University of Southern California Dissertations and Theses

Genomic profiling associated with recurrence in patients with rectal cancer treated with chemoradiation

(USC Thesis Other)

Genomic profiling associated with recurrence in patients with rectal cancer treated with chemoradiation

PDF

Download

Open document

Flip pages

Download a page range

Download transcript

Copy asset link

Request this asset

Transcript (if available)

Content GENOMIC PROFILING ASSOCIATED WITH RECURRENCE IN PATIENTS WITH RECTAL CANCER TREATED WITH CHEMORADIATION by Michael Alexander Gordon A Thesis Presented to the FACULTY OF THE GRADUATE SCHOOL UNIVERSITY OF SOUTHERN CALIFORNIA In Partial Fulfillment of the Requirements for the Degree MASTER OF SCIENCE (CELL AND NEUROBIOLOGY) August 2006 Copyright 2006 Michael Alexander Gordon Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. UMI Number: 1438395 INFORMATION TO USERS The quality of this reproduction is dependent upon the quality of the copy submitted. Broken or indistinct print, colored or poor quality illustrations and photographs, print bleed-through, substandard margins, and improper alignment can adversely affect reproduction. In the unlikely event that the author did not send a complete manuscript and there are missing pages, these will be noted. Also, if unauthorized copyright material had to be removed, a note will indicate the deletion. ® UMI UMI Microform 1438395 Copyright 2006 by ProQuest Information and Learning Company. All rights reserved. This microform edition is protected against unauthorized copying under Title 17, United States Code. ProQuest Information and Learning Company 300 North Zeeb Road P.O. Box 1346 Ann Arbor, Ml 48106-1346 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Table of Contents List of Tables iii Abstract iv Chapter 1: Background 1 Hypothesis 1 Rectal Cancer 1 Role of Genomic Profiling in Cancer 5 Explanation of Genes of Interest 12 Chapter 2: Introduction 38 Chapter 3: Patients and Methods 41 Eligible Subjects 41 Genotyping 42 Statistical Analysis 44 Chapter 4: Results 44 Patients 44 Risk of Recurrence Analysis: Clinical Characteristics 45 Association between polymorphisms and clinical characteristics 46 Univariate Analysis of polymorphisms and tumor recurrence 46 Recursive Partitioning (RP) analysis of recurrence 52 Figure 1: Classification tree of genomic polymorphisms and clinical characteristics for recurrence status 53 Chapter 5: Discussion 54 Chapter 6: Future Directions 59 Bibliography 62 ii Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. List of Tables Table 1: Primer sequences and functional significance of the germ-line polymorphisms of genes involved in the principle pathways of cancer progression Table 2: Local recurrence in rectal cancer based on demographic and clinical parameters Table 3: Association between polymorphisms of genes involved in the principle pathways of cancer progression and recurrence in patients with rectal cancer treated with 5-FU based chemoradiation Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Abstract Stage II and III rectal cancer has an overall 5-year survival rate of 50%, and tumor recurrence remains a major problem despite an improvement in local control through chemoradiation. Therefore, it is imperative to identify patients who will benefit from chemoradiation and those who will develop recurrent disease. We tested whether 21 polymorphisms in 18 genes involved in critical pathways of cancer progression will predict risk of tumor recurrence in rectal cancer patients. Ninety patients with Stage II or III rectal cancer treated with chemoradiation were genotyped. A polymorphism in IL-8 was individually associated with tumor recurrence. CART analysis of all polymorphisms and clinical variables developed a risk tree including the following variables: node status, IL-8, ICAM-1, TGF-P, and FGFR-4. Genomic profiling may help identify patients who will benefit from chemoradiation and those who will recur. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Chapter 1: Background Hypothesis We tested the hypothesis whether germline polymorphisms of genes involved in pathways relevant to cancer progression would predict risk of tumor recurrence in rectal cancer patients treated with chemoradiation therapy. These molecular pathways include DNA repair, drug metabolism, cell cycle control, and angiogenesis/tumor microenvironment. We isolated genomic DNA from tissue samples collected from 90 rectal cancer patients. We tested a total of 21 polymorphisms in 18 genes to test whether they would predict risk of tumor recurrence. Rectal Cancer Rectal cancer has an annual incidence of 40,000 new cases in the United States, with approximately 8,000 annual deaths (Jemal et al 2006). Risk factors for development of rectal cancer are not well-defined, but include diet, gender, age, and family history (Potter 1996, Wei et al 2004). Screening for rectal cancer results in early-stage diagnosis and potentially improved survival (Battat et al 2004). Over the last twenty-five years, the relative survival rates in rectal cancer have not changed significantly, with overall marginal improvement reported for the United States and Europe (Kerr et al 2005). Prognosis in rectal cancer is dependent on tumor staging, with higher stage tumors resulting in decreased survival. Prognosis is dependent on tumor grade, number of lymph nodes involved, and presence of distant metastatic disease. Age is not a 1 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. prognostic factor in rectal cancer, with young patients having similar 5-year overall survival when compared to elderly patients (O ’Connell et al 2004). Rectal cancer is technically defined as a tumor localized within 15cm of the anal verge. The rectum is divided into the upper, middle, and lower sections, and treatment of rectal cancer depends partly on which section the tumor is located in. Treatment of early stage, node-negative rectal cancer usually involves surgical resection. Upper third rectal cancers may be removed by anterior resection, while middle and lower third rectal cancers may receive abdominoperineal resection. Treatment after surgery depends on the status of a variety o f factors, including T stage, lymph node involvement, distant metastasis, tumor differentiation, current health o f the patient, and other factors. Local advanced stage rectal cancers receive neo-adjuvant or adjuvant chemoradiotherapy followed by surgery. Current data support the role of preoperative chemoradiation as the standard o f care in treatment of rectal cancer. Several studies have found that preoperative chemoradiation has added benefit for locally advanced rectal cancer patients, with decreased toxicity rates and improved local control (Kapiteijn et al 2001, Ortholan et al 2006, Luna-Perez et al 2001, Swedish Rectal Cancer Trial 1997, Sauer et al 2004, Mohiuddin et al 2000). A study by Rodel et al found that tumor regression as a result of preoperative chemoradiotherapy in 385 rectal cancer patients resulted in improved disease-free survival (Rodel et al 2005). A study by Sauer et al examined preoperative versus postoperative chemoradiation in 823 rectal cancer patients. They found that preoperative therapy significantly improved local 2 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. control and toxicity. (Sauer et al 2004). A study by Mohiuddin et al found that tumor downstaging as a result of neoadjuvant chemoradiation resulted in an excellent prognosis (Mohiuddin et al 2000). They found that patients with TO, T l, or T2 disease after preoperative chemoradiation had a 5-year survival rate of 100%. Patients with T3 or higher tumors had a significantly lower overall survival rate (78%), and the authors indicate these patients may benefit from further postoperative therapy. As with colon cancer, rectal cancer patients receiving chemotherapy are administered a 5-fluorouracil-based regimen. The mechanism of action of 5-FU involves inhibition of thymidylate synthase, an enzyme involved in conversion of dUMP to dTMP. By inhibiting nucleotide synthesis, 5-FU prevents replication of cellular DNA and subsequently prevents cell division. 5-FU was developed 50 years ago, yet it remains the standard drug in the treatment of many solid tumors, including colon and rectal cancer. Even with the recent explosion of new anticancer drugs, including monoclonal antibodies, DNA damaging agents, and drugs targeting epigenetic mechanisms, the standard drug for rectal cancer remains 5-FU. With this advent o f new drugs for rectal cancer, studies are ongoing to examine the efficacy of combination drug regimens in rectal cancer patients. Oxaliplatin, irinotecan, and cisplatin have all been tested in combination with 5-FU or capecitabine (oral 5-FU), with varying degrees of improved benefit over 5-FU alone (Turitto et al 2006, Klautke et al 2006, Hofheinz et al 2005, Willett et al 2005, James et al 2003). 3 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Along with chemotherapy, radiation remains a critical tool in local control of rectal cancer. Radiotherapy has an enhanced effect when combined with 5-FU (Nakajima et al 1979). Radiation therapy has a therapeutic effect due to its targeting of cellular DNA. Radiation initially causes cell cycle arrest. The ultimate effects of radiation include apoptosis, necrosis, or differentiation. However, the cell has efficient repair mechanisms that act during cell cycle arrest to reverse DNA damage caused by irradiation. This fact may contribute in part to the variability of efficacy of radiotherapy in both the clinical and laboratory setting. Therefore, the true benefit of radiation therapy is derived from cells being forced into apoptosis, not cell cycle arrest. In addition, radiation therapy may have variable efficacy due to changes in the cell cycle of tumor cells. In vitro experiments have found that cells are most sensitive to radiation during mitosis and G2 phases (Chaffey et al 1971). Cells in G1 are resistant to radiation damage. Additionally, the amount of hypoxia present in the tumor may also contribute to the efficacy of radiotherapy. It has been shown that lower doses of irradiation are required to kill cells in aerobic conditions than in hypoxic conditions (Belli et al 1967). The conversion of oxygen into free radicals is a central element of the DNA damage mechanism of radiation. Without oxygen, a decrease in the amount of available free radicals may hinder the therapeutic effect of radiation. Therefore, hypoxic tumors may be more radioresistant than well-vascularized tumors. Large, bulky tumors tend to be hypoxic, which indicates that radiotherapy may be contraindicated in these tumor types. 4 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Clinically, radiation therapy for rectal cancer has potential complications and side effects. Both short- and long-term toxicities are known to occur, in relation to the volume, duration, and intensity of irradiation administered. Some of these side effects include diarrhea, thrombocytopenia, delayed wound healing, bleeding, and possibly altered sphincter function (Rubin et al 1968). Radiation therapy has potential benefits in both the preoperative and postoperative setting. In the preoperative setting, radiotherapy may turn a potentially unresectable tumor into a resectable one by shrinking it, as well as decreasing the risk of local recurrence. Postoperative radiation can be combined with chemotherapy for a potentially additive therapeutic effect. However, the optimal treatment modality and timing for radiation is still under investigation. Role of Genomic Profiling in Cancer One o f the overall goals in genomic profiling o f cancer is to further subcategorize patients beyond the standard histological and pathological staging techniques, and treat them accordingly. Two tumors that may appear similar based on T-stage, grading, size, etc., may progress entirely differently. Traditional staging techniques cannot always explain these differences. The limits of traditional tumor staging can be supplemented by examining the tumor at the molecular and genetic level. Classifying a tumor based on its molecular characteristics can provide a much more detailed analysis of how the tumor may potentially progress. In addition, establishing molecular markers can help 5 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. determine subsets of patients who will benefit most from particular therapies. Genetic profiling can be accomplished by examining either tumor RNA or germline DNA. Examining mRNA expression levels generally requires a biopsied sample of tumor tissue, and results of these assays show differential transcriptional activity of a particular gene of interest. Knowledge of gene expression levels of cancer-related genes can provide insight into a variety of processes, including apoptotic evasion and cell cycle deregulation, malignant or metastatic growth, and resistance to chemotherapy (Huerta et al 2003, Tokunaga et al 1998, Vallbohmer et al 2005). Gene expression studies directly examine the levels of transcript in a given tumor, which leads to unambiguous results about the behavior of the gene of interest. Furthermore, immunohistochemical assays can be used in place of or in complementation to gene expression studies. Immunohistochemistry uses antibodies to examine protein activity levels in tumor tissue, providing even more insight into the molecular activity of the tumor. Antibodies are synthesized to bind a protein of interest. The antibody is applied to a sample of tumor tissue, and the level of binding is quantified. The level of the protein of interest present in the tumor sample is determined. There are drawbacks to gene expression and protein expression studies. One drawback has to do with availability of tissue. These assays can only be performed on tumor tissue, which means a biopsied sample is required. Peripheral blood samples, which are easy to obtain from patients, are generally of no use in gene or protein expression studies. A drawback specific to gene expression studies is the requirement for pure tumor tissue. Gene 6 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. expression studies are conducted by isolating RNA from the tissue sample. Since gene expression levels will inevitably be different between tumor cells and adjacent normal cells, measuring gene expression levels in a sample of cells that is mixed will produce erroneous results that are not true indicators of tumor gene expression. As such, laser-capture microdissection is required to avoid normal tissue contamination. This process is labor-intensive and time consuming. In addition to requiring pure tumor tissue, recently resected tumor tissue must be handled quickly and either embedded in paraffin or snap-frozen in order to ensure that RNA remains intact and is not degraded. In protein expression studies, reproducibility is a major concern. Availability of anitbodies and subjective analysis of results are additional limitations to these studies. These assays are performed by staining a tumor sample with antibody, and measuring binding activity as an indicator of protein levels. Results are notoriously difficult to reproduce, becasue this approach depends on the quality of tissue handling and fixation. Examining DNA for genetic variation is another tool to better classify the tumor at the molecular level. DNA analysis includes mutation analysis and polymorphism analysis. Genetic mutation is a requirement for cancer development, and it may include chromosomal or microsatellite instability including loss o f heterozygosity, or point mutations in tumor suppressor genes or oncogenes. These mutations contribute to carcinogenesis, and may also have an impact on cancer progression. Mutation in the p53 gene, for instance, has 7 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. been implicated in both cancer development and cancer progression (Calistri et al 2005). In addition to gene mutation analyses, gene polymorphism studies have gained acceptance as legitimate and convenient tests as predictive or prognostic markers in cancer. Polymorphisms are heritable genetic changes that exist in the germline DNA at about 1 in every 300 base pairs in the human genome. They are responsible for much of the phenotypic variation among individuals in a population. They can exist as single nucleotide polymorphisms (SNPs), insertion-deletion polymorphisms, and variable number of tandem repeats (VNTRs). Polymorphisms are examined using a variety of PCR-based techniques designed to detect changes at the base-pair level in the genome. Since these polymorphisms lead to changes in DNA sequence, many of them confer functional changes in mRNA and protein structure. These changes in DNA sequence can thus lead to amino acid substitutions in the primary structure of proteins, leading to altered or even abolished enzyme activity. Thus, discovering polymorphisms and determining their effect on enzyme activity can have a significant impact on the understanding of protein function and how it may impact cellular behavior. Examining polymorphisms in DNA can be done using any source of DNA. It is more convenient to examine polymorphisms because there is an unlimited supply of patient DNA, whereas expression studies require tumor tissue of which there is a finite amount. In addition to having an abundant source of sample, using peripheral blood instead of biopsied tumor tissue 8 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. for genetic testing provides a much more comfortable and less invasive alternative for the patient. Peripheral blood can be examined to study germline variations in the patient’s genetic makeup, including polymorphisms and mutations. Additional analyses can be performed on tumor DNA, such as screening for genetic instability or somatic mutations. Somatic mutations and genetic instability differ from germline polymorphisms. These genetic abnormalities are not inherited, but are acquired during the life of the patient in normal somatic cells. Genetic instability leading to loss of heterozygosity is a hallmark in carcinogenesis. Acquiring a somatic mutation in a tumor suppressor gene or oncogene also contributes to carcinogenesis. All these genetic variations can be conveniently detected using germline DNA. Examining germline polymorphisms is not without its limitations. A major challenge is determining the function and significance of a particular polymorphism. In vitro studies examining activity changes due to genomic polymorphisms often produce conflicting results, and the problem can be confounded further when examined in vivo. Due to the complex gene interactions that take place in cells, the question can be raised as to whether or not a single base pair change in a single gene will have an effect on survival or response to chemotherapy. Another issue in examining germline polymorphisms is that the normal genome is not the same as the tumor genome. Mutation, loss o f heterozygosity, microsatellite instability and chromosomal instability are all hallmarks of cancer cells, and these changes in the tumor DNA can lead to altered enzyme function that will not be detected by tests 9 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. examining the germline DNA (Laurent-Puig et al 1999). For instance, germline polymorphisms in the thymidylate synthase (TS) gene have been extensively studied for predicting response to fluorouracil-based chemotherapy. However, the TS gene is located on chromosome 18, which is known to experience loss of heterozygosity in colorectal cancer (Ogunbiyi et al 1998). Therefore, the genotype determined from peripheral blood cells may not match the genotype found in the tumor cells, and so a true representation of TS genotype and enzyme activity may not be conveniently obtained from the germline (Uchida et al 2004). Therefore, tumor DNA must be analyzed directly to obtain tumor genotype. The candidate gene approach of pharmacogenomics focuses on genes in pathways known to be involved in cancer development, progression, metastasis, and drug response. We examined prognostic and predictive markers relevant to rectal cancer and the 5-FU and radiation pathways. Understanding the difference between prognostic markers and predictive markers is critical to apply pharmacogenomics in the clinic. Prognostic markers are associated with patient survival regardless o f treatment. Predictive markers, on the other hand, are implicated in response to particular therapeutic regimens, either chemical or radiological. In addition to predicting drug response, they are also useful in predicting toxicity to specific anticancer drugs in patients. There have been several landmark studies with significant impact on the research in pharmacogenomics. In colorectal cancer, the most promising studies have focused on genes targeted to 5-fluorouracil, such as thymidylate 10 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. synthase (TS) and dihydropyrimidine dehydrogenase (DPD). TS in particular is critical in the 5-FU pathway. Since 5-FU acts by inhibiting the TS enzyme, the hypothesis is generated that high levels of TS will overwhelm the 5-FU drug and thus inhibit its therapeutic action. Patients with increased protein and/or mRNA levels of TS should therefore have a poorer response to chemotherapy and poor clinical outcome. Several studies have addressed this hypothesis. A study by Johnston et al was one of the first to examine TS protein expression in rectal cancer patients (Johnston et al 1994). They examined TS expression in 294 rectal cancer patients and found that it was a strong prognostic marker, independent of other pathologic characteristics. Patients with high levels of TS protein had a poorer disease-free survival and overall survival when compared with patients expressing low TS. A study by Pullarkat et al was important in correlating TS polymorphism with gene expression levels as well as with tumor response and toxicity in colorectal cancer patients (Pullarkat et al 2001). Patients carrying the genotype corresponding to lower TS levels had a better response to chemotherapy. A study by Salonga et al examined gene expression levels of DPD, the primary enzyme involved in 5-FU metabolism, in colorectal cancer patients (Salonga et al 2000). They found that low expressers of DPD had a better response to 5-FU chemotherapy when compared to high expressers. This study also found that low expressers of TS had a better response to 5-FU therapy when compared to high TS expressers. There are a large number of studies that have examined TS protein expression and gene expression in 5-FU-treated colorectal cancer. These 11 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. studies have produced varying results, depending on a multitude of factors. In order to address these differences and provide a comprehensive review of the results, a meta-analysis was conducted by Popat et al (2004). They examined 20 TS expression studies, and found that in both local and advanced colorectal cancer, TS expression is a predictor of survival. Their systematic analysis of the 20 studies found that high expressers of TS protein or mRNA had a poorer overall survival. Establishing prognostic and predictive markers is one of the next critical steps in the evolution of cancer treatment. Genetic profiling in colorectal cancer is a progressing field that has generated some promising clinical data but still awaits validation in independent sets and in large prospective trials. Applying these laboratory findings to the clinic is obviously the priority in this field of study, but a consistently reproducible molecular signature must first be established in order to have any rational clinical application. Explanation o f Genes o f Interest Eighteen genes were selected in this study for their relevance to cancer progression or chemotherapeutic efficacy. The gene set can be divided into four functional categories: tumor microenvironment, DNA repair, cell cycle control, and drug metabolism. Genes included in the tumor microenvironment category are vascular endothelial growth factor (VEGF), interleukin-8 (IL-8), intercellular adhesion molecule-1 (ICAM-1), cyclooxygenase-2 (Cox-2), fibroblast growth factor 12 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. receptor-4 (FGFR4), transforming growth factor B (TGF- B), matrix metalloproteinase-3 (MMP-3), and interleukin-10 (IL-10). These proteins are known to play roles in angiogenesis and/or cell adhesion (Carmeliet 2005, Brat et al 2005, Flubbard et al 2000, Wu et al 2004, Hart et al 2000, Massague 1990, Tlsty 1998, Huang et al 1996). Elements o f cancer progression controlled by tumor microenvironment genes include angiogenesis, inter-cellular adhesion, mitogenesis, and inflammation. Angiogenesis, which involves the formation of new capillaries from preexisting vessels, has been characterized by a complex surge of events involving extensive interchange between cells, soluble factors (e.g. cytokines), and extracellular matrix (ECM) components (Balasubramanian et al 2002). In addition to its fundamental role in reproduction, development, and wound repair, angiogenesis is known to be deregulated in cancer formation, and is central to tumor growth (Folkman2002). Improvement in the therapeutic ratio of radiation by targeting tumor cells via a combination of angiogenic blockades and radiotherapy have been implicated in recent studies (Gorski et al 1999, Mauceri et al 1996, Mauceri et al 1998). However, the mechanisms by which tumor cells respond to radiation through these antiangiogenic/vascular agents are yet to be elucidated. Moreover, in light of the fact that oxygen is a potent radiosensitizer, cancer therapy through the combination of ionizing radiation and antiangiogenic/vascular targeting agents may seem counterintuitive since a reduction in tumor vasculature would be expected to decrease tumor blood perfusion and lower oxygen concentration in the tumor (Wachsberger et al 13 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 2003). Therefore, angiogenic genes may play varying roles in the response to chemoradiotherapy treatments. Vascular endothelial growth factor (VEGF) is a central enzyme in the angiogenic pathway. It is a homodimeric glycoprotein that is up-regulated by a variety of factors and events, including hypoxia and growth factors such as epidermal growth factor (EGF), fibroblast growth factor (FGF), and platelet derived growth factor (PDGF). VEGF elicits its cellular response by binding to one of the transmembrane VEGF receptors, which are then phosphorylated and stimulate downstream signalling events. VEGF has been shown to directly control angiogenesis via endothelial cells (Pepper et al 1992). The role of VEGF in angiogenesis makes it an important factor in the viability and survival of solid tumors. Solid tumors such as rectal and colon cancer require a constant supply of blood and oxygen in order to survive. As the solid tumor grows in size, circulation to the inner part of the tumor may be cut off, creating a hypoxic scenario that inhibits tumor growth. In order to overcome this growth-limiting barrier, the tumor will secrete growth factors such as VEGF to stimulate the formation of new blood vessels so that circulation may be restored and tumor growth may continue. In relation to human tumors in vivo, increased VEGF expression plays an important clinical role. A study examining VEGF mRNA expression in colorectal tumor tissue versus normal tissue found that VEGF was significantly over-expressed in tumor tissue. In addition, VEGF mRNA expression was associated with depth of tumor invasion, lymph node metastasis and liver metastasis, as well as overall survival (Ishigami et al 1998). In 14 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. fact, VEGF is now considered to play such a central role in angiogenesis and tumor progression that monoclonal antibodies have recently been designed and approved for clinical use to therapeutically inhibit the action of VEGF. A polymorphism is located in the 3’ untranslated region (UTR) of the VEGF gene, at position 936, resulting in a C>T nucleotide shift. The T allele has been associated with decreased plasma levels of the VEGF protein (Renner et al 2000). However, the mechanism by which this polymorphism alters plasma levels is currently unknown. This polymorphism has also been associated with breast cancer risk (Krippl et al 2003). The interleukin family is known to play an important role in the angiogenic process. Interleukin-8, a member of the C-X-C cytokine family, is an inflammatory cytokine with angiogenic potential. IL-8 is expressed by a variety of human cells, including macrophages, neutrophils, fibroblasts, endothelial cells, hepatocytes, and also cancer cells. IL-8 is an important factor in solid tumors, especially in large hypoxic tumors. Uncontrolled growth of solid tumors will often cause blood flow to be cut off from the growing tumor. The tumor will counteract this hypoxic scenario by stimulating angiogenesis, via many growth factors, including IL-8. It has been implicated in cancer progression in a variety of cancer types including colorectal carcinoma, glioblastoma, and melanoma (Yuan et al 2000). In fact, IL-8 has been shown to be constitutively overexpressed in human tumor cells (Shi et al 1999, Le et al 2000, Miyamoto et al 1998). It has been shown that colon cancer cell lines exposed to IL-8 show dose-dependent growth and proliferation (Brew et al 15 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 2000). This study also showed that antagonism o f the IL-8 protein caused an inhibition of colon cancer cell proliferation. Additionally, the majority of colorectal cancers have been shown to express IL-8 (Brew et al 1996). A study by Konno et al examined the role of serum IL-8 levels in gastric cancer patients. They found that patients with high IL-8 levels in drainage veins were more likely to have large tumors, lymph node involvement, and shorter disease-free survival (Konno et al 2003). Additionally, elevated serum levels of interleukin- 8 are associated with liver metastasis, lung metastasis, and poor tumor differentiation in colorectal cancer (Ueda et al 1994). The IL-8 gene contains an A->T SNP 251 bp upstream of the transcription start site. The A allele has been associated with increased IL-8 production in vitro (Hull et al 2000). A study in prostate cancer found that patients were much more likely to carry the AA allele (increased IL-8 activity) than controls, indicating a possible protective role of the polymorphism in cancer development (McCarron et al 2002). Another member of the interleukin family is IL-10. This cytokine has immune suppressive functions, including inhibition of T lymphocytes, and reduction of T helper cytokines (Kazuyuki et al 1993). It is produced by cells of the humoral and cellular immune system, and it is known to be expressed in a variety of cancer types, including ovarian and breast cancer (Mustea et al 2006, Llanes-Fernandez et al 2006). The immune system plays a role in the inflammatory response, as well as in apoptosis and cell proliferation. Solid tumors such as colorectal cancer may require immune suppression in order 16 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. to progress and grow. Overexpression of IL-10 in melanoma cells has been shown to cause an inhibition o f metastasis and tumorigenicity in nude mice due to inhibition of angiogenic factors such as VEGF, TNF-alpha, and MMP-9 (Huang et al 1996). Additionally, elevated levels of the IL-10 protein have been detected in serum of patients with solid tumors (Fortis et al 1996), and have been associated with cell proliferation and apoptosis in colorectal tumors (Evans et al 2006). IL-10 serum levels have also been shown to be predictive of likelihood of curative surgery as well as risk of tumor recurrence in colon cancer patients (Galizia et al 2002). Given the multiple roles of IL-10 in cancer progression and immune function, its exact role in rectal cancer progression requires further examination. The IL-10 gene contains a polymorphism in the promoter region, at position 1082 upstream from the transcription start site. This A>G polymorphism is associated with altered production levels of IL-10 (Rees et al 2002, Stanilova et al 2006). This polymorphism has also been associated with cancer risk in lung, breast, and renal cell carcinoma (Seifart et al 2005, Langsenlehner et al 2005, Havranek et al 2005). Inter-cellular adhesion plays a major role in both local invasion and metastasis. Cell adhesion molecules (CAMs), which are cell-surface glycoproteins that are crucial for cell-to-cell interactions, have been shown to directly control differentiation, and interruption of normal cell-to-cell contacts has been observed in neoplastic transformation and in metastasis (Ruoslahti 1988, Maurer et al 1998). Intercellular adhesion molecule-1 (ICAM-1) is a 17 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. multi-functional cell surface glycoprotein receptor. It plays a role in cell adhesion, and it is also a stimulating signal for cytotoxic T lymphocytes and natural killer cells (Van Seventer et al 1990, Chong et al 1994). The role of ICAM-1 in cell adhesion implicates it as a potential player in the metastatic process of cancer progression. Decreased levels o f ICAM-1 may decrease amounts of cell adhesion in the tumor microenvironment, making cell migration from the primary site less inhibited. A study using immunohistochemistry to examine ICAM-1 levels in colorectal tumors found that ICAM-1-positive tumors had a significantly lower rate of liver metastasis, as well as significantly increased overall survival (Maeda et al 2002). Up-regulation of ICAM-1 in colon cancer cell lines and mouse models shows that increasing levels of ICAM- 1 leads to fewer liver metastases and increased adhesion of peripheral blood mononuclear cells (PBMCs). Increased adhesion o f PBMCs to cancer cells caused increased cytotoxicity o f cancer cells, which suggests that in the presence of ICAM-1, PBMCs have more opportunity to lyse cancer cells and increase immunogenicity (Tachimori et al 2005). Overexpression o f intercellular adhesion m olecule-1 (ICAM-1) in colorectal cancers has been shown to favor the extravasation and trafficking of cytotoxic lymphocytes toward the neoplastic cells, leading to host defense (Maurer et al 1998). A polymorphism has been identified in the ICAM -1 gene at codon 469 in exon 6. The C/T polymorphism results in an amino acid substitution of glutamic acid (E) to lysine (K). The impact on enzyme function or activity of this polymorphic change is unknown. It is located three base pairs upstream 18 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. from an mRNA splice site, and has been shown to have an effect on production o f mRNA splice variants (Iwao et al 2004). The C variant has been shown to cause a decrease in the amount of the splice variant form of ICAM-1 (ICAM-1- S). This variant has no intracellular or transmembrane domain, indicating a possibly decreased role in cell adhesion and receptor activity. However, the presence of only one study examining the function of this polymorphism warrants caution in interpreting its overall function. Another protein involved in the tumor microenvironment is cyclooxygenase-2 (Cox-2), or prostaglandin H synthase (PTGS). Cox-2 has gained recent attention for drugs that inhibit its role in the inflammatory response. In addition to inflammation, Cox-2 is also involved in mitogenesis. Cox-2 is involved in prostaglandin synthesis, and stimulates inflammation and mitogenesis; the COX-2 protein has been shown to be markedly overexpressed in colorectal cancers when compared to adjacent normal mucosa (Joo et al 2002). Unlike Cox-1, Cox-2 is not constitutively expressed in all tissues. Its expression is inducible in response to inflammation, and expressed in a limited number of tissue types, including the gut. Cox-2 catalyzes the conversion of arachidonic acid into prostaglandins. Prostaglandins have many cancer-related functions, including maintenance o f tissue homeostasis, angiogenesis, cell proliferation, and inflammation. The Cox-2 enzyme has been associated with increased colorectal cancer risk, and in the development of the disease. Cox-2 is significantly overexpressed in the majority of colorectal cancers (Elder et al 2002, Eberhart et al 1994), and is overexpressed early in carcinogenesis. 19 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Animal models have shown that absence of Cox-2 via knockout mice reduces the number of polyps, and administration of Cox-2 inhibitors also decreases the number of polyps as well as tumor incidence (Oshima et al 1996, Oshima et al 2001, Kawamori et al 1998). These and other similar findings have led to the conclusion that inhibition of Cox-2 decreases risk o f colorectal cancer, and that NSAIDS (non-steroidal anti-inflammatory drugs) may be of benefit in cancer prevention. Due to its important role in cancer development, and upregulation in colorectal cancer, it is logical to hypothesize that Cox-2 may also play a role in progression of disease and clinical outcome. The Cox-2 gene contains a SNP in the promoter region, resulting in a G<C substitution. A study using immunohistochemistry found that the G allele is associated with increased Cox-2 protein levels (Brosens et al 2005). Another study found that the C allele caused significantly decreased promoter activity (Papafili et al 2002). This polymorphism has also been associated with decreased risk of colorectal adenoma (Ulrich et al 2005). Another family of genes playing a critical role in angiogenesis is the receptor tyrosine kinase family of fibroblast growth factor receptors. There are four highly conserved FGFRs, which are involved in regulating a variety of cellular processes, including angiogenesis, cell growth, differentiation, motility, and carcinogenesis. The FGF/FGFR pathway has been implicated in several cancer types (Powers et al 2000). It has been shown in cell lines that activation of FGFR4 can directly induce cellular transformation (Hart et al 2000). Additionally, FGFR4 gene expression has been shown to be upregulated in 20 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. late stage pancreatic beta cell tumors; however it is not active in pancreatic carcinogenesis (Olson et al 1998). The FGFR4 gene contains a functional polymorphism in exon 9 that results in a Gly>Arg shift in the transmembrane domain of the protein. The exact effect o f the polymorphism on protein function remains undescribed, and it has been shown that the SNP has no effect on mRNA levels (Spinola et al 2005). In colon cancer patients, the Arg allele has been associated with an increase in early lymph node metastasis and advanced TNM staging, and in breast cancer patients the Arg allele is associated with decreased disease-free survival (Bange et al 2002). In support of these findings, a study conducted in breast cancer cell lines found that the Arg allele was associated with increased cell migration (Bange et al 2002). In a study examining the role of the FGFR4 polymorphism in lung cancer, it was shown that patients carrying the Arg allele had an earlier onset of cancer, shorter survival time, and increased lymph node involvement (Spinola et al 2005). Similarly, studies in soft-tissue sarcoma, prostate cancer, and head and neck cancer found that patients carrying the Arg allele had an overall poorer clinical outcome than patients carrying the Gly allele (Morimoto et al 2003, Wang et al 2004, Streit et al 2004). Interestingly all of the aforementioned studies reported similar genotype frequencies among cases and controls, indicating that the polymorphism has no role in cancer development, but that it significantly affects cancer progression. 21 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Transforming growth factor B is a widely expressed protein involved in many of the pathways that are central to cancer progression. This enzyme is involved in apoptosis, invasion and metastasis, cell growth and division, and angiogenesis. In normal cells it has a complex role as both a potential inhibitor and stimulator of cell growth (Massague 1990). However it has been shown that in colon cancer cells the cellular response to TGF- B is switched to cell growth (Hsu et al 1994). This implies that increasing levels of TGF- B in the colon may contribute to both carcinogenesis and cancer progression. The role of TGF- B in colorectal cancer has been heavily studied, but its role in development and progression of disease is not yet well established. Many studies have found an association between activity and expression levels of TGF- B and cancer progression, but the mechanism remains unclear (Friedman et al 1995, Robson et al 1996, Guzinska-Ustymowicz et al 2005). Given its close relationship with the progression of colorectal carcinoma, the potential significance of TGF- B as a prognostic marker is an important topic that requires further study. A T>C polymorphism in the TGF- B gene is located at nucleotide 29, resulting in an amino acid substitution o f leucine to proline. This polymorphism is located in the region encoding the signal sequence, and has been correlated with increased serum levels of TGF- B (Awad et al 1998, Yokota et al 2000). The role of this polymorphism on cancer progression remains unclear, however, as it has only been associated with increased breast and prostate cancer risk, and not in prognosis of cancer (LeMarchand et al 2004, Yokota et al 2000, Li et al 2004). 22 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. The family of at least 20 matrix metalloproteinsases are responsible for degradation of the extracellular matrix, which under normal conditions is required for such processes as bone turnover, wound healing, and cell division and growth. In the pathological state o f cancer, the MMPs play a central role in invasion and metastasis o f tumor cells. By degrading the extracellular matrix in the tumor microenvironment, the MMPs make way for newly generated blood vessels to access and nourish the tumor, allow for invasion of the growing tumor, and they allow potentially metastatic cells to achieve intravasation and migrate away from the primary tumor. However, the role of individual MMP enzymes in angiogenesis may be contradictory, in that some may potentiate angiogenesis while others inhibit it. The role of MMPs in this process is currently a subject of research, and the mechanisms and pathways that link them together are currently being examined. MMP-3 (stromeolysin-1) is important in degradation of the extracellular matrix. It stimulates activation of collagenases, releases E-cadherin, a molecule known to contribute to cancer development, and degrades elements of the extracellular matrix such as fibronectin, plasminogen, and collagen (Tlsty 1998). In colorectal cancer MMP-3 is primarily expressed by stromal cells (Newell et al 1994). In mammary epithelial cells, MMP-3 has been shown to degrade cell-cell contacts and contribute to an epithelial-mesenchymal shift, leading to a tumor like phenotype (Lochter et al 1997). 23 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. A common polymorphism is located in the promoter region of the MMP- 3 gene, resulting in 5 or 6 repeats of the adenosine nucleotide (5A vs. 6A). This polymorphism is significantly associated with promoter activity and subsequent gene expression levels. This polymorphism may lead to an accumulation or an abnormally low level of extracellular matrix, possibly affecting the invasive and metastatic potential of solid tumors such as rectal cancer. Genes included in the DNA repair category are: excision repair cross complementation group 1 (ERCC1); X-ray repair cross complementing group 3 (XRCC3), RAD51, and APE1. DNA repair capacity is especially significant for radiotherapy, as a cell’s ability to repair DNA damage relates directly to radiation therapy efficacy (Yanagisawa T et al). Irradiation can damage DNA directly, or indirectly via reactive oxygen species. The cell has several pathways to repair DNA damage including double-stranded break repair (DSBR), nucleotide excision repair (NER), and base excision repair (BER). Each pathway uses a different type of repair machinery to excise and replace damaged DNA. The type o f DNA damage determines the repair machinery that will act on it. Four DNA repair genes that are central to these pathways are ERCC1, XRCC3, RAD51, and APE1. A double stranded DNA break results in a complex acting on it that includes proteins encoded by Rad51 and several RAD51 paralogs (including XRCC3). XRCC3 and RAD51 are known to play a direct role in DSBR (Baumann et al 1998, Pierce et al 1999). Double stranded breaks are a less common result of ionizing radiation than single stranded breaks, however, 24 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. they are far more lethal and result in the most cell death (Nunez et al 1996). RAD51 has been implicated as an essential component in homologous recombination repair (HRR), one o f two types of double-stranded break repair (Lundin et al 2003). RAD51 is necessary for cell viability, proliferation, and genome maintenance, and a decrease in RAD51 activity leads to an accumulation o f chromosomal breaks and increased radiosensitivity (Baumann et al 1998, Russell et al 2003, Sonoda et al 1998). Correspondingly, an increase in RAD51 activity will correlate with increased DNA repair and greater resistance to radiation (Vispe et al 1998, Yanagisawa et al 1998). Increased expression of RAD51 has been linked to radioresistance in human carcinoma cell lines (Yanagisawa et al 1998). A G>C single nucleotide polymorphism is located at nucleotide position 135 in the 5’ untranslated region of the RAD51 gene. It was recently discovered that the G allele of this polymorphism results in significantly increased promoter activity (Hasselbach et al 2005). The C variant has been associated with increased risk o f breast cancer with patients carrying BRCA1/2 mutant genotypes and decreased risk of ovarian cancer (Wang et al 2001, Levy-Lahad et al 2001). However another study has found no association between the RAD51 SNP as an independent marker in correlation with development or progression of disease in breast cancer patients (Blasiak J et al 2003). The function of this polymorphism in vivo with respect to cancer progression remains to be determined. 25 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. XRCC3, a homolog of RAD51, is an essential component of the RAD51 repair complex (Bishop et al 1998, Liu et al 1998, Pierce et al 1999). XRCC3 is required for assembly and stabilization of RAD51 in HRR of DNA damage (Bishop et al). Findings have shown that XRCC3 deficiency drastically reduces homologous recombination repair (Pierce et al 1999). Cells deficient in either RAD51 or XRCC3 via knockout exhibit dramatically reduced repair ability via homologous recombination and increased radiosensitivity (Lio et al 2004, Yoshihara et al 2004). Mutation in the XRCC3 gene leading to loss of function has been associated with increased radiation sensitivity in vitro (Raaphorst et al 2005). XRCC3 contains a SNP in codon 241 which codes for a Thr>Met amino acid substitution in the XRCC3 protein, and the Met allele has been associated with an increased frequency of DNA adducts, although its specific function is unknown (Matullo et al 2001). The polymorphism has been associated with bladder cancer risk among smokers, and also with breast cancer (Stem et al 2002, Smith et al 2003). However this polymorphism is located in a non-ATP binding domain o f the protein, and its functional significance has yet to be elucidated (Shen et al 1998). The Met allele has been associated with increased DNA adduct levels in lymphocyte DNA, which indicates a possibly decreased DNA repair capacity for patients carrying this allele (Matullo et al 2001, Shen et al 1998). Recently, a study conducted in non-small-cell lung cancer patients receiving gemcitabine/cisplatin chemotherapy found the XRCC3 polymorphism to be significantly associated with median survival and risk of death (de Las Penas et al 2006). This study found 26 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. that XRCC3 241 Met/Met was significantly associated with increased survival, while heterozygous patients had the shortest survival. ERCC1 acts in the nucleotide excision repair (NER) pathway, and forms a complex with XPF to cleave DNA strands upstream of damaged DNA (Wood 1997). Defects in ERCC1 activity are directly associated with increased radiation sensitivity (Murray et al 2002). Also, it has previously been shown that the ERCC1 polymorphism is associated with clinical outcome in platinum- treated colorectal cancer patients (Park et al 2003). Increased expression levels of ERCC1 mRNA have been associated with increased chemoresistance in colon cancer cell lines in vitro (Arnould et al 2003), as well as decreased overall survival in colorectal cancer patients treated with 5-FU/oxaliplatin (Shirota et al 2001). The ERCC1 gene contains a polymorphic variant at codon 118, which involves a C/T shift. Although this polymorphism does not result in an amino acid change, it has been shown to result in decreased platinum-adduct repair ability, as well as possibly reduced expression levels. Viguier et al found that patients carrying the T/T genotype had a significantly better objective response to 5-FU/oxaliplatin treatment than patients carrying the C allele (Viguier et al 2005). A study by Park et al found that the polymorphism in the ERCC1 gene was predictive of clinical outcome in patients with advanced colorectal cancer, however these results found that the T/T allele was associated with decreased overall survival (Park et al 2003). With these conflicting results in mind, it is apparent that the exact functional significance of the ERCC1-118 27 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. polymorphism remains to be elucidated. Further in vitro work using both immunohistochemical and mRNA expression assays need to be conducted to determine the exact role this polymorphism plays in ERCC1 function. APE1 is a multifuncitonal endonuclease that acts in base excision repair (BER) (Evans et al 2000). APE1 acts in repairing apurinic/apyrimidinic (AP) DNA lesions, which can be a byproduct of oxidative damage from radiotherapy (Demple et al 1994). A decrease in repair of these AP sites can lead to mutation, genetic instability, and DNA replication inhibition (Loeb et al 1986). A P E l’s activity is also relevant outside o f DNA repair, as it has been associated with transcription factor regulation, cell cycle control, and cell signaling (Gaiddon et al 1999, Robertson et al 1997, He et al 2003). APE1 gene expression and protein expression are induced by oxidative agents, further supporting the central role of APE1 in BER (Ramana et al 1998). However, most studies examining gene expression levels o f APE-1 have not found a relationship between expression and radiosensitivity (Herring et al 1999, Walker et al, 1994). These negative findings might not explain the true in vivo activity by de emphasizing the complex regulation of APE1, including extensive post- translational modifications. A T 4 G SNP is located in exon 5 of the APE1 gene, leading to an Asp->Glu amino acid shift. Studies performed by Hu et al. have shown that the Glu allele is associated with increased mitotic delay, a marker for ionizing radiation sensitivity. The Glu variant has also been associated with increased breast cancer risk (Hu et al 2001, Hu et al 2002). To the best o f our 28 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. knowledge, the functionality and relation to cancer progression of this polymorphism have not been studied. Evasion of apoptosis and loss of sensitivity to cell cycle regulation are two hallmarks of cancer progression. Regulation of the cell cycle involves a multitude of factors, and inactivation or mutation o f many of these genes is known to be a tumorigenic event. Two genes that are centrally and essentially involved in cell cycle regulation are p53 and cyclin D1 (CCND1). The p53 gene, often referred to as the “guardian of the genome”, is a tumor suppressor gene and is one o f the central inhibitors o f cell cycle progression. By inducing p21, the p53 enzyme induces cell cycle arrest and consequently permits more time for the DNA repair machinery to function, or if need be, induces apoptosis. Mutation and hypermethylation of this gene has been extensively studied for its role in contributing to tumorigenesis and cancer progression. The p53 gene is mutated in greater than 50% of all cancers (Soussi et al 2001). Loss of function of the p53 gene via mutation or methylation is associated with tumorigenesis, due to accumulation of DNA damage and unchecked proliferation of cells harboring DNA damage. The expression of p53 has been analyzed to predict clinical outcome in a variety of cancer types, including rectal cancer. Patients with lower nuclear p53 have a better response to preoperative radiotherapy than patients with positive p53 nuclear expression (Adell et al 1999). While mutation o f p53 may be most directly responsible for tumorigenesis, polymorphism in the p53 gene may play a role in cancer progression and clinical outcome in cancer patients. 29 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Patients with a less active p53 enzyme may be more prone to cell death via DNA damage from chemoradiotherapy, and hence may respond to therapy more readily than patients with a normally functioning p53 protein. Two common polymorphisms in the p53 gene have been described, with both affecting activity of the p53 protein. The first polymorphism is an Arg/Pro shift located at codon 72. This protein domain is required for the growth arrest functions o f p53 (Walker et al 1996). The Arg variant has been shown to increase apoptotic capability in vitro in comparison to the Pro variant. This polymorphism has also been associated with response to chemotherapy or clinical outcome both in vitro and in vivo in head and neck cancer, endometrial cancer, and breast cancer (Wegman et al 2006, Saffari et al 2005, Sullivan et al 2004). Another polymorphism in the p53 gene is located at nucleotide 13964. This polymorphism has been examined in vitro and is known to alter cell survival and response to chemotherapy in cancer cell lines (Lehman et al 2000). Cyclin D1 is a member of the cyclin family o f regulatory proteins, whose main function is to bind cyclin dependent kinases (cdk) and promote progression through the cell cycle. CCND1 is an oncogene, due to its positive regulation of cell cycle activity, and heavy implication in cancer development. A gain of function mutation in the CCND1 gene can be one of the two hits in tumorigenesis. CCND1 is the main enzyme responsible for exit from G1 phase and entry into S phase of the cell cycle (Sherr 1996). Therefore, increased activity of this enzyme may result in an increased rate of cell cycle 30 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. progression, leading to more cell division and tumor growth. The mechanism of CCND1 action in vivo is still under investigation; studies examining protein expression levels of CCND1 in colorectal cancer have produced a wide assortment of results, implicating high CCND1 expression as either a marker for good prognosis or poor prognosis, or as an inadequate marker for prognosis (McKay et al 2000, McKay et al 2002, Palmqvist et al 1998). Few studies have been conducted examining mRNA levels of CCND1 in colorectal cancer; one such study found that increased gene expression was associated with poor prognosis (Oda et al 1999). CCND1 expression has previously been characterized in a variety of cancer types, including lung, head and neck, and breast. As with colorectal cancer, examination of CCND1 expression in other cancer types yields heterogeneous results, indicating that the role of CCND1 in cancer progression is complex and warrants further investigation (Kenny et al 1999, Utsumi et al 2000, Kornmann et al 1998). A polymorphism in exon 4 of the cyclin D1 gene results in an A>G shift at codon 241. This polymorphism lies at the exon4/intron 4 boundary, and results in an alternative transcript that does not splice at the boundary (Betticher et al 1995). This polymorphism has been associated with patient prognosis and tumor differentiation in head and neck cancer (Matthias et al 1998). It has also been associated with prognosis in breast cancer and non-small cell lung cancer, as well as with colorectal cancer risk (Betticher et al 1995, Shu et al 2005, Le Marchand et al 2003). 31 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Genes included in the drug metabolism category include thymidylate synthase (TS), glutathione S-transferase pi, (GSTP1), glutathione S-transferase tau (GSTT1), and glutathione S-transferase mu (GSTM1). Despite recent advancements in drug development, 5-fluorouracil, which has been available for almost 50 years, remains a central drug in the treatment of colorectal cancer. 5-fluorouracil acts by inhibiting thymidylate synthase (TS), a key enzyme in the pathway of deoxythymidine 5’-monophosphate (dTMP) synthesis from deoxyuridine 5’-monophosphate (dUMP). TS normally acts by catalyzing conversion of dUMP to dTMP, and subsequent incorporation into DNA. 5-FU is converted to its active metabolite, FdUMP and competes with dUMP for TS occupation, forming a stable complex with TS. Thymidine synthesis is thus inhibited, resulting in inhibition o f DNA synthesis and DNA repair. This cytotoxic therapy becomes most important in rapidly dividing cells which are actively synthesizing DNA. Epithelial cells of the colon in particular are sensitive to 5-FU therapy. Because of its direct correlation with TS, 5-FU efficacy may be compromised among patients with high TS levels and activity. Altered gene and protein expression levels of the TS gene have been investigated for differential response rates to 5-FU therapy. A study by Johnston et al found that TS gene expression and protein expression levels were inversely correlated with response to 5-FU chemotherapy among colorectal gastric cancer patients (Johnston et al 1995). A study by Aschele et al found that advanced colorectal cancer patients with high TS levels had a poor response to chemotherapy, shorter time to 32 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. tumor progression, and shorter overall survival compared with patients with low TS (Aschele et al 1999). A gene expression study by Salonga et al found that low TS expression levels were predictive of response when analyzed in combination with dihydropyrimidine dehydrogenase gene expression levels (Salonga et al 2000). These alterations in TS activity and gene expression may be attributed to polymorphic variants within the TS gene. Polymorphisms leading to altered function or activity levels of the TS enzyme have been associated with altered response to 5-FU chemotherapy. One polymorphic sequence of the TS gene has been described in the 5’ untranslated region, containing a series o f 28bp tandem repeats. The majority of patients carry either 2 (2R) or 3 (3R) repeats of this 28bp sequence; these variants have thus been the most intensively studied. The 3R/3R genotype has been associated with increased TS mRNA levels (Horie et al 1995, Pullarkat et al 2001). The study by Pullarkat et al found that patients carrying 2R/2R genotypes had significantly lower TS mRNA levels than 2R/3R or 3R/3R patients. They also found that TS mRNA expression in tumor tissue was 2.45- fold higher than in adjacent normal liver tissue. This difference between tumor and normal tissue was also significantly associated with TS genotype. The 3R/3R genotype has also been associated with increased TS protein expression in colorectal cancer patients (Kawakami et al 1999). Several studies have since correlated the increased expression activity of the 3R allele with clinical outcome in colorectal cancer patients treated with 5-FU. The majority of studies have found 3R allele to be associated with poor outcome when measuring 33 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. toxicity, tumor response, time to tumor progression, or overall survival. For example, a study by Chen et al examined prospectively the role of TS as a prognostic marker in 270 colorectal cancer patients. They found that patients carrying the 2R/2R genotype experienced increased overall survival (Chen et al 2000). In contrast, a study by Jakobsen et al examined TS 3R/2R polymorphism retrospectively in 88 patients with metastatic colorectal cancer and prospectively in 51 patients with metastatic colorectal cancer (Jakobsen et al 2005). Their results showed that patients carrying the 3R/3R allele have better response to 5- FU treatment and a longer time to tumor progression. However, these results only reached statistical significance when 3R/3R patients were compared against the combined group of 2R/3R and 2R/2R, not individually. Regardless, this study finds clinically opposite findings for the effect o f the 3R polymorphism, indicating that its exact function is still undetermined. There is a single nucleotide polymorphism (SNP) that has been described within the 5’ YNTR polymorphism. The C variant o f this polymorphism was initially found to down-regulate TS transcription relative to the G allele (Mandola et al 2003). This G-C SNP has been shown to be predictive of response in 5-FU based treatment of colorectal cancer patients (Marcuello et al 2004). In vitro studies have found that the 3R-G combination results in increased translatability o f the TS mRNA (Kawakami et al 2003). This polymorphism combination was found to be predictive of clinical outcome among 258 Japanese patients with colorectal cancer receiving oral fluoropyrimadine therapy (Kawakami et al 2003). Patients carrying one or 34 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. both 3G alleles, which was considered the high expression allele, had significantly decreased survival when compared to patients not carrying the 3G allele. Another polymorphism in the thymidylate synthase gene is a 6-bp insertion/deletion located in the 3 ’ UTR of the TS transcript. The deletion polymorphism has been associated with decreased mRNA stability and increased rate of mRNA decay in vitro (Mandola et al 2004), indicating that overall TS mRNA levels are decreased. Due to a lack of unified findings on the TS polymorphisms, the logical conclusion is that all three polymorphisms must be examined simultaneously to determine overall effect on TS expression levels and activity. A comprehensive analysis may help to explain why some patients who carry one polymorphism that indicates low TS expression, for instance the 2R allele, in fact have high TS activity. Studies examining this have unfortunately not found a conclusive and encompassing genotype of the TS gene that will predict with high efficacy and reproducibility both TS activity and clinical outcome. A recent study by Dotor et al examined all three polymorphisms as prognostic factors in 129 5FU-treated colorectal cancer patients (Dotor et al 2006). Individual analyses of the polymorphisms indicated that the 6bp deletion and the 3R/3R genotype were significant prognostic markers. Haplotype analysis from germline DNA showed that patients carrying 3R/-6bp haplotype had increased survival benefit. Analysis of the 3R G<C SNP did not yield statistically significant results, alone or in combination with the other polymorphisms. 35 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. The GST super-family of enzymes is involved in cellular defense, including detoxification of platinum compounds (Goto et al 1999). Therefore, altered activity o f genes in this family may have an impact on tumor response to platinum treatment and host toxicity, as well as other clinical endpoints. The GSTP-1 enzyme in particular has been studied extensively to determine its potential role in treatment outcome. The role of GSTP-1 specifically in oxaliplatin detoxification is still controversial. A study by Arnould et al found no correlation between GSTP-1 activity levels and cytotoxicity of oxaliplatin in colon cancer cell lines (Arnould et al 2003). GSTP-1 is overexpressed in colon cancer tissue, and increased drug resistance has been associated with high levels of GSTP-1 (Moscow et al 1989, Tsuchida et al 1992). Therefore, polymorphisms that alter expression or activity levels of GSTP-1 may be predictive of drug resistance or efficacy. A functional polymorphism is located in exon 5 of the GSTP-1 gene at codon 105; the polymorphism results in an Ile->Val shift, and is associated with decreased enzyme activity (Watson et al 1998). Several studies have examined the potential role of the GSTP-1 polymorphism in oxaliplatin-treated colorectal cancer. GSTP-1 Ilel05Val polymorphism is predictive o f survival in metastatic colorectal cancer patients treated with 5FU/oxaliplatin, with the allele leading to lower enzyme activity resulting in increased survival (Stoehlmacher et al 2002). These results were confirmed in multivariate analyses by the same group, in which GSTP-1 36 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. polymorphism was associated with both survival and time to tumor progression in oxaliplatin-treated refractory colorectal cancer patients (Stoehlmacher et al 2004). These results suggest that patients carrying the Val allele, which results in decreased enzyme activity, may experience an increased therapeutic effect of oxaliplatin due to decreased detoxification o f the drug. The involvement of GSTP-1 in drug detoxification indicates it may have an effect on toxicity levels in patients receiving oxaliplatin. A study by Grothey et al found that the GSTP-1 Ilel05Val polymorphism was associated with neurotoxicity in a group of 299 patients receiving 5-FU/oxaliplatin (Grothey et al 2005). The GSTM1 and GSTT1 genes have been associated with cancer risk in a variety of cancer types, including lung, colon, and breast (Malats et al 2000, Ates et al 2005, Park et al 2003). However, studies examining the roles o f these polymorphisms with respect to clinical outcome have not detected significant associations (Yang et al 2005, Stoehlmacher et al 2002). The deletion polymorphisms contained within the two genes are associated with a null allele resulting in abolished enzyme activity. (London et al 1995, Bruhn et al 1998). Among smokers, the GSTT1 and GSTM1 null alleles have been associated with increased chromosomal aberrations (van Poppel et al 1992, Tuimala et al 2004). Given the central role of these enzymes in cellular detoxification, however, the possibility that they may impact therapeutic efficacy should not be discounted. 37 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Chapter 2: Introduction The American Cancer Society estimated that in 2005 there would be 40,300 new cases of adenocarcinoma of the rectum, with an overall 5-year survival rate for approximately 50% of the patients with this disease (Jemal et al 2005). Adjuvant and neoadjuvant chemoradiation have generally been accepted in the United States and Canada as standard therapy for patients with cancer of the rectum. For patients with stage II or III rectal cancer, the combination of adjuvant chemoradiation therapy has been shown to ameliorate survival compared to surgery alone (Douglass et al 1986) or surgery plus radiation therapy (Krook et al 1991). However, rectal cancer remains a major problem due to failure of therapy leading to tumor recurrence. Although the addition of adjuvant therapy to surgical resection for adenocarcinoma of the rectum has been shown to improve local and systemic control, the efficacy of chemoradiation is limited due to significant inter-individual variations in response and host toxicity. In the post-genomic era, the possibility of individualizing cancer treatment is gaining wide acceptance, and numerous germ-line polymorphisms that may influence differential enzyme function or expression, and clinical responses to chemotherapy have been identified (Pullarkat et al 2001, Evans et al 1999, Nebert et al 1997, Stoehlmacher et al 2004). One o f the remaining challenges is to identify key molecular markers that predict clinical outcome to chemotherapy and/or radiotherapy. We examined 21 germ-line polymorphisms to see if they would predict recurrence in chemoradiation-treated rectal 38 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. cancer patients. These 21 polymorphisms are located in 18 genes involved in various pathways significant to cancer progression: tumor microenvironment, drug metabolism, cell cycle regulation, and DNA repair. Tumor microenvironment is a critical pathway in cancer progression and metastasis. Elements of cancer progression controlled by tumor microenvironment genes include angiogenesis, inter-cellular adhesion, mitogenesis, and inflammation. Angiogenesis, which involves the formation of new capillaries from preexisting vessels, has been characterized by a complex surge of events involving extensive interchange between cells, soluble factors (e.g. cytokines), and extracellular matrix (ECM) components (Balasubramanian et al 2002). Angiogenesis is known to be deregulated in cancer formation, and is central to tumor growth (Folkman et al 2002). Improvement in the therapeutic ratio o f radiation by targeting tumor cells via a combination o f angiogenic blockades and radiotherapy have been implicated in recent studies (Gorski et al 1999, Mauceri et al 1996, Mauceri et al 1998). However, the mechanisms by which tumor cells respond to radiation through these antiangiogenic/vascular agents are yet to be elucidated. The interleukin family is known to play an important role in the angiogenic process. Interleukin-8, an inflammatory cytokine with angiogenic potential, has been implicated in cancer progression in a variety of cancer types including colorectal carcinoma, glioblastoma, and melanoma (Yuan et al 2000). Additionally, elevated serum levels of interleukin-8 are associated with prognosis in colorectal cancer (Ueda et al 1994). 39 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Inter-cellular adhesion plays a major role in both local invasion and metastasis. Cell adhesion molecules (CAMs), which are cell-surface glycoproteins that are crucial for cell-to-cell interactions, have been shown to directly control differentiation, and interruption of normal cell-to-cell contacts has been observed in neoplastic transformation and in metastasis (Edelman 1988, Ruoslahti et al 1988). Overexpression o f intercellular adhesion molecule-1 (ICAM-1) in colorectal cancers has been shown to favor the extravasation and trafficking of cytotoxic lymphocytes toward the neoplastic cells, leading to host defense (Maurer et al 1998). Another protein involved in the tumor microenvironment is Cox-2, an enzyme implicated in the development o f colorectal cancer. Cox-2 is involved in prostaglandin synthesis, and stimulates inflammation and mitogenesis; it has been shown to be markedly overexpressed in colorectal adenomas and adenocarcinomas when compared to normal mucosa (Eberhart et al 1994). Another family of genes playing a critical role in angiogenesis is the receptor tyrosine kinase family of fibroblast growth factor receptors. FGFRs are also involved in tumor growth and cell migration (Bange et al 2002). The complex pathways of the tumor microenvironment have become the focus of widespread investigation for their role in tumor progression. Results from previous studies suggest that our candidate genes may play a major role in the principal pathways of cancer progression and recurrence, and that the corresponding germ-line polymorphisms may lead to significant differences at transcriptional and/or translational levels. Given such 40 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. biochemical evidence, we examined a panel o f germ-line polymorphisms of genes involved in drug metabolism, DNA repair, tumor microenvironment, and cell cycle regulation. We tested whether these polymorphisms, individually or in combination, may predict tumor recurrence in patients with rectal cancer treated with chemoradiation. Chapter 3: Patients and Methods Eligible Subjects The analyses of the present study were performed based on results from 90 patients diagnosed with stage II or III rectal cancer. This study was investigated at the Norris Comprehensive Cancer Center and approved by the Institutional Review Board (IRB) of the University of Southern California for Medical Sciences. A tumor was considered to be a rectal cancer if a portion of the tumor was situated below the peritoneal reflection or if the lower margin of tumor was within 12 cm of the anal verge on endoscopy (Tepper JE et al 2002). Out of 90 patients, 67 were treated with adjuvant infusional 5-FU chemotherapy combined with pelvic radiation. Twenty-three patients were treated with neo adjuvant chemoradiation therapy. Pelvic irradiation was given as a dose o f 45 Gy to the whole pelvis and an additional boost up to a total o f 54Gy (range 50.4- 54). During radiation, patients received 5-FU either as a 4-day infusion (lOOOmg/m ) at the beginning and end of radiation treatment or as daily continuous infusion (200 mg/m2). Age, ethnicity, and follow-up information for 41 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. each subject were obtained from retrospective chart reviews, and all patients in the study signed informed consent. Of the 90 subjects in this study, 59 were treated exclusively at the University of Southern California Norris Cancer Center or University of Southern California/Los Angeles County Hospital. Twenty o f these 59 patients (34%) experienced recurrence. The remaining 31 patients were originally treated at an outside facility and referred to USC/Norris for treatment of recurrent disease or for check-up. Genotyping Tissue samples were collected and genomic DNA was extracted from paraffin-embedded tissue using the QiaAmp kit (Qiagen, Valencia, CA). All samples were analyzed using PCR-RFLP-based technique. PCR reaction volume was 50pL. After restriction enzyme digestion, resulting PCR fragments were visualized in 3-4% ethidium bromide stained agarose gel. Primer sequences, restriction enzymes, and references for genotype analyses are given in Table 1. 42 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Table 1. Primer sequences and functional significance o f the germ-line polymorphisms o f genes involved in the principal pathways o f cancer progression Prim er Sequences Restriction Polymorphisms Enzymes (Localization) Functional Significance D rug M etabolism TS 5' U TR [Forward] [Reverse] TS 5' G _C SNP [Forward] [Reverse] TS 3' U TR [Forward] [Reverse] GSTM1 [Forward] [Reverse] GSTT1 [Forward] [Reverse] GSTP1-105 [Forward] [Reverse] DNA Repair E RCC1-118 [Forward] [Reverse] XRCC3 [Forward] 5'-GAAAAGGCGCGCGGAAGG-3' 5‘ -GCTCCGAGCCGGCCACA-3' 5'-GAAAAGGCGCGCGGAAGG-3' 5-GCTCCGAGCCGGCCACA -3' 5’-CAAATCTGAGGGAGCTGAGT-3' 5-CAGA TAAGTG GCAGTACAGA -3’ 5'-GAACTCCCTGAAAAGCTAAAGC-3’ 5'-GTTGGGCTCAAATATACGGTGG-3' 5'-TTCCTTACTGGTCCTCACATCTC-3' 5’-TC ACCGGATC ATGGCC AGC A-3' 5-A CCCCA GGGCTCTATGGG AA-3' 5'-TGAGGGCACAAGAAGCCCCT-3* 5 '-GC AGAGCTC ACCTGAGGAAC-3 ’ 5'-GAGGTGCAAGAAGAGGTGGA-3’ 5-G CCTGGTGGTCATCGACTC-3' [Reverse] ACAGGGCTCTGGAAGGCACTGCTCAGCTCACGCACC-3 APE1 [Forward] 5'-CTGTTTCATTTCTATAGGCTA-3' 5'-AGGAACTTGCGAAAGGCTTC-3' [Reverse] RAD51 [Forward] [Reverse] Tumor M icroenvironment IL-8 [Forward] [Reverse] MMP-3 [Forward] [Reverse] VEGF-936 [Forward] [Reverse] TG F-p [Forward] [Reverse] FGFR4 [Forward] [Reverse] IL-10 (-1082) [Forward] [Reverse] Cox-2 [Forward] [Reverse] ICAM-1 [Forward] [Reverse] Cell Cycle Regulation p53 (13964” ) [Forward] [Reverse] p53 (codon 72) [Forward] [Reverse] CCND1 [Forward] [Reverse] 5-TG GGAACTGCAA CTCATCTGG -3’ 5'-GCGCTCCTCTCTCCAGCAG-3' 5TTGTTCTA ACA CCTGCCACTCT3' 5'GGCAAACCTGAGTCATCACA3' 5'-GGTTCTCCATTCCTTTGATGGGGGGAAAGA-3' 5'-CTTCCTGGAATTCACATCACTGCCACCACT-3' M fel 5-AAGGAAGAGGAGACTCTGCGCAGAGC-3' TAA ATGTATG TATGTG GGTGGG TGTGTCTACAG G-3’ 5'-TGCCGCCCTCCGGGCTGCGGCTGCGGC-3' 5'-TCTTGCAGGTGGATAGTCCCGCGGTCGG-3' 5'-GACCGCAGCAGCGCCCGAGGCCAG-3' 5-AGAGGGAAGAGGGAGAGCTTCTG-3 ’ 5’ -CTCGCTGCAACCCAACTGGC-3' 5'-TCTTACCTATCCCTACTTCC-3’ 5-A CAGGGTAACTGCTTAGGACCA-3' 5'-AATACTGTTCTCCGTACCTTCACC-3’ 5'-CCATCGGGGAATCAGTG-3' 5’ -ACAGAGCACATTCACGGTC-3’ 5'-CTTGCCACAGGTCTCCCCAA-3' 5 -T GT GC AGGGT GGC A AGT GGC-3' 5'-ACAAGGGTTGGGCTGGGACCTGGAG-3' 5'-TGAGGGTGTGATGGGATGGATA AAAGC-31 5'-GTGAAGTTCATTTCCAATCCGC-3' 5-GGGACATCACCCTCACTTAC-31 Msp I 2R/3R (28bp repeat, 5’ UTR) Change in expression Horie et a Change in transcriptional M andolaetal activity 6+ /6- (6bp deletion, 3' UTR) M +/M - (deletion) T+/T- (deletion) Ile/Val (Exon 5) C/T (Exon 118) Thr241M et (Exon 7) A spl48G lu G/C (5’ UTR) T/A Unknown Ulrich et al Nla HI Abolished activity Arand et al Abolished activity Arand et al Change in Activity H arries et al Change in expression Park et al Change in DNA adduct Matullo et al level T th lll I Gly/Arg G/A G/C K469E (T/C) G/C (intron 6) A rg/Pro (G/C) G/A (exon 4) Unknown Levy-Lahad et al Change in expression Hull et al in vitro Change in Prom oter Gnasso et al activity Change in Plasma level Renner et al Change in Serum level Ziv et al Change in tumor Bange et al cell motility Change in Gene Edwards-Smith et a expression C hange in Gene Papafili et a expression Unknown Matsuzawa et a Change in Mutant gene expression Altered splicing Betticher et al 43 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Statistical analysis In this analysis, recurrence status was categorized into two groups: (1) having recurrence within 5 years of completion of chemoradiation; (2) being recurrence-free within 5 years of completion of chemoradiation. The associations of recurrence with demographic characteristics, clinicopathological variables, type of therapy, and polymorphism variables were summarized using contingency tables and were formally tested by Fisher’s exact tests. In addition, a classification and regression tree (CART) method based on recursive partitioning (RP) was used to explore gene polymorphisms for identifying homogenous subgroups for recurrence after completion of chemoradiation (Breiman L et al 1984, Cook NR et al 2004). RP analysis is a nonparametric statistical method for modeling a response variable and multiple predictors. RP analysis includes two essential processes: tree-growing and tree pruning. RP analysis included all patients with any gene polymorphism variables available, as well as TNM stage (n=90). All reported P values were two-sided. All analyses were performed using the SAS statistical package version 9.0 (SAS Institute Inc. Cary, NC), and CART 5.0 (Steinberg et al 1995). Chapter 4: Results Patients We obtained paraffin-embedded tissue samples from the aforementioned 90 patients for the genotype analysis. This group of 90 patients included 34 44 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. (38%) women and 56 (62%) men (Table 2). Median age was 52 years (range 25 - 79 years). Ethnic backgrounds were: 68% (61/90) Caucasian and 32% (29/90) others. Neoadjuvant radiotherapy was given to 23 patients and postoperative adjuvant radiotherapy to 67 patients. Twenty-five percent (23/90) had T2 and 75% (67/90) of the study participants had T3 tumor stages. Additionally, 82% (74/90) o f patients had grade I/II tumors and 18% (16/90) had grade III. Furthermore, 49% (44/90) were NO, 37% (33/90) were N l, and 14% (13/90) were N2 for node status. Fifty-one percent (46/90) of participants had tumor recurrences. Twelve (13%) patients developed distant metastases but did not have local recurrence. Thirty-four patients (38%) developed local recurrence. There were no significant differences in age, sex, race, T stage, N stage, grade, type of surgery, and therapy between patients treated exclusively at USC (n=59) and patients originally treated at an outside facility and referred to USC for treatment of recurrent disease or follow-up (n=31). 26 out of 31 referred patients developed recurrence versus 20 out o f 59 USC patients due to referring options. Risk o f recurrence analysis—Clinical Characteristics Age, gender, and ethnicity were not associated with tumor recurrence (Table 2). We observed an association between node status and recurrence (p=0.02, Fisher’s exact test), but there was no significant correlation between tumor grade, T-stage, or surgery type and recurrence. O f the eligible study participants, results from the assays for the aforementioned polymorphisms could be obtained as follows: TGFB: 89 45 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. patients; VEGF, p53 codon72: 88 patients; TS 5’UTR, GSTM1, GSTP1-105, APE1, RAD51, MMP3, COX-2, ICAM-1, p53-13964, CCND1: 87 patients; TS5’SNP, TS3’UTR, GSTT1, XRCC3, FGFR4: 86 patients; IL-8: 77 patients. Variability in patient numbers was due to quality of gDNA extracted from paraffin-embedded tissue. Association between polymorphisms and clinical characteristics Evaluation of polymorphisms revealed the following association with demographic and clinical variables: ERCC1-118 and race (p<0.001); XRCC3 and race (p=0.012); APE1 and node status (p=0.041); p53 (13964G C ) and node status (p=0.006); p53 (13964G C ) and grade (p=0.043). Univariate Analysis o f polymorphisms and tumor recurrence IL-8 polymorphism was significantly correlated with risk of recurrence (Table 3). Assessment of Cox-2, GSTP-1 and TGF-B polymorphisms indicated a trend for association with recurrence. Analyses of the remaining polymorphisms failed to individually show significant association with recurrence. IL-8. IL-8 genotype distribution was as follows: 42% (32/77) had T/T allele, 48% (37/77) were heterozygous A/T, and 10% (8/77) had A/A allele. Thirty-eight percent of patients carrying T/T genotype experienced recurrence (12/32), 57% of patients who were heterozygous experienced recurrence (21/37), and 88% of patients homozygous for the A allele experienced recurrence (7/8). Patients with A/A genotype were at increased risk for recurrence (p=0.029). 46 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Cox-2. The Cox-2 genotype distribution was as follows: 84% (73/87) had G/G, 16% (14/87) had G/C, and 0% (0/89) had C/C genotypes. Fifty-six percent (41/73) of the patients with homozygous G allele and 29% (4/14) o f those with heterozygous genotype showed evidence o f recurrence, respectively. Therefore, possession of C allele was associated with decreased risk for recurrence (p=0.081). GSTP1-105. The GSTP-1 genotype distribution was as follows: 44% (38/87) carried homozygous 1 0 5 Ile/1 0 5 Ile, 7% (6/87) carried homozygous 1 0 5 Val/1 0 5 Val and 49% (43/87) patients were heterozygous. Tumor recurrence was observed in 83% (5/6) of the patients with 1 0 5 V al/1 0 5 Val genotype, while 58% (22/38) o f those with 1 0 5 Ile/1 0 5 Ile genotype and 42% (18/43) of those heterozygous showed evidence of tumor recurrence. Patients with 1 0 5 Val/1 0 5 Val genotype were at increased risk for tumor recurrence (p=0.089). TGF-B. Thirty-five out of 89 (39%) patients were homozygous T/T. Forty patients were heterozygous C/T (45%), and 14 were homozygous C/C (16%). Tumor recurrence occurred in 13 of 36 T/T carriers (37%), 24/40 C/T carriers (60%), and 8 of 14 C/C carriers (57%). Patients carrying C allele experienced more recurrence (p=0.12). 47 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Table2. Local recurrence in rectal cancer based on demographic and clinical parameters Parameter n Recurrence Recurrence-free P valu ea Age, years <50 35 19 (54%) 16 (46%) 0.67 >50 55 27 (49%) 28 (51%) Sex Male 56 32 (57%) 24 (43%) 0.19 Female 34 14(41% ) 20 (59%) Ethnicity White 61 33 (54%) 28 (46%) 0.50 Other 29 13 (45%) 16 (55%) pT pT2 23 11 (48%) 12 (52%) 0.81 pT3 67 35 (52%) 32 (48%) pN NO 44 18(41% ) 26 (59%) 0.020 N1 33 17 (52%) 16 (48%) N2 13 11 (85%) 2(15% ) Grade I-II 74 37 (50%) 37 (50%) 0.78 III 16 9 (56%) 7 (44%) Surgery Typeb APR 26 15 (58%) 11 (42%) 0.49 LAR 55 28 (51%) 27 (49%) TR 9 3 (33%) 6 (67%) Therapy Adjuvant 67 34 (51%) 33 (49%) 1.00 Neoadjuvant 23 12 (52%) 11 (48%) a. Based on the Fisher’s exact test c. APR, abdominal perineal resection; LAR, lower anterior resection; TR, transanal resection Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Table 3. Association between polymorphisms of genes involved in the principle pathways of cancer progression and recurrence in patients with rectal cancer treated with 5-FU based chemoradiation Factor n Recurrence Recurrence-free P value Drue Metabolism TS 5' UTR 3R/3R 18 9 (50%) 9 (50%) 0.54 2R/3R 56 31 (55%) 25 (45%) 2R/2R 13 5 (38%) 8 (62%) TS 5' G->C SNP Low 38 20 (53%) 18(47% ) 1.00 High 48 25 (52%) 23 (48%) TS 3' UTR 6bp+/6bp+ 21 9 (43%) 12 (57%) 0.73 6bp+/6bp- 35 19(54% ) 16(46% ) 6bp-/6bp- 30 15(50% ) 15(50% ) GSTM1 M+ 42 19(45% ) 23 (55%) 0.29 M- 45 26 (58%) 19(42% ) GSTT1 T+ 42 20 (48%) 22 (52%) 0.67 T- 44 24 (55%) 20 (45%) GSTP1-105 Ile/Ile 38 22 (58%) 16(42% ) 0.089 Ile/Val 43 18(42% ) 25 (58%) Val/Val 6 5 (83%) 1 (17%) DNA repair ERCC1-118 C/C 23 12 (52%) 11 (48%) 0.24 C/T 48 21 (44%) 27 (56%) T/T 16 11 (69%) 5(31% ) XRCC3 Thr/Thr 39 19(49% ) 20 (51%) 0.50 Thr/Met 30 14 (47%) 16 (53%) Met/Met 17 11 (65%) 6 (35%) APE1 Asp/Asp 27 13 (48%) 14 (52%) 0.44 Asp/Glu 47 23 (49%) 24 (51%) Glu/Glu 13 9 (69%) 4(31% ) RAD51 G/G 60 32 (53%) 28 (47%) 0.94 G/C 19 9 (47%) 10(53% ) C/C 8 4 (50%) 4 (50%) 49 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Table 3: Continued Tumor Microenvironment MMP-3 6A/6A 25 11 (44%) 14 (56%) 5A/6A 46 24 (52%) 22 (48%) 5A/5A 16 10 (63%) 6 (38%) VEGF-936 C/C 56 30 (54%) 26 (46%) C/T 28 15(54% ) 13 (46%) T/T 4 0 (0%) 4 (100%) TGF-|3 T/T 35 13 (37%) 22 (63%) C/T 40 24 (60%) 16 (40%) C/C 14 8 (57%) 6 (43%) FGFR4 Gly/Gly 32 14 (44%) 18(56% ) Gly/Arg 38 23 (61%) 15(39% ) Arg/Arg 16 7 (44%) 9 (56%) IL-10(-1082) A/A 35 17(49% ) 18(51% ) G/A 39 18(46% ) 21 (54%) G/G 13 10(77% ) 3 (23%) COX-2 G/G 73 41 (56%) 32 (44%) G/C 14 4 (29%) 10(71% ) ICAM-1 C/C 24 9(38% ) 15(63% ) C/T 35 18(51% ) 17(49% ) T/T 28 18(64% ) 10 (36%) IL8 T/T 32 12(38% ) 20 (63%) A/T 37 21 (57%) 16 (43%) A/A 8 7 (88%) 1 (13%) 0.52 0.15 0.12 0.33 0.14 0.081 0.16 0.029 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Table 3: Continued Cell Cycle Regulation p53 (13964GC) G/G 74 C/G 13 p53 (codon 72) Pro/Pro 37 Arg/Pro 43 Arg/Arg 8 CCND1 G/G 25 A/G 46 A/A 16 41 (55%) 33 (45%) 4(31% ) 9(69% ) 20 (54%) 17 (46%) 21(49% ) 22(51% ) 4 (50%) 4 (50%) 17 (68%) 8 (32%) 21(46% ) 25 (54%) 7 (44%) 9 (56%) 0.14 0.90 0.16 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Recursive Partitioning (RP) analysis o f recurrence The 21 genomic polymorphism variables as well as TNM (tumor, node, metastasis) classification were considered in the RP analysis (a total of 23 predictors). The classification tree for recurrence is shown in Fig 1. The first split was based on lymph node status, with the best cutoff NO or N1 versus N2. For patients with N2, no further subgroups could be identified. Among those with NO or N1 the next division was according to IL-8 genotype. For patients with A/A or A/T of IL-8 further splits were made with ICAM-1, TGF-P, and FGFR4 polymorphisms. The polymorphisms of 4 genes involved in tumor microenvironment in addition to lymph node status were chosen as splits to classify patients in terms of recurrence probability. Six terminal nodes were fit. The high risk group for recurrence included Group 1, Group 2, and Group 6. The low probability group for recurrence included Group 3, Group 4, and Group 5. 52 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. (n=90) NOorN N2 IL-8 (n=77) Group 6 11/13 (85%) T/T A/A or A/T ICAM-1 (n=47) Group 5 9/30 (30%) C/C or C/T T/T TGF-p (n=30) Group 1 13/17 (76%) C/C or CT T/T Group 4 2/13 (15%) FGFR4 (n=17) Gly/Arg or Arg/Arg, Gly/Gly Group 2 9/11 (82%) Group 3 2/6 (33%) Figure 1. Classification tree of genomic polymorphisms and clinical characteristics for recurrence status. Fractions indicate patients who had recurrence vs. total number of patients and recurrence percentage in parentheses. Squares represent terminal nodes; circles represent intermediate subgroups. Shaded squares represent subgroups with high risk of recurrence, non-shaded squares represent low risk. Red genotypes indicate higher-risk genotypes; green genotypes indicate lower-risk genotypes. 53 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Chapter 5: Discussion While adjuvant and neoadjuvant chemoradiation lead to a noticeable improvement in local and systemic control among those with rectal carcinoma, the choice of optimal therapy may be compromised by a wide inter-patient variability of treatment response and host toxicity. The purpose of this study was to evaluate the influence of genomic variations on different cellular mechanisms that may modify therapy efficacy and to characterize patients at increased risk for tumor recurrence. Here, we have identified a germ-line polymorphism in the IL-8 gene that may be individually associated with tumor recurrence in patients with rectal cancer treated with chemoradiation. In addition to univariate analyses, we utilized an unbiased comprehensive approach (CART analysis) to prioritize the univariate analyses since multivariate analyses in this small patient size would not be reasonable. Using CART analysis we were able to stratify patient risk of recurrence based on tumor pathology as well as gene polymorphism. We found that patients presenting with N2 disease as well as unfavorable polymorphisms in the IL-8, ICAM-1, TGFB, and FGFR4 genes experienced significantly greater recurrence than patients without this profile. The angiogenic response in the microvasculature is associated with changes in cellular interactions between adjacent endothelial cells (ECs), pericytes, and surrounding ECM (Gupta et al 2003). Major regulators of angiogenesis and cell adhesion playing a role in cancer progression are IL-8, Cox-2, ICAM-1, TGF- fi, and FGFR4. 54 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Increased IL-8 expression has been associated with angiogenesis, advanced disease state, lymph node metastasis, shortened survival, and recurrence in non-small-cell lung cancer (Yuan et al 2000). In patients with colorectal cancer, an increase in serum IL-8 levels has been associated with lung or liver metastases (Ueda et al 1994). We found the IL-8 polymorphism to be significantly associated with risk of recurrence in both univariate analysis and in the regression-tree analysis, supporting the hypothesis that increased angiogenic potential is critical for tumor recurrence. Patients carrying the A variant allele, which has been associated with increased IL-8 expression in vitro (Hull et al 2000), experienced more recurrence than patients carrying homozygous T allele. Tumor recurrence can be attributed to a variety of different genes and pathways. Our study examined 21 polymorphisms in 18 genes to address the complexities involving tumor progression and recurrence. We used CART analysis to analyze all polymorphisms and TNM classification simultaneously and classify patients into low- and high-risk groups for tumor recurrence (Figure 1). CART analysis is advantageous in that it may be applied directly to a clinical setting because it is a practical and easy to understand method for stratifying patient risk. We developed a decision algorithm to screen for risk of recurrence using CART analysis. We found lymph node status to be the best stand-alone predictor of recurrence. Among patients with NO or N1 disease, those carrying the T/T allele of IL-8 had a better prognosis. 55 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Patients carrying the A allele in IL-8 were further distinguished by ICAM-1 polymorphism, with patients carrying T/T allele in a poor prognosis group. Mulder et al found that greater than 32% o f tumor cells from colorectal carcinoma patients displaying high expression of ICAM-1 were identified as having longer disease-free survival, implicating a protective effect of ICAM-1 protein (Vora et al 1994). However, the functional mechanism of the ICAM-1 polymorphism studied is unknown. This T->C polymorphism at position 469 results in a non-conservative amino acid substitution in the fifth immunoglobulin-like domain of ICAM-1 (Vora et al 1994). Our hypothesis is that patients with T alleles experienced more tumor recurrence due to the possibly decreased expression levels associated with this polymorphism. However, in vitro studies are needed to determine the functional mechanism of this ICAM-1 polymorphism. Those patients carrying C allele in ICAM-1 were further distinguished by TGF-B polymorphism. TGF-B is heavily implicated in a variety of cancer-related processes, including invasion and metastasis, angiogenesis, evasion of apoptosis, and cell proliferation (Elliott et al 2005). This T29->C SNP is associated with increased serum levels o f TGF-B (Yokota et al 2000). Tsushima et al found that TGF-B 1 plasma levels were significantly elevated in patients with colorectal cancer, and were correlated with tumor stage (Tsushima et al 1996). Another study found that colon cancer with high TGF-B protein expression had increased tumor recurrences compared to tumors with low TGF-B protein expression (Friedman et al 56 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 1995). We found that patients carrying the homozygous C allele or the heterozygous allele experienced more recurrence, which is associated with high TGF-B levels and consistent with previous findings. Patients carrying homozygous T allele in TGF-B were placed in a good prognosis group, while patients carrying C allele were further subdivided by FGFR4. FGFR4 is a member of the fibroblast growth factor receptor family, which contains 4 receptor tyrosine kinases involved in such cellular activities as angiogenesis, cell motility, and inflammation. We examined a SNP at codon 388, leading to a Gly-> Arg shift in the conserved transmembrane region. A previous study found that colorectal cancer patients carrying the Arg allele experienced greater lymph node involvement, higher tumor stage, and reduced overall survival (Bange et al 2002). In vitro data suggest that the FGFR4 Gly388 may be involved in an adhesion complex, with Arg388 possibly disrupting this complex, indicating a loss of function mutation (Bange et al 2002). Our study indicated that patients who were heterozygous at this locus were at greater risk of recurrence. Our findings support those of Bange et al, who found that breast cancer patients carrying the heterozygous genotype had shorter overall survival. The study also found that colon cancer patients carrying the Arg allele also had a significantly shorter overall survival compared with Gly/Gly patients. The FGFR4 gene is located on chromosome 5q. This chromosome is known to have loss of heterozygosity in the progression o f colorectal cancer (Solomon et al 1987, Losi et al 2005). The LOH on this 57 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. chromosome may have an impact on the FGFR4 gene, providing a potential explanation as to why heterozygous patients in our population have a poor prognosis. However, given the limited experimental data on the functional significance of this polymorphism and the fact that in our pilot study this polymorphism was only significant in the CART analysis, further in vitro and in vivo studies should be conducted on this polymorphism. CART analysis suggested the importance of the tumor microenvironment in association with tumor recurrence. In performing the analysis, we looked at all 21 polymorphisms simultaneously, and found that the four most statistically significant polymorphisms were all involved in the tumor microenvironment. The results were only based on statistical methodology, with no selection bias or exclusion o f genes. While these results do not discount the importance of the remaining 17 polymorphisms, they do present a convincing argument, in which angiogenesis and cell adhesion may be paramount in determining risk of recurrence in combination chemoradiation therapy. It is notable that there was a high recurrence rate among patients evaluated in this study. The high recurrence rate is due to bias by the fact that it is easier to identify patients with recurrence than patients without. The outside patients were referred to USC/Norris for treatment options because of their recurrence, and as such, there is an overall higher percentage of patients experiencing recurrence. This patient population has a higher recurrence rate because of these biases but the overall goal o f this study 58 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. was to identify a molecular signature in this patient population and validate it in a larger clinical trial setting. The ability to seek out patients who are at increased risk for experiencing tumor recurrence and/or those who may be more susceptible to clinical toxicity may significantly impact the development o f more effective but less toxic therapy regimens in the future. Our findings may contribute to identifying categories of high-risk patients and pathways which play a critical role in tumor recurrence as well as identifying novel targets for developing tailored treatment strategies. However, our results are based on a retrospective study and therefore, we are currently validating our preliminary results in a large prospective trial (SWOG 9304). Chapter 6: Future Directions The ultimate goal of pharmacogenomics in cancer is to affect treatment decisions in the clinic. This will be accomplished by giving the clinician another tool to examine the tumor. In addition to tumor pathology and patient history, genetic analysis will give a unique type of information to the clinician, allowing him to understand the potential behavior of the tumor at the molecular level, and predict its progression. With this added information, the clinician will stay one step further ahead o f the disease, and will ideally be able to administer the treatment with the maximum potential benefit for the individual patient. With the added knowledge of activity of enzymes that are directly involved in the pathways of specific therapies, 59 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. the patient will be spared unnecessary treatment and will have a tailored therapeutic regimen that will have the strongest impact on the tumor. Additionally, patients that have a genetic profile corresponding to potentially aggressive disease can be treated with the appropriate aggressive therapy. This study has selected a handful of genes that may directly influence an individual rectal cancer patient’s potential for recurrence o f disease. Obviously these are not the only genes and polymorphisms that may affect the clinical endpoint of risk of recurrence. As the thousands of polymorphisms contained within the human genome are identified and characterized, those that have functional importance and can alter protein activities and/or gene expression levels will be studied in more depth. As these polymorphisms are examined and the genes that contain them are better understood, we will have a better overall understanding of how and why individuals progress with cancer. This study is one of the first to examine the role of polymorphisms in recurrent rectal cancer, and hence the findings here are preliminary. Nonetheless, these findings have an impact in that they have laid a foundation for future studies and have examined some of the most prominent genes and polymorphisms known in colorectal cancer progression. This study was a retrospective analysis, which limits its statistical power. Additionally, the patient population was not homogeneous with respect to treatment or stage of disease. Therefore, designing prospective studies including larger patient populations enrolled in clinical trials with 60 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. uniformed treatment regimens are the next obvious steps in this field. We are currently validating the results of the present study in a larger prospective trial of rectal cancer patients (SWOG9304). The potential impact o f genomic profiling in cancer is far-reaching; affecting treatment decisions in the clinic is the goal in this field, and there is a very real potential benefit to be derived from gaining knowledge of the molecular behavior of a tumor. In 5-10 years, high-throughput microarray technology may be the preferred method of genotyping. With the advent of customizable chips, in addition to chips to test polymorphisms and gene expression, single nucleotide polymorphism genotyping using the RFLP method may become obsolete. Customizable SNP chips are currently being developed to quickly and efficiently genotype known polymorphisms. This technology, in theory, could eventually be used to simultaneously assay all the genes in this study. The development of these types of chips may be more likely when a set of genetic markers is firmly established as predictive and prognostic for rectal cancer, and other cancers. To this end, it is possible that microarray technology will be applied in the clinical setting. This technology may prove to be a fast and effective method to characterize each patient’s disease and subsequently tailor chemotherapy to the individual. 61 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Bibliography Adell G, Sun XF, Stal O, et al. p53 status: an indicator for the effect of preoperative radiotherapy of rectal cancer. Radiother Oncol 2: 169-174,1999. Arand M, Muhlbauer R, Hengstler J et al. A multiplex polymerase chain reaction protocol for the simultaneous analysis of the glutathione S-transferase GSTM1 and GSTT1 polymorphisms. Anal Biochem. 236: 184-186,1996. Amould S, Hennebelle I, Canal P, et al. Cellular determinants of oxaliplatin sensitivity in colon cancer cell lines. Eur J Cancer. 39: 112-119, 2003. Aschele C, Debemardis D, Casazza S, et al. Immunohistochemical quantitation of thymidylate synthase expression in colorectal cancer metastases predicts for clinical outcome to fluorouracil-based chemotherapy. J Clin Oncol. 17: 1760- 70, 1999. Ates NA, Tamer L, Ates C, et al. Glutathione S-transferase M l, T l, PI genotypes and risk for development of colorectal cancer. Biochem Genet. 43: 149-163,2005. Awad M, El-Gamel E, Hasleton P, et al. Genotypic variation in the transforming growth factor-betal gene: association with transforming growth factor betal production, fibrotic lung disease, and graft fibrosis after lung transplantation. Transplantation. 66: 1014-1020, 1998. Balasubramanian SP, Brown NJ, Reed MWR. Role of genetic polymorphisms in tumour angiogenesis. Br J Cancer 87: 1057-1065, 2002. Bange J, Prechtl D, Cheburkin Y, et al. Cancer progression and tumor cell motility are associated with the FGFR4 Arg388 allele. Cancer Res. 62: 840-847, 2002. Battat AC, Rouse RV, Dempsey L, et al. Institutional commitment to rectal cancer screening results in earlier-stage cancers on diagnosis. Ann Surg Oncol. 11:970-976, 2004. Baumann P, West SC. Role of the human RAD51 protein in homologous recombination and double-stranded-break repair. Trends Biochem Sci. 23: 247- 251,1998. Belli JA, Dicus GJ, Bonte FJ. Radiation response of mammalian tumor cells. Part 1. Repair of sublethal damage in vivo. J Natl Cancer Inst. 38: 673, 1967. 62 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Betticher DC, Thatcher N, Altermatt HJ, et al. Alternate splicing produces a novel cyclinD l transcript. Oncogene. 11: 1005-1011, 1995. Biros E, Kalina I, Kohut A et al. Germline polymorphisms of the tumor suppressor gene p53 and lung cancer. Lung Cancer. 31: 157-162, 2001. Bishop DK, Ear U, Bhattacharyya A, et al. Xrcc3 is required for assembly of Rad51 complexes in vivo. J Biol Chem 273: 21482-21488, 1998. Blasiak J, Przybylowska K, Czechowska A, et al. Analysis of the G/C polymorphism in the 5'-untranslated region of the RAD51 gene in breast cancer. Acta Biochim Pol. 50: 249-253, 2003. Brat DJ, Bellail AC, Van Meir EG. The role of interleukin-8 and its receptors in gliomagenesis and tumoral angiogenesis. Neuro-oncol. 7: 122-133, 2005. Breiman L, Friedman J, Olshen R, et al. Calssification and Regression Trees. Chapman & Hall (Wadsworth, Inc.), New York, NY, USA (1984). Brew R, Erikson JS, West DC, et al. Interleukin-8 as an autocrine growth factor for human colon carcinoma cells in vitro. Cytokine. 12: 78-85, 2000. Brew R, Southern SA, Flanagan BF, et al. Detection of interleukin-8 mRNA and protein in human colorectal carcinoma cells. Eur J Cancer. 32A: 2142-2147, 1996. Brosens LA, Iacobuzio-Donahue CA, Keller JJ, et al. Increased cyclooxygenase-2 expression in duodenal compared with colonic tissues in familial adenomatous polyposis and relationship to the -765G -> C COX-2 polymorphism. Clin Cancer Res. 11: 4090-4096, 2005. Bruhn C, Brockmoller J, Kerb R, et al. Concordance between enzyme activity and genotype of glutathione S-transferase theta (GSTT1). Biochem Pharmacol. 56: 1189-1193, 1998. Calistri D, Rengucci C, Seymour I, et al. Mutation analysis of p53, K-ras, and BRAF genes in colorectal cancer progression. J Cell Physiol. 204: 484-488, 2005. Carmeliet P. VEGF as a key mediator of angiogenesis in cancer. Oncology. 69: 4-10, 2005. Chaffey JT, Heilman S. Differing responses to radiation of murine bone marrow stem cells in relation to the cell cycle. Cancer Res. 31: 1613, 1971. 63 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Chen J, Hunter DJ, Meir J, et al. Polymorphism in the thymidylate synthase promoter enhancer regions modifies the risk and survival of colorectal cancer. Cancer Epidemiol. Biomark. Prev. 9: 1381-1385, 2000. Chong AS, Boussy IA, Jiang XL, et al. CD54/ICAM-1 is a costimulator of NK cell-mediated cytotoxicity. Cell Immunol. 157: 92-105,1994. Cook NR, Zee RY, Ridker PM. Tree and spline based association analyss of gene-gene interaction models for ischemic stroke. Stat Med. 23: 1439-1453, 2004. de las Penas R, Sanchez-Ronco M, Alberola Y, et al. Polymorphisms in DNA repair genes modulate survival in cisplatin/gemcitabine-treated non-small-cell lung cancer patients. Ann Oncol. 17: 668-675, 2006. Demple B, Harrison L. Repair of oxidative damage to DNA: enzymology and biology. AnuuRev Biochem. 63: 915-948, 1994. Dotor E, Cuatrecases M, Martinez-Iniesta M, et al. Tumor thymidylate synthase 1494del6 genotype as a prognostic factor in colorectal cancer patients receiving fluorouracil-based adjuvant treatment. J Clin Oncol. 24: 1603-1611,2006. Douglass HO Jr, Moertel CG, Mayer RJ et al. Survival after postoperative combination treatment of rectal cancer. N Engl J Med. 315: 1294-1295, 1986. Eberhart CE, Coffey RJ, Radhika A, et al. Up-regulation of cyclooxygenase 2 gene expression in human colorectal adenomas and adenocarcinomas. Gastroenterology. 207: 1183-1188. 1994. Edelman GM. Morphoregulatory molecules. Biochemistry. 27: 3533-3543, 1988. Edwards-Smith CJ, Jonsson JR, Purdie DM et al. Interleukin-10 promoter polymorphism predicts initial response of chronic hepatitis C to interferon a. Hepatology. 30: 526-530, 1999. Elder DJ, Baker JA, Banu NA, et al. Human colorectal adenomas deomstrate size-dependent increase in epithelial cyclooxygenase-2 expression. J Pathol. 198: 428-434, 2002. Elliott RL, Blobe GC. Role of transforming growth factor |3 in human cancer. J Clin Oncol. 23: 2078-2093, 2005. Evans AR, Limp-Foster M, Kelley MR. Going APE over ref-1. Mut Res 461: 83-108, 2000. 64 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Evans C, Morrison I, Heriot AG, et al. The correlation between colorectal cancer rates of proliferation and apoptosis and systemic cytokine levels; plus their influence upon survival. Br J Cancer. 2006 Apr 25; [Epub ahead of print]. Evans WE, Relling MV. Pharmacogenomics: translating functional genomics into rational therapeutics. Science. 286: 487-491,1999. Folkman J. Role of angiogenesis in tumor growth and metastasis. Semin Oncol 29(6): 15-18, 2002. Fortis C, Foppoli M, Gianotti L, et al. Increased interleukin-10 serum levels in patients with solid tumours. Cancer Lett. 104:1-5, 1996. Friedman E, Gold LI, Klimstra D, et al. High levels of transforming growth factor beta 1 correlate with disease progression in human colon cancer. Cancer Epidemiol Biomarkers Prev. 4: 549-554, 1995. Gaiddon C, Moorthy NC, Prives C. Ref-1 regulates the transactivation and pro- apoptotic functions of p53 in vivo. Embo J. 18: 5609-5621, 1999. Galizia G, Orditura M, Romano C, et al. Prognostic significance of circulating IL-10 and IL-6 serum levels in colon cancer patients undergoing surgery. Clin Immunol. 102: 169-178, 2002. Glynn-Jones R, Grainger J, Harrison M, et al. Neoadjuvant chemotherapy prior to preoperative chemoradiation or radiation in rectal cancer: should we be more cautious? Br J Cancer. 94: 363-371, 2006. Gnasso A, Motti C, Irace C et al. Genetic variation in human stromeolysin gene promoter and common carotid geometry in healthy male subjects. Arterioscler Thromb Vase Biol. 20: 1600-1605, 2000. Gorski DH, Beckett MA, Jaskowiak NT, et al. Blockage of the vascular endothelial growth factor stress response increases the antitumor effects of ionizing radiation. Cancer Res 59: 3374-3378, 1999. Gupta MK, Qin RY. Mechanism and its regulation of tumor-induced angiogenesis. World J Gastroenterol. 9: 1144-1155, 2003. Guzinska-Ustymowicz K, Kemona A. Transforming growth factor beta can be a parameter of aggressiveness of pTl colorectal cancer. World J Gastroenterol. 11: 1193-1195,2005. 65 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Harries LW, Stubbins MJ, Forman D et al. Identification of genetic polymorphisms at the glutathione S-transferase n locus and association with susceptibility to bladder, testicular, and prostate cancer. Carcinogenesis. 18: 641-644, 1997. Hart KC, Robertson SC, Kanemitsu MY, et al. Transformation and Stat activation by derivatives of FGFR1, FGFR3, and FGFR4. Oncogene. 19: 3309- 3320, 2000. Hasselbach L, Haase S, Fischer D, et al. Characterisation of the promoter region of the human DNA-repair gene Rad51. Eur J Gynaecol Oncol. 26: 89-58, 2005. Havranek E, Howell WM, Fussell HM, et al. An interleukin-10 promoter polymorphism may influence tumor development in renal cell carcinoma. J Urol. 173: 709-712, 2005. He T, Weintraub NL, Goswami PC, et al. Redox factor-1 contributes to the regulation of progression from G0/G1 to S by PDGF in vascular smooth muscle cells. Am J Physiol Heart Circ Physiol. 285:804-812, 2003. Henner WD, Evans AJ, Hough KM et al. Association of codon 72 polymorphism of p53 with lower prostate cancer risk. Prostate. 49: 263-266, 2001. Herring CJ, Deans B, Elder RH, et al. Expression levels of the DNA repair enzyme HAP1 do no correlate with the radiosensitivities of human or HAP-1 transfected cell lines. Br J Cancer. 80: 940-945, 1999. Hofheinz RD, von Gerstenberg-Helldorf B, Wenz F, et al. Phase I trial of capecitabine and weekly irinotecan in combination with radiotherapy for neoadjuvant therapy of rectal cancer. J Clin Oncol. 23: 1350-1357, 2005. Horie N, Aiba H, Oguro K, et al. Functional analysis and DNA polymorphism of the tandemly repeated sequences in the 5'-terminal regulatory region of the human gene for thymidylate synthase. Cell Struct Funct. 20: 191-197, 1995. Hu JJ, Smith TR, Miller MS, et al. Amino acid substitution variants of APE1 and XRCC1 genes associated with ionizing radiation sensitivity. Carcinogenesis. 22: 917-922, 2001. Hu JJ, Smith TR, Miller MS, et al. Genetic regulation of ionizing radiation sensitivity and breast cancer risk. Environ Mol Mutagen. 39: 208-215, 2002. Huang S, Xie K, Bucana CD, et al. Interleukin 10 suppresses tumor growth and metastasis of human melanoma cells: potential inhibition of angiogenesis. Clin Cancer Res. 2: 1969-1979, 1996. 66 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Hubbard AK, Rothlein R. Intercellular adhesion molecule-1 (ICAM-1) expression and cell signaling cascades. Free Radic Biol Med. 28: 1379-1386, 2000. Huerta S, Harris DM, Jazirehi A, et al. Gene expression profile of metastatic colon cancer cells resistant to cisplatin-induced apoptosis. Int J Oncol. 22: 663- 670, 2003. Hull J, Thomson A, Kwiatkowski D. Association of respiratory syncytial virus bronchiolitis with the interleukin 8 gene region in UK families. Thorax. 55: 1023-1027, 2000. Hsu S, Huang F, Hafez M, et al. Colon carcinoma cells switch their response to transforming growth factor 1 3 1 with tumor progression. Cell Growth Differ 5: 267-275, 1994. Ishigami SI, Arii S, Furutani M, et al. Predictive value of vascular endothelial growth factor (VEGF) in metastasis and prognosis of human colorectal cancer. Br J Cancer. 78: 1379-1384, 1998. Iwao M, Morisaki H, Morisaki T. Single-nucleotide polymorphism g.l548G > A (E469K) in human ICAM-1 gene affects mRNA splicing pattern and TPA- induced apoptosis. Biochem Biophys Res Commun. 317: 729-735, 2004. Jakobsen A, Nielsen JN, Gyldenkeme N, et al. Thymidylate synthase an methylene tetrahydrofolate reductase gene polymorphism in normal tissue as predictors of fluorouracil sensitivity. J Clin Oncol. 23: 1365-1369, 2005. James R, Meadows H. The second UK phase III anal cancer trial of chemoradiation and maintenance therapy (ACT II): preliminary results on toxicity and outcome. J Clin Oncol. 22: 287 (abstract 1151), 2003. Jemal A, Murray T, Ward E, et al. Cancer Statistics, 2005. CA Cancer J Clin 55: 10-30, 2005. Johnston PG, Fisher ER, Rockette HE, et al. The role of thymidylate synthase expression in prognosis and outcome of adjuvant chemotherapy in patients with rectal cancer. J Clin Oncol. 12: 2640-2647, 1994. Johnston PG, Lenz HJ, Leichman CG, et al. Thymidylate synthase gene and protein expression correlate correlate and are associated with response to 5- fluorouracil in human colorectal and gastric tumors. Caner Res. 55: 1407-1412, 1995. 67 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Joo YE, Kim HS, Min SW, et al. Expression of cyclooxygenase-2 protein in colorectal carcinomas. Int J Gastrointest Cancer. 31: 147-154, 2002. Kapiteijn E, Marijnen CA, Nagtegaal ID, et al. Preoperative radiotherapy combined with total mesorectal excision for resectable rectal cancer. N Engl J Med. 345:638-646, 2001. Kawakami K, Watanabe G. Identification and functional analysis of single nucleotide polymorphism in the tandem repeat sequence of thymidylate synthase gene. Cancer Res. 63: 6004-6007, 2003. Kawakami K, Omura K, Kanehira E, et al. Polymorphic tandem repeats in the thymidylate synthase gene is associated with its protein expression in human gastrointestinal cancers. Anticancer Res. 19: 3249-52, 1999. Kawamori T, Rao CV, Seibert K, et al. Chemopreventive activity of celecoxib, a specific cyclooxygenase-2 inhibitor, against colon carcinogenesis. Cancer Res. 58:409-412, 1998. Kazuyuki T, Mostowski H, and Tosato G. Human interleukin-10 can directly inhibit T cell growth. Blood. 81: 2964-2971,1993. Kenny FS, Hui R, Musgrove EA, et al. Overexpression of cyclin D1 messenger RNA predicts for poor prognosis in estrogen receptor-positive breast cancer. Clin Cancer Res. 5: 2069-2076, 1999. Kerr J, Engel J, Eckel R, et al. Survival for rectal cancer patients and international comparisons. Ann Oncol. 16: 664-672, 2005. Klautke G, Kuchenmeister U, Foitzik T, et al. Concurrent chemoradiation with capecitabine and weekly irinotecan as preoperative treatment for rectal cancer: results from a phase I/II study. Br J Cancer. 94: 976-981, 2006. Konno H, Ohta M, Baba M, et al. The role of circulating IL-8 and VEGF protein in the progression of gastric cancer. Cancer Sci. 94: 735-740, 2003. Kommann M, Ishiwata T, Itakura J, et al. Increased cyclin D1 in human pancreatic cancer is associated with decreased postoperative survival. Oncology. 55: 363-369, 1998. Krippl P, Langsenlehner U, Renner W, et al. A common 936 C/T gene polymorphism of vascular endothelial growth factor is associated with decreased breast cancer risk. Int J Cancer. 106: 468-471, 2003. Krook Je, Moertel CG, Gunderson LL et al. Effective surgical adjuvant therapy for high-risk rectal carcinoma. N Engl J Med. 324: 709-715, 1991. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Langsenlehner U, Krippl P, Renner W, et al. Interleukin-10 promoter polymorphism is associated with decreased breast cancer risk. Breast Cancer Res Treat. 90: 113-115,2005. Laurent-Puig P, Blons H, Cugnenc PH Sequence of molecular genetic events in colorectal tumorigenesis. Eur J Cancer Prev. 8: 39-47, 1999. Le X, Shi Q, Wang B, et al. Molecular regulation of constitutive expression of interleukin-8 in human pancreatic adenocarcinoma. J Interferon Cytokine Res. 20: 1532-1540, 2000. Lehman TA, Haffty BG, Carbone CJ, et al. Elevated frequency and functional activity of a specific germ-line p53 intron mutation in familial breast cancer. Cancer Res. 60: 1062-1069, 2000. Le Marchand L, Haiman CA, van den Berg D, et al. T29C polymorphism in the transforming growth factor betal gene and postmenopausal breast cancer risk: the Multiethnic Cohort Study. Cancer Epidemiol Biomarkers Prev. 13: 412-415, 2004. Le Marchand L, Seifried A, Lum-Jones A, et al. Association of the cyclin D1 A870G polymorphism with advanced colorectal cancer. JAMA. 290: 2843- 2848, 2003. Levy-Lahad E, Lahad A, Eisenberg S, et al. A single nucleotide polymorphism in the RAD51 gene modifies cancer risk in BRCA2 but not BRCA1 carriers. Proc Natl Acad Sci U S A. 98: 3232-3236, 2001. Li Z, Habuchi T, Tsuchiya N, et al. Increased risk of prostate cancer and benign prostatic hyperplasia associated with transforming growth factor-beta 1 gene polymorphism at codonlO. Carcinogenesis. 25: 237-240, 2004. Lio YC, Schild D, Brenneman MA, et al. Human Rad51C deficiency destabilizes XRCC3, impairs recombination, and radiosensitizes S/G2-phase cells. J Biol Chem. 279: 42313-42320, 2004. Liu N, Lamerdin JE, Tebbs RS et al. XRCC2 and XRCC3, new human Rad51- family members, promote chromosome stability and protect against DNA cross links and other damages. Mol Cell 1: 783-793, 1998. Llanes-Femandez L, Alvarez-Goyanes RI, Arango-Prado MD, et al. Relationship between IL-10 and tumor markers in breast cancer patients. Breast. 2006 Jan 3; [Epub ahead of print]. 69 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Lochter A, Galosy S, Muschler J, et al. Matrix metalloproteinase stromelysin-1 triggers a cascade of molecular alterations that leads to stable epithelial-to- mesenchymal conversion and a premalignant phenotype in mammary epithelial cells. J Cell Biol. 139: 1861-1872, 1997. Loeb LA, Preston BD. Mutagenesis by apurinic/apyrimidinic sites. Annu Rev Genet. 20:201-230, 1986. London SJ, Daly AK, Cooper J, et al. Polymorphism of glutathione S- transferase M l and lung cancer risk among African-Americans and Caucasians in Los Angeles County, California. JN atl Cancer Inst. 87: 1246-1253, 1995. Losi L, Baisse B, Bouzourene H et al. Evolution of intratumoral genetic heterogeneity during colorectal cancer progression. Carcinogenesis. 26: 916- 922, 2005. Luna-Perez P, Rodriguez-Ramirez S, Rodriguez Coria DF, et al. Preoperative chemoradiation therapy and anal sphincter preservation with locally advanced rectal adenocarcinoma. Int J Radiat Oncol Biol Phys. 49: 987-995, 2001. Lundin C, Schultz N, Amaudeau C, et al. RAD51 is involved in repair of damage associated with DNA replication in mammalian cells. J Mol Biol 328: 521-535,2003. Maeda K, Kang SM, Sawada T, et al. Expression of intercellular adhesion molecule-1 and prognosis in colorectal cancer. Oncol Rep. 9: 511-514, 2002. Malats N, Camus-Radon AM, Nyberg F, et al. Lung cancer risk in nonsmokers and GSTM1 and GSTT1 genetic polymorphism. Cancer Epidemiol Biomarkers Prev. 9: 827-833, 2000. Mandola M, Stoehlmacher J, Muller-Weeks S, et al. A novel single nucleotide polymorphism within the 5’ tandem repeat polymorphism of the thymidylate synthase gene abolishes USF-1 binding and alters transcriptional activity. Cancer Res. 63: 2898-2904, 2003. Mandola MV, Stoehlmacher J, Zhang W, et al. A 6 bp polymorphism in the thymidylate synthase gene causes message instability and is associated with decreased intratumoral TS mRNA levels. Pharmacogenetics. 14: 319-327, 2004. Marcuello E, Altes A, Del Rio E, et al. Single nucleotide polymorphism in the 5’ tandem repeat sequences of thymidylate synthase gene predicts for response to fluorouracil-based chemotherapy in advanced colorectal cancer patients. Int J Cancer. 112: 733-737, 2004. 70 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Massague J. The transforming growth factor- B family. Annu Rev Cell Biol. 6: 597-641, 1990. Matthias C, Branigan K, Jahnke V, et al. Polymorphism within the cyclin D1 gene is associated with prognosis in patients with squamous cell carcinoma of the head and neck. Clin Cancer Res. 4: 2411-2418, 1998. Matullo G, Guarrera S, Carturan S et al. DNA repair gene polymorphisms, bulky DNA adducts in white blood cells and bladder cancer in a case-control study. Int J Cancer. 92: 562-567, 2001. Matullo G, Palli D, Peluso M, et al. XRCC1, XRCC3, XPD gene polymorphisms, smoking and (32)P-DNA adducts in a sample of healthy subjects. Carcinogenesis. 22: 1437-1445, 2001. Matsuzawa J ,Sugimura K, Matsuda Y et al. Association between K469E allele of intercellular adhesion molecule 1 gene and inflammatory bowel disease in a Japanese population. Gut. 52: 75-78, 2003. Mauceri HJ, Hanna NN, Beckett MA, et al. Combined effects of angiostatin and ionizing radiation in antitumour therapy. Nature (Lond.) 394: 287-291, 1998. Mauceri HJ, Hanna NN, Wayne JD, et al. Tumor necrosis factor a (TNF-«) gene therapy targeted by ionizing radiation selectively damages tumor vasculature. Cancer Res 56: 4311-4314, 1996. Maurer CA, Friess H, Kretschmann B, et al. Over-expression of ICAM-1, VCAM-1 and ELAM-1 might influence tumor progression in colorectal cancer. Int J Cancer (Pred Oncol) 79: 76-81, 1998. McCarron SL, Edwards S, Evans PR, et al. Influence of cytokine gene polymorphisms on the development of prostate cancer. Cancer Res. 62: 3369- 3372, 2002. McKay JA, Douglas JJ, Ross VG, et al. Cyclin D1 protein expression and gene polymorphism in colorectal cancer. Int J Cancer. 88: 77-81, 2000. McKay JA, Douglas JJ, Ross VG, et al. Analysis of key cell-cycle checkpoint proteins in colorectal tumours. J Pathol. 196: 386-393, 2002. Miyamoto M, Shimizu Y, Okada K, et al. Effect of interleukin-8 on production of tumor-associated substances and autocrine growth of human liver and pancreatic cancer cells. Cancer Immunol Tmmunother. 47: 47-57, 1998. 71 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Mohiuddin M, Hayne M, Regine WF, et al. Prognostic significance of postchemoradiation stage following preoperative chemotherapy and radiation for advanced/recurrent rectal cancers. Int J Radiat Oncol Biol Phys. 48: 1075- 1080, 2000. Morris AM, Billingsley KG, Baxter NN, et al. Racial disparities in rectal cancer treatment: a population-based analysis. Arch Surg. 139: 151-155; discussion 156, 2004. Morimoto Y, Ozaki T, Ouchida M, et al. Single nucleotide polymorphism in fibroblast growth factor receptor 4 at codon 388 is associated with prognosis in high-grade soft tissue sarcoma. Cancer. 09: 2245-2250, 2003. Mulder WM, Stem PL, Stukart MJ et al. Low intercellular adhesion molecule 1 and high 5T4 expression of tumor cells correlate with reduced disease-free survival in colorectal carcinoma patients. Clin Cancer Res. 3: 1923-1930, 1997. Murray D, Yallee-Lucic L, Rosenberg E, et al. Sensitivity of nucleotide excision repair-deficient human cells to ionizing radiation and cyclophosphamide. Anticancer Res. 22: 21-6, 2002. Mustea A, Konsgen D, Braicu El, et al. Expression of IL-10 in patients with ovarian carcinoma. Anticancer Res. 26: 1715-1718, 2006. Nakajima Y, Miyamoto T, Tanabe M, et al. Enhancement of mammalian cell killing by 5-fluorouracil in combination with X-rays. Cancer Res. 39: 3763- 3767, 1979. Nebert DW. Polymorphisms in drug-metabolizing enzymes: what is their clinical relevance and why do they exist? Am J Hum Genet. 60: 265-271, 1997. Newell KJ, Witty JP, Rodgers WH, et al. Expression and localization of matrix- degrading metalloproteinases during colorectal tumorigenesis. Mol Carcinog. 10: 199-206, 1994. Nunez MI, McMillan TJ, Valenzuela MT, et al. Relationship between DNA damage, rejoining and cell killing by radiation in mammalian cells. Rad One 39: 155-165, 1996. O'Connell JB, Maggard MA, Liu JH, et al. Are survival rates different for young and older patients with rectal cancer? Dis Colon Rectum. 47: 2064-2069, 2004. Oda K, Okabayashi T, Kataoka M, et al. Evaluation of cyclin D1 mRNA expression in gastric and colorectal cancers. Res Commun Mol Pathol Pharmacol. 105: 237-252, 1999. 72 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Ogunbiyi OA, Goodfellow PJ, Herfarth K, et al. Confirmation that chromosome 18q allelic loss in colon cancer is a prognostic indicator. J Clin Oncol. 16: 427- 433,1998. Olson DC, Deng C, Hanahan D. Fibroblast growth factor receptor 4, implicated in progression of islet cell carcinogenesis by its expression profile, does not contribute functionally. Cell Growth Differ. 9: 557-564, 1998. Ortholan C, Francois E, Thomas O, et al. Role of radiotherapy with surgery for T3 and resectable T4 rectal cancer: evidence from randomized trials. Dis Colon Rectum. 49: 302-310, 2006. Oshima M, Dinchuk JE, Kargman SL, et al. Suppression of intestinal polyposis in Ape delta716 knockout mice by inhibition of cyclooxygenase 2 (COX-2). Cell. 87:803-809, 1996. Oshima M, Murai N, Kargman S, et al. Chemoprevention of intestinal polyposis in the Apcdelta716 mouse by rofecoxib, a specific cyclooxygenase-2 inhibitor. Cancer Res. 61:1733-1740, 2001. Pahlman, L, Glimelius, B. "Pre or postoperative radiotherapy in rectal and rectosigmoid carcinoma. Report from a randomized multicenter trial" Ann Surg. 211:187-195, 1990. Palmqvist R, Stenling R, Oberg A, et al. Expression of cyclin D1 and retinoblastoma protein in colorectal cancer. Eur J Cancer. 34: 1575-1581, 1998. Papafili A, Hill MR, Brull DJ, et al. Common promoter variant in cyclooxygenase-2 represses gene expression. Arterioscler Thromb Vase Biol. 22: 1631-1636, 2002. Park DJ, Zhang W, Stoehlmacher J, et al. ERCC1 gene polymorphism as a predictor for clinical outcome in advanced colorectal cancer patients treated with platinum-based chemotherapy. Hem Oncol 1: 162-166, 2003. Park SK, Kang D, Noh DY, et al. Reproductive factors, glutathione S- transferase M l and T1 genetic polymorphism and breast cancer risk. Breast Cancer Res Treat. 78: 89-96, 2003. Pepper MS, Ferrara N, Orci L, et al. Potent synergism between vascular endothelial growth factor and basic fibroblast growth factor in the induction of angiogenesis in vitro. Biochem Biophys Res Commun. 189: 824-31, 1992. Pierce AJ, Johnson RD, Thompson LH et al. XRCC3 promotes homolgy- directed repair of DNA damage in mammalian cells. Genes Dev 13: 2633-2638, 1999. 73 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Potter JD. Nutrition and colorectal cancer. Cancer Causes Control. 7: 127-146, 1996. Powers CJ, McLeskey SW, Wellstein A. Fibroblast growth factors, their receptors and signaling. Endocr Relat Cancer. 7: 165-197, 2000. Pullarkat ST, Stoehlmacher J, Ghaderi V, et al. Thymidylate synthase gene polymorphism determines response and toxicity of 5-FU chemotherapy. Pharmacogenomics J. 1: 65-70, 2001. Raaphorst GP, Leblanc M, Li LF. A comparison of response to cisplatin, radiation and combined treatment for cells deficient in recombination repair pathways. Anticancer Res. 25: 53-58, 2005. Ramana CV, Boldogh I, Izumi T, et al. Activation of apurinic/apyrimidinic endonuclease in human cells by reactive oxygen species and its correlation with their adaptive response to genotoxicitiy of free radicals. Proc Natl Acad Sci USA. 95: 5061-5066, 1998. Rees LE, W oodNA, Gillespie KM, et al. The interleukin-10-1082 G/A polymorphism: allele frequency in different populations and functional significance. Cell Mol Life Sci. 59: 560-569, 2002. Renner W, Kotschan S, Hoffmann C, et al. A common 936 C/T mutation in the gene for vascular endothelial growth factor is associated with vascular endothelial growth factor plasma levels. J Vase Res. 37: 443-448, 2000. Robertson KA, Hill DP, Xu Y, et al. Down-regulation of apurinic/apyrimidinic endonuclease expression is associated with the induction of apoptosis in differentiating myeloid leukemia cells. Cell Growth Differ. 8: 443-449, 1997. Robson H, Anderson E, James RD, et al. Transforming growth factor beta 1 expression in human colorectal tumours: an independent prognostic marker in a subgroup o f poor prognosis patients. Br J Cancer. 74:753-758, 1996. Rodel C, Martus P, Papadoupolos T, et al. Prognostic significance of tumor regression after preoperative chemoradiotherapy for rectal cancer. J Clin Oncol. 23: 8688-8696, 2005. Rubin P, Casarett GW. Alimentary tract; small and large intestine and rectum. Ed. Clinical radiation pathology. Philadelphia, WB Saunders. 1275, 1968. Ruoslahti E. Fibronectin and its receptors. Annu Rev Biochem. 57: 375-413, 1988. 74 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Russell JS, Brady K, Burgan WE, et al. Gleevec-mediated inhibition o f Rad51 expression and enhancement of tumor cell radiosensitivity. Cancer Res. 63: 7377-7383, 2003. Saffari B, Bernstein L, Hong DC, et al. Association of p53 mutations and a codon 72 single nucleotide polymorphism with lower overall survival and responsiveness to adjuvant radiotherapy in endometrioid endometrial carcinomas. Int J Gynecol Cancer. 15: 952-963, 2005. Seifart C, Plagens A, Dempfle A, et al. TNF-alpha, TNF-beta, IL-6, and IL-10 polymorphisms in patients with lung cancer. Dis Markers. 21: 157-165, 2005. Salonga D, Danenberg KD, Johnson M, et al. Colorectal tumors responding to 5-fluorouracil have low gene expression levels of dihydropyrimidine dehydrogenase, thymidylate synthase, and thymidine phosphorylase. Clin Cancer Res. 6: 1322-1327, 2000. Sauer, R, Becker, H, Hohenberger, W et al. Preoperative versus postoperative radiochemotherapy for rectal cancer. N Engl J Med. 351: 1731-1740, 2004. Shen MR, Jones IM, Mohrenweiser H. Nonconservative amino acid substitution variants exist at polymorphic frequency in DNA repair genes in healthy humans. Cancer Res. 58: 604-608, 1998. Sherr CJ. Cancer cell cycles. Science. 274: 1672-1677, 1996. Shi Q, Abbruzzese J, Huang S, et al. Constitutive and inducible interleukin-8 expression by hypoxia and acidosis renders human pancreatic cancer cells more tumorigenic and metastatic. Clin Cancer Res. 5: 3711-3721, 1999. Shirota Y, Stoehlmacher J, Brabender J, et al. ERCC1 and thymidylate synthase mRNA levels predict survival for colorectal cancer patients receiving combination oxaliplatin and fluorouracil chemotherapy. J Clin Oncol. 19: 4298- 4304, 2001. Shu XO, Moore DB, Cai Q, et al. Association of cyclin D1 genotype with breast cancer risk and survival. Cancer Epidemiol Biomarkers Prev. 14: 91-97, 2005. Smith TR, Levine EA, Oerrier ND, et al. DNA-repair genetic polymorphisms and breast cancer risk. Cancer Epidemiol Biomarkers Prev. 12: 1200-1204, 2003. Solomon E, Voss R, Hall V, et al. Chromosome 5 allele loss in human colorectal carcinomas. Nature. 328: 616-619, 1987. Sonoda E, Sasaki MS, Buerstedde JM, et al. Rad51 -deficient vertebrate cells Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. accumulate chromosomal breaks prior to cell death. EMBO J. 17: 598-608, 1998. Soussi T, Beroud C. Assessing TP53 status in human tumors to evaluate clinical outcome. Nat Rev Cancer. 1: 233-240, 2001. Spinola M, Leoni V, Pignatiello C, et al. Functional FGFR4 Gly388Arg polymorphism predicts prognosis in lung adenocarcinoma patients. J Clin Oncol. 23:7307-7311,2005. Stanilova SA, Miteva LD, Karakolev ZT, et al. Interleukin-10-1082 promoter polymorphism in association with cytokine production and sepsis susceptibility. Intensive Care Med. 32: 260-266, 2006. Steinberg D, Colla P. CART: Tree-Structured Non-Parametric Data Analysis. Salford Systems, CA, USA (1995). Stem MC, Umbach DM, Lunn RM, et al. DNA repair gene XRCC3 codon 241 polymorphism, its interaction with smoking and XRCC1 polymorphisms, and bladder cancer risk. Cancer Epidemiol Biomarkers Prev. 11: 939-943, 2002. Stoehlmacher J, Park DJ, Zhang W, et al. Association between glutathione S- transferase PI, T l, and M l genetic polymorphism and survival of patients with metastatic colorectal cancer. J Natl Cancer Inst. 94: 936-942, 2002. Stoehlmacher J, Park DJ, Zhang W, et al. A mutlivariate analysis of genomic polymorphisms: prediction of clinical outcome to 5-FU/oxaliplatin combination chemotherapy in refractory colorectal cancer. Br J Cancer. 91: 344-354, 2004. Streit S, Bange J, Fichtner A, et al. Involvement of the FGFR4 Arg388 allele in head and neck squamous cell carcinoma. Int J Cancer. Ill: 213-217, 2004. Sullivan A, Syed N, Gasco M, et al. Polymorphism in wild-type p53 modulates response to chemotherapy in vitro and in vivo. Oncogene. 23: 3328-3337, 2004. Swedish Rectal Cancer Trial. Improved survival with preoperative radiotherapy in resectable rectal cancer. N Engl J Med. 336: 980-987, 1997. Tachimori A, Yamada N, Sakate Y, et al. Up regulation of ICAM-1 gene expression inhibits tumour growth and liver metastasis in colorectal carcinoma. EurJ Cancer. 41: 1802-1810, 2005. Tepper JE, O’Connell M, Niedzwiecki D et al. Adjuvant therapy in rectal cancer: analysis of stage, sex and local control - final report of intergroup 0114. J Clin Oncol. 20. 1744-1750, 2002. 76 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Tlsty TD. Cell-adhesion-dependent influences on genomic instability and carcinogenesis. Curr Opin Cell Biol. 10: 647-653, 1998. Tokunaga T, Oshika Y, Abe Y, et al. Vascular endothelial growth factor (VEGF) mRNA isoform expression pattern is correlated with liver metastasis and poor prognosis in colon cancer. Br J Cancer. 77: 998-1002, 1998. Tsushima H, Kawata S, Tamura S et al. High levels of transforming growth factor-pi in patients with colorectal cancer: association with disease progression. Gastroenterology. 110: 375-382, 1996. Tuimala J, Szekely G, Wikman H, et al. Genetic polymorphisms of DNA repair and xenobiotic-metabolizing enzymes: effects on levels of sister chromatid exchanges and chromosomal aberrations. Mutat Res. 554: 319-333, 2004. Turitto G, Panelli G, Frattolillo A, et al. Phase II study of neoadjuvant concurrent chemioradiotherapy with oxaliplatin-containing regimen in locally advanced rectal cancer. Front Biosci. 11: 1275-1279, 2006. Uchida K, Hayashi K, Kawakami K, et al. Loss of heterozygosity at the thymidylate synthase (TS) locus on chromosome 18 affects tumor response and survival in individuals heterozygous for a 28-bp polymorphism in the TS gene. Clin Cancer Res. 10: 433-439, 2004. Ueda T, Shimada E, Urikawa T. Serum levels of cytokines in patients with colorectal cancer: possible involvement of interleukin-6 and interleukin-8 in hematogeneous metastasis. J Gastroenterol 29: 423-429, 1994. Ulrich CM, Bigler J, Velicer CM et al. Searching expressed sequence tag databases : discovery and confirmation of a common polymorphism in the thymidylate synthase gene. Cancer Epidemiol Biomarkers Prev. 9: 1381-1385, 2000. Ulrich CM, Whitton John, Yu JH, et al. PTGS2 (COX-2) -765G>C promoter variant reduces risk of colorectal adenoma among nonusers of nonsteroidal anti inflammatory drugs. Cancer Epidemiol Biomarkers Prev. 14: 616-619, 2005. Utsumi T, YoshimuraN, Maruta M, et al. Correlation of cyclin D1 MRNA levels with clinico-pathological parameters and clinical outcome in human breast carcinomas. Int J Cancer. 89: 39-43, 2000. Vallbohmer D, Zhang W, Gordon M, et al. Molecular determinants of cetuximab efficacy. J Clin Oncol. 23: 3536-3544, 2005. 77 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. van Poppel G, de Vogel N, van Balderen PJ, et al. Increased cytogenetic damage in smokers deficient in glutathione S-transferase isozyme mu. Carcinogenesis. 13: 303-305, 1992. Van Seventer GA, Shimizu Y, Horgan KJ, et al. The LFA-1 ligand ICAM-1 provides an important costimulatory signal for T cell receptor-mediated activation of resting T cells. J Immunol. 144, 4579— 4586, 1990. Van’t Veer LJ, Hongyue D, van de Vijver MJ, et al. Gene expression profiling predicts clinical outcome of breast cancer. Nature. 415: 530-536, 2002. Viguier J, Boige V, Miquel C, et al. ERCC1 codon 118 polymorphism is a predictive factor for the tumor response to oxaliplatin/5-fluorouracil combination chemotherapy in patients with advanced colorectal cancer. Clin Cancer Res. 11: 6212-6217, 2005. Vispe S, Cazaux C, Lesca C, et al. Overexpression of RAD51 protein stimulates homologous recombination and increases resistance of mammalian cells to ionizing radiation. Nucl Acids Res. 26: 2859-2864, 1998. Vora DK, Rosenbloom CL, Beaudet AL et al. Polymorphisms and linkage analysis for ICAM-1 and the selectin gene cluster. Genomics. 21: 473-477, 1994. Walker KK, Levine AJ. Identification of a novel p53 functional domain that is necessary for efficient growth suppression. Proc Natl Acad Sci U S A. 93: 15335-15340, 1996. Walker LJ, Craig RB, Harris AL, et al. A role for the human DNA repair enzyme HAP1 in cellular protection against DNA damaging agents and hypoxic stress. Nucleic Acids Res. 22: 4884-4889, 1994. Wang J, Stockton DW, Ittmann M. The fibroblast growth factor receptor-4 Arg388 allele is associated with prostate cancer initiation and progression. Clin Cancer Res. 10: 6169-6178, 2004. Wang WW, Spurdle AB, Kolachana P, et al. A single nucleotide polymorphism in the 5' untranslated region of RAD51 and risk of cancer among BRCA1/2 mutation carriers. Cancer Epidemiol Biomarkers Prev. 10: 955-960, 2001. Wachsberger P, Burd R, Dicker AP, et al. Tumor response to ionizing radiation combined with antiangionesis or vascular targeting agents: exploring mechanisms of interaction. Clin Cancer Res 9: 1957-1971, 2003. 78 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Wegman P, Stal O, Stenmark Askmalm M, et al. p53 polymorphic variants at codon 72 and the outcome of therapy in randomized breast cancer patients. Pharmacogenet Genomics. 16: 347-351, 2006. Wei EK, Giovannucci E, Wu K, et al. Comparison of risk factors for colon and rectal cancer. Int J Cancer. 108: 433-442, 2004. Willett CG, Boucher Y, Duda DG, et al. Surrogate markers for antiangiogenic therapy and dose-limiting toxicities for bevacizumab with radiation and chemotherapy: continued experience of a phase I trial in rectal cancer patients. J Clin Oncol. 23: 8136-8139, 2005. Wood RD. Nucleotide excision repair in mammalian cells. J Biol Chem 272: 23465-23468, 1997. Wu AW, Gu J, Li ZF, et al. COX-2 expression and tumor angiogenesis in colorectal cancer. World J Gastroenterol. 10: 2323-2326, 2004. Yanagisawa T, Urade M, Yamamoto Y, et al. Increased expression of human DNA repair genes, XRCC1, XRCC3, and RAD51, in radioresistant human KB carcinoma cell line N10. Oral Oncol. 34: 524-528, 1998. Yokota M, Ichihara S, Lin T-L, Nakashima N, Yamada Y. Association o f a T29-C polymorphism of the transforming growth factor-bl gene with genetic susceptibility to myocardial infarction in Japanese. Circulation. 101: 2783- 2787, 2000. Yoshihara T, Ishida M, Kinomura A, et al. XRCC3 deficiency results in a defect in recombination and increased endoreduplication in human cells. EMBO J. 23: 670-680, 2004. Yuan A, Yang PC, Yu CJ, et al. Interleukin-8 messenger ribonucleic acid expression correlates with tumor progression, tumor angiogenesis, patient survival, and timing of relapse in non-small-cell lung cancer. Am J Respir Crit Care Med 162: 1957-1963, 2000. Ziv E, cauley J, Morin Pa et al. Association betwen the T29>C polymnorphism in the transforming growth factor (3 1 gene and breast cancer among elderly white women: The Study of Osteoporotic Fractures. JAMA. 285: 2859-2863, 2001. 79 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.

Linked assets

University of Southern California Dissertations and Theses

Conceptually similar

PDF

Activin-mediated growth inhibition in prostate cancer LNCaP cells by transcriptional regulation of apoptosis-related genes

PDF

Molecular characterization of a subset of olfactory receptor neurons expressing guanylyl cyclase D in mouse olfactory neuroepithelium

PDF

Identification of DNA methylation markers for lung cancer and mesothelioma

PDF

Changes in growth factor and immune cell distributions in the lacrimal gland of pregnant rabbits following corneal injury

PDF

Studies of retinoid-induced growth inhibition of prostate cancer cells

PDF

Association between single nucleotide polymorphisms in the 3'untranslated region of the SRD5A2 gene and prostate cancer risk

PDF

Analysis of the pathological characteristics of breast carcinoma in Hispanic BRCA carriers

PDF

Somatic mutations in the SRD5A2 gene associated with prostate cancer

PDF

Pregnancy and lactation induce changes in growth factor and immune cell distribution in the lacrimal gland: A potential basis for predisposition to dry eye syndrome

PDF

Analysis of the HSD3B2 gene in prostate cancer

PDF

A transgenic mouse model for small cell lung cancer

PDF

Synergistic effects of histone deacetylase and DNA methyltransferase inhibitors on T24 cancer cells

PDF

BRCA1 mutations and polymorphisms in African American women with a family history of breast cancer identified through high throughput sequencing

PDF

Analysis of gene-environment interaction in lung cancer

PDF

Single-nucleotide polymorphisms in 17beta-hydroxysteroid dehydrogenase type III and prostate cancer risk

PDF

Dual functions of Vav in Ras-related small GTPases signaling regulation

PDF

Investigation of the role of epigenetic modification of DNA and chromatin in aberrant gene silencing in cancer cells

PDF

The effects of progesterone on cell cycle and differentiation status of human ovarian cancer cells

PDF

A coactivator complex among GRIP1, CARM1, and TIF1alpha contributes to gene activation directed by androgen receptor

PDF

Biochemical analysis of somatic mutations in steroid 5alpha-reductase type II in prostate cancer

Asset Metadata

Creator Gordon, Michael Alexander (author)

Core Title Genomic profiling associated with recurrence in patients with rectal cancer treated with chemoradiation

School Graduate School

Degree Master of Science

Degree Program Cell and Neurobiology

Publisher University of Southern California (original), University of Southern California. Libraries (digital)

Tag biology, genetics,biology, molecular,health sciences, oncology,OAI-PMH Harvest

Language English

Contributor Digitized by ProQuest (provenance)

Permanent Link (DOI) https://doi.org/10.25549/usctheses-c16-54263

Unique identifier UC11338347

Identifier 1438395.pdf (filename),usctheses-c16-54263 (legacy record id)

Legacy Identifier 1438395.pdf

Dmrecord 54263

Document Type Thesis

Rights Gordon, Michael Alexander

Type texts

Source University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Access Conditions The author retains rights to his/her dissertation, thesis or other graduate work according to U.S. copyright law. Electronic access is being provided by the USC Libraries in agreement with the au...

Repository Name University of Southern California Digital Library

Repository Location USC Digital Library, University of Southern California, University Park Campus, Los Angeles, California 90089, USA