Characterization of new factors involved in feline leukemia virus (FELV)-mediated leukemogenesis

PDF

Download

Open document

Flip pages

Download a page range

Download transcript

Copy asset link

Request this asset

Request accessible transcript

Transcript (if available)

Content INFORMATION TO U SER S
This manuscript h as been reproduced from the microfilm master. UMI films
the text directly from the original or copy submitted. Thus, som e thesis and
dissertation copies are in typewriter face, while others may be from any type of
computer printer.
The quality o f this reproduction is dependent upon the quality o f the
copy submitted. Broken or indistinct print, colored or poor quality illustrations
and photographs, print bleedthrough, substandard margins, and improper
alignment can adversely affect reproduction..
In the unlikely event that the author did not send UMI a complete manuscript
and there are missing pages, these wiil be noted. Also, if unauthorized
copyright material had to be removed, a note will indicate the deletion.
Oversize m aterials (e.g., maps, drawings, charts) are reproduced by
sectioning the original, beginning at the upper left-hand comer and continuing
from left to right in equal sections with small overlaps.
Photographs included in the original manuscript have been reproduced
xerographically in this copy. Higher quality 6” x 9" black and white
photographic prints are available for any photographs or illustrations appearing
in this copy for an additional charge. Contact UMI directly to order.
ProQ uest Information and Learning
300 North Zeeb Road, Ann Arbor, Ml 48106-1346 USA
800-521-0600
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
CHARACTERIZATION OF NEW FACTORS INVOLVED IN
FELINE LEUKEMIA VIRUS (FELV)-MEDIATED
LEUKEMOGENESIS
Copyright 2000
by
Yan Shi Zhao
A Dissertation Presented to the
FACULTY OF THE GRADUATE SCHOOL
UNIVERSITY OF SOUTHERN CALIFORNIA
In Partial Fulfillment o f the
Requirements for the Degree
DOCTOR OF PHILOSOPHY
(PATHOLOGY)
May 2000
Yan Shi Zhao
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
UM I Number: 3018048
___ ®
UMI
UMI Microform 3018048
Copyright 2001 by Bell & Howell Information and Learning Company.
All rights reserved. This microform edition is protected against
unauthorized copying under Title 17, United States Code.
Bell & Howell Information and Learning Company
300 North Zeeb Road
P.O. Box 1346
Ann Arbor, Ml 48106-1346
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
UNIVERSITY OF SOUTHERN CALIFORNIA
THE GRADUATE SCHOOL
UNIVERSITY PARK
LOS ANGELES. CALIFORNIA 90007
This dissertation, written by
under the direction of Jl.sj. Dissertation
Committee, and approved by all its members,
has been presented to and accepted by The
Graduate School, in partial fulfillment of re
quirements for the degree of
DOCTOR OF PHILOSOPHY
Yan S h i Zhao
Dean of Graduate Studies
D ate Max...;,.. 2000.
Chairperson
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
TABLE OF CONTENTS
LIST OF FIGURES.................................................................................................................iv
ABSTRACT.............................................................................................................................. vi
CHAPTER 1
INTRODUCTION..................................................................................................................... I
B a c k g r o u n d .............................................................................................................. 1
F eL V p a t h o g e n e s is ............................................................................................... 5
H y p o t h e s is a n d r a t io n a l ...............................................................................11
CHAPTER 2
A NOVEL TRUNCATED EN V GENE ISOLATED FROM A FELV-INDUCED
THYMIC LYMPHOSARCOMA.............................................................. 13
A b s t r a c t .................................................................................................................. 13
In t r o d u c t io n ......................................................................................................... 14
M a t e r ia l s a n d M e t h o d s ................................................................................ 15
D is c u s s io n ............................................................................................................... 34
CHAPTER 3
DIVERSE SELECTIVE PRESSURES MAY DETERMINE PRO VIRAL LONG
TERMINAL REPEAT NUMBERS........................... 38
A b s t r a c t ..................................................................................................................38
In t r o d u c t io n .........................................................................................................39
M a t e r ia l s a n d m e t h o d s .................................................................................40
R e s u l t s ..................................................................................................................... 4 4
D is c u s s io n ............................................................................................................... 57
CHAPTER 4
A COMMON PROVIRAL INTEGRATION SITE, CIT-1, IN FELINE LEUKEMIA
VIRUS INDUCED THYMIC LYMPHOSARCOMA...........................61
A b s t r a c t ..................................................................................................................61
In t r o d u c t io n .........................................................................................................77
M a t e r ia l s a n d M e t h o d s ................................................................................79
ii
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
R e s u l t s ...................................................................................................................... 6 6
D is c u s s io n ................................................................................................................ 80
CHAPTER 5
CONCLUSIONS AND FUTURE DIRECTIONS............................................................. 83
C o n c l u s io n s ............................................................................................................ 83
F u t u r e d ir e c t io n s ................................................................................................87
REFERENCES........................................................................................................................109
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
LIST OF FIGURES
Figure 1. Outlilne structure of the FeLV LTR with coordinates based on FeLV-
A/Glasgow-1........................................................................................................................8
Figure 2. Detection of deleted env species in lymphosarcomas in cats inoculated with
FeLV-A proviral DNA...................................................................................................... 22
Figure 3. Nucleotide and deduced amino acid sequence o f tercv.......................................... 24
Figure 4. Morphological changes in Raji cells induced by tenv expression.......................27
Figure 5. MTT assay of Raji cells infected with the tenv virus............................................29
Figure 6. TUNEL assay o f Raji cells infected with the Xenv virus....................................... 31
Figure 7. Detection of tenv gene expression in the original tumor tissue........................... 32
Figure 8. Cytotoxicity of te«v-expressing CEM cells to Raji and H927 cells....................33
Figure 9. Detection of de novo generated alterations in FeLV proviral LTRs in thymic
lymphosarcomas.................................................................................................................46
Figure 10. PCR analysis of LTR species in tissue specimens of buffy coat, bone marrow,
and the tumor from cat 5025.............................................................................................47
Figure 11. Comparison of nucleotide sequence of the cat 5025 tumor-derived proviral
LTRs with that of pFRA LTR..........................................................................................49
Figure 12. Relative luciferase gene activity directed by LTRs with different number of
enhancer repeats.................................................................................................................51
Figure 13. Relative luciferase gene activity directed by the SV40 promoter and LTR with
different number of enhancer repeats..............................................................................54
Figure 14. Relative luciferase gene activity directed by the SV40 promoter and LTR with
different number of enhancer repeats..............................................................................55
Figure 15. Southern analysis performed with Kpnl-P^I fragment o f FRA-LTR as the
probe....................................................................................................................................56
Figure 16. Schematic representation o f clone A5 and strategy o f subcloning into pBS
vector...................................................................................................................................69
Figure 17. Structure of the cloned proviral L T R ...................................................................70
iv
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Figure 18. Southern blot analysis of the common proviral integration site in T-cell tumors
.............................................................................................................................................73
Figure 19. Isolation of transcribed sequence from cit-1 locus by exon trapping................74
Figure 20. Detection of the cit- 1 transcripts in feline cell lines by Northern blot analysis
.............................................................................................................................................78
Figure 21. Detection of gene rearrangement around cit- 1 locus in FL-74 cells................. 79
Table 1. Susceptibility of various cell lines to tenv cytotoxicity......................................... 28
v
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
CHAPTER 1
INTRODUCTION
Background
Feline leukemia viruses (FeLV) are naturally occurring, contagiously transmitted
type C retroviruses in domestic cats that possess only the viral genes 5'-gag-pol-env-3 ’
necessary for replication (Hardy, 1993). Observations that FeLV is an infectious and
exogenous agent (Brodey et al., 1970; Hardy et al., 1973) provided the first evidence that
horizontally transmitted retroviruses were the causative pathogens for leukemia in nature.
Since its isolation in Scotland in 1964 (Jarrett et al., 1964), research on FeLV laid much
o f the groundwork for the discovery of human retroviruses. FeLV was the first retrovirus
that was shown not only oncogenic, but also a causative agent for degenerative disorders
such as aplastic anemia and immunosuppressive diseases that resemble today's human
AIDS (Anderson et al., 1971). Studies of'virus-negative' leukemia of cats and cows
helped the development of the concepts and techniques that led to the isolation of the first
human pathogenic retrovirus, the human T-lymphotropic virus (HTLV) (Poiesz et al.,
1980). One reason that understanding of FeLV pathogenesis is so important for obtaining
insights into human retroviral pathogenesis is because of the similarity between the two
populations (human and cat) that both are outbred species. Most questions that can not be
addressed in the murine leukemia virus (MuLV) system, which deals with an inbred
laboratory mouse strains, can be logically better pursued through FeLV studies.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Epidemiology
Epidemiological studies of FeLV have shown that almost half o f the cats are
infected with FeLV during their lifetime (Hardy et al., 1976; Roy-Burman, 1996).
Twenty eight percent FeLV exposed cats become persistently infected, and their life span
is dramatically shortened by the infection (Hardy, 1990). In a prospective study, it is
estimated that about 83% pet cats will die within 3.5 years after the diagnosis o f FeLV
infection compared to only 16% FeLV uninfected cats living in the same household
(Hardy, 1993; Roy-Burman, 1996). Most death is related to degenerative diseases
(anemia or immunodeficiency). The development o f lymphoma-leukemia complex is
responsible for 10% mortality in the persistently infected cats, of which T-cell
lymphosarcoma is the most common form (Hardy, 1993; Roy-Burman, 1996). The
primary route for viral transmission is reported to be saliva (Hardy et al., 1969; Rojko et
al., 1979).
FeL V subgroups
Replication competent FeLV isolates are classified into three subgroups, termed
FeLV subgroup A (FeLV-A), FeLV-B, and FeLV-C based on the viral interference and
neutralization assays (Sarma and Log, 1971; Sarnia and Log, 1973). Cell surface receptor
usage is determined by individual envelope (env) protein presented on the viral particle.
Viruses from different subgroups recognize distinct receptors for viral entry into cells.
However, interference to superinfection by viruses of the same subgroup will happen
because o f the occupation of receptors by the env proteins expressed from the resident
proviruses. Therefore, this classification reflects the genetic sequence variation in the
2
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
viral env gene and recognition of three distinct host cell receptors by FeLV (Roy-
Burman, 1996).
FeLV-A is the most prevalent form o f FeLV and has been found in 100% of
infected cats either alone or in combination with FeLV-B and/or FeLV-C. It is an
ecotropic virus whose host range is restricted to cat cells (Hardy et al., 1976; Jarrett and
Russell, 1978). Earlier studies on the FeLV-A isolates have shown that they are generally
o f low pathogenicity. However, recent experiments using a new FeLV-A molecular clone
and the prototype clone indicate that they could be more pathogenic and recombinegenic
than first speculated (Chen et al., 1998; Phipps et al., manuscript).
FeLV-B virus is polytropic retrovirus with the widest host range, including
replication in cat, dog, mink, and in human cells. It is found in approximately 40-50%
field isolates together with FeLV-A. However, they are over-represented in more than
60% of leukemic cats (Hardy et al., 1976; Jarrett et al., 1973; Jarrett and Russell, 1978;
Sarma et al., 1975). Their dependence on FeLV-A for in vivo propagation appears not
simply due to the requirement for replication because FeLV-B can often grow alone in
cultured feline fibroblastic cells (Neil et al., 1991;Bechtel et al., 1999; Sheets et al.,
1992). It has been speculated that FeLV-B arises by recombination between FeLV-A and
endogenous FeLV env elements (enFeLV) based on a series of observations: (I) sequence
analysis of FeLV-B env genes revealed that the FeLV-B 5’ env domain showed the
closest homology to the endogenous env elements but not with FeLV-A (Kumar et al.,
1989); (II) DNA hybridization probes representing the most divergent region of the env
genes of FeLV-A and FeLV-B, provided evidence that FeLV-B viruses 5’ portion of env
contain sequences related to enFeLV viruses (Elder and Mullins, 1983); (III) direct
3
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
sequence comparison o f FeLV-A, FeLV-B, and enFeLV suggested the recombination
process (Kumar et al., 1989). Finally, our recent report has provided a conclusive proof
for this hypothesis where intradermal introduction of the FeLV-A molecular clone FRA,
into newborn cats in the form of plasmid DNA, generated recombinant FeLV-B viruses
in vivo (Chen et al., 1998).
FeLV-C occurs rarely in pet cats (< 1%) in association with FeLV-A or FeLV-A
plus FeLV-B. FeLV-C exhibits polytropic host range and it is believed to arise from the
mutations in the FeLV-A env region based on the sequence analysis(Hardy et al., 1976;
Jarrett and Russell, 1978; Luciw et al., 1985; Riedel et al., 1986). Several lines of
evidence indicated a strong correlation between the presence o f subgroup C viruses and
acute hypoplasia of erythroid cells, that is, (i) FeLV-C variants are invariably isolated
from the anemic cats; (ii) the same kind of disease was able to be reproduced by
inoculation of several independent FeLV-C isolates (Hoover et al., 1974; Mackey et al.,
1975; Onions et al., 1982; (Mathes et al., 1994).
Endogenous FeLV Sequences
In addition to the exogenous FeLVs, there are approximately 15 copies of
endogenous FeLV (enFeLV) sequences per haploid genome of the domestic cat arranged
as discrete elements in a nontandem fashion (Roy-Burman, 1996). Compared to the
exogenous FeLV sequence, enFeLV elements retain several critical features such as
primer binding site, packaging signal, and leader sequences (Berry et al., 1988). The open
reading frames inpol and env genes but not in gag are intact (Kumar et al., 1989; Pandey
et al., 1991). Even though some full-length enFeLV sequences exist, they can not be
induced as infectious viruses (Benveniste et al., 1975; Soe et al., 1985). A major
4
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
difference is defined within long terminal repeat (LTR) U3 region, which is used to
distinguish exogenous FeLV proviruses from enFeLV sequences (Casey et al., 1981; Soe
et al., 1983; Berry et al., 1988). Transcription studies of 5’ enFeLV LTRs demonstrate
the presence of promoter and enhancer functions . However, the variable activities
resulting from the influence o f negative c/s-acting cellular sequences indicate a tight
regulation o f enFeLV expression through host cell genome via enFeLV LTRs (Berry et
al., 1988; Roy-Burman, 1996). Another distinguishing feature of interest is manifested by
scattered amino acid substitutions or deletions in enFeLV env gene (Soe et al., 1985;
Kumar et al.; Bechtel et al., 1999), which play an important role in generating FeLV-B
subgroup viruses.
FeLV pathogenesis
As mentioned above, FeLVs are simple retroviruses that induce a variety of
diseases in domestic cats. The multiple genetic events that are involved in FeLV
pathogenesis include generation of env variants, sequence amplifications within the LTR
enhancer region, and interactions between the host genome and retroviral genetic
elements, such as insertional mutagenesis.
FeLV env variation
Difference within proviral env genes is an important element in defining viral host
tropism and probably disease outcomes. The role o f the env gene in oncogenesis was
originally suggested by the isolation of mink cell focus-forming (MCF) viruses (Hartley
et al., 1977; Hiai et al., 1977), which are the recombinants between infectious MuLVs
and endogenous MuLV env and LTR sequences. Direct testing of the oncogenic potential
5
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
o f the envelope recombinants confirmed that MCF viruses were indeed causative agents
in induction o f thymic lymphosarcomas in AKR mice (Stoye et al., 1991).
Considered as a feline analogue of MCF, FeLV-B viruses display structural
similarity to MCF. As mentioned earlier, FeLV-B is a recombinant between FeLV-A and
enFeLV sequences. The 5' recombination sites usually reside in the highly conserved
region around pol-env junction, whereas the 3' crossover sites are confined within a
preferred stretch o f the SU sequence (Pandey et al., 1995; Sheets et al., 1993; Sheets et
al., 1992; Bechtel et al., 1998). Examination of sera from cats with thymic lymphomas
demonstrated FeLV-B like recombinant env genes with greater amount of endogenously
derived sequences predominate in the env population in the later stage of infection
(Bechtel et al., 1999; Chen et al., 1998). These observations imply that sequence
exchange with enFeLV env confers growth advantage to the recombinant FeLVs and
those with longer env substitutions are selected during viral proliferation possibly due to
differential cell receptor usage or preference.
Several mechanisms may be used by FeLV-B to induce diseases. First, FeLV-B
with recombinant env gene may circumvent superinfection resistance by FeLV-A.
Introduction o f viral elements into cells by superinfection may consequently increase the
chance of proviral insertional mutagenesis (Sheets et al., 1993; Tsatsanis et al., 1994).
Secondly, FeLV-B harboring some o f the enFeLV sequence may be able to elude the host
immune response, as implied by a cyclical pattern for FeLV-A viruses versus a consistent
level of recombinant FeLV RNA in the sera of cats coinfected with FeLV-A and FeLV-B
viruses (Pandey et al., 1995). Thirdly, recombinant FeLV glycoproteins or their variants
may have an independent effect on cell proliferation, blastogenesis, or cytopathicity, as
6
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
suggested by protection o f cells from cytopathic FeLV infection by an abnormally
processed recombinant env product (Bechtel et al., 1994). Lastly, recombinant FeLVs
having an expanded or altered cell tropism may be able to help establish FeLV-A
infection in the target cells by pseudotyping or other uncharacterized mechanisms
(Pandey et al., 1995; Sheets et al., 1993).
Analysis o f the env variant profile in the experimentally or naturally infected cats
that died of thymic lymphomas identified clusters of viruses that had point mutations,
insertions, and deletions in addition to those with recombinations. In particular, defective
env variants were prominent in T-cell tumors indicating a role for truncated subgroup A-
like env gene products in FeLV-induced tumors (Rohn et al., 1994; Sheets et al., 1993).
FeLV LTR variation
Proviral long terminal repeat sequence is the non-coding region containing
transcription promoter and enhancer motifs. The structure of the FeLV LTR is outlined in
Fig. 1. A comparison of mammalian type C retroviruses for the LTR sequences revealed
the central enhancer motifs are the highly conserved sections (Golemis et al., 1990),
which include nuclear factors LvB binding site (LvB) (Speck and Baltimore, 1987), core
enhancer binding site (core) (Speck and Baltimore, 1987), nuclear factor 1 (NF-1)
binding site, and a glucocorticoid response element (GRE) (Miksicek et al., 1986).
Studies o f the conserved sequences may allow us to identify regions that may be critical
for viral viability. Studies o f the variable regions may help to characterize the unique
features o f each virus and their biological functions.
FeLV proviral LTRs with enhancer repeats, predominantly enhancer duplication
and triplication, are detected in the majority of FeLV-induced T-cell tumor DNAs. No
7
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
F igure 1 . O utline structure o f th e F e L V L T R w ith coordinates b a se d o n FeLV-A/Glasgow-1 (Steweart e t al. 1986). A S discussed in
th e text, prim ary T-cell tum or isolates a n d h ig h ly leukemogenic variants o f F e L V frequently h a v e duplications o f th e L T R enhancer
core, including a cluster o f h ig h ly conserved binding sites fo r felin e nuclear protein. O n ly th e L v B /S V v o re cluster i s present i n a ll of
th e direct repeats.
defined boundary is found among the individual enhancer repeat, however, they all
encompass the core region (Fulton et al., 1990; Matsumoto et al., 1992). The duplications
are similar to those that are found in murine leukemia viruses, which demonstrate
accelerated leukaemogenic potential (Holland et al., 1989; Li et al., 1987). These
observations lead to the hypothesis that duplication of the enhancer may increase LTR
potency. Therefore, by driving viral transcription to higher levels, viruses with duplicated
enhancers will outgrow those without duplications. However, functional assays of LTR
activity using various reporter genes show only modest increases in activity resulting
from the duplications (Plumb et al., 1991).
A unique sequence m otif o f 21 bp that is 25 bp downstream o f the transcriptional
enhancer in the long terminal repeat is frequently found triplicated in tandem in an
unusual set of naturally occurring tumors. These are multicentric lymphosarcomas
containing non-T-cell and non-B-cell. Studies have shown that the triplication-containing
LTR provides transcriptional enhancer function to the LTR and is able to substitute at
least in part for the duplication o f the enhancer. The selective enhancer activity in a
primitive hematopoitic cell suggests that the 21 bp triplication may be one factor in the
induction o f tumors o f a particular phenotype, perhaps through transcriptional regulation
of the virus (Athas et al., 1995b). However, a recombinant retrovirus in which the U3
region of moloney MuLV is replaced by the U3 containing the 21 bp triplicates induces
tumors only of T-cell origin (Starkey et al., 1998). It indicates that the presence of this
unique motif is not enough to redirect the tumorigenic spectrum o f viruses.
Proviral LTRs containing 40 to 70 bp direct repeats in the upstream region of the
enhancer (URE) are reported to be frequently isolated from feline acute myeloid
9
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
leukemias. The repetitive URE sequence demonstrates an enhancer activity in myeloid
cells suggesting the URE region may contain sequences that is associated with
tumorigenic potential of FeLV in myeloid cells (Nishigaki et al., 1997).
Insertional mutaeenesis
Proviral insertion into host genome is a natural step in the viral replication cycle.
Once integrated, the strong transcriptional promoter/enhancer elements in the LTR may
provide retroviruses with a potent capability to activate host gene expression. Rare
circumstances have been described in which insertional inactivation of cellular genes
occurred through inactivating mutations (Rotter et al., 1984; Wolf and Rotter, 1984). In
contrast, most examples demonstrate that proviral integration resulted in the
overexpression o f proto-oncogenes that contribute to the neoplastic transformation.
Altered processing or stability of transcripts has been reported to have a role in this
process. However, aberrant transcription is generally involved in the majority of cases.
Two mechanisms have been proposed (Tsichlis and Lazo, 1991): (i) promoter insertion
where the transcription of proto-oncogene is initiated in the 3' or 5' proviral LTR; or (ii)
enhancer insertion where insertion may introduce enhancer effects on a nearby cellular
promoter. Study o f proviral insertional mutagenesis has identified a number o f new
proto-oncogenes and provided insight into oncogenesis and the normal pathways of
cellular growth and differentiation.
A few proviral integration sites have been cloned from FeLV positive naturally
occurring or experimentally induced tumors. The c-myc gene is frequently targeted by
FeLV insertion or transduction in about 32% o f field studies. Inoculation o f myc-
transducing viruses into neonatal cats is able to reproduce thymic lymphosarcomas very
10
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
rapidly demonstrating the causal relationship between the myc gene product and thym ic,
tumor formation (Levy et al., 1984; Neil et al., 1984; Tsatsanis et al., 1994). Proviral
integration is also common in the other two genetic loci that have been identified in
tumors induced by FeLV-myc viruses. One of them is flvi-2 that is interrupted by FeLV in
about 24% tumors examined (Levy and Lobelle-Rich, 1992; Levy et al., 1993b; Tsatsanis
et al., 1994). Flvi-2 encodes a feline homologue of bmi-1 gene, which is a myc
collaborator and represents a novel nuclear protein family with characteristic helix-tum
and zinc finger motifs (Haupt et al., 1991; Levy et al., 1993a; van Lohuizen et al., 1991).
The second common integration site by FeLV is fit-l, which is mapped to the
chromosome B2 with unknown coding potential (Tsujimoto et al., 1993). From a less
common form of lymphosarcoma isolated from spleen, another tumor-specific FeLV
insertion site,_/7v/-l, has been cloned. However, no coding sequence has been identified
within this locus (Levesque et al., 1990).
Hypothesis and rational
As described earlier, proviral LTR duplication and variations in env gene play
important roles in FeLV tumorigenesis. However, observations of these changes were
made in the naturally occurring tumors or experimental tumors that were induced by viral
inocula harvested from the viral producing cell culture. The uncertainty of the
composition o f the original inocula used in these studies left concerns as to whether the
documented changes in proviral elements actually came from contaminants in the virus
mixture. Recently, our lab developed a new molecular model where FeLV-A viruses
were introduced into neonatal cats in the form of plasmid DNA (Chen et al., 1998). The
11
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
purity o f inoculum in this system is not questionable. Documentation o f viral variants
using this model system will clarify the origin o f those changes. In the context of
insertional mutagenesis, little has been done on the other FeLV integration sites so far.
Overall, c-myc, flvi-1, flvi-2, and fit-1 only account for the insertional mutagenesis by
FeLV in less than half of the tumors. It will be necessary to study the genetic loci targeted
by FeLV in the remaining half.
Therefore, the goal of the work described herein was to study multiple parameters
in FeLV pathogenesis. The specific aims were: (i) to determine the in vivo generation of
env variants in the new model system and to study their biological functions; (ii) to
examine LTR variations in the new system and to compare their transcriptional functions
in vitro; (iii) to identify and characterize new FeLV integration sites in the remaining half
of the tumors.
12
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
CHAPTER 2
A NOVEL TRUNCATED env GENE ISOLATED FROM A FELV-INDUCED
THYMIC LYMPHOSARCOMA
Abstract
We PCR amplified the exogenous feline leukemia virus (FeLV)-related env gene
species from lymphosarcomas induced by intradermally administered plasmid DNA of
either the prototype FeLV, subgroup A molecular clone, F6A, or a new molecular clone,
FeLV-A, Rickard strain (FRA). O f the nine tumors examined, six showed presence of
deleted env species o f variable sizes in the tumor DNA. One env mutant, which was
detected in a FRA induced thymic lymphosarcoma, had a large internal deletion
beginning from almost the N-terminal surface glycoprotein (SU) up to the mid region of
the transmembrane (TM) protein o f the env gene. The deduced polypeptide o f this
truncated env (tenv) retained the complete signal peptide and seven amino acids o f the N-
terminal mature SU of FRA env gene, followed by eight amino acids from a frameshift in
the TM region. To study the biological function o f tenv, we used a murine retrovirus
vector to produce amphotropic virions. Infection o f feline fibroblasts (H927), human
fibrosarcoma cells (HT1080), or human B-lymphoma cells (Raji) led to pronounced
cytotoxicity, while the tenv virus did not induce significant cytotoxicity to feline T-
lymphoma cells (3201B) or human T-lymphoma cells (CEM). Together, these results
convincingly demonstrated that the genetic events that led to truncation in the env gene
occurred de novo in FeLV lymphomagenesis and that such a product, tenv could induce
cytotoxicity to fibroblastic and B-lymphoid cells but not to T-lymphoid tumor cells. This
13
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
type o f selective toxicity might be potentially important in the development of the
neoplastic disease.
Introduction
Retroviruses are causative agents in the induction of lymphoid malignancies
(leukemia-lymphoma complex) in mammals including humans. In the domestic cat, an
outbred species, which has the highest incidence of lymphoid malignancies of any
animals, the disease is naturally associated with chronic feline leukemia virus (FeLV)
infection (Hardy, 1993; Roy-Burman, 1996). There is solid evidence to indicate that
interactions between infectious FeLV and non-infectious inherited endogenous FeLV
elements generate recombinant viral quasispecies which represent a variety of chimeric
envelope glycoproteins depending on the extent of amino terminal portion replaced by
the endogenous env sequences (Kumar et al., 1989; Overbaugh et al., 1988; Sheets et al.,
1992). The viral species with specific adaptive amino acid mutations and with certain
sites of recombination are rapidly selected for replication efficiency and are over
represented at later time points after infection (Bechtel et al., 1998; Chen et al., 1998;
Pandey et al., 1995). FeLVs with recombinant env genes are detected with high frequency
in naturally as well as experimentally induced feline lymphosarcomas (Bechtel et al.,
1998; Chen et al., 1998; Levy et al., 1993b; Pandey et al., 1995; Sheets et al., 1993;
Tsatsanis et al., 1994). Evidence also exists to suggest that some defective env genes
detected in FeLV-induced lymphosarcomas may be additional factors in the disease
process (Rohn et al., 1994; Sheets et al., 1993).
14
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Although a previous study addressed the issue o f in vivo deviation o f defective
env genes from a FeLV, subgroup A (FeLV-A) molecular clone (Rohn et al., 1994),
administration o f an inoculum prepared by propagating the vims in feline cells culture
could not eliminate the possibility of introducing defective FeLV contam inants along
with the replication competent FeLV-A virus. In this report, we present data
demonstrating in vivo generation of defective env genes which were detected in majority
of lymphosarcomas induced by direct delivery of proviral DNA of molecular clones of
FeLV-A by intradermal injection into specific pathogen-free (SPF) cats. Detection of a
spectrum of truncated env genes, all beginning from an inoculum of a single molecular
species of FeLV and occurring in the lymphosarcomas induced, suggests that products of
some of these defective env genes retained in tumor cells may have a role in the multistep
process of FeLV pathogenesis. In this regard, we describe a highly truncated env gene
product derived form one of these lymphosarcomas which displayed a pattern o f selective
cytotoxicity.
Materials and Methods
Cell culture
H927 feline fibroblast and PA317 mouse amphotropic packaging cell lines were
maintained in the DMEM high glucose medium supplemented with 10% fetal bovine
serum. The human HT1080 fibrosarcoma cell line was cultured in Eagle’s MEM medium
with 10% fetal bovine serum. Raji and CEM, human B- and T-cell lines, respectively,
were grown in RPMI medium supplemented with 10% fetal bovine serum. Feline 320IB
15
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
T-cells were maintained in 1:1 RPMI/Leibovitz’s L-15 medium supplemented with 20%
fetal bovine serum. All media were purchased from Irvine Scientific Co..
PCR analysis o f exosenous-related env series in cat tumor tissues
Genomic DNA was isolated from tumors of six pFRA challenged cats 5022,
5023, 5024, 5025, 5039, 5041 (Chen et al., 1998), three pF6A challenged cats 5035,
5036, 5051 (Phipps et al., unpublished data), and a SPF fetus tissue. PCR reactions were
performed with Taq DNA polymerase (Gibco-BRL) to amplify env genes of FeLV-A and
the recombinants between FeLV-A and the endogenous env elements from these DNA
samples. The 5’ primer was made to the sequences conserved between FeLV-A and
endogenous FeLV pol region (H18)(Chen et al., 1998), and the 3’ primer was
complementary to the exogenous 3’-LTR sequence of FRA or F6A (H20) (Chen et al.,
1998). The env sequence was also amplified using the same strategy from the tumor of
cat 4746-5, which was challenged with an FeLV-A Rickard plasma preparation and a
mixture of in vitro-generated recombinant FeLVs (rFeLV) (Pandey et al., 1995; Sheets et
al., 1992).
Construction o f mutant or chimeric env-expressinz retroviral vector
PCR products of full-length env genes from tumors 4746-5, 5022, 5023, 5024 and
5025, and the 700 bp deleted env gene from tumor 5023 were cloned into the pCR2.1
vector (Invitrogen). To study recombinant env species harbored by these experimental
tumors, the complete env clones were then screened with the 5’ primer RB53 (Pandey et
al., 1995) corresponding to the endogenous-related FeLV env sequence and the 3’ primer
RBI7 (Pandey et al., 1995) complementary to the FeLV-A env sequence.
16
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
A recombinant FeLV-B like env (clone 40) from cat 4746-5 and the 700 bp env
gene (designed tenv) were selected to study their biological functions. Using the primer
set: RB447, the 3’ primer with sequence complementary to FRA in the env-LTR region
CAGCCACGAATTCTGGAAATCATGGTCGGTO: and RB448, the 5’ primer with the
sequence in the FRA pol-env region (GGTCCCGAATTCGATCCATCAAGATGGAA),
PCR reactions with Pfu DNA polymerase were employed to introduce EcoRI restriction
sites (underlined sequences) into the cloned env genes. The PCR products were then
cloned into pWZLneo vector, a Moloney MuLV-based retroviral vector (Freytag et al.,
1994; Rudra-Ganguly et al., 1998). This vector contains an internal ribosome entry site
(IRES) from the encephalomyocarditis virus (ECMV) in front of the selection marker
gene (NeoR ) so as to produce a bicistronic mRNA containing the gene o f interest and
NeoR .
RNA isolation and RT-PCR
Total RNA was extracted from thymic tumor and normal splenic tissues of the cat
5023 with a RNAeasy Kit (Qiagen). The reverse transcription reaction was performed
with 1 ug RNA primed with oligo(dT). The sequences related to exogenous FeLV env
species were amplified from the cDNA using RB447 and RB448 primers. As a control,
GADPH sequence was amplified from the same cDNA preparations with the primer set
RB581 (CC ACCC AT GGC AAATTCC AT GGC A) andRB582
(TCTAGACGGCAGGTCAGGTCCAC). To ensure absence of genomic DNA
contamination in the cDNA samples, experiments without RT enzyme were
simultaneously run.
17
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Sequence analysis
The cloned env genes in both pCR2.1 vector and pWZLneo vector were
sequenced using the M l3 reverse and RB693 primers, respectively. RB693 was made to
represent a complementary sequence to IRES of pWZLneo vector
(AAAAGACGGCAATATGGTGG). Automated fluorescence-based cycle sequencing
was conducted with the ABI Prism 377 DNA sequencer (Perkin-EImer, Foster City,
Calif.) and the ABI Prism Dye Terminator cycle-sequencing Kit (P/N 402080) as
specified by the manufacturer.
Stable transfection o f PA317 cells and conditioned media preparation
To produce amphotropic viruses, the parental pWZLneo, the FeLV-B like
recombinant env and the tenv retroviral constructs were transfected into P A317 cells by
lipofectamine (Gibco-BRL) following manufacturer’s protocol. After 48 hours, the cells
were split 1:10 and selected in G418-containing medium (400 ug/ml) for 10 days. As the
selection of transfected cells was based on the expression o f the G418 resistant gene from
the same bicistronic proviral DNA carrying the env fragment, the use of WZLneo vector
allowed virtually all selected resistant cells to express the env protein. The growth
medium was changed every three days and G418 resistant colonies were isolated and
expanded for further study.
When G418 resistant cells reached 80% confluence, the G418 containing growth
medium was replaced by G418 free medium. The virus-containing cell supernatant fluids
were harvested, passed through 0.45 um filters (Gelman Sciences), and stored at -80°C
for reverse transcriptase (RT) activity assay and infection of cell cultures.
18
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
RT activity assay
Titers o f the viruses harvested were estimated by RT activity assay (de Parseval et
al., 1997; Roy-Burman et al., 1976). M-MuLV reverse transcriptase and GA-FeLV-B
virus stock with known titers were included as standards. Each sample was tested in
triplicate. Filtered conditioned medium (25 ul) was mixed with 25 ul o f a cocktail
containing 50 nM Tris (pH, 8.3); 10 mM DTT; 10 mM MgCb; 60 mM NaCl; 0.05% NP-
40; 2 ug poly(rA):p(dT)i2-i8; and 3 uCi/ml a 3 2 P-dTTP. After 2 hours at 37°C, 5 ul o f the
reaction mixture was transferred to 2 cm x 2 cm squares of D E81 chromatographic paper
(Whatman International Ltd.) and allowed to dry. The DE81 paper was washed twice
with 2 x SSC for about 5 minutes each, and rinsed with ethanol. The dried filter paper
squares were then transferred to scintillation vials for counting. The reverse transcriptase
activity was used to obtain an estimate o f the number o f infectious particles by comparing
it with that o f a GA-FeLV-B preparation with known virus titer.
Cell infection
H927 and HT1080 cells were seeded in 6-well plates (2 x 105 /well) the day before
infection. On day 2, the cells were infected with 1 ml of individual virus preparations
(approximately 5 x 105 infectious units per ml). Twelve hours later, the conditioned
medium was replaced with G418-containing medium. The medium was changed every
three days for up to 10 days.
Aliquots (2 x 105 ) of Raji, CEM and 320IB cells were primed with 28 ug of
polybrene in 1ml for 24 hours prior to infection with conditioned medium containing
approximately 1 x 106 infectious units per ml in the absence o f polybrene. At 12 hours
post infection, the cells were re-suspended with growth media with or without G418.
19
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
M TT assay
Cytotoxic effect o f the mutant env protein to Raji cells was measured by MTT
assay. MTT is the yellow tetrazolium salt that can be converted to purple formazan dye
by metabolically active cells. After treatment with polybrene, Raji cells were mixed with
conditioned medium as described above and transferred to a 96-well plate (2.5 x 104
cells/well for 24-hour post infection measurement and 1.25 x 104 cells/well for 48-hour
post infection measurement). The MTT assay was conducted according to the
manufacturer's protocol (Boehringer Mannheim) after 24- and 48-hour infection.
TUNEL assay
An aliquot o f Raji cell suspension (50 ul) treated with conditioned medium was
transferred to the plastic slides at different time points after infection. Then the cells were
fixed with 10% paraformaldehyde and stored at -80°C. The TUNEL assay was
performed following the manufacturer's instructions (Boehringer Mannheim). ACE
(Vector Labs) was used as color substrate.
Cell Coculture
CEM cells were infected with pWZLneo retroviruses as described above and
selected in 1000 ug/ml G418. Cell lones expressing tenv or full length env along with
CEM cells were grown at the same cell concentration 24 hours before coculture. H927 (1
x 103) or Raji (5 x 103) cells were mixed with CEM cells at the ratio (H927 or Raji to
CEM) of 1:2, 1:1, or 2:1 in RPMI media supplemented with 10% fetal bovine serum. The
supernatant fluid was also harvested and filtered through 0.45 um filters, which was used
to culture H927 cells.
20
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Results
Detection o f deleted env series in experimentally induced tumors
To examine the env species in both pFRA- and pF6A-induced tumors (Chen et al.,
1998, Phipps et al., unpublished data), exogenous-related env genes were PCR amplified
using a 5' primer homologous to the sequence conserved between endogenous and
exogenous pol gene, and a 3' primer complementary to exogenous LTR sequence. As
expected, 2 kb full-length env PCR products were detected in all 9 tumors tested, and no
exogenous env gene was detected in normal SPF cat fetus tissue. In addition, four o f six
FRA-tumors and two of three F6A tumors exhibited PCR products smaller than 2 kb
complete env (Fig. 2). In all six tumors containing deleted env genes, one or more bands
corresponding to highly truncated env gene could be readily detected. For example, a
band of 700 bp was a major product amplified from the tumor o f cat 5023; four putative
truncated env species with sizes ranging from 500 bp to 850 bp were detected in tumor
5039, o f which the 850 bp env product was the most prominent species; and in tumor
5035, six smaller env species ranging in sizes from 600 bp to 1050 bp were abundant. For
the current work, the deleted 700 bp product was chosen for further structural and
functional studies.
Analysis o f tenv for nucleotide and deduced amino acid sequence
The 700 bp env species from cat tumor 5023, namely, tenv, was cloned and
sequenced. The tenv gene sequence was 100% homologous to FRA env (Chen et al.,
1998) except a large internal deletion o f 1519 bp that shortened tenv. The deletion began
from near the N-terminal SU (6099 of FRA ) up to the mid-TM region (7617 of FRA).
Both ends of deletion were flanked by a direct repeat of six nucleotides (Fig. 3). In
21
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
1 2 3 4 5 6 7 8 9 10 11
•*-2.0 kb
* -1 .5 kb
* -0 .6 kb
Figure 2. Detection o f deleted env species in lymphosarcomas in cats inoculated with
FeLV-A pro viral DNA. Genomic DNA was isolated from six pFRA-induced tumors and
three pF6A-induced tumors. The exogenous-related env genes were PCR amplified with
H I8 and H20 primers. A SPF cat fetus DNA was included as a negative control. Lanes:
1, H2O; 2, SPF cat fetus; 3, tumor 5022; 4, tumor 5023; 5, tumor 5024; 6, tumor 5025; 7,
tumor 5039; 8, tumor 5041; 9, tumor 5035; 10, tumor 5036; and 11, tumor 5051.
Molecular weights are indicated at right.
22
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
addition, this deletion also resulted in a frameshift that gave rise to a premature stop
codon (7645 o f FRA). Comparison o f the deduced polypeptide from this sequence to that
o f FRA indicated that it retained the complete signal peptide and seven amino acids of
the N-terminal mature SU of FRA env protein, followed by a sequence of eight altered
amino acids resulting from the frameshift in the TM region (Fig. 3).
Induction o f cell morphological changes and cell death by tenv expression
To study the biological function of tenv, we used a vector (pWZLneo) to express
the tenv protein. The WZLneo vector is a Moloney MuLV-based retroviral vector that
contains internal ribosome entry site (IRES) sequence upstream of the aminoglycoside
phosphotransferase (NeoR ) gene. Existence of IRES allows selected G418-resistant
clones to express theoretically both tenv and NeoR genes from the same RNA. To confirm
the expression o f tenv, RT-PCR was performed on tenv stably transfected PA317 clones.
The right size mRNA o f tenv was readily detected in the tenv transduced cells but not
vector transfected cells (data not shown). Cell free viral supernatant fluids from the stably
transfected clones o f amphotropic PA317 packaging cell line were used to infect
fibroblastic and lymphoid cell lines.
The feline H927 fibroblasts and the human HT1080 fibrosarcoma cells were
infected with the tenv virus harvested and pooled from two virus producing PA317
clones. After 12-hour infection, cells were placed in G418-containing medium and
cultured for at least six days. Unexpectedly, we failed to obtain any G418-resistant clones
either from H927 or HT1080 cells infected with the tenv virus. These experiments were
repeated twice and the results were the same. Microscopic examination of the cells
revealed hallmarks of apoptosis such as nuclear condensation and surface blebbing.
23
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
t e n v _____________________________________________
Jm _ E _ S _ P _ _T_ _H_ _P_ _K _ P _ s _ K_ _D_ _K_ _T_ _ L _ _ S _ W_]
a t g g m ^ gtccjG ^ c g c a c c c a a a a c c c t c t a a^gataagjC c t c t c t c g t g g
r K A 5968
* * * * * * * * * * * * * * * * *
ATGGAAAGTCCAACGCACCCAAAACCCTCTAAAGATAAGACTCTCTCGTGG
tenv
^ “ a ” f “ l “ v “ 3 C J L ” i ” d _ " i ~g~
FRA AACTTAGCGTTTCTGGTGGGGATCTTATTCACAATAGACATAGGAATGGCC
* * * * * * * * * * * * * * * * *
AACTTAGCGTTTCTGGTGGGGATCTTATTCACAATAGACATAGGAATGGCC
tenv
N P S P H | Q H T G L V R D N M A
7 ® T C C T K B T C H * |/ / ■ ■ H g g a c t c g t c c g a g a c a a t a t g g c t a a
FRA 6099 7617 7645
* * * * * _ - R T R P R Q Y G ♦
AATCCTAGTCCACAC---------------- CGGACTCGTCCGAGACAATATGGCTAA
Figure 3. Nucleotide and deduced amino acid sequence of tenv. Starting from FRA env
ATG (5968-5970), the deduced amino acids o f tenv and comparison to that o f FRA env
are depicted. The sequence in the dashed box represents the signal peptide. The sequence
in the solid box represents the N-terminal portion of pFRA mature SU which is retained
in tenv. The sequence underlined indicates a relevant portion of FRA mid-TM region
which is altered in tenv. The deletion junction is highlighted in gray. * indicates the same
amino acids between tenv and FRA env. ♦ denotes the premature stop codon.
24
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
The tenv virus was also used to infect human Raji B-cells. In five independent
experiments using virus preparations from two stably transfected clones, we consistently
observed formation o f large cellular aggregates which occurred as early as 4-hour post
infection. The aggregates could be disrupted mechanically but reformed quickly even
when the infected cells were cultured in the medium without viruses. As illustrated in
Fig. 4, the Raji cells treated with the tenv virus displayed cell aggregations o f 15-50 cells
each, whereas the Raji cells infected with vector or full-length env virus (data not shown)
under identical virus and cell concentrations for infection remained primarily as single
cells.
In contrast to the B-cells, parallel studies with other lymphoid cells like CEM and
320IB, human and feline T-cell lines, respectively, revealed no significant morphological
changes or cytotoxic effects. These results with different cell lines are summarized in
Table 1.
Quantification o f tenv cytotoxicity to Raii cells
Along with morphological changes in tenv-infected Raji cells, we also repeatedly
observed a decrease in viable cell numbers relative to those treated with vector or full-
length recombinant env viruses. Thus, we wanted to further examine cell death in tenv
transduced Raji cell clones after G418 selection as described above for H927 and
HT1080 cells. However, Raji cells were quite resistant to G418 treatment. For example,
in experiments with up to 1000 ug/ml G418, uninfected Raji cells remained viable even
after treatment. For that reason, we decided to use MTT assay to quantify cytotoxic
effects of tenv virus infection on Raji cells.
25
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
The same amount of Raji cells was infected with the same titer o f tenv or vector
viruses. MTT converting activity was then measured at different time points after
infection. As shown in Fig. 5, there was clearly a decrease in the number o f metabolically
active cells when the cells were monitored for up to 48 hours following tenv virus
infection. Compared to vector treated cells, there were 40% fewer tenv infected cells at
24-hour post infection. Furthermore, only 30% cells remained in tenv treated Raji cells
compared to that of vector control at 48-hour post infection (Fig. 5). Although the
observed cytotoxic effect was most likely related to the kinetics of tenv protein
expression, this issue could not be properly evaluated because of the lack o f appropriate
antiserum against this highly truncated env product with altered TM terminal sequences.
Evidence for induction ofapoptosis to Raii cells by tenv expression
Formation of cell aggregates was previously reported for FeLV-C treated 320 IB
feline T-lymphoid cells. Such morphological changes were followed by induction of
apoptosis (Pandey et al., 1991; Rojko et al., 1992). Similarly, we observed that clumping
o f Raji cells was induced following infection with the tenv virus. To this end, to examine
induction o f apoptosis in tenv treated Raji cells, we performed TUNEL assay to assess
levels o f apoptosis in vector virus or tenv virus-infected Raji cells. TUNEL assay is based
on the detection o f single- and double-stranded DNA breaks occurring in apoptosis.
Because at 24-hour post infection, massive cell death (60% of vector-infected cells) was
observed, Raji cells infected with tenv or vector viruses were collected at 4 hours, 8
hours, and 18 hours after infection for apoptosis assessment. For each slide, three fields
were counted for the total number of cells and the cells that were stained positive. At 18-
hour post infection, tenv virus treatment resulted in approximately 45 ± 9% stained Raji
26
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Figure 4. Morphological changes in Raji cells induced by tenv expression. Raji cells were
treated with the vector-containing virus or te«v-containing virus. At 24-hour post
infection, the cells treated with tenv virus (panel B) displayed formation o f large
aggregates, whereas the cells treated with vector virus alone (panel A) remained
primarily as single cells. Magnification, 40 X.
27
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
TABLE 1. Susceptibility of various cell lines to tenv cytotoxicity
Cell lines Description of cell lines Observed cytotoxicity
Raji Human B-cell lymphoma yes
HT1080 Human fibrosarcoma yes
H927 Feline embryofibroblast yes
3201B Feline T-cell lymphoma no
CEM Human T-cell lymphoma no
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
0.25
0.2
ID 0.15
o>
IO
<
0.1
0.05
0
0.25
0.2
0.15
0. 1
0.05
0
B
□ vector
■ tenv
Figure 5. MTT assay of Raji cells infected with the tenv virus. Cytotoxic effect o ftenv on
Raji cells was measured by MTT assay at A 595 at 24-hour (panel A) and 48-hour (panel
B) post-infection. The open bars represent the vector virus treated cells, and the gray bars
represent the tenv-treated cells. The standard deviations are indicated.
29
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
cells with dark red nuclei, whereas only about 8 + 3% o f the cells treated identically with
vector alone virus displayed this characteristic of apoptosis. Representative results of this
assay are shown in Fig. 6 .
Analysis o f tenv expression in the tumor tissue
To determine whether the deleted env gene was indeed expressed in the tumor
cells from which tenv sequences were isolated, we conducted RT-PCR of the total RNA
obtained from the tumor tissue and a normal tissue (spleen) form the 5023 tumored cat.
As shown in Fig. 7, a PCR product was readily detected in the tumor tissue but not in the
spleen. The size of the product corresponded well to the expected 453 bp from the tenv
gene sequence. The quality o f the RNA derived form the tissue was verified by the
detection of the GADPH gene product.
Cytotoxicity o f tenv expressing CEM cells to Raii and H927 cells
To test whether tenv expression provides T-cell a cytopathic activity to non-T
cells, coculturing of Raji or H927 cells with CEM was carried out. Fig. 8 is a
representative result from three independent experiments. When the cells were mixed at
the ratio of 2:1, approximately 30 to 40% cell death was observed in Raji cells 24 and 48
hours after coculturing with tenv-expressing CEM cells, or about 30% cell death in H927
cells 72 hours after coculturing (Fig. 8 ). However, when H927 cells were grown in cell-
free supernatant that was harvested from tenv-expressing CEM cells, no cell death was
detected by MTT assay (data not shown).
30
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
♦
A
♦ •
, *
■ \v
*
* w
- **%
j
...
- '
•
r*». V
•
. %
' ■:
B - s .;
v = > ’
o ' 0
a- o ’’
3 - 5
e dr:
9.
4
#
* v .
Figure 6 . TUNEL assay of Raji cells infected with the tenv virus. Suspension of infected
cells (50ul) was transferred to plastic slides and left until dry. Apoptosis was detected
with a red chromogenic substrate. Positively stained cells are the cells with dark red
nuclei. Panel A, the vector-treated cells, and panel B, the tewv-treated cells.
31
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
1 2 3 4 5
tenv
GAD PH
Figure 7. Detection o f tenv gene expression in the original tumor tissue. RT-PCR was
performed on total RNA isolated from normal (spleen) and thymic tumor tissues of cat
5023. While the GADPH transcript was detected in both normal and tumor samples, the
tenv gene was only expressed in the tumor (lane 4). RT-PCR without RNA or without RT
enzyme were included as negative controls. Lanes: 1, RNA (-); 2, spleen RT (+); 3,
spleen RT (-); 4, tumor RT (+); 5, tumor RT (-). The upper panel shows the RT-PCR of
tenv, and the lower panel shows that of GADPH.
32
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
24 hours after coculture
B
VI
9\
in
<
48 hours after coculture
$ 0.8
72 hours after coculture
< 0.2
m
Raji +
Raji +
H
Raji +
□ Raji +
Figure 8 . Cytotoxicity of tenv-expressing CEM cells to Raji and H927 cells. Same
number of Raji cells (5 x 103) or H927 cells (1 x 103) was cocultured with CEM cells thst
express tenv or full length env gene products at the ratios (CEM to Raji) of 1:2, 1:1, and
2:1. Each experiment was performed in quadruplicate and standard deviation bars are
shown. The results of MTT assay 24 hours (A) and 48 hours (B) after Raji and CEM cell
coculturing are shown. Panel C demonstrates cell death 72 hours after H927 and CEM
cell coculturing.
33
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Discussion
In analogy to murine retrovirus-induced disease processes, we predicted that
certain FeLV env recombinant or truncated env glycoproteins, would be involved in
signal transduction processes that regulate cell proliferation, cell death or phenotypic
expression. The basis for this prediction was the presence o f numerous reports on
functions of chimeric or truncated env glycoproteins of MuLVs different from the
primary role o f cell receptor recognition for entry into host cells. For example, infection
of an IL-2-dependent T-lymphoma cell line, specifically with the recombinant mink cell
focus-forming (MCF) virus, confers factor-independent growth (Tsichlis and Bear, 1991).
Another example is release o f a lymphoid cell line from IL-3 requirement when MCF SU
is coexpressed in these cells along with either erythropoietin receptor (EpoR) or the
structurally related molecule, IL-2 receptor p (Li and Baltimore, 1991). A chimeric env
glycoprotein, gp55 o f polycythemia-inducing Friend spleen focus-forming virus (SSFV),
which is a product o f MCF-derived extracellular SU domain fused to an ecotropic-
derived TM segment, is an abnormally processed defective protein. This protein is
needed to bind to EpoR to transform erythropoietic cells in the virus-induced disease (Li
et al., 1990; Ruscetti et al., 1990).
To pursue this prediction in FeLV pathogenesis, we describe in this report
experiments that provided direct evidence for the first time for in vivo generation of not
only viruses with recombinant env glycoprotein (Chen et al., 1998, Phipps et al,
unpublished data), but also a spectrum of truncated glycoprotein genes, all beginning
from an inoculum o f a single molecular species o f FeLV and occurring in the
lymphosarcomas induced. Since the proviral plasmid DNA was inoculated intradermally
34
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
into the cats, the composition o f the inoculum could not be questioned. Initially, we
selected a single truncated species, tenv, to examine its structure and function in cell
cultures. The deduced polypeptide of the cloned tenv gene indicates that besides the
complete signal peptide and the first seven amino acids o f the mature SU of FRA, tenv
does not contain any other SU sequence. The C-terminal portion of eight amino acids is
unique because o f the large internal deletion (1519 bp) and frameshift in the TM region.
The nucleotide sequence o f the C-terminal region, however, corresponds fully to the FRA
TM sequence. Thus, it appears that tenv is a direct derivative o f the FRA parental virus
rather than any recombinant generated in vivo. In some regards, however, tenv displays
structural similarity to SSFV gp55. Besides the internal deletion of 585 bp, one striking
feature in gp55 nucleotide sequence is a single base pair insertion that changes the
reading frame (Amanuma et al., 1983; Clark and Mak, 1983; Wolff et al., 1983).
Interestingly, although each SSFV isolate may differ in the type or position o f the base
pair inserted, the resulting SFFV env proteins all end with the same unique five to six C-
terminal amino acid sequence (Ruscetti and Wolff, 1984). There is evidence that EpoR
activation by gp55 is indeed dependent on sequences at the C-terminal of the factor,
while alterations in the N-amino terminus do not appear to abolish gp55 activity (Gomez-
Luciaetal., 1998).
For functional studies of tenv, we used a WZLneo retrovirus vector to transduce
this gene into a few different cell types. The tenv virions were produced in amphotropic
PA317 packaging cell line and used to infect a number o f fibroblastic and lymphoid cell
lines. The findings were striking. While feline fibroblasts (H927), human fibrosarcoma
(HT1080), and human Raji B-cells exhibited cytotoxic response to tenv virus infection,
35
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
the feline or human T-lymphoid tumor cells, namely 3201B and CEM cells, did not
manifest any significant cytopathicity. The differential cytotoxicity is interesting since all
of the lymphoid cell lines were infected with the same virus titer for the same amount of
cells. The fibroblasts, H927 and HT1080 cells, even received less amount of virus. Still
the findings will be more convincing once reagents are available to determine the levels
of tenv protein expression in the various cell lines tested. Additionally, it will be
necessary to extend the study to other target cell lines and natural feline cell populations
to increase the significance o f this cytotoxicity. It should, however, be noted that in
contrast to the observed effect o f tenv on the fibroblasts and B-cells, infection of these
cells with a full-length recombinant env-containing murine retroviruses or the vector
viruses did not induce any morphological changes or cytopathic effects. Thus, the
changes observed were specific for tenv expression and not due to nonspecific murine
retrovirus infection. Furthermore, there appears to be a target cell specificity for tenv as
well. In the limited study, the morphological changes induced in H927, HT1080, and Raji
cells by tenv appeared to be similar to some of the hallmarks o f apoptosis. The results
implied, but, certainly, did not prove, that the de novo generated tenv could be critical in
lymphomagenesis. Conceivably, while the T-tumor cells may be resistant to cell death by
expression o f this novel protein, other cell types like B lymphoid cells and stromal
(fibroblasts) cells may be targets o f selective killing by this product. This type of
selective cytopathic effects may potentiate compensatory proliferation o f the resistant
cells in the tumorigenic process.
In conclusion, we have documented conclusive proof for the in vivo generation of
truncated env genes in FeLV-induced neoplasia. Since majority o f the experimental
36
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
tumors display one or more discrete species o f variably truncated FeLV env genes, it is
quite likely that at least some of them will have functional consequences. In this regard,
the truncated version tested here, illustrates a cytotoxic property which is specific for cell
types.
37
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
CHAPTER 3
DIVERSE SELECTIVE PRESSURES MAY DETERMINE PRO VIRAL LONG
TERMINAL REPEAT NUMBERS
Abstract
A genetic event in nonacute retrovirus mediated tumorigenesis is believed to be
enhancer duplication or triplication within proviral long tenninal repeats (LTRs). Here
we describe de novo generation o f enhancer repeats in three out o f eight feline leukemia
virus (FeLV)-induced thymic lymphosarcomas in experimental cats inoculated directly
with single molecular species o f proviral DNA of two independent FeLV subgroup A
viruses, each containing a single copy of the enhancer element. Structural analysis o f
LTRs derived from such a tumor combined with functional studies using in vitro transient
transfection with luciferase reporter gene constructs led to the following findings: (i)
besides the single copy enhancer containing parental LTR, there were other LTR species
which harbored a 38 bp duplication, triplication or quadruplication around the core
enhancer region; (ii) of all the different species triplicate enhancer species were most
abundant in the tumor DNA; (iii) while the degree of transcription promotion activity of
the different LTR species varied with the type of transfected cells, the observed activity,
in all cases, was the highest with the LTR with four repeats; (iv) enhancer activity o f the
LTR with four repeats was also strongest relative to the other species when placed
downstream of the reporter gene in the same orientation; and (v) in all cell types
examined, LTR with three repeats, rather than the four repeats, displayed the strongest
enhancer activity when linked downstream but in opposite orientation with respect to the
38
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
reporter. These results provided conclusive proof for the evolution de novo o f enhancer
repeats and suggested that the selection o f repeat numbers might be influenced by
multiple factors, perhaps not just for viral replication efficiency.
Introduction
Multiple steps are involved in retroviral tumorigenesis. Studies on the murine
leukemia virus (MuLV) infection have demonstrated that the proviral long terminal
repeat (LTR), the non-coding region bearing the necessary transcription regulatory
sequences for the retroviral genome, is an important determinant in this process (Fan,
1997). As minute as a single nucleotide difference in the U3 core element was shown to
be associated with the differential lymphomagenicity between MuLV, SL3-3 strain and
Akv virus (Lenz et al., 1984; Morrison et al., 1995). Proviruses with enhancer repeats
were also isolated from the MuLV-induced tumors, and the recombinant retroviruses
containing these repeats demonstrated increased potential to induce diseases (Holland et
al., 1989; Li et al., 1987); (Stoye et al., 1991). Analogous to the murine system,
proviruses isolated from feline leukemia vims (FeLV)-induced thymic lymphosarcomas
frequently contained a tandem repeat o f two or three copies of the enhancer region of
variable length within the LTR (Fulton et al., 1990; Matsumoto et al., 1992), whereas the
proviruses isolated from the non-neoplastic diseases generally contained only a single
copy o f enhancer (Donahue et al., 1988; Matsumoto et al., 1992). Proviruses with
enhancer repeats, in some instances, were located adjacent to the proto-oncogenes such as
c-myc and flvi-2 in the feline tumor DNAs (Levy and Lobelle-Rich, 1992; Levy et al.,
1993b; Miura et al., 1987).
39
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
We recently reported a new experimental approach for efficient induction of
thymic tumors in cats by direct inoculation o f FeLV plasmid DNA. A new molecular
clone of FeLV subgroup A, Rickard strain (FRA) (Chen et al., 1998) or the proto-type
FeLV-A clone F6 A (Donahue et al., 1988) with 98% nucleotide identity with FRA was
used for intradermal administration in the DNA form. This procedure circumvented the
complexity of in vitro generated viral quasispecies when the inocula were prepared by
propagation o f the ecotropic FeLV-A in feline cells. Eight newborn specific pathogen
free (SPF) cats were inoculated with the FRA plasmid DNA and four newborn SPF cats
with F6 A (Chen et al., 1998). Each of the injected proviruses contained only one copy of
the enhancer sequence. O f these, six FRA challenged cats developed lymphosarcomas
(five thymic and one multicentric) and three F6 A cats developed thymic
lymphosarcomas. Analysis of the 8 thymic lymphosarcomas revealed that the DNA of
three tumors (1 FRA cat and 2 F6 A cats) contained de novo generated repetitive enhancer
domains in the proviral LTR. The current study was initiated to examine the functional
consequence of a specific type of enhancer expansion in proviral LTRs isolated from a
pFRA induced thymic tumor. In vitro transcriptional activity of a reporter gene was
scrutinized in homologous and heterologous cells using complete LTRs, as encountered
naturally, and in various orientations with respect to the reporter gene.
Materials and methods
Cell cultures
The H927 feline fibroblastic cells were maintained in DMEM (Irvine Scientific)
medium supplemented with 10% fetal bovine serum. The K562 cells, a human primitive,
40
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
multipotential, hematopoitic progenitor leukemia cell line, were maintained in RPMI
(Irvine Scientific) medium supplemented with 10% fetal bovine serum. The FL-74 cells,
a feline T-lymphoma cell line, chronically infected with feline leukemia virus (subgroups
A, B and C), were maintained in 1:1 Leibovitz’s medium L-15/RPMI (Irvine Scientific)
supplemented with 1 0 % fetal bovine serum.
Cloninz and sequencing o f LTRs
Genomic DNA was extracted from thymic lymphosarcomas o f cats 5022, 5023,
5024, 5025and 5039, which were challenged by pFRA via intradermal injection (Chen et
al., 1998). Similarly, DNA was purified from the thymic tumors o f cats 5051, 5035 and
5036 which received pF6 A DNA inoculation (our unpublished data). Genomic DNA was
also isolated from bone marrow and buffy coat samples of cat 5025 collected at various
postinfection (p.i.) time points. PCR amplification of proviral U3 region of the various
DNA preparation was performed with Taq DNA polymerase (Gibco-BRL) using primers
RB42 and RB84 as reported previously (Chen et al., 1998). The complete 3’-LTRs from
the tumor o f cat 5025 were amplified with cloned Pfu DNA polymerase (Strategene)
using the following primer set: RB490, the 5’ sense primer, corresponding to FRA
sequence 7885 to 7904 at the env/LTR junction with two-nucleotide changes (AA to TT)
at positions 7894 and 7895 to introduce the underlined //m dlll restriction site
(AGATAAAGCTTTACGATCCG); and RB489, the 3’ antisense primer, complementary
to the FRA sequence 8449 to 8431 (AAGCTTGA AAGACCCCTGAACTAG) to which
the underlined ///«dIII restriction site was introduced at the 5’ end o f the oligomer. The
PCR products of U3 region from two tumors (cats 5035 and 5036) with expanded
enhancer region were cloned into the pCR2.1 vector (Invitrogen), and the complete 3’-
41
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
LTR from the tumor of cat 5025 into the pCR-Blunt vector. Automated fluorescence-
based cycle sequencing was performed with the ABI Prism 377 DNA sequencer (Perkin-
Elmer, Foster City, Calif.) and the ABI Prism Dye Terminator Cycle-sequencing Kit (P/N
402080) as specified by the manufacturer using the M13 reverse primer. The complete
FRA 3’-LTR was also cloned into the pCR-Blunt vector using the same strategy from the
FRA plasmid DNA.
Fusion ofLT R s to reporter series
PGL3 vectors containing a reporter gene coding sequence for firefly luciferase
were used for the in vitro functional studies o f the cloned LTRs. The PGL3 basic vector
lacking eukaryotic promoter and enhancer sequences was used for the studies of
transcrptional activity of the cloned LTRs. The complete 3’-LTR in the TA-blimt vector
was cut out with Hin&lll and subcloned into the PGL3 basic vector (Promega) in the 5’-
3’ direction. The PGL3 promoter vector was used for the enhancer activity studies. In
order to clone the LTRs into PGL3 promoter vector, the BamHL restriction sites were
introduced by PCR amplification of the LTRs in the TA-blunt vector using cloned Pfu
DNA polymerase (Strategene) and primers: RB534, the 5’ sense primer, corresponding to
FRA sequence 7901 to 7921 at the beginning of 3’-LTR with two-nucleotide changes (C
to T and G to C) at positions 7907 and 7909 to introduce a BamYTL site
(CCGGATCCACCATGATTTCC): and RB533, the 3’ antisense primer, complementary
to the FRA sequence 8449 to 8431 (AGGATCCTGAAAGACCCCTGAACTAG) to
which the underlined BarriHl restriction site was introduced at the 5’ end of the oligomer.
The PCR products were digested with BairiHl and then cloned into the PGL3 promoter
vector (Promega) downstream of the luciferase gene in either 3’-5’ or 5’-3’ directions.
42
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
The orientation and sequences were confirmed by automated cycle sequencing as
described above.
Transient transfection
Cotransfection of LTR-luciferase PGL3 reporter plasmid and pRL-TK vector
plasmid DNA (Promega) was conducted in the 48-well plates for H927 cells and 96-well
plates for K562 and FL-74 cells. The pRL-TK vector was included as an internal control
reporter vector that contained a cDNA encoding Renilla luciferase. LTR-luciferase PGL3
plasmid DNA (0.5ug) and pRL-TK vector (0.05ug) plasmid DNA were introduced into
H927 cells using lipofectamine reagent (Gibco-BRL) as described by the manufacturer.
LTR-luciferase plasmid DNA (lug) and pRL-TK vector plasmid DNA (O.lug) were
introduced into K562 and FL-74 cells by SuperFect reagent (Qiagen). The ratio of
SuperFect to DNA was 1:20. The medium used for FL-74 cells during transfection was
1:1 Leibovitz’s medium L-15/RPMI (Irvine Scientific) supplemented with 20% fetal
bovine serum. Each experiment was done in triplicate.
Assay for luciferase activity
The cells were washed once with PBS and lysed with lysis buffer (Promega) 48
hours after transfection. The cell lysates were left at room temperature for 20 minutes for
H927 cells and 40 minutes for K562 or FL-74 cells with gentle shaking and then
subjected to one freeze-thaw cycle. The luciferase activity was measured according to the
protocol provided by Promega using Lumat LB9501 luminometer (Berthold). The firefly
luciferase activity was normalized for transfection efficiency by the activity o f
cotransfected, constitutively expressed Renilla luciferase.
43
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Southern blot analysis
Kpril and Pstl (Gibco-BRL) were used to obtain 375-489bp LTR fragments from
genomic DNA for the analysis o f LTR subpopulations. Since FeLV pro viruses do not
contain any internal £coRI site, iscoRI (Gibco-BRL) was used to estimate the number of
proviral integration loci in tumor DNA. A 0.8% agarose gel was used for the separation
of EcoRI fragments, and 2% low melting gel was used for the separation of Kpnl-Pstl
fragments. The DNA was transferred to membrane filters using the alkaline transfer
method and bound to the membrane by UV-crosslinking (Stratagene). Both
hybridizations were conducted in QuikeHyb solution (Stratagene) using the 375-bp Kpnl-
Pstl LTR fragment from FRA as the probe for 2 hours at 6 8 °C. The membranes were
washed twice with 5xSSC, 0.05% lauroyl-sarcosine, and 0.02% sodium pyrophosphate at
50°C and then exposed to the Kodak film at -80 °C from 1 day to 1 week.
Results
Detection and analysis o f de novo senerated repetitive enhancer in proviral LTRs
We examined thymic lymphosarcomas induced in SPF cats by direct inoculation
of proviral DNA o f FeLV-A molecular clones. DNA was isolated from eight such
tumors, five induced by pFRA and three by pF6 A, and the LTR U3 region o f the viral
integrants was amplified by PCR using the primers as described in the Methods. Among
these eight tumor DNAs, three showed PCR products larger than that o f either pF6 A or
pFRA DNA that carried a single enhancer unit (Fig. 9). Two (cats 5035 and 5036) of
these tumors were induced by pF6 A inoculation while one (cat 5025) was induced by
pFRA administration. The larger PCR products were molecularly cloned and several
44
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
clones were sequenced. An expansion o f a 38 bp stretch in the U3 of sample 5025 has
been previously reported (Chen et al., 1998). Comparison of the cloned U3 regions
derived from the two pF6 A-induced cat tumors with F6 A-LTR revealed that they also
contained direct duplications around the core region. For example, four clones from cat
5035 tumor DNA showed a 30 bp direct duplication (— 221 to — 192) starting from the
middle of Lvb-binding site to the middle o f NF-1 site (Donahue et al., 1988; Matsumoto
et al., 1992), and 2 clones showed a 6 6 bp direct duplication (-230 to -165)
encompassing the whole Lvb, core, GRE and NF-1 region (Fulton et al., 1990;
Matsumoto et al., 1992; Rohn and Overbaugh, 1995). Similarly, of the 8 clones
sequenced from sample 5036, 5 clones contained a direct duplication of 65 bp (— 236 to -
172) in the enhancer region, while 2 clones contained a direct duplication of 41 bp
involving — 230 to — 190. The last one clone showed a direct duplication of 79 bp (— 230 to
-152).
Analysis o f LTRs cloned from tumor and normal tissues o f cat 5025
Changes within proviral LTRs were first observed in the tumor tissue from cat
5025 (Chen et al., 1998). To investigate whether these changes only pertained to the
tumor, we compared proviral LTR species that existed in different tissues from the same
cat by PCR reactions. As illustrated in Fig. 10, in contrast to the tumor-derived LTRs that
contained both unchanged and expanded species, LTRs from the bufiy coat samples
obtained at 8 and 36 weeks p.i. or bone marrow samples obtained at 14 and 36 weeks p.i.
o f this cat exhibited only one band corresponding to the size of the FRA LTR. Thus,
enhancer expansion appeared to be an event specifically detected in the tumor DNA.
45
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
1 2 3 4 5 6 7 8
Figure 9. Detection of de novo generated alterations in FeLV proviral LTRs in thymic
lymphosarcomas. Exogenous FeLV-related U3 regions were PCR amplified with primers
RB42 and RB84. The normal fetus tissue DNA and water were included as negative
controls. The arrow indicates the expected PCR product of the size of FRA-LTR. Lanes:
1) H2O; 2) normal SPF cat fetus; 3) tumor 5023; 4) pFRA; 5) pF6A; 6) tumor 5025; 7)
tumor 5035; 8) tumor 5036.
46
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Figure 10. PCR analysis o f LTR species in tissue specimens ofbuffy coat, bone marrow,
and the tumor from cat 5025. DNA samples were analyzed using the primers RB42 and
RB84. Water was included as a negative control, and pFRA was included as a positive
control. The lower arrow marks the size of LTR with single enhancer, and upper arrow
indicates the expected size of PCR product with 38-bp triplication. Lanes: 1) H2O; 2)
buffy coat at 8 weeks p.i.; 3) buffy coat at 36 weeks p.i.; 4) bone marrow at 14 weeks p.i.;
5) bone marrow at 36 weeks p.i.; 6) tumor; 7) pFRA.
47
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
The LTRs from the tumor o f cat 5025 were then selected to examine whether the
enhancer repeats present in this tumor DNA might have any structure-fiinction
relationship. The PCR products related to the 3’-LTR of the integrated proviruses from
thymic lymphosarcoma o f cat 5025 were cloned into the pCR-Blunt vector. Sequence
analysis, confirmed by sequencing the fragments in both PGL3 basic and PGL3 promoter
vectors, revealed that in addition to the parental FRA LTR, three other LTR species with
enhancer duplication, triplication, and quadruplication were cloned and they had the same
38-bp m otif spanning from the Lvb-binding site to the middle of the NF-1 site in the U3
region o f the LTR (Fig. 11). Comparison of the nucleotide sequence o f representative
clones o f each of the three amplified species to that of FRA demonstrated that they all
retained the same nucleotides as FRA that distinguished FRA from the prototype FeLV-A
clone 6 IE (Chen et al., 1998). There were also a few new mutations that were present in
all or some of the clones at identical positions. For example, all three representative
clones had the same nucleotide transition from T to C at position +15 from the CAP site,
and LTR with enhancer triplication and duplication had the same A to G transition at
position -166. Besides these, LTR with triplication had an additional C to G transition at
position +4 and a deletion right before the 38-bp repeats at -239.
Transcriptional activity o f the LTRs
To study the transcriptional activity of the proviral LTRs with different number of
enhancer repeats, we made reporter constructs containing the cloned 3'-LTR upstream of
a luciferase gene in the PGL3 basic vector. PGL3 basic vector is a reporter vector lacking
of any eukaryotic promoter and enhancer sequences. The constructs containing proviral
LTRs with variable enhancer repeats were introduced by lipofectamine reagent into a
48
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Reproduced with permission o f th e copyright owner. Further reproduction prohibited without permission.
FRA GGGAATGAAAGACCCCCTACCCCAAAATTTAGCCAGCTACTGCAGTGGTGCCATTTCACAAGGCATGGAAAATTACTCAAGTATG
2R ................................................................................................................................................................................................................
3R ................................................................................................................................................................................................................
4R ................................................................................................................................................................................................................
L v b C o r e NF- 1 ORE .1 7 7
FRA t t c c c a t g a g a t a c a a g g a a g t t a g a g g c t a a a a c a g g a t a t c t g t g g t t a a g c a c c t g g g c c c c g g c j t g a g g c c a a g a a c a g t
2R .......................................................................................................................................................................i ...................................
3R .................................................... “ ............................................................................................................. 4 .......................................
4R ....................................................................................................................................................................... I ......................................
-92
P R A t a a a c c c c g g a t a t a g c t g a a a c a g c a g a a g t t t c a a g g c c g c t a c c a g c a g t c t c c a g g c t c c c c a g t t g a c c a g g g t t c g a c c
2R .................................................................................................................. G..........................................................................................
jr :::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
4R
-7
TTCCGCCTCATTTAAACTAACCAATCCCCACGCCTCTCGCTTCTGTGCGCGCGCTTTCTGCTATAAAACGAGCCATCAGCCCCCA
2R ................................................................................................................................................................................................................
3R ................................................................................................................................................................................................................
4R
“ ‘US
+79
FRA ACGGGCGCGCAAGTCTTTGCTGAGACTTGACCGCCCCGGGTACCCGTGTACGAATAAACCTCTTGCTGATTGCATCTGACTCGTG
2R .............................................................. C ......................................................................................................................................................................................................
3R ....................G....................... C ..............................................................................................................................................................
4R .................................................c ............................................................................................................................................................
FRA GTCTCGGTGTTCTGTGGGCGCGGGGTCTCATCGCCGAGGAAGACCTAGTTCAGGGGTCTTTCA
2R ..........................................................................................................................................................
3R ..........................................................................................................................................................
4R ..........................................................................................................................................................
Figure 11. Comparison of nucleotide sequence of the cat 5025 tumor-derived proviral LTRs with that of pFRA LTR. 2R denotes the clone of LTR with
enhancer duplication, 3R for the clone of LTR with enhancer triplication, and 4R for the enhancer quadruplication. The underlined 38 bp indicates the
region amplified and the subscripts indicate the number of repeat expansion. The dots indicate the same nucleotide sequence as FRA, (-) indicates
vo deletion. The U3, R and U5 regions are shown, CAP site is also marked. Numbers above the sequence represent the relative distance from the CAP site.
feline fibroblastic cell line, H927. The constructs were also introduced by SuperFect
reagent into two other cell lines: K562, a human primitive, multipotential, hematopoitic
progenitor leukemia cell line, and FL-74, a feline T-lymphoma cell line chronically
infected with FeLV subgroups A, B and C. Each set o f transient transfections was done in
triplicate with the same amount o f DNA. After 48 hours, the transfected cells were
harvested, lysed, and the lysates were used for luciferase activity measurement. Fig. 12
illustrates the pooled results o f at least 3 independent experiments of the relative
luciferase activity compared to that of FRA LTR-driven reporter construct.
In all cell lines tested, the luciferase activity was higher with LTRs containing
enhancer amplifications compared to FRA LTR. In all cases, the observed activity was
the highest with the LTR containing enhancer quadruplication. LTR with enhancer
duplication demonstrated a slightly higher transcriptional activity than that of the LTR
with enhancer triplication. The degree of transcriptional activity, however, varied with
cell types. For example, the luciferase activity was about three-fold higher with LTR
containing quadruplication than that of FRA LTR in a feline fibroblastic cell line, H927.
Yet in the other two leukemia cell lines tested, K562 and FL-74, the luciferase activity of
the same constructs was about 6-fold or 9-fold higher, respectively, compared to that of
parental FRA LTR.
Enhancer activity o f the LTRs
To examine the enhancer activity of these cloned proviral LTRs, we inserted the
complete 3'-LTR including its own promoter along with its enhancer into the PGL3
promoter vector. The PGL3 promoter vector contains the luciferase gene driven by the
SV40 promoter. The cloned 3'-LTRs were placed downstream o f the luciferase gene in
50
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
IH H ]—
LTR luc+ PoIy(A)
Relative Luciferase Activity
(0.12) (0.15) (0.15)
1R (1.00)
(1.00) (1.00)
2R (2.38)
(4.14) (3.73)
3R (1.52)
(3.05) (3.00)
4R (3.15)
i i i" i " i
1234
(6.11) (9.15)
I I I I I I I I I
12345678
I I I I I I I I I ! I
12345678910
A B C
Figure 12. Relative luciferase gene activity directed by LTRs with different number of
enhancer repeats. The structure of the general construct is shown on the top of the panel.
LTR- denotes the construct without LTR, FRA for the construct with FRA-LTR, and 2R,
3R and 4R for the enhancer duplication, triplication, and quadruplication, respectively.
The arrow indicates the orientation of the LTR. The LTR-luciferase plasmids were
transfected into H927 (A), K562 (B), and FL-74 (C) cells. The bars are pooled results
from at least 3 independent experiments and shown in parenthesis as values relative to the
luciferase activity o f the FRA-LTR-luciferase control. The FRA LTR activity was set at
1.00. The standard deviations are marked.
51
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
either 5-3' or 3-5' orientation. Transient transfection was performed in various cell lines
as mentioned above. Fig. 13 and Fig. 14 illustrate the pooled relative luciferase activity
from at least 3 independent experiments for each o f the constructs.
The LTRs placed downstream of the reporter gene at 5-3' direction had activities
that showed a similar pattern to that o f the promoter studies (Fig. 13). The enhancer with
four 38-bp repeats possessed the highest activity among all the enhancers examined in the
all three cell lines tested. The enhancers with triplication and duplication displayed
activity that was similar to each other but lower than that o f the four repeats.
Interestingly, the proviral LTRs demonstrated a different pattern of enhancer activity
when placed downstream o f the SV40 promoter in 3-5' direction. As illustrated in Fig.
14, the enhancer with triplication showed the highest activity while the LTR with
quadruplication displayed activity which was comparable to the enhancer duplication
construct. Another interesting finding was that in this orientation, the enhancer with three
repeats functioned in the H927 cells, a feline fibroblastic cell, as efficiently as it did in the
FL-74 cells, a feline leukemia cell line, and better than the human K562 cells.
Relative proportion ofLTR svecies with various number o f enhancer repeats in the tumor
DNA
The triplication-containing LTR distinguished itself by the highest enhancer
activity while placed downstream o f the luciferase gene in the 3'-5' orientation. This
raised the question whether there might have been any selection pressure in vivo to favor
this proviral LTR species. To address this point, we directly examined the proviral LTR
sub-populations in the original tumor tissue from the cat 5025. The genomic DNAs
extracted from the tumor tissue of cat 5025 and that o f cat 5023, which showed no LTR
52
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
sequence expansion, and from a normal SPF cat fetus were double digested with Kpnl
and Pj/I to obtain the 375-489 bp fragments encompassing the proviral LTR enhancer
region. Southern blot analysis showed that, as expected, no exogenous LTR specific
sequences were detected in the SPF cat fetus tissue, and only one band corresponding to
the size o f FRA LTR was present in the cat 5023 tumor tissue (Fig. 15, panel A).
Although multiple FRA LTR sub-populations existed in the cat 5025 tumor tissue,
overwhelmingly prominent LTR subpopulation detected was the one which corresponded
to the size expected for the LTR with enhancer triplication, and the second prominent
LTR population was the LTR o f the size of the original inoculum FRA (Fig. 15, panels
A), with only minor proportions o f species corresponding to sizes o f double and
quadruple enhancer classes, which were, however, not visible in the photo reproduction.
The southern blot analysis o f the same DNA after digestion with EcoRI, which does not
cleave within the FeLV proviruses, and probing with exogenous U3-specific sequences
revealed a fairly large number, approximately 15-20 copies of FeLV pro viruses
containing EcoiRL fragments o f sizes equal to or higher than 8.5 kb in this tumor DNA
(Fig. 15, panel B). Additionally, there were LTR-containing bands at about 2.0 kb size
which probably represented highly truncated pro viruses (data not shown). DNA
fragm ents varying in size from 1 kb to > 14 kb were eluted from a parallel gel at 2 kb size
increments and examined for the composition o f proviral LTR species. PCR analysis with
primers that amplified LTR U3 region in fractions that contained proviruses revealed
LTRs o f primarily two size classes, one corresponding to single copy LTR and the other
one to the triplicate version. In most fractions, however, the triplicate displayed a stronger
intensity over the single copy fraction (data not shown). Consequently, a vast majority of
53
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
SV40 luc+ LTR poIy(A)
promoter
Relative Luciferase Activity
v B * (0.20) E r (0.30)
&
(0.72)
1R ^ (1.00) (1.00)
□
(1.00)
2R
- (1.44) (1.15)
—r
(1.46)
3R -
(1.55) E^=f~ (1.19) (2.17)
4R ^ '. ----- (2.82)
£ - (2.07)
(3.56)
— I 1 ---- 1 ---- 1
1 2 3 4
i i r
1 1 1 1
1 2 3 4 5 1 2 3
A B C
Figure 13. Relative luciferase gene activity directed by the SV40 promoter and LTR with
different number o f enhancer repeats. The LTR was placed downstream o f the luciferase
reporter gene in the 5’-3’orientation. The structure of the general construct is shown on
the top of the panel. LTR- denotes the construct without LTR, FRA for the construct with
FRA-LTR, and 2R, 3R and 4R for the enhancer duplication, triplication, and
quadruplication, respectively. The arrow indicates the orientation of the LTR. The
reporter constructs were transfected into H927 (A), K562 (B), and FL-74 (C) cells. The
bars are pooled results from at least 3 independent experiments and shown in parenthesis
as values relative to the luciferase activity of the FRA-LTR-SV40-luciferase control. The
FRA LTR activity was set at 1.00. The standard deviations are indicated.
54
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
— — ► -| -----
SV40
promoter
luc+ LTR poly(A)
Relative Activity
V & (0.23) & (0.25) E h (0.68)
I R Q
(1.00) Eh (1.00) □ (1.00)
2R E 3 - (1.05) - (1.45)1 - f (1.70)
3R (4.71) ' (2.57) (4.45)
4R E}
(1.17) (1.36) & (1.51)
I i I ! i I
1 2 34 5 6
i —i —i —i
123
i i i \ i i i
1 2 3 4 5 6
A B C
Figure 14. Relative luciferase gene activity directed by the SV40 promoter and LTR with
different number of enhancer repeats. The LTR was placed downstream of the luciferase
reporter gene in the 3’-5’ orientation. The structure of the general construct is shown on
the top of the panel. Other descriptions are as in the legend o f Fig. 13.
55
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
1 2
29kb
24kb
17kb
8.2kb
A B
Figure 15. Southern analysis performed with YLpnWstl fragment of FRA-LTR as the
probe. A) Detection of the proviral LTR species in the tumor 5025 DNA. Lanes: 1)
normal SPF fetus; 2) tumor 5023; 3) tumor 5025. Genomic DNA was digested with PM
and Kpnl and separated in a 2% low melting agarose gel. The lower arrow indicates the
size estimated for a product with single enhancer. The upper arrow indicates the size
estimated for enhancer triplication. B) Analysis o f the number of proviruses in the same
tumor DNA. Lanes: 1) tumor 5025; 2) normal SPF cat fetus. Genomic DNA was digested
with EcoRl and separated in a 0.8% agarose gel. About 15-20 bands ranging from 8.4 kb
up to more than 30 kb were detected in the tumor DNA (lane 1) while normal cat DNA
(lane 2) served as control showing no detectable bands. The molecular weight markers
are indicated at right.
56
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
these integrants, complete or deleted, are likely to retain enhancer triplication in the
LTRs.
Discussion
Multiple virological events, such as env gene recombination between exogenous
and endogenous virus elements, alterations in the U3 region of the virus genome, and
insertional mutagenesis o f cellular genes, have been implicated in FeLV-induced
leukemia-lymphomas in the domestic cats (Bechtel et al., 1998; Chen et al., 1998; Roy-
Burman, 1996; Sheets et al., 1993; Tsatsanis et al., 1994). Previous reports indicated that
a large fraction of proviruses in many FeLV-induced T-cell malignancies might contain
LTRs with enhancer repeats, mainly double or triple motifs encompassing the enhancer
core sequence in the U3 region (Fulton et al., 1990; Matsumoto et al., 1992; Rohn and
Overbaugh, 1995). In some multicentric non-T-cell, non-B-cell lymphomsarcomas, a 21-
bp sequence, encompassing a protein binding site (FLV-1), is found to be triplicated
downstream of a single copy of the enhancer in FeLV proviruses (Athas et al., 1995a;
Athas et al., 1995b; Levesque et al., 1990). Although this triplication contribute to
enhancer function in vitro preferentially in a primitive hematopoitic cell line (Athas et al.,
1995b), substitution of such LTR into Moloney murine leukemia virus, however, does
not appear to alter or expand the T-cell lymphosarcoma inducibility of the mouse virus in
vivo (Starkey et al., 1998). Direct repeats of 40 to 74 bp in the upstream region of the
LTR are also frequently found in FeLVs cloned from acute myeloid leukemia. This
repetitive sequence appears to confer an enhancer function upon gene expression in
myeloid cells (Nishigaki et al., 1997).
57
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
While these findings o f LTR alterations have direct implications in FeLV
pathogenesis, there were difficulties in ascertaining the origin of the viral species with U3
alterations. Since all previous inocula were virion populations, existence o f minor virus
populations with modifications in the U3 region that might have been selected in vivo
could not be ruled out. This dilemma, at least in the case of enhancer repeats in thymic
lymphosarcomas, has been resolved first by our recent study in which enhancer
triplication was noted in a thymic lymphosarcoma induced by direct inoculation of
proviral DNA o f a molecular clone o f FeLV-A into the cat (Chen et al., 1998), and here
by documentation of a similar phenomena in other cats administered with proviral DNA
of another FeLV-A molecular clone. While the parental proviruses, FRA and F6A,
contained only a single copy o f enhancer element, three of the total o f eight thymic
lymphosarcomas (one from FRA cats, two from F6A cats) carried enlarged U3 region.
Structural analyses o f this repetitive enhancer region revealed two or more copies of
sequences ranging in sizes of 30 bp to 79 bp surrounding the “core enhancer” domain.
Thus conclusive proof has now been obtained for the de novo generation o f repetitive
enhancer elements in FeLV-related thymic lymphomagenesis.
Our functional studies of the cloned LTRs from one tumor with different number
of repeats o f a given stretch of enhancer domain provide another interesting information.
While the results of transcription promotion and enhancement studies with the luciferase
reporter gene constructs are generally in agreement with the previous reports of activities
o f FeLV proviral LTRs (Fulton et al., 1990; Matsumoto et al., 1992), we identified
another aspect which may be critical in FeLV lymphomagenesis. Although LTR species
containing a 38 bp duplication, triplication or quadruplication around the core enhancer
58
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
element were cloned from the thymic tumor DNA o f cat 5025, the species with the triple
enhancers was the most abundant species in this tumor DNA. Assuming that there may
be a correlation between in vitro reporter gene activity and the in vivo viral replication
efficiency, the preferential selection o f three repeats in the tumor tissue did not
correspond very well with the observed luciferase activities. We found that, while the
transcription promotion activity o f the various LTR constructs varied with the cell type,
in all cases, the activity was the highest with the LTR harboring four enhancer repeats
followed by two repeats, three repeats and single copy enhancer, in this descending order.
In contrast to the transcription promotion results, the three repeat structure was found to
be most robust in activity in enhancing a foreign promoter-driven reporter activity when
linked downstream o f the reporter in the opposite orientation. However, when linked
downstream but in the same orientation with the reporter, the four repeats, not the three
repeats, exhibited stronger enhancing activity. In this regard, it is noteworthy that the flvi-
2 gene insertional activation in thymic tumors induced by FeLV is found to be largely
associated with downstream proviruses in either orientation (Levy et al., 1993b; Neil et
al., 1991). However, every tumor appears to have an individual characteristic in terms of
provirus integration site and orientation in the vicinity of a given cellular gene. A major
defining factor for these parameters is obviously the random event of integration and
clonal selection of tumor cells with strong activation of relevant proto-oncogenes. In
addition, here we raise the possibility that dependent on the specific nature of LTR
enhancer expansion, there may be an advantage for the tumor cell to select a certain
enhancer repeat numbers over others. In other words, it is likely that multiple selective
pressures may determine the enhancer repeat number in FeLV lymphomagenesis.
59
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Biochemical parameters o f these natural selection processes, conceivably, may relate to
binding and spacing of interacting proteins to the specific stretch expanded, DNA folding
or looping, and other factors. Although the underlying molecular mechanisms for the
observed selection of three repeats o f 38 bp enhancer domain in the thymic tumor of cat
5025 remain undefined, our findings should instill motivation for such analyses.
60
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
CHAPTER 4
A COMMON PROVIRAL INTEGRATION SITE, cit-l, IN FELINE LEUKEMIA
VIRUS INDUCED THYMIC LYMPHOSARCOMA
Abstract
We have identified a new proviral integration site, named cit-l, from an
experimentally induced thymic lymphosarcoma. Among 27 FeLV positive, naturally
occurring or experimentally induced tumors examined, 3 of 18 thymic lymphosarcomas
demonstrated viral integration within the cit-l locus whereas none o f the 4 alimentary
and 5 multicentral lymphosarcomas showed the gene rearrangement. One o f the three
thymic tumors was experimentally induced and harbored an FeLV integration in the c-
myc gene, the other two tumors were naturally occurring and no proviral insertion into c-
myc was detected. Therefore, no causal collaborating relationship was identified between
cit-l gene and c-myc. Extensive sequence analysis and database searching failed to
identify cit-l with any known gene based on nucleotide or amino acid sequences. Exon
trapping system and Northern blot analysis were employed to study the coding potential
of this locus. In the original tumor from which cit-l was isolated, the gene is in the same
transcriptional orientation with respect to the pro virus. In addition, two cit-l transcripts of
approximately 4.7 kb and 1.7 kb were overexpressed in a feline T lymphoma cell line,
FL-74, where alteration of this locus was also observed in its genome. These results
indicated that cit-l may encode a novel gene that is important in the induction of T-cell
tumors.
61
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Introduction
Proviral integration into the host genome is a natural step in the viral life cycle.
Early findings have shown that retroviruses insert into the genome with little selectivity
for host sequences (Shih et al., 1988). However, proviruses isolated from tumors have
been found frequently around certain genetic loci. This paradoxical specificity o f proviral
insertion suggested a process o f selection of cells harboring these proviral integration
sites. The notion that insertional mutagenesis is involved in the multistep process of
retroviral pathogenesis has led to the discovery of many proto-oncogenes and the
understanding o f gene interaction and regulation. For example, the identification o f the c-
myc proto-oncogene activation by proviral integration in ALV-induced bursal
lymphomas for the first time (Hayward et al., 1981) initiated the extensive researches o f
this oncogene and many others. Studies with rodents have also identified a large number
of integration sites by murine leukemia virus (MuLV), such as mlvi-I to mlvi-4, fim -1 to
fim-3, pim-1, fis-1, gin-1, evi-1, evi-2, int-1 to int 3, et al (Bordereaux et al., 1987;
Buchberg et al., 1988; Cuypers et al., 1984; Koehne et al., 1989; Moreau-Gachelin et al.,
1988; Mucenski et al., 1988; Silver and Kozak, 1986; Sola et al., 1988; Tsichlis et al.,
1985; Vijaya et al., 1987; Villemur et al., 1987).
Compared to the MuLV studies, only a few feline leukemia virus (FeLV)
integration sites have been identified. FeLV is a replication-competent type C retrovirus
that is associated in domestic cats with neoplastic diseases, of which T-cell
lymphosarcoma is the most common form (Neil et al., 1991; Roy-Burman, 1996). Like
other mammalian leukemia retroviruses, FeLV does not carry any transforming gene in
its genome. One mechanism of FeLV tumorigensis is believed to be due to the
62
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
interactions between viral and host genetic information, such as insertional mutagenesis
(Neil et al., 1991; Roy-Burman, 1996). Early researches have gathered evidence
indicating that in about 32% o f field studies, c-myc proto-oncogene was activated by
either viral tranduction or proviral insertional mutagenesis (Levy et al., 1984; Neil et al.,
1984; Tsatsanis et al., 1994). By studying the genetic loci interrupted by proviruses in
tumors induced by FeLV-myc viruses, two other common integration sites were isolated.
One of these was flvi-2 that was interrupted by FeLV in about 24% thymic tumors (Levy
and Lobelle-Rich, 1992; Levy et al., 1993b; Tsatsanis et al., 1994). Flvi-2 was later
proved to be a feline homologue o f bmi-1, which encoded a gene for a nuclear protein of
the zinc finger family (Haupt et al., 1991; Levy et al., 1993a; van Lohuizen et al., 1991).
Since the bmi-1 gene was first discovered as a common proviral integration site in B cell
lymphomas in Efi-myc transgenic mice infected with Moloney MuLV, it has been
speculated that the bmi-1 gene product may act as a myc collaborator in the induction of
B- and T-cell lymphomas (Athas et al., 1994; van Lohuizen et al., 1991). Another site,/?f-
1, was only shown in a small number of tumors (8%) to be interrupted by integration,
whose coding potential has not been characterized (Tsujimoto et al., 1993). Overall,
FeLV integration sites were only identified in about 50% thymic tumors, and little is
known in the remaining half. In this regard, we initiated the present study and
characterized a new common integration site by FeLV in thymic tumors.
63
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Materials and Methods
Subeenomic cloninz
Genomic DNA was purified from the thymic tumor tissue of cat 4746-5, which
was challenged by a FeLV-A Rickard plasma preparation and a mixture o f in vitro-
generated recombinant FeLV (rFeLV) (Pandey et al., 1995; Sheets et al., 1992). Since
.EcoRI does not cut into FeLV proviruses, a subgenomic library was constructed by
ligation of 8- to 20-kb iscoRI fragments to the X DASH II phagemid (Strategene, La
Jolla, Calif.) vector. The exU3 , which is specific for the U3 region o f all known
exogenous FeLV long terminal repeat (LTR) sequences (Casey et al., 1981; Mullins et
al., 1986), was used as a probe to screen the phage library. Proviral clones containing cat
genomic sequences were identified and subcloned into pBluescript (pBS) (Stratagene)
vector. One o f the clones, A5, was determined later in our study to harbor a frequently
targeted genetic locus by FeLV integration by Southern blotting analysis. For further
sequence analysis, 5' cellular sequence of A5 was subcloned into EcoRL-Kpnl site of pBS
vector, and 3' cellular region was first cloned into the Kpnl-Kpnl site o f pBS vector and
then subsequently cloned into Kpnl-HindUl and HindlTL-Kpnl sites o f pBS vectors,
respectively.
Nucleotide sequencing and primers
Sequences within individual fragment subcloned from the A5 plasmid were
determined first by primers T3 and T7 on the pBS vector. Multiple primers were
subsequently designed based on these sequences for further sequenc analysis. Automated
cycle sequencing were performed as described previously (chapter 2).
64
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Southern blotting
A number o f naturally occurring or experimentally induced thymic, alimentary, or
multicentric lymphosarcomas were included for southern analysis. DNAs (10 ug) were
digested with either SStl or EcoRI and separated in 0.8% agarose gels. The DNAs were
then transferred to Nylon membranes (MSI) and hybridized with the 5' EcoRI-Kpnl
cellular fragment o f A5 clone in hybridization solution (Gibco-BRL) at 42°C overnight.
Blots were washed with 2 x SSC-0.1% SDS once at room temperature and 0.1 x SSC-
0.1% SDS at 50°C twice and then exposed at - 80°C to Kodak XRP film with double
intensifying screens. The blots that contain the DNA samples with cit-l locus
rearrangement were stripped and hybridized to the exU3 probe. One of the membrane
was also stripped and hybridized with a bmi-1 probe, Ht2 (Levy et al., 1993a).
Genomic DNA was also purified from FL-74 cells using the buffer containing 100
mM NaCl, 10 mM Tris-HCl (pH = 8.0), 25 mM EDTA, 0.5% SDS, O.lmg/ml proteinase
K at 50°C. DNAs from the normal SPF fetus tissue and FL-74 cells were treated with
Xhol, £coRI or Sstl and hybridized with the 900 bp sequence obtained using exon
trapping system. Southern analysis was carried out as described above.
Exon trapping analysis
The pSPL3 vector (Gibco-BRL) used in this analysis is an exon tapping vector
that contains splice donor (SD) and splice acceptor (SA) sequences from HIV tat gene.
The 5'- or 3'-cellular regions o f clone A5 was inserted into Pstl site or Xhol site of pSPL3
vector in both sense and antisense orientations, respectively. The Pstl sites on the pBS
vector and the 5' proviral LTR region were used to clone the 5' cellular sequence. The 3'
Xhol cellular fragment was obtained using the restriction sites on the pBS vector that
65
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
contains the 3' Kpnl cellular fragment as described above. The transfections, RNA
isolation, RT-PCR and cloning were carried out following the manufacturer's instruction
(Gibco-BRL). The trapped exon was then analyzed by autosequencing using the SD2
primers(Gibco-BRL).
Northern blotting
Total cellular RNA was isolated from feline H927 fibroblastic cells and feline FL-
74 cells, a T-tumor cell line that was chronically infected with FeLV subgroup A, B, and
C. Message RNA (mRNA) was prepared from the total RNA o f H927 and FL-74 cells
using mRNA mini kit (Qiagen). RNA samples (20 ug total cellular RNA or 5 ug mRNA)
were subjected to electrophoresis in agarose/formaldehyde gels and transferred to nylon
membranes (MSI). The membranes were first hybridized to a human P-actin cDNA probe
in 50% formamide, 5 x SSC, 10 x Denhardt’ s, NaH2P04, 0.1% SDS at 42°C overnight,
washed and exposed as described in the Southern blotting. The same membranes were
then stripped and hybridized to the trapped exon fragment and washed as described
above.
Results
Identification o f a new FeLV proviral integration site in a thymic tumor
The insertional mutagenesis hypothesis implicates that slow retroviruses, which
do not carry oncogenes in their genomes, induce tumors by integrations into particular
loci in host DNA thereby interrupting expressions of normal cellular genes. Consistent
findings of proviral sequences around the same locus in different tumors suggest this
locus may encode a gene that is important in the multistep process o f tumorigenesis. To
66
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
search for such loci, cloning o f proviral integration sites from one thymic tumor was
attempted. A phagemid DNA library was established by linking X DASH II vector to the
EcoKL digested genomic DNA fragments that were prepared from a thymic tumor of cat
4746-5. This cat had been challenged by a FeLV-A Rickard plasma preparation and a
mixture of in vitro-generated recombinant FeLV (rFeLV) (Pandey et al., 1995; Sheets et
al., 1992). EcoKL restriction enzyme was used to obtain the proviral sequences along with
the cellular flanking regions because there was no EcoKL restriction site in all known
FeLV proviral clones. The resulting phage DNA library was then screened with the exU3
that is specific for all known exogenous FeLV long terminal repeat (LTR) sequences
(Casey et al., 1981; Mullins et al., 1986).
With this strategy, two integration sites were identified. These two fragments in X
DASH II were subsequently cloned into the EcoKL site o f pBluescript (pBS) KS vector.
Sequence analysis revealed that c-myc gene resided in one of the cloned integration sites.
A few hundreds base pair nucleotide sequence for the other integration site, however, was
not informative. This clone was named as A5 and the restriction enzyme site map is
shown in Fig. 16.
To facilitate identification of the cloned integration site carried by clone A5, its 5’
cellular region was ligated to EcoRL-Kpnl site o f pBS, and the 3’ cellular region to the
KpnL-KpnL site. The sequence between the 5’ cellular KpriL site and the junction of
proviral integration was PCR amplified using the sequence information obtained from the
EcoRI-Kpnl cellular region and primer RB42 (Chen et al., 1998) complementary to the 5’
LTR region. The PCR product was sequenced directly. The clone containing 3’ cellular
region was further cut into two pieces and cloned into KpnL-HindLLL and HindKL-KpnL
67
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
sites o f pBS. Sequences within different fragments were determined first by primers on
the pBS vector. Then various primers were designed based on these sequences for
progressive DNA sequencing. Fig. 16. illustrates cloning strategy and the portions of A5
that were sequenced.
The 5' LTR of pro virus was sequenced with a viral specific primer RB42 that is
conserved between endogenous and exogenous FeLVs. The comparison of the sequence
with that of F6A revealed that A5 harbored a exogenous virus containing a 73 bp direct
repeat around LTR core region (Fig. 17). PCR amplification of the env gene using the
primers RB52 and RB59 (Sheets et al., 1993) that are specific for the exogenous FeLV
env was carried out (data not shown) and confirmed A5 carried the FeLV-A provirus.
These two lines o f evidence indicate that the cloned provirus is exogenous in origin and
kept in the cat genome during the tumor formation.
Clone A5 carried about 6.5 kb cellular sequence with 2 kb flanking the 5' provirus
and 4.5 kb downstream of the 3' provirus. Approximately 4 kb nucleotides, including the
entire 5' cellular region (based on the orientation of the pro virus) and part of the 3'
cellular region, were sequenced. Extensive search using the Genbank Blast database only
showed a high homology o f 54 and 50 bp with Felis catus clone Fca550 and Fcal8
microsatellite sequences that are scattered on the chromosomes B1 and X, respectively
(Menotti-Raymond et al., 1999).
Examination o f the integration locus in the DNAs o f other FeLV-induced tumors
If the cloned integration site was involved in the induction of tumors by FeLV,
then it is likely that this particular locus could also be interrupted by pro viruses in other
68
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Reproduced with permission o f th e copyright owner. Further reproduction prohibited without permission.
o\
N O
PE K P S s K H EXK
i i i * * ***
P r o v i r u s 3 ’ p B S
EXK
- n r - _ u ♦ — t a _
E K P 3’ v P B S
TTp b s
K PB S
Figure 16. Schematic representation of clone A5 and strategy o f subcloning into pBS vector. The empty boxes indicate the
cellular regions flanking the cloned proviral sequence, which is shown in dashed box. The orientation of the provirus is as
shown. The 5 cellular fragment was cloned into EcoRl-Kpnl sites o f pBS. The 3 cellular region was first cloned into pBS
using the Kpn\ sites on the original pBS vector and on the 3 LTR region. Subsequently, the 3 cellular fragment was double
digested into two pieces with Kpnl and Hindlll and cloned into another pBS vector, respectively. The solid lines represent
the first pBS vector, and the broken lines indicates the vectors used for subcloning. Symbols: E, EcoKL; K, Kpnl; H, Hindlll;
P, Pstl; X, Xhol; S, Sstl.
F6A A5
— 400 b p
— 300 b p
A
-2 7 4
I
F G A T nC K 2W 3I!iaX 3rraJZ K rG K 3aX IW 33W m X 3X 3B C nW U £2& 3a2aX X !G
A5 TI^U lJA ftGI^ l ^ T C X X ^ A !IX3\GM30^QGg\aGrraGgy^ a i^aAAflCaQ3^33\3CT^
a s TOGrmftXAXTOGGmx i a ^ 'i t a G g c x a fta ^ ^ g ria A ftx o a a G g m m ^ o G
F6A T B AA CBG CR GA fiG FI T
A5 @ftAfiCRGC»GaflCTTT
B
Figure 17. Structure of the cloned proviral LTR. (A) PCR amplification of the cloned
proviral LTR using the primer set RB84 and RB42. The templates for the PCR reaction
are shown on the top. Molecular weights are marked at the right. (B) Sequence
comparison of the cloned proviral LTR and F6A. The sequences in the solid box
indicates the 73 bp duplication in the cloned proviral LTR around the core region that is
underlined. The number on the top of sequence denotes the relative distance of the
nucleotide to the CAP site.
70
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
independent FeLV-induced tumors. To test this possibility, in addition to the tumor from
cat 4746-5, we recruited twenty naturally occurring FeLV-related tumors and six
experimentally induced tumors. Among those, 18 are thymic lymphosarcomas (LSA-T),
4 are alimentary lymphosarcomas (LSA-A), and 5 are multicentric lymphosarcomas
(LSA-M).
High molecular weight DNAs were isolated from these tumor tissues and digested
with either Sstl or EcoRl. Sstl cuts twice in FeLV genome at the positions 634 and 3738
according to the F6A sequence, and EcoRI does not cut FeLV provirus at all. DNA
fragments were separated in 0.8% agarose gels and hybridized to the probe representing
the sequence o f 5' cellular EcoRI-Kpnl region of clone A5. As shown in Fig. 18, the
probe recognized normal EcoRl fragments o f approximately 6.4 kb in SPF fetus and all
tumor tissues. In the P6 tumor DNA, an additional 8.5 kb fragment was identified
indicating probably the insertion o f a truncated proviral sequence. Similarly, while the
same probe recognized normal cellular Sstl fragments of approximately 9.4 kb in the
normal and tumor tissues, altered fragments of 7.5 kb and 4.0 kb were also identified in
the P15 and 4746-5 tumor DNAs, respectively. Therefore, including the original tumor
where the A5 was cloned, three independent tumors showed rearrangement around this
locus. Meanwhile, the membranes that had DNA samples from tumors 4746-5 and P I5
were stripped and rehybridized with the exU3 probe. This exogenous-specific proviral
LTR probe also identified the additional bands aside from the normal cellular fragments.
These results indicated that the integration site carried by clone A5 is a common proviral
integration site in FeLV-induced tumors. We name this locus as cit-l, an acronym for cat
integration site in thymic tumor-1.
71
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
To exclude the possibility that cit-1 may carry a known proviral integration site in
the unsequenced region, several Sstl digested SPF and tumor DNAs were hybridized to
the bmi-1 cDNA probe (Levy et al., 1993a). A 12 kb germline fragment instead o f the 9.4
kb cit-1 band was detected (data not shown). In addition, it has been reported that EcoKL
fit-1 fragment is about 2.3 kb whereas cit-1 EcoKL fragment is about 6.4 kb. Therefore,
we believe that cit-1 is a novel integration site identified in FeLV-induced T-cell tumors.
Identification o f transcription votential o f the cit-1 locus usine exon trapping system
Extensive searching in the Genbank blast database with the known cit-1 sequence
was not revealing. It is most likely that cit-\ encodes a novel gene. To isolate coding
sequences from this locus, exon trapping system (Gibco-BRL) was employed. The
splicing vector, pSPL3, contains an SV40 segment designed for replication and
transcription in COS-7 cells and HIV tat splicing signals serving as splice donor (SD) and
splice acceptor (SA) sites. The 5' cit-1 cellular sequence was inserted into pSPL3 vector
at both directions using the Pstl sites on the pBS vector and the 5' proviral LTR region.
The 3' cellular region was subcloned from the Kpnl-Kpnl fragment in pBS vector as
described above using the Xhol sites on the pBS vector. Fig. 19A schematically
represents the detail o f the construction of exon trapping plasmids. These constructs were
then transfected into COS-7 ceils with lipofectamine. Twenty-four hours after
transfection, the total RNA was isolated and RT-PCR was carried out using the primers
provided by the manufacture. A potential exon o f 900 bp was identified from the 5’
cellular region at the same orientation as the pro virus (Fig. 4B) and cloned into pAMPIO
vector (Gibco-BRL). Sequence analysis indicated that this potential exon started from -
1494 to -670 upstream of the 5' proviral integration junction in the cloned cit-l locus (the
72
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
N 4746-5 N P6 N P15
Sstl Sstl EcoRI
A B C
Figure 18. Southern blot analysis of the common proviral integration site in T-cell
tumors. High molecular weight DNA was isolated from thymic tumors that were either
naturally occurring (cat P6 and P I5) or experimentally induced (cat 4746-5). DNA
samples (lOug) were digested with either Sstl (panel A and B) or EcoRI (panel C),
separated in a 0.8% agarose gels, and transferred to nylon membranes. The resulting
filters were then hybridized to a probe representing the 5' EcoRI-Kpnl cellular region of
clone A5. DNA from a SPF cat fetus tissue was included as a negative control. Molecular
weight markers are indicated. In the panel A and B, the upper arrows denote the
uninterrupted cellular fragments, and lower arrows indicate the rearranged regions due to
proviral integrations, and vice versa in the panel C.
73
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Figure 19. Isolation, of transcribed sequence from c/Y-1 locus by exon trapping. (A)
Schematic representation of the exon trapping constructs. The empty boxes indicate the
cellular regions flanking the cloned proviral sequence. The dashed box indicates the
pro virus. The 5' and 3' o f the provirus are shown. The 5' cellular fragment was cloned
into pSPL3 using the Pstl sites in the 5' proviral LTR region and on the pBS vector. The
clone containing the 3' cellular fragment was used for the construction of the 3' cellular
region into pSPL3. ThsX hol sites carried from the original pBS vector and on the second
pBS vector were used to ligate the 3' cellular fragment to pSPL3. The horizontal arrows
represent the orientations of fragments in pSPL3. The constructs are named from A to D.
Symbols: E, EcoKL; K, Kpnl; H, HindUI; P, Pstl; X, Xhol. (B) Analysis o f exon trapping
products by gel electrophoresis. RT-PCR was performed on the total RNA isolated from
the COS-7 cells 24 hours after transfection with individual plasmid DNA A to D and
empty pSPL3 vector. The constructs used for transfection are indicated on top of the
agarose gel. Lane (+) is the RT-PCR product o f 244 bp obtained from cells that were
transfected with a control plasmid DNA provided by the manufacturer; lane V i is the
products from cells that were transfected with empty pSPL3 vector; lane V 2 is the same
RT-PCR reaction as lane V 1 but the RT products were treated with Bstl restriction
enzyme before PCR reaction to reduce non-specific PCR products. M represents the 100
bp molecular weight marker. The arrow indicates the trapped exon from construct B.
74
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
VI
P Q
Q<
VI
«
o -
fc k
• PM
o
u
H *
M *
X
X !
X X
k - X
U
X
rv
IT)
wVjJ.
0k T <«- C k
«
75
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
B
M B D V x
M
76
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
first 5’ proviral nucleotide was designed +1). No coding sequence was able to be trapped
from the 3' cellular region.
Cit-l expression in feline cells
To assess the expression of cit-1, a Northern blot of poly (A*) RNA from different
cell lines was hybridized with the trapped exon sequence. Two transcripts o f 4.7 kb and
1.7 kb were detected in the FL-74 cells, a feline T-tumor cell line that was chronically
infected with FeLV subgroup A, B, and C. Barely detectable levels of these transcripts
were expressed in H927 cells, a feline fibroblastic cell line (Fig. 20). Because we stripped
the membrane o f P-actin and rehybridized it with the cit-1 probe, the p-actin signal
reappeared on the membrane after extensive exposure, underscoring the lower abundance
o f cit-1 message comparing to that of P-actin.
Rearrangement o f cit-l locus in FL-74 cells
The finding o f gene rearrangement around the cit-l locus in 3 of 18 thymic
tumors examined and the observation o f cit-l gene over-expression in one FeLV infected
T-lymphoma cell line raised the question that whether this locus was also interrupted by
the virus in FL-74 cells. Genomic DNAs from FL-74 cells and a normal SPF fetus tissue
were digested by Xhol restriction enzyme and hybridized with the trapped exon sequence.
Interestingly, the Xhol fragment of cit-l locus shifted in FL-74 cells compared to that in
the normal tissue (Fig. 21).
77
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
H927 FL-74
P-actin
Figure 20. Detection o f the cit- 1 transcripts in feline cell lines by Northern blot analysis.
Polyadenylylated RNA was hybridized to a 3 2 P-labeled probe representing the 900 bp
sequence that was obtained from exon trapping system. The estimated size for the
transcript is shown at right. The sources of mRNA are marked at the top. The same
membrane that was hybridized with P-actin is also shown.
78
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
N FL-74
Figure 21. Detection of gene rearrangement around cit-1 locus in FL-74 cells. Genomic
DNA (10 ug) purified from a SPF cat fetus tissue and FL-74 cells were digested with
Xhol restriction enzyme and subject to electrophoresis on a 0.8% agarose gel. The DNAs
were then hybridized to the radio-labeled probe representing the trapped exon sequences.
The approximate molecular weight of individual band is marked at the right. N stands for
genomic DNA isolated from a normal SPF cat fetus.
79
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Discussion
One mechanism o f slow retroviral tumorigenesis is proposed as insertional
mutagenesis where a provirus insert near a cellular gene that is important for cell
differentiation or proliferation and lead to aberrant cellular gene expression. One feature
o f these pro viruses is that most o f them bear changes within the long terminal repeat
(LTR) region, most often enhancer duplication or triplication. As a representative o f this
virus family, FeLV has been found to target certain genetic loci in lymphosarcomas o f T-
cell origin, such as c-myc,flvi-2. The study here reported the identification of another
common integration site by FeLV, named cit-l, in thymic tumors.
Cit-l locus was isolated from the experimentally induced thymic tumor of cat
4746-5 that had been challenged by FeLV Rickard strain subgroup A and a mixture of
rFeLV prepared in vitro (Pandey et al., 1995; Sheets et al., 1992). The provirus that
resides within this locus is confirmed to be exogenous FeLV-A and contains an enhancer
duplication of 73 bp around the core region. Potential exon sequence was identified using
exon trapping system from the cellular region upstream o f the 5' provirus and is
orientated in the same transcriptional direction with respect to the virus. It is most likely
that the proviral integration in this tumor increased the expression level of a gene
upstream of the viral integration site. However, limited to the availability of the original
tumor, we could not compare the expression levels of cit- 1 gene in the tumor of cat 4746-
5 and normal tissue.
Approximately 4 kb region of the cloned c/7-1 locus has been sequenced, and
extensive Genbank database search didn't reveal high homology o f c/7-1 with any known
gene in nucleotide or amino acid sequences. Probes for FeLV integration sites that was
80
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
reported earlier (flvi-2 and fit-1) were also shown to light up different germline fragments
from cit-l probe. Therefore, cit-1 is a new FeLV integration site identified, and it
probably encodes a novel gene.
Interestingly, including the original tumor from where the cit-l locus was
isolated, the FeLV integration was observed in 3 of 18 (17%) thymic tumors examined.
Among these, the tumor from cat 4746-5 is experimentally induced and harbor proviral
insertion near c-myc gene. The tumors of P6 and P15 were naturally occurring thymic
tumors and contain no FeLV integration around c-myc (our unpublished data?). These
results indicate that (i) proviral integration into cit-l locus is not a random event, and it
has been selected during the tumor formation; (ii) unlike flvi-2 or fit- 1, cit-l gene product
may not have a direct collaborating function with c-myc.
Our study also identified a potential exon sequence o f 900 bp within c/Y -1 locus.
Northern analysis indicates that the cit-l transcripts are about 4.7 kb and 1.7 kb in length.
The reason that cit-l locus encodes two transcripts is still under investigation, and we
speculate that they may result from different splicing processes. Moreover, the expression
level of cit-l gene is much higher in FL-74 cells, a feline T-lymphoma cell line that are
chronically infected with FeLV subgroup A, B, and C viruses, than that in H927 cells, a
feline fibroblastic cell line. Southern blotting analysis of Xhol genomic DNA fragment in
FL-74 cells revealed gene rearrangement around cit-l locus. This change may results
from integration of defective proviral sequence considering the virus producing feature of
FL-74 cells or mutations within this region considering the observation documented in a
cell line.
81
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
The present study demonstrated that cit-1 locus identified as a frequently targeted
genetic site for FeLV encodes a novel gene that may play a role in the induction of T-cell
lymphomas. In view of the cit-\ over expression in one T lymphoma cell line tested, it
becomes important to identify the complete coding sequence of this gene and extend its
functional study in T cell tumor induction in other species, such as human.
82
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
CHAPTERS
CONCLUSIONS AND FUTURE DIRECTIONS
Conclusions
The primary goal of the work described in this dissertation was to gain a better
understanding o f in vivo generation o f FeLV variants and their biological functions as
well as host-virus interactions through insertional mutagenesis. The specific points that
can be addressed by the present studies are: (i) deletions of env gene could arise de novo
from exogenous viruses, and the resulting env gene products dominate the viral profile in
FeLV-induced thymic lymphomas; (ii) this phenomenon may be partly explained by
selective cytopathicity in vitro o f such a truncated env protein on non-T cells; (iii)
proviral LTRs with enhancer repeats indeed generated from a single LTR, and the
number o f enhancer repeats may reflect the diverse selective pressures during the T-cell
tumorigenesis; (iv) a new proviral integration site cit- 1 may encode a gene that is
activated by a provirus containing enhancer amplification, and this gene may play an
important role in thymic tumor formation.
A unique feature of retroviruses is their capability to generate a large genetic
diversity. However, the reason certain genetic variants to survive viral evolution is
attributed to the selection pressures during the tumorigenesis. It has been reported that a
cluster of viruses with mutations, deletions and insertions within their env gene exists,
and the viruses containing truncated env compose the majority o f the mixture of viruses
(Rohn et al., 1994). Repeated detection o f various env mutants by PCR analysis from
different thymic tumors induced by molecular clones o f FeLV subgroup A, FRA and
83
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
F6A, not only provided a direct evidence that changes within env gene derived de novo,
but also implicated a growth advantage that may be conferred to T-tumor cells by the
mutant env gene products. Expression o f one such truncated env (tenv) gene using
retroviral vector demonstrated cytotoxic activity to different cells, but not to T-cells. In
one B-cell line (Raji) tested, tenv expression induced cell aggregation formation and cell
death probably by the mechanism of apoptosis. The observed selective cytopathicity of
tenv suggests its possible role in tumor formation. T-cell expressing Xenv may be resistant
to the tenv cytotoxicity, however, other cells such as B-cells and fibroblastic cells may be
vulnerable to its killing effect. This selective toxicity will be very important in the
differentiation step for B-cell depletion or in the process of metastasis to destroy the
texture of connective tissue. In support o f this hypothesis, coculture of B-cells (Raji) or
fibroblastic cells (H927) with tenv expressing T-cells (CEM) reproduced a certain degree
of death in the cocultured cells. Failing to induce cell death in Raji and H927 cells by the
supernatant from te«v expressing CEM cells, suggests that this protein may anchor on the
cell membrane. It is interesting to note that Xenv bears structural similarity to MuLV
SFFV gp55, which is also a truncated env protein that is trapped in the ER complex and is
able to release cells from erythropoeitin dependent growth (Li et al., 1990; Ruscetti et al.,
1990). A common striking feature of gp55 is that, besides the internal deletion, each
isolate has a nucleotide insertion that results in a premature stop codon and therefore a
unique C-terminal end (Amanuma et al., 1983; Clark and Mak, 1983; W olff et al., 1983).
Recent experiments have demonstrated that the C-terminal instead of N-terminal o f gp55
protein defines its function (Gomez-Lucia et al., 1998). Similarly, sequence analysis
reveals that tenv has a large internal deletion and frameshift which gives rise to a
84
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
premature stop codon. Whether the C-terminal amino acids determine the unique
biological activity of Xenv like that in gp55 is still an open question.
The significance of this work is also manifested by the ability to clarify the origin
o f enhancer repeats that are frequently found in FeLVs isolated from thymic tumors.
Inoculation of plasmid DNA into newborn cats allows no chance o f prior alterations
within the proviral genome. The appearance of proviruses with enhancer amplification
from independent cat tumors drew a final conclusion that enhancer repeats indeed
generate de novo from a single LTR. Southern analysis o f the LTR species of one tumor
harboring enhancer expansion indicates that proviruses containing a 38 bp enhancer
triplication are the major variants. Interestingly, contrary to what we assumed, the LTR
with enhancer triplication could not elicit the highest transcriptional and enhancer activity
in vitro except when it was placed in an anti-sense orientation regarding to the reporter
gene. In this direction, the triplicated LTR also functioned preferentially in feline cells
(H927 and FL-74) instead of human hematopoitic cells (K562). It is noteworthy that the
proviruses involved in insertional mutagenesis using enhancer insertion mechanism are
always oriented nonrandomly despite that the enhancers are classically orientation
independent. In combination with the fact that proviruses with LTR triplication compose
the major population in the tumor, the disparity of in vitro transcriptional and enhancer
activity may imply that the selective pressures shape the viral population. The provirus
containing LTR duplication and quadruplication may be advanced in their ability to drive
the viral gene expression, whereas the LTRs with enhancer triplication may be more
robust to exert enhancer effects on an adjacent cellular gene promoter in an opposite
orientation in the given tumor.
85
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
In the context o f cellular gene regulation by proviral LTR elements, a new FeLV
integration site, cit-1, has been identified. Among the 18 thymic tumors examined, three
(17%) demonstrated gene rearrangement around this locus. None o f the alimentary and
multicentric lymphosarcomas examined harbors this change. The provirus in the cloned
czY -1 locus contains a direct enhancer repeat o f 73 bp, which implies that cit-l may be a
proto-oncogene and its expression may be up-regulated by viral LTR. This hypothesis is
further supported by the observations of cit-l gene overexpression in FL-74 cells where
changes within cit-l locus also exist in their genomic DNA. FL-74 is a T tumor cell line
that is chronically infected by FeLV subgroup A, B, and C viruses. Thus, the alterations
in the cit-l locus and its gene expression may be the result of proviral integration or
mutations within this region, and these changes may have a causal relationship with T-
cell tumor formation. In order to obtain the complete information on the cit-l gene, an
exon trapping system was employed and part o f cit-l transcript was identified. So far no
known gene matches the cit-l coding sequence, which indicates that this is a novel gene.
Currently, efforts are being made to characterize the complete gene coding information.
At the same time, it will be very interesting to study cit-l gene expression in the human T
tumor cells.
In summary, the work described in this dissertation has provided a conclusive
evidence for the de novo generation of FeLV variants. At the same time, several new
factors involved in FeLV lymphomagenesis have been identified and characterized.
Under the selective pressure, certain FeLV variants that contain advantageous mutations
emerge gradually from a mixture of viruses. Such variants are able to either help cells
that produce these viruses to undergo clonal expansion or migration to the other body
86
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
site, such as tenv variant, or drive viral proliferation to a higher level, such as LTR
variants with 38 bp enhancer duplication or quadruplication, or turn on cellular proto
oncogenes via their LTRs such as provirus containing a 38 bp enhancer triplication, and
in this regard, c/Y -1 is a candidate cellular gene for this type of regulation.
Future directions
Characterization o f tenv zene product and its interacting proteins
To study the mechanism o f tenv toxicity, it will be necessary to develop a tenv
protein detection system. However, the epitopes that can be recognized by the available
antibodies are encoded by the region missing from the tenv gene. To overcome this
problem, an octapeptide (flag epitode) was linked to the 3’ end o f tenv. Direct detection
o f tenv will be achieved by the detection of the tenv-flag fusion protein since anti-flag
antibody is commercially available. Introduction of this chimeric protein by retroviruses
into Raji cells again produced cell clusters 24 and 48 hours post infection. However, the
cell aggregation effects are not as striking as what we observed before. One explanation
would be that the addition o f 10 amino acids to this already small peptide may interfere
with its functioning. Problems we are now facing are the optimal working conditions for
tenv Western analysis. A particular type of gel might be suitable to resolve such small
sized product. With the ability to trace tenv protein, it will be interesting to examine the
expression and biological effects of this protein to primary hematopoitic cells.
It is well accepted that env protein is interacting with cell surface receptor.
Identification of tenv interacting protein will be very important for dissecting the
87
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
mechanism o f its function. Yeast two-hyb system may be used to identify the counterpart
o f tenv interaction.
Functional study o f full-length FeLV-B like recombinant env variants
FeLV-B subgroup is speculated as a proximal leukemogen as it is over presented
in diseased cats. Studies also demonstrated that recombinants with larger amount of
endogenous env sequences are gradually emerging as a predominant species toward the
later stage o f disease. Regarding mounted evidence of FeLV-B involvement in the
leukemogenesis, it becomes necessary to test the biological function o f recombinant env
on various cell lines and primary lymphocytes directly. Three full-length recombinant
envs with distinct 3’ crossover sites were engineered into a retroviral vector, pWZLneo.
Introducing viruses containing these env variants into various cell lines will allow us to
examine and compare their biological functions. Introducing these viruses to the cells
manifesting factor dependent growth will especially help to identify the variants that may
be able to confer cell factor independent growth.
Continuous characterization o f cit-l gene
Extensive Genbank database search indicates that c/Y -1 is a novel gene.
Overexpression of c/Y -1 in a T lymphoma cell line makes it interesting not only as a
common proviral integration site, but also as a proto-oncogene important in thymic tumor
formation. Efforts should be made to obtain full-length cDNA of c/Y-1. Limited by the
little information on the gene and higher background, Rapid amplification of cDNA ends
(RACE) was not successful. While continuos working on the RACE system, establishing
a cDNA library may be helpful. At the same time, it will be interesting to examine the
c/Y-1 expression in human cell lines o f different origin. If c/Y -1 is indeed an important
88
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
gene in cat lymphomagenesis, its expression may be also altered in human T tumor cells.
Once again, insertional mutagenesis will be proved as an important and efficient tool to
identify new proto-oncogene and new molecular interactions during cell growth and
differentiation.
Identification o f other senetic loci targeted by FeLV
Although identification of c/Y -1 helps better understanding on FeLV insertional
mutagenesis, more common genetic loci are still not uncovered if compared to the MuLV
system. For rapid isolation and identification o f these loci, different strategy may be used.
HindiII may be proved to be a useful enzyme for cat tumor genomic DNA fragmentation.
Hindlll cut twice (1780 and 6450 of FRA) within FeLV proviral genome and leave the
5’and 3’ LTRs intact with reasonably smaller sizes (1.7 kb and 2 kb). Establishing a
genomic DNA library and subsequent pBS vector subcloning can be simplified by using
ZAP Express Vector Excision Kit (Stratagene). The screening strategy will be similar
with that for cit-1.
89
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
REFERENCES
Amanuma, H., Katori, A., Obata, M., Sagata, N. and Ikawa, Y. (1983) Complete
nucleotide sequence o f the gene for the specific glycoprotein (gp55) of Friend
spleen focus-forming virus. Proc. Natl. Acad. Sci. U. S. A. 80(13), 3913-7.
Anderson, L.J., Jarrett, W.F., Jarrett, O. and Laird, H.M. (1971) Feline leukemia-virus
infection of kittens: mortality associated with atrophy of the thymus and lymphoid
depletion. J. Natl. Cancer Ink. 47(4), 807-17.
Athas, G.B., Choi, B., Prabhu, S., Lobelle-Rich, P.A. and Levy, L.S. (1995a) Genetic
determinants of feline leukemia virus-induced multicentric lymphomas. Virol.
214(2), 431-8.
Athas, G.B., Lobelle-Rich, P. and Levy, L.S. (1995b) Function o f a unique sequence
motif in the long terminal repeat of feline leukemia virus isolated from an unusual
set of naturally occurring tumors. J. Virol. 69(6), 3324-32.
Athas, G.B., Starkey, C.R. and Levy, L.S. (1994) Retroviral determinants of
leukemogenesis. Crit. Rev. Oncol. 5(2-3), 169-99.
Bechtel, M.K., Hayes, K.A., Mathes, L.E., Pandey, R., Stromberg, P.C. and Roy-Burman,
P. (1999) Recombinant feline leukemia virus (FeLV) variants establish a limited
infection with altered cell tropism in specific-pathogen-free cats in the absence of
FeLV subgroup A helper virus. Veterinary Pathology 36(2), 91-9.
Bechtel, M.K., Mathes, L.E., Hayes, K.A., Phipps, A.J. and Roy-Burman, P. (1998) In
vivo evolution and selection of recombinant feline leukemia virus species. Virus
Research 54(1), 71-86.
Bechtel, M.K., Stallcup, M.R., Bedgood, R.M., Corey, J.L., Pandey, R. and Roy-Burman,
P. (1994) Abnormal processing of a recombinant feline leukemia virus envelope
polyprotein and its interference with subgroup C virus infection. Virol. 202, 329-
338.
Benveniste, R.E., Sherr, C.J. and Todaro, G J. (1975) Evolution o f type C viral genes:
origin o f feline leukemia virus. Science 190, 886-8.
Berry, B.T., Ghosh, A.K., Kumar, D.V., Spodick, D.A. and Roy-Burman, P. (1988)
Structure and function of endogenous feline leukemia virus long terminal repeats
and adjoining regions. J. Virol. 62,3631-3641.
90
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Bordereaux, D., Fichelson, S., Sola, B., Tambourin, P.E. and Gisselbrecht, S. (1987)
Frequent involvement of the fim-3 region in Friend murine leukemia virus-
induced mouse myeloblastic leukemias. J. of Virol. 61(12), 4043-5.
Brodey, R.S., McDonough, S.K., Frye, F.L. and Hardy, W.D. (1970) Epidemiology of
feline leukemia (lymphosarcoma). Bibliotheca Haematologica(36), 333-42.
Buchberg, A.M., Bedigian, H.G., Taylor, B.A., Brownell, E., Ihle, J.N., Nagata, S.,
Jenkins, N.A. and Copeland, N.G. (1988) Localization o f Evi-2 to chromosome
11: linkage to other proto-oncogene and growth factor loci using interspecific
backcross mice. Oncogene Res. 2(2), 149-65.
Casey, J.W., Roach, A., Mullins, J.I., Burck, K.B., Nicolson, M.O., Gardner, M.B. and
Davidson, N. (1981) The U3 portion o f feline leukemia virus DNA identifies
horizontally acquired proviruses in leukemic cats. Proc. Natl. Acad. Sci. USA 78,
7778-7782.
Chen, H., Bechtel, M.K., Shi, Y., Phipps, A., Mathes, L.E., Hayes, K.A. and Roy-
Burman, P. (1998) Pathogenicity induced by feline leukemia virus, Rickard strain,
subgroup A plasmid DNA (pFRA). J. Virol. 72(9), 7048-56.
Clark, S.P. and Mak, T.W. (1983) Complete nucleotide sequence o f an infectious clone
o f Friend spleen focus-forming provirus: gp55 is an envelope fusion glycoprotein.
Proceedings of the National Academy o f Sciences of the United States o f America
80(16), 5037-41.
Cuypers, H.T., Selten, G., Quint, W., Zijlstra, M., Maandag, E.R., Boelens, W., van
Wezenbeek, P., Melief, C. and Bems, A. (1984) Murine leukemia virus-induced
T-cell lymphomagenesis: integration o f proviruses in a distinct chromosomal
region. Cell 37(1), 141-50.
de Parseval, A., Lemer, D.L., Borrow, P., Willett, B.J. and Elder, J.H. (1997) Blocking of
feline immunodeficiency virus infection by a monoclonal antibody to CD9 is via
inhibition o f virus release rather than interference with receptor binding. Journal
o f Virology 71(8), 5742-9.
Donahue, P.R., Hoover, E.A., Beltz, G.A., Riedel, N., Hirsch, V.M., Overbaugh, J. and
Mullins, J.I. (1988) Strong sequence conservation among horizontally
transmissible, minimally pathogenic feline leukemia viruses. J. Virol. 62, 722-
731.
Elder, J.H. and Mullins, J.I. (1983) Nucleotide sequence of the envelope gene of
Gardner-Amstein feline leukemia virus B reveals unique sequence homologies
with a murine mink cell focus-forming virus. J. Virol. 46, 871-880.
91
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Fan, H. (1997) Leukemogenesis by Moloney murine leukemia virus: a multistep process.
Trends in Microbiology 5(2), 74-82.
Freytag, S.O., Paielli, D.L. and Gilbert, J.D. (1994) Ectopic expression of the
CCAAT/enhancer-binding protein alpha promotes the adipogenic program in a
variety o f mouse fibroblastic cells. Genes & Development 8(14), 1654-63.
Fulton, R., Plumb, M., Shield, L. and Neil, J.C. (1990) Structural diversity and nuclear
protein binding sites in the long terminal repeats of feline leukemia virus. J. Virol.
64(4), 1675-1682.
Golemis, E.A., Speck, N.A. and Hopkins, N. (1990) Alignment of U3 region sequences
o f mammalian type C viruses: identification o f highly conserved motifs and
implications for enhancer design. J. Virol. 64(2), 534-542.
Gomez-Lucia, E., Zhi, Y., Nabavi, M., Zhang, W., Kabat, D. and Hoatlin, M.E. (1998)
An array o f novel murine spleen focus-forming viruses that activate the
erythropoietin receptor. Journal of Virology 72(5), 3742-50.
Hardy, W.D., Jr. (1990) Biology of feline retroviruses. In: R.C. Gallo and F. Wong-Staal
(Eds), Retrovirus biology and human diseases, pp. 33-85. Marcel Dekker, New
York.
Hardy, W.D., Jr. (1993) Feline oncoretroviruses. In: J.A. Levy (Ed), The Retroviridae,
pp. 109-180. Vol. 2. Plenum Press, New York, N.Y.
Hardy, W.D., Jr., Geering, G., Old, L.J., E, D.E.H., Brody, R.S. and McDonough, S.
(1969) Feline leukemia virus: occurrence o f viral antigen in the tissues of cats
with lymphosarcoma and other diseases. Science 166(908), 1019-21.
Hardy, W.D., Jr., Hess, P.W., MacEwen, E.G., McClelland, A.J., Zuckerman, E.E.,
Essex, M., Cotter, S.M. and Jarrett, O. (1976) Biology o f feline leukemia virus in
the natural environment. Cancer Res. 36, 582-588.
Hardy, W.D., Jr., Old, L.J., Hess, P.W., Essex, M. and Cotter, S. (1973) Horizontal
transmission of feline leukaemia virus. Nature (London) 244,266-9.
Hartley, J.W., Wolford, N.K., Old, L J. and Rowe, W.P. (1977) A new class of murine
leukemia virus associated with development o f spontaneous lymphomas. Proc
Natl Acad Sci USA 74(2), 789-92.
Haupt, Y., Alexander, W.S., Barri, G., Klinken, S.P. and Adams, J.M. (1991) Novel zinc
finger gene implicated as myc collaborator by retrovirally accelerated
lymphomagenesis in E mu-myc transgenic mice [see comments]. Cell 65(5), 753-
63.
92
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Hayward, W.S., Neel, B.G. and Astrin, S.M. (1981) Activation o f a cellular one gene by
promoter insertion in ALV-induced lymphoid leukosis. Nature 290(5806), 475-
80.
Hiai, H., Morrissey, P., Khiroya, R. and Schwartz, R.S. (1977) Selective expression of
xenotropic virus in congenic HRS/J (hairless) mice. Nature 270(5634), 247-9.
Holland, C.A., Thomas, C.Y., Chattopadhyay, S.K., Koehne, C. and PV, O.D. (1989)
Influence of enhancer sequences on thymotropism and leukemogenicity of mink
cell focus-forming viruses. Journal o f Virology 63(3), 1284-92.
Hoover, E.A., Kociba, G.J., Hardy, W.D., Jr. and Yohn, D.S. (1974) Erythroid hypoplasia
in cats inoculated with feline leukemia virus. J. Natl. Cancer Inst. 53(5), 1271-6.
Jarrett, O., Laird, H.M. and Hay, D. (1973) Determinants of the host range of feline
leukaemia viruses. J. Gen. Virol. 20(2), 169-75.
Jarrett, O. and Russell, P.H. (1978) Differential growth and transmission in cats of feline
leukemia viruses of subgroups A and B. Int. J. Cancer 21, 466-472.
Jarrett, W.F.H., Crawford, E.M., Martin, W.B. and Davie, F.A. (1964) A virus-like
particle associated with leukemia (lymphosarcoma). Nature (London) 202, 567-
569.
Koehne, C.F., Lazo, P.A., Alves, K., Lee, J.S., Tsichlis, P.N. and PV, O.D. (1989) The
Mlvi-1 locus involved in the induction of rat T-cell lymphomas and the pvt-
1/Mis-l locus are identical. J. o f Virol. 63(5), 2366-9.
Kumar, D.V., Berry, B.T. and Roy-Burman, P. (1989) Nucleotide sequence and
distinctive characteristics of the env gene of endogenous feline leukemia pro virus.
J. Virol. 63, 2379-2384.
Lenz, J., Celander, D., Crowther, R.L., Patarca, R., Perkins, D.W. and Haseltine, W.A.
(1984) Determination of the leukaemogenicity of a murine retrovirus by
sequences within the. long terminal repeat. Nature 308(5958), 467-70.
Levesque, K.S., Bonham, L. and Levy, L.S. (1990) flvi-1, a common integration domain
of feline leukemia virus in naturally occurring lymphomas of a particular type.
Journal of Virology 64(7), 3455-62.
Levy, L.S., Gardner, M.B. and Casey, J.W. (1984) Isolation o f a feline leukaemia
provirus containing the oncogene myc from a feline lymphosarcoma. Nature
308(5962), 853-6.
93
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Levy, L.S. and Lobelle-Rich, P.A. (1992) Insertional mutagenesis of flvi-2 in tumors
induced by infection with LC-FeLV, a myc-containing strain o f feline leukemia
virus. Journal of Virology 66(5), 2885-92.
Levy, L.S., Lobelle-Rich, P. A. and Overbaugh, J. (1993a) flvi-2, a target o f retroviral
insertional mutagenesis in feline thymic lymphosarcomas, encodes bmi-1.
Oncogene 8(7), 1833-8.
Levy, L.S., Lobelle-Rich, P.A., Overbaugh, J., Abkowitz, J.L., Fulton, R. and Roy-
Burman, P. (1993b) Coincident involvement offlvi-2, c-myc, and novel env genes
in natural and experimental lymphosarcomas induced by feline leukemia virus.
Virology 196, 892-895.
Li, J.P., AD, D.A., Lodish, H.F. and Baltimore, D. (1990) Activation of cell growth by
binding of Friend spleen focus-forming virus gp55 glycoprotein to the
erythropoietin receptor. Nature 343(6260), 762-4.
Li, J.P. and Baltimore, D. (1991) Mechanism o f leukemogenesis induced by mink cell
focus-forming murine leukemia viruses. Journal of Virology 65(5), 2408-14.
Li, Y., Golemis, E., Hartley, J.W. and Hopkins, N. (1987) Disease specificity o f
nondefective Friend and Moloney murine leukemia viruses is controlled by a
small number of nucleotides. Journal o f Virology 61(3), 693-700.
Luciw, P., Parker, D., Potter, S. andNajarian, R. (1985) Feline leukemia virus (FeLV),
strains A/Glasgow-1 and C, env genes. In: R. Weiss, N. Teich, H. Varmus and J.
Coffin (Eds), RNA tumor-viruses, pp. 1000-4. Cold Spring Harbor Laboratory,
Cold Spring Harbor, N.Y.
Mackey, L., Jarrett, W., Jarrett, O. and Laird, H. (1975) Anemia associated with feline
leukemia virus infection in cats. J. Natl. Cancer Inst. 54(1), 209-17.
Mathes, L.E., Pandey, R., Chakrabarti, R., Hofman, F.M., Hayes, K.A., Stromberg, P.
and Roy-Burman, P. (1994) Pathogenicity of a subgroup C feline leukemia virus
(FeLV) is augmented when administered in association with certain FeLV
recombinants. Virology 198, 185-195.
Matsumoto, Y., Momoi, Y., Watari, T., Goitsuka, R., Tsujimoto, H. and Hasegawa, A.
(1992) Detection of enhancer repeats in the long terminal repeats o f feline
leukemia viruses from cats with spontaneous neoplastic and nonneoplastic
diseases. Virology 189, 745-749.
Menotti-Raymond, M., David, V.A., Lyons, L.A., Schaffer, A.A., Tomlin, J.F., Hutton,
M.K. and SJ, O.B. (1999) A genetic linkage map of microsatellites in the
domestic cat (Felis catus). Genomics 57(1), 9-23.
94
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Miksicek, R., Heber, A., Schmid, W., Danesch, U., Posseckert, G., Beato, M. and Schutz,
G. (1986) Glucocorticoid responsiveness of the transcriptional enhancer of
Moloney murine sarcoma virus. Cell 46(2), 283-90.
Miura, T., Tsujimoto, H., Fukasawa, M., Kodama, T., Shibuya, M., Hasegawa, A. and
Hayami, M. (1987) Structural abnormality and over-expression of the myc gene
in feline leukemias. International Journal of Cancer 40(4), 564-9.
Moreau-Gachelin, F., Tavitian, A. and Tambourin, P. (1988) Spi-1 is a putative oncogene
in virally induced murine erythroleukaemias. Nature 331(6153), 277-80.
Morrison, H.L., Soni, B. and Lenz, J. (1995) Long terminal repeat enhancer core
sequences in pro viruses adjacent to c-myc in T-cell lymphomas induced by a
murine retrovirus. Journal of Virology 69(1), 446-55.
Mucenski, M.L., Taylor, B.A., Ihle, J.N., Hartley, J.W., Morse, H.C.d., Jenkins, N.A. and
Copeland, N.G. (1988) Identification of a common ecotropic viral integration site,
Evi-1, in the DNA of AKXD murine myeloid tumors. Mol. Cell. Biol. 8(1), 301-
8.
Mullins, J.I., Chen, C.S. and Hoover, E.A. (1986) Disease-specific and tissue-specific
production o f unintegrated feline leukemia virus variant DNA in feline AIDS.
Nature (London) 319, 333-6.
Neil, J.C., Fulton, R., Rigby, M. and Stewart, M. (1991) Feline leukemia virus:
generation o f pathogenic and oncogenic variants. Curr. Top. Microbiol. Immunol.
171, 68-92.
Neil, J.C., Hughes, D., McFarlane, R., Wilkie, N.M., Onions, D.E., Lees, G. and Jarrett,
O. (1984) Transduction and rearrangement of the myc gene by feline leukaemia
virus in naturally occurring T-cell leukaemias. Nature 308(5962), 814-20.
Nishigaki, K., Endo, -Y., Matsumoto, Y., Watari, T., Goitsuka, R., Tsujimoto, H. and
Hasegata, A. (1997) Regulation of gene expression directed by the long terminal
repeats of feline leukemia viruses. Leukemia ll(Suppl 3), 189-92.
Onions, D., Jarrett, O., Testa, N., Frassoni, F. and Toth, S. (1982) Selective effect of
feline leukaemia virus on early erythroid precursors. Nature 296(5853), 156-8.
Overbaugh, J., Reidel, N., Hoover, E.A. and Mullins, J.I. (1988) Transduction of
endogenous envelope genes by feline leukemia virus in vitro. Nature (London)
332, 731-734.
95
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Pandey, R., Bechtel, M.K., Su, Y., Ghosh, A.K., Hayes, K.A., Mathes, L.E. and Roy-
Burman, P. (1995) Feline leukemia virus variants in experimentally induced
thymic lymphosarcomas. Virology 214, 584-592.
Pandey, R., Ghosh, A.K., Kumar, D.V., Bachman, B.A., Shibata, D. and Roy-Burman, P.
(1991) Recombination between feline leukemia virus subgroup B or C and
endogenous env elements alters the in vitro biological activities of the viruses. J.
Virol. 65, 6495-6508.
Plumb, M., Fulton, R., Breimer, L., Stewart, M., Willison, K. and Neil, J.C. (1991)
Nuclear factor 1 activates the feline leukemia virus long terminal repeat but is
posttranscriptionally down-regulated in leukemia cell lines. J Virol 65(4), 1991-9.
Poiesz, B.J., Ruscetti, F.W., Gazdar, A.F., Bunn, P.A., Minna, J.D. and Gallo, R.C.
(1980) Detection and isolation of type C retrovirus particles from fresh and
cultured lymphocytes of a patient with cutaneous T-cell lymphoma. Proc. Natl.
Acad. Sci. USA 77(12), 7415-9.
Riedel, N., Hoover, E.A., Gasper, P.W., Nicolson, M.O. and Mullins, J.I. (1986)
Molecular analysis and pathogenesis of the feline aplastic anemia retrovirus,
FeLV-C-Sarma. J. Virol. 60, 242-260.
Rohn, J.L., Linenberger, M.L., Hoover, E.A. and Overbaugh, J. (1994) Evolution of
feline leukemia virus variant genomes with insertions, deletions, and defective
envelope genes in infected cats with tumors. J. Virol. 68, 2458-2467.
Rohn, J.L. and Overbaugh, J. (1995) In vivo selection of long terminal repeat alterations
in feline leukemia virus-induced thymic lymphomas. Virology 206, 661-5.
Rojko, J.L., Fulton, R.M., Rezanka, L.J., Williams, L.L., Copelan, E., Cheney, C.M.,
Reichel, G.S., Neil, J.C., Mathes, L.E., Fisher, T.G. and et al. (1992)
Lymphocytotoxic strains o f feline leukemia virus induce apoptosis in feline T4-
thymic lymphoma cells. Laboratory Investigation 66(4), 418-26.
Rojko, J.L., Hoover, E.A., Krakowka, S., Olsen, R.G. and Mathes, L.E. (1979) Influence
of adrenal corticosteroids on the susceptibility of the cats to feline leukemia virus.
Cancer Res. 39, 3789-3791.
Rotter, V., Wolf, D., Pravtcheva, D. and Ruddle, F.H. (1984) Chromosomal assignment
of the murine gene encoding the transformation-related protein p53. Molecular &
Cellular Biology 4(2), 383-5.
Roy-Burman, P. (1996) Endogenous env elements: partners in generation of pathogenic
feline leukemia viruses. Virus Genes 11, 147-161.
96
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Roy-Burman, P., Dougherty, M., Pal, B.K., Charman, H.P., Klement, V. and Gardner,
M.B. (1976) Assay for type C virus in mouse sera based on particulate reverse
transcriptase activity. Journal of Virology 19(3), 1107-10.
Rudra-Ganguly, N., Zheng, J., Hoang, A.T. and Roy-Burman, P. (1998) Downregulation
of human FGF8 activity by antisense constructs in murine fibroblastic and human
prostatic carcinoma cell systems. Oncogene 16(11), 1487-92.
Ruscetti, S. and Wolff, L. (1984) Spleen focus-forming virus: relationship o f an altered
envelope gene to the development o f a rapid erythroleukemia. Current Topics in
Microbiology & Immunology 112,21-44.
Ruscetti, S.K., Janesch, N.J., Chakraborti, A., Sawyer, S.T. and Hankins, W.D. (1990)
Friend spleen focus-forming virus induces factor independence in an
erythropoietin-dependent erythroleukemia cell line. Journal o f Virology 64(3),
1057-62.
Sarma, P.S. and Log, T. (1971) Viral interference in feline leukemia-sarcoma complex.
Virology 44,352-358.
Sarma, P.S. and Log, T. (1973) Subgroup classification of feline leukemia and sarcoma
viruses by viral interference and neutralization tests. Virology 54, 160-169.
Sarma, P.S., Log, T., Jain, D., Hill, P.R. and Huebner, R.J. (1975) Differential host range
of viruses o f feline leukemia-sarcoma complex. Virology 64(2), 438-46.
Sheets, R.L., Pandey, R., Jen, W.-C. and Roy-Burman, P. (1993) Recombinant feline
leukemia virus genes detected in naturally occurring feline lymphosarcomas. J.
Virol. 67,3118-3125.
Sheets, R.L., Pandey, R., Klement, V., Grant, C.K. and Roy-Burman, P. (1992)
Biologically selected recombinants between feline leukemia vims (FeLV)
subgroup A and an endogenous FeLV element. Virology 190, 849-855.
Shih, C.C., Stoye, J.P. and Coffin, J.M. (1988) Highly preferred targets for retrovirus
integration. Cell 53(4), 531-7.
Silver, J. and Kozak, C. (1986) Common proviral integration region on mouse
chromosome 7 in lymphomas and myelogenous leukemias induced by Friend
murine leukemia vims. J. Virol. 57(2), 526-33.
Soe, L.H., Devi, B.G., Mullins, J.I. and Roy-Burman, P. (1983) Molecular cloning and
characterization of endogenous feline leukemia vims sequences from a cat
genomic library. J. Virol. 46, 829-840.
97
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Soe, L.H., Shimizu, R.N., Landolph, J.R. and Roy-Burman, P. (1985) Molecular analysis
of several classes of endogenous feline leukemia virus elements. J. Virol. 46, 829-
840.
Sola, B., Simon, D., Mattei, M.G., Fichelson, S., Bordereaux, D., Tambourin, P.E.,
Guenet, J.L. and Gisselbrecht, S. (1988) Fim-1, Fim-2/c-ftns, and Fim-3, three
common integration sites of Friend murine leukemia virus in myeloblastic
leukemias, map to mouse chromosomes 13, 18, and 3, respectively. J. Virol.
62(11), 3973-8.
Speck, N.A. and Baltimore, D. (1987) Six distinct nuclear factors interact with the 75-
base-pair repeat of the Moloney murine leukemia virus enhancer. Mol. Cell. Biol.
7(3), 1101-1110.
Starkey, C.R., Lobelle-Rich, P.A., Granger, S., Brightman, B.K., Fan, H. and Levy, L.S.
(1998) Tumorigenic potential of a recombinant retrovirus containing sequences
from Moloney murine leukemia virus and feline leukemia virus. Journal o f
Virology 72(2), 1078-84.
Stewart, M.A., Wamock, M., Wheeler, A., Wilkie, N., Mullins, J.I., Onions, D.E. and
Neil, J.C. (1986) Nucleotide sequences o f a feline leukemia virus subgroup A
envelope gene and long terminal repeat and evidence for the recombinational
origin o f subgroup B viruses. J. Virol. 58, 825-834.
Stoye, J.P., Moroni, C. and Coffin, J.M. (1991) Virological events leading to spontaneous
AKR thymomas. Journal of Virology 65(3), 1273-85.
Tsatsanis, C., Fulton, R., Nishigaki, K., Tsujimoto, H., Levy, L., Terry, A., Spandidos,
D., Onions, D. and Neil, J.C. (1994) Genetic determinants of feline leukemia
virus-induced lymphoid tumors: patterns o f proviral insertion and gene
rearrangement. J. Virol. 68, 8296-8303.
Tsichlis, P.N. and Bear, S.E. (1991) Infection by mink cell focus-forming viruses confers
interleukin 2 (IL-2) independence to an IL-2-dependent rat T-cell lymphoma line.
Proceedings o f the National Academy o f Sciences o f the United States o f America
88(11), 4611-5.
Tsichlis, P.N. and Lazo, P.A. (1991) Virus-host interactions and the pathogenesis of
murine and human oncogenic retroviruses. Currunt Topics in Microbiology &
Immunology 171, 95-171.
Tsichlis, P.N., Lohse, M.A., Szpirer, C., Szpirer, J. and Levan, G. (1985) Cellular DNA
regions involved in the induction o f rat thymic lymphomas (Mlvi-1, Mlvi-2, Mlvi-
3, and c-myc) represent independent loci as determined by their chromosomal
map location in the rat. J. Virol. 56(3), 938-42.
98
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Tsujimoto, H., Fulton, R., Nishigaki, K., Matsumoto, Y., Hasegawa, A., Tsujimoto, A.,
Cevario, S., SJ, O.B., Terry, A., Onions, D. and et al. (1993) A common proviral
integration region, fit-1, in T-cell tumors induced by myc-containing feline
leukemia viruses. Virology 196(2), 845-8.
van Lohuizen, M., Verbeek, S., Scheijen, B., Wientjens, E., van der Gulden, H. and
Bems, A. (1991) Identification of cooperating oncogenes in E mu-myc transgenic
mice by provirus tagging [see comments]. Cell 65(5), 737-52.
Vijaya, S., Steffen, D.L., Kozak, C. and Robinson, H.L. (1987) Dsi-1, a region with
frequent proviral insertions in Moloney murine leukemia virus-induced rat
thymomas. J. Virol. 61(4), 1164-70.
Villemur, R., Monczak, Y., Rassart, E., Kozak, C. and Jolicoeur, P. (1987) Identification
of a new common pro virus integration site in gross passage A murine leukemia
virus-induced mouse thymoma DNA. Mol. Cell. Biol. 7(1), 512-22.
Wolf, D. and Rotter, V. (1984) Inactivation of p53 gene expression by an insertion of
Moloney murine leukemia virus-like DNA sequences. Mol Cell Biol 4(7), 1402-
10.
Wolff, L., Scolnick, E. and Ruscetti, S. (1983) Envelope gene of the Friend spleen focus-
forming virus: deletion and insertions in 3' gp70/pl5E-encoding region have
resulted in unique features in the primary structure o f its protein product.
Proceedings of the National Academy of Sciences o f the United States of America
80(15), 4718-22.
99
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.

Asset Metadata

Creator Zhao, Yan Shi (author)

Core Title Characterization of new factors involved in feline leukemia virus (FELV)-mediated leukemogenesis

Contributor Digitized by ProQuest (provenance)

School Graduate School

Degree Doctor of Philosophy

Degree Program Pathology

Publisher University of Southern California (original), University of Southern California. Libraries (digital)

Tag biology, microbiology,biology, molecular,OAI-PMH Harvest

Language English

Advisor [illegible] (committee chair), Shackleford, Gregory M. (committee member), Stallcup, Michael R. (committee member)

Permanent Link (DOI) https://doi.org/10.25549/usctheses-c16-70766

Unique identifier UC11337737

Identifier 3018048.pdf (filename),usctheses-c16-70766 (legacy record id)

Legacy Identifier 3018048.pdf

Dmrecord 70766

Document Type Dissertation

Rights Zhao, Yan Shi

Type texts

Source University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Access Conditions The author retains rights to his/her dissertation, thesis or other graduate work according to U.S. copyright law. Electronic access is being provided by the USC Libraries in agreement with the au...

Repository Name University of Southern California Digital Library

Repository Location USC Digital Library, University of Southern California, University Park Campus, Los Angeles, California 90089, USA