University of Southern California Dissertations and Theses

Discovery of a novel role of vasopressin in astrocytes: Vasopressin-induced cytoplasmic and nuclear calcium and kinases signaling cascade and modulation of astrocytes immune function

(USC Thesis Other)

Discovery of a novel role of vasopressin in astrocytes: Vasopressin-induced cytoplasmic and nuclear calcium and kinases signaling cascade and modulation of astrocytes immune function

PDF

Download

Open document

Flip pages

Download a page range

Download transcript

Copy asset link

Request this asset

Transcript (if available)

Content DISCOVERY OF A NOVEL ROLE OF VASOPRESSIN IN ASTROCYTES: VASOPRESSIN-INDUCED CYTOPLASMIC AND NUCLEAR CALCIUM AND KINASES SIGNALING CASCADE AND MODULATION OF ASTROCYTES IMMUNE FUNCTION by Lixia Zhao A Dissertation Presented to the FACULTY OF THE GRADUATE SCHOOL UNIVERSITY OF SOUTHERN CALIFORNIA In Partial Fulfillment o f the Requirements for the Degree DOCTOR OF PHILOSOPHY (MOLECULAR PHARMACOLOGY AND TOXICOLOGY) May 2003 Copyright 2003 Lixia Zhao Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. UMI Number: 3103987 UMI UMI Microform 3103987 Copyright 2003 by ProQuest Information and Learning Company. All rights reserved. This microform edition is protected against unauthorized copying under Title 17, United States Code. ProQuest Information and Learning Company 300 North Zeeb Road P.O. Box 1346 Ann Arbor, Ml 48106-1346 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. UNIVERSITY OF SOUTHERN CALIFORNIA THE GRADUATE SCHOOL UNIVERSITY PARK LOS ANGELES, CALIFORNIA 90089-1695 This dissertation, written by Lixia Zhao under the direction o f h er dissertation committee, and approved by all its members, has been presented to and accepted by the D irector o f G raduate and Professional Programs, in p artial fulfillm ent o f the requirements fo r the degree o f DOCTOR OF PHILOSOPHY D irector Date Ma.y 16 ,^ 2003 _ 1 X D issertaH on/C om m ittee^f Chair Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. DEDICATION This dissertation is dedicated to my mother and father, who instilled in me a deep appreciation of scholarship and the virtue of hard work, to my sisters and brothers for their encouragement and faith in me, and to my friends for their guidance and support. I especially want to dedicate this dissertation to Nelson J. Gilman, who has been a tremendous help in every aspect o f my life since I came to the United States four and half years ago. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. ACKNOWLEDGEMENTS This work was supported by grants from the Kenneth T. and Eileen L. Norris Foundation to RDB and the National Institutes of Aging (POl AG1475: Project 2) to RDB. Laser Scanning Confocal Microscopy was supported by the Confocal Microscopy Subcore of the USC Center for Liver Diseases supported by NIH 1 P30 DK48522. Dr. Steven S. Schreiber, Dr. Zhiqun Tan and Dr. Michael Son provided important technical resources. Most of all, I wish to thank Dr. Roberta Diaz Brinton, my Ph. D. advisor, for being my mentor, setting high standards for scientific research and teaching me how to be a scientist. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. TABLE OF CONTENTS Dedication - ii Acknowledgements --------------------------------------------------------------- iii List of Tables ........................................... v List of Figures ---------------------------------------------------------------------- vi Abstract ------------------------------------------------------------------------------ ix Body Introduction -------------------------------------------------------------- 1 C hapter! Vasopressin-Induced Cytoplasmic and Nuclear Calcium Signaling in Cultured Cortical Astrocytes — 15 Chapter I! Vasopressin-Induced Dynamics of Calcium and Calcium-Dependent Kinases Translocation in Cortical Astrocytes --------------------------------------- 49 Chapter III. Suppression of Pro-Inflammatory Cytokines Interleukin-lp and Tumor-Necrosis Factor-a in Astrocytes by Vasopressin: A CREB-Dependent Mechanism -------------------------------------------------- 98 Conclusion ----------------------------------------------------------------------- 135 Bibliography ------------------------------------------------------------------------ 139 iv Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. LIST OF TABLES 9+ Table I. Dose-Response of Vi agonist-induced Intracellular Ca Rise in Cortical astrocytes. Table II. Densitometric quantification of Vi agonist-induced cytokine gene suppression. Table III. Oligonucleotide primers used for cDNA amplification. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. LIST OF FIGURES Figure 1. Fura-2 Ca2 + images of cortical astrocytes prior to and following Vi agonist exposure in the presence or absence of Via antagonist. 27 2+ Figure 2. Heterogeneity of Vi agonist induced intracellular Ca rise. 28 Figure 3. Time-lapse fura-2 intracellular Ca2 + images of cortical astrocytes exposed to 250 nM Vi agonist. 30 94- • Figure 4. Cytoplasmic and nuclear Ca rise in response to Vi agonist. 31 Figure 5. Time-lapse confocal fluo-3 Ca2 + images of Vi agonist-induced nuclear Ca2 + rise in cortical astrocytes. 33 Figure 6. Immunocytochemical images of cortical astrocytes. 34 Figure 7. Concentration-response analysis of Vi agonist-stimulated [3 H]EPi accumulation in cortical astrocytes. 35 Figure 8. Antagonism of Vi agonist (Vi a)-stimulated [3 H]IPi accumulation by a V ia antagonist in cultured cortical astrocytes. 36 94- Figure 9. Abolishment of Vi agonist-mduced rise in intracellular Ca • • 94 - concentration in the absence of extracellular Ca . 37 Figure 10. Vi agonist (Vi a) induction of [3 H]IPi accumulation in the presence and absence of extracellular Ca2+. 38 Figure 11. Concentration-response analysis of Vi agonist-stimulated 45Ca2 + uptake in cultured cortical astrocytes. 39 Figure 12. Time course analysis of Vi agonist-stimulated 45Ca2 + uptake in cultured cortical astrocytes. 40 Figure 13. Antagonism of Vi agonist (Vi a)-stimulated 45Ca2 + uptake by a V ia antagonist in cultured cortical astrocytes. 41 Figure 14. Laser scanning confocal fluo-3 Ca2 + images of Vi agonist- induced [Ca2+ ]c and [Ca2+ ]n rise in cortical astrocytes. 64 VI Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Figure 15. Cytoplasmic [Ca2+ ]c and nuclear [Ca2+ ]n rise in response to Vi agonist in cortical astrocytes. 66 Figure 16. PKC activation in cortical astrocytes in response to Vi agonist. 68 Figure 17. CaMKII activation in response to Vi agonist in whole cell extracts of cortical astrocytes. 70 Figure 18. CaMKII activation and dynamic translocation in cytoplasmic and nuclear compartments of cortical astrocytes. 72 Figure 19. Activation and translocation of ERK1 and ERK2 in response to Vi agonist in cytoplasmic and nuclear compartments of cortical astrocytes. 77 Figure 20. Activation of ERK1/2 required upstream MEK, PKC and CaM kinases. 83 Figure 21. Activation of CREB in nuclei of cortical astrocytes in response to Vi agonist. 85 Figure 22. Activation of CREB is dependent on both MAPK and CaM kinases activation. 88 Figure 23. Schematic of vasopressin-induced cytoplasmic and nuclear signaling cascades in cortical astrocytes. 89 Figure 24. Profile of inflammatory cytokines gene expression in response to Vi agonist in cortical astrocytes. 110 Figure 25. Suppression of IL-1(3 gene expression by Vi agonist is confirmed by RT-PCR. 113 Figure 26. Suppression of TNF-a gene expression by Vi agonist is confirmed by RT-PCR. 114 Figure 27. Vi Agonist-Induced Suppression of TL-1 ( 1 is Dependent on CREB Activation. 116 Figure 28. Vi Agonist-Induced Suppression of TNF-a is Dependent on CREB Activation. 117 v ii Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Figure 29. Vi agonist-induced decrease of IL-ip detected in the medium of cortical astrocytes and its dependence on CREB activation. Figure 30. Vi agonist-induced decrease of TNF-a detected in the medium of cortical astrocytes and its dependence on CREB activation. Figure 31. LDH analysis demonstrating neuroprotective effect of Vi agonist-induced suppression of IL-1 ( 3 and TNF-a against LPS-treated astrocyte-conditioned medium. Figure 32. TUNEL analysis demonstrating neuroprotective effect of Vi agonist-induced suppression of IL-ip and TNF-a against LPS-treated astrocyte-conditioned medium. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. ABSTRACT We sought to determine whether vasopressin Via receptor (ViaR) mRNA detected in cortical astrocytes was translated into functional receptors by investigating the effector signaling cascade and gene expression associated with Via R. Analysis of intracellular Ca2 + ([Ca2+ ],) dynamics using the Ca2 + sensitive dyes fura-2 AM and/or fluo-3 AM indicated that exposure of astrocytes to V) vasopressin receptor agonist (Vi agonist), [Phe2, Om8 ]-oxytocin, induced a marked increase in [C a2+]j which was the result of influx of extracellular Ca2 + and activation of the 9 + phosphatidylinositol signaling cascade which releases Ca from endoplasmic 9 + reticulum stores. Furthermore, a rapid dynamic translocation o f Ca from the cytoplasm to the nucleus occurred in response to V) agonist. In the pursuit of the • • 9 + • • downstream consequences of ViaR activation of Ca signaling, we demonstrated that V ia R activation led to a significant rise in PKC, CaMKII and ERK1/2 activation with CaMKII and ERK1/2 demonstrating dynamic transport between cytoplasmic and nuclear compartments. While no evidence of PKC translocation was apparent, PKC and CaM kinases were required for activation and nuclear translocation of ERK1/2. Subsequent to CaMKII and ERK1/2 translocation to the nucleus, CREB activation occurred and was found to be dependent upon upstream activation of ERK1/2 and CaM kinases. Because astrocytes can exert immune effects analogous to immune cells in the periphery, we further investigated vasopressin regulation of cytokine gene expression in astrocytes. Results from gene array, RT-PCR and ix Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. ELISA studies indicated that vasopressin dramatically decreased the mRNA and peptide levels of two important pro-inflammatory cytokines, interleukin-1 (3 (IL-ip) and tumor necrosis factor-a (TNF-a), suggesting an immunomodulatory function of vasopressin in astrocytes in vitro. This cytokine suppression was dependent on the upstream CREB activation and was demonstrated to be neuroprotective. To our knowledge, this is the first documentation of a vasopressin receptor-induced nuclear Ca2 + signaling and modulation of cytokine gene expression in any cell type. Implications for vasopressin’s role in fever, neurodegeneration, autoimmune diseases, stress and neuropsychiatric behaviors are discussed. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. INTRODUCTION Vasopressin (AVP), a neuropeptide hormone with nine amino acids, is synthesized in magnocellular and parvocellular neurosecretory cells in the paraventricular, supraoptic and suprachiasmatic nuclei of the hypothalamus, the bed nucleus o f the stria terminalis and the medial amygdala (Soffoniew, 1985; Buijs, 1987; Caffe et al., 1987). Following its synthesis in hypothalamus, it is transported down the axons of the neurosecretory cells to the posterior pituitary where it is stored until it is released into the circulation upon activation of the neurosecretory cells by appropriate stimuli. Furthermore, vasopressinergic fibers also innervate a widespread area in the brain including the limbic system, the brain stem and the spinal cord, where vasopressin is released as a neurotransmitter (Swanson and Kuypers, 1980; DeVries et ah, 1985). There are at least three types o f vasopressin receptors: V ja, Vib and V2 vasopressin receptors (Via R, VibR and V2R respectively) that are all G- protein-coupled receptors with seven transmembrane domains. Biochemically, the Via R and V ^R act through phosphatidylinositol hydrolysis to increase the intracellular Ca2 + while the V 2R acts through Gs to increase the cyclic AMP level in the target cells (Jard, 1998). Vasopressin receptors are localized in different organs, therefore vasopressin has a broad range of functions in both the peripheral system and the central nervous system (CNS). In the periphery, vasopressin acts on a variety of target organs, including kidney, vascular smooth muscle and liver. Vasopressin is well known as the 1 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. antidiuretic hormone (ADH) because of its physiological role as a promotor of water reabsorption. It increases the permeability of the collecting ducts of the kidney, so that water enters the hypertonic interstitium of the renal pyramids. The overall effect is therefore retention of water in excess of solute; consequently, the effective osmotic pressure of the body fluids is decreased. The mechanism by which vasopressin exerts its antidiuretic effect is activated by the V 2R which stimulates the insertion of the aquaporin-2 water channels into the luminal membrane o f the collecting duct epithelium (Nielsen et al., 1993; Hayashi et al., 1994; Marples et al., 1995; Knepper, 1997; Saito et al., 1997). Besides, vasopressin is also a significant participant in physiological regulation of the cardiovascular system. Vasopressin is a potent stimulator of vascular smooth muscle in vitro and the V iaR mediates the vasoconstrictor effect of vasopressin. Peripherally secreted vasopressin is an important factor maintaining blood pressure in dehydration and hemorrhage as well as playing a role in the pathogenesis of certain forms of clinical and experimental hypertension (Cowley et al., 1980; Aisenbrey et al., 1981; Andrews and Brenner, 1981; Krakoff et al., 1985). In addition to its functions in kidney and cardiovascular system, vasopressin has been shown to elicit a glycogenolytic response in rat heptocytes (Tolbert et al., 1980), which is mediated by Via R in liver membranes that has been solubilized and characterized (Fishman et al., 1987). Vasopressin acts as a neurotransmitter in the CNS, evidenced by the demonstrations that 1) vasopressin can be released from central axons as are classical 2 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. neurotransmitters and vasopressin is detected in brain extracellular fluid and cerebral spinal fluid, 2) ViaR and VibR are present in various brain areas, and 3) electrophysiological studies show cellular actions of vasopressin on neurons. Vasopressin is released into various limbic structures after hypovolemic or osmotic stimuli (Pittman et al., 1982), into the ventral septal area during fever (Kasting et al., 1982) and into the perfusates of the spinal cord after electrical stimulation of the paraventricular nucleus (Pittman et al., 1984). Central release of vasopressin conforms to that expected for neurotransmitters in that it is Ca2 + dependent and can be evoked by depolarization (Buijs and Van Heerikhuize, 1982). Autoradiographic and radioligand-binding studies in a number of laboratories including ours have demonstrated the presence of putative receptors for [3 H] vasopressin in most regions in the brain in which vasopressinergic terminals have been found (Dorsa et al., 1983; Brinton et al., 1984; Audigier and Barberis, 1985). The binding is saturable, reversible, and of high affinity, and studies of structural analogs and antagonists indicate that these receptors are Via R (Muhlethaler et al., 1982; Tiberiis et al., 1983; Vallejo et al., 1984). mRNA for the V ia R in the brain has also been detected using in situ hybridization (Ostrowski et al., 1994; Szot et al., 1994). The V ^R appears to be unique to the anterior pituitary, where they mediate increased adrenocorticotropic hormone (ACTH) secretion from the corticotropes. Electrophysiologically, it has been demonstrated that a number of neurons in the lateral septum respond to microiontophoretically applied vasopressin with an increase in spontaneous single 3 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. unit activity in the same way as the excitatory neurotransmitter glutamate increases the activity of these neurons (Joels and Urban, 1982). Vasopressin is also capable of modulating long-term potentiation in slices prepared from rats (Teyler and DiScenna, 1987). Vasopressin in the CNS is involved in a number of homeostatic, behavioral and cognitive functions, and in situ injection of vasopressin antagonists can interfere with its central functions. For example, there is now considerable evidence that the cardiovascular role of vasopressin goes well beyond its direct peripheral effect on vascular smooth muscle, the interaction between vasopressin and cardiovascular regulation also depends on the effects of vasopressin in the CNS (Pittman and Bagdan, 1992). Vasopressin is found in regions of the brain known to be involved in cardiovascular regulation such as the locus coeruleus, nucleus tractus solitarius, dorsal motor nucleus of the vagus, and intermediolateral column of the spinal cord (Saper et al., 1976; Swanson, 1976; Buijs, 1978; Sofroniew et al., 1981; Sofroniew, 1985). Furthermore, an injection of vasopressin into the lateral ventricles, intrathecal space, or directly into circumscribed brain tissue sites causes elevation of blood pressure and heart rate in both anesthetized and conscious rats (Pittman et al., 1987). Activation of central nuclei containing vasopressin neurons cause vasopressin release in appropriate post-synaptic areas and this release is responsible for the elevations in blood pressure (Ciriello and Calaresu, 1980; Lawrence and Pittman, 1985; Pittman and Franklin, 1985). It has been demonstrated that brain vasopressin is involved in 4 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. blood pressure regulation in pathophysiological states (Toba et a l, 1998). It is of interest to mention that relatively large amounts of vasopressin are needed to raise blood pressure in vivo, because the vasoconstrictive effect o f vasopressin is masked by the buffering effect of the cardiovascular reflexes whose activation reduces cardiac output although total peripheral resistance remains elevated (Cowley et al., 1980). In addition to the central cardiovascular regulation by vasopressin, pioneering work from Dr. David De Wied and his colleagues was the first to describe the memory enhancing functions of vasopressin (de Wied, 1971; de Wied et al., 1976). Later studies by others in non-human primates and in humans using paradigms ranging from aversive to positively motivated tasks confirmed the observation. Vasopressin facilitates consolidation and retrieval processes in passive avoidance tests (Bohus et al., 1978a; Bohus et al., 1978b). Social recognition, a relevant memory model in rodents, is also facilitated by vasopressin (Popik et al., 1991; Dantzer and Bluthe, 1992). Learning and memory processes have been found to be disturbed in Brattleboro rats that are deficient in vasopressin, and these disturbances can be corrected by vasopressin (de Wied et al., 1993). Furthermore, central injection of antivasopressin serum induces severe disturbances in both active avoidance behavior and passive avoidance behavior (van Wimersma Greidanus et al., 1975; van Wimersma et al., 1975). In addition, the memory enhancing effects of vasopressin was found to be positively correlated with the complexity of the task. The more complex the task is, the greater the memory enhancing effect of vasopressin 5 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. (Messing and Sparber, 1985). V ia R and the ligand vasopressin are also present in brain during embryogenesis and can regulate several aspects of brain development (Boer, 1985; Chen et al., 2000a). Vasopressin-deficient Brattleboro rat exhibits deficits in cerebral cortical development manifested by a decrease in the cortical weight, cortical lipid content and DNA content of the cerebral cortex, suggesting a functional role of vasopressin in the cortical development (Boer et al., 1982). Besides, vasopressin is involved in the complex, stereotypic behavior, flank marking, a type of scent marking used in olfactory communication when it is microinjected into the medial preoptic area of the hypothalamus (Ferris et al., 1984). There is a strong correlation between vasopressin and lower level of aggression (Everts et al., 1997). The release of vasopressin also represents an important component of the stress response (Jezova et al., 1995). One of the most important functions of vasopressin that has received considerable attention over the last several years is its immune function. Fever response is one of the immune defense mechanisms in response to infections. Upon invasion by microorganisms, the immune system is exposed to large lipopolysaccharide molecules (LPS) often called exogenous pyrogens or endotoxins. LPS binds to a soluble, circulating LPS-binding protein and this complex in turn binds to the CD 14 surface receptor found on certain monocytes and macrophages. These in turn synthesize and release a variety of endogenous peptides including interleukin-lp (IL-ip), interleukin-6 (IL-6) and tumor necrosis factor-a (TNF-a) 6 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. that cross the blood brain barrier and activate an inducible cyclooxygenase (COX 2) in glial cells to cause central synthesis of prostaglandins, largely of the E series (PGE) which cause fever. It has been suggested that vasopressin is an antipyretic molecule, effective in lowering fever (Pittman et al., 1998). In most mammals, injection or infusion of exogenous vasopressin into ventral septal area or central medial amygdala reduces fever (Cooper et al., 1979a; Cooper et al., 1979b; Federico et al., 1992). Vasopressin has also been suggested to be implicated in “endogenous antipyresis”, in which fever responses to a normal pyrogenic stimulus are greatly attenuated (Pittman and Wilkinson, 1992). It is now apparent that there are a number of situations where animals fail to develop the normal febrile response to pyrogens such as in neonate rat pups and in parturient animals, and brain vasopressin has been implicated as the molecule responsible for this suppression o f fever (Pittman and Wilkinson, 1992). A number of studies have also reported that central administration of high doses of vasopressin intracerebroventricularly or into brain tissues can cause hypothermia (Meisenberg and Simmons, 1984; Naylor et al., 1986; de Wied et al., 1993; Diamant and De Wied, 1993; Drago et al., 1997). Besides the antipyretic action of vasopressin, there is other evidence supporting an immune function of vasopressin. Brain vasopressin is involved in stress-induced suppression of the immune function in rats by suppressing the proliferative response of splenic T cells and natural killer cell cytotoxicity (Shibasaki et al., 1998). De Wied’s group has suggested that vasopressin m aybe an endogenous 7 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. mediator determining the outcome of the avoidance behavior and the primary antibody response (Croiset et al., 1990). Moreover, rabbits immunized against vasopressin develop autoimmune alterations in neurohypophysis as evidenced by infiltration by immune cells and extracellular deposits of immunoglobulins (Cau and Rougon-Rapuzzi, 1979); and the lack of vasopressin in Brattleboro rats elevates baseline natural killer cell activity (Yirmiya et al., 1989). The long-held theory for vasopressin immunomodulation is that vasopressin modulates ACTH release which in turn stimulates adrenal glands to release glucocorticoids that suppress the immune system by suppressing pro-inflammatory cytokines (Sternberg, 1997). The release of ACTH is controlled primarily by corticotropin-releasing factor (CRF), but vasopressin has intrinsic releasing activity as well as potententiating the action of CRF at both hypothalamic and pituitary levels (McCann et al., 1987). However, despite the findings of vasopressin localization in immune cells in the brain such as astrocytes and microglia, and in immune tissues in the periphery, such as in the human thymus which is one of the glands of the immune system that plays a pivotal role in the maturation and differentiation of T-lymphocytes (Melis et al., 1993), direct vasopressin effect on immune cells has been largely neglected. As mentioned above, Via R is a typical G-protein-coupled receptor with seven transmembrane domains. Previous studies from our laboratory using both the endogenous ligand, vasopressin, and a selective antagonist against ViaR has demonstrated the presence of vasopressin recognition sites throughout the cerebral 8 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. cortex of the mammalian brain. This finding has been confirmed by a number of other laboratories; in situ hybridization localization of mRNA for the ViaR in the adult rat brain revealed ViaR mRNA expression in the cerebral cortex of adult male and female rats (Ostrowski et al., 1994; Szot et al., 1994). Furthermore, since there are a variety of cell types in the cerebral cortex, we sought to determine the cell specificity of ViaR expression. Results from these studies indicate that V ia R is present in all cell types studied, including cortical neurons, astrocytes and oligodendrocytes, supporting our earlier observation of extensive V ia R presence throughout the cerebral cortex. Based on this pioneering work, we have embarked upon a series of studies to determine the functionality of V ia R in different cell types in cerebral cortex. Studies on functional cellular response for vasopressin in the cortical neurons have indicated that vasopressin significantly increases multiple features of nerve cell morphology, including neurite length, number of branches, branch length, number of branch bifurcation points and number of microspikes, suggesting a neurotrophic role of vasopressin in cortical neurons which may mediate the ability of vasopressin to enhance memory function (Chen et al., 2000b). Further biochemical analysis on cortical neurons have revealed that ViaR activation leads to activation o f the phosphotidylinositol signaling pathway, resulting in a rise in intracellular Ca2 + which is dependent on Via R activated influx of extracellular Ca2 + through activation of L-type Ca2 + channels (Son and Brinton, 1998; Son and Brinton, 2001). 9 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Although plenty is known on the functions of ViaR in cortical neurons, the function of V ia R in cortical astrocytes is largely unknown. Astrocytes, one type of glial cells in the CNS, have long been thought to be a supporting element in the brain until recently when accumulating evidence indicate that astrocytes play a key role in CNS development, maintenance and regeneration. Astrocytes outnumber neurons in the CNS, secrete neurotrophic factors, guide neuronal development, contribute to the metabolism of neurotransmitters and regulate extracellular pH and K+ levels (Bezzi et al., 2001). Furthermore, astrocytes can contribute to neural circuit development and maintenance by increasing the number of mature functional synapses on neurons and maintaining synaptic contacts in vitro (Ullian, 1999). Astrocytes also contribute to both structural and functional integrity of the blood brain barrier (Prat et al., 2001). An emerging role of astrocytes within the CNS is regulation of the immune response via secretion of cytokines and chemokines (Dong, 2001). Although still controversial, upon stimulation astrocytes have been found to express major histocompatability complex class II molecules (MHC II), molecules that play a critical role in induction of immune responses through presentation of processed antigens to CD4+ T-helper cells (Wong et al., 1984), and costimulatory molecules including CD40, B7-1 and B7-2 that are essential for activation of naive T cells (Nikcevich et al., 1997), suggesting that astrocytes could function as antigen- presenting cells. Furthermore, astrocytes are potent producers of a number of cytokines and chemokines. Both in vitro and in vivo studies have documented the 10 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. ability of astrocytes to express IL-1, -6, and -10; interferon-a, and -(5; colony- stimulating factors GM-CSF, M-CSF, and G-CSF; TNF-a, TGF-(3; and a number of chemokines (Benveniste, 1998). Cytokines and chemokines in the CNS could influence T-helper cell 1 versus T-helper cell 2 responses, monocyte infiltration, and monocyte/microglia effector functions, as well as aspects of astrogliosis and demyelination (Benveniste, 1998). Among the cytokines expressed by astrocytes, IL- ip and TNF-a have received considerable attention recently because of their pro- inflammatory effects in the CNS. Because of the lack of the understanding of the functionality of ViaR in cortical astrocytes, this dissertation explored in details the biochemical signaling cascade induced by vasopressin in astrocytes. To study the function of V ia R in 2 _ j_ astrocytes, a natural approach to take is to conduct intracellular Ca imaging studies to determine whether ViaR activation is associated with activation of the phosphotidylinositol signaling cascade. Ca2 + is an important second messenger that has been demonstrated to play an important role as a signal in glial networks. Multiple physiological processes including protein kinase phosphorylation (Novak- Hofer and Levitan, 1983; Naim et al., 1985), cell proliferation (Silver, 1990), cell volume regulation (O'Connor and Kimelberg, 1993) and cell death (Fem, 1998; Robb et al., 1999) involve changes in intracellular Ca2 + in astrocytes. Furthermore, vasopressin has been demonstrated to induce the expression of several immediate early genes, including NGFI-A in astrocytes (Brinton et al., 1998) and c-fos in the 11 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. brain (Giri et al., 1990) and in the periphery (Nambi et al., 1989). It is conceivable that intracellular Ca2 + rise might be involved in the signaling pathways leading to the expression of these immediate early genes. Results of the Ca2 + signaling studies are described in Chapter I of this dissertation, which documents that Via R rapidly increases intracellular Ca2 + levels both within the cytoplasm and the nucleus. The rise in nuclear Ca2 + occurs simultaneous with the Ca2 + rise in the cytoplasm followed by an increase in nuclear Ca2 + concentration which appears to result from translocation of cytoplasmic Ca2 + into the nuclear compartment. The rise in nuclear Ca2 + remains high for several seconds followed by a translocation back to the cytoplasm and eventual decline in cytoplasmic Ca2 + concentration. The source of V) 2 + 2-f- agonist-induced rise in intracellular Ca is the result of influx o f extracellular Ca 9 + and activation of the phosphatidylinositol signaling cascade which releases Ca from endoplasmic reticulum stores. These data indicate that in cortical astrocytes, 9 + ViaR is functional and that activation of Via R leads to dynamic Ca signaling in both the cytoplasm and nucleus of cortical astrocytes. The spatial dynamics of the 9 -1 - Ca signal may implicate differential gene expression induced by vasopressin in cortical astrocytes. 9 + As mentioned above, Ca is an important second messenger involved in activation of a variety of kinases. To investigate the signaling pathway activated by vasopressin-induced Ca2 + signaling, we pursued activation of Ca2+ -activated protein kinases, protein kinase C (PKC) and Ca2 + calmodulin-dependent kinase II (CaMKII). 12 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Because both PKC and CaMKII can activate the MAP kinases ERK1/2, we also investigated the impact of V ia R activation on MAP kinases and their nuclear translocation. Furthermore, since V ia R activation leads to nuclear Ca2 + rise, we sought to determine whether the nuclear Ca2 + was paralleled by nuclear compartmentalization of Ca2+ -activated kinases and subsequent activation of the transcription factor CREB. The results of these studies are reported in Chapter II of this dissertation, which describe that V ia R activation leads to a significant rise in PKC, CaMKII and ERK1/2 activation with CaMKII and ERK1/2 demonstrating dynamic transport between cytoplasmic and nuclear compartments. While no evidence o f PKC translocation is apparent, PKC and CaM kinases are required for activation and nuclear translocation of ERK1/2. Subsequent to CaMKII and ERK1/2 translocation to the nucleus, CREB activation occurs which is dependent upon upstream activation of ERK1/2 and CaM kinases. Because of the presence of V ia R in cortical astrocytes, an immune cell type in the CNS, astrocytes is a perfect cell model to study immune function of vasopressin in the CNS. Given the importance of cytokines in astrocyte immune function coupled with our previous finding of the complex signaling cascade in astrocytes induced by vasopressin, in Chapter III of this dissertation, we investigated the impact of ViaR activation on the immune function of astrocytes, focusing on modulation of cytokine expression. Using a variety of experimental techniques, including gene array, RT- PCR, and enzyme-linked immunosorbent assay (ELISA), we have demonstrated that 13 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. vasopressin suppresses expression of a number of cytokines, especially the two important pro-inflammatory cytokines, IL-ip and TNF-a, both at the mRNA and protein levels. Furthermore, we have shown that the suppression of both EL-1(3 and TNF-a is dependent on upstream CREB activation and this suppression accounts for neuroprotective effect exerted by vasopressin against LPS-induced inflammation. Overall, the studies contained within this dissertation will provide insights into the questions of whether Via R in astrocytes are functional and what their functions are by exploring in details the complex biochemical signaling cascade and gene expression induced by ViaR activation in cortical astrocytes. 14 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. CHAPTER I VASOPRESSIN-INDUCED CYTOPLASMIC AND NUCLEAR CALCIUM SIGNALING IN CULTURED CORTICAL ASTROCYTES Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. ABSTRACT We sought to determine whether vasopressin ViaR mRNA detected in cortical astrocytes was translated into functional receptors by investigating the effector Ca2 + signaling cascade associated with the vasopressin V ia receptor subtype. Analysis of intracellular Ca2 + dynamics using the Ca2 + sensitive dye fura-2 AM indicated that exposure of cortical astrocytes to Vi vasopressin receptor agonist, [Phe2, Om8 ]-oxytocin, induced a marked dose-dependent increase in intracellular Ca2 + which was abolished by depletion of extracellular Ca2+. Furthermore, Vi agonist treatment induced a rapid increase in Ca2 + signal in both the cytoplasm and nucleus, which was followed by an accumulation of the Ca2 + signal in the nucleus suggesting translocation of cytoplasmic calcium into the nucleus. The nuclear Ca2 + signal was sustained for several seconds followed by translocation back to the 9+ cytoplasm. Following the nuclear to cytoplasm Ca translocation, total free intracellular Ca2 + concentration decreased. The dynamic Ca2 + cytoplasmic and nuclear localization was confirmed by laser scanning confocal microscopy coupled with Ca2 + sensitive dye fluo-3 AM. To determine the sources of Ca2+ , Vi agonist- induced 45Ca2 + uptake and [3 H]IPi accumulation were investigated. Vi agonist induced significant and rapid uptake of 45Ca2 + and significant dose-dependent increase in [3 H]IPi accumulation in cortical astrocytes. To our knowledge, this is the first documentation of a vasopressin receptor-induced Ca2 + signaling cascade in 16 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. cortical astrocytes and the first documentation of vasopressin receptor induction of nuclear Ca signaling. INTRODUCTION Vasopressin, the endogenous ligand for Via vasopressin receptor, is a nonapeptide hormone synthesized in a number of sites in the brain including paraventricular, supraoptic and suprachiasmatic nuclei of the hypothalamus, the bed nucleus of the stria terminalis and the medial amygdala (Sofroniew, 1985; Buijs, 1987; Caffe et al., 1987). Vasopressin is known to act as a neurotransmitter (Brinton, 1998), mediating a variety of behavioral and cognitive functions in the CNS including scent marking (Ferris et al., 1984), aggression (Everts et al., 1997) and learning and memory (de Wied, 1971; de Wied et al., 1976). The central functions of vasopressin are mainly mediated by the V ia vasopressin receptor (Albers et al., 1986; Ferris and Potegal, 1988; Alescio-Lautier et al., 1995; Brinton, 1998). Our earlier autoradiographic work using radiolabeled vasopressin, the endogenous ligand, and a selective antagonist binding to the ViaR demonstrated that vasopressin recognition sites were present throughout the cerebral cortex of the mammalian brain (Brinton et al., 1984; Chen et al., 1993; Brinton, 1998). These findings were confirmed by a number of laboratories which detected mRNA for the Via R in the cerebral cortex (Ostrowski et al., 1992; Ostrowski et al., 1993; Ostrowski et al., 1994; Szot et al., 1994; Yamazaki et al., 1997). In addition, we sought to 17 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. determine the cell types in the cerebral cortex that express V ia R recognition sites. Using differential culturing techniques, we found that neurons, astrocytes and oligodendrocytes from rat cerebral cortex all express Via R mRNA (Yamazaki et al., 1997). To determine whether Via R in cortical astrocytes are linked to a biochemical 9 + • signaling cascade, we investigated Ca signaling in cortical astrocytes m response to a specific V) vasopressin receptor agonist, [Phe2, Om 8]-oxytocin. Use of the specific V) agonist as a substitute for the endogenous arginine vasopressin was intended to define the specificity of the receptor involved in the responses to vasopressin. This Vi agonist is not metabolically protected, and therefore has the same half-life in vitro as arginine vasopressin. Fluorescent intracellular Ca2 + imaging with the Ca2 + sensitive dye Fura-2 AM to analyze intracellular Ca2 + dynamics was conducted and confirmed by Fluo-3 AM intracellular Ca2 + localization by laser scanning confocal - 2 t t t t microscopy. Tritium labeled InsPi ([ H]IPi) accumulation was utilized as an index for activation of phospholipase C. 4 5Ca2 + uptake was assayed to evaluate Ca2 + influx from extracellular compartment. Results of these studies indicate that ViaR rapidly increases intracellular Ca2 + levels both within the cytoplasm and the nucleus. The rise in nuclear Ca2 + occurs simultaneous with the Ca rise in the cytoplasm followed by an increase in nuclear Ca2 + concentration which appears to result from translocation o f cytoplasmic Ca2 + into the nuclear compartment. The rise in nuclear Ca2 + remains high for several 18 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. seconds followed by a translocation back to the cytoplasm and eventual decline in cytoplasmic Ca2 + concentration. The source of Vi agonist-induced rise in intracellular Ca2 + is the result of influx of extracellular Ca2 + and activation of the phosphatidylinositol signaling cascade which releases Ca2 + from endoplasmic reticulum stores. These data indicate that in cortical astrocytes, V ia vasopressin receptor is functional and that activation of the V ia R leads to dynamic Ca2 + signaling in both the cytoplasm and nucleus of cortical astrocytes. The spatial dynamics o f the Ca2 + signal may implicate differential gene expression induced by vasopressin in cortical astrocytes. MATERIALS AND METHODS Cell culture preparation. Cultures of cortical astrocytes were prepared following the method described in Brinton et al (Brinton et al., 1998). Cortices were dissected from the brains of embryonic day 18 (E l 8 ) Sprague-Dawley rat fetuses. The tissue was treated with 0.05% trypsin in Hank’s balanced salt solution (100 mM NaCl, 2.0 mM KC1, 4.2 mM N aHC03, 1.0 mM MgCl2 -6H20 , l.OmM NaH 2P 0 4 -H2 0 , 2.5 mMCaCl2 -2H20 , 12.5 mM HEPES, 10.0 mM Dextrose) for 5 min at 37°C. Following incubation, trypsin was inactivated with cold phenol red free Dulbeccos Modified Eagle Medium (DMEM; Invitrogen Corp., Carlsbad, CA) supplemented with 10 mM NaHC03, 10% fetal bovine serum, 5 U / ml penicillin and 5 pg / ml streptomycin, and 10% F12 nutrient medium for 3 min at 37°C. Tissue was then 19 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. washed with Hank’s balanced salt solution twice and dissociated by repeated passage through a series of fire polished constricted Pasteur pipettes. Cells were plated at a concentration of 1 X 106 cells / ml in 25mm flasks. Cultures were maintained in phenol red free DMEM supplemented with 10 mM NaHC03, 10% fetal bovine serum, 5 U / ml penicillin and 5 pg / ml streptomycin, and 10% F I2 nutrient medium at 37°C with 5% CO2 . Following 3-7 days in culture, glial cells were shaken at 220 rpm for 16 hours to remove oligodendrocytes and microglia and then the attached • • 9+ astrocytes were plated onto polyethylemmine (PEI) coated coverslips for Ca imaging and confocal microscopy studies, onto 4-well chamber slides for immunocytochemical staining studies and onto PEI coated 35mm petri dishes for [3H]IPi accumulation assay and 4 5Ca2 + uptake assay. The cortical astrocytes were cultured in the same FBS serum-containing medium at 37°C with 5% CO2 for 2-5 days before experiments. Fura-2 Intracellular Ca2 + Imaging. Cortical astrocytes to be used in Ca2 + imaging studies were cultured at a density of lx l0 5 cell/ml onto PEI coated coverslips then placed on to coverslip clamp chamber MS-502S (ALA Scientific Instruments; NY) for the Ca2 + imaging analysis. Astrocytes were briefly washed with KREBs buffer (137 mM NaCl, 5.3 mM KC1, 1.0 mM MgCl2 - 6 H 2 0 , 1.2 mM KH2PO 4 , 10 mM HEPES, 25 mM Dextrose, and 1.5 mM CaCL) then loaded with fura-2 acetoxymethyl ester (1.5 pmol / L; Molecular Probes, Inc., OR) in the dark at room temperature with gentle shaking (30-40 rpm) for 45 minutes. Excess fura-2 20 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. dye was removed by washing with KREBs buffer and incubated for 30 minutes at 37 °C for astrocytes to equilibrate. Five micromolar glutamate was used at the end of each experiment as positive control. The coverslip with fura-2 AM-loaded astrocytes was removed and attached to the coverslip clamp chamber MS-502S (ALA Scientific Instruments, Westbury, NY) for the Ca2 + imaging analysis. Fluorescence measurements of [Ca2+ ]i were performed using the InCyt2™ fluorescence imaging system (Intracellular Imaging, Inc., Cincinnati, OH). Astrocytes were placed on the stage of an inverted microscope (MT-2, Olympus) equipped with epifluorescence optics (20X, Nikon). The perfusion solution is KREBs buffer and the perfusion system connected to the perfusion chamber was balanced using two variable speed pumps. Imaging was performed at room temperature. Fluorescence was excited at wavelengths o f 340 and 380 nm •y I alternatively using a rotating 4-wheel filter changer. The Ca concentration curve was recorded during the experiment or images were saved for analysis after the experiment. To minimize the background noise of the fura-2 signal, successive values (16 sample images, 8 background images) were averaged (~13 images / min). After 30 sec of basal image acquisition, 100 ng/ml V) agonist was perfused into the chamber throughout the remaining observation time. To exclude any effect of mechanical stimulation, control KREBs buffer was perfused without V) agonist and the Ca2 + response observed for the same time. 21 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Laser Scanning Confocal Microscopy. Cortical astrocytes to be used in confocal imaging studies were cultured at a density of lxlO 5 cell/ml onto PEI coated coverslips then placed on to coverslip clamp chamber MS-502S (ALA Scientific Instruments, NY) for the confocal imaging analysis. Astrocytes were briefly washed with KREBs buffer (137 mM NaCl, 5.3 mM KC1, 1.0 mM MgCl2 -6H20 , 1.2 mM KH2P 0 4 , 10 mM HEPES, 25 mM Dextrose, and 1.5 mM CaCl2 ) then loaded with fluo-3 acetoxymethyl ester (5.0 pmol / L; Molecular Probes, Inc., OR) in the dark at room temperature for 45 minutes. Excess fluo-3 dye was removed by washing with KREBs buffer and incubated for 30 minutes at 37 °C for astrocytes to equilibrate. Coverslips were then examined with a Nikon PCM Quantitative Measuring High- Performance Confocal System equipped with argon and green HeNe lasers attached to a Nikon TE300 Quantum inverted microscope. The 488 nm argon laser line was directed to the astrocytes via a 510 nm primary dichroic filter. Pinhole size was set at 100pm. Images were acquired with Simple PCI C-Imaging Hardware and Quantitative Measuring Software and processed with Metamorph 4.5 (Universal Imaging Corporation). Immunocytochemical Staining. Cortical astrocytes were cultured on a chamber slide for 2-3 days before being washed with PBS and fixed with 95% methanol at 4°C. Nonspecific antibody binding was blocked by incubation in 1% horse serum in PBS for 30 min at room temperature. The slide was then incubated with primary antibody, mouse monoclonal anti-GFAP, for two hours. After being 22 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. washed with PBS, the slide was incubated in anti-mouse secondary antibody conjugated with Texas red for 30 min. The slides were washed again and then mounted with a cover glass with DAPI-containing mounting medium and viewed under fluorescent microscope. Assessment o f f HJIPj accumulation. After 2-5 days of incubation, 1 ml of the culture media was aspirated off and replaced with 0.5 ml of media containing 4 pCi / ml of [3H] myo-inositol (specific activity = 23.45 Ci / mmol). Preliminary studies indicated that 24 h of incubation with [3H] myo-inositol was optimal for incorporation into the cell lipids. Astrocytes were rinsed twice with 1ml of KREBs Ringer bicarbonate KRB buffer (124 mM NaCl, 5 mM KC1, 1.3 mM MgCl2 • 6 H 2O, 1.2 mM KH 2PO 4 , 26 mM NaHCCL, 10 mM dextrose and 1 mM CaCl) then pre incubated in 1 ml of KRB for 20 min at 37°C. Following the preincubation period, solution was exchanged for KRB + 10 mM LiCl (inositol phosphatase inhibitor) + test peptides at 20 min at 37°C for the. Peptides were dissolved in KRB solution (with lOmM LiCl) immediately prior to use. The reaction was terminated by the addition of 750 ml of ice cold methanol, astrocytes were scraped from the petri dishes with a cell scraper, and transferred to test tubes containing 1 ml of chloroform and 0.5 ml of deionized distilled water. An additional 750 ml of ice-cold methanol was added to the petri dishes then transferred to the same test tubes. Chloroform samples were vortexed then centrifuged at 2000 rpm for 5 min. The aqueous phase was transferred to test tubes containing 4 ml of deionized distilled water, vortexed, 23 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. and centrifuged at 2000 rpm for 5 min. 200ml of the chloroform organic phase sample was transferred to scintillation vials and counted after evaporation of chloroform. 5ml of the aqueous sample was filtered through 1ml Dowex columns (Bio-Rad, MO), which had been generated using 1 ml of 1 M ammonium formate / 0.1 M formic acid. Columns were washed with 5 ml of distilled deionized water twice, which was discarded, followed by 2.5 ml of 1 M ammonium formate / 0.1 M formic acid. This eluate containing the inositol phosphates was collected and 1 ml of the 2.5 ml eluate was counted by scintillation in 5 ml of scintillation fluid. In order to ■ 3 present comparable data cross experiments, [ H] IPi accumulation data were analyzed by determining the ratio of aqueous CPM / organic CPM and expressed as a percent of basal accumulation. 45Ca2 + Uptake Assay. Cultures were similar in age and cellular density to those used m [ HJIPi accumulation assay. Cultures were rinsed twice with KREBs buffer (124 mM NaCl, 5 mM KC1,1.3 mM MgCl2 • 6H20 , 1.4 mM KH2P 0 4, 26 mM NaHCC>3 , 10 mM dextrose, 1 mM CaCl and 10 mM HEPES) and then pre-incubated in 2ml KREBs buffer for 20 min at 37°C. Following this incubation, Vi agonist test solution prepared in KREBs with 1.0 pCi 4 5Ca2 + per 2ml was added to the cultures (specific activity of 4 5 Ca2 + = 30.7 mCi / mg). Following the incubation period with Vi agonist, the treatment solution was decanted and cultures were washed twice with 2 ml of KREBs buffer without 4 5 Ca2+ . After decanting the last KREBs wash, the reaction of 4 5 Ca2 + uptake was terminated by the addition of 1 ml of 7% ice cold 24 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. trichloroacetic acid (TCA) to each culture dish and incubated for 45 min at 4°C. TCA extracts were removed and transferred into scintillation vials for counting and lm l of NaOH added to the cultures to solubilize proteins for analysis of protein content by the Lowry method. Chemicals. Fura-2 AM and fluo-3 AM were purchased from Molecular Probes, [3H] Myo-inositol (spec. act. 23.4 Ci / mmol) and 4 5Ca2 + (spec. act. 30.7 mCi / mg) were purchased from Dupont New England Nuclear, Vi agonist ([Phe2 , Om8 ]- oxytocin) and the linear Via R antagonist, ([Phenylac1 , o-Tyr(Me)2, Arg6’ 8, Lys- NH2 9]-vasopressin) were purchased from Bachem. Dowex, ammonium formate, and formic acid for the ion exchange columns were obtained from Sigma. Monoclonal mouse anti-GFAP antibody, Texas red-conjugated secondary antibody and DAPI- containing mounting medium were from Vector. Data analysis. For Ca2 + imaging analyses, the Ca2 + level, frequency of response and timing of response were derived from more than 1 0 0 individual astrocytes. [ HJIPi accumulation data are presented as mean percent of basal ± S.E.M., as determined by the ratio of aqueous cpm /organic cpm. 4 5Ca2 + uptake data are presented as mean percent of basal ± S.E.M. Statistical analysis was performed by a Student’s t-test or by a one-way analysis of variance followed by Newman- Keuls post hoc analysis. 25 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. RESULTS Intracellular Ca2 + rise in response to Vi agonist Cultured cortical astrocytes were exposed to various concentrations of Vi agonist (1, 10, 100, 250 and 500 nM) and intracellular Ca2 + concentration was analyzed using fura-2 ratiometric fluorescent imaging. Five parameters were assessed; (1) the number of responsive cells, (2) average lag time of response, (3) Table I. Dose-Response of Vi agonist-induced Intracellular Ca Cortical astrocytes 2 + Rise in • • 2 4 " • Cortical astrocytes were loaded with fura-2 for ratiometnc Ca measurement m response to varying concentrations of Vi agonist. Five aspects of the response profile were analyzed: number of responsive cells, average lag time, average intracellular Ca2 + rise, average slope of intracellular Ca2 + rise and average slope of intracellular Ca2 + decay. 250 nM Vi agonist induced the maximal Ca2 + response (150 ± 21 nM) with about 73% of cortical astrocytes responding. Data points represent mean ± S.E.M., ** p < 0.01, *** p < 0.001 as compared to control perfused astrocytes. Concentra tion of V) agonist Number of responsive cells Average lag time (sec) Average [Ca2 + ]j increase (nM) Average slope of [Ca2 + ]j rise (nM / sec) Average slope of [Ca2 + ]i decay (nM / sec) 1 nM 7.4% ± 1.1 324 ± 26 50 ±9** 2.5 1 0.3 1 .5 1 0 .4 lOnM 8.5% ± 1.7 141 ± 13 124 ± 18 *** 5 .6 1 1.0 1 .7 1 0 .5 lOOnM 15.2% ± 3.4 120 ± 17 1 1 0 1 2 6 *** 13.610.5 *** 2.2 1 0.5 250nM 73.0% ± 5.2*** 50 ± 7 150121 *** 1 7 .711.6*** 3 .4 1 0 .6 500nM 14.3% 1 3.2 85 + 14 91 + 13 *** 14.4 ±0.8 *** 2.4 1 0.5 24 " 24- average magnitude of intracellular Ca rise; (4) average slope of intracellular Ca * * > | rise and (5) average intracellular Ca decay. Dose response analyses demonstrated that 250 nM Vi agonist induced the maximum response in cortical astrocytes (Table 26 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. I). At 250 nM Vi agonist, 73.0% ± 5.2 (*** p < 0.001) of the astrocytes responded, with an average intracellular Ca2 + rise of 150 ± 21 nM (*** p < 0.001). The average lag time was 50 + 7 seconds and the temporal profile of the response was very rapid (average slope of intracellular Ca2 + rise was 17.7 ± 1.6 (*** p < 0.001)). The average 9+ slopes of intracellular Ca decay, however, were not significantly different among different concentrations of Vi agonist (from 1.5 ± 0.4 to 3.4 ± 0.6 nM/sec) (Table I). Based on these findings, 250 nM was used as the V) agonist concentration for the i following Ca imaging studies. Figure 1. Fura-2 Ca2 + images of cortical astrocytes prior to and following Vi agonist exposure in the presence or absence of Via antagonist. Cultures of cortical astrocytes were loaded with fura-2 for 45 minutes (A), then exposed to 250nM Vi agonist (B) or pretreated with lOOnM Via antagonist for 30 minutes (C), or exposed to 250nM V) agonist and lOOnM Via antagonist (D). The pseudocolor bar was produced based on calibration with standard curve of Ca2 + concentrations ranging from 0 to 351nM. Scale bar = 50pm. A Before V 1 agonist With V ia C B eforeV I agonist 27 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. To determine the spatial response of astrocytes to Vi agonist, time-lapse fura- 2 C a2+ images were acquired for post-hoc analysis (Fig. 1). Vi agonist evoked a dramatic intracellular C a2+ rise (150 ± 21 nM). To confirm that the Vi agonist- induced [C a2+]j responses were mediated by ViaR activation, a specific linear ViaR antagonist, ([Phenylac1 , D -Tyr(Me)2, Arg6’ 8, Lys-NH2 9]-vasopressin) was used. Results of these analyses demonstrated that cortical astrocytes pre-incubated in the presence of 100 nM Via antagonist for 30 min followed by co-perfusion of 250 nM Vi agonist and 100 nM V ia antagonist showed no V) agonist-induced rise in intracellular Ca2 + concentration (Fig. 1). Figure 2. Heterogeneity of Vi agonist induced intracellular Ca2 + rise. Four astrocytes from the same culture were selected to provide a representative picture of the heterogeneity of V) agonist induced rise in intracellular Ca2+. 250nM V) agonist was perfused where indicated and was present throughout the entire observation period. A 70-90nM intracellular Ca2 + rise occurred in response to V) agonist exposure. Note that the temporal response profiles and the magnitude of the Ca2 + rise of these astrocytes were heterogeneous. 150 i 0 50 100 150 200 250 300 350 Time (sec) 28 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. To determine the temporal characteristics of intracellular Ca2 + rise in response to Vi agonist, real time analysis of intracellular Ca was performed (Fig. 2). A 70-90 nM rise in intracellular Ca2 + occurred following 250 nM Vi agonist treatment. The temporal response profile of astrocytes was highly heterogeneous, with some astrocytes responding rapidly while others responded much more slowly. For example, one astrocyte responded after about 40 seconds of exposure to Vi agonist, whereas another astrocyte did not respond to the same concentration of Vi agonist until after about 70 seconds. Nuclear Ca2 + localization In addition to the increase in intracellular Ca2 + in selected astrocytes, a change in intracellular Ca2 + localization was observed (Fig. 3). In the fura-2 Ca2 + images, Ca was initially increased in both the cytoplasm and nucleus. The cytoplasmic rise was followed by a rapid and transient Ca2 + localization into the nucleus. Following the nuclear rise in Ca2+ , translocation of nuclear Ca2 + back to the cytoplasm occurred before the decrease of total intracellular Ca concentration took place (Fig. 3). Although heterogeneous temporal response profiles of individual astrocytes were observed, with some astrocytes responding much earlier than others, all the responding astrocytes showed the Ca2 + nuclear localization. To quantify the cytoplasmic and nuclear Ca2+ , five responsive individual astrocytes were selected from Figure 3 (Fig. 4A) and window apertures were used to 29 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. obtain separate cytoplasmic and nuclear Ca2 + values (Fig. 4B,C,D,E,F). These data indicate that Ca2 + was initially increased in both the cytoplasm and nuclei of cortical astrocytes, followed by a rapid and transient Ca2 + translocation from the cytoplasm • • • 2d " to the nucleus. Each of the astrocytes showed a concomitant rise in nuclear Ca simultaneous with a decline in Ca2 + signal in cytoplasm. Following the nuclear Ca2 + rise, translocation of nuclear Ca2 + back to the cytoplasm occurred before the total intracellular Ca2 + concentration decreased. This was especially apparent in the data derived from astrocytes 2 and 3. Figure 3. Time-lapse fura-2 intracellular Ca2 + images of cortical astrocytes exposed to 250 nM Vi agonist. Cortical astrocytes were loaded with fura-2 in KREBs buffer followed by ratiometric Ca2 + measurement in response to Vi agonist. Images were captured every 7 seconds. Vi agonist was added at the 1st image. Note that Ca2 + was initially increased in both the cytoplasm and nucleus. The cytoplasmic rise was followed by a rapid and transient Ca2 + localization into the nucleus. Following the nuclear rise in Ca2+ , translocation of nuclear Ca2 + back to the cytoplasm occurred before the 94- decrease of total intracellular Ca concentration took place. Scale bar = 20 pm. 30 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Figure 4. Cytoplasmic and nuclear Ca2 + rise in response to Vi agonist. Five responsive cortical astrocytes were selected and numbered cell No. 1 to 5 (A). Window apertures were used to locate cytoplasm and nucleus of individual cortical astrocytes, and the cytoplasmic and nuclear Ca2 + were plotted against time (B: astrocyte 1; C: astrocyte 2; D: astrocyte 3; E: astrocyte 4; and F: astrocyte 5). Vi agonist was added where indicated and was present throughout the entire observation period. Note that Ca2 + was initially increased in both the cytoplasm and nucleus, followed by a rapid and transient Ca2 + localization into the nucleus. Following the rise in nuclear Ca2+ , translocation of nuclear Ca2 + back to the cytoplasm occurred before the total intracellular Ca concentration decreased. Astrocyte 1 1 250 -cytoplasmic o 150 V1 ag o n ist 0 150 50 100 200 250 250 Astrocyte2 200 150 § c 1 0 0 I 3 8 V1 a g o n ist 50 0 0 50 100 150 200 250 Astrocyte3 S 1 5 0 o 150 50 100 200 250 Tima (sac) Astrocyte4 - c - cytoplasmic V1 a g o n ist 0 50 100 150 200 250 200 | 150 .5 -♦ “ -nuclear -<*• cytoplasmic 100 i I 50 V 1 a g o n ist o o 5 0 100 iso 200 250 31 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. The dynamic Ca2 + nuclear localization was confirmed using laser confocal microscopy conducted with fluo-3 AM (Fig. 5). In the resting state, fluorescence signals were low, but sufficient to localize the cells and to define an appropriate optical plane through the cells. Furthermore, basal Ca2 + fluo-3 fluorescence signal in the nucleus was slightly higher than in the cytoplasm of cortical astrocytes. The apparent higher resting nuclear Ca2 + concentration is very likely due to a preferential 2 " h localization of fluo-3 to the nuclear compartment which does not occur with the Ca indicator fura-2 (Thomas et al., 2000). To exclude any effect of mechanical stimulation, 300 pi of KREBs buffer was added and the Ca2 + response observed for 3 min. A second addition of 300 pi of KREBs buffer was conducted followed by another 3 minutes of observation. This procedure was conducted on 5 coverslips containing a total of 35 astrocytes. Results of these experiments showed that neither the first nor the second addition of a 300pl KREBs buffer induced a rise in 'yi intracellular Ca in either the cytoplasm or the nucleus of cortical astrocytes. Following addition of V) agonist, the fluorescence intensity increased in both cytoplasmic and nuclear compartments followed by a much higher Ca2 + signal in the nucleus for several seconds. The Ca2 + signal encompassed the entire nucleus and then spread back to the cytoplasm followed by a decrease in total intracellular Ca2 + 'y j (Fig. 5), consistent with the fura-2 Ca imaging data. To confirm the nucleus localization in cortical astrocytes, immunocytochemical staining was conducted with anti-GFAP primary antibody and Texas red-conjugated secondary for cytoplasmic 32 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. localization and DAPI in the mounting media to for nuclear localization. The location and morphology of nuclei seen in immunocytochemical images reflect the nuclei observed in confocal images, confirming our nuclei observation in confocal studies (Fig. 6 ). Figure 5. Time-lapse confocal fluo-3 Ca2 + images of Y\ agonist-induced nuclear Ca2 + rise in cortical astrocytes. Confocal images were captured every 5 seconds for 2 minutes. Vi agonist was added at the 5th image. Following addition of Vi agonist, the fluorescence intensity was increased in both cytoplasmic and nuclear compartments followed by a much higher Ca2 + signal in nucleus for several seconds. The signal covered the whole nucleus and then spread back to the cytoplasm followed by the decrease in total intracellular Ca2+ , consistent with the fura-2 Ca2 + imaging data. Scale bar = 20 pm. 33 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Figure 6. Immunocytochemical images of cortical astrocytes. Cytoplasm of astrocytes was stained with anti-GFAP primary antibody and Texas red-conjugated secondary antibody and the nuclei of astrocytes were labeled with DAPI. The location and morphology of astrocyte nuclei in the immunocytochemical images are very similar to those observed in confocal studies. Scale bar = 20pm. Activation of phosphatidylinositol signaling pathway Two possible sources for the intracellular Ca2 + rise in response to Vi agonist are those derived from intracellular sources and that derived from the extracellular ^ I I compartment. Intracellularly, Ca can be released from intracellular Ca stores such as endoplasmic reticulum following IP3 production; and extracellularly, Ca2 + can enter astrocytes through various Ca2 + channels, pumps and/or ion exchangers. To elucidate the contribution of Ca2 + release from endoplasmic reticulum, we investigated the phosphatidylinositol signaling pathway by measuring generation of -i H labeled InsPi, an index of phospholipase C activation, in response to Vi agonist. Astrocyte cultures were treated with a range of Vi agonist concentrations: 10, 100, 250, 500, and 1000 nM. The dose response analysis demonstrated a significant 34 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. accumulation of [3H]EPi after exposure to 100 nM Vi agonist (141.7 % ± 16.4, * p < 0.05) which plateaued at 250 nM (131.9 % ± 7.1, * p < 0.05) and 500 nM (129.6 % ± 6 .6 , * p < 0.05) and began to decline in magnitude at 1000 nM (109.1 % ± 9.3) (Fig. 7). Figure 7. Concentration-response analysis of Vi agonist-stimulated [3 H]IPi accumulation in cortical astrocytes. Cultures were exposed to varying concentrations of V) agonist for 60 min. Values are from one experiment and are representative of three separate experiments, with six to eight cultures per condition per experiment. Data points represent mean ± S.E.M., * p < 0.05. to 8 160 - 00 o 140 ■ c o ro | 120 • 3 o o < ^ 100 • Q . X co 0 10 100 250 500 1000 V-| agonist (nM) To confirm that the Vi agonist induced [3H]IPi accumulation is also mediated by the Via receptor, the specific linear ViaR antagonist, ([Phenylac1 , D -Tyr(Me)2, Arg6’ 8, Lys-NH2 9]-vasopressin) was used in the [3H]IPi accumulation assay. The 35 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. antagonist (100 nM) alone had no significant effect on [3H]IPi accumulation, whereas it significantly blocked the Vi agonist-induced [3H]IPi accumulation (97.8 % ± 2.1) (Fig. 8 ). Figure 8. Antagonism of Vi agonist (Vi a)-stimulated [3H]IPi accumulation by a Via antagonist in cultured cortical astrocytes. Cultures were exposed to 100 nM Vi agonist for 60 min with or without pretreatment with lOOnM Via antagonist for 20 min. Values are mean ± S.E.M. from one experiment and are representative of data obtained from three separate analyses with six to eight cultures per condition per experiment, * p < 0.05. C D c .2 4-* J 2 D E 3 O o < X C O 120 ■ 80 ■ Preincubation in the presence of 100 nM V ia antagonist Ca2 + influx In addition to release of intracellular stores, the rise in intracellular Ca2 + may be due, in part, to an influx of extracellular Ca2+. To investigate the role of extracellular Ca2 + on the vasopressin response, we depleted Ca2 + from extracellular compartment and controlled osmolality with magnesium. Removal o f extracellular 36 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Ca2 + resulted in a complete abolishment of Vi agonist-induced intracellular Ca2 + rise (Fig. 9), indicating that the Ca2 + response to Vi agonist is dependent on the presence of extracellular Ca2+. Figure 9. Abolishment of Vj agonist-induced rise in intracellular Ca2 + concentration in the absence of extracellular Ca2 + . Cultures of cortical astrocytes were loaded with fura-2 for 45 minutes in the presence of extracellular Ca2 + (A), then exposed to 250nM Vi agonist (B), or were loaded with fura-2 in the absence of extracellular Ca2 + (C), then exposed to 250nM Vi agonist (D). The pseudocolor bar was produced based on calibration with standard curve of Ca2 + concentrations ranging from 0 to 351nM. Scale bar = 50pm. Extracellular A Before VfosgQni'st Extracellular C Before Vt agonist Two possible explanations can account for the abolishment of intracellular rise in the absence of extracellular Ca2+: lack of activation o f phospholipase C which leads to lack of IP3 production and Ca2 + release o f intracellular stores, or lack of Ca2 + influx which is necessary for Ca2 + release from intracellular stores. To discriminate these two explanations, [3H]IPi accumulation assay was conducted to investigate 37 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. whether the ViaR and the phosphotidylinositol signaling cascade were intact in the 94- absence of extracellular Ca . Vi agonist induced a significant rise in [ H]IPi accumulation in the absence of extracellular Ca2 + (160.1 % ± 5.0, * p < 0.05) (Fig. 1 0 ), which indicated that the loss in intracellular rise in the absence of extracellular 94- 94- Ca was due to lack of Ca influx. Figure 10. Vi agonist (Vf a) induction of [3H ]IP j accumulation in the presence and absence of extracellular Ca2 + . 1.0 mM Magnesium was added to the Ca2 + free KRB buffer to control osmolality. Cultures of cortical astrocytes were exposed to lOOnM V) agonist in 1.0 mM and 0.0 mM Ca2 + containing KRB buffer for 60 min. Values represent mean ± S.E.M. from one experiment and are representative of three separate analyses with six to eight cultures per condition per experiment, * p < 0.05. C O C O c o 00 c o 200 150 - J2 100 E 3 O o < 50 ■ I CO 1.0 mM Ca2+ 0.0 mM Ca2+ * ~sn~ Since extracellular Ca2 + was required for intracellular Ca2 + rise in cortical astrocytes in response to the Vi agonist, 4 5Ca2 + uptake analysis was conducted to 38 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. investigate whether Vi agonist induced Ca2 + entry from extracellular compartment. Vi agonist significantly increased 4 5Ca2 + influx in a concentration and time- dependent manner. A significant increase in 4 5Ca2 + uptake was observed at the concentration o f 10 nM (107.2 % ± 2.7, * p < 0.05) and reached its maximum at 100 nM (131.1 % ± 1.9, * p < 0.05), which plateaued at 250 nM (119.5 % ± 3.4, * p < 0.05), 500 nM (113.3 % ± 3.7, * p < 0.05) and 1000 nM (109.0 % ± 4.2, * p < 0.05), while still significantly higher than the basal level (Fig. 11). V) agonist induced significant 4 5Ca2 + uptake after as short as 5 seconds of exposure to Vi agonist (112.6 % ±4.1, * p < 0.05). It continued to rise until 15 seconds (129.8 % ± 4.9, * p < 0.05) and 30 seconds (128.1 % ± 3.1, * p < 0.05) and then declined to basal level at 1 and 2 minutes, 103.7 % ± 3.2 and 103.8 % ± 5.5, respectively (Fig. 12). Figure 11. Concentration-response analysis of Vi agonist-stimulated 4 5 Ca2 + uptake in cultured cortical astrocytes. 4 Ca2 + uptake values are from one experiment and are representative of three separate experiments, with six to eight cultures per condition per experiment. Data points represent mean ± S.E.M., * p < 0.05. 140 130 - 120 • Q- 1 1 0 ■ 100 ■ io 0 10 100 250 500 1000 V, ag o n ist (nM) 39 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Figure 12. Time course analysis of Vi agonist-stimulated 4 5 Ca2 + uptake in cultured cortical astrocytes. 4 5Ca2 + was added simultaneously with 100 nM Vi agonist or control buffer for different time periods. Values are from one experiment and are representative of three different experiments, with six to eight cultures per condition per experiment. Data points represent mean ± S.E.M., * p <0.05. 140 130 ■ 120 ■ CL 100 - io 0 20 40 60 80 100 120 140 Time (sec) To confirm that the 4 5Ca2 + uptake following Vi agonist treatment was mediated by Via vasopressin receptor, the V ia antagonist inhibition of 4 5Ca2 + uptake was determined. As expected, the antagonist alone had no effect on 4 5Ca2 + uptake, whereas it blocked Vi agonist induced 4 5Ca2 + uptake (Fig. 13; 99.4 % ± 3.4). 40 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Figure 13. Antagonism of Vi agonist (Vi a)-stimulated 4 5 Ca2 + uptake by a Via antagonist in cultured cortical astrocytes. Cultures were exposed to 100 nM Vi agonist for 15 sec with or without pretreatment with lOOnM Via antagonist for 20 min. Values are mean ± S.E.M. from one experiment and are representative of data obtained in three separate analyses with six to eight cultures per condition per experiment, * p <0.05. 160 - 15 1 4 0 - ( / ) £§ 120 - 4 — 5 100 - 3. 80 - . 2 3 60 - - C O 4 0 - O £ 20 - 0 - DISCUSSION The functionality of Via vasopressin receptors in cortical astrocytes was investigated. Results of this study demonstrated that Vi receptor agonist induced a marked intracellular Ca2 + rise in cultured cortical astrocytes with a dynamic Ca2 + b nuclear localization. This intracellular Ca2 + rise was composed of both release of intracellular Ca2 + stores and influx of extracellular Ca2+. 41 preincubation in the presence o f 100 nM V ia antagonist Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Cytoplasmic and nuclear Ca2 + rise in response to Vi agonist 2+ , , The temporal profile of Vi agonist-induced intracellular Ca rise in cortical astrocytes was highly heterogeneous and the intracellular Ca2 + rise in response to Vi agonist was concentration dependent. Five concentrations of Vi agonist were used in the Ca2 + imaging studies with 250nM Vi agonist inducing the maximal response in terms of percentage of responsive cells, average lag time, level of intracellular Ca increase and temporal profile of the response. This dose-dependency indicated that concentrations of Vi agonist influenced the pattern of astrocyte Ca2 + dynamics. In both the fura-2 Ca2 + imaging analysis and fluo-3 confocal microscopy, our results demonstrated that the increase of intracellular Ca2 + by V] agonist took place initially at both the cytoplasm and nucleus, which was followed by a rapid and transient Ca2 + nuclear localization for several seconds followed by translocation back to the cytoplasm. A caveat to these findings is the characteristics of the Ca2 + indicators used for analysis. In the confocal imaging analyses, we consistently observed a slightly 2 j higher Ca fluo-3 fluorescence signal in the nucleus of cortical astrocytes. The higher resting nuclear Ca2 + level maybe a function of the Ca2 + indicator, fluo-3. In an analysis of different Ca2 + sensitive dyes, Thomas and colleagues (Thomas et al., 2000) reported that fluo-3 preferentially localizes to the nucleus, albeit not to the same extent as other indicators. In contrast, the Ca2 + indicator fura-2 does not preferentially localize to cell organelles including the nucleus. This is apparent in our 42 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. fura-2 images in which the resting nuclear Ca2 + level is similar to cytoplasmic Ca2+. 9 + Thus, we would suggest at this time that the higher basal Ca levels within the nucleus are attributable to fluo-3 concentration within the nucleus and not to any property of the astrocytes or the experimental conditions. Functions of cytoplasmic and nuclear Ca2 + 94- Although Ca has been studied extensively as a versatile second messenger which controls many cellular processes (Hardingham and Bading, 1999; Cruzalegui 9 + and Bading, 2000), the function of nuclear Ca remains largely uncharted. It has been suggested that gene expression is differentially regulated by cytoplasmic and nuclear Ca2 + which enables a single second messenger to generate diverse transcriptional response (Hardingham et al., 1997). One of the targets of nuclear Ca2 + may be calmodulin. The presence of calmodulin in the nucleus has been demonstrated (Vendrell et al., 1991; Bachs et al., 1994), and together with nuclear 2d - Ca , calmodulin may activate Ca/calmodulin-dependent protein kinase type II and IV(CaM kinase II and IV) in the nucleus (Ohta et al., 1990; Chawla et al., 1998). CaM kinase II and IV play a pivotal role in regulating the activation of CREB (Sheng et al., 1991) and its coactivator CBP (Chawla et al., 1998). Another possible target of nuclear Ca2 + is PKC. Formation of diacylglycerol (DAG) has been shown to take place in the nucleus (Divecha et al., 1991; Leach et al., 1992) and it can lead to translocation of PKC from cytoplasm to nucleus (Leach 43 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. et al., 1992). Furthermore, PKC has been detected in the nucleus in unstimulated cells (Buchner et al., 1992). DAG and nuclear Ca2 + can then activate PKC and lead to its insertion into membranes (Buchner et al., 1992). PKC has been suggested to phosphorylate several nuclear proteins, including DNA topoisomerases I and II (Rottmann et al., 1987; Pommier et al., 1990) and the nuclear IP3 receptor (Matter et al., 1993). While the functional significance of Via vasopressin receptor-activated cytoplasmic and nuclear Ca2 + signaling in astrocytes remains to be determined, intracellular Ca2 + has been demonstrated to play an important role as a signal in glial networks. Multiple physiological processes including protein kinase phosphorylation (Novak-Hofer and Levitan, 1983; Naim et al., 1985), cell proliferation (Silver, 1990), cell volume regulation (O'Connor and Kimelberg, 1993) and cell death (Fem, 1998; Robb et al., 1999) involve changes in intracellular Ca2 + in astrocytes. Furthermore, vasopressin has been demonstrated to induce the expression of several immediate early genes, including NGFI-A in astrocytes (Brinton et al., 1998) and c- fos in the brain (Giri et al., 1990) and in the periphery (Nambi et al., 1989). It is 94- conceivable that intracellular Ca rise might be involved in the signaling pathways leading to the expression of these immediate early genes. Moreover, while learning and memory are typically thought to be mediated by neurons, increasing evidence suggests a critical role o f astrocytes in cognitive function (Trachtenberg and Pollen, 1970; Laming, 1989). 44 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Activation of phosphatidylinositol signaling pathway and Ca2 + influx Vasopressin induction of [3H]IPi accumulation in cortical astrocytes and its link to vasopressin receptor are consistent with previous findings of vasopressin action in other cell types, including neurons (Brinton et al., 1994), heptocytes (Dibas et al., 1997) and smooth muscle cells (Plevin et al., 1992). V Ja vasopressin receptor is a G-protein coupled receptor and when bound by its agonist activates Gq protein which in turn activates phospholipase C. Phospholipase C can cleave phosphotidylinositol to produce IP3 and DAG. Activation of this signaling cascade is well known to release Ca2 + from endoplasmic reticulum stores upon IP3 production. The fluorescent Ca2 + imaging data demonstrated that influx of extracellular Ca2 + was required for the increase in intracellular Ca2+. In the absence of extracellular Ca2+ , no rise in intracellular Ca2 + was observed, whereas Vi agonist- induced [3H]EPi accumulation was not affected. Furthermore, Ca2 + influx was induced in response to Vi agonist. These data indicated that the influx of Ca2 + was an obligatory and primary step for the rise of intracellular Ca2 + in response to Vi agonist, followed by a secondary nvinducible intracellular Ca2 + release. The requirement of extracellular Ca2 + influx is consistent with a Ca2+ -dependent release of intracellular Ca2 + from the endoplasmic reticulum, so called “Ca2+ -induced Ca2 + release model” (Berridge, 1993; Son and Brinton, 1998). Furthermore, Ca2 + uptake declined back to basal level at one minute of exposure to Vi agonist, suggesting a 45 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. pumped efflux of Ca2+. These data further suggest that Ca2 + influx acts as a rapid and transient trigger for initiation o f the vasopressin-induced Ca2 + signaling cascade. In the Ca2 + imaging experiments, 250nM was found to be the optimal concentration to induce intracellular Ca2 + rise, while in [3H]IPi accumulation assay and 4 5 Ca2 + uptake assay, lOOnM V) agonist induced the maximal response. The most likely explanation for the disparity in EC 100s is that in the Ca2 + imaging experiments, Vi agonist was perfused into a chamber containing 600pl KREBs control buffer thereby effectively diluting the concentration of Vi agonist until complete exchange of the chamber which occurs within 20-30 seconds whereupon the concentration of the agonist reached the perfused agonist concentration. In the [3H]IPi accumulation assay and 4 5 Ca2 + uptake assay, however, lOOnM Vi agonist was administered directly to the cells without initial dilution or perfusion delay time. Pathways of Ca2 + influx The question arises regarding the route of Vi agonist-induced Ca2 + influx. Astrocytes express voltage-gated Ca2 + channels, most notably L and T types (Verkhratsky and Steinhauser, 2000). There are also studies demonstrating expression of other voltage-dependent Ca2 + channels such as the N-type (White et al., 1992). It is now becoming increasingly apparent that the influx of Ca2 + through voltage-sensitive Ca2 + channels can be modulated by receptor-mediated events. A number of cell surface receptors are coupled either directly to Ca2 + channels 46 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. (Fasolato et al., 1994) or through the intermediate G-proteins (Hescheler and Schultz, 1993; Strubing et al., 1997). In magnocellular vasopressin neurons isolated from the rat supraoptic nucleus, for example, L-, N- and T- but neither P- nor Q-type Ca2+ channels control vasopressin-induced Ca2+ influx (Sabatier et al., 1997), while in cultured cortical neurons, L-type Ca2 + channel mediates vasopressin-induced Ca2 + influx (Son and Brinton, 1998; Son and Brinton, 2001). Multiple Ca2 + channels might be involved in the Ca2 + influx in response to Vi agonist in cortical astrocytes • 2 ~ f ~ and studies are currently underway to investigate the involvement of different Ca channels. In conclusion, our results demonstrated that the V ia R mRNA found in cortical astrocytes is associated with functional V ia vasopressin receptors. 2+ , Activation of the V ia vasopressin receptors induced a dramatic intracellular Ca rise in cortical astrocytes and that the Ca2 + responses are due to an interplay of Ca2 + influx from the extracellular compartment and IP3 -induced Ca2 + release from intracellular stores. Remarkably, activation of Via vasopressin receptor induced a rise of both cytoplasmic and nuclear Ca2+. Both visual and quantitative analyses indicate that the rise in nuclear Ca2 + is dependent upon Ca2 + translocation from the cytoplasm. Moreover, the dynamics of the Ca2 + signaling are consistent with hypotheses o f differential regulation of gene expression. We are currently pursuing 47 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. the functional significance of vasopressin-induced rises in nuclear Ca2 + and its role in regulating gene expression in cortical astrocytes. 48 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. CHAPTER II VASOPRESSIN-INDUCED DYNAMICS OF CALCIUM AND CALCIUM-DEPENDENT KINASES TRANSLOCATION IN CORTICAL ASTROCTYES Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. ABSTRACT The current study sought to determine the downstream consequences of Via vasopressin receptor activation of Ca2 + signaling in cortical astrocytes. Results of these analyses confirmed that ViaR activation led to a marked increase in both cytoplasmic and nuclear Ca2+. We further investigated V ia R activation of Ca2+ - activated signaling kinases, PKC, CaMKII and the MAP kinases ERK1/2, their localization within cytoplasmic and nuclear compartments, and activation of their downstream nuclear target, the transcription factor, cyclic-AMP response element- binding protein (CREB). Results of these analyses demonstrated that V ia R activation led to a significant rise in PKC, CaMKII and ERK1/2 activation with CaMKII and ERK1/2 demonstrating dynamic transport between cytoplasmic and nuclear compartments. While no evidence of PKC translocation was apparent, PKC and CaM kinases were required for activation and nuclear translocation of ERK1/2. Subsequent to CaMKII and ERK1/2 translocation to the nucleus, CREB activation occurred and was found to be dependent upon upstream activation of ERK1/2 and CaM kinases. These data provide the first systematic analysis of ViaR-induced Ca signaling cascade in cortical astrocytes. In addition, results o f this study introduce a heretofore unknown effect of vasopressin, dynamic Ca2 + signaling between cytoplasm and nucleus that leads to comparable dynamics of kinase activation and shuttling between cytoplasmic and nuclear compartments. Implications for 50 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. development and regeneration following ViaR activation of CREB-regulated gene expression in cortical astrocytes are discussed. INTRODUCTION The V ia R and its cognate ligand, vasopressin, are present in brain during embryogenesis and can regulate several aspects of brain development (Boer, 1985; Chen et al., 2000a). In the mature brain, vasopressin regulates a broad spectrum of behavioral and cognitive functions including homeostasis (Kasting et al., 1982) and an array of complex behaviors including learning and memory (de Wied, 1971; Ferris et al., 1984; Everts et al., 1997; Brinton, 1998). Earlier studies from our laboratory detected vasopressin recognition sites in the cerebral cortex of the mammalian brain (Brinton et al., 1984; Chen et al., 1993; Brinton, 1998). Both radiolabeled vasopressin and a selective antagonist binding to the V ia R revealed that recognition sites for vasopressin were uniformly distributed throughout the cortical subregions. Subsequent in situ hybridization localization of mRNA for the ViaR in the adult rat brain revealed Via R mRNA expression in the cerebral cortex of adult male and female rats (Ostrowski et al., 1994; Szot et al., 1994). Analysis of the cellular localization of Vja R mRNA indicated the presence of ViaR mRNA in neurons, astrocytes, oligodendrocytes and microglia of the cerebral cortex (Yamazaki et al., 1997). 51 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. In the pursuit of the functionality of V ia R in cortical astrocytes, we investigated V iaR regulation of Ca2 + signaling in cortical astrocytes (Zhao and Brinton, 2002). Using quantitative fura-2 AM intracellular Ca2 + imaging, we found 2" h that Vi agonist induced a rapid and significant increase in intracellular C a concentration ([C a2+] i ). Results of these studies also demonstrated that C a2+ influx- dependent C a2+ release from endoplasmic reticulum is the source for the [C a2+]j rise in response to V) agonist (Zhao and Brinton, 2002). Surprisingly, we discovered that Vi agonist-induced C a2+ led to a rise in both cytoplasmic ([C a2+]c) and nuclear C a2+ ([Ca2+ ]n). In the current work, we sought to determine the downstream consequences of • • 9 + • Vi agomst-mduced Ca signaling in both the cytoplasm and the nucleus of cortical astrocytes. Using laser scanning confocal microscopy with the Ca2+ -sensitive dye fluo-3, we confirmed that V) agonist induced a rapid dynamic [Ca2+ ]c and [Ca2+ ]n rise. [Ca2+ ]c and [Ca2+ ]n obtained with fura- 2 indicated that V) agonist induced an 9 + initial Ca increase in both the cytoplasm and the nucleus of cortical astrocytes, which was followed by an accumulation of the Ca2 + signal in the nucleus, suggesting 9 , translocation of cytoplasmic Ca into the nucleus. To investigate the signaling pathway activated by vasopressin-induced Ca2 + signaling, we pursued activation of Ca2+ -activated protein kinases, PKC and CaMKII. Furthermore, because both PKC and CaMKII can activate the MAP kinases ERK1/2, we investigated the impact of Vi agonist on MAP kinases and their nuclear translocation. Because Via R activation 52 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. led to [Ca2+ ]n rise, we sought to determine whether the nuclear Ca2 + was paralleled by nuclear compartmentalization of Ca2+ -activated kinases and subsequent activation of the transcription factor CREB. MATERIALS AND METHODS Cell culture preparation. Cultures of cortical astrocytes were prepared following the method described previously (Zhao and Brinton, 2002). Cortices were dissected from the brains of embryonic day 18 (El 8 ) Sprague-Dawley rat fetuses. The tissue was treated with 0.05% trypsin in Hank’s balanced salt solution (5.4 mM KC1, 0.4 mM KH2P 0 4, 137 mM NaCl, 0.34 mM Na2H P0 4 -7H2 0 , 10.0 mM Glucose, 10.0 mM HEPES) for 5 min at 37 °C. Following incubation, trypsin was inactivated with cold phenol red free 10% serum-containing medium containing Dulbeccos Modified Eagle Medium (DMEM; Invitrogen Corp., Carlsbad, CA) supplemented with 10 mM NaHC03, 10% fetal bovine serum (FBS; Invitrogen Corp., Carlsbad, CA), 5 U / ml penicillin and 5 pg / ml streptomycin, and 10% F12 nutrient medium for 3 min at 37 °C. Tissue was then washed with Hank’s balanced salt solution twice and dissociated by repeated passage through a series of fire polished constricted Pasteur pipettes. Cells were plated at a concentration of 1 X 106 cells / ml in 25 mm flasks. Cultures were maintained in 10% serum-containing medium at 37 °C with 5% C 0 2. Following 3-7 days in culture, glial cells were shaken at 220 rpm for 16 hr to remove oligodendrocytes and microglia. The attached astrocytes were then plated 53 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. onto poly-D-lysine-coated coverslips for laser scanning confocal microscopy and fura-2 intracellular Ca2 + imaging experiments, onto poly-D-lysine-coated 8 -well chamber slides for immunocytochemical fluorescent microscopy experiments, and onto poly-D-lysine-coated 60 mm petri dishes for PKC activity assay and Western blot experiments. Cortical astrocytes were cultured in the same FBS serum- containing medium at 37 °C with 5% CO2 for 2-5 days before the experiments. Laser scanning confocal microscopy. Two to five-day-old cortical astrocytes grown on poly-D-lysine-coated coverslips were briefly washed with KREBs buffer (137 mM NaCl, 5.3 mM KC1, 1.0 mM MgCl2 -6H20 , 1.2 mM KH2P 0 4, 10 mM HEPES, 25 mM Dextrose, and 1.5 mM CaCl2 ), then loaded with fluo-3 acetoxymethyl ester (5.0 pmol / L) in the dark at room temperature for 45 min. Excess fluo-3 dye was removed by washing with KREBs buffer, and astrocytes were incubated in KREBs buffer for 30 min at room temperature to equilibrate. Coverslips were then placed onto coverslip clamp chamber MS-502S (ALA Scientific Instruments, Westbury, NY) and examined with a Nikon PCM Quantitative Measuring High-Performance Confocal System equipped with argon and green HeNe lasers attached to a Nikon TE300 Quantum inverted microscope. Fluo-3- loaded astrocytes were excited at 488 nm using an argon-ion laser, and the fluorescence emission was observed at 515 nm. Pinhole size was set at 20 pm. All observations were conducted at room temperature. Frame scanning mode was used to monitor changes in [Ca2+ ]j. In the frame-scanning mode, the entire field of view is 54 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. scanned. This mode provides high spatial resolution and is ideally suited for studying the location of subcellular changes in [Ca ]j. Images were acquired with Simple PCI C-Imaging Hardware and Quantitative Measuring Software, and the acquired image size was 640 X 480 pixels. One frame was obtained every 2 sec to generate a time course of [Ca2+ ]; change. After 30 sec of basal image acquisition, stock Vi agonist solution was added to the chamber yielding a final Vi agonist concentration 100 nM. The scanning settings were kept constant throughout the experimental procedures to ensure comparability between groups. To exclude any effect of mechanical I stimulation, 300 pi of KREBs buffer was added and the Ca response observed for 3 min. A second addition of 300 pi of KREBs buffer was conducted followed by another 3 min of observation. This procedure was conducted on 5 coverslips containing a total of 35 astrocytes. Results of these experiments showed that neither the first nor the second addition of a 300 pi KREBs buffer induced a rise in Ca2 + in either the cytoplasm or the nucleus of cortical astrocytes (data not shown). After fluo-3 confocal images were acquired, montages were made with Metamorph 4.5 software (Universal Imaging Corporation, Downingtown, PA). Color transformation of gray scale was added to the fluo-3 confocal images using the InCyt2™ fluorescence imaging system (Intracellular Imaging, Inc., Cincinnati, OH). Fura-2 intracellular Ca2 + imaging. Two to five-day-old cortical astrocytes grown on poly-D-lysine-coated coverslips were briefly washed with KREBs buffer (137 mM NaCl, 5.3 mM KC1, 1.0 mM MgCl2 -6H20 , 1.2 mM KH2P 0 4, 10 mM 55 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. HEPES, 25 mM Dextrose, and 1.5 mM CaC^), then loaded with fura-2 acetoxymethyl ester (1.5 pmol / L) in the dark at room temperature with gentle shaking (30-40 rpm) for 45 min. Excess fura-2 dye was removed by washing with KREBs buffer and then the astrocytes were incubated in KREBs buffer for 30 min at 37 °C to equilibrate. Coverslips were then placed on to coverslip clamp chamber MS-502S (ALA Scientific Instruments, Westbury, NY) for the Ca2 + imaging analysis. Fluorescence measurements of [Ca2+ ]j were performed using the InCyt2™ fluorescence imaging system (Intracellular Imaging, Inc., Cincinnati, OH). Astrocytes were placed on the stage of an inverted microscope (MT-2, Olympus) equipped with epifluorescence optics (20X, Nikon). Fluorescence was excited at wavelengths of 340 and 380 nm alternatively using a rotating 4-wheel filter changer. To minimize the background noise of the fura-2 signal, successive values (16 sample images, 8 background images) were averaged (~13 images / min). After 30 sec of basal image acquisition, 100 nM Vi agonist solution was perfused into the chamber throughout the remaining observation time. 5 pM glutamate was used at the end of each experiment as a positive control. To exclude any effect o f mechanical stimulation, 300 pi of KREBs buffer was added and the Ca2 + response observed for 3 min. A second addition o f 300 pi of KREBs buffer was conducted followed by another 3 min of observation and no [Ca2 + ]j rise was observed following either the first or the second addition of KREBs buffer. After Ca2 + ratiometric images were obtained, window apertures were then used to obtain [Ca2+ ]c and [Ca2+ ]n in 56 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. individual cortical astrocytes in the InCyt2™ fluorescence imaging system (Intracellular Imaging, Inc., Cincinnati, OH) PKC activity assay. Cortical astrocytes plated on poly-D-lysine-coated 60 mm dishes were serum deprived for 12 hr and then treated with 100 nM V) agonist for 5, 10, 20, 30 and 60 min, and after the media were discarded, washed with cold PBS solution, then 1 ml of PKC extraction buffer (20 mM Tris-HCl; pH 7.4, 2 mM EDTA, 0.5 mM EGTA, 0.25 M sucrose, 50 mg / ml PMSF) was added. Cells were scraped and transferred to centrifuge tubes, then centrifuged at 14,000 g for 30 min. The pellet was dissolved with 1 ml lysis buffer and 0.2% Triton X-100, and protein concentration was determined using the Bicinchoninic Acid (BCA; Sigma Chemical Co., St. Louis, MO) method. PepTag Assay for Non-Radioactive Detection of PKC (Promega Corp., Madison, WI) was conducted. PKC was diluted to 2.5 pg / ml in PKC buffer. Reaction mixtures were prepared containing 5 pi PepTag Protein Kinase C Reaction 5X Buffer, 2 pg PepTag C l Peptide, 1 pi Peptide Protection Solution, 5 pi protein sample, and 4 pi deionized water. 4 pi of 2.5 pg / ml PKC was substituted for the sample proteins for the PKC positive control. For the PKC negative control, sample protein was replaced with deionized water. At time zero, reaction mixtures were removed from the ice and incubated in a 30 °C water bath for 2 min. The samples or PKC were added and incubated at 30 °C for 30 min. Reaction was stopped by placing the tubes in a boiling water bath or a 95 °C heating block for 10 min. Samples were then loaded onto 0.8% agarose gel in 50 mM Tris-HCl, pH 8.0 57 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. then ran at 100 V for 15 to 20 min to separate the phosphorylated and unphosphorylated PepTag Peptides. To visualize the separation, ultraviolet light was used to view the bands and a photograph was taken. Un-Scan-It gel image software (Silk Scientific, Inc., Orem, UT) was used for the quantitative analyses. Whole cell lysate preparation. Cortical astrocytes grown on poly-D-lysine- coated dishes for 2-5 days were serum deprived overnight and treated with Vi agonist and various pharmacological chemicals for appropriate periods. Treated astrocytes were washed with cold PBS once and scraped off the dish. Cells were then centrifuged at 5,000 g for 5 min and the pellets were dissolved in the RIP A lysis buffer (PBS, 1% Triton, 0.2% SDS and protease and a phosphatase inhibitor cocktail containing 1 |ig/ml antipain, 1 pg/ml leupeptin, 1 pg/ml pepstatin, 1 0 pg/ml soybean trypsin inhibitor, 1 mM sodium orthovanadate and 1 mM PMSF) and suspended by passage through a 200 (al pipette tip. Following incubation at 4 °C for 30-60 min, the samples were centrifuged at 1 2 , 0 0 0 g for 1 0 min, and the supernatants were the whole cell protein extracts. Cytoplasmic and nuclear lysate preparation. Cytoplasmic and nuclear lysates were prepared following the method described by Chen et al. (Chen et al., 1992) with minor modifications. Cortical astrocytes grown on poly-D-lysine-coated dishes for 2- 5 days were serum deprived overnight and treated with Vj agonist and various pharmacological agents for appropriate periods. Treated astrocytes were washed with cold PBS once and scraped into 1 ml PBS. Cells were then centrifuged at 5,000 g for 58 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 5 min and the pellet was dissolved in Cytoplasm Extraction buffer (lOmM HEPES, 1 mM EDTA, 60 mM KC1, 0.075% Igepal and a protease and phosphatase inhibitor cocktail) and suspended by passage through a 200 pi pipette tip. After 30-45 min of incubation at 4 °C, the samples were centrifuged at 5,000 g for 5 min to generate the cytoplasmic extract in the supernatant. The supernatant was then removed and the cytoplasmic extract centrifuged again at 1 2 , 0 0 0 g for 1 0 min to yield a supernatant containing the final cytoplasmic extract. Nuclear extraction buffer (20 mM Tris HC1, 1.5 mM MgCl2, 420 mM NaCl, 0.2 mM EDTA, 25% glycerol, 0.5% Igepal and a protease and phosphatase inhibitor cocktail) was added to the pellet followed by 5 M NaCl to break the nuclear membrane. Following 30-45 min o f incubation at 4 °C, the samples were centrifuged at 1 2 , 0 0 0 g for 1 0 min to generate a supernatant containing the final nuclear extract. Purity of cytoplasmic and nuclear lysates was confirmed by the absence of p-actin immunoreactivity in the nuclear lysate and the absence o f histone HI immunoreactivity in the cytoplasmic lysate in Western immunoblotting. Western immunoblotting. Protein concentration was determined by the BCA method. An appropriate volume of 4X sample buffer was added to the protein samples, and samples were boiled at 95 °C for 5 min. Samples (25 pg of proteins per well) were loaded on a 10% SDS-PAGE gel and resolved by standard electrophoresis at 90 V. Proteins were then electrophoretically transferred to Immobilon-P PVDF membranes overnight at 32 V at 4 °C. Membranes were blocked 59 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. for 1 hr at room temperature in 10% non-fat dried milk in PBS containing 0.05% Tween 20 (PBS-T), incubated with appropriate primary antibodies against P-actin (mouse monoclonal, 1:200; Santa Cruz Biotechnology, Inc.), phospho-CaMKII (pT286, rabbit polyclonal, 1:5000; Promega Corp., Madison, WI), total CaMKII (mouse monoclonal, 1:200; Santa Cruz Biotechnology, Inc.), phospho-CREB (pSer1 3 3 , mouse monoclonal, 1:2000; Cell Signaling Technology, Beverly, MA), histone HI (mouse monoclonal, 1:200; Santa Cruz Biotechnology, Inc.), phospho- ERK1/2 (pTpYl85/187, rabbit polyclonal, 1:760; Biosource International, Camarillo, CA) at temperatures and times specified by the antibody providers. All primary antibodies were dissolved in PBS-T with 1% horse serum for mouse monoclonal antibodies or 1% goat serum for rabbit polyclonal antibodies. After washing in PBS- T, the membranes were incubated with horseradish peroxidase-conjugated anti mouse IgG (1:5000; Vector Laboratories, Inc., Burlingame, CA) in PBS-T with 1% horse serum or anti-rabbit IgG (1:5000; Vector Laboratories, Inc., Burlingame, CA) in PBS-T with 1% goat serum for 1 hr. Immunoreactive bands were visualized by TMB detection kit (Vector Laboratories, Inc., Burlingame, CA) and quantified using Un-Scan-It gel image software (Silk Scientific, Inc., Orem, UT). Following transfer, gels were stained with Coomassie blue (Bio-rad Laboratories, Hercules, CA) to double-check equal protein loading. Immunocytochemical staining. Cortical astrocytes were cultured on poly-D- lysine-coated 8 -well chamber slides for 2-3 days prior to serum deprivation for 12 hr 60 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. and treated with Vi agonist for specified periods described in the results section. The slides were briefly washed with PBS and then fixed with 95% methanol at 4 °C. Nonspecific antibody binding was blocked by incubation in Universal Blocking Buffer (provided by Dr. Zhiqun Tan of the University of Southern California) for 30 min at room temperature. The slides were then incubated with primary antibodies against GFAP (mouse monoclonal, 1:200; Santa Cruz Biotechnology, Inc.), and phospho-CaMKII (pT286, rabbit polyclonal, 1:5000; Promega Corp., Madison, WI), phospho-ERKl/2 (pTpY1 8 5 7 1 8 7 , rabbit polyclonal, 1:760; Biosource International, Camarillo, CA), or total ERK1/2 (rabbit polyclonal, 1:5000; Santa Cruz Biotechnology, Inc.) for 2 hr. All primary antibodies were dissolved in PBS. After being washed with PBS, the slides were incubated in a mixture of secondary antibodies containing anti-mouse IgG conjugated with Texas red (1:50, Vector Laboratories, Inc., Burlingame, CA) and anti-rabbit IgG conjugated with FITC (1:150, Vector Laboratories, Inc., Burlingame, CA) for 30 min. The secondary antibodies were also dissolved in PBS. The slides were washed extensively with PBS, and coversliped with DAPI-containing mounting medium (Vector Laboratories, Inc., Burlingame, CA) and viewed under a fluorescent microscope. Images of immunocytochemically stained cortical astrocytes were assembled into montages using Adobe Photoshop (Adobe Systems, Mountain View, CA). Chemicals. Fura-2 AM and fluo-3 AM were purchased from Molecular Probes, Inc., Eugene, OR. Vi agonist ([Phe2 , Om 8]-oxytocin) was purchased from 61 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Bachem Bioscience, Inc., King of Prussia, PA. PD98059, U0126, U0124, Bisindolylmaleimide I, Calphostin C, Bisindolylmaleimide V, KN-93, KN-62 and KN-92 were purchased from Calbiochem Corporation, San Diego, CA. Inhibitors o f kinases. Non-specific effects of these inhibitors were prevented by using two different inhibitors for each kinase plus one structurally similar but inactive compound. For MEK, two structurally different compounds, U0126 and PD98059 and a compound structurally similar to U0126 but inactive as a MEK inhibitor, U0124, were used. For PKC inhibition, we used Bisindolylmaleimide I (BIS I) and Calphostin C (Cal C), and a control compound that is chemically similar to BIS I but not active as a PKC inhibitor, Bisindolylmaleimide V (BIS V). For CaM kinases, KN-93 and KN-62 were used as inhibitors and KN-92 was used as the control compound to rule out non-specific effect of KN-93 since KN-92 is structurally similar to KN-93 but inactive as a CaM kinases inhibitor. The selection of doses for the MEK, PKC and CaM kinases inhibitors were based on the recommended doses from the manufacturer and from literature. The inhibitors at the chosen doses are effective as inhibitors for these kinases while not causing non specific effects in the cells. Data analysis. Data were presented as group means ± SEM. Immunoblot data were expressed as the percentage relative to unstimulated controls run in the same experiment. Statistical analysis was performed by Student’s t-test or by one-way analysis of variance followed by Newman-Keuls post hoc analysis. 62 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. RESULTS Cytoplasmic and nuclear Ca2 + rise in cortical astrocytes following exposure to Vi agonist To investigate the dynamics of cytoplasmic ([Ca2+ ]c) and nuclear ([Ca2+ ]n) in cortical astrocytes in response to Vi agonist, laser scanning confocal microscopy was conducted using the Ca2 + sensitive dye fluo-3 AM (Fig. 14). In the resting state, fluorescence signals were low, but sufficient to localize the cells and to define an optimal optical plane through the cells. During the basal Ca2 + assessment, fluo-3 fluorescence in the nucleus was slightly higher than in the cytoplasm of cortical astrocytes (Fig. 14/4). The apparent higher resting [Ca2+ ]n is very likely due to a preferential localization of fluo-3 to the nuclear compartment (Thomas et al., 2000). Following the addition of V) agonist for 50 sec, fluorescence intensity increased in 2'h • both cytoplasmic and nuclear compartments with a much higher Ca signal in the nucleus (Fig. 14A). Following exposure to V) agonist for 100 sec, fluorescent intensity was slightly lower in the cytoplasmic compartment but was more concentrated in the nucleus. At 200 sec, both [Ca2+ ]c and [Ca2+]n were decreased, though [Ca2+ ]n was still slightly higher than the [Ca2+ ]c (Fig. 14,4). Control experiments indicated that addition of an equal volume of KREBs buffer did not induce a rise in either [Ca2 + ]c or [Ca2+ ]n of cortical astrocytes (data not shown), indicating that the response to V) agonist was not due to an artifact of mechanical stimulation. Confocal images were processed using an InCyt2™ fluorescence 63 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. imaging system to transform fluo-3 images into color images of [Ca2+ ]c and [Ca2+ ]n rise (Fig. 142?). Figure 14. Laser scanning confocal fluo-3 Ca2 + images of Vi agonist- induced [Ca2 + ]c and [Ca2 + ]„ rise in cortical astrocytes. A. Cortical astrocytes were loaded with fluo-3, and confocal images were captured at 0, 50, 100 and 200 sec after V) agonist was added to the cells. Following addition of V) agonist for 50 sec, the fluorescence intensity was increased in both cytoplasmic and nuclear compartments with a much higher Ca2 + signal in the nucleus. The fluorescence intensity decreased slightly in the cytoplasm but became more concentrated in the nucleus at 100 sec. At 200 sec, both cytoplasmic and nuclear fluorescence intensity were decreased. B. Confocal images were processed with the InCyt2™ fluorescence imaging system to transform gray scale images into color for better visualization of [Ca2+ ]c and [Ca2+ ]n rise, especially nuclear Ca2 + localization. Scale bar = 20 pm. A 200sec 64 Osec 100sec Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. To further investigate the temporal profile of [Ca2+ ]c and [Ca2+ ]n rise and to quantify the Ca2 + increase, intracellular Ca2 + imaging with fura-2 was conducted in individual cortical astrocytes, and then window apertures were set to obtain separate [Ca2+ ]c and [Ca2+ ]n values (Fig. 15). Figure 15A shows fura-2 generated Ca2 + images under basal condition and following addition of V) agonist for 100 sec, V) agonist induced a marked nuclear Ca2 + compartmentalization, confirming our fluo-3 confocal Ca2 + imaging results. To further confirm the nucleus localization in cortical astrocytes, immunocytochemical staining was conducted with anti-GFAP primary antibody and Texas red-conjugated secondary to stain cytoplasm and DAPI in the mounting media to stain the nucleus. The location and morphology of nuclei seen in immunocytochemical images reflect the nuclei observed in fura-2 Ca2 + images, confirming our nuclei observation in Ca2 + imaging studies (Fig. 152?). Figure 15C 9 + 9 + • documents the temporal profile of [Ca ]c and [Ca ]n rise in a single cortical astrocyte that was typical of most responsive astrocytes. The time course data demonstrate that the Ca2 + signal was simultaneously increased in both the cytoplasm 9+ and nuclei of cortical astrocytes, followed by a rapid and transient Ca translocation from the cytoplasm to the nucleus. Translocation of the Ca2 + signal was accompanied by a decline in Ca2 + signal in the cytoplasm. Following the [Ca2+ ]n rise, translocation 9 I of nuclear Ca back to the cytoplasm occurred prior to diminution of the total [Ca2+ ]i (Fig. 15Q. 65 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Figure 15. Cytoplasmic [Ca2 + ]c and nuclear [Ca2 + ]„ rise in response to Vj agonist in cortical astrocytes. Cortical astrocytes were loaded with fura-2, and Ca2 + images were recorded using the InCyt2™ fluorescence imaging system. A. Fura-2 generated Ca"2 images under basal condition and following addition of Vi agonist for 1 0 0 sec. Vi agonist induced a marked nuclear Ca2 + compartmentalization. B. To further confirm the nucleus localization in cortical astrocytes, immunocytochemical staining was conducted with anti-GFAP primary antibody and Texas red-conjugated secondary to stain cytoplasm and DAPI in the mounting media to stain the nucleus. The location and morphology of nuclei seen in immunocytochemical images reflect the nuclei observed in fura-2 Ca2 + images, confirming our nuclei observation in Ca2 + imaging studies. C. Window apertures were used to locate the cytoplasm and nucleus of one , 2+ individual cortical astrocyte, and [Ca2+ ]c and [Ca/+]n were plotted against time. Vi agonist was added where indicated and was present throughout the entire observation period. Note that Ca2 + was initially increased in both the cytoplasm and nucleus, followed by a rapid and transient Ca2 + localization into the nucleus. Following the 2 + i rise in [Ca2+ ]n, translocation of nuclear Ca2 + back to the cytoplasm occurred prior to 2+ the return to baseline total [Ca2 + ]i P rio r to V1 a g o n is t ( n M ) 1500 F o llo w in jiV I a g o n is t 250 [Ca]i B — 500 - i n u c le a r - c y to p la s m ic 400 - 300 - 200 - Vi a g o n is t 100 - 0 50 100 150 200 250 T im e (se c ) 66 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Activation of PKC in cortical astrocytes in response to Vi agonist 7 4 - It is well known that activation of the phosphatidylinositol - Ca signaling pathway leads to activation of PKC (Berridge, 1993; Son and Brinton, 1998). To confirm V) agonist-induced activation of PKC, we used a non-radioactive fluorescent peptide substrate as an indicator of PKC activation. When the peptide substrate is phosphorylated, its net charge is converted from + 1 to - 1 , thus migrating towards the positive electrode, allowing the phosphorylated and non-phosphorylated versions of the substrate to be rapidly separated on an agarose gel. PKC activity was assessed following exposure to V) agonist for 5, 10, 20, 30 and 60 min. As shown in Figure 16A, phosphorylated substrate was dramatically increased in cortical astrocytes in response to Vi agonist. Statistical analysis of optical density from four independent experiments is shown in Figure 16B and indicates that following exposure to Vi agonist, PKC activity was transiently but significantly increased. The maximal increase occurred at 10 min (148.89% ± 14.77, ** p < 0.01), which was diminished by 20 min (131.46% ± 13.02, * p < 0.05), followed by a return to basal level by 30 min. 67 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Figure 16. PKC activation in cortical astrocytes in response to Vi agonist. A. Primary cortical astrocytes were treated with Vi agonist (100 nM) for 5, 10, 20, 30 and 60 min, and protein samples were collected in the PKC extraction buffer, ensuring integrity of PKC structure and activity. PKC activity was assayed using fluorescent PKC peptide substrate. Samples were then loaded onto 0.8% agarose gel to separate phosphorylated and unphosphorylated substrate peptides. PKC activity peaked at 10 min after exposure, while levels of p-actin protein were unchanged. B. The percent increase in PKC activity is presented in the bar graph in which each bar represents the mean ± SEM (n = 4 for each exposure period), * p < 0.05, ** p < 0.01 versus control. A CTRL 5 10 20 30 60 (min) unphosphorylated substrate phosphorylated substrate m p-actin B S 1 8 0 1 8 160 v 140 < 120 2 100 CTRL 5 10 20 30 60 Time (min) Activation of CaMKII in cytoplasm and nuclei of cortical astrocytes in response to Vi agonist Because V uR activation led to a significant rise in [Ca2+]i, we investigated V) agonist activation of the Ca2+ -activated kinase CaMKII. Using an antibody against 68 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. active phosphorylated CaMKII, Western blot analyses were performed to determine the temporal profile of CaMKII activation in whole cell lysates of cortical astrocytes following exposure to Vi agonist for 5, 10, 20, 30, 60 and 120 min. As shown in Figure 17A, phospho-CaMKII levels increased dramatically following 5 min of exposure to Vi agonist and were sustained throughout the observation time of 1 2 0 min. Total CaMKII levels were unchanged in cortical astrocytes in response to Vi agonist. Statistical analysis of optical density from six independent experiments is shown in Figure 17B. Results of this analysis indicate that within 5 min of exposure, Vi agonist induced a significant increase in CaMKII activation relative to control (184.27% + 16.01 , ** p < 0 .0 1 ), which was sustained and remained significantly increased throughout the 120 min of analysis (ranging from 173.88% to 186.52%, ** /><0.01). Figure 17. CaMKII activation in response to Vj agonist in whole cell extracts of cortical astrocytes. A. Western immunoblots showing activation of CaMKII. Primary cortical astrocytes were treated with V) agonist (100 nM) for indicated periods. Whole-cell lysates were subjected to SDS-PAGE and probed with anti-phospho-CaMKII and anti-total CaMKII. While levels of total CaMKII protein were unchanged, the level of phospho-CaMKII increased dramatically after 5 min of exposure, and the activation persisted throughout the experiment. B. The percent increase in CaMKII 69 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. activation is presented in the bar graph where each bar represents the mean + SEM (n = 6 for each exposure period), ** p < 0 . 0 1 versus control. phospho- CaMKII * ■ ***« (» ■ total CaMKII CTRL 5 10 20 30 60 120 (min) 2 250 * 150 r 100 CTRL 5 10 20 30 60 120 Time (min) Because we had observed that V) agonist induced a rise in [Ca ]j and [Ca2+ ]n, we determined the cytoplasmic / nuclear localization of the phospho- CaMKII signal in cortical astrocytes. Cytoplasmic and nuclear lysate fractions of cortical astrocytes were isolated and Western blot analyses using anti-phospho- CaMKH antibody were performed. Figure 18A contains a representative Western blot and 5B shows the statistical analysis of optical density from four independent experiments. Surprisingly, the compartmentalization of the CaMKII signal was highly dynamic over the 120 min of observation. In control untreated astrocytes, 70 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. both cytoplasmic and nuclear phospho-CaMKII levels were low. In Vi agonist- treated astrocytes, activated CaMKH was elevated in parallel in both cytoplasmic and nuclear compartments within 5 min (cytoplasmic 172.33% ± 12.79, *** p < 0.001 relative to control; nuclear 200.00% ± 15.88, *** p < 0.001 relative to control). By 10 min, nuclear compartmentalization of CaMKII was significantly higher than cytoplasmic (cytoplasmic 169.81% ± 13.25, ** p < 0.01 relative to control, nuclear 240.18% ± 17.74, *** p < 0.001 relative to control; cytoplasmic versus nuclear, >p< 0 .05). A rapid reversal was apparent by 20 min with the nuclear compartment significantly lower than cytoplasmic (cytoplasmic 241.20% ± 18.06, *** p < 0.001 relative to control, nuclear 129.80% ± 9.26, * p < 0.05 relative to control; cytoplasmic versus nuclear, p < 0.01). The reversal was sustained for an additional 10 min (cytoplasmic 249.06% ± 18.39, *** p < 0.001 relative to control, nuclear 126.79% ± 10.14, * p < 0.05 relative to control; cytoplasmic versus nuclear,b p < 0.01). By 60 and 120 min, compartmentalization of CaMKII was equally distributed between the cytoplasm and nucleus (at 60 min, cytoplasmic 179.87% ± 14.39, *** p < 0.001 relative to control, versus nuclear 210.62% ± 15.65, *** p < 0.001 relative to control; at 120 min, cytoplasmic 172.33% ± 13.79, ** p < 0.01 relative to control, versus nuclear 210.39% ± 16.83, *** p < 0.001 relative to control). Importantly, the same pattern of cytoplasmic and nuclear phospho-CaMKII rise was not observed in cortical astrocytes exposed to only serum-free medium for 71 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. the same time periods, indicating that the cytoplasmic and nuclear localization of phospho-CaMKII was specifically induced by Vi agonist. Figure 18. CaMKII activation and dynamic translocation in cytoplasmic and nuclear compartments of cortical astrocytes. A. Western immunoblots showing activation o f CaMKII and translocation of activated CaMKII between cytoplasmic and nuclear compartments of cortical astrocytes. B. The percent increase in CaMKII activation in cytoplasmic and nuclear lysates is presented in the line graph in which each point represents the mean ± SEM (n = 4 for each exposure period), * p < 0.05, ** p < 0.01, *** p < 0.001 versus control; ap < 0.05, hp < 0.01 comparison between cytoplasmic and nuclear percent increases. C. Immunofluorescence of active CaMKII in cortical astrocytes following exposure to V) agonist for indicated periods. Scale bar = 25 pm. cy to p la s m ic ♦ n u c le a r cytoplasm ic: phospho rs*' CaMKII (V ia )2 phospho- 1 CaMKII (SFM )£ p-actin -x nuclear: phospho- § CaMKII(V1a) 'S phospho- 2 CaMKII (SFM)jj CTRL T im e (m in) c control Smin 10min 20min 30min 60min 120min To confirm the cytoplasmic and nuclear Western blot observation, we performed immunocytochemical analysis using phospho-CaMKII antibody (Fig. 18Q. Consistent with the Western blot analyses, control untreated astrocytes 72 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. exhibited low phospho-CaMKII levels in both cytoplasmic and nuclear compartments. Within 10 min of exposure to Vi agonist, nuclear phospho-CaMKII was dramatically higher than cytoplasmic phospho-CaMKII staining. At 20 and 30 min, cytoplasmic phospho-CaMKII staining was markedly higher than the nuclear signal. At 60 min, the higher phospho-CaMKII immunocytochemical signal returned to the nuclei of cortical astrocytes and finally at 1 2 0 min, the fluorescence intensity was distributed evenly in cytoplasm and nuclei of cortical astrocytes. ERK1/2 activation and translocation in cytoplasm and nuclei of cortical astrocytes in response to Vi agonist ERK1/2 are part of a family of serine/threonine protein kinases that are activated rapidly following the binding of extracellular signals to cell surface receptor tyrosine kinases or heterotrimeric G-protein-coupled receptors, or by a variety of upstream kinases. To explore whether V ia R-induced Ca2 + signaling led to activation of the ERK signaling pathway, we investigated ERK1 (M. W. = 44 kD) and ERK2 (M. W. = 42 kD) activation following V] agonist treatment using Western blot analyses with a phospho-specific antibody against active ERK1/2 (Fig. 19A,B). Results of these analyses indicated that ERK1/2 activities were significantly increased in response to V) agonist in both cytoplasmic and nuclear compartments of cortical astrocytes. The time course for cytoplasmic localization was coincident with that of nuclear ERK1/2 activation, with maximal activation at 20 min in both 73 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. compartments (Fig. 19,4). Statistical analyses of optical density from six independent cytoplasmic experiments indicates that cytoplasmic pERKl (160.63% ± 15.54, ** p < 0.01) and pERK2 (163.61% ± 18.19, ** p < 0.01) were significantly increased at 10 min and peaked at 20 min (173.46% + 20.12, ** p < 0.01 and 180.84% ± 23.00, ** p < 0 . 0 1 respectively), following by a gradual decline in activation but which still remained significantly higher than control at 120 min (122.03% ± 5.63, ** p < 0.01 and 117.84% ± 7.05, * p < 0.05 respectively). Statistical analyses of optical density from six independent determinations of nuclear pERKl and pERK2 indicated that both were significantly increased after only 5 min of exposure to V) agonist (135.81% ± 8.56, ** p < 0.01 and 162.56% ± 10.73, **p < 0.01 respectively), which peaked at 20 min (200.44% ± 26.91, ** p < 0.01 and 282.90% ± 50.85, ** p < 0.01 respectively) and decreased by 120 min (114.33% ± 4.75, * p < 0.05 and 104.50% + 6.44 respectively) (Fig. 192?). Vi agonist activation of cytoplasmic and nuclear ERK1/2 in cortical astrocytes was confirmed by immunocytochemical staining using the same antibody against phospho-ERKl/2 (Fig. 19C). In control untreated cortical astrocytes, cytoplasmic and nuclear ERK1/2 were very low, with nuclei of cortical astrocytes evident as dark centers. Following exposure to V) agonist for 20 min, both cytoplasmic and nuclear pERKl/2 immunofluorescence were considerably higher than control cells, indicating activation of ERK1/2 in both cytoplasmic and nuclear compartments. To confirm the nuclear localization in cortical astrocytes, 74 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. immunocytochemical staining was conducted with anti-GFAP primary antibody and Texas red-conjugated secondary to stain cytoplasm and DAPI in the mounting media to stain the nucleus (Fig. 19C). Since activated ERK1/2 was detected in both cytoplasmic and nuclear compartments, we investigated whether ERK1/2 was activated in the cytoplasm and subsequently translocated into the nucleus (the classical pathway), or whether ERK1/2 was activated directly within the nucleus. To address this issue, we assessed the immunofluorescence of total ERK1/2 in cytoplasmic and nuclear compartments. Immunocytochemical analysis using a polyclonal antibody against total ERK1/2 (both phosphorylated and unphosphorylated proteins) showed an increase in nuclear staining of total ERK1/2 following 20 min of V) agonist exposure (Fig. 1929). Because unphosphorylated ERK1/2 does not readily translocate into nuclei (Lenormand et al., 1998), the increased nuclear immunoreactivity of total ERK1/2 is consistent with translocation of activated phosphorylated ERK1/2 from the cytoplasmic compartment to the nuclear compartment. Figure 19. Activation and translocation of ERK1 and ERK2 in response to Vi agonist in cytoplasmic and nuclear compartments of cortical astrocytes. A. Western immunoblots showing activation of ERK1/2 in cytoplasmic and nuclear extracts of cortical astrocytes. Primary cortical astrocytes were treated with Vi agonist (100 nM) for indicated periods. Cytoplasmic and nuclear lysates were 75 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. subjected to SDS-PAGE and probed with anti-pERKl/2. The cytoplasmic protein levels were normalized against p-actin levels and nuclear protein levels against histone HI protein levels. Both ERK1 and ERK2 were activated in a time-dependent manner in both cytoplasmic and nuclear compartments. B. The percent increase in ERK1 and ERK2 activation is presented in the bar graphs. Each bar represents the mean + SEM (n = 6 for each exposure period), * p < 0.05, ** p < 0.01 versus control. C. Immunofluorescence of active ERK1/2 in cortical astrocytes prior to and following exposure to V) agonist for 20 min. The corresponding cytoplasmic GFAP and nuclear DAPI are shown on right. Scale bar = 20 pm. D. immunofluorescence of total ERK1/2 in cortical astrocytes prior to and following exposure to V) agonist for 20 min. Immunofluorescence for total ERK1/2 was low in control cells and concentrated in perinuclear regions. Following 20 min exposure to V) agonist, immunofluorescence markedly increased in astrocyte nuclei. Since inactive ERK1/2 does not translocate to cell nuclei, the increase in nuclear signal for total ERK1/2 is very likely due to translocation of activated ERK1/2 from the cytoplasmic compartment to the nuclear compartment. Corresponding cytoplasmic GFAP and nuclear DAPI are shown on the right. Scale bar = 30 pm. 76 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. (Figure 19: continued) cytoplasmic: dERK1/2 « # P l. 4 & T . ' ~ p-actin nuclear: B 400 - i 5 350 - o | 300 ^ 250 - Q . | 200 • 1 150 O 1 0 0 O 5 s 50 0 ~ f pERKI/2 histone CTRL 5 10 20 30 60 120 (min) H Cyto pERKl E 3 Cyto pERK2 ■ Nuclear pERKl ** S S Nuclear pERK2 CTRL pERKI/2 cytoplasm and nuclei CTRL V 1 agonist (20min) pERK1/2 cytoplasm and nuclei CTRL V1 agonist (20min) b b KB B Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Upstream activators of ERK1/2 in cortical astrocytes The classical signal transduction pathway for ERK1/2 activation is phosphorylation on tyrosine and threonine residues by a dual-specificity protein kinase termed ERK1/2 kinase (MEK). MEK in turn is activated by phosphorylation on serine/threonine residues, which can be catalyzed either by the Raf family of protein kinase, the protooncogene product Mos or MEK kinases. To determine whether ERK1/2 activation in response to Vi agonist was through the MEK pathway, MEK inhibitors were used to block V) agonist activation of ERK1/2 (Fig. 20A). Because of potential non-specific properties of inhibitors, we used two chemically quite different inhibitors and a control compound structurally similar to one of the inhibitors but inactive as an inhibitor were used to rule out non-specific effects. Two MEK inhibitors, U0126 and PD98059 were used to block Vi agonist-induced activation of ERK1/2. U0124, which is chemically similar to U0126 but inactive as a MEK inhibitor, was also used as a control compound. Figure 20A shows representative cytoplasmic and nuclear Western blots and the statistical analyses of three independent cytoplasmic and nuclear Western blot experiments. The MEK inhibitors, U0126 and PD98059, completely blocked Vi agonist-induced ERK1 and ERK2 activation in both cytoplasmic (101.49% ± 6.37 and 112.15% + 7.99 respectively for U0126, and 101.41% ± 5.69 and 97.85% ± 4.55 respectively for PD98059 relative to control) and nuclear (107.69% ± 7.73 and 98.02% ± 8.04 respectively for U0126, and 99.62% ± 7.21 and 100.54% ± 5.03 respectively for 78 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. PD98059 relative to control) compartments of cortical astrocytes. Vi agonist-induced ERK1/2 activation was not affected by U0124, indicating that blockade of ERK1/2 by U0126 was not due to a non-specific effect. These data indicate that V) agonist activation of ERK is via the MEK pathway. To determine whether V) agonist activation of PKC was an upstream regulator of ERK1/2 activation, analyses using two chemically different inhibitors of PKC were conducted. Two broad spectrum PKC inhibitors, Bisindolylmaleimide I (BIS I) and Calphostin C (Cal C), were used to investigate their effect on ERK1/2 activation (Fig. 205). Bisindolylmaleimide V (BIS V), chemically similar to BIS I but inactive as a PKC inhibitor, was also used as a control compound. Figure 20B shows representative cytoplasmic and nuclear Western blots and the statistical analyses of four independent cytoplasmic and nuclear Western blot experiments. Both BIS I and Calphostin C partially blocked Vi agonist-induced ERK1 and ERK2 activation in both cytoplasm (145.78% ± 9.69 and 167.85% ± 17.18 respectively for BIS I, and 153.29% ± 5.98 and 156.92% + 9.55 respectively for Calphostin C relative to control, ** p < 0.01) and nucleus (146.42% ± 8.77 and 143.94% ± 18.32 respectively for BIS I, and 152.02% ± 8.78 and 146.01% ± 17.08 respectively for Calphostin C relative to control, ** p < 0.01) of cortical astrocytes. The inactive compound BIS V had no effect on V) agonist-induced ERK1/2 activation. These data indicate that PKC contributes to, but is not solely responsible for, Vi agonist activation of ERK1/2. 79 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Because ERK1/2 activation was only partially blocked by inhibitors of PKC, we pursued the role of CaMKII in ERK1/2 activation as CaMKII can indirectly lead to activation of ERK1/2 in other systems, such as in vascular smooth muscle cells (Muthalif et al., 1998). As a selective inhibitor of CaMKII does not yet exist, we used two broad spectrum CaM kinases family inhibitors, KN-93 and KN-62. To control for non-specific effects of the inhibitors, KN-92 which is chemically similar to KN-93 but inactive as a CaM kinases inhibitor, was used. Figure 20C shows representative cytoplasmic and nuclear Western blots and the statistical analyses of five independent cytoplasmic and nuclear Western blot experiments. Both KN-93 and KN-62 partially blocked V) agonist-induced ERK1 and ERK2 activation in both cytoplasmic (159.33% ± 15.84 and 155.60% ± 10.38 respectively for KN-93, and 152.48% ± 13.99 and 159.59% ± 13.03 respectively for KN-62 relative to control) and nuclear compartments of cortical astrocytes (151.06% + 5.22 and 160.15% ± 5.58 respectively for KN-93, and 146.67% ± 7.29 and 170.66% ± 16.66 respectively for KN-62 relative to control, ** p < 0.01). The inactive compound KN-92 had no effect on V) agonist-induced ERK1/2 activation. These data indicate that like PKC, CaM kinases contribute to, but are not solely responsible for, V) agonist-induced ERK1/2 activation. 80 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Figure 20. Activation of ERK1/2 required upstream MEK, PKC and CaM kinases. A. Western immunoblotting data showing abolishment of ERK1/2 activation in cytoplasmic and nuclear extracts of cortical astrocytes by MEK inhibitors U0126 and PD98059. ERK1/2 activation was not affected by U0124, a structurally similar compound to U0126 but inactive as a MEK inhibitor. Primary cortical astrocytes were treated with or without Vi agonist (100 nM) in the presence or absence of U0126 (10 p M ), PD98059 (25 p M ) or U0124 (20 p M ) for 20 min. Cytoplasmic and nuclear lysates were subjected to SDS-PAGE and probed with anti-pERKl/2. The cytoplasmic protein levels were normalized against P-actin levels and nuclear protein levels against histone HI protein levels. The percent increase in ERK1 and ERK2 activation relative to control is presented in the bar graphs. Each bar represents the mean ± SEM (n = 3 for each condition), ** p < 0.01 versus control. B. Western immunoblotting data showing partial inhibition of ERK1/2 activation in cytoplasmic and nuclear extracts of cortical astrocytes by PKC inhibitors BIS I and calphostin C (Cal C). ERK1/2 activation was not affected by BIS V, a structurally similar compound to BIS I but inactive as a PKC inhibitor. Primary cortical astrocytes were treated with or without V) agonist (100 nM) in the presence or absence of BIS I (5 pM ), Calphostin C (500 nM) or BIS V (5 p M ) for 20 min. Cytoplasmic and nuclear lysates were subjected to SDS-PAGE and probed with anti-pERKl/2. The percent increase in ERK1 and ERK2 activation relative to control is presented in bar graphs. 81 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Each bar represents the mean ± SEM (n = 4 for each condition), ** p < 0.01 versus control. C. Western immunoblotting data showing partial inhibition of ERK1/2 activation in cytoplasmic and nuclear extracts of cortical astrocytes by CaM kinases inhibitors KN-93 and KN-62. ERK1/2 activation was not affected by KN-92, a structurally similar compound to KN-93 but inactive as a CaM kinases inhibitor. Primary cortical astrocytes were treated with or without V) agonist (100 nM) in the presence or absence of KN-93 (10 pM), KN-62 (10 pM) or KN-92 (10 pM) for 20 min. Cytoplasmic and nuclear lysates were subjected to SDS-PAGE and probed with anti-pERKl/2. The percent increase in ERK1 and ERK2 activation relative to control is presented in bar graphs. Each bar represents the mean ± SEM (n = 5 for each condition), ** p < 0.01 versus control. D. Western immunoblotting data showing complete abolishment of ERK1/2 activation by a combination of PKC inhibitors and CaM kinases inhibitors in cytoplasmic and nuclear extracts o f cortical astrocytes. Primary cortical astrocytes were treated with or without Vi agonist (100 nM) in the presence or absence of various combinations of inhibitors for 20 min. Cytoplasmic and nuclear lysates were subjected to SDS-PAGE and probed with anti-pERKl/2. The percent increase in ERK1 and ERK2 activation relative to control is presented in bar graphs. Each bar represents the mean ± SEM (n = 4 for each condition), ** p < 0.01 versus control. 82 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. (Figure 20: continued) cyto: nuclear: V ia U0126 PD98059 U0124 B cyto: nuclear: V ia BIS I Cal C BIS V cyto: nuclear: pERK1/2 P-actin pERK1/2 hlstone + + + + + + V ia - + - - - + KN-93 - - + - . + KN-62 - - - + - KN-92 - - - - + - D cyto: T ! » » W ' nuclear: ' Z ;rr .... * w m e m f * ' ‘ ‘ ‘ m m m s m V ia h + + + + + + + BIS 1 - ■ - + + + - - - - Cal C - ■ - - - - + + + - BIS V KN-93 - • - + - - + - - + KN-62 - ■ - - + - - + - - KN-92 - . - + . _ + - ** □ Cyto pERKl 8 Cyto pERK2 ■ Nuclear pERKl „ . . . ''TOlJlf'8 n C D V I 10 ; p C l \ r \ 114 n c D v i in S H t \ ' p C K M / Z — — histone + + + + + - - + + - - + pERK1/2 P-actin pERK1/2 histone pERK1/2 p-actin pERK1/2 histone 5 300 Q- 200 —150 = 100 v s o ** 0CytopERK1 Cyto pERK2 «250 Nuclear pERKl B Nuclear pERK2 ** H (SCytopERKI 0 Cyto pERK2 Nuclear pERKl B Nuclear pERK2 ** ** 50 - Cyto pERKl i Cyto pERK2 ■ Nuclear pERKl H Nuclear pERK2 ,0 * \o* A k A n ^ ^ ^ A N * ■ * " . * - + - + 83 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. To determine whether a combination of PKC and CaM kinases was sufficient and necessary to activate ERK1/2, we combined the PKC inhibitors and CaM kinases inhibitors (Fig. 20D). When combined, ERK1 and ERK2 activation were completely blocked in both cytoplasmic (101.51% + 1.49 and 101.67% + 3.07 respectively for BIS I + KN-93; 103.92% ± 3.74 and 91.97% ± 4.93 respectively for BIS I + KN-62; 98.56% ± 6.33 and 99.91% ± 8.92 respectively for Calphostin C + KN-93; and 99.61% ± 3.81 and 99.01% ± 1.73 respectively for Calphostin C + KN- 62 relative to control) and nuclear (94.74% + 3.87 and 98.69% ± 3.45 respectively for BIS I + KN-93; 99.79% ± 4.61 and 103.70% + 5.15 respectively for BIS I + KN- 62; 99.82% ± 1.57 and 99.81% ± 9.29 respectively for Calphostin C + KN-93; and 99.37% ± 0.98 and 99.49% ± 9.36 respectively for Calphostin C + KN-62 relative to control) compartments of cortical astrocytes in response to V) agonist. These data indicate that activation of both PKC and CaM kinases are required for the full activation of ERK1/2 by Vi agonist. CREB activation in nuclei of cortical astrocytes in response to Vi agonist Because both CaMKII and ERK1/2 are translocated to the nucleus in response to V) agonist, we sought to determine whether translocation of these kinases led to phosphorylation of the Ca2 + /cAMP-activated transcription factor CREB. To determine whether CREB was activated following V) agonist treatment, cytoplasmic and nuclear fractions of cortical astrocytes were obtained, and CREB 84 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. activation assayed by Western immunoblotting using an antibody against active CREB (phospho-specific anti-CREB antibody). pCREB was significantly increased in the nuclear fraction of cortical astrocytes in response to V) agonist in a time- dependent manner (Fig. 21) while not detected in the cytoplasmic fraction (data not shown). Statistical analysis of optical density from eight independent experiments is shown in Figure 21. Results of this analysis indicate that within 10 min of exposure, Vi agonist induced a significant increase in CREB activation relative to control (149.59% ± 28.78, ** p < 0.01), which was sustained and remained significantly increased throughout the 120 min of analysis (ranging from 149.59% to 308.60%, ** /><0.01). Figure 21. Activation of CREB in nuclei of cortical astrocytes in response to Vi agonist. A. Western immunoblots showing activation of CREB in nuclear extracts of cortical astrocytes. Primary cortical astrocytes were treated with V) agonist (100 nM) for indicated periods. Nuclear lysates were subjected to SDS-PAGE and probed with anti-pCREB. Levels of pCREB increased at 10 min and persisted until 120 min. Nuclear protein levels were normalized against histone HI protein levels. B. The percent increase in CREB activation relative to control is presented in a bar graph. Each bar represents the mean + SEM (n = 8 for each exposure period), ** p < 0.01 versus control. A 0 5 10 20 30 60 120 (m in) . . . . . am m m t #** p C R E B B .0 400 I 350 | 300 gj 250 g 2 0 0 I 1 5 0 = 100 I " 3 2 0 CTRL 5 10 20 30 60 120 Time (min) 85 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. To determine whether ERK1/2 and/or CaM kinases are required for CREB activation in response to Vi agonist, the MEK inhibitors and CaM kinases inhibitors were utilized to determine their effect on Vi agonist-induced CREB activation (Fig. 22). In cortical astrocytes exposed to MEK inhibitors U0126 and PD98059, CREB activation was partially blocked (169.52% ± 11.44 for U0126 and 175.31% ± 10.30 for PD98059 relative to control, ** p < 0.01) (Fig. 22A). In cortical astrocytes exposed to CaM kinases inhibitors KN-93 and KN-62, CREB activation was also partially blocked (165.28% ± 26.07 for U0126 and 182.62% ± 23.22 for PD98059 relative to control, ** p < 0.01) (Fig. 225). The combination of MEK inhibitors and CaM kinases inhibitors completely abolished V) agonist-induced CREB activation (101.39% ± 7.30 for U0126 + KN-93; 99.24 % ± 3.81 for U0126 + KN-62; 100.50% ± 7.45 for PD98059 + KN-93; and 91.82% ± 9.91 for PD98059 + KN-62 relative to control) (Fig. 22 C), indicating that both ERK1/2 and CaM kinases signaling cascades are required for Vi agonist activation of CREB in cortical astrocytes. Figure 22. Activation of CREB is dependent on both MAPK and CaM kinases activation. A. Western immunoblotting data showing partial inhibition of CREB activation by the MEK inhibitors U0126 and PD98059. CREB activation was not affected by U0124, a structurally similar compound to U0126 but inactive as a MEK inhibitor. Primary cortical astrocytes were treated with or without V) agonist (100 nM) in the 86 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. presence or absence of U0126 (10 pM), PD98059 (25 pM) or U0124 (20 pM) for 30 min. Nuclear lysates were subjected to SDS-PAGE and probed with anti-pCREB. Nuclear protein levels were normalized against histone HI protein levels. The percent increase in CREB activation relative to control is presented in bar graphs. Each bar represents the mean ± SEM (n = 4 for each condition), ** p < 0.01 versus control. B. Western immunoblotting data showing partial inhibition of CREB activation by the CaM kinases inhibitors KN-93 and KN-62. CREB activation was not affected by KN-92, a structurally similar compound to KN-93 but inactive as a CaM kinases inhibitor. Primary cortical astrocytes were treated with or without Vi agonist (100 nM) in the presence or absence of KN-93 (10 pM), KN-62 (10 pM) or KN-92 (10 pM) for 30 min. Nuclear lysates were subjected to SDS-PAGE and probed with anti-pCREB. The percent increase in CREB activation relative to control is presented in bar graphs. Each bar represents the mean ± SEM (n = 4 for each condition), ** p < 0.01 versus control. C. Western immunoblotting data showing complete inhibition of CREB activation by a combination of MEK inhibitors and CaM kinases inhibitors. Primary cortical astrocytes were treated with or without V) agonist (100 nM) in the presence or absence of various combinations of MEK and CaM kinases inhibitors. Nuclear lysates were subjected to SDS-PAGE and probed with anti-pCREB. The percent increase in CREB activation relative to control is presented in bar graphs. Each bar represents the mean ± SEM (n = 4 for each condition), ** p < 0.01 versus control. 87 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. (Figure 22: continued) V ia U0126 ■ PD 98059• U0124 ■ B V1a KN-93 KN-62 KN-92 + - . + + + + - - + pCREB? histone 2 ill & pCREB> histone + - _ + + + + - - + 0* & V ia U0126 PD98059 U0124 KN-93 KN-62 KN-92 + + + - + + + + + - + + + - - - + + - + - - - + + - - . pCREB § * histone § 400 350 300 250 200 150 100 50 11 * * * * I..Ill & r$ J & * < ? < ? x j C n V ^ > * /vvv ^ ^ /yv X > ,K * / Z5 jP , K » ^ ^ * A A A schematic of the complex signaling cytoplasmic / nuclear cascade set into motion through activation of the V ia R in cortical astrocytes is depicted in Figure 23. 88 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Figure 23. Schematic of vasopressin-induced cytoplasmic and nuclear signaling cascades in cortical astrocytes. Vasopressin activates V ia R leading to activation of the phosphatidylinositol (PI) signaling pathway and an influx of extracellular Ca2 + (Zhao and Brinton, 2002). Activation of the PI pathway and the influx of Ca2 + are required for the Ca2+ - dependent release of Ca2 + from the endoplasmic reticulum and the subsequent rise in [Ca2+ ]c and [Ca2+ ]n (Zhao and Brinton, 2002). PKC and CaMKII are activated in response to Vasopressin-induced [Ca2+ ]c rise. The MEK-dependent ERK1/2 signaling cascade is activated by PKC and CaM kinases. Activated CaMKII and ERK1/2 dynamically translocate in and out of nuclei of cortical astrocytes. Subsequent to CaMKII and ERK1/2 translocation to the nucleus, CREB activation occurs in the nuclei. Vasopressin-induced CREB activation is dependent on upstream ERK1/2 and CaM kinases. Mechamisms ofVasopressin Action in Astrocytes Ca2 + C alphostln C Cytoplasm K N -93, K N -62 #t'Ucleus K N -93, K N -62 U0126, PD98059 U0126 "CCOQOCt PD 980S9 89 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. DISCUSSION In the present study, we have elucidated the complex signaling cascade induced by Vi agonist in cytoplasmic and nuclear compartments o f cortical astrocytes. By conducting fluo-3 and fura-2 C a2+ imaging, we have demonstrated that this cascade is initiated by a rise in [C a2+]j with C a2+ compartmentalization into the nucleus. As depicted in Figure 23, P K C and C aM K II are activated in response to 9 + • • • . Vi agonist-induced [Ca ]c rise. The MEK-dependent ERK1/2 signaling cascade is activated by PKC and CaM kinases. Activated CaMKII and ERK1/2 dynamically translocate in and out of nuclei o f cortical astrocytes. Subsequent to CaMKII and ERK1/2 translocation to the nucleus, CREB activation occurs in cortical astrocyte nuclei. V] agonist-induced CREB activation is dependent on upstream ERK1/2 and CaM kinases. As depicted in Figure 23, the complex signaling cascade initiated by ViaR - indicates that activation of each crucial point of divergence in the cascade is dually regulated. In the case of initiation of the signaling cascade, both an influx of extracellular Ca2 + and generation of second messenger IP3 are required for the increase in cytoplasmic and nuclear Ca2 + (Zhao and Brinton, 2002). Activation of ERK1/2 is dependent upon both PKC and CaM kinases. Phosphorylation and activation of the transcription factor CREB is dually regulated by both CaM kinases and ERK1/2. The requirement of dual regulatory factors throughout the V) agonist- induced signaling cascade is indicative of a highly controlled and conditional signaling pathway. These data are the first to demonstrate that V ia R activation leads 90 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. to a complex cascade of Ca2 + and kinase signaling that is evident within both the cytoplasmic and nuclear compartments. The expected normal concentration of vasopressin in the cerebrospinal fluid ranges between 0.5 and 2.0 pM (Sorensen, 1986). It might be expected, therefore, that the dose of V) agonist used in this study, 100 nM, is too high to have physiological relevance. However, upon stimulation, brain vasopressin level can be increased up to nM concentration. Furthermore, at synapses where vasopressin is released, vasopressin concentration is much higher than the actual cerebrospinal fluid concentration. Therefore, true to all in vitro experiments, their relevance to actual in vivo condition has to be confirmed by conducing in vivo experiments, but at least these in vitro studies could serve as a basis for the in vivo analyses. Potential relevance of nuclear Ca2 + localization 9-1- Our results indicated a dynamic Ca translocation between cytoplasm and nucleus, this translocation observation, of course, is based on the assumption that 9 + 9 + there are no intranuclear Ca stores that release and/or uptake Ca in the nucleus since no intranuclear Ca2 + stores haven been identified to date. Nuclear Ca2 + has received considerable attention in recent years; however, the function of nuclear Ca2 + remains largely uncharted. Bading’s group has suggested that gene expression is differentially regulated by cytoplasmic and nuclear Ca2 + which enables a single second messenger to generate diverse transcriptional responses (Hardingham et al., 91 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 1997). These investigators found that nuclear Ca2 + mediates cyclic AMP response element (CRE)-mediated transcription, whereas serum response element (SRE)- mediated transcription is triggered by a rise in [Ca2+ ]c (Hardingham et al., 1997). One of the inducers of nuclear Ca2+ -mediated transcription may be CaM kinases. The presence of calmodulin in the nucleus has been demonstrated (Vendrell et al., 1991; Bachs et al., 1994), and together with nuclear Ca2+ , calmodulin may activate CaM kinases II and IV in the nucleus (Ohta et al., 1990; Chawla et al., 1998). Both CaM kinases II and IV play a pivotal role in regulating activation of CREB (Sheng et al., 1991) and its coactivator CREB binding protein (CBP) (Chawla et al., 1998). Activation of kinases in the cytoplasmic and nuclear compartments of cortical astrocytes C a2+ is a versatile second messenger which sets into motion a cascade of biochemical signaling events that leads to activation of kinases and transcription factors and induction of new gene expression. To explore the downstream signaling cascades of [C a2+]j rise, we investigated the activation of several candidate C a2+- activated kinases, including PKC, CaMKII and ERK1/2. That PKC was activated in response to Vi agonist was anticipated because of our previous demonstration that phospholipase C (PLC) was activated in response to ViaR activation in cortical astrocytes (Zhao and Brinton, 2002). PKC plays a pivotal role in controlling 92 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. numerous cellular functions, including cell proliferation (Buchner, 2000), long-term potentiation (Colley and Routtenberg, 1993), and potentiation of NMDA-induced current (Urushihara et al., 1992). Based on their dependence on intracellular Ca2 + and/or diacyl glycerol (DAG), PKC can be grouped into three types: classical, novel and atypical. Among the classical isoforms, PKCa, pi and pil are expressed in astrocytes. The novel isoforms PKC8, s, 0 and r| and atypical isoforms PKC^ and PKCi are also expressed in astrocytes (Slepko et al., 1999). Our ongoing studies are investigating which PKC isoforms are activated in astrocytes by vasopressin and their respective roles in the signaling cascade. CaMKII was persistently activated in response to V) agonist throughout the observation time of two hours. Our results are consistent with others reporting sustained CaMKII activation (Makhinson et al., 1999). Two distinct mechanisms may mediate the early-phase and late-phase CaMKII activation. The initial CaMKII activation may be dependent on intracellular Ca2 + and calmodulin, (Colbran, 1992), whereas the delayed CaMKII activation may be due to autophosphorylation of CaMKII. Accumulating evidence indicates that activated CaMKII can maintain its activity by autophosphorylation, rendering the kinase partially Ca2 + -calmodulin- independent (Miller and Kennedy, 1986; Miller et al., 1988). Autophosphorylation also leads to a several-hundredfold increase in Ca2 + -calmodulin-binding affinity (Meyer et al., 1992). Furthermore, both the Western blot data and the immunocytochemical data in our study revealed dynamic translocation of active 93 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. CaMKII between cytoplasmic and nuclear compartments of astrocytes. In the cytoplasmic compartment, CaMKII is involved in regulation of ERK1/2, whereas, in the nuclear compartment, CaMKII is involved in regulation of transcription factors, such as CREB. The MAP kinases ERK1/2 can be activated by a variety of extracellular signals and is involved in regulation of a wide range of genes. MAP kinases represent a point of convergence for cell surface signals regulating cell growth, division, differentiation, and protection (Chang and Karin, 2001). Our observation of PKC dependence of ERK1/2 activation is consistent with other reports demonstrating that PKC activation by phorbol esters PMA or TP A leads to ERK1/2 activation (Stadheim and Kucera, 1998; Lee et al., 1999; Abe and Saito, 2000). PKC has been suggested to phosphorylate Raf, the most common MAPK kinase kinase (Cai et al., 1997). In addition to PKC as an activator of ERK1/2, CaM kinases can also lead to ERK1/2 activation as has been demonstrated in other systems, such as in vascular smooth muscle cells (Muthalif et al., 1998). CaMKII actives ERK1/2 via an indirect pathway involving activation of cytosolic Phospholipase A2, followed by generation o f a fatty acid that induces activation of Ras signaling cascade leading to activation of ERK1/2 (Muthalif et al., 1998). It has also been demonstrated that CaMKII can activate Pyk2 or Fak tyrosine kinases, which can lead to ERK activation (Chen et al., 1998). 94 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Are ERK1/2 activated in nuclei of cortical astrocytes via upstream nuclear molecules? In the present study, immunocytochemical analysis showed an increase in nuclear pERKl/2 immunoreactivity following 20 min treatment with Vi agonist. To date there is no evidence for translocation of unphosphorylated ERK1/2 into nuclei (Lenormand et al., 1998), thus the increased nuclear ERK1/2 following V) agonist exposure is most likely phosphorylated ERK1/2. This is consistent with a large body of literature indicating that ERK1/2 can be translocated to cell nuclei upon activation (Martin et al., 1997; Boglari et al., 1998; Lenormand et al., 1998; Brunet et al., 1999). However, this does not exclude the possibility of ERK1/2 activation in the nucleus. Our preliminary analysis of the nuclear fraction of astrocyte extracts detected a small amount of total ERK1/2. In addition, a small but detectable level of MEK was found in the nucleus. Although MEK possesses a nuclear export signal in its protein sequence (Fukuda, 1996), it may enter the nucleus, but does not accumulate in the nucleus (Zheng, 1994); however, the short period of time when MEK is present in the nucleus could result in activation of nuclear ERK1/2. Furthermore, V) agonist-induced increase in [Ca2 + ]n could activate a signaling cascade leading to ERK1/2 activation in the nucleus. Moreover, both PKC and CaMKII, two activators of ERK1/2 in the cytoplasm, have been detected in the nucleus (Vendrell et al., 1991; Buchner, 2000). 95 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Convergence of cytoplasmic signals into nuclei One of the intriguing aspects of ViaR-induced signaling is the convergence of the cascade into the nuclei of astrocytes. Interestingly, both CaMKII and ERK1/2 translocate to nuclei of astrocytes upon activation, where they then activate CREB. CREB activation by CaM kinases and ERK1/2 is consistent with reports from a number of other laboratories (Wu et al., 2001; Komhauser et al., 2002). CREB, a multipurpose transcription factor, is involved in synaptic plasticity underlying refinement o f neuronal connections during development, or in processes like LTP and learning and memory (De Luca and Giuditta, 1997; Lamprecht et al., 1997; Silva et al., 1998). In addition, CREB is involved in cell division and proliferation (Tokunou et al., 2001). Activation of CREB in astrocytes fits well with previous data indicating that V) agonist promotes proliferation of cortical astrocytes (Lucas and Salm, 1995). Potential functional role of Vi agonist-induced signaling in astrocytes Astrocytes play a key role in CNS development and regeneration by secreting neurotrophic factors, guiding neuronal development, contributing to the metabolism of neurotransmitters and regulating extracellular pH and K+ levels (Bezzi et al., 2001). Furthermore, astrocytes can contribute to neural circuit development and maintenance by increasing the number of mature functional synapses on neurons and maintaining synaptic contacts in vitro (Ullian, 1999). Astrocytes also contribute to 96 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. both structural and functional integrity of the blood brain barrier (Prat et al., 2001). An emerging role of astrocytes within the CNS is regulation of the immune response via secretion of cytokines and chemokines (Dong, 2001). The relationship between ViaR activation of nuclear signaling cascades reported in this study and regulation of immune signaling by astrocytes is describe in the Chapter III of this dissertation where we presented evidence that ViaR activation leads to suppression of pro- inflammatory cytokine expression. The presence of Via R in astrocytes during CNS development and throughout the life span coupled with activation of a pivotal cytoplasmic to nuclear signaling, suggests that vasopressin could regulate key aspects of development and circuit remodeling during regeneration or the development of the immune response in brain through its regulation of astrocyte function. 97 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. CHAPTER III SUPPRESSION OF PRO-INFLAMMATORY CYTOKINES INTERLEUKIN-1 p AND TUMOR NECROSIS FACTOR-a IN ASTROCYTES BY VASOPRESSIN: A CREB-DEPENDENT MECHANISM Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. ABSTRACT Previous research from our laboratory has demonstrated that vasopressin induces a complex intracellular Ca2 + signaling cascade in cortical astrocytes which is initiated by G protein-coupled Via vasopressin receptor-mediated cytoplasmic and nuclear Ca2 + rise and converges upon activation of the nuclear transcription factor CREB. In the current study, we pursued the downstream functional consequences of vasopressin-induced Ca2 + signaling cascade for gene expression. Because astrocytes can exert immune effects analogous to immune cells in the periphery, we investigated vasopressin regulation of cytokine gene expression in astrocytes. Results from gene array studies indicate that vasopressin dramatically decreased the mRNA level of five cytokines. The two most important pro-inflammatory cytokines, interleukin-ip (IL-ip) and tumor necrosis factor-a (TNF-a) were selected and their expression was further confirmed with RT-PCR. Furthermore, ELISA analyses demonstrated that the peptide level of IL-lp and TNF-a in the astrocyte medium was also decreased in response to vasopressin. Using CREB antisense to determine the causal relationship between vasopressin-induced CREB activation and suppression of IL-ip and TNF-a, we demonstrated that decreased IL-ip and TNF-a gene expression was dependent on upstream CREB activation. Vasopressin-induced decrease of cytokine release from cortical astrocytes was also shown to be neuroprotective in cortical neurons. To our knowledge, this is the first documentation of vasopressin modulation of cytokine gene expression in any cell type. Implications 99 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. for vasopressin as an antipyretic agent and vasopressin’s role in neurodegeneration, autoimmune diseases, stress and neuropsychiatric behaviors are discussed. INTRODUCTION One of the most important functions of vasopressin that has received considerable attention within the last several years is its immune modulatory capabilities. It has been suggested that brain vasopressin is involved in stress- induced suppression of the immune function in rats by suppressing the proliferative response o f splenic T cells and natural killer cell cytotoxicity (Shibasaki et al., 1998). Moreover, rabbits immunized against vasopressin develop autoimmune alterations in neurohypophysis as evidenced by infiltration by immune cells and extracellular deposits o f immunoglobulins (Cau and Rougon-Rapuzzi, 1979); and the lack of vasopressin in Brattleboro rats elevates baseline natural killer cell activity (Yirmiya et al., 1989). The long-held theory for vasopressin immunomodulation is that vasopressin modulates adrenocorticotropin (ACTH) release which in turn stimulates the adrenal glands to release glucocorticoids that suppress the immune system by suppressing pro-inflammatory cytokines (Sternberg, 1997). Despite the findings of vasopressin receptor localization in immune cells in the brain such as astrocytes and microglia, and in immune tissues in the periphery, such as in the human thymus, which plays a pivotal role in the maturation and differentiation of T-lymphocytes (Melis et al., 100 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 1993), investigation of direct effects of vasopressin on immune cells has been minimal. One of the cell types in the central nervous system (CNS) that regulates immune response in brain is astrocytes (Dong, 2001). Although still controversial, upon stimulation astrocytes have been found to express major histocompatability complex class II molecules (MHC II), molecules that play a critical role in induction of immune responses through presentation of processed antigens to CD4+ T-helper cells (Wong et al., 1984), and co-stimulatory molecules including CD40, B7-1 and B7-2 that are essential for activation of naive T cells (Nikcevich et al., 1997), suggesting that astrocytes could function as antigen-presenting cells. Furthermore, astrocytes are potent producers of a number of cytokines and chemokines. Among the cytokines expressed by astrocytes, IL-ip and TNF-a have received considerable attention recently because of their pro-inflammatory effects in the CNS. Earlier studies from our laboratory have revealed that Via vasopressin receptor (Via R) activation induces a significant rise in both cytoplasmic and nuclear 7 + • • Ca concentrations in astrocytes (Zhao and Brinton, 2002). Furthermore, ViaR activation leads to a complex signaling cascade involving activation of PKC, CaMKII and ERK1/2, which results in CREB activation in the nucleus (Zhao and Brinton, 2003). The present study sought to determine the downstream consequences of vasopressin receptor activation of the Ca2 + / kinases / CREB cascade. Because of the immune function of astrocytes and the immunoregulatory function of vasopressin 101 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. in the periphery, we investigated the impact of vasopressin on the immune function of astrocytes, specifically modulation of cytokine expression. Using gene array, RT- PCR, and enzyme-linked immunosorbent assay (ELISA), we demonstrated that vasopressin suppresses expression of a number of cytokines, especially the two important pro-inflammatory cytokines, IL-ip and TNF-a, both at the mRNA and protein levels. Furthermore, suppression of both IL-lp and TNF-a was shown to be dependent on upstream CREB activation, and decreased IL-ip and TNF-a release from astrocytes was neuroprotective in cortical neurons. MATERIALS AND METHODS Cell culture preparation. Cultures of cortical astrocytes were prepared following the method described previously (Zhao and Brinton, 2002). Briefly, cortices were dissected from the brains of embryonic day 18 (E l8) Sprague-Dawley rat fetuses. The tissue was treated with 0.05% trypsin in Hank’s balanced salt solution (HBSS; 5.4 mM KC1, 0.4 mM KH2 P 0 4, 137 mM NaCl, 0.34 mM Na2HP 0 4 - 7 H2 0 , 10.0 mM Glucose, 10.0 mM HEPES) for 5 minutes at 37°C. Following incubation, trypsin was inactivated with cold 10% fetal bovine serum (FBS; Invitrogen Corp., Carlsbad, CA)-containing Dulbeccos Modified Eagle Medium (DMEM; Invitrogen Corp., Carlsbad, CA) supplemented with 10 mM NaHC03, 5 U / ml penicillin and 5 pg / ml streptomycin, and 10% F12 nutrient medium for 3 minutes at 37°C. Tissue was then washed with HBSS twice and 102 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. dissociated by repeated passage through a series of fire polished constricted Pasteur pipettes. For astrocyte culture, cells were plated at a concentration of 1 X 106 cells / ml in 10% FBS-containing DMEM in 25mm flasks and the cultures were maintained at 37°C with 5% CO2 . Following 3-7 days in culture, glial cells were shaken at 220 rpm for 16 hours to remove oligodendrocytes and microglia. The attached astrocytes were then trypsinized and plated onto poly-D-lysine (10 pg/ml)-coated 60mm petri dishes and cultured in the same medium at 37°C with 5% CO2 for 2-5 days before experiments. For neuronal culture, 105 cells / ml were plated onto poly-D-lysine- coated 24-well culture plates for LDH analyses, whereas between 20,000 and 40,000 cells were seeded onto poly-D-lysine-coated 4-well chamber slides for TUNEL analyses. Neurons were grown in Neurobasal medium (NBM, Invitrogen Corp., Carlsbad, CA) supplemented with B27, 5 U/ml penicillin, 5 pg/ml streptomycin, 0.5 mM glutamine and 25 pM glutamate, at 37°C in 10% CO2 . The culture media were exchanged with glutamate-free NBM 3 days after the day of cell culture and the cortical neurons were fed with glutamate-free NBM twice weekly before experiments. Inflammatory response cytokine gene array. Cortical astrocytes grown on poly-D-lysine-coated dishes were serum-deprived overnight and then treated with V) vasopressin receptor agonist (Vi agonist) or control vehicle for 24 hours. After treatment, astrocytes were rinsed twice with ice-cold PBS and total RNA was extracted using TRIzol (Invitrogen Corp., Carlsbad, CA) according to the 103 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. manufacturer’s instructions and resuspended in 10 pi of DEPC-treated water. RNA concentration was determined using a BioPhotometer (Eppendorf - Netheler - Hinz GmbH, Hamburg, Germany). The gene expression profile of inflammatory cytokines was determined using an Inflammatory Response Cytokine PathwayFinder GEArray system (mGEA1013030; Super Array Inc., Bethesda, MD) which detects 23 genes involved in inflammatory responses and two housekeeping genes, P-actin and GAPDH. Briefly, total RNA was used as templates for biotinylated probe synthesis. Each total RNA sample (8 pg) was combined with 2 pi GEAprimer mix and preheated at 70°C for 2 minutes. 20 pi master labeling mix (containing 8 pi 5X GEAlabeling buffer, 4 pi of ImM Biotin-16-dUTP, 1 pi RNase inhibitor, 100 U MMLV reverse transcriptase, and 5 pi RNase-free H 2O) was added to each sample, and the labeling reaction was conducted at 42°C for 2 hours. The labeled cDNA probe was then hybridized with the inflammatory cytokine GEArray membrane containing pre-spotted cDNA fragments at 68°C overnight with continuous agitation. The membrane was washed at 68°C twice with pre-warmed solution 1 (2X SSC, 1% SDS) and twice with pre-warmed wash solution 2 (0.1X SSC, 0.5% SDS) for 20 minutes each. The membrane was then blocked with 10 ml GEAblocking solution for 40 minutes, and incubated with 1:5000-1:10,000 diluted AP-streptavidin for 40 minutes. Following extensive washes, the membrane was incubated with CDP-Star for 2-5 minutes and exposed to X ray film. The relative expression level of each gene was determined by comparing the signal intensity of each gene in the array after 104 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. normalization to the signal of housekeeping genes, P-actin and/or GAPDH. Densitometric quantification of the array was performed with Un-Scan-It gel image software (Silk Scientific, Inc., Orem, UT). The limitation of this method is that the arrays are pre-spotted with mouse cytokine cDNAs. While the arrays are developed using common sequences between rats and mice, it is possible that some biotinylated cDNAs do not hybridize with the sequences on the arrays and therefore, we might not be able to detect all the genes. RT-PCR. Cortical astrocytes grown on poly-D-lysine-coated culture dishes for 2-5 days were serum-deprived overnight and treated with V] agonist and various pharmacological agents for appropriate periods. Following treatment, total RNA was extracted from astrocytes using TRIzol (Invitrogen Corp., Carlsbad, CA) according to the manufacturer’s instructions and resuspended in 10 pi of DEPC-treated water. RNA concentration was determined using a BioPhotometer (Eppendorf - Netheler - Hinz GmbH, Hamburg, Germany). 4 pg RNA was reverse-transcribed to generate cDNA using random hexamer primers and Superscript II (Invitrogen, Inc., Carlsbad, CA). PCR was conducted using a RoboCycler (400864; Stratagene, La Jolla, CA). Primer sequences and annealing temperatures for IL-ip and TNF-a PCR are listed in Table 1 1 1 . PCR products and a lkb DNA molecular weight marker were then electrophoresed on a 1% agarose gel, and the gel was visualized and photographed under UV light. Un-Scan-It gel image software (Silk Scientific, Inc., Orem, UT) was used for the quantitative analyses. 105 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Enzyme-Linked Immunosorbent Assay (ELISA). Cortical astrocytes grown on poly-D-lysine-coated dishes for 2-5 days were serum-deprived overnight and treated with Vi agonist and various pharmacological agents for appropriate periods. Following treatment, the medium was collected from cortical astrocytes. ELISA was conducted using Quantikine IL-ip or TNF-a ELISA system (R&D Systems, Minneapolis, MN). Briefly, a monoclonal antibody specific for rat IL-ip or TNF-a was pre-coated onto a microplate. 50 pi assay diluent was added to each well of the microplate. 50 pi standards, controls or samples were pipetted into the wells and incubated for 2 hours at room temperature. Following extensive washing to remove any unbound substances, an enzyme-linked polyclonal antibody specific for rat IL- ip or TNF-a (100 pi) was added to each well and incubated for 2 hours at room temperature. The wells were extensively washed to remove any unbound antibody- enzyme reagent and 100 pi Substrate Solution was added to each well to incubate for 30 minutes at room temperature in the dark. 100 pi Stop Solution was then added to each well and the optical density of each well was read at 450 nm using a microplate reader (Molecular Devices Corp., Sunnyvale, CA). CREB antisense treatment. The contribution of CREB on the vasopressin- induced suppression of IL-ip and TNF-a was determined by examining the influence of 200 nM CREB antisense, sense and random oligonucleotides. The sequences of the oligonucleotides were 5’TGGTCATCTAGTCACCGGTG3’ for CREB antisense, 5 ’CACCGGTGACTAGATGACCA3 ’ for CREB sense, and 106 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 5 ’TGCTGAACTTGTCGCCAGTG3 ’ for the random oligonucleotide. The CREB antisense oligonucleotide have been used in several previous studies and shown to attenuate CREB expression (Konradi et al., 1994; Konradi and Heckers, 1995; Guzowski and McGaugh, 1997; Murphy and Segal, 1997; White et al., 2000). The phosphorothioate modified, HPLC purified oligonucleotides were transfected into cortical astrocytes in the presence of a transfection reagent oligofectamine (Invitrogen Corp., Carlsbad, CA) in Opti-MEM I Reduced Serum Medium (Opti- MEM; Invitrogen Corp., Carlsbad, CA). Briefly, astrocytes were washed with Opti- MEM once prior to addition of oligonucleotides and oligofectamine. Following an overnight incubation, astrocytes were treated with V) agonist and/or lipopolysaccharide (LPS) for 24 hours in fresh Opti-MEM with fresh oligonucleotides and oligofectamine added prior to RNA or medium collection for RT-PCR or ELISA analyses. Efflux Assay o f Lactate Dehydrogenase (LDH). LDH release was used as an indicator of neuronal membrane integrity. Briefly, cortical neuronal cultures grown in 24-well plates in Neurobasal Medium (NBM) were treated with astrocyte- conditioned medium and various cytokines for 24 hours followed by medium change to fresh NBM. LDH release into the NBM culture media was measured 24 hours later using a Cytotoxicity Detection Kit from Boehringer Mannheim Biochemicals according to the manufacturer’s instructions, and absorption was read at 490 nm with a microplate reader. 107 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. TUNEL Analysis. Apoptotic neuronal cell death was determined using TUNEL (TdT-Mediated dUTP-X Nick End Labeling). Briefly, cortical neuronal cultures grown on 4-well chamber slides were treated with astrocyte-conditioned medium and various cytokines for 24 hours. The treated cells were rinsed with PBS and fixed with 95% methanol for 5 minutes at 4C°. Subsequently, neurons were incubated with the TUNEL reaction mixture [In Situ Cell Death Detection Kit (Fluorescein), Boehringer Mannheim Biochemicals, Indianapolis, IN] for 60 minutes at 37°C. After washing with PBS extensively for three times, neurons were mounted with Mounting Medium containing DAPI (Vector Laboratories, Inc., Burlingame, CA) to stain the nucleus. Apoptosis was qualified by fluorescence microscopy. 'y & Chemicals.Vi vasopressin receptor agonist ([Phe , Om ]-oxytocin) was purchased from Bachem Bioscience, Inc., King of Prussia, PA. LPS, IL-ip and TNF- a were obtained from Sigma Aldrich Co., St. Louis, MO. CREB antisense, sense and random oligonucleotides were purchased from Integrated DNA Technologies, Inc., Coralville, Iowa. Data analysis. Data were presented as group means ± SEM. RT-PCR, ELISA and LDH data were expressed as the percentage relative to unstimulated controls run in the same experiment. Statistical analysis was performed by Student’s t-test or by one-way analysis of variance followed by Newman-Keuls post hoc analysis. 108 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. RESULTS To define the specificity of the receptor involved in the responses to 9 o vasopressin, a specific Vi vasopressin receptor agonist, [Phe , Om ]-oxytocin, was used as a substitute for the endogenous arginine vasopressin. Our earlier studies showed that both the endogenous arginine vasopressin and the Vi agonist exerted comparable effects in raising intracellular Ca2 + level and kinase activation, therefore, we used this Vi agonist in our subsequent studies. The dose of Vi agonist used in this study was 100 nM, which was chosen based on our previous study on Vi agonist- induced intracellular Ca2 + signaling (Zhao and Brinton, 2002). In those studies, extensive dose response studies were conducted and 100 nM was found to be the optimal concentration to induce the maximal response. Suppression of inflammatory cytokines gene expression in response to Vi agonist in cortical astrocytes. Astrocytes, which can function as immune cell in the brain produce a variety of cytokines and chemokines. To investigate the impact of vasopressin on the immune function of astrocytes, the expression profile of inflammatory cytokines was investigated using an inflammatory response cytokine GEArray system which determines gene expression level of 23 cytokines related to inflammatory responses. 109 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Figure 24. Profile of inflammatory cytokines gene expression in response to Vi agonist in cortical astrocytes. Astrocytes were treated in the absence or presence of 100 nM Vi agonist for 24 hours followed by inflammatory cytokine GEArray analysis. Each cytokine is represented by two consecutive spots on both membranes. This array is representative of two independent analyses. Expression of a number of cytokines was decreased, including IL -la (lE & IF), IL-1J3 (2A & 2B), IL-2 (2C & 2D), Lymphotoxin-B (5E & 5F) and TNF-a (8A &8B) that are shown in white boxes. Expression of cytokines shown in the black boxes, including GROl Oncogene (1C & ID), IL-6 (3C & 3D), TGFpl (7A & 7B) and TGFp3 (7E & 7F), were unchanged. Housekeeping genes including P-actin (3G & 4G) and GAPDH (5G, 6G, 7G, 8E, 8F & 8G) were consistent between two membranes. A B C D E F G A B C D E F G CTRL V1 agonist Astrocytes were serum-deprived overnight and subsequently treated in the absence or presence of 100 nM V) agonist for 24 hours followed by RNA extraction. Biotinylated cDNA was synthesized and hybridized respectively with control and the Vi agonist membranes containing pre-spotted cDNA fragments. Each cytokine is represented by two consecutive spots on both membranes. The array set shown in figure 24 is a representative of two independent experiments. Expression o f five 110 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. cytokines were decreased in response to Vi agonist, including IL -la (IE & IF), IL- ip (2A & 2B), IL-2 (2C & 2D), Lymphotoxin-B (5E & 5F) and TNF-a (8A & 8B) shown in white boxes (Fig. 24). The percent of cytokine expression relative to control is shown in Table II. Expression of cytokines shown in the black boxes, including GROl Oncogene (1C & ID), IL-6 (3C & 3D), TGFpl (7A & 7B) and TGFP3 (7E & 7F), were unchanged. Expression of the housekeeping genes P-actin Table II. Densitometric quantification of Vi agonist-induced cytokine gene suppression Astrocytes were treated in the absence or presence of 100 nM V) agonist for 24 hours followed by inflammatory cytokine GEArray analysis. Densitometric quantification of Vi agonist-induced cytokine gene expression was analyzed with Un-Scan-It gel image software and expressed as percent of control gene expression. Cytokines IL -la IL-ip IL-2 Lymphotoxin-B TNF-a Percent of Control 80.78 % 85.21 % 86.86 % 88.20 % 75.23 % (3G & 4G) and GAPDH (5G, 6G, 7G, 8E, 8F & 8G) were consistent across both conditions. To further confirm the gene array data indicating suppression of IL-ip by V) agonist, semi-quantitative RT-PCR was conducted. Cortical astrocytes were serum- deprived overnight and subsequently treated in the absence or presence of 100 nM Vi agonist for 24 hours. Furthermore, to determine whether V) agonist also prevents toxin-stimulated inflammatory response, astrocytes were treated with LPS (50 111 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. ng/ml), a bacterial endotoxin known to induce cytokine upregulation in a number of immune cells (Raetz and Whitfield, 2002); and the impact of vasopressin on LPS- upregulated IL-ip expression was investigated (Fig. 25). Primer sequences and annealing temperatures for IL-ip PCR are listed in Table HI. RT-PCR statistical data from three independent experiments indicate that V) agonist (Vi a) significantly decreased the IL-ip mRNA level (78.29% ± 3.36 relative to control, * p < 0.05 1 mRNA 'able III. Oligonucleo Sense primer tide primers used for Antisense primer cDNA an Anneal temp nplificati PCR target on Cycles IL-1|3 5 ’ GCACCTTCTTTTC CTTCATC3’ 5 ’CTGATGTACCAGT TGGGGAA3’ 55°C 448 bp 40 TNF-a 5 ’GGCAGGTCTACTT TGGAGTCATTGC3 ’ 5 ’ ACATTCGGGGATC CAGTGAGTTCCG3 ’ 56°C 319 bp 40 compared to control), consistent with the gene array data. When astrocytes were stimulated with LPS, IL-ip mRNA increased significantly (123.68% ± 7.61 relative to control, * p < 0.05 compared to control). IL-ip mRNA induction was significantly reduced compared to the LPS level following Vi agonist treatment (101.59% ± 7.51 relative to control, + p< 0.05 compared to LPS alone). Suppression of TNF-a by V) agonist was also investigated using RT-PCR (Fig. 26). Cortical astrocytes were treated the same as for the IL-lp mRNA analysis. Primer sequences and annealing temperatures for TNF-a PCR are also listed in Table III. Statistical data from three independent experiments indicate that V) agonist significantly decreased TNF-a mRNA level (80.87% ± 5.15 relative to 112 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. control, * p < 0.05 compared to control), consistent with the gene array data. As expected, LPS significantly upregulated TNF-a gene expression (122.82% ± 1.86 relative to control, * p < 0.05 compared to control) which was reversed to control level by 100 nM Y \ agonist treatment (103.79% ± 4.77 relative to control, + p < 0.05 compared to LPS alone). Figure 25. Suppression of IL-ip gene expression by Vi agonist is confirmed by RT-PCR. Astrocytes were treated in the absence or presence of V) agonist (100 nM) or LPS (50 ng/ml) for 24 hours followed by RNA extraction and RT-PCR on IL-lp. PCR products were then run on an agarose gel to determine the expression level of IL-ip. The percent change of IL-ip gene expression relative to control is presented in the bar graph. Each bar represents the mean ± SEM (n = 3 for each condition), * p < 0.05 versus control, + p < 0.05 versus LPS-treated culture. V) agonist significantly reduced IL-lp gene expression in astrocytes. Furthermore, V) agonist repressed LPS-upregulated IL-lp expression back to control level. CTRL V. a LPS LPS+V. a P-actin CTRL V, a LPS LPS+V, a 113 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Figure 26. Suppression of TNF-a gene expression by Vi agonist is confirmed by RT-PCR. Astrocytes were treated in the absence or presence of Vi agonist (100 nM) or LPS (50 ng/ml) for 24 hours followed by RNA extraction and RT-PCR on TNF-a. PCR products were then run on an agarose gel to determine the expression level of TNF-a. The percent change of TNF-a gene expression relative to control is presented in the bar graph. Each bar represents the mean ± SEM (n - 3 for each condition), * p < 0.05 versus control, + p < 0.05 versus LPS-treated culture. V) agonist significantly reduced TNF-a gene expression in astrocytes. Furthermore, V) agonist blocked LPS induction o f TNF-a. CTRL V, a LPS LPS+V, a p-actin CTRL V, a LPS LPS+V, a Suppression of IL-ip and TNF-a gene expression in response to Vi agonist is dependent on transcription factor CREB activation. CREB is a multifunctional leucine-zipper-containing transcription factor involved in the regulation of a variety of genes. Our earlier studies on V) agonist- induced nuclear signaling cascade demonstrated that CREB is significantly activated in the nucleus of cortical astrocytes in response to V) agonist in a time-dependent 114 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. manner (Zhao and Brinton, 2003). Furthermore, it has been suggested that CREB is involved in suppression of cytokines gene expression in other systems (Delgado et al., 1998; Perez et al., 1999; Cho et al., 2001). To determine whether CREB is required for V) agonist-induced suppression of IL-ip and TNF-a gene expression in astrocytes, CREB antisense oligonucleotide (AS) was used to knock out CREB in astrocytes. Impact of the CREB antisense on IL-ip and TNF-a mRNA level was investigated using RT-PCR. CREB sense oligonucleotide (S) and a random oligonucleotide (R) were also used to rule out non specific effects of CREB antisense. Cortical astrocytes were transfected overnight with various oligonucleotides in the presence of oligofectamine in Opti-MEM medium followed by treatment with V) agonist and/or LPS for 24 hours. Statistical analysis of RT-PCR data on IL-ip from three independent experiments is shown in Figure 27 and indicates that CREB antisense completely blocked V) agonist-induced suppression of IL-ip gene expression (Fig. 27; column AS + V) a; 104.06% ± 3.60 relative to control; compared with column Vi a), while CREB sense and random oligonucleotides had no effect (Fig. 27; compare columns V) a with S+V) a or R+Vi a). Similarly, CREB antisense completely reversed V) agonist inhibition of LPS induction of IL-ip (Fig. 27; column AS+LPS+Vi a; 129.91% ± 4.00 relative to control; compared with column LPS+Vi a), while CREB sense and random oligonucleotides had no effect (Fig. 27; compare columns LPS+Vi a with S+LPS+Vi a or R+LPS+Vi a). 115 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Figure 27. Vi Agonist-Induced Suppression of IL-ip is Dependent on CREB Activation. Astrocytes were treated according to the indicated conditions for 24 hours followed by RNA extraction and RT-PCR on IL-ip. CREB antisense oligonucleotide (AS) was used to knock out CREB in the cortical astrocytes. Sense oligonucleotide (S) and random oligonucleotide (R) were used as control conditions to rule out non specific effects of CREB antisense. PCR products were run on an agarose gel to determine the expression level of IL-ip. The percent change of IL-ip gene expression relative to control is presented in the bar graph. Each bar represents the mean ± SEM (n = 3 for each condition), * p < 0.05 versus control, + p < 0.05 versus LPS-treated culture. CREB antisense reversed V) agonist-induced suppression o f IL- 1P gene expression back to control level, and prevented V) agonist repression of LPS-upregulated IL-ip. CREB sense and random oligonucleotides, however, had no effect on V) agonist-induced change in IL-ip expression. P-actin a > 150 - > _ i 140 - < 130 - z tn 120 - E C O . 110 - T- ■ _J 100 - O k. 90 - c O 80 - O > * - 70 - o SS 60 - 50 - < r V 4K 116 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Figure 28. Vj Agonist-Induced Suppression of TNF-a is Dependent on CREB Activation. Astrocytes were treated according to the indicated conditions for 24 hours followed by RNA extraction and RT-PCR on TNF-a. CREB antisense oligonucleotide (AS) was used to knock out CREB in the cortical astrocytes. Sense oligonucleotide (S) and random oligonucleotide (R) were used as control conditions to rule out non-specific effects of CREB antisense. PCR products were run on an agarose gel to determine the expression level of TNF-a. The percent change of TNF- a gene expression relative to control is presented in the bar graph. Each bar represents the mean ± SEM (n = 3 for each condition), * p < 0.05 versus control, + p < 0.05 versus LPS-treated culture. CREB antisense reversed V) agonist-induced suppression of TNF-a gene expression back to control level, and abolished V) agonist inhibition of LPS-induced TNF-a. CREB sense and random oligonucleotides, however, had no effect on V) agonist-induced change in TNF-a expression. | TNF-a P-actin v1 a LPS AS s R + - + - + + + - + - + + + + + - + + + + + + + + ■ + + + + I 110- 117 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. CREB regulation of Vi agonist-induced suppression of TNF-a was also investigated using CREB antisense (Fig. 28). Cortical astrocytes were transfected overnight with CREB antisense, sense or random oligonucleotides prior to treatment with Vi agonist and/or LPS for 24 hours. Statistical analysis of RT-PCR data on TNF-a from three independent experiments indicates that V) agonist-induced suppression of TNF-a gene expression was completely abolished by CREB antisense (Fig. 28; column AS + V) a; 99.52% ± 6.21 relative to control; compared with column Vi a), while not affected by CREB sense and random oligonucleotides (Fig. 28; compare columns V) a with S+V) a or R+V) a). Similarly, CREB antisense completely abolished Vi agonist repression of LPS-upregulated TNF-a (Fig. 28; column AS+LPS+Vi a; 121.16% ± 5.26 relative to control; compared with column LPS+Vi a), while CREB sense and random oligonucleotides had no effect (Fig. 28; compare columns LPS+Vi a with S+LPS+Vi a or R+LPS+Vi a). Vi agonist-induced decrease of IL-lp and TNF-a detected in the medium of cortical astrocytes and its dependence on CREB activation. As shown above, V) agonist decreased the mRNA level of IL-lp and TNF-a in astrocytes. We next pursued whether the products of IL-lp and TNF-a gene expression were altered in response to V) agonist. IL-ip and TNF-a are released into the extracellular medium following synthesis and cleavage of their precursors to generate mature active peptides by IL-ip converting enzyme and TNF-a converting 118 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. enzyme respectively (Dinarello, 1994; Black et al., 1997; Moss et al., 1997). We conducted cytokine specific Enzyme-Linked-Immunosorbent Assay (ELISA) to determine the level of IL-lp and TNF-a in the astrocyte medium. Cortical astrocytes were either serum-deprived overnight with Opti-MEM medium or transfected overnight with various oligonucleotides in the presence of oligofectamine in Opti- MEM medium followed by treatment with V) agonist and/or LPS for 24 hours. Statistical analysis of IL-ip relative to control is shown in Figure 29 and is a representative of three independent experiments. Vi agonist treatment of astrocytes significantly decreased IL-ip peptide level in the medium (43.69% ± 17.51 relative to control, * p < 0.05 compared to control). LPS-stimulated IL-ip peptide upregulation (approximately 250 pg/ml) was completely blocked by treatment with Vi agonist (approximately 125 pg/ml; 97.16% ± 2.95 relative to control, + p < 0.05 compared to LPS alone). The contribution of CREB to the V) agonist effect was investigated using CREB antisense, sense and random oligonucleotides. CREB antisense completely blocked V) agonist-induced IL-ip peptide decrease in the medium derived from treated astrocytes (column AS + V) a; 97.35% ± 2.07 relative to control; compared with column Vi a), while CREB sense and random oligonucleotides had no effect (compare columns V) a with S+V) a or R+V) a). Similarly, V) agonist inhibition of LPS induction o f IL-ip peptide in the astrocytes medium was completely reversed by CREB antisense (column AS+LPS+Vi a; 166.95% ± 21.68 relative to control; 119 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. compared with column LPS+Vi a), while CREB sense and random oligonucleotides had no effect (Fig. 29; compare columns LPS+Vi a with S+LPS+Vi a or R+LPS+Vi a). Figure 29. Vj agonist-induced decrease of IL-ip detected in the medium of cortical astrocytes and its dependence on CREB activation. Astrocytes were treated according to the indicated conditions for 24 hours followed by medium collection and ELISA analysis on IL-ip. CREB antisense oligonucleotide (AS) was used to knock out CREB in the cortical astrocytes. Sense oligonucleotide (S) and random oligonucleotide (R) were used as control conditions to rule out non-specific effects of CREB antisense. Results are expressed as mean ± SEM percent change of IL-lp level in the medium relative to control and are representative of three separate experiments, n = 3 for each condition, * p < 0.05 versus control, + p < 0.05 versus LPS-treated culture. V) agonist significantly reduced IL-ip level in the medium of astrocytes. Furthermore, V) agonist brought LPS-upregulated IL-ip to control level. CREB antisense reversed V) agonist- induced decrease of IL-ip in the medium back to control level, and in the case of LPS presence, back to LPS level. CREB sense and random oligonucleotides, however, had no effect on V) agonist-induced change in IL-ip level in the medium. E D C D CD -C 250 200 • CD > <D _l C O . c o O o n P \z C.X & 120 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. TNF-a level in astrocyte medium following Vi agonist treatment was also investigated using ELISA (Fig. 30). Cortical astrocytes were either serum-deprived overnight in Opti-MEM medium or transfected overnight with CREB antisense, sense or random oligonucleotide in Opti-MEM medium prior to treatment with V) agonist and/or LPS for 24 hours. Statistical analysis of TNF-a relative to control is shown in Figure 30 and is a representative of three independent experiments. V) agonist significantly decreased TNF-a peptide level in the medium (37.94% ± 8.71 relative to control, * p < 0.05 compared to control) and significantly reversed LPS induction of TNF-a from approximately 100 pg/ml to 50 pg/ml (98.19% ± 0.82 relative to control, + p < 0.05 compared to LPS alone). CREB antisense completely abolished Vi agonist-induced TNF-a peptide level decrease (column AS + V) a; 90.80% ± 11.57 relative to control; compared with column V) a), while CREB sense and random oligonucleotide had no effect (compare columns V) a with S+V) a or R+Vi a). Similarly, CREB antisense completely abolished V) agonist inhibition of LPS induction of TNF-a peptide (column AS+LPS+Vi a; 185.43% ± 16.10 relative to control; compared with column LPS+Vi a), while CREB sense and random oligonucleotides had no impact on the V) agonist effect (Fig. 30; compare columns LPS+Vj a with S+LPS+Vi a orR+LPS+V! a). 121 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Figure 30. Vi agonist-induced decrease of TNF-a detected in the medium of cortical astrocytes and its dependence on CREB activation. Astrocytes were treated according to the indicated conditions for 24 hours followed by medium collection and ELISA analysis on TNF-a. CREB antisense oligonucleotide (AS) was used to knock out CREB in the cortical astrocytes. Sense oligonucleotide (S) and random oligonucleotide (R) were used as control conditions to rule out non-specific effects of CREB antisense. Results are expressed as mean ± SEM percent change of TNF-a level in the medium relative to control and are representative of three separate experiments, n = 3 for each condition, * p < 0.05 versus control, + p < 0.05 versus LPS-treated culture. Vf agonist significantly reduced TNF-a level in the medium of astrocytes. Furthermore, V) agonist brought LPS-upregulated TNF-a to control level. CREB antisense reversed Vj agonist- induced TNF-a decrease in the medium back to control level, and abolished V) agonist repression of LPS-induced TNF-a. CREB sense and random oligonucleotides, however, had no effect on V) agonist-induced change in TNF-a peptide level in the medium. E g T3 CD a ) CD > CD z K - c O o 200 - Ssv St* 122 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Impact of decreased cytokine release from astrocytes on cortical neuronal survival. In an attempt to determine the impact of reduced astrocyte cytokine release on neurons, astrocyte-conditioned medium (ACM) was collected to treat cortical neurons followed by LDH release assessment to determine the plasma membrane integrity of neurons. LDH is a stable cytoplasmic enzyme present in all cells including neurons and is rapidly released into media when the plasma membrane is damaged. Cortical astrocytes were treated with LPS and/or Vi agonist for 24 hours. ACM was then collected and used to treat cortical neurons for 24 hours (Fig. 31). Results are expressed as mean ± SEM percent of control LDH release and are representative of three separate experiments. Following treatment with LPS-treated ACM, LDH release in neuronal medium was significantly increased compared to control (139.29% ± 2.50, * p < 0.05 compared to control), which was reversed by treatment with medium collected from LPS+Vi agonist-treated astrocytes (101.44% ± 3.02 relative to control). To determine whether this neuroprotection exerted by V) agonist is due to reduced cytokine release from astrocytes, IL-lp (125 pg/ml) and/or TNF-a (50 pg/ml) were added to cortical neurons together with LPS+Vi agonist- treated ACM. The doses of IL-ip and TNF-a were chosen based on the ELISA data showing Vi agonist reduced IL-ip release by 125 pg/ml and TNF-a release by 50 pg/ml. IL-ip or TNF-a alone had no impact on the neuroprotective effect o f V) agonist, while the combination of these two pro-inflammatory cytokines were able to 123 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. reverse the Vi agonist-induced neuroprotection (136.53% ± 21.41 relative to control, * p < 0.05 compared to control), indicating a synergistic effect of IL-1(3 and TNF-a. Figure 31. LDH analysis demonstrating neuroprotective effect of Vi agonist-induced suppression of IL-ip and TNF-a against LPS-treated astrocyte- conditioned medium. Cortical neurons grown in 24-well plates were treated with astrocyte- conditioned medium (ACM) collected from LPS and/or V) agonist-treated cortical astrocytes followed by LDH release analysis to determine the plasma integrity of neurons. Results are expressed as mean + SEM percent of control LDH release and are representative of three separate experiments. LPS-treated ACM induced significantly higher LDH release than control, which was reversed by medium collected from LPS+Vi agonist-treated astrocytes. Addition of IL-ip (125 pg/ml) or TNF-a (50 pg/ml) alone to neuronal cultures together with LPS+Vi agonist-treated ACM had no effect on V) agonist-induced neuroprotection while the combination of IL-ip and TNF-a reversed it. n = 12 per condition. * p < 0.05 compared with control cultures. CD 1 140 C D O S 120 x Q c o O V — O CTRL ACM ACM ACM (LPS) (V1 a) IL-ip TNF-a IL-1P+ TNF-a I ACM (LPS+V1 a) I 124 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Figure 32. TUNEL analysis demonstrating neuroprotective effect of Vi agonist-induced suppression of IL-ip and TNF-a against LPS-treated astrocyte- conditioned medium. Cortical neurons grown on 4-well chamber slides were treated with LPS and/or Vi agonist-treated astrocyte-conditioned medium (ACM), and then neuronal apoptotic cell death was determined using fluorescent TUNEL analysis. Neuronal nuclei were labeled with DAPI to quantitate total number o f neurons. Medium collected from LPS-treated astrocytes induced massive apoptotic cell death which was reversed by medium collected from LPS+Vi agonist-treated astrocytes. When the pro-inflammatory cytokines IL-ip (125 pg/ml) and/or TNF-a (50 pg/ml) were added to neuronal cultures together with LPS+Vi agonist-treated ACM, they alone had no impact on Vi agonist-induced prevention of apoptotic cell death while the combination of IL-ip and TNF-a reversed the neuroprotective effect of Vi agonist. Scale bar = 50 pm. TUNEL DAPI TUNEL DAPI CTRL ACM ACM (LPS) ACM (Vi a) ACM (LPS+ Vt a) ACM (LPS+ Vi a) +IL-1p ACM (LPS+ Vi a) +TNF-a ACM (LPS+ Vi a) +IL-1p +TNF-a Besides LDH release, apoptotic cell death in response to ACM was determined. TUNEL staining was utilized to detect DNA damage in neurons undergoing apoptotic cell death. In addition, DAPI was used to label neuronal nuclei 125 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. to quantitate the total number of neurons in the field (Fig. 32). Fluorescent images of TUNEL staining show that LPS-treated ACM induced a marked increase in the number o f neurons undergoing apoptosis. This increase in apoptotic cell death was blocked by V) agonist in that LPS+V) agonist-treated ACM completely reversed the apoptotic effect of LPS-treated ACM. To determine whether Vi agonist-induced prevention of apoptosis is due to reduced cytokine release from astrocytes, IL-lp (125 pg/ml) and/or TNF-a (50 pg/ml) were added to cortical neurons together with LPS+Vi agonist-treated ACM followed by TUNEL analysis of apoptotic cell death. IL-ip or TNF-a alone had no impact on Vi agonist-induced neuroprotection, while the combination of these two pro-inflammatory cytokines synergistically reversed Vi agonist-induced prevention o f neuronal apoptosis. DISCUSSION In the present study, we pursued the functional significance of the complex signaling cascade activated by vasopressin in astrocytes by investigating the impact of vasopressin on the immune function of astrocytes, focusing on the regulation of inflammatory cytokine production in astrocytes. Results of these analyses indicate that vasopressin suppresses IL-ip and TNF-a expression o f both mRNA and secreted peptide levels. Using CREB antisense to knock out CREB in astrocytes, we demonstrated that suppression of IL-ip and TNF-a requires upstream activation of transcription factor CREB. Furthermore, suppression of IL-1 ( 3 and TNF-a was 126 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. shown to be neuroprotective against inflammatory insults from LPS-stimulated astrocytes. This study provides a functional consequence of the vasopressin activated complex Ca2 + and kinase signaling cascade that leads to CREB activation in astrocytes. Specifically, results of this investigation indicate that in astrocytes, vasopressin acts as an immune modulator to repress the expression and production of two pro-inflammatory cytokines IL-1(3 and TNF-a. These data suggest that vasopressin could exert an anti-inflammatory effect in vivo. Based on our findings, vasopressin, a neuropeptide hormone, can be added to the growing list of neuropeptides or hormones that modulate the immune responses in the CNS. Thus far, that list of peptide immune regulators include vasoactive intestinal peptide (VIP) and the pituitary adenylate cyclase-activating polypeptide (PACAP) whose primary immunomodulatory function is also anti-inflammatory in nature. VIP and PACAP have been found to suppress LPS-induced production of pro-inflammatory cytokines TNF-a and IL-6 (Delgado et al., 1998). There are other hormones that also possess an immunomodulatory function in the CNS, such as estrogen. Estrogen exerts anti-inflammatory effects on immune cells and prevents LPS-induced inflammatory response in the brain (Bruce-Keller et al., 2000; Vegeto et al., 2001). 127 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Potential functional implications of Vi agonist-induced suppression of IL-ip and TNF-a in astrocytes The current finding of vasopressin repression of pro-inflammatory cytokines production suggests that vasopressin is a potential direct immunosuppressive and anti-inflammatory molecule in the CNS. To understand the potential functional implications of cytokine suppression, a brief discussion of the role of IL-ip and TNF-a in the brain is provided. IL-ip and TNF-a are intimately associated with elements of the acute phase immune responses including fever and are responsible for LPS (a potent bacterially derived pyrogen)-induced fever (Saigusa, 1990; Luheshi et al., 1997; Luheshi, 1998). This is o f particular interest since vasopressin functions as an antipyretic peptide (Naylor et al., 1988; Pittman and Wilkinson, 1992; Pittman et al., 1998). In most mammals, injection or infusion of exogenous vasopressin into ventral septal area or central medial amygdala reduces fever (Cooper et al., 1979a; Cooper et al., 1979b; Federico et al., 1992). O f equal interest, IL-1J3 is a potent stimulator for vasopressin release to activate an antipyretic pathway (Wilkinson et al., 1994), forming a negative feedback loop. Expression of cytokine genes IL-ip and TNF-a have been linked to diverse forms of brain injury and neurodegeneration. Results from the current study have shown that IL-ip and TNF-a synergistically induce neuronal cell death in vitro. Others have shown that the expression of both cytokines is rapidly induced as early 128 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. as one hour of experimental focal or global ischemia, neonatal hypoxic injury and excitotoxic insults (Buttini et al., 1994; Liu et al., 1994; Wang et al., 1994; Buttini et al., 1996). Exogenous addition of TNF-a has been shown to induce dose-dependent cytotoxicity in primary septo-hippocampal cultures (Zhao et al., 2001), and when co administered, IL-ip and TNF-a synergistically cause neurotoxicity (Chao et al., 1995; Hu et al., 1997). The intracerebral injection o f recombinant IL-ip or TNF-a exacerbates ischemic and excitotoxic damages in vivo [Yamasaki, 1995 #544; Barone, 1997 #545]. Conversely, inhibition of IL-ip or TNF-a dramatically reduces the damage (Loddick and Rothwell, 1996; Barone et al., 1997; Nawashiro et al., 1997; Mayne et al., 2001). IL-ip and TNF-a are also associated with impairment of learning and memory and cognition, and are involved in the pathogenesis of a variety of neurodegenerative diseases including Alzheimer’s (AD) and Parkinson’s (PD) disease. In AD patients, increased pro-inflammatory cytokines can cause increased APP production and P-amyloid deposition (Griffin and Mrak, 2002). Immunocytochemical analyses have shown that these cytokines are closely associated with senile plaques (Griffin et al., 1989; Yan et al., 1996; Mehlhom et al., 2000). This is o f particular interest given the increasing number of reports that show a beneficial effect of anti-inflammatory drugs on the progression of AD (Andersen et al., 1995; McGeer and McGeer, 1995; Breitner, 1996). In PD, increased levels of IL-ip and TNF-a are also found in postmortem PD brains and in MTPT or 60HDA- induced experimental PD animals (Boka et al., 1994; Mogi et al., 1994; Nagatsu et 129 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. al, 2000). Together, these data suggest that reducing inflammatory cytokine production could be an effective therapeutic strategy for preventing or delaying the progression of these neurodegenerative disorders and diseases. Autoimmune diseases such as multiple sclerosis (MS) are also associated with elevated levels of inflammatory cytokines. MS is a chronic inflammatory demyelinating disease of the CNS and is characterized by infiltration of inflammatory cells consisting of T cells, B cells, plasma cells and macrophages. Examination of cerebrospinal fluid and brain tissue from patients with MS has revealed dramatic elevation of IL-ip and TNF-a compared to controls (Peter et al., 1991; Woodroofe and Cuzner, 1993; Merrill and Benveniste, 1996; Baranzini et al., 2000). Moreover, these cytokines can either directly cause oligodendrocytes injury and demyelination (Carrieri et al., 1992) or induce T cell activation which leads to further myelin sheath damage (Martino et al., 1998). Stress is usually associated with activation of the hypothalamic-pituitary- adrenal (HPA) axis and suppressed immune function (Irwin, 1994). The long prevailing view is that activated HPA axis leads to increased secretion of corticotropin-releasing factor (CRF), which regulates ACTH secretion from pituitary. The endocrine action of ACTH in turn stimulates the release of adrenal stress hormone, glucocorticoid, an immune suppressor. However, vasopressin secretion is also a typical constituent of the response to several types of stressors (Ebner et al., 1999; Altemus et al., 2001). The current finding of vasopressin- 130 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. suppressed cytokine production may be an alternative theory for suppressed immune function in stress situations. Inflammatory cytokines are also implicated in a variety of psychiatric disorders such as schizophrenia and depressive disorders, and even autism. Increased production of inflammatory cytokines have been proposed to play a pivotal role in the pathogenesis of schizophrenia, possibly due to the activation of immune system in the CNS by these cytokines (Smith, 1992; Ganguli et al., 1994; Muller and Ackenheil, 1998). Both clinical and experimental studies indicate that depression is associated with increased concentrations of IL-ip and TNF-a in the CNS (Connor and Leonard, 1998). Interestingly, plasma vasopressin level is increased in patients with major depression (van Londen et al., 1997), possibly acting via a negative feedback mechanism by suppressing the production of the pro-inflammatory cytokines. Autism, a pervasive developmental disorder characterized by impairment of social interaction and language and restricted, repetitive and stereotyped patterns of behavior, interests and activities, has been hypothesized to be accompanied by activation of pro-inflammatory cytokines which could contribute to the etiology of some autistic symptoms such as social withdrawal, suppression of exploratory behavior, sleep disturbances and mood alterations (Croonenberghs et al., 2002). Despite the adverse effects of cytokines discussed above, several in vitro studies report neuroprotective actions of IL-lp and TNF-a in cultured neurons or brain slices (Cheng et al., 1994; Strijbos and Rothwell, 1995; Bruce et al., 1996). 131 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. These conflicting data are probably due to different cell types, different animal species, different insults used or more importantly, different cytokine network environments. Cytokines interact with each other, and the spaciotemporal expression patterns of different cytokines are pivotal in determining the impact of these cytokines in pathophysiology as discussed below. Complexity of cytokine network Cytokines operate within a complex network and may act either synergistically or antagonistically and can influence the production of other cytokines. For example, when co-administered individually, IL-ip and TNF-a synergistically induce cytotoxicity (Chao et al., 1995; Hu et al., 1997). Furthermore, two groups of cytokines with opposing actions exist. IL-lp, TNF-a and IL-6 are typical pro-inflammatory molecules, while other cytokines such as IL-4, IL-10 and TGFp are recognized as anti-inflammatory molecules. Also, IL-ip and TNF-a can induce expression of other cytokines such as IL-6, IL-8 and colony-stimulating factors in human astrocytes (Aloisi et al., 1992), which complicates the end effect. Therefore, a complete picture of spaciotemporal cytokine expression is essential for a thorough understanding of the pharmacological effect of any anti-inflammatory drug, and therapeutic intervention against inflammatory cytokines should take into consideration the expression profile of other cytokines. 132 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. In our current study, cytokine gene expression was first determined using a gene array method which allowed the screening of 23 differently regulated RNAs. Results of the multigene analysis indicated that in addition to the two cytokines IL- 1 (3 and TNF-a investigated, other cytokines were also suppressed such as IL -la, IL- 2 and Lymphotoxin-B while others were not affected by vasopressin. CREB involvement in cytokine suppression In the present study, CREB was found to be the pivotal transcription factor involved in vasopressin suppression of IL-1(3 and TNF-a, which is consistent with findings from other laboratories. A CRE-like promoter sequence is found in the promotor region of both IL-lp and TNF-a genes (Gray et al., 1993; Cogswell et al., 1994; Newell et al., 1994; Liu and Whisler, 1998; Perez et al., 1999). Suppression of LPS-induced IL-lp and TNF-a by N-acetyl-O-methyldopamine (NMDA) was found to be dependent on CREB activation (Cho et al., 2001). VIP and PACAP-induced repression o f TNF-a expression was also demonstrated to involve CREB (Delgado et al., 1998). In conclusion, we have demonstrated that the neuropeptide vasopressin suppresses pro-inflammatory cytokines IL-ip and TNF-a at both mRNA and released peptide levels via a CREB-dependent mechanism, and the cytokine 133 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. suppression is neuroprotective. The potential therapeutic implications of vasopressin as an anti-inflammatory agent are currently under investigation. 134 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. CONCLUSION Based on our earlier detection of Via vasopressin receptors presence in cortical astrocytes, our studies have been guided by a motivation to understand the basic science principles of Via vasopressin receptor (ViaR) function in astrocytes. Part of that mechanistic understanding required a thorough analysis of the signaling cascades activated by the vasopressin receptor. Therefore, this dissertation has explored in detail the functionality of these receptors by conducting extensive biochemical analysis of the signaling cascade induced by ViaR activation in cortical astrocytes. In this endeavor, I have demonstrated that the ViaR in cortical astrocytes are indeed functional as evidenced by the complex cytoplasmic and nuclear Ca2 + and kinases signaling cascade induced by activation of the V iaR. From these basic science insights, we have moved forward to address the functional consequence of vasopressin receptor activation. Results of the signaling study coupled with the immune function of astrocytes has led me to explore the impact of vasopressin receptors on immune function of astrocytes, specifically modulation o f inflammatory cytokines in astrocytes. Results of these studies revealed that activation of the V ia R leads to suppression of inflammatory cytokines in astrocytes, indicating a novel role of vasopressin in the CNS as an immunomodulatory molecule and propose vasopressin as an anti-inflammatory agent that could be used in clinical intervention against neurodegenerative and neuroinflammatory diseases. Thus, by following a basic science path of determining receptor presence and receptor-associated 135 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. signaling cascades, I was led to investigate CREB-regulated astrocyte genes that we I now discovered are part of the immune function of astrocytes. One of the novel findings of this study is the dynamic nuclear Ca2 + signaling upon vasopressin receptor activation. Nuclear Ca2 + is still a relatively new field but indications of distinct roles of nuclear Ca2 + are emerging. Because of its presence in 9+ the organelle involved in gene transcription, nuclear Ca could be involved m phosphorylation of nuclear kinases, activation and/or suppression of transcription factors and cofactors, assembly of transcription complex, and even chromosome assembly, histone acetylation and DNA methylation. O f interest in our study is the corresponding activation of nuclear kinases such as MAPK and CaM kinases and transcription factor CREB, which has led us to pursue the cytokine gene regulation by vasopressin receptors. A complete understanding of the immunomodulatory function of vasopressin, however, requires further studies of interaction among vasopressin receptor- regulated cytokines. Cytokines exist in a complex network where they interact with each other, either antagonistically or synergistically. In the current study, two cytokines, IL-1(3 and TNF-a, were given particular attention because of their potent inflammatory properties. However, to fully understand the biological function of vasopressin, a complete picture of the expression profile o f all the cytokines is a necessity. Gene array data from our studies indicate that five cytokines were suppressed by vasopressin receptor activation; RT-PCR confirmation of the other 136 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. three cytokines will be needed for the future studies. Furthermore, ELISA and/or cytokine protein array will have to be conducted on the other cytokines to determine whether the peptide levels are modulated correspondingly. The challenge of these studies will be to find arrays that are specific to rats; otherwise at least some cytokines will not be detected. One established immune function of vasopressin is its suppression of fever response upon microorganism invasion. Because inflammatory cytokines especially IL-ip and TNF-a have been indicated to be involved in fever responses, this study provides the essential link between vasopressin and its antipyretic effect by demonstrating that vasopressin receptor activation leads to suppression of the cytokines that cause fever. As indicated above, one intriguing possibility is that vasopressin may be of benefit in patients suffering from neurodegenerative and neuroinflammatory diseases, such as Alzheimer’s disease and multiple sclerosis. The well-documented role of vasopressin in cognitive functions makes this hypothesis even more worth pursuing. Indeed, investigations of the role of vasopressin in neurodegenerative dementia are onging. A number of studies have documented stable or higher vasopressin-immunoreactive cells or vasopressin binding sites in humans with cognitive deficits. Swaab and colleagues have reported stable vasopressin innervation in the degenerating human locus coeruleus and constant number of vasopressin-immunoreactive cells in the paraventricular, supraoptic and pontine 137 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. parabrachial nuclei during aging or in Alzheimer’s disease (van Zwieten et al., 1994; Van der Woude et al., 1995; van Zwieten et al., 1996). They also provided indirect evidence for an activation of paraventricular and supraoptic nuclei, consisting 90- 95% vasopressin neurons (Lucassen et al., 1994), and an increase in vasopressin binding sites in the human choroids plexus in Alzheimer’s disease patients (Korting et al., 1996). The findings of Swaab and coworkers were confirmed by Labudova et al. who reported increased brain vasopressin levels in Down syndrome and Alzheimer’s disease patients (Labudova et al., 1998). The increased vasopressin in patients suffering neurodegenerative diseases might suggest an adaptive response of our body to neuronal damage seen in these diseases, possibly due to increased inflammatory cytokines which stimulate vasopressin release, rather than an involvement of vasopressin in pathomechanisms of the diseases (Labudova et al., 1998). To experimentally determine the exact role of vasopressin in neurodegenerative diseases, in vivo studies are required. Intracerebral injection of vasopressin and/or vasopressin antagonists into animal models of Alzheimer’s disease or multiple sclerosis will help us elucidate the involvement of vasopressin in neurodegenerative and neuroinflammatory diseases. 138 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. BIBLIOGRAPHY Abe K, Saito H (2000) The p44/42 mitogen-activated protein kinase cascade is involved in the induction and maintenance of astrocyte stellation mediated by protein kinase C. Neurosci Res 36:251-257. Aisenbrey GA, Handelman WA, Arnold P, Manning M, Schrier RW (1981) Vascular effects of arginine vasopressin during fluid deprivation in the rat. J Clin Invest 67:961-968. Albers HE, Pollock J, Simmons WH, Ferris CF (1986) A Vl-like receptor mediates vasopressin-induced flank marking behavior in hamster hypothalamus. J Neurosci 6:2085-2089. Alescio-Lautier B, Rao H, Paban V, Devigne C, Soumireu-Mourat B (1995) Inhibition of the vasopressin-enhancing effect on memory retrieval and relearning by a vasopressin V 1 receptor antagonist in mice. Eur J Pharmacol 294:763-770. Aloisi F, Care A, Borsellino G, Gallo P, Rosa S, Bassani A, Cabibbo A, Testa U, Levi G, Peschle C (1992) Production of hemolymphopoietic cytokines (IL-6, IL-8, colony- stimulating factors) by normal human astrocytes in response to IL-1 beta and tumor necrosis factor-alpha. J Immunol 149:2358-2366. Altemus M, Roca C, Galliven E, Romanos C, Deuster P (2001) Increased vasopressin and adrenocorticotropin responses to stress in the midluteal phase of the menstrual cycle. J Clin Endocrinol Metab 86:2525-2530. Andersen K, Launer LJ, Ott A, Hoes AW, Breteler MM, Hofman A (1995) Do nonsteroidal anti-inflammatory drugs decrease the risk for Alzheimer's disease? The Rotterdam Study. Neurology 45:1441-1445. Andrews CE, Jr., Brenner BM (1981) Relative contributions of arginine vasopressin and angiotensin II to maintenance of systemic arterial pressure in the anesthetized water- deprived rat. Circ Res 48:254-258. Audigier S, Barberis C (1985) Pharmacological characterization of two specific binding sites for neurohypophyseal hormones in hippocampal synaptic plasma membranes o f the rat. EMBO J 4:1407-1412. Bachs O, Agell N, Carafoli E (1994) Calmodulin and calmodulin-binding proteins in the nucleus. Cell Calcium 16:289-296. 139 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Baranzini SE, Elfstrom C, Chang SY, Butunoi C, Murray R, Higuchi R, Oksenberg JR (2000) Transcriptional analysis of multiple sclerosis brain lesions reveals a complex pattern of cytokine expression. J Immunol 165:6576-6582. Barone FC, Arvin B, White RF, Miller A, Webb CL, Willette RN, Lysko PG, Feuerstein GZ (1997) Tumor necrosis factor-alpha. A mediator of focal ischemic brain injury. Stroke 28:1233-1244. Benveniste EN (1998) Cytokine actions in the central nervous system. Cytokine Growth Factor Rev 9:259-275. Berridge MJ (1993) Inositol trisphosphate and calcium signalling. Nature 361:315- 325. Bezzi P, Domercq M, Vesce S, Volterra A (2001) Neuron-astrocyte cross-talk during synaptic transmission: physiological and neuropathological implications. Prog Brain Res 132:255-265. Black RA, Rauch CT, Kozlosky CJ, Peschon JJ, Slack JL, Wolfson MF, Castner BJ, Stocking KL, Reddy P, Srinivasan S, Nelson N, Boiani N, Schooley KA, Gerhart M, Davis R, Fitzner JN, Johnson RS, Paxton RJ, March CJ, Cerretti DP (1997) A metalloproteinase disintegrin that releases tumour-necrosis factor- alpha from cells. Nature 385:729-733. Boer GJ (1985) Vasopressin and brain development: studies using the Brattleboro rat. Peptides 6:49-62. Boer GJ, Van Rheenen-Verberg CM, Uylings HB (1982) Impaired brain development o f the diabetes insipidus Brattleboro rat. Brain Res 255:557- 575. Boglari G, Erhardt P, Cooper GM, Szeberenyi J (1998) Intact Ras function is required for sustained activation and nuclear translocation of extracellular signal-regulated kinases in nerve growth factor-stimulated PC 12 cells. Eur J Cell Biol 75:54-58. Bohus B, Kovacs GL, de Wied D (1978a) Oxytocin, vasopressin and memory: opposite effects on consolidation and retrieval processes. Brain Res 157:414- 417. Bohus B, Urban I, van Wimersma G, de Wied D (1978b) Opposite effects of oxytocin and vasopressin on avoidance behaviour and hippocampal theta rhythm in the rat. Neuropharmacology 17:239-247. 140 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Boka G, Anglade P, Wallach D, Javoy-Agid F, Agid Y, Hirsch EC (1994) Immunocytochemical analysis of tumor necrosis factor and its receptors in Parkinson's disease. Neurosci Lett 172:151-154. Breitner JC (1996) The role of anti-inflammatory drugs in the prevention and treatment of Alzheimer's disease. Annu Rev Med 47:401-411. Brinton RD (1998) Vasopressin in the mammalian brain: The neurobiology of a mnemonic peptide. In: Progress in Brain Research (Urban IJA, Burbach JP, de Wied D, eds), pp 177-199. Dublin, Ireland: Elsevier Science B.V. Brinton RD, Gonzalez TM, Cheung WS (1994) Vasopressin-induced calcium signaling in cultured hippocampal neurons. Brain Res 667:151-159. Brinton RD, Yamazaki R, Gonzalez CM, O'Neill K, Schreiber SS (1998) Vasopressin-induction of the immediate early gene, NGFI-A, in cultured hippocampal glial cells. Brain Res Mol Brain Res 57:73-85. Brinton RE, Gee KW, Wamsley JK, Davis TP, Yamamura HI (1984) Regional distribution of putative vasopressin receptors in rat brain and pituitary by quantitative autoradiography. Proc Natl Acad Sci U S A 81:7248-7252. Bruce AJ, Boling W, Kindy MS, Peschon J, Kraemer PJ, Carpenter MK, Holtsberg FW, Mattson MP (1996) Altered neuronal and microglial responses to excitotoxic and ischemic brain injury in mice lacking TNF receptors. Nat Med 2:788-794. Bruce-Keller AJ, Keeling JL, Keller JN, Huang FF, Camondola S, Mattson MP (2000) Antiinflammatory effects of estrogen on microglial activation. Endocrinology 141:3646-3656. Brunet A, Roux D, Lenormand P, Dowd S, Keyse S, Pouyssegur J (1999) Nuclear translocation of p42/p44 mitogen-activated protein kinase is required for growth factor-induced gene expression and cell cycle entry. EMBO J 18:664- 674. Buchner K (2000) The role of protein kinase C in the regulation of cell growth and in signalling to the cell nucleus. J Cancer Res Clin Oncol 126:1-11. Buchner K, Otto H, Hilbert R, Lindschau C, Haller H, Hucho F (1992) Properties of protein kinase C associated with nuclear membranes. Biochem J 286:369- 375. 141 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Buijs RM (1978) Intra- and extrahypothalamic vasopressin and oxytocin pathways in the rat. Pathways to the limbic system, medulla oblongata and spinal cord. Cell Tissue Res 192:423-435. Buijs RM (1987) Vasopressin localization and putative function in the brain. In: Vasopressin: Principles and Properties (Gash DM, Boer GJ, eds), pp 91-115. New York: Plenum Press. Buijs RM, Van Heerikhuize JJ (1982) Vasopressin and oxytocin release in the brain- -a synaptic event. Brain Res 252:71-76. Buttini M, Sauter A, Boddeke HW (1994) Induction of interleukin-1 beta mRNA after focal cerebral ischaemia in the rat. Brain Res Mol Brain Res 23:126- 134. Buttini M, Appel K, Sauter A, Gebicke-Haerter PJ, Boddeke HW (1996) Expression of tumor necrosis factor alpha after focal cerebral ischaemia in the rat. Neuroscience 71:1-16. Caffe AR, Van Leeuwen FW, Luiten PG (1987) Vasopressin cells in the medial amygdala of the rat project to the lateral septum and ventral hippocampus. J Comp Neurol 261:237-252. Cai H, Smola U, Wixler V, Eisenmann-Tappe I, Diaz-Meco MT, Moscat J, Rapp U, Cooper GM (1997) Role of diacylglycerol-regulated protein kinase C isotypes in growth factor activation of the Raf-1 protein kinase. Mol Cell Biol 17:732-741. Carrieri PB, Maiorino A, Provitera V, Soscia E, Perrella O (1992) Cytokines in the pathogenesis of multiple sclerosis. Acta Neurol (Napoli) 14:333-341. Cau P, Rougon-Rapuzzi G (1979) Autoimmune alterations in the neurohypophysis of rabbits immunized against vasopressin. Brain Res 177:265-271. Chang L, Karin M (2001) Mammalian MAP kinase signalling cascades. Nature 410:37-40. Chao CC, Hu S, Ehrlich L, Peterson PK (1995) Interleukin-1 and tumor necrosis factor-alpha synergistically mediate neurotoxicity: involvement of nitric oxide and of N-methyl-D-aspartate receptors. Brain Behav Immun 9:355- 365. 142 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Chawla S, Hardingham GE, Quinn DR, Bading H (1998) CBP: a signal-regulated transcriptional coactivator controlled by nuclear calcium and CaM kinase IV. Science 281:1505-1509. Chen C, Brinton RD, Shors TJ, Thompson RF (1993) Vasopressin induction o f long- lasting potentiation of synaptic transmission in the dentate gyrus. Hippocampus 3:193-203. Chen HJ, Rojas-Soto M, Oguni A, Kennedy MB (1998) A synaptic Ras-GTPase activating protein (p i35 SynGAP) inhibited by CaM kinase II. Neuron 20:895-904. Chen Q, Schreiber SS, Brinton RD (2000a) Vasopressin and oxytocin receptor mRNA expression during rat telencephalon development. Neuropeptides 34:173-180. Chen Q, Patel R, Sales A, Oji G, Kim J, Monreal AW, Brinton RD (2000b) Vasopressin-induced neurotrophism in cultured neurons of the cerebral cortex: dependency on calcium signaling and protein kinase C activity. Neuroscience 101:19-26. Chen RH, Samecki C, Blenis J (1992) Nuclear localization and regulation of erk- and rsk-encoded protein kinases. Mol Cell Biol 12:915-927. Cheng B, Christakos S, Mattson MP (1994) Tumor necrosis factors protect neurons against metabolic-excitotoxic insults and promote maintenance of calcium homeostasis. Neuron 12:139-153. Cho S, Kim Y, Cruz MO, Park EM, Chu CK, Song GY, Joh TH (2001) Repression of proinflammatory cytokine and inducible nitric oxide synthase (NOS2) gene expression in activated microglia by N-acetyl-O- methyldopamine: protein kinase A-dependent mechanism. Glia 33:324-333. Ciriello J, Calaresu FR (1980) Role of paraventricular and supraoptic nuclei in central cardiovascular regulation in the cat. Am J Physiol 239:R137-142. Cogswell JP, Godlevski MM, Wisely GB, Clay WC, Leesnitzer LM, Ways JP, Gray JG (1994) NF-kappa B regulates IL-1 beta transcription through a consensus NF-kappa B binding site and a nonconsensus CRE-like site. J Immunol 153:712-723. Colbran RJ (1992) Regulation and role of brain calcium/calmodulin-dependent protein kinase II. Neurochem Int 21:469-497. 143 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Colley PA, Routtenberg A (1993) Long-term potentiation as synaptic dialogue. Brain Res Brain Res Rev 18:115-122. Connor TJ, Leonard BE (1998) Depression, stress and immunological activation: the role of cytokines in depressive disorders. Life Sci 62:583-606. Cooper KE, Kasting NW, Lederis K, Veale WL (1979a) Evidence supporting a role for endogenous vasopressin in natural suppression of fever in the sheep. J Physiol 295:33-45. Cooper KE, Veale WL, Kasting N, Pittman QJ (1979b) Ontogeny of fever. Fed Proc 38:35-38. Cowley AW, Jr., Switzer SJ, Guinn MM (1980) Evidence and quantification of the vasopressin arterial pressure control system in the dog. Circ Res 46:58-67. Croiset G, Heijnen CJ, de Wied D (1990) Passive avoidance behavior, vasopressin and the immune system. A link between avoidance latency and immune response. Neuroendocrinology 51:156-161. Croonenberghs J, Bosnians E, Deboutte D, Kenis G, Maes M (2002) Activation of the inflammatory response system in autism. Neuropsychobiology 45:1-6. Cruzalegui FH, Bading H (2000) Calcium-regulated protein kinase cascades and their transcription factor targets. Cell Mol Life Sci 57:402-410. Dantzer R, Bluthe RM (1992) Vasopressin involvement in antipyresis, social communication, and social recognition: a synthesis. Crit Rev Neurobiol 6:243-255. De Luca A, Giuditta A (1997) Role of a transcription factor (CREB) in memory processes. Riv Biol 90:371-384. de Wied D (1971) Long term effect of vasopressin on the maintenance o f a conditioned avoidance response in rats. Nature 232:58-60. de Wied D, Diamant M, Fodor M (1993) Central nervous system effects of the neurohypophyseal hormones and related peptides. Front Neuroendocrinol 14:251-302. de Wied D, van Wimersma G, Bohus B, Urban I, Gispen WH (1976) Vasopressin and memory consolidation. Prog Brain Res 45:181-194. 144 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Delgado M, Munoz-Elias EJ, Kan Y, Gozes I, Fridkin M, Brenneman DE, Gomariz RP, Ganea D (1998) Vasoactive intestinal peptide and pituitary adenylate cyclase- activating polypeptide inhibit tumor necrosis factor alpha transcriptional activation by regulating nuclear factor-kB and cAMP response element-binding protein/c-Jun. J Biol Chem 273:31427-31436. DeVries GJ, Buijs RM, Van Leeuwen FW, Caffe AR, Swaab DF (1985) The vasopressinergic innervation of the brain in normal and castrated rats. J Comp Neurol 233:236-254. Diamant M, De Wied D (1993) Simultaneous occurrence o f barrel rotation and hypothermia in rats following central injection of AVP. Ann N Y Acad Sci 689:582-588. Dibas AI, Rezazadeh SM, Vassan R, Mia AJ, Yorio T (1997) Mechanism of vasopressin-induced increase in intracellular Ca2 + in LLC-PK1 porcine kidney cells. Am J Physiol 272:C810-C817. Dinarello CA (1994) The interleukin-1 family: 10 years of discovery. FASEB J 8:1314-1325. Divecha N, Banfic H, Irvine RF (1991) The polyphosphoinositide cycle exists in the nuclei of Swiss 3T3 cells under the control of a receptor (for IGF-I) in the plasma membrane, and stimulation of the cycle increases nuclear diacylglycerol and apparently induces translocation of protein kinase C to the nucleus. EMBO J 10:3207-3214. Dong Y (2001) Immune function of astrocytes. Glia 36:180-190. Dorsa DM, Majumdar LA, Petracca FM, Baskin DG, Cornett LE (1983) Characterization and localization of 3H-arginine8-vasopressin binding to rat kidney and brain tissue. Peptides 4:699-706. Drago F, Stanciu M, Salehi S, Scapagnini U (1997) The block of central vasopressin VI but not V2 receptors suppresses grooming behavior and hypothermia induced by intracerebroventricular vasopressin in male rats. Peptides 18:1389-1392. Ebner K, Wotjak CT, Holsboer F, Landgraf R, Engelmann M (1999) Vasopressin released within the septal brain area during swim stress modulates the behavioural stress response in rats. Eur J Neurosci 11:997-1002. Everts HG, De Ruiter AJ, Koolhaas JM (1997) Differential lateral septal vasopressin in wild-type rats: correlation with aggression. Horm Behav 31:136-144. 145 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Fasolato C, Innocenti B, Pozzan T (1994) Receptor-activated Ca2 + influx: how many mechanisms for how many channels? Trends Pharmacol Sci 15:77-83. Federico P, Veale WL, Pittman QJ (1992) Vasopressin-induced antipyresis in the medial amygdaloid nucleus of conscious rats. Am J Physiol 262:R901-908. Fern R (1998) Intracellular calcium and cell death during ischemia in neonatal rat white matter astrocytes in situ. J Neurosci 18:7232-7243. Ferris CF, Potegal M (1988) Vasopressin receptor blockade in the anterior hypothalamus suppresses aggression in hamsters. Physiol Behav 44:235-239. Ferris CF, Albers HE, Wesolowski SM, Goldman BD, Luman SE (1984) Vasopressin injected into the hypothalamus triggers a stereotypic behavior in golden hamsters. Science 224:521-523. Fishman JB, Dickey BF, Fine RE (1987) Purification and characterization of the rat liver vasopressin (VI) receptor. J Biol Chem 262:14049-14055. Fukuda M (1996) Cytoplasmic localization of mitogen-activated protein kinase kinase directed by its NH2-terminal, leucine-rich short amino acid sequence, which acts as a nuclear export signal. J Biol Chem 271:20024-20028. Ganguli R, Yang Z, Shurin G, Chengappa KN, Brar JS, Gubbi AV, Rabin BS (1994) Serum interleukin-6 concentration in schizophrenia: elevation associated with duration of illness. Psychiatry Res 51:1-10. Giri PR, Dave JR, Tabakoff B, Hoffman PL (1990) Arginine vasopressin induces the expression of c-fos in the mouse septum and hippocampus. Brain Res Mol Brain Res 7:131-137. Gray JG, Chandra G, Clay WC, Stinnett SW, Haneline SA, Lorenz JJ, Patel IR, Wisely GB, Furdon PJ, Taylor JD, et al. (1993) A CRE/ATF-like site in the upstream regulatory sequence of the human interleukin 1 beta gene is necessary for induction in U937 and THP-1 monocytic cell lines. Mol Cell Biol 13:6678-6689. Griffin WS, Mrak RE (2002) Interleukin-1 in the genesis and progression of and risk for development of neuronal degeneration in Alzheimer's disease. J Leukoc Biol 72:233-238. 146 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Griffin WS, Stanley LC, Ling C, White L, MacLeod V, Perrot LJ, White CL, 3rd, Araoz C (1989) Brain interleukin 1 and S-100 immunoreactivity are elevated in Down syndrome and Alzheimer disease. Proc Natl Acad Sci U S A 86:7611-7615. Guzowski JF, McGaugh JL (1997) Antisense oligodeoxynucleotide-mediated disruption of hippocampal cAMP response element binding protein levels impairs consolidation of memory for water maze training. Proc Natl Acad Sci U S A 94:2693-2698. Hardingham GE, Bading H (1999) Calcium as a versatile second messenger in the control of gene expression. Microsc Res Tech 46:348-355. Hardingham GE, Chawla S, Johnson CM, Bading H (1997) Distinct functions of nuclear and cytoplasmic calcium in the control of gene expression. Nature 385:260-265. Hayashi M, Sasaki S, Tsuganezawa H, Monkawa T, Kitajima W, Konishi K, Fushimi K, Marumo F, Saruta T (1994) Expression and distribution of aquaporin of collecting duct are regulated by vasopressin V2 receptor in rat kidney. J Clin Invest 94:1778-1783. Hescheler J, Schultz G (1993) G-proteins involved in the calcium channel signalling system. Curr Opin Neurobiol 3:360-367. Hu S, Peterson PK, Chao CC (1997) Cytokine-mediated neuronal apoptosis. Neurochem Int 30:427-431. Irwin M (1994) Stress-induced immune suppression: role of brain corticotropin releasing hormone and autonomic nervous system mechanisms. Adv Neuroimmunol 4:29-47. Jard S (1998) Vasopressin receptors. A historical survey. Adv Exp Med Biol 449:1- 13. Jezova D, Skultetyova I, Tokarev DI, Bakos P, Vigas M (1995) Vasopressin and oxytocin in stress. Ann N Y Acad Sci 771:192-203. Joels M, Urban IJ (1982) The effect of microiontophoretically applied vasopressin and oxytocin on single neurones in the septum and dorsal hippocampus of the rat. Neurosci Lett 33:79-84. Kasting NW, Veale WL, Cooper KE (1982) Vasopressin: a homeostatic effector in the febrile process. Neurosci Biobehav Rev 6:215-222. 147 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Knepper MA (1997) Molecular physiology of urinary concentrating mechanism: regulation of aquaporin water channels by vasopressin. Am J Physiol 272:F3- 12. Konradi C, Heckers S (1995) Haloperidol-induced Fos expression in striatum is dependent upon transcription factor cyclic AMP response element binding protein. Neuroscience 65:1051-1061. Konradi C, Cole RL, Heckers S, Hyman SE (1994) Amphetamine regulates gene expression in rat striatum via transcription factor CREB. J Neurosci 14:5623- 5634. Komhauser JM, Cowan CW, Shaywitz AJ, Dolmetsch RE, Griffith EC, Hu LS, Haddad C, Xia Z, Greenberg ME (2002) CREB Transcriptional Activity in Neurons Is Regulated by Multiple, Calcium-Specific Phosphorylation Events. Neuron 34:221-233. Korting C, van Zwieten EJ, Boer GJ, Ravid R, Swaab DF (1996) Increase in vasopressin binding sites in the human choroid plexus in Alzheimer's disease. Brain Res 706:151-154. Krakoff LR, Elijovich F, Barry C (1985) The role of vasopressin in experimental and clinical hypertension. Am J Kidney Dis 5:A40-47. Labudova O, Fang-Kircher S, Caims N, Moenkemann H, Yeghiazaryan K, Lubec G (1998) Brain vasopressin levels in Down syndrome and Alzheimer's disease. Brain Res 806:55-59. Laming PR (1989) Do glia contribute to behaviour? A neuromodulatory review. Comp Biochem Physiol A 94:555-568. Lamprecht R, Hazvi S, Dudai Y (1997) cAMP response element-binding protein in the amygdala is required for long- but not short-term conditioned taste aversion memory. J Neurosci 17:8443-8450. Lawrence D, Pittman QJ (1985) Response of rat paraventricular neurones with central projections to suckling, haemorrhage or osmotic stimuli. Brain Res 341:176-183. Leach KL, Ruff VA, Jarpe MB, Adams LD, Fabbro D, Raben DM (1992) Alpha- thrombin stimulates nuclear diglyceride levels and differential nuclear localization of protein kinase C isozymes in IIC9 cells. J Biol Chem 267:21816-21822. 148 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Lee CH, Yun HJ, Kang HS, Kim HD (1999) ERK/MAPK pathway is required for changes o f cyclin D1 and B1 during phorbol 12-myristate 13-acetate-induced differentiation of K562 cells. Iubmb Life 48:585-591. Lenormand P, Brondello JM, Brunet A, Pouyssegur J (1998) Growth factor-induced p42/p44 MAPK nuclear translocation and retention requires both MAPK activation and neosynthesis of nuclear anchoring proteins. J Cell Biol 142:625-633. Liu B, Whisler RL (1998) Transcriptional activation and redox regulation of the tumor necrosis factor-alpha promoter in human T cells: role of the CRE/kappa3 promoter region. J Interferon Cytokine Res 18:999-1007. Liu T, Clark RK, McDonnell PC, Young PR, White RF, Barone FC, Feuerstein GZ (1994) Tumor necrosis factor-alpha expression in ischemic neurons. Stroke 25:1481-1488. Loddick SA, Rothwell NJ (1996) Neuroprotective effects of human recombinant interleukin-1 receptor antagonist in focal cerebral ischaemia in the rat. J Cereb Blood Flow Metab 16:932-940. Lucas RL, Salm AK (1995) Astroglia proliferate in response to oxytocin and vasopressin. Brain Res 681:218-222. Lucassen PJ, Salehi A, Pool CW, Gonatas NK, Swaab DF (1994) Activation of vasopressin neurons in aging and Alzheimer's disease. J Neuroendocrinol 6:673-679. Luheshi GN (1998) Cytokines and fever. Mechanisms and sites of action. Ann N Y Acad Sci 856:83-89. Luheshi GN, Stefferl A, Turnbull AV, Dascombe MJ, Brouwer S, Hopkins SJ, Rothwell NJ (1997) Febrile response to tissue inflammation involves both peripheral and brain IL-1 and TNF-alpha in the rat. Am J Physiol 272:R862- 868. Makhinson M, Chotiner JK, Watson JB, O'Dell TJ (1999) Adenylyl cyclase activation modulates activity-dependent changes in synaptic strength and Ca2 + /calmodulin-dependent kinase II autophosphorylation. J Neurosci 19:2500-2510. Marples D, Knepper MA, Christensen El, Nielsen S (1995) Redistribution of aquaporin-2 water channels induced by vasopressin in rat kidney inner medullary collecting duct. Am J Physiol 269:C655-664. 149 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Martin KC, Michael D, Rose JC, Barad M, Casadio A, Zhu H, Kandel ER (1997) MAP kinase translocates into the nucleus of the presynaptic cell and is required for long-term facilitation in Aplysia. Neuron 18:899-912. Martino G, Grohovaz F, Brambilla E, Codazzi F, Consiglio A, Clementi E, Filippi M, Comi G, Grimaldi LM (1998) Proinflammatory cytokines regulate antigen-independent T-cell activation by two separate calcium-signaling pathways in multiple sclerosis patients. Ann Neurol 43:340-349. Matter N, Ritz MF, Freyermuth S, Rogue P, Malviya AN (1993) Stimulation of nuclear protein kinase C leads to phosphorylation of nuclear inositol 1,4,5- trisphosphate receptor and accelerated calcium release by inositol 1,4,5- trisphosphate from isolated rat liver nuclei. J Biol Chem 268:732-736. Mayne M, Ni W, Yan HJ, Xue M, Johnston JB, Del Bigio MR, Peeling J, Power C (2001) Antisense oligodeoxynucleotide inhibition of tumor necrosis factor- alpha expression is neuroprotective after intracerebral hemorrhage. Stroke 32:240-248. McCann SM, Ono N, Khorram O, Kentroti S, Aguila C (1987) The role of brain peptides in neuroimmunomodulation. Ann N Y Acad Sci 496:173-181. McGeer PL, McGeer EG (1995) The inflammatory response system of brain: implications for therapy of Alzheimer and other neurodegenerative diseases. Brain Res Brain Res Rev 21:195-218. Mehlhom G, Hollbom M, Schliebs R (2000) Induction of cytokines in glial cells surrounding cortical beta-amyloid plaques in transgenic Tg2576 mice with Alzheimer pathology. Int J Dev Neurosci 18:423-431. Meisenberg G, Simmons WH (1984) Hypothermia induced by centrally administered vasopressin in rats. A structure-activity study. Neuropharmacology 23:1195- 1200. Melis MR, Stancampiano R, Argiolas A (1993) Oxytocin- and vasopressin-like immunoreactivity in the rat thymus: characterization and possible involvement in the immune response. Regul Pept 45:269-272. Merrill JE, Benveniste EN (1996) Cytokines in inflammatory brain lesions: helpful and harmful. Trends Neurosci 19:331-338. Messing RB, Sparber SB (1985) Greater task difficulty amplifies the facilitatory effect of des-glycinamide arginine vasopressin on appetitively motivated learning. Behav Neurosci 99:1114-1119. 150 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Meyer T, Hanson PI, Stryer L, Schulman H (1992) Calmodulin trapping by calcium- calmodulin-dependent protein kinase. Science 256:1199-1202. Miller SG, Kennedy MB (1986) Regulation of brain type II Ca2 + /calmodulin- dependent protein kinase by autophosphorylation: a Ca2+ -triggered molecular switch. Cell 44:861-870. Miller SG, Patton BL, Kennedy MB (1988) Sequences of autophosphorylation sites in neuronal type II CaM kinase that control Ca2+ -independent activity. Neuron 1:593-604. Mogi M, Harada M, Riederer P, Narabayashi H, Fujita K, Nagatsu T (1994) Tumor necrosis factor-alpha (TNF-alpha) increases both in the brain and in the cerebrospinal fluid from parkinsonian patients. Neurosci Lett 165:208-210. Moss ML, Jin SL, Milla ME, Bickett DM, Burkhart W, Carter HL, Chen WJ, Clay WC, Didsbury JR, Hassler D, Hoffman CR, Kost TA, Lambert MH, Leesnitzer MA, McCauley P, McGeehan G, Mitchell J, Moyer M, Pahel G, Rocque W, Overton LK, Schoenen F, Seaton T, Su JL, Becherer JD, et al. (1997) Cloning of a disintegrin metalloproteinase that processes precursor tumour-necrosis factor-alpha. Nature 385:733-736. Muhlethaler M, Dreifuss JJ, Gahwiler BH (1982) Vasopressin excites hippocampal neurones. Nature 296:749-751. Muller N, Ackenheil M (1998) Psychoneuroimmunology and the cytokine action in the CNS: implications for psychiatric disorders. Prog Neuropsychopharmacol Biol Psychiatry 22:1-33. Murphy DD, Segal M (1997) Morphological plasticity of dendritic spines in central neurons is mediated by activation of cAMP response element binding protein. Proc Natl Acad Sci U S A 94:1482-1487. Muthalif MM, Benter IF, Karzoun N, Fatima S, Harper J, Uddin MR, Malik KU (1998) 20-Hydroxyeicosatetraenoic acid mediates calcium/calmodulin- dependent protein kinase Il-induced mitogen-activated protein kinase activation in vascular smooth muscle cells. Proc Natl Acad Sci U S A 95:12701-12706. Nagatsu T, Mogi M, Ichinose H, Togari A (2000) Changes in cytokines and neurotrophins in Parkinson's disease. J Neural Transm Suppl 60:277-290. Naim AC, Hemmings HC, Jr, Greengard P (1985) Protein kinases in the brain. Annu Rev Biochem 54:931-976. 151 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Nambi P, Watt R, Whitman M, Aiyar N, Moore JP, Evan GI, Crooke S (1989) Induction of c-fos protein by activation of vasopressin receptors in smooth muscle cells. FEBS Lett 245:61-64. Nawashiro H, Martin D, Hallenbeck JM (1997) Inhibition of tumor necrosis factor and amelioration of brain infarction in mice. J Cereb Blood Flow Metab 17:229-232. Naylor AM, Ruwe WD, Veale WL (1986) Thermoregulatory actions of centrally- administered vasopressin in the rat. Neuropharmacology 25:787-794. Naylor AM, Pittman QJ, Veale WL (1988) Stimulation of vasopressin release in the ventral septum of the rat brain suppresses prostaglandin El fever. J Physiol 399:177-189. Newell CL, Deisseroth AB, Lopez-Berestein G (1994) Interaction of nuclear proteins with an AP-l/CRE-like promoter sequence in the human TNF-alpha gene. J Leukoc Biol 56:27-35. Nielsen S, Muller J, Knepper MA (1993) Vasopressin- and cAMP-induced changes in ultrastructure of isolated perfused inner medullary collecting ducts. Am J Physiol 265:F225-238. Nikcevich KM, Gordon KB, Tan L, Hurst SD, Rroepfl JF, Gardinier M, Barrett TA, Miller SD (1997) IFN-gamma-activated primary murine astrocytes express B7 costimulatory molecules and prime naive antigen-specific T cells. J Immunol 158:614-621. Novak-Hofer I, Levitan IB (1983) Ca++/calmodulin-regulated protein phosphorylation in the Aplysia nervous system. J Neurosci 3:473-481. O'Connor ER, Kimelberg HK (1993) Role of calcium in astrocyte volume regulation and in the release of ions and amino acids. J Neurosci 13:2638-2650. Ohta Y, Ohba T, Miyamoto E (1990) Ca2 + /calmodulin-dependent protein kinase II: localization in the interphase nucleus and the mitotic apparatus of mammalian cells. Proc Natl Acad Sci U S A 87:5341-5345. Ostrowski NL, Lolait SJ, Young WS (1994) Cellular localization of vasopressin V ia receptor messenger ribonucleic acid in adult male rat brain, pineal, and brain vasculature. Endocrinology 135:1511-1528. 152 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Ostrowski NL, Young WS, Knepper MA, Lolait SJ (1993) Expression of vasopressin V ia and V2 receptor messenger ribonucleic acid in the liver and kidney of embryonic, developing, and adult rats. Endocrinology 133:1849-1859. Ostrowski NL, Lolait SJ, Bradley DJ, O'Carroll AM, Brownstein MJ, Young WS (1992) Distribution of V ia and V2 vasopressin receptor messenger ribonucleic acids in rat liver, kidney, pituitary and brain. Endocrinology 131:533-535. Perez RL, Ritzenthaler JD, Roman J (1999) Transcriptional regulation o f the interleukin-1 beta promoter via fibrinogen engagement of the CD 18 integrin receptor. Am J Respir Cell Mol Biol 20:1059-1066. Peter JB, Boctor FN, Tourtellotte WW (1991) Serum and CSF levels of IL-2, sIL- 2R, TNF-alpha, and IL-1 beta in chronic progressive multiple sclerosis: expected lack of clinical utility. Neurology 41:121-123. Pittman QJ, Franklin LG (1985) Vasopressin antagonist in nucleus tractus solitarius/vagal area reduces pressor and tachycardia responses to paraventricular nucleus stimulation in rats. Neurosci Lett 56:155-160. Pittman QJ, Bagdan B (1992) Vasopressin involvement in central control of blood pressure. Prog Brain Res 91:69-74. Pittman QJ, Wilkinson MF (1992) Central arginine vasopressin and endogenous antipyresis. Can J Physiol Pharmacol 70:786-790. Pittman QJ, Veale WL, Lederis K (1982) Central neurohypophyseal peptide pathways: interactions with endocrine and other autonomic functions. Peptides 3:515-520. Pittman QJ, Riphagen CL, Lederis K (1984) Release of immunoassayable neurohypophyseal peptides from rat spinal cord, in vivo. Brain Res 300:321- 326. Pittman QJ, Riphagen CL, Martin SM (1987) Arginine vasopressin: new roles for an old peptide. In: Organization of the Autonomic Nervous System: Central and Peripheral Mechanisms (Ciriello J, Calaresu FR, Renaud LP, Polosa C, eds), pp 327-336. New York: Alan R. Liss. Pittman QJ, Chen X, Mouihate A, Hirasawa M, Martin S (1998) Arginine vasopressin, fever and temperature regulation. Prog Brain Res 119:383-392. 153 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Plevin R, Stewart A, Paul A, Wakelam MJ (1992) Vasopressin-stimulated [3H]- inositol phosphate and [3H]-phosphatidylbutanol accumulation in A10 vascular smooth muscle cells. Br J Pharmacol 107:109-115. Pommier Y, Kerrigan D, Hartman KD, Glazer RI (1990) Phosphorylation of mammalian DNA topoisomerase I and activation by protein kinase C. J Biol Chem 265:9418-9422. Popik P, Wolterink G, De Brabander H, van Ree JM (1991) Neuropeptides related to [Arg8]vasopressin facilitates social recognition in rats. Physiol Behav 49:1031-1035. Prat A, Biemacki K, Wosik K, Antel JP (2001) Glial cell influence on the human blood-brain barrier. Glia 36:145-155. Raetz CR, Whitfield C (2002) Lipopolysaccharide endotoxins. Annu Rev Biochem 71:635-700. Robb SJ, Robb-Gaspers LD, Scaduto RC, Jr, Thomas AP, Connor JR (1999) Influence of calcium and iron on cell death and mitochondrial function in oxidatively stressed astrocytes. J Neurosci Res 55:674-686. Rottmann M, Schroder HC, Gramzow M, Renneisen K, Kurelec B, Dorn A, Friese U, Muller WE (1987) Specific phosphorylation of proteins in pore complex- laminae from the sponge Geodia cydonium by the homologous aggregation factor and phorbol ester. Role of protein kinase C in the phosphorylation of DNA topoisomerase II. EMBO J 6:3939-3944. Sabatier N, Richard P, Dayanithi G (1997) L-, N- and T- but neither P- nor Q-type Ca2 + channels control vasopressin-induced Ca2 + influx in magnocellular vasopressin neurones isolated from the rat supraoptic nucleus. J Physiol (Lond) 503:253-268. Saigusa T (1990) Participation of interleukin-1 and tumor necrosis factor in the responses of the sympathetic nervous system during lipopolysaccharide- induced fever. Pflugers Arch 416:225-229. Saito T, Ishikawa SE, Sasaki S, Fujita N, Fushimi K, Okada K, Takeuchi K, Sakamoto A, Ookawara S, Kaneko T, Marumo F (1997) Alteration in water channel AQP-2 by removal of AVP stimulation in collecting duct cells of dehydrated rats. Am J Physiol 272:F183-191. Saper CB, Loewy AD, Swanson LW, Cowan WM (1976) Direct hypothalamo- autonomic connections. Brain Res 117:305-312. 154 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Sheng M, Thompson MA, Greenberg ME (1991) CREB: a Ca2+ -regulated transcription factor phosphorylated by calmodulin-dependent kinases. Science 252:1427-1430. Shibasaki T, Hotta M, Sugihara H, Wakabayashi I (1998) Brain vasopressin is involved in stress-induced suppression of immune function in the rat. Brain Res 808:84-92. Silva AJ, Kogan JH, Frankland PW, Kida S (1998) CREB and memory. Annu Rev Neurosci 21:127-148. Silver RB (1990) Calcium and cellular clocks orchestrate cell division. Ann N Y Acad Sci 582:207-221. Slepko N, Patrizio M, Levi G (1999) Expression and translocation of protein kinase C iso forms in rat microglial and astroglial cultures. J Neurosci Res 57:33-38. Smith RS (1992) A comprehensive macrophage-T-lymphocyte theory of schizophrenia. Med Hypotheses 39:248-257. Sofroniew MV (1985) Vasopressin- and neurophysin-immunoreactive neurons in the septal region, medial amygdala and locus coeruleus in colchicine-treated rats. Neuroscience 15:347-358. Sofroniew MV, Weindl A, Schrell U, Wetzstein R (1981) Immunohistochemistry of vasopressin, oxytocin and neurophysin in the hypothalamus and extrahypothalamic regions of the human and primate brain. Acta Histochem Suppl 24:79-95. Son M, Brinton RD (2001) Regulation and Mechanism of L-Type calcium channel activation via V ia vasopressin receptor activation in cultured cortical neurons.,. Neurobiol Learn Mem. Son MC, Brinton RD (1998) Vasopressin-induced calcium signaling in cultured cortical neurons. Brain Res 793:244-254. Sorensen PS (1986) Studies of vasopressin in the human cerebrospinal fluid. Acta Neurol Scand 74:81-102. Stadheim TA, Kucera GL (1998) Extracellular signal-regulated kinase (ERK) activity is required for TPA-mediated inhibition of drug-induced apoptosis. Biochem Biophys Res Commun 245:266-271. 155 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Sternberg EM (1997) Neural-immune interactions in health and disease. J Clin Invest 100:2641-2647. Strijbos PJ, Rothwell NJ (1995) Interleukin-1 beta attenuates excitatory amino acid- induced neurodegeneration in vitro: involvement of nerve growth factor. J Neurosci 15:3468-3474. Strubing C, Rohwedel J, Ahnert-Hilger G, Wiedenmann B, Hescheler J, Wobus AM (1997) Development of G protein-mediated Ca2 + channel regulation in mouse embryonic stem cell-derived neurons. Eur J Neurosci 9:824-832. Swanson LW (1976) The locus coeruleus: a cytoarchitectonic, Golgi and immunohistochemical study in the albino rat. Brain Res 110:39-56. Swanson LW, Kuypers HG (1980) The paraventricular nucleus of the hypothalamus: cytoarchitectonic subdivisions and organization of projections to the pituitary, dorsal vagal complex, and spinal cord as demonstrated by retrograde fluorescence double-labeling methods. J Comp Neurol 194:555- 570. Szot P, Bale TL, Dorsa DM (1994) Distribution of messenger RNA for the vasopressin V ia receptor in the CNS of male and female rats. Brain Res Mol Brain Res 24:1-10. Teyler TJ, DiScenna P (1987) Long-term potentiation. Annu Rev Neurosci 10:131- 161. Thomas D, Tovey SC, Collins TJ, Bootman MD, Berridge MJ, Lipp P (2000) A comparison of fluorescent Ca2 + indicator properties and their use in measuring elementary and global Ca2 + signals. Cell Calcium 28:213-223. Tiberiis BE, McLennan H, Wilson N (1983) Neurohypophysial peptides and the hippocampus. II. Excitation of rat hippocampal neurones by oxytocin and vasopressin applied in vitro. Neuropeptides 4:73-86. Toba K, Ohta M, Kimura T, Nagano K, Ito S, Ouchi Y (1998) Role of brain vasopressin in regulation of blood pressure. Prog Brain Res 119:337-349. Tokunou T, Ichiki T, Takeda K, Funakoshi Y, lino N, Takeshita A (2001) cAMP response element-binding protein mediates thrombin-induced proliferation of vascular smooth muscle cells. Arterioscler Thromb Vase Biol 21:1764-1769. 156 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Tolbert ME, White AC, Aspry K, Cutts J, Fain JN (1980) Stimulation by vasopressin and alpha-catecholamines of phosphatidylinositol formation in isolated rat liver parenchymal cells. J Biol Chem 255:1938-1944. Trachtenberg MC, Pollen DA (1970) Neuroglia: biophysical properties and physiologic function. Science 167:1248-1252. Ullian EM (1999) Control of synapse number by glia. Science 283:36-37. Urushihara H, Tohda M, Nomura Y (1992) Selective potentiation of N-methyl-D- aspartate-induced current by protein kinase C in Xenopus oocytes injected with rat brain RNA. J Biol Chem 267:11697-11700. Vallejo M, Carter DA, Lightman SL (1984) Haemodynamic effects of arginine- vasopressin microinjections into the nucleus tractus solitarius: a comparative study of vasopressin, a selective vasopressin receptor agonist and antagonist, and oxytocin. Neurosci Lett 52:247-252. Van der Woude PF, Goudsmit E, Wierda M, Purba JS, Hofman MA, Bogte H, Swaab DF (1995) No vasopressin cell loss in the human hypothalamus in aging and Alzheimer's disease. Neurobiol Aging 16:11-18. van Londen L, Goekoop JG, van Kempen GM, Frankhuijzen-Sierevogel AC, Wiegant VM, van der Velde EA, De Wied D (1997) Plasma levels of arginine vasopressin elevated in patients with major depression. Neuropsychopharmacology 17:284-292. van Wimersma Greidanus TB, Bohus B, de Wied D (1975) The role of vasopressin in memory processes. Prog Brain Res 42:135-141. van Wimersma TB, Dogterom J, de Wied D (1975) Intraventricular administration of anti-vasopressin serum inhibits. Life Sci 16:637-643. van Zwieten EJ, Ravid R, Swaab DF (1996) Differential vasopressin and oxytocin innervation of the human parabrachial nucleus: no changes in Alzheimer's disease. Brain Res 711:146-152. van Zwieten EJ, Ravid R, Hoogendijk WJ, Swaab DF (1994) Stable vasopressin innervation in the degenerating human locus coeruleus in Alzheimer's disease. Brain Res 649:329-333. 157 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Vegeto E, Bonincontro C, Pollio G, Sala A, Viappiani S, Nardi F, Brusadelli A, Viviani B, Ciana P, Maggi A (2001) Estrogen prevents the lipopolysaccharide-induced inflammatory response in microglia. J Neurosci 21:1809-1818. Vendrell M, Aligue R, Bachs O, Seratosa J (1991) Presence of calmodulin and calmodulin-binding proteins in the nuclei of brain cells. J Neurochem 57:622- 628. Verkhratsky A, Steinhauser C (2000) Ion channels in glial cells. Brain Res Brain Res Rev 32:380-412. Wang X, Yue TL, Barone FC, White RF, Gagnon RC, Feuerstein GZ (1994) Concomitant cortical expression of TNF-alpha and IL-1 beta mRNAs follows early response gene expression in transient focal ischemia. Mol Chem Neuropathol 23:103-114. White DM, Walker S, Brenneman DE, Gozes I (2000) CREB contributes to the increased neurite outgrowth of sensory neurons induced by vasoactive intestinal polypeptide and activity-dependent neurotrophic factor. Brain Res 868:31-38. White HS, Skeen GA, Edwards JA (1992) Pharmacological regulation of astrocytic calcium channels: implications for the treatment of seizure disorders. Prog Brain Res 94:77-87. Wilkinson MF, Horn TF, Kasting NW, Pittman QJ (1994) Central interleukin-1 beta stimulation of vasopressin release into the rat brain: activation of an antipyretic pathway. J Physiol 481:641-646. Wong GH, Bartlett PF, Clark-Lewis I, Battye F, Schrader JW (1984) Inducible expression of H-2 and la antigens on brain cells. Nature 310:688-691. Woodroofe MN, Cuzner ML (1993) Cytokine mRNA expression in inflammatory multiple sclerosis lesions: detection by non-radioactive in situ hybridization. Cytokine 5:583-588. Wu GY, Deisseroth K, Tsien RW (2001) Activity-dependent CREB phosphorylation: convergence of a fast, sensitive calmodulin kinase pathway and a slow, less sensitive mitogen- activated protein kinase pathway. Proc Natl Acad Sci U S A 98:2808-2813. 158 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Yamazaki RS, Chen Q, Schreiber SS, Brinton RD (1997) Localization of V ia vasopressin receptor mRNA expression in cultured neurons, astroglia, and oligodendroglia of rat cerebral cortex. Brain Res Mol Brain Res 45:138-140. Yan SD, Chen X, Fu J, Chen M, Zhu H, Roher A, Slattery T, Zhao L, Nagashima M, Morser J, Migheli A, Nawroth P, Stem D, Schmidt AM (1996) RAGE and amyloid-beta peptide neurotoxicity in Alzheimer's disease. Nature 382:685- 691. Yirmiya R, Shavit Y, Ben-Eliyahu S, Martin FC, Weiner H, Liebeskind JC (1989) Natural killer cell activity in vasopressin-deficient rats (Brattleboro strain). Brain Res 479:16-22. Zhao L, Brinton RD (2002) Vasopressin-induced cytoplasmic and nuclear calcium signaling in cultured cortical astrocytes. Brain Res 943:117-131. Zhao L, Brinton RD (2003) Vasopressin-induced cytoplasmic and nuclear calcium signaling in embryonic cortical astrocytes: dynamics of calcium and calcium- dependent kinases translocation. J Neurosci in press. Zhao X, Bausano B, Pike BR, Newcomb-Femandez JK, Wang KK, Shohami E, Ringger NC, DeFord SM, Anderson DK, Hayes RL (2001) TNF-alpha stimulates caspase-3 activation and apoptotic cell death in primary septo- hippocampal cultures. J Neurosci Res 64:121-131. Zheng CF (1994) Cytoplasmic localization of the mitogen-activated protein kinase activator MEK. J Biol Chem 269:19947-19952. 159 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.

Linked assets

University of Southern California Dissertations and Theses

Conceptually similar

PDF

Dynamic regulation of vasopressin, a mnemonic neuropeptide, induction of calcium signaling and V1a vasopressin receptors in the rat cerebral cortex

PDF

Homeostatic regulation of intracellular signaling networks by Etk /Bmx

PDF

Enhancement of mitochondrial antioxidative defenses and aging in Drosophila melanogaster

PDF

Aging, DNA damage and apoptosis

PDF

Fanconi's anemia and oxidative stress

PDF

A mutational analysis on monoamine oxidase

PDF

Roles of PKC isoforms in vasopressin V1a receptor signal desensitization

PDF

Cellular and molecular effects of vasopressin, a mnemonic neuropeptide, on cultured hippocampal and neocortical cells derived from embryonic rat brain

PDF

Bioenergetic fuel shift of reproductive aging: implication for late-onset Alzheimer's disease

PDF

An updated review of intracellular mRNA localization

PDF

Nonreceptor tyrosine kinase Etk /Bmx: Function and regulation in epithelial cells

PDF

Developmental and functional studies of the vasopressin system in the cerebral cortex

PDF

Immunogenicity of acute lymphoblastic leukemia: In vivo and in vitro studies of Bcr -Abl specific immune responses

PDF

Estrogen regulation of bioenergetics and mitochondrial function: implications for Alzheimer's disease risk and therapeutics

PDF

A halide peroxidase and reactive oxygen species in the mutualistic light organ symbiosis between the sepiolid squid Euprymna scolopes and the luminous bacterium Vibrio fischeri

PDF

Glutathione metabolism and transport in cystic fibrosis airway epithelia

PDF

Glutathione reduction and its effects on mitochondrial function and protein degradation: Implications for Parkinson's disease

PDF

A new model for hepatitis delta virus transcription and replication

PDF

Consequence of activation of cellular signaling pathways by hepatitis B virus X protein on the RNA polymerase I and III gene activities

PDF

Functional analysis of MSX2 and its role in skull patterning

Asset Metadata

Creator Zhao, Lixia (author)

Core Title Discovery of a novel role of vasopressin in astrocytes: Vasopressin-induced cytoplasmic and nuclear calcium and kinases signaling cascade and modulation of astrocytes immune function

School Graduate School

Degree Doctor of Philosophy

Degree Program Molecular Pharmacology and Toxicology

Publisher University of Southern California (original), University of Southern California. Libraries (digital)

Tag biology, cell,biology, molecular,biology, neuroscience,health sciences, immunology,OAI-PMH Harvest

Language English

Contributor Digitized by ProQuest (provenance)

Advisor Brinton, Roberta D. (committee chair), [illegible] (committee member), Cadenas, Enrique (committee member)

Permanent Link (DOI) https://doi.org/10.25549/usctheses-c16-283364

Unique identifier UC11340107

Identifier 3103987.pdf (filename),usctheses-c16-283364 (legacy record id)

Legacy Identifier 3103987.pdf

Dmrecord 283364

Document Type Dissertation

Rights Zhao, Lixia

Type texts

Source University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Access Conditions The author retains rights to his/her dissertation, thesis or other graduate work according to U.S. copyright law. Electronic access is being provided by the USC Libraries in agreement with the au...

Repository Name University of Southern California Digital Library

Repository Location USC Digital Library, University of Southern California, University Park Campus, Los Angeles, California 90089, USA