University of Southern California Dissertations and Theses

Identification and characterization of PR-Set7 and histone H4 lysine 20 methylation-associated proteins

(USC Thesis Other)

Identification and characterization of PR-Set7 and histone H4 lysine 20 methylation-associated proteins

PDF

Download a page range

Download transcript

Copy asset link

Request this asset

Transcript (if available)

Content
IDENTIFICATION AND CHARACTERIZATION OF PR-SET7 AND HISTONE H4
LYSINE 20 METHYLATION-ASSOCIATED PROTEINS

by

Tanya Magazinnik Spektor

__________________________________________________________________

A Dissertation Presented to the
FACULTY OF THE GRADUATE SCHOOL
UNIVERSITY OF SOUTHERN CALIFORNIA
In Partial Fulfillment of the
Requirements for the Degree
DOCTOR OF PHILOSOPHY
(BIOCHEMISTRY AND MOLECULAR BIOLOGY)

December 2009

Copyright 2009 Tanya Magazinnik Spektor
ii

Dedication
To my parents, Galina and Yuliy Magazinnik …
I am eternally grateful for the love and support you have provided me over the years.
iii

Acknowledgements
So many encouraged me along this journey as a graduate student, and it is a pleasure
to express my gratitude for their support and help.
First and foremost I would like to thank my husband, Slava. Without you I
would not have made it. Your love, patience, and support have guided me through the
tough times and given me strength when I needed it the most. Thank you for being
part of my life.
I would also like to thank my advisor, Dr. Judd Rice for his guidance and
support during these years. Your dedication and passion for science is inspiring and
contagious. Thank you for believing in me and giving me confidence in my scientific
accomplishments.
I would like to thank my committee members, Dr. Ite Laird, Dr. Michael
Stallcup and Dr. Gerry Coetzee for your guidance and help with my projects. Thank
you for always having your door open and welcoming any questions I have, I
appreciate it more then I can convey.
Thank you to all the past and present members of the Rice Lab members for
providing me with your unconditional friendship, scientific discussions, help and for
all the laughs. You guys rock!
Last, but not least, I would like to thank my family and friends. I would like to
thank my parents for their love and support, for raising me and teaching me the right
values, for always being there for me. I love you and am forever grateful to you.

iv

Table of Contents
Dedication
Acknowledgements
Table of Contents
List of Tables
List of Figures
Abstract

Introduction
Chromatin
Histone modifications and Histone modifying enzymes
PR-Set7 and Histone H4 Lysine 20 monomethylation
UBC9 and sumoylation
Lysine Histone Methyl binding proteins

Chapter 1: Identification and Characterization of the PR-Set7
Binding Proteins Using Tandem-tag Immunoaffinity
Purification (IAP) Methodology
Engineering of tandem-tag PR-Set7 and establishing a stable
cell line
Gel filtration chromatography of PR-Set7 indicates that it is a
part of a ~600kDa multi-protein complex
IAP and identification of PR-Set7 associated proteins by Mass
Spectrometry
PR-Set7 interacts with key components of the DNA damage
repair machinery
Summary, discussion and future directions

Chapter 2: UBC9 Mediated Sumoylation of PR-Set7 is Involved
in Regulation of Gene Repression.
Identification of UBC9 as a PR-Set7 interacting protein
PR-Set7 and UBC9 interact in vivo
The N-terminus of PR-Set7 mediates a direct interaction with
UBC9
The N-terminus of PR-Set7 is modified by SUMO1 in vitro
ARIP3, an E3 ligase, is required for PR-Set7 sumoylation in
vivo
UBC9 is required for PR-Set7 mediated gene repression
Summary, discussion and future directions
ii

iii

iv

vi

vii

ix

1
1
3
6
10
12

22

22

26

31

33

42

47

52
55
56

57
59

64
65
v

Chapter 3: Development of a Novel Technique to Identify
H4K20 Methyl Binding Protein

Principles and implementation of Mammalian Tethered
Catalysis (MTeC)
MTeC bait fusion proteins achieve specific degrees of Histone
H3 Lysine 9 (H3K9) methylation in vivo
Endogenous HP1β binds H3-G9a MTeC bait fusion proteins in
a methylation-dependent manner
HistoneH4K20 MTeC bait fusion proteins are differentially
methylated by distinct enzymes
Tandem tudor domain-containing proteins do not exhibit
differential H4K20 methyl-selective binding properties
in vivo
Full length G9a selectively binds monomethylated histone H3
Lysine 9 (H3K9me1) in vivo
Ku70 binds methylated H4K20 in vivo
Summary, discussion and future directions
Overall summary and future directions

Chapter 4: Methods
Nuclear extract isolation in preparation for gel filtration
chromatography
Immunoaffinity Purification (IAP)
Yeast-Two-Hybrid screening
In vitro binding assay
GST pull-down assay
In vitro and in vivo sumoylation assays
HMTase assay
Immunofluorescence studies (chromatin fibers)
Western blot analysis
Quantitative real time PCR Studies
Immunoprecipitation studies
BMH crosslinking
Protein precipitation using TCA
Characterization of MTeC constructs

Bibliography

75

77

78

80

82

83

87

92
95
106

108
108

109
111
112
113
113
113
114
117
120
124
128
128
129

131
vi

List of Tables
Table 1: Putative PR-Set7 binding proteins obtained from total
cellular extracts

Table 2: Putative PR-Set7 binding proteins obtained from nuclear
extracts

Table 3: Genotypes of yeast strains used for yeast two-hybrid
screen

Table 4: List of putative PR-Set7 binding proteins as identified
by yeast two-hybrid

Table 5: Antibodies used for immunofluorescence experiments

Table 6: Antibodies used for Western blot analysis

Table 7: Antibodies used for immunoprecipitations

Table 8: List of expression and sequencing primers

34

36

48

51

116

119

126

127

vii

List of Figures
Figure 1: Verification of HeLaS3 stable cell line expressing
FLAG-HA-PR-Set7

Figure 2: PR-Set7 is a part of large multi-protein complex

Figure 3: IAP of probable PR-Set7 interacting proteins

Figure 4: PR-Set7 binds DNA-PK, Ku80 and PARP1 in vivo

Figure 5: Histone H4 K20 monomethylation and components of
PR-Set7 multi-protein complex co-localize to the similar
genomic regions along extended chromatin fibers

Figure 6: Ku70 is not methylated by PR-Set7

Figure 7: Characterization of the yeast strain AH109 expressing
DNA-BD-PR-Set7 bait protein

Figure 8: UBC9 is PR-Set7 binding protein as identified by yeast
two-hybrid screen

Figure 9: PR-Set7 interacts with UBC9 in vivo

Figure 10: Direct interaction between PR-Set7 and UBC9 is
mediated via N-terminal domain of PR-Set7

Figure 11: N-terminal domain of PR-Set7 is sumoylated in ARIP3,
E3 ligase dependent manner

Figure 12: Overexpression of UBC9 does not affect global level of
H4K20me1 in HEK 293 cells

Figure 13: Depletion of UBC9 results in de-repression of PR-Set7
target genes

Figure 14: Principles of Mammalian Tethered Catalysis (MTeC)

Figure 15: H3-G9a MTeC bait fusion proteins attain specific
degrees of methylation in vivo and selectively bind
endogenous HP1β in a methyl-dependent manner

24

28

32

37

40

41

49

53

58

61

62

67

68

79

81

viii

Figure 16: Distinct enzymes used in MTeC to vary the degree of
H4K20 methylation demonstrate that full length tandem
tudor domain-containing proteins bind all three H4K20
methylated forms in vivo

85
Figure 17: MTeC reveals that full length G9a selectively binds
H3K9me1 in vivo

Figure 18: The estimated 70kDa fragment of G9a contains the
ankyrin repeats

Figure 19: Immunoaffinity purification of novel H4K20 methyl
binding proteins

Figure 20: Schematic representation of total protein targets
identified by MS

Figure 21: Ku70 binds H4K20 in methyl-dependent manner in vivo

Figure 22: Proposed model of the role PR-Set7 and H4K20me1 in
protecting the human genome from the DNA damage

88

91

93

94

96

101

ix

Abstract

Chromatin is the complex of DNA, histones, and nonhistone proteins found in the
nucleus of a eukaryotic cell and is known to play a critical role in regulation of DNA-
templated processes such as gene transcription, DNA replication, and DNA repair. The
numerous potential covalent modifications of the histone proteins help direct the
recruitment of specific nuclear factors to these modifications thus causing changes in
biological outcomes, phenomenon also known as ―histone code‖. One example of such
modification is the addition of methyl groups to lysine residues on N-terminal histone
tails by enzymes known as histone methyltransferases (HMTases). We previously
identified that PR-Set7 specifically methylates Lysine 20 of Histone H4 (H4K20); a mark
associated with transcriptional repression, condensed chromatin, and DNA repair. Our
biochemical purification of the native complex indicates that it is a part of a large multi-
protein complex. We hypothesize that these unidentified proteins play a critical role in
regulation of PR-Set7 function and H4K20me1 mediated pathways. In this study we are
using immunoaffinity purification and yeast two-hybrid techniques to identify PR-Set7-
associated proteins and a novel Mammalian Tethered Catalysis (MTeC) method to
identify H4K20 methyl binding proteins.
A tandem tag immunoaffinity purification (IAP) using full length PR-Set7
revealed that components of the DNA damage machinery, such as Ku70/80, DNA-PK
and PARP1, are part of its multi-protein complex. These findings provided evidence for a
novel function of PR-Set7 in the DNA repair pathway.
x
In a parallel approach, yeast two-hybrid assay was performed using full length
PR-Set7 as ―bait‖. Yeast two-hybrid screen revealed a novel interaction between PR-Set7
and the sumoylation-conjugation enzyme, UBC9. Additional studies demonstrated that
direct interaction with UBC9 is mediated by the N-terminal (non-catalytic) domain of
PR-Set7. Furthermore, we discovered that PR-Set7 is covalently modified specifically
with SUMO-1 and that this occurs in an ARIP3, E3 ligase-dependent manner in vivo.
Importantly, depletion of UBC9 in cells resulted in the derepression of PR-Set7 target
genes strongly suggesting that sumoylation by UBC9 is required for the normal
repressive effects of the PR-Set7 H4K20 monomethyltransferase.
Lastly, we developed and validated an innovative in vivo approach called
Mammalian Tethered Catalysis (MTeC). Using methylated histones and methyl-specific
histone binding proteins as the proof-of-principle, we determined that the simple MTeC
approach can compliment existing in vitro binding methods and can also provide unique
in vivo insights into PTM-dependent interactions. For example, we confirmed previous
in vitro findings that endogenous HP1 preferentially binds H3K9me3. However, in
contrast to recent in vitro observations, MTeC revealed that the tandem tudor domain-
containing proteins, JMJD2A and 53BP1, display no preferential H4K20 methyl-
selectivity in vivo. Finally, using MTeC in an unbiased manner we discovered novel
H3K9 and H4K20 methyl-specific PTMBPs. First, we determined that endogenous G9a
binds methylated H3K9 in vivo. Further use of MTeC to characterize this interaction
revealed that G9a selectively binds H3K9me1 in vivo but not H3K9me2, contrary to
recent in vitro findings. Second, we discovered and confirmed that Ku70 is a novel
H4K20me1 binding protein.
xi
In summary, we have provided evidence supporting a novel role of PR-Set7 and
H4K20me1 in protecting specific genomic regions from the DNA damage. Based on the
fact that PR-Set7 interacts with the components of the DNA damage machinery
(Ku70/80, DNA-PK and PARP1) and that H4K20me1 itself recruits Ku70 component of
Ku70/80 heterodimer, we hypothesize that PR-Set7 is targeted to the DNA damage
sensitive regions of the genome to provide direct layer of protection and prevent
accumulation of the DNA breaks; deregulation of PR-Set7 mediated pathway will lead to
cumulative DNA damage and genomic instability, two key events associated with
oncogenesis.

1
Introduction

Chromatin

Chromatin structure plays a key role in the regulation of DNA-templated
processes such as transcription, replication, and DNA repair. Therefore, understanding
the dynamic changes in chromatin structure is critical for understanding the underlying
mechanisms of these fundamental processes leading to successful cell growth,
differentiation, and survival.
Chromatin structure is comprised of genomic DNA, histone proteins, and non-
histone proteins, which together permit packaging of several meters of DNA into a
relatively small eukaryotic cell nucleus (Luger, Mader et al. 1997). There are two types
of chromatin: euchromatin and heterochromatin, which are defined by levels of
chromatin compaction within the interphase nucleus. Euchromatin is the portion of the
genome that decondenses rapidly following mitosis and often associates with actively
transcribed genes. In contrast, heterochromatin is highly condensed and therefore,
replicates late in S-phase and contains transcriptionally inert regions (Grewal and Rice
2004). More information about regulation of euchromatin and heterochromatin came
from series of studies in Drosophila melanogaster, where the phenomenon of position
effect variegation (PEV) demonstrated that relocation of actively transcribed genes from
euchromatic to heterochromatic regions resulted in transcriptional repression (Grewal
2000; Muller, Hart et al. 2002), and that this process is accompanied by many factors that
can modulate higher order chromatin structure and thus control chromatin function.
The basic repeating unit of chromatin compaction is the nucleosome. It consist of
146 base pairs of DNA wrapped around an octamer of histone molecules containing two
2
copies each of the four histones H2A, H2B, H3 and H4 (Luger, Mader et al. 1997), while
the non-core histone H1 binds ―linker DNA‖ between two nucleosomes and helps to form
a higher order chromatin structure (Nicholson, Wood et al. 2004). According to the
crystal structure, the assembly of a nucleosome occurs first by DNA binding to an H3-H4
tetramer followed by simultaneous association of the two separate H2A-H2B dimers
(Luger, Mader et al. 1997; Luger and Richmond 1998; Luger and Richmond 1998). Each
core histone has two domains: a well-structured globular domain and a flexible N-
terminal tail; histone H2A is unique in having an additional C-terminal tail, which
extends from the surface of the nucleosome. The globular domain of all four histones
contains highly similar ―histone-fold‖ motifs formed by three helices connected by
two loops (Luger, Mader et al. 1997). This motif is responsible for histone-histone and
histone-DNA binding, two essential events for the nucleosome assembly (Luger, Mader
et al. 1997). The unstructured and highly basic (due to a rich content of lysine and
arginine residues) N-terminal histone tails protrude outwards through the minor groove of
the DNA into the nuclear environment and are subject to post-translational modifications.
These modifications on histone tails have been correlated with stabilization of
nucleosome structure (Brower-Toland, Wacker et al. 2005), formation of heterochromatin
or euchromatin (Hansen, Tse et al. 1998; Grewal and Jia 2007) and regulation of cellular
processes such as gene expression, DNA damage, repair and replication (Marmorstein
2003; Sims, Nishioka et al. 2003; Martin and Zhang 2005) . More importantly, the
distinct histone modifications and the exact amino acids where they occur are typically
related to a specific biological process.

3
Histone modifications and Histone modifying enzymes
Histones are the most abundant proteins in the cell and are evolutionarily
conserved, with just few amino acid differences between yeast and human. Their high
degree of conservation and intimate association with the DNA suggests that they play
important and similar roles in specific DNA-templated processes in all eukaryotes.
Although histone proteins are highly conserved, different combinations of covalent
modifications on the histones allow for various functional biological outcomes. In
addition, not all modifications are present on the same histone at the same time, and the
timing of the appearance of a modification highly depends on the signaling conditions
within the cell.
Histone modifications were first reported over 40 years ago with the discovery of
lysine methylation on calf thymus histones (Murray 1964). Subsequently, other histone
modifications such as arginine methylation, acetylation, phosphorylation, ubiquitylation,
and ADP-ribosylation were discovered using wide range of different sources (Kleinsmith,
Allfrey et al. 1966; Ord and Stocken 1967; Vidali, Gershey et al. 1968; Gershey, Haslett
et al. 1969). Since then, only one other novel modification, sumoylation, was reported
(Shiio and Eisenman 2003) . As compared to acetylation or phosphorylation where a
single acetyl or phosphate group is added to lysine or serine residues of histones,
respectively, methylation of lysines and arginines is far more complicated. Extra
complexity comes from the fact that methylation at those amino acids exists in one of
three forms: mono-, di-, or –tri for lysines and mono- or di- (asymmetric or symmetric)
for arginines.
4
These covalent modifications can occur on all the histones, preferentially on
either amino or carboxy terminal tails which can affect the nucleosome structure
(previously described). Importantly, histone modifications can have different effects
depending on the type of modification and the location of the modification on the histone.
The best characterized histone modifications are acetylation and methylation. Acetylation
of histone lysine residues is associated with euchromatin and thus is involved in
transcriptional activation. Histone methylation has been implicated in a variety of
biological processes. For example, methylation of histone H3 lysine 4 residue (H3K4) is
involved in transcriptional activation (Ruthenburg, Allis et al. 2007) while histone H3
lysine 9 (H3K9) dimethylated residue is enriched within transcriptionally inactive regions
of euchromatin, whereas trimethylated form is preferentially targeted to constitutive
heterochromatin such as pericentric regions (Peters, O'Carroll et al. 2001; Schultz,
Ayyanathan et al. 2002). In addition, a completely different modification such as
methylation of histone H4 lysine 20 (H4K20) plays a role in two distinct biological
processes such as transcriptional regulation and DNA repair (Rice, Nishioka et al. 2002;
Sanders, Portoso et al. 2004; Houston, McManus et al. 2008) . Better understanding of
placement and timing of post-translational modification along histone tails came from the
discovery and characterization of histone-modifying enzymes.
Identification of enzymes responsible for each of these modifications has been the
focus of intense research over the last 13 years. Since most of the histone modifications
have been found to be dynamic, enzymes that remove the modification have become of
great interest as well. In 1996, two groups using affinity matrix chromatography, reported
the discovery of histone deacetylase (HDAC), the protein that harbors high sequence
5
identity with the yeast transcription repressor Rpd3 (De Rubertis, Kadosh et al. 1996;
Taunton, Hassig et al. 1996). These finding demonstrated for the first time the
reversibility of histone acetylation and its involvement in regulation of transcriptional
activation. Concurrently, purification of histone acetylatransferase (HAT) enzyme from
Tetrahymena thermophila that is highly homologous to yeast transcriptional adaptor
GCN5 directly linked histone acetylation to gene activation. In addition, it helped to
define bromodomain as an acetyl-methyl binding module (De Rubertis, Kadosh et al.
1996; Taunton, Hassig et al. 1996). The identification of these enzymes became a
landmark in understanding the biological functions underlying histone modifications
because they provided the first direct evidence directly connecting an enzyme (HAT) and
its corresponding histone modification (histone acetylation) to a biological outcome, such
as transcriptional activation.
Subsequently, other classes of histone modifying enzymes for methylation
(Zhang, Cao et al. 2004), phosphorylation (Nowak and Corces 2004), ubiqutination
(Shilatifard 2006), sumoylation (Nathan, Ingvarsdottir et al. 2006) and ADP-ribosylation
(Hassa, Haenni et al. 2006) were discovered implicating the role of histone modifying
enzymes and histone modifications in governing eukarytic DNA-templated processes
such as gene expression, cell cycle regulation, DNA repair and maintenance of genomic
stability. Furthermore, structural and biochemical studies have shed light on substrate
specificities and catalytic mechanisms of histone modifying enzymes. Of all the enzymes
that modify histones, methyltransferases are the most specific. For example, PR-Set7 is
the only known eukaryotic H4K20 monomethyltransferase and is unable to modify lysine
residues other than lysine 20, because the basic patch surrounding K20 is essential for
6
PR-Set7 interaction with H4 (Yin, Liu et al. 2005). Furthermore, due to the structural
nature of PR-Set7’s catalytic pocket it is limited to adding only single methyl group to
the lysine residue, and it takes an entirely different HMTase, Suv4-20, to di- or
trimethylate H4K20 (Fang, Feng et al. 2002; Nishioka, Rice et al. 2002). In many cases,
in addition to structural features, specificity and targeting of enzymes that modify
histones can be influenced by other factors, such as multi-protein complexes in which
enzymes are found may affect its selection of residue to modify (Metzger, Wissmann et
al. 2005) or the degree of methylation at a specific site (Steward, Lee et al. 2006).
Altogether discovery of histone modifications and histone modifying enzymes
notably expanded our understanding of their involvement in and influence on chromatin
structure to regulate diverse biological processes.
PR-Set7 and Histone H4 Lysine 20 monomethylation (H4K20me1)
Lysine 20 residue is the only currently known substrate for histone H4
methylation. Studies have shown that different methylated states of H4K20 are localized
to different regions of chromatin within the cellular interphase nucleus implying that
these modifications have distinct roles in regulating DNA-templated processes (Schotta,
Lachner et al. 2004; Sims, Houston et al. 2006) . There are two known enzymes that
methylate H4K20, PR-Set7/SET8/KMT5a and Suv4-20/KMT5b/KMT5c (Suv4-20 and
its function are briefly described in the previous section), both belonging to the SET-
domain containing family of proteins. These enzymes can transfer methyl group(s) from
S-adenosy-L-methionine (AdoMet) to the - amino group of a lysine residue, leaving S-
adenosyl-L-homocysteine as a cofactor byproduct (Cheng, Collins et al. 2005). The first
7
evidence demonstrating that SET domain itself possesses catalytic activity and is directly
involved in methyl group transfer came from the discovery of the first histone
methyltransferase, Drosophila Su(var)3-9 Enhancer of zeste and Trithorox (Suv39)
(Cheng, Collins et al. 2005). The active site of the SET domain enzymes contains two
conserved sequence motifs (RFINHXCXPN and ELXFDY) that are brought together by
a ―pseudoknot‖ fold to form the active site of the enzyme (Dillon, Zhang et al. 2005) thus
leading to the methyl group transfer. PR-Set7 has a unique protein structure, while it
lacks pre- and post-SET domains that are found in the most SET-domain containing
enzymes, it possesses special nSET and cSET regions that flank the SET domain
(Marmorstein 2003; Cheng, Collins et al. 2005; Couture, Collazo et al. 2005; Xiao, Jing
et al. 2005). These regions are thought to contribute to the specificity of the substrate
binding and catalytic activity of the PR-Set7 (Couture, Collazo et al. 2005). While it was
originally thought that PR-Set7 can catalyze dimethylation of H4K20, the recently solved
crystal structure revealed that it is monomethylase, both in vitro and in vivo (Couture,
Collazo et al. 2005; Xiao, Jing et al. 2005; Sims, Houston et al. 2006; Houston, McManus
et al. 2008) and that the basic patch surrounding K20 (RHRK
20
VLRDN) is essential for
PR-Set7 interaction with H4 (Yin, Liu et al. 2005). Furthermore, PR-Set7 will only
methylate the H4K20 residue in a nucleosomal context, suggesting that both DNA and a
histone octamer are required for catalysis (Yin, Liu et al. 2005).
Extensive studies of PR-Set7 and H4K20me1 functions suggest that they are
involved in regulation of diverse fundamental biological processes such as transcription,
cell cycle progression/proper development /differentiation and DNA repair, some of
which are described in more detail in the section below.
8
The Role of PR-Set7 and H4K20me1 in transcriptional regulation
Studies of H4K20me1 localization within the chromatin have demonstrated that
this mark associates with facultative heterochromatin (Fang, Feng et al. 2002; Martens,
O'Sullivan et al. 2005; Sims, Houston et al. 2006) and the inactive X chromosome
(Kohlmaier, Savarese et al. 2004), while being excluded from vast majority of known
mammalian repetitive elements (Martens, O'Sullivan et al. 2005). These findings
illustrate that H4K20me1 is a mark of repressive chromatin domains and is involved in
chromatin condensation. More direct evidence linking PR-Set7/H4K20me1 with
transcriptional repression came from studies demonstrating that they participate in a gene
repression pathway by recruiting and binding the L3MBTL1 repressor protein in vivo
(Kalakonda, Fischle et al. 2008; Sims and Rice 2008). The recruitment of L3MBTL1 to
H4K20me1 target gene, Runx1, is dependent upon PR-Set7 mediated monomethylation
and this event is required to induce gene repression (Sims and Rice 2008). Since Runx1 is
the master regulator of hemotopoetic differentiation, further elucidation of PR-
Set7/H4K20me1 mediated regulation of Runx1 may bring better understanding of
fundamental processes leading to normal blood formation.
Furthermore unpublished data from our lab (Lauren Congdon and Sai
Veerappan), using high throughput approaches such as Illumina expression arrays,
demonstrates that loss of PR-Set7 leads to dramatic de-repression of H4K20me1 target
genes further solidifying H4K20me1 as a mark of transcriptional repression.
PR-Set7 and H4K20me1are involved in regulation of the cell cycle progression.
Unlike other histone modifications, monomethylation of H4K20 fluctuates
dramatically during cell cycle progression, peaking at G2/M (Rice, Nishioka et al. 2002).
9
This suggests that this modification plays an important role in chromosome condensation
during cell division. Several reports have confirmed that PR-Set7 and H4K20me1 are
required for proper mitosis. Studies in Drosophila demonstrated that animals
heterozygous or homozygous for defective PR-Set7 allele display embryonic lethal
phenotype (die at the larva/pupal transition) with dramatic reduction of methylated
H4K20 in late-stage larvae (Karachentsev, Sarma et al. 2005) . Subsequent studies in
human cells using RNAi-mediated depletion of PR-Set7 and H4K20methylation show it
leads to aberrant centrosome amplification and results in the failure of cells to progress
into prometaphase (Houston, McManus et al. 2008). The cells also displayed enlarged
nuclei containing decondensed chromosomes, supporting evidence that PR-Set7 and
H4K20me1 are involved in chromatin condensation (Karachentsev, Sarma et al. 2005;
Sakaguchi and Steward 2007). Altogether, compromising the function of PR-Set7 leads
to abnormal cell cycle progression which is one of the key events leading to oncogenic
transformation. This underlines the importance of PR-Set7 and H4K20me1 in preventing
cells from acquiring an invasive phenotype.

PR-Set7 and H4K20me1 are involved in protecting cells from the DNA damage.
Recent findings strongly suggest that PR-Set7 and H4K20me1 play a protective
function in the genome. The loss of PR-Set7 in Drosophila leads to accumulation of
DNA damage and sensitized cells to genotoxic stress in S. pombe (Sanders, Portoso et al.
2004; Sakaguchi and Steward 2007). Furthermore, studies in human cells have illustrated
that cells depleted of PR-Set7 and H4K20me1 show massive accumulation of the DNA
damage (Houston, McManus et al. 2008). However, the discovery of how H4K20me1 is
10
directly involved in the cellular response to the DNA damage comes from identification
of H4K20me1 binding proteins (described below in Biological Relevance of Lysine
Histone Methyl Binding proteins section). Briefly, 53BP1 and its yeast homolog Crb2,
recognize H4K20methylation leading to downstream signaling events involving foci
formation at the sites of the DNA damage and phosphorylation of H2AXγ, another
histone modification known to be involved in the cellular response to DNA damage
(Sanders, Portoso et al. 2004; Du, Nakamura et al. 2006) . So far, this is the only known
mechanism linking PR-Set7 and H4K20 methylation to the DNA damage pathway.
However, studies described in this report, provide new evidence that PR-Set7 and
H4K20me1 are directly involved in the DNA repair pathway. Identification of PR-Set7
binding proteins revealed that PR-Set7 associates with the components of the DNA repair
machinery, Ku70/80 and DNA-PK (Chapter 1), while H4K20me1 is directly recognized
by Ku70 (Chapter 3). These findings suggest a novel mechanism of PR-Set7 and
H4K20me1involvement in protecting the human genome from damage (Figure 22).

UBC9 and sumoylation
Sumoylation involves covalent attachment of a SUMO (small ubiquitin-related
modifier) to substrate proteins through a series of enzymatic reactions. SUMO is a 100-
amino acid polypeptide that first gets activated by the heterodimeric E1-activating
enzyme (SAE1/SAE2) in an ATP-dependent manner and then gets transferred to the
SUMO-conjugating enzyme, UBC9. In the final step, an UBC9, an E2 enzyme transfers
the SUMO group to the lysine residue of the target protein (Lin, Tatham et al. 2002). The
last step in many cases involves E3 ligase (Pichler, Gast et al. 2002; Ivanov, Peng et al.
11
2007) whose function is to enhance the sumoylation process. Mammals contain four
SUMO forms: SUMO-1, SUMO-2/3 and SUMO-4. SUMO-1 exists mostly conjugated
to proteins, while SUMO2/3 are mainly found in free form, however once conjugated to
the protein they can form multi-peptide chains (Saitoh, Bell et al. 2000). The SUMO
pathway has diverse substrate proteins that include transcription factors p53 and c-Jun,
the GTPase-activating protein RanGAP1 and DNA repair proteins RAD51and 52.
Although these proteins are involved in different biological pathways, they all share a
conserved SUMO consensus motif: KxE/D (where is bulky hydrophobic residue and
x is any amino acid) which is directly recognized by UBC9.
UBC9 consists of a relatively conserved catalytic core domain of about 150 amino
acids and the specificity of the protein is determined by the loop insertions near the
enzyme active site within the core domain (Tatham, Chen et al. 2003). Structural studies
of UBC9 revealed that Asp100 and Lys101 are part of the loop insertion and are directly
involved in the substrate recognition (Tatham, Chen et al. 2003; Tatham, Kim et al.
2005), whereas the Cys93 residue located in the middle of the active site is essential for
UBC9 catalytic activity. Mutation of this cystine to serine leads to a catalytically inactive
form of the UBC9 (Tong, Hateboer et al. 1997).
UBC9- dependent sumoylation has been shown to play a role in the maintenance
of heterochromatin stability and transcriptional repression. For example, UBC9 interacts
with and sumoylates heterochromatin proteins Swi6 and Chp2 leading to heterochromatin
formation, while defective sumoylation of these two proteins compromises gene silencing
(Shin, Choi et al. 2005). Also, sumoylation of histone H4 has been directly linked to
transcriptional repression in vitro and in vivo (Shiio and Eisenman 2003). More recently,
12
UBC9 mediated sumoylation of chromatin associated proteins and/or transcription factors
such as p300, Elk-1 and reptin has been shown to directly recruit various histone
deacetylases (HDACs) (Girdwood, Bumpass et al. 2003; Yang and Sharrocks 2004; Kim,
Choi et al. 2006) and thus leads to transcriptional repression. Furthermore, studies
described in this report demonstrate that UBC9 interacts with PR-Set7, linking
sumoylation and methylation in transcriptional silencing.
Lysine Histone Methyl binding proteins

In the previous section the importance of methyl modifications on various lysine
residues of histones and their role in regulation of the chromatin structure was addressed.
Once these distinct marks or combinations of marks are laid out by corresponding histone
lysine methyltransferase (HKMTs) enzymes they create the binding platform for methyl
specific binding factors- a phenomenon also known as the histone code hypothesis. These
methyl-binding proteins (also known as effector modules) are either part of or promote
the recruitment of biological complexes that read the histone code and lead to further
regulation of DNA and chromatin-based cellular processes such as gene expression, DNA
repair and genomic instability. Because lysine residues on histone tails can exist in mono-
, di- or tri- methylated states (Zhang and Reinberg 2001) each distinct methyl-lysine mark
can recruit different effector modules causing diverse biological outcomes. This adds an
even greater complexity to how processes such as genes expression, DNA damage and
the maintenance of genomic stability are regulated.

13
Identification of histone methyl-binding proteins
Researchers have used a number of different techniques to identify proteins that
bind histones in lysine methylation-dependent manner. Initially, histone pull-down
experiments were used to demonstrate the interaction between a protein of interest and
reconstituted or native octamers in a modification-dependent manner(Sims, Trojer et al.
2006). While this method was useful for determining a protein’s ability to bind histones,
it did not allow identification of the exact histone-modified residues that served as a
binding site for the interaction. The first technique that demonstrated direct interaction
between the protein and methyl-lysine mark of histone was peptide affinity
chromatography. Using this approach several research groups were able to demonstrate
preferential binding of Heterochromatin Protein 1 (HP1) to di- and tri-methylated lysine 9
on histone H3 (H3K9) (Bannister, Zegerman et al. 2001; Lachner, O'Carroll et al. 2001;
Jacobs and Khorasanizadeh 2002). Furthermore it was determined that chromodomain of
HP1 is responsible for the H3K9me specific interaction. Among chromodomain
containing proteins that bind lysine methyl-specific marks are CHD1, CDY1 and MRG15
(Sims, Chen et al. 2005; Sims, Trojer et al. 2006). In addition to the chromodomain,
proteins containing tudor, MBT (malignant brain tumor), PWWPs (conserved Proline and
Tryptophan), PHD finger (plant homeodomain) and WD40 domains were identified as
lysine methyl specific effector proteins by using peptide affinity chromatography
combined with more a complex protein-domain microarray approach (Kim, Daniel et al.
2006). Also, detailed sequence and structure-based studies of proteins containing chromo,
tudor, PWWP and MBT domains revealed that they originated from a common ancestor
(based on significant sequence similarity) and that they have structural similarities
14
because they possess three -stranded core region which may play a role in methyl-
substrate-binding (Maurer-Stroh, Dickens et al. 2003). Because these domain types are
structurally and functionally related they were grouped into one domain family known as
the ―Royal Family‖.
To better understand the kinetics and specificity of lysine-methyl-specific proteins
and methyl mark binding, researchers have been using techniques such as isothermal
titration calorimetry, NMR spectroscopy or fluorescence spectroscopy (Sims, Chen et al.
2005). For example, isothermal titration calorimetry was used to demonstrate that HP1
chromodomain binds to H3K9me3 with greater affinity than to a H3K9me2 peptide,
leading to further elucidation of the mechanism by which methyl-lysine is recognized by
chromodomain. Finally, to examine the interaction between methyl-binding protein and
histone lysine methyl mark in a more physiological environment, investigators have been
using nucleosome-binding assays. These assays examined if the role of chromatin
compaction is functionally important for the methyl mark recognition by corresponding
effector protein [73]. For example, it has been shown that HP1 recognized H3K9me in a
content of mononucleosomes (Nielsen, Schneider et al. 2001). While nucleosome-
binding assays have been successful in characterizing previously identified interactions
between methyl-binding proteins and nucleosomes, to our knowledge, there are no
known methods to identify novel modification-specific binding proteins in vivo.
To combat this problem and to successfully identify novel-methyl binding
proteins in vivo, we developed and validated an innovative approach called Mammalian
Tethered Catalysis (MTeC). Using methylated histones and methyl-specific histone
binding proteins as the proof-of-principle, we determined that the new MTeC approach
15
can complement existing in vitro binding methods and can also provide unique in vivo
insights into PTM-dependent interactions. For example, we confirmed previous in vitro
findings that endogenous HP1 preferentially binds H3K9me3. However, in contrast to
recent in vitro observations, MTeC revealed that the tandem tudor domain-containing
proteins, JMJD2A and 53BP1, display no preferential H4K20 methyl-selectivity in vivo.
Finally, we utilized MTeC approach to identify novel H4K20 methyl-binding proteins,
among which was DNA repair protein, Ku70. This discovery provided an exciting first
evidence of the DNA repair protein’s direct involvement in H4K20 methylation mediated
pathways. Furthermore, using MTeC in an unbiased manner to identify H3K9 methyl-
specific PTMBPs, we determined that endogenous G9a binds methylated H3K9 in vivo.
Further use of MTeC to characterize this interaction revealed that G9a selectively binds
H3K9me1 in vivo but not H3K9me2, contrary to recent in vitro findings (Spektor and
Rice 2009). While this study focused solely on methylated histones, we demonstrate how
the innovative MTeC approach could be used to identify and characterize any PTMBP
that binds any PTM on any protein in vivo.

16
Histone lysine methyl binding proteins read histone code and regulate transcription

The role of HP1 and Pc methyl-binding proteins in transcriptional silencing
Histone H3 methylation on lysines 9 and 27 has mainly been associated with gene
silencing and heterochromatin formation. These distinct modifications are recognized by
chromodomain containing proteins, HP1 and Pc respectively. Once targeted to the methyl
mark, the biological signal is further propagated by the recruitment of additional proteins
or protein complexes- the type of which dictates specific biological outcomes. For
example, HP1 has been shown to interact with various proteins that are involved in
transcriptional regulation, DNA replication, DNA repair and heterochromatin formation.
HP1 was first identified in Drosophila melanogaster as a strong suppressor of
position effect variegation (PEV). PEV is translocation of genes in Drosophila from
transcriptionally active regions of chromatin (euchromatic) to pericentric heterochromatin
(Eissenberg et al, 1990). This finding suggested that HP1 is a major component of
heterochromatin and it plays a key role in its formation and maintenance (Hayakwa et al,
2003). In humans, there are three isoforms of HP1: , and All isoforms share
sequence similarity and contain N-terminal chromodomain and C-terminal chromo-
shadow domain. Chromodomain of HP1 contains three essential aromatic residues
(Tyr24, Trp45 and Tyr48) that form a recognition pocket for H3K9me (Jacobs et al,
2002), however the binding affinity of chromodomain and lysine residues was
determined to be relatively weak thus allowing for rapid ―on-off‖ binding (Daniel et al,
2005). Several mechanisms by which methyl binding protein, HP1, causes transcriptional
silencing have been proposed. One such pathway involves targeting of HP1- Suv39H1-
17
Rb (Retinoblastoma) protein complex to a precise genomic location. Transcription factor
E2F recruits SUV39H1 and HP1 through tumor suppressor Rb to a specific Cyclin E
gene promoter (Nielsen, Schneider et al. 2001). SUV39H1 tri-methylates lysine 9 on
histone H3 and hence promotes HP1 chromodomain dependent binding to the methyl
mark. Once HP1 is bound it can promote recruitment of more HP1 molecules and its
associated proteins. It is able to do so through chromo-shadow domain homodimer
formation. This causes H3K9 methylation of an adjacent histone H3 and thus linear
spreading of heterochromatin formation that leads to genes silencing (Brasher, Smith et
al. 2000).
HP1 also associates with another multi-protein complex that causes gene silencing
of KRAB domain zinc-finger proteins target genes. In this pathway HP1 associates with
novel SETDB1 histone H3K9 methyltransferase and KAP-1 corepressor protein to cause
repression of transcription (Schultz et al, 2006). KAP-1 interacts with chromo-shadow
domain of HP1 and together KAP-1, HP1 and SETDB1 are recruited to promoters of
KRAB-ZFP family target genes (Schultz, Ayyanathan et al. 2002). The above examples
demonstrate how the same methyl binding protein is targeted to unique locations within
the genome by associating with different multi-protein complexes. Each complex
contained different histone H3 lysine K9 methyltransferase coordinating both H3K9
methylation at particular genomic locations and the deposition of HP1 to silence gene
expression.
Methylation of Histone H3 Lysine 27 is also known to cause transcriptional
inactivation. Pc protein contains chromo-domain that has sequence similarity to that of
18
HP1. Within its chromo-domain it also possesses the three aromatic residues that form
recognition site for the methyl mark binding. Also, immediate sequence that flanks lysine
9 and 27 of histone H3 is the same (Fischle, Wang et al. 2003). However, Pc protein
recognizes H3K27me3 mark and not H3K9me3. To discriminate between K9 and K27
target residues Pc uses its extended recognition groove and thus binds to amino acid
sequences flanking conserved motif that contains K27(Daniel, Pray-Grant et al. 2005). Pc
is part of multi-protein complex PRC1 (Polycomb repressive complex 1) that plays
critical role in regulating transcription of homeobox genes, which are important for
embryonic development [79]. EED-EZH2 complex is responsible for tri-methylation of
H3K27, however it is still unclear which member of this complex contains intrinsic
histone methyltransferase activity. Upon H3K27 methylation PRC1 is recruited to the
methyl mark through Pc chromodomain recognition. The mechanism by which PRC1
causes Hox gene silencing is still unclear, however couple possible explanations are
circulating in the field. One possibility is that dimerization of Pc protein through
chromodomain causes it to bind H3K27 methyl marks of two neighboring nucleosomes
hence causing structural compaction of the chromatin (Cao, Wang et al. 2002; Cao and
Zhang 2004). Second, some groups have shown that EZH2 and PRC1 complexes
physically bind thus targeting Pc to the methyl mark and cause gene silencing (Cao and
Zhang 2004). Lastly, it is possible that Pc and HP1 work in concert. They either
sequentially or simultaneously recognize H3K27me and H3K9me marks, respectively,
causing gene silencing (Cao and Zhang 2004). This idea greatly supports the histone code
hypothesis which states that specific architecture of the chromatin is laid out so that
19
nonhistone chromosomal proteins can recognize it and alter chromatin structure causing
either transcriptional activation or silencing (Jenuwein and Allis 2001).

H3K9 methylation and HP1 may also play a role in transcriptional activation
Although it is debatable, numbers of studies have shown that HP1 , and
localize to different regions of chromatin hinting functional differences (Minc, Allory et
al. 2001). For example, there are some evidences suggesting that HP1 is involved in
transcriptional activation as well as gene silencing. Even though H3K9 methylation is
mainly found in regions of heterochromatin, surprisingly it has been shown that H3K9 di
and tri methylation co-localizes together with HP1 at regions of actively transcribed
genes [85]. In addition, HP1 can physically interact with phosphorylated form of RNA
Polymerase II, which associates with transcriptional elongation. It is proposed that
recruitment of HP1 to H3K9me regions of transcribed genes depends on phosphorylated
form of RNA Polymerase II and that H3K9 methylation is coordinated with other
modifications (H3K4, H3K36 and H3K79) creating a unique methyl mark pattern that
identifies transcribed regions of the genome (Vakoc, Mandat et al. 2005).
Crb2/53BP1 recognizes H4K20me1/2 and plays a role in the DNA response.
Methylation of histone H4 lysine 20 has been linked to DNA repair. In fission
yeast, a single methyltransferase enzyme, Set9, is responsible for mediating all three
forms of H4K20 methyliatoin (-mono,-di and –tri) (Sanders, Portoso et al. 2004). The
loss of Set9 protein or replacement of the wild type histone H4 with the mutant
containing lysine 20 mutated to alanine were both associated with hypersensitivity to
20
DNA damage. Subsequent work demonstrated that K20 methylation is required for the
recruitment of Crb2, a protein involved in DNA damage checkpoint signaling to DNA
double strand breaks (Sanders, Portoso et al. 2004; Dou, Milne et al. 2006) and that the
recognition of H4K20me is mediated by double tudor domains of Crb2 (Botuyan, Lee et
al. 2006). Formation of nuclear foci by Crb2 and H4K20 methylation leads to cell cycle
arrest in order for the DNA to be repaired (Sanders, Portoso et al. 2004; Botuyan, Lee et
al. 2006). In human cells, 53BP1, the homolog of Crb2, operates in a very similar
manner, where it is recruited to sites of the DNA damage via H4K20 methylation
(Botuyan, Lee et al. 2006) and facilitates repair of the DNA.

Introduction to Chapter 1 and 2
Identification of the interaction partners of a particular protein can become a
valuable way to gain insight into the physiological role of the protein. For example,
Retinoblastoma (Rb) tumor suppressor associates with Suv39H1, histone H3 lysine 9
methyltransferase (H3K9) and heterochromatin protein 1 (HP1) and together cooperate to
repress the gene expression of cyclin E. Identification of Rb as Suv39H1 binding protein
demonstrated that in addition to heterochromatin silencing, Suv39H1 is also involved in
euchromatin gene repression (Nielsen, Schneider et al. 2001). In similar manner, the
discovery of proteins that interact with EZH2, H3 lysine 27 methyltransferase (H3K27),
to form PRC2 complex have lead to a better understanding of how PRC2 complex is
involved in Hox gene silencing mechanism which is important for embryonic
development (Cao, Wang et al. 2002; Zhang, Azevedo et al. 2003). Lastly, identification
of proliferation cell nuclear antigen (PCNA) as PR-Set7 interacting partner revealed a
21
novel role of PR-Set7 and H4K20me1 in regulating DNA replication fork progression
(Jorgensen, Elvers et al. 2007; Huen, Sy et al. 2008). However, in addition to DNA
replication, PR-Set7 has also been implicated in playing a role in transcriptional gene
repression, maintenance of genomic stability, DNA repair, and cell cycle regulation
(Rice, Nishioka et al. 2002; Sanders, Portoso et al. 2004; Karachentsev, Sarma et al.
2005; Houston, McManus et al. 2008; Schotta, Sengupta et al. 2008; Sims and Rice 2008;
Oda, Okamoto et al. 2009). Although all these biological processes are mediated by PR-
Set7, the underlying mechanism of PR-Set7 regulation is not fully understood. Therefore,
we hypothesize that unidentified binding proteins of PR-Set7 are critical for the in vivo
function of PR-Set7 and, thus will play an important role in PR-Set7 mediated processes.
To identify PR-Set7 binding proteins we decided to use two approaches; we
simultaneously utilized biochemical (tandem- tag Immunoaffinity Purification (Nakatani
and Ogryzko 2003)) and yeast two-hybrid methods (Fields and Song 1989; Luban and
Goff 1995). While yeast two-hybrid will allow us to identify mostly binary interactions,
biochemical approach will lead to identification of intramolecular interaction partners of
PR-Set7 – components of a multimeric protein complex.

22
Chapter 1: Identification and Characterization of PR-Set7 Binding Proteins using
Tandem- tag Immunoaffinity Purification (IAP) Methodology

For identification of members of PR-Set7 multi-protein complex, purification of
the native protein complex from the cells would be the ideal method. However, standard
biochemical purification of PR-Set7 using sequential column chromatography steps (total
of seven) lead to purification of PR-Set7 enzyme but failed to identify PR-Set7 associated
proteins (Nishioka, Rice et al. 2002). To avoid losing components of PR-Set7 multi-
protein complex, we utilized well established biochemical technique, immunoaffinity
purification (IAP) (Nakatani and Ogryzko 2003). This method involves generation of a
stable cell line that expresses double epitope-tagged (FLAG-HA) version of protein of
interest. The exogenous tagged protein is synthesized de novo and integrated into its
proper multi-protein complex (Ogryzko, Kotani et al. 1998; Ogawa, Ishiguro et al. 2002).
The protein complex can then be purified by first performing an immunoprecipitation
with a FLAG antibody, eluting the complex and performing a second
immunoprecipitation with an HA antibody. The purified protein complex is then
fractionated by SDS-PAGE and, by comparison to the control samples (cell line
expressing FLAG-HA), unique binding proteins can be isolated and identified by
standard mass spectrometry methods.

Engineering of tandem-tag PR-Set7 and establishing stable cell line
Tandemly tagged (FLAG-HA) eukaryotic expression vector containing the full
length wild type PR-Set7 was generated by first subcloning sequence containing Kozak
consensus sequence, followed by an initiation methionine, and FLAG and HA tags
23
(sequences of FLAG and HA were obtained from (Nakatani and Ogryzko 2003)) into the
BamHI and EcoRI sites of pcDNA4/TO eukaryotic expression vector carrying zeocin
resistant gene. Subsequently we inserted cDNA sequence encoding full length wild type
PR-Set7 into EcoRI and XbaI of the pcDNA4/TO-FLAG-HA vector. To ensure that
FLAG-HA-PR-Set7 is expressed in cells, HEK 293 cell were transfected with either
pcDNA4/TO-FLAG-HA (null) or pcDNA4/TO-FLAG-HA-PR-Set7. 24h post-
transfection whole cell lysates were made and immunoprecipitation assay using anti-
FLAG conjugated beads was performed. Next, bound material was resolved on SDS-
PAGE gel and analyzed by Western analysis using anti-FLAG antibody. FLAG-HA-PR-
Set7 was detected in the cells transfected with pcDNA4/TO-FLAG-HA-PR-Set7 and not
FLAG-HA alone (Figure 1A).
In order to generate stable cell line expressing FLAG-HA or FLAG-HA-PR-Set7,
HeLaS3 cells were transfected with the pCDNA4/TO constructs and selected in zeocin
containing medium for 17 days (600 g/mL for the first 7 days; 800 g/mL for the
remaining 10 days). We chose to use HeLaS3 cells because they can be grown in as a
suspension culture providing unlimited supply of the input material for the purification.
After selection, individual colonies were isolated and analyzed for FLAG-HA-PR-Set7
expression. mRNA, whole cell lysates and genomic DNA were extracted from potential
cell lines and analyzed by qRT-PCR and Western Analysis to monitor expression and
protein levels of FLAG-HA-PR-Set7, respectively. Out of two probable stable cell lines,
only one confirmed overexpression of FLHA-PR-Set7 (Figure 1B-C). The negative
control cell line expressing FLAG-HA was verified by amplification of FLAG-HA PCR
product from total genomic DNA (Figure 1D). Next we fractionated HeLaS3 stable cell
24
Figure 1: Verification of HeLaS3 stable cell line expressing FLAG-HA-PR-Set7.
(A) Expression of pcDNA4/TO-FLAG-HA-PR-Set7 in HEK 293 cells. Indicated
plasmids were transfected into HEK293 cells. Whole cell lysates were extracted and used
for immunoprecipitation with FLAG-conjugated beads. Bound material was resolved on
SDS-PAGE gel and analyzed by Western analysis using anti-FLAG antibodies. (B)
Expression level of FLAG-HA-PR-Set7 in established HeLaS3 stable cell lines as
verified by qRT-PCR. Results were normalized to GAPDH expression and plotted as n-
fold increase relative to null. Fold change was calculated using the 2^(- Ct) and plotted
relative to the values of FLAG-HA stable cells, normalized to 1. (C) Protein expression
of FLAG-HA-PR-Set7 in HeLaS3 stable cell lines. Whole cell lysates were used to
perform FLAG immunoprecipitation, followed by analysis of the bound material using
anti-PR-Set7 antibodies. (D) Verification of FLAG-HA HeLaS3 stable cell line. Genomic
DNA was extracted from cell lines indicated above and analyzed by PCR using FLAG-
HA epitope tag specific primers. In= input, Un=unbound, B=bound.

25

26
line into cytoplasmic and nuclear fractions to test subcellular localization of FLAG-HA-
PR-Set7. Similar to the endogenous PR-Set7 (Nishioka, Rice et al. 2002), majority of
FLAG-HA-PR-Set7 was found in the nuclear fraction (Figure 2A). Therefore, using
nuclear extracts to performed purification of PR-Set7 multi-protein complex will provide
more concentrated input material and will eliminate contaminants that are found within
cytoplasmic fraction.

Gel filtration chromatography PR-Set7 indicates that it is a part of a ~600KDa multi-
protein complex
To confirm that PR-Set7 is indeed a part of larger multi-protein complex we used
size- exclusion chromatography to estimate molecular weight of the complex. Nuclear
extracts from FLAG-HA-PR-Set7 and FLAG-HA stable cell lines grown in suspension (8
x 10^9 cells) were isolated using standardized protocol (Malik and Roeder 2003) and
subjected to gel filtration chromatography using Superdex200 column. Collected
fractions were resolved on SDS-PAGE gel and analyzed by Western analysis using anti-
FLAG or anti-PR-Set7 antibodies. Both FLAG-HA-PR-Set7 and endogenous PR-Set7
was found within fraction corresponding to molecular weight much greater (~600kDa)
than that of PR-Set7 (48kDa) (Figure 2B). These results confirmed that PR-Set7 is indeed
a part of larger multi-protein complex.
Previous studies from our lab demonstrated that the highest level of PR-Set7 and
H4K20me1 peaks during mitosis, and that both are important for cell cycle progression
and for the maintenance of genomic stability (Rice, Nishioka et al. 2002; Houston,
McManus et al. 2008). Although FLAG-HA-PR-Set7 is not under the endogenous
27
promoter and will not be cell cycle regulated, performing purification of components of
PR-Set7 multi-protein complex in cells that are arrested in G2/M is beneficial. It will
assure that biologically relevant proteins that are themselves cell cycle regulated and bind
to PR-Set7 are not omitted. To arrest cells in G2/M, HeLaS3 suspension culture was
grown in nocodazole containing medium and analyzed by flow cytometry using
propidium iodide staining. The optimal condition for successful cell cycle arrest of
FLAG-HA-PR-Set7 stable cell line was 400ng/mL of nocodozol per 8.9x10^7 cells
(Figure 2C).
Next we wanted to address whether endogenous PR-Set7 is still found within
multi-protein complex during G2/M phase of cell cycle. We used nocodazole arrested
FLAG-HA stable cell line for gel filtration chromatography. We were able to extract
nuclear fraction from G2/M arrested cells and analyze using Superdex200 column as
previously described (Figure 2D), however the yield of usable material was substantially
reduced. Because during normal progression through mitosis, the structural
reorganization

of chromatin into condensed chromosomes takes place, isolation of soluble
nuclear fraction containing chromatin and associated proteins from G2/M arrested cells
was technically difficult. Nevertheless, we were able to demonstrate that endogenous PR-
Set7 is still part of ~600kDa multi-protein complex during mitosis (Figure 2D).
In order to successfully purify members of PR-Set7 multi-protein complex we
needed to scale up the nocodozole arrested culture to obtain substantial amount of input
material. However after numerous attempts, IAP using G2/M arrested cells proved to be
technically difficult to achieve because of insufficient amount of FLAG-HA-PR-Set7 in

28
Figure 2: PR-Set7 is a part of large multi-protein complex.
(A) FLAG-HA-PR-Set7 localizes to the nuclear fraction. Nuclear and cytoplasmic
fractions from stable HeLaS3 cell lines expressing either FLAG-HA or FLAG-HA-PR-
Set7 were isolated and immunoprecipitation reactions were performed using FLAG-
conjugated beads. 10% of the bound (B) and flow through (Un) materials and 1% of the
input (In) were resolved on SDS-PAGE gel and analyzed by Western analysis using anti-
PR-Set7 antibodies. (B) Size-exclusion analysis using Superdex200 column of tandemly
tagged (top) and endogenous (bottom) PR-Set7 from HeLaS3 stable cell lines indicates
that bulk of PR-Set7 resides in ~600kDa fractions. (C) FLAG-HA-PR-Set7 HeLaS3 cells
were treated with 400ng/mL of nocodozole for 24 hours. Post-treatment cells were
stained with propidium iodide and their cell cycle profiles were analyzed by flow
cytometry. 85.5% of cells were arrested in G2/M as compared to control (16.9%). (D)
Size-exclusion analysis using Superdex200 column of endogenous PR-Set7 in
nocodozole arrested cells.

29

30
the input material. This is most likely due to that fact that during cell cycle PR-Set7 is
trapped in the insoluble chromatin fraction. Therefore applying harsher conditions
(higher concentration of detergent and salt) to isolate PR-Set7 would lead to increased
amounts of PR-Set7 in the input material, but will most likely dissociate the multi-protein
complex.
Next we attempted to use asynchronous HeLaS3 stable cell lines expressing
FLAG-HA-PR-Set7 and FLAG-HA for IAP. Unfortunately, large-scale purification of
PR-Set7 multi-protein complex was unsuccessful. At the time, it was not known that
high levels of PR-Set7 in cells for prolonged periods resulted in cell death (Jorgensen,
Elvers et al. 2007; Sakaguchi and Steward 2007; Tardat, Murr et al. 2007; Houston,
McManus et al. 2008). These findings provide an explanation for the technical difficulties
we encountered during large-scale IAP. On one hand, the spinner cultures expressing
FLAG-HA-PR-Set7 were unable to reach the required cell number for the large-scale
purification resulting in low amount of input material and thus futile IAP. On the other
hand, FLAG-HA-PR-Set7 HeLaS3 stable cell line that grew successfully to produce
enough input material stopped expressing tandemly tagged PR-Set7 as we failed to detect
FLAG-HA-PR-Set7 in the input and immunoaffinity purified fractions. To avoid these
problems, stable cell lines expressing low levels of PR-Set7 using methods such as
retroviral transduction and low expression plasmids were used. However no positive
clones of cells expressing PR-Set7 were obtained.
In conclusion, while we were able to successfully generate stable cell line
overexpressing FLAG-HA-PR-Set7, we were not able to use it to identify members of
31
PR-Set7 multi-protein complex due to lethal phenotype caused by overexpression of PR-
Set7.

IAP and Identification of PR-Set7 associated proteins by Mass Spectrometry
As an alternative approach to successfully identify members of PR-Set7 multi-
protein complex we performed IAP from transiently transfected HEK 293 cells. Briefly,
pcDNA4/TO-FLAG-HA and pcDNA4/TO-FLAG-PR-Set7 vectors were used to
overexpress tandemly tagged PR-Set7 in HEK 293 cells. 24 hours post-transfection total
cellular extracts from ~2.5 x 10^8 cells per reaction were collected and used for IAP (see
Chapter 3 for details). 5% of total FLAG immunoprecipitated material and 10% of HA
purified material were fractionated on SDS-PAGE gel and stained to visualize putative
PR-Set7 binding proteins (Figure 3). Because there were ~ 20 visual bands corresponding
to novel PR-Set7 binding proteins after the second purification step, total purified
material was TCA (trichloroacetic acid) precipitated and sent for standard mass
spectrometry analysis (Taplin Mass Spectrometry Facility; Harvard Medical School; Dr.
Don Kirkpatrick).
To confirm mass spectrometry data we repeated IAP experiments using nuclear
extracts (instead of total cellular extracts as described above) isolated from HEK 293
cells transfected with pcDNA4/TO-FLAG-HA-GFP (as a negative control) and
pcDNA4/TO-FLAG-HA-PR-Set7. After second purification step total bound material
was TCA precipitated and sent for mass spectrometry analysis. Summarized in Table 1
and 2 are the lists of probable PR-Set7 binding proteins that were unique to experimental
(FLAG-HA-PR-Set7) and were absent from the control (FLAG-HA or FLAG-GFP)
32

Figure 3: IAP of probable PR-Set7 interacting proteins.
A tandemly tagged FLAG-HA only or full length PR-Set7 vector were transfected into
HEK 293 cells. Total cellular extracts were isolated and used for Immunoaffinity
purification using a FLAG antibody, followed by HA antibody. 5% of total FLAG bound
material and 10% of total HA purified material were fractionated by SDS-PAGE gel
followed by Silver or SYPRORuby staining. Arrows indicated FLAG-HA-PR-Set7.

33
reactions. Both sets of IAPs identified probable PR-Set7 proteins that belong to DNA
repair, RNA processing and splicing, DNA replication, and protein translation (ribosomal
components) biological processes. Interestingly, only Ku70, Ku80 and PCNA proteins
were identified by both sets of IAPs. While PCNA has already been identified as PR-Set7
interacting protein (Jorgensen, Elvers et al. 2007; Huen, Sy et al. 2008), no evidence
demonstrating that DNA repair machinery components (Ku70/80) bind to PR-Set7 have
been reported. These exciting results imply that PR-Set7’s novel function may be directly
involved in preventing localized DNA damage which has not yet been identified.

PR-Set7 interacts with key components of the DNA damage repair machinery
To begin investigating the role of PR-Set7 in the DNA damage response, we first
confirmed that Ku70/80, PARP1 and DNA-PK are true components of PR-Set7 multi-
protein complex. HEK 293 cells were transfected with plasmids expressing tandemly
tagged PR-Set7 or negative control proteins (FLAG-HA or FLAG-HA-GFP) and FLAG
immunoprecipitation using nuclear cell extracts was performed. Next, input and bound
materials from each reaction were subjected to Western analysis using antibodies to
detect endogenous PARP-1, DNA-PK , Ku70 and Ku80. As shown in Figure 4, PR-Set7
co-immunoprecipitated with PARP1, DNA-PK and Ku80, but not Ku70. This was
surprising because Ku70 and K80 exist as heterodimer and therefore both proteins should
be detected in PR-Set7 bound fraction. The differences in detection of PR-Set7-Ku70
interaction between mass spectrometry data and immunoprecipitation assay could be
attributed to the quality of anti-Ku70 antibody and extremely low levels of endogenous
Ku70 in the input material (Figure 4A). To attempt verification of this interaction again,
34
Table 1: Putative PR-Set7 binding proteins obtained from total cellular extracts
Annotation
# of peptides
(PR-Set7)
# of peptides
(FLAG-HA-
GFP)
DNA Damage

Homo sapiens POLY [ADP-RIBOSE] POLYMERASE 1.
[MASS=112953] (PARP-1) 31 0
Homo sapiens ATP-DEPENDENT DNA HELICASE 2
SUBUNIT 2. [MASS=82573] (KU86) 26 0
Homo sapiens ATP-DEPENDENT DNA HELICASE II,
70KDA KU70 12 0
DNA Replication

Homo sapiens PROLIFERATING CELL NUCLEAR
ANTIGEN. [MASS=28769] (PCNA) 16 0
Splicing and RNA processing
Homo sapiens ISOFORM 1 OF POLYADENYLATE-
BINDING PROTEIN 1. [MASS=70671] (PABPC1) 16 0
Homo sapiens ISOFORM 1 OF HETEROGENEOUS
NUCLEAR RIBONUCLEOPROTEIN Q. [MASS=69603] 14 0
Homo sapiens ATP-DEPENDENT RNA HELICASE A.
[MASS=140881] (DDX9) 14 0
Homo sapiens ISOFORM 5 OF INTERLEUKIN
ENHANCER-BINDING FACTOR 3. [MASS=74607] (ILF3) 12 0
Homo sapiens ISOFORM SHORT OF HETEROGENEOUS
NUCLEAR RIBONUCLEOPROTEIN U. [MASS=88814] 10 0
Homo sapiens ISOFORM 1 OF HETEROGENEOUS
NUCLEAR RIBONUCLEOPROTEIN D0. [MASS=38434] 6 0
Homo sapiens ISOFORM 5 OF INTERLEUKIN
ENHANCER-BINDING FACTOR 3. [MASS=74607] (ILF3) 12 0
Homo sapiens HETEROGENEOUS NUCLEAR
RIBONUCLEOPROTEIN M ISOFORM A. [MASS=77516] 12 0
Homo sapiens HNRPA2B1 PROTEIN. [MASS=28412] 8 1
rRNA and Nucleolus
Homo sapiens ISOFORM 2 OF NUCLEOPHOSMIN.
[MASS=29465] (NPM) 14 2
Homo sapiens ISOFORM 1 OF NUCLEOLAR RNA
HELICASE 2. [MASS=87344] 8 0
Ribosomal Components
Homo sapiens (Human) 40S RIBOSOMAL PROTEIN S3.
[MASS=26688] 20 4
Homo sapiens (Human) DNA-BINDING PROTEIN
TAXREB107. [MASS=32891] (RPL6) 14 0
Homo sapiens (Human) 60S RIBOSOMAL PROTEIN L3.
[MASS=45978] 14 0
Homo sapiens (Human) 40S RIBOSOMAL PROTEIN S4 14 0
Homo sapiens (Human) 40S RIBOSOMAL PROTEIN S15.
[MASS=16909] 11 0
Homo sapiens (Human) 40S RIBOSOMAL PROTEIN S2.
[MASS=31324] 11

0

35
Table 1, Continued

Annotation
# of peptides
(PR-Set7)
# of peptides
(FLAG-HA)
Homo sapiens (Human) 60S RIBOSOMAL PROTEIN L5.
[MASS=34231] 11 0
Homo sapiens (Human) 40S RIBOSOMAL PROTEIN S9.
[MASS=22460] 11 0
Homo sapiens (Human) 40S RIBOSOMAL PROTEIN S18.
[MASS=17719] 11 0
Homo sapiens (Human) 60S RIBOSOMAL PROTEIN L23A.
[MASS=17695] 10 0
Homo sapiens (Human) 40S RIBOSOMAL PROTEIN S16.
[MASS=16314] 10 0
Homo sapiens (Human) 60S ACIDIC RIBOSOMAL
PROTEIN P0. [MASS=34274] 10 1
Homo sapiens (Human) 60S RIBOSOMAL PROTEIN L7A.
[MASS=29864] 10 0
Homo sapiens (Human) 40S RIBOSOMAL PROTEIN S8.
[MASS=24074] 10 0
Homo sapiens (Human) 60S RIBOSOMAL PROTEIN L4.
[MASS=47566] 10 0
Homo sapiens (Human) 40S RIBOSOMAL PROTEIN S7.
[MASS=22127] 9 0
Homo sapiens (Human) 60S RIBOSOMAL PROTEIN L31.
[MASS=14463] 9 0
Homo sapiens (Human) 40S RIBOSOMAL PROTEIN S14.
[MASS=16142] 9 0
Homo sapiens (Human) 60S RIBOSOMAL PROTEIN L8.
[MASS=27893] 9 0
Homo sapiens (Human) 40S RIBOSOMAL PROTEIN S17. 8 0
Homo sapiens (Human) 60S RIBOSOMAL PROTEIN L26-
LIKE 1. [MASS=17256] 8 0
Homo sapiens (Human) 60S RIBOSOMAL PROTEIN L27.
[MASS=15667] 8 0
Homo sapiens (Human) 40S RIBOSOMAL PROTEIN S13.
[MASS=17091] 8 0
Homo sapiens (Human) 60S RIBOSOMAL PROTEIN L7.
[MASS=29226] 8 0
Homo sapiens (Human) 60S RIBOSOMAL PROTEIN L9.
[MASS=21863] 7 1
Homo sapiens (Human) 60S RIBOSOMAL PROTEIN L18.
[MASS=21503] 7 0
Homo sapiens (Human) 60S RIBOSOMAL PROTEIN L13A. 7 0
Homo sapiens (Human) 60S RIBOSOMAL PROTEIN L14 7 0
Homo sapiens (Human) 60S RIBOSOMAL PROTEIN L10A. 6 1
Homo sapiens (Human) 40S RIBOSOMAL PROTEIN S6.
[MASS=28681] 6 0
Homo sapiens (Human) 60S RIBOSOMAL PROTEIN L28. 6 0
Homo sapiens (Human) 60S RIBOSOMAL PROTEIN L21.
[MASS=18434] 6 0
36
Table 2: Putative PR-Set7 binding proteins obtained from nuclear extracts
Annotation
# of peptides
(PR-Set7)
# of peptides
(FLAG-HA-
GFP)
DNA Damage
ATP-Dependent DNA Helicase 2 Subunit 2 (KU80) 6 0
ATP-Dependent DNA Helicase II, 70 KDA subunit (KU70) 3 0
Isoform 1 of DNA-Dependent Protein Kinase Catalytic
Subunit (DNA-PK) 2 0
Histones
Histone H2AV 3 0
Histone H4 3 0
Histone H2B Type1-L 2 0
Histone H2A Type 1-B 1 0
Splicing and RNA processing
Splicing Factor 3B Subunit 2 4 0
Splicing Factor 3B Subunit 1 2 0
Isoform 2 of U4/U6 Small Nuclear Ribonucleoprotein
PRP31 2 0
Heterogeneous Nuclear Ribonucleoprotein F 1 0
Splicing Factor 45 1 0
Ribosomal components
60S Ribosomal Protein L5 2 0
40S Ribosomal Protein S14 2 0
40S Ribosomal Protein S4, X Isoform 1 0
Replication
Proliferatin cell nuclear antigen 2 0
Miscellaneous
CDNA FLJ10100 FIS, Clone HEMBA1002469 2 0
Single-Stranded DNA-binding protein, Mito Precursor
(SSB) 2 0
11 KDA Protein 1 0
Isoform A of Ras-GTPase-activating protein binding protein
2 1 0
ALB Protein 1 0
Isoform 4 Apoptosis Inhibitor 5 1 0
Isoform 1 of Vezatin 1 0
Isoform 1 of Acetyl-CoA Synthetase 2-Like, Mito 1 0
37

Figure 4: PR-Set7 binds DNA-PK, Ku80 and PARP1 in vivo.
Tandemly tagged PR-Set7 or as negative controls FLAG-HA null (A) or FLAG-HA-GFP
(B) expression plasmids were transfected into HEK 293 cells followed by
immunoprecipitation with FLAG antibody. Western blot analysis was performed on input
(In) and bound (B) material using antibodies against endogenous (A) PARP1, Ku70,
Ku80 and (B) DNA-PK proteins.
38
co-immunopercipitation assay in HEK 293 cells overexpressing FLAG-Ku70 and DBD-
PR-Set7 were performed and subsequently FLAG-immunoprecipitated material was
analyzed by Western analysis using anti-DBD antibodies. Unfortunately results of this
assay were inconclusive and would have to be repeated again (data not shown).
Nevertheless, inability to verify Ku70 interaction with PR-Set7 suggests that perhaps PR-
Set7 associates with Ku complex via Ku80, while Ku70’s association with PR-Set7 is
indirect. An interesting observation supporting this prediction comes from mass
spectrometry data, where the abundance of peptides matched to Ku80 protein is
approximately two fold higher than that of Ku70 (Table 1 and 2). Since the number of
peptide matches in the mass spectrometry can be correlated to the abundance of proteins
in the bound material (Braisted, Kuntumalla et al. 2008), it is possible that the reduced
amount of Ku70 detected is due to its indirect association with PR-Set7. More
importantly, to verify that complex formation was not an artifact of the three factors
independently binding to DNA, immunoprecipitation experiments were carried out in the
presence of EtBr (ethidium bromide) to disrupt the DNA-protein interactions. These
experiments unfortunately yielded inconclusive results.
As a follow up to the above finding, we examined if DNA repair proteins are
found in the same genomic regions as H4K20me1, the mark of PR-Set7. Instead of
performing conventional whole cell immunofluorescence, immunofluorescence studies
on extended chromatin fibers from HEK 293 cells were performed. Extended chromatin
fibers allow visualizing the possible co-localization between H4K20me1 and the
endogenous DNA repair proteins at a lower organizational chromatin level. Consistent
with our previous findings significant overlap between H4K20me1 and PARP1 and Ku80
39
was detected, however regions where PARP1 or Ku80 without H4K20me1 were also
observed (Figure 5). In contrast, Ku70 was exclusively found with H4K20 monomethyl
mark supporting the finding that Ku70 is a novel H4K20me1 binding protein (discussed
in Chapter 3).
To further examine the relationship among PR-Set7, Ku70/80, DNA-PK and
PARP1 we asked whether PR-Set7 interacts with these proteins to regulate their function
via methylation. It has been reported that PR-Set7 SET domain recognizes
RHRK20VLRDN sequence on histone H4 tail which is required for successful
methylation of H4K20 in vitro (Yin, Liu et al. 2005) , however it is unclear whether
minimal consensus sequence recognized by the full length enzyme is the same. Analysis
of the amino acid sequences of each of the components of PR-Set7 multi-protein complex
reveled that only Ku70 contained RKV motif similar to that of H4 tail. Next, to determine
whether Ku70 is methylated by PR-Set7 in vitro histone methyltransferase assays
(HMTase) using recombinant PR-Set7 and Ku70 or Ku80, as a negative control was
performed. While PR-Set7 successfully methylated nucleosomes we failed to detect any
methylation of Ku70 or Ku80 proteins (Figure 6), suggesting that the role of PR-Set7
interaction with DNA repair proteins is independent of PR-Set7’s catalytic function.
Together these data demonstrates that PR-Set7 interacts with components of the DNA
repair machinery in vivo to recruit these proteins to H4K20me1-associated loci.

40

Figure 5: Histone H4 K20 monomethylation and components of PR-Set7 multi-
protein complex co-localize to the similar genomic regions along extended
chromatin fibers.

Extended chromatin fibers from HEK 293 cells were co-stained with the H4K20me1
(red) and Ku70, Ku80 or PARP1 (green). H4K20me1 preferentially co-localizes with
components of PR-Set7 multi-protein complex as seen by yellow in the merged image

41
Figure 6: Ku70 is not methylated by PR-Set7.
(A) Alignment of amino acid sequences of PR-Set7 substrate histone H4 and Ku70.
Asterick indicates PR-Set7 methylation site on H4 (B)Histone methyltransferase (HMT)
assay was performed by incubating recombinant PR-Set7 with Ku70 or Ku80 (negative
control) in the presence of 3H-labeled S-adenosyl methionine (SAM). As a positive
control and negative controls for HMT assay PR-Set7 was incubated with core histones
or nucleosomes, respectively. y-axis shows relative incorporation of 3H-SAM for each
reaction in counts per minute (CPM).

42
Summary, discussion and future directions
Recent findings strongly suggest that PR-Set7 and H4K20me1 play a protective
function in the genome as the loss of PR-Set7 results in the activation of DNA repair
pathways in Drosophila and sensitizes cells to genotoxic stress in S. pombe (Sanders,
Portoso et al. 2004; Sakaguchi and Steward 2007). In addition, loss of PR-Set7 and
H4K20me1 in human cells results in cell cycle defects, massive DNA damage and
genomic instability, however the mechanism of PR-Set7 and H4K20me1 in preventing
DNA damage and genomic instability is still not fully understood (Jorgensen, Elvers et
al. 2007; Tardat, Murr et al. 2007; Houston, McManus et al. 2008; Huen, Sy et al. 2008).
Our new data strongly suggests that this protection from DNA damage is provided by
PR-Set7’s ability to recruit the repair proteins to regions of the genome that are sensitive
to the DNA damage, thereby providing prompt response to fix DNA breaks (Figure 22).
Using unbiased biochemical purification approach, Ku 70/80, DNA-PK and PARP1 were
identified as members of the PR-Set7 multi-protein complex. These factors’ interaction
with PR-Set7 was further verified by standard co-immunoprecipitaion assays. These
experiments however did not demonstrate whether the interaction of Ku80, PARP1 and
DNA-PK with PR-Set7 is direct or indirect. This question is currently being addressed
through in vitro binding assays using recombinant proteins.
First, based on our preliminary results, we anticipate that Ku80 directly binds to
PR-Set7 to enable Ku70 to recognize H4K20me1 thus stabilizing the localization of the
repair machinery at specific loci. Furthermore, because Ku80 failed to interact with the
SET domain of PR-Set7 (Chapter 3), it is likely that Ku80 interacts with the N-terminal
region of PR-Set7. To confirm this prediction in vitro binding assays can be performed
43
using previously characterized PR-Set7 truncation mutants and recombinant Ku80
(Chapter 2, Figure 3C).
Second, extensive studies of non-homologous end-joining (NHEJ) pathway in
response to the DNA damage, have established that Ku heterodimer recruits DNA-PK to
the sites of DNA damage, while Ku mutant proteins that are unable to interact with DNA-
PK fail to repair DNA breaks (Mauldin, Getts et al. 2002; Merkle, Douglas et al. 2002).
These evidences hint that the interaction of DNA-PK with PR-Set7 is indirect and is
facilitated through Ku heterodimer. To support this theory, modified in vitro binding
assays using various combinations of Ku70, Ku80, and DNA-PK with PR-Set7
recombinant proteins will clarify minimal requirement for the recruitment of the DNA-
PK to PR-Set7 multi-protein complex. Alternatively, if the interaction between DNA-PK
and PR-Set7 is direct, then in addition to DNA-PK’s involvement in the DNA repair, it
could also play a role in regulating PR-Set7 function through phosphorylation. Previously
published data demonstrated that DNA-PK can phosphorylate proteins other than those
involved in the DNA repair pathway such as p53 and H2A.X (Lees-Miller, Sakaguchi et
al. 1992; Park, Chan et al. 2003). In addition, unpublished data (Shumin Wu) from our
lab provides evidence that PR-Set7 is phosphorylated in vivo, however the kinase
responsible for the phosphorylation event is not DNA-PK. Although it is not uncommon
for proteins to contain multiple phosphorylation sites therefore we cannot disregard the
possibility that PR-Set7 is phosphorylated by DNA-PK. This can be tested by performing
in vitro kinase assay using recombinant PR-Set7 and DNA-PK.
Lastly, there are two likelihood scenarios of PR-Set7 and PARP1 interaction. One
possibility is that PARP1 directly interacts with PR-Set7. If this is the case, PR-Set7 may
44
be recruiting PARP1 to the specific regions of the genome to serve as a sensor of the
DNA damage. It has been reported that once DNA damage occurs, PARP1 binds to the
sites of the DNA breaks (de Murcia and Menissier de Murcia 1994). The DNA binding
causes activation of catalytic activity of PARP1 thereby loosening nucleosome structure
near the DNA breaks and promoting the access of repair enzymes to these sites (de
Murcia and Menissier de Murcia 1994; Yu, Wang et al. 2002). Alternatively, direct
interaction of PARP1 and PR-Set7 may occur to facilitate ribosylation of PR-Set7 thus
adding another complexity layer to regulation of its function. This can be tested by
performing in vitro ribosylation assay using recombinant PARP1 and PR-Set7 proteins.
Second possibility is that interaction of PARP1 and PR-Set7 is facilitated via
DNA and instead of loosening chromatin to assist the repair of damaged DNA, it causes
chromatin condensation thereby providing an additional layer of protection from the
DNA damage. It has been reported that PARP1 binds nucleosomes and promotes the
compaction of nucleosomal arrays into higher order structures (Kim, Mauro et al. 2004)
and since PR-Set7 is nucleosomes specific histone methyltransferase (Nishioka, Rice et
al. 2002), it is possible that PARP1 and PR-Set7 binding is enhanced by the presence of
the DNA and these two proteins work in concert to protect genome integrity. To
distinguish the nature of PARP1 and PR-Set7 interaction, in addition to standard in vitro
binding assay using recombinant proteins, coimmunoprecipitation experiments in the
presence of DNase I, as an alternative to EtBr treatment (discussed above), can be
performed. Furthermore, the same assay can be used to examine whether the complex
formation is an artifact of PARP1, Ku70/80 and DNA-PK independently binding to
DNA, since the function of all these factors, including PR-Set7 itself, involves
45
association with the DNA. Once the network of interaction between PR-Set7 and its
binding partners is clearly defined, the role of each interacting protein in regulating PR-
Set7 function will be addressed through various approaches.
For example, co-localization studies using extended chromatin fibers
demonstrated that Ku70, Ku80, and PARP1 co-localize with the H4K20me1, strongly
suggesting that PR-Set7 multi-protein complex functions at specific genomic
H4K20me1-associated loci. Consistent with this data, Ku70 also have been shown to
bind H4K20me1 (Chapter 3) perhaps stabilizing PR-Set7 multi-protein complex
formation at these sites. These facts lead to an interesting question about PR-Set7 multi-
protein complex and its function in protecting specific locations of the genome from the
DNA damage. To demonstrate that PR-Set7 associated proteins are indeed found at
H4K20me1 positive regions to protect from the DNA damage, ChIP assays using
endogenous antibodies against Ku70, K80 and PARP1 in normal cells as compared to
cells depleted of PR-Set7 can be performed (H4K20me1 negative regions used as a
negative control) . We anticipate that, in the absence of PR-Set7 and subsequent
reduction of H4K20me1 at these loci, the recruitment of the DNA repair proteins will be
abolished, thus exposing the DNA to the damage. Furthermore, to monitor accumulation
of the DNA damage at H4K20me1 targets in cells lacking PR-Set7 as compared to
control, accumulation of γH2AX foci at the sites of damage can be monitored by
performing ChIPs using γH2AX antibodies or by monitoring γH2AX foci formation by
immunofluorescence staining. As an alternative in vitro approach, plasmid based assay
for DNA-end joining in vitro(Iliakis, Rosidi et al. 2006) can be performed to directly
access PR-Set7’s involvement DNA repair pathway. This assay uses DNA plasmid as
46
substrate for the in vitro DNA repair reaction involving nuclear extracts isolated from
cells of interest (in this case comparing control to PR-Set7 depleted cells). Then, the
efficiency of the DNA repair of the substrate can be evaluated by the gel electrophoresis.
In conclusion, we have provided first evidence towards implicating PR-Set7 in the
direct protection of the genome from DNA damage by interacting with the DNA repair
proteins. Future studies will help to elucidate the exact mechanism by which PR-Set7
multi-protein complex functions to prevent DNA damage at H4K20me1 loci.

47
Chapter 2: UBC9 Mediated Sumoylation of PR-Set7 is Involved in Regulation of
Gene Repression.

Yeast two-hybrid system is a well known technique commonly used to identify
novel protein-protein interactions (Fields and Song 1989; Chien, Bartel et al. 1991). The
principle of yeast two-hybrid is based on the interaction between a bait protein, that is
expressed as a fusion to the GAL4 DNA-binding domain (DNA-BD), and another library
protein, that is expressed as a fusion to the GAL4 activation domain (AD). When the bait
and library fusion proteins interact, the DNA-BD and AD are brought into close
proximity, thus activating transcription of specific reporter genes that are controlled by
GAL4-responsive upstream activating sequences (UASs) and promoter elements. We
sought to employ yeast-two hybrid (MATCHMAKER GAL4 Two-Hybrid System 3;
Clonetech) to find PR-Set7 binding proteins. In this system, an yeast strain AH109 (Table
3) was used to screen for positive interactions. This strain contains three reporter genes:
ADE2, HIS3 and MEL1, thereby allowing to perform screen using either medium
stringency conditions, where only expression of HIS3 reporter gene is measured or high
stringency, where all 3 reporter genes are used as indicators of binding. The bait plasmid
was created by inserting PCR-amplified fragment encoding full length human PR-Set7
into NdeI-BamHI restriction sites of pGBKT7 plasmid containing DNA-BD. The
resultant GAL4 DNA-BD-PR-Set7 plasmid or pGBKT7-GAL4 DNA-BD alone (control)
was transformed into AH109 yeast strain using standard LiAc protocol (BD Biosciences
Clontech Yeast Protocols Handbook). Whole cell lysates from the yeast strain expressing
DNA-BD-PR-Set7 or DNA-BD alone (negative control) were analyzed by Western
analysis to confirm expression of DNA-BD-PR-Set7 bait protein (Figure 7A). We also
48
Table 3: Genotypes of yeast strains used for yeast two-hybrid screen.
Strain Genotype References
AH109 MATa, trp1-901, leu2-3, 112,ura3-52,
his3-200, gal4 , gal80 ,
LYS2::GAL2
UAS
-GAL1
TATA
-
HIS3,GAL2
UAS
-GAL2
TATA
-ADE2,
URA3::MEL1
UAS
-MEL1
TATA
-LACZ
(James, Halladay et al.
1996)

Y187 MATα, ura3-52, his3-200,ade2-
101,trp1-901,leu2-3, 112,gal4 ,met
-
,
gal80 ,URA3::GAL1
UAS
-GAL1
TATA
-
lacZ
(Harper, Adami et al.
1993)

AH109 is host strain used to express DNA-BD fusion bait protein. Pre-transformed
human HeLa cDNA library was created in Y187 yeast strain, which was used as a mating
partner to AH109 strain to screen for novel protein-protein interactions.

49

Figure 7: Characterization of the yeast strain AH109 expressing DNA-BD-PR-Set7
bait protein.

(A) DNA-BD-PR-Set7 is expressed in yeast as demonstrated by Western analysis of
whole cell lysates obtained from AH109 strain transformed with DNA-BD-PR-Set7 or
negative control, DNA-BD alone. (B) Expressing PR-Set7 in yeast does not affect
AH109 yeast strain phenotype, whereas expressing SET domain containing C-terminal
part of PR-Set7 result in slow growing phenotype. AH109 strain expressing indicated
proteins was grown in liquid culture to OD
600
=0.8, then 10 fold serial dilutions were
spotted onto YPD or tryptophan lacking plates (to select for DNA-BD-PR-Set7 or DNA-
BD alone) and grown at permissive temperature (30 C)

50
tested whether expressing human PR-Set7 protein in yeast lacking PR-Set7 homolog, will
result in slow growing phenotype by performing serial dilution based growth assay
(Figure 7B). No apparent difference in growth of PR-Set7 expressing yeast strain was
observed as compared to DNA-BD only expressing strain. Next we proceeded with the
yeast two-hybrid by mating AH109 strain expressing either DNA-BD-PR-Set7 or DNA-
BD only, to pre-transformed human HeLa Matchmaker cDNA library (Clonetech; Cat#
HY4027AH) in Y187 yeast strain (Table 3). Then, mated yeast (representing 1.3 x 10^7
independent clones) were selected on medium stringency yeast plates lacking histidine
and with 5mM 3-AT (3-amino-1, 2, 4-triazole) added to suppress background growth.
The surviving colonies were re-streaked on both medium and high stringency plates
(without histidine and adenine, but with X-alpha-Gal added to screen for MEL1
expression) to assure maintenance of correct phenotype. Out of 18 positive clones
obtained, only 3 displayed correct phenotype on both medium and high stringency plates
(Table 4). Although the number of positive clones obtained was strikingly low, which
could partially be attributed to the low mating efficiency (less than 2%) of AH109 strain
expressing PR-Set7 as compared to the control strain (mating efficiency ~4%), we
continued analysis of the 3 positive clones. Plasmid DNA from yeast expressing PR-Set7
and each of the 3 potential novel binding proteins was isolated using YEASTMAKER
Yeast Plasmid Isolation Kit (Clontech). Yeast-purified plasmid DNA was then
transformed into E.coli DH5 to select for transformants containing only the
AD/library plasmid (as oppose to DNA-BD plasmid containing kanamycin selection
marker) by selecting on LB medium containing ampicillin and the cDNA inserts were
sequenced using T7 Sequencing Primer. Positive clones included UBC9, PJA2, and
51
Table 4: List of putative PR-Set7 binding proteins as identified by yeast two-hybrid.

Clone # cDNA Insert Function
1 E2I (yeast homolog of UBC9) Sumoylation-conjugating enzyme, E2
14 PJA2 (Ch5 Clone
CTC2128F4)
RING-finger protein contains cystine-
rich, zinc-binding domain and is
involved in the formation of
macromolecular scaffolds important for
transcriptional repression and
ubiquitination.
16 MGC32020 Hypothetical protein possibly plays a
role in the DNA repair.

Positive clones listed above were obtained by medium stringency screen. Their true
positive phenotype was confirmed by testing their survival on high stringency media.

52
MGC32030 (Table 4). While no further investigation was performed to characterize
PJA2 and MGC32030; UBC9 (UBE2I) conjugation enzyme, which plays a role in
heterochromatin formation and gene silencing (Shin, Choi et al. 2005) was the most
interesting among identified proteins, therefore became the focus of this study. For
example, UBC9 interacts with and sumoylates heterochromatin proteins Swi6 and Chp2
leading to heterochromatin formation, while defective sumoylation of these two proteins
compromises gene silencing (Shin, Choi et al. 2005). Since PR-Set7 also is involved in
chromatin condensation resulting in transcriptional repression (Sims, Houston et al. 2006;
Sims and Rice 2008), we hypothesize that UBC9 and PR-Set7 function together to
repress gene transcription through H4K20me1 silencing pathway (Figure 13C).

Identification of UBC9 as a PR-Set7 interacting protein
To solidify that clone #1 bearing cDNA corresponding to UBC9 is a true positive,
the plasmid DNA extracted from DH5α was re-transformed into fresh batch of AH109
yeast strain together with the bait plasmid containing either full length PR-Set7 or N-
terminal domain of PR-Set7 (amino acids 1-191) and tested for survival on medium and
high stringency plates again. The expression of the C-terminal domain of PR-Set7 (amino
acids 146-352) in AH109 resulted in slow growing phenotype and therefore was not used
in this set of experiments (Figure 7B). The interaction between PR-Set7 and UBC9 was
proven to be specific because co-expression of UBC9 with PR-Set7 full length or
PR-Set7 N-terminal activated HIS3, ADE2 and lacZ/MEL1 reporter genes present in the
indicator yeast strain therefore allowing co- transformants to survive on selective
medium. Growth of co-transformants on selective medium indicated direct interaction
53
Figure 8: UBC9 is PR-Set7 binding protein as identified by yeast-two-hybrid screen.

(A) Schematic representation of the constructs used for the yeast two-hybrid
screen/assay. Yeast-two hybrid screen was performed using full length PR-Set7 as bait.
hUBC9 protein missing 32 amino acids at the C-terminus (amino acids 1-126) bound to
PR-Set7. (B) The interaction between UBC9 and full length PR-Set7 (WT) or N-terminus
PR-Set7 (N) were examined by yeast two-hybrid assay. Gal4DBD-PR-Set7 (WT) or (N)
and Gal4AD-UBC9 were co-transformed into AH109 yeast strain. Yeast expressing PR-
Set7 and UBC9 proteins were grown on SD medium lacking: tryptophan and leucine
(DDO); tryptophan, leucine and histidine (TDO); or tryptophan, leucine, histidine,
adenine with addition of X-alpha-galactosidase (QDO+X-alpha-Gal). Growth of co-
transformants on TDO and QDO+X-alpha-Gal medium indicates direct interaction
between PR-Set7 and UBC9. (C) Co-immunoprecipitation assay of DBD-Myc-PR-Set7
and HA-UBC9 in yeast further confirmed UBC9/PR-Set7 interaction. Yeast cell lysates
were immunoprecipitated with anti-HA antibody and bound fractions were analyzed by
Western analysis using anti-PR-Set7 (top panel) or anti-UBC9 (bottom panel) antibodies.
In= input; U= flow through; B= bound.

54

55
between UBC9 and PR-Set7 full length and N-terminal, whereas the control reactions
containing DNA-BD-PR-Set7 and AD, DNA-BD and AD-UBC9 or AD and DNA-BD
alone, failed to survive (Figure 8B). To verify UBC9 and PR-Set7 interaction in yeast
using an independent approach from yeast-two hybrid we performed co-
immunoprecipitation assays in yeast. As shown in Figure 8C, full length DBD-My-PR-
Set7 co-precipitated in the bound fraction containing HA-UBC9 and not HA tag alone,
demonstrating that indeed UBC9 specifically interacts with PR-Set7. From the above
results we conclude that UBC9 is a novel PR-Set7 binding partner and that interaction
surface for UBC9 with PR-Set7 is most likely in the N-terminal domain, since
eliminating PR-Set7 C-terminal containing SET domain did not abolish PR-Set7 and
UBC9 association.

PR-Set7 and UBC9 interact in vivo
To investigate how UBC9 binding can influence the function of PR-Set7, we next
sought to determine whether UBC9 and PR-Set7 interact in mammalian cells. HEK 293
cells were transfected with FLAG tagged PR-Set7 or FLAG tag alone (negative control)
and immunoprecipitations using an anti-UBC9 antibody followed by immunoblotting
with an anti-FLAG antibody was performed. As shown in Figure 9A, endogenous UBC9
interacted with FLAG-PR-Set7 and not FLAG-tag alone, the binding efficiency was low.
Structural and kinetics studies of UBC9 binding to known targets such as p53, PML and
c-jun have demonstrated that UBC9 interacts with its substrate with
relatively low affinity and that the enzyme-substrate intermediate dissociates rapidly
(Lin, Tatham et al. 2002; Tatham, Kim et al. 2003). Therefore, we hypothesized that
56
UBC9 and PR-Set7 interaction is resolved in weak co-immunoprecipitations. To
demonstrate this, co-immunoprecipitation assays in the presence of bismaleimidohexane
(BMH) crosslinking reagent were performed. HEK 293 cells were co-transfected with
Myc-UBC9 and FLAG-PR-Set7, crosslinked with BMH, and subsequently PR-Set7 was
immunoprecipitated using anti-FLAG antibodies and Western analysis was performed on
the bound material. As a negative and positive control Myc-UBC9 and FLAG-null or
Myc-UBC9 and FLAG-p53, were used respectively. As predicted, treating cells with
BMH prior to immunoprecipitations substantially enhanced the level of UBC9 binding to
PR-Set7 compared to non-treated cells (Figure 9B). In contrast, no significant binding
was detected in the co-precipitates from the control cells. Collectively, these findings
confirmed that UBC9 and PR-Set7 engage in a specific interaction in vivo suggesting
involvement of UBC9 in regulation of PR-Set7 function and hence PR-Set7 mediated
cellular processes.

The N- terminus domain of PR-Set7 mediates direct interaction with UBC9
To further map the domain of interaction between PR-Set7 and UBC9, we
performed a series of in vitro binding assays. First, to confirm that these two proteins
indeed directly bind, we expressed and purified recombinant His-S-Tag-PR-Set7 and
GST-UBC9 from bacterial extracts (Figure 10A). Next, increasing amounts of His-S-
Tag-PR-Set7 was used to immunoprecipitate GST-UBC9 or GST alone as described in
the Material and Methods. As shown in Figure 10B, recombinant PR-Set7 interacts with
GST-UBC9, but not with GST alone demonstrating that this association is direct. To
determine the region of PR-Set7 responsible for binding with UBC9 we performed GST
57
pull-down assays using truncated forms of PR-Set7 and full length GST-UBC9 (Figure
10C). We created truncation mutants of PR-Set7 dividing the protein into non-conserved
N-terminal (amino acids 15-126) and catalytic SET domain containing C-terminal (amino
acids 128- 352) parts. Consistent with the structural and functional studies of PR-Set7
we postulated that PR-Set7 interaction will be mediated by an undefined portion of its N-
terminal since the interaction in the region of catalytic SET domain may disrupt its
methyltransferase activity (Nishioka, Rice et al. 2002; Couture, Collazo et al. 2005) . To
test this hypothesis, in vitro translated
35
S labeled full length PR-Set7, N- or C-terminal
proteins were incubated with purified recombinant GST-UBC9 or GST alone (negative
control), followed by the incubation with glutathione-conjugated sepharose beads. The
bead-bound material was extensively washed and analyzed by autoradiography or
Western analysis using anti-GST or anti-UBC9 antibodies. PR-Set7 and the N-terminal
region of PR-Set7 bound to UBC9, whereas C-terminal region did not (Figure 10D).
Together these results confirm our yeast two-hybrid results that PR-Set7 and UBC9
directly interact and that the N-terminus of PR-Set7 mediates this interaction.

The N-terminus of PR-Set7 is modified by SUMO1 in vitro
Since UBC9 functions as a SUMO E2 conjugating enzyme (Bernier-Villamor,
Sampson et al. 2002; Yunus and Lima 2006) and can directly interact with and modify
substrates containing consensus motif KxD/E (Sampson, Wang et al. 2001), we
hypothesized that PR-Set7 would encompass sumoylation consensus sequence and be
58

Figure 9: PR-Set7 interacts with UBC9 in vivo.
(A) PR-Set7 interacts with the endogenous UBC9 in HEK 293 cells. Cell lysates
expressing FLAG-PR-Set7 or FLAG tag alone were immunoprecipitated with anti-UBC9
antibody. Bound fractions were analyzed by Western analysis using anti-FLAG (top
panel) or anti-UBC9 (bottom panel) antibodies. (B) In vivo interaction of UBC9 and PR-
Set7 was further validated by co-immunoprecipitation in HEK 293 cells in the presence
of BMH crosslinking reagent. FLAG-PR-Set7 and Myc-UBC9 expressing HEK 293 cells
were treated with 10µM BMH. Whole cell lysates were immunoprecipitated with EZview
Red anti-FLAG M2 affinity gel followed by Western analysis of the bound material with
anti-Myc or anti-FLAG antibodies. In= input; U= flow through; B= bound
59
sumoylated within its N-terminal domain. Inspection of the amino acid sequence of PR-
Set7 for the sumoylation consensus sequence revealed two major putative sumoylation
sites at the N-terminus (lysine 110 and lysine 131 residues; Figure 11A). Both sites are
found in higher mammals and chicken suggesting that these SUMO motifs, at least in
part, are evolutionally conserved (Figure 11A). We next tested whether PR-Set7 can be
covalently modified by SUMO1 in vitro. Recombinant PR-Set7 encompassing aa15-352,
recombinant N-terminal domain only (aa 15-191) or in vitro translated C-terminal
domain of PR-Set7 containing aa128-352 were used for in vitro sumoylation reactions.
As seen on Figure 5B, an additional band of slower mobility was observed when SUMO1
wild type was present in the reaction with PR-Set7 or N-terminal domain only, however
was missing from the sample containing C-terminus. This band was also absent in the
negative control reactions where sumoylation-incompetent SUMO1 mutant was used
indicating that the band of slower mobility indeed is sumoylated PR-Set7. These results
also suggest that Lysine 110 (K110) is likely a major SUMO1 acceptor site because C-
terminus of PR-Set7 containing only lysine 131 (K131) site failed to be sumoylated.
Together, these data demonstrate that PR-Set7 is sumoylated in vitro and that lysine 110
residue within N-terminal domain of PR-Set7 is the best candidate for SUMO1 acceptor
site.

ARIP3, an E3 ligase, is required for PR-Set7 sumoylation in vivo
To investigate whether PR-Set7 is sumoylated in vivo, HEK 293 cells were co-
transfected with FLAG- PR-Set7 and GFP-SUMO1 in the presence or absence of N-
ethylmaleimide (NEM), an inhibitor of SUMO hydrolyases. Next, whole cell lysates were
60
collected and subjected to FLAG immunoprecipitations followed by Western analysis
using an anti-FLAG antibody.
In contrast to our in vitro studies, we were unable to observe a shift in the
molecular weight of PR-Set7 when overexpressing SUMO-1 even in the presence of
NEM (Figure 11C, lanes 5 and 6). However, in reconstituted sumoylation assays E3
ligases are dispensable, but in physiological context these proteins play an important role
in regulating post-translational sumoylation of proteins. Therefore, we hypothesized that
an E3 ligase could play a critical role in mediating conjugation of SUMO-1 to PR-Set7.
The two known E3 ligases, PIAS1 and ARIP3/PIASxα which both belong to protein
inhibitor of activated STAT (PIAS) family, have been implicated in transcriptional
repression by enhancing sumoylation of various transcription factors, transcriptional co-
regulators, and chromatin-remodeling proteins (Lyst, Nan et al. 2006; Tiefenbach, Novac
et al. 2006; Muraoka, Maeda et al. 2008). As shown in Figure 11C (lanes 1 and 2), co-
expression of FLAG-PR-Set7, GFP-SUMO1 with ARIP3/PIASxα in the presence of
NEM resulted in the additional band corresponding to PR-Set7-SUMO1, however this
band was not observed in the reaction lacking NEM treatment (negative control). PR-
Set7 failed to undergo modification in cells overexpressing PIAS1 as an E3 ligase (Figure
11C, lanes 3 and 4). Collectively these results illustrate that PR-Set7 is sumoylated in
vivo in ARIP3/PIASxα E3 ligase-dependent manner.
61

Figure 10: Direct interaction between PR-Set7 and UBC9 is mediated via N-
terminal domain of PR-Set7.

(A) SDS-PAGE analysis of purified recombinant proteins visualized by Coomassie
staining. (B) Recombinant His-S-tag-PR-Set7 was incubated with GST-UBC9 or GST
alone, followed by anti-S-tag immunoprecipitation. Western analysis of the bound
material using anti-UBC9 (top panel) or anti-His (bottom panel) antibodies confirmed
direct interaction between UBC9 and PR-Set7. (C) Schematic diagram of truncated forms
of PR-Set7. (D) N-terminal domain of PR-Set7 directly binds UBC9. GST pull down-
assay with recombinant GST-UBC9 or GST alone and in vitro translated S
35
labeled PR-
Set7 showed specific binding of UBC9 to N-terminal region of PR-Set7 but not C-
terminal.
62
Figure 11: N-terminal domain of PR-Set7 is sumoylated in ARIP3, E3 ligase
dependent manner.

(A) Predicted sumoylation sites K110 (perfect consensus sequence) and K131 (partial
consensus sequence) are conserved in higher mammals and chicken. Putative
sumoylation sites on schematic diagram of PR-Set7 were predicted using SUMOsp 2.0.
PR-Set7 sequences containing sumoylation sites were aligned using ClustalX. Conserved
residues are illustrated in color and red asterisks mark K110 and K131 sumoylation target
sites. (B) In vitro sumoylation assay of recombinant PR-Set7 (aa 15-352), recombinant
PR-Set7 N-terminal (aa 15-191) and in vitro translated PR-Set7 C-terminal (aa 128-352)
was performed using SUMOlink SUMO-1 Kit. Reactions were resolved on SDS-PAGE
gel followed by Western analysis using anti-His and anti-SUMO1 antibodies or
autoradiography. (C) In vivo sumoylation assay illustrates that ARIP3, a SUMO E3
ligase, is necessary for PR-Set7 sumoylation. HEK 293 cells were co-transfected with
indicated expression plasmids. Cell extracts were collected 48h post-transfection in the
presence or absence of 10 mM NEM, followed by immunprecipitaions using anti-FLAG
antibody. Bound material was resolved on SDS-PAGE gel and subjected to Western
analysis using anti-FLAG antibody.
63

64
UBC9 is required for PR-Set7 mediated gene repression
As previously discussed, PR-Set7 enzyme is the only known H4K20
monomethyltransferase (Fang, Feng et al. 2002; Nishioka, Rice et al. 2002; Couture,
Collazo et al. 2005; Xiao, Jing et al. 2005). PR-Set7 directs H4K20me1 to specific genes
and this histone modification is sufficient to repress the target gene’s transcription in vivo
(Sims, Houston et al. 2006). We demonstrated that UBC9 physically interacts with PR-
Set7, but whether this interaction has any effect on PR-Set7 function was still unclear. To
test whether UBC9 influences PR-Set7 activity, we analyzed global levels of H4K20me1
in cells overexpressing wild type UBC9 or previously characterized catalytically inactive
dominant negative mutant of UBC9 (C93S) or cells depleted of UBC9 by shRNA (Mo,
Yu et al. 2004). As shown in Figure 12 and Figure 13A, global levels of H4K20me1 did
not change suggesting that UBC9 regulates PR-Set7 function at a specific sub-set of
genes rather than globally. Since both PR-Set7 and UBC9 have been implicated to play a
role in gene repression (Shin, Choi et al. 2005; Kalakonda, Fischle et al. 2008; Kim, Park
et al. 2008; Sims and Rice 2008), we hypothesized that UBC9, and ARIP3 ligase
mediated sumoylation of PR-Set7 is involved in maintaining transcriptional silencing of a
sub-set of PR-Set7 target genes. To test this theory, a panel of PR-Set7 target genes were
examined for changes in transcriptional status upon UBC9 knock down. NFKBIZ,
VAMP1, and UBE2L6 are representative PR-Set7 target genes that were identified by
Illumina expression array (unpublished data, Lauren Congdon and Sai Veerappan), where
gene expression profiles of cells depleted of PR-Set7 was compared to untreated control
cells. To demonstrate that these genes are indeed true targets of PR-Set7 by examining
each gene separately, HEK 293 cells were transfected with a control shRNA vector (null)
65
or shRNA vector that specifically depletes cells of PR-Set7. We achieved 70 % reduction
of PR-Set7 expression level, as demonstrated by quantitative real-time PCR (qRT-PCR;
Figure 13A, left), and a significant decrease in the protein level and reduction in global
H4K20me1, as illustrated by Western blot analysis (Figure 13A, left). This reduction of
PR-Set7 levels lead to ~2.5 fold or more increase in the expression of PR-Set7 target
genes regardless of their basal expression level as measured by qRT-PCR (Figure 13B,
left). As a negative control we used, H4K20me3 target gene (unpublished data, Lauren
Congdon and Sai Veerappan), CBR1, whose expression was not altered by the PR-Set7
knock down. Next, to deplete cells of UBC9, HEK 293 cells were transfected with
control shRNA or UBC9 shRNA plasmids. The efficiency of knock down was examined
by measuring both expression and protein levels of the target protein (Figure 13A, right).
To investigate if UBC9 and thus sumoylation play a role in regulating transcription of
PR-Set7 target genes, we analyzed expression of NFKBIZ, VAMP1, UBE2L6, and CBR1
for changes in transcriptional status. As shown in Figure 13B, all three genes displayed
significant de-repression in UBC9 depleted cells as compared to mock treated cells, while
the expression of CBR1, negative control, remained unaffected. Altogether the above
data demonstrates that UBC9 is necessary for PR-Set7 mediated transcriptional silencing
of a panel of PR-Set7 target genes.

Summary, discussion and future directions
We previously demonstrated that PR-Set7 mediated H4K20me1 is important for
maintaining transcriptional repression of specific genes (Sims, Houston et al. 2006;
Kalakonda, Fischle et al. 2008; Sims and Rice 2008), however the temporal sequence of
66
events leading to such biological outcome is not fully defined. While the exact
mechanism of PR-Set7 catalytic activity towards histone H4 lysine 20 residue has been
reported through various structural and kinetic approaches(Fang, Feng et al. 2002;
Nishioka, Rice et al. 2002; Couture, Collazo et al. 2005; Xiao, Jing et al. 2005), the
molecular mechanisms of PR-Set7 enzyme regulation are largely elusive. In this study we
sought to gain better insights into regulation of PR-Set7 protein through identification of
its interacting partners. We identified UBC9 as a PR- Set7 novel binding protein by yeast
two-hybrid screen (Figure 8). This interaction was verified by both immunoprecipitations
in yeast and in vitro binding assays. Furthermore, through truncation analysis we
determined that the N-terminal domain of PR-Set7; specifically amino acids 15-126, are
responsible for association with UBC9 (Figure 10). This is consistent with the current
knowledge of PR-Set7 structure, in which evolutionarily conserved SET domain
containing C-terminal region of PR-Set7 possesses catalytic activity and is directly
involved in methyl group transfer by recognizing stretch of amino acid sequence
surrounding K20 residue (Cheng, Collins et al. 2005; Couture, Collazo et al. 2005; Yin,
Liu et al. 2005). Since placing H4K20me1 mark at PR-Set7 target genes is absolutely
necessary for maintaining transcriptionally inactive state, protein-protein interaction
occurring within C-terminal regions of PR-Set7 would directly interfere with its catalytic
activity thereby causing deregulation of transcription. Because UBC9 has been
implicated to play a role in transcriptional repression(Girdwood, Bumpass et al. 2003;
Kim, Park et al. 2008) we anticipated that UBC9 will serve as a positive regulator of PR-
Set7 function, therefore its binding to non-conserved N-terminal portion of PR-Set7
67

Figure 12: Overexpression of UBC9 does not affect global level of H4K20me1 in
HEK 293 cells.

HEK 293 cells were transfected with plasmids expressing Myc (Mock), Myc-UBC9 wild
type or Myc-UBC9 (C93S) catalytically inactive mutant. Whole cell lysates were
collected 48h post-transfection. Samples were resolved on SDS-PAGE gel, followed by
Western analysis using anti-Myc, anti-H4K20me1, or anti-H4 antibodies.

68
Figure 13: Depletion of UBC9 results in de-repression of PR-Set7 target genes.

HEK 293 cells were transfected with shRNA plasmids against PR-Set7 or UBC9 (Table
8). (A) qRT-PCR and Western analysis were performed to determine the expression and
protein levels of PR-Set7 or UBC9, respectively. (B) qRT-PCR analysis was performed
to analyze the expression levels of three PR-Set7 and H4K20me1 target genes or CBR1
(negative control) in cells containing the control shRNA (black), or PR-Set7 or UBC9
shRNA (grey bar) plasmids. Results were normalized to 18S expression and plotted as n-
fold increase relative to null (black bar). Fold change was calculated using the 2^(- Ct)
and plotted relative to the values of null transfected cells, normalized to 1.Three technical
replicates were used to generate standard deviations. Statistical significance was
calculated using student-T test, where asterisks correspond to p 0.05. Similar de-
repression phenomenon of these genes was observed in biological replicates. (C)
Proposed model of how UBC9 plays a role in PR-Set7 mediated gene repression. UBC9
binds PR-Set7 and sumoylates it at N-terminal domain (likely K110). Sumoylated PR-
Set7 is targeted to monomethylate H4K20 at particular sub-set of genes to maintain
repressive state.
69

70
should not impede on its catalytic activity. In order to establish biological relevance of
this interaction we first investigated whether PR-Set7 and UBC9 association occurs in
mammalian cells. We found that endogenous UBC9 binds to PR-Set7 in HEK 293 cells,
however low level of binding was detected (Figure 9). This is presumably because the
interaction between UBC9 and its substrate is transient, as previously described in the
literature (Bernier-Villamor, Sampson et al. 2002; Tatham, Chen et al. 2003).
To improve the detectible level of UBC9 binding to PR-Set7 we examined this
interaction in the presence of crosslinking reagent. Our findings confirmed that
crosslinking enhanced UBC9-PR-Set7 complex formation in mammalian cells suggesting
that PR-Set7 is a true target substrate of UBC9. Since predominant role of UBC9 is to
target proteins for post-translational modification with different SUMO moieties (Gong,
Kamitani et al. 1997; Johnson and Blobel 1997; Sampson, Wang et al. 2001; Shiio and
Eisenman 2003), we asked whether PR-Set7 is subjected to sumoylation. Identification
of two consensus sequences within N-terminal portion of PR-Set7, K110 (MKSE) and
K131 (QKSEA) (Figure 11), supported our rationale that sumoylation is involved in
regulation of PR-Set7 function. These two PR-Set7 sumoylation motifs are conserved
among mammals and chicken suggesting that this type of PR-Set7 regulation is at least
partially conserved through evolution. Finally, we provided first evidence that PR-Set7 is
sumoylated in vitro and in vivo and that K110 residue within N-terminal region of PR-
Set7 is most likely a SUMO-1 acceptor site (not SUMO2/3, data not shown). However,
in order to confirm that K110 indeed is a major SUMO1- acceptor site, point mutants of
PR-Set7 with each of the two lysines changed to alanine (K110A and K131A) must be
created and analyzed in in vitro sumoylation assay. Surprisingly, in vivo we were unable
71
to detect sumoylated PR-Set7 without overexpression of ARIP3, suggesting that E3
ligase is required for PR-Set7 sumoylation. However it cannot be formally excluded that
in vivo, the level of PR-Set7 sumoylation is too low to detect, because different lines of
evidence have shown that E3 ligases strongly enhance sumoylation of target proteins,
which is often marginal in vitro and in vivo in the presence of only E1 and E2 enzymes
(Kirsh, Seeler et al. 2002; Yang, Kim et al. 2008). In spite of this, ARIP3 is involved in
sumoylation of PR-Set7. The role of ARIP3 in regulating PR-Set7 function remains an
open question, which can be answered by detailed investigation of ARIP3-PR-Set7
interaction. By performing series of in vitro and in vivo binding assays, we would be able
to establish whether ARIP3 directly binds PR-Set7. It is likely that the interaction of
ARIP3 with PR-Set7 is mediated through C- terminal region of ARIP3. This is because
PIAS1 failed to promote sumoylation of PR-Set7 and the major structural difference
between ARIP3 and PIAS1 is the serine/threonine-rich C-terminal region (Wu, Wu et al.
1997; Moilanen, Karvonen et al. 1999). In addition to promoting PR-Set7 sumoylation,
ARIP3 can alter PR-Set7’s function in E3 ligase independent manner by controlling its
nuclear localization. This can occur via SAP or SIM domains of ARIP3, which are not
required for the SUMO E3 ligase activity (Kotaja, Karvonen et al. 2002). To examine
whether ARIP3 can change PR-Set7’s sub-nuclear localization immunofluorescence
studies tracing PR-Set7 localization can be performed in cells overexpressing PR-Set7
alone as compared to cells overexpressing PR-Set7 together with ARIP3. Since physical
interaction of ARIP3 with PR-Set7 might be important for PR-Set7’s targeting to
appropriate regions of chromatin, and is necessary for PR-Set7 sumoylation, as
demonstrated in this study, it is logical to conclude that availability of ARIP3 ligase to
72
interact with PR-Set7 is a limiting step in PR-Set7 regulation. Therefore by controlling
levels of ARIP3 and by using H4K20me1 as readout of PR-Set7’s function, the affect of
ARIP3 on PR-Set7 can be analyzed by monitoring changes in global H4K20me1 upon
overexpression or downregulation of ARIP3. Lastly, monitoring expression of PR-Set7
target genes in cells overexpressing or depleted of ARIP3 can link PR-Set7-ARIP3
interaction to regulation of transcriptional repression.
To begin addressing the biological relevance of the interaction between UBC9
and PR-Set7 we first wanted to examine if UBC9 is involved in regulation of the PR-Set7
mediated silencing pathway. As reported previously, UBC9, its SUMO-1 addition, and
PR-Set7 are important for heterochromatin formation and gene silencing [12, 21, 49, 50].
In addition, UBC9 and PR-Set7 both show an embryonic lethal phenotype when
inactivated and are involved in regulation of G2/M cell cycle progression [6, 7, 51, 52].
These findings suggest that UBC9 and PR-Set7 are converging along the same biological
pathway.
To examine the effect of UBC9 dependent sumoylation of PR-Set7 on its function
in transcriptional repression, PR-Set7 target genes in cells depleted of UBC9 were
analyzed for changes in expression. The loss of UBC9 protein and therefore its enzymatic
activity will ensure complete abolishment of PR-Set7 sumoylation even in the presence
of ARIP3 endogenous levels. Reduced levels of UBC9 resulted in differential
derepression of subset of PR-Set7 target genes, suggesting that UBC9 is required for PR-
Set7 mediated gene silencing. These results open many more questions about the
mechanism of UBC9 mediated regulation of PR-Set7. For example, recent studies have
demonstrated that recruitment of histone deacetylases (HDACs) to sumoylated targets is
73
related to transcriptional repression [39, 53]. In addition, unpublished data from our lab
(Shumin Wu) have demonstrated that PR-Set7 multi-protein complex associates with the
strong deacetylase activity most likely caused by the interaction between PR-Set7 and
HDAC1. Based on the above stated findings it is possible that PR-Set7-SUMO1 recruits
an HDAC complex to its target genes, resulting in histone deacetylation. A lack of
histone acetylation at these target genes could therefore permit PR-Set7 mediated
H4K20me1 and subsequent transcriptional repression. This hypothesis can be tested by
performing chromatin immunoprecipitation (ChIP) assays comparing levels HDAC1 and
acetylated histones at PR-Set7 target genes in cells depleted of UBC9 as compared to
non-treated cells.
Alternatively, the protein-protein interactions between UBC9 and PR-Set7 might
enhance its methyltransferase function causing an increase in H4K20me1 at target genes.
To address whether UBC9 influences H4K20me1 levels at PR-Set7 target genes, ChIP
assays using anti-H4K20me1 antibodies can be performed. A third possibility is that
sumoylation of PR-Set7 may be involved in targeting it to the appropriate regions of
chromatin. To investigate this hypothesis, nuclear fractionation analysis (as previously
described in [54]) of cells depleted of UBC9 can be done to isolate euchromatic,
insoluble heterochromatic and matrix-associated fractions. Then, each fraction can be
analyzed for the presence of PR-Set7. If sumoylation is indeed responsible for tethering
PR-Set7 to heterochromatin then depletion of UBC9 will cause PR-Set7 to shift from the
insoluble heterochromatic to the soluble or euchromatic fraction. Lastly, we cannot rule
out the possibility that global depletion of endogenous pool of UBC9 could also impinge
on transcription by decreasing global level of histone H4 sumoylation [43, 55],
74
suggesting combinatorial role of H4 histone sumoylation and H4K20 monomethylation in
transcriptional repression. This can be tested by examining histone H4 sumoylation
status of core histones extracted from cells depleted of UBC9 subsequent mass
spectrometry can be used to monitor changes in posttranslational modifications.
In conclusion, we provide the first evidence that the chromatin-modifying
enzyme, PR-Set7 interacts with an E2 conjugating enzyme, UBC9 and undergoes
SUMO-1 modification in an E3 ligase, ARIP3 dependent fashion (Figure 11C). We also
demonstrate that UBC9 is required for PR-Set7 mediated gene silencing. Together, these
findings suggest that sumoylation may provide an important regulatory mechanism in
controlling PR-Set7 function in maintenance of transcriptionally inactive state.
Understanding the cooperative nature of these modifying enzymes will enable a greater
comprehension of how cells work to maintain heterochromatin and gene silencing.

75
Chapter 3: Development of a Novel Technique to Identify H4K20 Methyl Binding
Protein

Eukaryotic cells have developed intricate and distinct cellular signaling cascades
to translate particular intra- or extracellular stimuli into an appropriate biological
response. These signaling pathways rely heavily on enzymes that create specific post-
translational modifications (PTMs) on certain proteins of the pathway. These PTMs,
themselves, are typically required for signal propagation and the desired biological
response indicating that the post-translational modification of proteins is a central
component of most normal cellular programs. Recent advances in proteomics
demonstrate that the vast majority of eukaryotic proteins are post-translationally modified
in vivo presenting investigators with the formidable challenge of identifying the enzymes
responsible for each PTM and, importantly, determining the biological significance of
each PTM on each protein.
Increasing evidence indicates that one common outcome of protein PTM is the
creation of a high affinity binding site for the selective interaction with a specific post-
translational modification-specific binding protein (PTMBP). The interaction between
the PTMBP and the modified protein is often a critical step for downstream signaling and
the biological response. Based on these observations, many have attempted to discover
and characterize PTMBPs using various classic in vitro approaches. Although these
methods are typically amenable to high throughput screens, they are also subject to
numerous inherent limitations and, because of these problems, have resulted in the
identification of only a relatively small number of bona fide PTMBPs.
76
To overcome some of the limitations of in vitro approaches, a novel in vivo
method called yeast tethered catalysis was developed (Guo, Hazbun et al. 2004). In this
method, an expressed fusion protein containing a target peptide sequence was tethered to
an enzyme resulting in the constitutive PTM of the peptide and, thereby, served as the
bait in yeast two-hybrid screens for putative PTMBPs. While this was used successfully
to identify yeast PTMBPs, the ability to detect PTMBPs in higher eukaryotes is
constrained by the limitations of the yeast two-hybrid system.
By expanding on the principles of tethered catalysis, we have developed and
validated a new in vivo approach designed specifically for the discovery and
characterization of endogenous PTMBPs in mammalian cells, which we termed
Mammalian Tethered Catalysis (MTeC). Methylated histones were chosen as the proof-
of-principle for MTeC since increasing evidence indicates that the major role of histone
methylation is to bind distinct PTMBPs that, in turn, function to regulate a specific DNA-
templated process such as transcription, replication or repair (Jenuwein and Allis 2001).
By testing various MTeC bait fusion proteins, we demonstrate that this approach can be
consistently used to predictably modify MTeC bait fusion proteins in vivo. We also
demonstrate that this new technique can complement existing in vitro binding assays and,
importantly, can provide new in vivo insights into PTM-dependent interactions. Finally,
we show that MTeC was used in an unbiased manner to identify an H3K9me1-specific
binding protein and a panel of putative novel H4K20me1/2/3-specific binding proteins in
vivo. Unexpectedly, mass spectrometry analysis indicated that Ku70 and Ku80 were
among novel H4K20 methyl –binding proteins and were found exclusively in the H4-PR-
Set7 MTeC sample (they were absent in the H4K20A-PR-Set7 and H4-Suv4-20h2
77
samples) suggesting that Ku70 and Ku80 bind H4K20me1 in vivo. Collectively, our
findings indicate that MTeC could be employed as a new tool to identify and characterize
PTMBPs that bind any PTM on any protein in vivo.

Principles and implementation of Mammalian Tethered Catalysis (MTeC)
The overall goals of MTeC are to discover novel proteins, or validate those, that
selectively bind to a target peptide sequence in vivo only when the sequence possesses a
specific post-translational modification. As shown in Figure 14A, MTeC begins with the
creation of a bait expression plasmid that includes, in tandem, an affinity epitope tag
followed by a peptide sequence containing the target amino acid to be modified and,
finally, the catalytic domain of an enzyme known to modify the target residue of interest
within the peptide sequence. The MTeC bait plasmid is then introduced into the cells of
choice where, once in the cell, the catalytic domain of the expressed fusion protein is able
to selectively post-translationally modify the target residue within the peptide sequence.
The expressed MTeC fusion protein is then available to interact in vivo with proteins that
bind this particular modified peptide sequence. The cellular proteins bound to the
modified MTeC fusion protein can then be purified from cells using standard biochemical
techniques including fractionation of specific sub-cellular compartments, affinity
immunoprecipitation and/or a variety of other available chromatographic steps (Figure
14B). Once this material is isolated, the purified proteins are analyzed by mass
spectrometry for identification of the bound proteins. Importantly, the experiments are
performed in parallel with two critical controls. First control is an MTeC bait fusion
protein lacking the catalytic domain of the enzyme allowing subtraction of proteins that
78
may bind both the modified and unmodified peptide sequence. Second control is an
MTeC bait fusion protein where the modified target residue is eliminated and, therefore,
unavailable to be post-translationally modified, allowing subtraction of interacting
proteins that may bind another portion of the peptide sequence and/or the catalytic
domain of the tethered enzyme. Once the putative PTMBPs are identified, well-
established in vitro binding methods can be used to confirm the modification-specific
interaction and/or MTeC could also be used to verify these interactions in vivo.

MTeC bait fusion proteins achieve specific degrees of Histone H3 Lysine 9 (H3K9)
methylation in vivo
To test the ability of MTeC bait fusion proteins to acquire the appropriate PTM in
vivo, we capitalized on recent discoveries and characterizations of enzymes that modify
specific histone residues. In particular, we first focused on the well-described
methylation of histone H3 lysine 9 (H3K9) by the G9a methyltransferase (Tachibana,
Sugimoto et al. 2001; Tachibana, Sugimoto et al. 2002). An MTeC bait plasmid
containing a FLAG epitope and the first 44 amino acids of histone H3 were cloned
upstream of the catalytic SET domain of the human G9a. Since we previously
demonstrated that G9a is responsible for global dimethylation (H3K9me2) in mammalian
cells and, in vitro, has also been shown to cause trimethylation (H3K9me3), it was
unclear which H3K9 methylated form would be observed in an H3-G9a wild type MTeC
bait fusion protein (Figure 15A) (Peters, Kubicek et al. 2003; Rice, Briggs et al. 2003).
To determine this, the bait plasmid was transfected into HEK 293 cells and, following a
79

Figure 14: Principles of Mammalian Tethered Catalysis (MTeC).
(A) An MTeC bait plasmid is composed of an affinity tag fused in tandem with a peptide
sequence possessing an amino acid to be post-translationally modified in vivo followed
by the catalytic domain of an enzyme known to modify the residue. (B) The MTeC bait
plasmids are expressed in the cells of choice and, after the MTeC bait fusion protein is
confirmed to be properly modified in vivo, the post-translational modification-specific
binding proteins (PTMBP) are biochemically purified. Following SDS-PAGE of the
purified material, visible protein bands can be isolated and identified by mass
spectrometry or, alternatively, complete sample mixtures can be submitted for protein
identification. MTeC can also be used to verify and characterize PTM-dependent binding
in vivo.

80
FLAG immunoprecipitation, Western analysis on the FLAG-bound material using a
panel of H3K9 methyl-specific antibodies demonstrated that both H3K9me2 and
H3K9me3 were clearly achieved, however, monomethylation (H3K9me1) was not
detected (Figure 15B). In order to create
an MTeC fusion protein possessing H3K9me1, we capitalized on a previous report
demonstrating that an F->Y mutation in the catalytic portion of the G9a SET domain
caused an enzymatic shift in specificity towards H3K9me1 in vitro (Collins, Tachibana et
al. 2005). Consistent with the in vitro results, we found that a G9a F->Y mutant MTeC
bait fusion protein achieved H3K9me1 and H3K9me2 in vivo but lacked detectable
H3K9me3 (Figure 15B). The MTeC demonstrate that, depending upon the inherent
catalytic property of the fused enzyme, MTeC can be used to selectively and predictably
post-translationally modify a target amino acid within a given peptide sequence in vivo.

Endogenous HP1β binds H3-G9a MTeC bait fusion proteins in a methylation-dependent
manner
Once we showed that H3-G9a MTeC bait fusion proteins can achieve specific degrees
of H3K9 methylation in vivo, it was next necessary to determine if these fusion proteins
could selectively interact with an endogenous protein known to bind H3K9 in a
methylation-dependent manner. Previous in vitro binding studies showed that the
chromodomain of heterochromatin protein 1 (HP1) binds H3K9me3 > H3K9me2 >
H3K9me1 (Bannister, Zegerman et al. 2001; Jacobs, Taverna et al. 2001; Lachner,
O'Carroll et al. 2001; Jacobs and Khorasanizadeh 2002). Based on this, we stipulated

81

Figure 15: H3-G9a MTeC bait fusion proteins attain specific degrees of methylation
in vivo and selectively bind endogenous HP1β in a methyl-dependent manner.

(A) MTeC bait fusion proteins containing a FLAG affinity tag fused to the first 44 amino
acids of the H3 N-terminal tail (where K9 is wild type or mutated to arginine) followed
by the catalytic SET domain of wild type G9a (WT) or a F->Y G9a mutant (Mut). (B)
Western analysis of FLAG immunoprecipitated MTeC bait fusion proteins described
above from HEK 293 nuclear lysates using FLAG, HP1β or H3K9 methyl-specific
antibodies.

82
that endogenous HP1β would preferentially bind the H3-G9a wild type MTeC bait fusion
protein compared to the H3-G9a mutant when expressed in cells. To test this prediction,
Western analysis was performed on the FLAG-bound immunoprecipitated material
using an HP1β antibody (Figure 15B). As predicted, endogenous HP1β was clearly
bound to the H3-G9a wild type bait fusion proteins containing only the H3 sequence or
the H3K9R-G9a failed to achieve any detectable degree of methylation in vivo
confirming the utility of these plasmids as negative controls in further experiments
(Figure 15B).
MTeC bait fusion protein possessing H3K9me3 and H3K9me2 but was absent in the
H3K9R-G9a wild type and H3 tail-only MTeC control fusion proteins. These findings
confirm that HP1β selectively binds methylated H3K9 in vivo. Importantly, we
determined that HP1β binding was detectable, but significantly reduced, in the H3-G9a
mutant MTeC bait plasmid possessing H3K9me2 and H3K9me1 confirming recent
studies that HP1β preferentially binds H3K9me3 in vivo (Peters, O'Carroll et al. 2001;
Peters, Mermoud et al. 2002). These findings indicate that properly modified MTeC
fusion proteins expressed in cells can be successfully employed as bait for the binding,
purification and identification of endogenous PTMBPs.

Histone H4K20 MTeC bait fusion proteins are differentially methylated by distinct
enzymes
To validate that MTeC could be applied successfully for modified peptide
substrates other than H3K9, we shifted our focus to the N-terminal tail of histone H4. It
was previously reported that lysine 20 of histone H4 (H4K20) is selectively
83
monomethylated (H4K20me1) by the PR-Set7/KMT5a enzyme whereas the Suv4-
20/KMT5b/KMT5c enzymes are responsible for di- and trimethylation (H4K20me2 and
H4K20me3) in mammals (Schotta, Lachner et al. 2004; Couture, Collazo et al. 2005;
Xiao, Jing et al. 2005). Based on these findings, MTeC bait plasmids were created using
the FLAG affinity tag in tandem with the first 44 amino acids of H4 followed by the
catalytic SET domain of either human PR-Set7 or Suv4-20h2 (Figure 16A). The control
plasmids for non-specific binding included the H4 tail alone or where K20 was replaced
by alanine. As described above, HEK 293 cells were transiently transfected with these
various MTeC plasmids and a FLAG affinity immunoprecipitation was performed on
their nuclear lysates. As predicted, Western analysis of the FLAG-bound material
confirmed that H420me1 was selectively enriched in the H4-PR-Set7 MTeC fusion
protein but H4K20me2 and H4K20me3 were not detected (Figure 16B). In contrast,
H4K20me2 and H4K20me3 were selectively enriched in the H4-Suv4-20h2 MTeC fusion
protein but H4K20me1 was not detected. Importantly, H4K20 methylation was not
detected in the H4 tail only or H4K20A mutant MTeC fusion proteins. Collectively, our
findings demonstrate that selective degrees of methylation of a target residue within an
MTeC fusion protein can be consistently achieved in vivo by employing the specific
catalytic domains of different methyltransferases.

Tandem tudor domain-containing proteins do not exhibit differential H4K20 methyl-
selective binding properties in vivo
Increasing evidence indicates that the tandem tudor domain located within conserved
chromatin-associated proteins has the ability to selectively bind methylated histone
84
residues in vitro (Maurer-Stroh, Dickens et al. 2003; Kim, Daniel et al. 2006). For
example, the tandem tudor domain of the JMJD2A histone demethylase was recently
found to bind H4K20me3 and H4K20me2 in vitro, but not H4K20me1 (Kim, Daniel et
al. 2006; Lee, Thompson et al. 2008). To confirm this interaction in vivo, a plasmid
expressing only the tandem tudor domain of JMJD2A was co-transfected in HEK 293
cells with the various histone H4 MTeC plasmids. HA-immunoprecipitations of these
nuclear lysates verified that the JMJD2A tandem tudor domain preferentially binds the
H4-Suv4-20h2 MTeC bait fusion protein containing only H4K20me2 and H4K20me3 in
vivo (Figure 16C). Surprisingly, when a full length JMJD2A expression plasmid was
used in these experiments, JMJD2A also bound the H4-PR-Set7 MTeC bait fusion
protein containing only H4K20me1 (Figure 16D). These findings demonstrate that wild
type JMJD2A does not display selective binding properties for higher degrees of H4K20
methylation, rather, has the capacity to interact with all three methylated forms in vivo.
To determine if these results were consistent for another tandem tudor domain-
containing protein, similar studies were performed using the tandem tudor domain of the
53BP1 DNA repair protein which was previously reported to bind H4K20me2 >
H4K20me1 in vitro, but did not bind H4K20me3 (Botuyan, Lee et al. 2006; Kim, Daniel
et al. 2006). Consistent with the in vitro results, the 53BP1 tandem tudor domain alone
preferentially bound the H4-Suv4-20h2 MTeC bait fusion protein possessing H4K20me2
(Figure 16E). Similar to what was observed for full length JMJD2A, full length 53BP1
also bound the H4-PR-Set7 MTeC bait fusion protein containing only H4K20me1
indicating that wild type 53BP1 has the capacity to interact with all three H4K20
methylated forms in vivo (Figure 16F). In contrast to in vitro binding studies, these
85
Figure 16: Distinct enzymes used in MTeC to vary the degree of H4K20
methylation demonstrate that full length tandem tudor domain-containing proteins
bind all three H4K20 methylated forms in vivo.

(A) Schematic representation of MTeC bait fusion proteins: a FLAG affinity tag followed
by the first 44 amino acids of the wild type H4 N-terminal tail (where K20 is wild type or
mutated to alanine) followed by the catalytic SET domain of PR-Set7 or Suv4-20h2. (B)
Western analysis of the FLAG-immunoprecipitated MTeC bait fusion proteins from HEK
293 nuclear lysates using FLAG or H4K20 methyl-specific antibodies. An HA-tagged
JMJD2A tandem tudor domain only (C) or full length (D) plasmid were co-transfected in
HEK 293 cells with the histone H4 MTeC bait plasmids. Western analysis of the HA-
immunoprecipitates from nuclear lysates were performed using FLAG or HA antibodies.
Similar experiments were performed using an HA-tagged 53BP1 tandem tudor domain
only (E) of full length plasmid (F).
86

87
findings indicate that full length JMJD2A and 53BP1 can bind any methylated form of
H4K20 in vivo and suggests that similar binding properties will be observed for other
tandem tudor domain-containing proteins. Collectively, these findings highlight the use
of MTeC to accurately characterize post-translational modification-specific binding
properties in an in vivo context.

Full length G9a selectively binds monomethylated histone H3 Lysine 9 (H3K9me1) in
vivo
An important utility of MTeC is to identify novel endogenous proteins that selectively
bind a specific post-translationally modified peptide sequence in vivo. To test MTeC in
this application, we returned to the H3-G9a mutant MTeC bait plasmid in an attempt to
discover H3K9me1/me2 binding proteins (Figure 17). This plasmid or the H3K9R-G9a
mutant control MTeC bait plasmid were transiently transfected into HEK 293 cells and
the bound MTeC-associated proteins from nuclear lysates were purified by FLAG-
immunoprecipitation. Following extensive washing, the MTeC-associated proteins were
eluted with a FLAG peptide and resolved by SDS-PAGE (Figure 17A). Comparison of
the banding patterns between the two samples revealed a single band of ~70 kDa found
exclusively in the H3-G9a mutant MTeC sample (arrow). This band and its size
equivalent from the control sample were excised from the gel for protein identification by
mass spectrometry which resulted in the detection of 5 peptide fragments from only the
H3-G9a mutant MTeC sample that uniquely aligned to the C-terminal of G9a (Figure 18).
These findings were unexpected since full length G9a is ~130 kDa suggesting that our

88
Figure 17: MTeC reveals that full length G9a selectively binds H3K9me1 in vivo.
(A) Silver stain of FLAG-purified H3-G9a mutant and H3K9R-G9a mutant control
MTeC bait fusion proteins (*) from HEK 293 nuclear lysates. Mass spectrometry
identified ~70 kDa band as G9a (arrow). (B) Western analysis of FLAG-purified H3-
G9a MTeC bait fusion proteins from COS7 nuclear lysates indicates a distinct H3K9
methylation pattern compared to HEK 293 cells (Figure 2B). (C) A V5-tagged full-
length G9a plasmid was cotransfected in HEK 293 cells with the histone H3 MTeC bait
plasmids. Western blot analysis of the V5-immunoprecipitates from nuclear lysates was
performed by using FLAG or V5 antibodies. (D) Western analysis of HA-purified
COS7 nuclear lysates co-transfected with the indicated FLAG-tagged H3-G9a MTeC bait
plasmids and either an HA-tagged G9a ankyrin repeats only or full length HA-G9a
plasmid (E).
89

90
results were artifacts of contamination by the abundant amounts of the MTeC bait fusion
protein and/or potential homodimerization of the G9a SET domains, as was previously
reported (Tachibana, Ueda et al. 2005). However, G9a peptide fragments were not
detected by mass spectrometry in the H3K9R-G9a mutant MTeC negative control gel
slice indicating that the observed binding was most likely due to differences in H3K9
methylation and not due to contamination or to dimerization of G9a SET domains. The
putative G9a-H3K9 methyl-dependent interaction was confirmed in co-
immunoprecipitation experiments using full length G9a and the various H3 MTeC bait
plasmids in HEK 293 cells (Figure 17C).
While the origin of the observed truncated G9a remains unclear, we calculated that it
contains the SET domain and all 7 ankyrin repeats (Figure 18). Consistent with our
findings, it was recently shown that the ankyrin repeats of G9a bind H3K9me1 and
H3K9me2 with relatively high affinity in vitro (Collins, Northrop et al. 2008). To
confirm this interaction in vivo, MTeC was again employed by co-transfecting an HA-
tagged plasmid expressing only the G9a ankyrin repeats with the different H3-G9a MTeC
bait plasmids in COS7 cells. By switching the experimental cell line, we serendipitously
discovered that the expression of MTeC bait fusion proteins in different cell lines can
have dramatic effects on the modification characteristics of the target substrate. In
contrast to the observed H3K9 methylation patterns in HEK 293 cells (Figure 17C), the
H3-G9a wild type MTeC fusion protein displayed only H3K9me2 and the H3-G9a
mutant MTeC fusion protein displayed only H3K9me1 in COS7 cells (Figure 17B).
Western analysis performed on the HA-immunoprecipitated material from COS7 nuclear
91

Figure 18: The estimated 70kDa fragment of G9a contains the ankyrin repeats.
(A) MS results of the 70kDa gel slices taken from the purified H3-G9a Mut and H3K9R-G9a Mut mammalian tethered catalysis bait
fusion proteins. (B) Schematic representation of human G9a with its conserved domains (upper), and the unique peptide sequences
corresponding to G9a found exclusively in the purified H3-G9a mutant sample (lower). (C) The primary amino acid sequence of
human G9a. The conserved domains are colored as in B, and the unique peptides identified by MS are bolded and underlined.

92

lysates confirmed the in vitro results that the G9a ankyrin repeats bind both H3K9me1
and H3K9me2 in vivo (Figure 17).
Given the findings above of the tandem tudor domain-containing proteins, the in vivo
binding properties of full length G9a were further investigated using MTeC. Western
analysis performed on the HA-immunoprecipitated material from COS7 nuclear lysates
co-transfected with an HA-tagged full length G9a and the various H3-G9a bait plasmids
revealed that full length G9a selectively binds the H3-G9a mutant MTeC bait fusion
protein containing only H3K9me1 in vivo (Figure 17E). It is interesting to note that
while full length tandem tudor domain-containing proteins are less selective for histone
methyl-binding compared to the tudor domains alone, full length G9a displayed a
pronounced degree of methyl-selectivity compared to the G9a ankyrin repeats alone as it
preferentially bound H3K9me1 in vivo.

Ku70 binds methylated H4K20 in vivo
To identify novel H4K20 methyl binding proteins we utilized previously
characterized H4-PR-Set7 and H4-Suv4-20h2 bait plasmids (Figure 17B). As described
before, HEK 293 cells were transfected with constructs bearing H4K20me1 (H4-PR-
Set7) or H4K20me2/3 (H4-Suv4-20h2) modifications, as negative controls H4 tail alone
or plasmids containing K20 residue mutated to alanine were used (H4K20A-PR-Set7 or
H4K20A-Suv4-20h2). Isolated nuclear extracts were subjected to FLAG affinity
immunoprecipitation followed by extensive washes and subsequent elution of the bound
material using FLAG peptide. All FLAG-purified samples were resolved on SDS-PAGE
and analyzed by SYPRORuby staining or Western analysis for quality control

93

Figure 19: Immunoaffinity purification of novel H4K20 methyl binding proteins.
HEK 293 cell were transfected with indicated constructs. Nuclear extracts were used for
α-FLAG IAP. 5% of the total bound material was fractionated on SDS-PAGE gel and
analyzed by SYPRORuby staining or Western analysis. Asterisks indicate MTeC bait
proteins (H4 only is ~15 kDa and therefore cannot be visualized by SYPRORuby
staining).

94

Figure 20: Schematic representation of total protein targets identified by MS.

Venn diagram depicting categories of total proteins bound to (A) PR-Set7 or (B) Suv4-
20h2 containing bait plasmids. Tables contain list of the subset of proteins that
exclusively bound to H4K20me1 (top) or H4K20me2/3 (bottom).

95

(Figure 19). The remainder of the bound material from each sample was TCA
precipitated and analyzed by mass spectrometry (Taplin Mass Spectrometry Facility;
Harvard Medical School). We successfully identified 13 and 16 probable H4K20me1
and H4K20me2/3 methyl binding proteins, respectively (Figure 20). Unexpectedly,
Ku70 and Ku80 were found exclusively in the H4-PR-Set7 sample (and devoid in
H4K20A-PR-Set7, H4-Suv4-20h2, H4(K20A)-Suv4-20h2 and H4 only samples)
suggesting that they bind H4K20me1 in vivo. To verify this interaction, HA-tagged
version of Ku70 and Ku80 were co-transfected with various MTeC constructs in HEK
293 cells. Western analysis of HA-immunoprecipitated nuclear extracts demonstrated that
HA-Ku80 failed to bind to MTeC bait fusion proteins containing H4K20me1 and
H4K20me2/3 marks suggesting that it is a false positive interaction (Figure 22). On the
contrary, HA-Ku70 was confirmed as H4K20 methyl binding protein (Figure 21), but
surprisingly was found to be associated with both MTeC bait fusion constructs (H4-PR-
Set7 and H4-Suv4-20). Because HA-Ku70 failed to bind the negative controls (H4K20A-
PR-Set7 and H4K20A-Suv4-20h2) it confirmed that the interaction is H4K20
methylation-dependent. Identification of Ku70 as a novel H4K20 methyl binding protein
provides new evidence towards linking H4K20 methylation and protective role of Ku70
in maintaining genome integrity.

Summary, discussion and future directions
Here we describe an innovative in vivo method, Mammalian Tethered Catalysis
(MTeC), developed specifically for the discovery and characterization of novel post-

96

Figure 21: Ku70 binds H4K20 in methyl-dependent manner in vivo.
HA-tagged Ku70 or Ku80 were co-transfected with indicated MTeC construct in HEK
293 cells. Western analysis of HA-immunoprecipitated material demonstrates that Ku70
recognizes methylated H4K20 in vivo, while Ku80 fails to bind.

97

translational modification-specific binding proteins (PTMBPs). The MTeC approach can
be used as an unbiased method to detect and identify endogenous PTMBPs in vivo. For
example, by engineering and employing the H3-G9a bait fusion proteins in MTeC we
discovered that G9a binds H3K9 in a methylation-dependent manner. More importantly,
by employing the H4-PR-Set7 bait constructs we identified Ku70 as a novel
H4K20methyl binding protein. We also established that MTeC can be subsequently used
to validate and characterize the in vivo PTM-dependent binding properties of PTMBPs.
For example, we confirmed the H3K9 methyl-dependent binding of both G9a and HP1
using MTeC and elucidated their H3K9 mono- and trimethylation-selective binding
properties in vivo, respectively. Furthermore, we described how MTeC can be applied to
complement existing in vitro binding assays and can provide important perspectives into
in vivo PTM-specific interactions. For example, we demonstrated that the ankyrin
repeats of G9a bind both H3K9me1 and H3K9me2 in vivo, consistent with previous in
vitro results (Collins, Northrop et al. 2008). We also confirmed in vitro findings that the
tandem tudor domains of JMJD2A and 53BP1 selectively bind H4K20me2 and
H4K20me3 in vivo (Botuyan, Lee et al. 2006; Lee, Thompson et al. 2008). However,
MTeC also provided new and significant insights into the in vivo binding properties of
these proteins when expressed as full length proteins rather than when constrained to
small domains. For example, we demonstrated that full length JMJD2A and 53BP1
display relaxed methyl-binding characteristics by binding all three methylated forms of
H4K20 compared to their more methyl-selective tandem tudor domains. In contrast, we
found that full length G9a displayed enhanced binding selectivity for H3K9me1 in vivo
compared to the less methyl-selective ankyrin repeats.

98

These findings emphasize that significantly different and, perhaps, contradictory
PTM-dependent binding properties of full length proteins may be observed using the in
vivo MTeC method compared to conventional in vitro binding assays. The differences
could be due to several physiologically-relevant factors typically missing from in vitro
conditions that are known to dramatically alter protein binding properties, such as the
association of the PTMBP with a multi-protein complex and/or the post-translational
modification of the PTMBP, itself. For example, it was recently reported that the N-
terminal portion of G9a, which does not include the ankyrin repeats, can be methylated in
vivo (Sampath, Marazzi et al. 2007). The methylation of G9a results in the recruitment of
HP1 and, most likely, other associated factors which may explain the observed H3K9me1
selectivity of full length G9a in vivo. This highlights another useful application of MTeC
in which to determine the minimal region of the PTMBP required for in vivo PTM-
dependent binding selectivity by characterizing truncation mutants of the PTMBP.
Lastly and more importantly we were able to utilize this new and innovative approach
to successfully identify subset of novel H4K20 methyl specific binding proteins in vivo.
We demonstrated that we effectively performed immunoaffinity purification and obtained
sufficient amount of material for mass spectrometry analysis (Figure 19). We identified13
and 16 unique, H4K20me1 and H4K20me2/3 specific binding proteins, respectively
(Figure 20). Interestingly, among those were components of DNA repair machinery,
Ku70 and K80 proteins. Using MTeC method again we confirmed that Ku70 is a true
H4K20 methyl-binding protein, although the degree of methylation it preferentially binds
to is still unclear and requires further investigation. Because Ku70 lacks conventional
methyl binding domain such as chromo or tudor, it suggests that the interaction with

99

H4K20me1 is mediated through a novel methyl binding domain. To identify the novel
protein motif within Ku70 responsible for recognition of methylated H4K20, various
Ku70 truncation mutants can be created and used in methods such as MTeC or in vitro
pull down assays. Unexpectedly and in contradiction to mass spectrometry data, Ku80
failed to interact with methylated H4K20 at all. The discrepancy might be attributed to
that fact that Ku70 and Ku80 function as heterodimer (Koike, Ikuta et al. 1999) and
therefore the mass spectrometry analysis detected Ku80 protein by default. In contrast,
cells overexpressing Ku80 alone without stoichiometric quantities of Ku70 to form
heterodimeric Ku complex, did not confirm the interaction between H4K20me1 and
Ku80. This strongly suggests that Ku80 is not a direct H4K20me binding protein. This
can be further confirmed by an in vitro peptide pull down assays using recombinant Ku80
protein.
Discovery of Ku70 as a novel H4K20me1 binding protein provides new insights into
how H4K20me1 is directly participating in the regulation of the DNA damage response.
According to the histone code hypothesis, the methyl-binding proteins are part of multi-
protein complexes that recognize specific histone modifications and lead to further
regulation of DNA and chromatin based cellular processes. Here we demonstrate a new
example of such paradigm, where Ku70 is recruited to recognize H4K20me1 via novel
methyl-binding domain perhaps leading to a prompt response to the DNA damage. In
addition we have demonstrated that Ku70, Ku80 and DNA-PK are components of the
PR-Set7 multi-protein complex (Figure 4; Chapter 1, Section A) thus suggesting that
Ku70 is targeted to the methyl mark through PR-Set7-Ku80 interaction (Figure 22).
Although not directly evaluated in this study, it is likely that H4K20 monomethylation

100

serves as a protective mark at specific regions of the chromatin that are sensitive to the
DNA damage. Recent findings provide evidence supporting this hypothesis, it has been
shown that the loss of PR-Set7 and H4K20me1 results in the activation of DNA repair
pathway in Drosophila and sensitizes cells to genotoxic stress in S. pombe (Sanders,
Portoso et al. 2004; Sakaguchi and Steward 2007). In addition, the loss of PR-Set7 and
H4K20me1 in human cells results in cell cycle defects, massive DNA damage and
genomic instability [91, unpublished data S. Houston]. This theory can be tested by
determining whether disruption of Ku70 and H4K20me1 interactions (by overexpressing
Ku70 mutant lacking methyl-binding domain or by knocking down PR-Set7 thus
reducing global levels of H4K20me1) is sufficient to induce localized DNA damage at
H4K20me1 associated loci (identified by ChiP-seq data; unpublished data; Jennifer Sims,
Sai Veerappan, Sabrina Houston). In summary, the cumulative data suggest an exciting
model in which PR-Set7 and H4K20me1 are directly involved in protecting specific
genomic loci from the DNA damage (Figure 22).
In addition to Ku70, mass spectrometry data also identified SPT16 (H4K20me1) and
CHD1 (H4K20me2/3) chromatin associated proteins, as H4K20 methyl-binding proteins.
This is an interesting finding since both proteins are implicated in maintenance of
chromatin structure (Winston, Chaleff et al. 1984; Kaplan, Laprade et al. 2003; Flanagan,
Mi et al. 2005; Sims, Chen et al. 2005). For example, SPT16 is a highly conserved
component of FACT complex (facilitates chromatin transcription) and is involved in
nucleosome-disassembly by removing H2A/H2B dimer (Gonzalez and Palacian 1989;
Kireeva, Walter et al. 2002) and re-establishing disassembled nucleosomes via histone
chaperone activity (Belotserkovskaya, Oh et al. 2003). These functions are important in

101

Figure 22: Proposed model of the role PR-Set7 and H4K20me1 in protecting the
human genome from the DNA damage.

We predict that interplay between PR-Set7, H4K20me1 and DNA repair machinery is
critical for the maintenance of chromatin structure and that deregulation of this pathway
will result in cumulative DNA damage and genomic instability, two key events
associated with oncogenic transformation. To support this model we discovered that PR-
Set7 directly recruits DNA repair proteins, PARP1, DNA-PK and Ku70/80 (Ku80)
heterodimer, to specific genomic regions to protect them from DNA damage. In addition
we demonstrated that Ku70 directly binds H4K20me1 suggesting that this interaction is
there to stabilize the repair machinery at particular genomic loci. However, in the absence
of PR-Set7, this pathway is compromised leaving H4K20me1-associated loci unprotected
from the DNA damage.

102

103

facilitation of DNA repair, DNA replication, and transcriptional regulation. PR-Set7 and
H4K20me1 are also involved in regulation of these biological processes, suggesting that
SPO16 perhaps function in concert with K20 methylation to establish and maintain
chromatin structure during DNA repair, DNA replication and transcriptional regulation.
While this study focused solely on histone methylation and histone methyl-specific
binding proteins, MTeC could theoretically be employed to discover and characterize
PTMBPs that bind any PTM on any target peptide sequence in vivo. The first step in
MTeC is engineering the bait plasmid containing the target peptide sequence in tandem
with an appropriate enzyme followed by the confirmation that the bait fusion protein is
sufficiently modified in vivo. Although we did not vary the size of the H3 or H4 target
peptides, it seems likely that shorter substrates will reduce potential non-specific binding
and, additionally, it may be best to avoid peptide substrates with complex secondary
sequences that may structurally inhibit catalysis by the tethered enzyme in vivo. Similar
strategies should be applied when tethering the enzyme into the MTeC bait plasmid,
however, we found that the length of the enzyme required for maximal substrate
modification in vivo usually had to be determined empirically. Unlike methyltransferases
that are restrictive in terms of substrate peptide sequence and degree of methylation, more
promiscuous PTM-creating enzymes with robust activity, such as kinases or
acetyltransferases, could be used in MTeC to effectively modify a target peptide
sequence even if the enzyme responsible for the endogenous modification is unknown.
Finally, the ability of the bait fusion protein to be sufficiently modified when expressed
in the experimental cell system of choice must be assessed. While we were able to use
commercially available histone methyl-specific antibodies for this purpose, such

104

antibodies may not be available for other modified peptides. In these cases, it should be
possible to employ established mass spectrometry approaches on the purified MTeC bait
fusion protein to estimate the ratio of unmodified:modified substrate. Once a satisfactory
degree of peptide PTM has been attained for the experimental bait fusion protein, the
negative control bait plasmids can then be engineered.
The ability to successfully purify PTMBPs by MTeC relies mainly on the abundance
of the endogenous PTMBP and the strength of the interaction between the modified
substrate and the PTMBP in vivo. While we were able to easily observe endogenous HP1
binding the H3-G9a MTeC bait fusion proteins by Western analysis, we were unable to
use this method to detect the binding of other known endogenous PTMBPs (such as
JMJD2A or 53BP1). Although this could be due to the quality of the antibodies, it is
likely that these PTMBPs are in lower abundance compared to HP1 and/or the interaction
may be more transient in nature. We were able to consistently overcome this obstacle by
performing co-immunoprecipitations with HA-tagged versions of the putative PTMBPs
to verify and characterize their PTM-dependent interactions. However, this approach can
only be used when the putative PTMBP is already known. One possible way to counter
this may be to use a tandem affinity tag which will likely result in significantly less
background following the immunoprecipitation step and reveal a larger number of
putative PTMBPs. In addition, stable cell lines containing the experimental and control
MTeC bait plasmids could be created, thereby, providing a virtually unlimited pool of
input material to identify PTMBPs that are in low abundance. Furthermore, the use of
cross-linking reagents could also be employed prior to the purification process to capture
PTMBPs that transiently bind the modified MTeC bait fusion protein (Sutherland, Toews

105

et al. 2008). A more modern and sophisticated way to avoid both of these potential
problems would be to use the stable isotope labeling with amino acids method (SILAC)
followed by mass spectrometry to identify proteins specifically associated with the
experimental MTeC sample but absent in control samples (Trinkle-Mulcahy, Boulon et
al. 2008). In this case, the experimental MTeC cell lines would be cultured in medium
containing ―heavy‖ 13C
6
-lysine while the control MTeC cell lines would be cultured in
regular media containing the normal ―light‖ lysine. Following the purification steps, the
―heavy‖ bound proteins from the experimental MTeC sample and the ―light‖ bound
proteins from the control sample would be mixed 1:1 and processed for in solution digest
for mass spectrometry analysis. Peptides fragments containing ―light‖ lysine would be
considered non-specific as they were derived from the control sample, however, peptide
fragments that contain only ―heavy‖ lysine would be considered putative PTMBPs for
further analysis.
Compared to current in vitro methods, the MTeC approach offers the advantages of
identifying endogenous PTMBPs in an unbiased manner and, importantly, all
experiments are performed in a cellular context allowing for the more physiologically-
relevant in vivo characterization of PTM-dependent interactions. While we demonstrated
that MTeC can be used to vary the degree of methylation of MTeC bait fusion proteins, it
is conceivable that even more complex PTMs, such as SUMOylation or ubiquitination,
could also be achieved in vivo by tethering the target peptide to an appropriate ligase. In
addition, it should be possible to create and investigate a dual modified peptide in vivo by
flanking the MTeC target peptide sequence with different enzymes. Although the
experiments in this study were performed in mammalian cell lines, the MTeC bait

106

plasmids could easily be converted for use in transgenic systems for whole animal studies
or investigating tissue-specific PTM-dependent interactions. Collectively, this study
demonstrates that the MTeC approach provides investigators with an innovative
biological tool to gain important insights into in vivo PTM-dependent interactions in a
variety of different eukaryotic cell types.

Overall Summary and Conclusions
In this study we have provided evidence supporting a novel role of PR-Set7 and
H4K20me1 in protecting specific genomic regions from the DNA damage. Based on the
fact that PR-Set7 interacts with the components of the DNA damage machinery
(Ku70/80, DNA-PK and PARP1) as described in Chapter 1 and that H4K20me1 itself
recruits Ku70 component of Ku70/80 heterodimer (Chapter 3), we hypothesize that PR-
Set7 is targeted to the DNA damage sensitive regions of the genome to provide direct
layer of protection and prevent accumulation of the DNA breaks (Figure 22) and that
deregulation of PR-Set7 mediated pathway will lead to cumulative DNA damage and
genomic instability, two key events associates with oncogenesis. This phenomenon is
accomplished by two events. First, PR-Set7 directs H4K20me1 to specific genes and this
histone modification helps to stabilize the recruitment of PR-Set7 multi-protein complex
via Ku70 binding to the H4K20monomethyl mark. Second, PR-Set7 protein itself directly
associates with Ku70/80, DNA-PK, and PARP1 thereby allowing for the immediate
repair of the DNA breaks at the specific loci.
To test this model, first, analysis of Ku70/80 and PARP1 localization to the PR-
Set7 target genes in the presence or absence of PR-Set7 can be performed by ChIP assays

107

carried out in the cells depleted of PR-Set7 as compared to the control cells. As a
negative control genes or regions lacking H4K20me1 should be examined. This will
demonstrate that targeting of the components of the DNA damage machinery to the
H4K20me1 enriched loci is dependent upon PR-Set7. Second, accumulation of the DNA
damage in the absence of PR-Set7 can be analyzed by monitoring formation of γH2AX
foci at regions of the genome that are enriched in H4K20me1. This can be achieved by
performing ChIP assays using anti- γH2AX antibodies in PR-Set7 knock down cells as
compared to the control. Then H4K20me1 positive regions of the genome can be
examined for the presence of γH2AX using qRT-PCR with H4K20me1-specific loci
primers (H4K20me1 negative regions will be used as negative control). The
accumulation of γH2AX foci at H4K20me1 regions in the absence of PR-Set7 will
directly demonstrate how PR-Set7 can play a role in protecting genome from the DNA
damage. Lastly, to explore the importance of H4K20me1 and Ku70 interaction, PR-Set7
catalytically inactive dominant negative mutant can be overexpressed in cells resulting in
reduction of H4K20me1 levels without altering PR-Set7 protein levels which will lead to
disruption of H4K20me1 and Ku70 complex formation. Then, accumulation of the DNA
damage by monitoring γH2AX foci formation can be evaluated. This will help to address
whether disruption of Ku70/H4K20me1 interaction is sufficient enough to induce
localized DNA damage at H4K20me1 enriched regions. Taken together, these studies
will shed light on a novel function of PR-Set7 in direct protection from cumulative DNA
damage and genomic instability. Since these two processes are hallmarks of oncogenic
transformation it is crucial to understanding how PR-Set7 and H4K20me1 contribute to
regulation of this pathway.

108

Chapter 4: Methods
Nuclear extract isolation in preparation for gel filtration chromatography (Protocol
adapted from Woojin An Lab)
1. Re-suspend cell pellet with 20 mL PBS, transfer to 50 mL falcon tube (use 4 tubes
with 5 mL of re-suspended cells in each)
2. Spin at 1200 rpm for 5 min at 4C.
3. Pour off supernatant, re-suspend cell pellet in 25 mL (5X packed cell volume
[PCV]) of HB Buffer.
4. Spin at 2500 rpm for 5 min at 4C.
5. Carefully pour off supernatant, re-suspend the cells with 20 mL (2X of PCV) of
HB and keep on ice for 10 min.
6. Homogenize 20 times with size ―B‖ pestle in cold room.
7. Spin at 3500 rpm for 15 min at 4C. (Wash homogenizer with dH2O)
8. Re-suspend nuclear pellet in 5 mL (1/2X of nuclear pellet volume) of LSB Buffer.
9. Homogenize 15 times with size ―B‖ pestle in cold room.
10. Slowly (drop-wise) add 5 mL (1/2 X of nuclear pellet volume) of HSB Buffer.
11. Rotate for 30 min at 4C.
12. Spin at 14000 rpm for 30 min at 4C.
13. Dialyze supernatant against 2 L of appropriate buffer (or BC300) over night.
*** I dialyzed against either Nakatani Buffer or IAP Buffer.
14. Spin at 14000 rpm for 30 min at 4C.
Store nuclear extract at –80C freezer or precede w/further experiments.
HB Buffer
2mL 1M Tris pH7.3
0.8mL 3M KCl
0.3mL 1M MgCl
2
197mL H
2
O

LSB Buffer
2mL 1M Tris pH7.3
0.7mL 3M KCl
0.15mL 1M MgCl
2
0.04 mL 0.5M EDTA
25mL 100% Glycerol
72mL H
2
O

109

HSB Buffer
2mL 1M Tris pH7.3
40mL 3M KCl
0.15mL 1M MgCl
2
0.04 mL 0.5M EDTA
25mL 100% Glycerol
33mL H
2
O

BC300 Buffer
40mL 1M Tris pH7.3
200mL 3M KCl
0.8 mL 0.5M EDTA
400mL 100% Glycerol
1359mL H
2
O
Add 0.2% NP-40 and protease inhibitors

Immunoaffinity Purification (IAP)
PART1: Anti-FL Antibody Purification using Ezview Red ANTI-FLAG M2 Affinity
Gel (Sigma Cat# F3165)
***Everything should be done either in the cold room or on ice.
1. Aliquot 50-300 L (I usually use 300 L slurry of beads per 7 mL of nuclear
extract) of M2 anti-FL antibody conjugated beads in Eppendorf 1.5 mL tube or
Bio-Rad column.
2. Wash beads with 10X of 100mM glycin-HCl (pH2.5) to remove uncrossed
antibody.
3. Wash the beads with 10V (10 times bead volume) of 200 mM Tris-HCl (pH 8.0).
4. Wash the beads with 10V of Nakatani’s Washing Buffer/ or another appropriate
for the procedure buffer. (If using the column, close the bottom with the cap after
the last drop and add 1V of washing buffer, so that the beads don’t dry out). If
using Eppendorf tube remove washing buffer so that 1X of it remains in the tube.
5. Add appropriate amount of IP lysates to the equilibrated and washed beads. (The
amount of input varies, although if input is less then 500 L I usually bring the
volume up to 500 L with washing buffer).
****For the large scale purification I usually incubate 6mL of nuclear extract (input)
with 300 L slurry of beads in 15mL conical tube.
6. Rotate the tube o/n at 4C.

110

7. Centrifuge for 1 min at 10,000 X g (in the cold room). Remove supernatant into a
fresh tube – this is your Unbound material; store it at – 80C.
8. Wash the resin 3 times with 500 L or 1mL (large scale) of Nakatani’s Buffer/ or
appropriate washing buffer. Save all the washes.
9. Add 200 L of FL-peptide buffer to the FL-beads and rock at 4C for 6-8h.
10. Centrifuge for 1 min at 10,000 X g (in the cold room). Remove supernatant into a
fresh tube – this is your bound material; store it at – 80C.
11. Add another 200 L of FL-peptide buffer to the FL-beads and rock at 4C for 6-
8h again.
12. Centrifuge for 1 min at 10,000 X g (in the cold room). Remove supernatant and
combine with the bound material from step 10. Store it at – 80C or proceed with
2
nd
purification step using anti-HA conjugated beads.

PART2: Anti-HA Antibody Purification using Ezview Red ANTI-HA Affinity Gel
(Sigma Cat# E6779)
***Everything should be done either in the cold room or on ice.
13. Aliquot 20-100 L (I usually use 50 L slurry of beads per 200 L of FL purified
material) of anti-HA antibody conjugated beads in Eppendorf 1.5 mL tube or 1
mL Bio-Rad column .
14. Wash beads with 10X of 100mM glycin-HCl (pH2.5) to remove uncrossed
antibody.
15. Wash the beads with 10V (10 times bead volume) of 200 mM Tris-HCl (pH 8.0).
16. Wash the beads with 10V of Nakatani’s Washing Buffer/ or another appropriate
for the procedure buffer. (If using the column, close the bottom with the cap after
the last drop and add 1V of washing buffer, so that the beads don’t dry out). If
using Eppendorf tube remove washing buffer so that 1X of it remains in the tube.
17. Add appropriate amount of FL purified material to the equilibrated and washed
beads and bring the volume up to 300 L with washing buffer.
18. Rotate o/n (overnight) at 4C.
19. Centrifuge for 1 min at 10,000 X g (in the cold room). Remove supernatant into a
fresh tube – this is your Unbound material; store it at – 80C.
20. Wash the resin 3 times with 300 L of Nakatani’s Buffer/ or an appropriate
washing buffer. Save all the washes.
21. Add 100 L of HA-peptide buffer to the HA-beads and rock at 4C for 6-8h.
22. Centrifuge for 1 min at 10,000 X g (in the cold room). Remove supernatant into a
fresh tube – this is your bound material; store it at – 80C.
23. Add another 100 L of FL-peptide buffer to the FL-beads and rock at 4C for 6-
8h again.
24. Centrifuge for 1 min at 10,000 X g (in the cold room). Remove supernatant and
combine with the bound material from step 22. Store at – 80C.
This material can be resolved on SDS Gel followed by Silver Stain, SYPRO
Ruby or Coomassie staining, which then can be Mass Spec analyzed.

111

IP Lysis Buffer
50mM Tris pH 7.5
150mM NaCl
0.5mM DTT
1% NP-40
protease inhibitors (1μg/mL pepstatin A, 1μg/mL leupeptin/aprotinin, 1mM
PMSF)

Nakatani Washing Buffer
20 mM Tris-HCl, pH 8
100 mM KCl,
5mM MgCl
2

0.2 mM EDTA
10% Glycerol
0.1% Tween
10 mM 2-mercaptoethanol
0.25 mM PMSF
protease inhibitors (1μg/mL pepstatin A, 1μg/mL leupeptin/aprotinin, 1mM
PMSF)

Yeast-Two-Hybrid screening
Yeast-two-hybrid screen was performed according to MATCHMAKER GAL4 Two-
Hybrid System 3 protocol (Clontech). The bait plasmid was created by inserting PCR-
amplified fragment encoding full length human PR-Set7 into NdeI-BamHI restriction
sites of pGBKT7 plasmid. The resultant GAL4 DNA-BD-PR-Set7 plasmid or pGBKT7-
GAL4 DNA-BD alone (control) was transformed into AH109 yeast strain using standard
LiAc protocol (BD Biosciences Clontech Yeast Protocols Handbook) and each was
mated to pre-transformed human HeLa Matchmaker cDNA library in Y187 yeast strain.
Then mated yeast were selected on synthetic medium without: tryptophan and leucine
(DDO), tryptophan, leucine, histidine with 5mM 3-AT to suppress leaky histidine
reporter gene (TDO+5mM 3-AT) and tryptophan, leucine, histidine and adenine with X-

112

alpha-galactosidase (QDO+ X- -Gal) to screen for ADE2, HIS3 and MEL1 expression.
The surviving colonies on TDO and QDO medium were re-streaked on corresponding
selective plates to assure maintenance of correct phenotype followed by isolation of
plasmid DNA using YEASTMAKER Yeast Plasmid Isolation Kit (Clontech). Yeast-
purified plasmid DNA was then transformed into E.coli DH5 to select for transformants
containing only the AD/library plasmid (as oppose to DNA-BD plasmid) by selecting on
LB medium containing ampicillin and the cDNA inserts were sequenced. To re-confirm
the specific interaction between the candidate clones and PR-Set7 bait, they were co-
transformed back into AH109 yeast strain and tested again for growth on DDO, TDO and
QDO plates.

In vitro binding assay
Glutathione S-transferase (GST), GST-UBC9 and His-S-tag-PR-Set7 proteins were
expressed in bacterial strain BL21 and were isolated by either glutathione-conjugated
Sepharose 4B beads (GE Healthcare) or Ni Sepharose High Performance agarose beads
(GE Healthcare), respectively. Purified recombinant His-S-tag-PR-Set7 (5µg or 10µg),
3µg of anti-S-tag antibody and 20µL of pre-equilibrated Protein-A beads in a 300µL final
volume in IP buffer (50 mM Tris-HCl pH 7.0, 150 mM NaCl, 0.5 mM DTT, 1% NP-40,
1 mM PMSF, 1 μg/mL pepstatin and 1 μg/mL aprotinin/leupeptin) were incubated
overnight at 4 C. Next, purified GST-UBC9 (5μg) or GST alone (3μg) was added to the
reaction and incubated at 4 C for an additional 8 hours. Beads were washed thoroughly
with IP buffer and bound proteins were eluted in 20µL of SDS loading dye. 20% of the

113

eluted material was resolved on SDS-PAGE gel and analyzed by Western analysis using
anti-His or anti-UBC9 antibodies.

GST pull-down assay
3μg of the recombinant GST-UBC9 or GST alone was incubated with 15 μL of in vitro
translated [
35
S] labeled His-PR-Set7 proteins (TnT kit; Promega) in IP buffer overnight at
4 C, following an additional 4 hour incubation at 4 C with 20μL of pre-equilibrated
glutathione-conjugated Sepharose 4B beads (GE Healthcare). Bound proteins were
washed thoroughly with IP buffer and were analyzed by SDS-PAGE gel and
autoradiography or Western analysis using anti-GST or anti-UBC9 antibodies.

In vitro and in vivo sumoylation assays
HEK 293 cells were transfected with indicated plasmids using Lipofectomine 2000
standard protocol (Invitrogen). Cell extracts were collected with or without 10mM N-
ethylmaleimide 48h post-transfections. Immunoprecipitation with EZview Red M2
FLAG affinity gel (Sigma) were performed as previously described. Bound material was
resolved on SDS-PAGE gel followed by Western analysis using anti-FLAG antibodies.
The in vitro sumoylation assay was performed with a SUMOlink Kit (Active Motif)
using recombinant or in vitro translated
35
S labeled proteins as substrates.

HMTase assay

1. Set up the following 25 L reaction per sample:
12.5 L 2x HMT buffer (100mM Tris pH 8.0, 20% glycerol, 2mM DTT, 2mM PMSF
1 L
3
[H]-SAM (adenosy-L-methionine-S-[methyl-
3
H]; 72 Ci/mmol; 0.55 uCi/ul)

114

X L target substrate (i.e histones, nucleosomes, peptides, etc.)
Y L enzyme (i.e. recombinant protein, nuclear extract, etc.)
Z L diH20
Vf = 25 L
**It is easiest to make a master mix of everything without the enzyme (add enzyme last)
2. Mix well and incubate at 30C for 1 hour
3. Spot a designated amount of the reaction (any or all of it) onto P-81 filter paper.
Alternatively, you could run the product on a gel if target substrate is histone,
nucleosome, protein, etc. Or spot half on filter and use the other half on a gel.
4. Wash filter paper 3 x 200 mL of 50 mM Sodium Bicarbonate pH 9.0 for 10-15 min
shaking at room temp.
5. Place filter paper in scintillation tubes with 2mL of scintillation fluid.\
6. Counts (1.00 for
3
H)

Immunofluorescence studies (Chromatin fibers) (adapted from Susan Forsburg’s
protocol, modified and standardized by Jennifer Sims)
(See Table 1 for antibodies and dilutions; make all solutions fresh)
1. Trypsinize cells, wash in PBS and resuspend in NIB buffer. Spin down the cells
600xg 7 minutes at 4 deg. Wash nuclear pellet twice with PBS+1mM PMSF.
2. Resuspend nuclear pellet in chromatin lysis buffer and pipet lines of chromatin
down supercharged slides. Let dry for ~5 minutes. **I usually draw two lines
down the width of the slide using a liquid blocker marker (PAP PEN) before
streaking the chromatin onto the slides. This prevents the antibody from moving
beyond where the chromatin fibers should be**
3. Immerse slides in chromatin lysis buffer in a Coplin jar for 10 minutes.
4. Slowly lift the slides straight out of the jar and immerse in PBS for ~2 minutes
5. Immerse slides in 4% formaldehyde/PBS for 20 minutes
6. Slowly lift the slides straight out of the jar and immerse in PBS for ~10 minutes
7. Immerse slides in blocking solution for 1 hour at room temperature
8. Slowly lift the slides straight out of the jar and blot the ends of the slides to
remove excess moisture. Add 100uL primary antibody, diluted in blocking
solution, to the slides and incubate overnight at 4 deg.
9. Immerse slides in wash buffer 3x 5 minutes at room temperature
10. Add 100uL secondary antibody, diluted in blocking solution, to the slides and
incubate at room temperature for 1 hour. Make sure to cover the slides with foil
to protect from the light.
11. Immerse slides in wash buffer 3x 5 minutes at room temperature
12. Add mounting medium to the slides and a coverslip.

115

NIB Buffer Chromatin Lysis Buffer
150mM NaCl 25mM Tris, pH 7.5
10mM HEPES, pH 7.4 0.5M NaCl
1.5mM MgCl
2
1% Triton X-100
10mM KCl 0.5M Urea (diluted from 1M
0.5% NP-40 urea made up immediately
0.5mM DTT prior to use)
1mM PMSF
1ug/mL pepstatin
1ug/mL aprotinin/leupeptin

Blocking Solution (in PBS) Wash Solution
1% BSA 0.05% Tween 20 in PBS
0.5% Triton X-100
0.02% NaN
3

**For more detecting more loosely associated proteins, use Protein Lysis Buffer (200mM
Tris, pH 7.5, 50mM EDTA, and 0.5% SDS) instead of chromatin lysis buffer.

116

Table 5: Antibodies used for immunofluorescence experiments

Antibody Species Chromatin Fiber
Dilutions
H4K20me1 Rabbit 1:100
Ku70 Rabbit 1:100
Ku80 Rabbit 1:50
PARP1 Mouse 1:200
FITC secondary Rabbit 1:200
Cy3 secondary Rabbit 1:150

117

Western blot analysis
Preparation of Lysates
1. Collecting cells: Trypsinize cells off of petri dishes and spin down 500xg 5 min
Resuspend pellet in PBS and respin to wash out all media
2. Resuspend the cell pellets in 2x Laemmli to lyse the cells (final concentration of
10^7 cells/mL).
3. Boil the lysate for 10 minutes and homoginize using a 21-gauge needle (10-15x)
after lysate has cooled.
4. For western blot analysis, we usually load the gels by cell number/lane using ~10
5

cells/lane or ~10uL/lane.

2xLaemmli Buffer
0.2% SDS
3mM Tris
0.4M glycine

Gel Transfer
1. Make ―sandwich‖ of blot paper, membrane, and gel in the following order
(bottom to top):
• 9 pieces of blot paper soaked in 1x Tobin buffer+MeOH
• Membrane soaked in MeOH
• Gel soaked in 1x Tobin buffer+MeOH
• 6 pieces of blot paper soaked in 1x Tobin buffer+MeOH
2. Remove all air bubbles that may be trapped between the pieces of blot paper and
to smooth out the gel using a pipet to ensure good transfer.
3. Run transfer for 120 min at 54mA/gel (ex: 2 gels=106mA), place a 1L bottle
filled up at least 500mL on top of the apparatus to ensure that the sandwich is held
together tightly.
4. Disassemble ―sandwich‖ and place membrane into MeOH for ~5min. To check
for good transfer, the gel can be coomassie stained for 1hr and destained for 1 hr
after transfer.
5. Stain membrane with Ponceau S to look at transfer quality for 10 min (rocking)
and rinse with dH
2
O.

Blot (See Table 4 for antibody conditions and dilutions)
1. Block for 30 min in 5%milk/TBS pH 7.5
2. Seal the membrane in plastic pouch after adding primary antibody (diluted in 1%

118

milk/TBS, 4mL/whole membrane), incubate on Nutator for 1 hr at room
temperature. (The incubation time and temperature can be adjusted as the
antibody may require)
3. Wash membrane 3x10 min TBS/0.1% Tween-20
4. Seal membrane in plastic pouch after adding secondary antibody (diluted in 1%
milk/TBS, 4mL/whole membrane), incubate on Nutator for 1 hr at room
temperature. (The incubation time and temperature can be adjusted as the
antibody may require)
5. Wash membrane 3x10 min TBS/0.1% Tween-20
6. Develop using ECL plus kit:
Dilute 25μL of Solution B into 1mL of Solution A/blot (this solution is
light sensitive, so make in a foil wrapped 15mL conical tube)
Add dropwise to membrane, evenly covering the entire surface—
especially around your MW of interest.
Incubate 5 min, moving foil around to spread out ECL.
Develop using film, it’s best to do a 1 min and 3 min exposure to ensure
that you are seeing your bands of interest. A shorter or longer exposure
may also be required

119

Table 6: Antibodies used for Western blot analysis

Antibody Species Dilutions Conditions
H4K20 monomethyl
(linear)
Rabbit 1:8000 1.5h RT
H4K20 dimethyl
(branched)
Rabbit 1:15000 1h RT
H4K20 trimethyl
(branched)
Rabbit 1:10000 1.5h RT
H4 general Rabbit 1:40000 1h RT
H3K9 monomethyl Rabbit 1:40000 1.5h RT
H3K9 dimethyl Rabbit 1:60000 1.5h RT
H3K9 trimethyl Rabbit 1:6000 1.5h RT
PR-Set7 (D.
Reinberg)
Rabbit 1:1000 o/n at 4C
FLAG Mouse 1:2500 1h RT
FLAG Rabbit 1:4000 1h RT
PARP1 Rabbit 1:1000 1h RT
Ku70 Rabbit 1:1000 2h RT
Ku80 Rabbit 1:1000 2h RT
DNA-PK Rabbit 1:1000 2h RT
Myc Mouse 1:2000 1h RT
UBC9 Goat 1:500 2h RT
His Rabbit 1:1000 1h RT
GST Rabbit 1:5000 1h RT
HA Rabbit 1:500 1h RT
SUMO1 Rabbit 1:4000 1h RT
HP1β Rabbit 1:1000 1h RT
V5 Rabbit 1:1000 1h RT

120

Quantitative real time PCR studies (adapted from Jennifer Sims)

cDNA conversion from mRNA
**RNA is extracted using Qiagen RNeasy extraction kit (Cat#: 74104)
cDNA conversion kit (ABI TaqMan RT reagent Cat# N808-0234)
Using this kit, you can RT 2μg in 100μL but I have always RT’d 500ng in 50μL.
All reagents except DEPC H
2
O are kept at -40
0
C. Before starting, thaw 10x RT buffer,
MgCl
2
, dNTPs, random hexamers and RNA. Once items have thawed, store on ice. DO
NOT allow RNase or RT enzyme to come to RT, always store on ice.

RT Reaction Master Mix 1X RXN
10x RT buffer 5μL
MgCl
2
11μL
dNTPs 10μL
Random Hexamers 2.5μL
RNase Inhibitor 1μL
Reverse Transcriptase 1.25μL
DEPC H
2
O and RNA (combined total volume) 19.25μL

Reverse Transcription PCR Conditions
25
0
C for 10 minutes
48
0
C for 30 minutes
95
0
C for 5 minutes
4
0
C hold
We assume 100% conversion of RNA to cDNA and based on this we amplify 5-
15ng of cDNA

qPCR using SYBR green and Expression Primer Design for Real Time PCR using SYBR
green
Look up the gene of interest on UCSC genome browser (http://genome.ucsc.edu/) and
select the gene under the RefSeq Genes (these are the sequences that have been verified).

121

If your gene is not here, then select from known genes. This will bring up a map of the
gene within the genome and you want to click on the gene again under RefSeq. Then
select mRNA/Genomic Alignments. The cDNA sequence will be the first sequence that
you see and this is the sequence that you want to use to generate expression primers.
Select any portion of the sequence that is shown in blue as this is the portion that
is the coding region of the cDNA. Make sure that the portion that you select contains
some base pairs that are light blue because these are the exon-exon junctions and are
important for designing good expression primers. **Take note of where the exon-exon
junction is located, i.e. how many base pairs away it is from the start of the sequence that
you highlighted, and try to highlight at least 300 base pairs**

Copy and paste your sequence into Primer3 program (http://frodo.wi.mit.edu/cgi-
bin/primer3/primer3_www.cgi). It is not necessary to remove the numbers on the
outside of the sequence. Make sure that the boxes are checked for Pick left primer and
Pick right primer. Set the product size to be 150-250 and change the %GC Min to be
30% and then press ―Pick Primers‖. The next page will contain a list of 5 primer sets that
are optimal for your region of interest. The first set will be displayed at the top of the
page and the other 4 sets will be at the bottom of the page. The 1
st
set is the most optimal
set. It would be best to copy and paste all 5 primer sets into either word or excel so that
you have a record of the primer sequences in case the 1
st
set doesn’t work well so that
you don’t have to repeat the entire process. It is also a good idea to write down the length
of each primer because you will need this information later.

122

Open the USC/Norris Cancer Center DNA Core Facility oligo synthesis website
(http://uscnorriscancer.usc.edu/Core/DNA/OSynth.aspx). Select Judd Rice from the P.I.
list and fill in the rest of the information with your information (contact person, email
etc.). Make sure that DNA is selected from the Type of primers that you want to make.
Name your primers (the 1
st
primer is the forward primer so I usually call it gene name_F,
ex: myoD_F) and paste in the sequence into the box labeled 5’. After you have finished
adding in your primer sequences, make sure that 40nmole is selected from the scale and
that desalted (no charge) is selected from the purification and that None is selected from
the modifications. Select USC account number from the payment methods and enter in
the account number (provided by Judd). Select an Anantomical Site (required, you can
always put unsure or special studies, it doesn’t matter) and then press Refresh
Costs/Count Bases to double check that there are no errors in the information that you
added. If there is an error, it will show up in red. If everything seems okay, then press
submit. The oligos will be ready within 1-2 days after ordering and can be picked up
from NOR 5338 between 8am-5pm. You will also get an email when the oligos are
ready.

Testing Primers for Use with SYBR green and setting up Real Time using SYBR green
**It is critical to determine the melting temperature of primers to be used for SYBR
green as primer dimers can interfere with interpretation of the results because the SYBR
green will intercalate into the dimers as well as the true PCR product.

123

1. Set up 2 reactions, one using the cDNA of interest and one without cDNA
template.

PCR Master Mix 1X RXN
2X SYBR green 10μL
10 pmol F primer 1μL
10 pmol R primer 1μL
cDNA 1μL
PCR H
2
O 7μL
2. Run program JennMeltCurve:
95
0
C for 3 minutes
40-50 cycles of:
95
0
C for 10 seconds
56
0
C for 30 seconds**fluorescence read here**
95
0
C for 1 minute
56
0
C for 1 minute
71 cycles starting at 60
0
C, temperature increases 0.5
0
C every 10 seconds and
ending at 95
0
C**fluorescence read here**
3. Analyze data by comparing the melt curves ± cDNA. The optimal primer set will
not have any curves for the primers only sample but if there is a curve, it’s best to
find a temperature where the primers only curve will be completely melted away
without effecting the cDNA sample. It is important to retest the melt temperature
every time a new set of primers are ordered.
4. Once the melt temperature has been established, set up at least 3 reactions/sample
using the following master mix:

PCR Master Mix 1X RXN
2X SYBR green 10μL
10 pmol F primer 1μL
10 pmol R primer 1μL
cDNA 1μL
PCR H
2
O 7μL
**Make sure to include a –cDNA template control in duplicate
5. Run program JennSYBRgreen:
95
0
C for 3 minutes
40-50 cycles of:
95
0
C for 10 seconds
56
0
C for 30 seconds
melt spec temp for 10 sec **fluorescence read here**
hold at 20
0
C

124

Immunoprecipitation studies
IP Lysis Buffer
50mM Tris pH 7.5
150mM NaCl
0.5mM DTT
1% NP-40
protease inhibitors (1μg/mL pepstatin A, 1μg/mL leupeptin/aprotinin, 1mM
PMSF)

Preparation of agarose beads for immunoprecipitation
Protein A or G beads (use pipette tips cut at 10μL mark to transfer beads)
1. Beads are stored in 20% EtOH solution as a 50% slurry. Aliquot the amount
of beads needed for IPs and spin down 30 seconds 14000 rpm to remove
EtOH
2. Wash beads 2x1mL IP lysis buffer to equilibrate
3. Resuspend beads in 50% slurry of IP lysis buffer

Conjugated beads (use pipette tips cut at 10μL mark to transfer beads)

1. Beads are stored in solution as a 50% slurry. Aliquot the amount of beads
needed for IPs.
2. Add 10 volumes 100mM glycine pH 2.5 to remove excess antibody. Spin
down 30 seconds 14000 rpm to remove supernatent
3. Add 10 volumes 200mM Tris pH 8. Spin down 30 seconds 14000 rpm to
remove supernatent
4. Add 10 volumes IP lysis buffer + protease inhibitors. Spin down 30 seconds
14000 rpm to remove supernatent
5. Resuspend beads as 50% slurry in IP lysis buffer.

Immunoprecipitations from tissue culture cells
1. Trypsinize cells from 6 well plate and pellet cells 5 minutes 600xg RT
2. Wash pellet 1x PBS and re-spin
3. Resuspend cells in 300-500μL cold IP lysis buffer + protease inhibitors
4. Spin down 10 minutes 14000 rpm 4
0
C to pellet insoluable fraction
5. Separate supernatent from the pellet and use the supernatent for IPs.
**If using protein A or G beads, preclear lysates 4h-overnight using 40μL of 50%
slurry of appropriate beads. Spin down lysates 5 minutes 4000 rpm 4
0
C. Transfer
lysates to a new tube.

125

6. Keep ~20-50μL of supernatent at -40
0
C for input for Western blot analysis. Use
the remaining supernatent to set up IP reactions.
7. After adding beads and antibody or pre-conjugated beads, rotate overnight at 4
0
C.
8. Spin down 5 minutes 4000 rpm at 4
0
C and save supernatent as unbound fraction.
9. Wash beads 2x500μL cold IP lysis buffer.
10. Resuspend beads in 35μL 6x SDS dye and either boil 10 minutes or elute at 55
0
C
for 10 minutes. Elution at 55
0
C allows for separation of the bound fraction
without getting too much of the heavy and light chain of the antibody to reduce
background.
11. Collect bound fraction by poking a hole in the top of the epi tub and in the bottom
and placing in a clean epi tube to spin down. This allows for collection of the
bound material without getting any of the beads. Proceed with Western analysis
or save bound and unbound fractions at -40
0
C.

Immunoprecipitations using IP lysates and TNT’d material
1. Prepare IP lysates as described above and add 3-10μL of TNT’d material to the
lysates.
2. Proceed with IP reactions as above.
**The amount of TNT’d material that you will use depends on how efficient the
binding is. This will have to be standardized for each TNT’d protein.

126

Table 7: Antibodies used for immunoprecipitations
Antibody Amount Used Beads Used Preclear?
How long?

α-UBC9 3μg Protein G Yes, 4 h 4
0
C
α-FLAG 20μL 50%
slurry
pre-conjugated No
α-HA 20μL 50%
slurry
pre-conjugated No
Α-V5 20μL 50%
slurry
pre-conjugated No

Shown above are the amounts of antibody used for immunoprecipitations using a 300-
1000μL starting volume for IPs.

127

Table 8: List of expression and sequencing primers.
Primer Name Primer Sequence Use
T7 Sequencing
Primer
TAATACGACTCACTATAGGGC
AD cDNA library
inserts
shRNA_PR-Set7
CGCAACAGAATCGCAAAC
Knock down of PR-Set7
shRNA_UBC9
GGAACUUCUAAAUGAACCA
Knock down of UBC9
NFKBIZ_Forward
TGGTTGATACCATTAAGTGCCTA
qRT-PCR, expression
NFKBIZ_Reverse
GTAAGCCTTTGCATTCACAAAA
qRT-PCR, expression
VAMP1_Forward
AGCATCACAATTTGAGAGCAGT
qRT-PCR, expression
VAMP1_Reverse
GTGTTGAGAGAGCAAACAGAGG
qRT-PCR, expression
UBE2L6_Forward
CCATGATCAAATTCACAACCA
qRT-PCR, expression
UBE2L6_Reverse
TTCGGCATTCTTTCTGAACA
qRT-PCR, expression
CBR1_Forward
TGATCCCACACCCTTTCATA
qRT-PCR, expression
CBR1_Reverse
AGCTTTTAAGGGCTCTGACG
qRT-PCR, expression
PR-Set7_Forward
ATTGCCACCAAGCAGTTCTC
qRT-PCR expression
PR-Set7_Reverse
CGATGAGGATGAGGTGAGGT

GAPDH_Forward
CAGCCGAGCCACATCGCTCAGAC
A
qRT-PCR expression
GAPDH_Reverse
TGAGGCTGTTGTCATACTTCTC
qRT-PCR expression
FLAG-HA
CCCGGATCCGCCACCATGGACTAC
Sequencing
FLAG-HA
CCCCCCGTCGACTCCTCCGGCGT
AGTC
Sequencing

128

BMH crosslinking
BMH reacts specifically with sulfhydryl groups, this means that BMH crosslinking may
occur only if Cysteine residues are available around the interface(s) of both interacting
proteins.
For 6-well plate:
1. Wash cells twice with 2mL of PBS per well.
2. Incubate cells with 10 M BMH*** (this concentration may change depending on
the type of proteins you are working with) in 3mL of PBS/ per well for 10 min at
room temperature on a rocking platform.
3. Wash cells once with 2mL of PBS per well.
4. Incubate cells with 3mL/well of quenching buffer (1mM DTT/PBS) for 5 min at
room temperature on a rocking platform.
5. Wash cells once with 2mL/well of PBS.
6. Add 700 L of Co-IP buffer/well, incubating on ice on a rocking platform for 20
min. If needed check Co-IP lysates by Trypan Blue staining to make sure that
cells are appropriately lysed.
7. Spin Co-IP lysates for 10 min at max speed at 4C.
8. Proceed with Co-IP procedure according to standardized Co-IP protocol.
*** BMH needs to be prepared as stock solution in DMSO. It is better to use it fresh
every time. I usually prepare 20mM BMH in DMSO stock solution by mixing 5.5 mg of
BMH in 1mL of DMSO (BMH MW= 276.29g). Then add 1.5 microliters of 20mM BMH
stock into 3mL of either PBS or DMEM to get 10 M BMH (final) --- THIS IS ADDED
DIRECTILY TO THE CELLS! If cells are sensitive to prolonged incubations in PBS,
then final dilution of BMH can be made in DMEM medium instead of PBS.

Protein precipitation using TCA (Trichloroacetic-Acid)
***This protocol works best for dilute samples
1. Mix 10 volumes of cold 10% TCA in Acetone (Stored at -20C) with your
samples.
2. Vortex and incubate at -20C for at least 3 hours, but overnight is optimal.
3. Centrifuge samples at 15000 x g for 30 min at 4C and remove supernatant.
4. Add the same volume of cold Acetone only.
5. Vortex and incubate at -20C for 30 min.
6. Centrifuge at 15000 x g for 15 min at 4C, remove supernatant and allow pellets to
air dry.
*** It is important to prevent complete desiccation of the protein pellet as this will
make re-solubilization much harder and may cause problems during MassSpec

129

analysis. (For Mass Spec analysis, I omitted the washing step, so after centrifugation
(Step 3), supernatant was removed leaving the pellet in 20 microliters of 10%TCA in
Aceton. Sample was shipped for Mass Spec Analysis on dry ice.)

Characterization of MTeC constructs
When testing my constructs for the first time, I usually transfect 2-wells per construct and
use one well to make WCLs and second well to make IP lysates. I use WCLs to test
expression levels of constructs by re-suspending cell pellet in 200-300 L of 2X Laemmli
Buffer.
1. In 6-well plate seed 5 x 10^5 cells/mL of 293T cells.
2. When cells are ~70-80% confluent (usually 24 hour later), transfect 293T cells
using BioT transfection protocol ( use 2 g of the CsCl or midi-preped DNA per
transfection reaction).
3. Collect nuclear IP extracts 24h and 48h post-transfection:
1) Rise cells with 2mL of PBS
2) Trypsinize cells using 300 L of Trypsin per well at 37C
3) Add 700 L of fresh DMEM to trypsinized cells, mix well and transfer
cells into 1.2mL eppendorf tube.
4) Pellet cells at 600 x g for 5 min
5) Rinse cell pellet with 1mL of PBS
6) Pellet cells at 600 x g for 5 min
7) Re-suspend cell pellet in 1mL of NIB buffer to isolate nuclei
8) Pellet nuclei at 600 x g for 10 min at 4C
9) Discard supernatant (cytoplasmic fraction)
10) Re-suspend nuclear pellet in 500 L of CoIP buffer
11) Spin nuclear IP lysates at max speed for 5min at 4C
12) Transfer supernatant into a fresh 1.2mL eppendorf tube. This is your
nuclear IP lysates. Either store them at -80C or proceed with IPs.
4. Use 20 L of EZview
TM
Red ANTI-FLAG
®
M2 Affinity Gel per IP reaction.
5. Equilibrate M2 FLAG conjugated beads 2 x 200 L (or 10V) of CoIP buffer.
6. Re-suspend pre-equilibrated beads in 100 L of CoIP buffer per reaction.
7. Combine 300 L of Nuclear IP lysate with 100 L of pre-equilibrated FLAG-
conjugated beads and incubate over night at 4C rotating.
8. Pellet bound material at max speed for 3 min at 4C.
9. Transfer supernatant to a new tube and save as UNBOUND fraction.
10. Wash bound material 3 x 500 L with CoIP buffer. (I usually rotate tubes at 4C
for 3min between the washes).

130

11. Collect bound material by boiling for 5 min at 100C or 10min at 65C in 20-40 L
of 6X SDS loading dye. Store bound material at -80C or proceed with Western
Blot analysis.

Note: To analyze bound material by Western analysis, I usually load 50% of the bound
material for WB to detect the presence of the desired modification and 5-10% of the
bound material for WB with anti-FLAG antibody to make sure that IPs worked. I also
always run all bound fractions (controls and experimental) on one blot and all inputs on
the separate blot).

Nuclear Isolation Buffer (NIB)
300 L 5M NaCl (150mM final)
100 L 1M Hepes pH7.4 (10mM final)
15 L 1M MgCl2 (1.5mM final)
50 L 2M KCl (10mM final)
500 L 10% NP-40 (0.5% final)
5 L 1M DTT (0.5mM final)
100 L 100mM PMSF (1mM final)
10 L 1mg/mL pepstatin (1 g/mL)
10 L 1mg/mL aprotinin/leupeptin (1 g/mL)
8.9 mL of dH2O
Vf = 10mL

Coimmunoprecipitation Buffer (CoIP)

2.5mL 1M Tris-HCl pH 7.0 (50mM final)
1.5mL 5M NaCl (150mM final)
25 L 1M DTT (0.5mM final)
5mL 10% NP-40 (1% final)
100 L 100mM PMSF (1mM final)
10 L 1mg/mL pepstatin (1 g/mL)
10 L 1mg/mL aprotinin/leupeptin (1 g/mL)
40.8mL dH2O
Vf= 50mL
***Store buffers at 4C. Always add protease inhibitors right before use.

131

Bibliography
Bannister, A. J., P. Zegerman, et al. (2001). "Selective recognition of methylated lysine 9
on histone H3 by the HP1 chromo domain." Nature 410(6824): 120-4.

Belotserkovskaya, R., S. Oh, et al. (2003). "FACT facilitates transcription-dependent
nucleosome alteration." Science 301(5636): 1090-3.

Bernier-Villamor, V., D. A. Sampson, et al. (2002). "Structural basis for E2-mediated
SUMO conjugation revealed by a complex between ubiquitin-conjugating enzyme
Ubc9 and RanGAP1." Cell 108(3): 345-56.

Botuyan, M. V., J. Lee, et al. (2006). "Structural basis for the methylation state-specific
recognition of histone H4-K20 by 53BP1 and Crb2 in DNA repair." Cell 127(7):
1361-73.

Braisted, J. C., S. Kuntumalla, et al. (2008). "The APEX Quantitative Proteomics Tool:
generating protein quantitation estimates from LC-MS/MS proteomics results."
BMC Bioinformatics 9: 529.

Brasher, S. V., B. O. Smith, et al. (2000). "The structure of mouse HP1 suggests a unique
mode of single peptide recognition by the shadow chromo domain dimer." EMBO
J 19(7): 1587-97.

Brower-Toland, B., D. A. Wacker, et al. (2005). "Specific contributions of histone tails
and their acetylation to the mechanical stability of nucleosomes." J Mol Biol
346(1): 135-46.

Cao, R., L. Wang, et al. (2002). "Role of histone H3 lysine 27 methylation in Polycomb-
group silencing." Science 298(5595): 1039-43.

Cao, R. and Y. Zhang (2004). "The functions of E(Z)/EZH2-mediated methylation of
lysine 27 in histone H3." Curr Opin Genet Dev 14(2): 155-64.

Cao, R. and Y. Zhang (2004). "SUZ12 is required for both the histone methyltransferase
activity and the silencing function of the EED-EZH2 complex." Mol Cell 15(1):
57-67.

Cheng, X., R. E. Collins, et al. (2005). "Structural and sequence motifs of protein
(histone) methylation enzymes." Annu Rev Biophys Biomol Struct 34: 267-94.

Chien, C. T., P. L. Bartel, et al. (1991). "The two-hybrid system: a method to identify and
clone genes for proteins that interact with a protein of interest." Proc Natl Acad
Sci U S A 88(21): 9578-82.

132

Collins, R. E., J. P. Northrop, et al. (2008). "The ankyrin repeats of G9a and GLP histone
methyltransferases are mono- and dimethyllysine binding modules." Nat Struct
Mol Biol 15(3): 245-50.

Collins, R. E., M. Tachibana, et al. (2005). "In vitro and in vivo analyses of a Phe/Tyr
switch controlling product specificity of histone lysine methyltransferases." J Biol
Chem 280(7): 5563-70.

Couture, J. F., E. Collazo, et al. (2005). "Structural and functional analysis of SET8, a
histone H4 Lys-20 methyltransferase." Genes Dev 19(12): 1455-65.

Daniel, J. A., M. G. Pray-Grant, et al. (2005). "Effector proteins for methylated histones:
an expanding family." Cell Cycle 4(7): 919-26.

de Murcia, G. and J. Menissier de Murcia (1994). "Poly(ADP-ribose) polymerase: a
molecular nick-sensor." Trends Biochem Sci 19(4): 172-6.

De Rubertis, F., D. Kadosh, et al. (1996). "The histone deacetylase RPD3 counteracts
genomic silencing in Drosophila and yeast." Nature 384(6609): 589-91.

Dillon, S. C., X. Zhang, et al. (2005). "The SET-domain protein superfamily: protein
lysine methyltransferases." Genome Biol 6(8): 227.

Dou, Y., T. A. Milne, et al. (2006). "Regulation of MLL1 H3K4 methyltransferase
activity by its core components." Nat Struct Mol Biol 13(8): 713-9.

Du, L. L., T. M. Nakamura, et al. (2006). "Histone modification-dependent and -
independent pathways for recruitment of checkpoint protein Crb2 to double-
strand breaks." Genes Dev 20(12): 1583-96.

Fang, J., Q. Feng, et al. (2002). "Purification and functional characterization of SET8, a
nucleosomal histone H4-lysine 20-specific methyltransferase." Curr Biol 12(13):
1086-99.

Fields, S. and O. Song (1989). "A novel genetic system to detect protein-protein
interactions." Nature 340(6230): 245-6.

Fischle, W., Y. Wang, et al. (2003). "Molecular basis for the discrimination of repressive
methyl-lysine marks in histone H3 by Polycomb and HP1 chromodomains."
Genes Dev 17(15): 1870-81.

Flanagan, J. F., L. Z. Mi, et al. (2005). "Double chromodomains cooperate to recognize
the methylated histone H3 tail." Nature 438(7071): 1181-5.

133

Gershey, E. L., G. W. Haslett, et al. (1969). "Chemical studies of histone methylation.
Evidence for the occurrence of 3-methylhistidine in avian erythrocyte histone
fractions." J Biol Chem 244(18): 4871-7.

Girdwood, D., D. Bumpass, et al. (2003). "P300 transcriptional repression is mediated by
SUMO modification." Mol Cell 11(4): 1043-54.

Gong, L., T. Kamitani, et al. (1997). "Preferential interaction of sentrin with a ubiquitin-
conjugating enzyme, Ubc9." J Biol Chem 272(45): 28198-201.

Gonzalez, P. J. and E. Palacian (1989). "Interaction of RNA polymerase II with
structurally altered nucleosomal particles. Transcription is facilitated by loss of
one H2A.H2B dimer." J Biol Chem 264(31): 18457-62.

Grewal, S. I. (2000). "Transcriptional silencing in fission yeast." J Cell Physiol 184(3):
311-8.

Grewal, S. I. and S. Jia (2007). "Heterochromatin revisited." Nat Rev Genet 8(1): 35-46.

Grewal, S. I. and J. C. Rice (2004). "Regulation of heterochromatin by histone
methylation and small RNAs." Curr Opin Cell Biol 16(3): 230-8.

Guo, D., T. R. Hazbun, et al. (2004). "A tethered catalysis, two-hybrid system to identify
protein-protein interactions requiring post-translational modifications." Nat
Biotechnol 22(7): 888-92.

Hansen, J. C., C. Tse, et al. (1998). "Structure and function of the core histone N-termini:
more than meets the eye." Biochemistry 37(51): 17637-41.

Harper, J. W., G. R. Adami, et al. (1993). "The p21 Cdk-interacting protein Cip1 is a
potent inhibitor of G1 cyclin-dependent kinases." Cell 75(4): 805-16.

Hassa, P. O., S. S. Haenni, et al. (2006). "Nuclear ADP-ribosylation reactions in
mammalian cells: where are we today and where are we going?" Microbiol Mol
Biol Rev 70(3): 789-829.

Houston, S. I., K. J. McManus, et al. (2008). "Catalytic function of the PR-Set7 histone
H4 lysine 20 monomethyltransferase is essential for mitotic entry and genomic
stability." J Biol Chem.

Houston, S. I., K. J. McManus, et al. (2008). "Catalytic function of the PR-Set7 histone
H4 lysine 20 monomethyltransferase is essential for mitotic entry and genomic
stability." J Biol Chem 283(28): 19478-88.

134

Huen, M. S., S. M. Sy, et al. (2008). "Direct interaction between SET8 and PCNA
couples H4-K20 methylation with DNA replication." J Biol Chem.

Huen, M. S., S. M. Sy, et al. (2008). "Direct interaction between SET8 and proliferating
cell nuclear antigen couples H4-K20 methylation with DNA replication." J Biol
Chem 283(17): 11073-7.

Iliakis, G., B. Rosidi, et al. (2006). "Plasmid-based assays for DNA end-joining in vitro."
Methods Mol Biol 314: 123-31.

Ivanov, A. V., H. Peng, et al. (2007). "PHD domain-mediated E3 ligase activity directs
intramolecular sumoylation of an adjacent bromodomain required for gene
silencing." Mol Cell 28(5): 823-37.

Jacobs, S. A. and S. Khorasanizadeh (2002). "Structure of HP1 chromodomain bound to
a lysine 9-methylated histone H3 tail." Science 295(5562): 2080-3.

Jacobs, S. A. and S. Khorasanizadeh (2002). "Structure of HP1 chromodomain bound to
a lysine 9-methylated histone H3 tail." Science 295(5562): 2080-3.

Jacobs, S. A., S. D. Taverna, et al. (2001). "Specificity of the HP1 chromo domain for the
methylated N-terminus of histone H3." Embo J 20(18): 5232-41.

James, P., J. Halladay, et al. (1996). "Genomic libraries and a host strain designed for
highly efficient two-hybrid selection in yeast." Genetics 144(4): 1425-36.

Jenuwein, T. and C. D. Allis (2001). "Translating the histone code." Science 293(5532):
1074-80.

Johnson, E. S. and G. Blobel (1997). "Ubc9p is the conjugating enzyme for the ubiquitin-
like protein Smt3p." J Biol Chem 272(43): 26799-802.

Jorgensen, S., I. Elvers, et al. (2007). "The histone methyltransferase SET8 is required for
S-phase progression." J Cell Biol 179(7): 1337-45.

Kalakonda, N., W. Fischle, et al. (2008). "Histone H4 lysine 20 monomethylation
promotes transcriptional repression by L3MBTL1." Oncogene 27(31): 4293-304.

Kaplan, C. D., L. Laprade, et al. (2003). "Transcription elongation factors repress
transcription initiation from cryptic sites." Science 301(5636): 1096-9.

Karachentsev, D., K. Sarma, et al. (2005). "PR-Set7-dependent methylation of histone H4
Lys 20 functions in repression of gene expression and is essential for mitosis."
Genes Dev 19(4): 431-5.

135

Kim, E. J., J. S. Park, et al. (2008). "Ubc9-mediated sumoylation leads to transcriptional
repression of IRF-1." Biochem Biophys Res Commun 377(3): 952-6.

Kim, J., J. Daniel, et al. (2006). "Tudor, MBT and chromo domains gauge the degree of
lysine methylation." EMBO Rep 7(4): 397-403.

Kim, J. H., H. J. Choi, et al. (2006). "Roles of sumoylation of a reptin chromatin-
remodelling complex in cancer metastasis." Nat Cell Biol 8(6): 631-9.

Kim, M. Y., S. Mauro, et al. (2004). "NAD+-dependent modulation of chromatin
structure and transcription by nucleosome binding properties of PARP-1." Cell
119(6): 803-14.

Kireeva, M. L., W. Walter, et al. (2002). "Nucleosome remodeling induced by RNA
polymerase II: loss of the H2A/H2B dimer during transcription." Mol Cell 9(3):
541-52.

Kirsh, O., J. S. Seeler, et al. (2002). "The SUMO E3 ligase RanBP2 promotes
modification of the HDAC4 deacetylase." EMBO J 21(11): 2682-91.

Kleinsmith, L. J., V. G. Allfrey, et al. (1966). "Phosphorylation of nuclear protein early in
the course of gene activation in lymphocytes." Science 154(750): 780-1.

Kohlmaier, A., F. Savarese, et al. (2004). "A chromosomal memory triggered by Xist
regulates histone methylation in X inactivation." PLoS Biol 2(7): E171.

Koike, M., T. Ikuta, et al. (1999). "The nuclear localization signal of the human Ku70 is a
variant bipartite type recognized by the two components of nuclear pore-targeting
complex." Exp Cell Res 250(2): 401-13.

Kotaja, N., U. Karvonen, et al. (2002). "PIAS proteins modulate transcription factors by
functioning as SUMO-1 ligases." Mol Cell Biol 22(14): 5222-34.

Lachner, M., D. O'Carroll, et al. (2001). "Methylation of histone H3 lysine 9 creates a
binding site for HP1 proteins." Nature 410(6824): 116-20.

Lee, J., J. R. Thompson, et al. (2008). "Distinct binding modes specify the recognition of
methylated histones H3K4 and H4K20 by JMJD2A-tudor." Nat Struct Mol Biol
15(1): 109-11.

Lees-Miller, S. P., K. Sakaguchi, et al. (1992). "Human DNA-activated protein kinase
phosphorylates serines 15 and 37 in the amino-terminal transactivation domain of
human p53." Mol Cell Biol 12(11): 5041-9.

136

Lin, D., M. H. Tatham, et al. (2002). "Identification of a substrate recognition site on
Ubc9." J Biol Chem 277(24): 21740-8.

Luban, J. and S. P. Goff (1995). "The yeast two-hybrid system for studying protein-
protein interactions." Curr Opin Biotechnol 6(1): 59-64.

Luger, K., A. W. Mader, et al. (1997). "Crystal structure of the nucleosome core particle
at 2.8 A resolution." Nature 389(6648): 251-60.

Luger, K. and T. J. Richmond (1998). "DNA binding within the nucleosome core." Curr
Opin Struct Biol 8(1): 33-40.

Luger, K. and T. J. Richmond (1998). "The histone tails of the nucleosome." Curr Opin
Genet Dev 8(2): 140-6.

Lyst, M. J., X. Nan, et al. (2006). "Regulation of MBD1-mediated transcriptional
repression by SUMO and PIAS proteins." EMBO J 25(22): 5317-28.

Malik, S. and R. G. Roeder (2003). "Isolation and functional characterization of the
TRAP/mediator complex." Methods Enzymol 364: 257-84.

Marmorstein, R. (2003). "Structure of SET domain proteins: a new twist on histone
methylation." Trends Biochem Sci 28(2): 59-62.

Martens, J. H., R. J. O'Sullivan, et al. (2005). "The profile of repeat-associated histone
lysine methylation states in the mouse epigenome." EMBO J 24(4): 800-12.

Martin, C. and Y. Zhang (2005). "The diverse functions of histone lysine methylation."
Nat Rev Mol Cell Biol 6(11): 838-49.

Mauldin, S. K., R. C. Getts, et al. (2002). "DNA-PK-dependent binding of DNA ends to
plasmids containing nuclear matrix attachment region DNA sequences: evidence
for assembly of a repair complex." Nucleic Acids Res 30(18): 4075-87.

Maurer-Stroh, S., N. J. Dickens, et al. (2003). "The Tudor domain 'Royal Family': Tudor,
plant Agenet, Chromo, PWWP and MBT domains." Trends Biochem Sci 28(2):
69-74.

Merkle, D., P. Douglas, et al. (2002). "The DNA-dependent protein kinase interacts with
DNA to form a protein-DNA complex that is disrupted by phosphorylation."
Biochemistry 41(42): 12706-14.

Metzger, E., M. Wissmann, et al. (2005). "LSD1 demethylates repressive histone marks
to promote androgen-receptor-dependent transcription." Nature 437(7057): 436-9.

137

Minc, E., Y. Allory, et al. (2001). "Immunolocalization of HP1 proteins in metaphasic
mammalian chromosomes." Methods Cell Sci 23(1-3): 171-4.

Mo, Y. Y., Y. Yu, et al. (2004). "Overexpression of a dominant-negative mutant Ubc9 is
associated with increased sensitivity to anticancer drugs." Cancer Res 64(8):
2793-8.

Moilanen, A. M., U. Karvonen, et al. (1999). "A testis-specific androgen receptor
coregulator that belongs to a novel family of nuclear proteins." J Biol Chem
274(6): 3700-4.

Muller, J., C. M. Hart, et al. (2002). "Histone methyltransferase activity of a Drosophila
Polycomb group repressor complex." Cell 111(2): 197-208.

Muraoka, A., A. Maeda, et al. (2008). "Sumoylation of CoREST modulates its function
as a transcriptional repressor." Biochem Biophys Res Commun 377(4): 1031-5.

Murray, K. (1964). "The Occurrence of Epsilon-N-Methyl Lysine in Histones."
Biochemistry 3: 10-5.

Nakatani, Y. and V. Ogryzko (2003). "Immunoaffinity purification of mammalian protein
complexes." Methods Enzymol 370: 430-44.

Nathan, D., K. Ingvarsdottir, et al. (2006). "Histone sumoylation is a negative regulator in
Saccharomyces cerevisiae and shows dynamic interplay with positive-acting
histone modifications." Genes Dev 20(8): 966-76.

Nicholson, J. M., C. M. Wood, et al. (2004). "Histone structures: targets for
modifications by molecular assemblies." Ann N Y Acad Sci 1030: 644-55.

Nielsen, S. J., R. Schneider, et al. (2001). "Rb targets histone H3 methylation and HP1 to
promoters." Nature 412(6846): 561-5.

Nishioka, K., J. C. Rice, et al. (2002). "PR-Set7 is a nucleosome-specific
methyltransferase that modifies lysine 20 of histone H4 and is associated with
silent chromatin." Mol Cell 9(6): 1201-13.

Nowak, S. J. and V. G. Corces (2004). "Phosphorylation of histone H3: a balancing act
between chromosome condensation and transcriptional activation." Trends Genet
20(4): 214-20.

Oda, H., I. Okamoto, et al. (2009). "Monomethylation of histone H4-lysine 20 is involved
in chromosome structure and stability and is essential for mouse development."
Mol Cell Biol 29(8): 2278-95.

138

Ogawa, H., K. Ishiguro, et al. (2002). "A complex with chromatin modifiers that occupies
E2F- and Myc-responsive genes in G0 cells." Science 296(5570): 1132-6.

Ogryzko, V. V., T. Kotani, et al. (1998). "Histone-like TAFs within the PCAF histone
acetylase complex." Cell 94(1): 35-44.

Ord, M. G. and L. A. Stocken (1967). "Phosphate and thiol groups in histone f3 from rat
liver and thymus nuclei." Biochem J 102(2): 631-6.

Park, E. J., D. W. Chan, et al. (2003). "DNA-PK is activated by nucleosomes and
phosphorylates H2AX within the nucleosomes in an acetylation-dependent
manner." Nucleic Acids Res 31(23): 6819-27.

Peters, A. H., S. Kubicek, et al. (2003). "Partitioning and plasticity of repressive histone
methylation States in Mammalian chromatin." Mol Cell 12(6): 1577-89.

Peters, A. H., J. E. Mermoud, et al. (2002). "Histone H3 lysine 9 methylation is an
epigenetic imprint of facultative heterochromatin." Nat Genet 30(1): 77-80.

Peters, A. H., D. O'Carroll, et al. (2001). "Loss of the Suv39h histone methyltransferases
impairs mammalian heterochromatin and genome stability." Cell 107(3): 323-37.

Pichler, A., A. Gast, et al. (2002). "The nucleoporin RanBP2 has SUMO1 E3 ligase
activity." Cell 108(1): 109-20.

Rice, J. C., S. D. Briggs, et al. (2003). "Histone methyltransferases direct different
degrees of methylation to define distinct chromatin domains." Mol Cell 12(6):
1591-8.

Rice, J. C., K. Nishioka, et al. (2002). "Mitotic-specific methylation of histone H4 Lys 20
follows increased PR-Set7 expression and its localization to mitotic
chromosomes." Genes Dev 16(17): 2225-30.

Ruthenburg, A. J., C. D. Allis, et al. (2007). "Methylation of lysine 4 on histone H3:
intricacy of writing and reading a single epigenetic mark." Mol Cell 25(1): 15-30.

Saitoh, N., A. C. Bell, et al. (2000). "Structural and functional conservation at the
boundaries of the chicken beta-globin domain." EMBO J 19(10): 2315-22.

Sakaguchi, A. and R. Steward (2007). "Aberrant monomethylation of histone H4 lysine
20 activates the DNA damage checkpoint in Drosophila melanogaster." J Cell
Biol 176(2): 155-62.

139

Sampath, S. C., I. Marazzi, et al. (2007). "Methylation of a histone mimic within the
histone methyltransferase G9a regulates protein complex assembly." Mol Cell
27(4): 596-608.

Sampson, D. A., M. Wang, et al. (2001). "The small ubiquitin-like modifier-1 (SUMO-1)
consensus sequence mediates Ubc9 binding and is essential for SUMO-1
modification." J Biol Chem 276(24): 21664-9.

Sanders, S. L., M. Portoso, et al. (2004). "Methylation of histone H4 lysine 20 controls
recruitment of Crb2 to sites of DNA damage." Cell 119(5): 603-14.

Schotta, G., M. Lachner, et al. (2004). "A silencing pathway to induce H3-K9 and H4-
K20 trimethylation at constitutive heterochromatin." Genes Dev 18(11): 1251-62.

Schotta, G., R. Sengupta, et al. (2008). "A chromatin-wide transition to H4K20
monomethylation impairs genome integrity and programmed DNA
rearrangements in the mouse." Genes Dev 22(15): 2048-61.

Schultz, D. C., K. Ayyanathan, et al. (2002). "SETDB1: a novel KAP-1-associated
histone H3, lysine 9-specific methyltransferase that contributes to HP1-mediated
silencing of euchromatic genes by KRAB zinc-finger proteins." Genes Dev 16(8):
919-32.

Shiio, Y. and R. N. Eisenman (2003). "Histone sumoylation is associated with
transcriptional repression." Proc Natl Acad Sci U S A 100(23): 13225-30.

Shilatifard, A. (2006). "Chromatin modifications by methylation and ubiquitination:
implications in the regulation of gene expression." Annu Rev Biochem 75: 243-
69.

Shin, J. A., E. S. Choi, et al. (2005). "SUMO modification is involved in the maintenance
of heterochromatin stability in fission yeast." Mol Cell 19(6): 817-28.

Sims, J. K., S. I. Houston, et al. (2006). "A trans-tail histone code defined by
monomethylated H4 Lys-20 and H3 Lys-9 demarcates distinct regions of silent
chromatin." J Biol Chem 281(18): 12760-6.

Sims, J. K. and J. C. Rice (2008). "PR-Set7 establishes a repressive trans-tail histone
code that regulates differentiation." Mol Cell Biol 28(14): 4459-68.

Sims, R. J., 3rd, C. F. Chen, et al. (2005). "Human but not yeast CHD1 binds directly and
selectively to histone H3 methylated at lysine 4 via its tandem chromodomains." J
Biol Chem 280(51): 41789-92.

140

Sims, R. J., 3rd, K. Nishioka, et al. (2003). "Histone lysine methylation: a signature for
chromatin function." Trends Genet 19(11): 629-39.

Sims, R. J., 3rd, P. Trojer, et al. (2006). "Methods to identify and functionally analyze
factors that specifically recognize histone lysine methylation." Methods 40(4):
331-8.

Spektor, T. M. and J. C. Rice (2009). "Identification and characterization of
posttranslational modification-specific binding proteins in vivo by mammalian
tethered catalysis." Proc Natl Acad Sci U S A 106(35): 14808-13.

Steward, M. M., J. S. Lee, et al. (2006). "Molecular regulation of H3K4 trimethylation by
ASH2L, a shared subunit of MLL complexes." Nat Struct Mol Biol 13(9): 852-4.

Sutherland, B. W., J. Toews, et al. (2008). "Utility of formaldehyde cross-linking and
mass spectrometry in the study of protein-protein interactions." J Mass Spectrom
43(6): 699-715.

Tachibana, M., K. Sugimoto, et al. (2001). "Set domain-containing protein, G9a, is a
novel lysine-preferring mammalian histone methyltransferase with hyperactivity
and specific selectivity to lysines 9 and 27 of histone H3." J Biol Chem 276(27):
25309-17.

Tachibana, M., K. Sugimoto, et al. (2002). "G9a histone methyltransferase plays a
dominant role in euchromatic histone H3 lysine 9 methylation and is essential for
early embryogenesis." Genes Dev 16(14): 1779-91.

Tachibana, M., J. Ueda, et al. (2005). "Histone methyltransferases G9a and GLP form
heteromeric complexes and are both crucial for methylation of euchromatin at
H3-K9." Genes Dev 19(7): 815-26.

Tardat, M., R. Murr, et al. (2007). "PR-Set7-dependent lysine methylation ensures
genome replication and stability through S phase." J Cell Biol 179(7): 1413-26.

Tatham, M. H., Y. Chen, et al. (2003). "Role of two residues proximal to the active site of
Ubc9 in substrate recognition by the Ubc9.SUMO-1 thiolester complex."
Biochemistry 42(11): 3168-79.

Tatham, M. H., S. Kim, et al. (2005). "Unique binding interactions among Ubc9, SUMO
and RanBP2 reveal a mechanism for SUMO paralog selection." Nat Struct Mol
Biol 12(1): 67-74.

Tatham, M. H., S. Kim, et al. (2003). "Role of an N-terminal site of Ubc9 in SUMO-1, -
2, and -3 binding and conjugation." Biochemistry 42(33): 9959-69.

141

Taunton, J., C. A. Hassig, et al. (1996). "A mammalian histone deacetylase related to the
yeast transcriptional regulator Rpd3p." Science 272(5260): 408-11.

Tiefenbach, J., N. Novac, et al. (2006). "SUMOylation of the corepressor N-CoR
modulates its capacity to repress transcription." Mol Biol Cell 17(4): 1643-51.

Tong, H., G. Hateboer, et al. (1997). "Crystal structure of murine/human Ubc9 provides
insight into the variability of the ubiquitin-conjugating system." J Biol Chem
272(34): 21381-7.

Trinkle-Mulcahy, L., S. Boulon, et al. (2008). "Identifying specific protein interaction
partners using quantitative mass spectrometry and bead proteomes." J Cell Biol
183(2): 223-39.

Vakoc, C. R., S. A. Mandat, et al. (2005). "Histone H3 lysine 9 methylation and
HP1gamma are associated with transcription elongation through mammalian
chromatin." Mol Cell 19(3): 381-91.

Vidali, G., E. L. Gershey, et al. (1968). "Chemical studies of histone acetylation. The
distribution of epsilon-N-acetyllysine in calf thymus histones." J Biol Chem
243(24): 6361-6.

Winston, F., D. T. Chaleff, et al. (1984). "Mutations affecting Ty-mediated expression of
the HIS4 gene of Saccharomyces cerevisiae." Genetics 107(2): 179-97.

Wu, L., H. Wu, et al. (1997). "Miz1, a novel zinc finger transcription factor that interacts
with Msx2 and enhances its affinity for DNA." Mech Dev 65(1-2): 3-17.

Xiao, B., C. Jing, et al. (2005). "Specificity and mechanism of the histone
methyltransferase Pr-Set7." Genes Dev 19(12): 1444-54.

Yang, C. K., J. H. Kim, et al. (2008). "Differential regulation of the two transcriptional
activation domains of the coiled-coil coactivator CoCoA by sumoylation." BMC
Mol Biol 9: 12.

Yang, S. H. and A. D. Sharrocks (2004). "SUMO promotes HDAC-mediated
transcriptional repression." Mol Cell 13(4): 611-7.

Yin, Y., C. Liu, et al. (2005). "SET8 recognizes the sequence RHRK20VLRDN within
the N terminus of histone H4 and mono-methylates lysine 20." J Biol Chem
280(34): 30025-31.

Yu, S. W., H. Wang, et al. (2002). "Mediation of poly(ADP-ribose) polymerase-1-
dependent cell death by apoptosis-inducing factor." Science 297(5579): 259-63.

142

Yunus, A. A. and C. D. Lima (2006). "Lysine activation and functional analysis of E2-
mediated conjugation in the SUMO pathway." Nat Struct Mol Biol 13(6): 491-9.

Zhang, H., R. B. Azevedo, et al. (2003). "Global regulation of Hox gene expression in C.
elegans by a SAM domain protein." Dev Cell 4(6): 903-15.

Zhang, Y., R. Cao, et al. (2004). "Mechanism of Polycomb group gene silencing." Cold
Spring Harb Symp Quant Biol 69: 309-17.

Zhang, Y. and D. Reinberg (2001). "Transcription regulation by histone methylation:
interplay between different covalent modifications of the core histone tails."
Genes Dev 15(18): 2343-60.

Abstract (if available)

Abstract Chromatin is the complex of DNA, histones, and nonhistone proteins found in the nucleus of a eukaryotic cell and is known to play a critical role in regulation of DNA-templated processes such as gene transcription, DNA replication, and DNA repair. The numerous potential covalent modifications of the histone proteins help direct the recruitment of specific nuclear factors to these modifications thus causing changes in biological outcomes, phenomenon also known as “histone code”. One example of such modification is the addition of methyl groups to lysine residues on N-terminal histone tails by enzymes known as histone methyltransferases (HMTases). We previously identified that PR-Set7 specifically methylates Lysine 20 of Histone H4 (H4K20)

Linked assets

University of Southern California Dissertations and Theses

Conceptually similar

PDF

The role of histone H4 lysine 20 monomethylation in gene expression and differentiation

PDF

Studies of the biological relevance of Histone H4 Lysine 20 monomethylation: discovery of its role in the cell cycle and localization within the human genome

PDF

Multiple functions of the PR-Set7 histone methyltransferase: from transcription to the cell cycle

PDF

Determinination of the causal potential of histone modifications on transcription and chromatin structure

PDF

Characterization and functional study of a novel human protein SFMBT, and PR-Set7 histone methyltransferase

PDF

Epigenetic plasticity of cultured female human embryonic stem cells and regulation of gene expression and chromatin by PR-SET7 mediated H4K20me1

PDF

DNA methylation markers for blood-based detection of small cell lung cancer in mouse models

PDF

Cancer-recurrent missense mutations in SET domain alter KMT2A methyltransferase activity

PDF

Understanding DNA methylation and nucleosome organization in cancer cells using single molecule sequencing

PDF

Effects of chromatin regulators during carcinogenesis

PDF

Identification and characterization of cancer-associated enhancers

PDF

The structure and function of membrane curving proteins on different membrane shapes and their regulation by post-translational modifications

PDF

Regulation of Aurora kinase B and its effect on phosphorylation of G9a/GLP

PDF

Functional role of chromatin remodeler proteins in cancer biology

PDF

Profiling of protein methylation in mammalian cells and methods for deep methylproteomic analysis

PDF

Elucidating the functional role of CHD7 associated nuclear PDH complex and other associated proteins on neural crest development

PDF

I. Microwave-assisted synthesis of phosphonic acids; II. Design and synthesis of polymerase β lyase domain inhibitors

Asset Metadata

Creator Spektor, Tanya Magazinnik (author)

Core Title Identification and characterization of PR-Set7 and histone H4 lysine 20 methylation-associated proteins

School Keck School of Medicine

Degree Doctor of Philosophy

Degree Program Biochemistry and Molecular Biology

Degree Conferral Date 2009-12

Publication Date 11/18/2009

Defense Date 08/27/2009

Publisher University of Southern California (original), University of Southern California. Libraries (digital)

Tag chromatin,DNA repair,epigenetics,histone H4 lysine 20,histone methylation,Ku70/80,mammalian tethered-catalysis (MTeC),methyl-binding proteins,OAI-PMH Harvest,PARP1,PR-Set7,SUMOylation,UBC9

Language English

Contributor Electronically uploaded by the author (provenance)

Advisor Rice, Judd C. (committee chair), Coetzee, Gerhard A. (committee member), Laird, Ite (committee member), Stallcup, Michael R. (committee member)

Creator Email magazinn@usc.edu,tanyamspektor@gmail.com

Permanent Link (DOI) https://doi.org/10.25549/usctheses-m2746

Unique identifier UC1494436

Identifier etd-Spektor-3304 (filename),usctheses-m40 (legacy collection record id),usctheses-c127-280858 (legacy record id),usctheses-m2746 (legacy record id)

Legacy Identifier etd-Spektor-3304.pdf

Dmrecord 280858

Document Type Dissertation

Rights Spektor, Tanya Magazinnik

Type texts

Source University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Repository Name Libraries, University of Southern California

Repository Location Los Angeles, California

Repository Email cisadmin@lib.usc.edu