Synapse maintenance and function at the mouse neuromuscular junction: implications in diseases

PDF

Download

Open document

Flip pages

Summarize

Download a page range

Download transcript

Copy asset link

Request this asset

Transcript (if available)

Content SYNAPSE MAINTENANCE AND FUNCTION AT THE MOUSE
NEUROMUSCULAR JUNCTION: IMPLICATIONS IN DISEASES

by

Ming-Yi Lin

A Dissertation Presented to the
FACULTY OF THE USC GRADUATE SCHOOL
UNIVERSITY OF SOUTHERN CALIFORNIA
In Partial Fulfillment of the
Requirements for the Degree
DOCTOR OF PHILOSOPHY
(NEUROSCIENCE)

May 2011

Copyright 2011 Ming-Yi Lin
ii
Acknowledgements

I would like to thank people who have supported and helped me through the process
of completing this dissertation. My mentor, Dr. Chien-Ping Ko has provided me
with a great opportunity to explore in neuroscience and guided me through
difficulties in research. I also thank my committee members: Drs. Samantha Butler,
Jonah Chan, Robert Chow, Albert Herrera, and Jang Youn for their help and advice.

My great appreciation also goes to the members of the Ko lab. It is an honor to work
with such an exciting group of people, who are passionate, enthusiastic and always
kind. Dr. Yoshie Sugiura taught me almost all the experiment skills. Special thanks
to Dr. Zhihua Feng, who always provided me with critical insights; every discussion
with her was so valuable. Also special thanks to Karen Ling and Dr. Young Yoo,
who are always by my side. I would also like to thank Pam Ku and Rebecca Gibbs
for their help.

Finally and most importantly, I would like to thank my parents and family for their
sacrifices and full support during these years.

iii
Table of Contents
Acknowledgements ii

List of Tables iv

List of Figures v

Abstract vii

Chapter 1. General Introduction 1
1.1 The neuromuscular junction: a model synapse 1
1.2 The formation and maintenance of the neuromuscular
junction 2
1.3 Synaptic transmission at the neuromuscular junction 6

Chapter 2. Complexins Facilitate Exocytosis and Synchronize Vesicle
Release by Coupling Vesicles and Calcium Channels 10
2.1 Introduction 10
2.2 Materials and Methods 12
2.3 Results 15
2.4 Discussion 36

Chapter 3. The Function and Regeneration of Motoneurons and
Neuromuscular Junctions in the Absence of Myostatin 41
3.1 Introduction 41
3.2 Materials and Methods 43
3.3 Results 47
3.4 Discussion 60

Chapter 4. Neuromuscular Function in Spinal Muscular Atrophy 64
4.1 Introduction 64
4.2 Materials and Methods 65
4.3 Results 68
4.4 Discussion 77

Chapter 5. General Conclusion 80

References 85

iv
List of Tables
Table 2-1. EPP time course at different Ca
2+
concentrations. 28
Table 4-1. Neuromuscular transmission in low Ca
2+
/high Mg
2+
Ringer’s
solution. 73
v

List of Figures
Figure 1-1. The vertebrate neuromuscular junction (NMJ) is a tripartite
synapse. 3
Figure 2-1. Complexin 1 is the major complexin isoform at the mouse
NMJ. 17
Figure 2-2. Complexin 1/2, but not 3, 4 are expressed at wildtype NMJs. 18
Figure 2-3. Expression of complexin 2 and other major SNARE complex
proteins were not significantly different in complexin 1 KO
spinal cords. 20
Figure 2-4. NMJ structure is not altered in complexin 1 KO mice. 21
Figure 2-5. Spontaneous vesicle release is reduced at complexin 1 KO
NMJs. 23
Figure 2-6. Evoked vesicle release is reduced and desynchronized at
complexin 1 KO NMJs. 24
Figure 2-7. Increasing extracellular Ca
2+
cannot rescue defects in synaptic
transmission at complexin 1 KO NMJs. 27
Figure 2-8. Reduced RRP at complexin 1 KO NMJs. 30
Figure 2-9. Strengthened short-term synaptic plasticity at complexin 1
KO NMJs. 31
Figure 2-10. BAPTA-AM decreases the paired-pulse facilitation at
complexin 1 KO NMJs. 33
Figure 2-11. Knock-out of complexin 2 impairs coupling of vesicles with
voltage-gated calcium channels (VGCCs) in mouse
chromaffin cells. 35
Figure 3-1. The NMJ structure and motoneuron number are normal in
myostatin null mice. 48
Figure 3-2. Neuromuscular transmission at the NMJ of myostatin null
mice. 51
Figure 3-3. Myostatin null NMJs have a larger RRP. 52
vi
Figure 3-4. Myostatin null NMJs are similar in regeneration following
nerve crush. 54
Figure 3-5. Myostatin deletion increased muscle mass but did not
ameliorate motor axon or motoneuron degeneration. 56
Figure 3-6. Myostatin deletion increased hindlimb force but did not
extend life span in SOD1 mice. 59
Figure 4-1. Fully innervated NMJs in hindlimb muscles of SMA mice that
express YFP in motoneurons. 70
Figure 4-2. SMA NMJs display a decrease in synaptic efficacy. 72
Figure 4-3. SMA NMJs exhibit lower vesicle release probability. 74
Figure 4-4. SMA NMJs can elicit muscle contraction at the disease end-
stage. 76

vii
Abstract

The synapse is the fundamental building block of the brain circuitry responsible for
the human behavior. An understanding of synaptic structure and function is required
to elucidate how the brain functions. In this study, we used the neuromuscular
junction (NMJ) as a model synapse to investigate the basic mechanisms of synapse
function and maintenance.

In chapter 2 of the dissertation, we studied the mechanism of synaptic vesicle
release, more specifically, the function of a pre-synaptic protein, complexin, at the
NMJ. We found that genetic ablation of complexin caused a reduced and
asynchronous vesicle release at the NMJ without changing the NMJ structure. This
leads us to propose the hypothesis that complexin may facilitate and synchronize
vesicle release by coupling synaptic vesicles with calcium channels.

In chapter 3, we examined whether an increase in post-synaptic muscle size has a
retrograde effect on the motoneuron and NMJ. Knockout of myostatin, a negative
regulator for muscle growth, results in an increase in muscle and NMJ size. Synaptic
transmission was significantly increased in myostatin null mice, maintaining the
synaptic homeostasis. The effect of myostatin deletion on motoneuron and NMJ
degeneration was also explored in a mouse model of amyotrophic lateral sclerosis
(ALS).
viii

Finally, in chapter 4, we investigated the maintenance and function of the NMJ in a
mouse model of spinal muscular atrophy (SMA), a childhood motoneuron disease.
We found that despite the apparent muscle weakness, NMJs in the hindlimb muscles
were innervated and functional, which suggests that the NMJ may not be the cause of
hindlimb muscle dysfunction.

Maintaining proper synapse function is critical for the function of the nervous
system, and disruption in synaptic structure and function has been implicated in
many neurological diseases. The current study provides more understandings on
how synapses function and may bring insight into diseases that involve synaptic
defects.

1

Chapter 1
General Introduction

1.1 The neuromuscular junction: a model synapse
A synapse is a specialized structure where information is transmitted from one cell to
another in the nervous system. Emotion, cognitive function and behavior are all
mediated through a synaptic network of 10
14
synapses between 10
11
neurons in the
human brain (Kandel et al., 2000). Neurons receive, integrate and exchange information
by the synaptic network and normal brain function relies on the proper formation,
maintenance and function of synapses. Loss of synapses, inappropriate synaptic
connections, and disrupted synaptic function has been implicated in many neurological
and psychiatric diseases (van Spronsen and Hoogenraad, 2010). To understand how the
brain functions and how synaptic defects might affect brain function in diseases, we must
first understand the basic principles of how synapses function.

The neuromuscular junction (NMJ) is a prototypical chemical synapse between the
motoneuron and its peripheral synaptic target, the muscle. Sharing many basic
characteristics with the neuron-neuron synapse, the NMJ has the advantage of a large
size, simple organization and easy accessibility, and has been serving as a model synapse
for decades. Much of our understanding about synapse structure and function originates
from studying the NMJ.

2

The vertebrate NMJ is a tripartite synapse composed of the pre-synaptic nerve terminal,
the post-synaptic specialization, and peri-synaptic Schwann cells (PSCs) (Fig. 1-1). The
nerve terminal, capped by PSCs, contains synaptic vesicles filled with acetylcholine
(ACh). Clusters of synaptic vesicles can be found at the active zone where vesicle
exocytosis and transmitter release takes place. Across the synaptic cleft and apposing the
active zone, the muscle has concentrated acetylcholine receptors (AChRs) on the crests of
specialized junctional folds and voltage-gated sodium channels (VGSCs) in the depths of
the folds. This structural arrangement ensures the timely and reliable response to ACh
and the efficacy of neuromuscular transmission (Sanes and Lichtman, 1999; Slater,
2008).

1.2 The formation and maintenance of the neuromuscular junction
The formation of the NMJ requires the coordination and reciprocal signaling between the
pre-synaptic nerve terminal and the post-synaptic muscle fiber. The motor nerve
terminal-secreted molecules induce the differentiation and maturation of post-synaptic
specializations, and the post-synaptic muscle fiber provides retrograde signals, which
affect the pre-synaptic differentiation and function (Wu et al., 2010).

The formation of the NMJ begins with the nerve-muscle contact. Before the nerve
terminal contacts the muscle fiber, however, the growth cone is already capable of
releasing ACh and pre-patterned AChR clusters are present on the muscle surface. The
pre-patterned AChRs are usually located in the central band of the muscle and motor
axons are shown to preferentially contact the pre-patterned AChRs and incorporate

3

Fig. 1-1 The vertebrate neuromuscular junction (NMJ) is a tripartite synapse.

NMJs from a wildtype adult mouse are fluorescently labeled with α-bungarotoxin for
acetylcholine receptors (red), yellow fluorescent protein (YFP) for nerve terminals
(green), and anti-S100 for peri-synaptic Schwann cells (PSCs, blue). This demonstrates
that mammalian NMJs are tripartite synapses and the co-localization of these three major
cellular components.

4

them into synapses during the initial synaptogenesis (Flanagan-Steet et al., 2005; Panzer
et al., 2006). The extremely low frequency of transmitter release in the nerve growth
cone is significantly increased within minutes of nerve-muscle contact through an
unknown muscle signal (Xie et al., 1986). At the same time, the nerve terminal releases
both negative and positive regulators to modulate the post-synaptic AChR expression.
The ACh released from the nerve terminal is believed to disperse AChRs through a
cyclin-dependent-kinase 5 (Cdk5)-dependent signaling pathway (Fu et al., 2005; Lin et
al., 2005; Misgeld et al., 2005). At the synaptic area, however, this dispersion is
counteracted by nerve-secreted agrin, which binds to the post-synaptic Lrp4 receptor to
activate the Musk-rapsyn mediated AChR clustering (Wu et al., 2010). The AChR
clusters that are at the non-synaptic area and those that are not innervated by the nerve
terminal are later dispersed (Kummer et al., 2006; Wu et al., 2010).

Disrupted signaling between the pre- and post-synaptic components results in a defective
NMJ assembly. For example, agrin knockout mice fail to form NMJs and the AChR
aggregates are much smaller and reduced in number (Gautam et al., 1996), and the
genetic ablation of muscle-specific β-catenin results in severe pre-synaptic defects
including abnormal nerve branching and a decrease in neurotransmitter release (Li et al.,
2008).

The formation and maturation of the NMJ also involves the structural modifications of
both the pre- and post- synaptic compartments. At the initial nerve-muscle contact, the
pre-synaptic nerve terminal contains few synaptic vesicles and there are no recognizable

5

active zones, which are highly specialized, electron dense membranes where vesicle
release takes place. Subsequently, the number of synaptic vesicles is increased, active
zones are formed and vesicles begin to cluster at the active zones (Sanes and Lichtman,
1999). The post-synaptic differentiation is achieved through the formation and
elaboration of the junctional folds, which are always aligned with the pre-synaptic active
zones, and restricted expression and aggregation of AChRs at the synaptic area (Sanes
and Lichtman, 1999). In addition, the post-synaptic AChRs and VGSCs make the switch
from the embryonic, immature isoform to the adult isoform (Wood and Slater, 2001). As
a result of the differentiation and maturation of synaptic structures, the initially weak and
often subthreshold synaptic transmission is strengthened and synaptic efficacy is
increased (Sanes and Lichtman, 1999).

Once mature, the NMJ is quite stable in adult life. In vivo time-lapse imaging of
mammalian NMJs showed the structural stability for a prolonged period of time
(Lichtman et al., 1987). The neuromuscular transmission efficacy is also maintained with
a high safety margin to prevent transmission failure (Wood and Slater, 2001). It is
believed that there is continuous cross talk signaling between the nerve terminal and the
muscle to maintain the integrity of the synaptic structure and function (Sanes and
Lichtman, 1999; Wood and Slater, 2001). In addition to the nerve and the muscle, the
PSC is also shown to be actively involved in the long-term maintenance of the vertebrate
NMJ as a long-term ablation of PSCs causes the retraction of the nerve terminal and a
reduction in synaptic transmission at the NMJ (Reddy et al., 2003).

6

The stability of the NMJ can be disrupted, however, in diseased conditions or in aging.
In a motoneuron disease, amyotrophic lateral sclerosis (ALS), for example, significant
NMJ pathologies and denervations occur much earlier than the motoneuron loss (Fischer
et al., 2004). Morphological defects of the NMJ are also observed in aging. Age-related
degenerative signs of the NMJ include denervation and fragmented and loss of post-
synaptic receptors, which might underlie sarcopenia, the age-related loss of muscle
strength and function (Valdez et al., 2010).

The NMJ assembly and long-term stability are of great importance for the proper NMJ
function. As discussed above, the precise and correct formation of the NMJ and the long-
term maintenance of the NMJ structure and function require continuous signaling and
interactions between the motor nerve terminal and the muscle fiber.

1.3 Synaptic transmission at the neuromuscular junction
A successful synaptic transmission at the NMJ is a result of an orchestrated collaboration
between the pre- and post-synaptic components. Upon the arrival of an action potential
at the pre-synaptic nerve terminal, the depolarization in membrane potential activates the
voltage-gated calcium channels (VGCCs), and the calcium influx triggers the vesicle
fusion with the membrane to release ACh into the synaptic cleft. The binding of ACh
and the AChRs opens the cation-selective ion channels to cause a positive net current into
the post-synaptic membrane. Once the accumulation of positive charges reaches the
threshold to activate VGSCs, an action potential is generated in the muscle fiber, which
in turn elicits muscle contraction (Wood and Slater, 2001). The neuromuscular synaptic

7

transmission is a very reliable process with a high efficacy to guarantee the function of
voluntary movements.

One of the factors contributing to the high efficacy, or the high safety factor, at the NMJ
is the release of more ACh from the nerve terminal than the minimum amount needed to
activate the post-synaptic muscle fiber. Synaptic vesicle exocytosis, and thus the release
of the neurotransmitters at the NMJ, is controlled by a specific machinery shared by
neurons as well as other secretory cells, the soluble N-ethylmaleimide sensitive factor
attachment protein receptor (SNARE) complex. The SNARE complex is composed of a
vesicle protein (the v-SNARE), synaptobrevin, and two membrane proteins (the t-
SNARE), syntaxin and SNAP-25. The assembly of the SNARE complex brings the
vesicle in close proximity with the membrane, and the calcium sensor, synaptotagmin,
detects the action potential induced calcium influx through the VGCCs and triggers the
vesicle fusion. The SNARE-mediated vesicle fusion controls both the amount and timing
of neurotransmitter release and is tightly regulated by additional proteins such as
complexin and Munc-13 (Sudhof, 2004; Rizo and Rosenmund, 2008).

On the surface of the muscle fiber, the post-synaptic specializations are made to ensure a
rapid and effective response to ACh released from the nerve terminal. The AChR
clusters on the crests of the junctional folds apposing the active zones render the fast ACh
binding. The narrow interfold space at the junctional folds provides a higher input
resistance for current flow, which increases the efficiency of ACh-gated ion channels and
VGSCs. Once the ACh is dissociated from the AChRs, acetylcholine esterase (AChE)

8

quickly cleaves ACh and terminates ACh action to allow a high frequency neuromuscular
activation (Wood and Slater, 2001).

The highly secure neuromuscular transmission may be hindered by structural alterations
at either the pre- or post-synaptic sites. The Lambert-Eaton myasthenia syndrome
(LEMS) and myasthenia gravis (MG) are two autoimmune diseases exhibiting defects in
a pre- and post-synaptic component, respectively. Both diseases show symptoms of
muscle weakness as a result of neuromuscular transmission failures. In LEMS, the
autoantibodies attack the pre-synaptic VGCCs and cause a reduced neurotransmitter
release. In MG, autoantibodies against AChRs decrease the number of functional AChRs
by blocking the ACh binding with the receptors, increasing the AChR degradation and
inducing complement-mediated lysis of the AChRs (Lang and Vincent, 2009; Shigemoto
et al., 2010).

Neuromuscular transmission not only mediates voluntary movement, but is also
important in both the development and maintenance of the NMJ. In choline
acetyltransferase (ChAt) knockout mice, the complete loss of synaptic transmission
results in a lack of NMJ formation, extensive nerve sproutings and increases in the
number and size of AChRs (Brandon et al., 2003). The synaptic transmission also plays
an important role in the maturation of the NMJ during development. During the first two
weeks of neonatal life, mammalian NMJs are innervated by multiple synaptic inputs and
have to undergo synaptic elimination to become singly innervated. The strength of
synaptic transmission determines which synaptic input would withdraw and which input

9

would remain. Typically, the synaptic input with a stronger synaptic activity wins the
competition. Blocking synaptic activity slows the synapse elimination process and
increasing activity accelerates this process (Personius and Balice-Gordon, 2000). In adult
life, NMJ inactivity may cause nerve terminal sprouting and formation of ectopic AChRs
(Deschenes et al., 2006).

The NMJ, as a model synapse, has provided much fundamental knowledge of the
formation, structure and function of a chemical synapse. In this dissertation, we utilized
the NMJ to study the molecular mechanism of neurotransmitter release, the maintenance
and homeostasis of the NMJ function, and the involvement of NMJ dysfunction in a
motoneuron disease. In chapter two, we examine the function of a SNARE-associated
pre-synaptic protein, complexin, on vesicle exocytosis. In chapter three, the effect of
muscle enlargement on the structure and synaptic transmission of the NMJ is
investigated. And in chapter four, the maintenance and function of the NMJ in the
childhood motoneuron disease, spinal muscular atrophy (SMA), is studied.

10

Chapter 2
Complexins Facilitate Exocytosis and Synchronize Vesicle Release by Coupling
Vesicles and Calcium Channels

2.1 Introduction
Calcium-mediated vesicle exocytosis is critical for the proper function of the nervous and
endocrine system. The fusing of vesicle and plasma membranes during exocytosis is
mediated by the SNARE complex (synaptobrevin, SNAP-25 and syntaxin) and a number
of associated proteins (Sudhof, 2004). Complexin (Cplx) is one of these associated
proteins that bind to the SNARE complex in a 1:1 stoichiometry (Brose, 2008b). There
are four complexin isoforms (1-4) in mammals and they can be divided into two sub-
families, complexin 1, 2 and complexin 3, 4, with a similar structure and function within
the sub-family (Brose, 2008b). Changes in the complexin level are known to affect
vesicle exocytosis, and dysregulation of complexin expression was found in many
psychological and neurodegenerative disorders (Brose, 2008a and b). Although it is
generally accepted that complexin regulates the Ca
2+
-mediated synchronous vesicle
release, the exact function of complexin remains unclear (Brose, 2008b).

One hypothesis is that complexin binding “clamps” the SNARE complex, inhibiting
otherwise constitutive spontaneous exocytosis (Giraudo et al., 2006; Ono et al., 1998;
Schaub et al., 2006; Tang et al., 2006; Huntwork and Littleton, 2007). The bound
complexin is then displaced by synaptotagmin and this displacement relieves the “clamp”
allowing exocytosis to occur (Tang et al., 2006). However, the studies supporting the

11

negative clamp hypothesis were conducted mostly with invertebrate neurons (Huntwork
and Littleton, 2007) or artificially reconstituted, cell-free systems (Giraudo et al., 2006;
Schaub et al., 2006, Tang et al., 2006), which have the major drawback of incorporating
only a few components of the vast secretory machinery.

In contrast, another series of work demonstrated that complexin enhances secretion
(Reim et al., 2001; Tokumaru et al., 2001; Xue et al., 2008; Strenzke et al., 2009; Cai et
al., 2008). In an attempt to reconcile some of these contradicting results, a recently
proposed hypothesis is that complexin is capable of both inhibiting and enhancing
exocytosis depending on various factors: the number of complexin molecules (Yoon et
al., 2008), the type of vesicle release whether spontaneous, synchronous or asynchronous
(Maximov et al., 2009; Strenzke et al., 2009; Cho et al., 2010), which domain of
complexin dominates (Xue et al., 2007), and whether it’s Drosophila or murine
complexin (Xue et al., 2009). Although complexin’s significance in exocytosis is
obvious, the discrepancies in these studies make it difficult to generate a clear model of
complexin’s precise mechanistic role in neurotransmission.

Here, we use the mammalian NMJ and adrenal chromaffin cells as two complementary
model systems to study the function of complexin. The mouse NMJ allows us to
examine complexin function at an easily accessible chemical synapse whereas the
chromaffin cells allow us to investigate the mechanism of complexin. We present data
that show complexin is critical in facilitating and synchronizing the calcium-mediated
fast neurotransmitter release at the NMJ. In addition, we found a decrease in the number

12

of vesicles that are closely associated with the voltage gated calcium channels (VGCCs)
in chromaffin cells depleted of complexin.

2.2 Material and Methods
Animals.
Complexin knockout mice breeding pairs were started in the USC animal facility with
hemizygous mice (Cplx1
+/-
and Cplx2
+/-
) provided by Dr. Nils Brose (Max Planck
Institute for Experimental Medicine, Goettingen, Germany). Mice were tailed and
genotyped as described (Cai et al., 2008). Wildtype or hemizygous littermates were used
as control animals.

RT-PCR and quantitative RT-PCR.
To examine the expression of complexin isoforms, brain, spinal cord and retina from
adult wildtype mice were collected and the total RNA was extracted using TRIzol reagent
and treated with DNA-free kit (Ambion). The concentration of RNA was measured in a
spectrophotometer at 260 nm absorbance, and 2 µg of total RNA was reverse-transcribed
using SuperScript III (Invitrogen) to synthesize complementary DNA (cDNA).
Quantitative RT-PCR was performed using a CFX96 real-time PCR detection system
(Bio-Rad). The relative expression level for each gene was calculated using the 2
-DDCt

method (Livak and Schmittgen, 2001), and all PCR values was normalized with the
housekeeping gene, glyceraldehyde-3-phosphate dehydrogenase (GAPDH). Complexin
1 was detected using 5’-AGTTCGTGATGAAACAAGCCC-3’ and 5’-
TCTTCCTCCTTCTTAGCAGCA-3’ primers. Complexin 2 was detected using 5’-

13

AAGAGCGCAAGGCGAAACA-3’ and 5’- TGGCAGATATTTGAGCACTGTG-3’
primers. Complexin 3 was detected with 5’- AAGGGGGACGGAGACAAGT-3’ and 5’-
CTGTGCATCTCGCTCCATCTT-3’ primers. Complexin 4 was detected with 5’-
GGAGGTGGGTCTGAAGAAAAG-3’ and 5’- CCCTGAGGTGGACTCGTAGG-3’
primers. Synaptophysin was detected using 5’-CAGTTCCGGGTGGTCAAGG-3’ and
5’-ACTCTCCGTCTTGTTGGCAC-3’ primers. GAPDH was detected using 5’-
AGGTCGGTGTGAACGGATTTG-3’ and 5’-TGTAGACCATGTAGTTGAGGTCA-3’
primers. PCR condition was set as the following, 95ºC for 30 seconds, 55ºC for 30
seconds, and 72ºC for 60 seconds for 35 cycles.

Immunohistochemistry of NMJs.
Mice were anaesthetized by intraperitoneal injection of Nembutal (sodium pentobarbital;
50 mg/kg) or ketamine/ xylazine (100 mg/kg ketamine/ 10 mg xylazine) and
transcardially perfused with normal Ringer’s solution followed by 4% paraformaldehyde.
The extensor digitorum longus (EDL) muscle was teased into layers of 5-10 fibers thick
to facilitate penetration of antibodies that include: anti-complexin1/2, 3 and 4 (Synaptic
systems, Germany), anti-synaptophysin (Invitrogen) and anti-S100 (Dako).
Acetylcholine receptors (AChRs) were labeled by Alexa Fluor 594-conjugated α-
bungarotoxin (Invitrogen).

Intracellular recording of the neuromuscular junction.
The extensor digitorum longus (EDL) muscle from 1-4 months old mice was dissected
with the sciatic nerve attached. Intracellular recording was performed in oxygenated

14

normal mammalian Ringer’s solution (in mM, 135 NaCl, 5 KCl, 1 MgSO
4
, 15 NaHCO
3
,
1 Na
2
HPO
4
, 11 D-glucose, 2.5 Calcium gluconate, pH 7.4). Muscle contraction was
blocked by pre-incubating the muscle in 2- 3 µM µ-conotoxin (Biomol, US) for 30
minutes. The recording was then performed in the toxin-free Ringer’s solution. At least
20 miniature endplate potentials (MEPPs) and 40-70 evoked endplate potentials (EPPs)
were recorded from a given junction. The EPPs were elicited by 1Hz train through a
suction electrode, normalized to –75mV and corrected for nonlinear summation
(McLachlan and Martin, 1981). The mean quantal content was calculated by direct
method (del Castillo and Katz, 1954). Synaptic transmission was also assessed by pair-
pulse stimulation (10 ms apart) and high frequency (30 Hz) stimulation. In BAPTA-AM
experiments, the muscles were pre-incubated with normal Ringer’s solution containing
100 µM BAPTA-AM for 2 hours before recording. Hypertonic challenge was applied by
incubating the muscle in 500 mM sucrose-Ringer’s solution and the increase in MEPP
frequency was recorded in multiple junctions for the first 20 minutes. Data was acquired
and analyzed by pClamp8 software and Minialysis software.

Chromaffin cell culture.
Mice at 8-13 days of age were used for chromaffin cell experiments. Mouse adrenal
chromaffin cells were obtained as follows: (i) adrenal glands were dissected out from 8-
13 day old mouse, (ii) glands were digested with filtered, activated papain (~18 units per
1 ml of enzyme solution, bubbled with 95% O
2
, 5% CO
2
for > 20 min) by shaking in a 37
degree water bath for 25-30 min, (iii) enzyme solution was replaced by chromaffin cell
media and glands were triturated and plated on glass bottomed chambers (4 per mouse).

15

Enzyme solution contained L-cysteine-supplemented high glucose DMEM with 100 mM
CaCl
2
and 50 mM EDTA. Chromaffin cell media contained high glucose DMEM with
0.1% penicillin/streptomycin and 1% serum-free supplement (Insulin-Transferrin-
Selenium-X).

Electrophysiological experiments of Chromaffin cells.
Chromaffin cells were patched 2-4 days post dissection. Capacitance recordings were
obtained in conventional whole cell patch clamp configuration with an Olympus IX70
inverted microscope, EPC-9 amplifier and Pulse software (HEKA Electronics), as
described previously (Cai et al., 2008). The glass-bottomed chambers with adherent
chromaffin cells were washed with PBS and then filled with standard extracellular
solution consisting of 140 mM NaCl, 2.8 mM KCl, 10 mM HEPES, 1 mM MgCl
2
, 2 mM
CaCl
2
, 10 mM glucose, pH adjusted to 7.2-7.4, and osmolarity adjusted to 290-310. The
pipette solutions contained 10 mM NaCl, 145 mM glutamic acid, 10 mM HEPES, 1 mM
MgCl
2
, 2 mM ATP, 0.5 mM GTP, titrated with 5 M CsOH to pH 7.2-7.4, and osmolarity
adjusted to 290-310.

2.3 Results
Complexin 1 is the major isoform at the mouse NMJ
To examine which, if any, of the four complexin isoforms is expressed at the mouse
NMJ, we first used RT-PCR to detect complexin mRNAs in the ventral spinal cord,

16

where motoneurons are located (Fig. 2-1a). Complexin 1 and 2 mRNAs were both found
in the spinal cord of the wild-type (WT) mouse. Complexin 1 was expressed at a higher
level compared to complexin 2, which was barely detectable. Complexin 3 was not
detected in the spinal cord but present in the brain and retina. Complexin 4 was detected
only in the retina. This suggests that complexin 1 is the most highly expressed complexin
isoform in the spinal cord.

Next, we used immunocytochemistry to investigate the expression patterns of complexin
proteins at the mouse NMJ, using antibodies that recognize complexin 1/2, 3 and 4.
Complexin 1/2 was abundant and co-localized with the acetylcholine receptors (AChRs,
labeled with α-bungarotoxin) at WT NMJs (Fig. 2-1b) whereas complexin 3 and 4 were
undetectable (Fig. 2-2). Since the complexin 1/2 antibody cannot differentiate between
complexin 1 and 2, we next examined NMJs in complexin 1 KO and complexin 2 KO
mice. At complexin 1 KO NMJs, the complexin 1/2 immunoreactivity was absent or
very weak, which suggests a low complexin 2 expression. However, robust complexin
1/2 immunoreactivity could be seen at complexin 2 KO NMJs, which indicates a strong
complexin 1 expression (Fig. 2-1b). Similar to WT NMJs, complexin 3 and 4
immunoreactivity was absent at both complexin 1 KO and complexin 2 KO NMJs (data
not shown). Deletion of complexin 1 does not lead to significant changes in the
expression of complexin 2 and major SNARE complex proteins in the spinal cord (Fig. 2-
3). These results show that complexins are expressed at the mouse NMJ; complexin 1 is
the major complexin isoform; and absence of complexin 1 does not lead to a significant
change of other complexin isoforms and SNARE complex proteins.

17

Fig. 2-1 Complexin 1 is the major complexin isoform at the mouse NMJ.

(a) Expression of complexin (Cplx) mRNAs was examined with RT-PCR. In the spinal
cord, complexin 1 is the most abundant isoform; (b) NMJs from wildtype (WT),
complexin 1 KO and complexin 2 KO mice were labeled with α-bungarotoxin for
acetylcholine receptors (red) and antibodies against complexin 1/2 (green). Complexin 2
was found to be absent at complexin 1 KO NMJs, while robust complexin 1 expression
can be detected at complexin 2 KO NMJs.

18

Fig. 2-2 Complexin 1/2, but not 3, 4 are expressed at wildtype NMJs.

NMJs from wildtype (WT) mice were labeled with α-bungarotoxin for acetylcholine
receptors (red) and antibodies against complexin 1/2, 3 and 4 (green). Complexin 1/2
was found at WT NMJs but no complexin 3 or 4 expression can be detected.

19

Complexin 1 KO NMJs have a normal structure
To examine whether lack of complexin 1 would lead to NMJ structure alterations, WT
and complexin 1 KO NMJs were labeled with anti-synaptophysin for the nerve terminal,
anti-S100 for the peri-synaptic Schwann cells (PSCs), and α-bungarotoxin for post-
synaptic AChRs (Fig. 2-4). Similar to WT NMJs, nerves and PSCs are well co-localized
with the AChRs at complexin 1 KO NMJs. We did not find denervation or sprouting of
nerves or PSCs at the complexin 1 KO NMJ. Furthermore, when we examined the
ultrastructure of complexin 1 KO NMJs, the gross structure was similar, and there was no
difference in the number of docked and total vesicles between the WT and complexin 1
KO NMJs (data not shown). In summary, the complexin 1 KO NMJ structure was not
significantly changed.

Complexin 1 KO NMJs show a reduction in spontaneous vesicle release
To explore the effect of complexin 1 removal on NMJ synaptic transmission, we
performed intracellular recording in EDL muscles from adult (1-4 months old) mice.
Wild-type (Cplx1
+/+
) or hemizygous (Cplx1
+/-
) littermate controls were used in the
experiments since no difference in NMJ synaptic transmission was observed between the
two genotypes (data not shown). Muscles were pre-incubated with µ-conotoxin (2-3 µM)
before recording to prevent muscle contraction. At this low concentration, µ-conotoxin
selectively blocks muscle-specific sodium channels without affecting the pre-synaptic
synaptic transmission (Cruz et al., 1985). Spontaneous miniature and evoked endplate
potentials (MEPPs, EPPs) were recorded in toxin-free normal Ringer’s solution
containing 2.5 mM Ca
2+
.

20

Fig. 2-3 Expression of complexin 2 and other major SNARE complex proteins were
not significantly different in complexin 1 KO spinal cords.

Quantitative RT-PCR was performed to examine the gene expression of complexin 2,
SNAP 25, Synaptotagmin 1 and 2 (Syt 1 and Syt 2), Syntaxin 1a and VAMP 2 in the
spinal cord of wildtype (WT) and complexin 1 KO mice. No significant difference in
gene expression was found (n=3 mice from each genotype). Error bars, s.e.m.

21

Fig. 2-4 NMJ structure is not altered in complexin 1 KO mice.

NMJs from wildtype (WT) and complexin 1 KO mice were labeled with α-bungarotoxin
for acetylcholine receptors (red) and antibodies against synaptophysin for (a) nerve or (b)
S100 for Schwann cells (green). No denervation or nerve/Schwann cell sprouting was
observed at complexin 1 KO NMJs.

22

At complexin 1 KO NMJs, there was a significant decrease (~70 %) in MEPP frequency
(Fig. 2-5), suggesting a positive pre-synaptic role of complexin in regulating spontaneous
vesicle release. In contrast, the MEPP amplitude was not altered at complexin 1 KO
NMJs, and there was no change in the MEPP rise and decay time, which indicated that
complexin does not exert a post-synaptic effect on NMJ synaptic transmission. In
addition to complexin 1, the effect of complexin 2 deletion on spontaneous vesicle
release was also examined, and no significant change in MEPP frequency or amplitude
was detected at complexin 2 KO NMJs. The finding that there is a reduced MEPP
frequency at complexin 1 KO NMJs suggests that complexin facilitates spontaneous
vesicle release at the mouse NMJ.

Complexin 1 KO NMJs show a reduction and desynchronization in evoked vesicle
release
In addition to the decreased spontaneous vesicle release, complexin 1 KO NMJs
displayed severe defects in nerve evoked synchronous vesicle release. Complexin 1 KO
NMJs showed a 71 % decrease in EPP amplitude and a similar 66% decrease in quantal
content (QC) (Fig. 2-6). Moreover, complexin 1 KO NMJs were unable to maintain the
normal synchronization of evoked vesicle release. In control littermates, the EPP peak
time is almost always identical at a given junction, which indicates essentially
simultaneous release of multiple vesicles upon stimulation (Fig. 2-6a). However, at a
given complexin 1 KO junction, with every stimulus, the EPP peak time is no longer the
same, suggesting variations in the timing of nerve evoked vesicle release (Fig. 2-6a).

23

Fig. 2-5 Spontaneous vesicle release is reduced at complexin 1 KO NMJs.

(a) Sample traces of MEPPs from control (top) and complexin 1 KO (bottom) NMJs.
Sample traces of individual MEPPs from control and complexin 1 KO are shown on the
right; (b) MEPP frequency is significantly reduced at complexin 1 KO but not complexin
2 KO NMJs (Ctrl vs. complexin 1 KO vs. complexin 2 KO: 0.85±0.11 vs. 0.27±0.03 vs.
1.10±0.14 Hz); (c) MEPP amplitude is not different at both complexin 1 KO and
complexin 2 KO NMJs (Ctrl vs. complexin 1 KO vs. complexin 2 KO: 0.42±0.03 vs.
0.44±0.03 vs. 0.44±0.01 mV); (d, e) Rise time and decay time of MEPPs are similar
between complexin 1 KO and control NMJs (Rise time, Ctrl vs. complexin 1 KO:
0.86±0.03 vs. 0.92±0.03 ms; Decay time, Ctrl vs. complexin 1 KO: 1.46±0.07 vs.
1.46±0.04 ms.). (n=100-130 NMJs from 5-7 mice for each genotype; *** p< 0.001;
unpaired t-test) Error bars, s.e.m.

24

Fig. 2-6 Evoked vesicle release is reduced and desynchronized at complexin 1 KO
NMJs.

(a) Sample traces of EPPs from control (left) and complexin 1 KO (right) NMJs; (b) EPP
amplitude is greatly decreased at complexin 1 KO NMJs. However, EPP amplitude is
unaltered at complexin 2 KO NMJs (Ctrl vs. complexin 1 KO vs. complexin 2 KO:
20.34±0.45 vs. 6.20±0.53 vs. 21.09±1.06 mV); (c) Quantal content is significantly
reduced at complexin 1 KO NMJs but remained the same for complexin 2 KO NMJs.
(Ctrl vs. complexin 1 KO vs. complexin 2 KO: 42.39±2.82 vs. 14.37±1.09 vs.
40.45±1.74); (d, e, f) EPP rise time, decay time and half width were significantly
increased at complexin 1 KO NMJs (Rise time, Ctrl vs. complexin 1 KO vs. complexin 2
KO: 0.89±0.05 vs. 1.23±0.06 vs. 0.94±0.03 ms; Decay time, Ctrl vs. complexin 1 KO vs.
complexin 2 KO: 3.84±0.09 vs. 4.70±0.10 vs. 4.01±0.11 ms; Half width, Ctrl vs.
complexin 1 KO vs. complexin 2 KO: 2.77±0.10 vs. 3.51±0.12 vs. 2.86±0.09 ms); (g)
EPP time of peak show greater variances at complexin 1 KO NMJs; (h) The delayed
vesicle release was significantly increased at complexin 1 KO NMJs. (n=100-130 NMJs
from 5-7 mice for each genotype; * p<0.05; ** p< 0.01; *** p< 0.001; unpaired t-test)
Error bars, s.e.m.

25

Only about 8 % of complexin 1 KO NMJs showed synchronized evoked vesicle release,
which is in sharp contrast to the 97 % in control NMJs (Fig. 2-6g). The
desynchronization of vesicle release is further illustrated by the elongated EPP time
course and increase in delayed, asynchronous vesicle release at complexin 1 KO NMJs.
About 20~30 % increase in EPP rise time, decay time and half width was found at
complexin 1 KO NMJs (Fig. 2-6d-f). In addition, in control NMJs, the synchronization
of evoked vesicle release is so tightly regulated that there is rarely any vesicle release
immediately following the nerve evoked synchronous vesicle release (0.13± 0.01 event/
stimulation). However, in complexin 1 KO NMJs, there is significantly higher incidence
of the delayed vesicle release (0.87±0.13 event/ stimulation; p=0.016).

Contrary to complexin 1 KO NMJs, complexin 2 KO NMJs did not exhibit significant
alterations in synaptic transmission (Fig. 2-6). The severe defects in transmitter release at
the complexin 1 KO NMJs and the lack of changes in synaptic transmission in complexin
2 KO NMJs again indicates that complexin 1 is the major functional complexin isoform
at the mouse NMJ. The decrease in synchronous vesicle release at the mouse complexin
1 KO NMJ is consistent with previous complexin KO studies in mammals and suggests
that mammalian complexins facilitate transmitter release. The “desynchronization” in
vesicle release observed at the complexin 1 KO NMJ further indicates that complexin 1
might be critical for regulating the timing of evoked vesicle release at the mouse NMJ.

26

Increase of extracellular Ca
2+
cannot fully restore synaptic transmission of
complexin 1 KO NMJs
Previous studies of complexin 1/2 KO and complexin 1/2/3 KO neurons in the brain have
shown that increasing extracellular Ca
2+
can fully rescue the reduction in synchronous
vesicle release (Reim et al., 2001; Xue et al., 2008). To test whether this is also true at
the NMJ, we examined the NMJ synaptic transmission in Ringer’s solution containing
various concentrations of Ca
2+
(2.5, 5 and 10 mM) (Fig. 2-7). When the Ca
2+

concentration was raised from 2.5 to 5 mM, control NMJs showed only a slight increase
(7 %) in quantal release whereas complexin 1 KO NMJs showed a more significant
increase (39 %). When the Ca
2+
concentration was further elevated to 10 mM, a slight
increase in quantal content was still observed at control NMJs, but not at complexin 1 KO
NMJs. At all Ca
2+
concentrations examined, the quantal release of complexin 1 KO
NMJs remained significantly lower than control NMJs (Fig. 2-7a). The
desynchronization of vesicle release at complexin 1 KO NMJs was also not rescued by
elevated Ca
2+
concentrations as evaluated by the EPP peak time variations (Fig. 2-7b) and
the EPP time course (Table 2-1). In addition, the increase in delayed release at
complexin 1 KO NMJs was more pronounced at higher Ca
2+
concentrations (Fig. 2-7c).
Taken together, in contrast to central synapses lacking complexins, increasing
extracellular Ca
2+
is unable to fully restore synaptic transmission at complexin 1 KO
NMJs.

27

Fig. 2-7 Increasing extracellular Ca
2+
cannot rescue defects in synaptic transmission
at complexin 1 KO NMJs.

(a) Quantal content was examined in Ringer’s solution containing 2.5, 5 and 10 mM Ca
2+

at control and complexin 1 KO NMJs. Increasing extracellular Ca
2+
failed to restore the
quantal content in complexin 1 KO mice (Ctrl vs. complexin 1 KO: 2.5 mM Ca
2+
,
42.39±2.82 vs. 14.37±1.09; 5 mM Ca
2+
, 45.39±4.53 vs. 20.03±2.56; 10 mM Ca
2+
,
49.53±4.77 vs. 19.76±1.83); (b) Higher extracellular Ca
2+
can only slightly improve the
desynchronized evoked vesicle release at complexin 1 KO NMJs; (c) The increase in
delayed vesicle release at complexin 1 KO NMJs became more pronounced at elevated
Ca
2+
concentrations (Ctrl vs. complexin 1 KO: 2.5 mM Ca
2+
, 0.13±0.01 vs. 0.87±0.13; 5
mM Ca
2+
, 0.19±0.02 vs. 0.88±0.09; 10 mM Ca
2+
, 0.21±0.03 vs. 1.64±0.18 Hz). (n=64-
108 NMJs from 4-7 mice for each genotype at each calcium concentration) Error bars,
s.e.m.

28

2.5 mM Ca
2+
5 mM Ca
2+
10 mM Ca
2+

control Cplx1 KO control Cplx1 KO control Cplx1 KO
Rise time (ms) 0.89±0.05 1.23±0.06* 0.97±0.04 1.22±0.05* 1.01±0.02 1.24±0.04*
Decay time
(ms)
3.84±0.09 4.70±0.10* 4.00±0.19 4.84±0.18* 4.22±0.17 5.20±0.30*
Half Width
(ms)
2.77±0.10 3.51±0.12* 2.96±0.11 3.59±0.15* 3.01±0.03 3.71±0.15*

Table 2-1 EPP time course at different Ca
2+
concentrations

* Values in Cplx1 KO mice significantly different from control (p<0.05, unpaired t-test).

29

Decrease of readily releasable pool at complexin 1 KO NMJs
One of the possible reasons for the reduction in quantal release at complexin 1 KO NMJs
is a reduction in the size of readily releasable pool (RRP). Hypertonic challenge has been
used to estimate the RRP size at the NMJ (Hubbard 1968; Rosenmund and Stevens,
1996; Toonen et al., 2006; Sons et al., 2006). We measured the increase in MEPP
frequency upon hypertonic challenge and found that complexin 1 KO NMJs showed
significantly less elevated MEPP frequency (control vs. complexin 1 KO; 31.4 ± 2.58 Hz
vs. 11.48 ± 1.14 Hz), which indicates a reduced RRP size (Fig. 2-8).

Strengthened short-term synaptic plasticity at complexin 1 KO NMJs
Another possibility for the reduced quantal content at complexin 1 KO NMJs is a reduced
release probability. To investigate this possibility, the NMJ was subjected to paired-pulse
(10 ms apart) and high frequency (30 Hz) stimulations. Complexin 1 KO NMJs
exhibited a much stronger paired-pulse facilitation compared to control NMJs (Fig. 2-9a,
Control, 102.1±0.7 %; complexin 1 KO, ***158.4±10.2 %; p<0.0001). When
challenging the NMJ with high frequency stimulation, both control and complexin 1 KO
NMJs were able to maintain synaptic transmission without failures. In contrast to control
NMJs, which displayed synaptic depression upon high frequency stimulation, complexin
1 KO NMJs showed synaptic facilitation (Fig. 2-9b). The stronger paired-pulse
facilitation and synaptic facilitation upon high frequency stimulation suggest that
complexin 1 KO NMJs have an initial lower release probability, which would contribute
to the decrease in quantal content. It also indicates that the accumulation of local Ca
2+

30

Fig. 2-8 Reduced RRP at complexin 1 KO NMJs

Sample traces of MEPPs in response to hypertonic challenge were shown on the top.
Complexin 1 KO NMJs showed significantly lower MEPP frequency compared to
control NMJs indicating a smaller RRP size at complexin 1 KO NMJs (Control vs.
complexin 1 KO: 31.4 ± 2.58 vs. 11.48 ± 1.14 Hz; *** p<0.0001; unpaired t-test). (n=
58-70 junctions from 4-7 mice for each genotype) Error bars, s.e.m.

31

Fig. 2-9 Strengthened short-term synaptic plasticity at complexin 1 KO NMJs.

(a) Sample traces of paired-pulse (10 ms apart) responses from control (left) and
complexin 1 KO (right) NMJs. Stronger paired-pulse facilitation was observed at
complexin 1 KO NMJs (Control vs. complexin 1 KO, 102.1±0.7 vs. 158.4±10.2 %; ***
p<0.0001; unpaired t-test; n=16-19 NMJs from 3-5 mice for each genotype); (b) Sample
traces of EPP responses upon 30 Hz stimulation. Control NMJs display depression
whereas complexin 1 KO NMJs display strong synaptic facilitation. (n=22-29 NMJs from
7 mice for each genotype) Error bars, s.e.m.

32

during repetitive stimulations allows significantly more vesicles to be released at
complexin 1 KO NMJs.

BAPTA-AM reduces the synaptic facilitation at complexin 1 KO NMJs
To examine whether the significant increase in paired-pulse facilitation at the complexin
1 KO NMJ is contributed by the Ca
2+
accumulation, we incubated the muscle with a
calcium chelator, BAPTA-AM (100 µM) to reduce the local Ca
2+
concentration and
observed its effect on the paired-pulse facilitation. In the presence of BAPTA-AM, the
paired-pulse facilitation at the complexin 1 KO NMJ was decreased to 84% of that
without BAPTA-AM (Fig. 2-10, Without BAPTA-AM: 158.4±10.2 % vs. with BAPTA-
AM: 132.8±2.6 %; p=0.018).

The immediately releasable pool size in complexin 2 KO chromaffin cells is
decreased.
In phasic synapses, such as the NMJ, the fast, synchronous neurotransmitter release is
believed to be mediated through synaptic vesicles closely coupled with the voltage gated
calcium channels (VGCCs) or the immediately releasable pool (IRP) (Horrigan et al.,
1994; Voets et al., 1999; Wadel et al., 2007). Our findings at the NMJ suggest that lack
of complexin results in a desynchronized vesicle release, together with the finding that an
increase in local Ca
2+
concentration significantly promotes vesicle release at the
complexin 1 KO NMJ, lead us to hypothesize that deficiency of complexin might cause a
loss of coupling between vesicles and the VGCCs.

33

Fig. 2-10 BAPTA-AM decreases the paired-pulse facilitation at complexin 1 KO
NMJs.

Sample traces of paired-pulse responses from without (left) and with BAPTA-AM treated
(right) complexin 1 KO NMJs. The calcium chelator, BAPTA-AM, significantly reduces
the paired-pulse facilitation at complexin 1 KO NMJs (Without BAPTA: 158.4±10.2 %
vs. with BAPTA-AM: 132.8±2.6 %; * p=0.018; unpaired t-test; n=19-20 NMJs from 3-5
mice for each group). Error bars, s.e.m.

34

To test this hypothesis, we monitored the vesicle secretion more directly by measuring
capacitance changes in chromaffin cells lacking complexin 2, the only complexin isoform
expressed in chromaffin cells (Archer et al., 2002; Cai et al., 2008). We elicited the
fusion of vesicles that are co-localized with calcium channels (IRP) by stimulating the
cell with brief 10 ms depolarizing pulses. The brief depolarizations induce a local
calcium influx that triggers the fusion of only the vesicles that are in close proximity with
the calcium channels. The brief 10 ms depolarization pulses were followed by a train of
longer 100 ms depolarizing pulses to induce fusions of other vesicles in the RRP (Fig. 2-
11a). We compared the IRP sizes in WT and KO cells by calculating the IRP/RRP ratio,
with the IRP represented by the sum of capacitance change during the brief 10 ms
depolarizations and the RRP by the total capacitance change during the brief 10 ms and
long 100 ms depolarizations (Voets et al., 1999). We observed a smaller capacitance step
changes during the brief 10 ms depolarizations in KO cells compared to WT cells,
resulting in a decrease in the IRP/RRP ratio (Fig. 2-11b). We compared WT and KO pups
ranging from 9-12 day old from the same litter to minimize genetic variability. Averaged
data from one recording session from a WT and KO mice belonging to the same litter
were collected and shown in Fig. 2-11c. WT cells showed an IRP/RRP ratio of 0.255 ±
0.022 whereas KO cells showed a 39% average decrease in IRP/RRP ratio (0.156 ±
0.085). We also combined multiple recording sessions as quantified in Fig. 2-11d, which
still showed a significant decrease of the IRP/RRP ratio in KO cells (overall average of
34% decrease, from 0.296 ± 0.027 to 0.196 ± 0.04). Thus, in chromaffin cells, deletion
of complexin results in a decrease in IRP size.

35

Fig. 2-11 Knock-out of complexin 2 impairs coupling of vesicles with voltage-gated
calcium channels (VGCCs) in mouse chromaffin cells.

(a) Example current traces from a WT (+/+, black) and KO (-/-, gray) chromaffin cells. A
series of 6 brief 10 ms depolarization pulses were used to selectively elicit fusion of
vesicles in the immediately releasable pool (IRP), followed by a series of 7 longer 100 ms
depolarization pulses were used to induce fusion of remainder vesicles in the readily
releasable pool (RRP). (b) Example normalized capacitance measurements from the one
WT (red) and one KO (blue) chromaffin cell showing decreased secretion of vesicles in
the IRP. Current traces from the first 10 ms pulse are shown to demonstrating that the
decrease in secretion is not due to a decrease in calcium influx (inset; Scale bars, 5 ms,
0.5 nA). (c) Averaged and normalized capacitance recordings done in one recording
session from chromaffin cells of a WT (+/+, black) or a KO (-/-, gray) mice. (d)
Calculated IRP/ RRP ratio (sum of step capacitance increases during brief 10 ms
depolarizing jump to 0 mV divided by the total step capacitance increases during brief 10
ms and long 100 ms depolarizing jumps to 0 mV) in WT and KO cells, as indicated.
Values for WT and KO cells are 0.25 + 0.015 (41 traces, 33 cells) and 0.17 + 0.016 (38
traces, 26 cells), respectively with a P value of 0.0004 (Mann Whitney). There was no
significant difference in the calculated averaged ionic current recordings (averaged area
of the inward current, ignoring the initial large spike due to Na+ channels) in WT and KO
cells, as indicated.

36

2.4 Discussion
We have shown that complexin 1 is the major isoform at the mouse NMJ. Lack of
complexin 1 caused a significant decrease of both spontaneous and evoked vesicle release
without altering the NMJ structure. Moreover, the synchronicity of vesicle release was
greatly disrupted and Ca
2+
accumulation following repeated stimulations resulted in
significant increases in vesicle release at complexin 1 KO NMJs. These data raise the
possibility that vesicles are no longer tightly coupled with calcium channels in the
absence of complexin. This hypothesis was supported by the decreased IRP size in
chromaffin cells depleted of complexin 2. Our data suggest that complexin positively
regulates vesicle release and is critical for synchronizing vesicle release by associating
vesicles with calcium channels.

Synchronicity of vesicle release
Besides the reduced synaptic transmission, desynchronization of vesicle release is one of
the major synaptic transmission defects at complexin 1 KO NMJs. Faithful, synchronous
synaptic transmission is critical for normal synaptic function. The variations in EPP peak
time and the increase in asynchronous, delayed vesicle release could affect normal NMJ
function and contribute to the severe ataxia in complexin 1 KO mice. Recently, it was
also reported that complexin 1 is required for precise timing of vesicle release at auditory
synapses and as a result, complexin 1 KO mice have hearing deficits (Strenzke et al.,
2009). It is interesting to note that the delayed release increases at higher extracellular
Ca
2+
concentrations at complexin 1 KO NMJs (Fig. 2-7). After a high frequency stimulus
train, the delayed release increased by 7 folds in complexin 1 KO mice, and the release

37

was the highest within 0.5 seconds following the train (data not shown). This would
indicate the asynchronous release is at least in part dependent on the residual Ca
2+
.
Another possible mechanism for the increase of asynchronous release is the association
between complexin and synaptotagmin. Similar to complexin 1 KO mice, in
synaptotagmin 2 KO mice, the NMJs displayed more asynchronous vesicle release (Pang
et al., 2006). The interaction of complexin, synaptotagmin and the SNARE complex will
be discussed in more detail later.

Coupling of vesicles and calcium channel
Normally, at phasic synapses such as mouse NMJs, during high frequency stimulation,
vesicle depletion would lead to synaptic depression. At complexin 1 KO NMJs,
however, they behave more like tonic synapses, showing reduced, more asynchronous
release upon stimulation, and displayed synaptic facilitation during high frequency
stimulation. Recently a model was proposed for the mechanism behind these different
properties between phasic and tonic synapses (Pan et al., 2009). The model suggested
two primed pools of vesicles, one attached to calcium channels and the other unattached,
and showed that the different synaptic responses of phasic vs. tonic synapses could be
simulated by varying the number of vesicles that are associated with calcium channels
(immediately releasable pool, IRP). The fast, synchronous vesicle release and synaptic
depression upon high frequency stimulation at phasic synapses could be reproduced by
increasing the size of IRP and the asynchronous vesicle release and facilitation upon high
frequency stimulation at tonic synapses by decreasing the size of IRP. The phasic-to-
tonic change of synaptic transmission at complexin 1 KO NMJs thus indicated a possible

38

decrease in IRP size. To further test this hypothesis, we used chromaffin cells, a system
where we could directly measure the IRP size and confirmed a reduced IRP in chromaffin
cells depleted of complexin 2.

The coupling of vesicles to calcium channels has been shown to be the rate-limiting step
for fast synchronous release (Wadel et al., 2007) and recent studies implicate
synaptotagmin, besides functioning as a calcium sensor, may also be the key molecule
responsible for synchronizing release by positioning synaptic vesicles close to calcium
channels (Young et al., 2009). Binding of complexin and synaptotagmin to the SNARE
complex has been documented in several studies (Tokumaru et al., 2008; Chicka and
Chapman, 2009). Our data suggest that complexins are involved in coupling the synaptic
vesicles with the calcium channels. We propose that complexin binding to the SNARE
complex stabilizes it and consequently enhances the primed vesicle pool. It also provides
a bigger, perhaps more stable scaffold to which synaptotagmin can bind. This stable
binding of synaptotagmin can then increase the number of vesicles that are associated
with calcium channels. We believe that the SNARE complex, synaptotagmin and
complexin interaction is a crucial step in targeting vesicles near calcium channels.

Implications of complexin dysregulation in diseases
We and others have shown that complexin is critical for calcium-mediated synchronous
vesicle release, which is required for normal synapse function. In many psychological
and neurodegenerative disorders, complexin expression is found to be significantly lower
and might thus impact the function of the nervous system (Brose 2008a). In mammalian

39

brains, complexin 2 is the major isoform, typically found at axo-dendritic synapses,
whereas complexin 1 is typically expressed at axo-somatic synapses (Eastwood and
Harrison, 2001; Harrison and Eastwood, 1998; Takahashi et al., 1995; Yamada et al.,
1999). It was originally suggested that complexin 2 was specifically expressed at
excitatory synapses and complexin 1 at inhibitory synapses, but a later study found they
are redundantly expressed at glutamatergic and GABAergic synapses (Reim et al., 2001).
Complexin 2 KO mice show significant abnormal social interactions and exhibit
depression-like symptoms, which was believed to be a consequence of down-regulated
neurotransmitter caused by the deficiency in complexin 2 (Glynn et al., 2010). Similar to
a mouse model of Huntington’s disease, mossy fiber LTP is reduced in complexin 2 KO
mice (Gibson et al., 2005; Glynn et al., 2010). A double transgenic mouse model
generated by crossing complexin 2 KO mice with a mouse model of Huntington’s disease
did not affect the disease progression (Glynn et al., 2007), which suggests deficiency of
complexin 2 might contribute to the disease symptoms. In addition, complexin 1 KO
mice display behavioral deficits, which might be masked by their severe ataxia (Glynn et
al., 2005). Although the causal role of complexin in neurological diseases has not been
established, it is believed that changes in complexin level may contribute to the disease
symptoms.

Loss of vesicle-channel coupling has been documented in diabetes mellitus (Rose et al.,
2007) and may prove to be a significant factor in other diseases involving impairment of
calcium-based secretion. Our results support complexins playing a critical role in
positioning vesicles near calcium channels. Dissecting out the molecular mechanism of

40

secretion regulation particularly how vesicles are targeted to calcium channels may lead
to novel pharmaceutical treatments of these disease.
The q-PCR experiment in Fig. 2-3 was performed by Dr. Zhihua Feng.
Chromaffin cell experiment in Fig. 2-11 was performed by Dr. Joyce Rohan

41

Chapter 3
The Function and Regeneration of Motoneurons and Neuromuscular Junctions in
the Absence of Myostatin

3.1 Introduction
Voluntary movement, the ability to command muscles by mental activity, requires the
proper signal transmission from motoneurons to muscles through the neuromuscular
junction (NMJ). Neuromuscular transmission and the size and strength of muscles are
constantly being adjusted to adapt to loading and environmental needs (Grinnell, 1995;
Landmesser, 1998; Cassano et al., 2009). In aging and muscular or motoneuron diseases,
muscle function is often compromised with the impairment in neuromuscular function
and a progressive loss of muscle mass (Glass, 2003; Murray et al., 2010). Restoring
muscle function by counteracting the muscle loss may improve motor dysfunction in
diseased conditions and better the quality of life in patients.

One possibility to restore muscle mass is to manipulate molecular pathways that regulate
muscle growth. Discovered in 1997, myostatin is a new member of transforming growth
factor-β (TGF-β) superfamily that negatively regulates muscle growth (McPherron et al.,
1997). Myostatin null mice exhibit a double muscle phenotype, contributed by both
hypertrophy (increase in fiber size) and hyperplasia (increase in fiber number)
(McPherron et al., 1997). Myostatin is secreted in a latent, inactive form and has to
undergo proteolytic cleavages to become active. Binding of myostatin to activin receptor
IIB (ActRIIB) leads to phosphorylation of Smad proteins and activation/inactivation of

42

corresponding genes (reviewed by Lee, 2004; Joulia-Ekaza and Cabello, 2007).
Myostatin inhibitors such as follistatin, myostatin antibody and soluble ActRIIB, have
been shown to increase muscle mass in mice (Lee and McPherron, 2001; Whittemore et
al., 2003; Lee et al., 2005). Conversely, administration of myostatin induces a severe loss
of muscle mass and fat in mice, mimicking cachexia in human patients (Zimmers et al.,
2002). The therapeutic effect of myostatin inhibition has been tested in aging, cancer,
multiple muscle disorders and motoneuron degenerative diseases and was found to
effectively restore muscle strength in several transgenic mouse models (Joulia-Ekaza and
Cabello, 2007; Zhou et al., 2010).

Muscle and muscle-derived factors are crucial for motoneuron survival during early
development and are known to be actively involved in the formation and maturation of
motor nerve terminals (Grinnell, 1995; Wu et al., 2010). During embryonic
development, motoneuron survival is proportional to the number of myotubes; muscle
ablation results in more motoneuron death and transplantation of a bigger muscle would
allow more motoneuron survival (Hamburger, 1934; Hollyday and Hamburger, 1976;
Buss et al., 2006). Trophic factors secreted by muscles, and muscle-derived factors were
found to be critical for NMJ formation, pre-synaptic nerve terminal differentiation and
function (Schwander et al., 2004; Li et al., 2008; Wu et al., 2010). Given that muscles
exert a retrograde effect on motoneurons and motor nerve terminals, manipulating
muscles through myostatin pathway may cause changes in motoneurons and NMJs.

43

In this study, we investigate the long-term effect of myostatin deletion on motoneurons
and NMJs in both physiological and pathological conditions. We examined the
motoneuron number, NMJ structure and function as well as the regeneration of NMJs
following nerve injury in myostatin null mice. In addition, we tested whether genetically
removing myostatin could ameliorate motoneuron degeneration in a mouse model of
amyotrophic lateral sclerosis (ALS), a motoneuron disease characterized by marked
muscle atrophy.

3.2 Material and methods
Animals.
All procedures related to the care and use of laboratory animals were conducted
according to the US National Institutes of Health guidelines for the use of live animals
and were approved by the Institutional Animal Care and Use Committee of the
University of Southern California. Myostatin null (Mstn
-/-
) mice were obtained from Dr.
Se Jin Lee. SOD1
G93A
(abbreviated as SOD1) mice were purchased from the Jackson
Laboratory (Stock# 004435). The SOD1 mice start to show disease symptoms at around
P90 and live for about 160 days (Heimen-Patterson et al., 2005; Wooley et al., 2005).
Both myostatin and SOD1 mutant mice are congenic C57BL/6 background. SOD1/Mstn
-
/-
mice were produced in a two-step mating protocol. Briefly, the first step involves the
crossbreeding of SOD1 mutant mice containing wild type myostatin background
(SOD1/Mstn
+/+
) with myostatin mutant mice containing wild type SOD1 background
(WT/Mstn
-/-
). The second step is to mate the SOD1/Mstn
+/-
male mice with WT/Mstn
+/-

and WT/Mstn
-/-
female mice to produce SOD1/Mstn
-/-
mice and control littermates.

44

Some myostatin and SOD1 mutant mice also express YFP driven by the Thy-1 promoter
(Feng et al., 2000).

Genotyping.
Simplified DNA isolation from mouse tails (0.5cm) was performed according to the
method of Laird et al., (1991). Human SOD1 gene (236 bp) will be detected using 5’–
CATCAGCCCTAATCCATCTGA–3’ and 5’-CGCGACTAACAATCAAAGTGA-3’
primers. As an internal standard, IL-2 (324 bp) will also be amplified using 5’-
CTAGGCCACAGAATTGAAAGATCT-3’ and 5’-
GTAGGTGGAAATTCTAGCATCATCC-3’ primers. For genotyping of myostatin null
mice, myostatin C-terminal region (220 bp) will be amplified with 5’-
AGAAGTCAAGGTGACAGACACAC-3’ and 5’-GGTGCACAAGATGAGTATGCGG-
3’ primers. Myostatin knock out allele (332 bp) will be amplified with 5’-
GGATCGGCCATTGAACAAGAT G-3’ and 5’-GAGCAAGGTGAGATGACAGGAG-
3’ primers with the following conditions: 95°C for 30 sec, 55°C for 30 sec, and 72°C for
60 sec for 35 cycles.

Immunohistochemistry of NMJs.
Mice were anaesthetized by intraperitoneal injection of Nembutal (sodium pentobarbital;
50 mg/kg) or ketamine/ xylazine (100 mg/kg ketamine/ 10 mg xylazine) and
transcardially perfused with normal Ringer’s solution followed by 4% paraformaldehyde.
The extensor digitorum longus (EDL) muscle was teased into layers of 5-10 fibers thick
to facilitate penetration of antibodies that include: anti-synaptophysin (Invitrogen) and

45

anti-S100 (Dako). Acetylcholine receptors (AChRs) were labeled by Alexa Fluor 594-
conjugated α-bungarotoxin (Invitrogen).

Intracellular recording of the neuromuscular junction.
The extensor digitorum longus (EDL) muscle from 3-4 months old mice was dissected
with the sciatic nerve attached. Intracellular recording was performed in oxygenated
normal mammalian Ringer’s solution (in mM, 135 NaCl, 5 KCl, 1 MgSO
4
, 15 NaHCO
3
,
1 Na
2
HPO
4
, 11 D-glucose, 2.5 Calcium gluconate, pH 7.4). Muscle contraction was
blocked by pre-incubating the muscle in 2- 3µM µ-conotoxin (Biomol, US) for 30
minutes. The recording was then performed in the toxin-free Ringer’s solution. At least
20 miniature endplate potentials (MEPPs) and 40-70 evoked endplate potentials (EPPs)
were recorded from a given junction. The EPPs were elicited by 1Hz train through a
suction electrode, normalized to –75mV and corrected for nonlinear summation
(McLachlan and Martin, 1981). The mean quantal content was calculated by direct
method (del Castillo and Katz, 1954). Synaptic transmission was also assessed by high
frequency (30Hz) stimulation. The size of readily releasable pool was estimated
according to Elmqvist and Quastel (1965). The quantal content of each EPP in response
to 30Hz stimulation was plotted against the cumulative quantal content. The initial linear
depression part was fitted with a linear function and extrapolated to cross the x-axis to
obtain an approximate RRP size. The probability of release was estimated by dividing
the first EPP QC by the RRP size (Juttner et al., 2005). Data was acquired and analyzed
by pClamp8 software and Minialysis software.

46

Histological examination of motoneurons.
After perfusion fixation described above, the spinal cord was fixed with 4% PFA in 4°C
overnight. L3-L5 spinal cord segments were removed and processed for cryosections at
35 µm thickness. Motoneurons were labeled with anti-choline acetyltransferase (ChAt)
antibody (Chemicon). Motoneurons were identified by positive ChAt immunostaining,
location and size (>20µm diameter). Number of motoneurons was counted every 200 µm
for at least 10 sections for each animal. The size of motoneurons (with a clear nucleus)
was measured with ImageJ software.

Nerve crush surgery
Mice were anesthetized with ketamine/ xylaine (100mg.kg ketamine/ 10 mg xylazine)
and a small incision was opened to expose the sciatic nerve. Nerve crush was performed
with forceps (Dumont tweezers, #5) holding on the sciatic nerve (2-3mm posterior and
parallel to the femur) for 30 seconds. The wound was then sutured with 4-0 silk threads.
Nerve crush was performed on the right leg, and the sciatic nerve of the left leg was kept
intact for control. The animals were allowed to recover and were sacrificed two weeks
after surgery.

Motor axon number count.
L4 ventral roots were fixed with 4% glutaraldehyde, post-fixed with 1% osmium
tetroxide and embedded in EPON. One-µm cross-sections were stained with toluidine
blue and imaged with confocal microscopy at 100x. The number of axons was counted
with ImageJ software.

47

Behavior and life span.
Mice were monitored every 5 days and their body weights were recorded. Motor
performance was monitored by the rota-rod test and hindlimb grip strength measurement.
For the rota-rod test, the mouse was placed on a rotating rod and the rotating speed was
increased from 4 rpm to 40 rpm in 1 minute and the speed at which the mouse dropped
was recorded. The hindlimb grip strength was measured by a grip strength meter
(Chatillon). To examine life span, mice were sacrificed at the end stage when the animal
could not right itself within 30 seconds after being placed sideways.

3.3 Results
Myostatin null mice have normal NMJ structure and motoneuron number
To address whether deleting myostatin affects the NMJ structure, we examined the NMJ
with confocal microscopy in a hindlimb muscle, extensor digitorum longus (EDL), from
3-5 months old mice. To facilitate the visualization of the NMJ, we crossed myostatin
null mice with mice expressing yellow fluorescent protein (YFP) in all motoneurons
(Feng et al., 2000). As shown in Fig. 3-1, nerve terminals (YFP-positive) and peri-
synaptic Schwann cells (PSCs, labeled with anti-S100) were co-localized with the
acetylcholine receptors (AChRs, labeled with α-bungarotoxin) in both wildtype (WT)
and myostatin null (Mstn
-/-
) mice. Corresponding to the larger muscle fiber size
(McPherron et al., 1997; Mendias et al., 2006; Amthor et al., 2009), the endplate size
(AChR area) in myostatin null mice was significantly increased by ~28% (WT vs. Mstn
-/-
, 421.8±10.4 vs. 541.5±11.8 µm
2
; p<0.0001). Besides the endplate size difference, no

48

Fig. 3-1 The NMJ structure and motoneuron number are normal in myostatin null
mice

(a) NMJ structure was examined in the extensor digitorum longus (EDL) muscle from 3-
5 months old WT (top) and Mstn
-/-
(bottom) mice. Acetylcholine receptors were labeled
with α-bungarotoxin (BTX, red). Nerves were identified with the expression of yellow
fluorescent protein (YFP, green). Schwann cells were labeled with anti-S100 antibody
(blue). The merged images showed normal NMJ structure in both WT and Mstn
-/-
EDL
muscles; (b) Sample pictures of lumbar spinal cord sections (L3-5) show motoneurons
labeled with anti-ChAT (dark brown); (c) Number of motoneurons at L3-5 spinal
segments was found to be similar in WT and Mstn
-/-
mice. (At least 500 motoneurons
were counted in each animal; 3 mice per genotype) Error bars show s.e.m.

49

significant change was detected at the NMJ of myostatin null mice. The NMJ was singly
innervated and there was no loss or sprouting of nerve terminals and PSCs in myostatin
null mice.

Motoneuron survival depends on its target size during embryonic development and the
increase in the number and size of muscle fibers in myostatin null mice might result in
more motoneuron survival. However, when we counted the number of motoneuron
(identified with positive choline acetyltransferase (ChAT) immunoreactivity, size and
location; Fig. 3-1), there was no difference in motoneuron number between WT and
myostatin null mice in the spinal cord (lumbar 3-5) innervating hindlimb muscles (WT
vs. Mstn
-/-
, 26.7±1.5 vs. 28.2±0.5). In addition, motoneuron size was also not
significantly different (WT vs. Mstn
-/-
, 1270.0±58.5 vs. 1249.1±57.3 µm
2
). In summary,
genetic deletion of myostatin results in an increase in the endplate size, but does not
cause changes in the NMJ structure, motoneuron number and size.

Increase of quantal content at NMJs of myostatin null mice.
To explore whether the enlarged muscle fiber in myostatin null mice might affect the
neuromuscular transmission, intracellular recording was performed in EDL muscles from
adult (3-5 months old) WT and myostatin null mice. Muscle contraction was prevented
by pre-incubating the muscle in 2-3 µM of µ-conotoxin. Spontaneous and evoked
endplate potentials (MEPPs, EPPs) were then recorded in toxin-free normal Ringer’s
solution.

50

MEPPs and EPPs could be recorded from both WT and myostatin null mice (Fig. 3-2),
suggesting the morphologically intact NMJs are also functional in releasing
neurotransmitters. MEPP frequency was similar in both genotypes (Fig. 3-2; WT vs.
Mstn
-/-
, 1.37±0.13 vs. 1.44±0.11 Hz), and there was a slight but significant decrease in
MEPP amplitude at the NMJ of myostatin null mice (Fig. 3-2; WT vs. Mstn
-/-
, 0.51±0.05
vs. 0.40±0.02 mV; p<0.05). The lower MEPP amplitude was most likely due to the
smaller input resistance of the larger muscle fiber in myostatin null mice (McPherron et
al., 1997). However, EPP size was not altered at the NMJ of myostatin null mice (Fig. 3-
2; WT vs. Mstn
-/-
, 27.19±1.14 vs. 27.5±0.93 mV). Correspondingly, quantal content
(QC), calculated by dividing the average amplitude of EPP over MEPP (Del Castillo et
al., 1954), was significantly higher by 17% in myostatin null mice (Fig. 3-2; WT vs.
Mstn
-/-
, 47.10±2.06 vs. 54.97±2.14; p=0.008). Overall, neuromuscular transmission in
myostatin null mice was normal with a modest increase in quantal release.

Larger RRP size at myostatin null NMJs
The increase in quantal content found at the NMJ of myostatin null mice could result
from a higher release probability, a larger readily releasable pool (RRP) size or both. To
investigate these possibilities, we examined the NMJ response upon high frequency
stimulation (30Hz). During a 30Hz stimulus train, NMJs in myostatin null mice, similar
to WT NMJs, did not exhibit any failure in synaptic transmission. In addition, NMJs in
WT and myostatin null mice showed almost identical EPP responses (after normalizing to
the first EPP) during the 30Hz stimulation (Fig. 3-3). The RRP size, calculated according
to Elmqvist and Quastel (1965), revealed a significant increase (~50%) in RRP size in

51

Fig. 3-2 Neuromuscular transmission at the NMJ of myostatin null mice.

(a) Sample traces of MEPPs from WT (top) and Mstn KO (bottom) NMJs; (b) Sample
traces of EPPs of WT (left) and Mstn KO (right) NMJs; (c) Mstn KO NMJs had similar
MEPP frequency, but showed smaller MEPP amplitude. EPP amplitude was similar
between WT and Mstn KO NMJs. Quantal content was higher at Mstn KO NMJs (n=
48-60 NMJs from 3 WT and Mstn KO mice; *p<0.05, **p<0.001). Error bars show
s.e.m.

52

Fig. 3-3 Myostatin null NMJs have a larger RRP.

(a) Sample traces of EPPs upon 30Hz stimulation at WT (top) and Mstn KO (bottom)
NMJs; (b) Synaptic responses normalized to the first EPP. WT and Mstn KO NMJs are
similar in responses after normalization; (c) RRP size is larger at Mstn KO NMJs.
Release probability is not significantly different between WT and Mstn KO NMJs (n=14-
17 NMJs from 3 WT and 3 Mstn KO mice; ***p<0.0001). Error bars show s.e.m.

53

myostatin null mice (Fig. 3-3; WT vs. Mstn
-/-
, 1729±90 vs. 2666±191; p=0.0002). The
probability of release, calculated by dividing the QC of the first EPP by RRP size (Juttner
et al., 2005), was slightly lower, but not significantly different (Fig. 3-3; WT vs. Mstn
-/-
,
0.031±0.002 vs. 0.026±0.002; p=0.15). These data indicate that NMJs in myostatin null
mice can sustain repeated nerve activation and the increase in quantal release could be
attributed to a larger RRP.

Nerve regeneration following nerve crush was not compromised in myostatin null
mice
We have shown so far, that under physiological conditions, NMJs in myostatin null mice
are normal in structure and have a slightly enhanced synaptic efficacy, but it remains
unknown how motor nerve terminals respond to nerve injury in myostatin null mice. To
investigate this question, we crushed the sciatic nerve of the right hindlimb in 3-4 months
old WT and myostatin null mice and examined the NMJ regeneration in the EDL muscle
2 weeks after nerve injury. Muscle atrophy resulting from denervation was found to be
similar in WT and myostatin null mice. EDL muscles on the nerve-crush side weighed
~80% of that on the intact side (WT vs. Mstn
-/-
, intact: 14.4±0.7 vs. 25±1.2 mg, nerve-
crush: 11.9±0.6 vs. 18.7±1.1 mg). Two weeks after nerve injury, majority of nerve
terminals have come back to reinnervate NMJs in WT as well as in myostatin null mice
(Fig. 3-4). Only a small percentage of endplates remained partially innervated or
unoccupied by nerve terminals (WT vs. Mstn
-/-
, innervated: 88.3±2.3 vs. 74.3±10.9 %;
partially innervated: 9.8 ±0.9 vs. 20.7±6.9 %; denervated: 1.9±1.4 vs. 5.0±4.4 %). The
proportion of NMJs with nerve terminal sprouting and Schwann cell sprouting was also

54

Fig. 3-4 Myostatin null NMJs are similar in regeneration following nerve crush.

(a) The recovery of NMJs 2 weeks following nerve crush surgery was examined in EDL
muscle in both WT (left) and Mstn KO (right) mice. Acetylcholine receptors were labeled
with α-bungarotoxin (BTX, red), nerves were recognized with positive YFP expression
(green), and Schwann cells were labeled with anti-S100 (blue); (b) The reinnervation and
regeneration of NMJ are not significantly different in both WT (white bar) and Mstn KO
mice (black bar) (n= 350-400 NMJs in 3 mice for each genotype). Error bars show s.e.m.

55

similar between WT and myostatin null mice (Nerve sprouting: WT vs. Mstn
-/-
, 55.4±1.9
vs. 59.1±3.6 %; Schwann cell sprouting: WT vs. Mstn
-/-
, 72.7±0.6 vs. 79.4±0.9 %). Our
results indicate that genetic ablation of myostatin does not compromise the motor nerve
regeneration capacity following nerve crush injury.

Myostatin deletion does not improve disease pathology in SOD1 mice
In addition to physiological conditions and regeneration following acute nerve injury, we
would also like to investigate the effect of myostatin deletion on motoneurons in disease
conditions. Loss of muscle mass and strength are among the major symptoms of a
motoneuron disease, amyotrophic lateral sclerosis (ALS). By genetically removing
myostatin in SOD1
G93A
(abbreviated as SOD1) mice, a common ALS mouse model, we
hope to test the effect of myostatin deletion on retaining muscle mass, delaying
motoneuron degeneration and disease progression. The SOD1 mice begin to show motor
function deterioration at about postnatal day 90 (P90) and have an average life span of
about 150-160 days (Heiman-Patterson et al., 2005; Wooley et al., 2005). To generate
SOD1/Mstn
-/-
mice, SOD1 mice were bred with myostatin null mice (See method). The
effect of myostatin deletion on the muscle weight and motoneuron degeneration was
examined at P100.

Myostatin deletion was effective in increasing muscle mass in SOD1 mice as shown by
the significantly heavier hindlimb muscles in SOD1/Mstn
-/-
mice at P100 (Fig. 3-5a; WT
vs. SOD1/Mstn
+/-
vs. SOD1/Mstn
-/-
, Gastrocnemius (GN), 165.8±9.4 vs. 128.17±9.7 vs.
193±20.4, Anterior tibialis (AT), 55.3±5.2 vs. 33.9±2.8 vs. 53±2.7 mg; p<0.05).

56

Fig. 3-5 Myostatin deletion increased muscle mass but did not ameliorate motor
axon or motoneuron degeneration.

(a) Muscle weight of gastrocnemius (GN) and anterior tiabilis (AT) were measured at
P100. SOD1/Mstn
-/-
mice showed heavier muscle weight compared to WT and
SOD1/Mstn
+/-
mice; (b) Sample pictures of NMJs showing innervated (unmarked),
partially innervated (*) and denervated (#) NMJs; (c) The NMJ innervation rate was
examined at P100 in AT muscle and the degree of NMJ degeneration was similar in
SOD1/Mstn
+/-
and SOD1/Mstn
-/-
mice; (d) Representative pictures of L4 ventral roots
from P100 WT, SOD1/Mstn
+/-
and SOD1/Mstn
-/-
mice; (e) The loss of motor axon was
similar in SOD1/Mstn
+/-
and SOD1/Mstn
-/-
mice; (f) Representative spinal cord sections
from P100 mice were shown. Motoneurons were labeled with anti-acetylcholine
transferase (dark brown); (g) Motoneuron number from L3-L5 spinal cord sections
showed a similar loss of motoneuron in SOD1/Mstn
-/-
mice. (n=3 mice for each genotype;
*p<0.05, **p<0.001) Error bars show s.e.m.

57

To further investigate the effect of enlarged muscle on motoneuron degeneration, we
examined the NMJ innervation, motor axon and motoneuron number in SOD1/Mstn
-/-

mice and their littermates. Loss of nerve innervation at the NMJ is one of the initial
pathological events in SOD1 mice (Fischer et al., 2004; Pun et al., 2006). The
innervation of NMJs was examined in SOD1/Mstn
+/-
and SOD1/Mstn
-/-
mice that carry
YFP in all motoneurons. At P100, nerve degeneration at the NMJ was already evident as
shown by the complete or partial loss of nerve terminals at the NMJ (Fig. 3-5b).
Quantification revealed a slightly, yet insignificantly improved motor nerve degeneration
at the NMJ of the AT muscle in SOD1/Mstn
-/-
mice (Fig. 3-5c; SOD1/Mstn
+/-
vs.
SOD1/Mstn
-/-
, fully innervated: 23.1±2.9 vs. 30.8±4.2 %; partially innervated: 16.6 ±0.8
vs. 20.2±3.1 %; denervated: 60.3±3.2 vs. 49.1±6.4 %). A similar decrease in the number
of myelinated axons in the ventral roots of lumbar spinal segment (L4) was also observed
in SOD1/Mstn
+/-
and SOD1/Mstn
-/-
mice (Fig. 3-5d-e; WT vs. SOD1/Mstn
+/-
vs.
SOD1/Mstn
-/-
, 1053.7±50.3 vs. 814.8±40.8 vs. 740.8±63.9). In addition, motoneuron
survival in the lumbar spinal cord (L3-5) was not improved in SOD1/Mstn
-/-
mice (Fig. 3-
5f-g; WT vs. SOD1/Mstn
+/-
vs. SOD1/Mstn
-/-
, 26.7±0.9 vs. 16.9±1.5 vs. 16.2±1.2). Our
data suggest that myostatin deletion is effective in increasing muscle mass but does not
delay the motoneuron degeneration in SOD1 mice.

SOD1/Mstn
-/-
mice are stronger but do not show extended life span
Despite the lack of improvement in motoneuron degeneration, myostatin deletion did
preserve more muscle mass in SOD1 mice as shown above. We monitored the body
weight, hindlimb grip strength, rota-rod performance every 5 days to observe the effect of

58

myostatin deletion on overall disease progression and motor function. Compared to
control littermates, there was a significant increase in body weight (7-13%) in
SOD1/Mstn
-/-
mice from P50 to P100 (Fig. 3-6a). Corresponding to the increase in
muscle size, hindlimb grip strength was found to be significantly higher in SOD1/Mstn
-/-

mice almost throughout the disease progression from P50-P125 (Fig. 3-6b). However,
the SOD1/Mstn
-/-
mice started to show decline in grip strength at around the same time
(at ~P100) as control littermates, which indicates that myostatin deletion does not delay
the disease progression. Moreover, the stronger muscle force did not lead to a better rota-
rod performance in SOD1/Mstn
-/-
mice (Fig. 3-6c). In fact, they performed worse than
control littermate mice during later stages of the disease. The increase in muscle mass
and strength in SOD1/Mstn
-/-
mice did not extend the life span (Fig. 3-6d; SOD1/Mstn
+/+

vs. SOD1/Mstn
+/-
vs. SOD1/Mstn
-/-
; median survival, 155 vs. 155 vs. 153 days; n=27, 47,
22 mice for each genotype respectively). In summary, myostatin deletion
enhanced/maintained muscle strength for a long period of time during the disease
progression, but failed to extend the life span in SOD1 mice.

59

Fig. 3-6 Myostatin deletion increased hindlimb force but did not extend life span in
SOD1 mice.

(a) SOD1/Mstn
-/-
mice were 7-13% heavier than control littermates during P50-P100; (b)
Hindlimb grip strength was measured every 5 days in SOD1/Mstn
+/+
(black line),
SOD1/Mstn
+/-
(green line), and SOD1/Mstn
-/-
(red line) mice. SOD1/Mstn
+/+
mice
showed increased hindlimb force from P50-P125; (c) Rota-rod performance was
monitored and the speed (rpm) at which mice fell from the rod was recorded.
SOD1/Mstn
-/-
performed worse than the control littermates at later stages of the disease;
(d) The life span was not extended in SOD1/Mstn
-/-
mice compared to control littermates.
(n= 27, 47, 22 for SOD1/Mstn
+/+
, SOD1/Mstn
-/-
and SOD1/Mstn
-/-
mice; *p<0.05 one-
way ANOVA) Error bars show s.e.m.

60

3.4 Discussion
Our study demonstrated that genetic ablation of myostatin does not result in significant
changes in the NMJ structure and motoneuron number. In addition, the NMJ function
and regeneration after acute nerve injury were not compromised in myostatin null mice.
We further showed that in a mouse model of ALS, removal of myostatin effectively
increased the muscle mass and strength despite the lack of effect on delaying motoneuron
degeneration and extending life span. Our data would suggest that long-term myostatin
deficiency does not have significantly negative impacts on the motoneuron and NMJ
function in normal or diseased conditions.

Myostatin deletion does not affect motoneuron number
An increase in target muscle size has been shown to promote motoneuron survival during
development (Hollyday and Hamburger, 1976). In the current study, we found no
increase in motoneuron number in adult myostatin null mice despite the increase in
muscle size. One possibility is that muscle size is not increased in myostatin null mice
during embryonic development when motoneurons undergo programmed cell death.
Indeed, it has been reported previously that myostatin null mice do not show muscle
enlargement at birth (McPherron et al., 2009). The increase in muscle fiber number
without a proportional increase in motoneurons suggests a possible increase in the motor
unit size (the number of muscle fibers innervated by a given motoneuron) in myostatin
null mice.

61

Homeostasis of neuromuscular transmission in myostatin null mice
Although no difference in motoneuron number or NMJ structure was observed in
myostatin null mice, we did observe a significantly enhanced synaptic transmission at the
NMJ. It has been suggested that motor nerve terminals are able to adjust the amount of
neurotransmitter release according to the muscle fiber size or excitability (Grinnell, 1995;
Landmesser, 1998; Davis, 2006). When the muscle fiber increases in size or decreases in
excitability, nerve terminals strengthen the synaptic transmission to maintain the safety
margin of neuromuscular transmission (Grinnell, 1995; Landmesser, 1998; Wood and
Slater, 2001; Davis, 2006). The increase in the quantal release and RRP size at the NMJ
of myostatin null mice demonstrated the nerve’s capacity to maintain the homeostasis of
synaptic function in response to the post-synaptic modifications.

Muscle atrophy and nerve regeneration after nerve injury in myostatin null mice
Myostatin injection results in reduced muscle mass (Zimmers et al., 2002) and
upregulation of myostatin has been found in disuse-induced muscle atrophy such as
muscle unloading or microgravity (Carlson et al., 1999; Lalani et al., 2000; Wehling et al.,
2000). However, the correlation between myostatin level and denervation-induced
muscle atrophy is still unclear. While some studies found myostatin expression is
inversely correlated with muscle size after denervation (Liu et al., 2007), other studies
found persistently reduced myostatin (Armand et al., 2003) or varied expression level
(Sakuma et al., 2000; Bauman et al., 2003). Our data here showed that myostatin null
mice do not show difference in the degree of muscle atrophy two weeks following nerve
crush injury, suggesting myostatin deletion does not exacerbate or ameliorate denervation

62

induced muscle atrophy. In addition, we found that nerve regeneration was not affected
in myostatin null mice, indicating that lack of myostatin does not result in significant
defects in motoneuron regeneration capacity.

Interfering myostatin pathway in diseases
Muscle atrophy and weakness is the major symptom in muscle disorders and motoneuron
diseases. Since the discovery of myostatin, many studies have been done to test the
effectiveness of myostatin blockade or deletion in treating these diseases (Joulia-Ekaza
and Cabello, 2007). For example, pharmacological inhibition or genetic ablation of
myostatin was shown to ameliorate the muscle weakness and severe fibrosis in mdx mice,
a model of Duchenne and Becker muscular dystrophy (DMD) (Wagner et al., 2002;
Bogdanovich et al., 2002), and myostatin antibody was recently being tested in a clinical
trial in DMD patients (Wagner et al., 2008). In two other mouse models of more severe
muscular disorders, however, treatment by inhibiting myostatin was less effective (Li et
al., 2005; Parsons et al., 2006).

Besides muscle disorders, the therapeutic effect of myostatin inhibition was also
examined in motoneuron diseases such as spinal muscular atrophy (SMA) and
amyotrophic lateral sclerosis (ALS). In a severe SMA mouse model, myostatin inhibition
was found to have limited or no effect on muscle mass, strength and life span (Rose et al.,
2008; Sumner et al., 2009). In ALS mouse models, previous studies have shown that
interfering with the myostatin pathway through myostatin antibody injection, genetic
delivery of follistatin, injection of a soluble activin type IIB receptor, or genetically

63

removing myostatin, was effective in increasing muscle mass and strength but ineffective
in extending life span (Holzbaur et al., 2006; Miller et al., 2006; Morrison et al., 2009).
Our results are consistent with previous findings in ALS mouse models, and suggest that
myostatin inhibition might not increase life span but may be considered for a treatment
strategy to improve muscle strength and quality of life in ALS.

The therapeutic potential of myostatin blockade was recently demonstrated again by the
reversal of cancer-induced muscle wasting through blocking activin receptor IIB
pathway, which inhibits a subset of TGF-β family ligands including myostatin (Zhou et
al., 2010). In addition to regulating muscle size, blocking myostatin signaling
specifically in skeletal muscles was found to reduce adipose tissue and increase insulin
sensitivity (Guo et al., 2009). This raises the possibility for myostatin antagonists as
treatments for obesity and diabetes. The broad application of myostatin blockade calls
for a more thorough understanding on the effect of long-term myostatin inhibition. The
current study showed that the motoneuron number and the structure, function and
regeneration of motor nerve terminals were not significantly affected in myostatin null
mice and long-term depletion of myostatin in a motoneuron disease mouse model did not
worsen the disease progression. Our results suggest that long-term myostatin deficiency
does not result in significant defects in the motor nervous system.

64

Chapter 4
Neuromuscular Function in Spinal Muscular Atrophy

4.1 Introduction
Spinal muscular atrophy (SMA), characterized by muscle weakness and motoneuron loss,
is the leading genetic cause for infant death. The incidence of SMA is approximately
6,000-10,000 with a carrier frequency around 1 in 35-50 (Monani, 2005; Lunn and Wang,
2008). SMA is caused by a decrease in Survival of Motor Neuron (SMN) protein, due to
loss of function mutations in SMN1 gene; a closely related SMN2 gene produces a low
level of SMN protein (Sumner, 2007; Burghes and Beattie, 2009). SMN is known to be
involved in RNA metabolism, but its exact function remains unclear. Although SMN is
ubiquitously expressed, the deficiency in SMN protein affects primarily the motor
system.

One of the hypotheses for the cause of motor impairment in SMA is neuromuscular
junction (NMJ) denervation or dysfunction. This is implicated by electromyography
(EMG) findings in human patients (Crawford and Pardo, 1996). In a widely used SMA
mouse model (SMNΔ7) that recapitulates many symptoms of human SMA, denervation
(~7-15 %) is indeed identified in a few proximal muscles, such as the paraspinal and
intercostal muscles when motoneuron loss is modest at the end stage (Murray et al., 2008;
Kong et al., 2009). However, several studies have shown that in SMNΔ7 mice, hindlimb
muscles remain fully innervated throughout the disease progression despite apparent
muscle weakness and motor deficits (Kariya et al., 2008; Kong et al., 2009). Thus, it

65

remains intriguing why the ambulatory function is impaired. In addressing the structural
and functional integrity of NMJs, recent studies reported NMJ pathologies, including
neurofilament accumulation and immature endplate morphology, as well as a reduction in
quantal release in SMNΔ7 mice (Kariya et el., 2008; Murray et al., 2008; Kong et al.,
2009; Ruiz et al., 2010). However, given the high safety factor at the NMJ (Wood and
Slater, 2001), it is unclear whether the reduction of transmitter release would be severe
enough to cause neuromuscular transmission failure and muscle weakness in the non-
denervated muscle targets in SMNΔ7 mice. Thus, further functional analysis of the NMJ
and muscle contraction in SMNΔ7 mice is required to resolve the role of NMJs in muscle
weakness in SMA.

Ambulatory difficulty is one of the major symptoms in human SMA patients, and
identifying the site of defect is critical for devising treatment strategies. To address
whether NMJ dysfunction underlies motor deficits in SMA, we examined the innervation
pattern, synaptic transmission efficacy and muscle tension in a hindlimb muscle, extensor
digitorum longus (EDL), in SMNΔ7 mice.

4.2 Material and Methods
Animals.
All procedures related to the care and use of laboratory animals were conducted
according to the US National Institutes of Health guidelines for the use of live animals
and were approved by the Institutional Animal Care and Use Committee of the
University of Southern California. Transgenic mice expressing SMA-like phenotypes

66

were generated from breeder pairs obtained from Jacksons Laboratory (#5025; FVB.Cg-
Tg(SMN2*delta7)4299Ahmb Tg(SMN2)89Ahmb Smn1
tm1Msd
). YFP-SMA mice were
generated by cross-breeding the aforementioned SMA mice with a mouse-line expressing
YFP driven by the Thy-1 promoter (Feng et al., 2000). Genotypes of transgenic mice
were determined as described before (Feng et al., 2000, Le et al., 2005). Transgenic mice
carrying either homozygous/ heterozygous moues Smn alleles were used as non-SMA
littermate controls.

Immunohistochemistry of NMJs.
Mice were anaesthetized by intraperitoneal injection of Nembutal (sodium pentobarbital;
50 mg/kg) or ketamine/ xylazine (100 mg/kg ketamine/ 10 mg xylazine) and
transcardially perfused with normal Ringer’s solution followed by 4% paraformaldehyde.
The extensor digitorum longus (EDL) and other hindlimb muscles were teased into layers
of 5-10 fibers thick to facilitate penetration of antibodies that include: anti-synaptophysin
(Invitrogen) and anti-S100 (Dako). Acetylcholine receptors (AChRs) were labeled by
Alexa Fluor 594-conjugated α-bungarotoxin (Invitrogen).

Intracellular recording of the neuromuscular junction.
The extensor digitorum longus (EDL) muscle from P12-P14 mice was dissected with the
sciatic nerve attached. Intracellular recording was performed in oxygenated normal
mammalian Ringer’s solution (in mM, 135 NaCl, 5 KCl, 1 MgSO
4
, 15 NaHCO
3
, 1
Na
2
HPO
4
, 11 D-glucose, 2.5 Calcium gluconate, pH 7.4). Muscle contraction was
blocked by pre-incubating the muscle in 2- 3µM µ-conotoxin (Biomol, US) for 45

67

minutes or by incubating the muscle in low Ca2+/ high Mg2+ Ringer’s solution
containing 1 mM Ca
2+
/ 6 mM Mg
2+
. The recording was then performed in the toxin-free
Ringer’s solution. At least 7-10 miniature endplate potentials (MEPPs) and 40-70
evoked endplate potentials (EPPs) were recorded from a given junction. The EPPs were
elicited by 1Hz train, normalized to –50mV and corrected for nonlinear summation
(McLachlan and Martin, 1981). The mean quantal content was calculated by direct
method (del Castillo and Katz, 1954). Synaptic transmission was also assessed by pair-
pulse stimulation (10ms apart) and high frequency (50Hz) stimulation. The size of
readily releasable pool was estimated according to Elmqvist and Quastel (1965). The
quantal content of each EPP in response to 50Hz stimulation was plotted against the
cumulative quantal content. The initial linear depression part was fitted with a linear
function and extrapolated to cross the x-axis to obtain an approximate RRP size. The
first EPP was not included in the linear fitting in both non-SMA and SMA since both
show initial facilitation.

The probability of release was estimated by dividing the first
EPP QC by the RRP size (Juttner et al., 2005). Data was acquired and analyzed by
pClamp8 software and Minialysis software.

Muscle Twitch tension
Muscle twitch tension was measured according to Grinnell and Herrera (1980). Briefly,
muscle and nerve preparations were placed in Sylgard (Dow Corning, MI) coated dishes
and bathed in normal Ringer’s solution. The distal end of the muscle was attached to a
force transducer (UC2, Gould-Statham, OH) with a nylon thread. Muscle contraction
was evoked by stimulating the nerve via a suction electrode (indirect stimulation) or by

68

directly stimulating the muscle via silver wires (direct stimulation) at 1Hz, 10Hz, 40Hz
and 100Hz. The direct stimulation was performed with the presence of d-tubocurarine to
block the nerve evoked muscle contraction. The muscle length was adjusted to maximize
the force produced. The ratio of indirect/ direct stimulation evoked muscle contraction
was computed and compared for SMA and non-SMA controls.

Statistical Analyses
Data was statistically analyzed using two-tailed Student’s t-tests with statistic software
(Prism 5.0). p <0.05 was considered significant. Results were expressed as mean ±
s.e.m.

4.3 Result
NMJs in SMNΔ7 hindlimb muscles remain fully innervated throughout the disease
progression
Prior to addressing whether a defect in neuromuscular function contributes to motor
impairment, it is essential to examine the innervation pattern of NMJs in major hindlimb
muscles in SMNΔ7 mice. To facilitate the observation of the nerve terminals, we crossed
a mouse line that overexpressed yellow fluorescent protein (YFP) in all motoneurons
(Feng et al., 2000) with the SMNΔ7 mouse. Similar to the original SMNΔ7 mouse line
(Le et al., 2005), the SMNΔ7/YFP mice displayed progressive muscle weakness with a
life span of ~14 days. In addition, we labeled perisynaptic Schwann cells (PSCs) with
anti-S100 antibody and postsynaptic acetylcholine receptors (AChRs) with α-
bungarotoxin to examine the tripartite arrangement of the NMJ. Throughout the disease

69

progression (P1-14), we did not observe any denervated endplates in a wide range of
hindlimb muscles types, including predominantly fast muscle type (extensor digitorum
longus (EDL), tibialis anterior), slow muscle type (soleus) and mixed type
(gastrocnemius), and the most proximal limb muscle, gluteus maximus in SMNΔ7 mice
(Fig. 4-1a and b). Furthermore, over 99% of nerve-muscle contacts are colocalized with
PSCs in both fast and slow muscle types examined (Fig. 4-1a). We did not observe
sprouting of PSCs, a feature often seen following denervation (Son and Thompson,
1996). These findings suggest that NMJs in SMA mice, similar to that in non-SMA
control littermates, are tripartite synapses. The innervation pattern was further confirmed
with immunocytochemistry using antibodies against neurofilament and synaptophysin
(data not shown). As previously reported in various SMA mouse models (Cifuentes-Diaz
et al., 2002; Kariya et al., 2008; Murray et al., 2008; Kong et al., 2009; Michaud et al.,
2010; Ruiz et al., 2010), we also observed neurofilament accumulation in the majority of
SMNΔ7 NMJs. In short, our findings suggest that nearly all NMJs in SMNΔ7 hindlimb
muscles are fully innervated.

Reduced neuromuscular transmission in SMNΔ7 hindlimb muscles
To examine neuromuscular transmission in SMNΔ7 mice, we performed intracellular
recording in EDL muscles at the disease end-stage (P12-14). Muscle contraction was
prevented by pre-incubation of µ-conotoxin, which blocks voltage-gated sodium channels
in muscle (Cruz et al., 1985). Spontaneous miniature endplate potentials (MEPPs) and
evoked endplate potentials (EPPs) could be recorded from almost all junctions in both
control and SMNΔ7 mice. SMNΔ7 NMJs showed a significantly reduced MEPP

70

Fig. 4-1 Fully innervated NMJs in hindlimb muscles of SMA mice that express YFP
in motoneurons.

(a) Z-stacks of confocal micrographs showing typical NMJs in extensor digitorum longus
(EDL) of the SMA and non-SMA mice at P4, P7 and P14. Nerve terminals
overexpressing YFP (in green), the postsynaptic acetylcholine receptor (AChR) clusters
(in red) and the perisynaptic Schwann cells (PSCs; in blue). Scale bar, 40µm; (b) Bar
graph of the percentage of innervated NMJs at EDL in non-SMA and SMA mice at P1,
P4, P7 and P14; (c) Histogram showing the percentage of fully innervated NMJs at P14
hindlimb muscles (GN, gastrocnemius; SOL, soleus; AT, anterior tibialis; GLU, gluteus
maximus). Error bars show s.e.m.

71

frequency and increased MEPP amplitude (Fig. 4-2a, c and d). The small increase in
MEPP amplitude is probably due to the higher input resistance of the smaller SMNΔ7
muscle fibers. However, we found that the EPP amplitude was similar between control
and SMNΔ7 NMJs (Fig. 4-2b and e). Correspondingly, quantal content, calculated by
dividing the amplitude of EPP over MEPP (Del Castillo, 1954), was reduced by about 25
% in SMNΔ7 NMJs (Fig. 4-2f). Similar findings were also observed when the synaptic
transmission was monitored in low Ca
2+
/ high Mg
2+
Ringer’s solution (Table 4-1).

The reduced quantal content may have resulted from a decrease in vesicle release
probability, a smaller readily releasable pool (RRP) or both. We thus subjected the NMJs
to paired-pulse and 50 Hz stimulations to examine whether SMNΔ7 NMJs show
differences in release probability and RRP size. There was an increase in paired-pulse
facilitation in SMNΔ7 NMJs (Fig. 4-3a & b), indicating a lower vesicle release
probability (Zucker and Regehr, 2002). Upon 50Hz stimulation, similar to control NMJs,
SMNΔ7 NMJs were able to sustain repetitive stimulations without any failure (Fig. 4-3c
& d). Although SMNΔ7 NMJs exhibited more facilitated responses at the beginning of
the stimulus train, they depressed to a similar level as control NMJs. In addition, we
calculated the RRP size using the method by Elmqvist and Quastel (Elmqvist and
Quastel, 1965), and found a similar RRP size in control and SMNΔ7 NMJs (Fig. 4-3e).
The probability of release, calculated by dividing the quantal content of the first EPP by
RRP size (Juttner et al., 2005), however, is significantly lower by 26 % at SMNΔ7 NMJs
(Fig. 4-3f). These data suggest the reduced quantal content in SMNΔ7 hindlimb NMJs is
likely due to a decrease in vesicle release probability, rather than a reduction of RRP size.

72

Fig. 4-2 SMA NMJs display a decrease in synaptic efficacy.

Intracellular recording was performed in EDL muscle at P12-P14. (a) Sample recordings
of MEPP from non-SMA (top) and SMA (bottom) mice (horizontal scale 5s, vertical
scale 0.5mV); (b) Sample recordings of EPP from non-SMA (left) and SMA (right) mice
(horizontal scale 2ms, vertical scale 4mV); (c-f) Quantifications of the amplitude and
frequency of MEPPs (MEPP amplitude: non-SMA 0.61 ± 0.03 mV vs. SMA 0.82 ± 0.03
mV, p<0.0001; MEPP frequency: non-SMA 8.97 ± 0.99 min
-1
vs. SMA 3.16 ± 0.26 min
-
1
, p<0.0001;), EPP amplitude (non-SMA 7.27 ± 0.34 mV vs. SMA 7.53 ± 0.31 mV,
p=0.58) and quantal content (non-SMA 13.20 ± 0.77 vs. SMA 9.97 ± 0.45, p=0.007).
There is an increase in MEPP amplitude, a decrease in MEPP frequency and a reduction
in quantal content in SMA mice (n= 100-130 NMJs from 7 non-SMA and 10 SMA mice;
***p<0.0001, ** p=0.007). Error bars show s.e.m.

73

Control SMA
MEPP frequency (min
-1
) 4.1± 5.2 1.8 ± 2.6 ***
MEPP amplitude (mV) 0.47 ± 0.2 0.64 ± 0.25 ***
EPP amplitude (mV) 0.46 ± 0.23 0.55 ± 0.29 **
Quantal content 1.43 ± 0.57 0.92 ± 0.35 ***

Table 4-1 Neuromuscular transmission in low Ca
2+
/ high Mg
2+
Ringer’s solution

n>100 NMJs from 9-10 mice for each genotype
**, *** Values in SMA mice significantly different from control (**p<0.005,
***p<0.0001).

74

Fig. 4-3 SMA NMJs exhibit lower vesicle release probability.

Intracellular recording was performed in EDL muscle at P12-P14. (a) Example of
paired-pulse response from non-SMA (left) and SMA (right) NMJs (horizontal scale
10ms, vertical scale 2mV); (b) SMA NMJs showed stronger paired-pulse facilitation
indicating a lower vesicle release probability (non-SMA 119.4 ± 3.54 % vs. SMA 145.9 ±
12.5 %; p=0.02; n=14 NMJs from 2 non-SMA mice and 9 NMJs from 2 SMA mice; *
p=0.02); (c) Sample traces of high frequency (50 Hz) stimulation responses from non-
SMA NMJs (top) and SMA NMJs (bottom) (horizontal scale 20ms, vertical scale 4mV);
(d) Synaptic responses normalized to the first EPP. No transmission failure was observed
in both non-SMA and SMA mice; (e) RRP size is not different between non-SMA and
SMA NMJs (non-SMA 640.2 ± 77.1 vs. SMA 625.4 ± 54.8, p=0.9); (f) Probability of
release is significantly lower at SMA NMJs (non-SMA 0.027 ± 0.003 vs. SMA 0.02 ±
0.001, p=0.03; n=15 NMJs from 5 non-SMA mice and 14 NMJs from 6 SMA mice).
Error bars show s.e.m.

75

NMJs in SMNΔ7 hindlimb muscles are capable of eliciting muscle contraction
To address whether the reduced synaptic efficacy at the NMJ would lead to failures in
muscle contraction, we measured muscle twitch tension in response to the indirect
(nerve) and direct (muscle) stimulation at various frequencies (1, 10, 40, 100 Hz) in EDL
muscles at the disease end-stage (Fig. 4-4). If the amount of neurotransmitter release is
sufficient to trigger muscle contraction, the force generated through nerve and muscle
stimulation is expected to be the same and the ratio of indirect/direct stimulation should
be close to one. However, if neuromuscular transmission failures occur, the ratio would
be less than one. As expected, we found that in control muscle the single twitch tension
(1 Hz, Fig. 4-4a) as well as the tetanic force (100 Hz, Fig. 4-4b) generated by nerve
stimulation were similar to those by muscle stimulation. We found that this was also the
case for SMNΔ7 muscle (Fig. 4-4a and b). As quantified in Fig. 4-4c, the ratio of indirect
over direct stimulation evoked muscle tension was close to one at all frequencies
examined in both control and SMNΔ7 mice. These results suggest that the overall
neuromuscular transmission is not compromised in SMNΔ7 hindlimb muscles, despite
the reduction by approximately 25 % in quantal content.

We did find that SMNΔ7 muscles produced weaker tension (Fig. 4-4a & b), and had
smaller muscle size compared to control muscles (cross-section area: Control vs.
SMNΔ7, 0.46 ± 0.02 vs. 0.23 ± 0.02 mm
2
). To examine whether the reduced force
production can be attributed to the size difference, the specific force was calculated by
normalizing the maximum muscle tension (by direct muscle stimulation at 100 Hz) to the
muscle cross-section area. We found that the specific force was not significantly

76

Fig. 4-4 SMA NMJs can elicit muscle contraction at disease end-stage.

(a) Sample traces of muscle twitch tension measurements at 1Hz (horizontal scale 0.5s,
vertical scale 1g); (b) Sample traces of muscle tetanic force measurements at 100Hz
(horizontal scale 1s, vertical scale 0.5g). In both non-SMA (left) and SMA (right) EDL
muscles, indirect nerve (gray) and direct muscle (black) stimulation elicited similar
amounts of muscle force; (c) Quantification of the ratio of indirect over direct stimulation
evoked muscle contraction at 1, 10, 40, 100Hz. The ratio was close to one at all
frequencies examined, indicating overall NMJ function is not compromised in SMA
(Non-SMA vs. SMA: 1Hz, 0.97 ± 0.03 vs. 1.07 ± 0.07; 10Hz, 0.98 ± 0.02 vs. 1.09 ±
0.08; 40 Hz, 0.99 ± 0.04 vs. 1.03 ± 0.05; 100Hz, 1.02 ± 0.03 vs. 1.00 ± 0.05; n=9 non-
SMA muscles and 9 SMA muscles); (d) Specific force is not significantly different in
SMA and non-SMA mice (non-SMA 4.48 ± 0.54 g/mm
2
vs. SMA 4.23 ± 0.99 g/mm
2
,
p=0.84; n=7 non-SMA muscles and 8 SMA muscles). Error bars show s.e.m.

77

different between control and SMNΔ7 mice (Fig. 4-4d). These data suggest that the basic
muscle contractile ability may not be significantly affected and the reduced muscle force
was likely contributed by the smaller muscle size in SMNΔ7 mice.

4.4 Discussion
Innervation of hindlimb NMJs in SMA mouse models
We examined NMJ innervation with two approaches: genetically label the nerve terminal
with YFP and immunostain the nerve terminal with antibodies against neurofilament and
vesicle proteins. Neither method detected loss of nerve terminals at the NMJ of hindlimb
muscles in SMA throughout the disease progression. This is in agreement with recent
studies in the same animal model that showed NMJs are not denervated in the hindlimb
muscles examined (Kariya et al., 2008; Kong et al., 2009). One potential concern is that
the fully innervated NMJs observed might have resulted from a delay in synapse
elimination, which occurs during the first two weeks after birth (Sanes and Lichtman,
1999). However, this seems unlikely, as synapse elimination is not changed at NMJs of
SMNΔ7 mice (Kariya et al., 2008; Kong et al., 2009).

Although denervation is not observed in hindlimb muscles, it is important to note that
denervation has been found in several proximal muscles, and would likely contribute to
disease phenotypes seen in SMA patients and mouse models (Crawford and Pardo, 1996;
Kong et al., 2008; McGovern et al., 2008; Murray et al., 2008; Michaud et al., 2010). For
example, the intercostal muscles are denervated in the severe SMA mouse model (Smn
-/-
;SMN2
+/+
), while the diaphragm muscle is relatively spared (McGovern et al., 2008). The

78

denervation in the intercostal muscles may explain the clinical observations that
breathing is almost entirely diaphragmatic in type I SMA patients (Dubowitz, 1978). The
reason behind the selective degeneration of motor nerve terminals in different muscles
remains elusive and why and how muscles show different vulnerability to denervation in
SMA would require further investigation.

Neuromuscular transmission and function in SMA mouse models
Our intracellular recordings have shown an approximately 25% reduction in quantal
release, which is primarily attributed to a reduction in release probability rather than a
reduction in RRP size, in EDL muscle of SMNΔ7 mice. In addition, unlike in less severe
SMA mouse models (Kariya et al., 2008; Park et al., 2010), which showed neuromuscular
transmission failures during high frequency stimulations, the NMJs in SMNΔ7 mice did
not exhibit failures. This indicates that NMJs in SMNΔ7 mice can sustain repetitive
activations despite a lower synaptic efficacy, which is also supported by our twitch
tension measurements.

A reduction of approximately 50% in quantal release in tibialis anterior (Kong et al.,
2009), as well as in transversus abdominis and levator auris longus muscles (Ruiz et al.,
2010), have been reported in SMNΔ7 mice. However, since a faithful neuromuscular
transmission is so critical for the survival of an organism, motor nerve terminals typically
release 2 to 20 times more neurotransmitters than necessary in mice (Wood and Slater,
2001). The functional consequence of the 25-50% reduction in synaptic efficacy might
thus be negligible as our twitch tension measurement experiments demonstrated. This is

79

consistent with a recent study showing that muscle fibers could fire normal action
potentials in response to nerve stimulation even with a 50% reduction in quantal release
in SMNΔ7 mice (Ruiz et al., 2010). Thus, it seems unlikely that the motor impairment in
the hindlimb muscles of SMNΔ7 mice is simply caused by muscle denervation or
neuromuscular transmission failure. Our twitch tension findings suggest that the
ambulatory difficulties might be in part attributed to the reduced muscle force production
as a result of the smaller muscle size and possible abnormal muscle development in
SMNΔ7 mice.

Our data indicate that most of the NMJs in hindlimb muscles remain innervated and are
capable of releasing neurotransmitter and eliciting muscle contraction even at the end
stage in SMNΔ7 mice. Therefore, muscle weakness in hindlimb muscles is not a direct
consequence of neurotransmission failure, but is likely contributed by the decrease in
muscle size in SMNΔ7 mice. We do not exclude, however, in other more proximal or
more vulnerable muscles, NMJ denervation contributes to muscle dysfunction in SMA.
In fact, our group recently identified multiple vulnerable muscles with significant NMJ
denervation (unpublished observation), and revealed a significant loss of central synapses
onto SMA motoneurons (Ling et al., in press). The novel concept that synaptic defects
occur at multiple levels in the motor circuitry in SMA brings new insights into SMA
disease pathology and might help the development of future treatments.
The NMJ innervation experiment (Fig. 4-1) was performed by Karen Ling

80

Chapter 5
General Conclusion

The process and transmission of information between neurons depends on a stable
synapse structure and function. In the current study, we utilized the NMJ to investigate
the molecular and cellular basis for synapse maintenance and function and explored the
synaptopathy in neurological diseases.

Synaptic transmission at the NMJ: the function of complexin
Neurotransmitter release is a tightly regulated process. A single action potential activates
near-simultaneous exocytosis of multiple vesicles, within a time span of only about 1ms.
In chapter 2, we showed that the SNARE-associated pre-synaptic protein, complexin is
critical for facilitating and synchronizing the fast, calcium-mediated synaptic vesicle
release. Removing complexin resulted in a significant disruption of synaptic
transmission at the NMJ, causing a decreased and desynchronized vesicle release. The
exact mechanism of complexin function is still under debate, and our data point to a new
hypothesis that in addition to positively regulating the size of the primed vesicle pool,
complexin may regulate the timing and amount of vesicle release through the coupling of
synaptic vesicles with calcium channels.

A down-regulation of complexin has been observed in many neurological or psychiastric
disorders such as Huntington’s disease, depression, Parkinson’s disease and Alzheimer’s
disease (Brose, 2008a). The deficiency in complexin may have a significant impact on

81

the central nervous system since the neuron-neuron synapses are less effective and often
requires simultaneous firing of multiple synaptic inputs to trigger an action potential in
the post-synaptic neuron. Lack of precision in the timing and quantity of
neurotransmitter release would increase the probability of synaptic transmission failure,
and affect normal brain function.

Synaptic homeostasis
Homeostasis is the ability of maintaining the equilibrium of physiological processes in
the body. The stability and plasticity of the nervous system during development and
remodeling suggests a homeostatic signaling system exists to modulate synaptic activity
(Davis, 2006). At the NMJ, this homeostatic signaling ensures the proper assembly of
the NMJ during development and the maintenance of function throughout life. During
NMJ formation, pre-synaptic molecules such as nerve-derived agrin and ACh control the
post-synaptic AChR expression, and muscle-derived fibroblast growth factor (FGF) and
glia-derived neurotrophic factor (GDNF) are known to have a retrograde effect on pre-
synaptic transmitter release (Wu et al., 2010). The homeostasis in NMJ maintenance is
demonstrated by the compensatory increase in vesicle release when there is a decrease in
quantal size or the AChR density (Landmesser, 1998). In chapter 3, we examined the
homeostasis between the motoneuron and the muscle. The muscle fiber enlargement in
myostatin null mice results in a lower input resistance and a reduced synaptic efficacy.
Our study showed that the pre-synaptic nerve terminal was able to detect the change in
muscle fiber size and strengthen the synaptic transmission correspondingly. This

82

demonstrates the plasticity of the NMJ and its capacity to adapt to alterations in synaptic
efficacy.

The NMJ in motoneuron degenerative diseases
The neuromuscular transmission is extremely reliable, but in motoneuron diseases, the
NMJ is often vulnerable to degeneration and NMJ dysfunction often leads to muscle
weakness and paralysis. For example, in ALS, NMJ denervation is one of the initial
pathological events, which precedes the loss of motoneurons (Fischer et al., 2004).
Preventing denervation of the NMJ was shown to slow disease progression and relieve
motor function deterioration in an ALS mouse model (Pun et al., 2006). The NMJ
involvement in a childhood motoneuron disease, SMA, however, remains unclear.
Ambulatory difficulties can be observed in both human patients and mouse models and it
has been assumed that defects in NMJ structure or function may be the cause of hindlimb
muscle weakness (Kariya et al., 2008; Kong et al., 2009). In chapter 4, we examined the
NMJ morphology and physiology in hindlimb muscles of an SMA mouse model. Our
results, contradicting to the prevailing thinking, showed that despite a decrease in quantal
release, the high safety factor at the NMJ prevented the synaptic transmission failure.
Although recent findings in our lab suggest that in other muscles, NMJ denervation
indeed occur and can contribute to muscle weakness, our finding in hindlimb muscles
indicate that NMJ denervation or dysfunction is not the only cause for motor deficits in
SMA.

83

Synapse maintenance and function in neurodegenerative diseases
Synaptopathy, abnormal loss of synapses, aberrant synaptic connection and synaptic
dysfunction, is a common feature in many neurodegenerative diseases. In Alzheimer’s
disease, the accumulation of pathological amyloid-β (Aβ) reduces neuronal activity by
weakening the synaptic transmission and induces synaptic loss, which correlates with the
decline of the cognitive function. The abnormal synaptic function not only affects
synaptic function in individual neurons but also causes a destabilization of the entire
synaptic network in the brain (reviewed by Palop and Mucke, 2010). Autism is another
mental disorder that is believed to be caused by synaptopathy. Genetic mutations in cell
adhesion molecules such as neurexins and neuroligins and post-synaptic density proteins
such as shanks have been identified in human patients. These synaptic proteins are
known to regulate synaptogenesis, synaptic function and activity-dependent synaptic
homeostasis. Mutations in neurexin genes in mice showed that the synaptic transmission
is affected and these mice have defects in social interactions with relatively normal
cognitive functions or sometimes an enhanced space learning ability, mimicking the
disease hallmarks of autism (van Spronsen and Hoogenraad, 2010; Toro et al., 2010).
These findings that degeneration of synapses may underlie the brain dysfunction and
constitute the primary disease targets in neurological and mental disorders highlight the
vulnerability of synapses and the critical role of synaptic function.

Through studying the mechanism of synaptic transmission and the homeostatic changes
at the NMJ, our study advances the understanding of synapse function and maintenance,

84

which is crucial for understanding the synaptic network in the brain and for combating
neurodegenerative diseases.

85

References

Alvarez YD, Ibanez LI, Uchitel OD, Marengo FD (2008) P/Q Ca2+ channels are
functionally coupled to exocytosis of the immediately releasable pool in mouse
chromaffin cells. Cell Calcium 43:155-164.
Amthor H, Otto A, Vulin A, Rochat A, Dumonceaux J, Garcia L, Mouisel E, Hourde C,
Macharia R, Friedrichs M, Relaix F, Zammit PS, Matsakas A, Patel K, Partridge
T (2009) Muscle hypertrophy driven by myostatin blockade does not require
stem/precursor-cell activity. Proc Natl Acad Sci U S A 106:7479-7484.
An SJ, Grabner CP, Zenisek D (2010) Real-time visualization of complexin during single
exocytic events. Nat Neurosci 13:577-583.
Archer DA, Graham ME, Burgoyne RD (2002) Complexin regulates the closure of the
fusion pore during regulated vesicle exocytosis. J Biol Chem 277:18249-18252.
Armand AS, Della Gaspera B, Launay T, Charbonnier F, Gallien CL, Chanoine C (2003)
Expression and neural control of follistatin versus myostatin genes during
regeneration of mouse soleus. Dev Dyn 227:256-265.
Baumann AP, Ibebunjo C, Grasser WA, Paralkar VM (2003) Myostatin expression in age
and denervation-induced skeletal muscle atrophy. J Musculoskelet Neuronal
Interact 3:8-16.
Bogdanovich S, Krag TO, Barton ER, Morris LD, Whittemore LA, Ahima RS, Khurana
TS (2002) Functional improvement of dystrophic muscle by myostatin blockade.
Nature 420:418-421.
Brandon EP, Lin W, D'Amour KA, Pizzo DP, Dominguez B, Sugiura Y, Thode S, Ko
CP, Thal LJ, Gage FH, Lee KF (2003) Aberrant patterning of neuromuscular
synapses in choline acetyltransferase-deficient mice. J Neurosci 23:539-549.
Brose N (2008) Altered complexin expression in psychiatric and neurological disorders:
cause or consequence? Mol Cells 25:7-19.
Brose N (2008) For better or for worse: complexins regulate SNARE function and vesicle
fusion. Traffic 9:1403-1413.
Burghes AH, Beattie CE (2009) Spinal muscular atrophy: why do low levels of survival
motor neuron protein make motor neurons sick? Nat Rev Neurosci 10:597-609.
Buss RR, Sun W, Oppenheim RW (2006) Adaptive roles of programmed cell death
during nervous system development. Annu Rev Neurosci 29:1-35.

86

Butchbach ME, Edwards JD, Burghes AH (2007) Abnormal motor phenotype in the
SMNDelta7 mouse model of spinal muscular atrophy. Neurobiol Dis 27:207-219.
Cai H, Reim K, Varoqueaux F, Tapechum S, Hill K, Sorensen JB, Brose N, Chow RH
(2008) Complexin II plays a positive role in Ca2+-triggered exocytosis by
facilitating vesicle priming. Proc Natl Acad Sci U S A 105:19538-19543.
Carabelli V, Marcantoni A, Comunanza V, Carbone E (2007) Fast exocytosis mediated
by T- and L-type channels in chromaffin cells: distinct voltage-dependence but
similar Ca2+ -dependence. Eur Biophys J 36:753-762.
Carlson CJ, Booth FW, Gordon SE (1999) Skeletal muscle myostatin mRNA expression
is fiber-type specific and increases during hindlimb unloading. Am J Physiol
277:R601-606.
Cassano M, Quattrocelli M, Crippa S, Perini I, Ronzoni F, Sampaolesi M (2009) Cellular
mechanisms and local progenitor activation to regulate skeletal muscle mass. J
Muscle Res Cell Motil 30:243-253.
Chicka MC, Chapman ER (2009) Concurrent binding of complexin and synaptotagmin to
liposome-embedded SNARE complexes. Biochemistry 48:657-659.
Cho RW, Song Y, Littleton JT (2010) Comparative analysis of Drosophila and
mammalian complexins as fusion clamps and facilitators of neurotransmitter
release. Mol Cell Neurosci.
Cifuentes-Diaz C, Nicole S, Velasco ME, Borra-Cebrian C, Panozzo C, Frugier T, Millet
G, Roblot N, Joshi V, Melki J (2002) Neurofilament accumulation at the motor
endplate and lack of axonal sprouting in a spinal muscular atrophy mouse model.
Hum Mol Genet 11:1439-1447.
Coggins M, Zenisek D (2009) Evidence that exocytosis is driven by calcium entry
through multiple calcium channels in goldfish retinal bipolar cells. J Neurophysiol
101:2601-2619.
Crawford TO, Pardo CA (1996) The neurobiology of childhood spinal muscular atrophy.
Neurobiol Dis 3:97-110.
Cruz LJ, Gray WR, Olivera BM, Zeikus RD, Kerr L, Yoshikami D, Moczydlowski E
(1985) Conus geographus toxins that discriminate between neuronal and muscle
sodium channels. J Biol Chem 260:9280-9288.
Davis GW (2006) Homeostatic control of neural activity: from phenomenology to
molecular design. Annu Rev Neurosci 29:307-323.
Del Castillo J, Katz B (1954) Quantal components of the end-plate potential. J Physiol
124:560-573.

87

Deschenes MR, Tenny KA, Wilson MH (2006) Increased and decreased activity elicits
specific morphological adaptations of the neuromuscular junction. Neuroscience
137:1277-1283.
Dubowitz V (1978) Muscle disorders in childhood. Major Probl Clin Pediatr 16:iii-xiii, 1-
282.
Duncan RR, Greaves J, Tapechum S, Apps DK, Shipston MJ, Chow RH (2002) Efficacy
of Semliki Forest virus transduction of bovine adrenal chromaffin cells: an
analysis of heterologous protein targeting and distribution. Ann N Y Acad Sci
971:641-646.
Eastwood SL, Cotter D, Harrison PJ (2001) Cerebellar synaptic protein expression in
schizophrenia. Neuroscience 105:219-229.
Elmqvist D, Quastel DM (1965) A quantitative study of end-plate potentials in isolated
human muscle. J Physiol 178:505-529.
Feng G, Mellor RH, Bernstein M, Keller-Peck C, Nguyen QT, Wallace M, Nerbonne JM,
Lichtman JW, Sanes JR (2000) Imaging neuronal subsets in transgenic mice
expressing multiple spectral variants of GFP. Neuron 28:41-51.
Fischer LR, Culver DG, Tennant P, Davis AA, Wang M, Castellano-Sanchez A, Khan J,
Polak MA, Glass JD (2004) Amyotrophic lateral sclerosis is a distal axonopathy:
evidence in mice and man. Exp Neurol 185:232-240.
Fischer LR, Culver DG, Tennant P, Davis AA, Wang M, Castellano-Sanchez A, Khan J,
Polak MA, Glass JD (2004) Amyotrophic lateral sclerosis is a distal axonopathy:
evidence in mice and man. Exp Neurol 185:232-240.
Flanagan-Steet H, Fox MA, Meyer D, Sanes JR (2005) Neuromuscular synapses can
form in vivo by incorporation of initially aneural postsynaptic specializations.
Development 132:4471-4481.
Fu AK, Ip FC, Fu WY, Cheung J, Wang JH, Yung WH, Ip NY (2005) Aberrant motor
axon projection, acetylcholine receptor clustering, and neurotransmission in
cyclin-dependent kinase 5 null mice. Proc Natl Acad Sci U S A 102:15224-15229.
Gautam M, Noakes PG, Moscoso L, Rupp F, Scheller RH, Merlie JP, Sanes JR (1996)
Defective neuromuscular synaptogenesis in agrin-deficient mutant mice. Cell
85:525-535.
Gibson HE, Reim K, Brose N, Morton AJ, Jones S (2005) A similar impairment in CA3
mossy fibre LTP in the R6/2 mouse model of Huntington's disease and in the
complexin II knockout mouse. Eur J Neurosci 22:1701-1712.

88

Giraudo CG, Eng WS, Melia TJ, Rothman JE (2006) A clamping mechanism involved in
SNARE-dependent exocytosis. Science 313:676-680.
Glass DJ (2003) Signalling pathways that mediate skeletal muscle hypertrophy and
atrophy. Nat Cell Biol 5:87-90.
Glynn D, Drew CJ, Reim K, Brose N, Morton AJ (2005) Profound ataxia in complexin I
knockout mice masks a complex phenotype that includes exploratory and
habituation deficits. Hum Mol Genet 14:2369-2385.
Glynn D, Gibson HE, Harte MK, Reim K, Jones S, Reynolds GP, Morton AJ (2010)
Clorgyline-mediated reversal of neurological deficits in a Complexin 2 knockout
mouse. Hum Mol Genet.
Glynn D, Reim K, Brose N, Morton AJ (2007) Depletion of Complexin II does not affect
disease progression in a mouse model of Huntington's disease (HD); support for
role for complexin II in behavioural pathology in a mouse model of HD. Brain
Res Bull 72:108-120.
Grinnell AD (1995) Dynamics of nerve-muscle interaction in developing and mature
neuromuscular junctions. Physiol Rev 75:789-834.
Grinnell AD, Herrera AA (1980) Physiological regulation of synaptic effectiveness at
frog neuromuscular junctions. J Physiol 307:301-317.
Guo T, Jou W, Chanturiya T, Portas J, Gavrilova O, McPherron AC (2009) Myostatin
inhibition in muscle, but not adipose tissue, decreases fat mass and improves
insulin sensitivity. PLoS One 4:e4937.
Hamburger V (1934) The effects of wing bud extirpation in chick embryos on the
development of the central nervous system. J Exp Zool:449-494.
Harrison PJ, Eastwood SL (1998) Preferential involvement of excitatory neurons in
medial temporal lobe in schizophrenia. Lancet 352:1669-1673.
Heiman-Patterson TD, Deitch JS, Blankenhorn EP, Erwin KL, Perreault MJ, Alexander
BK, Byers N, Toman I, Alexander GM (2005) Background and gender effects on
survival in the TgN(SOD1-G93A)1Gur mouse model of ALS. J Neurol Sci 236:1-
7.
Hollyday M, Hamburger V (1976) Reduction of the naturally occurring motor neuron
loss by enlargement of the periphery. J Comp Neurol 170:311-320.

89

Holzbaur EL, Howland DS, Weber N, Wallace K, She Y, Kwak S, Tchistiakova LA,
Murphy E, Hinson J, Karim R, Tan XY, Kelley P, McGill KC, Williams G,
Hobbs C, Doherty P, Zaleska MM, Pangalos MN, Walsh FS (2006) Myostatin
inhibition slows muscle atrophy in rodent models of amyotrophic lateral sclerosis.
Neurobiol Dis 23:697-707.
Horrigan FT, Bookman RJ (1994) Releasable pools and the kinetics of exocytosis in
adrenal chromaffin cells. Neuron 13:1119-1129.
Hubbard JI, Jones SF, Landau EM (1968) An examination of the effects of osmotic
pressure changes upon transmitter release from mammalian motor nerve
terminals. J Physiol 197:639-657.
Huntwork S, Littleton JT (2007) A complexin fusion clamp regulates spontaneous
neurotransmitter release and synaptic growth. Nat Neurosci 10:1235-1237.
Joulia-Ekaza D, Cabello G (2007) The myostatin gene: physiology and pharmacological
relevance. Curr Opin Pharmacol 7:310-315.
Juttner R, More MI, Das D, Babich A, Meier J, Henning M, Erdmann B, Mu Ller EC,
Otto A, Grantyn R, Rathjen FG (2005) Impaired synapse function during
postnatal development in the absence of CALEB, an EGF-like protein processed
by neuronal activity. Neuron 46:233-245.
Kandel E.R. SJHaJTM (2000) Principles of Neural Science, 4th Edition. New York:
McGraw-Hill.
Kariya S, Park GH, Maeno-Hikichi Y, Leykekhman O, Lutz C, Arkovitz MS,
Landmesser LT, Monani UR (2008) Reduced SMN protein impairs maturation of
the neuromuscular junctions in mouse models of spinal muscular atrophy. Hum
Mol Genet 17:2552-2569.
Kong L, Wang X, Choe DW, Polley M, Burnett BG, Bosch-Marce M, Griffin JW, Rich
MM, Sumner CJ (2009) Impaired synaptic vesicle release and immaturity of
neuromuscular junctions in spinal muscular atrophy mice. J Neurosci 29:842-851.
Kummer TT, Misgeld T, Sanes JR (2006) Assembly of the postsynaptic membrane at the
neuromuscular junction: paradigm lost. Curr Opin Neurobiol 16:74-82.
Lalani R, Bhasin S, Byhower F, Tarnuzzer R, Grant M, Shen R, Asa S, Ezzat S,
Gonzalez-Cadavid NF (2000) Myostatin and insulin-like growth factor-I and -II
expression in the muscle of rats exposed to the microgravity environment of the
NeuroLab space shuttle flight. J Endocrinol 167:417-428.
Landmesser LT (1998) Synaptic plasticity: keeping synapses under control. Curr Biol
8:R564-567.

90

Lang B, Vincent A (2009) Autoimmune disorders of the neuromuscular junction. Curr
Opin Pharmacol 9:336-340.
Le TT, Pham LT, Butchbach ME, Zhang HL, Monani UR, Coovert DD, Gavrilina TO,
Xing L, Bassell GJ, Burghes AH (2005) SMNDelta7, the major product of the
centromeric survival motor neuron (SMN2) gene, extends survival in mice with
spinal muscular atrophy and associates with full-length SMN. Hum Mol Genet
14:845-857.
Lee SJ (2004) Regulation of muscle mass by myostatin. Annu Rev Cell Dev Biol 20:61-
86.
Lee SJ, McPherron AC (2001) Regulation of myostatin activity and muscle growth. Proc
Natl Acad Sci U S A 98:9306-9311.
Lee SJ, Reed LA, Davies MV, Girgenrath S, Goad ME, Tomkinson KN, Wright JF,
Barker C, Ehrmantraut G, Holmstrom J, Trowell B, Gertz B, Jiang MS, Sebald
SM, Matzuk M, Li E, Liang LF, Quattlebaum E, Stotish RL, Wolfman NM
(2005) Regulation of muscle growth by multiple ligands signaling through activin
type II receptors. Proc Natl Acad Sci U S A 102:18117-18122.
Li XM, Dong XP, Luo SW, Zhang B, Lee DH, Ting AK, Neiswender H, Kim CH,
Carpenter-Hyland E, Gao TM, Xiong WC, Mei L (2008) Retrograde regulation of
motoneuron differentiation by muscle beta-catenin. Nat Neurosci 11:262-268.
Li ZF, Shelton GD, Engvall E (2005) Elimination of myostatin does not combat muscular
dystrophy in dy mice but increases postnatal lethality. Am J Pathol 166:491-497.
Lichtman JW, Magrassi L, Purves D (1987) Visualization of neuromuscular junctions
over periods of several months in living mice. J Neurosci 7:1215-1222.
Lin W, Dominguez B, Yang J, Aryal P, Brandon EP, Gage FH, Lee KF (2005)
Neurotransmitter acetylcholine negatively regulates neuromuscular synapse
formation by a Cdk5-dependent mechanism. Neuron 46:569-579.
Ling KKY, Lin M-Y, Zingg B, Feng Z, Ko C-P Synaptic defects in the spinal and
neuromuscular circuitry in a mouse model of spinal muscular atrophy. Plos One.
Liu M, Zhang D, Shao C, Liu J, Ding F, Gu X (2007) Expression pattern of myostatin in
gastrocnemius muscle of rats after sciatic nerve crush injury. Muscle Nerve
35:649-656.
Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression data using real-
time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25:402-
408.
Lunn MR, Wang CH (2008) Spinal muscular atrophy. Lancet 371:2120-2133.

91

Marengo FD (2005) Calcium gradients and exocytosis in bovine adrenal chromaffin cells.
Cell Calcium 38:87-99.
Maximov A, Tang J, Yang X, Pang ZP, Sudhof TC (2009) Complexin controls the force
transfer from SNARE complexes to membranes in fusion. Science 323:516-521.
McGovern VL, Gavrilina TO, Beattie CE, Burghes AH (2008) Embryonic motor axon
development in the severe SMA mouse. Hum Mol Genet 17:2900-2909.
McLachlan EM, Martin AR (1981) Non-linear summation of end-plate potentials in the
frog and mouse. J Physiol 311:307-324.
McMahon HT, Missler M, Li C, Sudhof TC (1995) Complexins: cytosolic proteins that
regulate SNAP receptor function. Cell 83:111-119.
McPherron AC, Huynh TV, Lee SJ (2009) Redundancy of myostatin and
growth/differentiation factor 11 function. BMC Dev Biol 9:24.
McPherron AC, Lawler AM, Lee SJ (1997) Regulation of skeletal muscle mass in mice
by a new TGF-beta superfamily member. Nature 387:83-90.
Mendias CL, Marcin JE, Calerdon DR, Faulkner JA (2006) Contractile properties of EDL
and soleus muscles of myostatin-deficient mice. J Appl Physiol 101:898-905.
Michaud M, Arnoux T, Bielli S, Durand E, Rotrou Y, Jablonka S, Robert F, Giraudon-
Paoli M, Riessland M, Mattei MG, Andriambeloson E, Wirth B, Sendtner M,
Gallego J, Pruss RM, Bordet T (2010) Neuromuscular defects and breathing
disorders in a new mouse model of spinal muscular atrophy. Neurobiol Dis
38:125-135.
Miller TM, Kim SH, Yamanaka K, Hester M, Umapathi P, Arnson H, Rizo L, Mendell
JR, Gage FH, Cleveland DW, Kaspar BK (2006) Gene transfer demonstrates that
muscle is not a primary target for non-cell-autonomous toxicity in familial
amyotrophic lateral sclerosis. Proc Natl Acad Sci U S A 103:19546-19551.
Misgeld T, Burgess RW, Lewis RM, Cunningham JM, Lichtman JW, Sanes JR (2002)
Roles of neurotransmitter in synapse formation: development of neuromuscular
junctions lacking choline acetyltransferase. Neuron 36:635-648.
Monani UR (2005) Spinal muscular atrophy: a deficiency in a ubiquitous protein; a motor
neuron-specific disease. Neuron 48:885-896.
Morrison BM, Lachey JL, Warsing LC, Ting BL, Pullen AE, Underwood KW, Kumar R,
Sako D, Grinberg A, Wong V, Colantuoni E, Seehra JS, Wagner KR (2009) A
soluble activin type IIB receptor improves function in a mouse model of
amyotrophic lateral sclerosis. Exp Neurol 217:258-268.

92

Murray LM, Comley LH, Thomson D, Parkinson N, Talbot K, Gillingwater TH (2008)
Selective vulnerability of motor neurons and dissociation of pre- and post-
synaptic pathology at the neuromuscular junction in mouse models of spinal
muscular atrophy. Hum Mol Genet 17:949-962.
Murray LM, Talbot K, Gillingwater TH (2010) Review: neuromuscular synaptic
vulnerability in motor neurone disease: amyotrophic lateral sclerosis and spinal
muscular atrophy. Neuropathol Appl Neurobiol 36:133-156.
Ono S, Baux G, Sekiguchi M, Fossier P, Morel NF, Nihonmatsu I, Hirata K, Awaji T,
Takahashi S, Takahashi M (1998) Regulatory roles of complexins in
neurotransmitter release from mature presynaptic nerve terminals. Eur J Neurosci
10:2143-2152.
Pabst S, Hazzard JW, Antonin W, Sudhof TC, Jahn R, Rizo J, Fasshauer D (2000)
Selective interaction of complexin with the neuronal SNARE complex.
Determination of the binding regions. J Biol Chem 275:19808-19818.
Pabst S, Margittai M, Vainius D, Langen R, Jahn R, Fasshauer D (2002) Rapid and
selective binding to the synaptic SNARE complex suggests a modulatory role of
complexins in neuroexocytosis. J Biol Chem 277:7838-7848.
Palop JJ, Mucke L (2010) Amyloid-beta-induced neuronal dysfunction in Alzheimer's
disease: from synapses toward neural networks. Nat Neurosci 13:812-818.
Pan B, Zucker RS (2009) A general model of synaptic transmission and short-term
plasticity. Neuron 62:539-554.
Pang ZP, Melicoff E, Padgett D, Liu Y, Teich AF, Dickey BF, Lin W, Adachi R, Sudhof
TC (2006) Synaptotagmin-2 is essential for survival and contributes to Ca2+
triggering of neurotransmitter release in central and neuromuscular synapses. J
Neurosci 26:13493-13504.
Park GH, Maeno-Hikichi Y, Awano T, Landmesser LT, Monani UR (2010) Reduced
survival of motor neuron (SMN) protein in motor neuronal progenitors functions
cell autonomously to cause spinal muscular atrophy in model mice expressing the
human centromeric (SMN2) gene. J Neurosci 30:12005-12019.
Parsons SA, Millay DP, Sargent MA, McNally EM, Molkentin JD (2006) Age-dependent
effect of myostatin blockade on disease severity in a murine model of limb-girdle
muscular dystrophy. Am J Pathol 168:1975-1985.
Personius KE, Balice-Gordon RJ (2000) Activity-dependent editing of neuromuscular
synaptic connections. Brain Res Bull 53:513-522.

93

Photowala H, Freed R, Alford S (2005) Location and function of vesicle clusters, active
zones and Ca2+ channels in the lamprey presynaptic terminal. J Physiol 569:119-
135.
Pun S, Santos AF, Saxena S, Xu L, Caroni P (2006) Selective vulnerability and pruning
of phasic motoneuron axons in motoneuron disease alleviated by CNTF. Nat
Neurosci 9:408-419.
Reddy LV, Koirala S, Sugiura Y, Herrera AA, Ko CP (2003) Glial cells maintain
synaptic structure and function and promote development of the neuromuscular
junction in vivo. Neuron 40:563-580.
Reim K, Mansour M, Varoqueaux F, McMahon HT, Sudhof TC, Brose N, Rosenmund C
(2001) Complexins regulate a late step in Ca2+-dependent neurotransmitter
release. Cell 104:71-81.
Reim K, Wegmeyer H, Brandstatter JH, Xue M, Rosenmund C, Dresbach T, Hofmann K,
Brose N (2005) Structurally and functionally unique complexins at retinal ribbon
synapses. J Cell Biol 169:669-680.
Rizo J, Rosenmund C (2008) Synaptic vesicle fusion. Nat Struct Mol Biol 15:665-674.
Rose FF, Jr., Mattis VB, Rindt H, Lorson CL (2009) Delivery of recombinant follistatin
lessens disease severity in a mouse model of spinal muscular atrophy. Hum Mol
Genet 18:997-1005.
Rose T, Efendic S, Rupnik M (2007) Ca2+-secretion coupling is impaired in diabetic
Goto Kakizaki rats. J Gen Physiol 129:493-508.
Rosenmund C, Stevens CF (1996) Definition of the readily releasable pool of vesicles at
hippocampal synapses. Neuron 16:1197-1207.
Ruiz R, Casanas JJ, Torres-Benito L, Cano R, Tabares L (2010) Altered intracellular
Ca2+ homeostasis in nerve terminals of severe spinal muscular atrophy mice. J
Neurosci 30:849-857.
Sakuma K, Watanabe K, Sano M, Uramoto I, Totsuka T (2000) Differential adaptation of
growth and differentiation factor 8/myostatin, fibroblast growth factor 6 and
leukemia inhibitory factor in overloaded, regenerating and denervated rat
muscles. Biochim Biophys Acta 1497:77-88.
Sanes JR, Lichtman JW (1999) Development of the vertebrate neuromuscular junction.
Annu Rev Neurosci 22:389-442.
Schaub JR, Lu X, Doneske B, Shin YK, McNew JA (2006) Hemifusion arrest by
complexin is relieved by Ca2+-synaptotagmin I. Nat Struct Mol Biol 13:748-750.

94

Shigemoto K, Kubo S, Mori S, Yamada S, Akiyoshi T, Miyazaki T (2010) Muscle
weakness and neuromuscular junctions in aging and disease. Geriatr Gerontol Int
10 Suppl 1:S137-147.
Slater CR (2008) Structural factors influencing the efficacy of neuromuscular
transmission. Ann N Y Acad Sci 1132:1-12.
Son YJ, Trachtenberg JT, Thompson WJ (1996) Schwann cells induce and guide
sprouting and reinnervation of neuromuscular junctions. Trends Neurosci 19:280-
285.
Song Y, Panzer JA, Wyatt RM, Balice-Gordon RJ (2006) Formation and plasticity of
neuromuscular synaptic connections. Int Anesthesiol Clin 44:145-178.
Sons MS, Plomp JJ (2006) Rab3A deletion selectively reduces spontaneous
neurotransmitter release at the mouse neuromuscular synapse. Brain Res
1089:126-134.
Strenzke N, Chanda S, Kopp-Scheinpflug C, Khimich D, Reim K, Bulankina AV, Neef
A, Wolf F, Brose N, Xu-Friedman MA, Moser T (2009) Complexin-I is required
for high-fidelity transmission at the endbulb of held auditory synapse. J Neurosci
29:7991-8004.
Sudhof TC (2004) The synaptic vesicle cycle. Annu Rev Neurosci 27:509-547.
Sumner CJ (2007) Molecular mechanisms of spinal muscular atrophy. J Child Neurol
22:979-989.
Sumner CJ, Wee CD, Warsing LC, Choe DW, Ng AS, Lutz C, Wagner KR (2009)
Inhibition of myostatin does not ameliorate disease features of severe spinal
muscular atrophy mice. Hum Mol Genet 18:3145-3152.
Takahashi S, Yamamoto H, Matsuda Z, Ogawa M, Yagyu K, Taniguchi T, Miyata T,
Kaba H, Higuchi T, Okutani F, et al. (1995) Identification of two highly
homologous presynaptic proteins distinctly localized at the dendritic and somatic
synapses. FEBS Lett 368:455-460.
Tang J, Maximov A, Shin OH, Dai H, Rizo J, Sudhof TC (2006) A
complexin/synaptotagmin 1 switch controls fast synaptic vesicle exocytosis. Cell
126:1175-1187.
Tokumaru H, Shimizu-Okabe C, Abe T (2008) Direct interaction of SNARE complex
binding protein synaphin/complexin with calcium sensor synaptotagmin 1. Brain
Cell Biol 36:173-189.

95

Tokumaru H, Umayahara K, Pellegrini LL, Ishizuka T, Saisu H, Betz H, Augustine GJ,
Abe T (2001) SNARE complex oligomerization by synaphin/complexin is
essential for synaptic vesicle exocytosis. Cell 104:421-432.
Toonen RF, Wierda K, Sons MS, de Wit H, Cornelisse LN, Brussaard A, Plomp JJ,
Verhage M (2006) Munc18-1 expression levels control synapse recovery by
regulating readily releasable pool size. Proc Natl Acad Sci U S A 103:18332-
18337.
Toro R, Konyukh M, Delorme R, Leblond C, Chaste P, Fauchereau F, Coleman M,
Leboyer M, Gillberg C, Bourgeron T (2010) Key role for gene dosage and
synaptic homeostasis in autism spectrum disorders. Trends Genet 26:363-372.
Valdez G, Tapia JC, Kang H, Clemenson GD, Jr., Gage FH, Lichtman JW, Sanes JR
(2010) Attenuation of age-related changes in mouse neuromuscular synapses by
caloric restriction and exercise. Proc Natl Acad Sci U S A 107:14863-14868.
van Spronsen M, Hoogenraad CC Synapse pathology in psychiatric and neurologic
disease. Curr Neurol Neurosci Rep 10:207-214.
Voets T, Neher E, Moser T (1999) Mechanisms underlying phasic and sustained
secretion in chromaffin cells from mouse adrenal slices. Neuron 23:607-615.
Wadel K, Neher E, Sakaba T (2007) The coupling between synaptic vesicles and Ca2+
channels determines fast neurotransmitter release. Neuron 53:563-575.
Wagner KR et al. (2008) A phase I/IItrial of MYO-029 in adult subjects with muscular
dystrophy. Ann Neurol 63:561-571.
Wagner KR, McPherron AC, Winik N, Lee SJ (2002) Loss of myostatin attenuates
severity of muscular dystrophy in mdx mice. Ann Neurol 52:832-836.
Wehling M, Cai B, Tidball JG (2000) Modulation of myostatin expression during
modified muscle use. FASEB J 14:103-110.
Whittemore LA et al. (2003) Inhibition of myostatin in adult mice increases skeletal
muscle mass and strength. Biochem Biophys Res Commun 300:965-971.
Wood SJ, Slater CR (2001) Safety factor at the neuromuscular junction. Prog Neurobiol
64:393-429.
Wooley CM, Sher RB, Kale A, Frankel WN, Cox GA, Seburn KL (2005) Gait analysis
detects early changes in transgenic SOD1(G93A) mice. Muscle Nerve 32:43-50.
Wu H, Xiong WC, Mei L To build a synapse: signaling pathways in neuromuscular
junction assembly. Development 137:1017-1033.

96

Wu H, Xiong WC, Mei L (2010) To build a synapse: signaling pathways in
neuromuscular junction assembly. Development 137:1017-1033.
Xie ZP, Poo MM (1986) Initial events in the formation of neuromuscular synapse: rapid
induction of acetylcholine release from embryonic neuron. Proc Natl Acad Sci U
S A 83:7069-7073.
Xue M, Craig TK, Xu J, Chao HT, Rizo J, Rosenmund C (2010) Binding of the
complexin N terminus to the SNARE complex potentiates synaptic-vesicle
fusogenicity. Nat Struct Mol Biol 17:568-575.
Xue M, Lin YQ, Pan H, Reim K, Deng H, Bellen HJ, Rosenmund C (2009) Tilting the
balance between facilitatory and inhibitory functions of mammalian and
Drosophila Complexins orchestrates synaptic vesicle exocytosis. Neuron 64:367-
380.
Xue M, Reim K, Chen X, Chao HT, Deng H, Rizo J, Brose N, Rosenmund C (2007)
Distinct domains of complexin I differentially regulate neurotransmitter release.
Nat Struct Mol Biol 14:949-958.
Xue M, Stradomska A, Chen H, Brose N, Zhang W, Rosenmund C, Reim K (2008)
Complexins facilitate neurotransmitter release at excitatory and inhibitory
synapses in mammalian central nervous system. Proc Natl Acad Sci U S A
105:7875-7880.
Yamada M, Saisu H, Ishizuka T, Takahashi H, Abe T (1999) Immunohistochemical
distribution of the two isoforms of synaphin/complexin involved in
neurotransmitter release: localization at the distinct central nervous system
regions and synaptic types. Neuroscience 93:7-18.
Yoon TY, Lu X, Diao J, Lee SM, Ha T, Shin YK (2008) Complexin and Ca2+ stimulate
SNARE-mediated membrane fusion. Nat Struct Mol Biol 15:707-713.
Young SM, Jr., Neher E (2009) Synaptotagmin has an essential function in synaptic
vesicle positioning for synchronous release in addition to its role as a calcium
sensor. Neuron 63:482-496.
Zhou X, Wang JL, Lu J, Song Y, Kwak KS, Jiao Q, Rosenfeld R, Chen Q, Boone T,
Simonet WS, Lacey DL, Goldberg AL, Han HQ (2010) Reversal of cancer
cachexia and muscle wasting by ActRIIB antagonism leads to prolonged survival.
Cell 142:531-543.

97

Zimmers TA, Davies MV, Koniaris LG, Haynes P, Esquela AF, Tomkinson KN,
McPherron AC, Wolfman NM, Lee SJ (2002) Induction of cachexia in mice by
systemically administered myostatin. Science 296:1486-1488.
Zucker RS, Regehr WG (2002) Short-term synaptic plasticity. Annu Rev Physiol 64:355-
405.

Abstract (if available)

Abstract The synapse is the fundamental building block of the brain circuitry responsible for the human behavior. An understanding of synaptic structure and function is required to elucidate how the brain functions. In this study, we used the neuromuscular junction (NMJ) as a model synapse to investigate the basic mechanisms of synapse function and maintenance.

Linked assets

University of Southern California Dissertations and Theses

Conceptually similar

PDF

The role of Schwann cells in the development of the neuromuscular junction

PDF

Exploring alternative roles of visual arrestin 1 in photoreceptor synaptic regulation and deciphering the molecular pathway of retinal degeneration using mouse knockout technology

Asset Metadata

Creator Lin, Ming-Yi (author)

Core Title Synapse maintenance and function at the mouse neuromuscular junction: implications in diseases

School College of Letters, Arts and Sciences

Degree Doctor of Philosophy

Degree Program Biology (Neurobiology)

Publication Date 02/22/2011

Defense Date 11/23/2010

Publisher University of Southern California (original), University of Southern California. Libraries (digital)

Tag amyotrophic lateral sclerosis,complexin,motoneuron,muscle,myostatin,neuromuscular junction,OAI-PMH Harvest,spinal muscular atrophy

Language English

Contributor Electronically uploaded by the author (provenance)

Advisor Ko, Chien-Ping (committee chair), Butler, Samantha J. (committee member), Chow, Robert (committee member), Youn, Jang H. (committee member)

Creator Email mingyili@usc.edu,mingyilin@gmail.com

Permanent Link (DOI) https://doi.org/10.25549/usctheses-m3669

Unique identifier UC1423078

Identifier etd-lin-4336 (filename),usctheses-m40 (legacy collection record id),usctheses-c127-428181 (legacy record id),usctheses-m3669 (legacy record id)

Legacy Identifier etd-lin-4336.pdf

Dmrecord 428181

Document Type Dissertation

Rights Lin, Ming-Yi

Type texts

Source University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Repository Name Libraries, University of Southern California

Repository Location Los Angeles, California

Repository Email cisadmin@lib.usc.edu