University of Southern California Dissertations and Theses

A new model for hepatitis delta virus transcription and replication

(USC Thesis Other)

A new model for hepatitis delta virus transcription and replication

PDF

Download a page range

Download transcript

Copy asset link

Request this asset

Transcript (if available)

Content INFORMATION TO USERS
This manuscript has been reproduced from the microfilm master. UMI films
the text directly from the original or copy submitted. Thus, some thesis and
dissertation copies are in typewriter face, while others may be from any type of
computer printer.
The quality of this reproduction is dependent upon the quality of the
copy submitted. Broken or indistinct print, colored or poor quality illustrations
and photographs, print bleedthrough, substandard margins, and improper
alignment can adversely affect reproduction.
In the unlikely event that the author did not send UMI a complete manuscript
and there are missing pages, these will be noted. Also, if unauthorized
copyright material had to be removed, a note will indicate the deletion.
Oversize materials (e.g., maps, drawings, charts) are reproduced by
sectioning the original, beginning at the upper left-hand comer and continuing
from left to right in equal sections with small overlaps.
Photographs included in the original manuscript have been reproduced
xerographically in this copy. Higher quality 6" x 9" black and white
photographic prints are available for any photographs or illustrations appearing
in this copy for an additional charge. Contact UMI directly to order.
ProQuest Information and Learning
300 North Zeeb Road, Ann Arbor, Ml 48106-1346 USA
800-521-0600
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
A NEW MODEL FOR HEPATITIS DELTA VIRUS
TRANSCRIPTION AND REPLICATION
By
Lucy Elizabeth Modahl
A Dissertation Presented to the
FACULTY OF THE GRADUATE SCHOOL
UNIVERSITY OF SOUTHERN CALIFORNIA
In Partial Fulfillment of the
Requirements for the Degree
DOCTOR OF PHILOSOPHY
(MOLECULAR MICROBIOLOGY AND IMMUNOLOGY)
May 2001
Copyright 2001 Lucy Elizabeth Modahl
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
UMI Number: 3041500
Copyright 2001 by
Modahl, Lucy Elizabeth
All rights reserved.
___ ®
UMI
UMI Microform 3041500
Copyright 2002 by ProQuest Information and Learning Company.
All rights reserved. This microform edition is protected against
unauthorized copying under Title 17, United States Code.
ProQuest Information and Learning Company
300 North Zeeb Road
P.O. Box 1346
Ann Arbor, Ml 48106-1346
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
UNIVERSITY OF SOUTHERN CALIFORNIA
THE GRADUATE SCHOOL
UNIVERSITY PARK
LOS ANGELES. CALIFORNIA 90007
T h is dissertation, w ritten by
Lucy_Elizabeth_Modahl...........
under the direction of h e x Dissertation
Com m ittee, and approved by all its members,
has been presented to and accepted b y The
G raduate School, in partial fulfillm ent of re
quirem ents for the degree of
D O C TO R O F PH ILO SO PH Y
Dean of Graduate Studies
Da te ... . P . ? . ? . ? . 1 ? * ? ? r .. A 2000
DISSERTATION COMMITTEE
trperson
J
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Lucy Elizabeth Modahl Michael M. C. Lai
ABSTRACT
A NEW MODEL FOR HEPATITIS DELTA VIRUS TRANSCRIPTION AND
REPLICATION
Hepatitis delta virus (HDV) is an unusual subviral pathogen associated with
chronic and fulminant hepatitis worldwide. HDV is a single-stranded RNA virus, which
encodes a single protein, the hepatitis delta antigen (HDAg). HDAg comes in two forms:
small HDAg (S-HDAg, 24 kD) and large HDAg (L-HDAg, 27 kD). S-HDAg is required
for viral replication, whereas L-HDAg potently inhibits HDV replication and is required
for virion packaging. Like the closely related plant viroids, HDV is thought to use
cellular RNA polymerase II to replicate and to transcribe the 0.8-kb HDAg mRNA.
The current model for HDV replication and mRNA synthesis holds that the 0.8-kb
HDAg mRNA is the initial product of replication. Synthesis of the 1.7-kb antigenome
from the same genomic template requires suppression of the HDAg mRNA
polyadenylation signal by HDAg, resulting in synthesis of the 0.8-kb HDAg mRNA only
at the outset of the replication cycle. However, this model does not provide a mechanism
for the synthesis of new 0.8-kb mRNA encoding L-HDAg. This mRNA must appear late
in the replication cycle for virion packaging to occur. Further, this model does not
address the difficult question of how HDV replication is initiated during natural infection,
when L-HDAg is present in a roughly equal ratio to S-HDAg.
The studies which experimentally supported the above model were compromised
by their reliance on HDV c-DNA-based transfection systems. I therefore developed a
cDNA-ffee transfection system to study HDV RNA transcription and replication in cell
I
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
culture. I determined that synthesis of the genome, the antigenome, and the 0.8-kb
HDAg mRNA have distinct metabolic requirements. This finding is based on the
following conclusions, which are supported by the experimental evidence presented in
this dissertation: 1) HDAg does not inhibit the 0.8-kb polyadenylation signal, 2) synthesis
of the HDV genome, antigenome, and 0.8-kb HDAg mRNA are differentially sensitive to
a-amanitin and L-HDAg, 3) antigenome synthesis may not be carried out by pol II, and
4) initiation of HDV replication can occur in the presence of L-HDAg. A new model for
HDV transcription and replication is presented.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
2
Acknowledgements
Acknowledgements
This dissertation could not have been accomplished without the help of
many individuals. Dr. King-Song Jeng originally trained me in the basics of
molecular biology, and introduced me to the study of hepatitis delta virus. He
also provided me with many constructs which were used throughout my research.
For this I am very grateful. Members of the Lai lab also gave me invaluable
training and technical advice. Mindy Zhu, Kiersten Lo, Soon Hwang, and
Raymond Sheu were instrumental to the development of my technical skills in the
lab. Stephanie Shi and I began some collaborative projects not presented in this
thesis; I am grateful for this interaction. She became a role model for me in her
professionalism, which she brings to her experimental work, her oral
presentations of her work, and her interactions with other members of the lab. I
also thank members of the Johnson lab for their assistance in performing the
RNase protection assay.
Dr. C.-M. Lee (Chang-Gung Hospital, Kaoshiung, Taiwan) generously
provided the HDV genotype II clones which were used to establish the RNA
transfection system, used for virtually all the studies presented in this dissertation.
Dr. J. L. Corden (Johns Hopkins University, Baltimore, Maryland) kindly
provided the a-amanitin-resistant pol II clone.
My research was partially supported by the Life and Health Insurance
Medical Research Fund. This financial support gave me the opportunity to
ii
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Acknowledgements
participate in meetings and to gain access to materials which were very helpful in
the accomplishment of my dissertation.
I thank the members of my dissertation committee, Dr. Stanley Tahara and
Dr. Deborah Johnson, and the Dean of Scientific Affairs, Dr. Lolley, who each
provided advice and encouragement throughout the course of my research.
Finally, I would like to thank my advisor, Dr. Michael Lai, whose support
and firm guidance were critical to my intellectual development. His influence on
my thinking, both within and beyond scientific endeavor, is a gift that I will cany
with me throughout my career.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Table of Contents
Table of Contents
ii
viii
x
Acknowledgements
List of Figures
List of Tables
Chapter 1:
The Molecular Biology of Hepatitis Delta Virus (HDV) 1
1.1 Introduction 1
Classification 2
1.2 Virion Structure 3
1.3 Genome Structure 4
1.3.1 Ribozyme structure and properties 9
1.4 Hepatitis Delta Antigen (HDAg) 11
1.4.1 Structural features of HDAg 12
1.4.2 Biological functions of HDAg 22
1.5 Viral Replication 24
1.5.1 In vitro and in vivo models for studying HDV replication 24
1.5.2 Metabolic requirements for HDV RNA replication 28
1.5.3 Double rolling-circle replicadon 30
1.5.4 Subgenomic mRNA species 32
1.5.5 Translation 34
1.5.6 RNA editing 35
1.5.7 Virus assembly 37
1.6 Discrimination between HDV Replication and Transcription:
The Goal of this Dissertation 38
1.7 References 44
iv
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Table of Contents
Chapter 2:
Transcription of HDAg mRNA Continues throughout
HDV Replication: A Proposed New Model for HDV
Transcription and Replication 57
2.1 Summary and Purpose 57
2.2 Abstract 60
2.3 Introduction 61
2.4 Materials and Methods 64
2.4.1 Cell culture and transfection 64
2.4.2 Vectors and plasmid construction 66
2.4.3 In vitro transcription 66
2.4.4 Northern blot analysis 67
2.4.5 Western blot analysis 68
2.4.6 Primer extension analysis 68
2.5 Results
2.5.1 Heterogeneity of HDAg-encoding mRNA in cDNA-
70
based HDV replication systems
2.5.2 Abundance of an HDV RNA-templated mRNA in a
70
cDNA-ffee transfection system
2.5.3 The HDAg mRNA and HDV monomer are
78
synthesized in parallel in the presence of small HDAg 84
2.6 Discussion 88
2.7 References 96
Chapter 3:
Synthesis of the HDV Antigenome and the HDAg
mRNA are Differentially Regulated 99
3.1 Summary and Purpose 99
3.2 Introduction 101
3.3 Materials and Methods 105
3.3.1 Cell culture and transfection 105
3.3.2 Vectors and plasmid construction 106
3.3.3 In vitro transcription 108
3.3.4 Northern blot analysis 108
3.3.5 Western blot analysis 110
3.3.6 RNase protection assay 110
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Table of Contents
3.4 Results • 111
3.4.1 Synthesis of the 0.8-kb HDAg mRNA is sensitive to
inhibition by a-amanitin in cell culture 111
3.4.2 Synthesis of the 1.7-kb antigenome is insensitive to
inhibition by a-amanitin in ell culture after abundant
S-HDAg appears 112
3.4.3 An a-amanitin-resistant pol II mutant fails to completely
restore transcription of the 0.8-kb HDAg mRNA 131
3.4.4 Temperature dependence of 0.8-kb mRNA synthesis
from the genomic RNA template 134
3.4.5 Transcription of the 0.8-kb HDAg mRNA can occur in the
absence of HDV RNA replication 140
3.5 Discussion 142
3.6 References 155
Chapter 4:
Synthesis of the Hepatitis Delta Virus Genome and
Antigenome are Differentially Regulated 159
4.1 Summary and Purpose 159
4.2 Materials and Methods 163
4.2.1 Cell culture and transfection 163
4.2.2 Vectors and plasmid construction 164
4.2.3 In vitro transcription 165
4.2.4 Northern blot analysis 165
4.2.5 Western blot analysis 167
4.3 Results 167
4.3.1 Transcription of the 1.7-kb antigenome occurs in the
presence of equal amounts of S- and L-HDAg 167
4.3.2 Synthesis of the 0.8-kb HDAg mRNA occurs in the
presence of equal amounts of S- and L-HDAg 173
4.3.3 Synthesis of the 1.7-kb antigenome occurs in the
presence of increasing amounts of L-HDAg,
independently of mRNA synthesis 179
4.3.4 Genomic and antigenomic HDV RNA synthesis are
differentially sensitive to' a-amanitin 184
4.4 Discussion 187
4.5 References 193
vi
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Table of Contents
Chapter 5:
A New Model for HDV Transcription and Replication 195
5.1 Introduction 195
5.2 Trans-a.ctivation of HDAg mRNA synthesis and trans-
activation of 1.7-kb antigenomic synthesis: two distinct
roles for S-HDAg 198
5.3 A proposed molecular mechanism for the differential
activation of mRNA versus antigenomic RNA synthesis
by S-HDAg 203
5.4 The role of L-HDAg in the differential fra/w-activation of
HDAg mRNA synthesis and HDV replication 208
5.5 Synthesis of the antigenome: the role of oligomerization
and regulation by L-HDAg 214
5.6 A new model for HDV transcription and replication 218
5.7 References 223
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
List o f Figures
List of Figures
Chapter 1
Figure 1. Schematic diagram of the HDV RNAs 6
Figure 2. Schematic diagram of the small and large forms of HDAg 13
Chapter 2
Figure 1. Identification of subgenomic HDAg mRNAs in three
cell culture systems 72
Figure 2. Determination of the structure of the H I59 subgenomic
mRNA 75
Figure 3. Detection of the 0.8-kb subgenomic mRNA in the cDNA-
free HDV RNA transfection system 79
Figure 4. Kinetics of the synthesis of antigenomic HDV RNA
and HDAg 86
Figure 5. Proposed models of HDV RNA transcription and
replication 90
Chapter 3
Figure 1. HDV genomic RNA synthesis from HDV cDNA
and RNA templates is inhibited by a-amanitin 113
Figure 2. Synthesis of the RNA-templated 0.8-kb HDAg mRNA
is sensitive to a-amanitin 115
Figure 3. a-Amanitin inhibits the synthesis of the 0.8-kb HDAg
mRNA but not a pol HI transcript 119
Figure 4. a-Amanitin does not inhibit antigenome synthesis at
day 3 post-transfection 123
viii
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
List of Figures
Figure 5. Time course of the effects of a-amanitin on antigenome
synthesis 125
Figure 6. The antigenomic HDV RNA is less stable than the
choA mRNA 129
Figure 7. Characterization of the cell line BCHAWT, which
expresses an a-amanitin:resistant pol II mutant 132
Figure 8. The a-amanitin-resistant pol II mutant only partially
restores HDV transcription in the presence of a-amanitin 135
Figure 9. HDV replication in Ts63 cells at 34°C and 37°C 138
Figure 10. Isolated synthesis of the 0.8-kb HDAg mRNA 143
Chapter 4
Figure 1. Synthesis of genomic HDV RNA is inhibited by
small amounts of L-HDAg 169
Figure 2. Antigenomic HDV RNA synthesis is not inhibited
by equal amounts of S-HDAg and L-HDAg 171
Figure 3. L-HDAg does not inhibit 0.8-kb HDAg mRNA synthesis 176
Figure 4. L-HDAg does not inhibit synthesis of the 1.7-kb anti genome 181
Figure 5. a-Amanitin inhibits synthesis of the 1.7-kb genomic
HDV RNA 185
Chapter 5
Figure 1. The sources of S-HDAg which enter the nucleus 200
Figure 2. Proposed mechanism for the role of L-HDAg
in mRNA versus antigenomic RNA synthesis 211
Figure 3. A new model for HDV transcription and replication 220
ix
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
List of Tables
List of Tables
Chapter 1
Table 1. Biochemical and biological activities of HDAg 20
Table 2. Transfection systems for HDV replication in cell culture 42
Chapter 2
Table 1. The sequences of primers used for northern blot and
primer extension 69
x
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 1
Chapter 1
The Molecular Biology of Hepatitis Delta Virus
1.1 Introduction
In 1977, Dr. Mario Rizzetto of Turin, Italy, discovered what was initially
thought to be a new hepatitis B virus (HB V)-encoded antigen in the hepatocytes of
patients infected with HBV (Rizzetto et al., 1977). Successful transmission of
infectious hepatitis to chimpanzees using these patients’ sera, which contained a
new type of viral particle, ultimately proved that the new antigen, termed delta
antigen (HDAg), was derived from a then unknown virus, hepatitis delta vims
(HDV) (Rizzetto et al., 1980). HDV particles include a nucleocapsid consisting of
viral RNA and HDAg, surrounded by an envelope containing hepatitis B surface
antigen (HBsAg) (Rizzetto et al., 1980). Production and transmission of HDV
particles relies on the presence of HBsAg, and thus concurrent HBV infection
(Rizzetto et al., 1980). Therefore, the epidemiology of HDV overlaps that of HBV;
however, geographical variations in the prevalence of HDV do not correspond
exactly to those of HBV. HDV is particularly prevalent in the Mediterranean
1
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 1
basin, Middle East, South America, West Africa, and certain South Pacific islands
(Ponzetto et al., 1985; Rizzetto et al., 1980). Recently, a significant decrease in the
number of new HDV infections has been noted worldwide (Huo et al., 1997;
Sagnelli et al., 1997). HDV is associated with fulminant hepatitis and increased
risk of chronic hepatitis. The clinical severity of infection varies with HDV isolates
(Hadler et al., 1992), and may also depend on the nature of the coinfecting HBV
strain.
1.1.1 Classification
HDV is considered a subviral particle because it does not encode its own
envelope protein (Diener and Pruisner, 1985), and thus strictly requires the
presence of HBV for production and transmission of infectious virions. Unlike
classical satellite viruses, however, HDV can replicate autonomously and does not
share sequence homology with its helper vims HBV. Its circular RNA genome
and mode of RNA replication most closely resemble those of the subviral plant
pathogens, viroids and virusoids (Diener and Pruisner, 1985). Partly because of its
lack of relatedness to any other animal viruses, HDV has been assigned
taxonomically as a lone member of a floating genus, Deltaviridae (Murphy, 1995).
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 1
1.2 Virion Structure
Virus particles isolated from infected patient and chimpanzee sera are
enveloped, spherical particles with a diameter of 36 nm (Bonino et al., 1984;
Rizzetto et al., 1980). The buoyant density of HDV particles in cesium chloride is
1.24-1.25 g/cm\ and their sedimentation velocity is between that of HBV and the
22-nm empty HBsAg particles (Bonino et al., 1984; Rizzetto et al., 1980). Similar
viral particles have been isolated from tissue-culture cells cotransfected with HDV
cDNA and HBsAg (Wang et al., 1991). After the vims particle is disrupted with
nonionic detergents, an internal nucleocapsid is released and HDAg becomes
detectable (Bonino et al., 1986; Ryu et al., 1993). The nucleocapsid is spherical
and approximately 19 nm in diameter (Ryu et al., 1993) and consists of HDAg and
the HDV RNA genome. The HDAg usually consists of two protein species, the
large (214 amino acids) and the small (195 amino acids) form, in variable ratios
(Bergmann and Gerin, 1986; Bonino et al., 1986; Pohl et al., 1987). Recent studies
have shown that HDAg forms dimers through an antiparallel coiled coil, and the
dimers further interact to form octamers, which are arranged in a 50-A ring lined
with basic side chains (Zuccola et al., 1998). This structure is unique for viral
nucleocapsid proteins. The viral nucleocapsids derived from the nuclei of infected
cells (nRNP) and the nucleocapsids from the virion (vRNP) differ in that nRNP
contains approximately 30 molecules of HDAg (predominantly of the small form)
and both genomic- and antigenomic-sense HDV RNAs, while the vRNP
3
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 1
contains approximately 70 molecules of HDAg (in an unknown ratio of the large
and small forms) and only genomic-sense HDV RNA (Ryu et al., 1993).
The envelope of HDV particles consists of lipid and S, M, and L proteins of
HBsAg (Bonino et al., 1986). The ratio of these three proteins in the HDV
envelope is 95:5:1 (S:M:L), a ratio that is more similar to that of the empty HBsAg
particle than of the infectious HBV particle (Bonino et al., 1986). The different
HBsAg content between the HDV and HBV envelopes may account for the
slightly different host range and target cell specificity between the two viruses.
1.3 Genome Structure
The HDV genome consists of a single-stranded, circular RNA that is
approximately 1700 nt in size. As such, it is the smallest and only circular RNA
among animal viruses. Due to extensive intramolecular base pairing within the
genome, the circular molecule typically forms a rod-like structure (Kos et al.,
1986), where approximately 70% of the bases are paired (Kuo et al., 1988; Makino
et al., 1987; Wang etal., 1986).
Three genotypes of HDV have been described so far (Casey et al., 1993).
Genotype I, which has been identified in most areas of the world and is represented
by many different isolates, causes hepatic diseases ranging from mild to severe.
Genotype H , which shows approximately 75% homology to genotype I, has been
detected primarily in Asia and is associated with relatively milder hepatitis (Imazeki
et al., 1991; Wu et al., 1995). Genotype HI has been identified only in South
—
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 1
America so far (Casey et al., 1993); this genotype typically causes severe disease,
often associated with fulminant hepatitis (Hadler et al., 1992). Genotype III shares
about 60-65% homology with genotypes I and H. A recent isolate from
Taiwan was found to be significantly diverged from genotype n, and is suggested
to belong to a new subclass, genotype lib (Wu et al., 1998).
HDV RNA exists in any one patient as a collection of quasispecies, with slight
sequence heterogeneity. The evolution rate of HDV RNA during infection has
been estimated to be approximately 3 x 10*2 - 3 x 10'3 substitutions/nucleotide/year
(Imazeki et al., 1990; Lee et al., 1992). The evolution rate varies with the clinical
stage of the disease, with a higher evolution rate during the acute infection (Lee et
al., 1992).
To organize the genome, a unique HindlTI restriction enzyme site in the cDNA
of the prototype HDV RNA was designated nucleotide 1 (Figure 1). The ends of
the rod-like structure correspond to nt 795 and 1638 (according to the
nomenclature of Makino) (Makino et al., 1987). There are several highly
conserved domains within the genome, corresponding to the ribozyme domains,
portions of the HDAg open reading frame (ORF), and the putative promoter for
the HDAg mRNA (see below). The greatest sequence heterogeneity among
different HDV isolates is clustered between nucleotides 1 and 615 (Casey et al.,
1993; Chao et al., 1990; Chao et al., 1991). HDV shares limited sequence
similarity with viroid RNAs between nucleotides 615 and 950, which
encompasses the ribozyme domain (Elena et al., 1991). Other than this
5
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 1
Figure 1. Schematic diagram of die HDV RNAs. A) Structure of the genomic
and antigenomic strands of the HDV genome. B) Structure of the mRNAs
encoding the small and large forms of HDAg. Nucleotide 1015 represents the
RNA editing site. All nucleotide numbers represent those on the genomic strand.
The 0.8-kb mRNA is derived from the antigenomic strand.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Reproduced with permission o f th e copyright owner. Further reproduction prohibited without permission.
A.
1.7-kb genomic RNA
Genomic
strand
1638
795
0/1683
688/9
Antigenomic
strand
(E d)
1015 903/904
(A)n
0/1683
H I Ribozyme domain
EEB HDAg open reading frame
C-terminal 19 amino-acid extention
CD
0 5
<
0
X
c h
0 5
<
o
X
8
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 1
similarity, HDV RNA demonstrates no extensive sequence similarity with
other known viral or cellular RNAs.
A putative cellular homologue of HDAg, termed delta-interacting protein (Dip),
has been identified (Brazas and Ganem, 1996). However, the evolutionary
relationship of Dip with HDAg has been questioned (Long et al., 1997). These
structural features have led to the suggestion that HDV was derived from a
recombination between viroid-like RNA and a cellular mRNA (Branch et al., 1989;
Robertson, 1996).
1.3.1 Ribozyme structure and properties
Both the genomic and antigenomic HDV RNAs contain ribozyme activity,
which cleaves the genome (or antigenome), allowing the production of unit length,
1.7-kb RNA (Kuo et al., 1988; Sharmeen et al., 1988; Wu and Lai, 1989; Wu et al.,
1989). This ribozyme can work in cis and in trans (Branch and Robertson, 1991;
Perrotta and Been, 1992; Puttaraju et al., 1993; Wu et al., 1992). Efficient catalysis
by the ribozyme occurs in vitro at physiological pH and temperature, in the
presence of magnesium. The ribozyme activity has also been demonstrated in vivo
indirectly (Jeng et al., 1996; Jeng et al., 1996; Lazinski and Taylor, 1995). While
no protein factors are required for efficient RNA cleavage by the HDV ribozyme,
HDAg has been demonstrated to enhance HDV ribozyme cleavage in vivo (Jeng et
al., 1996). Other cellular factors may also contribute to correct RNA folding
and/or stabilization of the active ribozyme conformation (Lazinski and Taylor,
1995). The ribozymes can also mediate the ligation of RNA in vitro (Sharmeen et
9
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 1
al., 1989), but whether this reaction occurs in vivo or not has not been established.
The genomic HDV ribozyme is located near one end of the rod-like structure,
roughly spanning nucleotides 680 to 780 (Figure 1A). Cleavage occurs at
nucleotides 688/689 (Kuo et al., 1988; Wu et al., 1989). The ribozyme domain of
the antigenome is similarly located at the end of the rod, in the complementary
position to the genomic ribozyme.
In possessing ribozyme activity, HDV again shares functional attributes with
some plant viroids and virusoids. However, the HDV ribozyme significantly
differs from viroid and virusoid ribozymes both in sequence and in structure. The
two best characterized ribozyme structures are the hammerhead (Forster and
Symons, 1987) and hairpin/paperclip (Hampel and Tritz, 1989) ribozymes; both
types are found in virusoids. The HDV ribozyme cannot assume these
conformations, and was proposed to form one of several model conformations
(Been, 1994; Perrotta and Been, 1993; Tanner et al., 1994). In vitro mutagenesis
studies of the ribozyme domain generally supported a pseudoknot ribozyme
structure (Perrotta and Been, 1991). Mutagenesis studies of the full-length HDV
RNA and its function in cell culture confirmed the activity and requirement of this
pseudoknot structural model in vivo (Jeng et al., 1996). The RNA conformation
for the ligation reaction has not been characterized. Unlike the cleavage reaction, in
vitro ligation is very slow in the absence of cell extract.
RNA cleavage by the genomic and antigenomic ribozymes takes place by a
rrans-esterification reaction, yielding a 5’-OH and 2’-3’-cyclic monophosphate
terminus (Wu et al., 1989). Only 85 nucleotides of the HDV ribozyme are
10
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 1
required for cleavage, and all of the active nucleotides are located on the 3’ side of
the cleavage site (Perrotta and Been, 1990; Wu et al., 1992). This minimal
ribozyme can cleave even 1 nucleotide, irrespective of sequence, from the 5’ side of
the cleavage site (Perrotta and Been, 1990). This feature has allowed the
productive use of the HDV ribozyme to create RNA species with uniform 3’ ends,
where the HDV ribozyme is added to the 3’ end of the desired RNA product
(Pattnaik et al., 1992). The unique sequence and structural requirements of the
HDV ribozyme may contribute to the development of novel therapeutic targets for
ribozyme-mediated cleavage.
Ribozyme activity is required for HDV replication (Macnaughton et al., 1993).
Site-directed mutagenesis studies of the HDV ribozyme sequence in the full-length
HDV RNA demonstrated that the in vitro self-cleavage activity of any mutant RNA
(Wu and Huang, 1992) usually paralleled its replication ability in vivo
(Macnaughton et al., 1993). However, some mutants which retain the cleavage
activity in vitro and in vivo were unable to replicate (Jeng et al., 1996;
Macnaughton et al., 1993), suggesting that sequences relevant for the activity of the
ribozyme may also play other roles in RNA replication.
1.4 Hepatitis Delta Antigen (HDAg)
HDAg is the only protein encoded by HDV that has been detected in all HDV-
infected cells (Rizzetto et al., 1977). HDAg is a nuclear phosphoprotein (Chang et
al., 1988), which exists in two forms: a 24-kD species (S-HDAg) which is
11
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 1
required for replication (Bergmann and Gerin, 1986; Bonino et al., 1986; Kuo et
al., 1989; Pohl et al., 1987; Roggendorf et al., 1987), and a 27-kD species (L-
HDAg) which is required for virion assembly (Chang et al., 1991; Ryu et al., 1992;
Wang et al., 1991), and inhibits HDV replication (Chao et al., 1990; Glenn and
White, 1991). The two forms are identical in amino acid sequence, except that L-
HDAg has an additional 19 amino acids at the C-terminus. Both forms are found
at varying levels in infected patients. They are synthesized from two distinct
mRNA species, which are identical in structure, except that the mRNA encoding L-
HDAg contains a tryptophan codon at the site of the S-HDAg amber stop codon,
allowing translation to continue to the end of the L-HDAg open reading frame.
This mRNA is the result of an RNA editing event, where a double-stranded RNA
deaminase (ADAR1 and/or ADAR2) selectively edits the antigenome (see below)
(Casey and Gerin, 1995; Poison et al., 1996; Poison et al., 1998).
1.4.1 Structural features of HDAg
HDAg is a strongly hydrophilic protein which lacks a transmembrane domain.
The N-terminal two-thirds of the protein is highly basic, whereas the C-terminal
one-third is relatively uncharged. S-HDAg and L-HDAg contain the following
structural features (Figure 2):
Coiled-coil structure: Both forms of HDAg possess a coiled-coil domain near
the N-terminus (amino acids 31-52). This domain has the classical features of the
12
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 1
Figure 2. Schematic diagram of the small and large forms of HDAg.
13
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Reproduced with permission o f th e copyright owner. Further reproduction prohibited without permission.
L-HDAg
(NLS) HLH
CRBD CCS NLS ARM-1 I ARM-II
2-27 31-52 68-88 97-107 136-146
PAS
195-214
m
S-HDAg
■
1 I
H i Coiled-coil seq u en ce (CCS)
1 H Nuclear localization signal (NLS)
VZ1 Arginine-rich motif (ARM)
Helix-loop-helix (HLH)
S-HDAg-specific epitope
DDH Packaging signal (PAS)
Hi Epitopes recognized byAb from patients
Hi Epitopes recognized by peripheral T-cells from patients
E 3 Cryptic RNA-binding domain (CRBD)
Chapter 1
leucine-zipper sequence, including four leucines or isoleucines, each separated by
six amino acids (Chen et al., 1992; Wang and Lemon, 1993; Xia and Lai, 1992).
The coiled-coil structure functions as a protein-protein interacting domain, and
allows multimerization of S-HDAg and L-HDAg with themselves or each other
(Chang et al., 1993; Wang and Lemon, 1993; Xia and Lai, 1992). The leucine
residues are critical to the interaction between HDAg molecules (Xia and Lai,
1992). The helix-loop-helix (HLH) domain in the middle of the protein (aa 108 to
135) may also contribute to protein-protein interactions (Chang et al., 1993).
Nuclear localization signal (NLS): The NLS, a bipartite, basic amino acid-rich
region, is located between amino acids 68 and 88 from the N-terminus (Xia et al.,
1992). HDAg appears to enter the nucleus as a complex; thus, HDAg with a
deleted NLS can enter the nucleus by binding to wild-type HDAg (Chang et al.,
1992; Xiaet al., 1992). The NLS of HDAg interacts with karyopherin a2 in vitro,
suggesting that nuclear import of HDAg is mediated by the karyopherin cx2p
heterodimer (Chou et al., 1998). A cryptic NLS is located between amino acids
35-50, but this NLS has no activity unless a downstream hydrophobic domain is
removed (Chang et al., 1992). HDAg mediates the import of the HDV RNA into
the nucleus (Chou et al., 1998),where RNA replication occurs.
RNA-binding domain: The RNA-binding domain of HDAg consists of two
arginine-rich regions (Lee et al., 1993), which resemble the arginine-rich motifs
(ARMs) of other RNA-binding proteins, such as rev and tat of human
—
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 1
immunodeficiency virus (Lazinski • et al., 1989). Deletion of either ARM
diminishes or eliminates HDV RNA binding in vitro, suggesting that the presence
of these two motifs is essential for the formation of HDAg-HDV RNA complexes
(Lee et al., 1993). The HLH motif between the two ARMs is also required for the
binding of HDAg to HDV RNA (Lee et al., 1993; Wang et al., 1994); however, the
sequence specificity in this region is not clear. A cryptic RNA-binding domain has
also been described at the very N-terminus of HDAg (amino acids 2-27) by in
vitro peptide binding experiments (Poisson et al., 1993; Poisson et al., 1995).
The requirements for HDV RNA binding by HDAg in vivo, however, are not
as stringent as experiments performed in vitro would suggest. Studies on the
HDAg-mediated nuclear import of HDV RNA indicate that functional HDV RNA-
binding by HDAg occurs in the presence of any one of the three RNA-binding
domains -- the cryptic RNA-binding domain, ARMI, or ARMII (Chou et al.,
1998). Structural studies of HDAg multimerization further suggest that the N-
terminal cryptic RNA-binding domain (aa 2-27) may play a role in HDV RNA
binding in the nucleocapsid or nuclear RNP complex (Zuccola et al., 1998). All
three RNA-binding domains may be required for HDV RNA replication (Lee et al.,
1993; Yeh et al., 1996). Adding further complexity to the HDV RNA-binding
properties of HDAg is a recent study demonstrating that the coiled-coil region of
HDAg binds to the ribozyme domain of genomic HDV RNA and may thereby
modulate the ribozyme’s autocatalytic activity (Cheng et al., 1998; Huang and Wu,
1998).
16
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 1
HDAg binds HDV RNA specifically, but whether this specificity is conferred
by RNA structure or sequence has not been determined (Lin et al., 1990). HDAg
binding at one site of the HDV genome can be competed away by HDV RNA
sequences from other regions of the genome (Lin et al., 1990). HDAg binds to the
rod-like structure formed by unit-length HDV RNA (Chao et al., 1991), but does
not bind to double-stranded RNA consisting of non-HDV sequences (Chao et al.,
1991; Lin et al., 1990). Both the genomic and antigenomic strands of HDV RNA
can bind to HDAg (Lin et al., 1990), and both the L-HDAg and S-HDAg bind
HDV RNA with equal affinity (Hwang et al., 1992); it is unknown why only
genomic RNA, but not antigenomic RNA, is incorporated into the virion particles.
Phosphorylation sites: Both L-HDAg and S-HDAg are phosphorylated at
serine residues (Chang et al., 1988). L-HDAg has a six-fold higher level of
phosphorylation than S-HDAg (Hwang et al., 1992). The role of HDAg
phosphorylation in the HDV life cycle has only begun to be studied.
Phosphorylation of S-HDAg at Ser-2, probably by casein kinase II, positively
affects HDV replication, since mutation of this residue to alanine significantly
reduces HDV replication (Yeh et al., 1996). Mutation of Ser-123 to alanine,
however, does not affect HDV replication. Inhibitors of casein kinase II inhibited
RNA replication, suggesting that phosphorylation of HDAg is important for RNA
replication (Yeh et al., 1996). This effect may be caused by the alteration of RNA-
binding activity, since Ser-2 is located at the first residue of the N-terminal cryptic
RNA-binding domain of HDAg (Poisson et al., 1995). Phosphorylation at Ser-2
17
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 1
and Ser-123 do not affect the trans-suppression activity of L-HDAg, assembly of
empty vims-like HDAg particles, or transport of HDAg into the nucleus (Yeh et al.,
1996).
Protein kinase C (PKC) activity also appears to upregulate HDV replication
(Yeh et al., 1996). Inhibitors of PKC suppress both HDV replication and the
phosphorylation level of S-HDAg (Yeh et al., 1996). PKC inhibitors did not
reduce the phosphorylation level of L-HDAg, and mutation of Ser-210 (a
conserved PKC recognition site within L-HDAg) to alanine did not affect any
known functions of L-HDAg (Yeh et al., 1996). Whether the effect of PKC on
HDV replication is through phosphorylation of Ser or Thr residues within S-
HDAg or through phosphorylation of cellular factors is unknown. However, this
finding does suggest that the differential regulation of S-HDAg and L-HDAg
phosphorylation may be another mechanism by which these two similar proteins
achieve their very different biological activities.
Conserved C-terminal domain (amino acids 146-195) o f S-HDAg: Unlike the
N-terminal two-thirds of S-HDAg, the C-terminal domain is rich in proline and
glycine and highly hydrophobic. Functionally, this domain has been postulated to
contain a trans-activating function required for HDV RNA synthesis. Site-specific
mutagenesis studies show that this domain is indispensable for the trans-activation
property of S-HDAg in HDV RNA replication (Lazinski and Taylor, 1993).
However, efforts to directly demonstrate a trans-activation activity for this domain
using DNA-templated pol II transcription systems have been unsuccessful (Hwang
—
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 1
et al., 1995). This suggests that while this domain may be significant for the trans-
activation of RNA-templated HDV RNA synthesis, it does not possess trans-
activation activity relevant for DNA-templated pol II transcription. S-HDAg
contains a unique conformation different from that of L-HDAg in this domain, as
suggested from a monoclonal antibody which recognizes this domain of S-HDAg
only (Hwang and Lai, 1993). This property is consistent with the fact that only S-
HDAg can /rans-activate HDV RNA replication, whereas L-HDAg inhibits RNA
replication (Table 1). Surprisingly, a recent report shows that L-HDAg, but not S-
HDAg, can tranj-activate DNA-templated pol II transcription (Wei and Ganem,
1998). This is difficult to reconcile with the biological activities of L-HDAg in
HDV replication. In contrast, it has also been reported that both S-HDAg and L-
HDAg can inhibit cellular pol II, but not pol I or pol ID, transcription (Lo et al.,
1998). This latter finding suggests that S-HDAg and L-HDAg sequester factors
required for pol II transcription. Both these studies are consistent with the notion
that HDAg interacts with host transcription machinery, although it is not clear
whether these findings are relevant to the biological roles of HDAg in HDV
replication.
C-terminal 19-amino-acid extension o f L-HDAg: The C-terminal 19-amino-
acid extension of L-HDAg is highly conserved within each genotype. However,
the first 15 amino acids of the 19-amino-acid extension are poorly conserved
between genotypes (Casey et al., 1993; Imazeki et al., 1991). Common to all
isolates of L-HDAg is a cysteine residue 4 amino acids from the C-terminus,
19
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 1
Table 1. Biochemical and biological activities of HDAg.
Large Sm all
Amino acid residues 214 195
Dimerization + +
RNA-binding + +
Isoprenylation + -
C-terminus-specific epitope
-
+
(9E4)
Phosphorylation +++ (6x) +
Nuclear transport of HDV + +
RNA
Trans-activation of HDV
_
+
RNA synthesis
Trans-dominant inhibition +
_
of HDV RNA synthesis
Interaction with HBsAg + + +
Stabilization of HDV RNA + +
Enhancement of ribozyme + +
activity
RNA chaperone activity nd +
nd = not determined
20
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 1
which functions as an isoprenylation signal directing the addition of a famesyl
group (Glenn et al., 1992; Otto and Casey, 1996). Isoprenylation is required for
packaging of the HDV virion (Chang et al., 1994; Glenn et al., 1998; Glenn et al.,
1992; Lee et al., 1995; Lee et al., 1994), probably because isoprenylation of L-
HDAg is required for the binding of L-HDAg to HBsAg (de Bruin et al., 1994;
Hwang and Lai, 1993). Isoprenylation alone is not sufficient to mediate
packaging, however, since addition of an isoprenoid to S-HDAg does not allow S-
HDAg-HBsAg interaction (Hwang and Lai, 1993). Thus, the 15 amino acids
upstream of the isoprenylation motif participate in the packaging function of L-
HDAg. Since this amino acid sequence diverges among the three described
genotypes, the significance of these amino acids in particle formation probably lies
in their contribution to the overall conformation of the protein, rather than in the
primary amino acid sequence.
Isoprenylation of L-HDAg may also contribute to the ability of L-HDAg to
suppress viral replication (Hwang and Lai, 1994). The presence of a prenoid
group changes the conformation of HDAg, masking a S-HDAg-specific epitope
recognized by the monoclonal antibody 9E4 (Hwang and Lai, 1993). This epitope
is exposed when the isoprenylation motif of L-HDAg is destroyed by site-directed
mutagenesis of the cysteine residue, and a reduction in the tra/w-dominant
inhibition of replication occurs (Hwang and Lai, 1994; Hwang and Lai, 1993).
21
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 1
1.4.2 Biological functions of HDAg
L-HDAg and S-HDAg have very distinct biological roles in the HDV life cycle
despite their underlying structural similarities (Table 1). S-HDAg is required for
HDV RNA replication, and can act in trans to activate replication of an HDV
genome containing a defective open reading frame for S-HDAg (Kuo et al., 1989).
Since most mutants of S-HDAg cannot trans-activate HDV replication (Chang et
al., 1994; Chang et al., 1993; Hwang and Lai, 1994; Lazinski and Taylor, 1993; Lee
et al., 1993; Xia and Lai, 1992), all the known domains of S-HDAg are presumably
involved in HDV RNA replication. However, the putative role of S-HDAg in HDV
RNA replication has not been directly demonstrated in an in vitro replication
system. Furthermore, rra/w-activation of HDV RNA replication by S-HDAg
appears to be genotype-specific, since genotype I S-HDAg cannot support
genotype DI viral replication, and genotype HI S-HDAg cannot support genotype I
viral replication (Casey and Gerin, 1998). The molecular basis for this
phenomenon has not yet been elucidated.
L-HDAg, on the other hand, acts as a potent rrans-dominant inhibitor of HDV
RNA replication (Chao et al., 1990; Glenn and White, 1991). The presence of L-
HDAg in as little as 10% of the total HDAg pool can almost completely inhibit
HDV replication (Chao et al., 1990). This frans-dominant inhibitory activity of L-
HDAg requires the ability of L-HDAg to form a complex with S-HDAg (Xia and
Lai, 1992). Inhibition of HDV replication by L-HDAg probably results from the
conformational differences between S-HDAg and L-HDAg (Hwang and Lai, 1994;
Hwang and Lai, 1993), where L-HDAg disrupts a S-HDAg multimer required for
22
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 1
HDV replication (Xia and Lai, 1992). This notion is supported by the finding that
most deletion mutants of S-HDAg and L-HDAg can act as trans-dominant
negative inhibitors of replication, as long as the coiled-coil domain required for
HDAg multimerization is intact (Chen et al., 1992; Xia and Lai, 1992). Notably,
the ARMI and ARMII RNA-binding domains of HDAg are not required for
inhibition, suggesting that L-HDAg does not need to bind HDV RNA to inhibit
replication (Lazinski and Taylor, 1993). However, the potential role of the cryptic
N-terminal RNA-binding domain in inhibiting HDV RNA replication has not been
investigated. The recent finding that full-length genotype E D S-HDAg can also
function as a rra/zs-dominant negative inhibitor of genotype I viral replication
further supports the strict requirement for homogeneous S-HDAg complexes for
the rra/w-activation function of S-HDAg (Casey and Gerin, 1998). However, the
failure of genotype I S-HDAg to function as a trans-dominant inhibitor of
genotype E l viral replication suggests that the molecular basis for the trans-
activation and trans-dominant inhibition activities of HDAg may be more complex
than our current understanding (Casey and Gerin, 1998).
L-HDAg also mediates assembly of the mature HDV virion (Chang et al.,
1991). L-HDAg appears to be the only HDV element strictly required for the
formation of HDV-like particles, since L-HDAg and HBsAg can be secreted in a
virus-like particle in the absence of S-HDAg and HDV RNA (Chang et al., 1991).
S-HDAg is incapable of initiating particle assembly, but must be included in the
virion for infectivity, since S-HDAg is required for replication of the HDV genome
(Kuo et al., 1989). S-HDAg incorporation into the virion requires the presence of
23
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 1
L-HDAg, and probably depends on the direct interaction between S-HDAg and L-
HDAg (Chen et al., 1992).
Both forms of HDAg can stabilize HDV RNA (Lazinski and Taylor, 1994)
and enhance its ribozyme activity (Jeng et al., 1996). Both forms have also been
shown to inhibit HDV mRNA polyadenylation in cDNA-based transfection
systems, thus facilitating HDV RNA replication (Hsieh and Taylor, 1991; Hsieh et
al., 1994). However, this latter activity may not function in the natural HDV
replication cycle (Modahl and Lai, 1998).
These biological properties of HDAg are to some extent genotype-specific, as
HDAg derived from genotypes I and E D of HDV vary in their ability to trans-
activate or inhibit HDV RNA replication and to stabilize the HDV genome (Casey
and Gerin, 1998). These properties may be partially responsible for the difference
in the pathogenic potentials of these two genotypes (Hadler et al., 1992). The
relative biological activities of HDAg derived from genotype II have not yet been
evaluated.
1.5 Viral Replication Cycle
1.5.1 In vitro and in vivo models for studying HDV replication
HDV infection of cultured cell lines so far has not been successful. The only
cell culture susceptible to HDV infection is primary hepatocytes from woodchucks
or chimpanzees (Choi et al., 1988; Sureau et al., 1991; Taylor et al., 1987). This
restriction in cultured cell lines probably is due to the lack of receptors in most
—
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 1
cells, as is the case with HB V. The receptors for these two viruses are probably the
same since they have similar envelope proteins, but neither of these receptors has
been identified. Infection of primary hepatocytes is inefficient, however, and
primary hepatocytes are difficult to obtain; thus, this approach is not useful for
molecular biology studies.
The system most commonly used to study HDV replication has been the
transfection of plasmid DNA containing a dimer or trimer of the HDV genome
under a foreign promoter. This system bypasses requirements for virus attachment
and entry. HDV RNA transcribed from the transfected plasmid can replicate in the
cells, as evidenced by the detection of HDV genomic- and antigenomic-sense RNA
and HDAg (Kuo et al., 1989; Macnaughton et al., 1993). Because this system has
proven so useful, most of our knowledge on HDV replication has come from
studies using this approach. Unfortunately, this system introduces an artificial
requirement for DNA-templated transcription of the HDV genome, which
complicates the study of HDV replication. This complexity is furthered by the
presence of a strong endogenous promoter within the HDV cDNA (Macnaughton
etal., 1993; Taietal., 1993). Indeed, an HDV cDNA without a foreign promoter,
such as a recircularized monomer HDV cDNA, is an effective source for
replicating HDV RNA (Macnaughton et al., 1993; Tai et al., 1993)
To bypass the dependence on HDV cDNA, several systems have used in vitro
transcribed HDV RNA for transfection (Glenn et al., 1990; Hwang et al., 1995;
Wang et al., 1997). However, the transfected HDV RNA can replicate only in cells
in which HDAg is being constitutively expressed from a stably integrated cDNA.
25
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 1
Again, the presence of cDNA for HDAg complicated the analysis of events in
HDV replication in the cells. For reasons that are unclear, cotransfection of a
plasmid encoding HDAg with the HDV RNA genome does not allow for HDV
replication (Glenn et al., 1990; Hwang et al., 1995). More recently, two cDNA-free
transfection systems have been developed. Transfection of a ribonucleoprotein
(RNP) complex, consisting of purified S-HDAg and the HDV genome, by
liposomal agents can establish HDV replication (Bichko et al., 1994; Dingle et al.,
1998). This system has the advantage of allowing direct manipulation of HDAg
and/or HDV RNA during the initial phase of replication, and may potentially be the
method of choice for the study of early events in the HDV replication cycle.
However, this system is difficult and the efficiency of transfection is low. Another
method is the cotransfection of the HDV RNA genome with in vitro transcribed,
capped mRNA encoding HDAg (Modahl and Lai, 1998). This approach leads to
robust HDV RNA replication and mRNA transcription, and is easy to perform.
Animal models of HDV infection and related hepatic disease most commonly
used are the chimpanzee and woodchuck (Ponzetto et al., 1984; Ponzetto et al.,
1988; Rizzetto et al., 1980). Infection by HDV in these animals closely mimics
HDV infection in humans, leading to hepatitis and liver damage (Ponzetto et al.,
1984; Ponzetto et al., 1988; Rizzetto et al., 1977). Efforts to establish a mouse
model have thus far been unsuccessful. Intraperitoneal or intravenous inoculation
of wild-type and SCID mice resulted in only transient and inefficient HDV
infection of hepatocytes; no hepatitis developed (Netter et al., 1993).
26
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 1
Transgenic mice expressing HDV RNA have also been developed. HDV RNA
was found to replicate very well in a number of tissues, including skeletal muscle,
brain, testes, and kidney (Poloetal., 1995). Surprisingly, replication was relatively
poor in the liver, suggesting that the liver may not be the natural target of HDV, and
that the hepatotropism of HDV is likely due to restricted expression of the surface
receptor for HDV in most tissues. No pathology was seen in the transgenic
mouse, suggesting that HDV RNA replication and HDAg are not directly
cytopathic (Polo et al., 1995). Intramuscular injection of HDV cDNA into mice
also leads to HDV RNA replication in skeletal muscles and the development of
humoral antibodies to HDAg (Polo et al., 1995).
HDV RNA replication has been demonstrated in nuclear run-on experiments
using isolated nuclei from HDV-replicating cells (Macnaughton et al., 1991).
Exogenous HDV RNA has also been shown to replicate in nuclear extracts from
uninfected cells, demonstrating that cellular transcription machineries are sufficient
to replicate HDV RNA (Beard et al., 1996; Macnaughton et al., 1991). However,
the addition of S-HDAg to this system had no effect on HDV RNA synthesis.
These data conflict with the demonstrated requirement of S-HDAg for HDV
replication in cells (Kuo et al., 1989). A reconstituted in vitro pol II-mediated
transcription system, consisting of purified basal transcription factors and pol n,
has also been reported to replicate exogenously added HDV RNA (Fu and Taylor,
1993). Unfortunately, this latter work has so far not been reproduced. It is most
likely that HDV replication in vitro requires factors or conditions that have not yet
been elucidated.
27
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 1
1.5.2 Metabolic requirements for HDV RNA replication
The host range of HDV is similar to that of HBV, since the envelope of HDV
consists of HBsAg. However, unlike HBV, which infects some extrahepatic
tissues such as pancreas or peripheral blood cells (Halpem et al., 1983; Pasquinelli
et al., 1986), extrahepatic replication has never been demonstrated for HDV. In
addition, HDV can infect woodchucks, whereas HBV cannot (Ponzetto et al., 1984;
Taylor et al., 1987). The slight difference in host range could be the result of the
different ratios of the three components of HBsAg in the envelopes of HDV and
HBV (Bonino et al., 1986). The receptors for HDV have not been identified.
Once the virus enters the cell, HDV RNA is transported to the nucleus, where
RNA replication occurs (Gowans et al., 1988). Transport of HDV RNA into the
nucleus is mediated by HDAg (Chou et al., 1998). In addition, de novo
synthesized S-HDAg appears to play a direct role in the initiation of HDV
replication, since ribonucleoprotein containing HDV genomic RNA and HDAg
transfected into cells led to RNA replication only when the genome contained an
intact open reading frame for S-HDAg (Dingle et al., 1998). A puzzling dilemma
is that the HDV virion contains variable amounts of L-HDAg, which can inhibit
HDV replication even in the presence of a large excess of S-HDAg (Chao et al.,
1990); thus, the mechanism by which HDV replication is established by the
infecting HDV virion, which contains both S-HDAg and L-HDAg, is unclear.
28
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 1
The enzymes and machineries which carry out HDV replication are still largely
unknown. HDV does not encode an RNA polymerase of its own, and can replicate
in the absence of HBV in cells transfected with the HDV RNA genome. Thus,
HDV must utilize cellular transcription machineries to propagate itself. HDV does
not replicate via a DNA intermediate, since HDV replication is insensitive to
actinomycin D (Macnaughton et al., 1990), but rather replicates via RNA-
dependent RNA synthesis. In vitro studies of HDV replication indicate that HDV
replication is sensitive to a-amanitin at a concentration of 1 ug/ml, suggesting that
cellular RNA pol IE may be involved in HDV replication (Macnaughton et al.,
1991). This possibility is in parallel with the work demonstrating that the plant
equivalent of RNA pol II replicates viroid RNA (Rackwitz et al., 1981), with which
HDV shares structural homology (Diener and Pruisner, 1985).
The mechanism by which HDV redirects pol II to its RNA template has yet to
be elucidated. Because HDV RNA forms a rod-like structure with extensive
intramolecular base-pairing, it has been suggested that pol II may recognize
double-stranded regions of the HDV RNA genome. Using double-stranded HDV
cDNA as a model, it was found that pol II could recognize a sequence of the HDV
cDNA corresponding to one end of the HDV RNA rod structure to direct DNA-
dependent RNA transcription (Macnaughton et al., 1993). HDV RNA was
subsequently found to possess the promoter activity in the same region for RNA-
dependent RNA transcription in vitro (Beard et al., 1996). However, mutational
analysis of the promoter revealed that two bulges and the stem-loop structure at the
end of the rod were critical to the promoter activity for RNA-dependent RNA
29
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 1
transcription (Beard et al., 1996). These studies of HDV replication suggest that
cellular transcription machineries may have the surprising and previously
unsuspected capability to perform RNA-templated RNA synthesis.
1.5.3 Double rolling-circle replication
Like viroids, HDV is thought to replicate according to the double rolling-circle
model (Branch and Robertson, 1984). In this model, the circular genome acts as
the template for synthesis of antigenomic RNA. The nascent antigenomic strand,
which is longer than monomer length, is cleaved via the antigenomic ribozyme into
monomer-length, linear RNA. This antigenomic monomer is then religated to form
a circular template for genomic RNA synthesis. Genomic RNA is also cleaved and
religated by the genomic ribozyme, providing both new template for antigenomic
RNA synthesis and genomic RNA for new viral particles.
This model of HDV replication has been supported experimentally. Multimer
RNAs of both genomic and antigenomic senses are detected in infected livers
(Chen et al., 1986), and in cells transfected with HDV cDNA or RNA (Kuo et al.,
1989; Macnaughton et al., 1993; Tai et al., 1993). Also, monomeric RNAs of both
genomic and antigenomic senses can be separated into circular and linear forms
(Chen et al., 1986). This model predicts that genomic and antigenomic ribozyme
activity is required for replication; indeed, site-specific mutations of the ribozyme
domain, which result in the loss of the ribozyme activity in vitro, also result in loss
of replication in vivo (Macnaughton et al., 1993). Finally, the detection in vivo of
monomer, dimer, and trimer HDV RNAs, with little heterogeneous RNA species in
_
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 1
between, suggests that HDV RNA is precisely processed. This is in accordance
with the double rolling-circle model, where nascent HDV RNA is specifically
cleaved and religated via the ribozyme.
An interesting question concerns the mechanism by which the HDV ribozyme
is regulated. HDV dimers and trimers are perhaps formed when the nascent HDV
RNA is not completely processed by the ribozyme into monomers during
transcription. However, it is unclear how the multimers would then self-cleave into
unit-Iength monomers, since these multimeric molecules are predicted to form a
large rod-shaped structure (Kos et al., 1986) which would interfere with the
formation of the active ribozyme. One possibility is that the multimeric RNAs
represent replicative dead-ends, rather than intermediates in the replication cycle.
Another possibility is that viral protein or cellular factors regulate the formation of
ribozyme structure. Indeed, HDAg has been shown to enhance the HDV ribozyme
activity in cells (Jeng et al., 1996). Because the HDV ribozyme is crucial to
successful HDV replication, it may provide a target for HDV therapy.
The relative ratio of genomic and antigenomic RNA is approximately 15:1
(Chen et al., 1986). The regulatory mechanism by which genomic strand synthesis
outpaces antigenomic strand synthesis is unclear. A recent report described HDV
RNA mutations which abrogated genomic strand synthesis without affecting
antigenomic strand synthesis (Wang et al., 1997), suggesting that the synthesis of
these two strands is under separate regulation. The fact that the genomic RNA is
used for the synthesis of both HDAg mRNA and antigenomic HDV may be one
explanation for the limited production of antigenomic RNA. A high ratio of
31
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 1
genomic RNA to antigenomic RNA may facilitate the selective incorporation of
genomic RNA into progeny virus. It is estimated that each infected cell contains
approximately 300,000 copies of HDV genomic RNA (Chen et al., 1986).
The initiation and termination points of RNA replication have not been
determined. A recent study (Beard et al., 1996) showed that the sequence spanning
nt 1608 to nt 1669 can function as a promoter for HDV RNA synthesis. The
potential RNA promotor activity of these sequences was suggested by the finding
that a double-stranded cDNA spanning nt 1650 functioned as a promoter for
DNA-templated HDV RNA transcription (Macnaughton et al., 1993). This
endogenous promoter had bidirectional activity, generating both genomic-sense
and antigenomic-sense transcripts (Macnaughton et al., 1993; Tai et al., 1993). It
is not known whether the corresponding RNA sequences constitute the promotors
for both genomic strand synthesis and antigenomic strand synthesis. The selective
inhibition of genomic strand synthesis by linker-scanning mutagenesis in a recent
study (Wang et al., 1997) suggests that the cis elements required for initiation of
genomic and antigenomic strand synthesis may differ.
1.5.4 Subgenomlc mRNA species
Also detected in infected cells is a 0.8-kb, poly(A)-containing RNA species
which contains the open reading frame for HDAg (Chen et al., 1986; Hsieh et al.,
1990; Modahl and Lai, 1998). The 5’-end of this RNA is located at nucleotide
1631, corresponding to one end of the HDV RNA rod structure, about 30
nucleotides upstream of the start of the HDAg ORF (Chen et al., 1986; Hsieh et
32
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 1
al., 1990; Modahl and Lai, 1998). -This initiation site is adjacent to the promoter
found in HDV RNA (Beard et al., 1996). The mRNA ends near a eukaryotic
polyadenylation signal (AAUAAA) located about 60 nucleotides downstream of
the ORF (Figure IB) (Chen et al., 1986; Hsieh et al., 1990). It was hypothesized
that this mRNA may be generated during the first round of RNA replication from
the incoming HDV RNA (Chen et al., 1986; Hsieh et al., 1990). The nascent RNA
is processed and polyadenylated at the polyadenylation signal, generating the 0.8-
kb, poly(A)-containing RNA, which serves as an mRNA for translation of HDAg.
HDAg was proposed to suppress the HDV polyadenylation signal, allowing
subsequent rounds of RNA replication to continue past the polyadenylation signal
to generate monomeric and multimeric HDV antigenomic RNAs (Hsieh and
Taylor, 1991; Hsieh et al., 1994). This model predicted that the HDAg mRNA
would be synthesized only early during infection. Recent studies using RNA
transfection method have shown this not to be the case (Modahl and Lai, 1998).
Instead, HDAg mRNA is synthesized throughout the HDV replication cycle; thus,
it appears that mRNA transcription and genomic RNA replication take place
independently, and may have different initiation sites (Modahl and Lai, 1998).
Mutagenesis studies have further suggested that ds-acting elements critical for
mRNA synthesis and genomic RNA replication may not be identical (Wang et al.,
1997). It is not clear whether the recently identified promoter element for HDV
RNA synthesis (antigenomic strand) directs mRNA synthesis or RNA replication
(Beard etal., 1996).
33
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 1
1.5.5 Translation
HDV RNA contains several ORFs on both the genomic and antigenomic
strands (Makino et al., 1987; Wang et al., 1986). However, only one, the ORF that
encodes HDAg on the antigenomic strand, is preserved among all the isolates.
This is the only protein detected in the majority of cells containing replicating
HDV. An additional ORF, designated ORF K, which encodes a 27-amino acid
peptide sharing partial sequence similarity to HBV polymerase, has also been
shown to be translated in a small fraction of infected woodchuck liver or
transfected cells (<2%) (Bichko et al., 1996; Khudyakov et al., 1993; Khudyakov
andMakhov, 1990). The coding sequence for this protein overlaps the 3’-end of
the ORF for HDAg, and is in the -1 reading frame relative to that of HDAg. Some
patients with HDV infection have antibodies to the peptide (Bichko et al., 1996).
What role this protein may play in HDV infection is unknown.
The mechanism of translation for HDAg has been controversial. HDAg is
present in abundance in infected cells; despite this, the 0.8-kb HDAg mRNA is
often difficult to detect. This led to the hypothesis that perhaps the antigenome
itself, either in circular or linear form, could act as a template for HDAg synthesis
(Lai, 1995). This does not appear to be the case, since only the 0.8-kb mRNA, and
not the antigenomic monomer, is associated with polysomes during HDV
replication (Lo et al., 1998). Furthermore, the full-length HDV RNA can not be
translated in vitro, even under the conditions that favor internal initiation of
translation (Lo et al., 1998). Another explanation for the paucity of the 0.8-kb
mRNA relative to HDAg is that the mRNA is relatively unstable. The recent
—
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 1
finding that the 0.8-kb mRNA is synthesized throughout replication, but not only
at the beginning, provides the continuous supply of template for the synthesis of S-
HDAg throughout replication, and of L-HDAg late in the replication cycle
(Modahl and Lai, 1998).
L-HDAg and S-HDAg are translated from two separate HDV RNA molecules
containing ORFs of different lengths. The origin of these two RNAs is discussed
in the following section.
1.5.6 RNA editing
The two HDAg species, S-HDAg and L-HDAg, have opposing biological
activities: S-HDAg is required for HDV RNA replication (Kuo et al., 1989),
whereas L-HDAg inhibits replication (Chao et al., 1990), and is required for vims
assembly (Chang etal., 1991). These properties suggest that S-HDAg is required
early in the HDV life cycle when HDV RNA replication is active; in contrast, L-
HDAg should not be present until later in the infection when sufficient viral RNA
has been made, and vims particles are being assembled. This temporal regulation
of HDAg expression has been demonstrated experimentally: when an HDV
dimeric cDNA with a functional ORF for S-HDAg was transfected into cells,
initially only S-HDAg was synthesized (Luo et al., 1990). L-HDAg appeared
three to four days later in the cell culture (Luo et al., 1990). Correspondingly, an
HDV RNA species with a larger ORF encoding L-HDAg emerged, in which a
specific mutation had occurred at the amber termination codon of the ORF for S-
HDAg (Luo et al., 1990). After several conflicting reports (Casey et al., 1992;
35
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 1
Casey and Gerin, 1995; Luo et al., 1990; Zheng et al., 1992), about which strand,
genomic or antigenomic, of HDV RNA is edited, it has been finally determined that
the antigenomic strand is edited at adenosine 1012 (Poison et al., 1996)
(numbering according to W ang et al (Wang et al., 1986)), the equivalent of
adenosine 1015 (numbering according to Makino et al (Makino et al., 1987)).
Editing is carried out by the cellular enzyme double-stranded-RNA-adenosine
deaminase (ADAR), which converts the adenosine in the amber termination codon
to inosine by deamination (Poison et al., 1996; Poison et al., 1998). The inosine,
like G, prefers to pair with C. Thus, after replication to the genomic strand and
synthesis of a new mRNA, UAG (stop) is converted to UGG (tryptophan),
allowing synthesis of L-HDAg.
The mechanism for the regulation of RNA editing is not entirely clear.
Because the emergence of HDV genomes which encode L-HDAg will cause RNA
replication to stop, some mechanism likely exists to regulate the timing and extent
of RNA editing. Poison et al recendy described findings which suggest two
mechanisms by which this might be accomplished (Poison et al., 1998). First, the
authors found that promiscuous editing of non-amber/trp adenosines did occur on
HDV RNA at random sites (which may interfere with its replication), but it
occurred only on genomes which were also edited at the amber/trp site (nt 1012).
This suggests that genomes encoding L-HDAg may be selectively removed from
the replicadng HDV RNA pool as increasing numbers of adenosines are edited.
Second, the authors found that S-HDAg strongly suppressed editing of the
adenosine at the amber/trp site in a dose-dependent manner. Suppression of HDV
—
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 1
editing by this mechanism would limit the production of genomes encoding L-
HDAg during infection. The authors suggest that S-HDAg may sterically interfere
with editing by ADAR by binding to the HDV RNA, since the major RNA-binding
motif (ARMI and ARMH) of S-HDAg is required for suppression (Poison et al.,
1998). It is unknown whether L-HDAg has similar effects on deamination at the
HDV amber/trp site.
1.5.7 Virus assembly
Formation of the mature HDV virion, which contains HBsAg, L-HDAg, S-
HDAg, and HDV RNA, is absolutely dependent on the presence of the helper
vims, HBV. While all of these components are necessary for formation of
infectious HDV, several studies have shown that noninfectious particles can be
formed when only L-HDAg and HBsAg are present (Chang et al., 1991; Chen et
al., 1992; Ryu et al., 1992; Wang et al., 1991). L-HDAg, specifically its C-terminal
19 amino acids containing the isoprenylation motif, is necessary and sufficient for
interaction with HBsAg (Hwang and Lai, 1993; Lee et al., 1995; Lee et al., 1994).
Mutations of either the isoprenylation signal or the 19 amino acids affected vims
assembly, and fusion of these 19 amino acids to a reporter protein (c-H-ray)
allowed this fusion protein to be secreted with HBsAg (Lee et al., 1995). Thus, L-
HDAg and HBsAg are the minimal components for the assembly of HDV-like
particles. HDV RNA and S-HDAg are not required (Chen et al., 1992).
37
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 1
HDV RNA can be packaged w#h L-HDAg and HBsAg into the viral particle in
the absence of S-HDAg (Chen et al., 1992), but inclusion of S-HDAg improves
the efficiency of HDV RNA packaging (Wang et al., 1994). Thus, while S-HDAg
is not required for and cannot initiate particle formation, it likely plays a role in the
specificity of particle formation. Incorporation of S-HDAg into the virion depends
on its interaction with L-HDAg (Wang et al., 1994), and probably HBsAg as well
(Hourioux et al., 1998). For the formation of infectious HDV particles, the large
form of HBsAg is absolutely required (Sureau et al., 1993).
1.6 Discrimination Between HDV Replication and
Transcription: The Goal of This Dissertation
The overall objective of my research is to understand the mechanism of
hepatitis delta virus (HDV) RNA replication and transcription. Still little is known
about the metabolic requirements for HDV RNA replication and transcription or
the mechanisms by which the cell and/or the vims regulate the production of the
genome, antigenome, and HDAg mRNA. As the HDV replication cycle is
currently understood, there are few criteria by which replication of the HDV
genome and transcription of the HDAg mRNA can be discriminated. Virtually the
only unique regulatory mechanism that has been assigned to the synthesis of any
of the three HDV RNA species is the proposed inhibition of HDAg mRNA
synthesis by suppression of the polyadenlylation site by HDAg. Thus the
—
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 1
metabolic demands of regulated HDV replication and transcription exist as though
in a black box, and many questions about the HDV life cycle remain unanswered.
How is the genome selectively incorporated into the virion? How is replication
initiated when the infecting virion contains L-HDAg? Why does genome
accumulation occur at 15 times the rate of antigenome accumulation? These
questions suggest specific regulation of the synthesis of the genome, antigenome,
and mRNA.
Perhaps not surprisingly, the established models for the regulation of HDV
replication and transcription contain several features which are either inconsistent
with what is known about the natural life cycle of HDV, or are poorly supported by
experimental evidence. These include the following:
1) Inhibition of polyadenylation by HDAg. It has been proposed that upon
synthesis of S-HDAg during the initial phase of the HDV replication cycle, the
polyadenylation site for the HDAg mRNA is suppressed, allowing synthesis of the
full-length, 1.7-kb antigenome (Hsieh and Taylor, 1991; Hsieh et al., 1994).
Suppression of the polyadenylation site by HDAg was demonstrated using a
cDNA of the HDV polyadenylation signal; this activity has not been
experimentally demonstrated for the HDV RNA genome. Furthermore, this
proposal does not provide a plausible mechanism for the production of mRNA for
L-HDAg late in the replication cycle, which would require use of the
polyadenylation signal.
2) Transcription of the 1.7-kb genomic and antigenomic HDV monomers, as
well as the 0.8-kb HDAg mRNA, is carried out by cellular RNA pol II. This
—
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 1
hypothesis is based on the finding that 1 jig/ml of a-amanitin can inhibit HDV
RNA-templated transcription in vitro using nuclear extract from H159 cells, which
contain an integrated cDNA trimer of HDV (Macnaughton et al., 1991). It is
possible that what was detected was a DNA-template-mediated transcription event,
since the same authors were unable to inhibit HDV transcription with a-amanitin
from an exogenous HDV RNA template added to HepG2 cells. Furthermore, the
relative sensitivities of synthesis of the various HDV RNA species (mRNA, 1,7-kb
genomic and antigenomic RNAs) to a-amanitin were not assessed. Thus, it has
not been definitively established whether mRNA transcription and genomic RNA
replication of HDV are carried out by cellular RNA pol II.
3) Inhibition of replication by L-HDAg. Studies of HDV replication using
cDNA-based transfection systems have provided evidence that L-HDAg is a potent
inhibitor of HDV replication, where very small amounts of L-HDAg relative to S-
HDAg is sufficient to block replication (Chao et al., 1990; Glenn and White,
1991). However, the infecting HDV virion contains variable amounts of both L-
HDAg and S-HDAg, often in approximately equal ratios. Thus the understanding
of L-HDAg as a potent dominant-negative inhibitor of HDV replication contradicts
what is known about the natural life cycle of HDV, since in natural infection there
is successful initiation of HDV replication in the presence of L-HDAg.
The specific aims of my research center on these three aspects of the current
model for the regulation of HDV replication and transcription, with the goal of
discriminating between the synthesis of the HDV genome, antigenome, and HDAg
mRNA. To address the above inconsistencies in our understanding of HDV
—
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 1
transcription and replication, I developed a new method to examine the metabolic
requirements of HDV transcription and replication in cell culture (Modahl and Lai,
1998). Previously, the central limitation in studies of HDV replication was the
reliance on cDNA-based transfection systems. In these systems, the artificial
introduction of HDV cDNA compromises conclusions regarding HDV RNA-
templated transcription and replication. Examination of the various transfection
methods for studying HDV replication in cell culture will clarify this problem
(Table 2). Most commonly, a plasmid containing a multimeric cDNA of HDV
under the control of a foreign promoter is either transiently or permanently
expressed in cultured cells. However, if a circularized, HDV cDNA monomer is
transfected into cells, HDV replication can also be established (Macnaughton et al.,
1993). In this case, HDV RNA is transcribed from cryptic promoters within the
HDV cDNA. This phenomenon results in ambiguity regarding whether detected
HDV RNA species are produced from cDNA or RNA templates in these systems.
Multimeric, in vitro transcribed HDV RNA can also be transfected into cells
which stably express S-HDAg from an integrated cDNA (Hwang et al., 1995).
However, these HDV cDNA sequences contain portions of the described cryptic
promotor activity.
41
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 1
Table 2. Transfection Systems for HDV Replication in Cell Culture
cDNA plasmid encoding HDV multimer under a foreign promoter
Circularized HDV cDNA monomer
Multimeric HDV RNA into cells stably expressing HDAg
To avoid the limitations inherent in the cDNA transfection systems, I
established a cDNA-free transfection system for the study of HDV RNA
replication and transcription in cell culture (Modahl and Lai, 1998). Once this was
achieved, the central goal of my work was to use this system to further investigate
the metabolic requirements of HDV replication and transcription, with the aim to
distinguish transcription of the 0.8-kb HDAg mRNA and replication of the 1.7-kb
genome and antigenome. I therefore re-evaluated the following critical parameters
of the current model for the regulation of HDV transcription and replication:
1) suppression of the HDAg mRNA polyadenylation signal by HDAg,
2) transcription of the three individual HDV RNA species by cellular pol II
3) inhibition of the synthesis of the three individual HDV RNA species by L-
HDAg.
The findings from these studies, and the conclusions which can be drawn from
them, are discussed in Chapters 2, 3, and 4, respectively. A new model for HDV
transcription and replication synthesized from the conclusions of this work, and
42
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 1
perspectives on future directions in the discrimination between HDV replication
and transcription, are discussed in Chapter 5.
43
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 1
1.7 References
Beard, M. R., MacNaughton, T. B„ and Gowans, E. J. (1996). Identification and
characterization of a hepatitis delta virus RNA transcriptional promoter. J Virol 70,
4986-95.
Been, M. D. (1994). Cis- and trans-acting ribozymes from a human pathogen,
hepatitis delta virus. Trends Biochem Sci 19,251-6.
Bergmann, K. F., and Gerin, J. L. (1986). Antigens of hepatitis delta vims in the
liver and serum of humans and animals. J Infect Dis 154, 702-6.
Bichko, V., Netter, H. J., and Taylor, J. (1994). Introduction of hepatitis delta vims
into animal cell lines via cationic liposomes. J Virol 68, 5247-52.
Bichko, V. V., Khudyakov, Y. E., and Taylor, J. M. (1996). A novel form of
hepatitis delta antigen. J Virol 70, 3248-51.
Bonino, F„ Heermann, K. H., Rizzetto, M., and Gerlich, W. H. (1986). Hepatitis
delta vims: protein composition of delta antigen and its hepatitis B virus-derived
envelope. J Virol 58, 945-50.
Bonino, F., Hoyer, B., Shih, J. W. K., Rizzetto, M., Purcell, R. H., and Gerin, J. L.
(1984). Delta hepatitis agent: structural and antigenic properties of the delta-
associated particle. Infect Immunity 43, 1000-5.
Branch, A. D., Benenfeld, B. J., Baroudy, B. M., Wells, F. V., Gerin, J. L., and
Robertson, H. D. (1989). An ultraviolet-sensitive RNA structural element in a
viroid-like domain of the hepatitis delta vims. Science 243, 649-52.
Branch, A. D., and Robertson, H. D. (1991). Efficient trans cleavage and a
common structural motif for the ribozymes of the human hepatitis delta agent. Proc
Natl Acad Sci USA 88, 10163-7.
Branch, A. D., and Robertson, H. D. (1984). A replication cycle for viroids and
other small infectious RNA’ s. Science 223,450-5.
Brazas, R., and Ganem, D. (1996). A cellular homolog of hepatitis delta antigen:
implications for viral replication and evolution. Science 274,90-4.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 1
Casey, J. L., Bergmann, K. F., Brown, T. L., and Gerin, J. L. (1992). Structural
requirements for RNA editing in hepatitis delta virus: evidence for a uridine-to-
cytidine editing mechanism. Proc Nad Acad Sci USA 89,7149-53.
Casey, J. L., Brown, T. L., Colan, E. J., Wignall, F. S., and Gerin, J. L. (1993). A
genotype of hepatitis D virus that occurs in northern South America. Proc Natl
Acad Sci USA 90, 9016-20.
Casey, J. L., and Gerin, J. L. (1998). Genotype-specific complementation of
hepatitis delta vims RNA replication by hepatitis delta antigen. J Virol 72, 2806-14.
Casey, J. L., and Gerin, J. L. (1995). Hepatitis D vims RNA editing: specific
modification of adenosine in the antigenomic RNA. J Virol 69, 7593-7600.
Chang, F. L., Chen, P. J., Tu, S. J., Wang, C. J., and Chen, D. S. (1991). The large
form of hepatitis 5 antigen is crucial for assembly of hepatitis 6 vims. Proc Natl
Acad Sci USA 88, 8490-4.
Chang, M. F., Baker, S. C., Soe, L. H., Kamahora, T., Keck, J. G., Makino, S.,
Govindarajan, S., and Lai, M. M. (1988). Human hepatids delta antigen is a nuclear
phosphoprotein with RNA-binding activity. J Virol 62, 2403-10.
Chang, M. F., Chang, S. C., Chang, C. I., Wu, K., and Kang, H. Y. (1992). Nuclear
localization signals, but not putative leucine zipper motifs, are essential for nuclear
transport of hepatitis delta antigen. J Virol 66, 6019-27.
Chang, M. F., Chen, C. J., and Chang, S. C. (1994). Mutational analysis of delta
antigen: effect on assembly and replication of hepatitis delta vims. J Virol 68, 646-
53.
Chang, M. F., Sun, C. Y., Chen, C. J., and Chang, S. C. (1993). Functional motifs
of delta antigen essential for RNA binding and replication of hepatitis delta vims. J
Virol 67, 2529-36.
Chao, M., Hsieh, S. Y., and Taylor, J. (1991). The antigen of hepatitis delta vims:
examination of in vitro RNA-binding specificity. J Virol 65,4057-62.
Chao, M., Hsieh, S. Y., and Taylor, J. (1990). Role of two forms of hepatitis delta
vims antigen: evidence for a mechanism of self-limiting genome replication. J
Virol 64 ,5066-9.
45
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 1
Chao, Y. C., Chang, M. F., Gust,. L, and Lai, M. M. C. (1990). Sequence
conservation and divergence of hepatitis delta virus RNA. Virology 178, 384-92.
Chao, Y. C., Lee, C. M., Tang, H. S., Govindarajan, S., and Lai, M. M. C. (1991).
Molecular cloning and characterization of an isolate of hepatitis delta virus from
Taiwan. Hepatology 13, 345-52.
Chen, P. J., Chang, F. L., Wang, C. J., Lin, C. J., Sung, S. Y„ and Chen, D. S.
(1992). Functional study of hepatitis delta virus large antigen in packaging and
replication inhibition: role of the amino-terminal leucine zipper. J Virol 66, 2853-9.
Chen, P. J., Kalpana, G., Goldberg, J., Mason, W., Werner, B., Gerin, J. L., and
Taylor, J. (1986). Structure and replication of the genome of hepatitis delta virus.
Proc Natl Acad Sci USA 83, 8774-8.
Cheng, J. W„ Sin, I. J., Lou, Y. C., Pai, M. T., and Wu, H. N. (1998). Local helix
content and RNA-binding activity of the N-terminai leucine-repeat region of
hepatitis delta antigen. J Biomol NMR 12, 183-8.
Choi, S. S., Rasshofer, R., and Roggendorf, M. (1988). Propagation of woodchuck
hepatitis delta virus in primary woodchuck hepatocytes. Virology 167,451-7.
Chou, H. C., Hsieh, T. Y„ Sheu, G. T., and Lai, M. M. C. (1998). Hepatitis delta
antigen mediates the nuclear import of hepatitis delta virus RNA. J Virol 72, 3684-
90.
de Bruin, W., Leenders, W., Kos, T., and Yap, S. H. (1994). In vitro binding
properties of the hepatitis delta antigens to the hepatitis B virus envelope proteins:
potential significance for the formation of delta particles. Virus Research 31, 27-
37.
Diener, T. O., and Pruisner, S. B. (1985). Viroids and prions. In Subviral
pathogens of plants and animals, K. Maramorosch and J. J. McKelvey, eds.
(Orlando: Academic), pp. 3-18.
Dingle, K., Bichko, V., Zuccola, H., Hogle, J., and Taylor, J. (1998). Initiation of
hepatitis delta virus genome replication. J Virol 72,4783-8.
Elena, S. F., Dopazo, J., Flores, R., Diener, T. O., and Moya, A. (1991). Phylogeny
of viroids, viroidlike satellite RNAs, and the viroidlike domain of hepatitis delta
virus RNA. Proc Natl Acad Sci USA 88, 5631-4.
46
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 1
Forster, A. C., and Symons, R. H. (1987). Self-cleavage of plus and minus RNAs
of a vimsoid and a structural model for the active sites. Cell 50,9-16.
Fu, T. B., and Taylor, J. (1993). The RNAs of hepatitis delta virus are Copied by
RNA polymerase II in nuclear homogenates. J Virol 67, 6965-72.
Glenn, J. S., Marsters, J. C., and Greenberg, H. B. (1998). Use of a prenylation
inhibitor as a novel antiviral agent. J Virol 72, 9303-6.
Glenn, J. S., Taylor, J. M., and White, J. M. (1990). In vitro-synthesized hepatitis
delta virus RNA initiates genome replication in cultured cells. J Virol 64, 3104-7.
Glenn, J. S., Watson, J. A., Havel, C. M., and White, J. M. (1992). Identification of
a prenylation site in delta vims large antigen. Science 256, 1331-3.
Glenn, J. S., and White, J. M. (1991). Tra/w-dominant inhibition of human
hepatitis delta vims genome replication. J Virol, 2357-61.
Gowans, E. J., Baroudy, B. M., Negro, F., Ponzetto, A., Purcell, R. H., and Gerin, J.
L. (1988). Evidence for replication of hepatitis delta vims RNA in hepatocyte
nuclei after in vivo infection. Virology 167, 274-8.
Hadler, S. C., de Monzon, M. A., Rivero, D., Perez, M., Bracho, A., Fields, H., and
x (1992). Epidemiology and long-term consequences of hepatitis delta vims
infection in the Yucpa Indians of Venezuela. Am J Epidemiol 136, 1507-16.
Halpem, M. S., England, J. M., Deery, D. T., Petcu, D. J., Mason, W. S., and
Molnar-Kimber, K. L. (1983). Viral nucleic acid synthesis and antigen
accumulation in pancreas and kidney of Pekin ducks infected with duck hepatitis B
vims. Proc Natl Acad Sci USA 80,4865-9.
Hampel, A., and Tritz, R. (1989). RNA catalytic properties of the minimum (-
)sTRSV sequence. Biochemistry 28,4929-33.
Hourioux, C., Sureau, C., Poisson, F., Brand, D., Goudeau, A., and Roingeard, P.
(1998). Interaction between hepatitis delta virus-encoded proteins and hepatitis B
vims envelope protein domains. J Gen Virol 79, 1115-9.
Hsieh, S. Y., Chao, M., Coates, L., and Taylor, J. (1990). Hepatitis delta vims
genome replication: a polyadenylated mRNA for delta antigen. J Virol 64, 3192-8.
47
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 1
Hsieh, S. Y., and Taylor, J. M. (19,91). Regulation of polyadenylation of hepatitis
delta virus antigenomic RNA. J Virol 6 5 ,6438-46.
Hsieh, S. Y., Yang, P. Y„ Ou, J. T., Chu, C. M., and Liaw, Y. F. (1994).
Polyadenylation of the mRNA of hepatitis delta virus is dependent upon the
structure of the nascent RNA and regulated by the small or large delta antigen. Nuc
Acids Res 22, 391-6.
Huang, Z. S., and Wu, H. N. (1998).. Identification and characterization of the
RNA chaperone activity of hepatitis delta antigen peptides. J Biol Chem 273,
26455-61.
Huo, T. I., Wu, J. C., Lin, R. Y., Sheng, W. Y., Chang, F. Y., and Lee, S. D. (1997).
Decreasing hepatitis D vims infection in Taiwan: an analysis of contributory
factors. J Gastroenterol Hepatol 12, 747-51.
Hwang, S. B., Jeng, K. S., and Lai, M. M. C. (1995). Studies of functional roles of
hepatitis delta antigen in delta vims RNA replication. In The unique hepatitis delta
vims, G. Dinter-Gottlieb, ed. (Austin: R. G. Landes Company), pp. 95-109.
Hwang, S. B., and Lai, M. M. C. (1994). Isoprenylation masks a conformational
epitope and enhances rra/u-dominant inhibitory function of the large hepatitis delta
antigen. J Virol 68, 2958-64.
Hwang, S. B., and Lai, M. M. C. (1993). Isoprenylation mediates direct protein-
protein interactions between hepatitis large delta antigen and hepatitis B vims
surface antigen. J Virol 67,7659-62.
Hwang, S. B., and Lai, M. M. C. (1993). A unique conformation at the carboxyl
terminus of the small hepatitis delta antigen revealed by a specific monoclonal
antibody. Virology 193, 924-31.
Hwang, S. B., Lee, C. Z., and Lai, M. M. C. (1992). Hepatitis delta antigen
expressed by recombinant baculovimses: comparison of biochemical properties
and post-translational modifications between the large and small forms. Virology
790,413-22.
Imazeki, F., Omata, M., and Ohto, M. (1991). Complete nucleotide sequence of
hepatitis delta vims RNA in Japan. Nuc Acids Res 19, 5439.
48
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 1
Imazeki, F., Omata, M., and Ohto, M. (1990). Heterogeneity and evolution rates of
delta virus RNA sequences. J Virol 64,5594-9.
Jeng, K. S., Daniel, A., and Lai, M. M. C. (1996). A pseudoknot ribozyme
structure is active in vivo and required for hepatitis delta virus RNA replication. J
Virol 70, 2403-10.
Jeng, K. S., Su, P. Y„ and Lai, M. M. C. (1996). Hepatitis delta antigens enhance
the ribozyme activities of hepatitis delta virus RNA In vivo. J Virol 70,4205-9.
Khudyakov, Y. E., Favorov, M. O., and Fields, H. A. (1993). A small open reading
frame of the hepatitis delta virus antigenomic RNA encodes a protein that elicits
antibodies in some infected patients. Virus Res 27, 13-24.
Khudyakov, Y. E., and Makhov, A. M. (1990). Amino acid sequence similarity
between the terminal protein of hepatitis B virus and predicted hepatitis delta vims
gene product. FEBS Lett 262, 345-8.
Kos, A., Dijkema, R., Amberg, A. C., van der Meide, P. H., and Schellekens, H.
(1986). The hepatitis delta vims possesses a circular RNA. Nature 323, 558-60.
Kuo, M. Y. P., Chao, M., and Taylor, J. (1989). Initiation of replication of the
human hepatitis delta vims genome from cloned DNA: Role of delta antigen. J
Virol 63, 1945-50.
Kuo, M. Y. P., Goldberg, J., Coates, L., Mason, W., Gerin, G., and Taylor, J.
(1988). Molecular cloning of hepatitis delta vims RNA from an infected
woodchuck liver: sequence, structure and application. J Virol 62, 1855-61.
Kuo, M. Y. P., Sharmeen, L., Dinter-Gottlieb, G., and Taylor, J. (1988).
Characterization of self-cleaving RNA sequences on the genome and antigenome
of human hepatitis delta vims. J Virol 62,4439-44.
Lai, M. M. C. (1995). The molecular biology of hepatitis delta vims. Annu Rev
Biochem 64, 259-86.
Lazinski, D., Grzadzielska, E., and Das, A. (1989). Sequence-specific recognition
of RNA hairpins by bacteriophage antiterminators requires a conserved arginine-
rich motif. Cell 59, 207-18.
49
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 1
Lazinski, D. W., and Taylor, J. M. (1994). Expression of hepatitis delta virus RNA
deletions: cis and trans requirements for self-cleavage, ligation, and RNA
packaging. J Virol 6 8 ,2879-88.
Lazinski, D. W„ and Taylor, J. M. (1995). Intracellular cleavage and ligation of
hepatitis delta virus genomic RNA: Regulation of ribozyme activity by cis-acting
sequences and host factors. J Virol 69, 1190-1200.
Lazinski, D. W., and Taylor, J. M. (1993). Relating structure to function in the
hepatitis delta virus antigen. J Virol 67,2672-80.
Lee, C. M., Bih, F. Y., Chao, Y., Govindarajan, S., and Lai, M. M. C. (1992).
Evolution of hepatitis delta virus RNA during chronic infection. Virology 188,
265-73.
Lee, C. Z., Chen, P. J., and Chen, D. S. (1995). Large hepatitis delta antigen in
packaging and replication inhibition: role of the carboxyl-terminal 19 amino acids
and amino-terminal sequences. J Virol 69, 5332-6.
Lee, C. Z., Chen, P. J., Lai, M. M. C., and Chen, D. S. (1994). Isoprenylation of
large hepatitis delta antigen is necessary but not sufficient for hepatitis delta virus
assembly. Virology 199, 169-75.
Lee, C. Z., Lin, J. H., Chao, M., McKnight, K., and Lai, M. M. C. (1993). RNA-
binding activity of hepatitis delta antigen involves two arginine-rich motifs and is
required for hepatitis delta virus RNA replication. J Virol 67, 2221-7.
Lin, J. H., Chang, M. F., Baker, S. C., Govindarajan, S., and Lai, M. M. C. (1990).
Characterization of hepatitis delta antigen: specific binding to hepatitis delta vims
RNA. J Virol 64, 4051-8.
Lo, K., Hwang, S. B., Duncan, R., Trousdale, M., and Lai, M. M. C. (1998).
Characterization of mRNA for hepatitis delta antigen: exclusion of the full-length
antigenomic RNA as an mRNA. Virology 250, 94-105.
Lo, K., Sheu, G. T., and Lai, M. M. C. (1998). Inhibition of cellular RNA
polymerase II transcription by delta antigen of hepatitis delta vims. J Virol 247,
178-88.
Long, M., de Souza, S. J., and Gilbert, W. (1997). Delta-interacting protein A and
the origin of hepatitis delta antigen. Science 276, 824-5.
Luo, G., Chao, M., Hsieh, S. Y., Sureau, C., Nishikura, K., and Taylor, J. (1990). A
specific base transition occurs on replicating hepatitis delta vims RNA. J Virol 64,
1021-7.
50
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 1
Macnaughton, T. B., Beard, M. R., Chao, M., Gowans, E. J., and Lai, M. M. C.
(1993). Endogenous promoters can direct the transcription of hepatitis delta vims
RNA from a recircularized cDNA template. Virology 196,629-36.
Macnaughton, T. B., Gowans, E. J., Jilbert, A. R., and Burrell, C. J. (1990).
Hepatitis delta vims RNA, protein synthesis and associated cytotoxicity in a stably
transfected cell line. Virology 177,692-8.
Macnaughton, T. B., Gowans, E. J., McNamara, S. P., and Burrell, C. J. (1991).
Hepatitis 5 antigen is necessary for access of hepatitis 5 vims RNA to the cell
transcriptional machinery but is not part of the transcriptional complex. Virology
184, 387-90.
Macnaughton, T. B., Wang, Y. J., and Lai, M. M. C. (1993). Replication of
hepatitis delta vims RNA: effect of mutations of the autocatalytic cleavage sites. J
Virol 67, 2228-34.
Makino, S., Chang, M. F., Shieh, C. K., Kamahora, T., Vannier, D. M.,
Govindarajan, S., and Lai, M. M. C. (1987). Molecular cloning and sequencing of
a human hepatitis delta vims RNA. Nature 329, 343-6.
Modahl, L. E., and Lai, M. M. C. (1998). Transcription of hepatitis delta antigen
mRNA continues throughout hepatitis delta vims (HDV) replication: a new model
of HDV replication and transcription. J Virol 72, 5449-56.
Murphy, F. A. (1995). Vims taxonomy : - classification and nomenclature of
vimses : sixth report of the International Committee on Taxonomy of Vimses [for
the] Virology Division, International .Union of Microbiological Societies. In
Archives of Virology (Wien; New York: Springer-Verlag), pp. 586.
Netter, H. J., Kajino, K., and Taylor, J. M. (1993). Experimental transmission of
human hepatitis delta vims to the laboratory mouse. J Virol 67, 3357-62.
Otto, J. C., and Casey, P. J. (1996). The hepatitis delta vims large antigen is
famesylated both in vitro and in animal cells. J Biol Chem 277,4569-72.
Pasquinelli, C., Laure, F., Chatenoud, L., Beaurin, G., Gazengel, C., Bismuth H,
Degos, F., Tiollais, P., Bach, J. F., and Brechot, C. (1986). Hepatitis B vims DNA
in mononuclear blood cells. A frequent event in hepatitis B surface antigen-positive
and -negative patients with acute and chronic liver disease. J Hepatol 3 ,95-103.
Pattnaik, A. K., Ball, L. A., LeGrone, A. W., and Wertz, G. W. (1992). Infectious
defective interfering particles of VSV from transcripts of a cDNA clone. Cell 69,
1011- 20.
51
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 1
Perrotta, A. T., and Been, M. D. (1993). Assessment of disparate structural
features in three models of the hepatitis delta virus ribozyme. Nuc Acids Res 27,
3959-65.
Perrotta, A. T., and Been, M. D. (1992). Cleavage of oligoribonucleotides by a
ribozyme derived from the hepatitis delta vims RNA sequence. Biochemistry 31.
16-21.
Perrotta, A. T., and Been, M. D. (1991). A pseudoknot-like structure required for
efficient self-cleavage of hepatitis delta vims RNA. Nature 350,434-6.
Perrotta, A. T., and Been, M. D. (1990). The self-cleaving domain from the
genomic RNA of hepatitis delta vims: sequence requirements and the effects of
denaturant. Nuc Acids Res 18, 6821-7.
Pohl, C., Baroudy, B. M., Bergmann, K. F., Cote, P. J., Purcell, R. H., Hoofnagle,
J., and Gerin, J. L. (1987). A human monoclonal antibody that recognizes viral
polypeptides and in vitro translation products of the genome of the hepatitis D
vims. J Infect Dis 156, 622-9.
Poisson, F., Roingeard, P., Baillou, A., Dubois, F., Bonelli, F., Calogero, R. A., and
Goudeau, A. (1993). Characterization of RNA-binding domains of hepatitis delta
antigen. J Gen Virol 74, 2473-8.
Poisson, F., Roingeard, P., and Goudeau, A. (1995). Direct investigation of protein
RNA-binding domains using digoxigenin-labelled RNAs and synthetic peptides:
application to the hepatitis delta antigen. J Virol Methods 55, 381-9.
Polo, J. M., Jeng, K. S., Lim, B., Govindarajan, S., Hofman, F., Sangiorgi, F., and
Lai, M. M. C. (1995). Transgenic mice support replication of hepatitis delta vims
RNA in multiple tissues, particularly in skeletal muscle. J Virol 6 9 ,4880-7.
Polo, J. M., Lim, B., Govindarajan, S., and Lai, M. M. C. (1995). Replication of
hepatitis delta vims RNA in mice after intramuscular injection of plasmid DNA. J
Virol 69, 5203-7.
Poison, A. G., Bass, B. L., and Casey, J: L. (1996). RNA editing of hepatitis delta
vims antigenome by dsRNA-adenosine deaminase. Nature 380,454-6.
Poison, A. G., Ley, H. L., Bass, B. L., and Casey, J. L. (1998). Hepatitis delta vims
RNA editing is highly specific for the amber/W site and is suppressed by hepatitis
delta antigen. MCB 18, 1919-26.
52
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 1
Ponzetto, A., Cote, P. J., Popper, JL, Hoyer, B. H., London, W. T., Ford E C,
Bonino, F., iWcell, R. H., and Gerin, J. L. (1984). Transmission of the hepatitis B
virus-associated delta agent to the eastern woodchuck. Proc Natl Acad Sci USA 81,
2208-12.
Ponzetto, A., Forzani, B., Parravicini, P. P., Hele, C., Zanetti, A., and Rizzetto, M.
(1985). Epidemiology of hepatitis delta vims (HDV) infection. Eur J Epidemiol I,
257-63.
Ponzetto, A., Negro, F., Popper, H., Bonino, F., Engle, R., Rizzetto, M., Purcell, R.
H., and Gerin, J. L. (1988). Serial passage of hepatitis delta vims in chronic
hepatitis B vims carrier chimpanzees. Hepatology 8, 1655-61.
Puttaraju, M., Perrotta, A. T., and Been, M. D. (1993). A circular trans-acting
hepatitis delta vims ribozyme. Nuc Acids Res 2 1 ,4253-8.
Rackwitz, H. R., Rohde, W., and Sanger, H. L. (1981). DNA-dependent RNA pol
II of plant origin transcribes viroid RNA into full-length copies. Nature 291, 297-
301.
Rizzetto, M., Canese, M. G., Arico, S., Crivelli, O., Trepo, C., Bonino, F., and
Verme, G. (1977). Immunofluorescence detection of new antigen-antibody system
(delta/anti-delta) associated to hepatitis B vims in liver and in semm of HBsAg
carriers. Gut 18,997-1003.
Rizzetto, M., Canese, M. G., Gerin, J. L., London, W. T., Sly, D. L., and Purcell, R.
H. (1980). Transmission of the hepatitis B virus-associated delta antigen to
chimpanzees. J Infect Dis 141, 590-602.
Rizzetto, M., Hoyer, M. G., Canese, M. G., Shih, J. W. K., Purcell, R. H., and
Gerin, J. L. (1980). Delta agent: association of 5 antigen with hepatitis B surface
antigen and RNA in semm of 5-infected chimpanzees. Proc Natl Acad Sci USA
77, 6124-8.
Rizzetto, M., Purcell, R. H., and Gerin, J. L. (1980). Epidemiology of HBV-
associated delta agent: geographical distribution of anti-delta and prevalence in
polytransfused HBsAg carriers. Lancet 1, 1215-8.
Robertson, H. D. (1996). How did replicating and coding RNAs first get together?
Science 274, 66-7.
Roggendorf, M., Pahlke, C., Bohm, B., and Rasshofer, R. (1987). Characterization
of proteins associated with hepatitis delta vims. J Gen Virol 68, 2953-9.
53
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 1
Ryu, J. S., Netter, H. J., Bayer, M., and Taylor, J. (1993). Ribonucleoprotein
complexes of hepatitis delta virus. J Virol 6 7 ,3281-7.
Ryu, W. S., Bayer, M., and Taylor, J. (1992). Assembly of hepatitis delta virus
particles. J Virol 66, 2310-5.
Sagnelli, E., Stroffolini, T., Ascione, A., Chiaramonte, M., Craxi, A., Giusti, G., and
Piccinino, F. (1997). Decrease in HDV endemicity in Italy. J Hepatol 26, 20-4.
Sharmeen, L., Kuo, M. Y., and Taylor, J. (1989). Self-ligating RNA sequences on
the antigenome of human hepatitis delta virus. J Virol 63, 1428-30.
Sharmeen, L., Kuo, M. Y. P., Dinter-Gottlieb, G., and Taylor, J. (1988).
Antigenomic RNA of human hepatitis delta vims can undergo self-cleavage. J
Virol 62, 2674-9.
Sureau, C., Guerra, B., and Lanford, R. E. (1993). Role of the large hepatitis B
vims envelope protein in infectivity of the hepatitis delta virion. J Virol 67, 366-72.
Sureau, C., Jacob, J. R., Eichberg, J. W., and Lanford, R. E. (1991). Tissue culture
system for infection with human hepatitis delta vims. J Virol 65, 3443-50.
Tai, F. P., Chen, P. J., Chang, F. L., and Chen, D. S. (1993). Hepatitis delta vims
cDNA monomer can be used in transfection experiments to initiate viral RNA
replication. Virology 197, 137-42.
Tanner, N. K., Schaff, S., Thill, G., Petit-Koskas, E., and Crain, A. M. (1994). A
three-dimensional model of hepatitis delta vims ribozyme based on biochemical
and mutational analyses. Curr Biol 4 ,488-98.
Taylor, J., Mason, W., Summers, J., Golberg, J., Aldrich, C., Coates, L., Gerin, J.,
and Gowans, E. (1987). Replication of human hepatitis delta vims in primary
cultures of woodchuck hepatocytes. J Virol 61, 2891-5.
Wang, C. J., Chen, P. J., Wu, J. C., Patel, D„ and Chen, D. S. (1991). Small-form
hepatitis B surface antigen is sufficient to help in the assembly of hepatitis delta
vims-like particles. J Virol 65, 6630-6.
Wang, H. W„ Chen, P. J., Lee, C. Z., Wu, H. L., and Chen, D. S. (1994).
Packaging of hepatitis delta vims RNA via the RNA-binding domain of hepatitis
delta antigens: different roles for the small and large delta antigens. J Virol 68,
6363-71.
54
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 1
Wang, H. W., Wu, H. L., Chen, D. S., and Chen, P. J. (1997). Identification of the
functional regions required for hepatitis D virus replicaiton and transcription by
linker-scanning mutagenesis of viral genome. Virology 239, 119-31.
Wang, J. G., and Lemon, S. M. (1993). Hepatitis delta virus antigen forms dimers
and multimeric complexes in vivo. J Virol 67,446-54.
Wang, K. S., Choo, Q. L., Weiner, A. J., Ou, J. H., Najarian, R. C., Thayer, R. M.,
MuIIenbach, G. T., Denniston, K. J., Gerin, J. L., and Houghton, M. (1986).
Structure, sequence, and expression of the hepatitis delta viral genome. Nature 323,
508-14.
Wei, Y., and Ganem, D. (1998). Activation of heterologous gene expression by the
large isoform of hepatitis delta antigen. J Virol 72, 2089-96.
Wu, H. N., and Huang, Z. S. (1992). Mutagenesis analysis of the self-cleavage
domain of hepatitis delta vims antigenomic RNA. Nuc Acids Res 20, 5937-41.
Wu, H. N., and Lai, M. M. C. (1989). Reversible cleavage and ligation of hepatitis
delta vims RNA. Science 243, 652-4.
Wu, H. N., Lin, Y. J., Lin, F. P., Makino, S., Chang, M. F„ and Lai, M. M. C.
(1989). Human hepatitis delta vims RNA subfragments contain an autocleavage
activity. Proc Natl Acad Sci USA 86, 1831-5.
Wu, H. N., Wang, Y. J., Hung, C. F.', Lee, H. J., and Lai, M. M. C. (1992).
Sequence and structure of the catalytic RNA of hepatitis delta vims genomic RNA.
J Mol Biol 223, 233-45.
Wu, J. C., Chiang, T. Y., and Sheen, I. J. (1998). Characterization and phylogenetic
analysis of a novel hepatitis D vims strain discovered by restriction fragment
length polymorphism analysis. J Gen Virol 79, 1105-13.
Wu, J. C., Choo, K. B., Chen, C. M., Chen, T. Z., Huo, T. I., and Lee, S. D. (1995).
Genotyping of hepatitis D vims by restriction-fragment length polymorphism and
relation to outcome of hepatitis D. Lancet 346,939-41.
Xia, Y. P., and Lai, M. M. C. (1992). Oligomerization of hepatitis delta antigen is
required for both the trans-activating and rranj-dominant inhibitory activities of
the delta antigen. J Virol 66, 6641-8.
Xia, Y. P., Yeh, C. T., Ou, J. H., and Lai, M. M. C. (1992). Characterization of
nuclear targeting signal of hepatitis de.lta antigen: nuclear transport as a protein
complex. J Virol 6 6 ,914-21.
55
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 1
Yeh, T. S., Lo, S. J., Chen, P. J., and Lee, Y. H. W. (1996). Casein kinase II and
protein kinase C modulate hepatitis delta virus RNA replication but not empty viral
particle assembly. J Virol 70, 6190-8.
Zheng, H., Fu, T. B., Lazinski, D., and TAylor, J. (1992). Editing on the genomic
RNA of human hepatitis delta virus. J Virol 66,4693-7.
Zuccola, H. J., Rozzelle, J. E., Lemon, S. M., Erickson, B. W., and Hogle, J. M.
(1998). Structural basis of the oligomerization of hepatitis delta antigen. Structure
6, 821-30.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 2
Chapter 2
Transcription of Hepatitis Delta Antigen mRNA
Continues throughout Hepatitis Delta Virus (HDV)
Replication: A Proposed New Model for HDV RNA
Transcription and Replication
2.1 Summary and Purpose
The initial goal of my research was to develop an RNA transfection system for
the study of HDV replication in cell culture. The system I developed has several
advantages over the traditional methods for the study of HDV replication in cell
culture, outlined in Chapter 1. First, this RNA transfection system completely
avoids the use of artificial cDNA intermediates. This allows the specific detection
of RNA-templated transcription and replication. Second, this system provides for
the specific detection of de novo HDV RNA transcription. This represented the
first time the 0.8-kb HDAg mRNA could be detected in cell culture in the absence
of any artificial cDNA intermediates. Finally, this system closely mimics natural
infection of cells by the HDV virion. These three features of this system allow a
more complete and confident analysis of the regulation of RNA-templated HDV
transcription and replication then was previously allowed by the cDNA transfection
57
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 2
systems originally used to develop the current model of HDV transcription and
replication.
Based on data gathered from cDNA-based transfection systems, the
established model for the regulation of synthesis of the 0.8-kb HDAg mRNA and
the 1.7-kb antigenome proposed the following: 1) the initiation sites of the 0.8-kb
HDAg mRNA and the 1.7-kb antigenome are identical and performed by the same
enzymatic machinery; 2) mRNA transcription is the initial event of the HDV
replication cycle; 3) synthesis of the 1.7-kb antigenome requires inhibition of the
polyadenylation site for the HDAg mRNA by HDAg, and 4) the 0.8-kb HDAg
mRNA is only synthesized early during the HDV replication cycle, after which its
production is suppressed by the presence of HDAg.
The RNA transfection system I developed allowed me to test the four central
elements of this model. To do so, I pursued the following specific aims:
1. Determine whether the initiation sites of the HDAg mRNA and the 1.7-kb
antigenome are identical.
a) Detect newly synthesized 1.7-kb antigenomic RNA and 0.8-kb HDAg
mRNA by Northern blot.
b) Determine the 5’ end of the HDAg mRNA in the polyadenylated RNA
fraction from transfected cells by primer extension.
c) Detect the same 5’ end for the 1.7-kb antigenomic RNA in the non-
polyadenylated RNA fraction from transfected cells.
58
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 2
2. Determine whether inhibition of the polyadenylation signal by HDAg occurs
during the HDV replication cycle.
a) Analyze the kinetics of 1.7-kb antigenome and the 0.8-kb mRNA
synthesis by Northern analysis.
b) Determine whether inhibition of 0.8-kb mRNA synthesis occurs after
the production of S-HDAg in transfected cells, using Western and
Northern blots to detect HDAg and the antigenomic HDV RNAs,
respectively.
3. Determine whether the 0.8-kb HDAg mRNA is synthesized only at the
beginning of the HDV replication cycle.
a) Analyze the kinetics of 1.7-kb antigenome and the 0.8-kb mRNA
synthesis by Northern analysis.
My data demonstrates that transcription of the 0.8-kb HDAg mRNA continues
throughout the replication cycle, despite high levels of HDAg. This finding
establishes that synthesis of the 0.8-kb HDAg mRNA is not restricted to the
beginning of the HDV replication cycle. Because high levels of the 0.8-kb HDAg
mRNA are made in the presence of high levels of S-HDAg, suppression of the
0.8-kb mRNA polyadenylation site does not appear to be a major mechanism to
promote synthesis of the 1.7-kb antigenome, rather than the 0.8-kb mRNA, from
the genomic RNA template. Finally, primer extension analysis provides evidence
59
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 2
for a possible initiation site for the 1.7-kb antigenome which is distinct from the
established initiation site for the 0.8-kb HDAg mRNA.
Overall, these findings support our hypothesis that the established model for
the regulation of synthesis of the antigenome and the HDAg mRNA is inaccurate.
Furthermore, since these two distinct RNA species are synthesized from the same
template, our data suggested that these two events may differ in their metabolic
requirements, which would provide a mechanism for the independent regulation of
mRNA versus antigenome production.
2.2 Abstract
Hepatitis delta virus (HDV) replicates by RNA-dependent RNA synthesis
according to a double rolling circle model. Also synthesized during replication is a
0.8-kb, polyadenylated mRNA encoding the hepatitis delta antigen (HDAg). It has
been proposed that this mRNA species represents the initial product of HDV RNA
replication; subsequent production of genomic-length HDV RNA relies on
suppression of the HDV RNA polyadenylation signal by HDAg. However, this
model was based on studies which required the use of an HDV cDNA copy to
initiate HDV RNA replication in cell culture, thus introducing an artificial
requirement for DNA-dependent RNA synthesis. We now utilize an HDV cDNA-
free RNA transfection system and a method we developed to detect specifically the
mRNA species transcribed from the HDV RNA template. We established that this
polyadenylated mRNA is 0.8 kb in length and its 5’ end begins at nt 1631.
__
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 2
Surprisingly, kinetic studies showed that this mRNA continued to be synthesized
even late in the viral replication cycle, and that the mRNA and the genomic-length
RNA increased in parallel, even in the presence of HDAg. Thus, a switch from
production of the HDAg mRNA to the full-length HDV RNA does not occur in
this system, and suppression of the polyadenylation site by HDAg may not
significantly regulate the synthesis of the HDAg mRNA, as previously proposed.
These findings reveal novel insights into the mechanism of HDV RNA replication.
A new model of HDV RNA replication and transcription is proposed.
2.3 Introduction
Hepatitis delta vims (HDV) is an unusual subviral pathogen associated with
fulminant and chronic hepatitis. HDV depends on hepatitis B vims (HBV)
coinfection to form infectious virions, since it uses hepatitis B surface antigen to
form its viral envelope (Rizzetto et al., 1980). It contains a single-stranded circular
RNA genome of 1.7 kb (Kuo et al., 1988; Makino et al., 1987; Wang et al., 1986),
which can replicate in the absence of HBV (Chen et al., 1986; Glenn et al., 1990).
Three genotypes of HDV strains have been described, which differ by as much as
35% in their nucleotide sequence (Casey et al., 1993) and may also differ in their
pathogenicity. HDV replicates through a double rolling circle mechanism,
generating multiple-length genomic and antigenomic-sense HDV RNA, which are
processed into monomeric circular HDV genomic and antigenomic RNA (Chen et
al., 1986; Lai, 1995; Taylor et al., 1987). This replication process is presumably
61
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 2
carried out by cellular RNA polymerase n, since it is inhibited by a-amanitin
(Macnaughton et al., 1991).
Also detected in HDV-infected liver tissue and some cultured cells replicating
HDV RNA is a polyadenylated, 800-nucleotide antigenomic-sense HDV RNA
(Chen et al., 1986; Hsieh et al., 1990) that contains the open reading frame for a
protein termed hepatitis delta antigen (HDAg). This is the only protein produced
by HDV, but is usually composed of two forms: the small form (24 kDa) is
required for viral RNA replication (Kuo et al., 1989), while the large form (27 kDa)
is a dominant negative inhibitor of HDV replication (Chao et al., 1990) and is
required for virion assembly (Chang et al., 1991; Ryu et al., 1992). The production
of large HDAg is the result of an RNA editing event during HDV replication (Luo
et al., 1990), which extends the HDAg open reading frame (ORF) for an additional
19 amino acids. This editing event is reported to occur at a late stage in the viral
replication cycle, such that when the large form of HDAg is synthesized, HDV
RNA replication will stop and virus assembly will begin.
The nature of the 0.8-kb mRNA has been controversial, since it is very difficult
to detect in most cells replicating HDV RNA. It was proposed that this mRNA
represents the initial product of HDV RNA replication; upon reaching the HDV
RNA polyadenylation signal, the nascent transcript is polyadenylated and released
as the HDAg-encoding mRNA (Hsieh et al., 1990; Hsieh and Taylor, 1991). The
HDAg synthesized from this mRNA, in turn, inhibits the polyadenylation signal,
thus allowing subsequent rounds of RNA replication to proceed beyond the
polyadenylation signal, producing genomic size (1.7 kb) HDV RNA (Hsieh and
62
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 2
Taylor, 1991). This model thus explains the paucity of the 0.8-kb mRNA species
(Lai, 1995). Indeed, experimental evidence has shown that HDAg (both the small
and large forms) can negatively regulate the HDV polyadenylation signal within an
HDV cDNA construct (Hsieh and Taylor, 1991; Hsieh et al., 1994).
There are, however, some unanswered questions in this model. First, how is
abundant HDAg synthesized from so little HDAg mRNA template? The scarcity
of the HDAg mRNA might be explained by inhibition of the HDV RNA
polyadenylation site by HDAg, but then the little HDAg mRNA produced must be
very stable to produce the typically high levels of HDAg during infection.
Alternatively, low levels of HDAg mRNA may be due to rapid degradation of the
mRNA; in this case the mRNA would likely be abundantly synthesized at the
beginning of replication, before significant inhibition of the HDV RNA
polyadenylation site. Second, how are abundant levels of large HDAg achieved
later in infection? The mRNA for the large HDAg will not be abundantly
synthesized under this scenario since RNA editing does not occur until later in
infection, when a large amount of small HDAg has already been produced. This
question has, so far, been difficult to address because the amount of the 0.8-kb
RNA is very low or even undetectable in HDV-infected human or chimpanzee liver
tissues, or in cell cultures and transgenic mice (Polo et al., 1995) which actively
replicate HDV RNA. A further complication is that HDV RNA replication has
always been studied using an HDV cDNA transfection approach (for review, see
Lai, 1995). We have previously shown that the HDV cDNA contains several
bidirectional promoters (Macnaughton et al., 1993). Thus, the study of RNA
63
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 2
transcription or replication from HDV RNA in these systems is compromised by
the potential initiation of transcription from the cryptic promoters within the HDV
cDNA. So far, the only successful HDV RNA transfection system ever reported is
the transfection of HDV RNA into cells stably expressing an HDAg-encoding
mRNA (Glenn et al., 1990). Again, this artificial cDNA-based mRNA has
complicated the study of authentic HDAg-encoding mRNA synthesis.
In this report, we developed an RNA transfection approach which was totally
devoid of HDV cDNA and could detect specifically HDAg-encoding mRNA
transcribed from HDV RNA. Using this approach, we found that HDV mRNA
was abundantly synthesized throughout the HDV life cycle. Thus, contrary to the
current model of HDV RNA transcription and replication (Hsieh et al., 1990;
Hsieh and Taylor, 1991; Lai, 1995; Lazinski and Taylor, 1994), there was no
detectable inhibition of HDV mRNA synthesis by HDAg. Furthermore, the
initiation point of the 0.8-kb mRNA may differ from the initiation point of HDV
genomic RNA, again contradicting the current model. These findings provide
novel insights into the mechanism of HDV RNA replication. A new model of
HDV RNA replication and transcription is proposed.
2.4 Materials and Methods
2.4.1 Cell culture and transfection
Ts53 cells, which were derived from a temperature-sensitive hamster cell line
(Wang and Tjian, 1994) and stably express the small HDAg from an integrated
—
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 2
cDNA copy of the HDAg-encoding mRNA under the cytomegalovirus (CMV)
promoter (Hwang et al., 1995), were cultured at 33°C in Dulbecco’s modified
Eagle’s medium (DMEM) supplemented with 10% fetal bovine serum, 100 IU of
penicillin per ml, and 100 mg of streptomycin per ml. H I89 cells, which contain an
integrated cDNA for trimer HDV RNA (Macnaughton et al., 1990) were cultured
at 37°C in the same medium. Huh7 cells (Nakabayashi et al., 1982) were cultured
at 37°C in DMEM supplemented with 10% fetal bovine serum, 100 IU of
penicillin per ml, 100 mg of streptomycin per ml, 2mM L-glutamate, and 1%
nonessential amino acids (complete DMEM). All transfections were performed
using the DOTAP (Boehringer Mannheim) method according to the protocol
provided by the manufacturer. Briefly, 1 day prior to transfection, Ts83 or Huh7
cells were seeded onto 60-mm-diameter dishes. On the following day, the cells
were refreshed with 5 ml of the appropriate culture medium before transfection.
Cells were transfected with 5 jxg of plasmid cDNA (for Huh7 cells) or RNA (for
Ts63 cells) in 0.15 ml of transfection mixture or 10 |xg of RNA (for Huh7 cells) in
0.3 ml of transfection mixture. Following incubation overnight at 33 °C (Ts53) or
37°C (Huh7), the culture medium was replaced with fresh medium and the cells
were further incubated for an additional 1 to 5 days. For experiments involving the
use of cycloheximide, 10 |xg/ml of cycloheximide was added to the culture medium
1 or 2 days post-transfection and cells were incubated a further 2 days.
65
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 2
2.4.2 Vectors and plasmid construction
Plasmid PX9-I/H, which expresses an mRNA encoding the genotype 1/E
chimeric HDAg under the T7 promoter, was developed from the plasmid PX9,
which expresses an mRNA encoding the HDAg of the American isolate of
genotype I. PX9 contains the pT7-3 plasmid backbone and HDV sequences 21
through 658 (reading through nt 0) inserted in the BamHI-PstI site. To construct
plasmid PX9-I/II, the EcoRI (in the multiple cloning site) -StuI (at HDV nt 1334)
fragment from the plasmid PX9 was replaced with the corresponding fragment
from plasmid 63 of an HDV genotype II cDNA clone (Lee et al., 1996). Thus,
genotype I nucleotides 21 to 1334 (reading through nt 0) were replaced with the
corresponding genotype II nucleotides 1663 to 1334. pKS/HDVD2, which
contains a dimer HDV cDNA in a plasmid derived from the pRC/CMV plasmid
(Jeng et al., 1996), was used for HDV cDNA transfections.
2.4.3 In vitro transcription
Genomic HDV RNA (1.9 kb), which contains the entire HDV genome plus
approximately 200 additional nucleotides of HDV sequence, was transcribed from
pKS/HDV1.9 (Jeng et al., 1996) with T7 MEGAscript (Ambion) after linearization
by EcoRV digestion. Antigenomic HDV RNA (1.9 kb) was transcribed from
pKS/HDV1.9 with SP6 MEGAscript (Ambion) after linearization by SnaBI
digestion. Capped, polyadenylated mRNA for small HDAg was transcribed from
PX9 or PX9-I/H (see above) with T7 mMESSAGE mMACHINE (Ambion) after
linearization by Hindin digestion.
—
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 2
2.4.4 Northern blot analysis
Total RNA was extracted from transfected Ts53 and Huh7 cells or from H I59
cells using the guanidinium thiocyanate method (Chomczynski and Sacchi, 1987).
Polyadenylated RNA was isolated with an oligo-dT cellulose column (Sigma)
according to the standard method (Sambrook et al., 1989). The RNA was digested
with RQ1 DNase (Promega), treated with formaldehyde, electrophoresed through
formaldehyde-containing 1.2% agarose gels, blotted onto a nitrocellulose
membrane (Hybond C extra; Amersham), and probed with 3 2 P-UTP-labeled HDV
strand-specific riboprobes. Riboprobes for detecting HDV RNA were transcribed
with T7 RNA polymerase (Promega) from plasmids S18 (to detect genomic HDV
RNA) or S29 (to detect antigenomic HDV RNA), following linearization with
EcoRV digestion (Makino et al., 1987). For the analysis of the H I59 HDV
mRNA, various genomic-sense oligonucleotides were end-labeled with 3 2 P-ATP
and T4 polynucleotide kinase (New England Biolabs). To detect newly
synthesized HDAg mRNA in Huh7 cells transfected with genotype I HDV RNA
(1.9 kb) and the chimeric genotype VO. mRNA, blots were probed with 3 2 P-end-
labeled oligonucleotide 1565, specific for the American isolate of genotype I HDV
(Makino et al., 1987). The protocol for Northern blots using oligonucleotide
probes was adapted from Geliebter et al, 1986 (Geliebter et al., 1986). The
membranes were prehybridized for 2 hours at 55°C in 7% SDS, 20mM sodium
phosphate (pH 7.0), 5x Denhardt’s solution, 5xSSC, and 100 ng/ml salmon sperm
DNA, and hybridized overnight at 55°C in the same solution containing 10%
—
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 2
dextran sulfate and 2-3 x 106 cpm/ml radiolabeled probe. Blots were washed with
3xSSC, 10 mM sodium phosphate (pH 7.0), 0.5x Denhardt’s solution, and 5%
SDS for 1 minute at room temperature followed by 1 hour at 55°C. Northern
blots probed with full-length HDV riboprobes were hybridized and washed as
described previously (Jeng et al., 1996). RNA extracted from H I59 cells, which
express and replicate HDV RNA from an integrated cDNA trimer, was used as a
positive control in all Northern blots. After autoradiography, computer images
were generated by using Adobe Photoshop 3.0, and Canvas 5.0.
2.4.5 Western blot analysis
Protein was extracted from transfected Huh7 cells according to the standard
method (Sambrook et al., 1989). After denaturation by boiling in 2x sample buffer
(100 mM Tris-HCl pH 6.8, 200mM DTT, 4% SDS, 0.2% bromophenol blue, 20%
glycerol), 40 jj.g of protein from each sample was loaded onto a 12.5% SDS-
PAGE minigel. The gel was electrophoresed for 60 to 90 minutes at 150 volts.
Proteins were then transferred to a nitrocellulose membrane (Hybond C extra;
Amersham). Small and large HDAg were detected by the ECL western blot
detection system (Amersham) using a rabbit polyclonal antibody against both
forms of HDAg, and visualized by autoradiography.
2.4.6 Primer extension analysis
RNA extracted from Ts53 and Huh7 cells (as described above) and the
appropriate 3 2 P-end-labeled oligonucleotides were coprecipitated in 0.3 M sodium
—
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 2
acetate and 2.5 volumes ethanol. The pellet was vacuum dried and resuspended in
8 j j .1 Tris-EDTA, pH 7.6, followed by the addition of 2 jxl of 5 X hybridization
buffer (1.25 M KC1, 50 mM Tris-HCl pH 7.4, 5 mM EDTA). The samples were
incubated at 50°C for 1 hour, followed by the addition of 40 pi reverse transcription
mix (25 mM KC1, 50 mM Tris-HCl pH 7.5, 10 mM DTT, 3.5 mM MgCl2 , 0.5
mM dNTPs, 100 ng/ml BSA, and 20 U avian myeloblastosis virus reverse
transcriptase (Boehringer Mannheim) and further incubation for 1 hour at 37°C.
Reaction mixtures were ethanol precipitated and dried as above, and the pellet was
resuspended in 4 p .1 ddH2 0. After the addition of 2 p .1 sequencing gel loading
buffer (98% formamide, lOmM EDTA pH 8.0, 0.025% xylene cyanol FF, 0.025%
bromophenol blue), the samples were heat denatured, stored on ice, and loaded
onto a 6% polyacrylamide gel containing 8 M urea. A dideoxy sequence
(Amersham) generated from plasmid pKS/HDV1.9 primed by the same
oligonucleotide used in the primer extension was used as a nucleotide sequence
Table 1. The sequences of primers used for Northern blot and primer
extension.
marker.
Qligo Sequence
63
303
468
676
902
1484
1565
1634
CGGTAAAGAGCATTGGAACGTCGGAGA
AATCACCTCCAGAGGACCCCTTCAGCGAAC
GAGTGAGGCTT ATCCCGGGG
TTTCTTACCTGATGGCCGGC
CCCGAAGAGGAAAGAAGGACGCGAGACGCA
TCTTCTTTGTCTTCCGGAGGTCTCTCTCG
CCCCGCGGTCTTTCCTTCTTTCGGACC
T ACTCTTTTCTGT AAAG AGG AG ACTGCTGG
69
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 2
2.5 Results
2.5.1 Heterogeneity of HDAg-encoding mRNA in cDNA-based HDV
replication systems
In order to characterize the mechanism of synthesis of the HDAg-encoding
mRNA, we first attempted to study this mRNA in the various reported cDNA-
based HDV replication systems in cell culture. Three systems were studied: Huh7
cells transiently transfected with a plasmid expressing a genomic dimer RNA of
HDV, Ts53 cells, which stably express HDAg from an integrated cDNA copy of
HDAg-encoding mRNA under the CMV promoter (Hwang et al., 1995), and H 159
cells which stably express an antigenomic HDV trimer RNA from an integrated
cDNA copy (Macnaughton et al., 1990). Previously it has been very difficult to
detect the 0.8-kb mRNA species in any of these systems. Based on the report that
cycloheximide treatment can inhibit mRNA translation and thereby stabilize some
mRNA species (Ross, 1995), we treated these cell lines with 10 ng/ml
cycloheximide. Figure 1 shows that a polyadenylated subgenomic HDV RNA of
antigenomic sense was detected in various amounts in all three systems. However,
these putative mRNAs surprisingly ran at different positions in denaturing agarose
gels. The subgenomic mRNA in Huh7 cells transiently transfected with an HDV
cDNA was barely detectable, but appeared to have an electrophoretic mobility
(Figure 1, lane 1) similar to the mRNA previously characterized in cDNA-
transfected COS7 cells (Hsieh et al., 1990). The mRNA was polyadenylated and
its 5’ end mapped to nt 1631 (data not shown). The amount of this mRNA was
not increased by treatment with cycloheximide (lane 2). In H I59 cells, a
—
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 2
significantly larger subgenomic RNA was detected. This RNA was
polyadenylated, and, unlike the mRNA from cDNA-transfected Huh7 cells, was
stabilized by the addition of cycloheximide (Figure 1, compare lane 5 and lane 7).
The mRNA expressed in Ts53 cells had an electrophoretic mobility between the
mRNA species detected in cDNA-transfected Huh7 cells and H I59 cells. This
mRNA was also polyadenylated and was most remarkably stabilized by
cycloheximide (Figure 1, compare lane 9 and lane 11). These results indicated that
the HDV subgenomic mRNA species synthesized in the three systems differed not
only in amounts but also in their size and structure, since they differed in the ability
to be stabilized by cycloheximide.
71
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 2
Figure 1. Identification of subgenomic HDAg mRNAs in three cell culture
systems. RNA was isolated from H159, Ts53 cells, and Huh7 cells transiently
transfected with the plasmid pKS/HDVD2, which expresses an HDV RNA dimer
of genomic sense, at day 4 post-transfection. Some cells were treated with 10
(ig/ml cycloheximide (CHX) for 48 hours before harvest. H I59 and Ts53 cells
were separated into polyA (+) and polyA (-) fractions. Northern blot of HDV
antigenomic sense RNA was performed using a 3 2 P-labeled 1.7-kb HDV genomic
sense RNA as a probe. The following antigenomic HDV RNAs are indicated: the
1.7 kb antigenomic HDV RNA (monomer), the H I59 HDAg endogenous mRNA
(A), the TsS3 endogenous HDAg mRNA (B), and the HDAg mRNA in transiently
transfected Huh7 cells (C). T: total unfractionated RNA.
72
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Huh7 +
CDNA
H1S9 Ts53
monomer
polyA:
9 10 11
73
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 2
To understand the basis for the mRNA heterogeneity in these systems, we
performed primer extension studies using primer 1484 (Figure 2A) to determine
the initiation points of these mRNAs. The subgenomic mRNA produced in Ts53
cells from the cDNA construct used to establish HDAg expression in these cells
(Hwang et al., 1995) is predicted to begin 53 nucleotides before the start codon for
HDAg. Primer extension analysis confirmed this prediction (data not shown).
We also performed primer extension on RNA extracted from Ts53 cells
transfected with a 1,9-kb genomic sense HDV RNA to determine whether a second
subgenomic mRNA species expressed from the HDV cDNA or replicating HDV
RNA could be detected. No such primer-extended product was detected (data not
shown). This result suggested that in Ts83 cells, which synthesize an mRNA from
an integrated cDNA copy (Hwang et al., 1995), HDV mRNA production from
replicating HDV RNA is severely restricted.
The subgenomic mRNA species in H I89 cells was much larger than the 0.8-kb
mRNA species and was stabilized by cycloheximide treatment (Figure 1 , lane 7).
This mRNA was detectable with a full-length genomic RNA probe (S29) (Figure
2B). To characterize this mRNA species, we first used oligonucleotide probes
complementary to various regions of the HDV antigenome (Figure 2A) to
determine the origin of the additional HDV sequences seen in this mRNA. Oligo
1484, which is complementary to antigenomic HDV RNA in the HDAg ORF,
bound to both monomer-length HDV RNA and the mRNA (Figure 2B). Oligo
902, which hybridizes to antigenomic HDV RNA in the region between the polyA
74
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 2
Figure 2. Determination of the structure of the H159 subgenomic mRNA.
3 2 P-end-labeled oligonucleotides representing various regions of the HDV genome
(A) were used to probe total RNA from CHX-treated (as described in FIG 1) and
untreated H I59 cells (B). (C) Oligonucleotide 63 was used for primer extension
analysis of polyA selected RNA from CHX-treated and untreated H I59 cells.
Lanes 5 and 6: polyA (-) and polyA (+) RNA (respectively) from CHX-untreated
H I59 cells. Lanes 7 and 8: polyA (-) and polyA (+) RNA (respectively) from
CHX-treated H I59 cells. A dideoxy sequence generated from plasmid
pKS/HDV1.9 using oligonucleotide 63 serves as a nucleotide sequence marker
(lanes 1-4).
75
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
s
c
t
C D
h -
< 0
o i l I k
o f?#ra*«Kg * s L "
< ^#5?8 '9V 9 -
S
< g
g & v £
X
z
o
44
C M
S
8
c n
0 1 e
E
76
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 2
addition site and the ribozyme cleavage site, bound to monomer-length antigenomic
HDV RNA but not to the subgenomic mRNA, indicating that the 3’-end of this
mRNA was not extended beyond the polyadenylation signal reported for the 0.8-
kb mRNA (Hsieh et al., 1990). However, oligos 1634 and 63, which are
complementary to antigenomic HDV RNA sequence upstream of the previously
characterized HDAg mRNA, bound to the HI59 mRNA, indicating that the 5 ’-
untranslated region of this mRNA was longer than the previously described
HDAg-encoding mRNA (Hsieh et al., 1990). Oligos 303, 468, and 676 did not
bind to the mRNA; so, its 5’-end lay somewhere between nucleotides 63 and 303.
Primer extension analysis of H I59 RNA using oligo 63 revealed a band
corresponding to a 5’-end located at nt 158; this band was only detectable in the
polyadenylated RNA from cycloheximide-treated H I59 cells (Figure 2C, lane 8).
This result indicated that this mRNA was initiated from an aberrant site not
previously reported. No primer-extended product corresponding to an RNA
species with a 5’ end at nucleotide 1631 was detected even in cycloheximide-
treated samples (data not shown).
These results indicated that the HDV subgenomic mRNA species detected in
various cDNA-transfection systems have different origins of transcription.
Therefore, these transcripts may represent aberrant transcription from cryptic
promoters within the HDV cDNA. In all cases, the reported 0.8-kb RNA species
was not, or only barely, detected. Thus, the presence of HDV cDNA appears to
interfere with the synthesis of the authentic subgenomic mRNA species, probably
because of the presence of potent promoters in the HDV cDNA (Macnaughton et
—
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 2
al., 1993). This phenomenon may ..have led to the previous interpretations that the
presence of HDAg inhibited the synthesis of the 0.8-kb RNA during HDV RNA
replication (Hsieh and Taylor, 1991; Hsieh et al., 1994).
2.5.2 Abundance of an HDV RNA-templated mRNA in a cDNA-free
transfection system
The results shown above suggested that cDNA-initiated transcription may
interfere with the synthesis of the HDAg-encoding mRNA. To study the authentic
mRNA synthesis of HDV RNA, we therefore adapted an RNA-only transfection
system to detect the HDAg mRNA produced from the replicating HDV genome.
Briefly, in vitro transcribed genomic HDV RNA (1.9 kb, slightly longer than the
monomer-size RNA) was cotransfected with an in vitro transcribed, capped and
polyadenylated HDAg-encoding mRNA into Huh7 cells. This approach led to
robust HDV RNA replication in the transfected cells, as evidenced by the detection
of antigenomic-sense HDV monomer RNA (Figure 3B, lane 5). A subgenomic
RNA species was also detected; however, it could not be distinguished from the
mRNA used for transfection (Figure 3B, lane 5). In order to distinguish between
the mRNA produced from the genomic HDV template in the transfected cells and
the exogenous mRNA used for transfection, we used for transfection a chimeric
HDAg mRNA that contains sequences from both genotype I and genotype n,
whereas the genomic RNA (1.9 kb) used for transfection was genotype I (Figure
3A). This chimeric mRNA supported HDV RNA replication (Figure 3B, lane 6).
78
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 2
Figure 3. Detection of the 0.8-kb subgenomic mRNA in the cDNA-free
HDV RNA transfection system. (A) Schematic diagram of the mRNAs used
for transfection and the oligonucleotide probe used for detection. (B) Total RNA
harvested from Huh7 cells transfected with in vitro transcribed mRNA I alone
(lane 3), chimeric mRNA I/II alone (lane 4), mRNA I plus in vitro transcribed 1.9-
kb genomic HDV RNA (lane 5), or mRNA I/II plus 1.9-kb genomic HDV RNA
(lane 6) was analyzed by Northern blot. 3 2 P-end-labeled oligonucleotide 1565,
which is specific for the American isolate of HDV genotype I (Makino et al.,
1987), was used as a probe. Total RNA extracted from H189 cells and from
mock-transfected Huh7 cells (lane 2) serve as controls. (C) RNA isolated from
Huh7 cells 4 days after transfection with 1.9-kb HDV RNA plus mRNA I/II
(T=total RNA) was separated into polyA(+) and polyA(-) fractions and analyzed
as in (B). (D) Primer extension analysis of the polyA(-) RNA (lane 5), polyA (+)
RNA (lane 6), and in vitro transcribed mRNA I/II (lane 7), using oligonucleotide
1565 as the probe. A dideoxy sequence generated from plasmid pKS/HDV1.9
using the same oligonucleotide serves as a nucleotide sequence marker (lanes 1-4).
79
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
A.
HDAg mRNA I:
HDAg mRNA I/II:
B.
genotype I
cap ------1 ------------------------- 1 --------- AAAAA AAAAAAAA
genotype II genotype I
cap ------1 ------------- 1 --------- A A AAA AAAAAAAA
0 >
£ 8
x E
- S
< <
_ s
< <
s
E
+
E
E
E
E
E
E
+
>
o
H D V monomer
HDAg mRNA
5 6
80
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
polyA
HDAg mRNA
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
X A S
< < <
A C G T g . § . E
nt 1646
5' end of
HDAg mRNA
82
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 2
Since the oligonucleotide probe used for Northern blotting was specific for
genotype I (nt 1565 to 1591), it detected only the genotype I mRNA (100%
complementarity to nt 1565 to 1591)(lane 3) but not the genotype I/II chimeric
mRNA (55% complementarity to nt 1565 to 1591) (lane 4). Therefore, only the
HDAg mRNA produced from the genomic RNA (genotype I) as a result of HDV
RNA replication, but not the transfected chimeric mRNA, would be detected
(Figure 3A, compare lanes 5 and 6). This probe also did not hybridize to the HDV
RNA in H I89 cells (lane 1), which express the Italian isolate of genotype I HDV
(Macnaughton et al., 1990), since the Italian and American isolates of genotype I
HDV also diverge in the region probed (74% homology in nt 1565 to 1591). This
finding further indicates the specificity of this oligonucleotide probe. The result
showed that a distinct 0.8-kb mRNA of antigenomic sense, which represents the
RNA derived from the HDV monomer RNA, was synthesized at detectable levels
(lane 6). The amount of this RNA was far greater than that seen in any cDNA
transfection system reported so far. It is polyadenylated, whereas the genomic
sized RNA does not contain polyA (Figure 3C). Primer extension analysis of the
polyadenylated RNA mapped the 5’ end to nucleotide 1631 (Figure 3D, lane 6),
indicating that this RNA-templated HDAg mRNA was initiated from the same site
as the previously reported mRNA in a cDNA transfection system (Hsieh et al.,
1990). Significantly, no corresponding primer-extended product was detected in
the polyA-deficient fraction (Figure 3D, lane 5), which represents all of the
monomer-sized RNA, even though this fraction contained at least 10 times more
HDV-specific RNAs. Instead, a prominent band at nt 1646 was detected. This
—
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 2
result suggests that the HDV genomic RNA may be initiated from a different site
from the 0.8-kb mRNA species. As a control, this primer did not generate any
primer extension products on the in vitro transcribed chimeric mRNA used for
transfection (Figure 3D, lane 7).
2.5.3 The HDAg mRNA and HDV monomer are synthesized in parallel in
the presence of small HDAg
The experiments described above demonstrated the feasibility of this RNA-
based transfection system for the study of de novo RNA-templated synthesis of
the full-length antigenomic HDV RNA and HDAg mRNA. We next investigated
the kinetics of the synthesis of these two RNA species. Previous studies indicated
that HDAg could inhibit the production of the 0.8-kb HDAg-encoding mRNA in
an HDV cDNA-transfected system, probably as a result of the inhibition of the
polyadenylation signal in HDV cDNA or RNA (Hsieh and Taylor, 1991). This
inhibition was seen with both the large and small HDAg (Hsieh et al., 1994).
Based on these studies, Hsieh and Taylor proposed that the first round of
transcription on the HDV RNA template would produce the HDAg mRNA; small
HDAg translated from this mRNA would then suppress polyadenylation during
subsequent rounds of RNA synthesis, allowing the production of 1.7-kb
antigenomic RNA (Hsieh and Taylor, 1991). If this model is correct, it is predicted
that the 0.8-kb mRNA would be synthesized first, followed by synthesis of the
1.7-kb monomer RNA, and that the 0.8-kb mRNA would be synthesized early in
the viral replication cycle. To test this hypothesis, we analyzed HDV RNA and
HDAg from day 1 through day 5 in the RNA transfection system described in the
—
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 2
previous section. The results showed that the monomer RNA was detectable
starting at day 2, and increased in amount through day 4 (Figure 4A). Particularly,
there was a significant increase between day 2 and day 3. Interestingly, the 0.8-kb
mRA species started to be detectable at day 3, and there was a particularly
significant increase between day 3 and day 4. There was a slight decrease in both
the monomer RNA and the 0.8-kb mRNA from day 4 to day 5. Thus, the mRNA
and monomer RNA increased in parallel. The relative ratio between the monomer
RNA and mRNA was determined by phosphoimager analysis and was found to
remain roughly the same (approximately 3 in molar ratio, except on day 2, when
the amount of HDAg mRNA was too small to be reliably determined) throughout
the 5-day period. The amount of HDAg in these cells was determined by
immunoblotting using polyclonal antibody against HDAg. Figure 4B shows that
the small HDAg could be detected by day 3 and increased through day 5. By day
4, the large HDAg became detectable as a result of RNA editing, consistent with
previous findings (Luo et al., 1990). It is notable that despite the presence of a
large amount of HDAg at day 3-4, the amount of 0.8-kb mRNA continued to
increase, particularly between day 3 and day 4. This observation gave further
support to the conclusion that the 0.8-kb mRNA species detected represents newly
synthesized RNA, but not merely stabilization of mRNA, since the template for the
mRNA encoding the large HDAg will not be generated until an RNA editing event
occurs late in infection (Luo et al., 1990). The accumulation of large HDAg at day
4 and day 5 may explain the slight decrease in the amounts of both
85
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 2
Figure 4. Kinetics of the synthesis of antigenomic HDV RNA and HDAg.
Total RNA was isolated from Huh7 cells transfected with 1.9-kb HDV genomic
RNA plus mRNA I/E on days 1 through 5 post-transfection and analyzed by
Northern blot using 3 2 P-end-Iabeled oligonucleotide 1565 as a probe (A). Arrows
indicate the 1.7-kb antigenomic HDV monomer and the 0.8-kb HDAg mRNA.
(B) Protein isolated from a similar experiment was analyzed by Western blot
utilizing a rabbit polyclonal antibody against HDAg. Arrows indicate the large (27
kD) and small (24 kD) forms of HDAg.
86
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
1 2 3 4 5
B.
43 kOa
29
18
14.3
87
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
C V I < * J
> > > > >
« c o m
T J T J T J
> »
a
■ o
in
>.
a
■ o
la rg e HDAg
sm all HDAg
1 2 3 4 5
Chapter 2
monomer RNA and the 0.8-kb raRNA at day 5, consistent with the previous
finding that the large HDAg inhibits HDV RNA synthesis (Chao et al., 1990).
These data reveal several important phenomena which contradict the current
model for HDV mRNA synthesis (Hsieh and Taylor, 1991; Lai, 1995; Lazinski
and Taylor, 1994). First, the mRNA and antigenomic monomer RNA are not
produced sequentially but rather in parallel, suggesting that there is not a switch
from mRNA synthesis to monomer RNA synthesis. Second, both species are still
produced in the presence of HDAg, suggesting that HDAg does not significantly
inhibit the production of its own mRNA.
2.6 Discussion
We describe in this paper a novel system for the unequivocal detection of an
HDAg-encoding mRNA transcribed from an HDV RNA. In this cDNA-free
RNA transfection system, abundant synthesis of a 0.8-kb, polyadenylated, HDAg-
encoding mRNA occurs during the HDV replication cycle. Kinetic studies of the
production of antigenomic-sense HDV RNA in this system demonstrated that the
amount of the RNA-templated HDAg-encoding mRNA increases in parallel with
the monomeric-length (1.7 kb) antigenomic HDV RNA from day 1 to day 4 post
transfection, followed by a slight decrease in both species from day 4 to day 5
post-transfection. The ratio of the 1.7-kb and 0.8-kb antigenomic HDV RNAs
remains the same throughout the replication cycle, despite increasing levels of
HDAg. The 5’-end of the RNA-templated HDAg mRNA was mapped to
—
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 2
nucleotide 1631 by primer extension analysis. We did not detect a similar primer-
extended band in the polyA-deficient fraction of RNA from cells replicating HDV,
but instead detected another major band upstream of the initiation site for HDAg
mRNA synthesis, at nucleotide 1646.
The above findings lead to several conclusions regarding the mechanism of
HDV RNA replication and mRNA synthesis that contradict the current model of
HDV replication (Figure 5A). The current model (Hsieh and Taylor, 1991; Lai.
1995; Lazinski and Taylor, 1994) states that the 0.8-kb mRNA represents the
initial product of HDV RNA replication, which is terminated by polyadenylation.
Once HDAg is synthesized, polyadenylation will be inhibited during subsequent
rounds of RNA synthesis, allowing elongation of the RNA transcript into
multimeric HDV RNA. Our studies here provide three critical pieces of evidence
contradicting this model. First, the HDV RNA polyadenylation signal does not
appear to be suppressed by HDAg in cell culture. This conclusion is supported by
our finding that HDAg mRNA synthesis continues to increase despite increasing
levels of HDAg. Second, The HDAg mRNA may not be synthesized as the
product of initiation of HDV RNA replication. This conclusion is supported by
the finding that the 0.8-kb HDAg mRNA increases in parallel with the 1.7 kb
antigenomic HDV RNA; if the HDAg mRNA were the initial product of HDV
RNA replication, the mRNA would be predicted to appear only early in the HDV
replication cycle. Our findings are in direct contrast to this prediction. Third, the
mRNA and polyA(-) RNA (including HDV monomer RNA) may have different
initiation points. This conclusion is suggested by the absence of a primer
—
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 2
Figure 5. Proposed models of HDV RNA transcription and replication.
(A) The previously accepted model of HDV RNA transcription and replication
(Hsieh and Taylor, 1991; Lai, 1995; Lazinski and Taylor, 1994). The initial
product of replication from the genomic HDV RNA template is the 0.8-kb HDAg-
encoding mRNA (1). HDAg produced from this mRNA suppresses the HDV
polyadenylation signal, allowing synthesis of multimeric RNA (2), which is
processed into full-length antigenomic HDV RNA (3). Subsequent rounds of
replication bypass the polyadenylation signal due to the presence of HDAg, and
directly synthesize full-length antigenomic HDV RNA (4). (B) The proposed
new model for HDV RNA transcription and replication presented in this paper.
The synthesis of 0.8-kb mRNA (a) and 1.7-kb monomer RNA (b) are independent
and occur in parallel.
90
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
® o
E o)
S' >
£8
k u
C M
O )
<
Q
J
m
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
cleavage
Chapter 2
extension product at nucleotide 1631 in polyA-deficient RNA from cells
containing replicating HDV RNA. Instead, a major primer extention product at nt
1646 was detected in this fraction. This nt is located at the site complementary to
nt 1631 in the rod-like HDV RNA structure (Kuo et al., 1988; Makino et al., 1987;
Wang et al., 1986). Interestingly, this complementary region encompassing both
nt 1631 and nt 1646 in the HDV cDNA has been shown to have a bidirectional
promoter activity, suggesting that nt 1646 may serve as a signal for initiation of
RNA synthesis (in the same orientation as the HDAg mRNA)(Macnaughton et al.,
1993). Although we can not rigorously rule out the possibility that the product of
initiation of RNA replication in the polyA(-) fraction is quickly degraded, the fact
remains that no evidence can be provided to support a single initiation site for both
the 0.8-kb HDAg mRNA and the 1.7-kb antigenomic HDV RNA.
The current model for HDV RNA replication and transcription was developed
from some cridcal assumptions regarding the mechanism of HDV transcription
and replicauon, only a few of which are supported by experimental evidence.
Essential to this model is the conclusion that HDAg suppresses the HDV RNA
polyadenylation signal, originally reached by Hsieh et al (1991), who examined the
effect of HDAg expression on an HDV cDNA polyadenylation signal (Hsieh and
Taylor, 1991). While expression of HDAg did appear to suppress the HDV
cDNA polyadenylation signal, there was not a corresponding increase in read-
through transcripts (Hsieh and Taylor, 1991). Therefore, HDAg may have
functioned in these experiments to suppress pol II transcription from the DNA
promoter. Indeed, preliminary evidence showed that HDAg has a capacity to
—
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 2
inhibit DNA-templated pol II transcription (K Lo and MMC Lai, unpublished
data). Subsequent examination of the effects of HDAg on the HDV cDNA
polyadenylation by Hsieh et al (1994) did reveal an increase in read-through
transcripts in the presence of HDAg (Hsieh et al., 1994). However, re-examination
of the data in this experiment revealed that there was still abundant polyadenylated
transcripts in the presence of HDAg. Thus, the observed effects of HDAg in
inhibiting polyadenylation may have been associated with DNA-templated
transcription. Furthermore, these studies (Hsieh and Taylor, 1991; Hsieh et al.,
1994) showed that HDAg inhibited polyadenylation only when the HDV cDNA
included sequences covering almost the full 1.7-kb genome. This result was
interpreted to mean that a folded-back rod-like structure of HDV RNA was
required for HDAg suppression of polyadenylation (Hsieh and Taylor, 1991;
Hsieh et al., 1994; Lazinski and Taylor, 1994); however, this cDNA structure may
also produce endogenous promoter activity in the HDV cDNA (Macnaughton et
al., 1993). Our studies presented here showed that when HDV RNA replication
was inidated from an RNA template, HDAg did not strongly suppress the
synthesis of the HDAg mRNA. Therefore, HDV RNA replication and
subgenomic mRNA transcription may occur independently and in parallel
throughout the viral life cycle (Figure 5B). This new view of HDV RNA
transcription and replication thus solves a puzzling question left unanswered by the
old model of HDV RNA transcription, namely, how can the mRNA for large
HDAg be synthesized late in infection if mRNA synthesis has already been shut
off by the small HDAg? However, a different question arises as to how the
—
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 2
polyadenylation signal is bypassed during RNA replication. We can not rule out
the possibility that HDAg may partially suppress the HDV RNA polyadenylation
site during synthesis of the 1.7-kb antigenomic strand. The answers to this
question will require additional experimentation.
Another critical element of the current HDV replication model is the hypothesis
that the sites of initiation of both mRNA transcription and genome replication are
the same. This assumption has not been supported by experimental evidence so
far. Because transcription of a functional mRNA for the expression of HDAg
appears to be critical for replication in natural HDV life cycle (Kuo et al., 1989),
any potential studies that attempt to link the inhibition of mRNA initiation with
inhibition of genome replication may not be able to prove that these two processes
represent the same event. Recently, Wu et al (1997) found that mutations at the top
of the genomic HDV RNA rod (in the region of the putative RNA promoter for
HDAg mRNA synthesis) which severely restricted HDV RNA replication could be
rescued by small HDAg provided in trans (Wu et al., 1997). This finding
suggests that sites critical for initiation of mRNA transcription may not be critical
for initiation of replication. This is consistent with our data showing that the
HDAg mRNA and polyA(-) HDV RNA have different primer extension products,
and thus may have different initiation points.
Finally, RNA pol II is hypothesized to be responsible for transcription of both
the HDAg mRNA and the 1.7 kb antigenomic HDV RNA. This hypothesis is
based on the finding that 1 jog/ml of a-amanitin could inhibit HDV RNA-templated
transcription in vitro using H I59 nuclear extract; however, it is possible that this
— -
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 2
was a DNA-templated transcription event, since the same authors were unable to
inhibit HDV transcription with a-amanitin from an exogenous HDV RNA
template added to HepG2 cells (Macnaughton et al., 1991). Further, the relative
sensitivities of synthesis of the various HDV RNA species (mRNA, 1.7-kb
genomic and antigenomic RNAs) to a-amanitin have not been assessed. Thus, it is
not clear whether mRNA transcription and genomic RNA replication of HDV are
carried out by the same polymerase and regulated by the same mechanism. Our
findings described here suggest the tantalizing possibility that the 0.8 kb HDAg
mRNA and the 1.7 kb antigenomic RNA may be separately initiated but
coordinately regulated. This possibility will require further studies.
95
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 2
2.7 References
Casey, J. L., Brown, T. L., Colan, E. J., Wignall, F. S., and Gerin, J. L. (1993). A
genotype of hepatitis D virus that occurs in northern South America. Proc Natl
Acad Sci USA 90, 9016-20.
Chang, F. L., Chen, P. J., Tu, S. J., Wang, C. J., and Chen, D. S. (1991). The large
form of hepatitis 5 antigen is crucial for assembly of hepatitis 5 vims. Proc Natl
Acad Sci USA 88, 8490-4.
Chao, M., Hsieh, S. Y., and Taylor, J. (1990). Role of two forms of hepatitis delta
vims antigen: evidence for a mechanism of self-limiting genome replication. J
Virol 64, 5066-9.
Chen, P. J., Kalpana, G., Goldberg, J., Mason, W„ Wemer, B„ Gerin, J. L., and
Taylor, J. (1986). Structure and replication of the genome of hepatitis delta vims.
Proc Natl Acad Sci USA 83, 8774-8.
Chomczynski, P., and Sacchi, N. (1987). Single-step method of RNA isolation by
acid guanidinium thiocyanate-phenol-chloroform extraction. Analytic Biochemistry
162, 156-9.
Geliebter, J., Zeff, R. A., Schulze, D. H., Pease, L. R., Weiss, E. H., Mellor, A. L„
Flavell, R. A., and Nathenson, S. G. (1986). Interaction between Kb and Q4 gene
sequences generates the Kbm6 mutation. Mol. Cell. Biol 6, 645-652.
Glenn, J. S., Taylor, J. M., and White, J. M. (1990). In vitro-synthesized hepatitis
delta vims RNA initiates genome replication in cultured cells. J Virol 64, 3104-7.
Hsieh, S. Y., Chao, M., Coates, L., and Taylor, J. (1990). Hepatitis delta vims
genome replication: a polyadenylated mRNA for delta antigen. J Virol 64, 3192-8.
Hsieh, S. Y„ and Taylor, J. M. (1991). Regulation of polyadenylation of hepatitis
delta vims antigenomic RNA. J Virol 65, 6438-46.
Hsieh, S. Y., Yang, P. Y., Ou, J. T., Chu, C. M., and Liaw, Y. F. (1994).
Polyadenylation of the mRNA of hepatitis delta vims is dependent upon the
stmcture of the nascent RNA and regulated by the small or large delta antigen. Nuc
Acids Res 22, 391-6.
96
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 2
Hwang, S. B., Jeng, K. S., and Lai, M. M. C. (1995). Studies of functional roles of
hepatitis delta antigen in delta virus RNA replication. In The unique hepatitis delta
virus, G. Dinter-Gottlieb, ed. (Austin: R. G. Landes Company), pp. 95-109.
Jeng, K. S., Daniel, A , and Lai, M. M. C. (1996). A pseudoknot ribozyme
structure is active in vivo and required for hepatitis delta vims RNA replication. J
Virol 70, 2403-10.
Kuo, M. Y. P., Chao, M., and Taylor, J. (1989). Initiation of replication of the
human hepatitis delta vims genome from cloned DNA: Role of delta antigen. J
Virol 63, 1945-50.
Kuo, M. Y. P., Goldberg, J., Coates, L., Mason, W„ Gerin, G., and Taylor, J.
(1988). Molecular cloning of hepatitis delta vims RNA from an infected
woodchuck liver: sequence, structure and application. J Virol 62, 1855-61.
Lai, M. M. C. (1995). The molecular biology of hepatitis delta vims. Annu Rev
Biochem 64, 259-86.
Lazinski, D. W„ and Taylor, J. M. (1994). Recent developments in hepatitis delta
vims research. Adv Vims Res 43, 187-231.
Lee, C. M., Changchien, C. S., Chung, J. C., and Liaw, Y. F. (1996).
Characterization of a new genotype II hepatitis delta vims from Taiwan. J Med
Virol 49, 145-54.
Luo, G., Chao, M., Hsieh, S. Y., Sureau, C., Nishikura, K , and Taylor, J. (1990). A
specific base transition occurs on replicating hepatitis delta vims RNA. J Virol 64.
1021-7.
Macnaughton, T. B., Beard, M. R., Chao, M., Gowans, E. J., and Lai, M. M. C.
(1993). Endogenous promoters can direct the transcription of hepatitis delta vims
RNA from a recircularized cDNA template. Virology 196, 629-36.
Macnaughton, T. B., Gowans, E. J., Jilbert, A. R., and Burrell, C. J. (1990).
Hepatitis delta vims RNA, protein synthesis and associated cytotoxicity in a stably
transfected cell line. Virology 177, 692-8.
Macnaughton, T. B., Gowans, E. J., McNamara, S. P., and Burrell, C. J. (1991).
Hepatitis 8 antigen is necessary for access of hepatitis 5 vims RNA to the cell
transcriptional machinery but is not part of the transcriptional complex. Virology
184, 387-90.
97
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 2
Makino, S., Chang, M. F., Shieh, C. K., Kamahora, T., Vannier, D. M.,
Govindarajan, S., and Lai, M. M. C. (1987). Molecular cloning and sequencing of
a human hepatitis delta virus RNA. Nature 329, 343-6.
Nakabayashi, H., Taketa, K., Miyano, K., Yamane, T., and Sato, J. (1982). Growth
o f human hepatoma cell lines with differentiated function in chemically defined
medium. Cancer Res 42, 3858-3863.
Polo, J. M., Jeng, K. S., Lim, B., Govindarajan, S., Hofman, F., Sangiorgi, F., and
Lai, M. M. C. (1995). Transgenic mice support replication of hepatitis delta virus
RNA in multiple tissues, particularly in skeletal muscle. J Virol 69, 4880-7.
Rizzetto, M., Hoyer, M. G., Canese, M. G., Shih, J. W. K., Purcell, R. H., and
Gerin, J. L. (1980). Delta agent: association of 8 antigen with hepatitis B surface
antigen and RNA in serum of 8-infected chimpanzees. Proc Natl Acad Sci USA
77, 6124-8.
Ross, J. (1995). mRNA stability in mammalian cells. Microbiol Rev 59,423-450.
Ryu, W. S., Bayer, M., and Taylor, J. (1992). Assembly of hepatitis delta virus
particles. J Virol 66, 2310-5.
Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989). Molecular cloning (Cold
Spring Harbor, NY: Cold Spring Harbor Press).
Taylor, J., Mason, W., Summers, J., Golberg, J., Aldrich, C., Coates, L„ Gerin, J.,
and Gowans, E. (1987). Replication of human hepatitis delta vims in primary
cultures of woodchuck hepatocytes. J Virol 61, 2891-5.
Wang, E. H., andTjian, R. (1994). Promoter-selective transcriptional defect in cell
cycle mutant ts 13 rescued by hTAFjj250. Science 263, 811-4.
Wang, K. S., Choo, Q. L., Weiner, A. J., Ou, J. H., Najarian, R. C., Thayer, R. M.,
Mullenbach, G. T., Denniston, K. J., Gerin, J. L., and Houghton, M. (1986).
Structure, sequence, and expression of the hepatitis delta viral genome. Nature 323,
508-14.
Wu, T. T., Netter, H. J., Lazinski, D. W., and Taylor, J. M. (1997). Effects of
nucleotide changes on the ability of hepatitis delta vims to transcribe, process, and
accumulate unit-length, circular RNA. J Virol 71, 5408-14.
98
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 3
Chapter 3
Synthesis of the Hepatitis Delta Virus Antigenome and
the HDAg mRNA are Differentially Regulated
3.1 Summary and Purpose
As a result of the studies described in Chapter 2, we hypothesized that
mechanisms other than the suppression of polyadenylation by HDAg are
significant to the regulation of HDV transcription and replication. We therefore
examined the metabolic requirements of HDV transcription and replication,
focusing on the hypothesis that cellular pol II transcribes these two RNA species.
Details on the mechanism of HDV replication and transcription have been very
elusive. The hypothesis that cellular RNA pol II is responsible for the synthesis of
the HDAg mRNA, the 1.7-kb antigenomic HDV RNA, and the 1.7-kb genomic
HDV RNA is based on the finding that 1 pg/ml of a-amanitin can inhibit HDV
replication in vitro (Macnaughton et al., 1991). As described in Chapter 1 , the
relative sensitivities of these three HDV transcripts to a-amanitin have not been
determined. Thus it has not been experimentally demonstrated that these three
transcripts are each synthesized by cellular pol II. To test whether this assumption
is correct, the following specific aims were pursued:
99
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 3
1. Establish that cellular RNA pol II carries out transcription of the 0.8-kb,
HDAg-encoding mRNA.
a) Demonstrate inhibition of 0.8-kb mRNA synthesis at low
concentrations of a-amanitin in cell culture.
b) Rescue transcription of the 0.8-kb mRNA in the presence of a-
amanitin using an a-amanitin-resistant pol II mutant.
2. Establish that cellular RNA pol II carries out transcription of the 1.7-kb
antigenomic HDV monomer.
a) Demonstrate the ability of low concentrations of a-amanitin to inhibit
synthesis of the antigenomic monomer in cell culture.
b) Rescue transcription of the genomic monomer in the presence of a-
amanitin using an a-amanitin-resistant pol II mutant.
In summary, inhibition of both the 0.8-kb HDAg mRNA and the genomic 1.7-
kb monomer was achieved with low amounts of a-amanitin in cell culture, which is
consistent with hypothesis that pol II carries out these events. However, we were
unable to demonstrate inhibition of the synthesis of the 1.7-kb antigenomic
monomer by a-amanitin. Furthermore, though the synthesis of the 0.8-kb mRNA
was sensitive to low amounts of a-amanitin, an a-amanitin-resistant pol II mutant
was unable to completely restore transcription of this mRNA in the presence of a-
amanitin. This suggests that while transcription of the 0.8-kb mRNA may be
carried out by pol II, some differences between the metabolic requirements for
——
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 3
transcription of this mRNA and the requirements for transcription of most cellular
mRNAs may exist. This is further demonstrated by the poor transcription of the
0.8-kb HDAg mRNA at 34°C relative to cellular mRNAs.
These findings support our hypothesis that distinct metabolic requirements
exist for the synthesis of the 1.7-kb antigenome and the 0.8-kb HDAg mRNA, and
suggest the possibility that synthesis of the 1.7-kb antigenome may not be carried
out by pol n.
3.2 Introduction
Hepatitis delta virus (HDV), an RNA satellite vims of hepatitis B vims (HBV),
is associated with chronic (Polish et al., 1993; Wu et al., 1995) and fulminant
(Govindarajan et al., 1984; Smedile et al., 1982; Tassopoulos et al., 1990) viral
hepatitis . HDV incorporates the HBV surface antigen in its envelope (Rizzetto et
al., 1980), and so requires previous or concurrent infection with HBV for
productive infection of the human host. However, HDV can replicate in cells in the
absence of HBV, so does not require the contribution of any HBV-associated
factors to complete its replication cycle. During HDV replication, three major
HDV RNA species are produced: the 1.7-kb antigenome, the 1.7-kb genome, and
the 0.8-kb mRNA encoding the hepatitis delta antigen (HDAg). In the HDV virion
and in HDV-infected cells, two forms of HDAg are found: a small form (S-
HDAg), which is 195 amino acids in length; and a large form (L-HDAg), which is
214 amino acids in length (Bergmann and Gerin, 1986; Bonino et al., 1986; Pohl et
101
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 3
al., 1987). Both forms are translated from the same open reading frame present on
the 0.8-kb HDAg mRNA; the large form results from an RNA editing event on the
antigenome prior to mRNA synthesis (Casey and Gerin, 1995; Poison et al., 1996;
Poison et al., 1998), extending the S-HDAg open reading frame by 19 amino
acids. S-HDAg is strictly required for HDV replication in vivo (Bergmann and
Gerin, 1986; Bonino et al., 1986; Kuo et al., 1989; Pohl et al., 1987; Roggendorf et
al., 1987), and L-HDAg has been shown to potently inhibit HDV replication (Chao
et al., 1990; Glenn and White, 1991).
It is still poorly understood how this single-stranded, negative-sense RNA
vims replicates its 1.7-kb genome and transcribes the 0.8-kb mRNA for HDAg.
HDAg is the only HDV-encoded protein detected in virtually all HDV-infected
cells (Rizzetto et al., 1977). While S-HDAg is required for HDV replication in
vivo, it does not possess RNA polymerase activity. Since HDV can replicate in the
absence of HBV, HDV does not require HBV reverse transcriptase activity to
replicate. In accordance with this, naturally occurring HDV cDNA intermediates
have not been detected in infected cells. Because the presence of HDAg and the
RNA genome are sufficient to allow HDV replication in cell culture (Dingle et al.,
1998; Modahl and Lai, 1998), it has been postulated that this unusual subviral
RNA pathogen utilizes host cell enzymatic machinery to replicate and to transcribe
the HDAg mRNA.
Early in vitro studies of HDV revealed that HDV RNA synthesis could be
inhibited by a-amanitin in concentrations as low as 1 pg/ml, suggesting the direct
involvement of cellular RNA polymerase II (pol II) in HDV RNA synthesis
102
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 3
(Macnaughton et al., 1991). However, these studies were performed using nuclear
extracts from H I59 cells, which contain an integrated cDNA trimer of HDV. Since
it is unknown what proportion of the detected HDV RNA synthesis could be
attributed to transcription from the HDV RNA template versus the HDV cDNA
template, it is unclear whether the effect of a-amanitin in this experiment was
simply to inhibit cDNA-templated HDV RNA synthesis by pol II. Interestingly,
when the same authors added exogenous HDV RNA template to untransfected
HepG2 cells, they were unable to inhibit HDV replication with a-amanitin
(Macnaughton et al., 1991). The effects of a-amanitin on the synthesis of the three
individual HDV RNA species— the 1.7-kb genome, the 1.7-kb antigenome, and the
0.8-kb HDAg mRNA— have not been investigated. However, despite the paucity of
experimental evidence to support the involvement of pol II in HDV replication and
transcription, the current model of HDV replication holds that pol II transcribes
each of the three HDV RNA species listed above.
Though our understanding of the mechanisms for HDV replication and
transcription is still limited, two central conflicts exist in the currently accepted
model of the HDV replication cycle. The first concerns the mechanism by which
both the 1.7-kb antigenome and the 0.8-kb HDAg mRNA are synthesized by pol
II from the same RNA template, the 1.7-kb genome. (The second, the role of L-
HDAg in the regulation of HDV replication and transcription, will be discussed in
Chapter 4). It was hypothesized that the primary pol II transcript from the
genomic RNA template was the 0.8-kb HDAg mRNA (Chen et al., 1986; Hsieh et
al., 1990). Synthesis of the 1.7-kb genome occurred only after suppression of the
103
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 3
HDAg mRNA polyadenylation signal by HDAg (Hsieh and Taylor, 1991; Hsieh
etal., 1994). This would allow pol II to bypass the polyadenylation signal on the
genomic template, such that the full-length copy of the genome, the 1.7-kb
antigenome, could be produced. The prediction from this model was that the 0.8-
kb HDAg mRNA could only be synthesized early in infection . Therefore, this
model excluded the opportunity for new 0.8-kb mRNA synthesis late in infection,
when L-HDAg appears.
We recently tested the hypothesis that suppression of the HDAg
polyadenylation site by HDAg would restrict expression of the 0.8-kb HDAg
mRNA to the initial phase of the replication cycle, using a cDNA-free transfection
system (Modahl and Lai, 1998). We found, in contrast to the accepted model of
HDV transcription and replication, that the 0.8-kb HDAg mRNA continued to be
synthesized throughout the replication cycle, and increasing amounts of S-HDAg
did not suppress the production of the 0.8-kb HDAg mRNA. Instead, increasing
amounts of S-HDAg were associated with increasing amounts of both the 1.7-kb
antigenome and the 0.8-kb HDAg mRNA. This finding suggested that, while
some suppression of the polyadenylation site by HDAg could not be ruled out,
other mechanisms may be more significant in the regulation of synthesis of the
1.7-kb antigenome versus the 0.8-kb HDAg mRNA.
This conceptual problem in our understanding of the regulation of HDV
replication— namely, production of both the 1.7-kb antigenome and the
polyadenylated, 0.8-kb HDAg mRNA from the same genomic template— led us to
further investigate possible regulatory mechanisms which may differentially govern
104
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 3
HDV replication and transcription. We used the cDNA-free transfection system
we previously developed to examine the individual effects of a-amanitin on
synthesis of the genomic-sense and antigenomic-sense 1.7-kb HDV RNAs and the
0.8-kb HDAg mRNA in cell culture. We report here our initial findings, which
strongly suggest that the metabolic requirements for the synthesis of the three
individual HDV RNA species may be more varied, and the regulatory mechanisms
more elaborate, than previously suspected.
3.3 M aterials and M ethods
3.3.1 Cell culture and transfection
Huh7 cells (Nakabayashi et al., 1982) were cultured at 37°C in DMEM
supplemented with 10% fetal bovine serum, 100IU of penicillin per ml, 100 mg of
streptomycin per ml, 2mM L-glutamate, and 1% nonessential amino acids
(complete DMEM). BC10 M/E cells were cultured at 37°C in DMEM
supplemented with 10% fetal bovine serum, 100 IU of penicillin per ml, and
lOOmg of streptomycin per ml. The two permanent cell lines derived from BC10
M/E cells, E10 and BCHAWT, were selected in 600 |ig/ml G418 after transfection
with either pcDNA-3 alone (E10) or pcDNA-3 and pHAWT (BCHAWT), and
G 418-resistant colonies were selected and expanded. Clones transfected with
pcDNA-3 and HAWT were further selected in 10 (ig/ml a-amanitin, and G418-
and a-amanitin-resistant clones were expanded for further analysis. E10 and
BCHAWT cells were cultured at 37°C in DMEM supplemented with 10% fetal
_
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 3
bovine serum, 100 IU of penicillin per ml, and 7.5 pg/ml gentamycin. TsS3 cells,
which were derived from a temperature-sensitive hamster cell line (Wang and Tjian,
1994) and stably express the small HDAg from an integrated cDNA copy of the
HDAg-encoding mRNA under the cytomegalovirus (CMV) promoter (Hwang et
al., 1995), were cultured at 33°C in Dulbecco’s modified Eagle’s medium
(DMEM) supplemented with 10% fetal bovine serum, 100 IU of penicillin per ml,
and 7.5 |ig/ml gentamycin to maintain selection for neo resistance. All
transfections were performed using the DMRIE-C reagent (GibcoBRL) according
to the protocol provided by the manufacturer, with some modification. Briefly, I
day prior to transfection, cells were seeded onto 60-mm-diameter dishes. On the
following day, cells were transfected with the appropriate amount of RNA
(typically 5-10 (ig) in 2 ml of transfection mixture in serum-free media. After one
to two hours, two mis of culture media raised to 20% fetal bovine serum was added
to the cells. Following incubation overnight, the culture medium was replaced with
fresh medium and the cells were further incubated for an additional 1 to 5 days.
For experiments involving the use of a-amanitin, the appropriate amount of a-
amanitin dissolved in sterile water at a concentration of 1 mg/ml was added directly
to the culture medium.
3.3.2 Vectors and plasmid construction
Construction of plasmid PX9-I/II, which expresses the genotype I/H chimeric
S-HDAg, was reported previously (Modahl and Lai, 1998). For cDNA-templated
transcription of genomic-sense HDV RNA, Huh7 cells were transfected with
106
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 3
plasmid pKS/HDV1.9, which expresses 1.9-kb genomic-sense HDV RNA under
the CMV promoter. pKS/H2ag, which expresses the antigenomic-sense strand of
a mutant trimer HDV RNA under the CMV promoter, was used to establish
stability of the 1.7-kb antigenome (Jeng et al., 1996). pCMV/neo-Sm was
transfected for expression of S-HDAg in the stability experiment (Jeng et al.,
1996). Plasmid pKS/HDV1.9m expresses 1.9-kb genomic-sense HDV RNA
which contains a premature stop codon in the ORF for S-HDAg, such that a
truncated form of HDAg (m-HDAg) is translated. pKS/HDV1.9m was
constructed by digesting pKS/HDV1.9 (Jeng et al., 1996) with Aflll (nt 1209),
followed by a fill-in reaction with the klenow fragment to blunt the ends. The
blunt-ended product was ligated to produce the final plasmid, which contains an
insertion of 5 nucleotides. This causes both a frameshift in the HDAg open
reading frame and the introduction of a stop codon. Plasmid pBS/T7G-SP, used
to detect antigenomic sense HDV RNA in the non-coding region of the genome,
was constructed by inserting the SacH (nt 25) - PstI (nt 658) fragment of the
American HDV isolate into the same two sites of the multiple clonings site of
pBSU/KS-k The final construct expresses genomic-sense HDV RNA from nt 25
to 658 under the T7 promoter. The plasmid pArg-maxigene was used to measure
pol EU transcription. pArg-maxigene is a derivative of a Drosophila tRNA^* gene,
where 12 nucleotides have been inserted between the internal promoter regions
(Garber et al., 1991). The cell line E10 was established by transfection with
pcDNA-3, and the cell line BCHAWT by cotransfection of plasmids pcDNA-3
and pHAWT. pHAWT contains the pSTC backbone and genomic DNA encoding
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 3
the a-amanitin-resistant mutant of the mouse pol II largest subunit, RPII215, in
which a single AT-to-GC transition at nucleotide 6819 results in an asparagine-to-
aspartate substitution at amino acid 793 (Bartolomei and Corden, 1987). An HA
tag is placed at the N-terminus of the protein.
3.3.3 In vitro transcription
Genomic HDV RNA (1.9 kb), which contains the entire HDV genome plus
approximately 200 additional nucleotides of HDV sequence, was transcribed from
pKS/HDV1.9 (Jeng et al., 1996) with T7 MEGAscript (Ambion) after linearization
by EcoRV digestion. Mutant genomic HDV RNA (1.9-kb) was transcribed by the
same protocol. Antigenomic HDV RNA (1.9 kb) was transcribed from
pKS/HDV1.9 with SP6 MEGAscript (Ambion) after linearization by SnaBI
digestion. Capped, polyadenylated mRNAs for wildtype S-HDAg were
transcribed from the plasmid PX9 (Modahl and Lai, 1998) and for chimeric S-
HDAg from PX9-I/II with T7 mMESSAGE mMACHENE (Ambion) after
linearization by Hindlll digestion.
3.3.4 Northern blot analysis
Total RNA was extracted from transfected Ts53, Huh7, and the BC10 M/E cell
lines using the guanidinium thiocyanate method (Chomczynski and Sacchi, 1987).
Polyadenylated RNA was isolated with an oligo-dT cellulose column (Sigma)
according to the standard method (Sambrook et al., 1989). The RNA was digested
with RQ1 DNase (Promega), treated with formaldehyde, electrophoresed through
108
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 3
formaldehyde-containing 1.2% agarose gels, blotted onto a nitrocellulose
membrane (Hybond C extra; Amersham), and probed with 3 2 P-UTP-labeled HDV
strand-specific riboprobes. Riboprobes for detecting HDV RNA were transcribed
with T7 RNA polymerase (Promega) from plasmids S 18 (to detect genomic HDV
RNA) after linearization with Hindin digestion (Makino et al., 1987), or
pBS/T7G-SP (to detect antigenomic HDV RNA in the non-coding region of the
genome), following linearization with HindHI digestion. To detect newly
synthesized HDAg mRNA in Huh7 cells transfected with genotype I HDV RNA
(1.9 kb) and the chimeric genotype I/n mRNA, blots were probed with 3 2 P-end-
labeled oligonucleotide 1565A (1565-CCCCGCGGTCTTTCCTTCTTTCGG
ACC-1581), specific for the American isolate of genotype I HDV (Makino et al.,
1987). The protocol for Northern blots using oligonucleotide probes was adapted
from a published protocol (Geliebter et al., 1986). The membranes were
prehybridized for 2 hours at 55°C in 7% SDS, 20mM sodium phosphate (pH 7.0),
5x Denhardt’s solution, 5xSSC, and 100 p.g/ml salmon sperm DNA, and
hybridized overnight at 55°C in the same solution containing 10% dextran sulfate
and 2-3 x 106 cpm/ml radiolabeled probe. Blots were washed with 3xSSC, 10 mM
sodium phosphate (pH 7.0), 0.5x Denhardt’s solution, and 5% SDS 3 times for 20
minutes at 55°C. Northern blots probed with full-length HDV riboprobes were
hybridized and washed as described previously (Jeng et al., 1996). RNA extracted
from H I89 cells, which express and replicate HDV RNA from an integrated cDNA
trimer, or RNA from Huh7 cells previously transfected with RNA, were used for
109
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 3
positive controls. After autoradiography, computer images were generated by
using Canvas, version 5.0.
3.3.5 Western blot analysis
Protein was extracted from transfected Huh7 or Ts53 cells according to the
standard method (Sambrook et al., 1989). After denaturation by boiling in 2x
sample buffer (100 mM Tris-HCl pH 6.8, 200mM DTT, 4% SDS, 0.2%
bromophenol blue, 20% glycerol), 40 ug of protein from each sample was loaded
onto a 12.5% SDS-PAGE minigel. The gel was electrophoresed for 60 to 90
minutes at 150 volts. Proteins were then transferred to a nitrocellulose membrane
(Hybond C extra; Amersham). Small and large HDAg were detected by the ECL
western blot detection system (Amersham) using a combination of 3 monoclonal
antibodies against both forms of HDAg, and visualized by autoradiography.
3.3.6 RNase Protection Assay
RNA extracted for Northern analysis was analyzed by RNase protection assay
with the RPA II RNase Protection Assay Kit (Ambion). Briefly, 3 2 P-UTP-labeled
probe (antisense to the expressed Arg-maxigene) was transcribed from the pArg-
maxigene after linearization with Xbal digestion. Transcription was stopped with
the addition of EDTA (final 25 mM), and the sample was phenol/chloroform
extracted and ethanol precipitated. After probe and sample were denatured in a
boiling water bath, 1 x 106 cpm of radiolabeled probe was hybridized to 2.5 ng
total RNA at 43°C overnight, subjected to RNase A/Tl digestion, and precipitated
110
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 3
according to the protocol provided with the kit. After precipitation, RNA was air
dried and resuspended in 8 p .1 gel loading buffer (provided with the kit), and
subjected to electrophoresis at 20 mAmp in an 8% acrylamide/8M urea gel. The
protected bands were visualized by autoradiography.
3.4 Results
3.4.1 Synthesis of the 0.8-kb HDAg mRNA is sensitive to inhibition by a-
amanitin in cell culture
In order to evaluate the role of pol II in HDV replication, we examined the
sensitivity of HDV replication to a-amanitin in cell culture. We chose to use cell
culture for several advantages it offered over in vitro systems. First, we are easily
able to measure HDV replication and mRNA transcription using a transient,
cDNA-free transfection system. This system allows the unambiguous assessment
of the effects of a-amanitin on RNA-templated HDV RNA synthesis, without the
complication of effects on an artificial, HDV cDNA-templated transcription event.
Second, we can use Northern blot to easily detect the three major replication
products~the 1.7-kb genomic RNA, 1.7-kb antigenomic RNA, and the 0.8-kb
HDAg mRNA. We first compared the a-amanitin sensitivity of RNA-templated
HDV RNA synthesis to cDNA-templated HDV RNA synthesis (Figure 1). Huh7
cells were transiently transfected with either in vitro transcribed antigenomic-sense
1.9-kb HDV RNA and capped, polyadenylated mRNA encoding S-HDAg, or
plasmid encoding 1.9-kb genomic-sense HDV RNA under the CMV promoter.
The primary transcripts from both transfections are genomic-sense HDV RNAs.
I ll
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 3
Both RNA- and cDNA-templated HDV RNA synthesis were sensitive to 3 ug/ml
a-amanitin, added at the time of transfection. This finding is in agreement with
previous in vitro data demonstrating the sensitivity of HDV replication to low
concentrations of a-amanitin (Macnaughton et al., 1991), and consistent with the
hypothesis that pol II transcribes both the RNA- and cDNA-templated HDV
genomic RNA in these cells. Since a-amanitin added at the time of transfection
completely inhibited HDV replication in the RNA-transfected cells, we were unable
to independently evaluate the effects of a-amanitin on the synthesis of the 0.8-kb
HDAg mRNA and synthesis of antigenomic RNA separately, since the inhibition
of HDAg synthesis from the beginning would inhibit the synthesis of genomic-
size RNA. We therefore performed another experiment, in which a-amanitin was
not added until three days post-transfection, to allow HDAg to accumulate before
the addition of a-amanitin; the cells were harvested on day 4 for HDV RNA
analysis (Figure 2). Synthesis of the 0.8-kb HDAg mRNA was completely
inhibited by 5 (ig/ml a-amanitin. ChoA, an endogenous cellular pol II transcript,
was also sensitive to increasing amounts of a-amanitin. The 0.8-kb mRNA
became undetectable only 24 hours after inhibition of synthesis by a-amanitin,
whereas the decrease in choA was more gradual as the concentration of a-amanitin
increased. This result suggests that transcription of the 0.8-kb mRNA is at least as
sensitive as, or even more sensitive than, the cellular pol II transcript. It also
suggests that the half-life of the HDAg mRNA is shorter than that of choA,
possibly as short as a few hours.
112
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 3
Figure 1. Northern blot demonstrating the effects of a-amanitin on HDV
genomic RNA synthesis from HDV cDNA and RNA templates. Huh7 cells
were transfected with ether plasmid pKS/1.9 or in vitro transcribed S-HDAg
mRNA and 1.9-kb antigenomic HDV RNA, in vitro transcribed from plasmid
pKS/1.9. The indicated amounts of a-amanitin were added to cells at the time of
transfection. Cells were harvested 3 days post-transfection, and analyzed by
Northern blot using 3 2 P-UTP-labeled antigenomic-sense HDV RNA as a probe.
Lane 1, total RNA from Hld9 cells, indicating the position of the 1.7-kb genomic
monomer. Lanes 2-5, total RNA from Huh7 cells transfected with HDV cDNA.
Lanes 6-9, total RNA from Huh7 cells transfected with HDV RNA.
113
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
E
o
§<
o>z
jaoc
<
z
cc
Q
a
OC
01 -
so
0
O'C
0 1 .
S'O
0
t
*
*
a>
oo
h-
(O
in
co
C M
(0
E
C O
&
114
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 3
Figure 2. Synthesis of the RNA-templated 0.8-kb HDAg mRNA is
sensitive to a-amanitin. Huh7 cells were cotransfected with in vitro transcribed
S-HDAg mRNA and in vitro transcribed 1.9-kb genomic HDV RNA, and
harvested at day 3, or exposed to a-amanitin at day 3 and harvested at day 4 post-
transfection. The blot was probed for HDV antigenomic RNA with 3 2 P-end-
labeled oligonucleotide 1565A, and exposed to autoradiography (upper panel).
The HDV-specific probe was then stripped from the membrane, and then probed
for a second time using 3 2 P-dCTP-!abeled DNA probe specific for the endogenous
pol II transcript choA Gower panel). Lane 1, positive control from previously
transfected Huh7 cells, indicating the positions of the 1.7-kb antigenome and the
0.8-kb HDAg mRNA. Lane 2, total RNA from transfected Huh7 cells at day 3
post-transfection. Lanes 3-7, total RNA from transfected Huh7 cells at day 4 post
transfection, after treatment with the indicated amounts of a-amanitin at day 3 post
transfection.
115
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
a-am anitin
M
• « i
1.7-kb
antigenom ic
m onom er
0.8 kb mRNA
1 2 3 4 5 6 7
choA
l
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 3
In contrast, the synthesis of the 1.7-kb antigenomic RNA from day 3 to day 4 was
surprisingly resistant to a-amanitin treatment under this protocol, quite different
from the effect of a-amanitin on the synthesis of the 0.8-kb HDAg mRNA. From
the data in Figure 2, this species did not appear to decrease notably from day 3 to
day 4. We further investigated this finding, and this data is discussed in the next
section.
The a-amanitin sensitivity of the synthesis of the 0.8-kb HDAg mRNA is in
agreement with the hypothesis that pol II carries out transcription of this RNA-
templated mRNA. However, two alternative explanations for our findings include
generalized toxicity due to a-amanitin, and inhibition of cellular RNA polymerase
HI (pol ID) transcription, which is sensitive to a-amanitin at higher concentrations
of a-amanitin (approximately 100 (ig/ml). To rule out these two possibilities, we
evaluated the a-amanitin sensitivity of RNA synthesis from a pol III reporter
plasmid, pArg-maxigene. This construct expresses the tRNA^8 with a 12
nucleotide insertion, allowing specific detection of this transcript by RNase
protection assay. Huh7 cells were cotransfected with HDV RNA and pArg-
maxigene, and a-amanitin was added to cells either on day one or day two post-
transfection, and total RNA was harvested on day two or day three, respectively.
RNA from each sample was analyzed either by Northern blot for detection of
HDV RNA (Figure 3A), or by RNase protection assay for detection of the pol III
transcript (Figure 3B). The 0.8-kb mRNA was not detected until day 3, and was
completely inhibited by 20 pg/ml a-amanitin added one day prior to the harvest of
cells (Figure 3A, lane 5). In contrast, the pol HI transcript was not affected (Figure
—
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 3
3B, lanes 1-4). Since synthesis of this pol HI reporter transcript was uninterrupted
by a-amanitin, our data support the conclusion that the decrease in the amount of
0.8-kb HDAg mRNA in a-amanitin-treated cells is due to specific inhibition of pol
II transcription.
Similar to the results in Figure 2, the 1.7-kb antigenomic RNA was much less
affected when a-amanitin was added on day 2. However, when it was added at day
1, the 1.7-kb antigenome was completely inhibited by 20 jig/ml a-amanitin, similar
to the findings in Figure 1 (Figure 3A, lanes 3 and 5). As a comparison, the
cellular pol II transcript GAPDH was inhibited by a-amanitin to the same extent
regardless of when a-amanitin was added. These findings support the hypothesis
that pol II carries out synthesis of the 0.8-kb HDAg mRNA. However, the
inhibition of the 1.7-kb antigenome may be the result of inhibition of HDAg
synthesis. The a-amanitin sensitivity of 1.7-kb antigenomic RNA synthesis is
discussed in the next section.
118
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 3
Figure 3. Comparison of the effects o f a-amanitin on the synthesis of
the 0.8-kb HDAg mRNA and the 1.7-kb antigenome to the effects of a-
amanitin on pol II and pol HI transcripts. Huh7 cells were transiently
transfected with in vitro transcribed mRNA encoding S-HDAg, in vitro transcribed
1.9-kb genomic HDV RNA, and pArg-maxigene. Cells were treated with 20 ng/ml
a-amanitin at day one or day two, and cells were harvested one day after a-
amanitin treatment. Samples were analyzed by either Northern blot (A) to detect
antigenomic sense HDV RNA (upper panel) and GAPDH (lower panel), or by
RNase protection assay (B) to detect Arg-maxigene. A) Antigenomic HDV RNA
was detected using 3 2 P-end-labeled oligonucleotide 1565A. After autoradiography,
the blot was stripped and reprobed with 3 2 P-UTP-labeIed antisense GAPDH RNA
probe to detect endogenous GAPDH. Lane 1, positive control marking the
positions of the 1.7-kb antigenome and the 0.8-kb HDAg mRNA. Lanes 2 and 4,
total RNA harvested from transfected Huh7 cells at days 2 and 3, respectively,
without treatment with a-amanitin. Lanes 3 and 5, total RNA harvested from
transfected Huh7 cells at days 2 and 3, respectively, after one day of a-amanitin
treatment. B) Total RNA from the samples analyzed by Northern blot in (A) were
analyzed by RNase protection assay, using 3 2 P-UTP-labeled antisense Arg-
maxigene as a probe. Lanes 1-4 correspond to lanes 2-5 in (A).
119
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
A.
20 p.g/ml
a-am anitin:
day 2 day 3
-Tr\-.
1 2 3 4 5
day 2 d ay 3
12 3 4
1.7-kb antigenom e
0.8-kb HDAg mRNA
GAPDH
Arg-Maxi
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 3
These data suggest that the synthesis of the 0.8-kb HDAg mRNA is inhibited
by specific inactivation of pol II by a-amanitin, since this effect is not due to
generalized toxicity or inhibition of pol EH transcription. However, these data do
not rule out the possibility that the effect was secondary to a decrease in a pol II
product required for HDAg mRNA synthesis, since a-amanitin treatment was over
the course of 24 hours. Finally, there does exist the remote possibility that some
other, as yet uncharacterized a-amanitin-sensitive RNA polymerase may be
responsible for synthesis of the 0.8-kb HDAg mRNA.
3.4.2 Synthesis of the 1.7-kb antigenome is insensitive to inhibition by a-
amanitin in cell culture after abundant S-HDAg appears
Once we established the sensitivity of transcription of the 0.8-kb HDAg
mRNA to a-amanitin, we evaluated the sensitivity of HDV replication to a-
amanitin. Figure 3 demonstrates that, like the 0.8-kb HDAg mRNA, synthesis of
the 1.7-kb antigenome was inhibited by a-amanitin added at day one post
transfection. When it was added on day 2 post-transfection, the 1.7-kb RNA was
much less affected. Furthermore, the synthesis of the 1.7-kb antigenome appeared
not to be inhibited at all by a-amanitin when a-amanitin was added at day 3 post
transfection (Figure 2). We therefore investigated the effects of a-amanitin on the
synthesis of the 1.7-kb antigenome more thoroughly.
First, we re-evaluated the data shown in Figure 2 to better determine the effect
of a-amanitin on synthesis of the 1.7-kb antigenome. Shorter exposure of the
upper panel in Figure 2 (detection of HDV antigenomic RNA) demonstrates that,
—
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 3
in contrast to the effect on the 0.8-kb HDAg mRNA and the endogenous pol II
transcript choA, the level of 1.7-kb antigenomic RNA appears to increase in the a-
amanitin-treated cells (in which a-amanitin was added on day 3 and RNA
harvested on day 4), rather than decrease (Figure 4). This effect was seen in cells
exposed to as much as 25 gg/m a-amanitin; at 100 ug/ml a-amanitin, the level of
I.7-kb antigenomic RNA remains the same as in untreated cells. This finding
conflicts with the hypothesis that the antigenomic HDV RNA is transcribed by pol
II. The sensitivity of this RNA to a-amanitin early in viral replication could be the
indirect effects of inhibition of HDAg mRNA synthesis.
To more carefully establish the sensitivity of 1.7-kb antigenomic HDV RNA
synthesis to a-amanitin at different times after transfection, we added a-amanitin to
HDV RNA-transfected Huh7 cells at several time points after transfection and
analyzed the effect on 1.7-kb antigenomic HDV RNA synthesis two days later
(Figure 5A). We found that that when a-amanitin was added to cells at day one,
the synthesis of the HDV antigenome was completely inhibited. However, when
a-amanitin was added at day two, there was some, but not complete inhibition.
When it was added on day three, no inhibition of 1.7-kb RNA synthesis was
observed at all (Figure 5A, lane 7). This kinetics coincides with the appearance of
abundant S-HDAg typically detected in HDV RNA-transfected cells on day 3
post- transfection (data not shown). ChoA was inhibited to the same extent by a-
amanitin at all 3 time points. To further establish that the 1.7-kb antigenomic RNA
synthesis was not inhibited by a-amanitin if HDAg is supplied in abundance, we
examined the a-amanitin sensitivity of HDV RNA synthesis in Ts53 cells, which
— —
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 3
Figure 4. Northern blot of .showing the effects of a-amanitin on
antigenome synthesis at day 3 post-transfection. The blot is identical to that
shown in Figure 2, with a shorter exposure to detect the 1.7-kb antigenomic
monomer. Lanes are identical to those described in Figure 2.
123
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
o
•an
E
o
c
0)
o>
1 *
2 i
£ E
%
001.
s s
01.
s
0
0
i
I
I
t
•
3
I
<
o
if
co o>
s 5
124
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 3
Figure 5. Time course of the effects of a-amanitin on antigenome synthesis.
A) Northern blot of total RNA harvested from Huh7 cells transfected with in vitro
transcribed HDAg mRNA and 1.9-kb genomic HDV RNA, treated with 5 ng/ml a-
amanitin one, two, and three days post-transfection. Cells from each treatment
group were harvested at days three, four, and six, respectively. Antigenomic HDV
RNA (upper panel) was detected using 3 2 P-end-labeled oligonucleotide 1565A.
Endogenous choA RNA was detected using 3 2 P-dCTP-labeled cDNA probe. Lane
1, positive control marking the position of the 1.7-kb antigenome. Lanes 2, 4, and
6, total RNA harvested at days 3, 4, and 6 from transfected Huh7 cells untreated
with a-amanitin. Lanes 3, 5, and 7, total RNA harvested at days 3, 4, and 6 from
transfected Huh7 cells treated with a-amanitin at days 1 , 2, and 3, respectively. B)
Northern blot of total RNA harvested from Ts53 cells transfected with in vitro
transcribed 1,9-kb antigenomic HDV RNA, detected as in (A). Cells were treated
or left untreated with 5 pg/ml a-amanitin at day 2 post-transfection. Lanes 1 and 2,
RNA from untreated cells harvested at day 2 and day 3, respectively. Lane 3, RNA
from cells treated with a-amanitin at day 2, harvested at day 3. The 1.7-kb
antigenome and the cDNA-templated HDAg mRNA endogenously expressed in
Ts53 cells are indicated.
125
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
a-am anitin *
(5 ug/ml) _ + - + - +
f
II - m -'U m
antigenom ic
m onom er
choA
2 3 4 5 6 7
B .
/v
6 ^
C M
a-amanitin
— - _ +
(5 ug/ml)
I ! *
2 3
1.7 kb antigenom ic
m onom er
en d o g en o u s mRNA
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 3
stably express S-HDAg. In this cell line, a-amanitin failed to inhibit synthesis of
the HDV antigenome at day 2 post-transfection, whereas the endogenous mRNA
which was expressed from the cDNA copy containing the HDAg ORF (1.1 kb)
was inhibited. This supports the hypothesis that inhibition of HDV antigenome
synthesis at early time points is secondary to inhibition of S-HDAg production.
A major concern with the finding that the amount of 1.7-kb antigenomic RNA
did not decrease with the addition of a-amanitin to transfected cells is the
possibility that this RNA species is very stable. This would have prevented
detection of a decrease in the amount of antigenomic HDV RNA, even if the
synthesis of this species had ceased 24 hours earlier. To rule out this possibility,
we examined the stability of the 1.7-kb antigenomic HDV RNA transcribed from a
plasmid expressing an antigenomic trimer of a replication-defective HDV mutant
(pKS/H2ag) under the CMV promoter (Figure 6). This construct has a mutation
in the genomic strand, which inactivates the genomic ribozyme and prevents
synthesis of antigenomic RNA from the genomic RNA template (Jeng et al„
1996). The antigenomic ribozyme, however, is fully functional, allowing cleavage
of the primary trimeric transcript into 1.7-kb, monomeric-length antigenomic HDV
RNA. The addition of a-amanitin to cells transfected with this plasmid would
inhibit the synthesis of the trimer, since it is transcribed exclusively from the
cDNA template. This allows the measurement of the stability of the 1.7-kb
antigenomic RNA.
Huh7 cells were transfected with pKS/H2ag and pCMV/neo-Sm, which
expresses a wild-type S-HDAg (Figure 6). A plasmid expressing S-HDAg was
—
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 3
included in the transfection mixture-to mimic the condition under which the RNA-
based transfection studies were carried out. At three days post-transfection, 5
Ug/ml a-amanitin was added to cells, and total RNA was harvested from untreated
cells at day 3, and from a-amanitin-treated cells at days 4 and 5 post-transfection.
The results showed that after one day of a-amanitin treatment, the amount of 1.7-
kb antigenomic RNA detectable by Northern blot was significantly decreased, and
the primary transcript (5.1-kb antigenomic trimer) was undetectable (Figure 6,
compare lanes 1 and 2). After two days of exposure to a-amanitin, the 1.7-kb
antigenomic monomer was barely detectable. For a positive control, the levels of
endogenous choA mRNA were also assessed. Similar to previous experiments, a
gradual decrease in the amount of choA mRNA was detected over the two day
treatment period. This result suggests that the half-life of the 1.7-kb antigenomic
HDV RNA, like the 0.8-kb HDAg mRNA, is shorter than that of choA. Therefore,
the insensitivity of the 1.7-kb antigenomic RNA to a-amanitin treatment as shown
above most likely reflects the true resistance of the synthesis of 1.7-kb antigenomic
RNA to a-amanitin. We therefore conclude that, late in the replication cycle,
synthesis of the 1.7-kb antigenomic HDV RNA is not inhibited by a-amanitin in
cell culture.
128
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 3
Figure 6. Northern blot demonstrating the stability of antigenomic HDV
RNA and the stability of choA mRNA. Huh7 cells were transiently transfected
with pKS/H2ag and pKS/CMV-sm. Cells were treated with 5 (ig/ml a-amanitin at
day three post-transfection. Total RNA was harvested from untreated cells at day
3, and from a-amanitin treated cells at day 4 and day 5. Samples were analyzed by
Northern blot, first using 3 2 P-UTP-labeled probe which detects antigenomic HDV
RNA in the non-coding portion of the genome. After autoradiography, the blot
was probed a second time (without stripping) for choA, using a 3 2 P-dCTP-labeled
cDNA probe. The final autoradiograph shows both the HDV antigenomic RNA
and choA mRNA, as indicated. Lane 1, total RNA from transfected Huh7 cells
harvested at day 3, without a-amanitin treatment. Lanes 2 and 3, total RNA from
transfected Huh7 cells harvested ad days 4 and 5, one and two days after a-
amanitin treatment, respectively.
129
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
< D 0)
I I
o o
E
o
E
o
c
0) 4 >
O) O)
c c
< Q (0
.a .o
^ J S C
IO C O
a>
E
o
c
o
E
o
■ ■ a
E
o
c
< D
O)
c
C O
■ O ^
K. °
^ s .
t - O
n i
to
*o
* a-
T3
C O
•a
+
+
C O
cv
•5 E
2 w >
I 6
130
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 3
3.4.3 An a-amanitin-resistant pol II mutant fails to completely restore
transcription of the 0.8-kb HDAg mRNA
If inhibition of 0.8-kb HDAg mRNA synthesis can be attributed to inhibition
of pol II, we hypothesized that transcription of this mRNA in the presence of a-
amanitin would be restored in cells expressing an a-amanitin-resistant mutant of
pol II. We therefore established a cell line (BCHAWT) expressing an a-amanitin-
resistant pol II mutant (Bartolomei and Corden, 1987). Interestingly, the
expression of this transfected pol II mutant in this cell line was very low, but was
significantly induced by two days of a-amanitin treatment (Figure 7B). This cell
line was found to grow in 5 ug/ml a-amanitin at a rate similar to the parental cell
line (BC10ME) in the absence of a-amanitin (Figure 7A). The parental cell line
died after two days of exposure to this amount of a-amanitin (Figure 7A). The
slow induction of the pol II mutant may have accounted for the slightly slower
growth rate of BCHAWT cell line in the presence of a-amanitin as compared to
that in the absence of the drug.
We first studied the effects of a-amanitin treatment on the synthesis of the 0.8-
kb HDAg mRNA in the parental cell line transfected with vector alone (E10). The
sensitivity to a-amanitin of the synthesis of HDV RNA in this cell line was found
to be similar to what was observed in Huh7 cells (Figure 2); i.e., 0.8-kb mRNA
was inhibited by 3 pg/ml a-amanitin, whereas the 1.7-kb antigenomic RNA was
not affected by a-amanitin up to 25 jig/ml , when a-amanitin was added at day 3
post-transfection and RNA harvested 1 day later (data not shown).
131
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 3
Figure 7. Characterization of the cell line BCHAWT, which expresses an
a-amanitin resistant pol II mutant. A) 60 mm culture dishes were seeded with
either lx 105 BC10ME or the same number of BCHAWT cells. Three plates of
each cell type were either treated with 5 ug/ml a-amanitin, or left untreated, at the
time of seeding. Cells from each of the four treatment groups were counted with a
hemacytometer on days 1, 2, and 3 after seeding. B) Western blot of BC10ME
cells, BCHAWT cells, and BCHAWT cells treated with a-amanitin for two days
prior to protein harvest. Protein was separated on 5% polyacrylamide gel,
transferred to a nitrocellulose membrane, and probed with anti-HA mAb. Lane 1 ,
BC10ME cells. Lane 2, BCHAWT cells. Lane 3, BCHAWT cells treated with a-
amanitin.
132
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
<
x
I
m
C O
O
o
o
C M
- C O
- C M
U J
S
o
o o o o
C D C D C Q G O
C O in
C O
■ o
#1193
133
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 3
In BCHAWT cells, overall HDV replication and mRNA synthesis was slightly
poorer than in E10 cells, even in the absence of a-amanitin (data not shown). To
fully induce the a-amanitin-resistant pol n, a-amanitin was added to cells at the
time of transfection and harvested at day 3 and day 4. The results showed that
choA transcription was not affected by a-amanitin up to 25 (ig/ml, indicating that
the a-amanitin-resistant pol II mutant conferred resistance to a-amanitin (Figure 8,
lower panel). However, the overall levels of 0.8-kb mRNA synthesis were lower in
cells treated with 5 mg/ml a-amanitin or above (Figure 8, upper panel), indicating
that the synthesis of this mRNA was not fully restored by the pol II mutant. The
failure of the pol H mutant to transcribe the 0.8-kb HDAg mRNA as efficiently as
wild-type pol II may be due a defect in the function of the polymerase itself as it
transcribes the HDAg mRNA, or may be due to reduced amounts of some cellular
pol II product which the pol II mutant fails to transcribe. Therefore, the
requirement of 0.8-kb HDV mRNA and cellular pol II transcript appear to be
different. As shown in Fig 2, the 1.7-kb antigenomic RNA was not inhibited by a-
amanitin.
3.4.4 Temperature dependence of 0.8-kb mRNA synthesis from the
genomic RNA template
The previous finding suggested that, while our data was consistent with the
hypothesis that pol II transcribes the 0.8-kb HDAg mRNA, there may be some
unique characteristics of pol II transcription from the HDV RNA template. We
had previously found that HDV replication is influenced by temperature, where
134
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 3
Figure 8. Northern blot of demonstrating the effect of increasing amounts
of a-amanitin on HDV transcription and replication in a cell line
expressing an a-amanitin-resistant pol II mutant. BCHAWT cells were
transfected with in vitro transcribed S-HDAg mRNA and 1.9-kb genomic HDV
RNA. When the transfection mixture was removed from cells, fresh media
including the indicated amounts of a-amanitin was added to cells. Total RNA was
harvested at day 3 and day 4 post-transfection for each treatment. HDV
antigenomic RNA was detected with 3 2 P-end-labeled oligonucleotide 1565A (upper
panel). After autoradiography, the blot was stripped and reprobed with 3 2 P-dCTP-
labeled cDNA specific for endogenous choA mRNA (lower panel). Lane 1 ,
positive control from Huh7 cells marking the positions of the 1.7-kb antigenome
and 0.8-kb HDAg mRNA. Lane 2, untransfected BCHAWT cells. Lanes 2-7,
BCHAWT cells transfected with HDV RNA and treated with the indicated
amounts of a-amanitin, from the time of transfection to harvest at day 3. Lanes 8-
12, BCHAWT cells transfected with HDV RNA and treated with the indicated
amounts of a-amanitin, from the time of transfection to harvest at day 4.
135
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
>»
C D
CO
>t
C D
■ o
in
C M
in
in
C M
in
I
C M
T “
o
o>
C D
h-
CO
in
eo
C M
i f
l l
o
E
o
c
o
E
O)
<
Q
z
n <
J C Z
GOC
© E
<
o
136
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 3
replication at 34°C is poorer than at 37°C, whereas cellular mRNA synthesis was
equivalent at both temperatures (Hwang et al., 1995). Further, we had found that
when Ts53 cells (which are routinely grown at 34°C) were transfected with HDV
RNA, only the HDAg mRNA transcribed from the integrated HDAg cDNA, but
not the 0.8-kb mRNA synthesized from the HDV RNA, could be detected by
Northern blot (Modahl and Lai, 1998). We surmised that, like replication, RNA-
templated HDAg mRNA transcription may be sensitive to temperature. We
therefore compared the synthesis of the RNA-templated HDAg mRNA at 34°C
versus 37°C (Figure 9A). Indeed, while the HDAg mRNA (1.1 kb) transcribed
from the integrated HDAg cDNA was easily detectable at 34°C, the RNA-
templated 0.8-kb HDAg mRNA was not (Figure 9A lanes 2 and 4). Conversely,
the RNA-templated 0.8-kb HDAg mRNA was readily detected in cells maintained
at 37°C after transfection, while the HDAg mRNA transcribed from the integrated
HDAg cDNA was somewhat decreased (Figure 9A lanes 3 and 5). Indeed, cells
passaged at 37°C before transfection produced very little of the cDNA-templated
transcript but ample RNA-templated transcript (Figure 9B, lane 3). Notably, the
amount of S-HDAg, which is produced from both the cDNA-templated and RNA-
templated mRNA, is also higher in transfected cells grown at 37°C, and yet the
HDAg mRNA transcript is more abundant at 37°C (Figure 9C), again confirming
our model that S-HDAg does not inhibit the production of the 0.8-kb HDAg
mRNA. Finally, the temperature dependence of 0.8-kb HDAg mRNA synthesis
137
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 3
Figure 9. HDV replication in«Ts53 cells at 34°C and 37°C. Ts83 cells
passaged at 34°C were transfected with in vitro transcribed 1,9-kb genomic HDV
RNA; cells were maintained at 34°C during the transfection period. The
transfection mixture was then replaced with fresh media, and three plates remained
at 34°C, while three were moved to 37°C until harvest. Total RNA was harvested
from cells at day two and day three, and protein at day 3. A) Northern blot
detecting antigenomic HDV RNA, probed with 3 2 P-end-labeled oligonucleotide
1565A. Lane 1, positive control from HDV RNA-transfected Huh7 cells, marking
the positions of the 1.7-kb antigenome and the 0.8-kb HDAg mRNA. Lanes 2 and
4, total RNA from HDV RNA-transfected Ts83 cells grown at 34°C, harvested at
days 2 and 3, respectively. Lanes 3 and 5, total RNA from HDV RNA-transfected
Ts83 cells grown at 37°C after transfection, harvested at days 2 and 3, respectively.
B) Western blot detecting HDAg. Protein was harvested at day 3 from HDV
RNA-transfected Ts83 cells grown at 34°C and 37°C, and HDAg was detected with
a combination of three monoclonal antibodies against HDAg.
138
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
1.7-kb antigenomic
monomer
RNA-templated 0.8-kb
HDAg mRNA
B.
1.7-kb antigenomic
monomer
RNA-templated 0.8-kb
HDAg mRNA
day 2 day 3
34 37 34 37
2 3 4 5
cDNA-templated
HDAg mRNA
day 3
34 37
cDNA-templated S-HDAg
HDAg mRNA ^ ~
1 2
Chapter 3
demonstrates that RNA-templated pol H transcription of the HDAg mRNA has
properties distinct from cDNA-templated pol II synthesis of a similar transcript.
3.4.5 Transcription of the 0.8-kb HDAg mRNA can occur in the absence of
HDV RNA replication
Previous data showed that replication of HDV genomic-length RNA and
transcription of 0.8-kb mRNA have different metabolic requirements, and that
HDV RNA replication can occur in the absence of 0.8-kb mRNA transcription.
To examine whether the reverse is also true, i.e. 0.8-kb mRNA transcription can
occur in the absence of HDV genomic-size RNA synthesis, we took advantage of a
previous report that when genomic HDV RNA containing a defective S-HDAg-
coding region was transfected together with wild-type S-HDAg as a
ribonucleoprotein complex, HDV genomic replication does not occur (Dingle et al.,
1998). When we used a similarly defective genomic RNA together with an in vitro
transcribed mRNA encoding S-HDAg to transfect cells, we also failed to detect
HDV RNA replication (data not shown).
We therefore developed a more sensitive system to detect the transcription of
0.8-kb mRNA in the absence of RNA replication, since the amount of mRNA
made is expected to be limited because of the limited amount of RNA template in
the absence of RNA replication. For this purpose, we used an HDV genomic
RNA mutant that encodes a truncated HDAg. Since this protein can only be
translated from the mRNA (Lo et al., 1998), the accumulation of the truncated
protein can be used as a marker for the mRNA synthesized from this genomic
140
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 3
RNA. Huh7 cells were transfected with in vitro transcribed S-HDAg mRNA and
either wild-type 1.9-kb genomic HDV RNA or mutant 1.9-kb genomic HDV
RNA, and total protein and RNA were harvested two and three days, respectively,
post-transfection.
Western blot of protein from cells harvested at day two post-transfection
confirms the production of a functional mutant mRNA and translation of m-HDAg
(Figure 10A). Though by day three there is dramatically more 0.8-kb HDAg
mRNA from cells transfected with the wild-type genome when compared to cells
transfected with the mutant genome, there are comparable levels of S-HDAg and
m-HDAg at day two. Since mHDAg can be synthesized only from the mRNA,
this result suggests that the mRNA was transcribed from the mutant HDV genome.
To determine whether there was 1.7-kb antigenome synthesis in cells
transfected with the mutant genome, we analyzed RNA by Northern blot, using a
3 2 P-UTP-labeled RNA probe to detect antigenomic RNA in the non-coding region
of the genome (Figure 10B). Use of this probe prevents cross-hybridization with
ribosomal RNA, and so reduces background enough to discern any specific
hybridization to HDV antigenomic RNA. While the wild-type genomic HDV
RNA led to robust RNA synthesis, we were unable to detect any newly synthesized
1.7-kb antigenomic RNA in cells transfected with the mutant genomic HDV RNA.
Finally, to determine whether the 0.8-kb mRNA encoding m-HDAg was
synthesized, total RNA from transfected cells was subjected to polyA selection, and
total (T), polyA-deficient (A-), and poIyA-enriched (A+) fractions were analyzed
by Northern blot (Figure IOC). When the samples were analyzed by hybridization
_
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 3
with oligonucleotide 1565A, substantial amounts of the 0.8-kb S-HDAg mRNA
were detected in the polyA-enriched fraction from cells transfected with the wild-
type genomic HDV RNA. A small amount of the 0.8-kb m-HDAg mRNA was
detected in the polyA-enriched fraction from cells transfected with mutant genomic
HDV RNA. We were unable to detect this species in the total RNA fraction.
Because of background due to cross-hybridization of the oligonucleotide to 18S
rRNA, we were unable to determine with this blot whether there were low amounts
of 1.7-kb antigenomic HDV RNA in cells transfected with the mutant HDV
genome. This problem was avoided in Figure 10B. These results indicate that the
HDAg mRNA can be transcribed in the absence of RNA replication.
3.5 Discussion
We describe in this paper our investigation of the regulation of HDAg mRNA
and 1.7-kb antigenome synthesis using a transfection system devoid of HDV
cDNA. First, we demonstrate the differential sensitivity of synthesis of the 0.8-kb
HDAg mRNA and the 1.7-kb antigenome to a-amanitin in cell culture. Synthesis
of the 0.8-kb mRNA was sensitive to inhibition by 3 pg/ml a-amanitin at day 3
post-transfection, whereas synthesis of the 1.7-kb antigenomic HDV RNA was
resistant to a-amanitin at concentrations as high as 25 p-g/ml. Second, we show
that the putative transcription of the 0.8-kb mRNA by cellular pol II demonstrates
142
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 3
Figure 10. Isolated synthesis o£ the 0.8-kb HDAg mRNA. Huh7 cells were
transfected with in vitro transcribed S-HDAg mRNA and either wild-type 1.9-kb
genomic HDV RNA or mutant 1.9-kb genomic HDV RNA. Protein was harvested
from cells two days after transfection and analyzed by western blot (A), and total
RNA was harvested from cells three days post-transfection and subjected to polyA
selection and northern blot analysis (B, C). A). Western blot probed with a
combination of three monoclonal antibodies against HDAg. Lane 1, Huh7 cells
transfected with plasmids encoding HDAg-S and HDAg-L. Lane 2, untransfected
Huh7 cells. Lanes 3 and 4, cells transfected with in vitro transcribe S-HDAg
mRNA and either wild-type 1.9-kb genomic HDV RNA or mutant 1.9-kb genomic
HDV RNA. B). The northern blot shown in C was stripped and reprobed with
3 2 P-UTP-labeled HDV RNA detecting antigenomic HDV RNA in the non-coding
region of the genome. C). Northern blot probed with 3 2 P-end-labeled
oligonucleotide 1565A. Lane 1 , positive control from Huh7 cells marking the
positions of the 1.7-kb antigenomic monomer and the 0.8-kb HDAg mRNA. Lane
2, total RNA from untransfected Huh7 cells. Lanes 3-5, total, polyA(-) , and
polyA(+) RNA from Huh7 cells transfected with wild-type 1.9-kb genomic HDV
RNA and S-HDAg mRNA. Lanes 6-8, total, polyA(-), and polyA(+) RNA from
Huh7 cells transfected with mutant 1.9-kb genomic HDV RNA and S-HDAg
mRNA. Lanes 1-5 were exposed to autoradiography for 24 hours, while lanes 6-8
were exposed for 48 hours.
143
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
1.7 kb
m onom er
3 4 5 6
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
o>
<
o
E
n<
^ z
00 O C
o E
I
+
C O
C O
+
<
|
*Ar.-
- » ■ * 3 *
E
0 >
•
<
V * .
1 ^ .
T_
1-
< 0
O
* m w
t
145
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 3
metabolic requirements which are specific to RNA-templated transcription of the
0.8-kb mRNA.
The a-amanitin-sensitivity of the 0.8-kb mRNA is consistent with its synthesis
by pol II, but an a-amanitin-resistant pol II mutant fails to completely restore
synthesis of this species in the presence of 5 pg/ml a-amanitin; in contrast, the
endogenous cellular transcript choA is unaffected. Also, synthesis of the 0.8-kb
HDAg mRNA is suppressed at 34°C relative to transcription of cellular mRNAs,
and synthesis is restored at 37°C, when transcription of a cDNA-templated HDAg
mRNA is suppressed. Finally, we demonstrate that isolated HDAg mRNA
synthesis can occur in the absence of 1.7-kb antigenome synthesis.
The above findings lead to several conclusions about the regulation of HDV
replication and transcription. The differential sensitivity of 0.8-kb mRNA and 1.7-
kb antigenome to inhibition by a-amanitin suggests that the cellular machineries
which synthesize these two RNA species may be quite different. In the case of the
0.8-kb mRNA, synthesis is completely inhibited by only 3 pg/ml a-amanitin. At
this concentration of a-amanitin, cDNA-templated transcription of HDV RNA is
also efficiendy inhibited, and at 5 pg/ml a-amanitin, the endogenous cellular pol II
transcript choA is modestly inhibited. Inhibition of the DNA-templated pol II
transcripts is specific, since transcription of a reporter pol E H transcript was
unaffected by as much as 20 pg/ml a-amanitin. Our demonstration that RNA-
templated HDAg mRNA transcription is very sensitive to inhibition by a-amanitin,
therefore, strongly supports the hypothesis that cellular RNA pol II carries out
transcription of this HDV RNA species.
146
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 3
Our finding that synthesis of the 1.7-kb antigenome is resistant to 25 fig/ml a-
amanitin at day 3 post-transfection, however, is in direct contrast to the hypothesis
that it too is synthesized by cellular RNA pol n. Our inability to detect a decrease
in the amount of 1.7-kb antigenome after treatment with as much as 25 p.g/ml a-
amanitin is not likely due to the stability of this species, since inhibition of cDNA-
templated transcription of the antigenome with 5 jig/ml a-amanitin was easily
detected after only 24 hours, even in the presence of S-HDAg (Figure 6). The
striking difference in the sensitivities of the 0.8-kb HDAg mRNA and the 1,7-kb
antigenome to a-amanitin suggests that the cellular machineries which carry out
synthesis of these two species are distinct.
Interestingly, we often detected an increase in the 1.7-kb antigenome in a-
amanitin-treated cells relative to untreated cells (Figure 4). A possible explanation
for this phenomenon may be the inhibition of L-HDAg mRNA synthesis, which, if
1.7-kb antigenome synthesis is not directly affected by a-amanitin, would result in
more synthesis of the 1.7-kb antigenome than in cells where L-HDAg was actively
produced. In accordance with this hypothesis, L-HDAg typically appears between
days 3 and 4 in the RNA transfection system (Modahl and Lai, 1998).
Alternatively, the inhibition of pol II synthesis by a-amanitin, which typically
causes the rapid degradation of the pol II large subunit (Nguyen et al., 1996), may
promote more efficient synthesis of non-pol II transcripts via the increased
availability of common transcription machinery, such as TBP. Notably, we saw a
similar increase in the pol m reporter transcript in the presence of a-amanitin
(Figure 3B, compare lanes 3 and 4).
147
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 3
Our data suggest that, if pol II synthesizes the 1.7-kb antigenome, it does so in
such a manner that synthesis is highly resistant to a-amanitin. If a-amanitin
inhibited only initiation of RNA transcription, it is conceivable that transcription of
the 1.7-kb antigenome could continue around the circularized genomic template.
However, a-amanitin functions by inhibiting elongation of the nascent RNA, after
the formation of a single phosphodiester bond (Vaisius and Wieland, 1982). The
binding of a single molecule of a-amanitin to pol II is sufficient to inhibit further
transcription (Cochet-Meilhac and Chambon, 1974). It is conceivable that the pol
II transcription complex actively synthesizing the 1.7-kb antigenomic RNA is
somehow resistant a-amanitin. There have been some in vitro conditions
described in which wild-type RNA pol II transcribes new RNA in the presence of
a-amanitin; however, this property required manipulation of NTP availability, and
the elongation rate was only I % that of uninhibited pol II (Cochet-Meilhac and
Chambon, 1974). There have been no reports, to our knowledge, of transcript-
dependent pol II resistance to a-amanitin.
Surprisingly, the more likely explanation for the failure of that a-amanitin to
inhibit the production of antigenomic HDV RNA is that cellular pol II does not
carry out RNA-templated synthesis of the 1.7-kb antigenome. This conclusion
may be compromised by the exposure of cells to a-amanitin for 24 hours;
however, the concern of generalized toxicity is more relevant to successful
inhibition of the synthesis of an RNA species. Another possibility is that the wild-
type 1.7-kb antigenome is more stable than the 1.7-kb antigenome (the
complement of a genomic-strand ribozyme mutant) we tested. While the mutation
148
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 3
in the genomic strand ribozyme domain does not alter the ribozyme activity of the
antigenomic strand, the stability of the antigenome may depend on active synthesis
of the genomic strand from the antigenome. The genomic ribozyme defect may
affect this process. One way to resolve this possibility definitively is to
demonstrate the resistance of antigenome synthesis to a-amanitin in an in vitro
system, where newly synthesized RNA can be directly measured after inhibition of
pol II with a-amanitin. This work is in progress. Alternatively, since the largest
subunit of RNA pol II is degraded in response to a-amanitin-binding (Nguyen et
al., 1996), it may be possible to demonstrate selective preservation of this protein in
association with replicating HDV RNA in cells.
Our studies of the a-amanitin sensitivity of the 0.8-kb mRNA support the
hypothesis that this RNA is transcribed by pol II. However, the finding that the a-
amanitin-resistant pol II mutant failed to restore transcription of the HDAg mRNA
in the presence of a-amanitin to wild-type levels (Figure 8), suggests that there are
some differences between pol II transcription of most cellular mRNAs and the 0.8-
kb HDAg mRNA. The a-amanitin-resistant pol II mutant is capable of
transcribing most cellular mRNAs, as cells which express this mutant grow in a-
amanitin without detectable change from cells grown in the absence of a-amanitin.
However, the mutation in another a-amanitin-resistant pol II mutant (Crerar et al.,
1983) resulted in decreased ability to transcribe genes necessary for myotube
formation during myogenesis. The possible transcriptional defects of the a-
amanitin-resistant mutant in this study have not been described, but selective
defects in transcription likely exist for this mutant as well.
_
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 3
The functional defects of a-amanitin-resistant pol II mutants may be due to
promotor selectivity of the mutant (Bartolomei and Corden, 1987). Alternatively,
the functional defect may be due to differences in translocation requirements of the
polymerase along different templates (Bartolomei and Corden, 1995). The a-
amanitin-resistant mutant used in this study, like other described a-amanitin-
resistant mutants, contains a mutation in the region of the largest subunit required
for transcription elongation (Bartolomei and Corden, 1987). Four mutations
(including the asparagine 792 to aspartate substitution) have been described in this
domain for the mouse pol II largest subunit; thus this region has been proposed to
constitute and a-amanitin-binding pocket (Bartolomei and Corden, 1995). It is
tempting to speculate that the reduced ability of the a-amanitin-resistant mutant to
transcribe the 0.8-kb HDAg mRNA is due to a defect in elongation, where the
RNA template confers the requirement for wild-type pol II for efficient
transcription of the 0.8-kb mRNA.
The sensitivity of 0.8-kb mRNA transcription to temperature also suggests that
the use of the RNA template for transcription by pol n has strict requirements for
efficient production of the 0.8-kb mRNA. One explanation for this sensitivity to
temperature is that temperature affects the conformation of the RNA template. It is
possible that at 34°C there may be more extensive intramolecular base-pairing of
the 1.7-kb circularized genome than at 37°C, thus preventing adequate unwinding
of the template for transcription. The greater stability of RNA-RNA hybrids
relative to DNA-DNA hybrids may thus contribute to the differential effect of
temperature on transcription of the 0.8-kb HDAg mRNA versus transcription of
_
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 3
cellular mRNAs or the HDAg mRNA from a cDNA template. Alternatively,
temperature may affect the function of the genomic and/or antigenomic ribozymes,
thus reducing the availability of functional template for new transcription of the
0.8-kb mRNA, or may interfere with the formation of an active transcription
complex specific for 0.8-kb mRNA transcription. Finally, it is conceivable that at
34°C there is increased formation of very stable duplexes between genomic and
antigenomic-sense RNAs, also resulting in a reduction of functional template for
new 0.8-kb mRNA transcription.
The determination that 0.8-kb mRNA transcription can occur in the absence of
1.7-kb antigenome synthesis further underscores that HDV RNA transcription and
replication have differing metabolic requirements. By Western blot, we were able
to demonstrate that comparable levels of S-HDAg and m-HDAg were produced
(only a 2-fold reduction in m-HDAg relative to S-HDAg), whereas we were unable
to detect synthesis of the 1.7-kb antigenome. The difference in mRNA levels for
S-HDAg and m-HDAg was more significant than the difference in protein levels.
This is likely due to decreased stability of the m-HDAg mRNA relative to wild-
type; indeed, it is commonly observed that mRNA’s possessing a premature stop
codon are destabilized (Ross, 1995). The mechanism for this phenomenon is
unclear. Most mRNA’s which are destabilized by such a mutation are found to be
degraded in the nucleus (Ross, 1995). However, a few, such as the (3-globin
mRNA containing a premature stop codon, have been shown to be degraded in the
cytoplasm (Ross, 1995). The ability of the m-HDAg mRNA to produce amounts
of protein approaching wild-type levels suggests that this mRNA is degraded in the
151
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 3
cytoplasm. This feature may be important in the development of therapies for
HDV infection based on the expression of mutant HDAg species which can inhibit
in trans HDV replication in infected cells.
Since replication of the mutant genome was not observed in cells transiendy
transfected with the mutant genome and mRNA encoding wild-type S-HDAg,
while the mRNA encoding m-HDAg was, replication of the genome may require
more abundant quantities of S-HDAg than does transcription of the 0.8-kb
mRNA. Indeed, we found that when the mutant genome was transfected into TsS3
cells, which stably express S-HDAg, replication of this species occurred (data
shown in Chapter 4). The requirement for newly synthesized S-HDAg for
genome replication supports our conclusion that the inhibition of 1.7-kb
antigenome synthesis by a-amanitin early after transfection is secondary to
inhibition of 0.8-kb mRNA synthesis. However, the question remains as to the
mechanism behind the differing requirements for S-HDAg for mRNA synthesis
and antigenome synthesis. One possibility is that abundant S-HDAg is indeed
required to inhibit the polyadenylation signal for the 0.8-kb mRNA, thus allowing
synthesis of the full-length genome. However, our consistent demonstration that
synthesis of the 0.8-kb mRNA is not inhibited by the presence of abundant S-
HDAg makes this explanation unlikely. An alternative explanation is that the
nature of S-HDAg and its binding to the genome determines the preference for
transcription of the 0.8-kb mRNA versus the 1.7-kb antigenome. For example, the
phosphorylation state of S-HDAg appears to have differential effects on replication
and nuclear import of the HDV genome; phosphorylation of Ser 2 appears to
152
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 3
positively affect replication since substitution of this residue for alanine reduces
replication, while the phosphorylation status of this site does not affect the
assembly of empty virus-like HDAg particles or nuclear import (Yeh et al., 1996).
It would be interesting to determine whether substitution of Ser 2 for alanine has
differential effects on 0.8-kb mRNA transcription versus 1.7-kb antigenome
synthesis. If so, it is conceivable that the phosphorylation status of S-HDAg
differs in the virion RNP and the nuclear RNP. The antigenic structure of the two
species is very similar; however, the number of S-HDAg molecules bound to the
virion RNP is much higher than the nuclear RNP. Moreover, the N-terminus of S-
HDAg, where Ser 2 is located, is now thought to play a more significant role in
HDV RNA binding than previously suspected (Poisson et al., 1995). Alternatively,
the processing of S-HDAg provided by exogenous mRNA versus endogenous
0.8-kb mRNA may differ, rendering the exogenous S-HDAg incapable of
synthesizing 1.7-kb antigenomic RNA. Such possibilities will require further
study.
In conclusion, we demonstrate here the differential regulation of HDV
transcription and replication. We provide new evidence to support the hypothesis
that cellular RNA pol II carries out transcription of the 0.8-kb HDAg mRNA, and
evidence that the 1.7-kb antigenome may not be synthesized by this enzyme.
Further, we distinguish the putative pol II transcription of the 0.8-kb HDAg
mRNA from the genomic RNA template from pol II transcription from DNA
templates by two criteria: 1) transcription by an a-amanitin-resistant mutant of pol
n, and 2) transcription at 34°C. Finally, we demonstrate that transcription of the
——
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 3
0.8-kb mRNA can occur in the absence of replication. Though the precise
mechanisms behind the differential regulation of 1.7-kb antigenome synthesis and
0.8-kb mRNA synthesis, and behind the differential regulation of the putative pol
H-mediated transcription from the HDV RNA template and pol II-mediated
transcription from exogenous and cellular DNA template are unclear, the data
presented here provide a number of new directions in which to pursue the
understanding of the molecular biology of the HDV replication cycle.
154
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 3
3.6 References
Bartolomei, M. S., and Corden, J. L. (1995). Clustered alpha-amanitin resistance
mutations in mouse. Mol Gen Genetics 246, 778-82.
Bartolomei, M. S., and Corden, J. L. (1987). Localization of an a-amanitin
resistance mutation in the gene encoding the largest subunit of mouse RNA
polymerase II. Molecular and Cellular Biology 7,586-594.
Bergmann, K. F., and Gerin, J. L. (1986). Antigens of hepatitis delta virus in the
liver and serum of humans and animals. J Infect Dis 154, 702-6.
Bonino, F., Heermann, K. H., Rizzetto, M., and Gerlich, W. H. (1986). Hepatitis
delta virus: protein composition of delta antigen and its hepatitis B virus-derived
envelope. J Virol 58, 945-50.
Casey, J. L., and Gerin, J. L. (1995). Hepatitis D virus RNA editing: specific
modification of adenosine in the antigenomic RNA. J Virol 69, 7593-7600.
Chao, M., Hsieh, S. Y., and Taylor, J. (1990). Role of two forms of hepatitis delta
virus antigen: evidence for a mechanism of self-limiting genome replication. J
Virol 64, 5066-9.
Chen, P. J., Kalpana, G., Goldberg, J., Mason, W., Werner, B., Gerin, J. L., and
Taylor, J. (1986). Structure and replication of the genome of hepatitis delta vims.
Proc Natl Acad Sci USA 83, 8774-8.
Chomczynski, P., and Sacchi, N. (1987). Single-step method of RNA isolation by
acid guanidinium thiocyanate-phenol-chloroform extraction. Analytic Biochemistry
162, 156-9.
Cochet-Meilhac, M., and Chambon, P. (1974). Animal DNA-dependent RNA
polymerases. 11. Mechanism of the inhibition of RNA polymerases B by
amatoxins. Biochimica et Biophysica Acta 353, 160-84.
Crerar, M. M., Leather, R., David, E., and Pearson, M. L. (1983). Myogenic
differentiation of L6 rat myoblasts: evidence for pleiotropic effects on myogenesis
by RNA polymerase II mutations to alpha-amanitin resistance. Molecular &
Cellular Biology 3, 946-55.
Dingle, K., Bichko, V., Zuccola, H., Hogle, J., and Taylor, J. (1998). Initiation of
hepatitis delta vims genome replication. J Virol 72,4783-8.
155
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 3
Garber, M. E., Panthanathan, S., Fan, R. F., and Johnson, D. L. (1991). The
phorbol ester, TPA, induces specific transcription by RNA polymerase ID in
Drosophila Scheider cells. J Biol Chem. 266, 20598-20601.
Geliebter, J., Zeff, R. A., Schulze, D. H., Pease, L. R., Weiss, E. H., Mellor, A. L.,
Flavell, R. A., and Nathenson, S. G. (1986). Interaction between Kb and Q4 gene
sequences generates the Kbm6 mutation. Mol. Cell. Biol 6, 645-652.
Glenn, J. S., and White, J. M. (1991). Trans-dominant inhibition of human
hepatitis delta virus genome replication. J Virol, 2357-61.
Govindarajan, S., Chin, K. P., Redeker, A. G., and Peters, R. L. (1984). Fulminant
B viral hepatitis: role of delta agent. Gastroenterology 86, 1417-20.
Hsieh, S. Y n Chao, M., Coates, L., and Taylor, J. (1990). Hepatitis delta virus
genome replication: a polyadenylated mRNA for delta antigen. J Virol 64, 3192-8.
Hsieh, S. Y., and Taylor, J. M. (1991). Regulation of polyadenylation of hepatitis
delta virus antigenomic RNA. J Virol 65, 6438-46.
Hsieh, S. Y„ Yang, P. Y„ Ou, J. T., Chu, C. M., and Liaw, Y. F. (1994).
Polyadenylation of the mRNA of hepatitis delta virus is dependent upon the
structure of the nascent RNA and regulated by the small or large delta antigen. Nuc
Acids Res 22, 391-6.
Hwang, S. B., Jeng, K. S., and Lai, M. M. C. (1995). Studies of functional roles of
hepatitis delta antigen in delta virus RNA replication. In The unique hepatitis delta
virus, G. Dinter-Gottlieb, ed. (Austin: R. G. Landes Company), pp. 95-109.
Jeng, K. S., Daniel, A., and Lai, M. M. C. (1996). A pseudoknot ribozyme
structure is active in vivo and required for hepatitis delta virus RNA replication. J
Virol 70, 2403-10.
Jeng, K. S., Su, P. Y., and Lai, M. M. C. (1996). Hepatitis delta antigens enhance
the ribozyme activities of hepatitis delta virus RNA In vivo. J Virol 70,4205-9.
Kuo, M. Y. P., Chao, M., and Taylor, J. (1989). Initiation of replication of the
human hepatitis delta virus genome from cloned DNA: Role of delta antigen. J
Virol 63, 1945-50.
Lo, K., Hwang, S. B., Duncan, R , Trousdale, M., and Lai, M. M. C. (1998).
Characterization of mRNA for hepatitis delta antigen: exclusion of the full-length
antigenomic RNA as an mRNA. Virology 250,94-105.
156
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 3
Macnaughton, T. B., Gowans, E. J., McNamara, S. P., and Burrell, C. J. (1991).
Hepatitis 8 antigen is necessary for access of hepatitis 5 virus RNA to the cell
transcriptional machinery but is not part of the transcriptional complex. Virology
184,387-90.
Makino, S., Chang, M. F., Shieh, C. K., Kamahora, T., Vannier, D. M.,
Govindarajan, S., and Lai, M. M. C. (1987). Molecular cloning and sequencing of
a human hepatitis delta virus RNA. Nature 329, 343-6.
Modahl, L. E., and Lai, M. M. C. (1998). Transcription of hepatitis delta antigen
mRNA continues throughout hepatitis delta virus (HDV) replication: a new model
of HDV replication and transcription. J Virol 72, 5449-56.
Nakabayashi, H., Taketa, K., Miyano, K., Yamane, T., and Sato, J. (1982). Growth
of human hepatoma cell lines with differentiated function in chemically defined
medium. Cancer Res 42, 3858-3863.
Nguyen, V. T., Giannoni, F., Dubois, M. F., Seo, S. J., Vigneron, M., Kedinger, C.,
and Bensaude, O. (1996). In vivo degradation of RNA polymerase II largest
subunit triggered by alpha-amanitin. Nucleic Acids Research 24, 2924-9.
Pohl, C., Baroudy, B. M., Bergmann, K. F., Cote, P. J., Purcell, R. H., Hoofnagle,
J., and Gerin, J. L. (1987). A human monoclonal antibody that recognizes viral
polypeptides and in vitro translation products of the genome of the hepatitis D
virus. J Infect Dis 156, 622-9.
Poisson, F., Roingeard, P., and Goudeau, A. (1995). Direct investigation of protein
RNA-binding domains using digoxigenin-labelled RNAs and synthetic peptides:
application to the hepatitis delta antigen. J Virol Methods 55, 381-9.
Polish, L. B., Gallagher, M., Fields, H. A., and Hadler, S. C. (1993). Delta
hepatitis: molecular biology and clinical and epidemiological features. Clin Micro
Rev 6, 211-29.
Poison, A. G., Bass, B. L., and Casey, J. L. (1996). RNA editing of hepatitis delta
virus antigenome by dsRNA-adenosine deaminase. Nature 380,454-6.
Poison, A. G., Ley, H. L., Bass, B. L., and Casey, J. L. (1998). Hepatitis delta virus
RNA editing is highly specific for the amber/W site and is suppressed by hepatitis
delta antigen. MCB 18, 1919-26.
Rizzetto, M., Canese, M. G., Arico, S., Crivelli, O., Trepo, C., Bonino, F., and
Verme, G. (1977). Immunofluorescence detection of new antigen-antibody system
(delta/anti-delta) associated to hepatitis.B vims in liver and in serum of HBsAg
carriers. Gut 18,997-1003.
157
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 3
Rizzetto, M., Hoyer, M. G., Canese, M. G., Shih, J. W. K., Purcell, R. H., and
Gerin, J. L. (1980). Delta agent: association of 8 antigen with hepatitis B surface
antigen and RNA in serum of 8-infected chimpanzees. Proc Natl Acad Sci USA
77, 6124-8.
Roggendorf, M., Pahlke, C., Bohm, B., and Rasshofer, R. (1987). Characterization
of proteins associated with hepatitis delta virus. J Gen Virol 68,2953-9.
Ross, J. (1995). mRNA stability in mammalian cells. Microbiol Rev 59 ,423-450.
Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989). Molecular cloning (Cold
Spring Harbor, NY: Cold Spring Harbor Press).
Smedile, A., Verme, G., Farci, P., Caredda, F., Cargnel, A., Caporaso, N., Dentico,
P., Trepo, C., Opolon, P., Gimson, A., Vergani, D., and Williams, R. (1982).
Influence of delta infection on severity of hepatitis B. Lancet ii, 945-7.
Tassopoulos, N. C., Koutelou, M. G., Macagno, S., Zorbas, P., and Rizetto, M.
(1990). Diagnostic significance of IgM antibody to hepatitis delta vims in
fulminant hepatitis B. B J Med Virol 30, 174-7.
Vaisius, P., and Wieland, T. (1982). Formation of a single phosphodiester bond by
RNA polymerase B from calf thymus is not inhibitedbu a-amanitin. Biochemistry
21, 3097-3101.
Wang, E. H., andTjian, R. (1994). Promoter-selective transcriptional defect in cell
cycle mutant ts 13 rescued by hTAFjj250. Science 263, 811-4.
Wu, J. C., Chen, T. Z., Huang, Y. S., Yen, F. S., Ting, L. T„ Sheng, W. Y„ Tsay, S.
H., and Lee, S. D. (1995). Natural history of hepatitis D viral superinfection:
significance of viremia detected by polymerase chain reaction. Gastroenterology
108, 796-802.
Yeh, T. S., Lo, S. J., Chen, P. J., and Lee, Y. H. W. (1996). Casein kinase II and
protein kinase C modulate hepatitis delta virus RNA replication but not empty viral
particle assembly. J Virol 70, 6190-8.
158
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 4
Chapter 4
Synthesis of the Hepatitis Delta Virus Genome and
Antigenome are Differentially Regulated
4.1 Summary and Purpose
In the previous two chapters, we provided evidence that the regulation of
transcription of the 0.8-kb HDAg mRNA and synthesis of the 1.7-kb antigenome
may be distinguished by several criteria, including sensitivity to a-amanitin and the
requirement for newly synthesized S-HDAg. In accordance with this model,
others have demonstrated by mutational analysis that constructs deficient in HDAg
mRNA synthesis can synthesize 1.7-kb antigenomic RNA if S-HDAg is supplied
in trans, suggesting that the cis elements required for successful mRNA
transcription and 1.7-kb antigenomic RNA synthesis can be distinguished (Wang
et al., 1997). These authors also demonstrated mutations which selectively
abolished production of antigenomic RNA, while synthesis of genomic RNA could
occur. This further suggested that, like mRNA transcription and antigenome
synthesis, the cis elements required for genomic versus antigenomic synthesis may
differ. We therefore examined whether the metabolic requirements for genomic
and antigenomic 1.7-kb RNA synthesis could be distinguished. Because the role
—
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 4
of L-HDAg during initiation of replication (synthesis of antigenomic RNA)
remains unclear, we focused on the role of L-HDAg on the regulation of
antigenomic versus genomic strand synthesis.
L-HDAg was previously demonstrated to potently inhibit HDV replication
(Chaoet al., 1990; Glenn and White, 1991). In cDNA-based transfection systems,
a ratio of L-HDAg to S-HDAg as small as 1:10 almost completely abolishes
synthesis of genomic- and antigenomic-sense HDV RNAs (Chao et al., 1990); this
finding has been repeated by our lab and others (Casey and Gerin, 1998; Glenn
and White, 1991; Hwang and Lai, 1994). However, it is difficult to conceptualize
how HDV replication can be established during natural infection, where the
infecting virion contains both S-HDAg and L-HDAg. The exact ratio of these two
proteins in the typical virion is unknown; however, it has been estimated that they
are typically present in approximately equal amounts (Bergmann and Gerin, 1986;
Boninoetal., 1986; Pohl et al., 1987). Interestingly, the experimental protocols for
the original study of the role of L-HDAg in HDV replication did not permit
evaluation of the effects of L-HDAg on synthesis of the 0.8-kb HDAg mRNA
(Chaoetal., 1990).
We considered that there may be differential regulation of antigenomic and
genomic HDV RNA synthesis by L-HDAg. Since the original data for the role of
L-HDAg in the regulation of HDV replicaiton was generated in cDNA-based
transfections (Chao et al., 1990), we used the cDNA-free, RNA transfection system
to determine whether HDV RNA can indeed establish replication in cell culture
when S-HDAg and L-HDAg are present in equal amounts. To investigate the role
160
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 4
of L-HDAg in the regulation of HDV replication and transcription, we pursued the
following objectives:
1. Demonstrate that equimolar amounts of S-HDAg and L-HDAg can support the
establishment of HDV replication in cell culture.
a) Measure the suppressive effect of increasing amounts of L-HDAg
relative to S-HDAg on synthesis of the 1,7-kb antigenome, using Northern
and Western blot analysis.
b) Compare the suppressive effect of L-HDAg in the RNA and cDNA
transfection systems.
2. Compare of the effect of L-HDAg on HDV mRNA transcription and synthesis
of the 1.7-kb antigenome.
a) Measure the effect of increasing amounts of L-HDAg relative to S-
HDAg on transcription of the HDAg-encoding mRNA.
b) Measure the effect of increasing amounts of L-HDAg relative to S-
HDAg on synthesis of the 1.7-kb antigenome.
3. Compare the effect of L-HDAg on synthesis of the 1.7-kb antigenome and the
1.7-kb genome.
a) Measure the effect of increasing amounts of L-HDAg relative to S-
HDAg on synthesis of the 1.7-kb antigenome.
161
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 4
b) Measure the effect of increasing amounts of L-HDAg relative to S-
HDAg on synthesis of the 1.7-kb genome.
4. Investigate whether, like antigenome and mRNA synthesis, genomic and
antigenomic strand synthesis were differentially sensitive to a-amanitin.
We were able to distinguish between genomic versus antigenomic strand
synthesis by two criteria: regulation by L-HDAg and sensitivity to a-amanitin. In
contrast to the current understanding of the function of L-HDAg in the
suppression of HDV replication, we found that HDV replication can indeed be
established in the presence of equal amounts of L-HDAg and S-HDAg. Unlike
synthesis of the genome, which we found to be inhibited by the presence of very
small amounts of L-HDAg, synthesis of the 1.7-kb antigenome and the 0.8-kb
HDAg mRNA were only moderately inhibited by L-HDAg. As a result, in the
presence of equal amounts of L-HDAg and S-HDAg, the 1.7-kb antigenome and
newly synthesized HDAg accumulates at approximately half the rate as when S-
HDAg alone is present. Thus, we were able to differentiate synthesis of the 1.7-kb
genome from synthesis of the 1.7-kb antigenome and the 0.8-kb HDAg mRNA by
this criterion. Moreover, we have established that synthesis of new HDAg and
replication of the genome can occur when equal amounts of S-HDAg and L-
HDAg are initially present. Finally, we demonstrate that while synthesis of the
antigenome is insensitive to a-amanitin up to 25 jig/ml, synthesis of the genome,
like the 0.8-kb HDAg mRNA, is inhibited by 5 (ig/ml a-amanitin.
162
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 4
4.2 Materials and Methods*
4.2.1 Cell culture and transfection
Huh7 cells (Nakabayashi et al., 1982) were cultured at 37°C in DMEM
supplemented with 10% fetal bovine serum, 100IU of penicillin per ml, 100 mg of
streptomycin per ml, 2mM L-glutamate, and 1% nonessential amino acids
(complete DMEM). Ts83 cells, which were derived from a temperature-sensitive
hamster cell line (Wang and Tjian, 1994) and stably express the small HDAg from
an integrated cDNA copy of the HDAg-encoding mRNA under the
cytomegalovirus (CMV) promoter (Hwang et al., 1995), were cultured at 33°C in
Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% fetal
bovine serum, 100 IU of penicillin per ml, and 7.5 pg/ml gentamycin to maintain
neo resistance. All transfections were performed using the DMREE-C reagent
(GibcoBRL) according to the protocol provided by the manufacturer, with some
modifications. Briefly, 1 day prior to transfection, cells were seeded onto 60-mm-
diameter dishes. On the following day, cells were transfected with the appropriate
amount of RNA (typically 5-10 ug) in 2 ml of transfection mixture in serum-free
media. After one to two hours, 2ml culture medium raised to 20% fetal bovine
serum was added to the cells, giving a final concentration of 10% fetal bovine
serum. Following incubation overnight, the culture medium was replaced with
fresh medium and the cells were further incubated for an additional 1 to 5 days.
163
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 4
4.2.2 Vectors and plasmid construction
Plasmid PB1-3-I/II, which expresses an mRNA encoding the genotype I/n
chimeric L-HDAg under the T7 promoter, was developed from the plasmid PB 1 -3,
which expresses an mRNA encoding the L-HDAg of the American isolate of
genotype I. This plasmid was constructed by the same method used to develop
plasmid PX9-I/II, which expresses encoding the genotype I/n chimeric S-HDAg.
PB1-3 contains the pT7-3 plasmid backbone and HDV sequences 21 through 658
(reading through nt 0) inserted in the BamHI-PstI site. This plasmid differs from
PX9 only in that PB1-3 contains the open reading frame for L-HDAg, rather than
S-HDAg. To construct plasmid PBl-3-I/n, the EcoRI (in the multiple cloning
site) -StuI (at HDV nt 1334) fragment from the plasmid PB1-3 was replaced with
the corresponding fragment from plasmid 63 of an HDV genotype II cDNA clone
(Lee et al., 1996). Thus, genotype I nucleotides 21 to 1334 (reading through nt 0)
were replaced with the corresponding genotype H nucleotides 1663 to 1334.
Plasmid pKS/HDV1.9m expresses 1.9-kb genomic-sense HDV RNA which
contains a premature stop codon in the ORF for S-HDAg, such that a truncated
form of HDAg (m-HDAg) is translated. pKS/HDV1.9m was constructed by
digesting pKS/HDV1.9 with AfHI (site located at nt 1209), followed by a fill-in
reaction with the klenow fragment to blunt the ends. The blunt-ended product was
ligated to produce the final plasmid, which contains an insertion of 5 nucleotides.
This causes both a frameshift in the HDAg open reading frame and the
introduction of a stop codon. Plasmid pBS/T7G-SP, used to detect antigenomic
sense HDV RNA in the non-coding region of the genome, was constructed by
164
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 4
inserting the SacII (at nt 25) - PstI (at nt 658) fragment of the American HDV
isolate into the same two sites of the multiple cloning site of pBSH/KS+. The final
construct expresses genomic-sense HDV RNA from nt 25 to 658 under the T7
promoter.
4.2.3 In vitro transcription
Genomic HDV RNA (1.9 kb), which contains the entire HDV genome plus
approximately 200 additional nucleotides of HDV sequence, was transcribed from
pKS/HDV 1.9 (which contains both the T7 and SP6 promoters flanking the insert)
(Jeng et al., 1996) with T7 MEGAscript (Arnbion) according to the manufacturer’s
directions, after linearization by EcoRV digestion. Mutant genomic HDV RNA
(1.9-kb) was transcribed by the same protocol, from plasmind pKS/HDV 1.9m.
Andgenomic HDV RNA (1.9 kb) was transcribed from pKS/HDV 1.9 with SP6
MEGAscript (Arnbion) according to the manufacturer’s directions, after
linearization by SnaBI digestion. Capped, polyadenylated mRNAs for wildtype S-
HDAg and L-HDAg were transcribed from PX9 and PB1-3, respictively, and for
chimeric S-HDAg and L-HDAg from PX9-I/II and PB1-3-I/II, respectively, with
T7 mMESSAGE mMACHINE (Arnbion) after linearization by HincUII digestion.
4.2.4 Northern blot analysis
Total RNA was extracted from transfected Ts53, Huh7, and the BC10 M/E cell
lines using the guanidinium thiocyanate method (Chomczynski and Sacchi, 1987).
Polyadenylated RNA was isolated with an oligo-dT cellulose column (Sigma)
165
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 4
according to the standard method (Sambrook et al., 1989). The RNA was digested
with R Q 1 DNase (Promega), treated with formaldehyde, electrophoresed through
formaldehyde-containing 1.2% agarose gels, blotted onto a nitrocellulose
membrane (Hybond C extra; Amersham), and probed with 3 2 P-UTP-labeled HDV
strand-specific riboprobes. Riboprobes for detecting HDV RNA were transcribed
with T7 RNA polymerase (Promega) from plasmids S18 (to detect genomic HDV
RNA) (Makino et al., 1987) or pBS/T7G-SP (to detect antigenomic HDV RNA in
the non-coding region of the genome), following linearization with EcoRV
digestion. To detect newly synthesized HDAg mRNA in Huh7 cells transfected
with genotype I HDV RNA (1.9 kb) and the chimeric genotype I/n mRNA, blots
were probed with 3 2 P-end-labeled oligonucleotide 1565A, specific for the American
isolate of genotype I HDV (Makino et al., 1987). The protocol for Northern blots
using oligonucleotide probes was adapted from a published protocol (Geliebter et
al., 1986). The membranes were prehybridized for 2 hours at 55°C in 7% SDS,
20mM sodium phosphate (pH 7.0), 5x Denhardt’s solution, 5xSSC, and 100
ug/ml salmon sperm DNA, and hybridized overnight at 55°C in the same solution
containing 10% dextran sulfate and 2-3 x 106 cpm/ml radiolabeled probe. Blots
were washed with 3xSSC, 10 mM sodium phosphate (pH 7.0), 0.5x Denhardt’s
solution, and 5% SDS for 1 minute at room temperature followed by 1 hour at
55°C. Northern blots probed with full-length HDV riboprobes were hybridized
and washed as described previously (Jeng et al., 1996). RNA extracted from H I89
cells, which express and replicate HDV RNA from an integrated cDNA trimer, or
RNA from Huh7 cells previously transfected with RNA, were used for positive
_
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 4
controls. After autoradiography, computer images were generated by using
Canvas, version 5.0.
4.2.5 Western blot analysis
Protein was extracted from transfected Huh7 or Ts53 cells according to the
standard method (Sambrook et al., 1989). After denaturation by boiling in 2x
sample buffer (100 mM Tris-HCl pH 6.8, 200mM DTT, 4% SDS, 0.2%
bromophenol blue, 20% glycerol), 40 pg of protein from each sample was loaded
onto a 12.5% SDS-PAGE minigel. The gel was electrophoresed for 60 to 90
minutes at 150 volts. Proteins were then transferred to a nitrocellulose membrane
(Hybond C extra; Amersham). Small and large HDAg were detected by the ECL
western blot detection system (Amersham) using a combination of 3 monoclonal
antibodies against both forms of HDAg, and visualized by autoradiography.
4.3 Results
4.3.1 Transcription of the 1.7-kb antigenome occurs in the presence of
equal amounts of S- and L-HDAg
Previous reports demonstrated that L-HDAg is a potent inhibitor of HDV
replication in cells transiently transfected with HDV cDNA (Casey and Gerin,
1998; Chao et al., 1990; Glenn and White, 1991; Hwang and Lai, 1994). However,
our lab recently demostrated that S-HDAg and L-HDAg can both inhibit pol II
transcription from a DNA template (Lo et al., 1998). Thus it is possible that the
effects of L-HDAg may not have been directly on RNA-templated HDV RNA
167
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 4
synthesis. We therefore considered.that in the context of a cDNA-free transfection
system, different results might be obtained. Furthermore, the effects of L-HDAg
on HDAg mRNA synthesis have never been determined.
We first examined synthesis of the 1.7-kb genome in the presence of both S-
HDAg and L-HDAg, using the cDNA-free transfection system (Modahl and Lai,
1998). Similar to previous results, we found that transfecting low levels of L-
HDAg mRNA relative to S-HDAg mRNA potently inhibited synthesis of
genomic-sense HDV RNA from transfected antigenomic HDV RNA (Figure 1).
When L-HDAg mRNA was transfected in a ratio to S-HDAg mRNA of 1:5,
almost complete inhibition of genomic strand synthesis was observed (Figure 1 ,
lane 3). When equal amounts of L-HDAg mRNA and S-HDAg mRNA were
transfected with 1.9-kb antigenomic HDV RNA, synthesis of genomic HDV RNA
was completely inhibited (Figure 1, lane 4). As expected, transfection of 1.9-kb
antigenomic HDV RNA with L-HDAg mRNA alone did not allow synthesis of
genomic HDV RNA (Figure 1, lane 6).
We then examined the synthesis of 1.7-kb antigenomic HDV RNA from
transfected genomic RNA, under the same conditions (Figure 2). Surprisingly, we
only observed complete inhibition of antigenomic HDV RNA synthesis when the
amount of transfected L-HDAg mRNA was in excess of the amount of transfected
S-HDAg (Figure 2A, lane 4). When equal amounts of mRNA encoding S-HDAg
and L-HDAg mRNA were transfected, synthesis of the 1.7-kb antigenome was
only reduced by about 25-50 percent (Figure 2A, lane 3).
168
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 4
Figure 1. Synthesis of genomic HDV RNA is inhibited by small amounts
of L-HDAg. Northern blot of total RNA harvested from Huh7 cells transfected
with 1.9-kb antigenomic HDV RNA, mRNA encoding S-HDAg, and increasing
amounts of mRNA encoding L-HDAg. RNA was harvested at day 4 post
transfection. RNA is probed with 3 2 P-UTP-labeled riboprobe detecting genomic
sense HDV RNA. Lane 1, positive control indicating the position of the 1.7-kb
genomic monomer. Lane 2, antigenomic RNA transfected with mRNA encoding
S-HDAg alone. Lanes 3-5, antigenomic RNA transfected with mRNA encoding
S-HDAg and increasing amounts of mRNA encoding L-HDAg.
169
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
L-HDAg mRNA: o o- v v
S-HDAg mRNA: a? V 5 < 1? • & «
HDV antigenom e: +
1.7-kb
genom ic
m onom er
1 2 3 4 5 6
170
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 4
Figure 2. Antigenomic HDV RNA synthesis is not inhibited by the
presence of equal amounts of S-HDAg and L-HDAg. (A) Northern blot of
antigenomic RNA from Huh7 cells transfected with l.9-kb antigenomic HDV
RNA, mRNA encoding S-HDAg, and increasing amounts of mRNA encoding L-
HDAg. Cells were harvested at day 4. B) Western blot of protein from
untransfected Huh7 cells (lane 1), and Huh7 cells transfected with mRNA
encoding S-HDAg and increasing amounts of mRNA encoding L-HDAg. Cells
were harvested at day 2.
171
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
A.
L-HDAg mRNA: o ofr n ? < r
S-HDAg mRNA: • & *
HDV genom e: < £ > < £ >
1.7-kb
an tig en o m ic
m o n o m er
tra n sfe c te d
HDAg mRNA
B.
L-HDAg: * < y > < £ >
S-HDAg: V* n?
L -H D A g
S-H D A g
172
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 4
When L-HDAg mRNA was transfected in a ratio of 1:5 to transfected S-HDAg
mRNA, no obvious inhibition of replication was observed (Figure 2A, lane 2).
This in stark contrast to the effect of L-HDAg on genomic strand synthesis, where
L-HDAg mRNA transfected in a ratio of 1:5 to transfected S-HDAg mRNA
almost completely abolished genomic strand synthesis (Figure 1, lane 3).
To ensure that the transfected HDAg mRNAs express the expected amounts of
S- and L-HDAg, we examined HDAg levels in Huh7 cells transfected with S-
HDAg mRNA and increasing amounts of L-HDAg (Figure 2B). We excluded
1.9-kb genomic HDV RNA, since any transcription of de novo 0.8-kb S-HDAg
mRNA would alter the original ratio of HDAg provided by the transfected
mRNAs. When equal amounts of mRNA encoding S-HDAg and L-HDAg are
transfected into Huh7 cells, equal amounts of S-HDAg and L-HDAg protein are
produced (Figure 2B, lanes 3 and 4). Since this represents the original ratio of S-
HDAg to L-HDAg present at the beginning of the HDV replication cycle, we
conclude that HDV replication (synthesis of the antigenome and the 0.8-kb HDAg
mRNA) can be established when equal amounts of S-HDAg and L-HDAg are
initially present.
4.3.2 Synthesis of the 0.8-kb HDAg mRNA occurs in the presence of equal
amounts of L- and S-HDAg
The synthesis of the 1.7-kb antigenome in the presence of equal amounts of L-
and S-HDAg could be the result of three possible scenarios: 1) the 1.7-kb
antigenome and the 0.8-kb HDAg mRNA are both less sensitive to L-HDAg than
the 1.7-kb genome, and 2) the 0.8-kb mRNA is insensitive to the presence of L-
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 4
HDAg, and transcription of the mRNA for S-HDAg rescues synthesis of the 1.7-
kb antigenome after the L-HDAg from the transfected mRNA degrades, and 3) the
1.7-kb antigenome alone is insensitive to L-HDAg, and the synthesis of the
genome and the 0.8-kb mRNA occur only after L-HDAg from the transfected
mRNA degrades. This last possibility seems unlikely, since it would require that
L-HDAg degrades faster than S-HDAg. However, the relative stability of the L-
versus S-HDAg is unknown. To determine whether the 0.8-kb mRNA, the 1.7-kb
antigenome, or both, are sensitive to the presence of L-HDAg, we examined the
effects of L-HDAg on the synthesis of these two species in isolation.
To examine the sensitivity of 0.8-kb mRNA transcription to L-HDAg, we took
advantage of a system we previously developed, where 0.8-kb mRNA synthesis
occurs in the absence of 1.7-kb antigenome synthesis (Chapter 3). We transfected
Huh7 cells with in vitro transcribed 1.9-kb genomic RNA, which contains a
premature stop codon in the open reading frame for HDAg, and mRNA encoding
wild-type S-HDAg. In this system, only new 0.8-kb mRNA encoding the mutant
HDAg (m-HDAg) is transcribed, and only m-HDAg is translated from this
mRNA. The m-HDAg does not possess mms-activation activity, and, unlike other
HDAg mutants, does not function as a frans-dominant inhibitor of replication.
This system has several advantages for the analysis of 0.8-kb mRNA transcription.
First, since there is no background of replication, it is possible to measure the
amount of 0.8-kb mRNA product in the absence of differing backgrounds of
replication, which can alter the amount of template available for mRNA
transcription. Second, this system allows the detection of transfected S-HDAg and
174
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 4
L-HDAg, and newly translated m-HDAg. Therefore, we can establish the amounts
of S-HDAg and L-HDAg initially present at the time of transcription initiation, and
the ultimate product of de novo transcription, m-HDAg, within the same sample.
Finally, because the mRNA encoding m-HDAg seems to be very unstable and thus
difficult to detect, western blot can be used to assess mRNA transcription via the
measurement of protein production, since it has been established that the
antigenome itself cannot be used as a template for HDAg translation.
We found that when equal amounts of mRNA encoding wild-type S-HDAg
and L-HDAg are transfected into cells with the mutant genome, m-HDAg is
produced at levels 50% that of cells transfected with the mutant genome and S-
HDAg alone (Figure 3A). To confirm that mRNA was synthesized in the presence
of equal amounts of S-HDAg and L-HDAg, we transfected cells with the 1.9-kb
mutant genome and either chimeric mRNA encoding only S-HDAg, or mRNA
encoding both chimeric S-HDAg and chimeric L-HDAg. A fraction of the cells
were analyzed by western blot, and m-HDAg and the appropriate amounts of L-
and S-HDAg were detected in both samples (data not shown). Total RNA from
each sample was subjected to poly(A) selection, and the poly(A)-enriched fractions
were analyzed by Northern blot (Figure 3B). Transfection of chimeric mRNAs for
both HDAg species allows specific detection of newly synthesized 0.8-kb mRNA
(Modahl and Lai, 1998). The 0.8-kb m-HDAg mRNA can be detected in the RNA
from cells transfected with mutant genome and mRNA encoding S-HDAg alone
(Figure 3B, lane 3), and, faintly, from cells transfected with mutant genome and
mRNA encoding S-HDAg and L-HDAg (Figure 3B, lane 4).
_
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 4
Figure 3. L-HDAg does not inhibit 0.8-kb HDAg mRNA synthesis. (A)
Western blot of protein harvested from Huh7 cells transfected with 1,9-kb mutant
genomic HDV RNA and either mRNA encoding S-HDAg (lane 1) or mRNA
encoding S-HDAg and an equivalent amount of mRNA encoding L-HDAg mRNA
(lane 2). Cells were harvested at day 2 post-transfection. (B) Northern blot of
poly(A) selected mRNA from cells transfected as in (A). Lane 1 , positive control
marking position of the 1.7-kb antigenome and the 0.8-kb mRNA. Lane 2, total
RNA from untransfected cells. Lane 3, poly(A)-enriched RNA from cells
transfected with the mutant genome and S-HDAg mRNA. Lane 4, poly(A)-
enriched RNA from cells transfected with the mutant genome and both S-HDAg
mRNA and L-HDAg mRNA.
176
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
O ) o>
< < Q
Q O “
x x T
1 1 r
- I (A C
C M
® < <
E z z
O IE O C
S E E
O ) O ) O )
ts < <
g o o
■ s j 1 1
3 1 1
£ C O - J
.a
■
o>
177
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
o c
E
O )
<
Q
I
® < <
E z z
O O C D C
g E E
0) 0) 0)
♦; < <
O Q
X X
c / > -j
(0
a
■
O )
CD
178
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 4
These results confirm that transcription of the 0.8-kb HDAg mRNA and
translation of new HDAg occurs in the presence of equal amounts of S- and L-
HDAg. This is in contrast to the effect of L-HDAg on genomic-sense RNA
synthesis, where very little L-HDAg relative to S-HDAg strongly inhibits genomic
RNA synthesis, and at a ratio of 1:1, no synthesis of genomic RNA can be
detected. We conclude that transcription of the 0.8-kb mRNA and de novo
translation of HDAg occurs in the presence of equal amounts of S- to L-HDAg.
4.3.3 Synthesis of the 1.7-kb antigenome occurs in the presence of
increasing amounts of L-HDAg, independently of mRNA synthesis
Once we established that de novo transcription of HDAg mRNA and de novo
translation of HDAg can occur in cells containing equal amounts of S- and L-
HDAg, we examined the effects of L-HDAg on the synthesis of 1.7-kb
antigenomic RNA. In order to separate the effect of L-HDAg on antigenome
synthesis from its effect on mRNA transcription, we transfected Ts53 cells, which
stably express S-HDAg from an integrated cDNA containing the open reading
frame of S-HDAg, with 1.9-kb mutant genomic RNA and increasing amounts of
mRNA encoding L-HDAg (Figure 4A). In this system, the amount of S-HDAg
remains constant, since the only source of functional S-HDAg is from the
integrated cDNA; transcription from the transfected genome will produce mRNA
which encodes the truncated m-HDAg. This was confirmed by Western blot (data
not shown). The m-HDAg will not contribute to replication, and therefore the level
179
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 4
of 0.8-kb mRNA transcription will not affect production of 1.7-kb antigenome via
de novo translation of S-HDAg.
Increasing amounts of L-HDAg gradually inhibited the synthesis of the 1.7-kb
antigenome (Figure 4A, lanes 1-4). At 20 pg of L-HDAg mRNA, synthesis of the
1.7-kb antigenome was still detectable (lane 4). In contrast, the level of
endogenous 1.1-kb HDAg mRNA (transcribed from the integrated cDNA),
remained constant with increasing amounts of L-HDAg. In this experiment,
production of the 0.8-kb mRNA encoding m-HDAg could also be detected. In
parallel with the 1.7-kb antigenome, increasing amounts of L-HDAg gradually
inhibited production of this mRNA, and small amounts were still detectable in the
presence of 20 pg of L-HDAg mRNA.
We considered the possibility that since S-HDAg is already present in Ts53
cells, newly synthesized L-HDAg may not be able to inhibit RNA synthesis as well
as when S-HDAg and L-HDAg are synthesized together. To rule out that the
modest effect of L-HDAg on antigenomic RNA synthesis was peculiar to this
system, we evaluated the effect of transfected L-HDAg mRNA on the synthesis of
genomic-sense HDV RNA (Figure 4B). We observed immediate inhibition of
genomic RNA synthesis with the introduction of only 5 pg of L-HDAg mRNA
(Figure 4B, lane 3). This confirms that, regardless of the prior presence of S-
HDAg, L-HDAg differentially affects genomic and antigenomic RNA synthesis.
We conclude that, like the 0.8-kb mRNA, the 1.7-kb antigenome is only modestly
inhibited by L-HDAg.
180
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 4
Figure 4. L-HDAg does not* inhibit synthesis of the 1.7-kb HDV
antigenome. (A) Northern blot of antigenomic RNA from Ts53 cells transfected
with 1.9-kb mutant genomic HDV RNA and increasing amounts of mRNA
encoding L-HDAg (lanes 1-4), or 1.9-kb wild-type genomic HDV RNA (lane 5).
Lane 6, total RNA from untransfected Ts53 cells. Lane 7, positive control from
RNA-transfected Huh7 cells marking the positions of the 1.7-kb antigenome and
the 0.8-kb HDAg mRNA. (B) Northern blot of genomic RNA from Ts83 cells
transfected with 1.7-kb antigenomic HDV RNA and increasing amounts of mRNA
encoding L-HDAg (lanes 3-6). Lane 1, positive control from RNA-transfected
Huh7 cells marking the position of the 1.7-kb genome. Lane 2, total RNA from
untransfected Ts53 cells.
181
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
o>
o > ^
§ 1
3 1
t t t
® < <
E z z
O Q C D C
g E E
C D O)
5 < <
Q Q
< 0
n
a
■
■ o *o
a> «
< a a
a. a.
E E
a > a >
T -r
< <
z z
a cc
° XI
n ^
W I
. 00
182
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
o>
C O
o>
o
C M
in
.a
is.
to
in
C O
C M
O)
n
c c
E
O)
<
Q
!
a>
E
o
c
Q )
cn
.a
183
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 4
4.3.4 Genomic and antigenomic HDV RNA synthesis are differentially
sensitive to a-amanitin
We previously demonstrated that synthesis of the 1.7-kb antigenome is
resistant to inhibition by a-amanitin (Chapter 3). We considered that if genomic
and antigenomic RNA synthesis were differentially sensitive to inhibition by L-
HDAg, they may also be differentially sensitive to inhibition by a-amanitin. We
therefore tested the sensitivity of genomic RNA synthesis to 5 pg/ml a-amanitin at
several time points (Figure 5). Unlike antigenomic HDV RNA, where synthesis
was sensitive to a-amanitin only at the beginning of the replication cycle, synthesis
of genomic RNA was observed to be sensitive to a-amanitin throughout the
replication cycle. When a-amanitin was added at day 1 post-transfection,
synthesis of genomic RNA was completely inhibited and undetectable at day 3
(Figure 5, lanes 3 and 4). When a-amanitin was added at day 2 post-transfection,
some genomic RNA was detected at day 4, but the level was much lower than that
in untreated cells (Figure 5, lanes 5 and 6). When a-amanitin was added at day 3
post-transfection, again a small amount of genomic RNA was detected at day 5
relative to untreated cells (lanes 6 and 7). However, the amount of genomic RNA
detected in cells treated with a-amanitin at day 3 and harvested at day 5 was less
than in untreated cells harvested at day 3, indicating that the genomic RNA detected
was likely the remains of genomic RNA present at the time of a-amanitin
treatment. This is in contrast to the effect of a-amanitin on antigenome synthesis,
where the addition of a-amanitin at day 3 did not result in a decrease in the amount
of antigenomic RNA, even when harvested 3 days after a-amanitin treatment.
184
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 4
Figure 5. a-Amanitin inhibits synthesis of the 1.7-kb genomic HDV RNA.
Huh7 cells were transfected with antigenomic 1.9-kb HDV RNA and mRNA
encoding S-HDAg. Genomic HDV RNA was detected with antigenomic-sense
3 2 P-UTP-labeled riboprobe. Cells were treated with 5 |ig/ml a-amanitin 48 hours
prior to harvest. Lane 1, positive control marking the position of the 1.7-kb
genome. Lanes 3-8, total RNA harvested from treated and untreated transfected
cells at the indicated time points.
185
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
in
>»
co
*o
C O
T3
CO
>»
C O
•o
I"-
co
in
C O
C M
E
1 3 >
t
co
E
C O
&
E
o
Q ) Q )
®1
£ E
186
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 4
We conclude that, unlike synthesis of antigenomic HDV RNA, synthesis of
genomic RNA is sensitive to inhibition by a-amanitin.
4.4 Discussion
In this study we demonstrate that in the RNA transfection system, as others
have found in cDNA transfection systems, genomic HDV RNA synthesis is
potently inhibited by the presence of small amounts of L-HDAg relative to S-
HDAg. However, unlike previous findings, we provide evidence that synthesis of
HDV antigenomic RNA— both the 1.7-kb antigenome and the 0.8-kb HDAg
mRNA— is only modestly inhibited by L-HDAg. When equal amounts of S-
HDAg and L-HDAg are initially present, 0.8-kb mRNA synthesis and de novo
HDAg synthesis occur at levels approximately 50% that of when S-HDAg is
present alone. In cells which stably express S-HDAg, the transfection of
increasing amounts of L-HDAg mRNA with genomic HDV RNA only modestly
inhibits synthesis of the 1,7-kb antigenome. At the highest amount of transfected
L-HDAg mRNA (20 pg), synthesis of the 1.7-kb antigenome is still detected. In
these same cells, synthesis of the 0.8-kb HDAg mRNA can also be detected, and
synthesis of this RNA species is also only modestly inhibited by increasing L-
HDAg, following the same pattern as synthesis of the 1.7-kb antigenome. In
contrast, genomic RNA synthesis is completely inhibited by the lowest amount of
transfected L-HDAg mRNA (5 pg). Finally, synthesis of the genomic strand is
——
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 4
sensitive to inhibition by a-amanitin througout the replication cycle, where 5 pg/m1
a-amanitin inhibits genome synthesis when added at days 1, 2, and 3 post
transfection. This is in contrast to the effect of a-amanitin on antigenome
synthesis, where even 25 pg/ml a-amanitin fails to inhibit synthesis of the 1.7-kb
antigenome at day 3 post-transfection.
The above findings lead to several conclusions about the role of L-HDAg in
the HDV replication cycle and the regulation of antigenomic versus genomic HDV
RNA synthesis. First, the finding that both the 0.8-kb mRNA and the 1.7-kb
antigenome can be synthesized when L- and S-HDAg are initially present in equal
amounts, solves a lingering question about the establishment of HDV replication
during natural infection. Previous data on the role of L-HDAg in the HDV
replication cycle suggested that synthesis of all HDV RNA had essentially
zero tolerance for the presence of L-HDAg (Chao et al., 1990; Glenn and White,
1991). However, the presence of near-equal amounts of L- and S-HDAg in the
HDV virion is a troubling element in this model, since HDV successfully
establishes replication in this case in the presence of both L- and S-HDAg.
Interestingly, we did find that there was some dose-dependent inhibition of
antigenomic RNA synthesis by L-HDAg. While ample replication occured in the
presence of equal amounts of L-HDAg and S-HDAg, we were never able to
demonstrate replication or 0.8-kb mRNA synthesis when the amount of L-HDAg
exceeded the amount of S-HDAg. This suggests that the ratio of S-HDAg to L-
HDAg in the packaged virion may be critical for the the viral particle to be
infectious.
188
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 4
Beyond resolving the important question of initiation of replication during
natural infection, these findings also provide evidence that, like transcription of the
0.8-kb HDAg mRNA and synthesis of the 1.7-kb antigenome, synthesis of the
genome and antigenome are differentilly regulated. However, the mechanism by
which L-HDAg may differentially inhibit genome versus antigenome synthesis
remains to be answered. Some insights into this issue may be possible by
considering the proposed molecular basis for the transactivation of HDV
replication by S-HDAg, and the mechanism by which L-HDAg is thought to
inhibit this process. The original finding that the presence of small amounts of L-
HDAg could interrupt HDV replication was understood to support a model where
oligomerization of S-HDAg is essential for an the assembly of a transcription
complex capable of using HDV RNA as a template for new RNA synthesis (Chao
et al., 1990; Glenn and White, 1991; Xia and Lai, 1992). This model was
supported by evidence demonstrating that mutation of the coiled-coil domain in S-
HDAg abolished HDV replication, and mutation of this same domain destroyed
the ability of L-HDAg to inhibit replication (Xia and Lai, 1992). Further, S-HDAg
from genotype III acts as a trans-dominant inhibitor of genotype I replication
(Casey and Gerin, 1998). Studies of chimeras between the two genotypes
supported the hypothesis that the coiled-coil domain of the genotype E L I S-HDAg
was responsible for the inhibition (Casey and Gerin, 1998). The data presented
here are in agreement with this model in the case of genomic strand synthesis,
since small amounts of L-HDAg to S-HDAg potently inhibits replication.
189
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 4
Our finding that equal amounts of L-HDAg and S-HDAg can support 0.8-kb
mRNA and 1.7-kb antigenome synthesis, however, contradicts this model. What
could be the molecular basis for this finding? Interestingly, in the study that
demonstrated trans-dominant inhibition of genotype I replication by genotype III
S-HDAg, the authors found that the reverse was not true; namely, genotype I S-
HDAg did not interfere with genotype III replication if genotype III S-HDAg was
also present (Casey and Gerin, 1998). This finding contradicts the hypothesis that
any interference with homogeneous oligomerization of S-HDAg will inhibit
replication. Further, the authors found that S-HDAg from one genotype alone was
not able to support replication of the genome of other genotype. Since, in this
scenario, S-HDAg can still form oligomers, other functions of S-HDAg, such as
the nature of its binding to the RNA of its same genotype, may also play a critical
role in the frans-activation of replication.
Our finding that L-HDAg has different effects on genomic and antigenomic
RNA synthesis therefore raises the question of whether oligomerization of S-
HDAg plays the same role in genomic strand synthesis as it does in antigenomic
strand synthesis. We (Chapter 3) and others (Dingle et al., 1998) have found that
when genomic HDV RNA is transfected into cells with either small amounts of
purified S-HDAg, or with in vitro transcribed mRNA encoding S-HDAg (which
provides only small amounts of S-HDAg), synthesis of the 1.7-kb antigenome
does not occur unless the transfected genomic RNA contains the open reading
frame for wild-type S-HDAg. However, transcription of the 0.8-kb HDAg mRNA
does occur in this context (Chapter 3). Perhaps this confusing reliance on the
_ _
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 4
amount of S-HDAg for antigenome -synthesis can be understood in terms of the
requirement for oligomerization. If 0.8-kb mRNA transcription does not require
oligomerization of S-HDAg, then the introduction of L-HDAg would not inhibit its
synthesis via interruption of such oligomerization. The requirement for
oligomerization in transcription of the 0.8-kb mRNA has not been evaluated.
A difference in the requirement S-HDAg multimerization may explain the
relative insensitivity of 0.8-kb mRNA synthesis to L-HDAg, but this does not
explain the difference between genomic and antigenomic RNA synthesis. Both
appear to require more abundant amounts of S-HDAg than does the 0.8-kb mRNA
for successful synthesis. However, our final result may point to a possible
explanation for this phenomenon as well. Synthesis of the genomic strand and the
antigenomic strand were demonstrated to be differentially sensitive to a-amanitin.
While the hypothesis that the cause of this differential sensitivity is due to radically
different enzymatic machinery (pol II in the case of genome synthesis, and some
other polymerase in the case of antigenome synthesis) will require further study to
confirm, it is reasonable to conclude from this finding that the machinery for the
synthesis of each RNA species has inherent structural differences, which allows a-
amanitin to inhibit genome synthesis, but precludes inhibition of antigenome
synthesis. Thus the model of strictly homogeneous multimers for successful
synthesis of genomic strand synthesis may be correct. However, the structure of
S-HDAg multimers in the context of antigenome synthesis may not rely on such
strictly homogeneous oligomerization. Indeed, the role of abundant S-HDAg for
antigenome synthesis may lie in the RNA-binding capacity of S-HDAg, which
191
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 4
may allow access of the machinery specific to synthesis of antigenomic RNA to
the genomic template for this purpose.
In conclusion, we have demonstrated that, like the 0.8-kb mRNA and the 1.7-
kb antigenome, the synthesis of the 1.7-kb antigenome and the 1.7-kb genome may
have very different metabolic requirements. This is reflected by the very different
role of L-HDAg in the inhibition of the synthesis of each species, and the
differerential sensitivity of each strand to a-amanitin. A more complete discussion
of a new model for HDV transcription and replication is provided in Chapter 5.
192
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 4
4.5 References
Bergmann, K. F., and Gerin, J. L. (1986). Antigens of hepatitis delta virus in the
liver and serum of humans and animals. J Infect Dis 154,702-6.
Bonino, F., Heermann, K. H., Rizzetto, M., and Gerlich, W. H. (1986). Hepatitis
delta virus: protein composition of delta antigen and its hepatitis B virus-derived
envelope. J Virol 58, 945-50.
Casey, J. L., and Gerin, J. L. (1998). Genotype-specific complementation of
hepatitis delta virus RNA replication by hepatitis delta antigen. J Virol 72, 2806-14.
Chao, M., Hsieh, S. Y., and Taylor, J. (1990). Role of two forms of hepatitis delta
virus antigen: evidence for a mechanism of self-limiting genome replication. J
Virol 64,5066-9.
Chomczynski, P., and Sacchi, N. (1987). Single-step method of RNA isolation by
acid guanidinium thiocyanate-phenol-chloroform extraction. Analytic Biochemistry
162, 156-9.
Dingle, K., Bichko, V., Zuccola, H., Hogle, J., and Taylor, J. (1998). Initiation of
hepatitis delta virus genome replication. J Virol 72, 4783-8.
Geliebter, J., Zeff, R. A., Schulze, D. H., Pease, L. R., Weiss, E. H., Mellor, A. L.,
Flavell, R. A., and Nathenson, S. G. (1986). Interaction between Kb and Q4 gene
sequences generates the Kbm6 mutation. Mol. Cell. Biol 6, 645-652.
Glenn, J. S., and White, J. M. (1991). Tran^-dominant inhibition of human
hepatitis delta vims genome replication. J Virol, 2357-61.
Hwang, S. B., Jeng, K. S., and Lai, M. M. C. (1995). Studies of functional roles of
hepatitis delta antigen in delta vims RNA replication. In The unique hepatitis delta
vims, G. Dinter-Gottlieb, ed. (Austin: R. G. Landes Company), pp. 95-109.
Hwang, S. B., and Lai, M. M. C. (1994). Isoprenylation masks a conformational
epitope and enhances frans-dominant inhibitory function of the large hepatitis delta
antigen. J Virol 68, 2958-64.
Jeng, K. S., Daniel, A., and Lai, M. M. C. (1996). A pseudoknot ribozyme
structure is active in vivo and required for hepatitis delta vims RNA replication. J
Virol 70, 2403-10.
193
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 4
Lee, C. M., Changchien, C. S., Chung, J. C., and Liaw, Y. F. (1996).
Characterization of a new genotype II hepatitis delta virus from Taiwan. J Med
Virol 49, 145-54.
Lo, K., Sheu, G. T., and Lai, M. M. C. (1998). Inhibition of cellular RNA
polymerase II transcription by delta antigen of hepatitis delta virus. J Virol 247,
178-88.
Makino, S., Chang, M. F., Shieh, C. K., Kamahora, T., Vannier, D. M.,
Govindarajan, S., and Lai, M. M. C. (1987). Molecular cloning and sequencing of
a human hepatitis delta vims RNA. Nature 329, 343-6.
Modahl, L. E., and Lai, M. M. C. (1998). Transcription of hepatitis delta antigen
mRNA continues throughout hepatitis delta vims (HDV) replication: a new model
of HDV replication and transcription. J Virol 72, 5449-56.
Nakabayashi, H„ Taketa, K., Miyano, K., Yamane, T., and Sato, J. (1982). Growth
of human hepatoma cell lines with differentiated function in chemically defined
medium. Cancer Res 42, 3858-3863.
Pohl, C., Baroudy, B. M., Bergmann, K. F., Cote, P. J., Purcell, R. H., Hoofnagle,
J., and Gerin, J. L. (1987). A human monoclonal antibody that recognizes viral
polypeptides and in vitro translation products of the genome of the hepatitis D
vims. J Infect Dis 156, 622-9.
Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989). Molecular cloning (Cold
Spring Harbor, NY: Cold Spring Harbor Press).
Wang, E. H., andTjian, R. (1994). Promoter-selective transcriptional defect in cell
cycle mutant tsl3 rescued by hTAFn250. Science 263, 811-4.
Wang, H. W., Wu, H. L., Chen, D. S., and Chen, P. J. (1997). Identification of the
functional regions required for hepatitis D vims replicaiton and transcription by
linker-scanning mutagenesis of viral genome. Virology 239, 119-31.
Xia, Y. P., and Lai, M. M. C. (1992). Oligomerization of hepatitis delta antigen is
required for both the mmy-activating and fra/w-dominant inhibitory activities of
the delta antigen. J Virol 66, 6641-8.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 5
Chapter 5
A New Model for HDV Transcription and Replication
5.1. Introduction
In this dissertation, I have provided evidence which contradicts the currently
accepted model for HDV transcription and replication. According to the accepted
model, the cellular enzymatic machineries which carry out synthesis of the three
HDV RNA species— genome, antigenome, and mRNA— are presumed to be the
same; production of the 1.7-kb antigenome differs from the other two only in that
its production requires HDAg-mediated suppression of polyadenylation of the 0.8-
kb mRNA (Hsieh and Taylor, 1991; Hsieh et al., 1994). However, by examining
the synthesis of each of these species in a cDNA-free transfection system (Modahl
and Lai, 1998), I found that the metabolic requirements for genome, antigenome
and mRNA synthesis differ.
In my first study (Chapter 2), I found that S-HDAg does not inhibit synthesis
of the 0.8-kb HDAg mRNA in HDV RNA transfected cells, as was predicted by
earlier studies using a cDNA transfection system (Hsieh and Taylor, 1991; Hsieh
etal., 1994). This suggested that synthesis of the 1.7-kb antigenome may involve
195
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 5
regulatory mechanisms which extend further than the suppression of the 0.8-kb
polyadenylation site by HDAg.
In agreement with this hypothesis, I then found that synthesis of the 0.8-kb
mRNA and synthesis of the 1.7-kb antigenome are differentially sensitive to
inhibition by a-amanitin (Chapter 3). This finding supports the notion that pol II
carries out transcription of the 0.8-kb mRNA, but contradicts the hypothesis that
pol II also carries out synthesis of the 1.7-kb antigenome. Further, the 1.7-kb
antigenome was sensitive to a-amanitin before synthesis of new S-HDAg
occurred, suggesting that inhibition of new 0.8-kb mRNA synthesis prevents
replication. Extending this finding, I demonstrated that 0.8-kb mRNA
transcription successfully occurs with a limited source of S-HDAg (provided by
transfection of a S-HDAg-encoding mRNA), whereas synthesis of the 1.7-kb
antigenome does not occur under this condition. These data support the
hypothesis that, rather than using near-identical RNA synthesis machineries, the
0.8-kb mRNA and the 1.7-kb antigenome likely employ machineries which differ.
Differential regulation of the synthesis of the genome and the antigenome was
also demonstrated (Chapter 4). As was previously shown by others (Chao et al.,
1990; Glenn and White, 1991; Hwang and Lai, 1994), genomic RNA synthesis is
highly sensitive to the presence of L-HDAg. However, I demonstrated that
antigenomic RNA synthesis, including synthesis of both the 1.7-kb antigenome
and the 0.8-kb mRNA, are only modestly inhibited by the presence of L-HDAg,
even in amounts equal to the level of S-HDAg. Moreover, unlike antigenomic
RNA synthesis, genomic RNA synthesis was very sensitive to inhibition by a-
—
permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 5
amanitin. Thus it appears that syrfthesis of the genome and antigenome have
different metabolic requirements as well.
Together, these data make a strong case that the current model of HDV
transcription and replication is inadequate in its delineation of genome, antigenome,
and mRNA synthesis. However, these findings present some difficult questions
when attempting to build a new model for HDV transcription and replication. The
major difficulty is that the three RNA species do not appear to fall into discrete
regulatory groups. Genomic RNA and mRNA synthesis are sensitive to inhibition
by a-amanitin, whereas antigenome synthesis is not. On the other hand, only
genomic RNA synthesis is highly sensitive to inhibition by L-HDAg, and mRNA
and antigenomic RNA are only modestly sensitive. While these basic findings are
difficult to reconcile, a more detailed look at the data presented in this dissertation,
combined with a closer look at data provided by others in the field, reveals some
consistent findings which suggest a molecular mechanism which may tie these new
findings together into a comprehensive new model of HDV transcription and
replication.
197
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 5
5.2 Trans-Activation of HDAg mRNA Synthesis and trans-
Activation of 1.7-kb Antigenome Synthesis: Two Distinct Roles
for S-HDAg
To put the pieces of this complex puzzle together in an orderly fashion, I will
start by considering a central finding in my research, and extend my reasoning
from there. In Chapter 3 ,1 demonstrated by two means that synthesis of the 0.8-
kb mRNA occurs in the presence of limited amounts of S-HDAg, while synthesis
of the 1.7-kb antigenome requires de novo synthesis of S-HDAg, after the 0.8-kb
mRNA has been produced. This was seen most clearly in the failure of 1.7-kb
antigenomic RNA to be synthesized when the transfected genome contained a
defective open reading frame for S-HDAg. The sensitivity of 1.7-kb antigenome
synthesis to a-amanitin at early time points supports this finding. Others have also
found that an intact open reading frame is required for subsequent full-length
antigenome synthesis to occur (Dingle et al., 1998). At first glance, this appears to
be due to a difference of amount of S-HDAg; small amounts of S-HDAg are
sufficient to support mRNA transcription, but larger amounts are required to
support antigenome synthesis. This may be true. Indeed, when genomic RNA
which contains a defective open reading frame for S-HDAg is transfected into cells
which stably express S-HDAg, abundant antigenome synthesis is observed
(Chapter 4).
However, there may be other differences in S-HDAg in the context of mRNA
transcription and antigenome synthesis which are more significant than the
absolute amount of S-HDAg in the cell. In considering the various scenarios
198
of the copyright owner. Further reproduction prohibited without permission.
Chapter 5
under which mRNA synthesis or antigenome synthesis are favored, the data seem
to suggest that the mechanism behind such a difference may be related to the ratio
of S-HDAg to genomic RNA (Figure 1). There are two sources of S-HDAg in
transfection systems (and in infection): 1) S-HDAg produced by transfected
mRNA (or provided by transfected RNP or viral RNP) which enters the nucleus
bound to genomic RNA, and 2) S-HDAg which enters after translation of newly
synthesized 0.8-kb mRNA, free of genomic RNA. This difference is most obvious
in the cases of RNP transfection and infection by HDV virions, but is likely to be
true of the RNA transfection system as well, since the amount of S-HDAg
provided by transfected mRNA is very low, and transfected genomic RNA largely
degrades by day 2 post-transfection.1 Since the absence of new S-HDAg
synthesis results in the isolated synthesis of 0.8-kb mRNA, we can consider that
S-HDAg which enters the nucleus bound to HDV genomic RNA preferentially
transcribes HDAg mRNA. Conversely, if antigenome synthesis requires de novo
translated S-HDAg, we may consider the possibility that S-HDAg which enters the
nucleus in the unbound to the HDV genome will preferentially synthesize
antigenomic RNA (from template already present in the nucleus) rather than 0.8-kb
mRNA.
1 An exception to this is when antigenomic HDV RNA is transfected into cells with S-HDAg
mRNA. In this case, genomic strand synthesis occurs. However, for unknown reasons, the
amount of S-HDAg provided by the transfected mRNA exceeds (by about 10 fold, as estimated by
western blot) the amount of S-HDAg provided by the mRNA when transfected with genomic-
sense RNA.
199
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 5
Figure 1. The sources of S-HDAg which enter the nucleus. (A) S-HDAg
provided by RNA transfection, RNP transfection, and virus infection enters the
nucleus bound to HDV RNA. (B) S-HDAg provided by de novo HDAg mRNA
transcription, either from an RNA or a DNA temlate, enters the nucleus free of
genomic RNA. The S-HDAg which enters as in (A) preferentially transcribes the
0.8-kb mRNA from the genomic template, while the S-HDAg which enters as in
(B) preferentially synthesizes antigenomic RNA from the genomic template.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
RNA transfection
RNP transfection
virus infection
B.
S-HDAg
I
H DV RNA
RNA-templated mRNA
mRNA from integrated cDNA
mRNA from plasmid
S-HDAg
replication
HDAg mRNA
transcription
Chapter 5
If this functional difference does^exist, then we would predict that in systems
where the second source of S-HDAg (S-HDAg free of genomic RNA) dominates,
there would be preferential synthesis of the antigenome over the 0.8-kb mRNA.
This prediction is borne out by two pieces of experimental evidence. The first is
the preferential synthesis of antigenomic RNA over HDAg mRNA in the cDNA-
based transfection system. In this system, genomic and antigenomic RNA do not
appear in the cytoplasm (except, perhaps, during cell division), since the plasmid
encoding the HDV RNA genome enters the nucleus prior to HDV RNA synthesis.
New S-HDAg, provided by HDAg mRNA synthesis from either the RNA genome
or from cryptic promoters within the cDNA, enters the nucleus unbound to
genomic RNA (Figure 1, B). This transfection system produces very little HDAg
mRNA, to the point of it being nearly impossible to detect; however, antigenomic
synthesis is abundant (see Chapter 2, Figure 1). A second example is in natural
infection, when the genome is delivered to the nucleus by S-HDAg present in the
viral RNP (Figure 1, A), and subsequently translated S-HDAg from de novo
transcribed HDAg mRNA enters the nucleus in the absence of bound genomic
HDV RNA (Figure 1 , B). In infected woodchuck liver, HDAg mRNA has been
estimated to be 600 times less abundant than genomic RNA (Hsieh et al., 1990),
and about 50 times less abundant than genomic RNA (Chen et al., 1986). In
contrast, when genomic RNA and mRNA which encodes S-HDAg are
cotransfected into cells, the HDAg mRNA is only 3 times less abundant than 1.7-
kb antigenomic RNA (see Chapter 2, Figure 4A) (Modahl and Lai, 1998). In this
scenario, it is likely that multiple genomes enter the nucleus of each transfected cell,
202
of the copyright owner. Further reproduction prohibited without permission.
Chapter 5
each transported by some amount of S-HDAg; as such, there is abundant mRNA
transcription relative to antigenomic RNA synthesis. Another example of abundant
0.8-kb mRNA transcription is when genome is transfected into cells which stably
express S-HDAg; again, multiple copies of S-HDAg-bound genomes likely enter
the nucleus in this case as well (see Chapter 4, Figure 4B). Thus, in two systems
where very limited amounts of S-HDAg enters the nucleus bound to genomic
RNA, there is limited mRNA transcription relative to antigenomic RNA synthesis.
In two systems where more S-HDAg enters the nucleus bound to genome,
abundant mRNA synthesis occurs.
5.3 A Proposed Molecular Mechanism for the Differential
Activation of mRNA versus Antigenomic RNA Synthesis by S-
HDAg
What could be the mechanism for such a difference in S-HDAg function,
depending on whether S-HDAg is previously bound to the genome? One
possibility is that S-HDAg performs multiple roles in the synthesis of HDV RNA.
In the case of S-HDAg previously bound to the HDV genome, S-HDAg may act
as an activator, recruiting pol II transcriptional machinery to the genome for mRNA
synthesis, much as VP 16 enhances recruitment of TFTED, TFIIA, and the pol II
holoenzyme (Ranish et al., 1999). Very little S-HDAg might be required for such
a function, and S-HDAg competent to perform this role might be recycled many
times. However, when more abundant amounts of S-HDAg enter the nucleus in
the absence of genome binding, this form of S-HDAg may become part of a
203
permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 5
modified form of IhliD, or a modified holoenzyme which is subsequently
recruited to the HDV genome (Chang and Jaehning, 1997); this transcriptional
complex would not direct mRNA synthesis, but rather antigenome synthesis.
Alternatively, S-HDAg which entered the nucleus unbound to genomic RNA may
bind first to the HDV genome, but activate the recruitment of RNA synthetic
machinery which is specific for antigenome synthesis (Chang and Jaehning, 1997).
A functional difference in S-HDAg entering the nucleus by these two modes
may be manifested in ways that are measurable. For example, these two
hypothetical forms of S-HDAg may direct the HDV genome to discrete locations.
This possibility is suggested by the ability of HDV RNA to dramatically alter the
nuclear distribution of S-HDAg (Bichko and Taylor, 1996). When S-HDAg is
present alone, it accumulates only in the nucleolus. However, when the HDV
genome is present, S-HDAg is found throughout the nucleoplasm as well as in the
nucleolus (Bichko and Taylor, 1996; Cullen et al., 1995; Cunha et al., 1998).
Indeed, if the HDAg mRNA, the genome, and the antigenome are all synthesized
by pol n, one would expect that the various factors recruited to the HDV template
for synthesis of each RNA species might differ (Neugebauer and Roth, 1997).
For example, HDAg mRNA synthesis requires polyadenylation factors (Hsieh et
al., 1990) and possibly capping enzyme. Antigenomic and genomic RNA
synthesis, on the other hand, do not require capping enzyme or polyadenlylation
machinery (though both may be present), but may require the presence of other
cellular factors (possibly splicing factors) for efficient ribozyme activity (Lazinski
and Taylor, 1995). In support of this, the polypyrimidine tract binding protein
204
of the copyright owner. Further reproduction prohibited without permission.
Chapter 5
(PTB) has been found to bind to the genomic ribozyme domain (Ku and Lai,
unpublished data), and HeLa cell extract enhances ribozyme activity in vitro
(Daniel and Lai, unpublished data). With increasing evidence that mRNA
transcription and processing may be part of the same functional unit (Neugebauer
and Roth, 1997), one might imagine that very different processing units might
evolve for the efficient transcription of the HDAg mRNA and the synthesis of
genomic and antigenomic RNA.
Differences in the nature of the transcriptional processing units may be
reflected in differential nuclear localization for each activity. In light of the recent
view that discrete morphological ‘locations’ in the nucleus, such as the nucleolus
and SC35-associated speckles, are actually a result of transcriptional activity rather
than a cause (Singer and Green, 1997), such a determination would support the
view that synthesis of the 0.8-kb mRNA and synthesis of the antigenome are
metabolically distinct. Differential localization (if it exists) could be detected by
examination of the difference between S-HDAg localization during isolated HDAg
mRNA synthesis (transfection of S-HDAg-incompetent genome and S-HDAg
mRNA) and localization during simultaneous mRNA and antigenome synthesis
(transfection of wild-type genome and S-HDAg mRNA), via immunofluorescent
staining of S-HDAg.
The determination of differential localization would, however, only be a
demonstration of a manifestation of metabolic differences between mRNA
synthesis and antigenome synthesis. This would not reveal the causative
mechanism behind a functional difference between S-HDAg which enters the
205
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 5
nucleus bound to the HDV genome, and S-HDAg which enters unbound to the
HDV genome. Such a difference would likely lie in a direct modification of S-
HDAg. Phosphorylation is a dynamic modification of proteins which can
dramatically alter their function. S-HDAg is known to be phosphorylated, and the
phosphorylation state has been shown to differentially affect replication, nuclear
import, and virus-like particle assembly (Yeh et al., 1996). However, these findings
have not proven definitive. Another potential modification, which may occur in
addition to or instead of phosphorylation, is the addition of O-linked N-
acetylglucosamine (GlcNAc) sugar moieties to serine and threonine residues in S-
HDAg (for which S-HDAg is an excellent candidate— see below). It has not been
determined whether HDAg is modified by addition of this sugar moiety. This is a
particularly intriguing possibility for a number of reasons. First, there is
increasing evidence that O-linked GlcNAc may play a critical role in transcriptional
regulation (Hart, 1997). As such, various transcription factors, viral, heat-shock,
tumor suppresser, and nuclearoncogenic proteins, and the carboxy terminal domain
of the catalytic subunit of pol n, have been found to be modified in this way (Hart,
1997). O-linked GlcNAc addition is often found in phosphoproteins which form
highly structured— but reversible— homo- and hetero-oligomers, and is thought to
modulate protein-protein interactions among these proteins (Hart, 1997). For
example, removal of this moiety has been shown to promote Spl binding to
TF110, and it has been proposed that such removal may be a signal for protein
association (Roos et al., 1997). Presence of the sugar group in this model prevents
promiscuous oligomerization of these proteins. The transcription factor c-myc,
—
of the copyright owner. Further reproduction prohibited without permission.
Chapter 5
which, like HDAg, possesses leucine-zipper and helix-loop-helix motifs important
for its dimerization function, has also been shown to be modified by O-linked
GlcNAc addition to threonine 58, located in the transactivation domain (Chou et al.,
1995). Mutation of this residue is frequently found in v-myc and in Burkitt and
AIDS-related lymphomas, and is associated with the increased transforming
activity c-myc. The primary sequence requirements for O-linked glycosylation are
somewhat unpredictable, but typically involve stretches of serine and/or threonine
residues, with nearby proline and/or valine residues (Wilson et al., 1991). This
clustering of residues is common in HDAg. Finally, it has been proposed that O-
linked GlcNAc itself is sufficient for nuclear localization (Duverger et al., 1996).
Many of the nuclear pore proteins themselves possess O-linked GlcNAc, and this
moiety may play a role in the regulation of nuclear/cytoplasmic trafficking (Hart et
al., 1989). The dynamic nature of this modification (like phosphorylation) make
this a possibly fertile area for understanding the regulation of S-HDAg (and, for
that matter, L-HDAg) function.
For the sake of developing a specific and therefore testable model, what might
the role of O-linked glycosylation of S-HDAg play in the determination of mRNA
versus antigenome synthesis? The enzyme responsible for this modification,
UDP-GlcNAc:polypeptide O-GlcNAc transferase, is a membrane associated
protein with its active site located in the cytoplasm (Hart et al., 1989). If there is a
functional difference between HDAg which enters the nucleus bound to the HDV
genome, and HDAg which enters the nucleus unbound to the HDV genome, the
structural modification which may confer this difference is the differential O-linked
—
of the copyright owner. Further reproduction prohibited without permission.
Chapter 5
glycosylation of HDAg bound to HDV RNA over HDAg which is not bound to
HDV RNA in the cytoplasm. Such a modification may underlie the ability of
HDAg to transport HDV RNA into the nucleus (Chou et al., 1998; Duverger et al.,
1996). Such a modification would be expected to alter the ability of S-HDAg (and
L-HDAg) to form oligomers. The absence of the sugar moiety may underlie the
tendency of S- and L-HDAg to form extremely stable multimers in vitro, which are
resistant to denaturation (Sheu and Lai, unpublished observation). Binding of the
HDV genome by S-HDAg may promote this modification, or, alternatively, such a
modification may promote a stable interaction between S-HDAg and the genome.
The existence of this modification would be straightforward to establish.
Modification of in vitro translated S-HDAg with glycosidase or
glycosyltransferase treatment can be monitored by lectin-binding (Chou et al.,
1995), and purified S-HDAg modified by such means could be assayed for
biological activity by RNP transfection and Northern and Western blot analysis.
5.4 The Role of L-HDAg in the Differential trans-Activation of
HDAg mRNA Synthesis and HDV Replication
How could a modification such as glycosylation explain the findings I have
presented in the previous chapters? In my studies of the effect of L-HDAg on
mRNA, genomic RNA, and antigenomic RNA synthesis, I found that increasing
amounts of L-HDAg only modestly inhibit synthesis of the 0.8-kb mRNA and the
1.7-kb antigenome. This is in contrast to previous findings, which demonstrate
that very little L-HDAg relative to S-HDAg can almost completely inhibit
_ _
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 5
replication of both the genome and the antigenome (Chao et al., 1990; Glenn and
White, 1991) . The proposed mechanism for inhibition of HDV RNA synthesis
by L-HDAg hints at the possibility that there may be a structural and functional
difference between S-HDAg which supports mRNA transcription, and S-HDAg
which supports antigenomic or genomic RNA synthesis. In this section, I will
focus on the difference between 0.8-kb mRNA transcription, and 1.7-kb genomic
RNA synthesis. 1.7-kb antigenome synthesis will be discussed in the next section.
Based on findings from numerous studies of the role of S-HDAg
oligomerization in genomic RNA synthesis, L-HDAg has been proposed to inhibit
replication by disrupting highly ordered, homogeneous oligomerization of S-
HDAg (Chao et al., 1990; Glenn and White, 1991; Hwang and Lai, 1994; Lazinski
and Taylor, 1993; Xia and Lai, 1992). My data support this hypothesis (for
genomic RNA synthesis), since I also found that L-HDAg potently inhibits
genomic RNA synthesis in the RNA transfection system. Therefore, the resistance
of mRNA synthesis to L-HDAg begs two obvious questions: 1) is highly ordered,
homogeneous oligomerization of S-HDAg— identical to that required for genomic
RNA synthesis— required for 0.8-kb mRNA synthesis, and 2) if oligomerization is
required for mRNA synthesis, why isn’t this oligomerization sensitive to
disruption by L-HDAg the way that the oligomers putatively required for genomic
RNA synthesis are?
If we consider these questions in light of the possible mechanisms for
recruitment of transcriptional machinery to the HDV RNA template, one could
envision that in the case of replication, homogeneous oligomers of S-HDAg—
_
of the copyright owner. Further reproduction prohibited without permission.
Chapter 5
formed in the absence of HDV RNA binding and thereby escaping glycosylation
in the cytoplasm— may be strictly required for recruitment of transcriptional
machinery to an antigenomic RNA template for genome synthesis (Figure 2). The
presence of L-HDAg, which also entered the nucleus unbound to genomic RNA
(thereby avoiding glycosylation), would inhibit the formation of such an oligomer
by forming hetero-oligomers with S-HDAg, and genomic RNA synthesis would
not occur— ultimately due to a failure to recruit the appropriate transcriptional
machinery (Figure 2, A). In the original studies of the role of L-HDAg using a
cDNA transfection system, the S-HDAg and L-HDAG supplied in trans would
certainly follow this model (Chao et al., 1990; Glenn and White, 1991). In the
RNA transfection system there is some confusion, since genomic RNA synthesis
occurs. However, unlike when HDAg mRNA is transfected with genomic-sense
RNA, abundant S- and L-HDAg is provided by the transfected mRNA when it is
cotransfected with antigenomic RNA. The mechanism is unclear, but may involve
differences in the ability of the genome versus the antigenome to hybridize with the
transfected mRNA. In the case of genomic RNA, more hybrids would be expected
to form, thereby reducing the availability of mRNA template for translation— either
by steric hindrance or increased degradation of the double-stranded RNA by
cellular RNases. It is therefore possible that while some S-HDAg enters the
nucleus bound to the antigenomic RNA, S-HDAg also enters the nucleus free of
antigenomic RNA, thereby facilitating replication. If so, the same might be true of
L-HDAg, thus inhibiting synthesis of the genomic RNA. Clarifying these points
will require further experimentation.
210
of the copyright owner. Further reproduction prohibited without permission.
Chapter 5
Figure 2. Proposed mechanism for the role of L-HDAg in mRNA versus
antigenomic RNA synthesis. (A) L-HDAg synthesized within the infected cell
may inhibit replication of HDV RNA by forming hetero-oligomers with S-HDAg,
thereby disrupting the homo-oligomerization of S-HDAg required for trans-
activation of HDV RNA replication. (B) When L-HDAg intially enters the cell in
a complex with S-HDAg and the HDV genome, L-HDAg (and S-HDAg) may be
glycosylated or otherwise structurally distinct from HDAg newly synthesized
within the infected cell, and therefore fail to form oligomers. Oligomerization of S-
HDAg may not be required for HDAg mRNA synthesis; in such a scenario, L-
HDAg may not interfere with the fro/w-activation of transcription of 0.8-kb HDAg
mRNA by S-HDAg.
211
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
S-HDAg
S-H D A g-S-H D A g
replication
S-H D Ag-S-H D A g
S-H D A g-S-H D A g
nucleus
HDAg mRNA
transcription
O-linked
GlcNAc
O-linked
GlcNAc
S-HDAg L-HDAg
HDV RNA
212
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 5
Synthesis of the HDAg mRNA in the cases of transfected RNP, RNA transfection
(genomic RNA and HDAg mRNA), and viral RNP would not be expected to be
inhibited by L-HDAg according to my model, since S-HDAg (and L-HDAg, if
present) is bound to the genome in the cytoplasm, and therefore would be
glycosylated in order to transport the genome across the nuclear pore (Figure 2,
B). The functional organization of S-HDAg in this case may not involve extensive
homogeneous oligomerization, and thus would be resistant to disruption by L-
HDAg. Antigenomic strand synthesis would occur after newly synthesized S-
HDAg translated from the de novo transcribed 0.8-kb entered the nucleus without
glycosylation. The mechanism of antigenome synthesis will be discussed in the
next section.
Interestingly, there is no information regarding the potential role of S-HDAg
oligomerization in 0.8-kb mRNA synthesis, primarily because earlier studies
typically examined genomic RNA synthesis in cDNA transfection studies; often
this was done with an HDV construct which was defective in S-HDAg synthesis,
where the only S-HDAg was supplied in trans (Chao et al„ 1990; Glenn and
White, 1991). The requirement for S-HDAg oligomerization in HDAg mRNA
synthesis could be evaluated by transfecting genomic RNA with mRNA encoding
oligomerization-defective mutants of S-HDAg.
213
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 5
5.5 Synthesis of the Antigenome: the Role of Oligomerization
and Regulation by L-HDAg
In my discussion thus far, I have glossed over one particularly difficult
question— that is the differential sensitivity of antigenomic and genomic RNA to
inhibition by L-HDAg. Thus far, my model proposes that highly organized S-
HDAg oligomers are required for HDV replication. This would predict that L-
HDAg would inhibit antigenome synthesis as well as genome synthesis. I believe
there are two possible explanations for this finding. The first is that antigenomic
RNA synthesis really is sensitive to inhibition by L-HDAg, and the nature of the
system I used to evaluate the role of L-HDAg cannot detect this inhibition. The
second explanation is that the transcriptional machinery for genomic RNA and
antigenomic RNA is structurally different, and L-HDAg does not inhibit synthesis
of antigenomic RNA because the requirement for S-HDAg (and the nature of the
oligomers) is also different.
First, I will consider the possibility that the system I used to evaluate the role of
L-HDAg in antigenomic RNA synthesis cannot detect inhibition by L-HDAg, even
if this may be a true role for L-HDAg. According to my model, S- and L-HDAg,
provided by cotransfection of their respective mRNAs with genomic RNA, would
both bind to the transfected genome and enter the nucleus in glycosylated form.
Subsequent mRNA synthesis would ensue (by the mechanism described in the
previous section), and new S-HDAg then translated. The first possibility is that
translation of S-HDAg from the 0.8-kb mRNA may occur in a location distinct
— -
permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 5
from that of the originally transfected mRNAs. This possibility is supported by
the finding that when HDV genomic RNA is transfected with plasmid encoding S-
HDAg, no replication occurs— presumably due to a failure of the newly translated
S-HDAg to colocalize with the HDV genome in the cytoplasm (Hwang et al„
1995). The second is that the transfected mRNA may only be translated for a
short time after tranfection. Indeed, analysis by western blot indicates that the
amount of HDAg produced from transfected mRNA does not increase from day 1
to day 2, and subsequently begins to decline, often to become undetectable by day
3 post-transfection (Modahl and Lai, unpublished observation). Abundant de
novo-synthesized S-HDAg appears at day 3 (see Chapter 2, Figure 4B). This
second explanation is somewhat more likely, since the transfection of L-HDAg
mRNA into cells which stably express S-HDAg (see Chapter 4, Figure 4A)
successfully inhibits genomic RNA synthesis (i.e. transfected mRNA-encoded L-
HDAg and endogenously expressed S-HDAg appear to find each other in this
case; however, the processing of RNA-templated 0.8-kb mRNA may be different
than cDNA-templated mRNA).
Regardless of the mechanism, if the end result is that essentially all the L-
HDAg provided by mRNA transfection with genomic RNA into cells is incapable
of forming oligomers (perhaps due to glycosylation), newly synthesized S-HDAg
may not encounter L-HDAg which is in a form that is capable of forming hetero
oligomers with S-HDAg. Thus active S-HDAg oligomers could form in the
cytoplasm without interacting with L-HDAg, be transported to the nucleus, and
support replication without perturbation by L-HDAg. Thus, according to this
— -
of the copyright owner. Further reproduction prohibited without permission.
Chapter 5
analysis, the observation that L-HDAg does not potently inhibit antigenomic RNA
synthesis may be a result the system used to analyze the effect of L-HDAg
replication. On the other hand, the differential sensitivity of genomic RNA and
antigenomic RNA synthesis to L-HDAg in cells which stably express S-HDAg
suggests that there may be an essential difference in the sensitivity of antigenomic
and genomic RNA syntheis to L-HDAg. One way to test the sensitivity of
antigenomic RNA synthesis to the presence of L-HDAg is to examine whether the
synthesis of the antigenome in cells which stably express L-HDAg can be restored
by transfecting mRNA which expresses S-HDAg. Since L-HDAg is continuously
translated in such cells, it is unlikely that antigenome synthesis could be restored
by S-HDAg if L-HDAg does indeed inhibit antigenome synthesis as potently as it
does genome synthesis.
The second possible explanation for my finding that L-HDAg does not
potently inhibit antigenome synthesis is that there is an essential structural
difference in the RNA synthesis machinery which produces antigenomic RNA and
that which produces genomic RNA. In this scenario, S-HDAg which is capable of
frans-activating antigenomic RNA synthesis may be resistant to disruption by L-
HDAg, due to an interaction which either tolerates or excludes the presence of L-
HDAg. This more radical explanation of the difference in sensitivity between
genomic and antigenomic RNA synthesis to L-HDAg is supported by the finding
that the genome and antigenome are also differentially sensitive to a-amanitin. The
underlying cause for the differential sensitivity of genomic and antigenomic RNA
synthesis to a-amanitin has not been determined. However, one of two
of the copyright owner. Further reproduction prohibited without permission.
Chapter 5
explanations is likely: either antigenomic RNA synthesis is metabolically different
from genomic RNA synthesis (i.e., antigenomic RNA is not synthesized by pol II,
whereas genomic RNA synthesis is), or the structure of the metabolic machinery
required for the synthesis of these two RNA species (either by morphology or by
sequestration) is different, such that pol II which is synthesizing antigenomic RNA
is resistant to a-amanitin. In either case, it is likely that, just as the metabolic
requirements for mRNA and genomic RNA synthesis differ, the metabolic
requirements for the synthesis of genomic and antigenomic RNA differ.
The determination of the primary enzyme which carries out synthesis of the
1.7-kb antigenome will require further testing of RNA polymerase inhibitors.
DRB can be used to confirm the a-amanitin resistance of antigenomic RNA
synthesis, while tagetitoxin and higher doses of a-amanitin can be used to evaluate
the potential role of pol HI in antigenomic RNA synthesis. Testing these
inhibitors, however, will require the development of an adequate in vitro labeling
system, such as Br-UTP labeling of permeabilized cells or nuclear run-on assay,
since the expense and the toxicity of the above drugs prevent use in cell culture.
The possibility that antigenome synthesis is sequestered should also be
considered. For example, antigenome synthesis may occur in the nucleolus, or in
nucleoli-like structures. Indeed, the synthesis of antigenomic RNA itself may
induce formation of such a structure, just as pol I transcription is thought to induce
nucleolus formation (Singer and Green, 1997). These possibilities will require
further experimentation.
217
of the copyright owner. Further reproduction prohibited without permission.
Chapter 5
5.6 A New Model for HDV Transcription and Replication
The above discussion leads to the formulation of a backbone for a new model
for HDV transcription and replication (Figure 3). Rather than a single
transcription machinery responsible for the synthesis of all three HDV RNA
species, I propose that there are three distinct machineries--one for HDAg mRNA
transcription (Figure 3, A), one for HDV genomic RNA synthesis (Figure 3, B),
and one for antigenomic RNA synthesis (Figure 3, C). I hypothesize that these
differences may be manifested by differential localization of the three HDV-RNA
synthetic events within the nucleus. The underlying mechanism behind the
development of these three transcriptional machineries, I believe, lies in the
differential modification of S-HDAg in the cytoplasm. This modification may be
driven by whether S-HDAg must transport HDV RNA into the nucleus (in which
case a modification such as O-linked GlcNAc addition may occur) or whether S-
HDAg may enter the nucleus free of HDV RNA (in which case a modification
such as O-linked GlcNAc addition may not occur). The presence or absence of
such a modification results in the distinct functional organization of S-HDAg for
mRNA synthesis versus replication. The nature of the binding of these forms of
S-HDAg to the genome and the antigenome determines the nature of the
transcriptional machinery recruited to the HDV template, and thereby determines
which RNA species is (or is not) syntheisized.
The a-amanitin studies of genomic and mRNA synthesis indicated that both
are sensitive to low amounts of a-amanitin. Thus both of these species appear to
be synthesized by cellular RNA pol II. Thus, despite the difference in sensitivity to
218
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 5
L-HDAg, I envision these two synthetic events to be part of the same ‘factory’,
where pol II-transcribed genome is passed on to pol II transcription complexes
specific for mRNA synthesis. According to my model thus far, the concentration
of mRNA-specific transcription complexes would be limited by the amount of S-
HDAg originally entering the nucleus bound to genomic HDV RNA. As the
amount of S-HDAg increased (due to cytoplasmic production of new S-HDAg in
the absence of HDV genome), the number of genomic-RNA specific transcription
complexes would preferentially rise, increasing the amount of genomic RNA
synthesized relative to the amount of mRNA synthesized.
This model is testable, by the means suggested in this chapter. If found to be
accurate, it may explain many of the puzzling findings in HDV replication that have
accumulated over the years. These include the paucity of the 0.8-kb mRNA in
HDV cDNA transfected cells and in natural infection, the requirement for newly
synthesized S-HDAg for 1.7-kb antigenome synthesis, and, most significantly, the
ability of the HDV virion to establish the replication in the presence of both S- and
L-HDAg.
A central question emanating from my research which remains out in the cold,
however, concerns the mechanism of antigenomic RNA synthesis. It is still
unclear what molecular mechanism lies behind the antigenome’s insensitivity to a-
amanitin and the presence of L-HDAg, relative to the extreme sensitivity
demonstrated for the genome. This question is joined by several others, though,
which have long been begging for entrance into a comprehensive model for HDV
219
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 5
Figure 3. A new model for HDV transcription and replication. Three
distinct transcription machineries for the synthesis of HDAg mRNA (A), HDV
genomic RNA (B), and HDV antigenomic RNA (C). (A) L-HDAg does not
interfere with HDAg mRNA synthesis, possibly because S-HDAg oligomerization
does not play a role in this step of the HDV replication cycle. HDAg mRNA
synthesis is likely mediated by cellular RNA pol II in the nucleoplasm. (B)
Synthesis of the HDV genomic RNA does not tolerate the presence of L-HDAg,
which interferes with the proper oligomerization of S-HDAg required for genomic
strand synthesis. This step is also likely carried out by cellular RNA pol II in the
nucleoplasm. (C) Synthesis of the HDV antigenomic RNA is tolerant of the
presence of L-HDAg, and therefore may not depend on oligomerization of S-
HDAg. Antigenomic RNA synthesis may not be carried out by cellular RNA pol
n, and may occur in the nucleolus rather than in the nucleoplasm.
220
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Reproduced with permission o f th e copyright owner. Further reproduction prohibited without permission.
A.
0
no oligomerization
L-HDAg permissive
pol ll-mediated
nucleoplasmic
0.8 kb — — A A A A A A A
H D A g
0.8-kb m RNA
to
to
B.
oligomerization
L-HDAg intolerant
pol ll-mediated
nucleoplasmic
oligomerization?
L-HDAg permissive
not pol ll-mediated?
nucleolar?
I
rlbozyme
cleavage
I
rlbozyme
cleavage
1.7-kb genome
1.7-kb antigenome
Chapter 5
transcription and replication. For example, it is still unknown how genomic RNA
is selectively incorporated into the mature virion, or how the proportion of genomes
which encode L-HDAg is kept low enough that the virus does not extinguish itself.
Can this species replicate? The list goes on. Somewhat regretfully, I leave these
and other questions to be answered by others.
222
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 5
5.7 References
Bichko, V. V., and Taylor, J. M. (1996). Redistribution of the delta antigens in
cells replicating the genome of hepatitis delta virus. J Virol 70, 8064-70.
Chang, M., and Jaehning, J. A. (1997). A multiplicity of mediators: alternative
forms of transcription complexes communicate with transcriptional regulators.
Nucleic Acids Research 25,4861-5.
Chao, M., Hsieh, S. Y., and Taylor, J. (1990). Role of two forms of hepatitis delta
virus antigen: evidence for a mechanism of self-limiting genome replication. J
Virol 64, 5066-9.
Chen, P. J., Kalpana, G., Goldberg, J., Mason, W., Werner, B., Gerin, J. L., and
Taylor, J. (1986). Structure and replication of the genome of hepatitis delta vims.
Proc Natl Acad Sci USA 83, 8774-8.
Chou, H. C., Hsieh, T. Y., Sheu, G. T., and Lai, M. M. C. (1998). Hepatitis delta
antigen mediates the nuclear import of hepatitis delta vims RNA. J Virol 72, 3684-
90.
Chou, T. Y„ Dang, C. V., and Hart, G. W. (1995). Glycosylation of the c-Myc
transactivation domain. Proc Natl Acad Sci USA 92,4417-21.
Chou, T. Y„ Hart, G. W., and Dang, C. V. (1995). c-Myc is glycosylated at
threonine 58, a known phosphorylation site and a mutational hot spot in
lymphomas. Journal of Biological Chemistry 270, 18961-5.
Cullen, J. M., David, C., Wang, J. G., Becherer, P., and Lemon, S. M. (1995).
Subcellular distribution of large and small hepatitis delta antigen in hepatocytes of
hepatitis delta vims superinfected woodchucks. Hepatology 22, 1090-1100.
Cunha, C., Monjardino, J., Chang, D., Krause, S., and Carmo-Fonseca, M. (1998).
Localization of hepatitis delta vims RNA in the nucleus of human cells. Rna 4,
680-93.
Dingle, K., Bichko, V., Zuccola, H., Hogle, J., and Taylor, J. (1998). Initiation of
hepatitis delta vims genome replication. J Virol 72,4783-8.
Duverger, E., Roche, A. C., and Monsigny, M. (1996). N-acetylglucosamine-
dependent nuclear import of neoglycoproteins. Glycobiology 6, 381 -6.
223
of the copyright owner. Further reproduction prohibited without permission.
Chapter 5
Glenn, J. S., and White, J. M. £1991). Trans-dominant inhibition of human
hepatitis delta virus genome replication. J Virol, 2357-61.
Hart, G. W. (1997). Dynamic O-linked glycosylation of nuclear and cytoskeletal
proteins. Annual Review of Biochemistry 66, 315-35.
Hart, G. W„ Haltiwanger, R. S., Holt, G. D., and Kelly, W. G. (1989).
Nucleoplasmic and cytoplasmic glycoproteins. Ciba Found Symp 145, 112-8.
Hsieh, S. Y., Chao, M., Coates, L., and Taylor, J. (1990). Hepatitis delta virus
genome replication: a polyadenylated mRNA for delta antigen. J Virol 64, 3192-8.
Hsieh, S. Y., and Taylor, J. M. (1991). Regulation of polyadenylation of hepatitis
delta virus antigenomic RNA. J Virol 65, 6438-46.
Hsieh, S. Y., Yang, P. Y., Ou, J. T., Chu, C. M., and Liaw, Y. F. (1994).
Polyadenylation of the mRNA of hepatitis delta virus is dependent upon the
structure of the nascent RNA and regulated by the small or large delta antigen. Nuc
Acids Res 22, 391-6.
Hwang, S. B., Jeng, K. S., and Lai, M. M. C. (1995). Studies of functional roles of
hepatitis delta antigen in delta vims RNA replication. In The unique hepatitis delta
vims, G. Dinter-Gottlieb, ed. (Austin: R. G. Landes Company), pp. 95-109.
Hwang, S. B., and Lai, M. M. C. (1994). Isoprenylation masks a conformational
epitope and enhances trans-dominant inhibitory function of the large hepatitis delta
antigen. J Virol 68, 2958-64.
Lazinski, D. W., and Taylor, J. M. (1995). Intracellular cleavage and ligation of
hepatitis delta vims genomic RNA: Regulation of ribozyme activity by cis-acting
sequences and host factors. J Virol 69, 1190-1200.
Lazinski, D. W., and Taylor, J. M. (1993). Relating structure to function in the
hepatitis delta vims antigen. J Virol 67, 2672-80.
Modahi, L. E., and Lai, M. M. C. (1998). Transcription of hepatitis delta antigen
mRNA continues throughout hepatitis delta vims (HDV) replication: a new model
of HDV replication and transcription. J Virol 72, 5449-56.
Neugebauer, K. M., and Roth, M. B. (1997). Transcription units as RNA
processing units. Genes and Development 11, 3279-85.
Ranish, J. A., Yudkovsky, N., and Hahn, S. (1999). Intermediates in formation and
activity of the RNA polymerase II preinitiation complex: holoenzyme recmitment
224
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 5
and a postrecruitment role for the TATA box and TFlLB. Genes and Development
13,49-63.
Roos, M. D., Su, K., Baker, J. R., and Kudlow, J. E. (1997). O glycosylation of an
Spl-derived peptide blocks known Spl protein interactions. Mol Cell Biol 17,
6472-80.
Singer, R. H., and Green, M. R. (1997). Compartmentalization of eukaryotic gene
expression: causes and effects. Cell 91, 291-4.
Wilson, I. B., Gavel, Y., and von Heijne, G. (1991). Amino acid distributions
around O-linked glycosylation sites. Biochem J 275, 529-34.
Xia, Y. P., and Lai, M. M. C. (1992). Oligomerization of hepatitis delta antigen is
required for both the trans-activating and trans-dominant inhibitory activities of
the delta antigen. J Virol 66,6641-8.
Yeh, T. S., Lo, S. J., Chen, P. J., and Lee, Y. H. W. (1996). Casein kinase II and
protein kinase C modulate hepatitis delta virus RNA replication but not empty viral
particle assembly. J Virol 70, 6190-8.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.

Linked assets

University of Southern California Dissertations and Theses

Conceptually similar

PDF

Cellular factors involved in mouse hepatitis virus replication

PDF

Expression of the RGR opsin and its function in the photic visual cycle

PDF

Identification of oncogenes cooperating in murine mammary tumorigenesis and transgenic mouse models of breast cancer

PDF

Immunogenicity of acute lymphoblastic leukemia: In vivo and in vitro studies of Bcr -Abl specific immune responses

PDF

Functional analysis of MSX2 and its role in skull patterning

PDF

Cloning, characterization, anti -apoptotic molecular mechanism, transgenic and protein binding studies of mouse TOSO gene

PDF

Studies of hepatitis B virus and hepatitis C virus infection

PDF

Characterization of the physiological ligand and function of a novel opsin RGR from the retinal pigment epithelium

PDF

Cloning and characterization of Grb4: A novel adapter protein interacting with BCR -Abl

PDF

RNA viruses and cell membrane: Hepatitis C virus and coronavirus

PDF

Development of replication -competent retroviral vectors for efficient, targeted gene therapy of cancer

PDF

Identification and cloning of developmentally regulated genetic loci in transgenic mice by screening for novel expression pattern of the lacZ reporter gene

PDF

Discovery of a novel role of vasopressin in astrocytes: Vasopressin-induced cytoplasmic and nuclear calcium and kinases signaling cascade and modulation of astrocytes immune function

PDF

Biochemical characterization of hydrogen,potassium-ATPase-rich membranes from the gastric parietal cell

PDF

Breast cancer susceptibility gene 1: A role in transcriptional regulation

PDF

Glutathione reduction and its effects on mitochondrial function and protein degradation: Implications for Parkinson's disease

PDF

Dynamic regulation of vasopressin, a mnemonic neuropeptide, induction of calcium signaling and V1a vasopressin receptors in the rat cerebral cortex

PDF

Structure and functions of hepatitis C virus core protein

PDF

Feline leukemia virus: Disease and its control

PDF

The interactions of host cell proteins with mouse hepatitis virus RNA

Asset Metadata

Creator Modahl, Lucy Elizabeth (author)

Core Title A new model for hepatitis delta virus transcription and replication

School Graduate School

Degree Doctor of Philosophy

Degree Program Molecular Microbiology and Immunology

Publisher University of Southern California (original), University of Southern California. Libraries (digital)

Tag biology, microbiology,biology, molecular,health sciences, pathology,OAI-PMH Harvest

Language English

Contributor Digitized by ProQuest (provenance)

Advisor Lai, Michael M.C. (committee chair), [illegible] (committee member), Tahara, Stanley (committee member)

Permanent Link (DOI) https://doi.org/10.25549/usctheses-c16-132444

Unique identifier UC11328265

Identifier 3041500.pdf (filename),usctheses-c16-132444 (legacy record id)

Legacy Identifier 3041500-0.pdf

Dmrecord 132444

Document Type Dissertation

Rights Modahl, Lucy Elizabeth

Type texts

Source University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Access Conditions The author retains rights to his/her dissertation, thesis or other graduate work according to U.S. copyright law. Electronic access is being provided by the USC Libraries in agreement with the au...

Repository Name University of Southern California Digital Library

Repository Location USC Digital Library, University of Southern California, University Park Campus, Los Angeles, California 90089, USA