University of Southern California Dissertations and Theses

Cloning and characterization of Grb4: A novel adapter protein interacting with BCR -Abl

(USC Thesis Other)

Cloning and characterization of Grb4: A novel adapter protein interacting with BCR -Abl

PDF

Download a page range

Download transcript

Copy asset link

Request this asset

Transcript (if available)

Content INFORMATION TO USERS
This manuscript has been reproduced from the microfilm master. UMI films
the text directly from the original or copy submitted. Thus, som e thesis and
dissertation copies are in typewriter face, while others may be from any type of
computer printer.
The quality of this reproduction is dependent upon the quality of the
copy submitted. Broken or indistinct print, colored or poor quality illustrations
and photographs, print bleedthrough, substandard margins, and improper
alignment can adversely affect reproduction.
In the unlikely event that the author did not send UM I a complete manuscript
and there are missing pages, these w ill be noted. Also, if unauthorized
copyright material had to be removed, a note will indicate the deletion.
Oversize materials (e.g., maps, drawings, charts) are reproduced by
sectioning the original, beginning at the upper left-hand comer and continuing
from left to right in equal sections with small overlaps.
Photographs included in the original manuscript have been reproduced
xerographically in this copy. Higher quality 6” x 9” black and white
photographic prints are available for any photographs or illustrations appearing
in this copy for an additional charge. Contact UM I directly to order.
ProQuest Information and Learning
300 North Zeeb Road, Ann Arbor, M l 48106-1346 USA
800-521-0600
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
CLONING AND CHARACTERIZATION OF GRB4: A NOVEL ADAPTER PROTEIN
INTERACTING WITH BCR-ABL.
by
Sunita Patricia Ann Coutinho
A Dissertation Presented to the
FACULTY OF THE GRADUATE SCHOOL
UNIVERSITY OF SOUTHERN CALIFORNIA
In Partial Fulfillm ent o f the
Requirements for the D egree
DOCTOR OF PHILOSOPHY
(M olecular Microbiology and Immunology)
August 2000
Copyright 2000 Sunita Coutinho
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
UMI Number: 3018068
__ ___ ®
UMI
UMI Microform 3018068
Copyright 2001 by Bell & Howell Information and Learning Company.
All rights reserved. This microform edition is protected against
unauthorized copying under Title 17, United States Code.
Bell & Howell Information and Learning Company
300 North Zeeb Road
P.O. Box 1346
Ann Arbor, MI 48106-1346
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
UNIVERSITY O F SOUTHERN CALIFORNIA
THE GRADUATE SCHOOL
UNIVERSITY PARK
LOS ANGELES. CALIFORNIA 90007
This dissertation, written by
......
under the direction of hJLC Dissertation
Committee and approved by all its members,
has been presented to and accepted by The
Graduate School, in partial fulfillment of re
quirements for the degree of
DOCTOR OF PHILOSOPHY
lean o f Graduate Studies
Date
DISSERTATION COMMITTEE
Chairperson
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Sunita Patricia Ann Coutinho
Donald B. Kohn, M.D.
CLONING AND CHARACTERIZATION OF GRB4: A NOVEL
ADAPTER PROTEIN INTERACTING WITH BCR-ABL.
This work focuses on the cloning and characterization of a novel
adapter protein identified in a yeast two-hybrid screen using BCR-Abl as
the bait. The cDNA was identified as a 2.6 kb mRNA species coding for
a 47kD protein which was ubiquitously expressed in various tissues and
cells lines tested. Grb4, bound to BCR-Abl in a variety of systems, both
in vitro and in vivo and is an excellent substrate of the BCR-Abl tyrosine
kinase. The association of Grb4 and BCR-Abl in intact cells was
mediated by an SH2-mediated phosphotyrosine-dependent interaction as
well as an SH3-mediated phosphotyrosine-independent interaction. Grb4
has 68% homology to the adapter protein Nek but has distinct binding
specificities in K562 lysates. In contrast to Nek, co-expression of Grb4
with v-Abl strongly inhibited v-Abl induced AP-1 activation. Subcellular
studies indicate that Grb4 localizes to both the nucleus and the
cytoplasm. Co-expression of BCR-Abl with Grb4 resulted in the
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
translocation of Grb4 from the cytoplasm to the cytoskeleton to co-
localize with BCR-Abl while a significant amount of the protein
remained nuclear. In addition, expression o f Grb4 with wild type BCR-
Abl but not kinase defective BCR-Abl resulted in redistribution of actin-
associated BCR-Abl. These data indicate that Grb4 in conjunction with
wild type BCR-Abl is capable of modulating cytoskeletal structure and
of interfering with the signaling of Abl kinases.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
DEDICATION
To Maria Celine Coutinho and Filomeno Fernando Coutinho
Who Grew Me Up
and
To Caetano Francisco D e Sousa
For Standing By Us
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Acknowledgements
I'd like to begin by thanking the Chair o f my Graduate Committee, Dr. Donald Kohn,
M.D. for making all of this possible by consenting to remain my Chair while I
conducted off-site research in Germany. His mentorship, his thoughtful advice and his
support all through Graduate School - even when I was no longer in his laboratory -
are deeply appreciated. Alongside Dr.Kohn, I would like to thank Dr. Justus Duyster,
M.D. who has been an excellent supervisor over the last two years. He is to be
commended for always trying to be an honest and fair boss. In particular, I thank him
for his encouragement and support during one of the most difficult times imaginable
in the scientific sphere. I learnt a great deal in the two years I spent in his laboratory
and for that my profound thanks. Next, I would like to acknowledge individuals who
contributed to this work: Thomas Jahn, my best friend and my best critic over the last
four years. He introduced me to the signaling world and taught me a lot. He put in
many hours studying the intracellular localization of Grb4 and other proteins over the
last year using fusion fluorescent proteins. Stephan Feller for the Far Western analyses
that was conducted in his laboratory and for demonstrating that Grb4 interacts with
HPK1. To the members of my Graduate Committee: Dr. Minnie McMillan, Dr. Pradip
Roy-Burman, Dr. Lucio Comai for seeing me through the Ph.D.. To Stan Tahara for
his support from the very beginning right through the very end. To Professor
Christian Peschel in whose department I conducted this research.
To my friends in Goa who have remained my friends despite the seas between us and
the lack of frequent communication: Rekha Mishra, Amita de Sequeira, Oscar Pinto
Rebelo, Susana Rasquinha, Ruben Quadros. Vijaya and NarayanRao Shinde are
especially remembered. To their daughter Rashmi: there will never be another one like
you. And remembering little Rosalyn, her memory lives on. To Dr. Caetaninho de
Sousa who became an integral part of our family and cared for us.
iii
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
To my friends in Los Angeles : Martha ter Maat, Elizabeth McMurry, Ingrid Bahner,
Wanda Krall, Diane Skelton, Jesusa Arevalo. Especially thanking Orenda Tuason and
the entire Tuason Family. The Nobay Family especially Afra. To Lydia Gomez Stem,
Laura Steel and Manuela Alvarez-Wilson who helped me countless times with
countless things.
To the Germans who made Germany a friendlier place: Gabi Huebinger, Inka
Scheffrahn, Martina Enz. To Florian Bassermann for his often help and for the
camaraderie we shared. To the Hoffmann Family, to Frau Muller, all of who made
Windach the most charming of little German villages. To Helga Bernhard and Pieter
Hieronymus. And to Gunthard Lichtenberg and Meena Holzmann for the great
affection, the advice, the support which I could not have done without. And last but
not the least, to the Jahn Family - Dr. Dietmar Jahn, Frau Helga Jahn and their
daughter Henriette for the love they showed me.
Finally to Ma, Michael, Roselle and Rahul. And never forgetting my Father long gone
but yet right here. And yes, to Herman too. Thank you for being the most wonderful
and supportive family that I could have ever had. Thank you for the immense love, the
selflessness and for making me feel I always have somewhere to turn to if all else goes
wrong.
The Old Dog of the Mountain thanks you all.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
TABLE OF CONTENTS
Dedication ii
Acknowledgements iii
Table of Contents v
List of Figures vi
Chapter One: Introduction 1
Chapter Two: Background 2
Molecular mechanisms involved in the etiology of
leukemias and lymphomas 3
BCR-Abl and its role in chronic myeloid leukemia (CML)
Adapter proteins: Identification of a Novel Protein 21
Chapter Three: Materials and Methods 25
Chapter Four: Results 46
Chapter Five: Discussion 109
Bibliography 115
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
LIST OF FIGURES
Figure I: Several molecules interact with BCR-Abl 3
Figure 2: The Philadelphia chromosome 14
Figure 3: The structure of BCR-Abl 16
Figure 4: The traditional yeast two-hybrid system 47
Figure 5: The modified yeast two-hybrid system 48
Figure 6: Interaction of Grb4/F16 with BCR-Abl in yeast 50
Figure 7: Interaction of F16 and F20 in yeast 51
Figure 8: Comparison of Nek and Grb4 53
Figure 9: The RACE procedure 55
Figure 10: An 800 bp specific band contains the 5’ end of Grb4 56
Figure 11: The cDNA sequence of Grb4 57
Figure 12: Coomassie stained gel: GST-Grb/F16 protein 59
Figure 13: Coomassie stained gel: GST-Grb4 (full-length) 60
Figure 14: In vitro translated constructs of BCR-Abl and Abl 61
Figure 15: In vitro binding of Grb4/F16 to BCR-Abl 62
Figure 16: In vitro binding of Grb4 to various forms of BCR-Abl 64
Figure 17: Experimental schema for GST binding experiments 65
Figure 18: The Abl antibody, 8E9.... 67
Figure 19: Grb4 interacts with BCR-Abl and Abl in K562 lysates 68
Figure 20: Grb4/F16 interacts with BCR-Abl and Abl in K562 lysates 69
Figure 21: Grb4/Fl6 interacts with v-Abl 71
Figure 22: Northern analyses reveals a 2.6 kbase mRNA species 73
Figure 23: A rabbit polyclonal antibody recognizes Grb4 overexpressed Grb4
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Figure 24: The rabbit polyclonal antibody recognizes a 47 kD band in
various cell lysates 75
Figure 25: Experimental schema for immunoprecipitations and
co-immunoprecipitations 76
Figure 26: The rabbit polyclonal antibody immunoprecipitates Grb4 77
Figure 27: The interaction between Grb4/F16 & BCR-Abl is phosphotyrosine
dependent 79
Figure 28: Grb4/F16 is a substrate of BCR-Abl 81
Figure 29: Full-length Grb4 co-precipitates with BCR-Abl 83
Figure 30: The SH2 domain of Grb4 can mediate binding to BCR-Abl and
v-Abl 85
Figure 31: Binding of the SH2 mutant of Grb4 to BCR-Abl is
abrogated 86
Figure 32: The Grb4 SH2 mutant binds strongly to KD BCR-Abl 88
Figure 33: Far Western analyses with Grb4 on K562 lysates 90
Figure 34: Grb4 is an excellent substrate of the BCR-Abl kinase 91
Figure 35: Grb4 binds to HPK1 92
Figure 36: Identifying growth factor independence in Ba/F3 cells 94
Figure 37: Grb4 does not render Ba/F3 cells IL-3 independent 95
Figure 38: Grb4 does not activate the JNK signaling pathway in a
promoter assay 98
Figure 39: Grb4 does not activate JNK: kinase assays 99
Figure 40: Grb4 expression does not activate the CREB signaling pathway 100
Figure 41: Grb4 failed to activate the Elkl signaling pathway in 293 cells 101
vii
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Figure 42: Grb4 expression inhibited v-Abl induced AP-1 activation.....103
Figure 43: Subcellular localization of Grb4, wt BCR-Abl and kd BCR-Abl 105
Figure 44: Co-localization of wt BCR-Abl and Grb4 in cells... 106
Figure 45: Co-localization of kd BCR-Abl and Grb4 in cells... 107
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter One
Introduction
Human malignancies have long eluded successful therapy and a large
body of research focuses on the molecular basis of cancer progression in an
attempt to better understand a process that has defied effective therapeutic
strategies.
Leukemias and lymphomas are a group of malignancies involving the
leukocytic compartment of the hematopoietic system resulting in an
uncontrolled proliferation of hematopoietic cells of either the lymphoid or
the myelomonocytic lineages.
In order to be studied at the molecular level, leukemias and lymphomas
need to be considered in the light of the larger field of oncogenesis and
tumor progression. Oncogenesis is a multi-step process that results from the
accumulation of several mutations in critical genes. The mutations result
either in the activation of potential oncogenes or result in the loss of
function of a tumor suppressor gene. It is currently evident that no single
genetic mutation is capable of conferring a malignant phenotype on cells.
Likewise, there is no single mutation responsible for the development of
leukemias. Several mechanisms have been implicated in the etiology and
the progression of leukemias and these will be examined in the following
1
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
chapters (Brunet, 1998; Jackson and Loeb, 1998; Simpson and Camargo,
1998).
Our laboratory focuses on the development and progression of chronic
myeloid leukemia. Specifically, the focus of the laboratory has been the
study of BCR-Abl, the chimeric oncogene predominantly associated with
chronic myeloid leukemia and a fraction of acute lymphoblastic leukemia
and acute myeloid leukemia (Bartram et al., 1983; Chan et al., 1987;
Groffen et al., 1984; Hermans et al., 1987). While several molecules are
known to interact with BCR-Abl, critical downstream targets of BCR-Abl
contributing to BCR-Abl mediated oncogenesis remain unidentified (Figure
1). A modified yeast two-hybrid screen was therefore established in our
laboratory as a means of identifying interactions between BCR-Abl and
target proteins encoded by a K562 cDNA library. Using the modified
screen, a novel adapter protein, Grb4, was identified (Bai et al., 1998;
Weidner et al., 1996).
This work focuses on the cloning of Grb4 using the yeast two-hybrid
screen and RACE (Rapid Amplification of cDNA Ends) and the
characterization of this protein and of its interaction with BCR-Abl.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Figure 1.
A bi-l
Bapl
Abi-2
BCR AblSH3 AblSH2 Kinase Actin binding domain
Grb2'
3BP1
3BP2
Y177 Y796
PI3KJ
— O p
Grb2'
Crkl
She
RAS
Cbl
pl30
paxillin
dynamin
p!90
myc
myb
Several molecules are known to interact with BCR-Abl as shown above but the critical molecules
involved in BCR-Abl oncogenesis remain unidentified
Chapter Two
Background
Molecular mechanisms involved in the etiology o f leukemias and
lymphomas
Leukemias and lymphomas are a group of malignant disorders
characterized by the uncontrolled proliferation of hematopoietic cells. The
step-wise accumulation of genetic changes and mutations leading to
malignant proliferation is a critical feature of leukemias as it is for all
malignancies in general. In most cases, perhaps all, a combination of several
different changes are necessary for progression to the leukemic phenotype
in both human and animal models. Repeated association of specific
mutations or genetic processes with a specific type of leukemia has led to
the classification of the different biochemical processes underlying disease
progression to frank leukemia or lymphoma (Jackson and Loeb, 1998;
Simpson and Camargo, 1998).
Normal hematopoiesis is regulated by autonomous cellular signals and
by cell-bound and soluble growth factors. Transmission of signals from the
cytoplasm to the nucleus and vice versa can be modulated by changes in
growth regulating proto-oncogenes, in the number and function of cell-
surface receptors, by cytoplasmic signaling molecules and adapter proteins,
4
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
by nuclear transcription factors and signaling molecules. The development
of a hematopoietic malignancy results from an aberration of one or more of
these various pathways. The major mechanisms by which disturbances in
the regulation of cell growth lead to malignant transformation will be
briefly discussed (Jackson and Loeb, 1998).
Cell surface molecules:
The wide array of cell-surface molecules and their ligands define the field
of experimental hematopoiesis. Each factor and its cell-surface receptor can
transmit a signal across the cell membrane which can result in either a
positive or a negative effect on cell growth and/or differentiation. Growth
factors can interact in several ways with their receptors to generate an
intracellular signal. Some factors are released as soluble molecules and then
act either locally or travel through the blood stream or through inter
cellular space to act on other cells. Some factors (Coulombel et al., 1997)
like the Steel factor, are produced, by virtue of splicing, in two forms: one
has a transmembrane domain as a result of which it anchors itself to the
membrane; the other has a proteolytic cleavage site as a result of which it
gets released as a soluble molecule (Broudy, 1997).
Although a lot of different factors have been identified, there are not
very many examples of alteration of expression correlating with clonal
outgrowth and malignancies. The specific activation of the IL-3 gene by
the (5:13) translocation in a subset of patients with acute pre-B cell
5
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
leukemias is well-documented (Sakurai, 1986). Other modes of activation of
a growth factor gene include inserdonal activation by a retrovirus or an
intracellular mobile genetic element, the IAP or intracistemal A particle
(Hapel and Young, 1987). Growth factor receptors could also be stimulated
by “pseudoligands” as in the case of the Friend murine leukemia virus
complex where a 55 kDa viral protein binds to the EPO receptor and
stimulates it resulting in an autocrine loop and hyperplasia (Ikawa, 1997;
Ruscetti et al., 1990). Mutations in receptor encoding genes could also
result in a constitutively activated receptor that does not require binding of
a ligand to initiate downstream signaling pathways. Alternately, the over-
expression of the receptor might result in more sensitive signaling with low
levels of cognate factor.
Several studies suggest that changes in the adhesive properties of cells
may also be important in the disease process leading to malignancies.
Specifically, the loss of adhesion and the reversal of this phenomenon with
a-interferon therapy have been described. The cytoadhesion molecule
LFA-3 is generally low on cells of patients with CML and has been shown
to increase in response to therapy with interferon (Upadhyaya et al., 1991).
Molecules that might play a role in adhesion on hematopoietic cells include
the integrin VLA-4-, fibronectin, hemonectin, and TAN-1 to mention a few
(Coulombel et al., 1997; Coulombel et al., 1992; Crocker et a l, 1988; Dean
et al., 1991; Hemler, 1988; Klein, 1995; Pasternak et al., 1998; Verfaillie et
al., 1997).
6
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Intracellular signaling mechanisms:
The pathways used to transmit signals from the cell surface to the
nucleus are numerous and involve phosphorylation/dephosphorylation
reactions, GTP-binding proteins and associated regulatory proteins and
small second messenger molecules like cAMP, calcium and specific
phospholipids (Brunet, 1998).
Many signaling molecules are assumed to be critically involved in a
signaling function connected to a differentiated phenotype. It is
appropriate to mention the src family of tyrosine kinases in this context.
These are a group of cytoplasmic tyrosine kinases whose different members
are specifically expressed in specific hematopoietic cell types (Abts et al.,
1991; Brickell, 1992; Kefalas et al., 1995; Toyoshima et al., 1992). Of the
several src family members, the lck or p56 gene is particularly important in
the development of leukemias and was first described to be activated by a
retroviral insertion event in a murine T-cell derived leukemia (Burnett et al.,
1991; Burnett et al., 1994; Wright et al., 1994). Of the intracellular proteins
involved in cellular signaling, the ras oncogenes surely deserve a mention.
The ras oncogenes are the prototypic transforming alleles of the guanine
nucleotide-binding protein family. Activation of ras is usually associated
with point mutations that prolong the GTP-bound state and resist the
function of the GTPase-activating protein. A wide range of human tumors
are associated with point mutations in members of the ras family of
7
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
oncogenes and these include breast cancer and leukemias (Shannon, 1995).
In several studies of myelodysplastic syndrome and human acute
myelogenous leukemia, up to 40% of patients were found to have point
mutations in the N-ras allele. Patients with Philadelphia-chromosome
negative chronic myeloid leukemias (CML) are also often positive for Ras
mutations but those with Philadelphia chromosome-positive CML almost
never show such mutations. However a striking and consistent pattern in
ras mutations associated with leukemias has not been identified (Beaupre
and Kurzrock, 1999).
Lastly, the BCR-Abl protein which localizes to the cytoskeleton is quite
the hallmark of chronic myeloid leukemia and will be discussed in some
detail in the next section as this entire work focuses on a BCR-Abl
interacting gene.
Transcription factors and their role in the development o f hematological
malignancies:
Many different transcription factors have been implicated in the
evolution of human leukemias. The set of transcription factors involved
include the basic helix-loop-helix group of proteins (Eilers, 1999), LIM
proteins (Dawid et al., 1995), homeodomain proteins (Deschamps, and
Meiklink, 1992), thyroid-steroid receptor family proteins, zinc finger
proteins (Green and Begley, 1992; Ihle et al., 1990; Lopingco and Perkins,
1996; Saha et al., 1995), REL domain family proteins (Gilmore, 1992) and
8
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
tumor suppressor/oncogene group of proteins to mention the more
prominent sub-classes of transcription factors. Although many of these
factors have been suggested to be involved in the evolution of
hematological malignancies a definite correlation at the molecular level has
not been established.
The helix-loop-helix (HLH) group of proteins have a sequence of
domains organized to allow both protein-protein and protein-DNA
interactions. The NH2-terminal end of this group of proteins differ
appreciably from each other and is probably responsible for the specific or
activating effects of this group of genes. Of the HLH family, the c-myc gene
product is perhaps the best characterized and has been implicated in a
variety of oncogenic processes. Myc was originally described as the critical
factor in several independent strains of acute leukemias viruses of birds.
Retroviral insertional activation of the myc gene has been described in a
range of other animals (viz., mice, rats and cats) induced by long-latency
leukemia viruses. And although the precise structure of the rearrangements
and participating immunoglobulin gene heavy and light chain promoter
and enhancer segments can vary considerably, the overall effect in
Burkitt’s lymphoma and murine plasmacytomas is the sustained expression
of the myc gene whose involvement is almost universally found. Thus myc
has a role to play in a range of hematological malignancies and identifying
the specific genes activated or suppressed by myc could shed light on the
9
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
mechanisms involved in these malignancies. Other HLH proteins that are
involved in human leukemias include the LYL-1, TAL-1 and TAL-2 genes.
Translocation events in the intronic regions of transcription factors can also
result in the formation of fusion genes encoding fusion transcription
factors. Examples of these include PBX-E2A in pre-B cell ALL and the
PML RAR fusion gene of acute pro-myelocytic leukemia. Mechanisms
involved might include ectopic and deranged expression of the
transcription factor when expressed downstream of a different promoter,
modification of the specificity of its DNA-binding domain either by
substitution of its DNA-binding domain or by specific mutations altering its
specificity of binding (Green and Begley, 1992; Shapiro et al., 1994, Wu et
al., 1996).
The zinc finger group of proteins are also important in transcriptional
regulation and the EVI-1 gene is an example of this group of proteins
which is not normally expressed in hematopoietic cells but is expressed in
up to 6% of cases of leukemias. A variety of translocations, inversions and
deletions have been found in and around the EVI-1 locus. The position-
independence and long-distance effects of these changes cannot be
stressed enough and the importance of searching for key regulator genes in
areas of chromosome activity is critical in the identification of genes
involved in the etiology of malignancies (Ihle et al., 1990; Lopingco and
Perkins, 1996; Saha et al., 1995).
10
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
The REL family of transcriptional regulators have been implicated in the
evolution of leukemias. The avian retroviral strain, REV-T, is replication-
defective and encodes a truncated and mutated version of the cellular REL
gene which causes rapidly progressive B-lineage and myeloid-related
leukemias in avian species. It is difficult to comment on whether the growth
stimulus is a result of an excess of REL signaling or is through a dominant
negative effect created by an imbalance of REL family subunits (Gilmore,
1992; Ihle et al., 1990).
The homeobox family of genes include HOX2.6 and HOX 11 both of
which are activated and involved in the development of a murine leukemia
and a human T cell leukemia respectively. Homeobox genes were originally
discovered as the master genes that regulate the development of the body
plan in insects and have been found in a wide variety of species including
mouse and man (Deschamps and Meijlink, 1992; Wu et al., 1996)
Finally, genes regulating apoptosis or programmed cell death might also,
logically, be assumed to be key mediators of the oncogenic process.
Apoptosis can be induced by a variety of mechanisms like the addition
of monoclonal antibodies, cytotoxic drugs, specific factors and the
withdrawal of growth factors. Apoptosis is characterized by internal cell
changes including DNA fragmentation evidenced by “laddering” of DNA
on agarose gel electrophoresis which precedes the breakdown of the
plasma membrane. The Bcl-2 gene which is known to protect cells from
apoptosis has been implicated in the development of follicular lymphomas.
11
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Follicular lymphoma is a malignancy characterized by the relatively
indolent proliferation of B-lymphoid cells. In support of this, when growth
factor dependent cell lines are transfected with BCL-2, they can grow for
lengthy periods without the addition of growth factor and return to normal
growth on addition of the growth factor (Binet et al., 1996; Merino and
Cordero-Campana, 1998; Reed, 1995; Solary et al., 1994).
In summary, several mechanisms involved in the evolution of
hematopoietic malignancies have been described from changes in the cell
surface to nuclear mechanisms. More than one of these mechanisms act in
concert or cumulatively in the multi-step process leading to human
malignancy.
12
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
BCR-Abl and its role in chronic myeloid leukemia (CM L).
The BCR-Abl gene is a chimeric oncogene that is created by a
translocation event that fuses the BCR gene on chromosome 22 to the Abl
gene of chromosome 9 (Bartram et al., 1983; Chan et al., 1987; de Klein et
al., 1982). The resulting Philadelphia chromosome (Chromosome 22) is the
hallmark of the myeloproliferative disease, chronic myeloid leukemia
(Figure 2). The BCR gene is joined to the Abl gene in a head-to-tail fashion
and the fusion results in the activation and dysregulation of the Abl
tyrosine kinase. The BCR-Abl translocation is found in leukemic cells from
nearly every patient with chronic myelogenous leukemia (CML) and is also
present in approximately 30% of cases of adult acute lymphoblastic
leukemia (ALL) (Chan et al., 1987), 10% of pediatric ALL and about 1% of
adult acute myelogenous leukemia. Three forms of the BCR-Abl fusion
gene product have been described: the relatively rare p230, p210 and p i85
BCR-Abl (Li et al., 1999). The first and the second forms are mainly
associated with chronic myeloid leukemia and the third form, p i85, is
associated with Ph-positive acute lymphoblastic leukemia (Li et al., 1999).
Molecular cloning and sequencing has revealed that in chronic myeloid
leukemia the BCR gene is interrupted at the 5.8 kb region corresponding
to the eleventh or twelfth exon of BCR which is joined to the second Abl
exon. In contrast, in acute lymphoblastic leukemia, the first exon of BCR is
joined to the second Abl exon resulting in the shorter transcript and the
13
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Reproduced with permission o f th e copyright owner. Further reproduction prohibited without permission.
N O R M A L
Protein
COOH
Figure 2: The Philadelphia Chromosome. The left panel shows the longer chromosome 9 with the
Abl gene and the shorter chromosome 22 carrying BCR. The right panel shows the formation of the
Philadelphia chromosome in chronic myeloid leukemia: chromosome 9 is further lengthened with
addition of BCR sequences; chromosome 22 or the Philadelphia chromosome is shortened with the
fusion of Abl sequences to the 5 'portion of the BCR gene
4 ^
smaller protein of acute lymphoblastic leukemia (Heisterkamp et al, 1985;
Heisterkamp et al., 1983). As mentioned before, while all documented cases
of CML have traditional BCR breakpoints in the 5.8 kb region some
patients who present with Ph positive ALL and AML also have traditional
BCR breakpoints and express p210. These patients have persistence of the
Ph chromosome in remission and are probably cases of CML presenting in
blast crisis after an unrecognized chronic phase. In contrast, the majority of
patients with ALL with the more 5’ breakpoint become Ph chromosome
negative during remissions and do not exhibit the additional cytogenetic
abnormalities typical of CML blast crises, suggesting that they represent
transformation of a cell type which is more restricted in its differentiation
potential than a pluripotential stem cell. The BCR-Abl protein itself is made
up of varying lengths of BCR as described above fused to the Abl gene
(Hermans et al, 1987). At the DNA level this fusion occurs 5’ of the
common acceptor exon of the Abl gene segment. The portion of the Abl
gene fused to BCR include a portion of sequences encoding the Abl SH3
domain, the SH2 domain, the kinase or the SHI domain and the Abl C-
terminal end (Chan et al, 1987; de Klein et al., 1982) (Figure 3). The fusion
of BCR to Abl results in the formation of a complex molecule with several
multi-functional domains. The product of the BCR gene is a 160 kDa
phosphoprotein (Timmons and Witte, 1989) with a multidomain structure.
The N-terminal first exon encodes a novel serine-threonine kinase activity
(Maru and Witte, 1991), an oligomerization domain (McWhirter et al., 1993)
15
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Figure 3: The structure of BCR-Abl
The schematic shows the sequence of domains in the oncogene, BCR-Abl: B=BCR
portion, SH3= SH3 domain of Abl with the first exon deleted, SH2=SH2 domain of
Abl, K= Abl kinase domain, C= C terminal end of Abl containing the nuclear localization
signal, DNA-binding domain and the actin binding domain.
and a region that binds SH2 domains in a phospho-tyrosine independent
manner. The C-terminus encodes a GTPase-activating function for the small
GTP binding protein Rac (Diekmann et al., 1991). The middle part of the
protein has a region of sequence similarity to guanine nucleotide exchange
factors for the Rho family of GTP-binding proteins (Tan et al., 1993) and a
pleckstrin homology domain (Musacchio et al., 1993). Although these
different domains imply that BCR is involved in different intracellular
signaling pathways, litde is known about its actual biological role in the
cell. More is known, however, about the role of the BCR portion on the
function of BCR-Abl. The sequences in the first exon of BCR which are
fused upstream of the second exon of Abl are necessary for the activation
the Abl tyrosine kinase activity (McWhirter and Wang, 1991; Muller et al.,
1991) which is necessary for the oncogenic potential of the chimeric
oncogene (Lugo et al., 1990). A tyrosine in BCR gets phosphorylated by
the Abl kinase and serves as a binding site for the SH2 domain of the Grb2
adaptor protein thereby Unking BCR-Abl to the Ras signahng pathway
(Pendergast et al., 1993a; Pendergast et al., 1993b; Puil et al., 1994). The c-
Abl protein, originally identified as the cellular homolog of the v-Abl
oncogene product of the Abelson murine leukemia virus (A-MuLV) (Goff
et al., 1982; Wang et al., 1984) is a tyrosine kinase of unknown function.
Biochemical data suggest that c-Abl may regulate signal transduction
events in the cytoplasm and processes in the nucleus. c-Abl is found
primarily in the nucleus in transfected cells but is also found in the
17
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
cytoplasm bound to actin filaments and in association with the plasma
membrane (Van Etten et al., 1989; Van Etten et al., 1994). In several non
transfected hematopoietic cells, c-Abl is predominantly localized to the
cytoplasm with some nuclear staining (Wetzler et al, 1993). As previously
mentioned, the c-Abl protein has a complex structure that includes several
domains common to proteins implicated in signal transduction pathways,
the SH2 and SH3 domains. These are modular domains that are present in a
large number of proteins and are critical in the formation of stable signaling
protein complexes and have also been shown to regulate protein function
(Cohen et a l, 1995; Feller et al., 1994; Pawson, 1995).
The SH2 domain is a sequence of -100 amino acids originally identified
in the v-Fps and v-Src cytoplasmic tyrosine kinases, by virtue of its effects
on both catalytic activity and substrate phosphorylation. SH2 domains
apparently regulate protein-protein interactions by recognizing peptide
sequences that encompass tyrosine phosphorylation sites. Tyrosine
phosphorylation of the relevant ligand acts as a switch to induce high-
affinity SH2 binding. Most SH2-containing proteins also possess a distinct
motif of about 45 aminoacids termed the SH3 domain which classically
binds to proline-rich stretches in proteins and has been identified in a
variety of proteins that comprise or associate with the cytoskeleton and
membrane. This suggests that the SH3 domain plays a role in determining
intracellular localization and raises the intriguing possibility that SH2
18
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
domains may be important in regulating the cytoskeleton (Pawson, 1995;
Pawson, 1994; Pawson and Schlessinger, 1993; Pawson and Scott, 1997).
The SH3 domain suppresses the intrinsic transforming activity of c-Abl in
vivo (Franz et al., 1989; Jackson and Baltimore, 1989) while the SH2
domain is required for the transforming function of activated Abl genes
(Mayer and Baltimore, 1994; Mayer et al., 1992). The unique carboxy-
terminal region of Abl, which is encoded by a single exon, contains several
functional and structural domains that include a nuclear localization signal
(NLS) (Van Etten et al., 1989), proline rich sequences that have the
potential to bind to SH3-domain containing proteins (Feller et al., 1994;
Feller et al., 1994; Ren et al., 1994), a DNA binding domain (Kipreos and
Wang, 1992) and an actin binding domain (McWhirter and Wang, 1993,
Van Etten et al., 1994). Several serine/threonine residues within the
carboxy-terminal exon are phosphorylated by cdc-2 kinase (Kipreos and
Wang, 1990) and by protein kinase C (Pendergast et al., 1987). The
tyrosine kinase activity of c-Abl is tightly regulated in vivo (Pendergast et
al., 1991). Over-expression of c-Abl at levels 5- to 10- fold over the
endogenous c-Abl does not lead to cell transformation but causes cell arrest
(Jackson and Baltimore, 1989). In contrast, structurally altered forms of Abl
cause cell transformation and exhibit elevated tyrosine kinase activity
when expressed at similar levels. Three naturally occunng c-Abl derived
oncogenes have been identified which include the v-Abl oncogene of A-
MuLV (Goff et al., 1980), the v-Abl oncogene of Hardy-Zuckermann-2
19
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
feline sarcoma virus (HZ2-FSV) (Bergold et al., 1987) and the BCR-Abl
chimera of Philadelphia chromosome-positive human leukemias (Kurzrock
et al., 1988). Finally, it has been shown that the activation of the
oncogenic potential of c-Abl occurs as a consequence of structural
alterations in both the amino- and carboxy-terminal sequences (Wang,
1993).
20
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
A dapter proteins:Identification o f a N ovel Protein.
This last portion of the "Background" section is about adapter proteins
which is the group of molecules that Grb4, the focus of this thesis,
belongs.
Adapter proteins are an emerging class of proteins which contain
functional src homology domains, the SH2 and SH3 domains, and lack
intrinsic enzymatic function (Pawson and Scott, 1997). Adapter proteins
have a critical role in the formation of multimeric protein complexes and
connect different signaling molecules and, indeed, large protein complexes
to upstream and downstream signaling events (Pawson and Scott, 1997).
Already several important adapter proteins have been described. Grb2,
one of the first adapter proteins studied, exists in the cytoplasm in a
complex with a second protein, Son of Sevenless (SOS) which catalyzes
ras GTP/GDP exchange (Goga et al., 1995). On growth factor stimulation,
the EGF receptor binds the Grb2/Sos complex, translocating it to the
plasma membrane where it is in close proximity to and activates Ras
(Lowenstein et al., 1992). In contrast, another receptor, the insulin
receptor does not bind Grb2 directly but rather induces the tyrosine
phosphorylation of two proteins, insulin receptor substrate-1 and She, that
bind the Grb2/SOS complex. Again, ras is activated and proceeds to
stimulate a cascade of protein kinases that are important in myriad growth
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
factor responses (Frantz et al, 1997; Liu et a l, 1994; Ogawa et al, 1998).
Grb2 is also known to bind to BCR-Abl at an autophosphorylation site in
BCR and has been demonstrated to be involved in BCR-Abl-mediated
oncogenesis through its interaction with SOS/She (Ogura et al, 1999;
Tauchi et a l, 1994). BCR-Abl has also been shown to bind to other
adapter proteins like GrblO and Crk (discussed below) which were
implicated in BCR-Abl-mediated transformation. Thus screening for
adapter molecules interacting with BCR-Abl seems an efficient method of
identifying molecules important in BCR-Abl transformation.
A family of adapter proteins was discovered with the cloning of v-Crk.
The Crk family of proteins consist of v-Crk, c-Crk-I, c-Crk-II and the Crk-
Like protein, CRKL all of which possess a 5' SH2 domain and either one
or two SH3 domains. Crk family adapters bind directly to multidocking
proteins like DOCK180 and PI3 kinase, to activated receptor tyrosine
kinases like the PDGF-receptor, the Ephrin activated receptor EphB3, the
CSF-1 receptor, c-Fms and to non-receptor tyrosine kinases like BCR-Abl.
CrkL has been described as one of the major substrates of BCR-Abl in
ceils derived from chronic myeloid leukemia. Crk family proteins play a
role in the signaling pathways downstream of receptor and non-receptor
tyrosine kinases as well as in the dynamics of assembly and disassembly of
protein signaling complexes through both SH3- and SH2-mediated
interactions (Bhat et a l, 1998; Feller et al, 1994a; Feller et al, 1995;
22
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Feller et al., 1998; Feller et al., 1994b; Margolis et al., 1992; Nichols et al.,
1994; Oda et al., 1994; Posera et al., 1998; Salgia et al., 1995).
The adapter protein, Nek with an SH3-SH3-SH3-SH2 configuration,
links receptor tyrosine kinases, such as the EGF and PDGF receptors, to
downstream signaling pathways and is revealing itself to be a member of
an emerging family of adaptor proteins (Li et al., 1992; McCarty, 1998).
SOS-activated Ras signaling (Li et al., 1992), the p21 cdc42/rac-activated
kinase cascade (Aspenstrom et al., 1996) and human Wiskott-Aldrich
Syndrome protein (WASp)-mediated actin cytoskeleton changes (Anton
et al., 1998; Rivero-Lezcano et al., 1995) are all pathways in which Nek
is implicated as a possible player.
Alongside three other groups, we identified and cloned Grb4 (also
known as Nck-2/Nck-P) a novel adapter protein which shares 68%
aminoacid identity with Nek. Of the four groups (including our
laboratory) which identified Grb4, one identified the gene by screening a
human cDNA library with a partial mouse Nek cDNA, the second
identified Grb4 as a protein interacting with the LIM-only protein PINCH
and the third performed PCR using anchor primers and Grb4-specific
primers on a human brain cDNA library (Braverman and QuiUiam, 1999;
Chen et al., 1998, Tu et al., 1998). We identified Grb4 as a protein
interacting with BCR-Abl, the chimeric oncogene of chronic myeloid
leukemia in a modified yeast two-hybrid screen using BCR-Abl as bait.
We identified two C-terminal fragments of Grb4 which interacted with
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
BCR-Abl in yeast. We then performed 5’ RACE (Rapid Amplification of
cDNA ends) to clone the 5’ end of the gene (Frohman, 1994; Schaefer,
1995). The expression pattern of Grb4 was examined by Northern
analyses as well as at the protein level using a polyclonal antibody we
raised against the middle two SH3 domains and the SH2 domain of Grb4.
We characterized the interaction of Grb4 with BCR-Abl and
demonstrated that BCR-Abl and Grb4 interact with each other both in
vitro and in vivo and that the interaction involves a phosphotyrosine-
dependent and -independent interaction. It was determined that Grb4
was a substrate of the BCR-Abl kinase. A Grb4-EYFP protein localized to
both the nucleus and the cytoplasm in cos cells indicating that Grb4 may
be serving as a link between cytoplasmic and nuclear signaling
complexes. More significantly, co-expression of BCR-Abl and Grb4 in
cells resulted in re-distribution and co-localization of Grb4 with BCR-Abl.
We tested the effect of Grb4 activation on various signaling pathways
and found that while Grb4 expression did not activate the JNK, Elkl and
the CREB signaling pathways, Grb4 expression resulted in significant
inhibition of v-Abl induced API activation.
The nuclear localization of Grb4 and its inhibition of AP-1 induction by
Abl kinases strongly suggests a role for this novel adapter protein in the
modulation of nuclear signals elicited by Abl tyrosine kinases which are
likely to be important in the molecular pathogenesis of chronic myeloid
leukemia.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
C hapter Three:
Materials and Methods:
Cell lines and cell culture:
K562, a cell line from a patient with chronic myeloid leukemia in blast
crisis, 32D, a murine myeloid precursor cell line, Ba/F3, a murine pro-B
lymphoid cell line, Jurkat, a T cell line and Mo7e, a megakaryoblastic cell
line (with and without p210) were maintained in in RPMI 1640 with 10%
fetal calf serum (FCS) (Seromed, Berlin, Germany) in the presence of
penicillin 50 U/ml, 50 jig/ml of streptomycin (Irvine Scientific) and 2 mM L-
glutamine (GIBCO BRL, Karlsruhe, Germany). The 32D cell line and the
Ba/F3 cell line were grown in the presence of 1.5 ng/ml of murine
recombinant interleukin-3 (EL-3) (R&D Systems, DPC Bierman, GmbH,
Wiesbaden, Germany). Mo7e were grown in media supplemented with
GM-CSF (R&D Systems DPC Bierman GmbH, Wiesbaden, Germany). Rat-
1, a rat fibroblast cell line, 293, a transformed human primary embryonal
kidney cell line, cos-1 and cos— 7, both of which are SV40 transformed
African green monkey kidney cell lines, 3T3 a mouse embryo fibroblast cell
line and HeLa, a cell line derived from a human carcinoma of the cervix
were grown in DMEM supplemented with 10% fetal calf serum (FCS)
(Seromed, Berlin, Germany) in the presence of penicillin 50 U/ml, 50 pg/ml
of streptomycin (GEBCO BRL, Karlsruhe, Germany) and 2 mM L-glutamine
25
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
(GIBCO BRL, Karlsruhe, Germany). Unless otherwise stated all cells were
maintained in humidified incubators in 5% C 0 2 at 37°C.
DNA electroporations and transfections:
Ba/F3 cells and 32D cells were electroporated to stably transfect them
with DNA constructs. Electroporations were performed with the
geneZAPPER (D BI, Madison, Wisconsin) at 250 mV and 950 mF with 25
mg of DNA and 5 x 106 cells in cold phosphate buffered saline (PBS). After
48 hours, the transfected cells were selected with 1 mg of G418 (Serva,
Heidelberg, Germany) per ml for 14 days. All other cell lines were
transfected using the liposomal transfection agent DOTAP (Boehringer
Mannheim, Germany). Cells were plated the day before transfection in
either 6-well plates or 100 mm dishes at a concentration of 1.0 x lOVwell
and 1.0 x 106 /dish in DMEM supplemented with 10% fetal calf serum (FCS)
(Seromed, Berlin, Germany) in the presence of penicillin 50 U/ml, 50 pg/ml
of streptomycin (GIBCO BRL, Karlsruhe, Germany) and 2 mM L-glutamine
(GIBCO BRL, Karlsruhe, Germany). The DOTAP/DNA mixture was
prepared in the following manner for six well plates: 2.5 pg of DNA was
brought up to 25 ml of 25 mM HEPES buffer. 15 pi of DOTAP was diluted
to 50 pi in HEPES buffer and this DOTAP/HEPES buffer mixture was
added to the DNA/HEPES mixture. After an incubation at room
temperature for 10 minutes, the DOTAP/DNA/HEPES buffer mixture was
26
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
taken up in 10 ml of DMEM/10%FCS and layered gently over the cells.
The DOTAP/DNA mixture was prepared in the following manner for 100
mm dishes: 7.5 pg of DNA was brought up to 75 pi of 25 mM HEPES
buffer. 45 pi of DOTAP was diluted to 140 pi in HEPES buffer and the
DOTAP/HEPES mixture was added to the DNA/HEPES mixture. After an
incubation at room temperature for 10 minutes, the DOTAP/DNA/HEPES
buffer mixture was taken up in 10 ml of DMEM/10%FCS and layered
gently over the cells. Media was changed over the cells 8-24 hours after
transfection and cells were selected, if indicated, 48 hours after transfection
in the appropriate antibiotic.
Yeast two-hybrid system:
A yeast two-hybrid screen was performed to identify proteins which
interact with BCR-Abl in a phosphotyrosine-dependent manner. To
achieve autophosphorylation of the bait in yeast, BCR-Abl was fused to
LexA, a DNA binding protein which leads to dimerization and subsequent
phosphorylation of the fused bait (Behrens et al., 1996). Interaction of two
proteins in this system allows for growth on histidine-free medium and for
expression of (3-galactosidase. The cDNA for BCR-AblSal (the actin
binding domain of BCR-Abl was deleted to avoid detection of actin coding
cones) was fused to LexA sequences in the yeast expression vector
BTM116 (Weidner et al., 1996). Different hybrid cDNAs with different
27
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
spacing between the LexA and BCR-Abl coding sequences were
transfected into the yeast strain L40 (which contains a His3 and LacZ
reporter gene) and assayed for BCR-Abl tyrosine kinase
autophosphorylation activity. The yeast clone displaying the highest
autokinase activity was subsequently used and assayed for interaction
with proteins encoded by a VP16 activation domain cDNA library from
E10.5 mouse embryos (Behrens et al., 1996). Additionally, a cDNA library
prepared from K562 cells was used (purchased from Clontech, Heidelberg,
Germany). Mutants of BCR-AblASal including BCR-AblASalKD, BCR
(BCR aa 1-509), AblASal (Abl aa 1-934) and BCR 1-242/AblASal were
subcloned into the BTM-BCR-AblASal vector used for the yeast two-
hybrid screen. 3 x 107 clones were screened and several clones were
identified which specifically interacted with BCR-Abl in yeast.
GST fusion proteins and binding assays:
The Grb4 cDNA clones were cloned in frame into the vector pGEX2TK
to make GST (glutathione-S-transferase) fusion proteins (Smith and
Johnson, 1988). Two micrograms of pGEX2TK (Pharmacia, Freiburg,
Deutschland)) was digested with EcoRl and Xhol and then subjected to
dephosphorylation with calf intestinal alkaline phosphatase (GIBCO BRL,
Karlsruhe, Germany). The Grb4 cDNA clones were ligated into the
dephosphorylated vector using the Rapid DNA Ligation Kit (Boehringer
Mannheim, Germany). GST fusion proteins were produced by growing
28
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
E.coli transformed with the GST-fusion vector up to an optical density of
0.5. The bacteria were then induced with IPTG (Sigma, Deisenhofen,
Germany) (an IPTG-inducible promoter lies upstream of the GST gene) for
protein production. After 2 hours, the bacteria were spun down and lysed
in lysis buffer (1% Triton, lOmM TrisCl (pH 7.4), 5mM EDTA, 130 mM
NaCl, ImM phenylmethylsulfonyl fluoride and 10 mg/inl of each
phenanthroline, aprotinin, leupeptin and pepstatin). Different BCR-Abl
proteins (1-63, 1-242, 1-509 representing varying lengths of BCR) were in
vitro translated in the presence of S3 5 -labeled methionine using the TNT
system (Promega, Madison, Wisconsin, USA). The translation mix was
diluted to a final concentration of 10 mM Tris-HCl (pH 7.4), 10 mM MgC12,
1 mM dithiothreitol and 100 pM cold ATP and incubated at 4°C for 30
minutes to allow for autophosphorylation of the translated proteins.
Reactions were stopped by dilution to a final concentration of 10 mM Tris-
HCl (pH 7.4), 5 mM EDTA, 130 mM NaCl, 1% Triton, ImM
phenylmethylsulfonyl fluoride and 10 pg/ml of each phenantroline,
aprotinin, leupeptin and pepstatin (lysis buffer). 5 \xg of GST-fusion
proteins were added and incubated for 1 hour at 4°C. Protein complexes
were collected on glutathione agarose beads (Pharmacia, Freiburg, FRG),
washed thoroughly with lysis buffer and subjected to SDS-PAGE. In vitro
translated proteins were visualized by autoradiography.
29
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
For binding experiments with cell extracts, lxlO7 cells were solubilized in
lysis buffer, precleared with glutathione beads and subjected to SDS-
PAGE. BCR-Abl and Abl were detected by immunoblotting using an Abl-
specific antibody 8E9 (Duyster et al., 1995).
Rapid amplification o f cDNA ends (RACE):
Total RNA was extracted from K562 cells using the total RNA
extraction kit from Qiagen (RNEasy) (QIAGEN, Hilden, Germany). Poly A+
RNA was purified from the total RNA using poly T coated beads from
DYNAL (DYNAL, Germany). First strand cDNA synthesis was performed
using a modified lock-docking oligo (dT) primer (Clontech, Heidelberg,
Germany) which contains two degenerate nucleotides at the start of the
poly-A tail and thus eliminate the 3’ heterogeneity inherent with oligo d(T)
priming (Chenchnik et al., 1994). This Marathon cDNA synthesis primer is
a 52-mer with the sequence: 5TTCTAGAATTCAGCGGCCGCT8399N-
1N-3' where N1 is G, A or C and N is G, A, C, or T. The degenerate
nucleotides are represented by N1 and N. The reaction was perfomed with
the MoMuLV reverse transcriptase in a buffer containing 50 mM Tris pH
8.3), 6mM MgCl2 and 75 mM KC1. Second strand synthesis was performed
according to the method of Gubler and Hoffmann (Gubler and Hoffman,
1983) with a convenient cocktail of E.coli polymerase 1, RNase H and E.
coli DNA ligase. The second strand buffer used contained 100 mM KC1, 10
mM ammonium sulfate, 5 mM MgCl2 , 0.15 mM (3-NAD, 20 mM Tris (pH 7.5)
30
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
and 0.5 mg/ml bovine serum albumin (Clontech, Heidelberg, Germany).
Following creation of blunt ends with T4 DNA polymerase, the ds cDNA
was ligated to the Marathon cDNA Adaptor (Clontech). The ligation buffer
consisted of 50 mM Tris HC1 (pH 7.8), 10 mM Mg Cl2 , 1 mM DTT, 1 mM
ATP and 5% w/v polyethylene glycol (MW 8000). The Marathon cDNA
adaptor primer had the following sequence:
5 '-CTAAT ACGACTC ACT AT AGGGCTCGAGCGGCCGCCCGGGC AGGT-3'
3 '-ILN-CCCGTCC A-P04 -5
Long distance PCR was then performed on the adaptor ligated cDNAs
using the Advantage™ Klentaq Polymerase Mix (Clontech, Heidelberg,
Germany). An adapter primer and a gene specific primer were used in a
touch-down PCR. The sequence of the adapter primer, API, used was 5’-
CCATCCTAATACGACTGACTATAGGGC-3'. The positive control primer
for the 5 'RACE reaction was the 5 'RACE G3PDH primer: 5'-
TCCACCACCCTGTTGCTGTAG-3' (21-mer). The gene specific 5 'RACE
primer used had a melting temperature of 72.4°C and its sequence was 5'-
CCGTTGTAGCTGCCCCGCCACCAACCGTCGGC. The PCR reaction
buffer contained 0.2 mM dNTP, 0.2 pM of each of the primers (adaptor
and gene specific) and 1 pi of the Advantage™ Klentaq polymerase mix in
the 50 pi reaction volume (Clontech, Heidelberg, Germany). The positive
control reaction was for the 5’ end of the G3PDH gene. The gene specific
primer was designed in a manner that GC% was between 50-70% and the
Tm of the primer was around 70°C or higher. A touch-down PCR was
31
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
performed with the following conditions: 94°C for 1 minute followed by 5
cycles of 94° for 1 minute, 75 degrees for 1 minute, 72° for 4 minutes, 5
cycles with 94° for 1 minute, 72° for 4 minutes, 30 cycles of 94°, 1 minute,
68° for 4 minutes followed by a final 10 minutes at 72° and soaking at
10°C. A nested PCR was performed on varying dilutions of the PCR
products with exactly the same conditions except for the nested primers.
The AP2 primer was the nested primer for the adaptor region and was a 23-
mer with the sequence 5ACTCACTATAGGGCTCGAGCGGC-3'. The
nested gene specific primer had the sequence 5'-
GGAAAGCTTGGGGACTCCGC AGCCGCC-3’ (Frohman et al., 1988,
Dumas et al., 1991; Harvey and Darlison, 1991, Harvey and Darlison, 1991).
TA cloning o f RACE PCR product:
The PCR product was cloned into a TA cloning vector (Invitrogen,
Groningen, The Netherlands) for sequencing. Roughly, 10 ng of PCR
product was ligated into 50 ng of pCR® 2.1 vector (Invitrogen, Groningen,
The Netherlands) using T4 DNA ligase. Ligation reactions were incubated
at 14°C overnight. 1-2 m l of each ligation reaction was added to the One
ShotTM (Invitrogen, Groningen, The Netherlands) cells to which (3-ME was
added. The cells were gently stirred with a pipette tip and then incubated
on ice for 30 minutes. The bacteria were then heat-shocked for exactly 30
seconds in a 42°C water bath and placed on ice for 2 minutes. 250 |il of
SOC medium was added to each vial and then vials were agitated at 37°C
32
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
in a shaker at 225 rpm for exactly one hour. 50 and 200 pi of each
transformation were then added to an LB plate containing 50 pg/inl
ampicillin, X-Gal and BPTG. Plates were incubated at 37°C for at least 18
hours and then shifted to 4°C for 2-3 hours for color development. The
white transformants were grown for the presence and insertion of insert by
restriction mapping and sequencing.
Immunoprecipitation and immunoblotting:
For immunoprecipitations, lxlO7 cells were solubilized in lysis buffer
containinglO mM Tris-HCl (pH 7.4), 5 mM EDTA, 130 mM NaCl, 1% Triton,
ImM phenylmethylsulfonyl fluoride, ImM Na3 V 04 and 10 pg/ml of each
phenantroline, aprotinin, leupeptin and pepstatin. After clarification by
centrifugation, Grb4 was immunoprecipitated with an anti-Xpress™
antibody (Invitrogen, Groningen, The Netherlands) and BCR-Abl/Abl were
immunoprecipitated with an anti-Abl antibody 8E9 (Pharmingen, Hamburg,
Germany) and the monoclonal anti-phosphotyrosine antibody (PY20)
(Pharmingen, Hamburg, Germany). Nek was immunoprecipitated using the
Xpress™ antibody (Invitrogen, Groningen, The Netherlands) or a rabbit
polyclonal antibody (Pharmingen, Hamburg, Germany) (Duyster et al.,
1995). The secondary antibody was added after a period of two hours and
samples were agitated at 4°C for 10 minutes. Protein A was then added to
bring down the antibody complexes which were resolved by SDS gel
33
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
electrophoresis and then transferred (1000 mA) on to a nylon membrane for
Western blotting. Transfer time periods varied from 1 hour for Grb4 and
Nek to 3 hours for the much larger BCR-Abl.
Western Blotting:
Following transfer, nylons were washed with TBS/Tween 0.1% before
blocking it with Blotto (5% non-fat milk in TBS/Tween 0.1%) at 37° C for
thirty minutes, followed by a three hour incubation at room temperature in
Blotto containing a specific antibody to the protein to be identified. The
antibody was diluted in a one to thousand dilution in Blotto. Primary
antibodies used include the anti-Abl antibody, 8E9 (Duyster et al., 1995)
(Pharmingen, Hamburg, Germany), the Xpress™ antibody to the nine amino
acid sequence Xpress™ (Invitrogen, Groningen, The Netherlands), the anti-
Grb4 rabbit polyclonal antibody and the polyclonal rabbit antibody against
Nek (Pharmingen, Hamburg, Germany). When performing western blotting
to detect phosphotyrosine, 5% BSA or bovine serum albumin (Sigma,
Deisenhofen, Germany) was used in place of milk. The antibody used was
the PY20 antibody (Pharmingen, Hamburg, Germany) against
phosphotyrosine. Incubation with the primary antibody was at room
temperature for a period of three hours. The nylon membrane was then
washed three times with TBS/Tween 0.1% and then incubated at room
temperature for an hour in 25 ml of milk (5%) containing a secondary
antibody conjugated to horseradish peroxidase (Amersham Life Sciences).
34
of the copyright owner. Further reproduction prohibited without permission.
The secondary antibody was either an anti-mouse antibody or an anti
rabbit antibody. The membrane was washed three times with TBS/Tween
0.1% and then once with TBS alone. It was then developed using an ECL
solution (Amersham, Germany). The nylon was then exposed to a Biomax
MR film (Kodak/Integra, Femwald, Germany) for a few minutes up to an
hour.
Far Western analyses:
GST Grb4 was produced in E.coli Topp2 (Stratagene, Heidelberg,
Germany) bacteria. Expression was under standard conditions and protease
inhibitor cocktail tablets (Boehringer Mannheim, Germany) were used to
minimize any protease activity as GST-Grb4 is apparently quite protease-
sensitive. The proteins were radiolabelled by growing the bacteria in media
containing S3 5 -labelled methionine and cysteine (Amersham, Germany).
(Details in Feller et al., 1995). The GST-Sepharose bound probe was eluted
with free glutathione and dialyzed twice overnight against 1000 volumes
of 5mM TrisHCl pH 7.5. The S3 5 -GST-Grb4 probe was analysed for protein
quality by Coomassie Blue staining and autoradiography and was then
used at a final concentration of 10 pg/ml. Precipitation with cold GST-
fusion proteins (10 micrograms of GST and equimolar amounts of fusion
proteins) was done from 5 mg of total RIPA lysate of K562 cells at 4°C
overnight, approximately 0.2 ml of K562 lysate was diluted with a buffer
containing 20mM Tris, pH 7.5, ImM EDTA ph 7.5, 100 mM NaCl, 0.1%
35
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Tween 20, 5% glycerol to a final volume of 1 mL After three washes with
the forementioned buffer, samples were separated on a 6.5%
polyacrylamide gel, blotted (semi-dry), blocked and renatured at room
temperature as described by (Feller et al., 1995). The membrane was then
probed for four hours at room temperature, rinsed three times for ten
minutes with 50 ml of wash buffer and then completely dried. The dried
membranes were analysed using a phosphoimager and subsequent
autoradiography.
Northern analysis:
A P3 2 -labeled (Primelt Kit 2) (Stratagene, Heidelberg, Germany) cDNA
probe consisting of the two middle SH3 domains and the SH2 domain) was
hybridized in ExpressHyb (Clontech GmbH, Heidelberg, Germany) to a
human tissue Northern blot (Clontech GmbH, Heidelberg, Germany) at
65°C. The blots were washed three times in wash buffer (5X SSC/Triton
0.1%) at 65°C. Blots were then exposed to an autoradiogram for varying
lengths of time to obtain an optimal exposure.
AP-1. c-iun. elkl and CREB activation reporter assays:
A trans-activating fusion transcription factor was expressed in 293, cosl
or cos 7, Rat-1 or 3T3 cells along with Grb4, pFR-Luc encoding the
luciferase reporter gene under the control of a promoter responsive to the
fusion transcription factor, pFA2-cJun/Elkl/CREB, the fusion
36
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
transactivator for either of three different signaling pathways and |3-
galactosidase (PathDetect™ In vivo Signal Transduction Pathway Trans-
Reporting Systems, Stratagene, Heidelberg, Germany). Two days following
transfection (DOTAP, Boehringer Mannheim, Germany) in which a total of
3 pg of DNA was used per well, cells were starved for 6 hours before they
were harvested in 150 pi ice-cold PBS/lmM Na-orthovanadate. Cells were
frozen once at -80°C to enhance lysis before being lysed in a buffer
supplied by the manufacturer of Luciferase Assay With Reporter Lysis
Buffer (Promega, Madison, Wisconsin, USA). Luciferase activity and (3 -
galactosidase activity (Galacto-Light™, Tropix, Inc., Germany) were
measured using a luminometer (Bertholdt, Germany). For the luciferase
measurement, 20 pi of cell lysate was added to 50 pi of reaction buffer and
immediately measured. For the beta-galactosidase measurement, 200 pi of
the beta-galactosidase reaction buffer containing a 1:100 dilution of the
substrate was added to as many tubes as there were samples. Following a
50 second time course, 20 pi of lysate was added to the reaction buffer.
After an hour of incubation at room temperature, 300 pi of accelerator II
solution was added to every tube in the same order as lysates were added
to the reaction buffer and in the same time course (every fifty seconds). On
adding the accelerator n, samples were assayed for luminescence
immediately. Relative light units for luciferase activity were divided by the
beta-galactosidase values and were expressed in terms of fold-activation.
37
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Beta-galactosidase was co-transfected with the other constructs as a means
of normalizing results for transfection efficiency.
AP-1 activation was tested in a similar method using the PathDetect Cis-
Reporting System (Stratagene, Heidelberg, Germany). The cis-reporter
plasmid used in the assay contains the luciferase reporter gene driven by a
basic promoter element (TATA box) joined to seven tandem repeats of the
AP-1 binding element. The Grb4 cDNA was co-transfected with and
without various other constructs (BCR-Abl, v-Abl) to determine the effect
of Grb4 expression on the API signaling pathway.
Vectors and cloning o f DNA:
All expression constructs were cloned into the expression vector
pcDNA3.1 (Invitrogen, Groningen, The Netherlands) with either Neo® or
Zeo® as a marker for selection in mammalian cells. Unless otherwise stated,
all constructs of Grb4 were cloned into the EcoR l and X hol cloning sites
of the vector. The vector was digested with the two enzymes and then
treated with calf intestinal alkaline phosphatase (GIBCO BRL, Karlsruhe,
Germany). The insert (varying lengths of Grb4 or individual domains) were
sub-cloned using a PCR-based method with E coR l and X hol introduced
into its terminal ends or digested out of an existing clone of Grb4. The
ligation was performed following the instructions of the Rapid DNA
Ligation Kit (Boehringer Mannheim, Germany). For creation of GST-fusion
proteins, Grb4 and various constructs of Grb4 or its individual domains
38
of the copyright owner. Further reproduction prohibited without permission.
were cloned into the vector pGEX-2TK (Pharmacia, Freiburg, FRG. All
constructs of Grb4 and its individual domains were cloned, as described for
pCDNA3.1, into the EcoRl and X hol cloning sites of the vector pGEX-
2TK. Following the ligation, a transformation was performed using sub
cloning efficiency DH5a™ competent bacterial cells (GIBCO BRL,
Karlsruhe, Germany). DH5a™ were thawed on ice and then gently mixed.
50 pi of cells were put into a chilled microcentrifuge tube. 1-3 pi (1-10 ng of
DNA) of the ligation reaction was added to the tubes and again mixed
gently and allowed to remain on ice for thirty minutes. Cells were heat-
shocked for 45 seconds at 37°C and then placed on ice for 2 minutes. 0.95
ml of LB medium was then added to the bacteria which were allowed
to shake at 225 rpm for 1 hour at 37°C for expression. A fraction of the
culture was then plated on LB plates containing ampicillin for selection of
transformed bacterial clones. After 12 hours of growth on the LB-Amp
plates, bacteria were inoculated into LB media containing Ampicillin to
isolate DNA (Qiaprep plasmid miniprep kit, QIAGEN, Hilden, Germany) for
restriction analyses to confirm that the insert was in the vector and in the
correct orientation. Maxipreparations of the DNA were performed to obtain
purified DNA for transfection into mammalian cells.
39
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
For the PCR-based cloning of various domains of Grb4 and Nek, the
following primers were designed:
F16/Grb4 SH2 5’ primer 5’- GGA ATT CGG TGG TAC TAC GGG
AACGTG ACG-3’,
pGEX 3’ primer: 5’-CAC CGT CAT CAC CGA AAC GCG CGA GGC-3’
Nek SH2 5’ primer: 5’ -GGA AIT CGG GGA AAG TIT GCT GGC AAT
CC-3’
Nek SH2 3’ primer: 5’-CTC GAGTGC CTT TTT GTA ATG TTC-3’
5’ primer for the 3’ SH3 domain: 5’-GGC ATT CGG TAC CCC TTC AGC
TCA GTC-3’, 5’ primer for the middle SH3 domain: 5’-GGA ATT CGG GTC
AAG TTC GCC TAT GTG-3’
5’ primer for Grb4 with a 5’ EcoRl site: TCG AAT TCA GAT GAC AGA
AGA AGT TAT TGT GAT AGC C-3’
5’ primer for Grb4 with a BamHl site at the 5’ end: 5’GAA GGA TCC
ATG AAA GAT GAC AGA AG-3’
3’ Grb4 primer with a Stu site at the 3’ end: 5 ’-GTC TIG CCG AGG CCT
AGTGT-3’
3’ Grb4 primer with an Esp site at the 3’ end: 5’ -CAT TGC TCA GCG AGG
CGC-3’
5’ Nek middle SH3 domain: 5’-GTC GAA ZTTC ACC TCA ACA TGC
CCG CTT ATG TG-3’
5’ primer for Nek 3’ SH3 domain: 5’-TGG AAT TCT GTT GCA TGT GGT
ACA GGC-3’
40
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
5’ primer for Nek SH2 domain: 5’-TGG AAT TCT TGC TGG CAA TCC
TTG GTA TTA TGG-3’
Site-directed mutagenesis:
Site-directed mutagenesis was performed with the QuickChange site-
directed mutagenesis kit with Pfu DNA polymerase (Stratagene, Heidelberg,
Germany). Two complementary primers were designed containing the
desired mutation flanked by unmodified sequence. The primers contained a
restriction site to enable confirmation of the incorporation of the mutation.
The cycling conditions were as follows: Segment 1 had a single cycle at
95°C for 30 seconds followed by Segment 2 with 10-16 cycles at 95°C for
30 seconds followed by 55°C for a minute and lastly at 68°C for 2
minutes/kb of plasmid length. After the cycling, 1 pi of the restriction
enzyme Dpn 1 was added to the reaction which was mixed gently. Tubes
were incubated at 37°C for 1 hour to digest the parental (i.e. the non
mutated) supercoiled dsDNA. 1 pi of the Dpn 1 treated DNA was then
added to Epicurean Coli XLl-Blue supercompetent cells on ice. The
bacteria were kept on ice for 30 minutes before heat pulsing the
transformation reactions at 42°C for one minute. The reactions were then
placed on ice for 2 minutes before adding 0.5 ml of NZY+ broth preheated
to 42°C. Cultures were then shaken at 37 °C for an hour before plating
them on LB-Ampicillin plates. Plates were put at 37°C for >16 hours and
clones were then picked to grow up for DNA isolation. DNA was then
41
of the copyright owner. Further reproduction prohibited without permission.
sequenced with the ABI PRISM dye terminator cycle sequencing ready
reaction kit (Perkin-Elmer, Weiterstadt, Germany). The sequence for the
primers for site-directed mutagenesis of the Grb4 SH2 mutant were as
follows: sense primer for Grb4 SH2 mutant 5’-GAC TTC CTC ATT CTA
GAC AGC GAG TCC-3’, anti-sense primer for the Grb4 SH2 mutant 5 ’
GGA CTC GCT GTC TAG AAT GAG GAA GTC-3’.
Soft agar assays:
Rat-1 or 3T3 were trypsinized well to obtain a single cell suspension. 0.5
x 106 cells were plated per 100 mm plate and then using the transfection
agent, DOTAP (Boehringer Mannheim, Germany) cells were transfected
with the desired constructs. G418 was added to the cultures at the
concentration of 0.75 mg/ml about 1-2 days after transfection. Soft agar
assays were performed one-two weeks after selection. 0.65 ml of agar was
mixed into 50 ml of dH2 0 in a bottle with a lid. Agar and water mixture was
boiled in the microwave and then put in a 55 degree waterbath. An equal
volume of 2X ISCOVE (GEBCO-BRL, Karlsruhe, Germany) + 10% FCS
(Seromed, Berlin, Germany) + 2X P/S (penicillin/streptomycin) (GIBCO-
BRL, Karlsruhe, Germany) was mixed with agar and then plated in a
volume of 2-3 ml in 6 cm dishes. Dishes were then dried and put into the
37°C incubator. Then to 50 ml of IX Iscove 21 ml of 2X
ISCOVE/10%FCS/2XP/S, 8 ml of FCS and 1 ml of P/S were added and
mixed. 20 ml of the agar from the 55 °C waterbath was put at 37°C to cool.
4 2
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
The cells (10-30 thousand) were added in a volume of 1-2 ml to the 20 ml of
agar (cooled to 37°C) and mixed slowly and carefully with a pipette. Three
ml of the cell/agar mixture were put onto the dishes already coated with
one layer of the basal agar mixture and then allowed to dry for 30 minutes
to an hour. Plates were coated again with an upper layer of the initial
Iscove/FCS/penicillin/streptomycin/agar mixture used for the basal layer.
This last step was done very slowly and carefully and only when the agar
underneath was completely dry. Plates were dried for 15 minutes and then
put in a 37°C/5%C02 incubator for soft agar growth over a period of two-
three weeks after which foci were photographed (Bai et al., 1998).
Affinity purification o f the Grb4 rabbit polyclonal antibody:
A column was made using 400 |il of Affigel 10 (BIORAD, Muenchen,
Germany). The column was equilibrated in PBS/0.5M NaCl/0.5% NP-40.
About 3 ml of rabbit serum was loaded three times over the column. The
column was then washed with 5-10 column volumes of PBS/0.5M
NaCl/0.5% NP-40. The column was again washed twice with PBS/0.5M
NaCl. Fractions were eluted with 50 mM glycine/0.15 M NaCl (pH with
HC1 to 2.5) collected in six microcentrifuge tubes containing 0.05 volumes
of 2M Tris pH 7.9 and 0.01 volumes of 10% NP-40. Column was washed
with 6 volumes of elution buffer and then immediately equilibrated in
PBS/0.5M NaCl/0.1% azide. Eluates were then dialyzed in a small volume
43
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
dialysis kit (protocol, courtesy of Dr. L. Comai, University o f Southern
California).
Intracellular localization o f Grb4:
Grb4 was cloned in frame with a modified form of EGFP, EYFP
(enhanced yellow fluorescent protein). EYFP was at the 5' end of Grb4 in
the pCDNA3.1 Neo vector. (Invitrogen, Groningen, The Netherlands).
Grb4-EYFP was transiently transfected (DOTAP) into cos cells. BCR-Abl
(both wild type and kinase defective) was cloned in frame with ECFP
(cyan fluorescent protein) in the expression vector pcDNA3.1A Zeo and
co-transfected with Grb4 into cos cells to examine the effect, if any, on the
intracellular localization of Grb4. Both EYFP and ECFP were created by
site-directed mutagenesis of EGFP (kind gift of Dr. Donald Kohn, Childrens
Hospital Los Angeles, University of Southern California). Twenty four
hours following transfection, cells were visualized using fluorescence
microscopy using a yellow or cyan filter.
JNK kinase assay:
HA-tagged Jun-N-terminal Kinase (JNK) cloned into pCDNA 3
(Invitrogen, Groningen, The Netherlands) (courtesy: Dr. Lengyel,
Technical University of Munich) was over-expressed in 293 cells with
either empty vector, Grb4, BCR-Abl or v-Abl. Cells were harvested forty-
eight hours after transfection after a period of serum starvation (6 hours).
44
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Cells were harvested on ice and frozen down at -8 0 °C. Cells were then
thawed quickly on ice and then lysed in a lysis buffer provided with the
SAPK/JNK Assay Kit (New England Biolabs, Schwalbach/Taunus,
Germany). Cells were sonicated briefly (4 pulses at a duty of 50% at a
power of 4-5) and then spun down at 4°C for 10 minutes. Lysates were
pre-cleared with Protein A before adding 2 pg of an anti-HA antibody
(Boehringer Mannheim, Germany) and rotated on a wheel at 4°C for two-
three hours. A rabbit anti-mouse secondary antibody was then added and
samples were shaken for 10 minutes before the addition of Protein A.
Samples were again rotated at 4°C for an hour before washing three times
with 500 pi of lysis buffer and then twice with 500 pi of kinase buffer
(also provided by New England Biolabs, Schwalbach/Taunus, Germany).
The kinase assay was then performed in a 30 pi volume with 1 pg of GST-
jun (Santa Cruz, Heidelberg, Germany) as the substrate in the presence of
25 pM cold ATP to which 1 pi of y-P3 2 -labeled ATP (250 pCi/25 pi) had
been added. Kinase reactions were performed at 30°C for 20 minutes on a
shaker. Samples were then loaded on an 8% polyacrylamide gel and
exposed to a film (Kodak/Integra, Femwald, Germany).
45
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter Four
Results:
Bcr-Abl binds to a clone o f Grb4. F16 in the yeast two-hybrid system:
A yeast two-hybrid screen was performed to identify proteins which
interact with Bcr-Abl in a phosphotyrosine-dependent manner (Figure 4).
In order to detect phosphotyrosine interactions BCR-Abl needs to be
phosphorylated. However, phosphorylation of BCR-Abl does not occur
naturally in yeast. In order to address this and achieve
autophosphorylation of the bait, Bcr-Abl, in yeast, Bcr-Abl was fused to
LexA, a DNA binding protein which has the inherent ability to dimerize
(Bai etal., 1998; Weidner e ta i, 1996) (Figure 5). This led to dimerization
and subsequent phosphorylation of the fused bait (Behrens et aL, 1996).
Interaction of two proteins in this system allowed for growth on histidine-
free medium and for expression of (3-galactosidase. A K562 c-DNA library
was screened with Bcr-AblASal fused to LexA (the actin binding domain
in Bcr-Abl was deleted to avoid the isolation of actin encoding clones).
Expression and phosphorylation of the transfected Bcr-Abl constructs in
yeast was verified by Western blot analysis and the clone displaying the
highest autokinase activity was subsequently used. 3x10? clones were
screened and 62 clones were isolated which specifically interacted with
Bcr-Abl in yeast. Among these clones were proteins already known to
interact with Bcr-Abl both in a phospho-tyrosine-dependent and in a
phospho-tyrosine-independent manner like the SH2 domain of Grb2, the
46
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Reproduced with permission o f th e copyright owner. Further reproduction prohibited without permission.
Figure 4: The Traditional Yeast Two-Hybrid Screen
DNA- \
Activation ^
dom ain f I _ _ _
X T " e c l / I
^ U i c t i d v
DNA-
Binding
domain
Histidine
The traditional yeast two-hybrid system: this figure shows interaction between BCR-Abl
fused to the DNA binding domain of a transcription factor and a target protein fused to
the DNA activation domain of a transcription factor resulting in reconstitution of the
modular transcription factor and expression of a reporter gene (e.g. histidine, B-
galactosidase). However, a problem arises when trying to detect interactions that are
phosphotyrosine-dependent as BCR-Abl needs to dimerize to autophosphorylate.
-j
Reproduced w ith permission o f th e copyright owner. Further reproduction prohibited without permission.
Figure 5: The Modified Two-Hybrid Screen
LEX A-Bcr-Ab)
i
>
DIMERIZATION
LEX A-Bcr-Abl
>
LEX A-BCR-Abl
Target DNA-
Activation
Domain
LEX A-Bcr-Abl
Complex shuttles to nucleus
transactivation o f LEX A dependent reporter
The modifed yeast two-hybrid system: The Lex-A transcription factor has the inherent ability to
dimerize leading to the dimerization of BCR-Abl and its cross-strand autophosphorylation. This
allows then for the detection of phosphotyrosine-dependent interactions of BCR-Abl to target proteins.
■ p .
00
SH2 domain of P85PI3K and the Crk SH3 domain (Pendergast et aL,
1993, Puil et aL, 1994, Ren et aL, 1994). The F16 clone of Grb4 was
identified as an uncharacterized and novel protein sequence which
interacted with Bcr-Abl. A fragment of the murine cDNA had already been
identified and was already in GenBank (Accession No. 113161). The
fragment had been referred to as Grb4 and so we adhered to the original
nomenclature. Interaction of F16 with Bcr-Abl was specific as
demonstrated by the fact that F16 did not interact with lamin, a non
specific control protein. To determine if this interaction was
autophosphorylation dependent, a kinase defective Bcr-Abl (KD Bcr-Abl)
was assessed for its interaction with the F16 clone along with the Grb2
SIC domain as negative and the Crk SID domain as positive control.
While the wt Bcr-Abl bound to all three constructs, the kinase defective
Bcr-Abl failed to induce autotrophy in yeast with the Grb2 SIC and the
F16 clone demonstrating the phosphotyrosine dependency of these
interactions. As expected, the Crk SH3 domain which is known to bind to
a proline rich sequence in the Abl C terminus (Feller et aL, 1995; Ren et
aL, 1994) still showed interaction with the kinase defective Bcr-Abl in
yeast. Thus, binding of F16 to Bcr-Abl was specific and kinase dependent
(Figures 6 and 7). Grb4/F16 had 68% homology to the adapter protein
Nek in an NCBI Advanced BLAST comparison with high homology in
the SH domains and most divergence occurring in the areas between the
SH domains. Nek is an adapter protein with three SH3 domains and a
single SIC domain. We found through RACE and identification of other
of the copyright owner. Further reproduction prohibited without permission.
Reproduced with permission o f th e copyright owner. Further reproduction prohibited without permission.
Figure 6: Interaction of BCR-Abl and Grb4 in yeast
Abl
Bcr-Abl wt
Bcr-Abl kd
h b - 's c - i 1 1 '/'.
t U T I
S M I
-THL
w m i
i ’ "
G rb4/F16
G rb4/F I6
Orb4/F16
Grb4/F20
The F16 clone o f GrM interacts with BCR-Abl and Abl in a phosphotyrosine manner. Various constructs o f bcr-abl -wild
type (wt) and kinase defective (kd) were co-transfected with a K562 cDNA library into yeast, Co-transfected yeast was
plated onto agar lacking tryptophan and leucine and growth o f clones under this selection is represented by the left panel and
indicated efficiency o f transfection. Alternately, co-transfected yeast was grown on agar lacking tryptophan, leucine and
histidine and growth o f clones under these selection conditions is represented on the right and represents the specificity of
interaction with the target clone. As seen the FI6 clone o f Grb4 interacted with Bcr-Abl in a phosphotyrosine-dependent
manner, i.e. it interacted with BCR-Abl wt but not with BCR-Abl kd nor with Abl alone with Abl which is poorly
phosphorylated in yeast. The F20 clone o f GrM which possesses an additional SH3 domain interacted with Bcr-Abl and Abl
in a non-phosphotyrosine-dependent manner. Its interaction with Abl alone is shown above.
U i
o
Reproduced with permission o f th e copyright owner. Further reproduction prohibited without permission.
Figure 7 : Interaction of BCR-Abl and Abl with Grb4 in the yeast two hybrid screen
TL THL
FI 6/BCR-Abl WT + +
FI 6/BCR-Abl KD +
-
F16/Abl +
-
F20/BCR-Abl WT + +
F20/BCR-Abl KD + +
F20/Abl + +
The table above summarizes the yeast interaction data of the two Grb4 clones, FI6 and F20. As
indicated, while transfection effficiency was good with all constructs (reflected by growth on
plates lacking tryptophan and leucine) Grb4/F16 interacted with only WT BCR-Abl while
F20/Grb4 interacted with both wild type and kinase defective BCR-Abl, which lacks the ability
to autophosphorylate, as well as with Abl alone which is poorly phosphorylated in yeast.
Lamin, a control protein, did not interact with any of these constructs in this screen.
Grb4 clones in the yeast two-hybrid screen that Grb4 had the same
configuration of domains. Grb4/F16 had a portion of an SH3 domain (7
aminoacids of an average of 45 aminoacids that SH3 domains are made up
of), a complete SH3 domain and a single SH2 domain at the C-terminal
end. When we identified the complete cDNA sequence of GrM, we
determined that Grb/F16 extended from aminacod 154 to the very end of
the GrM sequence (aminoacid 380).
Two additional clones o f Grb4 were identified as BCR-Abl interacting
clones in the yeast two-hvbrid system:
In addition to the initial clone, F16, two other clones of GrM, the F20
and F40 were identified to interact with BCR-Abl in the yeast two-hybrid
screen. The F40 clone was identical to the F16 clone. The F20 clone
however was longer and contained additional 5’ sequences encoding a
portion of the 5’ SH3 domain of GrM and the portion of the middle SH3
domain missing in GrM/F16. This clone differed from the F16 and F40
clones of GrM in that they interacted with BCR-Abl irrespective of its
kinase activity and induced autotrophic growth in yeast (Figures 6, 7 and
8). This non-phosphotyrosine dependent interaction of GrM with BCR-
Abl draws a parallel between the non-phosphotyrosine-dependent SH3
mediated interaction of Nek and the proline-rich stretch at the C-terminal
end of BCR-Abl the significance of which has not been examined.
52
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Reproduced w ith permission o f th e copyright owner. Further reproduction prohibited without permission.
Figure 8: Comparison of the protein sequence of Grb4 and Nek.
NCK
-COOH
72%
87% 78%
Homology
-COOH SH2 NH2— SH3
SH3
SH3
SH2
SH3
SH3 SH3
F16 _ _ _ _ _ _ _ _ _ _ _ _
F20 — —
F40 .....................
The protein sequences of Grb4 and Nek were compared and found to have an overall homology
of 68% at the aminoacid level. As seen in the figure, both proteins have three SH3 domains and
a single SH2 domain. Stretches of very high homology were observed within the SH domains
and areas of high homology are indicated by the bars between the two sequences. Most
divergence occured in the stretches between the SH domains. Corresponding percentages
indicate the level of aminoacid homology. The extent of the clones identified in the
screen is represented by F I6, F20 and F40.
V\
w
Rapid amplification o f cDNA ends was performed to isolate the 5 'end o f
the Grb4 gene:
RACE, rapid amplification of cDNA ends was performed to identify the
missing 5'end of GrM which was not in any of the clones found to
interact with BCR-Abl in the yeast two-hybrid screen (Frohman et aL,
1988; Schaefer, 1995). Total RNA was isolated from K562 cells. K562
cells were chosen as they are derived from a patient with chronic myeloid
leukemia in blast crisis and so are representative of the malignancy under
study. The total RNA was further purified on oligo-T coated Dynal beads
(DYNAL, Germany) to isolate messenger RNA. The mRNA was, as
described in materials and methods, ligated to an adapter at either end
(Figure 9). Primers were designed for the gene-specific portion of Grb4 in
such a way that their GC content was greater than 70% and their melting
temperature was at or above 70°C. The adapter primers were provided
with the Marathon RACE kit (Clontech GmbH, Heidelberg, Germany).
While the initial PCR showed no product at all, the nested PCR revealed a
band of approximately 800 base pairs which was cloned into a TA cloning
vector and sequenced (Figure 10). The sequencing results revealed that
this band contained 5 'sequences of Grb4 and 5 'untranslated regions of
Grb4. The coding sequence in the identified fragment encoded for the
5 'end of the terminal SH3 domain. A stop codon immediately upstream of
the ATG suggested that the start codon we identified was the correct
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Reproduced w ith permission o f th e copyright owner. Further reproduction prohibited without permission.
Figure 9: Schematic showing the procedure followed in isolating the 5 'end of GrM
by a PCR-based method, RACE.
RACE (Rapid amplification of cDNA ends)
PolyA* RNA
♦ First and second strand cDNA
synthesis
ds cDNA
y Adaptor ligation
Library of adaptor ligated ds cDNA
t
Control PCR reaction
5 ’ RACftf M 3’ RACE
5' RACE fragment 3’ RACE fragment
* *
C loned RACE fragment
at
U l
Reproduced w ith permission o f th e copyright owner. Further reproduction prohibited without permission.
Figure 10: RACE reaction revealed an 800 bp specific band
LANES: M arker 1 2 3 4
RACE was performed using a K562 cDNA library using adapter and gene-specific
primers as described in Materials and Methods. A nested PCR revealed an 800 bp
specific band (Lane 3) the positive control was a PCR reaction for the 5 'end of the
G3PDH gene (Lane 1) which showed a band of the correct size (approx. 1.2 kb). TA
cloning and sequencing of the 5 'end of GrM revealed a start codon and additional
coding sequences for the 5 ' end of the terminal SH3 domain.
u »
O N
Reproduced with permission o f th e copyright owner. Further reproduction prohibited without permission.
Figure ll:The cDNA sequence of Grb4
ATGACAGAAGAAGTTATTGTGATAGCCAAGTGGGACTACACCGCCCAGCAG
GACCAGGAGCTGGACATCAAGAAGAACGAGCGGCTGTGGTTGCTGGACGAC
TCCAAGACGTGGTGGCGGGTGAGGAACGCGGCCAACAGGACGGGCTATGTA
CCGTCCAACTACGTGGAGCGGAAGAACAGCCTGAAGAAGGGCTCCCTCGTG
AAGAACCTGAAGGACACACTAGGCCTCGGCAAGACGCGCAGGAAGACCAGC
GCGCGGGATGCGTCCCCCACGCCCAGCACGGACGCCGAGTACCCCGCCAAT
GGCAGCGGCGCCGACCGCATCTACGACCTCAACATCCCGGCCTTCGTCAAG
TTCGCCTATGTGGCCGAGCGGGAGGATGAGTTGTCCCTGGTGAAGGGGTCG
CGCGTCACCGTCATGGAGAAGTGCAGCGACGGTTGGTGGCGGGGCAGCTAC
AACGGGCAGATCGGCTGGTTCCCCTCCAACTACGTCTTGGAGGAGGTGGAC
GAGGCGGCTGCGGAGTCCCCAAGCTTCCTGAGCCTGCGCAAGGGCGCCTCG
CTGAGCAATGGCCAGGGCTCCCGCGTGCTGCATGTGGTCCAGACGCTGTAC
CCCTTCAGCTCAGTCACCGAGGAGGAGCTCAACTTCGAGAAGGGGGAGACC
ATGGAGGTGATTGAGAAGCCGGAGAACGACCCCGAGTGGTGGAAATGCAAA
AATGCCCGGGGCCAGGTGGGCCTCGTCCCCAAAAACTACGTGGTGGTCCTC
AGTGACGGGCCTGCCCTGCACCCTGCGCACGCCCCACAGATAAGCTACACC
GGGCCCTCGTCCAGCGGGCGCTTCGCGGGCAGAGAGTGGTACTACGGGAAC
GTGACGCGGCACCAGGCGCAGTGCGCCCTCAACGAGCGGGGCGTGGAGGG
CGACTTCCTCATTAGGGACAGCGAGTCCTCGCCCAGCGACTTCTCCGTGTCC
CTTAAAGCGTCAGGGAAGAACAAACACTTCAAGGTGCAGCTCGTGGACAAT
GTCTACTGCATTGGGCAGCGGCGCTTCCACACCATGGACGAGCTGGTGGAA
CACTACAAAAAGGCGCCCATCTTCACCAGCGAGCACGGGGAGAAGCTCTAC
CTCGTCAGGGCCCTGCAGTGA
U l
transcriptional start site. Following the identification of the whole DNA
sequence, full-length Grb4 (Figure 11) was cloned into expression vectors
and into GST-fiision vectors to define and characterize the interaction of
BCR-Abl and Grb4 in vitro and in vivo.
Bcr-Abl specifically interacts with Grb4 in vitro:
Following the detection of an interaction of a bait protein with a target
protein in yeast, the next step is to prove that this interaction is a direct
interaction and not an indirect interaction mediated by a yeast-encoded
protein. Therefore an in vitro binding assay was performed. The F16 clone
of Grb4 and full-length Grb4 were cloned in frame into the vector
pGEX2TK vector to make GST fusion proteins (Smith and Johnson, 1988)
(Figures 12 and 13). BCR-Abl mutants were in vitro translated and 35s
labeled using the TNT system (Promega, Madison, Wisconsin, USA)
(Figure 14). Bacterially purified GST proteins were collected on
glutathione-agarose beads (Pharmacia, Freiburg, FRG) and assessed for
their ability to bind to Bcr-Abl constructs. Three different Bcr-Abl
constructs (1-63 Bcr-Abl, 1-242 Bcr-Abl and 1-509 Bcr-Abl) bound to
Grb4/F16 however Abl alone bound only very weakly suggesting that the
interaction is phosphorylation dependent as Abl does not
autophosphorylate efficiently in vitro (Figure 15). This was in agreement
with the yeast data where the F16 clone of Grb4 bound to a kinase active
BCR-Abl but not to the kinase-defective form or to Abl alone which is
known to phosphorylate poorly in yeast. Despite the weak binding to Abl
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Reproduced with permission o f th e copyright owner. Further reproduction prohibited without permission.
Figure 12: Coomassie stained gel showing recombinant Grb4/F 16
GST FYN SRC GRB2 Grb4/F16
The GrM clone isolated from the yeast 2-hybrid system was cloned
into the vector pGEX2TK to make a GST fusion protein. The
Coomassie stained gel above shows the purified recombinant fusion
protein GST/GrM/F16, see arrow.
L f\
V O
Figure 13:Coomassie-stained gel showing
full-length GST-Grb4
< GST-GrM
< GST-
Grb4fF16
The Grb4 clone isolated from the yeast 2-hybrid system was cloned into
the vector pGEX2TK to make a GST fusion protein. The Coomassie
stained gel above shows the purified recombinant fusion protein
GST/GRB4, see arrow. GST-Grb4/F16 is also indicated on this gel by
an arrow.
Reproduced with permission o f th e copyright owner. Further reproduction prohibited without permission.
Figure 14: Autoradiogram showing various in vitro translated S35-labeled
BCR-Abl constructs and three different Abl constructs
C 3
BCR-Abl and Abl were in vitro translated using rabbit reticulocyte lysates in
the presence of S35-labeled methionine. 50 pi of the lysate was first allowed to
autophosphorylate in vitro in the presence of cold ATP at 30°C. A tenth of the
lysate was then incubated with 5 pg of various GST fusion proteins.Five
different BCR-Abl constructs are represented with varying lengths of BCR: the
first 63, 175, 242,446 or 509 aminoacids. The three different Abl constructs
shown here are full-length Abl, AblASal and AblAApa-Apa.
O N
Figure 15: In vitro binding of Grb4/F16 to BCR-Abl
GST GST Grb4/FI6 GSTSrc
-63 1-242 1-509 Abl 1-63 1-242 1-509 Abl 1-63
The autoradiogram above represents an in vitro binding experiment using GST fusion proteins
and various S -labeled Abl/BCR-Abl constructs (1-63,1-242, 1-509 representing different
lengths of BCR) and Abl alone. BCR-Abl deletion mutants and Abl were in vitro translated in
the presence of S35-labeled methionine and then allowed to autophosphorylate in vitro in the
presence of cold ATP. 5 fig of either GST or GST-Grb4/F16 were then allowed to bind to the
different constructs. Bound proteins were resolved on SGS-PAGE and the dried gel was
exposed to a film. BCR-Abl binding by the GST fusion proteins was visualized
byautoradiography.
in vitro (explained by its poor in vitro phosphorylation), these data
suggested that binding of Grb4 to BCR-Abl occured at an Abl
autophosphorylation site and not in BCR as the first sixty three
aminoacids of BCR have no known major autophosphorylation sites.
Binding of the full-length Grb4 was tested with both kinase active and
kinase defective BCR-Abl as well as a deletion mutant (AXS) of BCR-Abl
which is kinase defective and lacks the proline rich stretch known to bind
to SH3-containing adapter molecules like Grb2 and CrkL (Feller et al.,
1995; Feller et al., 1998; Lowenstein et al., 1992). From our yeast data, we
expected that binding would be abrogated to a BCR-Abl construct that
lacks both kinase activity and the proline-rich stretch known to bind to
SH3 domains. However, the results were surprising in that Grb4 bound to
not just the wild type BCR-Abl but also to the kinase defective BCR-Abl
and the kinase defective mutant with the AXS deletion at the C-terminal
end. This demonstrated that the Grb4 N-terminal domain, lacking in F I6
but present in the F20 clone, mediated an SH3-binding independent of the
proline-rich stretch in the C-terminus of Abl (Figure 16).
Bcr-Abl and c-Abl bound to Grb4 in a GST binding experiment in K562
cell lysates:
K562 cells are a CML derived cell line obtained from a patient in blast
crisis and are a useful model for BCR-Abl positive chronic myeloid
leukemia as they express the chimeric oncogene (Villeval et al., 1983).
K562 cells were cultured in RPMI 1640 supplemented with 10% FCS. 1 x
of the copyright owner. Further reproduction prohibited without permission.
Figure 16: Binding of full-length Grb4 occurs independent of the kinase activity of
BCR-Abl and of the proline rich stretch of Abl.
Three different forms of BCR-Abl - wild type, kinase defective and the kinase defective mutant
with the AXS deletion were in vitro translated using rabbit reticulocyte lysates and l/10th of a
total volume of 50 pi was used in a binding experiment with 5 pg of GST, GST Grb4 or GST
Grb4-SH2 mutant. Bound fractions were resolved on SDS-PAGE and the dried gel was
visualized by autoradiography.
Figure 17: Experimental Schema for GST fusion protein
binding experiments with cellular lysates
l.Lysed 4 x 107 K562 cells in lysis buffer on ice.
2.1ncubated 5 pg purified GST or GST fusion protein (bound to
glutathione-coated beads) with K562 lysates on ice for 30 mins..
3.Washed three times with lysis buffer/NETN.
4.Subjected pellets to SDS-PAGE.
5. Western blot analyses using an a-A bl antibody or other
specific commercially available antibodies.
107 K562 cells were lysed in lx lysis buffer and incubated at 4° C for 30
minutes with Gst-Grb4 and GST alone. Lysates were then spun down and
the GST proteins were washed three times with lysis buffer to eliminate
any contaminants which might have bound non-specifically. These
samples were then subjected to electrophoresis on a 7.5% polyacrylamide
gel and the gel was then transferred to a nylon membrane (1000mA for
three hours). Western blotting was performed with a murine antibody to c-
Abl, 8E9 (Duyster et al, 1995) (Pharmingen, Hamburg, Germany) (Figure
18) for three hours at room temperature, an incubation with
Blotto/antimurine horseradish peroxidase for one hour at room
temperature before developing it using an ECL solution (Amersham,
Germany) (Figure 17). The nylon was then exposed to a Biomax MR film
(Kodak/Integra, Femwald, Germany) for one hour. It was observed that
both BCR-Abl and c-Abl interacted with the Grb4 protein. In addition,
GST alone did not interact with either BCR-Abl or c-Abl indicating that
the interaction of BCR-Abl/c-Abl and Grb4 was specific (Figure 19).
Grb4/F16 was also tested for its binding to BCR-Abl and Abl in K562
lysates. It was found that the F16 clone which comprises the SH2 domain,
the C-terminal SH3 domain and seven aminoacids of the middle SH3
domain, also contained the minimal sequences necessary for binding to
binding to BCR-Abl and Abl from K562 lysates (Figure 20).
66
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Reproduced with permission o f th e copyright owner. Further reproduction prohibited without permission.
Figure 18: The monoclonal antibody 8E9 recognizes the SH2 domain of
Abl
c-Abl
Bcr-A bl
The a-A bl antibody is a mouse monoclonal antibody which recognizes the SH2
domain of Abl. Therefore both the Bcr-Abl fusion protein as well as the normal
endogenous c-Abl protein are detected in cell lysates by western blotting.
Actin BD
Kinase
Kinase
Reproduced with permission o f th e copyright owner. Further reproduction prohibited without permission.
Figure 19: Full-length Grb4 interacts with BCR-Abl and Abl in a GST-pulldown experiment
Blot:
a-Abl BCR-Abl
Abl
1 x 107 cells K562 cells were lysed and cell lysates were bound to 5 pg of either GST
or GST-Grb4 (full-length). The figure above shows a GST pulldown experiment using K562
lysates.Bound fractions were run out on SDS-PAGE and western blot analyses was performed
using an anti-Abl antibody.
Q \
00
Figure 20: BCR-Abl and Abl interact with GST-Grb4/F16
in K562 lysates
1 x 107 cells K562 cells were lysed and cell lysates were bound to 5 of either GST
or GST-Fyn or GST-Grb4/F16. Fyn is a Src family tyrosine kinase which was also
identified to interact with BCR-Abl in the yeast two-hybrid screen. Bound fractions
were run out on SDS-PAGE and western blot analyses was performed using an anti-
Abl antibody.
F16/Grb4 binds to v~Abl in a GST binding experiment:
Our data suggested that the binding site of Grb4 on the BCR-Abl
molecule is the Abl portion of the molecule. This was supported by the
fact that Grb4 bound to Abl both in in vitro binding assays as well as to
Abl in K562 lysates. To further strengthen our data, we tested the binding
of F16/Grb4 to the oncogenic variant of Abl, v-Abl which carries gag
sequences of the Roux sarcome virus fused to Abl (Bergold et al., 1987a;
Bergold et al., 1987b). As expected, Grb4/F16 bound very strongly to v-
Abl while the control, GST alone, did not show any binding to v-Abl
(Figure 21). This data is significant in that, hitherto, all adapter proteins
found to interact with BCR-Abl (eg. Grb2, GrblO) have been found to
interact with an autophosphorylation site in the BCR-portion of BCR-
Abl. It is highly unlikely that the gag sequences of the Roux sarcoma
virus are contributing to this binding as no other BCR-Abl-interacting
SH2/SH3 containing adapter proteins have been described to bind to the
gag portion of v-Abl.
Northern analyses revealed that Grb4 was ubiquitously expressed in
various human tissues:
The Grb4/F16 clone was labeled with a-P3 2 dCTP and was used to
examine the distribution of Grb4 expression on Northern blots of RNA
from different human tissues. A 2.6 kbase mRNA species encoding Grb4
specifically hybridized with the labeled DNA probe. This mRNA species
encoding Grb4 was ubiquitously expressed in various human tissues
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Reproduced w ith permission o f th e copyright owner. Further reproduction prohibited without permission.
Figure 21: Grb4/F16 interacts with v-Abl
Blot: a-A bl
v-abl ►
1x10^ 293 cells were transiently transfected with v-Abl using DOTAP. Cells were
harvested 48 hours following transfection and a GST binding experiment was
performed using 5 pg of GST alone and GST-Grb4/F16. Bound fractions were
resolved on SDS-PAGE and western blotting was performed using the Abl antibody.
including the spleen and lymph node, drawing a parallel between Grb2, an
adapter molecule leading to ras pathway activation, which is also
ubiquitously expressed in different human tissues (Goga et al., 1995). Its
ubiquitous expression suggested that Grb4 is involved in an important
cellular function necessary for various cell types, possibly in the regulation
of cell growth and differentiation. Several cell lines were also tested by
Northern analyses for the expression of Grb4 mRNA. Those which
showed expression include K562, a cell line derived from a patient with
chronic myeloid leukemia in blast crisis, Molt4, a lymphoblastic leukemia
cell line, Raji, a Burkitt lymphoma cell line, SW480, a colorectal
adenocarcinoma cell line, A549, a lung carcinoma and G361, a melanoma
cell line. In addition, we could demonstrate that the gene was expressed in
the heart, brain, placenta, skeletal muscle and pancreas. It was also
observed that the Grb4 specific probe cross-hybridized to a smaller mRNA
species of approximately 2.1 kb which is most likely the mRNA encoding
Nek, the Grb4 homolog (McCarty, 1998) (Figure 22).
A polyclonal rabbit antibody raised against Grb4 recognizes a 47 kD
protein:
The pure form of the protein was isolated using an elution buffer (20
mM glutathione, 100 mM Tris (pH 8), 120 mM NaCl). A polyclonal rabbit
anti-sera against Grb4 was raised by injecting two milligrams of the pure
protein into the rabbit followed by three booster doses at Biogenes
GmbH, Berlin, Germany. The rabbit antibody was tested after purification
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Reproduced w ith permission o f th e copyright owner. Further reproduction prohibited without permission.
Figure 22: Northern analysis
2.6 kb^
A Northern analyses was performed using a P3 2 labeled Grb4 probe. As seen
above, Grb4 was ubiquitously expressed in a range of human tissues.In
addition, other human tissues and several cell lines were found to express
Grb4 (see text for list).
-j
W
Reproduced with permission o f th e copyright owner. Further reproduction prohibited without permission.
Figure 23: A polyclonal rabbit antibody specifically
recognizes Grb4
# / / * / /
Blot: aGrlvVF16 Blot: a Xprcss™
1 x 107 293 cells overexpressing Xpress™-tagged Grb4 were lysed and an Xpress™-
immunoprecipitation was performed. Bound proteins were resolved using SDS page and samples
were divided into half and anti-Xpress™ blotting or anti-Grb4 blotting was performed. The left
panel shows an anti-Grb4 western blot using the polyclonal serum from immunized rabbits, the
right panel shows an anti-Xpress™ western blot.
--j
Reproduced with permission o f th e copyright owner. Further reproduction prohibited without permission.
Figure 24: The Grb4 rabbit polyclonal antibody detects a 47
KD band on SDS electrophoresis of various cell lysates
2 x 107 cells of 293 (overexpressing Xpress™-tagged Grb4), Jurkat,
Mo7e, Mo7e/p210 and K562 cells were lysed and equal amounts of the
lysates were resolved on SDS-PAGE before Western blotting with the
Grb4 antibody. Native Grb4 is indicated by the arrow. Tagged Grb4
migrates slower (lane 1) than native Grb4.
Reproduced with permission o f th e copyright owner. Further reproduction prohibited without permission.
Figure 25: Experimental Schema for Immunoprecipitations
and Co-Immunoprecipitations.
1. Transfected 293 cells with Grb4 and /or BCR-Abl (wt/ts) using DOTAP.
2. Serum-deprived the cells for six hours before harvest.
3. Harvested cells after 48 hours and pellets were either frozen away for future use or
lysed in lysis buffer.
4. Lysates were spun down to get rid of cell debris.
5. Immunoprecipitations and co-immunoprecipitations were performed using either
an a-Grb4 antibody or a commercially available a -Xpress™ antibody or an a -Abl
antibody.
6. Protein-antibody complexes were run out on SDS-PAGE.
7. Western analyses were carried out using a secondary antibody: either a -Abl or an
a -phosphotyrosine/ a -Grb4/ a -Xpress™.
8. Nylon membranes were stripped, if necessary, for re-probing with a different
antibody.
~ - 4
O N
Reproduced with permission o f th e copyright owner. Further reproduction prohibited without permission.
Figure 26: The a-Grb4 polyclonal rabbit antibody immunoprecipitates
Grb4.
control Grb4 IP lysate
^ Grb4
2 x 107 293 cells were transfected with GrM using DOTAP. 48 hours after
transfection, cells were lysed and an immunoprecipitation was performed using the
rabbit polyclonal Grb4 antibody or a control rabbit antibody. Bound fractions were
run out on an SDS-polyacrylamide gel and a western blot was performed with the
Grb4 antibody.
-4
(see “Materials and Methods) for specificity in both western blotting and
immunoprecipitations. The antibody could, specifically detect Xpress™-
tagged Grb4 on western analysis (Figure 23). Specificity was comparable
to the anti-Xpress™ antibody. The antibody detected the denatured
protein efficiendy by western blotting in a variety of different cell lysates
like 293, a transformed primary embryonal kidney cell line, Jurkat, a T cell
line, Mo7E and Mo7E/p210, a megakaryoblastic cell line with and without
BCR-Abl and K562, a chronic myeloid leukemia cell line (Figure 24).
Endogenous Grb4 was also detected in LaMa, a chronic myeloid leukemia
cell line and in cells from patients with chronic myeloid leukemia (data not
shown). The polyclonal serum was also able to immunoprecipitate the
protein albeit with low efficiency (Figures 25 and 26).
The F I6 clone o f Grb4 hinds to BCR-Abl in a phosphotyrosine-
dependent manner:
The F16 clone of Grb4 was tested for binding to a temperature sensitive
BCR-Abl. ts-BCR-Abl carries a point mutation that renders its kinase
active at the permissive temperature of 32°C. The BCR-Abl kinase is
inactive at the restrictive temperature of 39 °C although some leakiness of
kinase activity has been observed. In a GST binding experiment using
GST Grb4/F16, it was seen that while F16/Grb4 bound very strongly to
BCR-Abl at the permissive temperature there was little or no binding at
the restrictive temperature of 39°C. This data emphasized that binding of
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Reproduced with permission o f th e copyright owner. Further reproduction prohibited without permission.
Figure 27: Grb4 binds to a temperature sensitive (ts) mutant of BCR-
Abl only at the permissive temperature indicating a phosphotyrosine-
dependent interaction.
ts BCR-Abl expressed in 293 cells
lysate
39°
Blot: a Abl
M BCR-Abl
1 x 106 293 cells were transiently transfected with ts-BCR-Abl using DOTAP. Cells
were harvested 48 hours after transfection. Cells were grown at either the permissive
(32°) or the restrictive (39°) temperature for 8 hours before the harvest, and a GST-
pulldown experiment was performed using 5 pg of GST or GST-Grb4/F16. GST-
Grb4/F16, however, interacted with BCR-Abl at only the permissive temperature
indicating a phosphotyrosine-dependent interaction.
V O
F16/Grb4 to BCR-Abl is dependent on an active BCR-Abl kinase (Figure
27).
The F16/Grb4 is a substrate o f the BCR-Abl kinase:
293 cells, a human kidney cell line, were transiently transfected with
F16/Grb4in the expression vector pcDNA3.1Neo (Invitrogen, Groningen,
The Netherlands). The BCR-Abl oncogene was co-expressed in these cells
and its expression was driven from the CMV promoter in the
pcDNA3.1Zeo vector. Forty eight hours after transfection, cells were
harvested in phosphate buffered saline (PBS) to which Na-orthovanadate
had been added to preserve phosphorylation of proteins by the inhibition
of phosphatases. The anti-Xpress™ antibody was used to
immunoprecipitate Grb4 which was tagged with the Xpress™ sequence.
After resolving the immunoprecipitated proteins on SDS-PAGE, western
blotting was performed with the polyclonal rabbit Grb4 antibody to
visualize Grb4, with the Abl antibody 8E9 to visualize BCR-Abl
(Pharmingen, Hamburg, Germany) and the PY20 antibody (Pharmingen,
Hamburg, Germany) to detect phospho-tyrosine (Duyster et al., 1995). As
seen in the adjoining figure, it was observed that Grb4/F16 was
phosphorylated when co-expressed with kinase-active BCR-Abl but not
at all or only marginally when co-expressed with the kinase-defective
BCR-Abl. These experiments indicated that Grb4/F16 co-precipitated with
the active BCR-Abl kinase and was a substrate (direct or indirect) of the
BCR-Abl kinase (Figure 28).
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Reproduced with permission o f th e copyright owner. Further reproduction prohibited without permission.
Figure 28:Grb4/F16 is a substrate of the BCR-Abl kinase
a-P Y blot
a-P Y blot
a-Grb4 blot
1 x 106 293 cells were co-transfected with either wild type BC R-A bl or the temperature sensitive
variant and Grb4/F16. C ells were grow n at 37° and those containing the temperature sensitive
mutant were shifted to the perm issive temperature, 32° or the restrictive temperature, 39° for
eight hours before harvest. C ells were lysed and a co-im m unoprecipitation experim ent was
performed using an antibody against Grb4. Bound fractions were resolved on SD S-P A G E and
im m unoblotted with a phosphotyrosine antibody (P Y 20) (upper tw o left hand panels) or an anti-
Grb4 antibody (low est left panel) or an anti-Abl antibody (8E9) (upper right hand panel which
was aligned with the upper left hand panel so that the distance at which B C R -A bl migrates can be
compared with the phosphorylated proteins migrating at the sam e level).
Grb4/F16 IP controls
00
Full-length Grb4 co-precipitates with BCR-Abl in transiently transfected
cells in a phosphotvrosine-independent interaction in 293 cells:
Full-length Grb4 and BCR-Abl, wild type and kinase defective, were
co-transfected into 293 cells and an anti-Xpress™ immunoprecipitation
was performed to isolate Grb4 and its interacting proteins. It was again
observed that Grb4 interacted with BCR-Abl however in contrast with
the character of the interaction of Grb4/F16 and BCR-Abl, this interaction
was constitutive and occured irrespective of the activity of the BCR-Abl
kinase. This data provided evidence that there are two interactions
responsible for the formation of the Grb4/BCR-Abl complex in vivo. One
of these interactions is clearly a phosphotyrosine dependent interaction
while the other is a phosphotyrosine independent interaction (Figure 29).
The SH2 domain o f Grb4 is sufficient for binding to BCR-Abl and to v-
Abl:
In a GST pulldown experiment with K562 lysates and in lysates of 293
cells which were transiently transfected with v-Abl it was seen that the
SH2 domain could mediate binding on its own to BCR-Abl and to v-Abl
and no additional sequences were required. The SIC domain binding is
much weaker than that mediated by the F16 clone suggesting that
additional sequences are required, perhaps to induce conformational
changes, for optimal binding (Figure 30).
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Figure 29: Complex formation of Grb4 and Bcr-Abl in transiently
transfected 293 cells
Control IPs a-Exp IPs
1 x 106293 cells were transfected with BCR-Abl (either wild type, kinase defective
or the temperature sensitive mutant) and Grb4. Cells were grown at 37° and those
containing the temperature sensitive m utant were shifted to 32 ° or 39° for eight
hours before harvest. Cells were harvested 48 hours following transfection. Cells
were lysed and the lysates w ere used in a co-immunoprecipitation experiment was
performed using an antibody against Grb4. Bound fractions were resolved on SDS-
PAGE and immunoblotted with a phosphotyrosine antibody (PY20) (two left hand
panels) or an anti-Grb4 antibody (lower right panel) or an anti-Abl antibody (8E9)
(upper right hand panel).
Binding characteristics o f the SH2 mutant o f Grb4:
In order to assess whether the binding of the SH2 domain occurred via
the FLVR motif of the SH2 domain or an independent PTB
(phosphotyrosine binding) motif, an SH2 mutant of Grb4 was constructed
as described in "Materials and Methods" using site-directed mutagenesis
to mutate the arginine in the FLVR motif to a lysine (Mayer et al., 1992).
The SH2 mutant of Grb4 did not bind v-Abl in a co-immunoprecipitation
experiment while wild type Grb4 bound very strongly to v-Abl indicating
that the phosphotyrosine dependent binding of Grb4 to BCR-Abl occurs
at an autophosphorylation site in Abl. However, very interestingly, the
Grb4 SH2 mutant whose phosphotyrosine binding to BCR-Abl is
abrogated bound as strongly as wild type Grb4 to a kinase-defective
BCR-Abl. In line with the v-Abl data, binding to wild type BCR-Abl was
stronger with wild type Grb4 than with the SH2 mutant. This indicated
that the phosphotyrosine-independent binding of Grb4 to BCR-Abl was
inhibited by phosphorylation of BCR-Abl. These data suggest a new
mode of regulation of SH2 and SH3 domains and their interactions and is
supported by other studies currently going on in our laboratory (Figures
31 and 32).
84
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Reproduced w ith permission o f th e copyright owner. Further reproduction prohibited without permission.
Figure 30: The SH2 domain of Grb4 can mediate binding to BCR-Abl and v-Abl
although strength of binding is weak.
A. B.
A. 1 x 107 cells K562 cells were lysed and cell lysates were bound to 5 fig of either GST or
GST-Grb4/SH2. The figure above shows a GST binding experiment using K562 lysates.
Bound fractions were run out on SDS-PAGE and western blot analyses was performed
using the Abl antibody, 8E9. B. 1 x 106 293 cells were transiently transfected with v-Abl
using a liposomal based transfection method. Cells were harvested 48 hours following
transfection and a GST binding experiment was performed using 5 fig of GST alone, GST-
Grb4/F16, GST-Grb4/SH2 and GST-vav, a protein identified to interact with BCR-Abl in
the yeast two-hybrid screen. Bound fractions were resolved on SDS-PAGE and western
blotting was performed using the Abl antibody, 8E9.
00
U l
Reproduced with permission o f th e copyright owner. Further reproduction prohibited without permission.
Figure 31: Binding of the Grb4 SH2 (FLVR) mutant to v-Abl is abrogated
A Grb4 (wl and mutant) expression level
1 x 106 293 cells were transiently transfected using a liposomal based
transfection method with v-Abl and either wt Grb4 or its SH2 mutant. A
Grb4 immunoprecipitation was performed and western blotting with the Abl
antibody, 8E9, was carried out.
o o
Os
Grb4 and Nek immunoprecipitate a distinct group o f proteins from RIP A
lysates o f K562 cells:
Grb4 and Nek are 68% homologous. The high homology between the
two proteins prompted us to examine the pattern of proteins complexed to
each. As described in the material and methods section, Far Western
analyses was performed on RIPA lysates of K562 cells (Feller et al., 1995).
The cold GST fusion proteins used for the binding assay included GST
alone, Grb4, Nek, Grb2, MONA, GRAP, Crk and CrkL. An S3 5 -labeled
GST-Grb4 fusion protein was used to probe the SDS-polyacrylamide gel
that the bound fraction was resolved on. As observed in figure 33, Grb4
and Nek bound to a similar range of proteins, as compared, for example, to
Grb2. However, there were distinct differences in both the range of
proteins that each of the proteins (Nek and Grb4) bound to as well as in
the strength of binding to the same proteins. Proteins bound by Grb4 and
either weakly or not at all by Nek are indicated by solid arrows.
Significantly, Grb4 bound very strongly to BCR-Abl when compared to
the binding by Nek. In addition, binding of Grb4 to BCR-Abl was
stronger than that of Grb2 to BCR-Abl. As forementioned, Grb2 is an
adapter protein with an important role in BCR-Abl mediated
transformation. The open arrows indicate proteins bound by both Grb4
and Nek while the solid circle indicates a protein bound solely by Grb4
and not by any of the other adapter proteins tested (Figure 33). Thus
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Reproduced w ith permission o f th e copyright owner. Further reproduction prohibited without permission.
Figure 32:The Grb4 SH2 mutant binds strongly to KD BCR-Abl indicating
regulation of SH3 binding by phosphorylation.
Controls Immunoprecipitations
1 x 1 $ 293 cells were transiently transfected with either WT or KD BCR-Abl and
WT Grb4 or the Grb SH2 mutant. 48 hours after transfection,cells were serum starved
and then harvested. Immunoprecipitations were performed using an antibody to Grb4.
Western blotting was done with the Abl 8E9 antibody.
00
00
despite their high overall similarity there are distinct differences in both
the specificity and strength with which Grb4 and Nek complex to proteins
in K562 lysates indicating a unique biological role for each protein. In line
with these data, when the phosphorylation of Grb4 was compared to that
of Nek when each of the proteins was co-transfected with BCR-Abl in
293 cells, it was observed that Grb4 was an excellent substrate of the
BCR-Abl kinase when compared to Nek (Figure 34).
Grb4 co-precipitates with HPK-1. the human progenitor cell kinase-1:
In a binding experiment on RIPA lysates of Mo7e cells, it was observed
that Grb4 precipitated with HPK-1, a kinase that is homologous to the
molecule GCKR (Figure 35). GCKR (Germinal Center Kinase Related) is a
serine-threonine kinase that links BCR-Abl and Ras to the Stress-
Activated Protein Kinase Pathway (Shi et al„ 1999). This association lent
support to the assumption that Grb4 might play a role in the regulation of
the JNK signaling pathway. It seemed logical therefore to examine the
effect of Grb4 expression on JNK activation: experiments to address this
were subsequently performed as discussed in the following sections.
89
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Reproduced with permission o f th e copyright owner. Further reproduction prohibited without permission.
Figure 33: Comparison of Grb4-binding proteins precipitated from K562 lysates by a
range of GST fusion proteins
o raciD -
precip.: OOZ O SO OO
1 ,
*» — • • 4 ^ (p2lOBer-Abl)
200— •
5 mg of total RIPA lysate of K562 cells was precipitated at 4°C overnight with 10 p.g of GST
or of various GST fusion proteins as indicated. Bound proteins were washed and resolved on
SDS-PAGE before being blotted, blocked and renatured at room temperature. The membrane
was then probed with S3 5 -GST-Grb4 for 4 hours at room temperature, rinsed three times for 10
minutes each with wash buffer and then completely dried. The dried membrane was analyzed
by phoshoimaging and subsequently by autoradiography. The solid arrows indicate proteins
bound strongly by GST-Grb4 and either weakly or not at all by Gst-Nck. The open arrow
indicates proteins that bind to both Gst-Grb4 and to Nek but show marginally stronger binding
to Grb4. The circle indicates proteins bound solely by Grb4 and by no other adapter protein
tested.
V O
O
Reproduced with permission o f th e copyright owner. Further reproduction prohibited without permission.
Figure 34: Grb4 is an excellent substrate of the BCR-Abl kinase in vivo
C O N TRO L
IPS
BCR-Abl -----
G rb4 IP NCR IP
a-PY blot
a-PY blot
a-Xpress™ blot
1 x 10^ 293 cells were transiently transfected with wt BCR-Abl and
either Grb4 or Nek which were Xpress™ tagged An Xpress™
immunoprecipitation was performed and bound fractions were resolved
on SDS-PAGE before performing western blotting with the anti-
phosphotyrosine antibody, PY20 (Pharmingen).
V O
Reproduced with permission o f th e copyright owner. Further reproduction prohibited without permission.
Figure 35: The human progenitor kinase 1 (HPK1) binds to Grb4 in Molt4 lysates
RIPA lysates of 1 x 10^ Molt4 cells and a GST binding experiment was performed with 5 pg of
GST alone or with GST-Grb4. Bound proteins were resolved on SDS-PAGE and western blotting
was then performed using a polyclonal rabbit antiserum to HPK1.
V O
N >
Ba/FS cells were not rendered IL-3-independent by Grb4:
Ba/F3 cells, a murine pro-B cell line which are IL-3 dependent are a
useful hematopoietic model to study the oncogenic potential of a gene.
The Ba/F3 cell line is rendered IL-3 independent with the expression of
oncogenes like BCR-Abl. Grb4 with or without BCR-Abl and BCR-Abl
alone were stably expressed in Ba/F3 cells and IL-3 was withdrawn to
select for IL-3 independent growth. However, while BCR-Abl induced IL-
3 independent growth as previously observed (Bai et al, 1998), Grb4
failed to induce the same and cells transfected with Grb4 did not survive
without IL-3 in the growth media. Furthermore, the concomitant
expression of Grb4 with BCR-Abl did not impede or accelerate the
development of growth factor independence (Figures 36 and 37). In line
with these results, Grb4 failed to induce anchorage-independent growth
in fibroblasts. Rat-1 BB cells, a rat fibroblast cell line, were transfected
with either the empty vector, pcDNA3.1Neo, with Grb4 or BCR-Abl. Cells
were selected in the appropriate antibiotic and then plated in soft agar
transformation assays, as described in "Materials and Methods" to assess
the ability of Grb4 to induce anchorage independent growth in fibroblasts
(Bai et al., 1998). It has been reported that Nek has the ability to
transform fibroblasts and it was expected that Grb4 would possess some
degree of this ability as well. However, as confirmed by other groups,
93
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Reproduced with permission o f th e copyright owner. Further reproduction prohibited without permission.
Figure 36: Identifying growth factor independence in Ba/F3
cells
1. BaF-3 cells, an IL-3 dependent lymphocytic cell line were
electroporated with Grb4 expression constructs.
2. Cells were selected in G418 for 2-3 weeks.
3. The selected pool of cells were subjected to IL-3
withdrawal.
4. Regular cell counts were performed to identify IL-3
independence along with trypan blue staining.
V O
Reproduced with permission o f th e copyright owner. Further reproduction prohibited without permission.
Figure 37: Growth of Ba/F3 cells expressing different constructs in the
presence and absence of IL-3
F16/G rb4 G rb4 BCR-Abl BCR-Abl &
Grb4
G row th of
Ba/F3 cells in
presence of
++ + +++ +++
IL.3
G row th of
Ba/F3 cells in
absence of IL J
• • +++ +++
V O
Grb4 did not cause any colonies in soft agar assays indicating that it is not
transforming on its own in this system. While transforming ability does
vary in different cell types, this data concurred with the lack of factor-
independent growth in Ba/F3 cells when Grb4 was expressed in them.
Effect o f Grb4 expression on different signaling pathways: JNK. Elkl.
CREB and A P I:
Nek and BCR-Abl were shown to activate the JNK signaling pathway
in a promoter activation assay when overexpressed in cells. Braverman and
Quilliam when reporting the identification of Grb4 also reported weak
activation of the Elkl signaling pathway when co-expressed with v-Abl
and SOS1. In addition, Abl kinases have been reported to activate the
CREB signaling pathway and there are reports of cross-talk between the
jun/fos/AP-1 pathways and the CREB signaling pathway. We decided to
test the ability of Grb4 to activate the JNK, Elkl and CREB signaling
pathways. The system used to detect the activation of the JNK, Elkl and
CREB signaling pathway used a unique fusion trans-activating plasmid
that expresses a fusion protein. The fusion protein is a trans-acting,
pathway-specific transcription factor (i.e., a fusion transctivator protein).
The fusion protein consists of the DNA binding domain of the yeast GAL4
(residues 1-147) fused to the activation domain of either the c-Jun, Elkl or
CREB transcriptional activators. The transcription activators c-Jun, Elkl
and CREB are phosphorylated and activated by c-Jun N-terminal kinase
96
of the copyright owner. Further reproduction prohibited without permission.
(JNK), mitogen-activated protein kinase (MAPK) or cyclic AMP-dependent
kinase (PKA) respectively and their activity reflects the in vivo activation
of these kinases and the corresponding signal transduction pathways
(Belsches et al., 1997; Bogoyevitch et a l, 1996; Burgess et al, 1998;
Denhardt, 1996; Liu et al., 1996; Raitano et al., 1995; Sassone-Corsi,
1998).
Grb4 and the specific luciferase reporter construct as well as a beta-
galactosidase reporter construct (to normalize for transfection efficiency)
were co-transfected into the following cell lines: 293, cos, Rat-1 or 3T3. 48
hours after transfection cells were harvested and lysates were measured for
luminescence. Results were normalized for transfection efficiency based on
the beta-galactosidase activity measured.
It was observed that none of the pathways - JNK, E lkl or CREB - were
activated by Grb4 expression in these cells (Figures 38, 40 and 41). In light
of the JNK activation by Nek, it was surprising that Grb4 failed to activate
this pathway given the high homology of the two proteins (Aspenstrom et
al., 1996; Stein et al., 1998). Therefore in an attempt to validate our data
showing lack of JNK activation by Grb4, kinase assays were performed as
described in "Materials and Methods" to ascertain if c-jun was
phosphorylated when Grb4 was over-expressed in 293 cells (Figure 39). It
was determined in more than four independent experiments that no
activation of the JNK signaling pathway was induced by Grb4 over-
expression. This was in contrast to MEKK, the positive control used in the
97
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Reproduced with permission o f th e copyright owner. Further reproduction prohibited without permission.
Figure 38: Grb4 expression did not activate the JNK signaling pathway
® Negative Positive Grb4 Neo
1 x 105 293 cells in 30 mm plates were transiently transfected with Grb4, a beta-galactosidase
Construct to normalize transfection efficiency and a construct for the expression of a fusion
transcription factor encoding the DNA activation domain of jun. The luciferase under the control
of the GAL4 promoter. Activation of jun resulted in the expression of luciferase. Cells were
serum starved for 12 hours before harvest and lysed before measuring luciferase activity. Results
are representative of at least three independent experiments.
V O
00
Reproduced with permission o f th e copyright owner. Further reproduction prohibited without permission.
Figure 39: Grb4 expression does not activate JNK
Studies using kinase assays.
1 x 105 293 cells were plated in 30 mm dishes and transiently transfected (DOTAP) with HA-tagged
JNK and either Grb4, MEKK, a known activator of JNK or BCR-Abl. Cells were harvested forty
eight hours after transfection following a six hour period of serum starvation. A JNK immuno-
precipitation was performed following which the bound fractions was resuspended in a 30 pi
volume in kinase buffer in the presence of 25 pM cold ATP to which 1 pi of y-P32-labeled ATP
(250 pCi /25 pi) had been added. Kinase reactions were performed for 20 minutes at 30°C.
Samples were resolved on SDS-PAGE and exposed to a film (Kodak).
V O
V O
Reproduced with permission o f th e copyright owner. Further reproduction prohibited without permission.
Figure 40: Grb4 expression did not activate the CREB signaling pathway
£ 70
| 60
\ 50
•| 40
f 30
I 20
I 10
I Negative PKA G rb4
1 x 105 293 cells in 30 mm plates were transiently transfected with Grb4, a beta-galactosidase
Construct to normalize transfection efficiency and a construct for the expression of a fusion
transcription factor encoding the DNA activation domain of CREB. The luciferase under the
control of the GAL4 promoter. Activation of CREB resulted in the expression of luciferase.
Cells were serum starved for 12 hours before harvest and lysed before measuring luciferase
activity. Results are representative of at least three independent experiments.
H -
8
Reproduced with permission o f th e copyright owner. Further reproduction prohibited without permission.
Figure 41: Grb4 expression did not activate the Elkl signaling pathway
1
t/i
2
I 3 > o
* 3
| 2,0
08
£
i 1,0
Negative MEK1 Grb4
1 x 105 293 cells in 30 mm plates were transiently transfected with Grb4, a beta-galactosidase
Construct to normalize transfection efficiency and a construct for the expression of a fusion
transcription factor encoding the DNA activation domain of E lkl. The luciferase under the control
of the GAL4 promoter. Activation of Elkl resulted in the expression of luciferase. Cells were
serum starved for 12 hours before harvest and lysed before measuring luciferase activity. Results
are representative of at least three independent experiments.
o
experiments, which activated JNK very strongly resulting in a high level of
c-Jun phosphorylation (Coso et al., 1995; Perez-Albueme et al., 1993).
Alongside these assays, AP-1 activation was examined using a reporter
construct with AP-1 sites upstream of the luciferase gene. It has been
shown that BCR-Abl itself can activate AP-1 at a low level and that v-Abl
is a strong activator of this signaling pathway. It was observed that while
Grb4 itself did not induce AP-1 activation it was a very potent inhibitor of
v-Abl-induced AP-1 activation. These results were consistently observed in
more than four independent experiments (Figure 42). Additionally, it was
observed that the minimal activation of the AP-1 activation pathway
induced by BCR-Abl was also inhibited by concomitant Grb4 expression.
Interestingly, Grb2 which was expressed as a control adapter protein in
these experiments, in sharp contrast to Grb4, augmented v-Abl-induced AP-
1 activation.
The level of v-Abl expression in every set of transfected cells was
determined and found to be equal. Thus, Grb4 is an inhibitor of Abl kinase-
induced pro-mitogenic pathways making it distinct from Nek which is
known to activate the JNK signaling pathways. It is likely that the role of
Grb4 in chronic myeloid leukemia is in the inhibition of apoptosis or
involves processes regulating cell adhesion (see discussion).
102
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Reproduced with permission o f th e copyright owner. Further reproduction prohibited without permission.
Figure 42: Grb4 expression resulted in a dramatic inhibition of v-Abl induced
AP-1 activation
To assess AP-1 activation, 1 x 105 293 cells were transiently transfected with
Grb4, beta-galactosidase and a luciferase expressing construct with the AP-1
site (7X) upstream of the luciferase gene. Cells were serum starved for 12 hours
before harvest and lysed before measuring luciferase activity. Results were
normalized for transfection efficiency using beta-galactosidase. Results are
representative of at least three independent experiments.
Intracellular localization o f Grb4:
A Grb4-EYFP fusion protein expression vector was constructed and
Grb4-EYFP was over-expressed in various cells including cos cells in
which Grb4-EYFP was best visualized due to the large, flat phenotype of
these cell (Baumann et al., 1998; Lybarger et al., 1998). Wild type BCR-
Abl and kinase edfective BCR-Abl co-localize with actin filaments as
previously shown by McWhirter et al. using immunofluorescence. In figure
43 A, B and C, BCR-Abl localization is represented by green, Grb4
localization is represented by red and co-localization of the two proteins is
represented by yellow. As can be seen in Figure A, left panel, wild type
BCR-Abl was pre-dominantly in juxtanuclear punctate aggregates which
probably contain F-actin with a fraction o f the wild type BCR-Abl staining
the stress fibers of the cytoskeleton. However, kinase-defective BCR-Abl
clearly localized to actin along the stress fibers of the cytoskeleton (Fig. 43
A middle panel). Both forms of BCR-Abl clearly did not localize to the
nucleus (43 A, left and middle panels). However, Grb4-EYFP localized both
to the nucleus and the cytoplasm of transiently transfected cos cells (right
panel, figure 43 A). When kinase defective BCR-Abl and Grb4 were co
expressed together in cos cells, the distribution of kinase defective BCR-
Abl did not change (figure 43C left panel) while Grb4 still remained in the
nucleus and the cytoplasm but showed distinct co-localization with BCR-
Abl in the cytoskeleton (Figure 43C, middle panel). In contrast, when Grb4
was co-expressed with wild type BCR-Abl, the distribution of BCR-Abl
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Reproduced with permission o f th e copyright owner. Further reproduction prohibited without permission.
Figure 43 A:Localization of wt or kd BCR-Abl and Grb4 alone in cells
WT-Bcr-Abl KD-Bcr-Abl Grb4
alone al°ne al°ne
Cos cells were plated on gelatin-coated Permanox chamber slides and transiently
transfected with Grb4-EYFP or wild type or kinase defective BCR-Abl-ECFP using
DOTAP. A day following transfection, cells were visualized using fluorescence
microscopy with the appropriate filters to detect the emission of the two proteins. Grb4
localization is represented with red, BCR-Abl is represented by green.
o
Figure 43 B: Co-localization wt BCR-Abl and Grb4 in cells
Bcr-Abl Grb4 overlay
WT-Bcr-Abl
+ Grb4
Cos cells were plated on gelatin-coated Permanox chamber slides and
transiently transfected with Grb4-EYFP and wild type BCR-Abl-ECFP using
DOTAP. A day following transfection, cells were visualized using fluorescence
microscopy with the appropriate filters to detect the emission of the two
proteins. Grb4 localization is represented with red, BCR-Abl is represented by
green and the co-localization of the two proteins is represented by yellow.
Figure 43 C:Co-localization kd BCR-Abl and Grb4 in cells
KD-Bcr-AbI
+ Grb4
Cos cells were plated on gelatin-coated Permanox chamber slides and transiently
transfected with Grb4-EYFP and kinase defective BCR-Abl-ECFP using DOTAP.
A day following transfection, cells were visualized using fluorescence microscopy
with the appropriate filters to detect the emission of the two proteins. Grb4
localization is represented with red, BCR-Abl is represented by green and the co-
localization of the two proteins is represented by yellow.
was altered (compare 43 B left panel to 43 A left panel) in that most of the
BCR-Abl appeared in punctate aggregates which were no longer pre
dominantly juxtanuclear and there was no wild type BCR-Abl visible along
the stress fibers of the cytoskeleton. While a significant amount of Grb4
remained in the nucleus, a major portion of the cytoplasmic Grb4 co
localized to the cytoskeleton with BCR-Abl (compare 43 B, middle panel
and 43A, right panel). The presence of Grb4 in the nucleus and the
cytoplasm to co-localize with BCR-Abl when the two proteins are co
expressed raises the possibility that Grb4 may be capable of modulating
and transmitting BCR-Abl induced signals from the cytoplasm to the
nucleus; this could occur in a single translocation step. The data showing
inhibition of v-Abl induced AP-1 activation does indeed demonstrate that
Grb4 interferes in nuclear signaling pathways activated by Abl family
kinases.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter Five
Discussion:
We established a modified yeast two-hybrid screen in our laboratory to
identify molecules that interact phosphotyrosine-dependently with BCR-
Abl (Bai e ta l, 1998; Weidner et a l, 1996) and which might play a role in
BCR-Abl mediated oncogenesis. Using this system, we identified several
known and novel interactions of BCR-Abl with target proteins (Bai et al.,
1998). In this dissertation, I describe the cloning of a novel adaptor protein,
Grb4, using a combination of the modified yeast two-hybrid screen and
RACE PCR (Frohman, 1994; Frohman et al., 1988), and the
characterization of its interaction with BCR-Abl. Grb4 had an overall
homology of 68% on the aminoacid level to Nek and like Nek consisted of
three SH3 and one SH2 domain with a homology of up to 90% within the
SH domains (Figure 8) (Li et al., 1992). Northern analyses of human tissue
mRNA blots showed that Grb4 was encoded by a 2.6 kilobase message
that was ubiquitously expressed. A rabbit polyclonal antibody raised to the
protein detected a 47 kilodalton protein that migrated at exactly the same
level as Nek. The antibody detected Grb4 very strongly on western
analyses and cross-reacted very weakly with Nek (data not shown). In
contrast to Nek, the SHE domain of Grb4 which shares a 72% homology
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
with Nek mediated a phosphotyrosine dependent interaction with BCR-
Abl in yeast, in vitro and in vivo. This interaction required an active BCR-
Abl kinase as shown by using a kinase-defective mutant of Bcr-Abl in
yeast and a temperature sensitive mutant of Bcr-Abl in vivo and led to the
phosphorylation of Grb4 indicating that Grb4 is a substrate of the Bcr-Abl
kinase. A second interacting clone of Grb4 was identified in the yeast two-
hybrid screen, F20/Grb4 which had additional N-terminal SH3 sequences
lacking in F16/Grb4. By virtue of these additional sequences, F20/Grb4 like
full length Grb4 interacted with BCR-Abl in a non-phosphotyrosine-
dependent manner in yeast, in vitro and in vivo. Grb4 was also shown to
interact with both BCR-Abl and Abl in the chronic myeloid leukemia cell
line K562. Thus, Grb4 contains two binding motifs for Bcr-Abl, one
phosphotyrosine dependent mediated by the SH2 domain and a second
phosphotyrosine independent mediated by N-terminal SH3 sequences.
Binding experiments with Bcr-Abl deletion mutants indicated that the
phosphotyrosine dependent binding to BCR-Abl occured at an
autophosphorylation site in the Abl portion of BCR-Abl. In line herewith a
Grb4 mutant lacking the 5’ SH3 domain bound strongly to v-Abl in
transiently transfected 293 cells. Thus Grb4 unlike any of the other known
BCR-Abl-interacting adapter proteins binds to an autophosphorylation site
in the Abl part of Bcr-Abl. This raises the interesting possibilitiy that Grb4 is
not only a potential mediator of Bcr-Abl-induced but also c-Abl, v-Abl or
Tel-Abl induced signals. Mapping studies are in progress in our laboratory
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
to define the exact phosphotyrosine residues responsible for mediating this
binding.
While the phosphotyrosine dependent binding of Grb4 to Bcr-Abl
already indicated a unique function of Grb4 distinguishing it from its
homologue Nek, we performed Far Western analyses on K562 lysates to
compare the binding profiles of both proteins. We showed that Nek and
Grb4 had distinct binding specificities. In addition, we determined that the
two proteins co-precipitated with an individual set of phosphorylated
proteins in 293 cells (data not shown) suggesting that Nek and Grb4 have
roles distinct from each other in various cell types.
Stein et al., reported that Nek is a central molecule linking EphBl
signaling to JNK (Stein et al., 1998). Nek also binds NEK, a Ste20-related
kinase which activates the SAPK/JNK cascade (Su et al., 1997; Su et al.,
1998). In addition Bcr-Abl has been shown to activate the JNK signaling
pathway (Burgess et al., 1998; Cortez et al., 1997; Raitano et al., 1995).
To test whether Grb4 is capable of activating the same pathway and
represents a potential link between Bcr-Abl and JNK activation we tested
the effect of Grb4 expression on JNK activation. Using luciferase reporter
assays with a fusion transcription factor containing the DNA binding
domain of Gal4 but the DNA activation domain of c-jun, we were unable to
demonstrate any JNK activation in several cell types tested. In addition,
JNK kinase assays showed no significant activation by the expression of
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Grb4. Thus, in addition to its distinct binding specificities, Grb4 does not
activate the same signaling pathways activated by Nek.
We examined AP-1 activation as both BCR-Abl and v-Abl are known to
activate this signaling pathway (Raitano et al., 1995) although the
activation by BCR-Abl is considerably weaker than that induced by v-Abl.
Very interestingly, we could demonstrate that concomitant Grb4 expression
consistently and dramatically inhibited v-Abl induced AP-1 activation.
Grb4 also inhibited the weaker AP-1 activation induced by BCR-Abl. Grb2
and GrblO which were included in this assay as control adapter proteins
did not show this inhibitory effect. Remarkably, Grb2, in stark contrast to
Grb4, augmented v-Abl induced AP-1 activation. These data suggest that
Grb4 is capable of inhibiting pro-mitogenic pathways. This is in contrast to
the data of Braverman and Quilliam reporting activation of the Elkl
signaling pathway when co-expressing both Grb2 and Grb4 with v-Abl
and SOS1 although the activation measured with Grb4 was very low (1.4
times activation) (Braverman and Quilliam, 1999). These differences may be
due to the reporter systems used or varying cell culture conditions.
However, Chen et al. demonstrated that Grb4 expression inhibited EGFR
and PDGFR stimulated DNA synthesis which is in keeping with our data
showing inhibition of v-Abl-induced AP-1 activation (Chen et al., 1998).
Chen et al. show that an SH2 domain mutant of Grb4 did not inhibit EGFR
and PDGFR stimulated DNA synthesis, suggesting that this effect is
mediated by the SH2 domain (Chen et al., 1998). In contrast, an SH2
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
mutant of Grb4 caused an even more pronounced inhibition of v-Abl
induced AP-1 activation implying that the inhibition of the AP-1 pathway is
an SH3 mediated response. It is likely that both the SH2 and the SH3
domains of Grb4 are involved in the inhibition of promitogenic signals.
Cellular localization studies indicate that Grb4 localizes to both the
nucleus and the cytoplasm and shows a significant fraction of cytoplasmic
Grb4 co-localizing with BCR-Abl to the cytoskeleton when the two
proteins are co-expressed. When expressed with kinase defective BCR-
Abl, a portion of the cytoplasmic pool of Grb4 co-localized with BCR-Abl
to the stress fibers of the cytoskeleton. However when co-expressed with
wt BCR-Abl, cytoplasmic Grb4, in an almost total translocation, co
localized with BCR-Abl in juxtanuclear punctate aggregates with what is
likely F-actin along the stress fibers of the cytoskeleton (McWhirter and
Wang, 1993). The presence of Grb4 in both the nucleus and the cytoplasm
suggests that this protein has a function in both compartments. Moreover,
it suggests that this protein might be a mediator, relaying specific signals
from the cytoplasm or the cytoskeleton to the nucleus in a single
translocation step. In the paper by Ti et al. describing Grb4 as a molecule
interacting with PINCH, a LIM only protein (Tu et al., 1999; Tu et al.,
1998), it was suggested that through its interaction with PINCH, Grb4 may
be linking growth factor receptor signaling pathways with integrin
signaling. PINCH is known to interact with integrin linked kinase, ILK (Tu
et al, 1999). Although the reciprocal translocation of chromosomes 9 and
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
22 are a hallmark of chronic myeloid leukemias (Bartram et al., 1983) and
despite many studies focusing on BCR-Abl, the chimeric oncogene which
results from the translocation, pathways regulating BCR-Abl mediated
oncogenesis are poorly understood (McWhirter and Wang, 1993).
Progenitor cells in chronic myeloid leukemia are known to have defects in
cell adhesion and recently accumulated evidence suggests that bcr-abl may
contribute to transformation not by promoting mitogenic signals but by the
inhibition of apoptotic signals and/or the dysregulation of adhesion signals
that regulate cell growth, differentiation and migration. Given that Grb4 co-
localizes with BCR-Abl in the cytoskeleton and the association of Grb4
with PINCH (which in turn interacts with integrin-interacting proteins like
ILK), it seems reasonable to speculate that Grb4 is a key mediator of BCR-
Abl-induced changes in cell adhesion linking the chimeric oncogene to
integrin signaling pathways. Alternately, and in contrast to the
forementioned hypotheses, the inhibition of Abl kinase induced AP-1
activation, make it possible that Grb4 expression contributes to the
indolent course of the CML disease by inhibiting pro-mitogenic pathways.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Bibliography
Abts, H, Jucker, M., Diehl, V., and Tesch, H. (1991). Human chronic
lymphocytic leukemia cells regularly express mRNAs of the
protooncogenes lck and c-fgr. Leuk Res 15, 987-97.
Anton, I. M., Lu, W., Mayer, B. J., Ramesh, N., and Geha, R. S. (1998). The
Wiskott-Aldrich syndrome protein-interacting protein (WIP) binds to the
adaptor protein Nek. J Biol Chem 273, 20992-5.
Aspenstrom, P., Lindberg, U., and Hall, A. (1996). Two GTPases, Cdc42
and Rac, bind directly to a protein implicated in the immunodeficiency
disorder Wiskott-Aldrich syndrome. Curr Biol 6, 70-5.
Bai, R., Dieter, P., Peschel, C., Morris, S., and Duyster, J. (1998). NPM-ALK
of large-cell anaplastic lymphoma is a constitutively active tyrosine kinase
utilizing PLC-gama to mediate its oncogenicity. Mol. Cell. Biol 18, 6951-
6961.
Bai, R., Jahn, T., Schrem, S., Munzert, G., Weidner, K., JYJ, W., and Duyster,
J. (1998). The SH2-containing adaptor protein GrblO interacts with Bcr-
Abl. Oncogene 17, 941-948.
Bartram, C. R., de Klein, A., Hagemeijer, A., van Agthoven, T„ van Kessel,
A. D., Bootsma, D., Grosveld, G., Ferguson-Smith, M. A., Davies, T., Stone,
M., Heisterkamp, N., Stephenson, J. R., and Groffen, J. (1983).
Translocation of c-Abl oncogene correlates with the presence of a
Philadelphia chromosome in chronic myelocytic leukemia. Nature 306,
277-280.
Baumann, C. T., Tim, C. S., and Hager, G. L. (1998). Simultaneous
visualization of the yellow and green forms of the green fluorescent
protein in living cells. J Histochem Cytochem 46, 1073-6.
Beaupre, D. M., and Kurzrock, R. (1999). RAS and leukemia: from basic
mechanisms to gene-directed therapy. J Clin Oncol 17, 1071-9.
115
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Behrens, J., von, K. J., Kuhl, M., Bruhn, L., Wedlich, D., Grosschedl, R., and
Birchmeier, W. (1996). Functional interaction of beta-catenin with the
transcription factor LEF-1. Nature 382, 638-642.
Belsches, A. P., Haskell, M. D., and Parsons, S. J. (1997). Role of c-Src
tyrosine kinase in EGF-induced mitogenesis. Front Biosci 2, d501-18.
Bergold, P. J., Blumenthal, J. A., D'Andrea, E., Snyder, H. W., Lederman, L.,
Silverstone, A., Nguyen, H, and Besmer, P. (1987). Nucleic acid sequence
and oncogenic properties of the HZ2 feline sarcoma virus v-abl insert. J
Virol 61, 1193-202.
Bergold, P. J., Wang, J. Y., Hardy, W. D., Jr., Littau, V _ , Johnson, E., and
Besmer, P. (1987). Structure and origins of the HZ2-feline sarcoma virus.
Virology 158, 320-9.
Bhat, A., Johnson, K. J., Oda, T., Corbin, A. S., and Druker, B. J. (1998).
Interactions of p62(dok) with p210(bcr-abl) and Bcr-Abl-associated
proteins. Journal Of Biological Chemistry 273, 32360-8.
Binet, J. L., Plunkett, W., Robertson, B., Merle-Beral, H., Mentz, F.,
Hoffbrand, A. V., and Panayiotidis, P. (1996). What does apoptosis mean in
CLL? Leuk Lymphoma 22 Suppl 2, 47-52.
Bogoyevitch, M. A., Gillespie-Brown, J., Ketterman, A. J., Fuller, S. J., Ben-
Levy, R., Ashworth, A., Marshall, C. J., and Sugden, P. H. (1996).
Stimulation of the stress-activated mitogen-activated protein kinase
subfamilies in perfused heart. p38/RK mitogen-activated protein kinases
and c-Jun N-terminal kinases are activated by ischemia/reperfusion. Circ
Res 79, 162-73.
Braverman, L. E., and Quilliam, L. A. (1999). Identification of
Grb4/Nckbeta, a src homology 2 and 3 domain- containing adapter
protein having similar binding and biological properties to Nek. J Biol
Chem 274, 5542-9.
Brickell, P. M. (1992). The p60c-src family of protein-tyrosine kinases:
structure, regulation, and function. Crit Rev Oncog 3, 401-46.
Broudy, V. C. (1997). Stem cell factor and hematopoiesis. Blood 90, 1345-
64.
Brunet, A. (1998). [Signal transduction from the membrane to the nucleus:
variations on common themes]. Bull Cancer 85, 527-37.
116
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Burgess, G. S., Williamson, E. A , Cripe, L. D„ Litz-Jackson, S., Bhatt, J. A,
Stanley, K, Stewart, M. J., Kraft, A. S., Nakshatri, H, and Boswell, H. S.
(1998). Regulation of the c-jun gene in p210 BCR-ABL transformed cells
corresponds with activity of JNK, the c-jun N-tenninal kinase. Blood 92,
2450-60.
Burnett, R. C., David, J. C., Harden, A. M., Le Beau, M. M., Rowley, J. D.,
and Diaz, M. O. (1991). The LCK gene is involved in the t(l;7)(p34;q34)
in the T-cell acute lymphoblastic leukemia derived cell line, HSB-2. Genes
Chromosomes Cancer 3 ,461-7.
Burnett, R. C., Thirman, M. J., Rowley, J. D., and Diaz, M. O. (1994).
Molecular analysis of the T-cell acute lymphoblastic leukemia- associated
t(l;7)(p34;q34) that fuses LCK and TCRB. Blood 84, 1232-6.
Chan, L. C., Karhi, K. K , Rayter, S. I., Heisterkamp, N., Eridani, S., Powles,
R., Lawler, S. D., Groffen, J., Foulkes, J. G., Greaves, M. F., and et, a. L
(1987). A novel abl protein expressed in Philadelphia chromosome
positive acute lymphoblastic leukaemia. Nature 325, 635-7.
Chen, M., She, H., Davis, E. M., Spicer, C. M., Kim, L., Ren, R., Le Beau, M.
M., and Li, W. (1998). Identification of Nek family genes, chromosomal
localization, expression, and signaling specificity. J Biol Chem 273, 25171-
8.
Cohen, G. B., Ren, R., and Baltimore, D. (1995). Modular binding domains
in signal transduction proteins. Cell 80, 237-48.
Cortez, D., Reuther, G., and Pendergast, A. M. (1997). The Bcr-Abl
tyrosine kinase activates mitogenic signaling pathways and stimulates Gl-
to-S phase transition in hematopoietic cells. Oncogene 15, 2333-42.
Coso, O. A., Chiariello, M., Kalinec, G., Kyriakis, J. M., Woodgett, J., and
Gutkind, J. S. (1995). Transforming G protein-coupled receptors potently
activate JNK (SAPK). Evidence for a divergence from the tyrosine kinase
signaling pathway. J Biol Chem 270, 5620-4.
Coulombel, L., Auffray, I., Gaugler, M. H , and Rosemblatt, M. (1997).
Expression and function of integrins on hematopoietic progenitor cells.
Acta Haematol 97,13-21.
Coulombel, L., Rosemblatt, M., Gaugler, M. H., Leroy, C., and Vainchenker,
W. (1992). Cell-cell matrix and cell-cell interactions during hematopoietic
differentiation. Bone Marrow Transplant 9, 19-22.
117
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Crocker, P. R., Morris, L., and Gordon, S. (1988). Novel cell surface
adhesion receptors involved in interactions between stromal macrophages
and haematopoietic cells. J Cell Sci Suppl 9, 185-206.
Dawid, I. B., Toyama, R., and Taira, M. (1995). LIM domain proteins. C R
Acad Sci TU 318, 295-306.
de Klein, A., van Kessel, A. D., Grosveld, C. R., Bartram, C. R., Hagemeijer,
A., Bootsma, D., Spurr, N. K , Heisterkamp, N., Groffen, J., and Stephenson,
J. R. (1982). A cellular oncogene is translocated to the Phidelphia
chromosome in chronic myelocytic leukaemia. Nature 300, 765-767.
Dean, D. C., Birkenmeier, T. M., Rosen, G. D., and Weintraub, S. J. (1991).
Glycoprotein synthesis and secretion. Expression of fibronectin and its
ceil surface receptors. Am Rev Respir Dis 144, S25-8.
Denhardt, D. T. (1996). Oncogene-initiated aberrant signaling engenders
the metastatic phenotype: synergistic transcription factor interactions are
targets for cancer therapy. Crit Rev Oncog 7, 261-91.
Deschamps, J., and Meijlink, F. (1992). Mammalian homeobox genes in
normal development and neoplasia. Crit Rev Oncog 3, 111-13.
Diekmann, D., Brill, S., Garrett, M. D., Totty, N., Hsuan, J., Monfries, C., Hall,
C., Lim, L., and Hall, A. (1991). Bcr encodes a GTPase-activating protein
for p21rac. Nature 351, 400-2.
Dumas, R., Lebrun, M., and Douce, R. (1991). Isolation, characterization
and sequence analysis of a full-length cDNA clone encoding
acetohydroxy acid reductoisomerase from spinach chloroplasts. Biochem
J 277, 469-75.
Duyster, J., Baskaran, R., and Wang, J. Y. J. (1995). Catalytic role for the
SH2 Domain of Abl tyrosine kinase. Proc Natl Acad Sci USA 92, 1555-
1559.
Eilers, M. (1999). Control of cell proliferation by Myc family genes. Mol
Cells 9,1-6.
Feller, S. M., Knudsen, B., and Hanafusa, H. (1994). c-Abl kinase regulates
the protein binding activity of c-Crk. Embo J 13, 2341-51.
Feller, S. M., Knudsen, B., and Hanafusa, H. (1995). Cellular proteins
binding to the first Src homology 3 (SH3) domain of the proto-oncogene
118
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
product c-Crk indicate Crk-specific signaling pathways. Oncogene 10,
1465-73.
Feller, S. M., Knudsen, B., Wong, T. W., and Hanafusa, EL (1995).
Detection of SH3-binding proteins in total cell lysates with glutathione S-
transferase-SH3 fusion proteins: SH3 blot assay. Methods Enzymol 255,
369-78.
Feller, S. M., Posem, G., Voss, J., Kardinal, C., Sakkab, D., Zheng, J., and
Knudsen, B. S. (1998). Physiological signals and oncogenesis mediated
through Crk family adapter proteins. Journal Of Cellular Physiology 177
http://www.biomednet.com/db/medline/99190628, 535-52.
Feller, S. M., Ren, R., Hanafusa, H., and Baltimore, D. (1994). SH2 and SH3
domains as molecular adhesives: the interactions of Crk and Abl. Trends
Biochem Sci 19, 453-458.
Frantz, J. D., Giorgetti, P. S., Ottinger, E. A., and Shoelson, S. E. (1997).
Human GRB-IRbeta/GRB 10. Splice variants of an insulin and growth
factor receptor-binding protein with PH and SH2 domains. J Biol Chem
272, 2659-67.
Franz, W. M., Berger, P., and Wang, J. Y. (1989). Deletion of an N-terminal
regulatory domain of the c-abl tyrosine kinase activates its oncogenic
potential. Embo J 8, 137-47.
Frohman, M. A. (1994). On beyond classic RACE (rapid amplification of
cDNA ends). PCR Methods Appl 4, S40-58.
Frohman, M. A., Dush, M. fC, and Martin, G. R. (1988). Rapid production
of full-length cDNAs from rare transcripts: amplification using a single
gene-specific oligonucleotide primer. Proc Natl Acad Sci U S A < S 5 , 8998-
9002.
Gilmore, T. D. (1992). Role of rel family genes in normal and malignant
lymphoid cell growth. Cancer Surv 15, 69-87.
Goff, S. P., Gilboa, E., Witte, O. N., and Baltimore, D. (1980). Structure of
the Abelson murine leukemia virus genome and the homologous cellular
gene: studies with cloned viral DNA. Cell 22, 777-85.
Goff, S. P., Tabin, C., Wang, J. Y. J., Weinberg, R., and Baltimore, D. (1982).
Transfection of fibroblasts with clone Abelson Murine Leukemia
Virus DNA and recovery of transmissible virus by recombination with
helper vims. J. Virol. 41, 271-285.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Goga, A., McLaughlin, J., Afar, D. E., Saffian, D. C., and Witte, O. N.
(1995). Alternative signals to RAS for hematopoietic transformation by
the BCR- ABL oncogene. Cell 82, 981-988.
Green, A. R., and Begley, C. G. (1992). SCL and related hemopoietic helix-
loop-helix transcription factors. Int J Cell Cloning 10, 269-76.
Groffen, J., Stephenson, J. R., Heisterkamp, N., de Klein, A., Bartram, C. R.,
and Grosveld, G. (1984). Philadelphia chromosomal breakpoints are
clustered within a limited region, bcr, on chromosome 22. Cell 36, 93-99.
Gubler, U., and Hoffman, B. J. (1983). A simple and very efficient method
for generating cDNA libraries. Gene 25, 263-9.
Hapel, A. J., and Young, I. G. (1987). Abnormal expression of interleukin-3
and leukaemia. Anticancer Res 7, 661-7.
Harvey, R. J., and Darlison, M. G. (1991). Random-primed cDNA synthesis
facilitates the isolation of multiple 5 - cDNA ends by RACE. Nucleic Acids
Res 19, 4002.
Heisterkamp, N., Stam, K., Groffen, J., de Klein, A., and Grosveld, G. (1985).
Structural organization of the bcr gene and its role in the Phi
translocation. Nature 315, 758-761.
Heisterkamp, N., Stephenson, J. R., Groffen, J., Hansen, P. F., de Klein, A.,
Bartram, C. R., and Grosveld, G. (1983). Localization of the c-abl
oncogene adjacent to a translocation break point in chronic myelocytic
leukaemia. Nature 315.
Hemler, M. E. (1988). Adhesive protein receptors on hematopoietic cells.
Immunol Today 9, 109-13.
Hermans, A., Heisterkamp, N., vonLindem, M., van Baal, S., Meijer, D., van
der Plas, D., Wiedemann, L. M., Groffen, J., Bootsma, D., and Grosveld, G.
(1987). Unique fusion of bcr and c-abl genes in Philadelphia
chromosome-positive acute lymphoblastic leukemia. Cell 51, 33-40.
Ihle, J. N., Morishita, K, Bartholomew, C., Matsugi, T., and Askew, D.
(1990). Phenotypes and mechanisms in the transformation of
hematopoietic cells. Int J Cell Cloning 8 Suppl 1, 130-46.
120
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Ikawa, Y. (1997). Pathogenesis of Friend leukemia virus. Leukemia 11
Suppl 3, 152-4.
Jackson, A. L., and Loeb, L. A. (1998). On the origin of multiple mutations
in human cancers. Semin Cancer Biol 8 ,421-9.
Jackson, P., and Baltimore, D. (1989). N-terminal mutations activate the
leukemogenic potential of the myristoylated form of c-Abl. EMBO 8, 449-
456.
Kefalas, P., Brown, T. R., and Brickell, P. M. (1995). Signalling by the
p60c-src family of protein-tyrosine kinases. Int J Biochem Cell Biol 27,
551-63.
Kipreos, E. T., and Wang, J. Y. J. (1992). Cell cycle-regulated binding of c-
Abl tyrosine kinase to DNA. Science 256, 382-385.
Kipreos, E. T., and Wang, J. Y. J. (1990). Differential phosphorylation of c-
Abl in cell cycle determined by cdc2 kinase and phosphatase activity.
Science 248, 217-220.
Klein, G. (1995). The extracellular matrix of the hematopoietic
microenvironment. Experientia 51, 914-26.
Kurzrock, R., Gutterman, J. U., and Talpaz, M. (1988). The molecular
genetics of Philadelphia chromosome-positive leukemias. N Engl J Med
319, 990-8.
Li, S., Daria, R. L., Million, R. P., Daley, G. Q., and Van Etten, R. A. (1999).
The P190, P210, and P230 forms of the BCR/ABL oncogene induce a
similar chronic myeloid leukemia-like syndrome in mice but have different
lymphoid leukemogenic activity [In Process Citation]. J Exp Med 189,
1399-412.
Li, W., Hu, P., Skolnik, E. Y., Ullrich, A., and Schlessinger, J. (1992). The
SH2 and SH3 domain-containing Nek protein is oncogenic and a common
target for phosphorylation by different surface receptors. Mol Cell Biol
12, 5824-33.
Liu, L., Damen, J. E., Cutler, R. L., and Krystal, G. (1994). Multiple
cytokines stimulate the binding of a common 145-kilodalton protein to
She at the Grb2 recognition site of She. Mol Cell Biol 14, 6926-35.
121
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Liu, Z. G., Baskaran, R., Lea, C. E., Wood, L. D., Chen, Y., Karin, M., and
Wang, J. Y. (1996). Three distinct signalling responses by murine
fibroblasts to genotoxic stress [see comments]. Nature 384, 273-6.
Lopingco, M. C., and Perkins, A. S. (1996). Molecular analysis of Evil, a
zinc finger oncogene involved in myeloid leukemia. Curr Top Microbiol
Immunol 211,211-22.
Lowenstein, E. J., Daly, R. J., Batzer, A. G., li, W., Margolis, B., Lammers,
R., Ullrich, A., Skolnik, E. Y., Bar, S. D., and Schlessinger, J. (1992). The
SH2 and SH3 domain-containing protein GRB2 links receptor tyrosine
kinases to ras signaling. Cell 70,431-42.
Lugo, T. G., Pendergast, A. M., Muller, A. J., and Witte, O. N. (1990).
Tyrosine kinase activity and transformation potency of bcr-abl oncogene
products. Science 247, 1079-82.
Lybarger, L., Dempsey, D., Patterson, G. H , Piston, D. W., Kain, S. R., and
Chervenak, R. (1998). Dual-color flow cytometric detection of fluorescent
proteins using single-laser (488-nm) excitation. Cytometry 31, 147-52.
Margolis, B., Silvennoinen, O., Comoglio, F., Roonprapunt, C., Skolnik, E.,
Ullrich, A., and Schlessinger, J. (1992). High-efficiency expression/cloning
of epidermal growth factor-receptor- binding proteins with Src homology
2 domains. Proc Natl Acad Sci U S A 89, 8894-8.
Mara, Y., and Witte, O. N. (1991). The BCR gene encodes a novel
serine/threonine kinase activity within a single exon. Cell 67, 459-68.
Mayer, B. J., and Baltimore, D. (1994). Mutagenic analysis of the roles of
SIC and SH3 domains in regulation of the Abl tyrosine kinase. Mol Cell
Biol 14, 2883-94.
Mayer, B. J., Jackson, P. K., Van Etten, R. A., and Baltimore, D. (1992).
Point mutations in the abl SIC domain coordinately impair
phosphotyrosine binding in vitro and transforming activity in vivo. Mol
Cell Biol 12,609-18.
McCarty, J. H. (1998). The Nek SH2/SH3 adaptor protein: a regulator of
multiple intracellular signal transduction events. Bioessays 20, 913-21.
McWhirter, J. R., and Wang, J. Y. J. (1993). An actin-binding function
contributes to transformation by the Bcr-Abl oncoprotein of Philadelphia
chromosome-positive human leukemias. Embo J. 12, 1533-1546.
122
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
McWhirter, J. R., and Wang, J. Y. J. (1991). Activation of tyrosine kinase
and microfilament-binding functions of c-Abl by Bcr sequences in Bcr/Abl
fusion proteins. Mol. Cell. Biol. 11, 1553-1565.
Merino, J. J., and Cordero-Campana, M. I. (1998). [Molecular bases of the
programmed cell death process: implications of tumor suppressor protein
p53 and other proteins in the control of cell cycle. Mechanisms of
apoptotic action. Review]. Invest Clin 39, 323-58.
Muller, A. J., Young, J. C., Pendergast, A. M., Pondel, M., Landau, N. R.,
Littman, D. R., and Witte, O. N. (1991). BCR first exon sequences
specifically activate the BCR/ABL tyrosine kinase oncogene of
Philadelphia chromosome-positive human leukemias. Mol Cell Biol 11,
1785-92.
Musacchio, A., Gibson, T., Rice, P., Thompson, J., and Saraste, M. (1993).
The PH domain: a common piece in the structural patchwork of signalling
proteins. Trends Biochem Sci 18, 343-8.
Nichols, G. L., Raines, M. A., Vera, J. C., Lacomis, L., Tempst, P., and Golde,
D. W. (1994). Identification of CRKL as the constitutively
phosphorylated 39-kD tyrosine phosphoprotein in chronic myelogenous
leukemia cells. Blood 84, 2912-8.
Oda, T., Heaney, C., Hagopian, J. R., Okuda, K., Griffin, J. D., and Druker, B.
J. (1994). Crkl is the major tyrosine-phosphorylated protein in neutrophils
from patients with chronic myelogenous leukemia. J Biol Chem 269,
22925-22928.
Ogawa, W., Matozaki, T., and Kasuga, M. (1998). Role of binding proteins
to IRS-1 in insulin signalling. Mol Cell Biochem 182, 13-22.
Ogura, K., Tsuchiya, S., Terasawa, H., Yuzawa, S., Hatanaka, H , Mandiyan,
Vn Schlessinger, J., and Inagaki, F. (1999). Solution Structure of the SH2
Domain of Grb2 Complexed with the She- derived Phosphotyrosine-
containing Peptide. J Mol Biol 289, 439-445.
Pasternak, G., Hochhaus, A., Schultheis, B., and Hehlmann, R. (1998).
Chronic myelogenous leukemia: molecular and cellular aspects. J Cancer
Res Clin Oncol 124, 643-60.
Pawson, T. (1995). Protein modules and signalling networks. Nature 373,
573-80.
123
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Pawson, T. (1994). Tyrosine kinase signalling pathways. Princess
Takamatsu Symp 24, 303-22.
Pawson, T., and Schlessinger, J. (1993). SH2 and SH3 domains. Curr. Biol.
3, 434-442.
Pawson, T., and Scott, J. D. (1997). Signaling through scaffold, anchoring,
and adaptor proteins. Science 278, 2075-80.
Pendergast, A. M., Gishizky, M. L., Havlik, M. K , and Witte, O. N. (1993).
SHI domain autophosphorylation of P210 BCR/ABL is required for
transformation but not growth factor independence. Mol Cell Biol 13,
1728-36.
Pendergast, A. M., Muller, A. J., Havlik, M. H , Clark, R., McCormick, F.,
and Witte, O. N. (1991). Evidence for regulation of the human ABL
tyrosine kinase by a cellular inhibitor. Proc Natl Acad Sci U S A 88, 5927-
31.
Pendergast, A. M., Quilliam, L. A., Cripe, L. D., Bassing, C. H., Dai, Z., Li, N.,
Batzer, A., Rabun, K. M., Der, C. J., Schlessinger, J., and Gishizky, M. L.
(1993). BCR-ABL-induced oncogenesis is mediated by direct interaction
with the SH2 domain of the GRB-2 adaptor protein. Cell 75, 175-185.
Pendergast, A. M., Traugh, J. A., and Witte, O. N. (1987). Normal cellule*
and transformation-associated abl proteins share common sites for protein
kinase C phosphorylation. Mol Cell Biol 7, 4280-9.
Perez-Albueme, E. D., Schatteman, G., Sanders, L. K., and Nathans, D.
(1993). Transcriptional regulatory elements downstream of the JunB gene.
Proc Nad Acad Sci U S A 9 0 ,11960-4.
Posem, G., Zheng, J., Knudsen, B. S., Kardinal, C., Muller, K. B., Voss, J.,
Shishido, T., Cowbum, D., Cheng, G., Wang, B., Kruh, G. D., Burrell, S. K L ,
Jacobson, C. A., Lenz, D. M., Zamborelli, T. J., Adermann, K., Hanafusa, E L ,
and Feller, S. M. (1998). Development of highly selective SH3 binding
peptides for Crk and CRKL which disrupt Crk-complexes with
DOCK180, SoS and C3G. Oncogene 16, 1903-12.
Puil, L., Liu, J., Gish, G., Mbamalu, G., Bowtell, D., Pelicci, P. G., Arlinghaus,
R., and Pawson, T. (1994). Bcr-Abl oncoproteins bind direcdy to
activators of the Ras signalling pathway. Embo J. 13, 764-773.
124
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Raitano, A. B., Halpem, J. R., Hambuch, T. M., and Sawyers, C. L. (1995).
The Bcr-Abl leukemia oncogene activates Jun kinase and requires Jun for
transformation. Proc Natl Acad Sci U S A 92,11746-11750.
Reed, J. C. (1995). Regulation of apoptosis by bcl-2 family proteins and its
role in cancer and chemoresistance. Curr Opin Oncol 7, 541-6.
Ren, R., Ye, Z.-S., and Baltimore, D. (1994). Abl protein-tyrosine kinase
selects the Crk adapter as a substrate using SH3-binding sites. Genes &
Dev. 8, 783-795.
Rivero-Lezcano, O. M., Marcilla, A., Sameshima, J. H., and Robbins, K. C.
(1995). Wiskott-Aldrich syndrome protein physically associates with Nek
through Src homology 3 domains. Mol Cell Biol 75, 5725-31.
Ruscetti, S. K., Janesch, N. J., Chakraborti, A., Sawyer, S. T., and Hankins,
W. D. (1990). Friend spleen focus-forming virus induces factor
independence in an erythropoietin-dependent erythroleukemia cell line. J
Virol 64, 1057-62.
Saha, V., Chaplin, T., Gregorini, A., Ayton, P., and Young, B. D. (1995). The
leukemia-associated-protein (LAP) domain, a cysteine-rich motif, is present
in a wide range of proteins, including MLL, AF10, and MLLT6 proteins.
Proc Natl Acad Sci U S A 92, 9737-41.
Sakurai, M. (1986). [Chromosome translocations and cellular oncogenes in
hematologic neoplasms]. Gan To Kagaku Ryoho 13, 652-60.
Salgia, R., Uemura, N., Okuda, K., Ii, J. L., Pisick, E., Sattler, M., de, J. R.,
Druker, B., Heisterkamp, N., Chen, L. B., and et, a. 1 . (1995). CRKL links
p210BCR/ABL with paxillin in chronic myelogenous leukemia cells. J
Biol Chem 270, 29145-29150.
Sassone-Corsi, P. (1998). Coupling gene expression to cAMP signalling:
role of CREB and CREM. Int J Biochem Cell Biol 30, 27-38.
Schaefer, B. C. (1995). Revolutions in rapid amplification of cDNA ends:
new strategies for polymerase chain reaction cloning of full-length cDNA
ends. Anal Biochem 227, 255-73.
Shannon, K. (1995). The Ras signaling pathway and the molecular basis of
myeloid leukemogenesis. Curr Opin Hematol 2, 305-8.
of the copyright owner. Further reproduction prohibited without permission.
Shapiro, D. N., Valentine, V., Eagle, L , Yin, X., Moms, S. W., and
Prochownik, E. V. (1994). Assignment of the human MAD and MXI1
genes to chromosomes 2pl2-pl3 and 10q24-q25. Genomics 23, 282-5.
Shi, C. S., Tuscano, J. M., Witte, O. N., and Kehrl, J. H. (1999). GCKR links
the Bcr-Abl oncogene and Ras to the stress-activated protein kinase
pathway. Blood 93, 1338-45.
Simpson, A. J., and Camargo, A. A. (1998). Evolution and the inevitability
of human cancer. Semin Cancer Biol 8, 439-45.
Smith, D. B., and Johnson, K. S. (1988). Single-step purification of
polypeptide expressed in Escheria coli as fusions with glutathione-S-
transferase. Gene 67, 31-40.
Solary, E., Bertrand, R., and Pommier, Y. (1994). Apoptosis induced by
DNA topoisomerase I and II inhibitors in human leukemic HL-60 cells.
Leuk Lymphoma 15, 21-32.
Stein, E., Huynh-Do, U., Lane, A. A., Cerretti, D. P., and Daniel, T. O.
(1998). Nek recruitment to Eph receptor, EphB 1/ELK, couples ligand
activation to c-Jun kinase. J Biol Chem 273, 1303-8.
Su, Y. C., Han, J., Xu, S., Cobb, M., and Skolnik, E. Y. (1997). NIK is a new
Ste20-related kinase that binds NCK and MEKK1 and activates the
SAPK/JNK cascade via a conserved regulatory domain. Embo J 16, 1279-
90.
Su, Y. C., Treisman, J. E., and Skolnik, E. Y. (1998). The Drosophila Ste20-
related kinase misshapen is required for embryonic dorsal closure and acts
through a JNK MAPK module on an evolutionarily conserved signaling
pathway. Genes Dev 12, 2371-80.
Tan, E. C., Leung, T., Manser, E., and Lim, L. (1993). The human active
breakpoint cluster region-related gene encodes a brain protein with
homology to guanine nucleotide exchange proteins and GTPase-
activating proteins. J Biol Chem 268, 27291-8.
Tauchi, T., Boswell, H. S., Leibowitz, D., and Broxmeyer, H. E. (1994).
Coupling between p210bcr-abl and She and Grb2 adaptor proteins in
hematopoietic cells permits growth factor receptor-independent link to ras
activation pathway. Journal of Experimental Medicine 179, 167-175.
Timmons, M. S., and Witte, O. N. (1989). Structural characterization of the
BCR gene product. Oncogene 4, 559-67.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Toyoshima, fC, Yamanashi, Y., Inoue, K., Semba, K , Y amamoto., T., and
Akiyama, T. (1992). Protein tyrosine kinases belonging to the src family.
Ciba Found Symp 164, 240-8.
Tu, Y., Li, F., Goicoechea, S., and Wu, C. (1999). The LIM-only protein
PINCH directly interacts with integrin-linked kinase and is recruited to
integrin-rich sites in spreading cells. Mol Cell Biol 19, 2425-34.
Tu, Y., Li, F., and Wu, C. (1998). Nck-2, a novel Src homology2/3-
containing adaptor protein that interacts with the LIM-only protein
PINCH and components of growth factor receptor kinase-signaling
pathways. Mol Biol Cell 9, 3367-82.
Upadhyaya, G., Guba, S. C., Sih, S. A., Feinberg, A. P., Talpaz, M.,
Kantaijian, H. M., Deisseroth, A. B., and Emerson, S. G. (1991). Interferon-
alpha restores the deficient expression of the cytoadhesion molecule
lymphocyte function antigen-3 by chronic myelogenous leukemia
progenitor cells. J Clin Invest 88, 2131-6.
Van Etten, R. A., Jackson, P., and Baltimore, D. (1989). The mouse type IV
c-abl gene product is a nuclear protein, and activation of transforming
ability is associated with cytoplasmic localization. Cell 58, 669-678.
Van Etten, R. A., Jackson, P. K., Baltimore, D., Sanders, M. C., Matsudaira,
P. T., and Janmey, P. A. (1994). The COOH terminus of the c-Abl tyrosine
kinase contains distinct F- and G-actin binding domains with bundling
activity [published erratum appears in J Cell Biol 1994 Mar; 124(5):865]. J
Cell Biol 124, 325-40.
Verfaillie, C. M., Hurley, R., Zhao, R. C., Prosper, F., Delforge, M., and
Bhatia, R. (1997). Pathophysiology of CML: do defects in integrin
function contribute to the premature circulation and massive expansion of
the BCR/ABL positive clone? J Lab Clin Med 129, 584-91.
Villeval, J. L., Pelicci, P. G., Tabilio, A., Titeux, M., Henri, A., Houesche, F.,
Thomopoulos, P., Vainchenker, W., Garbaz, M., Rochant, H., Breton-
Gorius, J., Edwards, P. A. W., and Testa, U. (1983). Erythroid properties of
K562 ceUs. Exp. Cell Res. 428-435.
Wang, J. Y. J. (1993). Abl tyrosine kinase in signal transduction and cell-
cycle regulation. Curr. Opin. Genet. Dev. 3, 35-43.
127
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Wang, J. Y. J., Ledley, F., Goff, S., Lee, R., Groner, Y., and Baltimore, D.
(1984). The mouse c-abl locus: Molecular cloning and characterization.
Cell 36, 349-356.
Weidner, K. M., Di, C. S., Sachs, M., Brinkmann, V., Behrens, J., and
Birchmeier, W. (1996). Interaction between Gabl and the c-Met receptor
tyrosine kinase is responsible for epithelial morphogenesis. Nature 384,
173-6.
Wetzler, M., Talpaz, M., Van Etten, R. A., Hirsh-Ginsberg, C., Beran, M.,
and Kurzrock, R. (1993). Subcellular localization of Bcr, Abl, and Bcr-Abl
proteins in normal and leukemic cells and correlation of expression with
myeloid differentiation. J Clin Invest 92, 1925-39.
Wright, D. D., Sefton, B. M., and Kamps, M. P. (1994). Oncogenic
activation of the Lck protein accompanies translocation of the LCK gene
in the human HSB2 T-cell leukemia. Mol Cell Biol 14, 2429-37.
Wu, H. K, Heng, H. H., Siderovski, D. P., Dong, W. F., Okuno, Y„ Shi, X.
M., Tsui, L. C., and Minden, M. D. (1996). Identification of a human LIM-
Hox gene, hLH-2, aberrantly expressed in chronic myelogenous leukaemia
and located on 9q33-34.1. Oncogene 12, 1205-12.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.

Linked assets

University of Southern California Dissertations and Theses

Conceptually similar

PDF

Immunogenicity of acute lymphoblastic leukemia: In vivo and in vitro studies of Bcr -Abl specific immune responses

PDF

A new model for hepatitis delta virus transcription and replication

PDF

Functional analysis of MSX2 and its role in skull patterning

PDF

Cloning, characterization, anti -apoptotic molecular mechanism, transgenic and protein binding studies of mouse TOSO gene

PDF

Identification of oncogenes cooperating in murine mammary tumorigenesis and transgenic mouse models of breast cancer

PDF

Expression of the RGR opsin and its function in the photic visual cycle

PDF

Development of novel adenovirus-retroelement vectors and their applications beyond gene therapy

PDF

Identification and cloning of developmentally regulated genetic loci in transgenic mice by screening for novel expression pattern of the lacZ reporter gene

PDF

Cellular factors involved in mouse hepatitis virus replication

PDF

Characterization of new factors involved in feline leukemia virus (FELV)-mediated leukemogenesis

PDF

Discovery of a novel role of vasopressin in astrocytes: Vasopressin-induced cytoplasmic and nuclear calcium and kinases signaling cascade and modulation of astrocytes immune function

PDF

A novel candidate ovarian cancer and melanoma tumor suppressor gene on chromosome 6q24.3

PDF

The interactions of host cell proteins with mouse hepatitis virus RNA

PDF

Characterization of the physiological ligand and function of a novel opsin RGR from the retinal pigment epithelium

PDF

Biochemical characterization of hydrogen,potassium-ATPase-rich membranes from the gastric parietal cell

PDF

Identifying hematopoietic stem cell proliferation genes for bone marrow transplantation

PDF

Glutathione reduction and its effects on mitochondrial function and protein degradation: Implications for Parkinson's disease

PDF

Essays on regulation of public utilities and the provision of public goods

PDF

Characterization of zebularine: A novel inhibitor of DNA methylation with clinical potential

PDF

Inhibition of cancer invasion and metastasis: Mechanistic analysis of contortrostatin function at the molecular and cellular levels

Asset Metadata

Creator Coutinho, Sunita Patricia Ann (author)

Core Title Cloning and characterization of Grb4: A novel adapter protein interacting with BCR -Abl

School Graduate School

Degree Doctor of Philosophy

Degree Program Molecular Microbiology and Immunology

Publisher University of Southern California (original), University of Southern California. Libraries (digital)

Tag biology, genetics,biology, molecular,OAI-PMH Harvest

Language English

Contributor Digitized by ProQuest (provenance)

Advisor Kohn, Donald B. (committee chair), [illegible] (committee member)

Permanent Link (DOI) https://doi.org/10.25549/usctheses-c16-74949

Unique identifier UC11337800

Identifier 3018068.pdf (filename),usctheses-c16-74949 (legacy record id)

Legacy Identifier 3018068.pdf

Dmrecord 74949

Document Type Dissertation

Rights Coutinho, Sunita Patricia Ann

Type texts

Source University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Access Conditions The author retains rights to his/her dissertation, thesis or other graduate work according to U.S. copyright law. Electronic access is being provided by the USC Libraries in agreement with the au...

Repository Name University of Southern California Digital Library

Repository Location USC Digital Library, University of Southern California, University Park Campus, Los Angeles, California 90089, USA