University of Southern California Dissertations and Theses

Assessing molecular heterogeneity in clinical isolates of Aspergillus fumigatus

(USC Thesis Other)

Assessing molecular heterogeneity in clinical isolates of Aspergillus fumigatus

PDF

Download

Open document

Flip pages

Download a page range

Download transcript

Copy asset link

Request this asset

Transcript (if available)

Content NOTE TO USERS This reproduction is the best copy available. ® UMI Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. ASSESSING MOLECULAR HETEROGENEITY IN CLINICAL ISOLATES OF ASPERGILLUS FUMIGATUS by Dennis To A Thesis Presented to the FACULTY OF THE GRADUATE SCHOOL UNIVERSITY OF SOUTHERN CALIFORNIA In Partial Fulfillment of the Requirements for the Degree MASTER OF SCIENCE EXPERIMENTAL AND MOLECULAR PATHOLOGY August 2005 Copyright 2005 Dennis To Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. UMI Number: 1430406 Copyright 2005 by To, Dennis All rights reserved. INFORMATION TO USERS The quality of this reproduction is dependent upon the quality of the copy submitted. Broken or indistinct print, colored or poor quality illustrations and photographs, print bleed-through, substandard margins, and improper alignment can adversely affect reproduction. In the unlikely event that the author did not send a complete manuscript and there are missing pages, these will be noted. Also, if unauthorized copyright material had to be removed, a note will indicate the deletion. ® UMI UMI Microform 1430406 Copyright 2006 by ProQuest Information and Learning Company. All rights reserved. This microform edition is protected against unauthorized copying under Title 17, United States Code. ProQuest Information and Learning Company 300 North Zeeb Road P.O. Box 1346 Ann Arbor, Ml 48106-1346 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. DEDICATION I would like to dedicate this thesis to my grandparents, who have faced adversities far greater than what I have encountered. Their wisdom, resilience, and determination are my guiding light as I confront newer challenges. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. ACKNOWLEDGEMENTS The research described here was carried out in the well-equipped laboratories of the Department of Pathology at Childrens Hospital, Los Angeles (CHLA), and in affiliation with the Department of Pathology at the University of Southern fh California, Keck School of Medicine. This work was presented in part at the 44 Interscience Conference on Antimicrobial Agents and Chemotherapy (ICAAC), Washington, DC, October 30 to November 2, 2004, abstract M-258. I wish to express my most sincere gratitude to my advisor, Professor Kevin A. Nash, for his willingness to support a young student, fresh from college, with little biology background, and no laboratory experience; it was a notably risky endeavor. From him, I learned basic bench-work science as well as how to think critically. I have developed into a scientist because of Dr. Nash, and for this I am indebted to him. This work could also not have been completed without the help of Nadya, an expert in the lab and an invaluable resource. I would like to thank Dr. Clark Inderlied and the Clinical Microbiology Laboratory at CHLA for the isolates. I am also grateful to Dr. David Hinton and Dr. Paul Pattengale for their insight, advice, and support. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. TABLE OF CONTENTS Dedication ii Acknowledgments iii List of Tables and Figures v Abstract vi INTRODUCTION 1 Pathogenesis of Aspergillus 2 Virulence factors 4 Epidemiology 5 PCR-based molecular typing methods 6 Antifungal therapy for invasive aspergillosis 7 METHODS 9 Reagents 9 Isolates 9 DNA Extraction 10 DNA Extraction using the PC A method 10 DNA Extraction using the DNeasy Tissue Kit 10 Polymerase Chain Reaction (PCR) 11 RAPD-PCR analysis 12 Microsatellite PCR analysis 12 Pattern analysis 13 Culture conditions and gliotoxin production 13 Assessing A. fumigatus culture biomass 14 Gliotoxin extraction 15 Quantification of gliotoxin by thin-layer chromatography 15 Macrodilution susceptibility test: amphotericin B 16 AmB effects on A. fumigatus gliotoxin production 17 RESULTS and DISCUSSION 18 Strain typing Aspergillus fumigatus 18 RAPD-PCR analysis 18 Optimization of the R-151 assay 20 The microsatellite-PCR analysis 24 Heterogeneity of gliotoxin production by A. fumigatus 27 Effects of amphotericin B on gliotoxin release 31 Concluding Remarks 35 REFERENCES 37 APPENDIX: Detection of gliotoxin by TLC 40 iv Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. LIST OF TABLES AND FIGURES Figure 1: Gliotoxin structure 4 Tablet: PCR primer sequences 13 Figure 2: The RAPD-PCRs 19 Figure 3: Effects of PCR conditions on the RAPD-PCR 23 Figure 4: The microsatellite strain-typing assay 24 Figure 5: A. fumigatus growth curve 28 Figure 6: Gliotoxin production at each time point 29 Figure 7: Peak gliotoxin secretion 31 Figure 8: Effect of amphotericin B on gliotoxin release by isolate #19 33 v Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. ABSTRACT Invasive aspergillosis, caused primarily by Aspergillus fumigatus, has recently become a major concern in many tertiary care hospitals. Even with aggressive antifimgal treatment, it continues to have high mortality rates. Epidemiological studies have been hampered by the ubiquity of A. fumigatus and the lack of a reproducible strain-typing method. A frequently-used method in many laboratories is the Randomly Amplified Polymorphic DNA-PCR (RAPD-PCR). In contrast, our studies suggest that the RAPD-based assays are problematic, and indicate that the microsatellite PCR assays are more reliable. In addition to its strain-typing pattern, an isolate can be categorized by its gliotoxin (a mycotoxin) secretion level. Our studies suggest that isolates can be separated into two groups: high gliotoxin producers (>230 pg/g) or low gliotoxin producers (<100 pg/g). Moreover, our studies demonstrate gliotoxin secretion increases (~100%) in the presence of the antifimgal agent amphotericin B. Gliotoxin release may correlate with pathogenicity of the organism. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. INTRODUCTION Fungi are ubiquitous, eukaryotic microorganisms. Many are saprophytes, thriving on nonliving organic materials. Fungi can be differentiated into two types based on cell morphology and growth: yeasts and filamentous fungi (molds). Yeasts are small, unicellular microorganisms that produce daughter cells from the parent cell by budding. Molds are multicellular microorganisms whose cells are joined together, forming long filaments (hyphae), and elongate by apical extension. In higher fungi such as Ascomycota and Basidiomycota, adjacent hyphal cells are separated by a septum, which provide structural support and regulate diffusion of material between cells. The hyphae of more primitive fungi (e.g. Chytridiomycota and Zygomycota) are aseptate, although a vestigial septum may be present. The growing hyphae in higher fungi branch and anastomose, forming a complex intertwined colony, or mycelium. As a fungal colony matures, reproductive structures develop and lead to the dispersal of asexual spores (e.g. conidia, sporangiospores) or sexual spores (e.g. ascospores, basidiospores). For instance, in an Aspergillus colony, a special hyphal cell gives rise to an erect, nonseptate cell (conidiophore). The tip of the conidiophore swells into a domelike vesicle, whose surface is then covered by a single layer of phialides, the flask-shaped, asexual conidiogenous cells. Conidial chains develop upward in a column, then radiate outward from the conidiophore. Once disturbed though, the 1 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. conidia separate easily and become airborne in large numbers. Although it can withstand harsh conditions, the conidia will only germinate in advantageous, nutrient-rich environments, initiating a new colony (Lennette et al., 1985). Pathogenesis of Aspergillus Systemic Aspergillus infections are usually acquired by inhalation of airborne conidia or traumatic inoculation. There are many types of mycoses caused by the pathogenic strains of Aspergillus, including allergic reactions (allergic bronchopulmonary aspergillosis, ABPA) and the colonization of the external mucosal epithelia (aspergilloma), particularly in the respiratory tract. These infections often occur in patients with pre-existing pulmonary conditions. Approximately 2% of asthmatic patients and 10% of cystic fibrosis patients are found to have ABPA. Aspergillomas account for 0.02% of all US hospital patients, although they are complications in 15-20% of all patients internationally. More serious, life-threatening illnesses arise when the hyphae invade tissue. The fungus can disseminate from the lung (the site of initial colonization) to the brain, heart, or kidneys. Even with early and aggressive antifimgal treatment, invasive aspergillosis (IA) has a mortality rate of 80-95% (Bernardo et al., 2003; Bertout et al., 2001; Reeves et al., 2004a), with death often occurring 7-14 days post-diagnosis (Reeves et al., 2004a). Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. The severity of the infection depends on the immunologic state of the patient. Invasive aspergillosis primarily affects immunocompromised patients, in particular, people undergoing immunosuppressive therapy for the treatment of cancer or organ transplantation. Reports indicate that IA occurs in 3-9% of all renal transplant recipients, and as high as 5% of bone marrow, heart, lung, or liver transplant recipients (Singh and Paterson, 2005). Moreover, invasive aspergillosis has become much more prevalent recently because of the growing number of bone marrow transplant operations (Wald et al., 1997). A majority of invasive aspergillosis infections (76%) occur 40 to 180 days post-transplantation (Singh and Paterson, 2005). The incidence of invasive aspergillosis in AIDS patients is 4-5% in the United Kingdom and 1-12% worldwide (Khan, 2003). Invasive aspergillosis is also a major problem for people with pre-existing pulmonary diseases (such as cystic fibrosis and tuberculosis) and has become the most frequent fungal pathogen found in tertiary care hospitals, overtaking candidiasis (i.e. infections with Candida spp.). About 4% of autopsy patients (irrespective of cause of death) are found to have IA, whereas only 2% of patients have invasive candidiasis (Groll et al., 1996). The Centers for Disease Control and Prevention (CDC) estimated the prevalence of aspergillosis in 2003 was 2 per 100,000 individuals. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Virulence factors Although many fungi have been associated with human diseases, the majority of invasive infections are caused by a relatively small number of species. As an opportunistic fungal pathogen, Aspergillus fumigatus is responsible for 80% of all aspergillosis cases. This suggests that it has specific virulence factors that enable it to cause disease. A. fumigatus is known to secrete toxins (mycotoxins) such as gliotoxin, fumagillin, and helvolic acid (Tomee and Kauffman, 2000). One well- studied mycotoxin is gliotoxin (Fig. 1), which is an epipolythiodioxopoperazine. It is named after the organism from which gliotoxin was first isolated, Gliocladium fimbriatum. This lipid soluble thiol reactive reagent (molecular weight of 326.4 g/mol) blocks the sulfhydryl active site required for nucleotide binding and enzymatic activity of nucleotide binding proteins. Figure 1. Gliotoxin structure. C H j CH. OH OH Gliotoxin has also antimicrobial and immunosuppressive properties, including the inhibition of phagocytosis by macrophages and mitogenic stimulation of 4 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. lymphocytes, and the induction of apoptosis in a variety of cell types (Mullbacher et al., 1985). The apoptotic activity can be attributed to the reactive disulfide bridge in the molecule as this moiety undergoes redox cycling, generates oxygen radicals, and causes oxidative damage to DNA (Bernardo et al., 2003; Sutton et al., 1996). Such properties may enable A. fumigatus to suppress the innate immune response. In addition, gliotoxin has been implicated in the destruction of human respiratory epithelium, which may contribute to tissue invasion (Amitani et a l, 1995a). Aside from the production of secondary metabolites, the morphological characteristics of A. fumigatus may also help explain its pathogenicity to humans. The organism grows well at 37°C (body temperature). In addition, fungi such as A. fumigatus produce small-sized spores (2-3 pm) which easily become airborne. The small size allows the spores to become trapped within the alveoli of the lungs. Epidemiology A. fumigatus is ubiquitous in the environment and its conidia can be found in ventilation systems, dust, carpeting, food, and soil (Fridkin and Jarvis, 1996). Thus, we are constantly exposed to the organism. However, primary host defense mechanisms, such as mucous membranes, mucociliary clearance, and local secretion of inflammatory mediators, usually provide sufficient protection (Tomee and Kauffman, 2000). Nevertheless, nosocomial aspergillosis still poses a serious problem to many hospitals and their patients (Leenders et al., 1996). 5 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Studying the epidemiology of aspergillosis is important to improve infection control. Many emerging techniques involve molecular strain typing (Taylor et al., 1999). A common approach for strain typing bacteria is based on restriction fragment length polymorphism (RFLP) analysis, in which restriction endonucleases cut the DNA at specific sequences. Changes in the DNA may add or remove cut-sites and thus alter fragment patterns, thereby distinguishing isolates as different. However, the A. fumigatus genome (-28 Mbp in 8 chromosomes) is much larger than a bacterial genome (-4 Mbp) and RFLP analysis would be more complex. PCR-based molecular typing methods The randomly amplified polymorphic DNA-PCR (RAPD-PCR) is a method that is considered standard in many laboratories (Diaz-Guerra et al., 2000; Rath et al., 2002). Assays based on RAPD-PCR determine the DNA sequence variation by amplifying DNA fragments flanked by sequences complementary to short primers. DNA profiles will differ between strains by the presence or absence of primer sites, priming completeness, and the distance between priming sites. Although the RAPD- PCR has potentially great discriminatory power, it presents significant technical challenges and can be difficult to implement. An alternative PCR-based approach is the microsatellite (or simple tandem repeats) assay. The genomic DNA of many organisms, including A. fumigatus, contains 6 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. variable microsatellite regions, i.e. a stretch of polynucleotide repeats of various lengths. The length of a particular microsatellite may mark a particular lineage (i.e. strain). When the unique sequence flanking both ends of the microsatellite region is known, a PCR can be performed to determine the length of the repeat region (Groppe and Boiler, 1997). Antifungal therapy for Invasive Aspergillosis Current antifungal treatment for aspergillosis remains unsatisfactory as IA continues to exhibit high mortality rates. In many healthcare institutions, amphotericin B preparations are the drugs of choice, though the development of new azoles and echinocandins are very promising (Singh and Paterson, 2005). Amphotericin B belongs to the polyene class of antifungals which directly targets ergosterol, the primary sterol found in fungal cytoplasmic membranes. This interaction increases membrane permeability, causing cell death through membrane leakage. Amphotericin B in some formulations (e.g. containing deoxycholate) interacts with cholesterol in human cell membranes, which may explain the nephrotoxicity in 80% of patients (Abuhammour and Habte-Gaber, 2004). To reduce the toxicity of amphotericin B, liposomal formulations have been developed. Furthermore, this formulation has the added benefit of improved pharmacokinetics. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Azoles, such as itraconazole and voriconazole, disrupt fungal cell integrity by inhibiting the cytochrome P450 (CYP-450) system involved in the conversion of lanosterol to ergosterol. Voriconazole is generally well tolerated. Both liposomal amphotericin B and voriconazole are currently considered first-line treatment options for IA (Abuhammour and Habte-Gaber, 2004). Echinocandins, such as Caspofimgin, are a new class of antifugals. These agents act by inhibiting the synthesis of P-l,3-glucan, a polysaccharide in the fungal cell wall (Abuhammour and Habte-Gaber, 2004). Such disruption of the fungal cell wall results in osmotic stress and eventual lysis. Aside from the shortcomings of current antifungal therapies, the Division of Bacterial and Mycotic Diseases of the CDC has recently listed other challenges facing the treatment of aspergillosis. Chiefly among these: the ability to identify risk factors for disease in immunocompromised individuals, the improvement of understanding of the source and routes of transmission, and the development of sensitive and specific methods for earlier diagnosis (CDC, 2003). The purpose of this project is to optimize and compare PCR-based strain typing methods, detect and quantify gliotoxin production in clinical isolates, and test amphotericin B effects on A. fumigatus gliotoxin release. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. METHODS Reagents Unless otherwise stated, reagents were obtained from Sigma-Aldrich, St. Louis, Missouri. Isolates Thirty-eight A. fumigatus isolates were acquired from the Clinical Microbiology Laboratory of Childrens Hospital Los Angeles. The organisms were obtained as anonymous cultures to protect patient confidentiality and private health information (PHI) as mandated by HIPAA. Species identification was based on the colonial and microscopic morphology of the isolates. Subcultures were maintained on Mock YEPD Agar plates (20 g of peptone-Y, 10 g of Mock Yeast Extract, 20 g of dextrose, and 17 g of agar-Y per liter; Q-biogene, Irvine, Calif.) and stored at 4°C. Mock yeast media was chosen because it contains no fungal material (e.g. DNA), which would have possibly complicated our molecular analyses. Conidial suspensions of each isolate were archived in phosphate buffer saline (PBS)-10% glycerol solution and stored at -80°C. All procedures involving the transfer of conidia were performed in a class II biological safety cabinet to reduce the risk of cross-contamination between the experimental cultures and the environment. 9 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. DNA extraction Two methods of extracting A. fumigatus genomic DNA were compared: a method using phenol-chloroform isamyl alcohol (PCA; 25:24:1) and the DNeasy Tissue kit (Qiagen, Valencia, Calif.). DNA extraction using the PCA method A nickel-size swab of mycelium was transferred to 2 ml microcentrifuge tube containing 2 mm silica beads (Lysing Matrix C, Q-biogene), TE buffer, and PCA. The samples were then vigorously shaken in the FastPrep Instrument (BiolOl Systems, Irvine, Calif.) at a speed of 6.5 for 45 seconds. The tube was then centrifuged (at 13,300 r.p.m.) at room temperature for 3 min. and the upper, aqueous solution was transferred to a separate tube. Sodium acetate buffer (pH 5.2) was added to a final concentration of 0.3 M, and the DNA was precipitated by the addition of an equal volume of isopropanol. The DNA was pelleted by centrifugation and the material was washed with 70% ethanol. The air-dried DNA pellet was re-dissolved in TE buffer (lOmM Tris-Cl, pH 8.3, 1 mM EDTA), diluted to 25 ng/pl, and stored at -20°C. DNA extraction using the DNeasy Tissue kit A nickel-size swab of mycelium was transferred to a 2 ml microcentrifuge tube containing 2 mm silica beads and buffers ATL and AL from the DNeasy Tissue kit, then processed in the FastPrep Instrument at a speed of 6.5 for 45 seconds. After the 10 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. addition of proteinase K and RNase A, the tubes were incubated at 70°C for 30 minutes. DNA was isolated from the supernatant using the DNeasy Tissue kit following the manufacturer’s instructions. The extracted DNA was then diluted with TE buffer to 25 ng/pl and stored at -20°C. Preliminary studies showed that the extraction method had no effect on PCR results. However, the DNeasy Tissue kit resulted in a more consistent recovery of DNA and avoided the use of hazardous organic materials. Thus, it was the preferred method used for subsequent experiments. Polymerase Chain Reaction (PCR) The basic PCR conditions were: 1.25 units of HotStarTaq DNA polymerase (Qiagen), 200 pM dNTPs, lx HotStarTaq Buffer (a propriety buffer containing 1.5 mM MgCh), 10 pmoles primers, and 25-100 ng/DNA in a final volume of 25 pi. Quantitation of the DNA was performed using the Nucleic dotMetric Assay (Geno Technology, St. Louis, Mo.). The reactions were cycled in an iCycler Thermal Cycler (Bio-rad, Hercules, Calif.). In some experiments, the PCR additives, DMSO (5%; Stratagene, La Jolla, Calif.) or Solution Q (a proprietary additive from Qiagen) were used. 11 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. RAPD-PCR analysis Four RAPD-PCR assays were evaluated using the primers: R-108, R-151, AP12h, and PC (Table 1). The amplification conditions were 45 cycles of 94°C for 1 minute, 36°C for 2 minutes, and 72°C for 2 minutes. These initial cycling conditions were based on the approach described by Diaz-Guerra, et al. (2000). The RAPD-PCR products were resolved by 1% agarose gel electrophoresis with SYBR Gold staining (Molecular Probes, Eugene, Ore.). Microsatellite PCR analysis Four microsatellite assays were evaluated using the 4 primer pairs: A-l & A-2; B-l & B-2; C-l & C-2, and D-l and D-2 (Table 1). The basic reaction conditions of the microsatellite PCR were 32 cycles of 94°C for 30 seconds, 57°C for 30 seconds, and 72°C for 30 seconds. The microsatellite products were resolved by electrophoresis using 6% polyacrylamide gel in TBE (TBE-PAGE) and stained with SYBR Safe (Molecular Probes). Each polyacrylamide gel was made fresh in the laboratory using a 19:1 bis-acrylamide solution (Genemate, Kaysville, Utah) and in a final concentration of lx TBE buffer (0.45 M Tris-Borate, pH 8.3, 0.01 M EDTA; Eppendorf Scientific, Westbury, New York). Two internal markers were developed to aid the size analysis of the microsatellite PCR products. The standards (66-bp and 219-bp) were generated from Mycobacterium smegmatis DNA by PCR using primer pairs: (a) ASPIC-1 & ASPIC- 12 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 2; and (b) ASPIC-3 & ASPIC-4 (Table 1). The standards were added to each post- PCR microsatellite reaction prior to loading the polyacrylamide gels. Table 1: PCR primer sequences Typing Method Primer Sequence References RAPD R-108 R-151 AP12h PC GTATTGCCCT GCTGTAGTGT CGGCCCCTGT TCACCCTGGA (Rath et al., 2002) (Diaz-Guerra et al., 2000) (Diaz-Guerra et al., 2000) (Rath et al., 2002) A-l A-2 GCCTACGATGACCGAAATGA CTGTTTTGAGAAGCGGATGG (Bart-Delabesse etal., 1998) B -l B-2 TTGCCATCGCTTGTCATAGA GCAGGTGGTTCAATAGGACAG (Bart-Delabesse et a l, 1998) C-l C-2 CGAAGCTCTCCCCTGCAAATC GATGCCGCTGGTGGTGTTGT (Bart-Delabesse et al., 1998) D-l D-2 AGGGATACGGCTACGGACAA AAAGCGTCTGTCAGCGTGTCT (Bart-Delabesse et al., 1998) ASPIC-1 ASPIC-2 CGAACTGCGCACGGAGAAGCCT TGGAGCTGCCGGGAATTGAACC this study this study in te rn a l m a n re rs - ASPIC-3 GCTGATCGACGGCTTGTTCTAC this study ASPIC-4 GCTGCGTTCCACCCATTTAAT this study Pattern analysis A Kodak FOTO/UV 300 transilluminator (Eastman Kodak, Rochester, New York) was used to help view the gels, and the images were captured and digitized using a Kodak EDAS 290 digital documentation system (Eastman Kodak). The sizes of the bands within each pattern was analyzed using the Discovery Series Quantity One software package (Bio-rad). Culture conditions and gliotoxin production Conidia were harvested from 4-day-old agar plate cultures of each Aspergillus isolate 13 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. and placed in a PBS-10% glycerol solution. The optical density (OD) of the sample was read using a SmartSpec 3000 spectrophotometer (Bio-rad). Culture counting experiments determined that an OD (X — 600 nm) of 1.00 was equivalent to 3.9 x 106 conidia/mL. The basic culture conditions were 107 A. fumigatus conidia in 25 ml of Mock YEPD-G Broth (20 g of peptone-Y, 10 g of Mock Yeast Extract, and 20 g of dextrose per liter; Q-biogene; supplemented with 10 g/1 of glucose). The suspensions were cultured in 250-ml Erlenmeyer flasks at 37°C and 150 r.p.m. rotation for 24 to 96 hours. To harvest the cells and supernatant for gliotoxin detection, the suspensions were filtered through a basket-type coffee filter paper sheet stacked on top of a 9.0 cm filter paper disk (Fisher Scientific). The use of the basket filter paper facilitated the recovery of the organism. The supernatant was collected and stored at -80°C. Assessing A. fumigatus culture biomass Two methods were used to determine the biomass of a culture. The first method was utilized when the culture size was small. A sample of the culture was initially placed in the FastPrep Instrument and shaken vigorously to disrupt the mycelium. The optical density (A , = 600 nm) of the homogenized mycelium was then measured. The second method assessed biomass by determining the dry weight of the organism. The filtered organisms (as described above) were dried at 94°C until the weight 14 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. stopped decreasing (approximately 2 days). It was determined that 1.13 mg/mL dry weight was equivalent to an OD of 1.00. Gliotoxin extraction The procedure for the extraction of gliotoxin has been previously decribed by Richard, et al. (1989). Briefly, chloroform (stabilized with 1% ethanol; Sigma- Aldrich) was added to the thawed culture filtrate at a 1:1 v/v ratio, and continually mixed for 10 minutes. The chloroform fraction was removed and this process was repeated 2 more times with fresh chloroform. The 3 chloroform fractions were collected and evaporated to dryness in a 47°C water bath. Dried extracts were dissolved in 100 pi of methanol and stored at -20°C until assayed. Quantification of gliotoxin by thin-layer chromatography The detection and quantification of gliotoxin was performed by thin-layer chromatography (TLC). Five microliters of each extract in methanol were spotted 3 cm from the bottom of a TLC plate (20 x 20 cm acid washed silica gel, highly purified matrix, on glass with fluorescent indicator; Sigma-Aldrich) along with 3 dilutions of a gliotoxin standard (gliotoxin from Gliocladium virens; Fluka-Riedel, Switzerland). The running solvent was methanol, and the plates were developed in a latch-lid Chromatotank (General Glassblowing Co., Richmond, Calif.) until the solvent front was 3 cm from the end of the TLC plate. The plates were dried in a 50°C oven and viewed using the Kodak ED AS 290 digital documentation system 15 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. (Eastman Kodak). Quantity One software (Bio-rad) was used to determine spot size. Quantitation of gliotoxin was achieved by comparing spot size with gliotoxin standards run on the same TLC plate and reference to an external extended standard curve determined previously. Gliotoxin area size on the TLC plate was shown to have a linear relationship with the amount of gliotoxin spotted. The TLC plate development was tested on several different methanol-chloroform solvent systems, as described in previous publications (Belkacemi et al., 1999; Richard et al., 1989). However, the gliotoxin spots developed best in a 100% methanol solvent. In addition, treatment of the developed TLC plates with sulfuric acid (Richard et al., 1989) or silver nitrate (Belkacemi et al., 1999) was found to be unnecessary. Macrodilution susceptibility test: amphotericin B (AmB) Two A. fumigatus isolates were sub-cultured on YEPD agar plates and incubated at 30°C for 4 days to allow for germination and conidial growth. The conidia were swabbed off and placed in Mock YEPD-G Broth media, which was incubated at 37°C for 4 to 8 hours to germinate. The sample was distributed among test tubes containing a dilution series of a deoxycholate formulation of amphotericin B (Sigma- Aldrich). The drug concentrations were determined from the proportion of the drug preparation that was amphotericin (45%). The growth was scored visually at 24, 48, and 72 hours, and rated using a 0 to 4-plus scale. 16 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. AmB effects on A. fumigatus gliotoxin production Three A. fumigatus isolates (isolate #19, #9, and #6) were sub-cultured on YEPD agar plates, and incubated at 30°C for 4 days. For each isolate, six 250-ml Erlenmeyer flasks containing 75 ml of Mock YEPD-G Broth were inoculated with 3 x 107 conidia. The flasks were incubated for 48 hours at 37°C and 150 r.p.m. After 48 hours, the culture supernatant and cells were separated from one flask and the biomass was determined as described above. The remaining cultures were supplemented with amphotericin B at final concentrations of 0, 0.32, 0.64, 1.28, and 2.56 pg/ml, then incubated at 37°C for an additional 4 hours. The supernatant and cells were separated as described above. The supernatant were split into three equal aliquots and the gliotoxin was extracted. The three aliquots controlled for variability in gliotoxin extraction. 17 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. RESULTS AND DISCUSSION Strain typing Aspergillus fumigatus The hypothesis for this section is that PCR-based strain typing assays can distinguish between different strains of A. fumigatus. Moreover, the purpose of these studies was to compare the Aspergillus strain typing ability of 8 PCR-based assays: 4 RAPD-PCR assays and 4 microsatellite assays (Table 1). The assays were evaluated based on the clarity of the results, robustness, discriminatory power, and ease of use. As an initial part of these studies, the assays were optimized. RAPD-PCR analysis Currently, the RAPD-PCR assay is considered by many laboratories as the method of choice for strain typing Aspergillus and is a popular method to study epidemiology of other fungi (Chen et al., 2005; Heinemann et al., 2004). It uses a single, short primer (about 10-bp) and low stringency amplification reactions (i.e. low primer annealing temperatures). Such reactions can generate amplification products with sizes ranging from 200-bp to 3000-bp. A single nucleotide substitution can allow or prevent primer binding, so small differences in the DNA would be reflected in the appearance of bands (Taylor et al., 1999). Thus, with the right primer, it is theoretically possible to distinguish closely related, but nonetheless genetically distinct lineages of organisms (i.e. different strains). 18 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Initially, the RAPD-PCR assays were set up with the run parameters proposed by Diaz-Guerra, et al. (2000). However, these reactions gave unsatisfactory results (a few faint bands). Higher annealing temperatures (30 to 38°C) produced more bands, and optimal results for each assay were achieved at 36°C. Increasing the number of PCR amplification cycles was also shown to produce more bands. Satisfactory results were achieved only when more than 40 cycles were performed. The 4 RAPD-PCR assays were initially evaluated against 10 isolates, but only two assays gave satisfactory results, namely R-151 and PC (Fig. 2). The R-151 and PC assays gave clearer, brighter, and an optimal number of bands (e.g. 5 to 25 bands). Different strains are distinguished by the banding pattern produced by each assay. An assay has a greater discriminatory potential if it produces a larger number of discemable bands. However, too many bands (greater than 25 bands) will make discerning changes difficult. Figure 2. The RAPD-PCRs. The 4 RAPD-PCR assays were assessed against 10 isolates (numbered 1 to 10). (C) no-DNA control. (M) DNA ladder (50-bp to 3000- bp)^___________________________________________________________________ 19 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. R-108 gave the least reproducible results and the poorest discriminatory power (producing only 4 patterns from 10 strains). This was somewhat surprising as this RAPD-PCR has been heralded in several laboratories as the standard method of A. fumigatus strain typing (Chen et al., 2005; Lasker, 2002; Lin et al., 1995), The AP12h assay was initially promising, giving several banding patterns. However, because bands were consistently found in the no-DNA control, the results from this assay were deemed as unreliable (Fig. 2). The DNA fragments found in the no-DNA control most likely resulted from the primer binding to residual E. coli DNA usually present in Taq preparations. The two best RAPD-PCR assays were tested against 5 additional isolates. In a comparison of the 15 isolates, the R-151 assay was able to generate 11 patterns, whereas the PC assay could generate only 7 patterns. By combining the results of both assays, 12 different patterns were detected. Intriguingly, the R-151 assay consistently produced the same two bright bands (2233-bp and 1398-bp) for each isolate (Fig. 2), with the differential banding patterns apparent in the smaller, fainter bands. Optimization o f the R-151 assay Based on the previous experiments, the R-151 RAPD-PCR assay was chosen for this investigation, specifically to determine effects of several PCR conditions: template DNA concentration, PCR additives, primer purity, and MgCl2 concentration. 20 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. A range of DNA concentrations (5 to 80 ng/pl) from 5 Aspergillus isolates were tested against the R-151 assay. For each preparation, DNA concentrations of 20-25 ng/pl resulted in the brightest bands, with higher concentrations resulting in fewer and fainter bands. Bands disappeared completely when DNA template concentrations were greater than 40 ng/pl. The PCR additives Solution Q (a proprietary PCR enhancer from Qiagen) and DMSO are sometimes used in PCRs and may improve results. However, with the possible exception of very high GC content DNA (>70% GC), the effects of such PCR additives cannot be predicted, and thus requiring empiric evaluation. Both additives were found to alter banding patterns (Fig. 3 A), with 5% DMSO giving highest banding intensity and the most bands. In fact, the addition of Solution Q resulted in fewer bands than the no-additive control (Fig. 3 A). In all experiments, the no-template DNA controls did not contain any bands. To assess the affect of primer purity on the RAPD results, a desalted preparation of R-151 (unpurified; estimated 60 to 80% full length) was compared to a high performance liquid chromatography (HPLC)-purified fraction of R-151 (estimated >90% pure). Interestingly, the HPLC-purified R-151 produced fewer bands than the unpurified R-151 (Fig. 3B). An explanation for this result may be that purification 21 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. reduces variability within primer preparations, which consequently, will reduce the potential for random priming. This result has several significant implications to the implementation of RAPD-PCR. First, unpurified primers may have greater utility for RAPD-PCR, i.e. they improve banding patterns. Second, and perhaps more importantly, the purity of the primer may impact the obtained banding patterns. This raises serious implications for the reproducibility of the assays between batches of primer and between laboratories. Another parameter that can profoundly affect PCR performance is the Mg concentration, and like the PCR enhancers, the effects of Mg2 + must be assessed experimentally. Concentrations of MgCb between 2.5 and 5.0 mM were tested and exhibited concentration-dependent effects on the banding patterns (Fig. 3C). Higher MgCb concentrations resulted in fainter and fewer bands. The optimal MgCh concentration was deemed to be 3.0 mM. 22 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Figure 3. Effects of PCR conditions on the RAPD-PCR: (A) PCR enhancers, Solution Q and DMSO. (B) Unpurified versus HPLC-purified primer (R-151). (C) Mg2 + concentration. (M) DNA ladder (50-bp to 3000-bp). 1 2 3 4 5 6 ggggg **lp| SSI hriff S 3 ig N g p H * * " " " * * * * tlltetrtfflWiil f l P P P H ^ Isolate #16 1. no additive 2. with Solution Q 3. with 5% DMSO Isolate #$ 4. no additive 5. with Solution Q 6. with 5% DMSO B #16 #8 #13 #15 #2 U P U P U P U P U P ■4 Isolate Accession Number (U) unpurifed R-151 (P) H PLC-purified R-151 ISOLATE #16 ISOLATE #9 M 2.5 3.0 3.5 4.0 4.5 5.0 2.5 3.0 3.5 4.0 4.5 5.0 -< [MgCl2] (mM) 23 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. The microsatellite-PCR analysis The microsatellite assay, an emerging approach to strain typing, utilizes the highly variable DNA regions made up of many tandem repeats of nucleotide n-tuplets (e.g. couplets, triplets, quadruplets). Unlike RAPD-PCR assays, microsatellite assays usually produce only a single band, the size of which is dependent on the number of repeats in the microsatellite region (Fig. 4). The number of repeats is believed to be conserved within a genetic lineage (i.e. strains). Isolates having a different number of repeats would indicate genetic deviation, and hence assumed to be different strains. Microsatellite assays, like traditional PCRs, use 2 primers to amplify the target; RAPD-PCR uses only one primer. Figure 4. The microsatellite strain-typing assay. Tested against 10 A. fumigatus isolates (numbered 1 to 10). The internal size standards are indicated by the arrows. (M2) DNA ladder (51-bp to 587-bp). PRIM ER S A 1 & A -2 PRIM ER S D-l & D-2 M 2 1 2 3 4 5 6 7 8 9 10 I 2 3 4 5 ( > 7 8 9 10 Size (bp) 122 144 128 144 121 110 122 109 128 123 122 132 114 104 % 104 120115 112 100 24 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Two internal size standards were created for the accurate sizing of the microsatellite PCR products (Fig. 4). Often, polyacrylamide gels would distort when subjected to high current and voltage levels. Since the strain type is determined by the size of single band, accurate strain typing could only be achieved when all lanes run at the same rate. The 219-bp and 66-bp standards correct for any distortions and discrepancies between lanes. In fact, with the internal markers, comparisons of PCR products from separate gels can be made with greater accuracy. The effects of several PCR conditions (e.g. primer annealing temperatures, the number of PCR amplification cycles, and PCR additives) were evaluated against the 4 microsatellite assays (see Table 1). Different primer annealing temperatures (55 to 65°C) were tested against the microsatellite assays, and were shown not to change the band size. However, there was a disappearance of bands when annealing temperatures were above 57°C. The number of PCR amplification cycles (30 to 34 cycles) was also shown not to change the microsatellite-PCR results. PCR enhancer Solution Q had no effect on band sizes or banding intensities. Since the assays were not affected by PCR amplification conditions, the effects of Mg2 + concentration and primer purity were not tested. The four microsatellite assays were initially evaluated against ten A. fumigatus isolates. The B-1/-2 assay had very poor discriminatory power, distinguishing two strain types from 10 isolates, while the C-1/-2 assay had no discriminatory power 25 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. (i.e. determining that all 10 isolates had the same strain type). The two better assays (A-1/-2 and D-1/-2) were evaluated against 5 additional isolates. The A-1/-2 assay and the D-1/-2 assay could only detect respectively 4 strain types and 6 strain types out of 15 isolates, individually. However, when both assays are combined, they could discern 10 strain types out of 15 isolates. After evaluating the assays, it was concluded that the microsatellite method is much more robust than the RAPD-PCR method. The bands resulting from the microsatellite assays were not affected by PCR conditions, and produced consistent results. Unlike the RAPD-PCR assays, the microsatellite assays would report consistent band sizes for a particular isolate, regardless of PCR amplification conditions. Although the shorter primers and multiple banding characteristics of the assay give the RAPD-PCR method potentially great discriminatory power, it also suggests that its results would be subject to PCR conditions. Its lack of reproducibility has been well documented (Bart-Delabesse et al., 1998; Lasker, 2002; Leenders et al., 1999; Lin et al., 1995). The RAPD-PCR assays’ sensitivity to PCR conditions suggests that interpretation of results between laboratories would be difficult, and collaborative efforts necessitate tightly controlling laboratory conditions. On the other hand, the combined microsatellite assay (A-1/-2 and D-1/-2) has good discriminatory power, is much more robust, and is easier to interpret than the RAPD- 26 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. PCR assays. The internal size standards would help ensure correct band sizing. Since results can be generated quickly and accurately, the microsatellite assay would work well for in any lab with experience in PCR. Heterogeneity of gliotoxin production by A. fumigatus The A. fumigatus isolates exhibited molecular heterogeneity, as determined by the strain typing assays. Hence, heterogeneity in gliotoxin secretion was also expected. However, before a study of gliotoxin production in vitro can be initiated, the growth characteristics of the organisms needed to be evaluated. The growth of A. fumigatus was tracked by measuring optical density of the homogenized mycelium as an indication of biomass (Fig. 5). The growth curve of isolate #19 showed that the growth phase continued until 48 hours, when the culture began to enter stationary phase. Previous studies have shown that most of the gliotoxin was produced after 29 hours of incubation (Belkacemi et al., 1999). Since the gliotoxin accumulation was likely to be maximal when the culture was in stationary phase, the kinetics of gliotoxin secretion was assessed at 48, 72, and 96 hours using TLC (see Appendix: Detection of gliotoxin by TLC). Each of the 15 isolates evaluated produced detectable amounts of gliotoxin (estimated detection limit -40 ng/mL). The total amount of gliotoxin in the culture supernatant for sample was normalized to the biomass of the 27 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. mycelium in the sample. This ensured that any differences in the level of secreted gliotoxin were not due to differences in mycelium size. 25.0 O O 10.0 c ro a > ^ 5.0 0.0 40 60 80 0 20 100 Time (in hours) Figure 5. A. fumigatus growth curve. Optical density (OD) measurements of isolate #19 during culture in YEPD-G media at 37°C. The average gliotoxin produced was 141 pg/g [dry weight, dw] (median 127 pg/g [dw]), though the standard deviation was high (76% of the mean). This variability between isolates was deemed to be too high to enable meaningful analysis using absolute gliotoxin levels. Therefore, the data was modified for each isolate and 28 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. calculated as a proportion of the maximum gliotoxin secretion level for that particular isolate. Overall, the extracellular gliotoxin levels remained relatively constant over the 48 to 96 hour screening period (Fig. 6). Using a two-tailed t-test, no significant differences were found in the amount of gliotoxin produced between 48 hours and 72 hours (P = 0.273), between 72 hours and 96 hours (P = 0.240), or between 48 hours and 96 hours (P = 0.975). Assuming that detectable gliotoxin does not leave the system (e.g. by degradation or reuptake by the organism), it is concluded that A. fumigatus cultures produce gliotoxin maximally by 48 hours. Figure 6. Gliotoxin production at each time point. Gliotoxin (gtx) production is represented as a percentage of the peak for each isolate. 100 n ? ! 8°- ■C o CO CD o iu 60 ■ “ ■ C D £ * - o>£ %% 40- '■*= C D Q_ <D w- 2 0 - O '' 48 72 96 Time Point 29 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. In order to assess the inter-isolate variability, the isolates were ordered in respect to gliotoxin secretion (Fig. 7). Intriguingly, this analysis suggested that the isolates form two groups: a set of low gliotoxin producers (less than 100 pg/g) and a set of high gliotoxin producers (above 230 pg/g). The one exception appeared to be isolate #2, which secreted an intermediate level of gliotoxin (151 pg/g). A one-tailed t-test shows a significantly greater amount of gliotoxin found in the supernatant of the high producers (P < 0.0001). Exclusion or inclusion of isolate #2 in either group for the statistical test does not change the significance. Although the groups may reflect sampling bias of a continuum, it is intriguing to speculate that the dichotomy may be clinically relevant. For instance, Reeves et al. found that Galleria mellonella infected with high producers were more susceptible to invasive aspergillosis (Reeves et al., 2004b). Furthermore, they found that gliotoxin plays a more important role in virulence than growth rate or enzymatic activity. Thus, gliotoxin levels alone may be an indicator for invasiveness of disease. 30 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Figure 7. Peak gliotoxin secretion. The peak amount of gliotoxin produced for each isolate. Two distinct populations are seen: 7 isolates producing less than 100 pg/g [dw] of gliotoxin and 7 isolates producing more than 230 pg/g [dw] of gliotoxin. The strain typing pattern was determined by the microsatellite assay. 450 HIGH PRODUCERS S. 350 i 300 LOW PRODUCERS 38 1 6 8 14 10 2 19 15 13 3 16 4 5 A K L D H G G c E F I B G J Isolate Number - Strain Typing Pattern Effects of amphotericin B on gliotoxin release The antifungal, amphotericin B, acts by increasing the permeability of the fungal cell wall, leading to cell death. However, this change in permeability may also lead to an increased release of intracellular gliotoxin. Elevated levels of gliotoxin may exacerbate the effects of an A. fumigatus infection by increased toxin-mediated 31 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. cellular damage, and increased suppression of the immune response. Thus, this study was initiated to investigate the effects of amphotericin B on gliotoxin release. As a prelude to investigating the effects of amphotericin B on gliotoxin release, the susceptibility of the test isolates to this antifungal agent was assessed. The isolates used in these studies were #19, #9, and #6. These were chosen because they were distinct strains (indicated by the typing assays described previously) and they represented a high gliotoxin producer (#19) and low gliotoxin producers (#9 and #6). The minimum-inhibitory concentration of amphotericin B for all three isolates was 2.56 pg/ml. The effect of amphotericin B was assessed on 48-hour cultures (i.e. early stationary phase). The amphothericin B incubation was limited to four hours to minimize permeability changes resulting from cell death and disintegration. The gliotoxin levels showed a concentration dependent relationship with amphotericin B for isolate #19, up to a concentration of 0.64 pg/ml (Fig. 8). Gliotoxin secretion levels decreased at amphotericin concentrations higher than 0.64 pg/ml. Equivalent results were obtained for two other isolates (isolates #9 and #6). Although it was anticipated that amphotericin B has an effect, the simplest hypothesis to statistically test is that this drug has no significant effect on gliotoxin release. An analysis of variance (ANOVA) was performed to test whether 32 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. amphotericin B had any effect on the amount of gliotoxin released. The ANOVA showed that there are significant differences between the amount of gliotoxin produced from cultures supplemented with amphotericin B and cultures not supplemented with amphotericin B, where F(8,18) = 40.1 (P < 0.001). T-tests were also performed for each drug concentration against the average gliotoxin produced from the 48-hour no-drug control (TO), and significant differences (P < 0.001) were found at certain final amphotericin B concentrations (Fig. 8). Figure 8: Effect of Amphotericin B on gliotoxin release by A. fumigatus isolate #19. The TO culture was harvested at immediately prior to the addition of amphotericin B; all other cultures were harvested 4 hours later. The bold horizontal line and shaded region represents mean gliotoxin yield ± s.e. (~7% of mean) for all samples in this experiment. (*) T-test (P < 0.001). 300 U) ___ a 200 o 150 mean = 178 0.04 0.08 0.16 0.32 0.64 1.28 Amphotericin B concentration (pg/ml) 33 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Interestingly, the amphotericin B effects on gliotoxin secretion were only seen at concentrations below the MIC. However, since the MIC is a measure of growth inhibition, how this breakpoint relates to organisms in stationary phase (i.e. organisms that are not growing) is not known. These studies established that amphotericin B can cause an increased release of gliotoxin. The results corroborate the findings observed by other groups (Reeves et al., 2004a). In their study, gliotoxin levels also increased after A. fumigatus cultures were supplemented with amphotericin B. The greatest amount of gliotoxin was detected in the culture supplemented with 0.32 pg/ml amphotericin B, although the effects of higher concentrations were not tested (Reeves et al., 2004a). The clinical significance of these results is unclear, although the administration of the drug may be deleterious to the patient. Gliotoxin (LD50 = 67 mg/kg) has less acute toxicity than aflatoxin (a mycotoxin produced by A.flavus, LD50 = 0.4 mg/kg). Despite this, gliotoxin has a profound effect on cells, especially cells involved in primary and cell-mediated immunity, causing damage to mucosal epithelial and inducing macrophage apoptosis (Amitani et al., 1995b). Thus, therapies which increase levels of gliotoxin may exacerbate tissue damage and invasion for patients with aspergillosis. 34 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Concluding Remarks These results have important implications in the control of invasive aspergillosis. Strain typing clinical isolates is a method of studying the epidemiology of A. fumigatus and determining the source of a pathogenic strain, as well as being a potential diagnostic tool. Although I have demonstrated that the RAPD-PCR assay is very sensitive to PCR conditions, the microsatellite assay has good discriminatory power and is a good alternative. Aside from DNA-based methods, gliotoxin secretion may also be useful in diagnosis. In a recently published paper, investigators have found detectable levels of gliotoxin in the sera of patients with invasive aspergillosis, which suggests that evidence of gliotoxin in sera could also be diagnostic for L A . (Stanzani et al., 2005). Before a gliotoxin-based method for diagnosis can be developed, it is necessary to establish that all invasive A. fumigatus strains produce gliotoxin. In our study, all 15 isolates are shown to produce detectable levels of gliotoxin, although not all isolates are likely to be invasive. In addition, these studies suggest two distinct populations of A. fumigatus, high producers and low producers. If the level of gliotoxin secretion is important to the virulence of A. fumigatus as indicated by Reeves et al. (2004b), then some isolates may be more invasive than others. Thus, the risk of invasive disease depends not only on the health (i.e. immune status) of the person, but also on the type of the infecting pathogen. If the organism is a 35 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. high gliotoxin producer, the patient may be more likely to develop for invasive disease. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. REFERENCES Abuhammour W, Habte-Gaber E. 2004. Newer antifungal agents. Indian J Pediatr 71(3):253-9. Amitani R, Murayama T, Nawada R, Lee WJ, Niimi A, Suzuki K, Tanaka E, Kuze F. 1995a. Aspergillus culture filtrates and sputum sols from patients with pulmonary aspergillosis cause damage to human respiratory ciliated epithelium in vitro. EurRespir J 8(10):1681-7. Amitani R, Taylor G, Elezis EN, Llewellyn-Jones C, Mitchell J, Kuze F, Cole PJ, Wilson R. 1995b. Purification and characterization of factors produced by Aspergillus fumigatus which affect human ciliated respiratory epithelium. Infect Immun 63(9):3266-71. Bart-Delabesse E, Humbert JF, Delabesse E, Bretagne S. 1998. Microsatellite markers for typing Aspergillus fumigatus isolates. J Clin Microbiol 36(9):2413-8. Belkacemi L, Barton R, Hopwood V, Evans E. 1999. Determination of optimum growth conditions for gliotoxin production by Aspergillus fumigatus and development of a novel method for gliotoxin detection. Med. Mycol. 37:227-233. Bernardo P, Brasch N, Chai C, Waring P. 2003. A novel redox mechanism for the glutathione-dependent reversible uptake of a fungal toxin in cells. J Biol Chem. 278(47):46549-46555. Bertout S, Renaud F, Barton R, Symoens F, Burnod J, Piens M-A, Lebeau B, Viviani M-A, Chapuis F, Bastide J-M and others. 2001. Genetic Polymorphism of Aspergillus fumigatus in Clinical Samples from Patients with Invasive Aspergillosis: Investigation Using Multiple Typing Methods. J Clinical Microbiology 39(5):1731- 37. CDC. December, 2003. Aspergillosis - technical information. <http://www.cdc.gov/ncidod/dbmd/diseaseinfo/aspergillosis t.htm>. Accessed March 22, 2005. Chen J, Li H, Li R, Bu D, Wan Z. 2005. Mutations in the cyp51A gene and susceptibility to itraconazole in Aspergillus fumigatus serially isolated from a patient with lung aspergilloma. J Antimicrob Chemother 55(l):31-7. Diaz-Guerra TM, Mellado E, Cuenca-Estrella M, Gaztelurrutia L, Navarro JI, Tudela JL. 2000. Genetic similarity among one Aspergillus flavus strain isolated from a patient who underwent heart surgery and two environmental strains obtained from the operating room. J Clin Microbiol 38(6):2419-22. 37 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Groll AH, Shah PM, Mentzel C, Schneider M, Just-Nuebling G, Huebner K. 1996. Trends in the postmortem epidemiology of invasive fungal infections at a university hospital. J Infect 33(l):23-32. Groppe K, Boiler T. 1997. PCR assay based on a microsatellite-containing locus for detection and quantification of Epichloe endophytes in grass tissue. Appl Environ Microbiol 63(4): 1543-50. Heinemann S, Symoens F, Gordts B, Jannes H, Nolard N. 2004. Environmental investigations and molecular typing of Aspergillus flavus during an outbreak of postoperative infections. J Hosp Infect 57(2): 149-55. Khan AN. March 6, 2003. Aspergillosis, Thoracic. <http://wvAv.emedicine.com/radio/topic55.htm>. Accessed March 10, 2005. Lasker B. 2002. Evaluation of Performance of Four Genotypic Methods for Studying the Genetic Epidemiology of Aspergillus fumigatus Isolates. J Clinical Microbiology 40(8):2886-2892. Leenders A, van Belkum A, Behrendt M, Luijendijk A, Verbrugh H. 1999. Density and Molecular Epidemiology of Aspergillus in Air and Relationship to Outbreaks of Aspergillus Infection. J Clinical Microbiology 37(6): 1752-1757. Leenders A, van Belkum A, Janssen S, de Marie S, Kluytmans J, Wielenga J, Lowenberg B, Verbrugh H. 1996. Molecular epidemiology of an apparent outbreak of invasive aspergillosis in a hematology ward. J Clin Microbiol(34):345-352. Lennette E, Balows A, Hausler W, Shadomy H, editors. 1985. Manual of Clinical Microbiology. Fourth ed. Washington, DC: American Society for Microbiology. 1149 p. Lin D, Lehmann P, Hamory B, Padhye A, Durry E, Pinner R, Lasker B. 1995. Comparison of Three Typing Methods for Clinical and Environmental Isolates of Aspergillus fumigatus. J Clinical Microbiology 33(6):1596-1601. Mullbacher A, Waring P, Eichner RD. 1985. Identification of an agent in cultures of Aspergillus fumigatus displaying anti-phagocytic and immunomodulating activity in vitro. J Gen Microbiol 131(5): 1251-8. Rath PM, Petermeier K, Verweij PE, Ansorg R. 2002. Differentiation of Aspergillus ustus strains by random amplification of polymorphic DNA. J Clin Microbiol 40(6):2231-3. Reeves E, Murphy T, Daly P, Kavanagh K. 2004a. Amphotericin B enhances the synthesis and release of the immunosuppressive agent gliotoxin from the pulmonary 38 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. pathogen Aspergillus fumigatus. J Med Microbiol 53:719-725. Reeves EP, Messina CG, Doyle S, Kavanagh K. 2004b. Correlation between gliotoxin production and virulence of Aspergillus fumigatus in Galleria mellonella. Mycopathologia 158(l):73-9. Richard JL, Lyon RL, Fichtner RE, Ross PF. 1989. Use of thin layer chromatography for detection and high performance liquid chromatography for quantitating gliotoxin from rice cultures of Aspergillus fumigatus fresenius. Mycopathologia 107(2-3): 145-51. Singh N, Paterson DL. 2005. Aspergillus infections in transplant recipients. Clin Microbiol Rev 18(l):44-69. Stanzani M, Orciuolo E, Lewis R, Kontoyiannis DP, Martins SL, St John LS, Komanduri KV. 2005. Aspergillus fumigatus suppresses the human cellular immune response via gliotoxin-mediated apoptosis of monocytes. Blood 105(6):2258-65. Sutton P, Waring P, Mullbacher A. 1996. Exacerbation of invasive aspergillosis by the immunosuppressive fungal metabolite, gliotoxin. Immunol Cell Biol 74(4):318-22. Taylor J, Geiser D, Burt A, Koufopanou V. 1999. The evolutionary biology and population genetics underlying fungal strain typing. Clin Microbiol Rev 12(1): 126- 146. Tomee J, Kauffman H. 2000. Putative virulence factors of Aspergillus fumigatus. Clin Exp Allergy 30:476-484. Wald A, Leisenring W, van Burik J, Bowden R. 1997. Epidemiology of Aspergillus infections in a large cohort of patients undergoing bone marrow transplantation. J Infect Dis. 175(6): 1459-1466. 39 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. APPENDIX: DETECTION OF GLIOTOXIN BY TLC Thin-layer chromatography (TLC) was used for the detection and quantitation of gliotoxin in this study. Chromatography is a method that separates mixtures of compounds by distributing it over a stationary phase and a mobile phase. Since different compounds have different solubilities and absorptions to the two phases, they will partition and settle at different spots along the TLC plate. The Rf value is defined as a ratio between the distance the spot traveled and the distance the solvent traveled. Substances with similar solubility to both phases should have the same Rf value. Clearly, TLC cannot be used solely to identify substances. Unless mass spectrometry was performed, the identity of the substance detected on our TLC plates is not indisputable. However, there is evidence that strongly suggests that the sample in my study is indeed gliotoxin. The substance detected did not have the same conformation as the glitoxin standard. Our samples had a tear-drop shape on the developed TLC plate, whereas the standard appeared circular. To account for this, YEPD broth media was spiked with the glitoxin standard and taken through the extraction process. The extracted gliotoxin was assayed again by TLC, which now developed a tear-drop or elliptical shape. In addition, a tear-drop sample was divided in two, scraped off the silica gel, reconstituted in methanol, and assayed separately by TLC. The two halves had the 40 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. same Rf value and both developed the tear-drop shape. This suggests that a single compound is found in the spot. An explanation for the different conformations may lie in the extraction process, where the solubility of the gliotoxin molecules is slightly altered. Gliotoxin is soluble in both chloroform and methanol, though much more so in chloroform. Chloroform was initially used in the extraction of gliotoxin from the culture fdtrate and the dried extracts were kept in methanol (less volatile than chloroform) before the TLC assay. The solvent (mobile phase) used to develop our silica gel TLC plate (stationary phase) is methanol. The substance detected has the same Rf value as the gliotoxin standard; therefore, if not gliotoxin, it still has the same solubility to choloroform, methanol, and to the silica gel as gliotoxin. Also, no other substance was detected in our assay. Gliotoxin is a metabolite known to be secreted by A. fumigatus. The solitary spot on our TLC plate indicates that only one substance in the culture filtrate is soluble in chloroform and methanol, namely gliotoxin. Although the substance found on our TLC plates cannot be definitively identified as gliotoxin without further analysis (e.g. mass spectrometry), the characteristics of our substance highly resemble that of gliotoxin. It is therefore assumed that our material is in fact gliotoxin and our TLC assay is an acceptable method for detection. 41 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.

Linked assets

University of Southern California Dissertations and Theses

Conceptually similar

PDF

Epidemiological features of alcoholic liver disease in Los Angeles County, 1999

PDF

Analysis of Hsp70-peptide complexes in human white matter relevance to pathogenesis in multiple sclerosis

PDF

Characterization of the EWS -FLI1 fusion protein in the tumorigenesis of Ewing's family of tumors

PDF

Downstream targets of the Ewing's sarcoma EWS /FLI -1 fusion gene

PDF

Effect of contortrostatin, a snake venom disintegrin, on malignant gliomas

PDF

Analysis of the pathological characteristics of breast carcinoma in Hispanic BRCA carriers

PDF

Altered skin wound healing in homeobox gene Msx-2 knockout mice

PDF

An updated review of intracellular mRNA localization

PDF

Isolation and characterization of transformation-associated rat non-histone chromosomal protein HMGI-C promoter

PDF

Detection of anti-Hu antibodies, a possible key to early diagnosis of small cell lung cancer

PDF

Molecular basis of early liver development: A study focused on the role of beta-catenin

PDF

Feline leukemia virus: Disease and its control

PDF

A new model for hepatitis delta virus transcription and replication

PDF

A transgenic mouse model for small cell lung cancer

PDF

Characterization of new factors involved in feline leukemia virus (FELV)-mediated leukemogenesis

PDF

Studies of retinoid-induced growth inhibition of prostate cancer cells

PDF

Development of replication -competent retroviral vectors for efficient, targeted gene therapy of cancer

PDF

Impact of heterogeneity on evidence for linkage to type 2 diabetes mellitus in the Finnish population

PDF

Repair and regeneration: A study of tail regeneration in the Anolis carolinensis

PDF

Characterization of dynamin II and clathrin adaptor complex in the regulation of gastric hydrogen,potassium-ATPase recycling in oxyntic cells

Asset Metadata

Creator To, Dennis (author)

Core Title Assessing molecular heterogeneity in clinical isolates of Aspergillus fumigatus

School Graduate School

Degree Master of Science

Degree Program Experimental and Molecular Pathology

Publisher University of Southern California (original), University of Southern California. Libraries (digital)

Tag biology, microbiology,biology, molecular,health sciences, pathology,OAI-PMH Harvest

Language English

Contributor Digitized by ProQuest (provenance)

Advisor Nash, Kevin A. (committee chair), Hinton, David (committee member), Pattengale, Paul (committee member)

Permanent Link (DOI) https://doi.org/10.25549/usctheses-c16-46580

Unique identifier UC11338198

Identifier 1430406.pdf (filename),usctheses-c16-46580 (legacy record id)

Legacy Identifier 1430406.pdf

Dmrecord 46580

Document Type Thesis

Rights To, Dennis

Type texts

Source University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Access Conditions The author retains rights to his/her dissertation, thesis or other graduate work according to U.S. copyright law. Electronic access is being provided by the USC Libraries in agreement with the au...

Repository Name University of Southern California Digital Library

Repository Location USC Digital Library, University of Southern California, University Park Campus, Los Angeles, California 90089, USA