 Crabb, J. W., Goldflam, S., Harris, S. E., Saari, J. C. (1988) Cloning of the cDNAs encoding the cellular retinaldehyde-binding protein from bovine and human retina and comparison of the protein structures. J. Biol. Chem. 263, 18688-18692 Das, S. R., and Gouras, P. (1988) Retinoid metabolism in cultured human retinal pigment epithelium. Biochem. J. 250, 459-465 Das, S. R., Bhardwaj, N., Gouras, P. (1990) Synthesis of retinoids by human retinal epithelium and transfer to rod outer segments. Biochem. J. 268, 201-206 Davis, A., Bernstein, P., Bok, D., Turner, J., Nachtigal, M., and Hunt, R. (1995) A human retinal pigment epithelial cell line that retains epithelial characteristics after prolonged culture. Investig. Ophthalmol. Vis. Sci. 36, 955-964 D'Cruz, P. M., Yasumura, D., Weir, J., Matthes, M. T., Abderrahim, H., LaVail, M. M., and Vollrath, D. (2000) Mutation of the receptor tyrosine kinase gene M ertk in the retinal dystrophic RCS rat. Humam Mol. Genet. 9, 645-651 Deigner, P. S., Law, W. C., Canada F. J., and Rando, R. R. (1989) Membranes as the energy source in the endergonic transformation of vitamin A to 11-cis-retinol. Science 244, 968-971 Dredge, B. K., Polydorides, A. D., and Darnell, R. B. (2001) The splice of life: alternative splicing and neurological disease. Nat. Rev. Neurosci. 2, 43-50 Dunn, K. C., Aotaki-Keen, A. E., Putkey, F. R., and Hjelmeland, L. M. (1996) ARPE-19, a human retinal pigment epithelial cell line with differentiated properties. Exp. Eye Res. 62, 155-169 120 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Flannnery, J. G., O'Day, W., Pfeffer, B. A., Horwitz, J., and Bok, D. (1990) Uptake, processing and release of retinoids by cultured human retinal pigment epithelium. Exp. Eye Res. 51, 717-728 Flood, M. T., Bridges, C. D., Alvarez, R. A., Blaner, W. S., and Gouras, P. (1983) Vitamin A utilization in human retinal pigment epithelial cells in vitro. Investig. Ophthalmol Vis Sci. 24:1227-1235 Gelfman, C. M., Kelleher, C. M., and FIjelmeland, L. M. (1998) Differentiation of retinal pigment epithelial cells in vitro uncovers silencer activity in the FGF-5 gene promoter. Exp. Eye Res. 67, 151-162 Groenendijk, G. W., De Grip, W. J., and Daemen, F. J. M. (1979) Identification and characterization of syn- and anti-isomers of retinaloximes. Anal. Biochem. 99, 304-310 Groenendijk, G. W., De Grip, W. J., and Daemen, F. J. M. (1980) Quantitative determination of retinals with complete retention of their geometric configuration. Biochim. Biophys. Acta 617, 430-438 Hamel, C. P., Tsilou, E., Harris, E., Pfeffer, B. A., Hooks, J. J., Detrick, B., and Redmond, T. M. (1993) A developmentally regulated microsomal protein specific for the pigment epithelium of vertibrate retina. J. Neurosci. Res. 34, 414-425 Hao, W., and Fong, H. K. W. (1996) Blue and ultraviolet light-absorbing opsin from the retinaldehyde pigment epithelium. Biochemistry 35, 6251-6256 Hao, W., and Fong, H. K. W. (1999) The endogenous chromophore of retinal G protein- coupled receptor opsin from the pigment epithelium. J. Biol. Chem. 274, 6085-6090 Hao, W., Chen, P., and Fong, H. K.W. (2000) Analysis of chromophore of RGR: retinal G- protein-coupled receptor from pigment epithelium. Methods Enzymol. 316, 413-422 Hara-Nishimura, I., Matsumoto, T., Mori, H., Nishimura, M., Hara, R., and Hara, T. (1990) Cloning and nucleotide sequence of cDNA for retinochrome, retinal photoisomerase from the squid retina. FEBS Lett. 271, 106-110 Hargrave, P. A., and McDowell, J. H. (1992) Rhodopsin and phototransduction: a model system for G protein-linked receptors. FASEBJ., 6, 2323-2331 Hou, V. C., and Conboy, J. G. (2001) Regulation of alternative pre-mRNA splicing during erythroid differentiation. Current Opinion Hemat. 8, 74-79 Intres, R., Goldflam, S., Cook, J. R., and Crabb, J. W. (1994) Molecular cloning and structural analysis of the human gene encoding cellular retinaldehyde-binding protein. J. Biol. Chem. 269, 25411-25418 121 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Jang, G. F., McBee, J. K., Alekseev, A. M., Haeseleer, F., and Palczewski, K. (2000) Stereoisomeric specificity of the retinoid cycle in the vertebrate retina. J. Biol, Chem. 275, 28128-28138 Jiang, M., Pandey, S. and Fong, H. K. W. (1993) An opsin homologue in the retina and pigment epithelium. Investig. Ophthalmol. Vis. Sci. 34, 3669-3678 Jiang, M., Shen, D., Tao, L., Pandey, S., Heller, K., and Fong, H. K. W. (1995) Alternative splicing in human retinaldehyde mRNA transcripts of an opsin-related protein. Exp. Eye Res. 60, 401-406 Kafri, T., Blomer, U., Peterson, D. A., Gage, F. H., and Verma, I. M. (1997) Sustained expression of genes delivered directly into liver and muscle by lentiviral vectors. Nat. Genet. 17,314-317 Kato, T., Berger, S. J., Carter, J. A., and Lowry, O. H. (1973) An enzymatic cycling method for nicotinamide-adenine dinucleotide with malic and alcohol dehydrogenases. Anal. Biochem. 53, 86-97 Kennedy, B., Goldflam, S., Chang, M. A., Campochiaro, P., Davis, A. A., Zack, D. J., and Crabb, J. W. (1998) Transcriptional regulation of cellular retinaldehyde-binding protein in the retinal pigment epithelium. J. Biol. Chem. 273, 5591-5598 Kunzler, P., Matsuo, K., and Schaffner, W. (1995) Pathological, physiological and evolutionary aspects of short unstable DNA repeats in the human genome. Biol. Chem. 376, 201-211 Landers, G. M. (1990) High-performance liquid chromatography of retinoid isomers. Methods Enzymol. 189,70-80 Law, W. C., and Rando, R. R. (1988) Stereochemical inversion at C-15 accompanies the enzymatic isomerization of all-trans- to 11-cis-retinoids. Biochemistry 27, 4147-4152 Lion, F., Rotmans, J. P., Daemen, F. J. M., and Bonting, S. L. (1975) Biochemical aspects of the visual process XXVII. Stereospecificity of ocular retinol dehydrogenases and the visual cycle. Biochim. Biophys. Acta 384, 283-292 Lorson, C., and Androphy, E. J. (2000) An exonic enhancer is required for inclusion of an essential exon in SMA-determining gene SMN. Hum. Mol. Genet. 9, 259-265 Lund, R. D., Adamson, P., Sauve, Y., Keegan, D. J., Girman, S. V., Wang, S., Winton, H., Kanuga, N., Kwan, A. S., Beauchene, L., Zerbib, A., Hetherington, L., Couraud, P. O., Coffey, P., Greenwood, J. (2001) Subretinal transplantation of genetically modified human cell lines attenuates loss of visual function in dystrophic rats. Proc. Nat. Acad.Sci. 98, 9942- 9947 MacCrehan, W. A. (1990) Determination of retinol, a-tocopherol, and p-carotene in serum by liquid chromatography. Methods Enzymol. 189, 172-181 122 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Masland, R. H. (1994) Cell mosaics and neurotransmitter, in Principles and Practice o f Ophthalmology (Albert, D. M., and Jakobiec, F. A. eds) pp.309-332, W. B. Saunders Company, Philadelphia, PA Mata, N. L., Tsin, A. T., and Chambers, J. P. (1992) Hydrolysis of 11-cis- and all-trans- retinyl palmitate by retinal pigment epithelium microsomes. J. Biol. Chem. 267, 9794-9799 McBee, J. K., Kuksa, V., Alvarez, R., de Lera, A. R., Prezhdo, O., Haeseleer, F., Sokal, I., and Palczewski, K. (2000) Isomerization of all-trans-retinol to cis-retinols in bovine retinal pigment epithelial cells: dependence on the specificity of retinoid-binding proteins. Biochemistry 39, 11370-11380 McBee, J. K., Palczewski, K., Baehr, W., and Pepperberg, D. R. (2001) Confronting complexity: the interlink of phototransduction and retinoid metabolism in the vertebrate retina, in Progress in Retinal and Eye Research (Osborne, N. N., and Chader, G. J., eds) Vol. 20, pp. 469-529, Elsevier Science Ltd., Great Britain McCormick, A. M., and Napoli, J. L. (1982) Identification of 5,6-epoxyretinoic acid as an endogenous retinol metabolite. J. Biol. Chem. 257, 1730-1735 Miyoshi, H., Takahashi, M., Gage, F. H., and Verma, I. M. (1997) Stable and efficient gene transfer into the retina using an HIV-based lentiviral vector. Proc. Natl. Acad. Sci. 94, 10319-10323 Morimura, H., Saindelle-Ribeaudeau, F., Berson, E. L., Dryja, T. P. (1999) Mutations in RGR, encoding a light-sensitive opsin homologue, in patients with retinitis pigmentosa. Nat. Genet. 23, 393-394 Naldini, L., Blomer, U., Gallay, P., Ory, D., Mulligan, R., Gage, F. H., Verma, I. M., and Trono, D. (1996a) In vivo gene delivery and stable transduction of nondividing cells by a lentiviral vector. Science 272, 263-267 Naldini, L., Blomer, U., Gage, F. H., Trono, D., and Verma, I. M. (1996b) Efficient transfer, integration, and sustained long-term expression of the transgene in adult rat brains injected with a lentiviral vector. Proc. Natl. Acad. Sci. 93, 11382-11388 Napoli, J. L. (1986) Retinol metabolism in LLC-PK1 cells. J. Biol. Chem. 261, 13592-13597 Napoli, J. L. (2000) Retinoic acid: its biosynthesis and metabolism. Prog. Nucl. A cid Res. Mol. Biol. 63, 139-188 N ew ell, F. W. (1986) Anatomy and embryology, in Ophthalm ology: P rinciples an d Concepts. 6th edition, pp. 3-75, The C. V. Mosby Company, St. Louis, MO. Newman, E., and Reichenbach, A. (1996) The Muller cell: a functional element o f the retina. Trends Neurosci. 19,307-12 123 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Nicoletti, A., Kawase, K., and Thompson, D. A. (1998) Promoter analysis of RPE65, the gene encoding a 61-kDa retinal pigment epithelium-specific protein. Investig. Ophthal. Vis. Sci. 39, 637-644 Ozaki, K., Hara, R., Hara, T., and Kakitani, T. (1983) Squid retinochrome. Configurational changes of the retinal chromophore. Biophys. J. 44, 127-137 Ozaki, K., Terakita, A., Hara, R., and Hara, T. (1986) Rhodopsin and retinochrome in the retina o f a marine gastropod, Conomulex luhuanus. Vision Res. 26, 691-705 Palczewski, K., Van Hooser, J. P., Garwin, G. G., Chen, J., Liou, G. 1., and Saari, J. C. (1999) Kinetics of visual pigment regeneration in excised mouse eyes and in mice with a targeted disruption of the gene encoding interphotoreceptor retinoid-binding protein or arrestin. Biochemistry 3 8, 12012-12019 Pandey, S., Blanks, J. C., Spee, C., Jiang, M., and Fong, H. K. W. (1994) Cytoplasmic retinal localization of an evolutionary homolog of the visual pigments. Exp. Eye Res. 58, 605-613 Parish, C. A., Hashimoto, M., Nakanishi, K., Dillon, J. and Sparrow, J. (1998) Isolation and one-step preparation of A2E and iso-A2E, fluorophores from human retinal pigment epithelium. Proc. Natl. Acad. Sci. 95, 14609-14613 Pfeffer, B. A., Clark, V. M., Flannery, J. G., and Bok, D. (1986) Membrane receptors for retinol-binding protein in cultured human retinal pigment epithelium. Investig. Ophthalmol. Vis. Sci. 27, 1031-1040 Qtaishat, N. M., Okajima, T.-I. L., Li, S., Naash, M. I., and Pepperberg, K. R. (1999) Retinoid kinetics in eye tissues of VPP transgenic mice and their normal littermates. Investig. Ophthalmol. Vis. Sci. 40, 1040-1049 Rando, R. R. (1992) Molecular mechanisms in the visual pigment regeneration. Photochem. Photobiol. 56, 1145-1156 Rattner, A., Smallwood, P. M., and Nathans, J. (2000) Identification and characterization of all-trans-retinol dehydrogenase from photoreceptor outer segments, the visual cycle enzyme that reduces all-trans-retinal to all-trans-retinol. J. Biol. Chem. 275, 11034-11043 Redmond, T. M., Yu, S., Lee, E., Bok, D., Hamasaki, D., Chen, N., Goletz, P., Ma, J. X., Crouch, R. K., and Pfeifer, K. (1998) Rpe65 is necessary for production of 11-cis-vitamin A in the retinal visual cycle. Nat. Genet. 20, 344-351 Redmond, T. M ., Gentleman, S., Duncan, T., Yu, S., Wiggert, B., Gantt, E., and Cunningham, F. X. Jr. (2001) Identification, expression, and substrate specificity of a mammalian p-carotene 15,15'-dioxygenase. J. Biol. Chem. 276, 6560-6565 Roof, D. J., and Heth, C. A. (1994) Photoreceptors and retinal pigment epithelium; Transduction and renewal mechanisms, in Principles and Practice o f Ophthalmology 124 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. (Albert, D. M., and Jakobiec, F. A. eds) pp.309-332, W. B. Saunders Company, Philadelphia, PA Ruiz, A., Winston, A., Lim, Y. H., Gilbert, B. A., Rando, R. R., and Bok, D. (1999) Molecular and biochemical characterization of lecithin retinol acyltransferase. J. Biol. Chem. 274, 3834-3841 Saari, J. C., and Bredberg, D. L. (1988) CoA- and non-CoA-dependent retinol esterification in retinal pigment epithelium. J. Biol. Chem. 263, 8084-8090 Saari, J. C., and Bredberg, D. L. (1989) Lecithin:retinol acyltransferase in retinal pigment epithelial microsomes. J. Biol. Chem. 264, 8636-8640 Saari, J. C. (1994) Retinoids in photosensitive systems, in The retinoids: Biology, Chemistry and Medicine. 2n d edition. (Sporn, M. B., Roberts, A. B., and Goodman, D. S. eds), pp. 351- 385, Raven Press Ltd. New York Saari, J. C., Garwin, G. G., Van Hooser, J. P., and Palczewski, K. (1998) Reduction of all- trans-retinal limits regeneration of visual pigment in mice. Vision Res. 38, 1325-1333 Schiinermann, H. J., Grant, B. J. B., Freudenheim J. L., Muti, P., Browne, R. W., Drake, J. A., Klocke, R. A., and Trevisan, M. (2001) The relation o f serum levels of antioxidant vitamins C and E, retinol and caretenoids with pulmonary functions in the general population. Am. J. Respir. Crit. Care Med. 163, 1246-1255 Shen, D., Jiang, M., Flao, W., Tao, L., Salazar, M., and Fong, H. K. W. (1994) A human opsin-related gene that encodes a retinaldehyde-binding protein. Biochemistry, 33, 13117- 13125 Shi, Y. Q., Hubacek, L, and Rando, R. R. (1993) Kinetic mechanism of lecithin retinol acyltransferase. Biochemistry 32, 1257-1263 Simon, A., Heilman, U., Wernstedt, C., and Eriksson, U. (1995) The retinal pigment epithelial-specific 11-cis Retinol dehydrogenase belongs to the family of short chain alcohol dehydrogenases. J. Biol. Chem. 270, 1107-1112 Stecher, H., Gelb, M. H., Saari, J. C., and Palczewski K. (1999) Preferential release o f 11- cis-retinol from retinal pigment epithelial cells in the presence of cellular retinaldehyde- binding protein. J. Biol. Chem. 274, 8577-8585 Stryer, L. (1995) Signal transduction cascades, in Biochemistry, 4th edition, pp. 325-360, W. H. Freeman and Company, New York. Tao, L., Shen, D., Pandey, S., Hao, W., Rich, K. A., Fong, H. K. W. (1998) Structure and developmental expression of the mouse RGR opsin gene. Mol. Vis. 4, 25 (http://www.molvis.org/molvis/v4/p25) 1 2 5 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Timmers, A. M., and De Grip, W. J. (1990) Analysis of the visual cycle by short-term incubation of isolated retinal pigment epithelial cells. Methods Enzymol. 190, 3-17 Timmers, A. M., van Groningen-Luyben, D. A., and de Grip, W. J. (1991) Uptake and isomerization of all-trans retinol by isolated bovine retinal pigment epithelial cells: further clues to the visual cycle. Exp. Eye Res. 52, 129-138 Weng, J., Mata, N. L., Azarian, S. M., Tzekov, R. T., Birch, D. G., and Travis, G. H. (1999) Insights into the function of Rim protein in photoreceptors and etiology of Stargardt's disease from the phenotype in abcr knockout mice. Cell 98, 13-23 Williams, J. B., Pramanik, B. C., and Napoli, J. L. (1984) Vitamin A metabolism: analysis of steady-state neutral metabolites in rat tissues. J. Lipid Res. 25, 638-645 Yan, W., Jang, G. F., Haeseleer, F., Esumi, N., Chang, J., Kerrigan, M., Campochiaro, M., Campochiaro, P., Palczewski, K., and Zack, D. J. (2001) Cloning and characterization of a human P,P-carotene-l5,15-dioxygenase that is highly expressed in the retinal pigment epithelium. Genomics 72, 193-202 Yang, M., Wang, X., Stout, J. T., Hjelmeland, L. M., and Fong, H. K. W. (2000a) Over expression of recombinant RGR opsin in cultured cells using a lentiviral vector. Invest. Ophthal. Vis. Sci. 41, S616 Yang, M., Wang, X. G., Stout, J. T., Chen, P., Hjelmeland, L. M., Appukuttan, B., and Fong, H. K. W. (2000b) Expression of a recombinant human RGR opsin in Lentivirus-transduced cultured cells. Mol. Vis. 6, 237-242 (http://www.molvis.org/molvis/v6/a32) Yang, M., and Fong H. K. W. (2001) Uptake of all-fraws-retinol, novel all-trans-retinol dehydrogenase activity, and incorporation of the retinoid into the chromophore of RGR opsin. Invest. Ophthal. Vis. Sci. 42, S357 Yang, M., and Fong, H. K. W. (2002) Synthesis of the ail-frans-retinal chromophore of RGR opsin in cultured RPE cells. J. Biol. Chem. 277, 3318-3324. Zimmerman, W. F. (1974) The distribution and proportions of vitamin A compounds during the visual cycle in the rat. Vision Res. 14, 795-802 Zimmerman, W. F., Lion, F., Daemen, F. J. M., and Bonting, S. L. (1975) Biochemical aspects of the visual cycle process. XXX Distribution of stereospecific retinol dehydrogenase activities in subcellular fractions of bovine retina and pigment epithelium. Exp. Eye Res. 21, 325-332 Zimmerman, W. F. (1976) Subcellular distribution o f 11-cis retinol dehydrogenase activity in bovine pigment epithelium. Exp. Eye Res. 23, 159-164 1 2 6 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.

Linked assets

University of Southern California Dissertations and Theses

Conceptually similar

PDF

Characterization of the physiological ligand and function of a novel opsin RGR from the retinal pigment epithelium

PDF

A new model for hepatitis delta virus transcription and replication

PDF

Functional analysis of MSX2 and its role in skull patterning

PDF

Cellular factors involved in mouse hepatitis virus replication

PDF

Cloning, characterization, anti -apoptotic molecular mechanism, transgenic and protein binding studies of mouse TOSO gene

PDF

Immunogenicity of acute lymphoblastic leukemia: In vivo and in vitro studies of Bcr -Abl specific immune responses

PDF

Identification of oncogenes cooperating in murine mammary tumorigenesis and transgenic mouse models of breast cancer

PDF

Activity of Egfr pathway and its regulation in Drosophila eye development

PDF

Different roles of p160 coregulators in myogenesis

PDF

Expression and functional studies of the Notch signaling pathway in feather development

PDF

Cloning and characterization of Grb4: A novel adapter protein interacting with BCR -Abl

PDF

Characterization of cone arrestin's cis-elements that determine the fate of cone photoreceptor and pinealocyte gene expression

PDF

Identification and cloning of developmentally regulated genetic loci in transgenic mice by screening for novel expression pattern of the lacZ reporter gene

PDF

Functional analysis of the replicator ACE3 and origin beta required for Drosophila chorion gene amplification

PDF

Isolation and characterization of mouse Zac1, a novel co-regulator for transcriptional activation by nuclear receptors and p53

PDF

Biochemistry of nonhomologous DNA end joining (NHEJ) and its role in V(D)J recombination

PDF

An E2F-independent mechanism in transcriptional control of the hamster histone H3.2 gene expression

PDF

Characterization of target cell entry by murine leukemia viruses

PDF

Characterization of new factors involved in feline leukemia virus (FELV)-mediated leukemogenesis

PDF

An in vivo study of G protein coupled receptor mediated signaling

Asset Metadata

Creator Yang, Mao (author)

Core Title Expression of the RGR opsin and its function in the photic visual cycle

School Graduate School

Degree Doctor of Philosophy

Degree Program Molecular Microbiology and Immunology

Publisher University of Southern California (original), University of Southern California. Libraries (digital)

Tag biology, animal physiology,biology, molecular,OAI-PMH Harvest

Language English

Contributor Digitized by ProQuest (provenance)

Advisor Fong, Henry K.W. (committee chair), Lai, Michael M.C. (committee member), Lieber, Michael (committee member), Stallcup, Michael R. (committee member), Tahara, Stanley (committee member)

Permanent Link (DOI) https://doi.org/10.25549/usctheses-c16-550984

Unique identifier UC11339916

Identifier 3094391.pdf (filename),usctheses-c16-550984 (legacy record id)

Legacy Identifier 3094391.pdf

Dmrecord 550984

Document Type Dissertation

Rights Yang, Mao

Type texts

Source University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Access Conditions The author retains rights to his/her dissertation, thesis or other graduate work according to U.S. copyright law. Electronic access is being provided by the USC Libraries in agreement with the au...

Repository Name University of Southern California Digital Library

Repository Location USC Digital Library, University of Southern California, University Park Campus, Los Angeles, California 90089, USA