University of Southern California Dissertations and Theses

Trichostatin A and dihydrotestosterone as potential multi-systemic drugs for amyotrophic lateral sclerosis

(USC Thesis Other)

Trichostatin A and dihydrotestosterone as potential multi-systemic drugs for amyotrophic lateral sclerosis

PDF

Download

Open document

Flip pages

Download a page range

Download transcript

Copy asset link

Request this asset

Transcript (if available)

Content TRICHOSTATIN A AND DIHYDROTESTOSTERONE AS POTENTIAL
MULTI-SYSTEMIC DRUGS FOR AMYOTROPHIC LATERAL SCLEROSIS

by

Young-Eun Yoo

A Dissertation Presented to the
FACULTY OF THE USC GRADUATE SCHOOL
UNIVERSITY OF SOUTHERN CALIFORNIA
In Partial Fulfillment of the
Requirements for the Degree
DOCTOR OF PHILOSOPHY
(NEUROSCIENCE)

May 2010

Copyright 2010 Young-Eun Yoo
Dedication

To my loving grandmother Meo-Ja who had always prayed for me, and my parents,
Young-Shik and Hyung-Ae, and my husband In-Suk

ii
Acknowledgements

First of all, I would like to express my sincere gratitude to my mentor, Dr. Chien-
Ping Ko who has supported me throughout my doctoral research with his enthusiasm,
advice, and patience.
I would also like to thank my current and past committee members: Drs. Michel
Baudry, Samantha J. Butler, Albert Herrera, Christian J. Pike, and Jang H. Youn for
helpful suggestions about my research and their valuable time which they provided
to serve as my committee members.

In addition, I would like to thank Drs. Caleb E. Finch, Samantha J. Butler and David
D. McKemy for letting me use the lab equipment when needed. Thanks to Dr. Sarah
W. Bottjer for helping me with the method of DHT treatment, and Drs. Emily
Rosario and Jenna Carroll for their knowledge and experience in androgen treatment.

Also, I would like to acknowledge the ALS Association and Muscular Dystrophy
Association for funding my research.

My deepest thanks go to all the lab members in the Ko lab, Dr. Zhihia Feng, Ming Yi
Lin, Kar Ling, Dr. Yoshie Sugiura, and Brian Zingg. I was so fortunate to have great
lab mates as my best friends whom I can talk about science and life as well. I will
never forget the time we have had for a stimulating discussion, great food, and fun. I
also give my appreciation to undergraduate students, Julia Terr-Malloy, Jason Tso,
iii
Jessica Louie, and Pam Ku, who helped me with animal behavior tests and
quantifications under the fancy name of a blind-test.

I would like to thank my family members, specially my beloved parents, parents-in-
law, and my brothers, for their love and continuous prayers for me. I also thank Ji
Young, Eun Hee, and Suzy Lee for their support like a family. Especially, I would
like to give my thanks to my husband, Insuk Chong for his love and sacrifice during
all these years.

iv

Table of Contents

Dedication ii

Acknowledgements iii

List of Figures vii

Abstract ix

Chapter 1. General Introduction 1
1.1 Overview of amyotrophic lateral sclerosis 1
1.2 Non-cell autonomous mechanism of neurodegeneration
in ALS 2
1.3 The potential involvement of distal targets in the “dying-
back” mechanism of ALS 4
1.4 Potential treatments of targeting skeletal muscle as a
therapy for ALS 6
1.5 Potential treatments of targeting motoneurons as a
therapy for ALS 7
1.6 Potential treatments of targeting glial cells as a therapy
for ALS. 11
1.7 A need for a multi-systemic drug 13
1.8 Overview of trichostatin A (TSA) as a candidate of
multi-systemic drug for ALS 15
1.9 Overview of 5-α dihydrotestosterone (DHT) as a
candidate of multi-systemic drug for ALS 17

Chapter 2. Trichostatin A delays disease progression and increases survival
in a mouse model of amyotrophic lateral sclerosis 20
2.1 Introduction 20
2.2 Methods 22
2.3 Results 28
2.4 Discussion 52

Chapter 3. Dihydrotestosterone delays disease progression and improves
motor function in a mouse model of amyotrophic lateral
sclerosis 61
3.1 Introduction 61
v
3.2 Materials and Methods 65
3.3 Results 70
3.4 Discussion 89

Chapter 4. General discussion: multi-systemic drug as a new therapeutic
approach for ALS 96

References 102

vi
List of Figures
Figure 2-1. TSA increases histone acetylation in skeletal muscle and
ameliorates muscle atrophy in SOD1 mice. 30
Figure 2-2. TSA increases the expression of follistatin, but decreases the
expression of muscle ring finger (MuFR)-1 in SOD1 mice. 33
Figure 2-3. TSA improves neuromuscular junction (NMJ) innervation in
TA and diaphragm (DIA) muscles in SOD1 mice. 35
Figure 2-4. TSA ameliorates axonal degeneration in SOD1 mice. 39
Figure 2-5. TSA restores histone acetylation in the spinal cord of SOD1
mice. 43
Figure 2-6. TSA decreases glial activity and increases the expression of
GLT-1 in the spinal cord of SOD1 mice. 45
Figure 2-7. TSA attenuates motoneuron death in SOD1 mice. 48
Figure 2-8. TSA improves motor performances and survival in SOD1
mice 51
Figure 3-1. DHT increases whereas orchidectomy decreases the seminal
vesicle weight in SOD1 G93A (SOD1) and wild-type (WT)
mice. 71
Figure 3-2. DHT increases whereas orchidectomy decreases the weight of
hindlimb muscles in SOD1 mice. 74
Figure 3-3. DHT improves muscle strength in SOD1 mice. 76
Figure 3-4. DHT increases the expression of insulin-like growth factor
(IGF) -1 and -2 in SOD1 mice. 78
Figure 3-5. DHT improves the neuromuscular junction (NMJ) innervation
in SOD1 mice. 80
Figure 3-6. DHT attenuates axonal loss in phrenic nerve of SOD1 mice. 83
Figure 3-7. DHT ameliorates axonal loss in the ventral root of the spinal
cord in SOD1 mice. 84

vii
Figure 3-8. DHT improves motoneuron survival in SOD1 mice. 87
Figure 3-9. DHT improves motor performances and survival in SOD1
mice. 88
viii
Abstract

Amyotrophic lateral sclerosis (ALS, also known as Lou Gehrig’s disease) is a
lethal neurodegenerative disease characterized by motor neuron loss, progressive
muscle weakness, atrophy and paralysis. ALS is the most common motoneuron
disease in human adults, and currently, there is no cure for ALS. Although ALS is a
motoneuron disease, non-neuronal cells have been implicated in modulating
motoneuron degeneration and disease progression. Because trichostatin A (TSA)
and dihydrotestosterone (DHT) have shown beneficial effects on multiple cell types
implicated in ALS, we examined their effects as a potential drug in a mouse model
of ALS, SOD1 G93A mice.

The treatment of TSA or DHT to early symptomatic SOD1 G93A mice
ameliorated muscle atrophy, NMJ denervation, axonal degeneration, and motoneuron
death, which are the pathological characteristics found in SOD1 G93A mice. The
improved morphology in TSA- or DHT-treated SOD1 G93A mice was accompanied
by improved motor functions as well as prolonged lifespan. The beneficial effect
exerted by TSA or DHT might be mediated by their potential effects on multiple cell
types implicated in ALS. Since ALS is a disease that involves neuronal and non-
neuronal cell types, TSA or DHT treatment, which can target multiple cell types,
might be an effective strategy to slow motoneuron loss, as well as to improve motor
performance that may lead to the improved quality of life for ALS patients.
ix
Chapter 1
General Introduction

1.1 Overview of amyotrophic lateral sclerosis.
Amyotrophic lateral sclerosis (ALS, also known as Lou Gehrig’s disease) is a lethal
neurodegenerative disease characterized by the selective motor neuron loss in the
brain and spinal cord. The symptoms of ALS include progressive muscle weakness,
atrophy and paralysis, which eventually lead to fatal respiratory failure in the
diaphragm muscle. The majority of ALS cases are sporadic ALS (sALS) caused by
an unknown etiology; however 10% of cases are inherited form of ALS, called
familial ALS (fALS). About 20% of fALS patients show missense mutations in
Cu/Zn superoxide dismutase 1 (SOD1) gene, which accounts for approximately 2%
of all ALS patients (Rosen et al., 1993). More than 100 mutations of SOD1 gene
have been found in fALS patients, suggesting a critical role of SOD1 in ALS
pathogenesis (Gaudette et al., 2000; Cleveland and Rothstein, 2001). Many studies
described that the mutations in SOD1 gene do not cause a loss of enzymatic function
of SOD1, which converts reactive superoxide into hydrogen peroxide and water to
protect cells from oxidative stress (Rosen et al., 1993). Instead, the mutations cause
gain of unknown toxic functions (Reaume et al., 1996; Bruijn et al., 1998).

By inserting the mutated human SOD1 genes into mice, useful animal models
of ALS have been generated, which mimic the pathological features found in ALS
1
patients. Among the current animal models, the SOD1 G93A transgenic mouse
carrying mutation that substitutes gly93 to ala is the most extensively used rodent
model for ALS studies (Gurney et al., 1994). In SOD1 G93A transgenic mice, mild
limb tremor can be detected around postnatal day 70 (P70), and more obvious
clinical symptoms are observed around P90, and the average lifespan is about 130~
140 days (Chiu et al., 1995; Bendotti and Carri, 2004).

Extensive studies about underlying mechanisms of ALS have been enabled
through the use of rodent models of ALS. Although it is clear that SOD1 mutations
cause ALS pathogenesis, the link between the mutations and selective motoneuron
death still remains unsolved. Several hypotheses have been proposed as the
underlying mechanism of ALS such as glutamate excitotoxicity, oxidative stress,
protein misfolding, mitochondrial defect, impaired axonal transport, and
inflammation, and these mechanisms may work in a concert to contribute to the
pathogenesis of ALS (Bruijn et al., 2004; Pasinelli and Brown, 2006).

1.2 Non-cell autonomous mechanism of neurodegeneration in ALS.
Although ALS is a neurodegenerative disease showing selective motoneuron death
in the brain and spinal cord, restricted expression of mutant SOD1 within neuron is
not sufficient to generate ALS-like symptoms in transgenic mice (Pramatarova et al.,
2001; Lino et al., 2002). Similarly, mutant SOD1 expressing solely within astrocytes
is not sufficient to induce motoneuron death or ALS-like symptoms (Gong et al.,
2
2000). Restricted expression of mutant SOD1 gene in skeletal muscle, though
results in muscle atrophy, does not cause motoneuron death either (Dobrowolny et
al., 2008). Therefore, it suggests that mutant SOD1 expression in a single cell type,
even in motoneurons, is not sufficient to trigger the disease, but cumulative toxicity
caused by mutant SOD1 in motoneurons as well as non-neuronal cell types
contributes to ALS pathogenesis (Boillee et al., 2006b). More direct evidence of
non-cell autonomous mechanism in ALS is provided by the chimeric mice
containing both wild-type and mutant SOD1 expressing cells (Clement et al., 2003).
While wild-type motoneurons degenerate if surrounded by mutant SOD1 expressing
non-neuronal cells, mutant SOD1 expressing motoneurons are rescued from
degeneration if surrounded by non-neuronal wild type cells. Taken together, ALS is
not a disease caused by a defect in a single cell type, but toxicity mediated by several
cell types that express mutant SOD1.

To further examine how each cell type contributes to ALS pathogenesis, cell-
type specific gene excision was performed in SOD1 transgenic mice through Cre-
Lox recombination or gene silencing with small interference RNA. Selective
excision of mutant SOD1 gene in motoneurons delayed disease onset in SOD1
transgenic mice without affecting disease progression (Boillee et al., 2006b).
Reduced expression of mutant SOD1 gene in microglia or astrocytes in ALS
transgenic mice did not change disease onset, but markedly delayed later disease
progression, and extended lifespan (Boillee et al., 2006b; Yamanaka et al., 2007). In
3
Schwann cells, selective reduction of mutant SOD1 gene resulted in unexpected
acceleration in the disease progression probably due to increased oxidative stress
caused by the reduced dismutase activity of after gene knock-down (Lobsiger et al.,
2009). In skeletal muscle, partial gene excision of mutant SOD1 (about 50%) did
not change the disease onset or progression in a mouse model of ALS, suggesting
that mutant SOD1 in skeletal muscle is not a significant contributor to ALS
pathogenesis (Miller et al., 2006). However, this might be possible that the
remaining mutant SOD1 is toxic enough, so a partial reduction of this gene does not
relieve the toxic burden. In support of this, a recent study showed that even a low
level of mutant SOD1 expression within skeletal muscle is sufficient to cause
oxidative stress that leads to decreased muscle size and force (Dobrowolny et al.,
2008).

Taken together, it is likely that mutant SOD1 expressed in motoneurons
determines the disease onset, while mutant SOD1 expressed in astrocytes and
microglia contributes to the disease progression. However the role of skeletal
muscle in ALS pathogenesis remains controversial.

1.3 The potential involvement of distal targets in the “dying-back” mechanism
of ALS.
It has been generally accepted that muscle weakness and paralysis in ALS is a
consequence of motoneuron death. However, growing evidence demonstrates that
4
neuromuscular junction (NMJ) denervation occurs prior to motoneuron death
through histological (Frey et al., 2000; Fischer et al., 2004; Schaefer et al., 2005; Pun
et al., 2006) as well as physiological examinations (Kennel et al., 1996; Hegedus et
al., 2007). The sequential degeneration is observed through NMJ denervation, distal-
to-proximal axonal degeneration, and finally motoneuron death, suggesting the
“dying back” mechanism.

Furthermore, an elaborate study through a genetic approach confirmed that
NMJ denervation is not simply a consequence of motoneuron death. Despite of the
prevented motoneuron death through Bax knock-out, SOD1 transgenic mice fails to
prevent the dying- back degeneration including NMJ denervation, skeletal muscle
atrophy, and defective motor functions (Gould et al., 2006). This result suggests that
motoneuron death and functional defect can be a separate process, and also raises the
possibility that defective distal target muscle and other neighboring non-neuronal
cell types might play a role in this dying-back mechanism.

Although skeletal muscle is one of the neighboring cell types connected to
motoneuron, not much attention has been paid on its role during disease progression.
However, there is a growing literature describing that mutant SOD1 in skeletal
muscle contributes to muscle atrophy, suggesting muscle atrophy in ALS is not a
simple consequence of NMJ denervation (Mahoney et al., 2006; Dobrowolny et al.,
2008; Dupuis and Loeffler, 2009). Localized expression of mutant SOD1 in skeletal
5
muscle is sufficient to cause muscle atrophy, weakness, defective muscle structure,
and mitochondrial dysfunction in muscle (Dobrowolny et al., 2008). In accordance
with this finding, a recent study from our lab demonstrates that mutant SOD1
expression in skeletal muscle causes defective regenerative properties in muscle
(Sugiura Y, Yoo, YE, Ko, CP, in preparation). Compared to the wild-type muscle
graft, which regenerates and forms NMJs with the wild-type host, mutant SOD1
expressing muscle graft to wild-type host fails to regenerate, and eventually all
nerves retracts from the NMJs. Taken together, it is possible that mutant SOD1-
mediated defects in skeletal muscle may participate in dying-back degeneration, so
improving the health of muscle might positively modify disease progression in ALS.

Taken together, it is likely that motoneuron is not the only player in ALS
pathology, but other distal target muscle might contribute to the dying-back
degeneration in ALS. Considering these facts, distal target muscle might serve as a
good therapeutic target to slow the “dying-back” degeneration, and eventually extend
survival.

1.4 Potential treatments of targeting skeletal muscle as a therapy for ALS.
Because early clinical symptoms such as motor dysfunction and muscle atrophy
occur prior to motoneuron death (Barneoud et al., 1997; Wooley et al., 2005; Brooks
et al., 2004), several attempts have been made to ameliorate symptoms in muscle.
The effort to improve muscle symptoms can be valuable because increased
6
motoneuron survival is not necessarily linked with the improved motor functions
(Gould et al., 2006; Suzuki et al., 2007a). To prevent muscle atrophy in ALS, the
activity of myostain, a potent negative regulator of muscle growth, was blocked
through several different approaches. As myostatin knock out mice cause “double-
muscling” phenotype in wild-type animal (Lee and McPherron, 2001), this mice
were cross-bred with SOD1 transgenic mice to increase its muscle mass (Morrison et
al., 2009; Ko et al., 2006). Also, a soluble activin receptor type IIB (ActRIIB.mFc),
follistatin, or myostatin antibody, which binds to myostatin and blocks its effect, is
administrated to SOD1 mice to prevent muscle atrophy (Morrison et al., 2009;
Miller et al., 2006; Holzbaur et al., 2006, respectively). All these approaches
succeeded to prevent muscle atrophy and improve muscle strength, but failed to
improve NMJ innervation, protect motoneuron survival, and extend lifespan. Taken
together, treatments that target skeletal muscle are encouraging because they might
improve muscle strength in ALS patients, but this may not be sufficient to extend
survival.

1.5 Potential treatments of targeting motoneurons as a therapy for ALS.
Among many cell-types affected by ALS, targeting motoneuron survival is of high
priority, because motoneuron death causes inevitable paralysis leading to death. In
addition, defective neighboring glial cells found in ALS release neurotoxic
substances that also contribute to motoneuron death (Elliott, 2001; Seifert et al.,
7
2006). Considering the fact that motoneuron death is irreversible, a therapy that can
improve or maintain the health of motoneurons is necessary. Among several
possible ways to improve motoneuron survival, trophic factors are extensively
studied due to its potent role in preventing motoneuron death.

To examine the effect of trophic factors in preclinical studies in SOD1
transgenic mice, a gene encoding a trophic factor was delivered through adeno-
associated virus (AAV) or lentivirus for the efficient and chronic delivery of trophic
factors to motoneurons. Injected AAV containing insulin like growth factor-1 (IGF-
1) or glial cell-derived neurotrophic factor (GDNF) gene at limb muscle was
retrogradely transported to the spinal cord, and both trophic factors were able to
delay disease onset and prolong lifespan (Kaspar et al., 2003; Wang et al., 2002,
respectively). Injected lentiviral vector encoding vascular endothelial growth factor
(VEGF), which recently proved its neuroprotective effect (Lambrechts et al, 2003;
Storkebaum et al., 2004), also delayed disease onset and extended survival in SOD1
transgenic mice (Azzouz et al., 2004).

In addition, skeletal muscle was also utilized as a provider of neurotrophic
factors through retrograde transport to prevent motoneuron death. Skeletal muscle
expresses many kinds of trophic factors including GDNF, IGF-1, brain-derived
neurotrophic factor (BDNF), neurotrophin- 3 (NT-3), neurotrophin- 4 (NT-4),
cardiotrophin-1 (CT-1), and ciliary neurotrophic factor (CNTF), which prevents
8
motoneuron death as well as maintain normal muscle function (Oppenheim, 1996).
Restricted expression of IGF-1 in skeletal muscle by using muscle-specific promoter
slowed the disease progression in SOD1 transgenic mice (Dobrowolny et al., 2005).
Similarly, enhanced expression of GDNF in skeletal muscle was able to delay
disease onset and prolong survival in SOD1 transgenic mice (Li et al., 2007).
However, GDNF expressed in astrocytes failed to exert beneficial effects in delaying
disease progression or extending survival despite of its vicinity to motoneurons (Li et
al., 2007). It is possible that muscle-derived trophic factors might have a beneficial
effect to ameliorate the dying back degeneration by passing through axons. The
impaired trophic supply from skeletal muscle to motoneurons by disrupting
dynein/dynactin complexes, which involves in retrograde transport, causes defective
motor behavior similar to those found in SOD1 transgenic mice (LaMonte et al.,
2002), and this further suggests an important role of retrograde transport. Taken
together, muscle serve as a good source of trophic factors to motoneurons, so
enhancing trophic factor expression in muscle might be a potential therapy to
increase motoneuron survival in ALS.

In human trials, the beneficial effect of trophic factors found in animal
models, however, was not duplicated in most cases. Despite of the pronounced
effect of IGF-1 in SOD1 transgenic mice, the effect of IGF-1 was not significant in
ALS patients (Borasio et al., 1998; Mitchell et al, 2002). Similarly, BDNF or CNTF
treatment did not show beneficial effect in ALS patients (BNDF Study Group, 1999;
9
ALS CNTF Treatment Study group, 1996). This discrepancy is possibly due to
differences in species, but more likely due to inefficient drug deliveries. Because of
a safety issue, viral infection of genetically modified genes is not encouraged with
patients, and thus protein injections were made in the above human studies.
Compared with the chronically enhanced gene expression made through viral vectors,
proteins have a short half-life, and have difficulties to cross the blood-brain-barrier to
affect central nervous system (CNS). Indeed, there was a modest improvement in
extending survival in ALS patients when IGF-1 was administrated directly into the
spinal cord (intrathecal administration) (Nagano et al., 2005; Lepore et al., 2007).
Considering the beneficial effects exerted by muscle-derived trophic factors in
animal models, enhancing the expression of trophic factors in muscle can be one of
the strategies to improve the health of motoneurons through retrograde transport.
Different from animal models that utilized genetic approach to increase the
expression of trophic factors in muscle, an approach to increase their endogenous
expressions in muscle might be a more desirable therapy to benefit motoneurons in
clinical studies.

Another reason for the discrepancy between animal and human trials can be
possibly explained by the different time point when treatments start. In animal
models, drugs were usually treated before disease onset or at early stage of disease,
so the effect can be more pronounced than when it is treated later. For example,
when VEGF-expressing viral vectors were injected at P21, a lifespan is increased by
10
30% in SOD1 transgenic mice; however, when the same treatment was made at P90,
a lifespan is increased only by 15% (Azzouz et al., 2004). Similar results were found
with other treatments like IGF-1 expressing vectors (Kasper et al., 2003).
Considering the fact that drug treatments are likely to start after the clinical
symptoms appear in patients, early treatments as tested in SOD1 transgenic mice
may not be applicable to most of clinical trials. Therefore, it might be important to
start a drug treatment when symptoms are shown in animal models since patients
may also receive treatments after symptoms appear although earlier treatments may
be useful for a proof of concept.

1.6 Potential treatments of targeting glial cells as a therapy for ALS.
Astrocytes provide a supportive role to motoneurons such as transport of various
nutrients, maintenance of potassium homeostasis, and rapid uptake of glutamate
from the synaptic cleft by astrocytic glutamate transporter-1 (GLT-1, also known as
EAAT2) to protect motoneurons from excitotixicity (Maragakis and Rothstein, 2006;
Lobsiger and Cleveland, 2007). Both familial and sporadic ALS patients as well as
ALS animal models, demonstrate marked decrease in the expression of GLT-1 in the
brain and spinal cord (Rothstein et al., 1995; Lin et al., 1998; Howland et al., 2002).
Therefore, it is likely that drastic reduction of GLT-1 in astrocytes causes glutamate
excitotoxicity, and this contributes to promote motoneuron death. In fact, the only
one FDA-approved drug available for ALS, riluzole (Rilutek), works through
reducing glutamate excitotoxicity, though it is not likely through recovered
11
expression of GLT-1 (Bruijn et al., 2004), and increases lifespan by approximately 3
months (Bensimon et al., 1994). A treatment that can induce the expression of GLT-
1 in astrocytes might be a potential drug for both types of ALS patients. In support
of this, beta-lactam antibiotics stimulating the expression of GLT-1 in the brain and
spinal cord of SOD1 transgenic mice retarded the motoneuron loss and improved
muscle strength as well as survival (Rothstein et al., 2005).

In addition, astrocytes release either neurotrophic factors such as GDNF and
BDNF (Wu et al, 2008b) or inflammation-causing factors such as cytokines and
reactive oxygen species (ROS) (Elliott, 2001; Seifert et al., 2006). Therefore, a
treatment that can increase trophic factors or decrease potential neurotoxins in
astrocytes can be a potential treatment to promote motoneuron survival and slow
disease progression in ALS.

Activated microglia releases pro-inflammatory cytokines together with
astrocytes, such as tumor necrosis factor (TNF)-α, interleukin (IL)-1β during
motoneuron degeneration (Streit et al., 1999; Hensley et al., 2002). Markedly
increased microglial proliferation (about seven-fold) is found in SOD1 transgenic
mice at the later disease stage, suggesting its role in rapid disease procession found at
the later stage of the disease (Hall et al., 1998). Therefore, it is possible that a
treatment inhibiting microglial activity may help to slow disease progression. In fact,
nordihydroguaiaretic acid (NDGA), which suppresses the microglial activation,
12
increased survival of SOD1 transgenic mice (West et al., 2004), proposing the
potential therapeutic effect of targeting microglia to slow disease progression of ALS.

1.7 A need for a multi-systemic drug
Based on the accumulated evidence obtained through the use of transgenic animal
models of ALS, the current understanding of ALS pathogenesis is that this disease
involves motoneurons as well as their non-neuronal neighbors (reviewed in Boillee
et al., 2006). It is known that the toxicity caused by mutant SOD1 is not due to its
loss of enzymatic activity in reducing oxidative stress. It is, however, unknown
about how this mutant SOD1 causes gain of novel toxic functions that leads to
progressive motoneuron death. Removing the mutant SOD1 gene can be a direct
approach to reduce toxicity. However, a gene therapy to reduce mutant SOD1 in
patients is challenging because it is difficult to distinguish the mutated SOD1 and
normal SOD1, which often differs by a point mutation. Since most of ALS patients
(sporadic ALS) do not carry SOD1 mutations, a genetic approach cannot benefit
most of the patients even if it succeeds. Because there are still not much is known
about the primary source of toxicity linked to ALS pathogenesis, a possible option
would be a therapy designed to ameliorate degeneration in each cell type involved in
ALS.

Most of the treatments aimed to improve health of motoneurons show
beneficial effects on delaying disease onset or increasing survival in SOD1
13
transgenic mice (reviewed in Turner and Talbot, 2008). However, it is interesting to
note that complete prevention of motoneuron death cannot guarantee improved
motor behavior (Gould et al., 2006). Genetically preventing motoneuron death
through Bax knock-out in SOD1 transgenic mice failed to inhibit the dying-back
degeneration and defective motor functions, suggesting that pathological symptoms
of ALS is not just a passive consequence of motoneuron death. Therefore, a
treatment that can benefit both motoneurons and non-neuronal neighboring cells
might be more desirable for an efficient therapy. Indeed, we cannot exclude the
possibility that trophic factors, such as IGF-1 or VEGF delivered through viral
vectors (Kasper et al., 2003; Azzouz et al., 2004), acted on other cell types in
addition to motoneurons. Because those were injected at several points of skeletal
muscle and retrogradely transport to motoneurons, it is possible that non-neuronal
cells including muscle, Schwann cells or fibroblasts are affected, although glial cells
were not affected despite of their vicinity to neurons (Kasper et al., 2003).
Considering the result from the chimeric mice showing that mutant SOD1 expressing
motoneurons can be rescued from degeneration by the surrounding healthy non-
neuronal wild-type cells (Clement et al., 2003), it is possible that the improved
cellular conditions in non-neuronal cells may contribute to neuronal survival and
extended lifespan.

There are 4-6 per 100,000 peoples affected by ALS each year (Yoshida et al.,
1986), and currently there are 30,000 individuals suffering from this devastating
14
disease in U.S alone (Strong and Rosenfeld, 2003). However, only one FDA-
approved drug that is available for ALS, which slightly extends lifespan by
approximately 3 months (Bensimon et al., 1994), without any beneficial effect in
motor function (Lacomblez et al., 1996). Because there is no effective treatment that
can significantly ameliorate symptoms in ALS patients yet, the development of drug
that improves motor function as well as extends survival is required. Considering
the non-cell autonomous disease mechanism of ALS, a treatment that can affect
multiple cell types involved in ALS might be a potential therapeutic strategy to
intervene degeneration in multiple cell types.

1.8 Overview of trichostatin A (TSA) as a candidate of multi-systemic drug for
ALS.
Trichostatin A (TSA) is one of the most well studied histone deacetylase (HDAC)
inhibitors that can completely inhibit activity of most HDACs (Miller et al., 2003).
HDACs remove acetyl group from lysine residues of histones, and condense
chromatin structure to repress transcription. Conversely, histone acetyltransferases
(HATs) add acetyl groups on the lysine residues of histone to reduce the attractive
force between positively charged histone and negatively charged DNA phosphate
backbone, and thereby relax chromatin structure to allow access of transcription
factors (Grunstein, 1997; Cheung et al., 2000). Based on the activity of HDACs and
HATs, chromatin containing two copies of histone proteins H2A, H2B, H3, and H4,
15
changes its dynamic structure and controls a broad spectrum of gene transcription in
eukaryotic cells (Strahl and Allis, 2000).

HDAC inhibitors are used to increase histone acetylation, and thereby
activate gene transcription and correct the histone acetylation homeostasis (Cress and
Seto, 2000). The most tested HDAC inhibitors include sodium butyrate (SB),
phenylbutyrate (PB), valporic acid (VPA), and TSA. Among these HDAC inhibitors,
TSA is the most potent HDAC inhibitor that can inhibit the activity of both class I
and II HDACs at nanomolar doses (IC50 12nM; Miller et al., 2003), by binding to
zinc ion at the active site of HDACs (Finnin et al., 1999; Khan et al., 2008). On the
other hand, SB, PB, and VPA primarily inhibit class I HDACs (HDAC 1, 2, 3, and 8
out of 18 HDACs in human) at milimolar concentration.

Neuroprotective effect of TSA has been found in culture system under
several toxic conditions including glucose/ oxygen deprivation, and glutamate-
induced excitotoxicity (Meisel et al., 2006; Yildirim et al., 2008, Leng and Chuang,
2006). TSA increases motoneuron survival in a mouse model of spinal muscular
atrophy (SMA) through upregulating the expression of survival motor neuron (SMN).
Besides the effects on neurons, TSA reduces microglial activation in models of
stroke and neuroinflammation (Kim et al., 2007; Chen et al., 2007). Furthermore,
TSA improves the astrocyte survival (Niu et al., 2009), and induces the trophic factor
16
expression in astrocytes, which promotes the survival of neighboring neurons in a
cell culture system (Wu et al., 2008b).

TSA also act on skeletal muscle in addition to its effects in CNS. TSA
attenuates muscle atrophy in a mouse model of muscular dystrophy through
increasing the expression of follistatin, an endogenous blocker of myostatin, which
negatively regulates muscle growth (Minetti et al., 2006).

Taken together, because TSA demonstrates beneficial effects on multiple cell
types implicated in ALS, TSA might be a potential drug as a multi-systemic
treatment. Therefore, we tested its potential effect with SOD1 transgenic mice in
chapter II.

1.9 Overview of 5-α dihydrotestosterone (DHT) as a candidate of multi-systemic
drug for ALS.
Testosterone is a representative androgen mostly synthesized by testes. Testosterone
converts to either estradiol or 5α-dihydrotestosterone (DHT) by aromatase or 5α -
reductase, which binds to estrogen receptor (ER) or androgen receptor (AR),
respectively (Somboonporn and Davis, 2004). Androgenic effect is mediated
through AR, which is expressed in several cell types including neuron and muscle.

17
Androgens increase neurite outgrowth and survival of motoneurons in the
spinal cord. Besides the well- known effect of DHT on the spinal nucleus of the
bulbocavernosus (SNB) that innervates sexually dimorphic muscles in males
(Breedlove and Arnold, 1980; Forger et al., 1992; Jones et al., 1994), it also
markedly increases the survival of motoneurons that innervates hindlimb muscles
from axotomy-induced motoneuron death (Gould et al., 1999). Improved
motoneuron survival through androgens is also demonstrated in a culture model of
motoneurons through AR (Brooks et al., 1998; Marron et al., 2005). Furthermore,
testosterone is able to ameliorate the astrocyte proliferation and gliosis upon brain or
nerve injury, which is an indication of neuroinflammation (McQueen et al., 1992;
Jones et al., 1997; Coers et al., 2002).

The effect of androgen can be found in peripheral tissues including peripheral
nerves and muscles. Androgen treatment promotes peripheral nerve growth and
regeneration in hypoglossal, facial, and sciatic nerve (Vita et al., 1983; Yu and Cao,
1991; Kujawa et al., 1993; Yu and McGinnis, 2001; Jordan et al., 2002; Melcangi et
al., 2005). In addition, androgen exerts anabolic effect in skeletal muscle through
ARs expressed in muscle (Dionne et al., 1979; Dube et al., 1976; Carson et al., 2002),
and many studies support a positive correlation between androgen level and muscle
size (Mauras et al., 1998; Sattler et al., 1998; Sinha-Hikim et al., 2002, 2003; Bhasin
et al., 1996). Androgen-induced skeletal muscle growth is mediated by increased
protein synthesis combined with decreased protein degradation, which leads to a net
18
increase of muscle proteins (Sheffield-Moore et al., 1999). Especially, androgen
increases IGF-1 (Urban et al., 1995; Hobbs et al., 1993), which is a potent molecule
for muscle growth (Lalani et al., 2000; Musaro et al., 2001; Grounds, 2002; Glass,
2003) as well as neuronal survival (Lewis et al., 1993; Kasper et al., 2003).

Several lines of evidence suggest that DHT might be more potent as a
candidate drug for ALS compared to its precursor, testosterone. First, in the spinal
cord, ventral horn express a high level of 5-α reductase that converts testosterone
into DHT (Pozzi et al., 2003; Poletti et al., 2004), suggesting that DHT might be the
working molecule mediating neuroprotective effect in motoneurons. In addition,
DHT demonstrated more potent effect in stimulating neurite outgrowth compared
with testosterone through inducing neuritin, and blocking 5-α reductase, which
prevents testosterone to DHT conversion, abolished trophic effect of testosterone
(Marron et al., 2005). Finally, DHT demonstrates higher binding affinity than
testosterone, thus might exert more potent effect through AR (Liao et al., 1973;
Kummer et al., 1992, 1999; Somboonporn and Davis, 2004). Therefore, DHT might
be a potent candidate to benefit motoneurons, nerves, as well as skeletal muscle,
which are all involved in disease progression of ALS. Therefore, potential effect of
DHT is tested with SOD1 transgenic mice in chapter III.
19

Chapter 2
Trichostatin A delays disease progression and increases survival in a
mouse model of amyotrophic lateral sclerosis

2.1 Introduction

Amyotrophic lateral sclerosis (ALS) is a late onset motoneuron disease characterized
by selective motoneuron death in the brain and spinal cord. There are both sporadic
and familial forms of ALS, which share similar progressive skeletal muscle atrophy
and paralysis. About 20% of familial ALS, which represents 2% of all ALS cases,
shows mutations in the Cu/Zn superoxide dismutase 1 (SOD1) gene (Rosen et al.,
1993). Transgenic mice carrying mutated SOD1 gene exhibit a similar pathological
course as ALS patients, and thus serve as useful models to study the disease
mechanism and to test potential drugs for ALS (Gurney et al., 1994; Chiu et al.,
1995). Cell-specific insertion or deletion of mutant SOD1 gene in transgenic mice
suggested that ALS pathogenesis is mediated by non-neuronal cell types (reviewed
in Boillee et al., 2006a). This is further confirmed by the study that complete
prevention of motoneuron death through the Bax knock-out failed to prevent NMJ
denervation and associated motor dysfunction although modest increase (15%) in
lifespan was observed (Gould et al., 2006). Indeed, prior to motoneuron death,
defective characteristics of ALS are found at the neuromuscular junctions (NMJs)
20
followed by distal axonal degeneration, which suggests a “dying-back” axonopathy
(Frey et al., 2000; Fischer et al., 2004; Schaefer et al., 2005). Considering these
facts, besides preventing motoneuron death, targeting multiple cell types that can
contribute to this “dying-back” procedure might be an effective strategy to treat
ALS.

Transcriptional regulation is one of the mechanisms that can induce a broader
effect on many cell types. In fact, transcriptional dysregulation has been implicated
in many neurodegenerative diseases including ALS and Huntington’s disease
(Hahnen et al., 2008). To promote gene transcription, histone deacetylase (HDAC)
inhibitors such as valporic acid (VPA) and sodium pherylbutyrate (PBA) have been
tested in SOD1 transgenic mice, and their neuroprotective effect was observed
(Sugai et al., 2004; Ryu et al., 2005, Petri et al., 2006; Rouaux et al., 2007).
However, such neuroprotection was not sufficient to prevent denervation at the NMJ,
nor prolong survival (Rouaux et al., 2007). Both PBA and VPA are HDAC
inhibitors that primarily inhibit class I HDACs (Khan et al., 2008), but not class II
HDACs, which control muscle-related gene transcription, and microtubule dynamics
(Lu et al., 2000; Verdin et al., 2003). Considering recent studies showing that
skeletal muscle might be a primary target of mutant SOD1-mediated toxicity
(Mahoney et al., 2006; Dobrowolny et al., 2008; Dupuis and Loeffler, 2009),
inhibitors that inhibit both class I and II HDACs might exert more beneficial effect
in ALS.
21
Trichostatin A (TSA) is one of the most extensively studied pan-HDAC
inhibitors that can inhibit both class I and II HDACs (Yoshida et al., 1990; Khan et
al, 2007). The effect of TSA has been found in several cell types implicated in ALS.
TSA is known to prevent muscle atrophy in animal models of muscular dystrophy
and spinal muscular atrophy (Minetti et al., 2006; Avila et al., 2007, respectively).
Also, TSA can increase the expression of neuroprotective genes in glial cells (Wu et
al., 2008a, b; Niu et al., 2009), and protect neuron survival as well (Camelo et al.,
2005; Curtin et al., 2005; Meisel et al., 2006; Avila et al., 2007). Since the beneficial
effects of TSA are found in multiple cell types involved in the disease progression of
ALS, it is possible that TSA might be a potential therapeutic drug that ameliorates
degeneration in several disease targets of ALS. In the present study, we demonstrate
that TSA ameliorates pathological characteristics found in skeletal muscle, axons,
and the spinal cord of SOD1 G93A transgenic mice (denoted as SOD1 mice). More
importantly, these morphological improvements were accompanied by improved
motor behavior and extended lifespan in SOD1 mice, suggesting a potential drug
effect of TSA in enhancing motor functions and slowing the disease progression in
ALS patients.

2.2 Methods

Animal:
We used SOD1 mutant mice with C57BL/6J background [B6.Cg-Tg(SOD1-
22
G93A)1Gur/J, Stock# 004435, The Jackson Laboratory], which exhibit a slightly
longer lifespan compared with the intensively used hybrid line in a C57Bl6/SJL
background (143.6±7.5 vs. 130.2±11.2, respectively) (Heiman-Patterson et al., 2005).
In order to eliminate the gender effects, only male mice were used for the
experiments. To visualize NMJs, SOD1 mutant mice were cross-bred with the same
background mice expressing YFP in all motoneurons (thy1-YFP mice, B6.Cg-TgN
(Thy1-YFPH) 2Jrs, Jackson Labs) (Feng et al., 2000). Mice were housed in 12h
light-dark cycle, and given free access to food and water. Once the mice were
unable to reach food on top of the cage, food and water were placed on the floor of
the cage to avoid any effect of food restriction. The end-stage was determined by the
inability of an animal to right itself within 30 s when placed on one side, and the
mouse was sacrificed at this time point. Mice were anesthetized via an
intraperioneal (i.p.) injection with a mixture of Rompun (8 mg/Kg body weight) and
Ketamine (80 mg/Kg body weight). Surgical instruments were sterilized by an
autoclave prior to surgeries.

TSA application to SOD1 mice:
TSA dissolved in DMSO (0.6 mg per kg body weight) or vehicle (DMSO) was
treated 5days per week in 30µl per injection via an i.p. injection starting from
postnatal day 90 (P90) until the time of sacrifice.

23
Western blot:
Total proteins were extracted from tibialis anterior (TA) muscles with RIPA buffer
(150 mM NaCl, 1.0% NP-40, 0.5% deoxycholate, 0.1% SDS, and 50 mM Tris-Cl,
pH 7.5). The total lysate was collected and 20µg loaded for SDS-polyacrylamide gel
electrophoresis (SDS-PAGE). After electrophoresis, the proteins in the PAGE gel
were transferred to a PVDF membrane (Immobilon-P, Millipore, Billerica, MA)
using a Mini Trans-Blot Cell (Bio-Rad, Hercules, CA). The membrane was first
incubated with blocking buffer containing 5% nonfat milk and Tris-buffered saline-
Tween (TBS-T, 20 mM Tris, 0.14 M NaCl, pH 7.6, 0.1% Tween-20) for 30 minutes
at room temperature, followed by incubation with a 5 µg/ml primary antibody
specific to acetyl-Histone H3 (Lys14) (Upstate Cell signaling) overnight at 4°C. The
membrane was washed with TBS-T before it was further incubated with alkaline
horseradish peroxidase (HRP)-conjugated goat anti-rabbit IgG secondary antibody
(1:1000, Santa Cruz Biotechnology, Santa Cruz, CA) for 1 hour at room temperature.
After washing with TBS-T, immunoreactive signals were detected by enhanced
chemiluminescence using ECL system (Amersham).

Histological examination of muscles and nerves:
After dissection, skeletal muscles were fixed with 4% paraformaldehyde. After
rinsing in PBS, muscles were cryoprotected in 30% sucrose–PBS overnight, then
embedded in Tissue Tek O.C.T (Electron Microscopy Sciences, Hatfield PA), and
flash-frozen in supercooled isopentane. Serial cryosections (16µm thickness) were
24
used for hematoxylin and eosin staining to measure muscle cross-sectional area. To
assess the extent of innervated NMJs, whole TA or diaphragm (DIA) muscles were
teased, and fluorescently labeled with Alexa-594-alpha-bungarotoxin (Alexa-594 α-
BTX) for AChRs.

Histological examination of motor axons:
The spinal cord was fixed with 4% paraformaldehyde and ventral roots from the
lumbar segment 4 (L4), which innervate the hindlimb muscles (Nicolopoulos-
Stournaras and Iles, 1983), were dissected. The phrenic nerve innervating the
diaphragm muscle was also collected, and fixed with 4% paraformaldehyde. Ventral
roots and phrenic nerves were washed in 0.1 phosphate buffer, and further fixed with
1% osmium tetroxide for 2 hours, dehydrated, and embedded in Epon plastic (EM
Sciences, Cincinnati, OH). Cross-sections (1 µm) were stained with toluidine blue to
measure the number and the size of axons under light microscopy. Measurements of
axon numbers and calibers were made with Image J (NIH image).

Histological examination of the spinal cord:
The spinal cord was fixed with 4% paraformaldehyde, and the lumbar segments
(L3~L5) were dissected. After rinsing in PBS, lumbar segments were cryo-protected
in 30% sucrose overnight, then embedded in Tissue Tek O.C.T (Electron
Microscopy Sciences, Hatfield PA), and flash-frozen in supercooled isopentane.
Spinal cords were cross-sectioned at 25µm and stained with anti- choline
25
acetyltransferase (ChAT) antibody (Chiu, et al., 1995) to determine the number of α-
motoneurons, which were defined with cell body size ≥250 µm
2
(Drachman et al.,
2002). To examine the level of histone acetylation, sections of the spinal cord were
incubated with an antibody specific to acetyl-Histone H3 (Lys14) (5µg/ml) (Upstate
Cell signaling) overnight at 4°C. For microglia and astrocyte staining, spinal cord
sections were incubated with polyclonal anti-Iba-1 (1:400, WAKO, #019-19741) and
monoclonal anti-Glial Fribrillary Acidic Protein (GFAP) (1:500, Sigma).

Quantitative RT-PCR analysis:
To compare the gene expression in TSA-treated SOD1 mice with DMSO-treated
SOD1 littermates, quantitative RT-PCR was performed. Total RNA was extracted
from spinal cords by using TRIzol reagent (Invitrogen), and treated with DNase by
using DNA-free kit (Ambion). The concentration of total RNA was measured with a
spectrophotometer at 260nm absorbance, and 2 µg of total RNA was reverse-
transcribed using the SuperScript III (Invitrogen) to synthesize complementary DNA
(cDNA). Five µl of diluted cDNA (1:20) was used for each 20 µl RT-PCR reaction.
Real-time quantitative PCR (qPCR) was performed with SYBR green using DNA
Engine Opticon 2 system (Bio-Rad). Primers were tested for the efficiency and
specificity through the standard curve amplification, and a melting curve assay,
respectively, and optimized primers were used for quantitative PCR (qPCR). PCR
program was 95°C 20 sec, 60°C 20 sec, 72°C 30 sec for 40 cycles. The relative
expression level for each gene was calculated using 2 - ∆∆Ct method (Livak and
26
Schmittgen, 2001), and all expression values were normalized with the housekeeping
genes, such as glyceraldehyde-3-phosphate dehydrogenase (GAPDH) or β-actin.
The sequence of the primers as follows:
Follistatin: forward, 5’- TGCTGCTACTCTGCCAGTTC, reverse, 5’-
GTGCTGCAACACTCTTCCTTG; Muscle ring finger (MuRF)-1: forward, 5’-
ACCTGCTGGTGGAAAACATC, reverse, 5’-CTTCGTGTTCCTTGCACATC;
glutamate transporter 1 (GLT-1): forward, 5’- GGTGGAGGGGGTCACATAC,
reverse, 5’- AGATCCCGAAGCTGCCATAGA; GAPDH: forward, 5’-
TGCATCCTGCACCACCAACT, reverse, 5’- ATGCCTGCTTCACCACCTTC; β-
actin: forward, 5’- GGCTGTATTCCCCTCCATCG, reverse, 5’-
CCAGTTGGTAACAATGCCATGT.

Behavioral tests:
Mice were monitored twice a week, and their body weights were recorded. For the
rota-rod test, a mouse was placed on an accelerating rotating rod and the maximum
speed until the mouse falls from the rod was recorded. The highest speed (in rpm) in
3 trials was recorded. For the grip-strength analysis grip strength meter (Columbus
Instruments) was used. Mice were allowed to grasp a triangular pull bar connected
to a force gauge with the hind limb, and slowly pulled away from the pull bar until
the grip was released. Maximum tension of the pull bar was recoded from the
gauge’s digital readout. Five measurements were taken from each animal, and the
27
mean values were used for statistical analysis. Survival duration was analyzed by
Kaplan- Meier survival statistics (log rank test).

Statistical Analysis:
All data are expressed as the mean± SEM. All statistical analysis were performed on
PRISM 5.01 software (Graph-Pad, San Diego), using two-tailed student’s t tests,
except a two-way ANOVA for the comparison of gene expressions, the rota-rod and
the grip strength analysis. Kaplan-Meier analysis was used for comparing the
difference in survival. Significance was defined as p < 0.05.

2.3 Results

To imitate the time point when patients may start their treatments, we started its
treatment at 90 days of age (P90), when motor impairment was observed through the
grip-strength analysis. Since there is a gender difference in lifespan, muscle size and
muscle strength in SOD1 mice (Veldink et al., 2003; Heiman-patterson et al., 2005;
Suzuki et al., 2007b), we treated TSA only to males to avoid the ambiguity caused by
gender. To examine the effect of TSA, we sacrificed animals at P120, when is the
late stage of disease, except for the survival analysis.

28
TSA restores histone acetylation in skeletal muscle of SOD1 transgenic mice
To render accessibility of RNA polymerase for gene transcription, histone
acetylation occurs on lysine residues, which relaxes the chromatin structure
(Grunstein, 1997). In ALS animal models, transcriptional dysregulation associated
with reduced acetylation of histones in the spinal cord has been reported, and HDAC
inhibitors such as VPA and PBA were able to restore the acetylation level in the
spinal cord of ALS model mice (Rouaux et al., 2003; Ryu et al., 2003). However,
whether a HDAC inhibitor can induce acetylation in skeletal muscle has not been
examined.

We first tested whether skeletal muscle in SOD1 mice shows a reduced level
of histone acetylation compared with wild-type mice as it does in the spinal cord. As
shown in Fig.2-1A, SOD1 mice exhibited diminished acetylation level in histone 3
(H3) at lysine residue in skeletal muscles as compared to wild-type mice at P120.
Treatment of TSA, a pan-histone deacetylation inhibitor, increased the acetylation of
H3 in skeletal muscles, which confirms successful administrations of TSA.

TSA ameliorates skeletal muscle atrophy of SOD1 transgenic mice
To further test whether recovered histone acetylation in muscle is associated with
improved muscle morphology, we checked the mass and the size of TSA on the
gastrocnemius (GN) and tibialis anterior (TA) muscles. Located in the hindlimb,
these muscles are predominately composed of the fast fiber type, which have been
29
30

Figure 2-1: TSA increases histone acetylation in skeletal muscle and ameliorates
muscle atrophy in SOD1 mice.

SOD1 mice were treated with TSA or DMSO (vehicle) at P90 until P120.
A: Gastrocnemius (GN) muscles were collected at P120 for protein extraction.
DMSO-treated SOD1 mice showed reduced level of the acetylation in the GN
muscle compared with age-matched wild-type (WT) mice as assessed by western
blot using anti-acetylH3. TSA-treated SOD1 mice showed increased the histone
acetylation level comparable to the level of WT. Protein level of actin from WT,
DMSO-treated SOD1, and TSA-treated SOD1 mice reflects the similar loading of
protein.
B: DMSO-treated SOD1 mice showed 48% decrease in muscle weight of GN as
compared to age-matched WT mice at P120 (SOD1+DMSO: 97.3±7.5mg, WT:
187.7±13.3mg, p=0.00008). TSA-treated WT mice showed similar muscle weight
(GN: 195.3±6.1mg, TA: 63.2±3.2mg) with DMSO-treated WT mice (GN:
187.7±29.8mg, TA: 64.0±9.3mg). Compared to DMSO-treated SOD1 mice, TSA-
treated SOD1 mice showed a 41% increase in GN weight (SOD1+TSA:
137.0±5.4mg, p=0.0008). Similarly, 51% reduced muscle weight in tibialis anterior
(TA) was observed in DMSO-treated SOD1 mice at P120 compared with age-
matched WT mice (SOD1+DMSO: 31.2±1.5mg, WT: 64.0±4.2mg, p=0.000007).
TSA-treated SOD1 mice showed a 21% increase in TA weight compared with
DMSO-treated SOD1 mice (SOD1+TSA: 37.8±1.9mg, p=0.018).
Data are mean ± SEM. *p<0.05, ** p<0.01 (compared with DMSO-treated SOD1
mice), ### p<0.001 (compared with age-matched WT controls); two-tailed, equal
variance Student’s t test.
C: Representative pictures of cross-sectional area of GN muscle from WT (a),
DMSO-treated SOD1 (b), and TSA-treated SOD1 (c) mice at P120. SOD1 mice
showed reduced cross-sectional area as compared to age-matched WT mice (a).
TSA-treated SOD1 (c) mice showed larger cross-sectional area of GN muscle as
compared to DMSO-treated SOD1 mice (b).
31
Figure 2-1: continued

shown to be more susceptible to muscle atrophy than slow fibers in ALS (Frey et al.,
2000; Atkin et al., 2005; Pun et al., 2006; Hegedus et al., 2007). Compared to
hindlimb muscles of wild-type mice at P120, age-matched SOD1 mice showed a
48% and 51% decrease in muscle weight of GN and TA, respectively (Fig. 2-1B).
TSA-treated SOD1 mice showed a 41% and 21% increase in GN and TA muscles,
respectively, compared with vehicle-treated SOD1 mice [GA: 137.0 ± 5.4mg vs.
97.3 ± 7.5mg, TA: 37.8 ±1.9 mg vs. 31.2 ± 1.5mg, in TSA- vs. vehicle-treated SOD1
mice, respectively (Fig. 2-1B)]. However, we found no change in the muscle weight
of wild-type mice after TSA treatment (Fig. 2-1B), probably because TSA
ameliorates muscle atrophy in degenerating muscle, but not in healthy muscle (Iezzi
et al., 2004). Ameliorated muscle atrophy in weight of GN was correlated with
larger muscle cross-sectional area in TSA-treated SOD1 mice compared with
vehicle-treated SOD1 mice (Fig. 2-1C).

To elucidate the underlying mechanism of TSA in preventing muscle atrophy,
we checked whether TSA upregulates follistatin in SOD1 mice as it did in an animal
model of muscle dystrophy (Iezzi et al., 2004). Follistatin is known to counteract the
effect of myostatin, a negative regulator of muscle growth, and therefore increases
muscle size (Lee and McPherron, 2001). By using quantitative RT-PCR, we found
that TSA-treated SOD1 mice showed about 2-fold increase in follistatin expression
compared with vehicle-treated SOD1 mice (Fig.2-2A). Therefore, ameliorated
32

Figure 2-2: TSA increases the expression of follistatin, but decreases the
expression of muscle ring finger (MuFR)-1 in SOD1 mice.

SOD1 mice were treated with TSA or DMSO (vehicle) at P90 until P120, and TA
muscles were collected at P120 for quantitative RT-PCR to examine gene expression.
A: DMSO-treated SOD1 mice showed a 78% decrease of follistatin expression in the
TA muscle compared with age-matched WT mice. Compared to DMSO-treated
SOD1 mice, TSA-treated SOD1 exhibited about 2-folds increase in follistatin
expression (p=0.0163, one-way ANOVA).
B: DMSO-treated SOD1 mice showed about 60 times more expression of MuRF-1,
which induces progressive muscle atrophy, in TA muscle compared with WT mice.
TSA-treated SOD1 mice showed about a half of the MuRF1 expression found in
DMSO-treated SOD1 (p=0.053, one-way ANOVA).
33
muscle atrophy is possibly mediated by inhibiting myostatin through increased
follistatin expression upon TSA treatment.

Another mechanism responsible for muscle atrophy is the ubiquitin–
proteasome system, which leads to the degradation of muscle proteins. Especially,
Muscle RING Finger1 (MuRF-1), a muscle-specific ubiquitin ligase, is required to
mediate rapid muscle atrophy (Bodine et al., 2001; Lecker et al., 2004). Therefore,
we tested whether skeletal muscle of SOD1 mice shows a higher expression of
MuRF-1 compared with wild-type mice. By using quantitative RT-PCR, we found
about 60 times more MuRF-1 expression in skeletal muscle of vehicle-treated SOD1
mice compared with wild-type mice at P120, indicating atrophic state of muscle in
SOD1 mice. TSA-treated SOD1 showed about a 50% reduction of MuRF1
expression compared with vehicle-treated SOD1 (Fig. 2-2B), which implicates that
molecular pathway that triggers muscle atrophy is attenuated in TSA-treated muscle.
In summary, TSA ameliorates skeletal muscle atrophy of SOD1 mice, possibly
through the inhibition of myostatin and the ubiquitin-protease pathway.

TSA attenuates denervation at neuromuscular junctions (NMJs) in SOD1
transgenic mice
Together with muscular atrophy, one of the early pathological features of ALS is
NMJ denervation in skeletal muscle. For a better observation of NMJs, we bred the
congenic SOD1 transgenic mouse to a mouse of equal background expressing yellow
34

Figure 2-3: TSA improves neuromuscular junction (NMJ) innervation in TA
and diaphragm (DIA) muscles in SOD1 mice.

For an easier observation of NMJs, SOD1 mice were cross-bred with mice
expressing YFP in all motoneurons. SOD1/YFP mice were treated with TSA or
DMSO (vehicle) at P90 until P120, and the TA muscle and the diaphragm (DIA)
muscle were collected at P120, and stained with anti-bungarotoxin to label post-
synaptic acetylcholine receptors (AChRs). To check the NMJ innervation, whole
muscle was teased, and 400~500 NMJs per muscle were observed under a
fluorescent microscope. When a pre-synaptic nerve terminal (in green) overlaps the
post-synaptic AChRs (in red), the NMJ is termed as a “fully innervated NMJ”.
When the nerve terminal is partially overlapped with AChR, or is completely absent,
we defined that NMJ as a “partially denervated NMJ” or a “denervated NMJ”,
respectively (see arrows in A, b).
A: TSA-treated SOD1/YFP mice (c) showed improved NMJ innervation in TA at
P120, compared with DMSO-treated SOD1 mice (b) (fully innervated NMJs:
22.2±7.8 vs. 52.9±7, partially innervated NMJs: 16.3±4.3 vs. 19.6± 6.7, denervated
NMJs: 61.6±8.4 vs. 27.6±6.6, in DMSO- vs. TSA-treated SOD1, respectively).
B: In the DIA muscle, TSA-treated SOD1 showed increased innervation, but
decreased denervation compared with DMSO-treated SOD1 mice, although p value
was not statistically significant (fully innervated NMJs: 59.4±5.8% vs. 72.0±8.9%,
partially innervated NMJs: 15.6±6.4% vs. 13.8± 4.3%, denervated NMJs: 25.0±1.9%
vs. 14.2±4.7%, in DMSO- vs. TSA-treated SOD1, respectively).
C: Quantification of NMJs in the TA muscle from WT, DMSO-treated SOD1, and
TSA-treated SOD1 mice at P120 is shown.
D: Quantification of NMJs in the DIA muscle from WT, DMSO-treated SOD1, and
TSA-treated SOD1 mice at P120 is shown. Data are mean ± SEM. *p <0.05; two-
tailed, equal variance Student’s t test.

35
36
Figure 2-3: continued

fluorescence protein (YFP) in all motoneurons (thy1-YFP) (Feng et al., 2000). It has
been reported that there is no difference in disease onset and progression between
SOD1 mice and double transgenic SOD1 G93A/YFP mice (Schaefer et al., 2005).
When a pre-synaptic nerve terminal overlaps the post-synaptic acetylcholine receptor
(AChR), we define that NMJ as a “fully innervated NMJ”. However, if the nerve
terminal is partially overlapped with AChR, or is completely absent, leaving only
AChR, we defined that NMJ as a “partially innervated NMJ” or a “denervated NMJ”,
respectively. It has been reported that denervation of NMJs preferentially occurs in
fast-fatigue muscle fibers, but slow muscle fibers are less susceptible to denervation
(Frey et al., 2000; Atkin et al., 2005; Pun et al., 2006; Hegedus et al., 2007).
Therefore, it is possible that observing NMJs from random regions may not be a true
representative of a whole muscle which is composed of fast and slow fibers. To
exclude a bias that can be generated by a random selection of muscle area, we teased
the whole muscle of TA or diaphragm (DIA), and examined through out these teased
muscles. To avoid any bias in observations, a treatment was coded by an
investigator who collected muscles, and another investigator examined about 500
NMJs per muscle to quantify NMJ innervation without knowing to which group a
particular mouse belonged.

Compared to wild-type mice, which hardly show denervated NMJs (fully
innervated NMJs: 99.7±0.002%, partially innervated NMJs: 0.002±0.002%;
denervated NMJs: 0.0009±0.001% in wild-type, n=3, Fig.2-3 A a), SOD1 mice
37
showed about 80% denervated or partially innervated NMJs at P120 (Fig.2-3A b). In
TSA-treated SOD1 mice, there were as twice as many fully innervated NMJs in TA
muscle compared with vehicle–treated SOD1 mice (fully innervated NMJs: 52.9±7%
vs. 22.2±7.8%, partially innervated NMJs: 19.6± 6.7% vs. 16.3±4.3%, denervated
NMJs: 27.6±6.6% vs. 61.6±8.4% in TSA- vs. vehicle-treated SOD1, respectively,
Fig. 2-3 A and, C). In addition to the TA muscle, we examined the diaphragm
(DIA) muscle because denervation in DIA muscle causes fatal respiration failure in
ALS patients (Braun, 1987). Compared to the TA muscle, which showed only 22%
of fully innervated NMJs, the DIA muscle maintained 59% of fully innervated NMJ
in SOD1 mice at P120 (Fig. 2-3 B b). TSA treatment increased the fully innervated
NMJs by 21%, although it is not statistically significant (fully innervated NMJs:
72.0±8.9% vs. 59.4±5.8%, partially innervated NMJs: 13.8± 4.3% vs. 15.6±6.4%,
denervated NMJs: 14.2±4.7% vs. 25.0±1.9 % in TSA vs. vehicle-treated SOD1,
respectively, Fig. 2-3B c and, D). It is possible that compared to the TA muscle
which already underwent progressive NMJ denervation at P120, the diaphragm
muscle, which initiates NMJ denervation later compared to the TA muscle might
show more variations. Taken together, TSA treatment aids to protect NMJs from
denervation in SOD1 mice, which may lead to improved motor functions.

TSA ameliorates axonal degeneration in SOD1 transgenic mice
To further examine whether beneficial effects of TSA at the NMJs can be observed
in nerves, we first examined the number of myelinated axons in the phrenic nerve
38

Figure 2-4: TSA ameliorates axonal degeneration in SOD1 mice.

SOD1 mice were treated with TSA or DMSO (vehicle) at P90 until P120.
A: The phrenic nerves innervating the DIA muscle were collected at P120. Distal
part of the phrenic nerve at the entry of the DIA muscle was cross-sectioned to
observe the myelinated axons. DMSO-treated SOD1 mice (b) showed reduced
number of myelinated axons in phrenic nerve compared with age-matched WT mice
(a). TSA-treated SOD1 mice (c) showed more myelinated axons compared with
DMSO-treated SOD1 mice (b) in the phrenic nerve.
B: The ventral roots of the lumbar spinal cord segment 4 (L4) were collected at P120.
Proximal part of the ventral roots close to the spinal cord was cross-sectioned.
DMSO-treated SOD1 mice (b) showed reduced number of myelinated axons in L4
ventral root compared with age-matched WT mice (a). TSA-treated SOD1 mice (c)
showed more myelinated axons in L4 ventral root compared with DMSO-treated
SOD1 mice (b).
C: Quantification of myelinated axons in the phrenic nerve at P120 is shown.
DMSO-treated SOD1 mice showed about 40% reduced myelinated axon number in
the phrenic nerve compared with WT mice (WT: 308.3±14.5, SOD1+DMSO:
182.3±13.2, p=0.0014). TSA-treated SOD1 mice showed a 32% increase in
myelinated axon number in phrenic nerve compared with DMSO-treated SOD1 mice
(SOD1+TSA: 240±17.5, p=0.043).
D: Quantification of myelinated axons in the ventral root of L4 spinal cord at P120
is shown. DMSO-treated SOD1 mice showed a 37% reduced myelinated axon
number in L4 ventral root compared with age-matched WT mice (WT: 996.5±58.5,
SOD1+DMSO: 624.4±56.7, p=0.0015). TSA-treated SOD1 mice showed about a
20% increase in myelinated axon number in the L4 ventral root compared with
DMSO-treated SOD1 mice (SOD1+TSA: 756±67.7, p=0.043). Especially, the
number of the large caliber axons (>4 µm) were 58% less in SOD1 mice
(294.8±44.2) compared with WT mice (706.5±51.6, p=0.00014). TSA-treated SOD1
mice showed 47% more number of the large caliber axons (>4 µm) (435.8±72.7,
p=0.043) compared with the control SOD1 mice. Data are mean ± SEM. *p <0.05
(compared with DMSO-treated SOD1 mice), ###p<0.001 (compared with age-
matched WT controls); two-tailed, equal variance Student’s t test.
39
40
Figure 2-4: continued

innervating the diaphragm muscle. In SOD1 mice, we found a 41% loss in
myelinated axons in the phrenic nerve at P120 compared with age-matched wild-type
mice (Fig. 2-4A a, b, and quantified in C)]. In TSA-treated SOD1 mice, there were
32% more myelinated axons in the phrenic nerve as compared to vehicle-treated
SOD1 [240.0±17.5 vs. 182.3±13.2, in TSA- vs. vehicle-treated SOD1, respectively.
p=0.042 (Fig. 2-4A b, c, and quantified in C)].

To observe the effect of TSA on nerves that innervate hindlimb muscles, we
checked the number of myelinated axons in the ventral root of the lumbar spinal cord.
There was a 37% loss in myelinated axons in SOD1 mice in the ventral root of L4 at
P120 compared with age-matched wild-type mice (Fig. 2-4B a, b, and quantified in
D), which is consistent with the previous study (Fischer et al., 2004). TSA treatment
was able to preserve 21% more myelinated axons compared with vehicle-treated
SOD1 mice at P120 [756.8±67.7 vs. 624.4±56.7, in TSA- vs. vehicle-treated SOD1,
respectively. p=0.095 (Fig. 2-4 B b, c, and quantified in D)]. Especially, the number
of large caliber axons ( ≥ 4µm), which are known to be preferentially affected by the
disease (Kawamura et al., 1981; Sobue et al, 1981), were 47% more in TSA-treated
compared with vehicle-treated SOD1 mice (Fig. 2-4 D, p=0.043).

In summary, we found that TSA attenuates the loss of myelinated axon in
nerves innervating the diaphragm or hindlimb muscles of SOD1 mice at P120.

41

TSA restores histone acetylation in the spinal cord of SOD1 mice
We then further assessed the effects of TSA in the spinal cord. First, we checked
whether TSA can restore histone acetylation in the spinal cord, which is known to be
downregulated in ALS mouse models (Rouaux et al., 2003; Ryu et al., 2003)
Consistent with previous studies, SOD1 mice exhibited lower level of acetylation on
histone 3 (H3) compared with wild-type mice at P120 as assessed by staining with
anti-acetyl H3 (Fig. 2-5 a, b, d, e). Similar to other HDAC inhibitors that increased
histone acetylation in the spinal cord of SOD1 transgenic mice (Rouaux et al., 2003;
Ryu et al., 2003), TSA treatment also enhanced histone acetylation in SOD1 mice
compared with vehicle-treated SOD1 mice, which is the comparable level of wild-
type mice (Fig. 2-5 b, c, e, f). This result also indicates that TSA crossed the blood-
brain-barrier (BBB) as other studies have reported (Avila et al., 2007; Hahnen et al.,
2008).

TSA decreases the number of microglia and astrogliosis in SOD1 mice
The activation of microglia and astrocytes in the brain and spinal cord is one of the
prominent pathological features in patients and rodent models of ALS (Ince et al.,
1996; Pasinelli and Brown, 2006). Considering that HDAC inhibitors have been
suggested as anti-inflammatory agents for microglia (Adcock 2007; Chen et al.,
2007; Kim et al., 2007), we tested whether TSA can decrease the number of
42

Figure 2-5: TSA restores histone acetylation in the spinal cord of SOD1 mice.

SOD1 mice were treated with TSA or DMSO (vehicle) at P90 until P120 and lumbar
(L) 3~L5 spinal cord segment was collected at P120 for the cryosection. The spinal
cord sections (25 µm-thickness) were stained with anti-acetyl H3. DMSO-treated
SOD1 mice showed weak staining of acetylated histone compared with age-matched
WT mice (a, b: hemi-spinal cords in a low magnification, d, e: high magnification).
The spinal cord sections from TSA-treated SOD1 mice showed enhanced staining of
acetylated histone similar to the level found in WT mice (c, f). Arrows indicate
examples of the acetyl H3-positive staining.
43
microglia as assessed by Iba-1 positive immunostaining. As shown in Fig. 2-6 A
a~d, the spinal cord of TSA-treated SOD1 mice demonstrated a reduced number of
Iba-1 positive cells compared with vehicle-treated SOD1 [52.4 ± 5.3 vs. 91.3±13 in
TSA-treated vs. vehicle-treated SOD1 mice, p=0.0492 (quantified in Fig. 2-6 B)].

Prior to the activation and proliferation of microglia, astrogliosis also occurs,
and it progressively increases as disease progresses (Fischer et al., 2004; Yamanaka
et al., 2008). A recent study demonstrated that TSA can protect astrocytes from a
toxic insult like glucose deprivation through inhibiting the inflammatory reaction
(Niu et al., 2009). To check whether TSA is able to reduce astogliosis in the spinal
cord of SOD1 mice, we labeled astrocytes with GFAP to quantify astrogliosis. We
found that TSA-treated SOD1 mice show less astrogliosis compared with vehicle-
treated SOD1 mice as assessed by the number of GFAP-positive cells [48.8±7.8 vs.
81.1±7.7 in TSA-treated vs. vehicle-treated SOD1 mice, p=0.042 (Fig. 2-6 A e~f,
quantified in C)].

In addition to astrogliosis, astrocytes have been implicated in glutamate
excitotoxicity caused by the reduced expression of glutamate transporter (GLT-1) in
astrocytes (Rothstein et al., 1995). Supporting this, we found that SOD1 mice show
a 57% reduced expression of GLT-1 in the spinal cord compared with wild-type
mice (Fig. 2-6 C). Recently, there was a study showing that TSA can reduce
glutamate excitotoxicity by preventing the downregulation of
44

Figure 2-6: TSA decreases glial activity and increases the expression of GLT-1
in the spinal cord of SOD1 mice.

SOD1 mice were treated with TSA or DMSO (vehicle) at P90 until P120, and
lumbar (L) 3~ L5 spinal cord segment was collected at P120 for the cryosection.
The spinal cord sections (25 µm-thickness) were stained with anti-Iba-1 or anti-
GFAP to label microglia or astrocytes, respectively.
A: (a, b, c, d) TSA-treated SOD1 mice (c, d) showed less number of Iba-1 positive
microglia in the spinal cord sections compared with DMSO-treated SOD1 mice (a, b).
(e, f, g, h) TSA-treated SOD1 mice (g, h) showed less number of GFAP positive
astrocytes in the spinal cord sections compared with DMSO-treated SOD1 mice (e, f).
(a, c, e, g: low magnification, b, d, f, h: high magnification).
B: Iba-1- or GFAP-positive cells from the spinal cord sections were quantified.
TSA-treated SOD1 mice showed the 43% reduced number of Iba-1-positive
microglia in the spinal cord sections compared with DMSO-treated SOD1 mice
(SOD1+DMSO: 91.3±13, SOD1+TSA: 52.4±5.3, p=0.0492). Similarly, TSA-
treated SOD1 mice showed the 40% reduced number of GFAP-positive astrocyte in
the spinal cord sections compared with DMSO-treated SOD1 mice (SOD1+DMSO:
81.1±7.7, SOD1+TSA: 48.8±7.8, p=0.042). Data are mean ± SEM. *p <0.05; two-
tailed, equal variance Student’s t test.
C: SOD1 mice were treated with TSA or DMSO (vehicle) at P90 until P120, and the
spinal cords were collected at P120 for quantitative RT-PCR to examine the gene
expression. DMSO-treated SOD1 mice showed a 57% decrease in the glutamate
transporter (GLT-1) expression compared with age-matched WT mice (p=0.0003).
Compared to DMSO-treated SOD1 mice, TSA-treated SOD1 mice exhibited a 29%
increase in the GLT-1 expression (p=0.0018). Data are mean ± SEM. **p <0.01
(compared with DMSO-treated SOD1 mice), ###p<0.001 (compared with age-
matched WT); two-tailed, equal variance Student’s t test. p=0.0163, one-way
ANOVA.

45
46
Figure 2-6: continued
GLT-1 caused by toxic stresses like 1-methyl-4-phenylpyridinium (MPP
+
) (Wu et al.,
2008a). TSA treatment in SOD1 mice induced a 29% increase in the expression of
GLT-1 in the spinal cord compared with vehicle-treated SOD1 mice (Fig. 2-6C,
p=0.0018). It is possible that increased expression of GLT-1 through TSA treatment
might have contributed to uptake more glutamate and reduce glutamate
excitotoxicity, which in turn could resulted in decreased astrogliosis in SOD1 mice.

TSA attenuates motoneuron death in SOD1 mice
A neuroprotective role of TSA in neurons has been previously demonstrated in
mouse models of spinal muscular atrophy, and multiple sclerosis (Avila et al., 2007;
Camelo et al., 2005, respectively). To find whether TSA improves motoneuron
survival in SOD1 mice, we examined the number of motoneurons labeled with a
choline acetyltransferase (ChAT) antibody. We found about a 30% reduction in
motoneuron number in the lumbar spinal cord of SOD1 mice compared with wild-
type mice at P120 (Fig. 2-7A a, b, quantified in C). However, TSA attenuated the
motoneuron loss in SOD1 mice by 32% at P120 [19.3±2.1 vs. 15.4±0.9 in TSA- vs.
vehicle-treated SOD1 mice, p=0.016 (Fig. 2-7 A b, c, quantified in C)]. In the
cervical spinal cord, which contains motoneurons innervating the diaphragm, we
found there were 47% more motoneurons in TSA-treated SOD1 compared with
vehicle-treated SOD1 mice at P120 [26.8±4 vs. 18.2±1.8 in TSA- vs. vehicle-treated
SOD1 mice, respectively, p=0.027 (Fig. 2-7B b, c, and quantified in D)]. In
summary, TSA attenuates motoneuron loss in the spinal cord of SOD1 mice.
47

Figure 2-7: TSA attenuates motoneuron death in SOD1 mice.

SOD1 mice were treated with TSA or DMSO (vehicle) at P90 until P120, and
lumbar (L) 3 ~L5 spinal cord segment was collected at P120. The spinal cord
sections (25 µm-thickness) were stained with anti-choline acetyltransferase (ChAT).
A, C: DMSO-treated SOD1 mice (b) showed the 32% reduced number of ChAT-
positive motoneurons in the spinal cord compared with age-matched WT mice (a)
(WT: 22.8±2.6, SOD1+DMSO: 15.4±0.9, p=0.0016 ). TSA-treated SOD1 mice (c)
exhibited 25% more motoneurons in the lumbar spinal cord (SOD1+TSA: 19.3±2.1,
p=0.016).
B, D: DMSO-treated SOD1 mice (b) showed the 42% reduced number of ChAT-
positive motoneurons in the cervical segment of the spinal cord compared with age-
matched WT mice (a) (WT: 31.6±0.9, SOD1+DMSO: 18.2±1.8, p=0.0003). TSA-
treated SOD1 mice (c) exhibited 47% more motoneurons in the cervical spinal cord
(SOD1+TSA: 26.8±4, p=0.0267). Data are mean ± SEM. *p <0.05, **p <0.01
(compared with DMSO-treated SOD1 mice), ##p<0.01 ###p<0.001 (compared with
age-matched WT mice); two-tailed, equal variance Student’s t test.

48
49
Figure 2-7: continued
TSA improves motor performances and survival in SOD1 mice
To determine whether improved histological characteristics in TSA-treated SOD1
mice are associated with functional improvements, we tested the effects of TSA
treatment on motor functions and survival of SOD1 mice. To assess motor functions,
we employed both rota-rod and grip strength analysis. By the rota-rod analysis, we
found that vehicle-treated SOD1 mice showed about a 20% decrease in motor
function, already at P90, compared with wild-type mice, and further a 50% reduction
compared with wild-type mice at P135 (Fig. 2-8A). Compared to vehicle-treated
SOD1 mice, TSA-treated SOD1 mice were able to stay 20% longer at P120, and
60% longer at P135 on the rotating rod (Fig. 2-8A).

Similar to the rota-rod analysis, the grip-strength analysis demonstrated that
SOD1 mice show a 50% reduced grip-strength compared with wild-type mice at P90,
and the grip-strength gradually decreased to reach a 80% reduced level compared
with wild-type mice at P120 (Fig. 2-8 B). Compared with vehicle-treated SOD1
mice, TSA-treated SOD1 mice showed about 50% improved grip-strength at P120
(Fig. 2-8B). Markedly weakened grip-strength (15 gram force) observed at P120 in
vehicle-treated SOD1 mice was found about 2 weeks later in TSA-treated SOD1
mice, indicating delayed decline of grip strength in TSA-treated SOD1 mice (Fig. 2-
8B).
50

Figure 2-8: TSA improves
motor performances and
survival in SOD1 mice.

SOD1 mice were treated
with TSA or DMSO
(vehicle) at P90 until P120.
A: A mouse was placed on
an accelerating rotating rod
and the maximum speed
until the mouse falls from
the rod was recorded. TSA-
treated SOD1 mice (in red,
n=15) stayed longer on a
rotating rod, suggesting a
delayed decline of motor
function compared to
DMSO-treated SOD1 mice
(in blue, n=18), p<0.0001;
2-way ANOVA
B: The grip-strength meter
was used to assess the
muscle strength. SOD1 mice
exhibited diminished grip-
strength compared with the
WT mice (in black, n=12)
throughout the all time
points examined. TSA-
treated SOD1 mice (in red,
n=21) showed stronger grip-
strength compared with
vehicle-treated SOD1 mice.
C: TSA-treated SOD1 mice
showed significantly
increased survival
(159.1±2.9 days, n=18), as
compared to DMSO-treated
SOD1 mice (148.8±2.6 days,
n=16). p=0.027; Keplan-
Meier survival analysis

51
Furthermore, we found that TSA-treated SOD1 mice showed significantly increased
survival by approximately 7% (159.1±2.9 days, n=18), as compared to vehicle-
treated SOD1 mice (148.8±2.6 days, n=16) (Keplan-Meier survival analysis,
p=0.027, Fig. 2-8 C). Considering that the only available FDA-approved drug
riluzole increases the rate of survival by approximately 10% in ALS patients and
model mice (Lacomblez et al., 1996; Gurney et al., 1996, respectively), the effect of
TSA on survival is comparable to the effect of the currently available drug.
Moreover, it is important to note that TSA treatment delays motor dysfunction in
SOD1 mice, suggesting it might have functional benefits in ALS patients, which is
not achieved through riluzole treatment (Lacomblez et al., 1996).

2.4 Discussion

TSA treatment started after disease onset extends the lifespan of SOD1 mice.
The present study provided evidence that TSA, a pan-HDAC inhibitor, can improve
the clinical characteristics of ALS found in the several disease targets of SOD1 mice.
In skeletal muscle, TSA ameliorated muscle atrophy and NMJ denervation. In
nerves, TSA attenuated the loss of myelinated axons. In the spinal cord, TSA
reduced microgliosis and astrogliosis, and increased the number of motoneurons as
well. Most importantly, these ameliorated clinical symptoms were associated with
better motor behavior and extended lifespan.

52
Previously, other HDAC inhibitors, such as PBA and VPA demonstrating
neuroprotective effect in many neurodegenerative diseases, have been tested in
mouse models of ALS, and improved survival has been reported (Sugai et al., 2004;
Ryu et al., 2005, Petri et al., 2006). The most extended survival was observed with
the PBA treatment, which extended survival in SOD1 G93A mice by about 20%
when the treatment was started long before any clinical symptoms appear (P20) (Ryu
et al., 2005). It is possible that this profound effect in survival might have occurred
because the drug was treated early enough to prevent or delay any potential
degeneration before it occurred. In fact, when PBA or VPA was treated at P60 to the
SOD1 G86R mice, which has a similar lifespan with SOD1 G93A mice (~130 days),
no significant increase in survival was observed (Rouaux et al., 2007). Considering
the fact that most ALS patients start treatment after the symptoms appear, we tested a
potential drug effect of TSA from P90 when impaired motor function was observed
by the analysis of rota-rod and grip-strength. Although we started drug treatments
comparably late regarding other studies for testing potential drug effects, we did find
a moderate increase in survival in TSA-treated SOD1 G93A mice compared with
control SOD1 G93A mice (~7% increase).

TSA slows disease progression through affecting glial cells in the spinal cord.
The currently available drug for ALS, riluzole, reduces the glutamate excitotoxicity
and increases survival (Bensimon et al., 1994; Lacomblez et al., 1996; Gurney et al.,
1996). Glutamate excitotoxicity is often caused by the reduced level of glutamate
53
transporter GLT-1, which re-uptakes excessive extracellular glutamate from the
synaptic clefts to protect neurons (Seifert et al., 2006). In fact, glutamate
excitotoxicity associated with the reduced level of GLT-1 is the common
characteristics found among ALS patients and animal models, and thereby rescuing
the GLT-1 expression is one of the potential treatments for ALS (Rothstein et al.,
1995; Fray et al., 1998; Bendotti et al., 2001). A recent in vitro study showed that
TSA treatment is able to diminish glutamate toxicity through increasing the
expression of GLT-1 in astrocytes (Wu et al., 2008a). In our study, we demonstrated
that TSA increased the expression of GLT-1 in the spinal cord of SOD1 mice, which
might contribute to reduce glutamate excitotoxicity, and thus extend survival. In
addition to modifying GLT-1, TSA has been shown to increase the expression of
neuroprotective genes such as BDNF and GDNF through enhanced histone
acetylation in astrocytes (Wu et al., 2008b). Although it is not tested, it is possible
that TSA might increase the trophic factor expression in astrocytes of SOD1 mice.

It is likely that survival increase in TSA-treated SOD1 might be due to the
delayed disease progression rather than the delayed disease onset because we started
the TSA treatment after clinical symptoms appear indicating the time point after
disease onset. Mounting evidence suggested that disease progression is largely
affected by the degeneration in the glial cells including astrocytes and microglia
(reviewed in Lobsiger and Cleveland, 2007). Both astrogliosis and microgliosis are
associated with the neuroinflammation, and reduced level of them indicates a less
54
severe disease state (Lobsiger and Cleveland, 2007; Yamanaka et al., 2008).
Decreased expression of mutant SOD1 in microglia or astrocytes delays disease
progression in SOD1 transgenic mice and prolongs lifespan, suggesting that the
toxicity in glial cells accelerates disease progression (Boillee et al., 2006a;
Yamanaka et al., 2008). Since TSA and other HDAC inhibitors are known to
ameliorate neuroinflammation by decreasing reactive microglia, and improving
cellular conditions of astrocytes (Kim et al., 2007; Chen et al., 2007; Wu et al., 2008
a, b; Niu et al., 2009), it is possible that TSA might act on reducing astrogliosis and
microgliosis, and thus delay disease progression in SOD1 mice.

TSA delays skeletal muscle atrophy.
The effectiveness of TSA in SOD1 mice can be also explained by its inhibitory effect
on both class I and II HDACs (Khan et al., 2008). Regulation of class II HDACs
could be important because their inhibition increases the expression of muscle-
related genes responsible for generating and maintaining muscle (Lu et al., 2000;
Veldink et al., 2003), and thereby ameliorate defective muscle symptoms in ALS.
Atrophy and NMJ denervation in skeletal muscle are clinical symptoms linked to the
functional capacity of ALS patients, and these symptoms have been traditionally
attributed to motoneuron death in the spinal cord. However, increasing evidence
suggested that skeletal muscle might be also a target of mutant SOD1-mediated
toxicity, which leads to hypermetabolism and oxidative stress in muscle (Mahoney et
al., 2006; Dupuis and Loeffler, 2009). Supporting this hypothesis, a recent study
55
showed that overexpression of mutant SOD1 gene only in skeletal muscle is
sufficient to induce skeletal muscle atrophy (Dobrowonly et al., 2008). Since
rescuing motoneuron death does not necessarily assure improvement in clinical
symptoms in skeletal muscle (Gould et al., 2006; Suzuki et al., 2007a), targeting
skeletal muscle through TSA might have a potential therapeutic effect in ALS. In
fact, a recent study provided evidence that increased expression of HDAC4 in
skeletal muscle might contribute to muscle atrophy in mouse models of spinal
muscular atrophy and ALS (Cohen et al., 2007). HDAC4 classified as a class II
HDAC upregulates upon denervation, and represses the transcription of genes
required for maintaining muscle integrity (Cohen et al., 2007, 2009). Therefore, it is
possible that increased expression of HDAC4 in skeletal muscle might contributed to
muscle atrophy in ALS, and the ameliorated muscle atrophy in TSA-treated SOD1
mice might have been accomplished partly through HDAC4 inhibition. A recent
clinical study showed that ALS patients treated with class I HDAC inhibitor, VPA,
did not show improvement in daily motor functions and survival (Piepers et al.,
2009). Although it was suggested that lack of beneficial effect might be due to the
weak inhibitory effect of VPA, it is possible that lack of class II HDAC inhibitory
effect in VPA was not able to act on muscle, and probably failed to improve muscle-
related symptoms of ALS.

Besides from the HDAC inhibitory effects, TSA prevents muscle atrophy
through inducing follistatin, an endogenous blocker of myostatin that negatively
56
regulates muscle growth (Iezzi et al., 2004; Minetti et al., 2006), and this effect was
found in a mouse model of muscular dystrophy (Minetti et al., 2006). We also found
that TSA upregulates the follistatin expression in skeletal muscle of SOD1 mice (Fig.
2-2A), and this might have contributed to ameliorated muscle atrophy. Taken
together, beneficial effects of TSA on skeletal muscle either through HDAC4 or
follistatin might account for the delayed muscle atrophy in SOD1 mice, and this
might contributed to improved motor function. Given that the available FDA-
approved drug for ALS cannot ameliorate functional defects in ALS patients
(Lacomblez et al., 1996), a treatment that can intervene with muscle atrophy might
play a significant role to increasing strength for managing daily activities, and thus
improve the quality of the patients’ life.

While the effect of TSA on skeletal muscle might have contributed to the
improved muscle phenotype and motor functions in SOD1 mice, this may not be the
primary contributor to extend lifespan as well as improve motoneuron survival. It
has been shown that the improved muscle phenotype and grip strength in SOD1 mice
through several approaches was not associated with prolonged survival (Miller et al.,
2006; Morrison et al., 2009). Therefore, it is likely that ameliorated muscle atrophy
as well as increased motoneuron survival have contributed together to the improved
motor function and extended survival found in TSA-treated SOD1 mice.

57
Other possible mechanisms of TSA in delaying disease progression
TSA penetrates the blood-brain-barrier, and its treatment led to the improved
survival of neurons in the ventral horn of the spinal cord in mouse models of SMA
and multiple sclerosis (Avila et al., 2007; Camelo et al., 2005, respectively). It is
possible that TSA directly influence neurons to increase the transcription of
neuroprotective genes through promoting histone acetylation. In support of this
hypothesis, TSA treatment enhances the expression of neuroprotective genes
including IGF-2, survival motor neuron (SMN), or gelsolin in animal models or
neurotoxic culture systems (Camelo et al., 2005; Leng and Chuang, 2006; Avila et al.,
2007; Yildirim et al., 2008). It is also possible that TSA increases neuronal survival
indirectly through the improved health of glial cells upon TSA treatment as
addressed earlier.

Besides the effect on neuronal survival, TSA affects neuronal trafficking
mediated by microtubules (MT). TSA can increase the acetylation of MT, and
subsequently increase the MT-dependent vesicular transport, and this is enabled
through inhibition of HDAC6, a class II HDAC inhibitor (Dompierre et al., 2007).
Given that the impaired axonal transport is one of the underlying mechanisms of
ALS pathogenesis (Williamson and Cleveland 1999), and that disrupted retrograde
transport can cause ALS-like symptoms (LaMonte et al., 2002), facilitating the
transport through TSA might exert a beneficial effect in ALS.

58
TSA can be a potential drug that can systemically affect many cell types
implicated in ALS.
Based on accumulated studies suggesting that the underlying mechanism of ALS
involves neighboring non-neuronal cells in addition to motoneurons, a systemic
therapy that targets multiple cell types involved in disease progression might be a
more effective strategy for ALS therapy. Our study demonstrated that TSA, which
inhibits both type I and II HDACs and thus affects many cell types, ameliorated the
pathological features found in skeletal muscle, motoneurons, and glial cells in the
spinal cord, as well as increased the survival in SOD1 mice. Although we tested the
effect of TSA in an animal model for fALS, we hope that TSA might be applicable
to sALS patients, because the pathological course found in both fALS and sALS are
similar upon disease onset. In fact, a recent study provided evidence that there is a
common link between fALS and sALS by finding the covalently cross-linked SOD1-
containing protein species in both types of ALS, but not in other neurodegenerative
diseases (Gruzman et al., 2007). Given that riluzole is the only therapy that can
extend survival by 2-3 months without improving motor functions, but with several
side effects such as asthenia, dizziness, and gastrointestinal disorder, finding a
therapy for ALS is in a high priority. Our data suggest that TSA, a pan-HDAC
inhibitor, might be a potential therapy for ALS to slow down motoneuron loss as
well as improve motor function and survival. Although TSA exerts potent effect in
inhibiting most of the HDACs’ activity, it has not yet approved for clinical studies.
Therefore, other FDA-approved HDAC inhibitors, such as SAHA, which show
59
similar structures and functions to TSA, can be further tested as a potential drug for
ALS.

60

Chapter 3
Dihydrotestosterone delays disease progression and improves motor
function in a mouse model of amyotrophic lateral sclerosis

3.1 Introduction
Amyotrophic lateral sclerosis (ALS) is a lethal disease characterized by a progressive
loss of motoneurons in the brain and spinal cord. The clinical symptoms of ALS
include skeletal muscle weakness, atrophy and paralysis, which eventually lead to
the fatal respiratory failure within 2-5 years from the disease onset. The majority of
ALS cases are sporadic ALS (sALS) caused by unknown etiology, but 10% of cases
are an inherited form of ALS, called familial ALS (fALS) (Cleveland and Rothstein,
2001). In terms of pathological features, both sALS and fALS are indistinguishable
after disease onset, and thus imply that a potential drug for fALS might be applicable
to sALS cases as well. There is only one FDA-approved drug for ALS, riluzole
(Rilutek), which can slightly increase a lifespan through reducing glutamate
excitotoxicity (Bensimon et al., 1994). However, this drug does not show a
significant effect in improving motor function and muscle morphology in ALS
patients (Lacomblez et al., 1996). Therefore, a treatment that can delay skeletal
muscle atrophy and weakness might be a practical approach to improve the quality of
the patients’ life.

61
To prevent progressive muscle weakness and atrophy, enhancing muscle
mass and strength can be a possible approach. Androgens are anabolic steroid that is
widely used or even abused by athletes and body builders to increase skeletal muscle
size and enhance physical function (Strauss and Yesalis, 1991; Bhasin et al., 1996,
2001). It is, however, not known whether androgen treatment can also increase
muscle mass and strength in ALS patients who suffer from progressive muscle
atrophy and associated motor defect. Indeed, there is a report providing evidence
that ALS patients show a lower level of free testosterone, which is a bioavailable
form of androgen, compared with a non-ALS control group (Militello et al., 2002).
Since a low level of testosterone is associated with a reduced muscle mass and
strength (Mauras et al., 1998; Axell et al., 2006), it is possible that reduced
androgens found in ALS patients might contribute to progressive muscle atrophy and
weakness. Therefore, an androgen treatment might be one of the therapeutic
approaches to alleviate skeletal muscle atrophy and weakness in ALS.

Androgen increases skeletal muscle mass through inducing myoblast
proliferation and differentiation (Powers et al., 1975; Singh et al., 2003), as well as
enhancing protein synthesis whereas decreasing protein degradation (Sheffield-
Moore et al., 1999). Especially, androgen-induced skeletal muscle increase is known
to be mediated by insulin-like growth factor (IGF)-1 (Hobbs et al., 1993; Urban et al.,
1995), an anti-atrophy agent in muscle (Lalani et al., 2000; Musaro et al., 2001;
Grounds, 2002; Glass, 2003). Increasing IGF-1 through androgen treatment is
62
particularly interesting given that IGF-1 is the most effective among tested trophic
factors in delaying disease progression in ALS rodent models (Lewis et al., 1993;
Kasper et al., 2003, 2005; Dobrowolny et al., 2005). Restricted expression of IGF-1
only in skeletal muscle was able to protect motoneurons and increase lifespan of a
mouse model of ALS, suggesting that the neuroprotective effect of IGF-1 derived
from skeletal muscle (Dobrowolny et al., 2005). Because exogenous injections of
trophic factors failed to yield satisfactory results probably due to a short half-life of
proteins and inefficient drug deliveries (ALS CNTF Treatment Study group, 1996;
BNDF Study Group, 1999; Borasio et al., 1998), if DHT can increase endogenous
IGF-1 in skeletal muscle, it might be more efficient and relatively easy to translate
into ALS patients.

In addition to the effects on skeletal muscle, androgens affect motoneurons
directly through the highly expressed androgen receptors (ARs) in the ventral horn of
the spinal cord (Matsumoto 1997; Yu and McGinnis, 2001; Pozzi et al., 2003). The
neuroprotective effects of androgen such as promoting neuronal survival and neurite
outgrowth have been found in the spinal motoneurons, and extensively in sexually
dimorphic motoneurons such as the spinal nucleus of the bulbocavernosus (reviewed
in Fargo et al., 2008). Furthermore, androgens also enhance regeneration of the
sciatic nerve after nerve crush by increasing the rate of nerve growth towards its
target hindlimb muscles (Kujawa et al., 1993; Vita et al., 1983). Therefore,
63
androgens are likely to exert their beneficial effects directly on motoneurons as well
as peripheral nerves in addition to skeletal muscle.

To test whether androgen can alleviate pathological symptoms of ALS in
skeletal muscle and motoneurons, and potentially slow disease progression, we
administrated 5α-dihydro-testosterone (DHT), a metabolite of testosterone, to SOD1
G93A mice (denoted as SOD1 mice). Although testosterone is a representative
androgen, it can metabolize to 17beta-estradiol through aromatase which activates
estrogen receptor (ER) (Somboonporn and Davis, 2004). To distinguish the effect of
androgens and avoid the effect of estradiol, we used DHT that binds to AR with a
higher binding affinity compared with testosterone (Liao et al., 1973; Kummer et al.,
1993, 1999). Silicon rubber tubing containing DHT crystals were implanted sub-
cutaneously to SOD1 mice at 75 days of age (P75) when early symptoms appear to
mimic the time point when patients may receive treatments. To examine the effect
of DHT, we sacrificed the animal at P120, except for the survival data. Since there is
a gender difference in disease progression, lifespan, muscle size and strength in
SOD1 mice (Veldink et al., 2003; Heiman-patterson et al., 2005; Suzuki et al.,
2007b), we administrated DHT only to male mice to avoid any ambiguity caused by
gender. This also avoids any potential side effects that can be caused by androgenic
hormones in female mice.

64
In the present study, we found that DHT treatment ameliorates morphological
defects in skeletal muscle, nerves, and motoneurons in SOD1 mice possibly through
increasing IGF-1, and this improvement was associated with enhanced motor
behaviors and extended lifespan.

3.2 Materials and Methods

Animal:
We used SOD1 mutant mice with C57BL/6J background [B6.Cg-Tg(SOD1-
G93A)1Gur/J, Stock# 004435, The Jackson Laboratory], which exhibit a slightly
longer survival as compared to the hybrid line with C57Bl6/SJL background
(143.6±7.5 vs. 130.2±11.2, respectively) (Heiman-Patterson et al., 2005). To avoid
gender differences, only male mice were used for the current study. SOD1 mutant
mice were cross-bred with the same background mice expressing YFP in all
motoneurons (thy1-YFP mice, B6.Cg-TgN (Thy1-YFPH) 2Jrs, Jackson Labs) (Feng
et al., 2000) for visualizing nerves. Mice were housed in 12h light-dark cycle, and
given free access to food and water. Once the mice were unable to reach food on top
of the cage, food and water were provided on the floor of the cage. For the
morphological and molecular analyses, animals were sacrificed at postnatal day 120
(P120). The end-stage was determined by the inability of a mouse to right itself
within 30 s when placed on one side, at which time the mouse was sacrificed. Mice
65
were anesthetized via an intraperioneal (i.p.) injection with a mixture of Rompun (8
mg/Kg body weight) and Ketamine (80 mg/Kg body weight). Surgical instruments
were sterilized by an autoclave prior to surgeries.

DHT implant:
Crystalline 5α-dihydrotestosterone (DHT) (Sigma) was administered in the form of
silastic implant. One-cm length of silastic medical tubing (0.078 cm-inner diameter/
0.0125 cm- outer diameter; Dow Corning Corporation) was filled with 5 mg of DHT,
and both ends were sealed with a silastic medical-grade adhesive (Dow Corning).
Silastic tubing without DHT was used as a control. Since DHT is an androgenic
hormone, DHT treatment to females might cause an unusual hormone balance, which
could trigger undesirable side effects. Therefore, a DHT-filled or empty silastic tube
was implanted subcutaneously in the back of male SOD1G93A mice at P75, an early
symptomatic age. Before implanting the silastic tube, the tubes were equilibrated in
saline for overnight. Based on the method of calculating release dosage based on the
surface area of the DHT-filled silastic tube, the estimation of its plasma
concentration is ~500 ng/dl plasma, which is higher than normal physiological level
(Smith et al., 1997)

66
Measuring the weight of the seminal vesicle:
As an indication of androgen concentration in animals, a weight of the seminal
vesicle, which is sensitive to the androgen concentration, is measured after removing
the adhering tissue and fluid (Axell et al., 2006).

Histological examination of neuromuscular junctions:
After dissection of tibialis anterior (TA) and diaphragm (DIA) muscles, muscles
were fixed with 4% paraformaldehyde for 30 min. After rinsing in PBS, whole
muscles were teased, and stained with Alexa-594-alpha-bungarotoxin (Alexa-594 α-
BTX) for AChRs to examine the NMJ innervation.

Histological examination of motor axons:
The spinal cord was fixed with 4% paraformaldehyde and ventral roots from the
lumbar segment 4 (L4) were collected. Phrenic nerves attached to the diaphragm
muscle were collected and fixed with 4% paraformaldehyde. Both ventral roots and
phrenic nerves were washed in 0.1M phosphate buffer, and further fixed with 1%
osmium tetroxide for 2 hours, dehydrated, and embedded in Epon plastic (EM
Sciences, Cincinnati, OH). Cross-sections (1µm-thickness) were stained with
toluidine blue to measure the number and the size of axons under light microscopy.
Measurements of axon numbers and calibers were made with Image J (NIH image).

67
Histological examination of α-motoneurons:
The spinal cord was fixed with 4% paraformaldehyde, and the lumbar segments
(L3~L5) were dissected. After rinsing in PBS, lumbar segments were cryoprotected
in 30% sucrose overnight, and embedded in Tissue Tek O.C.T (Electron Microscopy
Sciences, Hatfield PA), and then flash-frozen in supercooled isopentane. To
examine a motoneuron number, spinal cords were cross-sectioned at 25µm and
stained with anti- choline acetyltransferase (ChAT) antibody (Chiu, et al., 1995), and
ChAT-positive motoneurons larger than 250 µm
2
were counted (Drachman et al.,
2002).

Quantitative RT-PCR analysis:
Total RNA was extracted from tibialis anterior muscle by using TRIzol reagent
(Invitrogen), and treated with DNase by using DNA-free kit (Ambion). The
concentration of total RNA was measured with a spectrophotometer at 260nm
absorbance, and 2 µg of total RNA was reverse-transcribed using the SuperScript III
(Invitrogen) to synthesize complementary DNA (cDNA). Five µl of diluted cDNA
(1:20) was used for each 20 µl RT-PCR reaction. Real-time quantitative PCR
(qPCR) was performed with SYBR green dye using DNA Engine Opticon 2 system
(Bio-Rad). Primers were tested for the efficiency and specificity through the
standard curve amplification, and a melting curve assay, respectively, and optimized
primers were used for quantitative PCR (qPCR). PCR program was 95°C 20 sec,
60°C 20 sec, 72°C 30 sec for 40 cycles. The relative expression level for each gene
68
was calculated using 2 - ∆∆Ct method (Livak and Schmittgen, 2001), and all
expression values were normalized with the housekeeping genes, such as
glyceraldehyde-3-phosphate dehydrogenase (GAPDH) or β−actin.
The sequence of the primers as follows:
IGF-1: forward, 5’- CTGGACCAGAGACCCTTTGC, reverse, 5’-
GGACGGGGACTTCTGAGTCTT; IGF-2: forward, 5’-
GTGCTGCATCGCTGCTTAC, reverse, 5’- ACGTCCCTCTCGGACTTGG;
GAPDH: forward, 5’- TGCATCCTGCACCACCAACT, reverse, 5’-
ATGCCTGCTTCACCACCTTC; β-actin: forward, 5’-
GGCTGTATTCCCCTCCATCG, reverse, 5’- CCAGTTGGTAACAATGCCATGT.

Behavioral tests:
Mice were monitored twice a week, and their body weights were recorded. For the
rota-rod test, a mouse was placed on a rotating rod that rotates at the speed of 11 rpm,
and the latency until a mouse falls from the rod was recorded. The longest latency
(in sec) in 3 trials was recorded. For the footprint analysis, hindlimbs were placed
into non-toxic paints and the animal was allowed to walk on a 50 cm length of paper,
and their continuous locomotion was recorded. Stride length was measured by
dividing the walking distance by the number of steps taken within the walking
distance. For the grip-strength analysis, the grip strength meter (Columbus
Instruments) was used. Mice were allowed to grasp a triangular pull bar connected
to a force gauge with their hind limb, and were slowly pulled away from the pull bar
69
until the grip was released. Maximum tension of the pull bar was recoded from the
gauge’s digital readout. Five measurements were taken from each animal, and the
mean values were used for statistical analysis.

Statistical Analysis:
All data are expressed as the mean± SEM. All statistical analyses were performed
on PRISM 5.01 software (Graph-Pad, San Diego), using Two-tailed student’s t tests,
except a two-way ANOVA for the grip strength analysis, the rota-rod test, and the
footprint analysis. Kaplan-Meier analysis was used to test the significance in
survival difference. Significance was defined as p < 0.05.

3.3 Results

DHT increases the seminal vesicle size in SOD1 mice
DHT was released from DHT-filled silastic tube, which is a widely used method to
release hormones systemically (Smith et al., 1977; Parte and Juneja, 1992; Kujawa et
al., 1993), to increase the concentration of DHT in SOD1 mice. We first tested the
DHT implant with wild-type mice at P75 to check whether the implant can
successively release DHT. An empty silastic tube was also implanted to age-
matched littermates, which serve as a control to exclude any possible artifact caused
by the implant surgery. To examine whether the DHT implant increases androgen
concentration in wild-type mice, we measured the weight of seminal vesicles at
70

Figure 3-1: DHT increases
whereas orchidectomy decreases
the seminal vesicle weight in
SOD1 G93A (SOD1) and wild-
type (WT) mice.

A: SOD1 mice (in black) and WT
mice (in blue) were implanted
with either a DHT-filled (filled
bar) or an empty silastic tube
(empty bar), or orchidectomized
(striped bar) at P75, and the
seminal vesicle weight was
measured at P120. DHT-treated
WT mice showed 19% increase in
seminal vesicle weight
(156±10.6mg, p=0.042) compared
with control WT mice
(132.1±6.4mg). In SOD1 mice,
DHT-filled silastic tube also
increased the seminal vesicle
weight by 38% (146.1±5.5mg,
p=0.0003) compared with control
SOD1 mice (105.8±4.6mg).
Conversely, orchidectomy
decreased the seminal vesicle
weight in both WT mice
(28.4±13mg, p<0.0001) and
SOD1 mice (20.8±3.5mg, p<0.0001) compared with the control mice. SOD1 control
mice showed 20% reduced seminal vesicle weight compared with WT control mice
(p=0.0039). Sample size is indicated in ( ) for each group. Data are mean ± SEM.
** p<0.01, ***p<0.001 (compared with control SOD1 mice), # p<0.05, ### p<0.001
(compared with age-matched WT mice); two-tailed, equal variance Student’s t test.
B: Representative pictures of the seminal vesicles at P120 after implanting a DHT-
filled or an empty silastic tube to WT mice or SOD1 mice. Increased size of the
seminal vesicle after DHT-treatment was observed in both WT and SOD1 mice.
C: The seminal vesicles from an orchidectomized WT (orchidectomy performed at
P75) and a control WT at P120 is shown. Drastic reduction on seminal vesicle size
in the orchidectomized WT mice was observed compared with the control WT mice.
Scale bar= 5mm.
71
postnatal day 120 (P120). Compared to a direct measurement of DHT concentration
in serum, which can be affected by anesthesia and stress during blood collection
(Oyama et al., 1977; Knol, 1991), measuring the seminal vesicle weight is a sensitive,
albeit indirect, way to assess an androgen level (Yin et al., 2003; Axell et al., 2006).
As shown in Fig. 3-1A and B, DHT-treated wild-type mice showed about 20%
increased seminal vesicle weight compared with control wild-type mice. To further
examine the sensitivity of seminal vesicle weight to different androgen concentration,
we attempted to decrease androgen concentration by performing orchidectomy in
wild-type mice, and checked whether the seminal vesicle weight decreases. After
removing both testicles that generate androgens at P75, we found about an 80%
reduction in seminal vesicle weight in wild-type mice at P120 (Fig. 3-1A and C).

Since it was reported that ALS patients show a lower level of bioavailable
form of testosterone compared with a non-ALS control group (Militello et al., 2002),
we examined whether the seminal vesicle mass of SOD1 mice is smaller than wild-
type mice. As shown in Fig. 3-1A and B, SOD1 mice showed a 20% lower seminal
vesicle weight compared with age-matched wild-type mice (SOD1: 105.8±4.6mg,
WT: 132.1±6.3mg, p=0.0039), which suggests a lower androgen level in SOD1 mice
compared with wild-type mice. DHT-filled silastic tube was able to increase the
seminal vesicle weight in SOD1 mice by 38% at P120, which reflects a successful
administration of DHT in SOD1 mice (SOD1+DHT: 146.1±5.5mg, SOD1:
105.8±4.6mg, p=0.0003, Fig. 3-1A and B). Conversely, orchidectomy in SOD1
72
mice led to an 80% reduction in seminal vesicle weight compared with control SOD1
mice (SOD1+Orx.: 20.8±3.5mg, p=0.0000012, Fig. 3-1A). By comparing the
increase in seminal vesicle weight between SOD1 mice and wild-type mice after the
DHT implant, we found that SOD1 mice showed a twice more increase rate in
seminal vesicle weight compared with wild-type mice upon DHT treatment (38% vs.
19% in SOD1 vs. wild-type mice, respectively). It is possible that slight deficiency
in androgen concentration makes SOD1 mice more sensitive to DHT treatment.
Taken together, we concluded that measuring the weight of seminal vesicle can be
used as an indicator to estimate DHT concentration, and confirmed that the DHT
implants can successively release DHT in SOD1 mice. As a confirmation of
successful DHT administration, the seminal vesicle weight was measured when mice
were sacrificed for the following experiments.

DHT attenuates skeletal muscle atrophy in SOD1 mice.
To examine whether DHT can attenuate skeletal muscle atrophy in SOD1 mice, we
measured the weight of gastrocnemius (GN) and tibialis anterior (TA), which are
vulnerable muscles in ALS (Frey et al., 2000; Atkin et al., 2005; Pun et al., 2006;
Hegedus et al., 2007). The muscle atrophy in GN and TA muscle was found in
SOD1 mice at P120 by showing 44% and 49% decreased muscle weight,
respectively, compared with age-matched wild-type mice (Fig. 3-2A and B). DHT
treatment increased the GN muscle weight by 32% (SOD1+DHT: 147.5±4.5 mg,
SOD1: 111.4±6.6mg, p=0.00017, Fig.3-2A), and TA muscle weight by 43% in
73

Figure 3-2: DHT increases
whereas orchidectomy decreases
the weight of hindlimb muscles
in SOD1 mice.

A: SOD1 mice were implanted
with either a DHT-filled or an
empty silastic tube, or
orchidectomized at P75. The
gastrocnemius muscle (GN)
weight was measured at P120.
DHT increased the GN weight by
32% (147.5±4.5mg, p=0.00017),
whereas orchidectomy decreased
it by 25% (83.4±5.7mg, p=0.0086)
in SOD1 mice compared with
control SOD1 mice
(111.4±6.6mg).
B: The weight of tibialsi anterior
muscle (TA) was measured at
P120 after implanting a DHT-
filled or empty silastic tube
implant, or orchidectomy at P75.
DHT increased the TA weight by
43% (46.3±2.5mg, p=0.0017),
whereas orchidectomy decreased
it by 22% (25.2±2.4mg, p=0.05)
in SOD1 mice compared with
control SOD1 mice (32.5±2.4mg).
Sample size is indicated in ( ) for
each group. Data are mean ± SEM. ** p<0.01, ***p<0.001 (compared with control
SOD1 mice), ## p<0.01, ### p<0.01 (compared with age-matched WT mice); two-
tailed, equal variance Student’s t test.
C: DHT-treated SOD1 mice (n=16) showed heavier body weight compared with
control SOD1 mice (n=20), although it was still lower than the weight of WT mice
(n=15) throughout the all time points. p<0.001; two-tailed, equal variance paired t-
test.
74
SOD1 mice (SOD1+DHT: 46.3±2.4 mg, SOD1: 32.5±2.5mg, p=0.0017, Fig. 3-2 B).
Conversely, orchidectomized SOD1 mice with a low level of androgen concentration
showed a decrease in the muscle weight of GN and TA by 25% and 22%,
respectively (SOD1+Orx: GN, 83.4±5.7mg; TA, 25.2±2.4mg, Fig. 3-2 A, B). To
further examine whether increased muscle weight through a DHT implant is
reflected as the increase in body weight, we measured the body weight of SOD1
mice. As shown in Fig. 3-2C, DHT-treated SOD1 mice showed heavier body
weights compared with control SOD1 mice, although it was not able to be rescued to
the level of wild-type mice (p=0.0125). DHT-treated SOD1 mice showed 6% and
7.5% heavier body weights compared with control SOD1 mice at P90 and P120,
respectively. In summary, we found that DHT can alleviate the loss of skeletal
muscle weight and body weight in SOD1 mice, which are prominent pathological
features of ALS.

DHT improves muscle strength in SOD1 mice.
Increased muscle mass mediated by androgens has been shown to be correlated with
the increased muscle strength (Bhasin et al., 1996; Storer et al., 2003; Ottenbacher et
al., 2006). Therefore, we examined whether increased muscle mass through DHT
treatment in SOD1 mice can enhance muscle strength. To assess muscle strength,
we used the grip-strength meter, which measures the maximum tension generated by
the grip of mouse on a special pull bar. As shown in Fig. 3-3, SOD1 mice exhibited
40% reduced grip-strength compared with wild-type mice at P90, and the grip-
75

Figure 3-3: DHT improves muscle strength in SOD1 mice.

SOD1 mice were implanted with either a DHT-filled or an empty silastic tube at P75.
The grip-strength meter was used to assess the muscle strength, and the maximum
tension generated by the grip of a mouse on the pull bar was recorded. SOD1 mice
(in black, empty square, n=20) exhibited diminished grip-strength compared with
WT mice (in blue, filled circle, n=15) throughout the all time points examined. DHT-
treated SOD1 mice (in back, filled square, n=17) showed stronger grip-strength
compared with control SOD1 mice, and the gap between this two groups gradually
increased as age advances. p<0.001; 2-way ANOVA.

76
strength was gradually weakened to reach only 20% of wild-type grip-strength at
P120. DHT treatment improved grip-strength in SOD1 mice, which showed
approximately 20% stronger grip-strength at P90 and 200% stronger grip-strength at
P120 compared to control SOD1 mice (Fig. 3-3).

DHT increases the expression of insulin-like growth factor (IGF) -1 and -2 in
skeletal muscle of SOD1 mice.
Increased skeletal muscle mass through androgen is known to be mediated by
insulin-like growth factor (IGF-1), which induces myoblast proliferation,
differentiation, and muscle hypertrophy (Lalani et al., 2000; Musaro et al., 2001;
Grounds, 2002; Glass, 2003). In fact, IGF-1 and IGF-2 prevent muscle atrophy and
improve muscle health in a mouse model of muscular dystrophy (Smith et al., 2000;
Barton et al., 2002). To examine whether DHT increases the gene expression of
IGF-1 in the skeletal muscle of SOD1 mice, we performed quantitative RT-PCR. As
shown in Fig. 3-4, DHT increased the expression of IGF-1 by about 4-fold in TA
muscle compared with control SOD1 mice (p=0.0261, Fig. 3-4A, and quantified in
B). Similarly, we found that the expression level of IGF-2, which plays a similar
role in muscle to IGF-1 (Florini et al., 1991; Stewart and Rotwein, 1996; Smith et al.,
2000), was also increased by about 2-fold in DHT-treated SOD1 mice compared
with control SOD1 mice (p=0.015, Fig. 3-4A, and quantified in B). In summary,
DHT increased the expression level of IGF-1 and IGF-2 in the skeletal muscle of
77

Figure 3-4: DHT increases the expression of insulin-like growth factor (IGF) -1
and -2 in SOD1 mice.

A: SOD1 mice were implanted with either a DHT-filled or an empty silastic tube at
P75, and the TA muscle was collected at P120 to check the expression of IGF-1 and
IGF-2 through quantitative RT-PCR. The representative bands of PCR products of
IGF-1 and IGF-2 were separated in an agarose gel to visualize the bands.
B: The mRNA expression level of IGF-1 or IGF-2 was normalized to the expression
level of actin to compare the gene expression in an equal loading of cDNA. DHT-
treated SOD1 mice (filled bar, n=4) showed increased expression of IGF-1 and IGF-
2, by approximately 4-fold, and 2-fold, respectively, compared with control SOD1
mice (empty bar, n=3). *p <0.05; two-tailed, equal variance Student’s t test.

78
SOD1 mice, and this increase might be the underlying mechanism for improved
muscle mass in SOD1 mice.

DHT improves the neuromuscular junction (NMJ) innervation in SOD1 mice.
In addition to muscle atrophy, denervation at the NMJs is a prominent symptom
found in skeletal muscle of ALS (Frey et al., 2000; Fischer et al., 2004). Before we
investigate the effect of DHT on NMJs, we generated double transgenic mice,
SOD1/YFP, which express fluorescent protein in all nerves to avoid any ambiguity
caused by unsuccessful staining. It has been reported that this double transgenic
does not elicit any changes in disease onset and progression in SOD1 mice (Schaefer
et al., 2005). When a pre-synaptic nerve terminal (in green) overlaps with the post-
synaptic acetylcholine receptor (AChR, in red) stained with anti-α-bungarotoxin (α-
BTX), we define that NMJ as an “innervated NMJ” (Fig. 3-5A d). However, if a
nerve terminal is partially overlapped with AChR, or is completely absent, leaving
only AChR, we defined that NMJ as a “partially innervated NMJ” (Fig. 3-5A e) or a
“denervated NMJ” (Fig. 3-5A f), respectively. For a blinded analysis, a treatment
was coded by one investigator, and another investigator examined 400~500 NMJs
per each muscle for NMJ quantification without knowing to which group a particular
animal belonged. As shown in Fig. 3-5A and B, SOD1/YFP mice showed a 77%
denervated or partially innervated NMJs in TA muscle at P120, which is in sharp
contrast to WT/YFP mice that showed almost 100% innervated NMJs (innervated
NMJs: 99.7±0.002%, partially innervated NMJs: 0.002±0.002%;
79

Figure 3-5: DHT improves the neuromuscular junction (NMJ) innervation in
SOD1 mice.

For an easier observation of NMJs, we obtained the SOD1/YFP double transgenic
mice by cross-breeding the SOD1 mice to mice of equal background expressing
yellow fluorescence protein (YFP) in all motoneurons (thy1-YFP) (Feng et al., 2000).
SOD1/YFP mice were orchidectomized or implanted with either a DHT-filled or an
empty silastic tube at P75, and the TA muscle and the diaphragm (DIA) muscle were
collected at P120, and stained with anti-bungarotoxin to label post-synaptic
acetylcholine receptors (AChRs). To check the NMJ innervation, whole muscle was
teased, and 400~500 NMJs per muscle were observed under a fluorescent
microscope. When a pre-synaptic nerve terminal (in green) overlaps the post-
synaptic AChRs (in red), the NMJ is termed as an “innervated NMJ (d)”. When the
nerve terminal is partially overlapped with AChR, or is completely absent, we
defined that NMJ as a “partially innervated NMJ (e)” or a “denervated NMJ (f)”,
respectively.
A: DHT-treated SOD1/YFP mice (b) showed improved NMJ innervation in the TA
muscle compared with the control SOD1/YFP mice. Orchidectomized SOD1/YFP
mice (c) showed more denervation compared with SOD1/YFP mice in TA muscle.
B: Quantification of NMJs at P120 in the TA muscle of DHT-treated (n=4, filled
bars), control SOD1/YFP mice (n=5, empty bars), and orchidectomized SOD1/YFP
mice (n=4, stripped bars) is shown. Compared to SOD1/YFP mice, which showed
only 22.3±5.7% of innervated NMJs, DHT-treated SOD1/YFP mice showed
47.3±14.1% of innervated NMJs. Orchidectomized SOD1/YFP mice showed only
6.6±2.2% of innervated NMJs.
C: Quantification of NMJs at P120 in the DIA muscle of DHT-treated (n=3, filled
bars), and control SOD1/YFP mice (n=5, empty bars) is shown. Compared to
SOD1/YFP mice, which showed 65.2±5% of innervated NMJs, DHT-treated
SOD1/YFP mice showed 81±4.5% of innervated NMJs. Data are mean ± SEM. *p
<0.05; two-tailed, equal variance Student’s t test.
80
81
Figure 3-5: continued

denervated NMJs: 0.0009±0.001%, n=3, data not shown in a figure). DHT treatment
increased the innervated NMJs by 2-fold, whereas decreased the denervated NMJs
by 56% in TA muscle at P120 (p=0.059, p=0.02, respectively, Fig. 3-5B).
Orchidectomized SOD1/YFP mice showed about 70% less innervated NMJs but
about 20% more denervated NMJs in TA muscle compared with the control
SOD1/YFP mice (p=0.058, p=0.12, respectively, Fig. 3-5A c, and B). We further
examined the diaphragm muscle (DIA) because denervation in this muscle causes
respiration failures in ALS patients (Braun, 1987). As shown in Fig. 3-5C, DHT-
treated SOD1/YFP mice exhibited a 24% increase in the innervated NMJs, whereas a
64% decrease in denervated NMJs compared with control SOD1/YFP mice at P120
(p=0.0039, p=0.014, respectively). Taken together, DHT improves the innervation
of NMJs in both TA and DIA muscles.

DHT ameliorates axonal degeneration in SOD1 mice.
To further examine whether the beneficial effect of DHT at the NMJs is
accompanied by improved morphology in nerves, we checked the phrenic nerve at
the entry of DIA muscle. In SOD1 mice, we found there was about a 40% loss in
myelinated axons in phrenic nerves compared with wild-type mice at P120
[SOD1:184.6±10.9, WT: 313±11.5, p=0.0003 (Fig. 3-6A and B)], which indicates
axonal degeneration in SOD1 mice. Compared with control SOD1 mice, DHT-
treated SOD1 mice exhibited 26% more myelinated axons in phrenic nerves
[SOD1+DHT: 232.3±16.8, p=0.0425 (Fig. 3-6A and B)].
82

Figure 3-6: DHT attenuates axonal loss in the phrenic nerve of SOD1 mice.

A: SOD1 mice were implanted with either a DHT-filled or an empty silastic
(control) tube at P75, and the phrenic nerve attached to the DIA muscle was
collected at P120. The phrenic nerve at the entry of skeletal muscle was sectioned to
observe myelinated axons. Representative pictures of the phrenic nerve from WT,
control SOD1, and DHT-treated SOD1 mice are shown.
B: Quantification of myelinated axon number in the phrenic nerves at P120 is shown.
The number of myelinated axons in the phrenic nerve of SOD1 mice (184.6±10.9,
n=5) is about 40% less compared with WT mice (313±11.5, n=3, p=0.0003). DHT-
treated SOD1 mice showed 26% more myelinated axon number (232.3±16.8, n=4,
p=0.0425) compared with control SOD1 mice. Data are mean ± SEM. *p <0.05
(compared with control SOD1 mice), ### p<0.001 (compared with WT mice); two-
tailed, equal variance Student’s t test.
83

Figure 3-7: DHT ameliorates axonal loss in the ventral root of the spinal cord in
SOD1 mice.

A: SOD1 mice were orchidectomized or implanted with either a DHT-filled or an
empty silastic (control) tube at P75, and the ventral root of the spinal cord lumbar 4
segment was collected at P120. Representative cross-sectional pictures of the ventral
roots in WT, control SOD1 mice, DHT-treated SOD1 mice, and orchidectomized
SOD1 mice are shown.
B: Quantification of myelinated axon number in the ventral root of the lumbar 4
spinal cord at P120 is shown. The total number of myelinated axons in SOD1 mice
(691.2±43.6, n=6) is about 30% less compared with that in WT mice (996.5±58.5,
n=6, p=0.0012). Orchidectomized SOD1 mice showed further a 20% reduction in
total myelinated axon number compared with control SOD1 mice (622.3±29.6, n=3,
p=0.01). Compared with control SOD1 mice, DHT-treated SOD1 showed 24% more
total myelinated axon number (859.6±53.4, n=6, p=0.013). Especially, the number
of the large caliber axons ( ≥4µm) were 43% less in SOD1 mice (404.2±31.1, n=6)
compared with WT mice (706.5±51.6, n=6, p=0.0005). DHT-treated SOD1 mice
showed 36% more large caliber axons ( ≥4µm) (547.8±22.2, n=6, p=0.006) compared
with control SOD1 mice. Data are mean ± SEM. *p <0.05, ** p<0.01 (compared
with the total myelinated axon numbers in SOD1 control), ##p <0.01, ### p<0.001
(compared with the number of large caliber axons in SOD1 control); two-tailed,
equal variance Student’s t test.
84
To observe the effect of DHT in nerves innervating hindlimb muscles, we checked
the myelinated axon number in the ventral root of the lumbar spinal cord. In SOD1
mice, about a 30% decrease in the total number of myelinated axons was observed at
the ventral root of L4 compared with age-matched wild-type mice at P120 [SOD1:
691.2±43.6, WT: 996.5±58.5, p=0.0012 (Fig. 3-7A and B)]. It has been reported that
large caliber axons are preferentially affected by ALS (Kawamura et al., 1981;
Sobue et al, 1981), and, indeed, we found a 43% reduction in the number of large
caliber axons in SOD1 mice compared with wild-type mice [SOD: 404.2±31.1, WT:
706.5±51.6, p=0.0005 (Fig. 3-7B)]. Compared with control SOD1 mice, there were
22% more total myelinated axons [SOD1+DHT: 859.6±53.4, SOD1: 691.2±43.6,
p=0.0133(Fig. 3-7A and B)], and 36% more large caliber axons in DHT-treated
SOD1 mice at P120 [SOD1+DHT: 547.8±22.2, SOD: 404.2±31.1, p=0.0037 (Fig. 3-
7 B)]. Conversely, orchidectomized SOD1 mice showed a 20% less number of total
myelinated axons compared with control SOD1 mice [SOD1+Orx.: 622.3±29.6,
p=0.01 (Fig. 3-7A and B)]. Although orchidectomized SOD1 mice showed the
similar number of large caliber axons to control SOD1 mice (394.7±37.5), there was
a 22% less number of small caliber axons in orchidectomized SOD1 mice
(227.7±15.6, p=0.045). In summary, we found that DHT attenuates the loss of
myelinated axons, preferentially the axons with the large caliber, in nerves of SOD1
mice. In addition, we found that reduced level of androgens through orchidectomy
aggravates the axonal loss in SOD1 mice.

85

DHT improves motoneuron survival in SOD1 mice.
To examine whether DHT protects motoneuron survival in SOD1 mice, we labeled
the spinal cord sections with a choline acetyltransferase (ChAT) antibody to
visualize motoneurons. We found about a 40% reduction in the number of
motoneurons in the lumbar spinal cord (L3~L5) of SOD1 mice compared with wild-
type mice at P120 (p=0.000047, Fig. 3-8B). Compared with control SOD1 mice,
DHT-treated SOD1 mice showed 27% more motoneurons in the lumbar spinal cord
[SOD1:13.9±0.7, SOD1+DHT: 17.7±0.8, p=0.0093 (Fig. 3-8A and B)]. In the
cervical spinal cord, which contains motoneurons innervating the DIA muscle, we
also found 18% more motoneurons in DHT-treated SOD1 compared with control
SOD1 mice [SOD1+DHT: 19.9±0.4, SOD1: 16.8±0.7, p=0.467 (Fig. 3-8 B)].

DHT improves motor performances and survival in SOD1 mice
To determine whether the improved histological characteristics in DHT-treated
SOD1 mice are accompanied by functional improvement, we tested the effects of
DHT treatment on motor function and survival in SOD1 mice. To assess motor
function, we employed the rota-rod analysis, which requires both balance and
strength in limbs to stay on the rotating rod. Although both DHT-treated and control
SOD1 mice showed a similar decline of motor function as assessed by the rota-rod
test, the gap between two groups increased as disease progressed (Fig.3-9A). DHT-
treated SOD1 mice stayed 40% longer on the rotating rod compared to control SOD1
mice at P140 (Fig. 3-9A, p=0.043, 2-way ANOVA).
86

Figure 3-8: DHT improves motoneuron survival in SOD1 mice.

A: SOD1 mice were implanted with either a DHT-filled or an empty silastic
(control) tube at P75, and the lumbar spinal cord (L) 3~L5 was collected at P120.
Cross-sectional pictures of the hemi-spinal cord in WT, control SOD1 mice, and
DHT-treated SOD1 mice are shown.
B: We found 41% reduction in motoneuron number in the L3~L5 of SOD1 mice
(13.9.±0.7, n=5) compared with age-matched WT mice (23.8.±0.9, n=5, p=0.000047).
DHT-treated SOD1 mice contained 27% more motoneuron (17.7±0.8, SOD1, n=4,
p=0.0093) compared with control SOD1 mice.
In the cervical spinal cord, there were 45% less motoneurons in SOD1 mice
(16.8±0.7, n=3) compared with age-matched WT mice (30.6±1.5, n=3, p=0.015).
There were 18% more motoneurons in DHT-treated SOD1 mice (19.9±0.4, n=3,
p=0.467) compared with control SOD1 mice. Data are mean ± SEM.
**p<0.01(compared with control SOD1 mice), #p <0.05, ### p<0.001 (compared
with WT mice); two-tailed, equal variance Student’s t test.

87
Figure 3-9: DHT improves motor
performances and survival in
SOD1 mice.
88

A: SOD1 mice were implanted
with either a DHT-filled or an
empty silastic (control) tube at P75,
and their motor performance was
accessed twice a week by the rota-
rod test. A mouse was placed on
the rotating rod at 11 rpm, and the
latency until a mouse falls from the
rotating rod was recorded in second.
DHT-treated SOD1 mice (in red-
filled square, n=16) stayed longer
on the rotating rod compared with
the control SOD1 mice (in black
empty circle, n=22). p=0.043; 2-
way ANOVA. Data are mean ±
SEM.
B: For the footprint analysis,
hindlimbs were placed into non-
toxic paints and a mouse was
allowed to walk on a 50 cm- length
of paper, and its continuous
locomotion was recorded.
Representative footprints obtained
from DHT-implanted or empty
tube-implanted SOD1 mice at P100
are shown. DHT-treated SOD1
mouse (top panel) showed longer
stride length compared with the
control SOD1 mice (bottom panel).
C: Stride length was quantified by
dividing walking distance by the
number of the steps taken within the
measured walking distance. DHT-
treated SOD1 mice (in red-filled
square, n=6) showed longer stride
length compared with the control
SOD1 mice (in black empty circle, n=7). p<0.0001; 2-way ANOVA. D: DHT-
treated SOD1 mice showed significantly increased survival by 8 days (in red,
157.9±2.9 days, n=18) compared with the control SOD1 mice (in black, 149.8±2.2
days, n=24). p=0.0174; Keplan-Meier survival analysis.
As an alternative way to examine whether DHT can improve motor function in
SOD1 mice, the footprint analysis was also performed. SOD1 mice’ paws were
placed into non-toxic paints and allowed to walk on a piece of 50cm- long paper.
The measurement of stride length has been used to detect impaired motor behavior
(Klapdor et al., 1997; Wooley et al., 2005). As shown in Fig. 3-9B, a DHT-treated
SOD1 mouse displayed a longer stride length compared with the littermate control
SOD1 mouse at P100. Quantified stride length data shows that DHT-implanted
SOD1 mice displayed a longer stride length compared with control SOD1 mice at
most of the time during disease progression (p <0.0001; 2-way ANOVA, Fig. 3-9C).

Furthermore, we found that DHT-treated SOD1 mice showed a slight, but
significant increase in survival by 5% (157.9±2.9 days, n=18, mean± SEM), as
compared to control SOD1 mice (149.8±2.2 days, n=24, mean± SEM) (Keplan-
Meier survival analysis, p=0.0174, Fig. 3-9 D). In summary, DHT treatment delays
motor dysfunction as assessed by the rota-rod, grip-strength, and foot-print analyses,
and furthermore DHT extends lifespan in SOD1 mice.

3.4 Discussion
The present study demonstrated that DHT ameliorates the pathological features
found in skeletal muscle, axons, and motoneurons in SOD1 mice, and these
improved morphology was associated with the improved motor behavior and
extended lifespan. Considering the fact that there is no available drug for ALS
89
patients to improve motor function, the effect of DHT in alleviating functional defect
might exert a significant benefit to patients who are suffering from progressive
muscle weakness.

The anabolic effect of DHT on skeletal muscle
Muscle atrophy and weakness are the early clinical symptoms found in ALS, but
currently there is no treatment to delay these clinical symptoms. The study showing
that increased motoneuron survival and improved motor function can be separate
processes (Gould et al., 2006; Suzuki et al., 2007a), urges us to find a potential drug
to target muscle symptoms in addition to target motoneuron. Androgens are well
known for the anabolic effect in increasing muscle size (Bhasin et al., 1996, 2001;
Sinha-Hikim et al., 2002, 2003). Increased androgen level through DHT treatment in
SOD1 mice was associated with ameliorated muscle atrophy and improved muscle
strength, which might be applicable to ALS patients. Conversely, reduced androgen
level via orchidectomy caused further muscle atrophy in SOD1 mice, supporting the
anabolic effect of androgens.

One of the underlying mechanisms involved in androgen-mediated muscle
growth is through the upregulation of IGF-1 (Urban et al., 1995; Hobbs et al., 1993).
Muscle-specific overexpression of IGF-1 markedly increases muscle size (Musaro et
al., 2001). Since DHT-treatment in SOD1 mice induced upregulation of IGF-1
expression in skeletal muscle, it is possible that the ameliorated muscle atrophy in
90
DHT-treated SOD1 mice is mediated through IGF-1 and its downstream signaling
pathways including phosphatidylinositol 3-kinase (PI3K)/ Akt/ mTOR kinase
cascade, which leads to muscle growth (Rommel et al., 2001; Glass, 2003)

Muscle-derived IGF-1 as a trophic source to motoneurons
IGF-1 has been shown the most potent effect among many trophic factors in delaying
disease progression and increasing survival (Kasper et al., 2003; Nagano et al., 2005).
The enhanced expression of IGF-1 in skeletal muscle can have a significant meaning
in consideration of translational studies to patients. Compared to the preclinical
studies utilizing viral vectors encoding trophic factor genes for an efficient and
prolonged supply, using viral vectors to deliver trophic factors cannot be easily
translated to patients due to many difficulties regarding gene therapy. Although
direct injection of IGF-1 is a possible option, survival was not increased through this
approach probably due to a short half-life of protein (Borasio et al., 1998; Mitchell et
al., 2002). Moderate success has been made through an intrathecal administration of
IGF-1 to patients, but repetitive invasive injections in the spinal cord are required for
a chronic delivery of IGF-1 (Nagano et al., 2005). Based on our study showing
enhanced expression of IGF-1 in SOD1 mice upon DHT treatment, DHT treatment
might be an indirect but relatively non-invasive way to increase endogenous IGF-1
expression at least in muscle although it is not tested whether IGF-1 expression is
increased in other cell types as well. The increase of IGF-1 in muscle needs to be
retrogradely transported to motoneurons to promote neuronal survival. In fact, there
91
was a report showing that muscle-derived, but not centrally delivered GDNF benefits
SOD1 mice (Li et al., 2007). Overexpressed GDNF in muscle, but not in astrocyte
increased the survival of motoneurons, and delayed onset and disease progression in
SOD1 mice (Li et al., 2007). Therefore, it is likely that there is an additional benefit
through the retrograde transport, and it is possible that muscle-derived trophic factors
can affect other non-neuronal cell types implicated in ALS in addition to
motoneurons, and thus exerts better effects through non-cell autonomous mechanism
of ALS.
In summary, DHT-mediated increase of endogenous IGF-1 expression in
muscle might be desirable because it avoids the difficulties required for an efficient
and chronic drug delivery. The increase in IGF-1 in muscle might contribute to
attenuate muscle atrophy, and benefit motoneuron survival as well through the
retrograde transport, which may lead to more systemic beneficial effect in delaying
disease progression.

The neuroprotective effect of DHT
In addition to the potential neuroprotective effect mediated by IGF-1, androgens
demonstrate effects in improving neuronal survival through AR (reviewed in Pike et
al., 2008). Motoneurons in the spinal cord express high level of ARs, and it has been
demonstrated that androgens increase motoneuron survival in several experimental
conditions (Matsumoto 1997; Yu and McGinnis, 2001; Pozzi et al., 2003).
Androgens increase motoneuron survival rate from 50% to 90% after nerve injury in
92
the avian embryonic lumbar spinal cord (Gould et al., 1999). Similarly, increased
motoneuron survival through androgen treatment was observed in organotopic
culture of the spinal cord (Hauser and Toran-Allerand, 1989), and in neuroblastoma
and motoneuron hybrid cells (Brooks et al., 1998). It is interesting to note that the
ventral horn of the spinal cord express high level of 5-α reductase (Pozzi et al., 2003;
Poletti et al., 2004), which converts testosterone into DHT. Therefore, it is possible
that improved neuronal survival in motoneurons is mediated by DHT in the spinal
cord, and we demonstrated that DHT treatment increases the survival of
motoneurons in the spinal cord of SOD1 mice.

The neuroprotective role of androgens seem to contribute in increasing
lifespan because improved skeletal muscle morphology and motor function, which
failed to increase motoneuron survival, did not demonstrated the prolonged lifespan
in SOD1 mice (Millet et al., 2006; Morrison et al., 2009). Although it is not studied
in the present study whether the improved motoneuron survival is mediated through
DHT and its receptor, AR, or through the muscle-derived IGF-1 and its receptor,
IGF-1R, or both, these mechanisms may converge to increase motoneuron survival.
Therefore, DHT treatment might be a good strategy to improve motoneuron survival
through several possible pathways such as AR-mediated signaling cascades
including PI3K/Akt and mitogen-activated protein kinase (MAPK)/extracellular
signal-regulated protein kinase (ERK) cascades, which promote cell survival (Pike et
al., 2008). Because IGF-1 treatments activate Akt in the spinal cord of SOD1 mice
93
(Kasper et al., 2003), both AR- and IGF-1R-mediated signaling cascades may
converge to activate Akt, a pro-survival signal in motoneurons after DHT treatment.

In addition to the effect on motoneuron survival, testosterone increases
regeneration rate in axons after peripheral nerve injury caused by axotomy (reviewed
in Fargo et al., 2008). So, improved NMJ innervation in hindlimb of DHT-treated
SOD1 mice might be mediated through the protective effect of DHT on axonal
regeneration. More myelinated axon number observed in the nerves of DHT-treated
SOD1 mice is also possibly mediated by DHT-induced axonal regeneration that
might counteract the dying-back axonal degeneration. Conversely, reduced
androgen level through orchidectomy led to further loss of myelinated axon number
in the ventral root of the lumbar spinal cord in SOD1 mice. It is interesting to note
that there was a decrease in a number of the small caliber axons rather than the large
caliber axons in orchidectomized SOD1 mice compared with control SOD1 mice. It
is possible that reduced androgen concentration decreased the axonal sprouting, so
there are less small caliber axons that are newly formed. The aggravated axonal loss
in orchidectomized SOD1 mice was also associated with more denervated NMJs in
hindlimb muscle, suggesting a positive correlation with androgen concentration with
the neuroprotective effect in SOD1 mice.

Taken together, improved morphological phenotype in skeletal muscle, axons,
and motoneurons observed in DHT-treated SOD1 mice might be mediated by a
94
neuroprotective effect of DHT through AR in addition the muscle-derived IGF-1
induced by DHT. Although molecular mechanisms are still remain to be answered,
due to the beneficial effect of DHT on multiple cell types, DHT might be a potential
candidate as a multi-systemic drug for ALS involving neuronal and non-neuronal
cells in disease progression.

Translational study
Our current study provides an initial step toward a possible therapy for ALS through
DHT treatment. However, there are several concerns regarding adverse side effects
of chronic DHT treatment. As DHT has known to increase the incidence of benign
prostate hyperplasia due to the proliferative activity in the prostate (Tenover, 1991),
alternative androgens that have almost no effect on prostate such as selective
androgen receptor modulators (SARMs) (Omwancha and Brown, 2006) can be tested
to see whether it can replicate the effects of DHT in ALS, without no adverse effect
on prostate. Since ALS is a progressive disease that cause death mostly within 2-3
years, if the side effect is minor with DHT or SARMs, these treatments might be
tolerable.

95
Chapter 4
General discussion: multi-systemic drugs as a new therapeutic
approach for ALS

In the present study we demonstrated beneficial effects of TSA and DHT as potential
drugs for ALS in ameliorating clinical features in multiple targets implicated in ALS.
Both TSA and DHT exert broad effects in variety of cellular events through
modifying gene transcriptions or affecting various androgen sensitive tissues,
respectively, and these properties might be responsible for their beneficial effects in
multiple cell types involved in ALS pathology.

Based on the accumulated evidence obtained through the use of transgenic
animal models of ALS, the current understanding of ALS pathogenesis is that this
disease involves motoneurons as well as their non-neuronal neighbors (reviewed in
Boillee et al., 2006). Insertion of the disease-causing gene, mutant SOD1, in a single
cell type demonstrated that the disease cannot be initiated by defects in a single cell
type. Conversely, reducing or deleting mutant SOD1 in each cell type revealed that
mutant SOD1 in motoneurons decides when to initiate degeneration, while its
expression in glial cells determines how fast the degeneration will progress. It is
possible that degenerating motoneurons caused by mutant SOD1-induced toxicity
release cytokines and unidentified toxic factors that can subsequently affect the
neighboring glial cells. Glial cells might, in turn, release reactive oxygen species,
96
inflammatory cytokines like TNF-α , and further aggravate motoneuron degeneration.
Otherwise, mutant SOD1 expressing glial cells might release neurotoxic substances
first, and degenerate motoneurons. Considering the fact that astrocytes are tightly
communicating to each other through the gap junctions (Seifert et al., 1996), and that
activated microglia can propagate degeneration by releasing toxic cytokines to
surrounding microglia (Sargsyan et al., 2005), defective cellular conditions in glial
cells might easily influence neighboring glial cells. These properties in glial cell
might explain why the focal degeneration in motoneurons spread out to neighboring
areas in ALS (Rowland, 2003). Due to the vicinity of motoneurons and glial cells,
the cross-talk among these cell types is likely to accelerate disease progression.
Therefore, a therapy that can positively modify both neurons and glial cells may
effectively slow down the disease progression in ALS.

TSA and other HDAC inhibitors are extensively used in preclinical and
clinical trials for many neurodegenerative diseases including spinal muscular atrophy,
Huntington’s disease, Parkinson’s disease (reviewed in Hahnen et al., 2008). The
neuroprotective effect of TSA is partly mediated through transcription modifications,
which increase beneficial gene expressions whereas decrease pro-apoptotic gene
expressions that lead to improved neuronal survival (Avila et al., 2007; Camelo et al.,
2005). In addition, HDAC inhibitors including TSA reduce inflammatory responses
in glial cells upon injury or other toxic insults (Camelo et al, 2005; Kim et al., 2007;
Zhang et al., 2008). Moreover, TSA is known to induce the GLT-1 expression in
97
astrocytes, which contributes to reduce the glutamate-mediated excitotoxicity that
seems to play a significant role in ALS pathogenesis (Wu et al., 2008a). In SOD1
transgenic mice, a mouse model of ALS, we found that TSA, indeed, increases
neuronal survival and reduces inflammatory responses in glial cells reflected by less
astrogliosis and microgliosis. In addition, TSA enhanced the expression of GLT-1 in
the spinal cord of SOD1 transgenic mice, which can also contribute to increase
motoneuron survival through reducing excitotoxicity. All these improved
characteristics in neurons and glial cells through TSA treatment might have
contributed to delay disease progression and extend lifespan of SOD1 mice.

There is a growing literature describing the beneficial effects of androgens in
promoting neuronal survival (Brooks et al., 1998; Hammond et al., 2001; reviewed
in Pike et al., 2007). Especially DHT increases survival of motoneurons in vitro
(Brooks et al., 1998; Marron et al., 2005) as well as in vivo (Gould et al., 1999).
DHT treatment in SOD1 transgenic mice increased motoneuron survival in the spinal
cord, and this was associated with delayed disease progression. Although it is not
examined whether DHT treatment reduces astrogliosis or microgliosis in SOD1
transgenic mice, it is possible that there might be less astrogliosis in DHT-treated
SOD1 mice, because testosterone prevents the upregulation of glial fibrillary acidic
protein which increases when astrogliosis occurs (Coers et al., 2002; Jones et al.,
1997). It is interesting to note that there is an association between a decreased level
of androgens and neurodegenerative diseases, such as ALS (Militello et al., 2002),
98
Alzheimer’s disease (Hogervorst et al., 2001), and Parkinson’s disease (Okun et al.,
2004), and this suggests reduced androgens might increase the susceptibility to
neurotoxic insults (Rosario and Pike, 2008). Although it is not answered whether
reduced androgen plays a role in ALS pathogenesis, increasing androgen
concentration through DHT treatment in SOD1 mice exerted neuroprotective role in
motoneuron survival, and this might have contributed to increase lifespan.

In addition to potential beneficial effects of TSA and DHT in neuronal and
neighboring glial cells, both delayed muscle atrophy and improved motor functions
in SOD1 transgenic mice. Mitigating muscle atrophy through TSA and DHT
treatments are likely mediated through follistatin and IGF-1, respectively. However,
it is also possible that improved NMJ innervation through neuroprotective effect of
drugs had indirect effect to ameliorated muscle atrophy, because NMJ denervation
contributes to progressive muscle atrophy. Although skeletal muscle may not be a
cell type that plays an active role in ALS pathogenesis (Miller et al., 2006), skeletal
muscle is an important component that can play a supportive role as a provider of
trophic factors to motoneurons. In fact, muscle atrophy might decrease the muscle-
derived trophic factors, and thus increase the risk of nerves to retract, so ameliorating
muscle atrophy might have a neuroprotective role as well.

More importantly, improved muscle size and strength through both TSA and
DHT treatments have significant implications to benefit ALS patients with their daily
99
activities that can improve their quality of life. Considering the fact that motoneuron
death and muscle dysfunction can be a separate process in ALS (Gould et al., 2006),
and that there is no effective therapy for functional impairment currently, targeting
muscle to improve muscle-related symptoms is valuable for treating functional
symptoms in ALS patients. Since we found protective effects of TSA and DHT in
muscle atrophy and motor behaviors after muscle strength is already diminished in
SOD1 transgenic mice, it is possible that these treatments might improve motor
functions in patients who already show impaired motor behaviors.

According to the evidence demonstrating neuronal and non-neuronal cells
both contribute to ALS pathology, a therapy that can target multiple cell types
involved in ALS might be more desirable than targeting motoneurons alone. The
present study provides a basis that a drug targeting multiple cell types implicated in
ALS, such as TSA and DHT, might be potent candidate drugs for ALS therapy. The
ultimate goal may be finding out the primary toxicity of ALS pathogenesis, and
targeting that particular pathway. However, with current knowledge, alleviating
degenerative cellular events in multiple cell types to slow disease progression as well
as to alleviate clinical symptoms might be a currently available option. Further
studies are needed to investigate other potential drug targets and underlying
molecular mechanisms upon TSA and DHT treatments to avoid potential side effects
and to learn about the disease mechanisms. However, since both HDAC inhibitors
and androgens are used in clinical trials in other disease conditions, we hope that the
100
current study might be relatively easy to translate into clinical trials to benefit ALS
patients with their motor functions and survival as well. Testing other HDAC
inhibitors or androgens, which are utilized in clinical studies and showing similar
properties to TSA and DHT, might facilitate to find potential drugs for ALS to
benefit patients who are currently suffering from devastating symptoms.

In conclusion, the current study provides evidence that multi-systemic drugs
such as TSA and DHT might be effective to treat ALS which involves multiple cell
types in disease pathology. We hope that this study can facilitate to develop a new
class of potential drugs targeting multiple cell types including skeletal muscle for
functional benefit, and improves the quality of life in ALS patients.

101

References

ALS CNTF Treatment Study Group (1996) A double-blind placebo-controlled clinical trial
of subcutaneous recombinant human ciliary neurotrophic factor (rHCNTF) in
amyotrophic lateral sclerosis. ALS CNTF Treatment Study Group. Neurology
46:1244-1249.
Adcock IM (2007) HDAC inhibitors as anti-inflammatory agents. Br J Pharmacol 150:829-
831.
Atkin JD, Scott RL, West JM, Lopes E, Quah AK, Cheema SS (2005) Properties of slow-
and fast-twitch muscle fibres in a mouse model of amyotrophic lateral sclerosis.
Neuromuscul Disord 15:377-388.
Avila AM, Burnett BG, Taye AA, Gabanella F, Knight MA, Hartenstein P, Cizman Z, Di
Prospero NA, Pellizzoni L, Fischbeck KH, Sumner CJ (2007) Trichostatin A
increases SMN expression and survival in a mouse model of spinal muscular
atrophy. J Clin Invest 117:659-671.
Axell AM, MacLean HE, Plant DR, Harcourt LJ, Davis JA, Jimenez M, Handelsman DJ,
Lynch GS, Zajac JD (2006) Continuous testosterone administration prevents skeletal
muscle atrophy and enhances resistance to fatigue in orchidectomized male mice.
Am J Physiol Endocrinol Metab 291:E506-516.
Azzouz M, Ralph GS, Storkebaum E, Walmsley LE, Mitrophanous KA, Kingsman SM,
Carmeliet P, Mazarakis ND (2004) VEGF delivery with retrogradely transported
lentivector prolongs survival in a mouse ALS model. Nature 429:413-417.
Barneoud P, Lolivier J, Sanger DJ, Scatton B, Moser P (1997) Quantitative motor
assessment in FALS mice: a longitudinal study. Neuroreport 8:2861-2865.
Barton ER, Morris L, Musaro A, Rosenthal N, Sweeney HL (2002) Muscle-specific
expression of insulin-like growth factor I counters muscle decline in mdx mice. J
Cell Biol 157:137-148.
Bartsch W, Knabbe C, Voigt KD (1983) Regulation and compartmentalization of androgens
in rat prostate and muscle. J Steroid Biochem 19:929-937.
Bendotti C, Carri MT (2004) Lessons from models of SOD1-linked familial ALS. Trends
Mol Med 10:393-400.

102
Bendotti C, Tortarolo M, Suchak SK, Calvaresi N, Carvelli L, Bastone A, Rizzi M, Rattray
M, Mennini T (2001) Transgenic SOD1 G93A mice develop reduced GLT-1 in
spinal cord without alterations in cerebrospinal fluid glutamate levels. J Neurochem
79:737-746.
Bensimon G, Lacomblez L, Meininger V (1994) A controlled trial of riluzole in amyotrophic
lateral sclerosis. ALS/Riluzole Study Group. N Engl J Med 330:585-591.
Bhasin S, Calof OM, Storer TW, Lee ML, Mazer NA, Jasuja R, Montori VM, Gao W,
Dalton JT (2006) Drug insight: Testosterone and selective androgen receptor
modulators as anabolic therapies for chronic illness and aging. Nat Clin Pract
Endocrinol Metab 2:146-159.
Bhasin S, Storer TW, Berman N, Callegari C, Clevenger B, Phillips J, Bunnell TJ, Tricker R,
Shirazi A, Casaburi R (1996) The effects of supraphysiologic doses of testosterone
on muscle size and strength in normal men. N Engl J Med 335:1-7.
Bhasin S, Woodhouse L, Storer TW (2001) Proof of the effect of testosterone on skeletal
muscle. J Endocrinol 170:27-38.
Blanco CE, Zhan WZ, Fang YH, Sieck GC (2001) Exogenous testosterone treatment
decreases diaphragm neuromuscular transmission failure in male rats. J Appl Physiol
90:850-856.
Bodine SC, Latres E, Baumhueter S, Lai VK, Nunez L, Clarke BA, Poueymirou WT, Panaro
FJ, Na E, Dharmarajan K, Pan ZQ, Valenzuela DM, DeChiara TM, Stitt TN,
Yancopoulos GD, Glass DJ (2001) Identification of ubiquitin ligases required for
skeletal muscle atrophy. Science 294:1704-1708.
Boillee S, Vande Velde C, Cleveland DW (2006) ALS: a disease of motor neurons and their
nonneuronal neighbors. Neuron 52:39-59.
Boillee S, Yamanaka K, Lobsiger CS, Copeland NG, Jenkins NA, Kassiotis G, Kollias G,
Cleveland DW (2006) Onset and Progression in Inherited ALS Determined by
Motor Neurons and Microglia. Science 312:1389-1392.
Borasio GD, Robberecht W, Leigh PN, Emile J, Guiloff RJ, Jerusalem F, Silani V, Vos PE,
Wokke JH, Dobbins T (1998) A placebo-controlled trial of insulin-like growth
factor-I in amyotrophic lateral sclerosis. European ALS/IGF-I Study Group.
Neurology 51:583-586.
Braun SR (1987) Respiratory system in amyotrophic lateral sclerosis. Neurol Clin 5:9-31.
Breedlove SM, Arnold AP (1980) Hormone accumulation in a sexually dimorphic motor
nucleus of the rat spinal cord. Science 210:564-566.

103
Brooks BP, Merry DE, Paulson HL, Lieberman AP, Kolson DL, Fischbeck KH (1998) A
cell culture model for androgen effects in motor neurons. J Neurochem 70:1054-
1060.
Brooks KJ, Hill MD, Hockings PD, Reid DG (2004) MRI detects early hindlimb muscle
atrophy in Gly93Ala superoxide dismutase-1 (G93A SOD1) transgenic mice, an
animal model of familial amyotrophic lateral sclerosis. NMR Biomed 17:28-32.
Bruijn LI, Houseweart MK, Kato S, Anderson KL, Anderson SD, Ohama E, Reaume AG,
Scott RW, Cleveland DW (1998) Aggregation and motor neuron toxicity of an ALS-
linked SOD1 mutant independent from wild-type SOD1. Science 281:1851-1854.
Bruijn LI, Miller TM, Cleveland DW (2004) Unraveling the mechanisms involved in motor
neuron degeneration in ALS. Annu Rev Neurosci 27:723-749.
Butler R, Bates GP (2006) Histone deacetylase inhibitors as therapeutics for polyglutamine
disorders. Nat Rev Neurosci 7:784-796.
Camelo S, Iglesias AH, Hwang D, Due B, Ryu H, Smith K, Gray SG, Imitola J, Duran G,
Assaf B, Langley B, Khoury SJ, Stephanopoulos G, De Girolami U, Ratan RR,
Ferrante RJ, Dangond F (2005) Transcriptional therapy with the histone deacetylase
inhibitor trichostatin A ameliorates experimental autoimmune encephalomyelitis. J
Neuroimmunol 164:10-21.
Carson JA, Lee WJ, McClung J, Hand GA (2002) Steroid receptor concentration in aged rat
hindlimb muscle: effect of anabolic steroid administration. J Appl Physiol 93:242-
250.
Chen PS, Wang CC, Bortner CD, Peng GS, Wu X, Pang H, Lu RB, Gean PW, Chuang DM,
Hong JS (2007) Valproic acid and other histone deacetylase inhibitors induce
microglial apoptosis and attenuate lipopolysaccharide-induced dopaminergic
neurotoxicity. Neuroscience 149:203-212.
Cheung WL, Briggs SD, Allis CD (2000) Acetylation and chromosomal functions. Curr
Opin Cell Biol 12:326-333.
Chiu AY, Zhai P, Dal Canto MC, Peters TM, Kwon YW, Prattis SM, Gurney ME (1995)
Age-dependent penetrance of disease in a transgenic mouse model of familial
amyotrophic lateral sclerosis. Mol Cell Neurosci 6:349-362.
Clement AM, Nguyen MD, Roberts EA, Garcia ML, Boillee S, Rule M, McMahon AP,
Doucette W, Siwek D, Ferrante RJ, Brown RH, Jr., Julien JP, Goldstein LS,
Cleveland DW (2003) Wild-type nonneuronal cells extend survival of SOD1 mutant
motor neurons in ALS mice. Science 302:113-117.
Cleveland DW, Rothstein JD (2001) From Charcot to Lou Gehrig: deciphering selective
motor neuron death in ALS. Nat Rev Neurosci 2:806-819.
104
Coers S, Tanzer L, Jones KJ (2002) Testosterone treatment attenuates the effects of facial
nerve transection on glial fibrillary acidic protein (GFAP) levels in the hamster
facial motor nucleus. Metab Brain Dis 17:55-63.
Cohen TJ, Barrientos T, Hartman ZC, Garvey SM, Cox GA, Yao TP (2009) The deacetylase
HDAC4 controls myocyte enhancing factor-2-dependent structural gene expression
in response to neural activity. Faseb J 23:99-106.
Cohen TJ, Waddell DS, Barrientos T, Lu Z, Feng G, Cox GA, Bodine SC, Yao TP (2007)
The histone deacetylase HDAC4 connects neural activity to muscle transcriptional
reprogramming. J Biol Chem 282:33752-33759.
Cress WD, Seto E (2000) Histone deacetylases, transcriptional control, and cancer. J Cell
Physiol 184:1-16.
Curtin BF, Tetz LM, Compton JR, Doctor BP, Gordon RK, Nambiar MP (2005) Histone
acetylase inhibitor trichostatin A induces acetylcholinesterase expression and
protects against organophosphate exposure. J Cell Biochem 96:839-849.
De Winter F, Vo T, Stam FJ, Wisman LA, Bar PR, Niclou SP, van Muiswinkel FL,
Verhaagen J (2006) The expression of the chemorepellent Semaphorin 3A is
selectively induced in terminal Schwann cells of a subset of neuromuscular synapses
that display limited anatomical plasticity and enhanced vulnerability in motor
neuron disease. Mol Cell Neurosci 32:102-117.
Dionne FT, Dube JY, Lesage RL, Tremblay RR (1979) In vivo androgen binding in rat
skeletal and perineal muscles. Acta Endocrinol (Copenh) 91:362-372.
Dobrowolny G, Aucello M, Rizzuto E, Beccafico S, Mammucari C, Boncompagni S, Belia S,
Wannenes F, Nicoletti C, Del Prete Z, Rosenthal N, Molinaro M, Protasi F, Fano G,
Sandri M, Musaro A (2008) Skeletal muscle is a primary target of SOD1G93A-
mediated toxicity. Cell Metab 8:425-436.
Dobrowolny G, Giacinti C, Pelosi L, Nicoletti C, Winn N, Barberi L, Molinaro M, Rosenthal
N, Musaro A (2005) Muscle expression of a local Igf-1 isoform protects motor
neurons in an ALS mouse model. J Cell Biol 168:193-199.
Dompierre JP, Godin JD, Charrin BC, Cordelieres FP, King SJ, Humbert S, Saudou F (2007)
Histone deacetylase 6 inhibition compensates for the transport deficit in
Huntington's disease by increasing tubulin acetylation. J Neurosci 27:3571-3583.
Dube JY, Tremblay RR, Chapdelaine P (1976) Binding of methyltrienolone to various
androgen-dependent and androgen-responsive tissues in four animal species. Horm
Res 7:333-340.

105
Dupuis L, Gonzalez de Aguilar JL, Echaniz-Laguna A, Eschbach J, Rene F, Oudart H,
Halter B, Huze C, Schaeffer L, Bouillaud F, Loeffler JP (2009) Muscle
mitochondrial uncoupling dismantles neuromuscular junction and triggers distal
degeneration of motor neurons. PLoS One 4:e5390.
Dupuis L, Loeffler JP (2009) Neuromuscular junction destruction during amyotrophic lateral
sclerosis: insights from transgenic models. Curr Opin Pharmacol 9:341-346.
Elliott JL (2001) Cytokine upregulation in a murine model of familial amyotrophic lateral
sclerosis. Brain Res Mol Brain Res 95:172-178.
Fargo KN, Galbiati M, Foecking EM, Poletti A, Jones KJ (2008) Androgen regulation of
axon growth and neurite extension in motoneurons. Horm Behav 53:716-728.
Feldman HA, Longcope C, Derby CA, Johannes CB, Araujo AB, Coviello AD, Bremner WJ,
McKinlay JB (2002) Age trends in the level of serum testosterone and other
hormones in middle-aged men: longitudinal results from the Massachusetts male
aging study. J Clin Endocrinol Metab 87:589-598.
Feng G, Mellor RH, Bernstein M, Keller-Peck C, Nguyen QT, Wallace M, Nerbonne JM,
Lichtman JW, Sanes JR (2000) Imaging neuronal subsets in transgenic mice
expressing multiple spectral variants of GFP. Neuron 28:41-51.
Finnin MS, Donigian JR, Cohen A, Richon VM, Rifkind RA, Marks PA, Breslow R,
Pavletich NP (1999) Structures of a histone deacetylase homologue bound to the
TSA and SAHA inhibitors. Nature 401:188-193.
Fischer LR, Culver DG, Tennant P, Davis AA, Wang M, Castellano-Sanchez A, Khan J,
Polak MA, Glass JD (2004) Amyotrophic lateral sclerosis is a distal axonopathy:
evidence in mice and man. Exp Neurol 185:232-240.
Florini JR, Magri KA, Ewton DZ, James PL, Grindstaff K, Rotwein PS (1991)
"Spontaneous" differentiation of skeletal myoblasts is dependent upon autocrine
secretion of insulin-like growth factor-II. J Biol Chem 266:15917-15923.
Forger NG, Hodges LL, Roberts SL, Breedlove SM (1992) Regulation of motoneuron death
in the spinal nucleus of the bulbocavernosus. J Neurobiol 23:1192-1203.
Fray AE, Ince PG, Banner SJ, Milton ID, Usher PA, Cookson MR, Shaw PJ (1998) The
expression of the glial glutamate transporter protein EAAT2 in motor neuron
disease: an immunohistochemical study. Eur J Neurosci 10:2481-2489.
Frey D, Schneider C, Xu L, Borg J, Spooren W, Caroni P (2000) Early and selective loss of
neuromuscular synapse subtypes with low sprouting competence in motoneuron
diseases. J Neurosci 20:2534-2542.

106
Gao W, Reiser PJ, Coss CC, Phelps MA, Kearbey JD, Miller DD, Dalton JT (2005)
Selective androgen receptor modulator treatment improves muscle strength and body
composition and prevents bone loss in orchidectomized rats. Endocrinology
146:4887-4897.
Gaudette M, Hirano M, Siddique T (2000) Current status of SOD1 mutations in familial
amyotrophic lateral sclerosis. Amyotroph Lateral Scler Other Motor Neuron Disord
1:83-89.
Glass DJ (2003) Molecular mechanisms modulating muscle mass. Trends Mol Med 9:344-
350.
Gong YH, Parsadanian AS, Andreeva A, Snider WD, Elliott JL (2000) Restricted expression
of G86R Cu/Zn superoxide dismutase in astrocytes results in astrocytosis but does
not cause motoneuron degeneration. J Neurosci 20:660-665.
Goshgarian HG, Rafols JA (1981) The phrenic nucleus of th albino rat: a correlative HRP
and Golgi study. J Comp Neurol 201:441-456.
Gould TW, Burek MJ, Ishihara R, Lo AC, Prevette D, Oppenheim RW (1999) Androgens
rescue avian embryonic lumbar spinal motoneurons from injury-induced but not
naturally occurring cell death. J Neurobiol 41:585-595.
Gould TW, Buss RR, Vinsant S, Prevette D, Sun W, Knudson CM, Milligan CE, Oppenheim
RW (2006) Complete dissociation of motor neuron death from motor dysfunction by
Bax deletion in a mouse model of ALS. J Neurosci 26:8774-8786.
Grounds MD (2002) Reasons for the degeneration of ageing skeletal muscle: a central role
for IGF-1 signalling. Biogerontology 3:19-24.
Grunstein M (1997) Histone acetylation in chromatin structure and transcription. Nature
389:349-352.
Gruzman A, Wood WL, Alpert E, Prasad MD, Miller RG, Rothstein JD, Bowser R,
Hamilton R, Wood TD, Cleveland DW, Lingappa VR, Liu J (2007) Common
molecular signature in SOD1 for both sporadic and familial amyotrophic lateral
sclerosis. Proc Natl Acad Sci U S A 104:12524-12529.
Gurney ME, Pu H, Chiu AY, Dal Canto MC, Polchow CY, Alexander DD, Caliendo J,
Hentati A, Kwon YW, Deng HX, et al. (1994) Motor neuron degeneration in mice
that express a human Cu,Zn superoxide dismutase mutation. Science 264:1772-1775.
Gurney ME, Cutting FB, Zhai P, Doble A, Taylor CP, Andrus PK, Hall ED (1996) Benefit
of vitamin E, riluzole, and gabapentin in a transgenic model of familial amyotrophic
lateral sclerosis. Ann Neurol 39:147-157.

107
Hahnen E, Hauke J, Trankle C, Eyupoglu IY, Wirth B, Blumcke I (2008) Histone
deacetylase inhibitors: possible implications for neurodegenerative disorders. Expert
Opin Investig Drugs 17:169-184.
Hall ED, Oostveen JA, Gurney ME (1998) Relationship of microglial and astrocytic
activation to disease onset and progression in a transgenic model of familial ALS.
Glia 23:249-256.
Hammond J, Le Q, Goodyer C, Gelfand M, Trifiro M, LeBlanc A (2001) Testosterone-
mediated neuroprotection through the androgen receptor in human primary neurons.
J Neurochem 77:1319-1326.
Harman SM, Metter EJ, Tobin JD, Pearson J, Blackman MR (2001) Longitudinal effects of
aging on serum total and free testosterone levels in healthy men. Baltimore
Longitudinal Study of Aging. J Clin Endocrinol Metab 86:724-731.
Hauser KF, Toran-Allerand CD (1989) Androgen increases the number of cells in fetal
mouse spinal cord cultures: implications for motoneuron survival. Brain Res
485:157-164.
Hegedus J, Putman CT, Gordon T (2007) Time course of preferential motor unit loss in the
SOD1 G93A mouse model of amyotrophic lateral sclerosis. Neurobiol Dis 28:154-
164.
Heiman-Patterson TD, Deitch JS, Blankenhorn EP, Erwin KL, Perreault MJ, Alexander BK,
Byers N, Toman I, Alexander GM (2005) Background and gender effects on
survival in the TgN(SOD1-G93A)1Gur mouse model of ALS. J Neurol Sci 236:1-7.
Hensley K, Floyd RA, Gordon B, Mou S, Pye QN, Stewart C, West M, Williamson K (2002)
Temporal patterns of cytokine and apoptosis-related gene expression in spinal cords
of the G93A-SOD1 mouse model of amyotrophic lateral sclerosis. J Neurochem
82:365-374.
Herbst KL, Bhasin S (2004) Testosterone action on skeletal muscle. Curr Opin Clin Nutr
Metab Care 7:271-277.
Herbst KL, Bhasin S (2004) Testosterone action on skeletal muscle. Curr Opin Clin Nutr
Metab Care 7:271-277.
Hobbs CJ, Plymate SR, Rosen CJ, Adler RA (1993) Testosterone administration increases
insulin-like growth factor-I levels in normal men. J Clin Endocrinol Metab 77:776-
779.
Hogervorst E, Williams J, Budge M, Barnetson L, Combrinck M, Smith AD (2001) Serum
total testosterone is lower in men with Alzheimer's disease. Neuro Endocrinol Lett
22:163-168.
108
Holzbaur EL, Howland DS, Weber N, Wallace K, She Y, Kwak S, Tchistiakova LA,
Murphy E, Hinson J, Karim R, Tan XY, Kelley P, McGill KC, Williams G, Hobbs C,
Doherty P, Zaleska MM, Pangalos MN, Walsh FS (2006) Myostatin inhibition slows
muscle atrophy in rodent models of amyotrophic lateral sclerosis. Neurobiol Dis
23:697-707.
Howland DS, Liu J, She Y, Goad B, Maragakis NJ, Kim B, Erickson J, Kulik J, DeVito L,
Psaltis G, DeGennaro LJ, Cleveland DW, Rothstein JD (2002) Focal loss of the
glutamate transporter EAAT2 in a transgenic rat model of SOD1 mutant-mediated
amyotrophic lateral sclerosis (ALS). Proc Natl Acad Sci U S A 99:1604-1609.
Iezzi S, Di Padova M, Serra C, Caretti G, Simone C, Maklan E, Minetti G, Zhao P, Hoffman
EP, Puri PL, Sartorelli V (2004) Deacetylase inhibitors increase muscle cell size by
promoting myoblast recruitment and fusion through induction of follistatin. Dev Cell
6:673-684.
Ince PG, Shaw PJ, Slade JY, Jones C, Hudgson P (1996) Familial amyotrophic lateral
sclerosis with a mutation in exon 4 of the Cu/Zn superoxide dismutase gene:
pathological and immunocytochemical changes. Acta Neuropathol 92:395-403.
Jones KJ (1994) Androgenic enhancement of motor neuron regeneration. Ann N Y Acad Sci
743:141-161; discussion 161-144.
Jones KJ, Kinderman NB, Oblinger MM (1997) Alterations in glial fibrillary acidic protein
(GFAP) mRNA levels in the hamster facial motor nucleus: effects of axotomy and
testosterone. Neurochem Res 22:1359-1366.
Jordan CL, Price RH, Jr., Handa RJ (2002) Androgen receptor messenger RNA and protein
in adult rat sciatic nerve: implications for site of androgen action. J Neurosci Res
69:509-518.
Kablar B, Belliveau AC (2005) Presence of neurotrophic factors in skeletal muscle correlates
with survival of spinal cord motor neurons. Dev Dyn 234:659-669.
Kaspar BK, Frost LM, Christian L, Umapathi P, Gage FH (2005) Synergy of insulin-like
growth factor-1 and exercise in amyotrophic lateral sclerosis. Ann Neurol 57:649-
655.
Kaspar BK, Llado J, Sherkat N, Rothstein JD, Gage FH (2003) Retrograde viral delivery of
IGF-1 prolongs survival in a mouse ALS model. Science 301:839-842.
Kawamura Y, Dyck PJ, Shimono M, Okazaki H, Tateishi J, Doi H (1981) Morphometric
comparison of the vulnerability of peripheral motor and sensory neurons in
amyotrophic lateral sclerosis. J Neuropathol Exp Neurol 40:667-675.

109
Kennel PF, Finiels F, Revah F, Mallet J (1996) Neuromuscular function impairment is not
caused by motor neurone loss in FALS mice: an electromyographic study.
Neuroreport 7:1427-1431.
Khan N, Jeffers M, Kumar S, Hackett C, Boldog F, Khramtsov N, Qian X, Mills E, Berghs
SC, Carey N, Finn PW, Collins LS, Tumber A, Ritchie JW, Jensen PB, Lichenstein
HS, Sehested M (2008) Determination of the class and isoform selectivity of small-
molecule histone deacetylase inhibitors. Biochem J 409:581-589.
Kim HJ, Rowe M, Ren M, Hong JS, Chen PS, Chuang DM (2007) Histone deacetylase
inhibitors exhibit anti-inflammatory and neuroprotective effects in a rat permanent
ischemic model of stroke: multiple mechanisms of action. J Pharmacol Exp Ther
321:892-901.
Klapdor K, Dulfer BG, Hammann A, Van der Staay FJ (1997) A low-cost method to analyse
footprint patterns. J Neurosci Methods 75:49-54.
Knol BW (1991) Stress and the endocrine hypothalamus-pituitary-testis system: a review.
Vet Q 13:104-114.
Ko CP, Lin MY, Yoo YS, Sugiura Y (2006) Loss of myostatin delays symptoms in mouse
model of ALS. Program No. 673.10. 2006 Neuroscience Meeting Planner. Atlanta, GA:
Society for Neuroscience, 2006
Koirala S, Reddy LV, Ko CP (2003) Roles of glial cells in the formation, function, and
maintenance of the neuromuscular junction. J Neurocytol 32:987-1002.
Kujawa KA, Jacob JM, Jones KJ (1993) Testosterone regulation of the regenerative
properties of injured rat sciatic motor neurons. J Neurosci Res 35:268-273.
Kumar N, Crozat A, Li F, Catterall JF, Bardin CW, Sundaram K (1999) 7alpha-methyl-19-
nortestosterone, a synthetic androgen with high potency: structure-activity
comparisons with other androgens. J Steroid Biochem Mol Biol 71:213-222.
Kumar N, Didolkar AK, Monder C, Bardin CW, Sundaram K (1992) The biological activity
of 7 alpha-methyl-19-nortestosterone is not amplified in male reproductive tract as is
that of testosterone. Endocrinology 130:3677-3683.
Lacomblez L, Bensimon G, Leigh PN, Guillet P, Meininger V (1996) Dose-ranging study of
riluzole in amyotrophic lateral sclerosis. Amyotrophic Lateral Sclerosis/Riluzole
Study Group II. Lancet 347:1425-1431.
Lalani R, Bhasin S, Byhower F, Tarnuzzer R, Grant M, Shen R, Asa S, Ezzat S, Gonzalez-
Cadavid NF (2000) Myostatin and insulin-like growth factor-I and -II expression in
the muscle of rats exposed to the microgravity environment of the NeuroLab space
shuttle flight. J Endocrinol 167:417-428.
110
Lambrechts D, Storkebaum E, Morimoto M, Del-Favero J, Desmet F, Marklund SL, Wyns S,
Thijs V, Andersson J, van Marion I, Al-Chalabi A, Bornes S, Musson R, Hansen V,
Beckman L, Adolfsson R, Pall HS, Prats H, Vermeire S, Rutgeerts P, Katayama S,
Awata T, Leigh N, Lang-Lazdunski L, Dewerchin M, Shaw C, Moons L, Vlietinck
R, Morrison KE, Robberecht W, Van Broeckhoven C, Collen D, Andersen PM,
Carmeliet P (2003) VEGF is a modifier of amyotrophic lateral sclerosis in mice and
humans and protects motoneurons against ischemic death. Nat Genet 34:383-394.
LaMonte BH, Wallace KE, Holloway BA, Shelly SS, Ascano J, Tokito M, Van Winkle T,
Howland DS, Holzbaur EL (2002) Disruption of dynein/dynactin inhibits axonal
transport in motor neurons causing late-onset progressive degeneration. Neuron
34:715-727.
Lecker SH, Jagoe RT, Gilbert A, Gomes M, Baracos V, Bailey J, Price SR, Mitch WE,
Goldberg AL (2004) Multiple types of skeletal muscle atrophy involve a common
program of changes in gene expression. Faseb J 18:39-51.
Lee SJ (2004) Regulation of muscle mass by myostatin. Annu Rev Cell Dev Biol 20:61-86.
Lee SJ, McPherron AC (2001) Regulation of myostatin activity and muscle growth. Proc
Natl Acad Sci U S A 98:9306-9311.
Leng Y, Chuang DM (2006) Endogenous alpha-synuclein is induced by valproic acid
through histone deacetylase inhibition and participates in neuroprotection against
glutamate-induced excitotoxicity. J Neurosci 26:7502-7512.
Lepore AC, Haenggeli C, Gasmi M, Bishop KM, Bartus RT, Maragakis NJ, Rothstein JD
(2007) Intraparenchymal spinal cord delivery of adeno-associated virus IGF-1 is
protective in the SOD1G93A model of ALS. Brain Res 1185:256-265.
Lewis ME, Neff NT, Contreras PC, Stong DB, Oppenheim RW, Grebow PE, Vaught JL
(1993) Insulin-like growth factor-I: potential for treatment of motor neuronal
disorders. Exp Neurol 124:73-88.
Li W, Brakefield D, Pan Y, Hunter D, Myckatyn TM, Parsadanian A (2007) Muscle-derived
but not centrally derived transgene GDNF is neuroprotective in G93A-SOD1 mouse
model of ALS. Exp Neurol 203:457-471.
Liao S, Liang T, Fang S, Castaneda E, Shao TC (1973) Steroid structure and androgenic
activity. Specificities involved in the receptor binding and nuclear retention of
various androgens. J Biol Chem 248:6154-6162.
Lin CL, Bristol LA, Jin L, Dykes-Hoberg M, Crawford T, Clawson L, Rothstein JD (1998)
Aberrant RNA processing in a neurodegenerative disease: the cause for absent
EAAT2, a glutamate transporter, in amyotrophic lateral sclerosis. Neuron 20:589-
602.
111
Lino MM, Schneider C, Caroni P (2002) Accumulation of SOD1 mutants in postnatal
motoneurons does not cause motoneuron pathology or motoneuron disease. J
Neurosci 22:4825-4832.
Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression data using real-time
quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25:402-408.
Lobsiger CS, Boillee S, McAlonis-Downes M, Khan AM, Feltri ML, Yamanaka K,
Cleveland DW (2009) Schwann cells expressing dismutase active mutant SOD1
unexpectedly slow disease progression in ALS mice. Proc Natl Acad Sci U S A
106:4465-4470.
Lobsiger CS, Cleveland DW (2007) Glial cells as intrinsic components of non-cell-
autonomous neurodegenerative disease. Nat Neurosci 10:1355-1360.
Lu J, McKinsey TA, Zhang CL, Olson EN (2000) Regulation of skeletal myogenesis by
association of the MEF2 transcription factor with class II histone deacetylases. Mol
Cell 6:233-244.
Ly LP, Jimenez M, Zhuang TN, Celermajer DS, Conway AJ, Handelsman DJ (2001) A
double-blind, placebo-controlled, randomized clinical trial of transdermal
dihydrotestosterone gel on muscular strength, mobility, and quality of life in older
men with partial androgen deficiency. J Clin Endocrinol Metab 86:4078-4088.
Magnaghi V, Cavarretta I, Zucchi I, Susani L, Rupprecht R, Hermann B, Martini L,
Melcangi RC (1999) Po gene expression is modulated by androgens in the sciatic
nerve of adult male rats. Brain Res Mol Brain Res 70:36-44.
Mahoney DJ, Kaczor JJ, Bourgeois J, Yasuda N, Tarnopolsky MA (2006) Oxidative stress
and antioxidant enzyme upregulation in SOD1-G93A mouse skeletal muscle.
Muscle Nerve 33:809-816.
Maragakis NJ, Rothstein JD (2006) Mechanisms of Disease: astrocytes in neurodegenerative
disease. Nat Clin Pract Neurol 2:679-689.
Marron TU, Guerini V, Rusmini P, Sau D, Brevini TA, Martini L, Poletti A (2005)
Androgen-induced neurite outgrowth is mediated by neuritin in motor neurones. J
Neurochem 92:10-20.
Matsumoto A (1997) Hormonally induced neuronal plasticity in the adult motoneurons.
Brain Res Bull 44:539-547.
Mauras N, Hayes V, Welch S, Rini A, Helgeson K, Dokler M, Veldhuis JD, Urban RJ
(1998) Testosterone deficiency in young men: marked alterations in whole body
protein kinetics, strength, and adiposity. J Clin Endocrinol Metab 83:1886-1892.

112
McQueen JK, Dow RC, Fink G (1992) Gonadal steroids regulate number of astrocytes
immunostained for glial fibrillary acidic protein in mouse hippocampus. Mol Cell
Neurosci 3:482-486.
Meisel A, Harms C, Yildirim F, Bosel J, Kronenberg G, Harms U, Fink KB, Endres M
(2006) Inhibition of histone deacetylation protects wild-type but not gelsolin-
deficient neurons from oxygen/glucose deprivation. J Neurochem 98:1019-1031.
Melcangi RC, Cavarretta IT, Ballabio M, Leonelli E, Schenone A, Azcoitia I, Miguel
Garcia-Segura L, Magnaghi V (2005) Peripheral nerves: a target for the action of
neuroactive steroids. Brain Res Brain Res Rev 48:328-338.
Midrio M (2006) The denervated muscle: facts and hypotheses. A historical review. Eur J
Appl Physiol 98:1-21.
Militello A, Vitello G, Lunetta C, Toscano A, Maiorana G, Piccoli T, La Bella V (2002) The
serum level of free testosterone is reduced in amyotrophic lateral sclerosis. J Neurol
Sci 195:67-70.
Miller TA, Witter DJ, Belvedere S (2003) Histone deacetylase inhibitors. J Med Chem
46:5097-5116.
Miller TM, Kim SH, Yamanaka K, Hester M, Umapathi P, Arnson H, Rizo L, Mendell JR,
Gage FH, Cleveland DW, Kaspar BK (2006) Gene transfer demonstrates that muscle
is not a primary target for non-cell-autonomous toxicity in familial amyotrophic
lateral sclerosis. Proc Natl Acad Sci U S A 103:19546-19551.
Minetti GC, Colussi C, Adami R, Serra C, Mozzetta C, Parente V, Fortuni S, Straino S,
Sampaolesi M, Di Padova M, Illi B, Gallinari P, Steinkuhler C, Capogrossi MC,
Sartorelli V, Bottinelli R, Gaetano C, Puri PL (2006) Functional and morphological
recovery of dystrophic muscles in mice treated with deacetylase inhibitors. Nat Med
12:1147-1150.
Mitchell JD, Wokke JH, Borasio GD (2002) Recombinant human insulin-like growth factor
I (rhIGF-I) for amyotrophic lateral sclerosis/motor neuron disease. Cochrane
Database Syst Rev:CD002064.
Mohajeri MH, Figlewicz DA, Bohn MC (1999) Intramuscular grafts of myoblasts
genetically modified to secrete glial cell line-derived neurotrophic factor prevent
motoneuron loss and disease progression in a mouse model of familial amyotrophic
lateral sclerosis. Hum Gene Ther 10:1853-1866.
Morrison BM, Lachey JL, Warsing LC, Ting BL, Pullen AE, Underwood KW, Kumar R,
Sako D, Grinberg A, Wong V, Colantuoni E, Seehra JS, Wagner KR (2009) A
soluble activin type IIB receptor improves function in a mouse model of
amyotrophic lateral sclerosis. Exp Neurol 217:258-268.
113
Musaro A, McCullagh K, Paul A, Houghton L, Dobrowolny G, Molinaro M, Barton ER,
Sweeney HL, Rosenthal N (2001) Localized Igf-1 transgene expression sustains
hypertrophy and regeneration in senescent skeletal muscle. Nat Genet 27:195-200.
Nagano I, Shiote M, Murakami T, Kamada H, Hamakawa Y, Matsubara E, Yokoyama M,
Moritaz K, Shoji M, Abe K (2005) Beneficial effects of intrathecal IGF-1
administration in patients with amyotrophic lateral sclerosis. Neurol Res 27:768-772.
Nan X, Ng HH, Johnson CA, Laherty CD, Turner BM, Eisenman RN, Bird A (1998)
Transcriptional repression by the methyl-CpG-binding protein MeCP2 involves a
histone deacetylase complex. Nature 393:386-389.
Nicolopoulos-Stournaras S, Iles JF (1983) Motor neuron columns in the lumbar spinal cord
of the rat. J Comp Neurol 217:75-85.
Niu F, Zhang X, Chang L, Wu J, Yu Y, Chen J, Xu Y (2009) Trichostatin A enhances OGD-
astrocyte viability by inhibiting inflammatory reaction mediated by NF-kappaB.
Brain Res Bull 78:342-346.
Okun MS, Walter BL, McDonald WM, Tenover JL, Green J, Juncos JL, DeLong MR (2002)
Beneficial effects of testosterone replacement for the nonmotor symptoms of
Parkinson disease. Arch Neurol 59:1750-1753.
Omwancha J, Brown TR (2006) Selective androgen receptor modulators: in pursuit of tissue-
selective androgens. Curr Opin Investig Drugs 7:873-881.
Oppenheim RW (1996) Neurotrophic survival molecules for motoneurons: an
embarrassment of riches. Neuron 17:195-197.
Ottenbacher KJ, Ottenbacher ME, Ottenbacher AJ, Acha AA, Ostir GV (2006) Androgen
treatment and muscle strength in elderly men: A meta-analysis. J Am Geriatr Soc
54:1666-1673.
Oyama T, Toyota M, Shinozaki Y, Kudo T (1977) Effects of morphine and ketamine
anaesthesia and surgery on plasma concentrations of luteinizing hormone,
testosterone and cortisol in man. Br J Anaesth 49:983-990.
Parte P, Juneja HS (1992) Temporal changes in the serum levels of gonadotrophins and
testosterone in male rats bearing subcutaneous implants of 5 alpha-
dihydrotestosterone. Int J Androl 15:355-364.
Pasinelli P, Brown RH (2006) Molecular biology of amyotrophic lateral sclerosis: insights
from genetics. Nat Rev Neurosci 7:710-723.

114
Petri S, Kiaei M, Kipiani K, Chen J, Calingasan NY, Crow JP, Beal MF (2006) Additive
neuroprotective effects of a histone deacetylase inhibitor and a catalytic antioxidant
in a transgenic mouse model of amyotrophic lateral sclerosis. Neurobiol Dis 22:40-
49.
Piepers S, Veldink JH, de Jong SW, van der Tweel I, van der Pol WL, Uijtendaal EV,
Schelhaas HJ, Scheffer H, de Visser M, de Jong JM, Wokke JH, Groeneveld GJ, van
den Berg LH (2009) Randomized sequential trial of valproic acid in amyotrophic
lateral sclerosis. Ann Neurol 66:227-234.
Pike CJ, Nguyen TV, Ramsden M, Yao M, Murphy MP, Rosario ER (2008) Androgen cell
signaling pathways involved in neuroprotective actions. Horm Behav 53:693-705.
Poletti A (2004) The polyglutamine tract of androgen receptor: from functions to
dysfunctions in motor neurons. Front Neuroendocrinol 25:1-26.
Powers ML, Florini JR (1975) A direct effect of testosterone on muscle cells in tissue culture.
Endocrinology 97:1043-1047.
Pozzi P, Bendotti C, Simeoni S, Piccioni F, Guerini V, Marron TU, Martini L, Poletti A
(2003) Androgen 5-alpha-reductase type 2 is highly expressed and active in rat
spinal cord motor neurones. J Neuroendocrinol 15:882-887.
Pramatarova A, Laganiere J, Roussel J, Brisebois K, Rouleau GA (2001) Neuron-specific
expression of mutant superoxide dismutase 1 in transgenic mice does not lead to
motor impairment. J Neurosci 21:3369-3374.
Pun S, Santos AF, Saxena S, Xu L, Caroni P (2006) Selective vulnerability and pruning of
phasic motoneuron axons in motoneuron disease alleviated by CNTF. Nat Neurosci
9:408-419.
Reaume AG, Elliott JL, Hoffman EK, Kowall NW, Ferrante RJ, Siwek DF, Wilcox HM,
Flood DG, Beal MF, Brown RH, Jr., Scott RW, Snider WD (1996) Motor neurons in
Cu/Zn superoxide dismutase-deficient mice develop normally but exhibit enhanced
cell death after axonal injury. Nat Genet 13:43-47.
Rommel C, Bodine SC, Clarke BA, Rossman R, Nunez L, Stitt TN, Yancopoulos GD, Glass
DJ (2001) Mediation of IGF-1-induced skeletal myotube hypertrophy by
PI(3)K/Akt/mTOR and PI(3)K/Akt/GSK3 pathways. Nat Cell Biol 3:1009-1013.
Rosario ER, Pike CJ (2008) Androgen regulation of beta-amyloid protein and the risk of
Alzheimer's disease. Brain Res Rev 57:444-453.
Rosen DR, Siddique T, Patterson D, Figlewicz DA, Sapp P, Hentati A, Donaldson D, Goto J,
O'Regan JP, Deng HX, et al. (1993) Mutations in Cu/Zn superoxide dismutase gene
are associated with familial amyotrophic lateral sclerosis. Nature 362:59-62.
115
Rothstein JD, Patel S, Regan MR, Haenggeli C, Huang YH, Bergles DE, Jin L, Dykes
Hoberg M, Vidensky S, Chung DS, Toan SV, Bruijn LI, Su ZZ, Gupta P, Fisher PB
(2005) Beta-lactam antibiotics offer neuroprotection by increasing glutamate
transporter expression. Nature 433:73-77.
Rothstein JD, Van Kammen M, Levey AI, Martin LJ, Kuncl RW (1995) Selective loss of
glial glutamate transporter GLT-1 in amyotrophic lateral sclerosis. Ann Neurol
38:73-84.
Rouaux C, Panteleeva I, Rene F, Gonzalez de Aguilar JL, Echaniz-Laguna A, Dupuis L,
Menger Y, Boutillier AL, Loeffler JP (2007) Sodium valproate exerts
neuroprotective effects in vivo through CREB-binding protein-dependent
mechanisms but does not improve survival in an amyotrophic lateral sclerosis mouse
model. J Neurosci 27:5535-5545.
Rowland LR. 2003.Clinical aspects of sporadic amyotrophic lateral sclerosis/motor neuron
disease. In: Shaw PJ, Strong MJ, editors.Motor neuron disorders. Philadelphia, PA:
Butterworth Heinemann.p 111–143.
Ryu H, Smith K, Camelo SI, Carreras I, Lee J, Iglesias AH, Dangond F, Cormier KA,
Cudkowicz ME, Brown RH, Jr., Ferrante RJ (2005) Sodium phenylbutyrate
prolongs survival and regulates expression of anti-apoptotic genes in transgenic
amyotrophic lateral sclerosis mice. J Neurochem 93:1087-1098.
Sargsyan SA, Monk PN, Shaw PJ (2005) Microglia as potential contributors to motor neuron
injury in amyotrophic lateral sclerosis. Glia 51:241-253.
Sattler F, Briggs W, Antonipillai I, Allen J, Horton R (1998) Low dihydrotestosterone and
weight loss in the AIDS wasting syndrome. J Acquir Immune Defic Syndr Hum
Retrovirol 18:246-251.
Schaefer AM, Sanes JR, Lichtman JW (2005) A compensatory subpopulation of motor
neurons in a mouse model of amyotrophic lateral sclerosis. J Comp Neurol 490:209-
219.
Seifert G, Schilling K, Steinhauser C (2006) Astrocyte dysfunction in neurological disorders:
a molecular perspective. Nat Rev Neurosci 7:194-206.
Sheffield-Moore M, Urban RJ, Wolf SE, Jiang J, Catlin DH, Herndon DN, Wolfe RR,
Ferrando AA (1999) Short-term oxandrolone administration stimulates net muscle
protein synthesis in young men. J Clin Endocrinol Metab 84:2705-2711.
Singh R, Artaza JN, Taylor WE, Gonzalez-Cadavid NF, Bhasin S (2003) Androgens
stimulate myogenic differentiation and inhibit adipogenesis in C3H 10T1/2
pluripotent cells through an androgen receptor-mediated pathway. Endocrinology
144:5081-5088.
116
Sinha-Hikim I, Artaza J, Woodhouse L, Gonzalez-Cadavid N, Singh AB, Lee MI, Storer TW,
Casaburi R, Shen R, Bhasin S (2002) Testosterone-induced increase in muscle size
in healthy young men is associated with muscle fiber hypertrophy. Am J Physiol
Endocrinol Metab 283:E154-164.
Sinha-Hikim I, Roth SM, Lee MI, Bhasin S (2003) Testosterone-induced muscle
hypertrophy is associated with an increase in satellite cell number in healthy, young
men. Am J Physiol Endocrinol Metab 285:E197-205.
Smith ER, Damassa DA, Davidson JM (1997) Hormone administration: peripheral and
intracranial implants. Methods in Psychobiology, Academic Press (London, New
York). Edited by R. D. Myers
Smith J, Goldsmith C, Ward A, LeDieu R (2000) IGF-II ameliorates the dystrophic
phenotype and coordinately down-regulates programmed cell death. Cell Death
Differ 7:1109-1118.
Sobue G, Matsuoka Y, Mukai E, Takayanagi T, Sobue I (1981) Pathology of myelinated
fibers in cervical and lumbar ventral spinal roots in amyotrophic lateral sclerosis. J
Neurol Sci 50:413-421.
Somboonporn W, Davis SR (2004) Testosterone effects on the breast: implications for
testosterone therapy for women. Endocr Rev 25:374-388.
Son YJ, Thompson WJ (1995) Nerve sprouting in muscle is induced and guided by
processes extended by Schwann cells. Neuron 14:133-141.
Son YJ, Thompson WJ (1995) Schwann cell processes guide regeneration of peripheral
axons. Neuron 14:125-132.
Stewart CE, Rotwein P (1996) Insulin-like growth factor-II is an autocrine survival factor for
differentiating myoblasts. J Biol Chem 271:11330-11338.
Storer TW, Magliano L, Woodhouse L, Lee ML, Dzekov C, Dzekov J, Casaburi R, Bhasin S
(2003) Testosterone dose-dependently increases maximal voluntary strength and leg
power, but does not affect fatigability or specific tension. J Clin Endocrinol Metab
88:1478-1485.
Storkebaum E, Lambrechts D, Carmeliet P (2004) VEGF: once regarded as a specific
angiogenic factor, now implicated in neuroprotection. Bioessays 26:943-954.
Strahl BD, Allis CD (2000) The language of covalent histone modifications. Nature 403:41-
45.
Strauss RH, Yesalis CE (1991) Anabolic steroids in the athlete. Annu Rev Med 42:449-457.
117
Streit WJ, Walter SA, Pennell NA (1999) Reactive microgliosis. Prog Neurobiol 57:563-581.
Strong M, Rosenfeld J (2003) Amyotrophic lateral sclerosis: a review of current concepts.
Amyotroph Lateral Scler Other Motor Neuron Disord 4:136-143.
Sugai F, Yamamoto Y, Miyaguchi K, Zhou Z, Sumi H, Hamasaki T, Goto M, Sakoda S
(2004) Benefit of valproic acid in suppressing disease progression of ALS model
mice. Eur J Neurosci 20:3179-3183.
Sullivan DH, Roberson PK, Johnson LE, Bishara O, Evans WJ, Smith ES, Price JA (2005)
Effects of muscle strength training and testosterone in frail elderly males. Med Sci
Sports Exerc 37:1664-1672.
Suzuki M, McHugh J, Tork C, Shelley B, Klein SM, Aebischer P, Svendsen CN (2007)
GDNF secreting human neural progenitor cells protect dying motor neurons, but not
their projection to muscle, in a rat model of familial ALS. PLoS One 2:e689.
Suzuki M, Tork C, Shelley B, McHugh J, Wallace K, Klein SM, Lindstrom MJ, Svendsen
CN (2007) Sexual dimorphism in disease onset and progression of a rat model of
ALS. Amyotroph Lateral Scler 8:20-25.
Tenover JS (1991) Prostates, pates, and pimples. The potential medical uses of steroid 5
alpha-reductase inhibitors. Endocrinol Metab Clin North Am 20:893-909.
The BDNF Study Group (1999) A controlled trial of recombinant methionyl human BDNF
in ALS: The BDNF Study Group (Phase III). Neurology 52:1427-1433.
Turner BJ, Talbot K (2008) Transgenics, toxicity and therapeutics in rodent models of
mutant SOD1-mediated familial ALS. Prog Neurobiol 85:94-134.
Urban RJ, Bodenburg YH, Gilkison C, Foxworth J, Coggan AR, Wolfe RR, Ferrando A
(1995) Testosterone administration to elderly men increases skeletal muscle strength
and protein synthesis. Am J Physiol 269:E820-826.
Veldink JH, Bar PR, Joosten EA, Otten M, Wokke JH, van den Berg LH (2003) Sexual
differences in onset of disease and response to exercise in a transgenic model of
ALS. Neuromuscul Disord 13:737-743.
Verdin E, Dequiedt F, Kasler HG (2003) Class II histone deacetylases: versatile regulators.
Trends Genet 19:286-293.
Vita G, Dattola R, Girlanda P, Oteri G, Lo Presti F, Messina C (1983) Effects of steroid
hormones on muscle reinnervation after nerve crush in rabbit. Exp Neurol 80:279-
287.

118
Wang LJ, Lu YY, Muramatsu S, Ikeguchi K, Fujimoto K, Okada T, Mizukami H,
Matsushita T, Hanazono Y, Kume A, Nagatsu T, Ozawa K, Nakano I (2002)
Neuroprotective effects of glial cell line-derived neurotrophic factor mediated by an
adeno-associated virus vector in a transgenic animal model of amyotrophic lateral
sclerosis. J Neurosci 22:6920-6928.
Weiner LP (1980) Possible role of androgen receptors in amyotrophic lateral sclerosis. A
hypothesis. Arch Neurol 37:129-131.
West M, Mhatre M, Ceballos A, Floyd RA, Grammas P, Gabbita SP, Hamdheydari L, Mai T,
Mou S, Pye QN, Stewart C, West S, Williamson KS, Zemlan F, Hensley K (2004)
The arachidonic acid 5-lipoxygenase inhibitor nordihydroguaiaretic acid inhibits
tumor necrosis factor alpha activation of microglia and extends survival of G93A-
SOD1 transgenic mice. J Neurochem 91:133-143.
Williamson TL, Cleveland DW (1999) Slowing of axonal transport is a very early event in
the toxicity of ALS-linked SOD1 mutants to motor neurons. Nat Neurosci 2:50-56.
Wooley CM, Sher RB, Kale A, Frankel WN, Cox GA, Seburn KL (2005) Gait analysis
detects early changes in transgenic SOD1(G93A) mice. Muscle Nerve 32:43-50.
Wu JY, Niu FN, Huang R, Xu Y (2008) Enhancement of glutamate uptake in 1-methyl-4-
phenylpyridinium-treated astrocytes by trichostatin A. Neuroreport 19:1209-1212.
Wu X, Chen PS, Dallas S, Wilson B, Block ML, Wang CC, Kinyamu H, Lu N, Gao X, Leng
Y, Chuang DM, Zhang W, Lu RB, Hong JS (2008) Histone deacetylase inhibitors
up-regulate astrocyte GDNF and BDNF gene transcription and protect dopaminergic
neurons. Int J Neuropsychopharmacol 11:1123-1134.
Xu WS, Parmigiani RB, Marks PA (2007) Histone deacetylase inhibitors: molecular
mechanisms of action. Oncogene 26:5541-5552.
Yamanaka K, Chun SJ, Boillee S, Fujimori-Tonou N, Yamashita H, Gutmann DH,
Takahashi R, Misawa H, Cleveland DW (2008) Astrocytes as determinants of
disease progression in inherited amyotrophic lateral sclerosis. Nat Neurosci 11:251-
253.
Yildirim F, Gertz K, Kronenberg G, Harms C, Fink KB, Meisel A, Endres M (2008)
Inhibition of histone deacetylation protects wildtype but not gelsolin-deficient mice
from ischemic brain injury. Exp Neurol 210:531-542.
Yin D, Gao W, Kearbey JD, Xu H, Chung K, He Y, Marhefka CA, Veverka KA, Miller DD,
Dalton JT (2003) Pharmacodynamics of selective androgen receptor modulators. J
Pharmacol Exp Ther 304:1334-1340.

119
Yoshida M, Kijima M, Akita M, Beppu T (1990) Potent and specific inhibition of
mammalian histone deacetylase both in vivo and in vitro by trichostatin A. J Biol
Chem 265:17174-17179.
Yoshida S, Mulder DW, Kurland LT, Chu CP, Okazaki H (1986) Follow-up study on
amyotrophic lateral sclerosis in Rochester, Minn., 1925 through 1984.
Neuroepidemiology 5:61-70.
Yu WH, Cao CG (1991) Muscle as the primary site for testosterone to promote survival of
axotomized motoneurons. Neuroreport 2:258-260.
Yu WH, McGinnis MY (2001) Androgen receptors in cranial nerve motor nuclei of male
and female rats. J Neurobiol 46:1-10.
120

Abstract (if available)

Abstract Amyotrophic lateral sclerosis (ALS, also known as Lou Gehrig’s disease) is a lethal neurodegenerative disease characterized by motor neuron loss, progressive muscle weakness, atrophy and paralysis. ALS is the most common motoneuron disease in human adults, and currently, there is no cure for ALS. Although ALS is a motoneuron disease, non-neuronal cells have been implicated in modulating motoneuron degeneration and disease progression. Because trichostatin A (TSA) and dihydrotestosterone (DHT) have shown beneficial effects on multiple cell types implicated in ALS, we examined their effects as a potential drug in a mouse model of ALS, SOD1 G93A mice.

Linked assets

University of Southern California Dissertations and Theses

Conceptually similar

PDF

Identification of therapeutic targets for neurons and microglia in amyotrophic lateral sclerosis

PDF

Functional study of C9ORF72 and its implication in the pathogenesis of amyotrophic lateral sclerosis

PDF

From mesenchymal stem cell therapy to discovery of drug therapy for systemic sclerosis

Asset Metadata

Creator Yoo, Young-Eun (author)

Core Title Trichostatin A and dihydrotestosterone as potential multi-systemic drugs for amyotrophic lateral sclerosis

School College of Letters, Arts and Sciences

Degree Doctor of Philosophy

Degree Program Neuroscience

Publication Date 02/02/2010

Defense Date 12/11/2009

Publisher University of Southern California (original), University of Southern California. Libraries (digital)

Tag amyotrophic lateral sclerosis,motor behavior,motor neurons,OAI-PMH Harvest,SOD1 G93A,therapy,transgenic mice

Language English

Contributor Electronically uploaded by the author (provenance)

Advisor Ko, Chien-Ping (committee chair), Butler, Samantha J. (committee member), Pike, Christian J. (committee member), Youn, Jang H. (committee member)

Creator Email youngeuy@gmail.com,youngeuy@usc.edu

Permanent Link (DOI) https://doi.org/10.25549/usctheses-m2827

Unique identifier UC1494133

Identifier etd-Yoo-3420 (filename),usctheses-m40 (legacy collection record id),usctheses-c127-288133 (legacy record id),usctheses-m2827 (legacy record id)

Legacy Identifier etd-Yoo-3420.pdf

Dmrecord 288133

Document Type Dissertation

Rights Yoo, Young-Eun

Type texts

Source University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Repository Name Libraries, University of Southern California

Repository Location Los Angeles, California

Repository Email cisadmin@lib.usc.edu