University of Southern California Dissertations and Theses

The transcriptional regulation of the pro-survival protein Grp78 by activating transcription factors and chromatin-modifying enzymes: its upregulation in response to HDAC-inhibitor treatment and ...

(USC Thesis Other)

The transcriptional regulation of the pro-survival protein Grp78 by activating transcription factors and chromatin-modifying enzymes: its upregulation in response to HDAC-inhibitor treatment and ...

PDF

Download a page range

Download transcript

Copy asset link

Request this asset

Transcript (if available)

Content THE TRANSCRIPTIONAL REGULATION OF THE PRO-SURVIV AL PROTEIN
GRP78 BY ACTIV ATING TRANSCRIPTION FACTORS AND CHROMATIN-
MODIFYING ENZYMES: ITS UPREGULATION IN RESPONSE TO HDAC-
INHIBITOR TREATMENT AND THE THERAPEUTIC CONSEQUENCES
by
Peter J. Baumeister
______________________________________________________________________
A Dissertation Presented to the
FACULTY OF THE GRADUATE SCHOOL
UNIVERSITY OF SOUTHERN CALIFORNIA
In Partial Fulfillment of the
Requirements for the Degree
DOCTOR OF PHILOSOPHY
(BIOCHEMISTRY AND MOLECULAR BIOLOGY)
December 2008
Copyright 2008! ! ! ! ! ! ! Peter J. Baumeister
Dedication
I dedicate this work to my grandfather, James P. Pipitone. A great man who
inspired great things from those who loved him.
ii
Acknowledgements
I thank my advisor, Dr. Amy Lee, for her patience, guidance, and undying
dedication to the thrill of science. Her uncanny ability to steer me in the direction of my
strengths, and to challenge my weaknesses has made me a better scientist and person, and
I am eternally thankful.
Dr. Debbie Johnson did an amazing job of “parenting” me through this
process. She listened, and took action, and that is worth volumes of gratitude. She is
eternally positive and encouraging and I will miss her dearly.
Dr. Robert Ladner is a great human being. Thank you, Bob, for having an open
door and a good ear. Your knowledge of what we do as scientists, from the nuts and bolts
on up to the skyscrapers, is staggering.
I thank my son, Calvin, for coming into the lab with me on weekends and for
thinking that of all the dads you know, I’m the one with the COOLEST job. Also, thanks
for the ideas on anti-cancer therapies, keep ‘em coming.
Lastly, and most importantly, I would like to thank my wife, Beth, for living in a
tiny house, driving an old car, and spending too many nights and weekends alone, but
above all: for always believing that I could do this.

iii
Table of Contents
Dedication ii
Acknowledgements iii
List of tables vii
List of figures viii
Abstract x
Chapter One: Overview and Introduction 1
1.1. ER stress and signaling 1
1.2. The Grp78 promoter contains multiple ERSEs 4
1.3. ER stress induction of Grp78 5
1.4. Histone-modifying enzymes and their role in
transcriptional regulation 8
1.5. Histone Deacetylases as the basis for anti-cancer therapies 10
1.6. Summary of introduction and an outline of the thesis 13
Chapter Two: YY1 is a regulator of the ER stress induction
of the Grp78 promoter and recruits activating factors and
chromatin-modifying enzymes 15
2.1. Introduction 15
2.2. Materials and methods 19
2.3. Results 26
2.3.1. YY1 is required for full induction of the Grp78
promoter in response to Tg stress 26
2.3.2. YY1 selectively binds the Grp78 promoter after Tg stress 29
2.3.3. The nuclear form of ATF6 increases YY1 binding
to the Grp78 promoter 32
2.3.4. Mapping of the interactive domains between YY1 and ATF6 36
2.3.5. YY1 is required for optimal ATF6 activation of the
Grp78 promoter 38
2.3.6. YY1 recruits the chromatin-modifying proteins PRMT1 to the 41
Grp78 promoter after ER stress
2.3.7. YY1 recruits the acetyltransferase p300 to the Grp78
promoter 45
2.4 Discussion 48
iv
Chapter Three: Identification of HDAC1 as a negative regulator
of the Grp78 promoter 54
3.1. Introduction 54
3.2. Materials and Methods 58
3.3. Results
3.3.1.Histone H4 is acetylated in the Grp78 promoter region
before and after ER stress 64
3.3.2. Acetylated histone H4 levels increase after Tg
treatment in HeLA cells 66
3.3.3. Thapsigargin treatment results in global acetylation 67
3.3.4. Synergistic induction of the -169Luc promoter by
HDAC inhibition and Tg-induced ER stress 69
3.3.5. Induction of GRP78 in vitro and in vivo by
histone deacetylase inhibitors 71
3.3.6. Identification of the HDACi response elements
in the Grp78 promoter 73
3.3.7. Grp78 promoter repression is mediated by HDAC1 76
3.3.8. HDAC1 binds the Grp78 promoter before but not after
ER stress and HDACi treatment 79
3.4. Discussion 81
Chapter Four: The cytoprotective role of Grp78 in HDACi treatment 86
4.1. Introduction 86
4.2. Materials and Methods 89
4.3. Results 91
4.3.1. HDACi treatment induces GRP78 in mouse brain and spleen 91
4.3.2. GRP78 knockdown by siRNA and treatment with HDACi 94
4.3.3. Suppression of GRP78 induction by siRNA in breast cancer
cells overcomes resistance to TSA-induced apoptosis 95
4.3.4. Overexpression of GRP78 protects 293T cells from
TSA-induced apoptosis 97
4.4. Discussion 99
Chapter Five: Conclusions and perspectives 102
Bibliography 107
v
List of Tables

Table 1.1 Histone Deacetylase inhibitors 11
Table 2.1 Primers used for ChIP assays 25
Table 3.1 Primer sequences used in plasmid construction 63
Table 3.2 Primer sequences used in RT-PCR 64

vi
List of Figures
1.1 Model of ER stress-inducible changes in transcription factor 7
occupancy and chromatin remodeling of the Grp78 promoter
2.1 YY1 is required for full induction of the Grp78 promoter in 28
response to Tg stress
2.2 YY1 selectively binds the Grp78 promoter after Tg stress 31
2.3 The nuclear form of ATF6 increases YY1 binding to the 36
Grp78 promoter
2.4 Mapping of the interactive domains between YY1 and ATF6 38
2.5 YY1 is required for optimal ATF6 activation of the Grp78 promoter 41
2.6 YY1 recruits the chromatin-modifying proteins PRMT1 45
and p300 to the Grp78 promoter after ER stress
2.7 YY1 recruits the acetyltransferase p300 to the Grp78 promoter 48
3.1 Histone H4 is acetylated in the Grp78 promoter 66
3.2 Acetylated histone H4 increases after Tg treatment in HeLA cells 67
3.3 Thapsigargin treatment results in global acetylation 69
3.4 Synergistic induction of the -169Luc promoter by HDAC 71
inhibition and Tg-induced ER stress
3.5 Induction of GRP78 by histone deacetylase inhibitors and 73
ER stress inducers
3.6 Identification of the HDACi response elements in the 76
Grp78 promoter
3.7 Grp78 promoter repression is mediated by HDAC1 79

3.8 HDAC1 binds the Grp78 promoter before but not after 81
Tg and HDACi treatment
vii
4.1 Induction of GRP78 protein levels in mouse brain and spleen in 94
response to HDACi treatment
4.2 GRP78 knockdown by siRNA and treatment with HDACi 95
4.3 Knockdown of GRP78 sensitizes cells to 97
HDACi-mediated apoptosis
4.4 Exogenous overexpression of GRP78 protects 293t cells from 99
TSA-induced apoptosis
viii
Abstract
The unfolded protein response (UPR) is an evolutionarily conserved mechanism
whereby cells respond to stress conditions that target the endoplasmic reticulum
(ER). One of the major targets of the UPR is the 78kDa Glucose Regulated Protein
Grp78 (BiP). The transcriptional activation of the promoter of GRP78 has been used
extensively as an indicator of the onset of the UPR. The transcriptional activation of
Grp78 in response to ER stress has been well documented. It is characterized by
multiple transcription factors such as YY1, TFII-I, ATF6(N), and NF-Y binding to
conserved promoter sequences at the onset of ER stress.
There are also epigenetic changes that occur during the activation of the Grp78
promoter. We have observed ER-stress induced binding of the histone
acetyltransferase p300 to the Grp78 promoter and histone H4 acetylation. We have
also seen the arginine methyltransferase PRMT1, and evidence of its action through
methylation of the arginine 3 residue on histone H4. We show the involvement of
histone deacetylase 1 (HDAC1) in the negative regulation of the Grp78 promoter not
only by its induction in the presence of the HDAC inhibitors trichostatin A, valproic
acid, MS-275 and SAHA, but also by exogenous overexpression and siRNA
knockdown of specific HDACs, and ChIP analysis that reveals the binding of
HDAC1 to the Grp78 promoter before but not after ER stress.

ix
This dissertation seeks to expand on what is currently known about the ER
stress inducible promoter of Grp78 by characterizing the role of activating
transcription factors and histone-modifying enzymes in Grp78 promoter regulation.
We report that HDAC-inhibition employs a novel mechanism for induction,
independent of the ER stress response. We show that overexpression of GRP78
confers resistance to, and suppression of GRP78 enhances the efficacy of HDAC
inhibitor-based therapy.

x
Chapter 1
Overview and Introduction
1.1 ER stress and signaling
The unfolded protein response (UPR) is a conserved mechanism spanning
from yeast to human that triggers multiple cellular pathways in response to stress
conditions that target the endoplasmic reticulum (ER). The ER, besides its role as an
intracellular calcium storage compartment, is a cellular organelle where secretory and
membrane proteins are synthesized and modified.
The initial responses to ER stress include: 1) transient arrest in protein
translation, 2) upregulation of ER chaperone proteins and folding enzymes and 3)
degradation of malfolded proteins. The ER chaperone proteins play an enormous
role in maintaining homeostasis in the cell and GRP78 is one of the most well-
characterized members of this group. GRP78 regulates ER function through protein
folding and assembly, targeting malfolded proteins for degradation, ER calcium
binding, and controlling the activation of trans-membrane ER stress sensors. Stress
induction GRP78 represents an important pro-survival component of the ER stress
response. If the initial protective responses such as the one mediated by GRP78 fail
to attenuate the ER stress, activation of apoptotic pathways mediated by JNK, CHOP
and caspases and of inflammation pathway through activation of transcription factor
nuclear factor-!B (NF-!B) will follow, resulting in irreversible cell death.
In mammalian cells, several ER-resident transmembrane proteins have been
identified that act as transducers of ER stress signaling: the serine/threonine kinase
1
and endoribonuclease IRE1, the PERK serine/threonine kinase (also referred to as
PEK) and the basic leucine-zipper transcription factor ATF6 (Rutkowski et al., 2004;
Sommer and Jarosch, 2002). In non-stressed cells, all three transducers remain
inactive and are bound by GRP78. When an intracellular event results in ER stress,
GRP78 releases from all three sensors. Once this happens, IRE1 and PERK activate
by homodimerization through their luminal domain and autophosphorylation of their
respective cytoplasmic domains. The third transducer, ATF6, translocates from the
ER to the Golgi complex where it is cleaved by S1P and S2P proteases. The cleaved
form of ATF6 enters the nucleus and directly activates the UPR target genes,
including Grp78 . GRP78 is a key regulator of these ER stress transducers, since their
activation in response to ER stress is dependent on its release (Hong et al; Schroder
and Kaufman).
GRP78 can also potentially interact directly with the cytosolic components via
a small population that may act as an ER transmembrane protein. For example,
GRP78 has been reported to complex with caspase-7 and caspase-12, two pro-
apoptotic enzymes that associate with the outer ER membrane. Through these
interactions, either directly or indirectly, GRP78 can regulate the balance between
cell survival and apoptosis in ER-stressed cells (Reddy et al.).
The Grp78 promoter is induced in a variety of cancers. In some cases, it is
highly expressed in the tumor microenvironment, where aberrant conditions, most
notably hypoxia, are present (Dong et al.). Recently published data utilizing
overexpression and siRNA-mediated knockdown has shown that Grp78 contributes to
2
tumor growth and confers drug resistance to cancer cells. Additionally,
overexpression of GRP78 can inhibit apoptosis in the cell (Fu, Li and Lee). Due to
its anti-apoptotic properties, the stress induction of Grp78 represents an important
survival mechanism for the UPR. Therefore, the role of GRP78 in disease, especially
cancers, is well established(Li and Lee).
3
1.2 The Grp78 promoter contains multiple ERSEs
An unusual feature of the mammalian Grp78 promoter is that it contains
multiple copies of CCAAT elements flanked by GC-rich sequences (Wooden et al.
1991; Parker et al. 2001). These have been shown to be repetitive units of the ER
stress response element (ERSE) which is conserved from invertebrates to plants and
humans (Roy and Lee). The ERSE exhibits a tripartite structure CCAAT-N9-CCACG
and is considerably more complex than the yeast ER stress element referred to as the
unfolded protein response element (UPRE). In yeast cells, ER stress leads to
activation of IRE1, which induces mRNA splicing and translation of Hac1, which in
turn binds to the UPRE and activates target gene transcription (Welihinda,
Tirasophon and Kaufman). Further, activated IRE1 directly recruits a transcription
co-activator complex consisting of GCN5 which has histone acetyltransferase
activity, as well as Ada gene products to specific chromosomal locus containing the
UPRE, resulting in localized histone acetylation and gene activation (Welihinda et al;
Welihinda, Tirasophon and Kaufman). Additionally, the yGCN5/Ada complex is
selectively required for the yeast UPR but not the heat shock response. Since
promoter-specific histone acetylation catalyzed by GCN5 has been proven to play
critical roles in target gene activation (Kuo et al. 1998), these observations provide
the first evidence that chromatin modification of the target gene loci may be
important for the trigger and/or maintenance of the UPR in eukaryotes.
4
1.3 ER stress induction of Grp78
The transcriptional activation of the Grp78 promoter is widely used as an
indicator for ER stress and the onset of the UPR. It also provides a unique example of
how the cell can signal from one organelle to another, in this case the presence of a
stress condition in the ER to the nucleus. The result is the initiation of transcription
of UPR target genes. The discovery of the ER stress response element (ERSE) as the
most critical element mediating the stress induction of the Grp78 promoter led to
further discoveries that identified the specific transcription factors that serve as
activators for the ERSE. Multiple copies of the ERSE are located just upstream of
the TATA element of the Grp78 promoter, and this arrangement accounts for a
majority of the regulatory infrastructure of Grp78 expression in response to ER
stress. The major ERSE-binding transcription factors include NF-Y, YY1, TFII-I and
the nuclear form of ATF6 (Hong et al; Li et al; Parker et al; Yoshida et al; Baumeister
et al.). The ER stress induction of the Grp78 promoter is diagrammed in figure 1.1.
The first observations of the differential binding of transcription factors to the
Grp78 promoter was discovered by in vivo footprinting assays. These experiments
showed that before ER stress, the NF-Y binding sites at the CCAAT motif of the
three ERSEs were constitutively occupied. The YY1/ATF6 binding site of the most
distal ERSE, in contrast, was occupied only after ER stress, and this was seen
consistently regardless of the manner of stress induction. This suggests that the
differential binding seen at the YY1/ATF6 site represents a universal, major
mechanism for induction of Grp78 in response to the UPR (Li et al.).
5
While the activation mechanism for the ERSE is relatively well understood,
the manner by which the cells maintain a low-level of GRP78 has not been fully
investigated. Experiments utilizing transgenic mouse models have shown that the
Grp78 promoter is repressed and activated in a tissue specific manner in vivo (Dong
et al; Mao et al.). Since high levels of GRP78 and the UPR can ultimately lead to
apoptosis, the cells must have a mechanism by which moderate amounts of GRP78
can be obtained without the activation of the other UPR target genes. The discovery
that a histone deacetylase can regulate the Grp78 promoter was the first step in
understanding a potential mechanism that can meet this requirement.
6
FIG. 1.1 Model of ER stress-inducible changes in transcription factor occupancy and
chromatin remodeling of the Grp78 promoter

In non-stressed cells, NF-Y and Sp proteins are in contact with the Grp78 promoter, and
HDAC1 is present. Upon ER stress, while NF-Y binding remains intact, HDAC1 exits, TFII-I binding
is enhanced, ATF6 is cleaved to produce a nuclear form, ATF6(N), which associates with YY1,
enhancing its binding to the Grp78 promoter. The YY1-interacting proteins PRMT1 and p300 are also
recruited to the Grp78 promoter. Additional chromatin changes of histone H4 include acetylation and
arginine 3 methylation.
7
1.4 Histone-modifying enzymes and their role in transcriptional regulation
Epigenetics has been defined as a stable, differential state of gene expression.
In order to accomplish this, the cell employs multiple mechanisms that establish
alternate states of chromatin structure, histone modification, associated protein
composition and transcriptional activity(Laird). Although epigenetic changes do not
occur exclusively on histones, the remodeling of chromatin is an excellent example
of the mechanism by which nucleosomes are modified resulting in “open” and
“closed” forms of chromatin, leading to changes in the transcriptional activity of the
associated gene. Potential modifications to the histones include acetylation,
methylation, poly-ADP ribosylation, ubiquitinylation, sumoylation, carbonylation
and glycosylation(Nightingale, O'Neill and Turner).
Acetylation and deacetylation of histone proteins requires two types of enzymes,
both of which do not affect histones exclusively. Histone acetyltransferases (HATs)
catalyze the addition of an acetyl group to lysine residues and histone deacetylases
(HDACs) catalyze their removal. To date, eighteen unique HDACs have been
identified in humans. They have been subdivided into four classes based on their
enzymatic activities, homology to yeast HDACs, and subcellular localization. Class
I HDACs (1,2,3 and 8) are homologous to yeast RPD3, occur ubiquitously in most
tissues and their subcellular localization is generally nuclear. Class II HDACs
(4,5,6,7,9 and 10) are homologous to the yeast protein Hda1 and can translocate
between the cytoplasm and nucleus. Within Class II HDACs are two subclasses, IIa
8
and IIb. The differences between the two are defined by the Class IIb HDACs 6 and
10; both are found in the cytoplasm and contain two deacetylase domains. HDAC6 is
unique in that it displays substrate specificity for the cytoplasmic protein a-tubulin.
The class III HDACs (SIRT1, 2, 3, 4, 5, 6 and 7) are yeast protein Sir2 homologues.
They require NAD+ for their activity to regulate gene expression, and can be
inhibited by the drug nicotinamide. The remaining HDAC member is HDAC11, and
since it shares sequence identities with the catalytic core of both classes I and II
without altogether resembling either class it is placed in class IV(Sengupta and Seto)
(Das, 2005) (Mellor, 2006; Bolden, Peart and Johnstone; Varier and Kundu).
The regulation of transcription by HDACs can occur either by their direct
action on histones or by their modification of non-histone proteins such as
transcription factors. Some examples of HDAC regulation via non-histone proteins
are the changes in activity of transcription factors E2F1, and TFII-I modulated by
their acetylation status(Marzio, 2000; Wen et al.).
The regulation of Grp78 transcription is not exclusive to the ER stress response.
Epigenetic changes at the region of the Grp78 promoter as well as at the promoters of
other ER stress genes have recently been reported (Gal-Yam et al; Donati, Imbriano
and Mantovani). The status of HDACs and their role in the ER stress induction
pathway as it pertains to Grp78 induction is still a mystery. Since HDAC inhibitors
are currently being evaluated in clinical trials as adjuncts to anti-cancer drugs, the
ability of Grp78 to impart drug resistance and anti-apoptotic properties to cancer
cells may add an undesired effect to the overall treatment outcome. Therefore, the
9
mechanism by which HDAC inhibitors induce Grp78 transcription, as well as the
overall epigenetic mechanisms by which the Grp78 promoter is regulated, are
concepts that take on a greater importance in the understanding of disease and its
treatment.
1.5 Histone Deacetylases as the basis for anti-cancer therapies
Histone deacetylases have become a major drug target for anti-cancer
therapies. The search for compounds that inhibit HDACs (HDACi) is ever-widening,
especially since the FDA’s first approval of an HDACi, SAHA, for the treatment of
cutaneous T-cell lymphoma. There are many types of HDACi, but the majority of the
compounds can be classified into three groups: 1) Hydroxamic acids 2) short-chain
fatty acids, and 3) benzamides and cyclic peptides. Table 1.1 summarizes the most
prevalent HDACi and their current status as potential therapies.
10
Table 1.1 Histone Deacetylase inhibitors
HDACi Type FDA trial stage
SAHA Hydroxamate FDA approved
LBH 589 Hydroxamate Stage II
Butyric acid Small fatty acid No longer in development
Valproic acid Small fatty acid FDA approved (anti-seizure)
Trichostatin A Hydroxamate No longer in development
MS-275 Benzamide Stage II
Phenylbutyric acid Small fatty acid Stage I
`
11

Since HDACi are global-acting enzymes, it is possible that there will be many
off-target effects, some good, and some that are detrimental to the overall goals of
therapy. In fact, many of these drugs have pleiotropic effects; the first-generation
HDACi are notorious for causing general toxicity issues in those receiving therapy.
Fortunately, in addition to new HDACi being discovered, the effects of the existing
ones are being worked out and the answer to the toxicity issue may lie in the idea that
the HDACi will be given as an adjunctive agent. The vast majority of anti-cancer
drugs are used as combination therapies, so it is likely that HDACi will find their
greatest utility not as monotherapies but as components of combination drug
regimes.
Early experiments in this lab established the induction of the pro-survival
protein Grp78 by the first-generation histone deacetylase inhibitor trichostatin A
(TSA). The K12 hamster cell line was treated with 10, 100 and 200 nM of TSA for
24 hr and RNA was harvested and subjected to northern blotting. The results showed
that in cells treated with up to 200nM of TSA, Grp78 mRNA was induced nearly 7-
fold. These experiments were repeated in vitro in cell lines and in vivo in mouse
models, with various HDACi, with similar results.
The problem with many cancer therapies is that the mechanism by which they
cause the malignant cells to die may also have the unwanted effect of inducing
transcription of genes that would serve to protect them. Our lab has recently shown
12
that vascular targeting agents as well as anti-angiogenesis therapy could lead to
GRP78 induction in residual tumor cells resulting in drug resistance (Dong et al.).
The same could be true for HDACi. Therefore, a thorough understanding of the
mechanism by which HDACs repress the transcription of Grp78 could prove to be a
crucial link to the development of more effective anti-cancer therapies, or at the very
least, the development of combined therapies that would serve to thoroughly
eradicate tumors without the chance of recurrence.
1.6 An outline of the thesis
The inducible promoter of Grp78 has been a hallmark description of the
stress-mediated regulation of transcription for many years. The promoter has been
investigated not only for its response to the aberrant conditions that occur in many
disease processes, it has been considered for therapeutic targeting in tumor cells from
a genetic therapy standpoint, but the Grp78 protein itself is being investigated as a
target for directed therapy in prostate cancer cells. Therefore, any information that
characterizes the regulation of the Grp78 promoter will only enhance the potential
applications of this promoter and add to the overall understanding of its role in health
and disease. This thesis presents:
1. The mechanism of regulation of the Grp78 promoter by activating factors and
chromatin-modifying enzymes.
13
2. The identification and characterization of the negative regulation of the Grp78
promoter by HDAC1.
3. The anti-apoptotic properties of Grp78 in tumor cell lines undergoing treatment
with the HDAC inhibitor TSA.

14
CHAPTER 2
YY1 is a regulator of the ER stress induction of the Grp78 promoter and recruits
activating factors and chromatin-modifying enzymes
2.1 Introduction
The unfolded protein response (UPR) is an evolutionarily conserved
mechanism whereby cells respond to physiologic stress conditions that target the
endoplasmic reticulum (ER) (Foti et al.) . For example, when mammalian cells
experience prolonged perturbations in the ER due to either calcium depletion stress, a
block in N-linked protein glycosylation, or exposure to protein denaturing agents,
there is an accumulation of unfolded proteins in the ER lumen. Induction of the UPR
triggers intracellular signaling pathways that allow the damaging presence of
malfolded proteins in the ER lumen to be communicated to the nucleus and
cytoplasm. A major cellular target of the UPR is GRP78/BiP, an ER chaperone that
not only binds to unfolded proteins but also regulates the activation of ER stress
transducers such as IRE1, PERK and ATF6 (Bertolotti et al.) (Shen et al.) (Lee et al.).
The transcriptional activation of the Grp78 promoter is used extensively as a
biological marker for onset of the UPR, as well as a unique model for deciphering the
mechanisms whereby ER stress upregulates nuclear gene expression.
Upon treatment of mammalian cells with thapsigargin (Tg), which blocks the ER
calcium-ATPase pump and depletes the ER calcium store, the transcription rate of the
Grp78 promoter is induced by as high as 20-fold (Li et al.). The Tg-induced stress
activation of Grp78 is primarily mediated by the multiple copies of the ER stress
15
response element (ERSE) with a consensus sequence of CCAAT(N9)CCACG located
upstream of the TATA element, although part of the response may also be attributed
to an ERSE-independent pathway (Yoshida et al.) (Roy and Lee) (Luo et al.). ERSE-
binding transcription factors include NF-Y (also referred to as CBF), YY1, TFII-I
and the nuclear form of ATF6 (Li et al.) (Li et al.) (Masuoka et al.) (Parker et al.).
The transcription factor ATF6 has two isoforms, " and #, both of which have
conserved protein domains but divergent transcriptional activation domains (Haze,
2001) (Shen et al.) (Thuerauf, Morrison and Glembotski). ATF6", the better
characterized of the two, is a 90 kDa ER transmembrane protein, a fraction of which
relocates to the Golgi and undergoes S1P/S2P mediated proteolytic cleavage after ER
stress (Haze, 1999; Ye, 2000 ). The cleaved, nuclear form of ATF6" [ATF6(N)] then
translocates to the nucleus to activate target genes including Grp78 (Yoshida et al.).
While ATF6(N) is unable to bind directly to DNA, it can activate the ERSE through
formation of a complex with NF-Y in a manner dependent on the CCACG sequence,
which is also the binding sequence for YY1 (Foti et al; Li et al; Shen et al.). Despite
these advances, the in vivo mechanism of ER stress activation of the Grp78 promoter,
in particular, the role of chromatin reconfiguration and modification, is not well
understood. The first hint that ER stress induces transcription factor binding or
chromatin changes to the mammalian Grp78 promoter is provided by in vivo
footprinting analysis in HeLa cells (Li et al.). These studies revealed that within a
cluster of bases encompassing the YY1/ATF6 binding site of the most distal ERSE
there are specific changes in the DMS reactivity pattern after ER stress whereas other
16
regulatory elements, including the NF-Y binding sites at the CCAAT motif, are
constitutively occupied (Li et al.). Importantly, these inducible changes in factor
occupancy at the YY1/ATF6 site were observed under diverse ER stress signals,
suggesting that it could be a common and important mechanism for the UPR
induction of its target genes.
The mammalian transcription factor YY1 is a constitutively expressed,
multifunctional protein capable of conferring both positive and negative regulation of
gene expression (Bushmeyer, Park and Atchison) (Hyde-DeRuyscher, Jennings and
Shenk; Li et al; Sui, 2004; Thomas and Seto). While a majority of studies document
its repressive activity, YY1 is directly involved in the transcriptional activation of c-
myc (Riggs, 1993), CAR3 (Arai et al.), Col1a1 (Riquet et al.), and B-type natriuretic
peptide (Bhalla, 2001), among others. In general, YY1 can activate transcription
through mechanisms such as direct binding to DNA and interaction with general
transcription factors, interaction with other proteins resulting in blockage of the
repressive domain of YY1 while unmasking its activation domain, or by recruiting
co-activators that either modify other transcription factors or modify histones to
achieve an open chromatin state (Thomas and Seto). In support of the latter, YY1 is
linked to a variety of histone-modifying enzymes that can subsequently alter
chromatin structure, such as CBP, p300, and PRMT1 (Gazit et al; Rezai-Zadeh et al.).
Recently, it was reported that YY1 binds and recruits the histone H4 (Arg 3)-specific
methyltransferase PRMT1 to a YY1-activated promoter in a targeted fashion to
activate specific transcription events (Rezai-Zadeh et al.). Furthermore, PRMT1 itself
17
has been shown to function cooperatively with the acetyltransferase p300 to enhance
transcriptional activation of its target promoter (Arai et al.). Thus, the role of YY1 in
recruiting co-factors and chromatin modifying enzymes may provide important clues
on novel in vivo mechanisms for the activation of the Grp78 promoter in response to
ER stress.
One unique feature concerning the regulation of the Grp78 promoter by YY1
is that despite its constitutive expression, YY1 has no effect on the basal activity of
the Grp78 promoter, yet it strongly enhances the induction of the Grp78 promoter in
cells subjected to ER stress (Li et al.). Towards understanding the underlying
mechanisms of the selective activation of the Grp78 promoter by YY1 under ER
stress conditions, we discover that YY1 only occupies the Grp78 promoter upon ER
stress and this is in part mediated by interaction with the nuclear form of ATF6. Here,
we describe the specific interaction of the zinc-finger domain of YY1 with the b-zip
domain of the activated form of ATF6 that leads to Grp78 promoter induction. We
also describe the further activation of the Grp78 promoter through the interaction of
YY1 with the histone H4 methyltransferase PRMT1, as well as the histone
acetyltransferase p300. Using siRNA targeted against endogenous YY1 and genetic
disruption of the ATF6" gene, we provide evidence that both YY1 and ATF6" are
required for optimal Tg-stress induction of the Grp78 promoter. A model for the Tg-
stress induced modification of the chromatin associated with the Grp78 promoter is
presented.
18
2.2 Materials and Methods
2.2.1 Cell culture conditions
NIH3T3, Cos-7, HeLa, CV-1 and 293T cells were grown in Dulbecco’s Modified
Eagle’s medium (Invitrogen) supplemented with 10% fetal calf serum, 100 units/ml
penicillin, and 100 µg/ml streptomycin, at 37°C in 5% CO2 environment. Cell lines
that had been stably transfected with blasticidin-resistance vector and expression
plasmid were maintained in similar media with the addition of 10 µg/ml of blasticidin
(Invitrogen). For stress induction, cells were treated with 300 nM Tg (Sigma) for
various intervals in normal growth media.
2.2.2 Plasmids
The construction of the reporter plasmid -169/Luc has been described (Luo and
Lee). The expression vectors for CMV-YY1 has been described (Li et al.). The
expression vector for HA-tagged full length ATF6 (pCGN-ATF6) was provided by
Dr. Ron Prywes (Columbia University) and has been described (Zhu, 1997). The
expression vectors for HA-tagged full length PRMT1 and p300 were provided by Dr.
Michael Stallcup (University of Southern California) and have been described (Koh
et al.). The construction of pCGN-ATF6(373) has been described (Luo and Lee).
Plasmid pCGN-ATF6(273) was constructed in the same manner as pCGN-ATF6(373)
with the only exception being the insertion of a stop-codon in the DNA sequence to
produce a 273 aa protein. The expression vector for the FLAG-tagged full length
YY1 and its mutants have been described (Yang, Yao and Seto). The pBluescript/U6
19
derived plasmids used for siRNA targeting of YY1 and the GFP control have been
described (Sui, 2004). The CMV-EGFP-C2 plasmid used in cell-sorting experiments
contains a mutagenized form of GFP, which does not share homology with the
sequence targeted by the U6 siGFP plasmid.
2.2.3 ATF6" insertional mutant cells and Northern blot
Primary mouse embryo fibroblasts (MEFs) derived from homozygous ATF6/#geo
insertional mutant mice were prepared and cultured as described previously
(Holmborn, 2004) (Skarnes et al.). The #geo cassette was inserted into the lumenal
domain of ATF6" at 69 amino acids upstream from the carboxyl terminus. The cells
were grown in 6 cm plates to 80% confluence and were further cultured in normal
media or supplemented with 300 nM Tg for 16 h. Total RNA was extracted from the
cells using Tri-Reagent (Sigma). Ten µg of total RNA was subjected to Northern blot
analysis as described previously (Zhou and Lee). The transcript levels were
quantitated by phosphorimager (Molecular Dynamics).
2.2.4 Immunofluorescence staining
NIH3T3 cells were transfected with 0.2 µg of HA-ATF6 expression plasmids
using Superfect transfection reagent (Qiagen). Immunofluorescence staining was
performed as previously described (Parker, 2001 #814). For the detection of HA-
ATF6, the cells were stained with anti-HA monoclonal antibody (1:100 dilution)
(Santa Cruz Biotechnology, Santa Cruz, CA) and Rhodamine-conjugated anti-mouse
20
IgG (1:500 dilution) (Vector Laboratories Inc., Burlingame, CA). For detection of
YY1, NIH3T3 cells were stained with anti-YY1 monoclonal antibody (1:500
dilution) (Santa Cruz) and FITC-conjugated anti-mouse IgG (1:500 dilution). Cells
were mounted in Vectashield with or without Propidium Iodide mounting medium
(Vector Labs) and visualized on a Zeiss LSM 510 dual-photon confocal microscope.

2.2.5 Transfection assays
NIH 3T3 cells were seeded in 24-well plates and grown to 60-80% confluence.
250 ng of the -169/Luc reporter plasmid was co-transfected with either 0.2 µg of
pCGN-ATF6(373) or empty vector and various amounts of either the YY1 wt or YY1
deletion mutant expression plasmids using Superfect transfection reagent (Qiagen).
For the U6 siYY1 transfection assays, 293T cells were seeded in 6-well plates and
grown to 80% confluence. Cells were then transfected with 0.5 µg of -169/Luc, 0.5
µg of CMV #-gal and 1 µg of either U6 siGFP (U6 siControl) or U6 siYY1 plasmids.
Approximately 96 h after transfection, cells were transfected again with 0.25 µg or
0.5 µg of pCGN-ATF6(373) and after an additional 18 h, cells were lysed and
assayed for luciferase activity. For the pCGN-ATF6(273) and pCGN-ATF6(373)
transfection for ChIP assay analysis of YY1 binding to the Grp78 promoter, two
15cm diameter dishes of 293T cells were each transfected with16$g of plasmid using
Polyfect transfection reagent and subjected to ChIP assay 20 h after transfection.For
the transfection assays involving the induction of Grp78 promoter by YY1 before and
after Tg stress, or by PRMT1, ATF6(373) and p300, CV-1 cells were seeded in 24-
21
well plates and grown to 40-50% confluence. They were subsequently transfected
with 0.5 µg of total DNA, including the CMV-Renilla luciferase control vector, using
Polyfect transfection reagent (Qiagen). Transfected cells were harvested at least 24 h
after transfection and assayed for luciferase activity by luminometer (Turner Design
Systems, Sunnyvale, CA).
2.2.6 Western blotting
Whole cell lysates were prepared in radioimmunoprecipitation (RIPA) buffer as
previously described (Foti et al.). Preparation of the HeLa nuclear extract from
control and cells treated with Tg for 6 h has been previously described (Parker et al.).
Conditions for Western blotting were as previously described (Li et al.). The primary
antibodies used were mouse monoclonal YY1 antibody (H-10) (Santa Cruz
Biotechnology) at a dilution of 1:1000 and anti-GAPDH antibody (Ambion, Austin,
TX) at a dilution of 1:4000. For detection of hemagglutinin epitope (HA)-tagged
ATF6, the primary antibody used was mouse monoclonal HA antibody (Santa Cruz)
at a dilution of 1:500. For detection of the FLAG-tagged YY1, the primary antibody
used was either mouse monoclonal FLAG (Sigma) or rabbit polyclonal FLAG
(Sigma) at a dilution of 1:1000. For detection of PRMT1, a rabbit polyclonal PRMT1
antibody (Upstate Biotechnology) was used. Protein bands were visualized by HRP
enhanced chemiluminescence (Amersham).
22
2.2.7 Chromatin immunoprecipitation
The ChIP assay was carried out as previously described (Luo et al.). Equal
amounts of chromatin from each sample were incubated at 4° overnight with at least
5 µg of antibodies against either YY1 (Santa Cruz), NF-Y (gift of Sankar Maity, U.
of Texas), acetylated histone H4 (Upstate Biotech), histone H3 (Santa Cruz),
PRMT1, methylated R3 histone H4, and p300 (gifts of Michael Stallcup, U. of
Southern California) and mouse or rabbit IgG (Santa Cruz) as a negative control.
After reversal of crosslinking, the DNA was purified by phenol-chloroform
extraction and ethanol precipitation. Purified DNA from the input and IP samples was
subjected to 30-45 cycles of PCR and the products were run on a 1.8% agarose gel
and visualized with EtBr staining. The primers used are listed in table 2.1.
2.2.8 Co-immunoprecipitation assays
Immunoprecipitation of FLAG-YY1 proteins were performed using anti-FLAG
M2 affinity gel (Sigma) following the manufacturer’s suggestions; normal mouse IgG
was used as a negative control. For HA-tagged ATF6 immunoprecipitation, protein
extract from each sample was immunoprecipitated with 5 µg of anti-HA monoclonal
antibody (Santa Cruz) at 4°C overnight. Antibody-protein complexes were collected
by incubation with protein A sepharose beads (Sigma), washed, collected by
centrifugation and incubated in elution buffer to release the protein complexes. The
immunoprecipitates were then subjected to Western blotting.
23
2.2.9 GFP cell sorting and RT-PCR
293T cells were grown in 75 cm
2
flasks to 80% confluence and then
transfected with 7 µg of either U6 siControl or U6 siYY1 plasmids and 1 µg of
EGFP-C2 plasmid using Polyfect transfection reagent. After 96 h, cells were either
left untreated or treated with 300 nM Tg for 4 h and subjected to fluorescence-
sorting. Cells containing EGFP were lysed and RNA was isolated by phenol-SDS
extraction. Approximately 1 µg of RNA from each sample was used as template to
produce cDNA using Superscript II and Oligo dT (Invitrogen) following the protocol
from the manufacturer. PCR reactions were carried out using cDNA template and
gene specific primers for GAPDH (Kurisaki, 2003 ), Grp78 (Siman, 2001), and YY1
(Santiago, 2001) for 30, 26, 22 and 18 amplification cycles for determination of
linear range. PCR products were run on a 1.4% agarose gel and quantitated using the
Gel-Doc 2000 system (Bio-Rad).
24
Table 2.1 Primers used for ChIP assays
Primer Name Sequence
Mouse Grp78
promoter forward 5’-CATTGGTGGCCGTTAAGAATGAC
promoter reverse 5’-AGTATCGAGCGCGCCGTCGC
exon VIII forward 5’-AGAGCGCATTGACACCAGGAATGAA
exon VIII reverse 5’-CCTCCACTTCCATAGAGTTTGCTGATA
Human Grp78
promoter forward 5’-GTGAACGTTAGAAACGAATAGCAGCCA
promoter reverse 5’-GTCGACCTCACCGTCGCCTA
exon VIII forward 5’-CCTCTGAAGATAAGGAGACCATGGAA
exon VIII reverse 5’-TGCTGTATCCTCTTCACCAGTTGG
25
2.3 Results
2.3.1 YY1 is required for full induction of the Grp78 promoter in response to Tg
stress
The human Grp78 gene contains 8 exons and is highly conserved between
human and mouse. The promoter of the Grp78 gene contains a canonical TATA
element and three ERSEs with the consensus sequence of CCAAT(N9)CCACG.
Previous in vivo footprinting studies reveal factor interaction sites that are
constitutively occupied, as well as sites that exhibit changes following ER stress
(Li et al.). Within the proximal region that contains the three ERSEs, the CCAAT
binding site of all three ERSEs shows protection of DMS methylation of G residues
before and after ER stress. The most striking change in the methylation protection
pattern following ER stress occurred at the GGCCAGC motif of ERSE#3; the first G
residue became more sensitive and the second and third G residues became more
protected in the stressed nuclei (Fig. 1A). With the exception of 2 bp, the sequence of
this ERSE and its flanking sequences are completely conserved between human and
mouse (Fig. 2.1A). Taken together, these results suggest that the CCAAT binding
factor NF-Y binds the ERSE constitutively, whereas factors binding to the CCAGC
motif occupy the site after stress. Currently, two transcription factors, YY1 and the
nuclear form of ATF6, have been shown to bind the CCAGC site in in vitro assays
(Li et al; Roy and Lee; Shen et al.).
Previously, we reported that despite the constitutive presence of YY1 in
NIH3T3 cells it could only activate the CAT reporter gene driven by the Grp78
promoter under ER stress conditions, however, the mechanism was not known
26
(Li et al.). To address this, we first used a second reporter gene system and a new cell
system to confirm the selective effect of YY1 on the Grp78 promoter. CV-1 cells
were co-transfected with an expression plasmid for YY1 and -169/Luc, a luciferase
plasmid driven by the Grp78 promoter containing the three ERSEs (Luo, 2002 #647).
In non-stressed cells, overexpression of YY1 had no effect on the reporter gene
activity; after Tg treatment, a 5-fold increase in Grp78 promoter activity was
detected, and this increase was enhanced to 12-fold in cells overexpressing YY1 (Fig.
2.1B). Thus, two different reporter gene systems in two different cell types
independently confirmed that YY1 can only activate the Grp78 promoter after Tg
stress.
We next determined the effect of YY1 depletion by siRNA on the Tg-stress
induction of endogenous Grp78 mRNA levels. The U6 siYY1 or a U6 siControl and
an EGFP-expression plasmids were transfected into 293T cells and 96 h later the
cells were treated with Tg for 4 h and sorted by fluorescence. RNA was then isolated
from each sorted sample and subjected to RT using Oligo-dT primers. The resulting
cDNA was then used in PCR reactions to amplify coding regions from YY1, Grp78
and GAPDH. In the cells transfected with U6 siYY1, the level of YY1 was below
detection limit (Fig. 2.1C). Depletion of YY1 shows minimal effect on the basal
expression of Grp78 mRNA, however, the Tg-stress induced level of Grp78 mRNA
was reduced from a 6-fold increase as seen in the U6 vector to about 2-fold (Fig.
2.1D). These results indicate that YY1 is required for full stress-induction of Grp78.
27
Fig. 2.1 YY1 selectively activates the Grp78 promoter in Tg-stressed cells and is
required for its full stress induction.
(A) Summary of ER-stress induced changes in the DMS methylation pattern of the Grp78 promoter as
revealed by in vivo footprinting (Li, 1994 #600). The sequence of the highly conserved human and
mouse Grp78 promoter containing ERSE #3 where most of the ER-stress induced site occupancy
changes occur is aligned. The closed arrow denotes constitutive protection from DMS methylation of
the G residue. The open arrows and star denote ER-stress inducible DMS methylation protection and
hypersensitivity, respectively. The binding sites for the transcription factors NF-Y, TFII-I and ATF6/
YY1 are underlined. (B) CV-1 cells were transfected with the –169/Luc reporter plasmid and with
either CMV-driven YY1 full-length expression plasmid or empty vector (V). Twenty-four h after
transfection, the cells were treated with 300 nM Tg for 16 h, harvested, and assayed for luciferase
activity. (C) 293T cells were transfected with the EGFP vector and either U6 siControl or U6 siYY1.
After 96 h, the cells were treated with Tg for 4 h and subjected to cell-sorting by fluorescence. RNA
was isolated from each sample and equal amounts were used as template in RT-PCR reactions using
oligo-dT primers for cDNA synthesis and gene-specific primers as indicated. PCR reactions were
carried out with 30, 26, 22 and 18 amplification cycles for determination of linear range. Data shown
was subjected to 22 cycles of PCR. (D) Quantitation of Grp78 PCR reaction products in panel C is
shown, corrected for GAPDH levels.
28
2.3.2 YY1 selectively binds the Grp78 promoter after Tg stress
To determine the mechanisms whereby YY1 can selectively activate
the Grp78 promoter upon Tg stress, we sought to determine whether YY1 itself
undergoes Tg-stress induced changes in protein level or location. Using HeLa nuclear
extracts prepared from control cells and cells treated with Tg in Western blot
analysis, we observed that YY1 is constitutively produced in similar amounts both
before and after Tg stress, as compared to the GAPDH loading control (Fig. 2.2A).
Confocal microscopy of control and Tg-treated NIH3T3 cells using antibodies
against YY1 and counterstained with propidium iodide confirmed a similar level of
YY1 and further showed that YY1 remains nuclear-localized both before and after
ER stress (Fig. 2.2B).
Next, chromatin immunoprecipitation (ChIP) assays were performed to
determine the in vivo binding kinetics of YY1 to the Grp78 promoter following Tg
treatment. NIH3T3 cells were either left untreated, or treated with Tg for 2 or 4 h.
DNA-protein complexes were immunoprecipitated with antibodies against either
YY1 or NF-Y. Purified DNA was used in PCR reactions that amplified a 223 bp
region of the proximal Grp78 promoter containing the three ERSEs, or as a control, a
248 bp region encoding exon VIII of Grp78.
In non-stressed cells, the presence of YY1 on the Grp78 promoter was barely
detectable (Fig. 2.2C). Previously, we showed a 25-fold increase in the transcription
rate of the endogenous Grp78 by 3 h of Tg treatment (Li et al.). The ChIP assay
showed a dramatic increase in YY1 binding to Grp78 after 2 h of Tg treatment which
29
persisted through 4 h of Tg treatment (Fig. 2.2C). In contrast, NF-Y was detected on
the Grp78 promoter constitutively.
The results of YY1 binding to the Grp78 promoter were confirmed to be in the
linear range of PCR by performing the same PCR reaction as in Fig. 2.2C but using
3-fold serial dilutions of the immunoprecipitated DNA (Fig. 2.2D). Finally, while
YY1 exhibited Tg stress-inducible binding and NF-Y showed constitutive binding to
the promoter region of Grp78, neither bound to exon VIII (Fig. 2.2E).
30
Fig. 2.2 ER-stress induced YY1 binding to the Grp78 promoter in vivo.
(A) 20 µg of HeLa nuclear extract from control and cells treated with Tg for 16 h were loaded
onto a SDS-polyacrylamide gel and the subsequent blot was reacted with anti-YY1 polyclonal and
anti-GAPDH monoclonal antibodies. (B) NIH3T3 cells were grown to 50% confluence in chamber
slides and treated as indicated with 300 nM Tg for 8 h. The cells were fixed and stained with anti-YY1
monoclonal antibody and counterstained with propidium iodide. The cells were visualized on a Zeiss
LSM510 confocal microscope at 400X power. (C) NIH3T3 cells were grown to 80-90% confluence
and treated with 300 nM Tg for 0, 2 and 4 h and then cross-linked with 1% formaldehyde. Chromatin
extracts were prepared and immunoprecipitation reactions were carried out with antibodies against
YY1 or NF-Y. After reversal of cross-links, DNA was subjected to PCR reactions to amplify a 223 bp
region of the Grp78 promoter. (D) Three-fold dilutions of the DNA from the YY1 ChIP assay as
shown in (C) were subjected to PCR for confirmation of linear range. (E) DNA collected from the
YY1 and NF-Y ChIP assays were subjected to PCR using primers for a 248 bp region of the Grp78
exon VIII coding region.
31
2.3.3 The nuclear form of ATF6 increases YY1 binding to the Grp78 promoter.

One mechanism for stabilization of YY1 binding the Grp78 promoter in
response to ER stress is through association with ER-stress specific transcription
factors such as the activated form of ATF6. First, to resolve the conflicting reports on
the importance of ATF6" in the induction of Grp78 in response to ER stress
(Lee, Neigeborn and Kaufman; Thuerauf, Morrison and Glembotski), primary MEFs
derived from homozygous mice with an insertional mutation of ATF6" (ATF6/#geo)
introduced by a gene trap method were used (Skarnes et al.). Western blot analysis of
the wild-type and mutant MEFs before and after Tg stress conditions confirmed that
the cells bearing the insertion expressed the ATF6/#geo fusion protein. The size of
the fusion protein is about 250 kDa, compared to the 90 kDa observed for the wild-
type protein. Upon Tg stress, the cleaved form of ATF6 was detected in the WT cells
but not the mutant form (Fig. 2.3A). A Northern blot of RNA from ATF6/#geo versus
wild-type MEFs subjected to normal culture conditions and 300 nM Tg for 16 h
shows a 25-fold induction of Grp78 mRNA levels after ER stress in wild-type cells.
However, in the ATF6 mutant cell line, the induction of Grp78 was reduced to 5-fold,
indicating that ATF6 is a major factor in the ER stress-induction pathway of Grp78
(Fig. 2.3B).

32
YY1 has been previously shown to be a co-activator of ATF6 but the mechanism is
not understood (Li et al.). To visualize co-localization of endogenous YY1 with
ATF6, Cos-7 cells were transfected with an expression vector encoding for either
HA-tagged full-length ATF6 which normally resides as an ER transmembrane protein
or HA-ATF6(373), which encodes the cleaved, nuclear form of ATF6. The cells were
then probed with anti-HA and anti-YY1 antibody, fluorescent secondary antibodies,
and viewed using confocal microscopy. As expected, p90ATF6 showed a perinuclear
staining pattern characteristic of ER localization, while the nuclear form of ATF6
showed distinct nuclear staining (Fig. 2.3C). Endogenous YY1 was observed in the
nucleus regardless of the type of ATF6 transfected and co-localization between YY1
and the nuclear form of ATF6(373) was evident in cells expressing the exogenous
protein.
In order to investigate the effect of ATF6(N) on the recruitment of YY1 to the
Grp78 promoter, 293T cells transfected with either HA-ATF6(373) or HA-
ATF6(273), a mutant, inactive form of ATF6 containing the transactivation domain
but not the b-Zip domain were subjected to the ChIP assay. An aliquot of whole cell
extract prepared from the transfected cells before cross-linking was subjected to
western blot analysis to confirm the presence of equivalent amounts of expressed
HA-ATF6(273) and HA-ATF6(373), with GAPDH used as a loading control (Fig
2.3D). The subsequent ChIP assay with anti-YY1 antibody as in Figure 2C showed
that in the presence of HA-ATF6(373), YY1 binding to the Grp78 promoter is
33
increased, but this effect is not seen in the presence of HA-ATF6(273) (Fig 2.3E),
providing direct evidence that ATF6(373) promotes YY1 binding to the Grp78
promoter in vivo.
34
Fig. 2.3 ATF6" is required for full induction of Grp78 and its nuclear form co-
localizes with YY1.
(A) Primary MEFs (wild-type) or with a #geo gene trap mutation in the ATF6" gene were cultured and
treated with Tg for 16 h. Western blot of protein extracts from control and cells with Tg were
performed with antibody against ATF6 (C1.12) (Li, 2000 #592). The bands corresponding to the wild-
type ATF6 (p90) and its nuclear form ATF6(N), as well as the ATF6/#geo fusion protein (p250), are
shown. (B) RNA was isolated from the wild-type and mutant mouse ES cells treated with Tg for 16 h.
Northern blot was performed to probe for Grp78 transcript level with GAPDH as a control. The results
were quantitated on a phosphorimager and are shown in graph format. (C) Cos-7 cells were grown to
50% confluence and transfected with either full length HA-ATF6 or HA-ATF6(373) plasmids. After a
24 h incubation, the cells were fixed and stained with anti-HA monoclonal antibody (red) and anti-
YY1 (green) polyclonal antibody. The cells were visualized on a Zeiss LSM510 confocal microscope
at 400X power. The merged image shows co-localization between the HA-ATF6(373) and YY1 in the
transfected cells (yellow). (D) 293T cells were transfected with either HA-ATF6(273) or HA-
ATF6(373), and equal amounts of whole cell extracts were subjected to sequential western blotting to
determine HA-ATF6 expression levels with the GAPDH level serving as a loading control. (E) The
transfected cells from (D) were concurrently cross-linked with formaldehyde and chromatin preps
were subjected to the ChIP assay using antibody against YY1 performed in duplicate and normal IgG
as control. PCR primers for the 213 bp region of the human Grp78 promoter encompassing the three
ERSEs were used, and the products are shown. Upper panel: cells transfected with HA-ATF6(273);
lower panel: cells transfected with HA-ATF6(373).
35
2.3.4 Mapping of the interactive domains between YY1 and ATF6
To map the interactive domains between ATF6 and YY1, co-
immunoprecipitation experiments were performed. Expression vectors coding for
HA-ATF6(373) and HA-ATF6(273) (Fig 2.4A) were transfected into 293T cells. The
cell lysates were subjected to immunoprecipitation with antibody against HA and
western blotted with antibodies against YY1 to detect co-immunoprecipitation of the
proteins. HA-ATF6(373) but not HA-ATF6(273) was able to interact with YY1.
These results show that the region of ATF6 between amino acids (aa) 273-373
encompassing the b-Zip domain is integral to its YY1 binding relationship (Fig.
2.4B).
To map the YY1 domain required for binding to the nuclear form of ATF6, co-
immunoprecipitation experiments were carried out using lysates from 293T cells
transfected with HA-ATF6(373) and expression vectors encoding for FLAG-tagged
YY1 proteins from amino acids 1-170, 1-261, 1-333, 1-414 (full-length) and 261-414
(Fig. 2.4C). Western blotting of the immunoprecipitates with antibody against HA
revealed co-immunoprecipitation of the 1-333, 1-414 and the 261-414 but not the
1-170 and 1-261 amino acid regions of YY1 (Fig. 2.4D). The 295-414 aa region of
YY1 is the zinc-finger domain required for DNA binding (Bushmeyer, Park and
Atchison). Our results indicate the region of YY1 between aa 261-333 is integral to
its interaction with ATF6(373).
36
Fig. 2.4 Mapping of YY1 and ATF6" interactive domains.
(A) Schematic drawings of the nuclear form of the HA-tagged ATF6 (amino acids 1-373) and the
truncated mutant (1-273). Locations of the transactivation and the b-zip domains are indicated. The
domain required for interaction with YY1 is bracketed on top. (B) 293T cells were transfected with
either the empty vector or the HA-ATF6 plasmids as depicted on top and whole cell extracts were
immunoprecipitated with antibody against HA. Immunoprecipitated protein preparations (top 2 panels)
as well as whole cell extract (bottom panel) were run on 8% SDS-PAGE gels and Western blotted with
either anti-YY1 or anti-HA antibodies as indicated. (C) Schematic representation of the full length
FLAG-YY1 (1-414) with its transcriptional activation, spacer and zinc-finger domains indicated. The
deletion mutants used for immunoprecipitation assays are shown below. The zinc finger domain is
indicated. The 261-333 aa region required for interaction with ATF6 is bracketed on top. (D) FLAG-
YY1 constructs as indicated on top were transfected into 293T cells. Whole cell extracts were
prepared and subjected to immunoprecipitation with anti-FLAG antibody-conjugated agarose.
Immunoprecipitated proteins resolved on a 4 to 15% gradient denaturing gel were analyzed by
Western blotting to detect HA-tagged ATF6(373) (top panel), FLAG-tagged YY1, and Western blots of
whole cell extracts with anti-HA antibodies (bottom panel).
37
2.3.5 YY1 is required for optimal ATF6 activation of the Grp78 promoter
Since YY1 is a binding partner of ATF6, we used two independent approaches
to determine the functional interaction between YY1 and ATF6. In the first
approach, NIH3T3 cells were transfected with -169/Luc as the reporter gene and co-
transfected with HA-ATF6(373) to mimic an ER stress response, either in the absence
or presence of increasing amounts of the 1-170 and 260-414 domain of YY1. The
prediction was that overexpression of domain 260-414 but not 1-170 will titrate
ATF6(373) away from productive interaction with endogenous YY1 and possibly
other protein partners, thus negatively affecting its activity towards the Grp78
promoter. As expected, we observed a 15-fold induction of the Grp78 promoter in the
presence of exogenous ATF6(373), and this induction was unhampered by the
addition of increasing amounts of transfected FLAG-YY1(1-170). However, in the
presence of increasing amounts of transfected FLAG-YY1(260-414), the form of
YY1 that showed distinct interaction with HA-ATF6(373), there was a dose-
dependent attenuation of Grp78 promoter activity (Fig. 2.5A). These results show
that overexpression of a non-functional YY1 subfragment that is capable of
interfering ATF6 binding with endogenous YY1, as well as blocking the YY1/ATF6
binding site on the Grp78 promoter, results in functional consequences.
In the second approach, using siRNA directed against YY1, we sought to
directly determine the requirement of YY1 for ATF6 activity on the Grp78 promoter.
Using a U6 plasmid encoding for a dsRNA oligo targeted against YY1, it was
determined that with a 70% transfection efficiency of the U6 siYY1 plasmid (counted
38
by EGFP fluorescence), a substantial decrease in the level of YY1 in 293T cells could
be seen by Western blot as compared to cells transfected with the U6 siControl (Fig.
2.5B). In subsequent transfection assays, either the U6 siYY1 plasmid or U6
siControl, and EGFP expression plasmids were co-transfected with the -169/Luc
reporter vector. Approximately 96 h after transfection with U6 siYY1, the same cells
were transfected with HA-ATF6(373) and assayed for luciferase activity 24 h later.
These assays revealed that induction of the Grp78 promoter in response to increasing
amounts of exogenous ATF6(373) was negatively affected by the reduction of the
endogenous level of YY1 (Fig. 2.5C). Thus, YY1 contributes to optimal activation of
the Grp78 promoter by the nuclear form of ATF6. by EGFP fluorescence), a
substantial decrease in the level of YY1 in 293T cells could be seen by Western blot
as compared to cells transfected with the U6 siControl (Fig. 2.5B). In subsequent
transfection assays, either the U6 siYY1 plasmid or U6 siControl, and EGFP
expression plasmids were co-transfected with the -169/Luc reporter vector.
Approximately 96 h after transfection with U6 siYY1, the same cells were
transfected with HA-ATF6(373) and assayed for luciferase activity 24 h later. These
assays revealed that induction of the Grp78 promoter in response to increasing
amounts of exogenous ATF6(373) was negatively affected by the reduction of the
endogenous level of YY1 (Fig. 2.5C). Thus, YY1 contributes to optimal activation of
the Grp78 promoter by the nuclear form of ATF6.
39
Fig. 2.5 YY1 is required for optimal activity of nuclear ATF6.
(A) 293T cells were transfected with ATF6(373), -169/Luc, CMV #-gal and increasing
amounts of either FLAG-YY1(1-170) or FLAG-YY1(260-414). Cell extracts were prepared and
assayed for luciferase activity. Values corrected for transfection efficiency by #-gal activity are
plotted. The standard deviations are shown. (B) 293T cells were transfected with EGFP vector and
either U6 siControl or U6 siYY1. Transfection efficiency was determined to be at least 70% by GFP.
Extracts were prepared 96 h after transfection and analyzed by Western blot using antibodies against
YY1 and GAPDH. (C) 293T cells transfected with U6 siControl or U6 siYY1, -169/Luc and CMV #-
gal vectors were grown for 96 h. Cells were then transfected with ATF6(373) and 24 h later cell
extracts were prepared and assayed for luciferase activity. Fold induction for each condition after
normalization for #-gal activity is plotted with standard deviations. The amount of transfected
ATF6(373) in $g is shown at the bottom.
40
2.3.6 YY1 recruits the chromatin-modifying protein PRMT1 to the Grp78 promoter
after ER stress
In addition to binding to transcription factors, YY1 can bind chromatin
modifiers such as the histone H4 [Arg3]-specific methyltransferase PRMT1, thereby
enhancing transcription (Rezai-Zadeh et al.). To determine the binding characteristics
of YY1 and PRMT1 in control and Tg-stressed cells, we performed a co-
immunoprecipitation reaction using Cos-7 cells stably transfected with F-YY1.
Immunoprecipitation with anti-Flag M2-conjugated agarose beads and subsequent
Western blotting with anti-Flag and anti-PRMT1 antibodies revealed complex
formation between YY1 and PRMT1 both before and after Tg-induced stress, and
this complex was not observed in immunoprecipitation with normal mouse IgG (Fig.
2.6A).
Since YY1 selectively binds the Grp78 promoter in vivo in response to ER
stress, the association between YY1 and PRMT1 predicts that PRMT1 may also bind
the Grp78 promoter in the ER-stressed nuclei. ChIP assays reveal that PRMT1
exhibits increased binding to the Grp78 promoter in Tg-stressed cells, as does YY1
(Fig. 2.6B). In accordance with its histone methyltransferase activity, the level of
histone H4 arg3 methylation associated with the Grp78 promoter was substantially
elevated. As a negative control, PCR was carried out using primers against exon VIII
of Grp78 and no PCR product was detected (data not shown). These in vivo results
reveal that PRMT1 is recruited along with YY1, correlating with Tg stress-induced
H4R3 methylation.
41
To further explore the role of PRMT1 in the induction of the Grp78 promoter,
we performed transfection assays in CV-1 cells using the -169/Luc and a combination
of plasmids coding for YY1, ATF6(373) and PRMT1. We first examined the effect of
expressing increasing amounts of PRMT1 on the induction of the Grp78 promoter in
non-stressed cells. The results show that within the range of plasmids being tested, in
the absence of over-expression of its known co-factor YY1, PRMT1 has little to no
effect on the basal -169/Luc activity (Fig. 2.6C). Next, we established the optimal
conditions for the synergistic effect of YY1 on the Grp78 promoter induction by
ATF6(373) by using a fixed amount of ATF6(373) expression plasmid and increasing
amounts of the full-length flag-tagged YY1 expression plasmid (Fig. 2.6D). The
results showed that YY1 activation of ATF6(373) was dosage dependent, such that at
higher concentration of YY1, the activation was attenuated. Finally, when both YY1
and ATF6(373) were included in the transfection at a level where ATF6 induces the
Grp78 promoter and YY1 enhances that induction, co-transfecting increasing
amounts of PRMT1 expression plasmid results in increased activity of the -169/Luc
reporter plasmid in CV-1 cell (Fig 2.6E). Additionally, PRMT1 showed no effect on
the induction of the Grp78 promoter by ATF6(373) in the absence of YY1. The
PRMT1 over-expression has been determined to have no effect on the expression
plasmids encoding for HA-ATF6(373) or CMV-YY1 (data not shown). These results
show that PRMT1, in the presence of YY1, is able to enhance the transcriptional
activation of the Grp78 promoter by the nuclear form of ATF6. Although the increase
42
is modest (1.8-fold), this represents further enhancement over a 6- to 8-fold already
achieved by a combination of ATF6(373) and YY1.
43
Fig. 2.6 PRMT1 is recruited to the Grp78 promoter in Tg-stressed cells and enhances
activation mediated by YY1 and ATF6(373).
(A) Cos-7 cells were stably transfected with F-YY1 and CMV-Bsd. Cells were either cultured under
normal conditions or treated with Tg for 3 h and harvested. Whole cell extracts were
immunoprecipitated with either normal mouse IgG or anti-Flag M2 agarose. Immunoprecipitates were
then run on an 8% PAGE and probed with antibodies against either Flag or PRMT1. A31 cell extract
was used as a positive control for the presence of PRMT1. (*) indicates a non-specific band. (B)
HeLa cells were treated with Tg for 3 h, chromatin extracts prepared as in Fig. 4 and
immunoprecipitation was carried out with antibodies against YY1, PRMT1, and methylated arginine 3
residue of histone H4, as well as normal IgG. Products of the PCR reaction using primers for the 213
bp region of the Grp78 promoter are shown. In each transfection experiment, CV-1 cells were
transfected with -169/Luc reporter vector and CMV-Renilla luciferase control vector; pBluescript was
used as empty vector. Cells were harvested 24 h after transfection and assayed for dual-luciferase
activity. (C) Increasing amounts of PRMT1 expression plasmid (in ng) were co-transfected as
indicated. (D) Increasing amounts of YY1 expression plasmid (in ng) were co-transfected to establish
the synergistic induction of the Grp78 promoter by YY1 in the presence of ATF6(373). (E) Increasing
amounts of PRMT1 (in ng) was co-transfected with YY1 and ATF6(373) expression plasmids. The
luciferase activity of the -169/Luc reporter gene alone is set at 1. * indicates p-value < 0.05
44
2.3.7 YY1 recruits the acetyltransferase p300 to the Grp78 promoter
To further characterize the role of YY1 in the recruitment of chromatin-
modifying co-factors to the Grp78 promoter, we looked for evidence of that the
histone acetyltransferase p300, a well-known binding partner of YY1, was involved.
We again employed ChIP assays in HeLa cells to test recruitment of p300 to the
Grp78 promoter and functional evidence of its binding.
We observed that p300, much like PRMT1, exhibits increased binding to the
Grp78 promoter in Tg-stressed cells, and this binding is concurrent with acetylation
of Histone H4 (Fig. 2.7A). The relatively constant level of histone H3 binding to the
Grp78 promoter served as a positive control for the ChIP experiment, and
immunoprecipitation with normal mouse IgG served as negative control. Since it has
been shown that histone methyltransferase and acetyltransferase activity can
synergistically activate the transcription of a promoter (Koh et al; Lee et al.), we
further tested the contribution of p300 to the activation of the Grp78 promoter in
transfection assays. Using CV-1 cells in conditions identical to transfection assays in
Fig. 2.6, we observed a p300-mediated increase in activation of the Grp78 promoter
over the YY1/ATF6(373) induction (Fig. 2.7B).
The p300 over-expression has been determined to have no effect on the
expression plasmids encoding for HA-ATF6(373) or CMV-YY1 (data not shown).
Addition of PRMT1 to the transfection further enhanced this activity, raising the
possibility that PRMT1 may work in conjunction with p300 to activate the Grp78
promoter after ER stress. Furthermore, the enhancing activities of p300 and PRMT
45
are largely dependent on YY1, suggesting that YY1 is the molecular link between
these chromatin modifiers and activation of the Grp78 promoter by ER stress.
46
Fig. 2.7 p300 is recruited to the Grp78 promoter in Tg-stressed cells and its
enhancing activity is dependent on YY1.
(A) The ChIP assays were performed with HeLa cells as described in Fig. 2.6B. The
immunoprecipitation assays were carried out with normal IgG or antibodies against p300, AcH4 and
histone H3, and the primers for PCR are identical to the ones used in Fig. 2.6B. (B) CV-1 cells were
transfected and assayed for luciferase activity as described for Fig. 2.6E except 0.1 µg of p300
expression plasmid was co-transfected as indicated.
47
2.4 Discussion
The transcriptional activation of Grp78 has been used extensively as a standard
indicator for the trigger of the UPR, a process that has numerous implications in
health and disease (Lee et al; Koh et al.). The induction of GRP78 confers protection
against ER stress due to its anti-apoptotic properties and represents the survival arm
of the UPR (Koh et al; Little et al; Rao, 2002; Reddy et al.). Important advances have
been made in discovering the ERSE as the most critical element mediating the stress
induction of the Grp78 promoter and specific transcription factors have been
identified that serve as activators for the ERSE. Here, using induction of the Grp78
promoter by Tg stress or transfection of ATF6(373) as models for the activation of
the UPR, we uncover several mechanisms including chromatin remodeling, for the
activation of the Grp78 promoter in response to the UPR.
In non-stressed cells, NF-Y is present on the Grp78 promoter and may play a
role in suppressing its activity through interactions with transcriptional repressors
(Schuettengruber, 2003; Uramoto, 2004). The presence of a high-affinity NF-Y
binding site has been previously shown to be necessary for ATF6-mediated induction
of the Grp78 promoter (Li et al.) and it may also attract other co-activators and
chromatin modifiers to the promoter, resulting in activation (Caretti et al.). Following
ER stress NF-Y binding is preserved and TFII-I binding is enhanced (Parker et al;
Hong et al.), ATF6 is cleaved within 1 hr of Tg stress treatment and its active form,
ATF6(N), locates to the nucleus and interacts with YY1. This facilitates binding of
YY1 to the Grp78 promoter, and further, the YY1 interactive partner PRMT1 is
48
recruited to the Grp78 promoter, correlating with the appearance of methylated
histone H4 at the arginine 3 residue. Additionally, the histone acetyltransferase
enzyme p300, a known interacting factor of both NF-Y and YY1, is recruited to the
Grp78 promoter after ER stress, resulting in the acetylation of histone H4. It has been
shown in the yeast system that the histone acetylase GCN5 is required for full ER-
stress induction of the Grp78 promoter (Welihinda et al.). Previously, we
hypothesized that the mammalian Grp78 gene system may also be regulated in an
analogous manner (Foti et al.). Since NF-Y can also associate with human GCN5 and
YY1 can also recruit histone acetyltransferases (Currie; Gazit et al.), these may
contribute to the acetylation of histones associated with the ERSE on the Grp78
promoter, resulting in transcriptional activation. To our knowledge, these results
provide the first evidence that the UPR induces specific acetylation and methylation
modifications of nucleosomes at the promoter of a major target gene in a mammalian
system.
The selective activation of the Grp78 promoter by YY1 in ER stressed cells
provides a novel model to address an intriguing issue of how a constitutively
expressed transcription factor can regulate gene activity under specific physiological
conditions. Here we discover that while the amount and localization of YY1 are not
affected by ER stress, in vitro binding of YY1 to the Grp78 promoter as revealed by
ChIP assays is much more pronounced in the nuclei of stressed cells. How might
YY1 only bind to the Grp78 promoter after ER stress? Since the YY1 binding site on
the ERSE is atypical (Li et al.), it is possible that YY1 needs to be in a complex that
49
confers higher stability in order to bind to that site in vivo. We propose that one
mechanism is through the association of YY1 with the nuclear form of ATF6, which
is only produced following ER stress. In support, we show that in the presence of an
exogenously expressed form of activated ATF6, YY1 exhibits increased binding to
the Grp78 promoter. We further map the domains required for physical interaction
between YY1 and ATF6 and have determined that it involves the b-zip domain of
ATF6 and the region bordering the zinc finger domain of YY1. Importantly, these
same domains are required for ATF6 and YY1 activation of the Grp78 promoter (Li
et al.). Further, depletion of endogenous YY1 level by siRNA, as well as
overexpression of the YY1 interacting domain with ATF6, interfere with the ability of
the nuclear form of ATF6 to activate the Grp78 promoter, confirming functional
interaction between the two proteins in vivo and the role of YY1 as a co-activator of
ATF6.Our study also provides new evidence on the requirement of ATF6 towards the
induction of chaperone promoters such as Grp78. In a study using siRNA targeted
against ATF6" in MEFs (Lee, Neigeborn and Kaufman), it was reported that ER-
stress induction of Grp78 mRNA was unaffected, suggesting that ATF6" is a
dispensable transcription factor in the UPR. However, in another study, siRNA
targeted against human ATF6" dramatically reduced tunicamycin-induced induction
of the Grp78 promoter in HeLa cells (Thuerauf, Morrison and Glembotski). Here,
using MEFs where ATF6" is produced as a 250 kDa fusion protein resulting from
insertional mutagenesis and ER-stress induced ATF6" cleavage is inhibited most
likely due to the bulky luminal domain (Shen, Zhang and Kaufman), we showed that
50
Tg induction of the endogenous Grp78 mRNA was severely compromised. Thus, in
our assay system ATF6" is required for the optimal stress induction of Grp78.
The discovery that PRMT1 and p300 can enhance transcriptional activation of
the Grp78 promoter adds to the diversity of its induction profile. This functional
synergy derived from the interaction of a transcription factor with PRMT1 in the
presence of p300 has been explored in a p53-dependent transcription activation
system with similar results
(Arai et al.). The additive effect of PRMT1 and p300 in a transfection assay yields a
2-fold increase in the ATF6(373) and YY1-mediated induction of -169/Luc, which is
remarkable considering that addition of YY1 already doubles the induction of
ATF6(373). Another consideration in the induction profile of Grp78 by chromatin
modifiers is the kinetics of the assembly of the transcriptional activation machinery
at the promoter level. It has been shown that PRMT1-mediated methylation of
arginine 3 on histone H4 presents a better substrate for p300-directed acetylation
(Wang, 2001). Since p300 is capable of acetylating multiple lysine residues on all
four histones (Schiltz et al.), PRMT1 association may be the initial trigger necessary
for full chromatin modification to occur. Furthermore, it has been reported that
PRMT1 is responsible for the first chromatin modification related to immediate
proteasome assembly in estrogen receptor-" directed activation of the pS2 gene
promoter (Metivier et al.). This would infer that the role of PRMT1 may be to prime
the chromatin for modification and subsequently allow maximal transcription of the
Grp78 promoter in response to ER stress.
51
Interestingly, another histone and transcription factor acetyltransferase, P/
CAF, has been previously shown to associate with and acetylate the same region of
YY1 as p300, as well as an additional domain on aa 170-200
(Yang, Yao and Seto). The ability of P/CAF to modify chromatin is limited to
acetylation of lysine 14 on histone H3 and lysine 8 on histone H4 (Schiltz et al.) and
it is not known if PRMT1 enhances this activity. However, P/CAF is unable to
enhance the transcriptional activation of Grp78 when it is transfected in place of
p300 in the presence of YY1, ATF6(373) and PRMT1 (data not shown). This result
suggests that the role of p300 in transcriptional enhancement of the Grp78 promoter
is unlikely due to acetylation of YY1, and increases the chance that the mode of
action is chromatin-directed. Future studies will be required to confirm this
hypothesis. Thus, upon ER stress, we propose that a multiprotein complex including
YY1 and ATF6, as well as PRMT1 and possibly p300, occupies the CCAGC site
giving rise to the ER stress induced DMS methylation protection pattern reported
earlier using in vivo genomic footprinting (Li et al.).
Finally, we investigated whether YY1 is an essential transcription activator
for Grp78 induction by ER stress. Through the use of siRNA, we achieved specific
suppression of YY1 expression in 293T cells and observed that Tg induction of
Grp78 dropped from 6- to 2-fold, revealing that YY1 is an important factor in Grp78
activation during the UPR. In contrast, genetic knock-down of known UPR regulators
IRE1 and XBP-1 showed minimal or no effect on ER stress induction of Grp78 (Lee,
Neigeborn and Kaufman; Lee et al.). The essential role of YY1 could be due to its
52
multiple functions, from serving as a transcriptional activator itself to serving as a
co-activator of ATF6, to recruiting the methyltransferase PRMT1 and histone
acetylases, thereby activating transcription. Likewise, evidence is emerging that the
transcriptional activators themselves are targets of post-translational modifications,
adding another layer of regulation on their function, and YY1 is an example whose
function can be regulated by acetylation and deacetylation (Imhof et al; Sartorelli et
al; Yang, Yao and Seto). It would be interesting to investigate whether or not the
transcription factors associated with the ERSEs are themselves targets of the histone
modifying enzymes, and if these modifications are essential for UPR target
induction.
53
Chapter 3
Identification of HDAC1 as a negative regulator of the Grp78 promoter
3.1 Introduction
The unfolded protein response (UPR) is an evolutionarily conserved
mechanism whereby cells respond to physiologic stress conditions that target the
endoplasmic reticulum (ER). For example, when mammalian cells experience
prolonged perturbations in the ER in the form of calcium depletion stress, a block in
N-linked protein glycosylation, or exposure to protein denaturing agents, there is an
accumulation of unfolded proteins in the ER lumen. Induction of the UPR triggers
intracellular signaling pathways that allow the damaging presence of malfolded
proteins in the ER lumen to be communicated to the nucleus and cytoplasm. A major
cellular target of the UPR is GRP78/BiP, an ER chaperone that not only binds to
unfolded proteins but also regulates the activation of ER stress transducers such as
IRE1, PERK and ATF6. As such, the transcriptional activation of the Grp78
promoter is used extensively as a biological marker for onset of the UPR.
An unusual feature of the mammalian Grp78 promoter is that it contains
multiple copies of CCAAT elements flanked by GC-rich sequence. These have been
shown to be repetitive units of the ER stress response element (ERSE) which is
conserved from invertebrates to plants and human. The ERSE exhibits a tripartite
structure CCAAT-N9-CCACG and is considerably more complex than the yeast ER
stress element referred to as the unfolded protein response element (UPRE). In yeast
cells, ER stress leads to activation of IRE1, which induces mRNA splicing and
54
translation of Hac1, which in turn binds to the UPRE and activates target gene
transcription. This activation may also incorporate chromatin modifications via the
recruitment of a complex containing yGCN5 and Ada gene products by IRE1, leading
to histone acetylation and promoter activation. The role of chromatin modifications
as well as the recruitment of chromatin-modifying enzymes by known transcription
factors in the mammalian strss response has not yet been delineated.
The transcription rate of the Grp78 promoter in mammalian cells is either
barely detectable or at a low basal level in non-stressed cells, and is induced by 20-
fold following treatment of cells with thapsigargin (Tg) which blocks the ER
calcium-ATPase pump and depletes the ER calcium stores. The Tg-induced stress
activation of Grp78 is primarily mediated by the ERSE, although part of the response
may also be attributed to an ERSE-independent pathway. ERSE-binding
transcription factors include NF-Y (also referred to as CBF), YY1, and the nuclear
form of ATF6 (p60) generated by SIP/S2P cleavage of a precursor form (p90)
following ER stress. NF-Y and YY1 were shown to constitutively bind the CCAAT
and CCACG regions, respectively, by in-vitro binding assays performed with nuclear
extracts and synthetic oligomers. Conversely, p60ATF6 is unable to bind to DNA,
but it is involved in the activation of the ERSE through complex formation with NF-
Y in a manner dependent on the CCACG sequence.
Previously, in vivo footprinting showed that the YY1/ATF6 binding site
exhibited specific changes before and after ER stress whereas the NF-Y binding site
was continuously occupied regardless of ER homeostasis status. Importantly, these
55
inducible changes in factor occupancy were observed under diverse ER stress signals,
suggesting that it is a common and important mechanism for UPR induction of its
target genes. However, the significance of NF-Y binding and ER-stress induced
changes on the YY1/ATF6 binding site on UPR target gene expression remains to be
determined.
The mammalian transcription factors NF-Y and YY1 are ubiquitously
expressed, multifunctional proteins involved in both positive and negative regulation
of gene expression. Evidence is emerging suggesting that the mechanism for the
diverse functions of NF-Y and YY1 is based on their ability to recruit specific protein
complexes to specific promoter loci. In addition to facilitating the loading of
transcription factor complexes onto specific target promoters, NF-Y, as well as YY1,
can also interact with histone–modifying enzymes that subsequently alter chromatin
structure or change the acetylation status of the proteins binding to the promoter
sequence.
The role of Grp78 in cancer has been established as an indicator of drug-
resistance and poor prognosis. Specifically, in the micro-environments of solid
tumors, GRP78 is induced by physiological stress conditions such as hypoxia, low
pH, and glucose deprivation. Since it is a pro-survival protein, and is also induced in
the tumor microenvironment, understanding the mechanism of its transcriptional
repression has the potential for a diverse range of applications.
Towards an understanding of this mechanism, the involvement of the histone
deacetylase enzyme HDAC1 has shown to be a factor in the regulation of the Grp78
56
promoter. Acetylation itself is a key event in the regulation of cellular pathways, and
the deacetylases complete the circle. This post-translational modification of proteins
is not limited to histones, there are many other proteins whose activity can be altered
by acetylation. Subsequently, both histone acetyltransferases (HATs) and histone
deacetylases (HDACs) have emerged as targets for drugs that would seek to regulate
these pathways. In these experiments, we seek to provide a framework for the
understanding of the regulation of the Grp78 promoter by a histone deacetylase
through the canonical ER stress elements.
57
3.2 Materials and Methods
3.2.1 Cell lines, culture, and drug treatment conditions
HCT116 and HT29 cell lines were provided by Dr. Robert Ladner. U87 and
LN229 cell lines were obtained from the American Tissue Culture Collection. The
cells were propagated in DMEM supplemented with 10% fetal bovine serum, 100
units/mL penicillin, 0.1 mg/mL streptomycin at 37°C, and 5% CO2. Thapsigargin
and Trichostatin A were obtained from Sigma-Aldrich. Thapsigargin was dissolved
in DMSO at 1mg/ml and added to the cell culture to a 300nM final concentration.
Trichostatin A was dissolved in DMSO at a concentration of 300mM. MS-275 was
purchased from CalBiochem (La Jolla, CA) and dissolved in DMSO at a 1.0 mM
concentration.
3.2.2 Immunoblots and antibodies
Fifty micrograms of total cell lysate prepared in radioimmunoprecipitation
assay buffer were processed for Western blot analysis as described (Harlow E, Lane
D 1999). The antibodies against GRP78, CHOP, b-actin, GAPDH, HSP70, His, PDI,
PARP (Santa Cruz Biotechnology, Inc.), caspase-7 (BD PharMingen), GRP94
(Stressgen) and FLAG (Sigma) were used according to the manufacturer's
recommendations. The secondary antibodies were coupled to horseradish peroxidase,
and were detected by chemiluminescence using SuperSignal West substrate (Pierce).
Each immunoblot was done at least twice to confirm the results.
58
3.2.3 Plasmid Construction
All luciferase reporters utilize the pGL3Basic vector backbone. For the
construction of Grp78 promoter deletion mutants, the -169Luc plasmid was used as a
template in a PCR reaction with the downstream primer
5’ATCTCGAGGTCCAAGTCAGTGTAGTCACAGCCAGTA3’ which contains an
Xho1 site at the 3’ end. The primers are listed in table 3.1. They were used to create
an Nhe1 site on the 5’ end of the fragment and an Xho1 site on the 3’ end. The PCR
product was digested with Nhe1 and Xho1, purified, and ligated into pGL3Basic at
the same sites to obtain the final plasmids. The ERSE mutants were generated by
site-directed mutagenesis and the primers are listed in table 3.1. For the construction
of -112Luc ERSE#1 mutants m1, m2, m3 and m4, the primers are listed in table 3.1.
All plasmids were confirmed by sequencing in each direction.
3.2.4 Transient transfection and luciferase assay
The Flag-tagged HDAC expression vectors and pGL191were kindly provided
by Dr. Ed Seto. All transfections were carried out using Lipofectamine 2000
(Invitrogen) per the manufacturer's guidelines. For reporter assays, cells were plated
in 96-well plates at a density of 200,000 cells/well with the transfection mixture and
incubated with Dulbecco's modified Eagle's medium containing 10% fetal calf serum
overnight. TSA, MS-275, or 100% DMSO was added to the culture medium 24 h
after transfection, and cells were incubated at 37°C for an additional amount of time
before harvesting with 50 $l of lysis buffer (Promega). Protein concentrations of all
59
samples were determined using BPA reagent (Bio-Rad), and the relative luciferase
activity was measured with firefly assay reagent (Promega) and a luminometer.
3.2.5 Small interfering RNA
The siRNA against Grp78 was previously described (Tsutsumi S, Namba T
2006). The siRNAs against human HDAC1, 2 and 3 were purchased from Applied
Biosystems. The control siRNA was purchased from Molecular Probes/Invitrogen
and contains an alexa-fluor fluorescent tag to determine transfection efficiency.
HeLa cells were grown to 80% confluence in 12-well dishes and transfected with 10
nM concentrations of either control siRNA or gene-specific siRNA, and with or
without 0.2 $g of -112 Luc or pGL181sx reporter plasmids using Lipofectamine 2000
transfection reagent (Invitrogen) according to the manufacturer's instructions. The
transfected cells were incubated for 48-72 hr after transfection before harvesting.
3.2.6 RT-PCR analysis
The HCT116 and HeLa cells were treated as indicated or transfected as
described and total RNA was extracted using TRIZOL (Invitrogen) following the
manufacturer's instructions. First-strand cDNA was synthesized with the Superscript
First-Strand Synthesis System for RT-PCR (Invitrogen). To detect human mRNA,
PCR was performed using the primers listed in table 3.2.
60
3.2.7 Chromatin immunoprecipitation
The ChIP assay was carried out as previously described (Baumeister et al; Gal-
Yam et al.). Stably transfected HeLa cells were grown in 15cm plates under normal
cell culture conditions to 80% confluence and treated as indicated. Equal amounts of
chromatin from each sample was incubated overnight with antibodies against
HDAC1 (Upstate). After purification of the complexes, formaldehyde-induced cross-
linking was reversed (4 h at 65°C) and the DNA was purified by phenol-chloroform
extraction and ethanol precipitation. Purified DNA from the input and IP samples
was subjected to quantitative PCR with SYBR green and the results were analyzed
according to the manufacturer’s recommendations (Perkin-Elmer).
3.2.8 Immunofluorescence
Cells were fixed with 4% paraformaldehyde for 10 minutes and washed twice
with PBS. Immunofluorescence staining was performed as previously described
(Parker et al.). Antibodies against pan-acetyl AcH4 were used at 1:500 with FITC-
conjugated secondary antibodies (Vector Labs). Cells were mounted in Vectashield
with propidium iodide mounting medium (Vector Labs).
61
Table 3.1 Primer sequences used in plasmid construction
Primer Name Sequence
-169Luc 3! Xho1 5’ATCTCGAGGTCCAAGTCAGTGTAGTCACAGCCAGTA
-144Luc 5’ Nhe1 5’ATGCTAGCTTGGTGGCATGAACCAACCAGCG
-112 5’ Nhe1 5’ATGCTAGCGAGTAGCGAGTTCACCAATCGGAG
-79Luc 5’ Nhe1 5’ATGCTAGCACGGGGCTGCGGGGAGGAT
-52Luc 5’ Nhe1 5’ATGCTAGCCGAGTCGGCGACCGGC
ERSE#2m 5’GAGGCCGCTTCTGATCGGcaGCG
ERSE#1m 5’TGGCCGCTGGTCAGTTcaTGCCAC
-112 mut 1 5’CACtgATCGGAGGCCTCCACGACGG
-112 mut 2 5’CACCAATCGGAttaCTCCACGACGG
-112 mut 3 5’CACCAATCGGAGGCCTaacaGACGG
-112 mut 4 5’CACCAATCGGAttaCTaacaGACGG
62
Table 3.2 Primer sequences used in RT-PCR
Gene Upstream primer Downstream primer
Xbp-1 spliced 5'GGTCTGCTGAGTCCGCAGCAGG
GRP78 5’AACCATACATTCAAGTTGATATTGGAGGTG
CHOP 5’GCAAGAGGTCCTGTCTTCAGATG
HDAC1 5’GTTCTCCTGGTAGTGTATGC
HDAC2 5’GTAATTCCACAGTTCTGACA
HDAC3 5’CCGAAATGTTGCCCGCTGCTG
63
3.3 Results
3.3.1 Histone H4 is acetylated in the Grp78 promoter region before and after ER
stress
Based on the data from our experiments detailing the recruitment of
chromatin-modifying enzymes to the Grp78 promoter by YY1, we sought to further
define the boundaries by which histone H4 was acetylated in the context of this
stress-inducible promoter. Also, in light of findings published at the time, which
questioned the presence of nucleosome in the ERSE-region of the Grp78 promoter,
we wanted to investigate the presence of other potential nucleosomes not directly in
contact with the ERSE but that may still have the proximity to regulate transcription.
HeLa cells were treated with Tg for 3 hr and crosslinked, then subjected to the
ChIP assay with antibodies against histones H3 and H4, as well as acetylated H3 and
AcH4, with IgG as control. The IP DNA was subjected to PCR using primers
designed to amplify a region approximately 750bp downstream of the Grp78
promoter, as well as the region encompassing the ERSEs in the Grp78 promoter. The
results showed that while there was a higher fold-change of AcH4 in the downstream
region, there was still acetylation of H4 in the ERSE-containing promoter region.
Acetylated histone H3 was also present in control cells, with a jump in its presence
after Tg induction.
64
Fig 3.1 Histones H3/H4 are acetylated in the Grp78 promoter region before and after
ER stress
HeLa cells were treated with Tg for 4˚ or untreated, then harvested, crosslinked and sonicated to
less than 300 bp in length. The extracts were subjected to chromatin immunoprecipitation with the
indicated antibodies. (Upper panel) PCR analysis was carried out with the indicated primers for 30 cycles
and run on a 2% agarose gel, (Lower panel) quantitative PCR analysis of samples as above.
Input AcH3 C AcH3 Tg AcH4 C AcH4 Tg
0
0.25
0.50
0.75
1.00
ERSEs P4
65
3.3.2 Acetylated histone H4 levels increase after Tg treatment in HeLA cells
The use of fluorescent microscopy is especially useful in looking at the cellular
distribution and amount of any given protein. In this experiment we sougt to determine
the amount of acetylated histone H4 after ER stress, specifically in the more active
heterochromatin regions of the nucleus. We treated HeLa cells for 18 hr and then fixed
and stained them for AcH4 with FITC secondary. As the pictures show, there is a slight
increase of AcH4 in the Tg-treated HeLa cells and the localization is more diffuse and
spreading into the euchromatin,where active transcription usually takes place. This
indicates that the histones that are being acetylated are in contact with actively
transcribed genes.
Figure 3.2 Acetylated histone H4 increases after Tg treatment in HeLA cells
HeLA cells were treated with Tg for 18 hr and then fixed with 4% paraformaldehyde and stained
with antibody against panacetyl H4 and propidium iodide. Cells were imaged on a Canon fluorescence
microscope at 200x power.
Control Tg 18 hr
PI AcH4
Merge
PI AcH4
Merge
66
3.3.3 Thapsigargin treatment results in global acetylation.
Since the activation of Grp78 by Tg results in the acetylation of histones in its
promoter region, we sought to determine if Tg-induced ER stress would lead to an
increase in acetylation globally. A recent study by Mintz et al. documented by proteomic
analysis the induction of close to 600 proteins in the ER alone in response to Tg
treatment, and it stands to reason that there may be some similar acetylation of histones
occurring in at least some of those genes (Mintz, 2008).
We treated HeLa cells with increasing amounts of Tg and TSA as a positive
control for 18 hr and isolated WCEs for western blot analysis to determine levels of
acetylated histone H3, with GAPDH as a control. The results show that upon Tg
treatment at concentrations similar to the the ones used to induce ER stress, there is an
increase in global acetylation of histone H3. While this is not meant to convey the idea
that Tg is an HDAC inhibitor, or that all ER stress-induced proteins are regulated
transcriptionally by acetylation. We merely wished to show that there may be a common
thread between the target genes of the ER stress pathway similar to the events described
for the Grp78 promoter.
67
Figure 3.3 Thapsigargin treatment results in global acetylation.

HeLa cells were treated with either Tg or TSA for 18 hr at the concentrations indicated and then
harvested and WCEs prepared. Western blots were performed to probe for acetylated histone H3, with
GAPDH used as a control.
0 0.3 0.9 1.5 3.0 6.0 0 0.1 0.5 1.0 2.0 4.0
Thapsigargin Trichostatin A
µM
AcH3
GAPDH
HeLa cells, 18 hr
68
3.3.4 Synergistic induction of the -169Luc promoter by HDAC inhibition and Tg-
induced ER stress
For this experiment we sought to determine the inducibility of the ERSE-
containing Grp78 promoter by both an inducer of global acetylation and Tg-induced ER
stress. We transfected the -169Luc along with an SV-40 driven Luc reporter plasmid into
293T cells. Following transfection, the cells were either untreated, or treated with 500
nM of TSA or 1 mM valproic acid (VPA) for a total of 24 hr. TG treatment was at 300
nM for 18 hr. When both TG and TSA or VPA were added, the cells were pretreated with
TSA or VPA for 6 hr, then TG was added for the last 18 hr, with total incubation time of
24 hr. The results showed that treatment with the histone deacetylase inhibitor TSA in
conjunction with Tg resulted in substantially higher activation of the -169 promoter
fragment, a 65-fold induction as opposed to a 16-fold with TSA alone or a 4.4-fold with
Tg alone. A similar phenomenon was observed with VPA treatment. These data show
that the pathways by which Tg and TSA induce the Grp78 promoter are not only different
in some respects, but that they may actually complement each other. The prevailing
wisdom states that transcription is facilitated when histones are acetylated, so the
induction of Grp78 by Tg after treatment with TSA may occur more rapidly and
vigorously as a result. Another interpretation of this is that the activating factors
undergoing differential acetylation during the Tg-induced stress response may be already
primed and the activation of target genes occurs more rapidly and with higher levels of
transcript.
69
Fig 3.4 Synergistic induction of the -169Luc promoter by HDAC inhibition and Tg-
induced ER stress
The -169 Luc reporter or SV40-driven luciferase reporter plasmid was transiently transfected into
293T cells, The cells were then either treated with 500 nM of TSA or 1 mM vaporic acid (VPA) or
untreated for a total of 24 hr. TG treatment was at a concentration of 300 nM for 18 hr. When both TG and
TSA or VPA were added, the cells were pretreated with TSA or VPA for 6 hr, then TG was added for the
last 18 hr, with total incubation time of 24 hr.
70
3.3.5 Induction of GRP78 in vitro and in vivo by histone deacetylase inhibitors
We examined GRP78 levels in five separate cancer cell lines incubated in a
500nM concentration of the HDACi trichostatin A(TSA) for 24 hr. We consistently
observed GRP78 induction in the human colon cancer cell lines HCT116 (wt p53)
and HT29 (p53 mutant), the human breast adenocarcinoma cell line MCF-7 and the
human glioma cell lines LN229 and U87 (Fig 3.5A). The transcriptional activation
of the Grp78 promoter was confirmed by RT-PCR using RNA isolated from HCT116
cells treated with either 500nM TSA for 12 hr or 300nM Thapsigargin (Tg) for 4 hr.
CHOP and spliced XBP-1 levels were unaffected by TSA treatment but were induced
in the presence of Tg (3.5B). In order to further investigate the effect of TSA on
tumor cells in vivo, nude mice with MDA/MB-435 xenografts were injected with
500mg/Kg of TSA once daily for four days and then sacrificed. The tumors were
removed and protein extracts were subjected to western blot, which shows induction
of GRP78 but not the stress-inducible heat-shock protein HSP70 (3.5C).
In order to test whether the HDACi-induced expression of GRP78 was
synergistic with its induction in response to ER stress, we pre-treated HCT116 cells
with increasing amounts of the Class I HDAC-inhibitor MS-275 for 24˚ and then
treated with 300nM Tg for 16˚. The combinatorial treatment with both Tg and
MS-275 resulted in the overall enhanced expression of GRP78 compared to either Tg
or MS-275 alone (Fig. 3.5D).
71
Fig 3.5 Induction of GRP78 by histone deacetylase inhibitors and ER stress inducers

(A) Cells as indicated above were either treated with TSA or untreated for 24 hr. WCE’s were
prepared and run on SDS-PAGE and subjected to western blot with antibodies against GRP78 and
GAPDH. (B) HCT116 cells were treated with Tg for 6 hr or TSA for 12 hr and then harvested for
RNA isolation. The RNA was subjected to RT-PCR analysis for GRP78, CHOP, spliced Xbp-1 and
GAPDH and run on an agarose gel. (C) MDA-MB-435 cells were injected into
immunocompromised mice and xenografts established. Mice were injected with TSA twice daily for
four days and the tumors were harvested. WCE’s were prepared and western blotting for GRP78,
HSP70 and Actin were performed. (D) HCT116 cells were treated with indicated amounts of MS-275
for 24 hr and then treated with Tg for 18 hr. WCE’s were prepared and western blots for GRP78 and
GAPDH were performed.
Ctrl
GRP78
CHOP
XBP1(S)
GAPDH
TSA Tg
A
U87 LN229
TSA
GRP78
GAPDH
HCT116 HT29 MCF7
+ - + - + - + - + -
0.1 0.5 1.5 µM MS-275:
Tg:
GRP78
GAPDH
0.1 0.5 1.5
- -
- + + + + - - -
B
D
C
Ctrl TSA
GRP78
B -Actin
HSP70
8.3 1.1 2.8 3.9 7.2 14.5 21.0 1.0
72

3.3.6 Identification of the HDACi response elements in the Grp78 promoter.
Previous studies have characterized the ER stress-inducible promoter of Grp78 and
its conserved elements, or ERSEs. First, utilizing a pGL3 basic backbone, we
constructed deletion mutants -169Luc, -144Luc, -112Luc and -79 Luc that contained
three, two, one and no ERSEs, respectively. Another mutant, -52Luc, was
constructed that contained the sequence immediately downstream of the TATA box to
the transcription start site. These were transfected into HeLa cells and 24˚ later were
treated with either 500nM of TSA or 1.5mM of the HDAC class I specific inhibitor
MS-275, or untreated. As shown in Fig. 3.6A, the -112Luc promoter was the
minimal promoter fragment sufficiently inducible at 6 to 7.5-fold over control levels,
and this was similar to the level of induction observed in the -144Luc and -169Luc
plasmids. The -79Luc and -52Luc showed no response to HDACi treatment,
confirming that ERSE#1 was adequate for HDACi-induced expression of the Grp78
promoter. In order to determine whether or not ERSE#1 was exclusively required for
HDACi-induced activity and to determine the contribution of ERSE#2 or 3, plasmids
containing two base-pair mutations in the CCAAT region of specific ERSEs were
constructed as shown in the diagram in Fig 3.6B. These were used in transfections
similar to Fig. 3.6A and the results show that ERSE#1, which is contained in the
-169(ERSE2m) and -112Luc, and is closest to the TATA box, is sufficient and
necessary for HDACi-mediated induction of the Grp78 promoter.
73
To determine the specific elements of the tripartite-structured ERSE#1
responsible for the induction of the Grp78 promoter by HDACi, the -112Luc plasmid
was used as a template for creating plasmids containing mutations that prevented the
binding of transcription factors with specific affinity for elements within ERSE#1.
The constructs mut1, mut2 and mut3 contained mutations in the NF-y, TF-II-I/Sp
and YY1/ATF6 binding sites, respectively. An additional mutant, mut 4, contained
mutations in both the YY1/ATF6 and TFII-I/SP binding sites. Transfections carried
out under similar conditions to Fig 3.6A and B show that the NF-Y binding site is
required for the HDACi-induced transcription of the -112Luc promoter fragment.
(Fig. 3.6C). These data suggest that the a single ERSE, specifically the CCAAT
element binding NF-Y, is the regulatory region for HDACi-induced expression of the
Grp78 promoter.
74
Fig. 3.6 Identification of the HDACi response elements in the Grp78 promoter
(A), (B), and (C) Plasmids were transfected into HeLa cells and incubated for 24 hr. The cells
were then treated with either TSA or MS-275 for 24 hr or left untreated and then harvested. WCEs were
isolated and and subjected to luciferase assay. Luciferase activity is shown relative to the untreated
control. The standard deviations are shown.
B
A
0 3 6
Fold Induction
1 2 4 5 7 8
-52
-112
-144
-169
-79
Ctrl
TSA
MS-275
TATA
-169 (ERSE2m)
-169 (ERSE1m)
-144 (ERSE1m)
-112 wt
Ctrl
TSA
MS-275
TATA
0 3 6 1 2 4 5 7 8
Fold Induction
0 3 1 2 4 5 6
Relative Luciferase Activity
7 8
C
-112 wt CCAATCGGAGGCCTCCACG
CtgATCGGAGGCCTCCACG mut 1
CCAATCGGAttaCTCCACG mut 2
CCAATCGGAGGCCTaacaG mut 3
CCAATCGGAttaCTaacaG mut 4
Ctrl
TSA
MS-275
75
3.3.7 Grp78 promoter repression is mediated by HDAC1.
In order to determine the specific HDACs involved in the negative regulation
of the Grp78 promoter, we utilized the specificity of MS-275, an HDAC inhibitor
that only blocks HDAC1, -2 and -3 at the concentrations used in this experiment and
yet still induces GRP78 at the promoter and protein levels to narrow the scope of the
investigation (Suzuki/Fukazawa 1999). Therefore, to determine which HDACs are
responsible for the repression of the Grp78 promoter, we transfected HeLa cells with
flag-tagged HDAC1, -2 and -3 expressing plasmids along with -169Luc, -112Luc,
-79Luc and the HDAC3-repressible luciferase reporter plasmid pGL191 and
measured luciferase activity after a 72˚ incubation. Overexpression of HDAC1 had
the most significant effect on the Grp78 promoter, causing a ten-fold decrease in
transcription of the -112Luc reporter and a lesser but still significant 3.5-fold
decrease in the -169Luc reporter activity. No change was seen in the -79Luc and
pGL191 activity for HDAC1, and neither promoter responded significantly to
HDAC2 overexpression. The Gdf11 promoter (pGL191) responded to an
overexpression of HDAC3, as was expected (Zhang et al.) but the Grp78 promoter
did not. These data show that HDAC1 is principally responsible for the repression of
the Grp78 promoter (Fig. 3.7A).
To confirm that HDAC1 is necessary for repression of the Grp78 promoter,
we used siRNA oligos directed against human HDAC1, 2, or 3 and transfected them
into HeLa cells along with the Grp78 promoter reporter plasmids. The pGL191
Gdf11 reporter was also transfected as a control. The siRNAs against HDAC 1, -2
76
and -3 sufficiently inhibited the expression their respective targets as determined by
quantitative RT-PCR (Fig. 3.7B). In agreement with the data showing that
overexpression of HDAC1 represses the minimal responsive -112 Grp78 promoter
activity, depletion of HDAC1 but not HDAC 2 or 3 increased the activity of the -112
Grp78 promoter. Additionally, the pGL191 Gdf11 promoter responded to the
depletion of HDAC3 but not HDAC1 or 2, as expected (Fig. 3.7C). These findings
strongly support the theory that HDAC1 is the sole HDAC responsible for
transcriptional repression of the Grp78 promoter and that it requires an intact ERSE1.
77

Fig. 3.7 Grp78 promoter repression is mediated by HDAC1
(A) -79 Luc, -112 Luc, -169 Luc, pGL191 and plasmids that express Flag-tagged HDACs 1-3
were cotransfected into HeLa cells. Luciferase assays were performed 72 hr after transfection, and
HDAC expression levels were monitored by Western blotting with an anti-Flag antibody
(representative blot is shown). All transfections were normalized to equal amounts of DNA. Standard
deviations are shown. (B) siRNA oligos targeted against human HDAC1, HDAC2 and HDAC3 were
transfected into HeLa cells and after a 72 hr incubation RNA was isolated and subjected to
quantitative RT-PCR. Levels of human HDAC1, HDAC2 and HDAC3 mRNA was monitored and
corrected against levels of GAPDH mRNA. Levels relative to cells transfected with a control siRNA
are shown, with standard deviations. (C) siRNA oligos against HDAC1, HDAC2 and HDAC3 were
cotransfected with -112Luc, -79Luc and pGL191 into HeLa cells. Luciferase assays were performed,
and the activity is shown relative to the control siRNA. Levels of siRNA activity were monitored by
quantitative RT-PCR as shown in (B).
F-HD1 F-HD2 F-HD3 Ctrl
Remaining Gene Expression
0.2
0.4
0.6
siHDAC3
siHDAC2
siHDAC1
0.8
1.0
0
3
5
1
2
4
7
6
siHDAC3
siHDAC2
siHDAC1
siCtrl
Fold Induciton
0
pGL191
A
B C
Relative Luciferase Activity
0.6
1.0
0.2
0.4
0.8
1.4
1.2
1.6
HDAC1
0.1 0.05 0.001
HDAC2
0.1 0.05 0.001
HDAC3
0.1 0.05 0.001
pGL191 Luc -169 Luc -112 Luc -79 Luc
-79 Luc -112 Luc
78
3.3.8 HDAC1 binds the Grp78 promoter before but not after ER stress and HDACi
treatment.
In order to determine the presence of HDAC1 on the promoter region of
Grp78 before but not after stress induction as well as after treatment with HDACi,
HeLa cells were stably transfected with blasticidin resistance vector and either
-112Luc or m1Luc and a stable pool of clones was selected. These cells were then
treated with either 500nM TSA for 12 hr or 300nM Tg for 4 hr and the chromatin was
immunoprecipitated with antibody against HDAC1. The isolated DNA was amplified
with primers matching pGL3 basic that either spanned the region encompassing the
Grp78 promoter insert of the -112Luc and m1Luc, (labeled “a” and “b”), or, as a
positive control for the m1 reaction the region of the endogenous Grp78 promoter
upstream of ERSE#3 and just downstream of the TATA box (labeled “c” and “d”) Fig
3.8A. These data show that there is HDAC1 binding to the -112Luc promoter before
but not after TSA or Tg treatment, and this binding is abolished by a mutation in the
NF-Y binding site as in m1Luc, Fig 3.8B. Concurrently, HDAC1 binds to the
endogenous Grp78 promoter in both the -112Luc and the m1Luc stable-transformed
cells but not after treatment with TSA or Tg.
79
Figure 3.8 HDAC1 binds the Grp78 promoter before but not after Tg and HDACi
treatment
(A) Diagram showing location of primers used to amplify the region spanning the -112 promoter insert
in pGL3 basic (a and b) and the endogenous Grp78 promoter region (c and d). (B) HeLa cells with
stably integrated -112 Luc expression vectors were treated with Tg for 4 hr or TSA for 12 hr or
untreated and then subjected to ChIP assay with anti-HDAC1 or IgG antibody as a control. The
precipitates were then subjected to quantitative PCR and the results are shown as percentage of input
DNA from the pre-immunoprecipitation step, normalized against the IgG values. Standard deviations
are shown.
Percent of Input
.03
.05
.01
.02
.04
.06
TSA
Tg
Ctrl
TATA
Luciferase
-112
a
b
ERSE 1 ERSE 2 ERSE 3 TATA
c
d
A
B
0
-112 Luc:
Grp78:
-112 m1 Plasmid
Primers a/b a/b
-112 m1
c/d c/d
Percent of Input
.03
.05
.01
.02
.04
.06
TSA
Tg
Ctrl
0
Plasmid
Primers
TATA
Luciferase
-112
a
b
m1 Luc:
80
3.4 Discussion
The mechanisms of gene regulation by HDACs can occur in one of two ways.
First, they can directly change the epigenetic status of the promoter-associated
chromatin in mammalian cells by deacetylating N-terminal lysine residues, especially
the core histones H2A, H2B, H3 and H4. The deacetylation of these histone residues
results in compacted chromatin, making the DNA inaccessible for transcription
factors, thereby inhibiting transcription (McLaughlin, Finn and La Thangue). The
second mechanism of action is achieved by changing the acetylation status of
transcription-related regulatory proteins, which may experience a subsequent change
in activation status, protein-protein interactions, or subcellular localization.
While the effects of HDACs are diverse and widespread, the actual number of
genes that exhibit a change in RNA levels after treatment with HDAC inhibitors is in
the range of 2 to 5% (Glozak and Seto). Of these genes, just as many are up-
regulated as are down-regulated. However, in general, large-scale profiles that seek
to establish a group of genes that show consistent transcriptional regulation by an
HDAC-inhibitor rarely achieve their goal.
In this study, we observed the effects of the HDAC inhibitors TSA and
MS-275 on colon and breast cancer cells, as well as malignant glioma cells and
observed consistent, specific and reproducible induction of GRP78, independent of
81
the other arms of the UPR (Figs 1a, 1b). In a mouse tumor-model utilizing MDA-
MB-435 xenografts, upregulation of GRP78 was observed after a 5-day TSA
treatment regimen (Fig 1c). These data confirm and establish the consistent
upregulation of GRP78 in the presence of histone deacetylation inhibitors in vitro as
well as in vivo in cancer cells. Furthermore, the enhanced induction of GRP78 when
HDAC inhibition precedes Tg-induced ER stress indicates that the process of
induction is dissimilar to the classic stress-induced pathway that has been so well
characterized (Fig 1d).
The same transcription factor binding sites collectively found in the ERSE
have been individually identified in other promoters as necessary for differential
regulation by HDACs. First, Sp1-binding sites are the DNA elements in the
p21Cip1, hTERT and tyrosine hydroxylase promoters that mediate HDAC inhibitor
activation. Secondly, CCAAT boxes, which bind NF-Y, are the critical elements for
HDAC inhibitor induction of the GADD45, MDR1 and GTPase RhoB promoters,
among others (Glozak and Seto).
It is interesting to note that although there are numerous Sp1-binding site and
CCAAT box-containing ERSEs in the Grp78 promoter, only one ERSE is required for
HDAC-mediated regulation. Furthermore, the differential binding of HDAC1 before
but not after both ER stress and HDAC inhibition was dependent on the CCAAT
sequence of ERSE1, which is closest to the transcription start site. This may be due
in part to its proximity to the TATA box. It was recently discovered that ER stress-
induced binding of Tata-Binding Protein (TBP) to the Grp78 promoter required an
82
intact NF-Y binding site (Luo et al.). The binding site, or CCAAT box, can bind C/
EBP, MSY1, NF-Y and CTF/NF-1, but in the case of the Grp78 promoter it is
constitutively occupied with NF-Y (Liang, Gardner 2001; Baumeister et al.). This is
similar to a previous report showing that HDAC1 regulates itself in part by self-
mediated repression, utilizing an intact NF-Y site along with a distal SP1 site to bind
to its own promoter (Schuettengruber/Seiser 2003).
Another finding regarding regulation of the Grp78 promoter by TBP correlates
with another recent report linking the interactions between HDAC1, p53 and TBP in
the oxidative-stress-induced repression of the IGF1R promoter (Kavurma/Littlewood
2007). Furthermore, YY1, another stress-induced Grp78 promoter-binding factor,
has been shown to bind TBP, (Austen, Luscher and Luscher-Firzlaff) and YY1 itself
can be acetylated and deacetylated through interaction with acetyltransferases and
histone deacetylases, however, the effect that this post-translational modification
status has on its ability to function as a transcriptional co-activator has not been
characterized (Yang, Yao and Seto).
One of the more compelling facts about the Grp78 promoter is that the 350-
base pair region upstream of the transcription initiation site is constitutively depleted
of nucleosomes (Gal-Yam et al.). Utilizing novel technology that pinpoints the the
location of nucleosomes coupled with ChIP assay to assess histone acetylation status,
differential changes in histone acetylation in the region near the transcription start
site of the Grp78 promoter before and after ER stress were discovered. Incidentally,
the presence or absence of NF-Y binding is not directly related to epigenetic changes
83
in the Grp78 promoter-related chromatin in the form of acetylation of H3-K9 and
trimethylation of H3-K4 in the GRP78 promoter region (Luo et al.). Therefore, the
regulation of the Grp78 promoter may not involve a chromatin-mediated mechanism,
however more work needs to be done to fully investigate this possibility.
There are multiple NF-Y binding sites within the promoters of ER stress-
regulated genes like Grp78, as well as the promoters of various genes activated
during developmental stages and the cell cycle, so its importance to cellular
processes on a global scale is well established (Fang 2004) (Kabe 2005) (Hu 2006).
Recently, Luo et al. published findings from experiments that shows NF-Y controls
endoplasmic reticulum stress induced transcription through recruitment of both
ATF6(N) and TBP. They further show no difference from a low basal amount of
acetylation at H3K9 before and after mutation of the NF-Y subunit responsible for
the interaction. We utilized pan-acetyl H3 and H4 antibodies for this thesis, which is
a more general approach. But we saw no reason to look after specific lysine residues
at this time, since our focus is on the specific HDAC involved and the induction of
Grp78 in response to HDAC inhibitor treatment.
The binding of regulatory factors to the Grp78 promoter is a dynamic process
that serves to maintain a low level of transcription and yet retain the ability for quick
induction by ER stress and produce a large amount of transcript, as would be
expected for a pro-survival chaperone protein. In this context, it is reasonable to
consider the presence of additional pathways for activation or suppression, as is the
case with HDAC1. Furthermore, it is interesting to think that cells may specifically
84
utilize GRP78 as an intrinsic anti-apoptotic response to global acetylation, as may
happen in response to a number of different damaging stimuli, and so these additional
requirements are met at the promoter level.
85
Chapter 4
The cytoprotective role of Grp78 in HDACi treatment
4.1 Introduction
The role of GRP78 in disease, especially cancers, is well established (Li and
Lee). Analysis of tumor samples and cancer cell lines has consistently revealed that
the Grp78 promoter is induced in a variety of cancers and is highly expressed in cells
subjected to the abnormal conditions of the tumor microenvironment (Dong et al.).
Additionally, recent experiments utilizing overexpression and siRNA-mediated
knockdown have shown that Grp78 contributes to tumor growth and confers drug
resistance to cancer cells (Banhegyi et al.). Specifically, overexpression of GRP78
has been shown to inhibit apoptosis in the cell due to its ability to bind and thereby
inactivate caspases. The overall contribution of GRP78 is to rescue the cell from a
variety of insults and it unequivocally represents a pro-survival arm of the UPR.
While it is well established that the ER plays an essential role in cellular
homeostasis, recent discovery points to the ER as a site of convergence of both pro-
and anti-apoptotic molecules and represents a novel focal point for the regulation of
apoptosis (Breckenridge et al., 2003; Scorrano et al., 2003). For survival under ER
stress, the UPR shuts down general protein translation while selectively activating
expression of chaperone proteins such as GRP78 which exhibits anti-apoptotic
properties through interference with caspase activation and probably other yet
undefined mechanisms (Rao et al., 2002; Reddy et al., 2003). Thus, GRP78 induction
under pathological conditions may represent a major cellular protective mechanism
86
for cells to survive ER stress and could have implications in organ preservation as
well as cancer progression (Lee, 2001).
It has been shown that chemically and virally transformed cells, which can
mimic malignant, cancer-like cells, spontaneously induce GRP78 under normal
culture conditions and glucose starvation further enhances GRP78 induction
(Patierno et al., 1987). This is likely due to the altered glucose intracellular stores
and an increased rate of glucose utilization by transformed and cancerous cells, and
more glucose starvation, similar to the type experienced in the tumor
microenvironment, further stimulates the ER stress signaling pathways to induce
Grp78 expression in these transformed cells. While that particular study is one of the
first to point out the abnormally high levels of GRP78 in transformed cells, since
then there has been ample evidence showing overexpression of GRP78 in a wide
variety of human cancers and tumor-associated endothelial cells (Dong et al; Lee et
al; Dong et al; Koh et al.).
The process by which the Grp78 promoter is targeted by the UPR is well
documented and involves a number of transcription factors and promoter elements
that are highly conserved across eukaryotic organisms. As stated previously in this
thesis, the Grp78 promoter is repressed by HDAC1, and its inhibition by HDACi
could seriously compromise the overall outcome of its use as an anti-cancer therapy.
Histone deacetylases (HDACs) are a promising, relatively new target for drug
development in cancer therapy. Compounds that inhibit HDACs are currently being
tested in numerous clinical trials as primary and adjunctive anti-cancer agents (see
87
table 1.1). SAHA (Vorinostat), is currently the only HDACi that has been approved
for clinical use; it is currently prescribed for treatment of cutaneous t-cell lymphoma.
Interestingly, the induction of GRP78 by an HDAC inhibitor was first discovered in
normal rat brain tissue after prolonged treatment with valproic acid, a mood
stabilizing and anti-convulsant drug later found to cause HDAC inhibition (Wang,
Young 1999). Since then, the mechanism of induction of GRP78 by HDAC
inhibitors and its overall implications on this type of anti-cancer therapy has not been
characterized.
In this chapter we show the up-regulation of the pro-survival protein GRP78
in cancer cells in response to HDAC-inhibitor treatment. Additionally, utilizing both
over-expression and siRNA-mediated knockdown, we show the role of GRP78 as an
inhibitor of caspase-dependent apoptosis in cancer cells undergoing HDAC-inhibitor
treatment. These data are presented here to broaden our understanding of how a
stress-inducible promoter is activated in the presence of HDACi in cancer cells to
pave the way for development of adjunctive therapies that could potentially bypass
this anti-apoptotic, drug-resistant response.
88
4.2 Materials and Methods

4.2.1 Cell culture and drug treatment conditions.
Cells were propagated in DMEM supplemented with 10% fetal bovine serum,
100 units/mL penicillin, 0.1 mg/mL streptomycin at 37°C, and 5% CO2.
Thapsigargin and Trichostatin A were obtained from Sigma-Aldrich. Thapsigargin
was dissolved in DMSO at 1mg/ml and added to the cell culture to a 300nM final
concentration. Trichostatin A was dissolved in DMSO at a concentration of 300mM.
MS-275 was purchased from CalBiochem (La Jolla, CA) and dissolved in DMSO at a
1.0 mM concentration.
4.2.2 Transient transfections and mitochondrial membrane potential staining.
293T cells were grown to 60% to 80% confluence. Two micrograms of His-
GRP78 or empty vector were transfected using Polyfect (Qiagen) according to the
manufacturer’s instructions. The green fluorescent protein (GFP) gene driven by
cytomegalovirus promoter was added to monitor for transfection efficiency. Empty
vector was added to adjust the total amount of plasmids to the same amount by mass.
Forty-eight hours later, the transfected cells were subjected to cell death assays or
Western blot. For mitochondrial membrane potential staining, because GFP
interferes with the green fluorescence of this assay, an empty vector was used as the
negative control.
89
4.2.3 Immunoblots and antibodies.
Fifty micrograms of total cell lysate prepared in radioimmunoprecipitation
assay buffer were processed for Western blot analysis as described (Harlow E, Lane
D 1999). The antibodies against GRP78, b-actin, GAPDH, HSP70, His, PDI, PARP
(Santa Cruz Biotechnology, Inc.), caspase-7 (BD PharMingen), GRP94 (Stressgen)
and FLAG (Sigma) were used according to the manufacturer's recommendations. The
secondary antibodies were coupled to horseradish peroxidase, and were detected by
chemiluminescence using SuperSignal West substrate (Pierce). Each immunoblot was
done at least twice to confirm the results.
4.2.4 Mouse drug treatments and xenograft studies
Orthotopic, xenograft breast cancer models were established by implantation
of 5 x 10
5
MDA-MB-435 cells in the mammary fat pad of nude mice as previously
described (Swenson, 2004). For mouse TSA and VPA optimization studies, wild-type
mice were injected with 0.5 mg/Kg TSA or 1.0 mg/Kg VPA twice daily for four to
five days and then sacrificed. Organs and xenografts were isolated and WCEs were
prepared and cleared, then used for western blot assay.
4.2.5 Transient transfection and luciferase assay
All transfections were carried out using Lipofectamine 2000 (Invitrogen) per
the manufacturer's guidelines. 293T cells transfected with either 1.0 µg of a plasmid
expressing His-tagged GRP78 or same amount of empty vector pcDNA3, or
90
increasing amounts of the plasmid expressing His-GRP78 (0.25, 0.5 and 1.0 µg).
Twenty-four hours after transient transfection, the cells were treated with 0.5 µM
TSA for 48 hr and then subjected to mitochondrial membrane potential staining using
the JC-1 assay according to the manufacturer’s guidelines.
4.2.5 Small interfering RNA
The siRNA against Grp78 was previously described (Tsutsumi S, Namba T
2006). The control siRNA was purchased from Molecular Probes/Invitrogen and
contains an alexa-fluor fluorescent tag to determine transfection efficiency. HeLa
cells were grown to 80% confluence in 12-well dishes and transfected with 10 nM of
either control siRNA or gene-specific siRNA using Lipofectamine 2000 transfection
reagent (Invitrogen) according to the manufacturer's instructions. The transfected
cells were incubated for 48-72 hr after transfection before harvesting.
4.3 Results
4.3.1 HDACi treatment induces GRP78 in mouse brain and spleen
As a preliminary study to the mouse xenograft studies carried out by Dezheng
Dong, we injected two mice each with either TSA or Valproic acid (VPA), or DMSO
as a negative control. The mice were treated twice a day for four days, and then
sacrificed and the organs were harvested, homogenized, cleared and used in WCE
preparations. These WCE were run on an SDS-PAGE and western-blotted for GRP78
and GAPDH as a loading control. We chose the spleen and brain to measure the in
91
vivo induction of Grp78 by HDACi, and in fact, the levels of GRP78 increased
significantly in the spleen in both HDACi treatment groups (Fig 4.1A). Less
induction of Grp78 was seen in the brain, especially in the TSA-treated mice, and
this may be due in part to the inability of TSA to effectively cross the blood-brain
barrier. The levels of acetylated histone H3 were also moderately higher in the
spleen after HDACi treatment, as expected. NIH3T3 cells were cultured and treated
with Tg, TSA and VPA, then harvested an run on SDS-PAGE and western blotted
alongside the brain WCE’s as a control as shown in Fig 4.1B. Interestingly, CHOP
was induced in the Tg-treated cells, as expected, but not in the HDACi-treated cells.
This was later confirmed again in tissue culture, suggesting that the induction of the
GRP78 promoter by HDACi utilizes a pathway not associated with the ER stress
response.
92
AcH3
Grp78
Ctrl VPA TSA
A
C
TSA
1mg/Kg
VPA
500mg/Kg
C TSA VPA Tg
Mouse Brain NIH 3T3 cells
GRP78
GAPDH
CHOP
B
Fig 4.1 Induction of GRP78 protein levels in mouse brain and spleen in response to
HDACi treatment
Mice were injected with either TSA, VPA or DMSO control as indicated in the materials and
methods for four days and then sacrificed. (A) Spleen was isolated and lysed and WCE’s prepared.
Western blot was performed with anti-GRP78 antibody and anti-acetyl H3. (B) Brains from the same
mice were homogenized and WCE’s prepared. Western blot was run and blotted with anti-GRP78,
GAPDH and CHOP antibodies. NIH 3T3 cells were grown and treated for 24 hr as a control.
93
4.3.2 GRP78 knockdown by siRNA and treatment with HDACi
We transfected 293t cells with varying concentrations of either siRNA against
Grp78 or a control siRNA. Increasing amounts of CMV-huGrp78, a human Grp78
expression vector, were co-transfected in a portion of the samples as indicated in
order to mimic overexpression of GRP78, and cells were also treated with the HDAC
inhibitor SAHA. The siRNA was able to attenuate and in some cases completely
block the expression of Grp78 in HDACi and exogenous overexpression cells.
Fig 4.2 GRP78 knockdown by siRNA and treatment with HDACi
293t cells were transfected with 10nM concentrations of either siRNA against Grp78 or a
control siRNA. Increasing amounts of CMV-huGrp78, a human Grp78 expression vector, were co-
transfected in a portion of the samples as indicated in order to mimic overexpression of GRP78. 48 hr
after transfection, the cells were harvested and WCEs prepared for western blotting with anti-GRP78
and GAPDH antibodies.
94
4.3.3 Suppression of GRP78 induction by siRNA in breast cancer cells overcomes
resistance to TSA-induced apoptosis.
Annealed siRNA oligos against Grp78 (siGrp78) or a random control (siCtrl)
were transfected into the breast carcinoma cell line MDA-MB-435 48 hr before
treatment with 400nM TSA for 24 hr. Apoptotic cells were identified using and
counted. The TSA treatment had minimal effect on the control cells but when Grp78
levels were reduced, over 75% of the cells entered apoptosis. (Fig. 5A) A similar
experiment was carried out in HCT116 cells and PARP cleavage was measured by
western blot. Again, in the cells where Grp78 was targeted by siRNA, there was
significant cleavage of PARP after TSA treatment compared to the random siRNA
control cells (Fig. 4.3).
95
Fig. 4.3 Knockdown of GRP78 sensitizes cells to HDACi-mediated apoptosis.
(A) Western blot analysis of GRP78 and #-actin level in breast carcinoma MDA-MB-435 cells
transfected with either control siRNA or siRNA against GRP78. The cells were either treated with 0.5 µM
TSA or the solvent DMSO for 16 hr. The relative GRP78 level under each condition was quantitated and
plotted below. (B) The extent of apoptosis under each condition in (A) was determined by the
mitochondrial potential staining assay. Red fluorescence indicates viable cells and green apoptotic cells.
Quantitation of the apoptotic cells are shown below with standard deviations. Our results showed that
breast cancer cells MDA-MB-435 induced GRP78 after TSA treatment and were resistant to this TSA
treatment regimen. Following knockdown of GRP78 by siRNA, the extent of apoptotic cells was greatly
increased. No effect was observed with control siRNA or cells not treated with TSA.
A
Percent of apoptotic cells
0
25
50
100
75 siGrp78
siCtrl
TSA Ctrl
-actin
GRP78
siCtrl siGrp78
TSA: + - + -
GRP78
PARP
GAPDH
116 kDa
85 kDa
B
siCtrl siGrp78
TSA: + - + -
96
4.3.4. Overexpression of GRP78 protects 293T cells from TSA-induced apoptosis.
Since depletion of GRP78 in cells increases their sensitivity to TSA, we
sought to determine if GRP78 overexpression would sufficiently protect cells from
the same treatment. A His-tagged GRP78 expression vector was transfected into 293t
cells in increasing amounts and 24 hr later, the cells were treated with 0.5$M TSA
for 48 hr. The data clearly show that as exogenous GRP78 levels increase, the
percentage of cells in apoptosis, as measured by mitochondrial membrane potential,
decrease in a dose-responsive manner. Therefore, we conclude that up-regulation of
GRP78 is a mechanism of resistance cells can enlist to prevent TSA-induced
apoptosis.
97
Fig. 4.4 Exogenous overexpression of GRP78 protects 293t cells from TSA-induced
apoptosis
(A) Cell lysates prepared from 293T cells transfected with either 1.0 µg of a plasmid expressing His-tagged
GRP78 or same amount of empty vector pcDNA3 were applied to SDS-PAGE and Western blotted with
anti-KDEL, anti-His, and anti-#-actin antibodies. The anti-KDEL antibody recognized the C-terminal
KDEL motif of GRP78, GRP94 and protein disulphide isomerase (PDI). (B) Empty vector pcDNA3 or
increasing amounts of the plasmid expressing His-GRP78 (0.25, 0.5 and 1.0 µg) as indicated were
transfected to 293T cells. Twenty-four hours after transient transfection, the cells were treated with 0.5 µM
TSA for 48 hr and then subjected to mitochondrial membrane potential staining using the JC-1 assay
(Immunochemistry Technologies, LLC, Bloomington, MN), which detects cells at early stage of apoptosis.
Red fluorescence indicates viable cells and green apoptotic cells. (C) The percent of apoptotic cells under
each condition in (B) was quantitated and plotted against the transfected amount of GRP78. The standard
deviations are shown. The insert shows the level of total GRP78 detected by Western blot in the transfected
cells treated with TSA: lane 1, pcDNA; lanes 2-4 transfected with 0.25, 0.5 and 1.0 µg of Grp78 expression
plasmid, respectively.
pcDNA3 His-Grp78
PDI
His-GRP78
GRP78
GRP94
!-actin
Ctrl TSA
pcDNA3
0.25
0.5
1.0
A
C
B
Ctrl
TSA
PcDNA3 1.0 0.5 0.25
His-Grp78 (!g)
GRP78
% apoptotic cells
80
60
40
20
100
0
His-Grp78 (!g)
!-actin
98
4.4 Discussion
GRP78 is commonly found to be over-expressed in drug-resistant human
cancer cells. This over-expression has been shown to protect cells from apoptosis
induced by anti-cancer therapies such as etoposide, adriamycin and camptothecin
(Reddy et al.). Conversely, suppression of GRP78 through the use of lentiviral
vector expressing siRNA sensitizes human cancer cells to estrogen starvation and
etoposide-mediated cell death (Fu 2008). The role of GRP78 in drug resistance of
human cancer cells is well established. There is additional evidence from a variety of
sources that high levels of GRP78 confer resistance to anti-cancer therapies in a
diverse population of malignant cells. A recent collaborative study by this lab and
others showed that GRP78 levels are highly elevated in the glioblastoma tumor
vasculature, both in tissue and in primary cell cultures, in contrast to the minimal
expression in normal brain. An siRNA-mediated knockdown of GRP78 by small
interfering RNA (siRNA) significantly sensitized primary cultures of human brain
endothelial cells, derived from blood vessels of malignant glioma tissues, to a variety
of chemotherapeutic agents, whereas exogenous overexpression of GRP78 in normal
brain endothelial cells rendered these cells drug-resistant (Virrey 2008).
Another study used microchip technology to measure the effects of
topoisomerase II inhibitor-VP-16 on a human lung cancer cell line NCI-H460 that
had been treated with the GRP78 inducer A23187 versus untreated cells. They
99
reported a three-fold reduction in the number of apoptotic cells in the cultures with
high levels of GRP78 versus the uninduced cultures when both were treated with
VP-16. Therefore, they showed that GRP78 is correlated to VP-16 resistance in a
human lung cancer cell line (Ying-Yan et al.).
Since the presence of elevated levels of GRP78 in cancer cells contributes to
their overall survival and drug resistance, we sought to determine if a similar effect
was present after induction of GRP78 in response to HDAC inhibition. We
determined that when GRP78 was exogenously overexpressed, there was nearly a
ten-fold decrease of entry into apoptosis in the presence of the HDAC inhibitor TSA
when compared to normal cells (Fig 4.4B, C). Furthermore, when the amount of
GRP78 is reduced to almost nothing, and its induction is attenuated, the ability of
TSA to force the cells into caspase-dependent apoptosis is dramatically increased
(Fig 4.3 A, B). Therefore, we conclude that GRP78 can confer resistance to TSA-
induced apoptosis in cancer cells, and ablation of GRP78 enhances the therapeutic
effect of the HDAC inhibitor.
Because GRP78 provides protects cancer cells from apoptosis, down-
regulation of GRP78 may become necessary in order for HDAC inhibitors to realize
their full clinical potential. Our results with siGRP78 show that lowering GRP78
levels significantly increases the apoptotic effects of the HDAC inhibitor TSA.
Small molecules that can specifically block GRP78 expression and/or its activity are
currently available and are being evaluated (Ermakova/Choy 2006; Fu, Li and Lee;
Zhou and Lee). If these prove effective in the silencing of GRP78, then their use as
100
an adjunct to HDAC-inhibitor therapy should result in their use as highly effective
anti-cancer therapies with broader applications for which they are currently
considered.
101
Chapter 5
Conclusions and Perspectives
The studies in this dissertation report novel discoveries that describe multiple
mechanisms by which a stress-inducible promoter is regulated. This dissertation also
explains the fundamental properties, from transcription to proteins, of how a class of
anti-cancer drugs such as histone deacetylase inhibitors can activate the pro-survival
protein GRP78; a protein known to inhibit apoptosis and contribute to drug
resistance. These findings contribute to the overall understanding not only how the
ER stress chaperone GRP78 is induced and inhibited at the transcription level, it
allows for the further investigation into how a new class of anti-cancer therapy can
be improved upon at a very early stage in its development, when the rudimentary
basis of therapeutic regimens are still being written.
This work began with answering the question of what was happening at one
point on a promoter that exhibited differential binding in relation to ER stress. What
came from it was a story that encompasses a broad range of cellular processes that
regulate many promoters utilizing few mechanisms. The discovery that the Grp78
promoter was highly inducible by the cleaved form of ATF6 working together with
YY1, and that this process involved the recruitment of histone-modifying enzymes
was not extraordinary. However, the fact that it required a canonical ER stress
element on that promoter was very interesting, and it may be employed to a broader
range of applications because of that.
102
The acetylation status of the Grp78 promoter before and after ER stress has
been confirmed, and we have gone so far as to point out that ER stress induction by
thapsigargin initiates the transcriptional machinery and a moderate rise in acetylation
is evident. The exact location of the acetylation events involving the chromatin
structure has not yet been worked out, nor has the question of what factors are
modified by HDAC1 in the negative regulation of the promoter. Attempts at both
were made, with no result. The laboratory of Dr. Peter Jones has come up with a
novel technology for measuring the site of nucleosome involvement with DNA, and
we were fortunate enough to contribute our GRP78 promoter plasmid.
They used a novel technology to footprint the nucleosomes and transcription
factors binding to the Grp78 promoter at the single nucleotide level utilizing a CpG
DNA methyltransferase coupled with bisulfite conversion and genomic sequencing
(9). These studies revealed that on the Grp78 promoter there is constitutive binding
of nucleosomes upstream and downstream of the core promoter region containing the
ERSEs and the TATA element, and there are a low level of bound transcription
factors during basal transcription that increase substantially as cells undergo ER
stress.
In summary, we recognize that acetylation is only one of the many forms of
modification that may impact Grp78 transcription. As stated previously, we have
also observed methylation of the arginine 3 residue at histone H4 upon ER stress.
This activating modification is mediated by the transcription factor YY1 and its
interaction with the methyltransferase PRMT1. With this in mind, it is entirely
103
possible that the Grp78 promoter is regulated both positively and negatively by a
plethora of epigenetic modifications. Since the Grp78 promoter is considered the
hallmark of the ER stress response, the application of this knowledge would
potentially benefit the overall understanding of numerous disease processes and
acquisition of drug resistance in cancers.
The mechanism by which the HDAC-inhibitor TSA induces apoptosis is via
Fas/FasL, which triggers activation of caspase-8. TSA also induces the catalytic
activation of caspase-9, caspase-3 and furthermore, expression of anti-apoptotic
Bcl-2 and Bcl-XL is attenuated.. This eventually results in release of cytochrome c
into the cytosol and a drop in mitochondrial membrane potential. In short, TSA
induces apoptosis through the signaling cascade of Fas/FasL-mediated extrinsic and
mitochondria-mediated intrinsic caspases pathways (Kim, Park 2006).
Disruption of endoplasmic reticulum (ER) homeostasis causes accumulation
of unfolded and misfolded proteins in the ER, triggering the ER stress response,
which can eventually lead to apoptosis when ER dysfunction is severe or prolonged.
The protective effect of GRP78 against apoptosis caused by disturbance of ER stress
through the use of pharmacologic agents, such as tunicamycin or thapsigargin, has
been well established (Lee/ TiBS 2001). The moderate induction of Grp78 has a
protective effect on cells in that it inhibits the ER stress response, which would
normally lead to apoptosis. GRP78 binds and inhibits the activation of caspase-7, an
executor caspase activated by both ER stress and genotoxic drugs (Reddy et al.).
GRP78 also binds and suppresses the activation of the BH-3 only pro-apoptotic
104
protein BIK, its downstream target BAX, and prevents cytochrome c release from the
mitochondria (Ranganathan 2006; Banhegyi et al.). Furthermore, GRP78, in
complex with other ER transmembrane proteins, may also indirectly modulate the
activity of these and other pro-apoptotic components.
It is of particular interest that the HDAC-inhibitors do not induce a
generalized ER stress response, which would eventually induce proteins involved in
the apoptotic process such as CHOP/Gadd153 that would lead to either cell cycle
arrest or apoptosis (Kim, Won 2002) . This specific induction of Grp78 enhances its
role as an anti-apoptotic protein in this context because there is no competition from
the pro-apoptotic proteins that are usually expressed during the ER stress response.
An interesting confirmation of some of the theories discussed in this paper can
be found in previously published data showing overexpression of GRP78 conferring
drug resistance to cells treated with the topoisomerase I inhibitor camptothecin
(Reddy et al.). In an unrelated study, Camptothecin was most effective at initiating
apoptosis in MDA-MB-435 cells when used in conjunction with the HDAC inhibitor
sodium butyrate, but only if the NaB was given 24 hr after Camptothecin. If NaB
was given 24 hr before, it was less effective than if not given at all (Bevins/Zimmer
2005). Based on these independent data, since the HDACi can induce GRP78 protein
levels, and since GRP78 overexpression can confer resistance to Camptothecin-
induced apoptosis, then pre-treatment with the HDACi results in overexpression of
GRP78 thereby protecting the cells from apoptosis.
105
A cell can utilize many pathways to activate the transcription of Grp78 . As
outlined here in this dissertation, we have observed the YY1-mediated activation pathway
that utilizes the cleaved form of ATF6 and the chromatin-modifying enzymes PRMT1
and p300. We have also seen the negative regulation of the Grp78 promoter by HDAC1,
and converseley, the activation by HDAC inhibitors. Since the Grp78 promoter is
considered the hallmark of the ER stress response, and GRP78 itself is a pro-survival
protein, the application of this knowledge stands to benefit the overall understanding of
drug resistance in cancers, as well as the role that GRP78 plays in the overall disease
process.
106
Bibliography
Arai, K, SR Lee et al. “Involvement of Erk Map Kinase in Endoplasmic Reticulum Stress
in Sh-Sy5Y Human Neuroblastoma Cells,” J Neurochem 89.1 (2004): 232-39.
Austen, M, B Luscher, and JM Luscher-Firzlaff. “Characterization of the Transcriptional
Regulator Yy1. The Bipartite Transactivation Domain is Independent of Interaction With
the Tata Box-Binding Protein, Transcription Factor Iib, Tafii55, Or Camp-Responsive
Element-Binding Protein (Cpb)-Binding Protein,” J Biol Chem 272.3 (1997): 1709-17.
Banhegyi, G, P Baumeister et al. “Endoplasmic Reticulum Stress,” Ann N Y Acad Sci
1113 (2007): 58-71.
Baumeister, P, S Luo et al. “Endoplasmic Reticulum Stress Induction of the Grp78/Bip
Promoter: Activating Mechanisms Mediated By Yy1 and Its Interactive Chromatin
Modifiers,” Mol Cell Biol 25.11 (2005): 4529-40.
Bertolotti, A, Y Zhang et al. “Dynamic Interaction of Bip and Er Stress Transducers in the
Unfolded-Protein Response,” Nat Cell Biol 2.6 (2000): 326-32.
Bolden, JE, MJ Peart, and RW Johnstone. “Anticancer Activities of Histone Deacetylase
Inhibitors,” Nat Rev Drug Discov 5.9 (2006): 769-84.
Bushmeyer, S, K Park, and ML Atchison. “Characterization of Functional Domains
Within the Multifunctional Transcription Factor, Yy1,” J Biol Chem 270.50 (1995):
30213-20.
Caretti, G, V Salsi et al. “Dynamic Recruitment of Nf-Y and Histone Acetyltransferases
on Cell-Cycle Promoters,” J Biol Chem 278.33 (2003): 30435-40.
Currie, RA. “Nf-Y is Associated With the Histone Acetyltransferases Gcn5 and P/Caf,” J
Biol Chem 273.3 (1998): 1430-34.
Donati, G, C Imbriano, and R Mantovani. “Dynamic Recruitment of Transcription
Factors and Epigenetic Changes on the Er Stress Response Gene Promoters,” Nucleic
Acids Res 34.10 (2006): 3116-27.
Dong, D, L Dubeau et al. “Spontaneous and Controllable Activation of Suicide Gene
Expression Driven By the Stress-Inducible Grp78 Promoter Resulting in Eradication of
Sizable Human Tumors,” Hum Gene Ther 15.6 (2004): 553-61.
107
Dong, D, B Ko et al. “Vascular Targeting and Antiangiogenesis Agents Induce Drug
Resistance Effector Grp78 Within the Tumor Microenvironment,” Cancer Res 65.13
(2005): 5785-91.
Dong, D, M Ni et al. “Critical Role of the Stress Chaperone Grp78/Bip in Tumor
Proliferation, Survival, and Tumor Angiogenesis in Transgene-Induced Mammary Tumor
Development,” Cancer Res 68.2 (2008): 498-505.
Foti, DM, A Welihinda et al. “Conservation and Divergence of the Yeast and Mammalian
Unfolded Protein Response. Activation of Specific Mammalian Endoplasmic Reticulum
Stress Element of the Grp78/Bip Promoter By Yeast Hac1,” J Biol Chem 274.43 (1999):
30402-09.
Fu, Y , J Li, and AS Lee. “Grp78/Bip Inhibits Endoplasmic Reticulum Bik and Protects
Human Breast Cancer Cells Against Estrogen Starvation-Induced Apoptosis,” Cancer Res
67.8 (2007): 3734-40.
Gal-Yam, EN, S Jeong et al. “Constitutive Nucleosome Depletion and Ordered Factor
Assembly At the Grp78 Promoter Revealed By Single Molecule Footprinting,” PLoS
Genet 2.9 (2006): e160.
Gazit, G, SE Kane et al. “Use of the Stress-Inducible Grp78/Bip Promoter in Targeting
High Level Gene Expression in Fibrosarcoma in Vivo,” Cancer Res 55.8 (1995):
1660-63.
Glozak, MA, and E Seto. “Histone Deacetylases and Cancer,” Oncogene 26.37 (2007):
5420-32.
Hong, M, M Li et al. “Endoplasmic Reticulum Stress Triggers an Acute Proteasome-
Dependent Degradation of Atf6,” J Cell Biochem 92.4 (2004): 723-32.
Hong, M, MY Lin et al. “Transcriptional Regulation of the Grp78 Promoter By
Endoplasmic Reticulum Stress: Role of Tfii-I and Its Tyrosine Phosphorylation,” J Biol
Chem 280.17 (2005): 16821-28.
Hyde-DeRuyscher, RP, E Jennings, and T Shenk. “DNA Binding Sites for the
Transcriptional Activator/Repressor Yy1,” Nucleic Acids Res 23.21 (1995): 4457-65.
Imhof, A, XJ Yang et al. “Acetylation of General Transcription Factors By Histone
Acetyltransferases,” Curr Biol 7.9 (1997): 689-92.
Koh, SS, D Chen et al. “Synergistic Enhancement of Nuclear Receptor Function By P160
Coactivators and Two Coactivators With Protein Methyltransferase Activities,” J Biol
Chem 276.2 (2001): 1089-98.
108
Laird, PW. “Cancer Epigenetics,” Hum Mol Genet 14 Spec No 1 (2005): R65-76.
Lee, AS. “Grp78 Induction in Cancer: Therapeutic and Prognostic Implications,” Cancer
Res 67.8 (2007): 3496-99.
Lee, HK, C Xiang et al. “Grp78 is Overexpressed in Glioblastomas and Regulates
Glioma Cell Growth and Apoptosis,” Neuro Oncol 10.3 (2008): 236-43.
Lee, K, L Neigeborn, and RJ Kaufman. “The Unfolded Protein Response is Required for
Haploid Tolerance in Yeast,” J Biol Chem 278.14 (2003): 11818-27.
Lee, K, W Tirasophon et al. “Ire1-Mediated Unconventional Mrna Splicing and S2P-
Mediated Atf6 Cleavage Merge to Regulate Xbp1 in Signaling the Unfolded Protein
Response,” Genes Dev 16.4 (2002): 452-66.
Li, J, and AS Lee. “Stress Induction of Grp78/Bip and Its Role in Cancer,” Curr Mol Med
6.1 (2006): 45-54.
Li, M, P Baumeister et al. “Atf6 as a Transcription Activator of the Endoplasmic
Reticulum Stress Element: Thapsigargin Stress-Induced Changes and Synergistic
Interactions With Nf-Y and Yy1,” Mol Cell Biol 20.14 (2000): 5096-106.
Li, WW, S Alexandre et al. “Transactivation of the Grp78 Promoter By Ca2+ Depletion.
A Comparative Analysis With A23187 and the Endoplasmic Reticulum Ca(2+)-Atpase
Inhibitor Thapsigargin,” J Biol Chem 268.16 (1993): 12003-09.
Li, WW, Y Hsiung et al. “Suppression of Grp78 Core Promoter Element-Mediated Stress
Induction By the Dbpa and Dbpb (Yb-1) Cold Shock Domain Proteins,” Mol Cell Biol
17.1 (1997): 61-68.
Li, WW, Y Hsiung et al. “Induction of the Mammalian Grp78/Bip Gene By Ca2+
Depletion and Formation of Aberrant Proteins: Activation of the Conserved Stress-
Inducible Grp Core Promoter Element By the Human Nuclear Factor Yy1,” Mol Cell Biol
17.1 (1997): 54-60.
Li, WW, L Sistonen et al. “Stress Induction of the Mammalian Grp78/Bip Protein Gene:
In Vivo Genomic Footprinting and Identification of P70Core From Human Nuclear
Extract as a DNA-Binding Component Specific to the Stress Regulatory Element,” Mol
Cell Biol 14.8 (1994): 5533-46.
Little, E, M Ramakrishnan et al. “The Glucose-Regulated Proteins (Grp78 and Grp94):
Functions, Gene Regulation, and Applications,” Crit Rev Eukaryot Gene Expr 4.1 (1994):
1-18.
109
Liu, CY , HN Wong et al. “The Protein Kinase/Endoribonuclease Ire1Alpha That Signals
the Unfolded Protein Response Has a Luminal N-Terminal Ligand-Independent
Dimerization Domain,” J Biol Chem 277.21 (2002): 18346-56.
Luo, R, JF Lu et al. “Cbf/Nf-Y Controls Endoplasmic Reticulum Stress Induced
Transcription Through Recruitment of Both Atf6(N) and Tbp,” J Cell Biochem 104.5
(2008): 1708-23.
Luo, S, P Baumeister et al. “Induction of Grp78/Bip By Translational Block: Activation
of the Grp78 Promoter By Atf4 Through and Upstream Atf/Cre Site Independent of the
Endoplasmic Reticulum Stress Elements,” J Biol Chem 278.39 (2003): 37375-85.
Luo, S, and AS Lee. “Requirement of the P38 Mitogen-Activated Protein Kinase
Signalling Pathway for the Induction of the 78 Kda Glucose-Regulated Protein/
Immunoglobulin Heavy-Chain Binding Protein By Azetidine Stress: Activating
Transcription Factor 6 as a Target for Stress-Induced Phosphorylation,” Biochem J 366.Pt
3 (2002): 787-95.
Mao, C, D Dong et al. “Transgenic Mouse Model for Monitoring Endoplasmic Reticulum
Stress in Vivo,” Nat Med 10.10 (2004): 1013-4; author reply 1014.
Masuoka, Y , K Shin-Ya et al. “Diheteropeptin, a New Substance With Tgf-Beta-Like
Activity, Produced By a Fungus, Diheterospora Chlamydosporia. I. Production, Isolation
and Biological Activities,” J Antibiot (Tokyo) 53.8 (2000): 788-92.
McLaughlin, F, P Finn, and NB La Thangue. “The Cell Cycle, Chromatin and Cancer:
Mechanism-Based Therapeutics Come of Age,” Drug Discov Today 8.17 (2003):
793-802.
Metivier, R, G Penot et al. “Estrogen Receptor-Alpha Directs Ordered, Cyclical, and
Combinatorial Recruitment of Cofactors on a Natural Target Promoter,” Cell 115.6
(2003): 751-63.
Nightingale, KP, LP O'Neill, and BM Turner. “Histone Modifications: Signalling
Receptors and Potential Elements of a Heritable Epigenetic Code,” Curr Opin Genet Dev
16.2 (2006): 125-36.
Parker, R, T Phan et al. “Identification of Tfii-I as the Endoplasmic Reticulum Stress
Response Element Binding Factor Ersf: Its Autoregulation By Stress and Interaction With
Atf6,” Mol Cell Biol 21.9 (2001): 3220-33.
Reddy, RK, C Mao et al. “Endoplasmic Reticulum Chaperone Protein Grp78 Protects
Cells From Apoptosis Induced By Topoisomerase Inhibitors: Role of Atp Binding Site in
Suppression of Caspase-7 Activation,” J Biol Chem 278.23 (2003): 20915-24.
110
Rezai-Zadeh, N, X Zhang et al. “Targeted Recruitment of a Histone H4-Specific
Methyltransferase By the Transcription Factor Yy1,” Genes Dev 17.8 (2003): 1019-29.
Riquet, FB, L Tan et al. “Yy1 is a Positive Regulator of Transcription of the Col1A1
Gene,” J Biol Chem 276.42 (2001): 38665-72.
Roy, B, and AS Lee. “Transduction of Calcium Stress Through Interaction of the Human
Transcription Factor Cbf With the Proximal Ccaat Regulatory Element of the Grp78/Bip
Promoter,” Mol Cell Biol 15.4 (1995): 2263-74.
Roy, B, and AS Lee.“The Mammalian Endoplasmic Reticulum Stress Response Element
Consists of an Evolutionarily Conserved Tripartite Structure and Interacts With a Novel
Stress-Inducible Complex,” Nucleic Acids Res 27.6 (1999): 1437-43.
Sartorelli, V , PL Puri et al. “Acetylation of Myod Directed By Pcaf is Necessary for the
Execution of the Muscle Program,” Mol Cell 4.5 (1999): 725-34.
Schiltz, RL, CA Mizzen et al. “Overlapping But Distinct Patterns of Histone Acetylation
By the Human Coactivators P300 and Pcaf Within Nucleosomal Substrates,” J Biol Chem
274.3 (1999): 1189-92.
Schroder, M, and RJ Kaufman. “The Mammalian Unfolded Protein Response,” Annu Rev
Biochem 74 (2005): 739-89.
Sengupta, N, and E Seto. “Regulation of Histone Deacetylase Activities,” J Cell Biochem
93.1 (2004): 57-67.
Shen, X, RE Ellis et al. “Complementary Signaling Pathways Regulate the Unfolded
Protein Response and Are Required for C. Elegans Development,” Cell 107.7 (2001):
893-903.
Shen, X, K Zhang, and RJ Kaufman. “The Unfolded Protein Response--a Stress
Signaling Pathway of the Endoplasmic Reticulum,” J Chem Neuroanat 28.1-2 (2004):
79-92.
Skarnes, WC, JE Moss et al. “Capturing Genes Encoding Membrane and Secreted
Proteins Important for Mouse Development,” Proc Natl Acad Sci U S A 92.14 (1995):
6592-96.
Song, MS, YK Park et al. “Induction of Glucose-Regulated Protein 78 By Chronic
Hypoxia in Human Gastric Tumor Cells Through a Protein Kinase C-Epsilon/Erk/Ap-1
Signaling Cascade,” Cancer Res 61.22 (2001): 8322-30.
111
Thomas, MJ, and E Seto. “Unlocking the Mechanisms of Transcription Factor Yy1: Are
Chromatin Modifying Enzymes the Key?,” Gene 236.2 (1999): 197-208.
Thuerauf, DJ, L Morrison, and CC Glembotski. “Opposing Roles for Atf6Alpha and
Atf6Beta in Endoplasmic Reticulum Stress Response Gene Induction,” J Biol Chem
279.20 (2004): 21078-84.
Varier, RA, and TK Kundu. “Chromatin Modifications (Acetylation/ Deacetylation/
Methylation) as New Targets for Hiv Therapy,” Curr Pharm Des 12.16 (2006): 1975-93.
Virrey, JJ, D Dong et al. “Stress Chaperone Grp78/Bip Confers Chemoresistance to
Tumor-Associated Endothelial Cells,” Mol Cancer Res 6.8 (2008): 1268-75.
Welihinda, AA, W Tirasophon et al. “Gene Induction in Response to Unfolded Protein in
the Endoplasmic Reticulum is Mediated Through Ire1P Kinase Interaction With a
Transcriptional Coactivator Complex Containing Ada5P,” Proc Natl Acad Sci U S A 94.9
(1997): 4289-94.
Welihinda, AA, W Tirasophon, and RJ Kaufman. “The Cellular Response to Protein
Misfolding in the Endoplasmic Reticulum,” Gene Expr 7.4-6 (1999): 293-300.
Welihinda, AA, W Tirasophon, and RJ Kaufman.“The Transcriptional Co-Activator Ada5
is Required for Hac1 Mrna Processing in Vivo,” J Biol Chem 275.5 (2000): 3377-81.
Wen, YD, WD Cress et al. “Histone Deacetylase 3 Binds to and Regulates the
Multifunctional Transcription Factor Tfii-I,” J Biol Chem 278.3 (2003): 1841-47.
Yang, WM, YL Yao, and E Seto. “The Fk506-Binding Protein 25 Functionally Associates
With Histone Deacetylases and With Transcription Factor Yy1,” EMBO J 20.17 (2001):
4814-25.
Yao, YL, WM Yang, and E Seto. “Regulation of Transcription Factor Yy1 By Acetylation
and Deacetylation,” Mol Cell Biol 21.17 (2001): 5979-91.
Ying-Yan, W, W Tao et al. “The Analysis of Chemotherapy Resistance in Human Lung
Cancer Cell Line With Microchip-Based System,” Biomed Microdevices 10.3 (2008):
429-35.
Yoshida, H, K Haze et al. “Identification of the Cis-Acting Endoplasmic Reticulum Stress
Response Element Responsible for Transcriptional Induction of Mammalian Glucose-
Regulated Proteins. Involvement of Basic Leucine Zipper Transcription Factors,” J Biol
Chem 273.50 (1998): 33741-49.
112
Yoshida, H, T Okada et al. “Atf6 Activated By Proteolysis Binds in the Presence of Nf-Y
(Cbf) Directly to the Cis-Acting Element Responsible for the Mammalian Unfolded
Protein Response,” Mol Cell Biol 20.18 (2000): 6755-67.
Zhang, X, W Wharton et al. “Activation of the Growth-Differentiation Factor 11 Gene By
the Histone Deacetylase (Hdac) Inhibitor Trichostatin a and Repression By Hdac3,” Mol
Cell Biol 24.12 (2004): 5106-18.
Zhou, Y , and AS Lee. “Mechanism for the Suppression of the Mammalian Stress
Response By Genistein, an Anticancer Phytoestrogen From Soy,” J Natl Cancer Inst 90.5
(1998): 381-88.
113

Abstract (if available)

Abstract The unfolded protein response (UPR) is an evolutionarily conserved mechanism whereby cells respond to stress conditions that target the endoplasmic reticulum (ER). One of the major targets of the UPR is the 78kDa Glucose Regulated Protein Grp78 (BiP). The transcriptional activation of the promoter of GRP78 has been used extensively as an indicator of the onset of the UPR. The transcriptional activation of Grp78 in response to ER stress has been well documented. It is characterized by multiple transcription factors such as YY1, TFII-I, ATF6(N), and NF-Y binding to conserved promoter sequences at the onset of ER stress.

Linked assets

University of Southern California Dissertations and Theses

Conceptually similar

PDF

Role of endoplasmic reticulum chaperones GRP78 and GRP94 in regulating unfolded protein response and cell survival

PDF

Role of GRP78 and its novel cytosolic isoform GRP78va in regulating the unfolded protein response in cancer

PDF

The role of endoplasmic reticulum proteins GRP78 and IP3R1 in regulation of glucose homeostasis and acute pancreatitis

PDF

The role of endoplasmic reticulum protein GRP78 in normal hematopoeises and PTEN-null leukemogenesis

PDF

The role of GRP78 in the regulation of apoptosis and prostate cancer progression

PDF

Utilizing novel small molecules to modulate GRP78 expression and activity in cancer

PDF

The role of endoplasmic reticulum chaperone glucose-regulated 78-kilodalton (GRP78) in lung cancer

PDF

The role of nuclear GRP78 in regulation of EGFR expression in lung cancer

PDF

The molecular mechanism of GRP78 translocation from the endoplasmic reticulum to the cell surface

PDF

Cell surface translocation mechanism of stress-inducible GRP78 in human cancer

PDF

The role of endoplasmic reticulum chaperone protein GRP78 in breast cancer

PDF

The role of endoplasmic reticulum chaperones in adipogenesis, liver cancer and mammary gland development

PDF

Cell surface translocation and therapeutic targeting of GRP78

PDF

Creating a multiple micrornia expression vector to target GRP78, an ER chaperone and signaling regulator in cancer

PDF

The role of endoplasmic reticulum chaperones in regulating hematopoietic stem cells and hematological malignancies

PDF

The roles of endoplasmic reticulum chaperones in regulating liver homeostasis and tumorigenesis

PDF

Examining perillyl alcochol in glioblastoma treatment and relating its effect to endoplasmic reticulum stress response to further advance its usage in combination treatment with dimethyl-celecoxib

PDF

The differential effects of selective COX-2 inhibitors on cell proliferation and induced ER stress in glioblastoma and pancreatic carcinoma cell lines

PDF

The role of glucose-regulated proteins in endometrial and pancreatic cancers

Asset Metadata

Creator Baumeister, Peter J. (author)

Core Title The transcriptional regulation of the pro-survival protein Grp78 by activating transcription factors and chromatin-modifying enzymes: its upregulation in response to HDAC-inhibitor treatment and ...

School Keck School of Medicine

Degree Doctor of Philosophy

Degree Program Biochemistry and Molecular Biology

Degree Conferral Date 2008-12

Publication Date 11/19/2008

Defense Date 08/27/2008

Publisher University of Southern California (original), University of Southern California. Libraries (digital)

Tag deacetylases,endoplasmic reticulum stress,GRP78,histone,OAI-PMH Harvest,transcription

Language English

Contributor Electronically uploaded by the author (provenance)

Advisor Lee, Amy S. (committee chair), Johnson, Deborah L. (committee member), Ladner, Robert D. (committee member)

Creator Email baumeist@usc.edu,pjbethcal@mac.com

Permanent Link (DOI) https://doi.org/10.25549/usctheses-m1773

Unique identifier UC148032

Identifier etd-Baumeister-2436 (filename),usctheses-m40 (legacy collection record id),usctheses-c127-130806 (legacy record id),usctheses-m1773 (legacy record id)

Legacy Identifier etd-Baumeister-2436.pdf

Dmrecord 130806

Document Type Dissertation

Rights Baumeister, Peter J.

Type texts

Source University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Repository Name Libraries, University of Southern California

Repository Location Los Angeles, California

Repository Email cisadmin@lib.usc.edu