University of Southern California Dissertations and Theses

PTEN deletion induced tumor initiating cells: Strategies to accelerate the disease progression of liver cancer

(USC Thesis Other)

PTEN deletion induced tumor initiating cells: Strategies to accelerate the disease progression of liver cancer

PDF

Download a page range

Download transcript

Copy asset link

Request this asset

Transcript (if available)

Content PTEN DELETION INDUCED TUMOR INITIATING CELLS:

STRATEGIES TO ACCELERATE THE DISEASE PROGRESSION OF

LIVER CANCER

by

Vivian Galicia Medina

A Dissertation Presented to the
FACULTY OF THE USC GRADUATE SCHOOL
UNIVERSITY OF SOUTHERN CALIFORNIA
In Partial Fulfillment of the
Requirements for the Degree
DOCTOR OF PHILOSOPHY
(SYSTEMS BIOLOGY AND DISEASE)

May 2011

Copyright 2011 Vivian Galicia Medina
ii

DEDICATION

First and foremost I would like to dedicate my doctoral thesis to my parents Fredy
and Gloria Galicia. I want to thank you for the bravery and sacrifice it took to bring me to
this country 27 years ago. Thanks to you I was able to become a citizen of this great
nation and achieve higher education. Mom and dad, I love you. I admire and respect you
for all of the hard work it takes to raise four children. Even though I am the oldest, I
know your love for me grows with each passing day. I would also like to thank Grandma
Berta, Sindy, Fredy, and Merlyn Galicia for your love. My big sister advice is to aim high
because anything is possible.
I would also like to dedicate my graduate degree to my nuclear family, my dear
husband Milton Medina and my daughter Sophia Aracely Medina. I cannot imagine a
more supportive and loving partner. I want to thank you for helping me get through the
rough patches during my doctoral training and for providing us with happy, loving home.
Most of all, I want to thank you for helping me create the tiny miracle that grows inside
me. Sophia we anxiously await your arrival.
Last but not least I would like to thank my lifelong friends Norma, Miriam, Alex
and Miguel. Some of the funniest and most memorable moments have happened in your
company and I am happy that you can celebrate this professional milestone with me as
well. I also want to acknowledge a lovely group of ladies I met here at USC; Jennifer,
Helty, Kim, Bernice, and Emily. Having a great support group is an important part of
graduate school survival. I am fortunate to have found great friends to share not only grad
school adventures with but also our evolving personal lives.
iii

ACKNOWLEDGEMENTS

I would like to earnestly thank my advisor Dr. Bangyan Stiles for all her scientific
guidance, and financial support over the last 5.5 years. I would like to thank her for her
patience, particularly during the first years as I developed my technical skills. And as my
understanding of the field caught up with my technical abilities, I want to thank her for
allowing me the freedom to pursue my own research interests. During the entire course of
my doctoral training Bangyan’s door was always open and she always had time to discuss
data, lab presentations, etc. I am happy to be her first graduate student and I know she has
enough brilliant ideas to successfully mentor dozens more.
I would also like to thank my thesis committee Dr. Pradip Roy-Burman and Dr.
James Ou for their scientific guidance and advice over the last three years. Their
constructive suggestions helped strengthen our projects, and we would like to share our
publication success with them. More importantly, I want to thank my committee for
signing off on my readiness to defend five months ago and for making it official on
March 18, 2011. I would also like to thank Mike Kahn for his continuing mentorship and
collaboration in the Wnt/β-Catenin project. Mike has generously provided ICG inhibitor
to support our experiments. I would also like to thank his lab members Cu, Goar, and
Elizabeth for their extraordinary willingness to help and technical assistance.
Last but certainly not least I would like to thank the core members of the Stiles
Lab: Jennifer, Lina, Yang, and Ni. We are a special group that genuinely cares about each
other and helps one another in any way possible with our projects. I would especially like
iv

to thank Ni, and PIBBS rotation student Anketse for their technical assistance the last two
months. I would not have finished key experiments in time for my defense without them.

v

TABLE OF CONTENTS
Dedication………………………………………………………………………………...ii
Acknowledgements………………………………………………………………………iii
List of Tables...…………………………………………………………………………..vii

List of Figures…………………………………………………………………………...viii

Abstract…………………………………………………………………………………..ix

Chapter I: Tumor Suppressor PTEN and its cellular functions…………………………..1

Chapter II: Expansion of hepatic tumor progenitor cells in Pten-null mice requires
liver injury and is reversed by loss of AKT2……………………………………………..6
Deletion of Akt2 inhibits liver cancer development in the Pten null mice……….7
Paradoxical Roles of PTEN and AKT2 in proliferation and survival of
liver cells…………………………………………………………………………..7
Pten null liver sustains chronic liver injury that is relieved by Akt2 deletion…..10
Accumulation of hepatic progenitor cells in Pten null mice is inhibited by
AKT2 loss……………………………………………………………………….13
Hepatic progenitor cells undergo proliferation and differentiation……………..14
Deletion of Akt2 does not alter the mixed cell characteristics of tumors……….19
Chemical injury in Dm mice leads to activation of liver progenitors and
development of premalignant lesions……………………………………………21
Growth factors may mediate the activation of hepatic progenitor cells………....24

Chapter III: Proliferation of hepatic TICs are inhibited in vitro and in vivo by Wnt/
β-Catenin inhibitor ICG-001………………………………………………………………....27
ICG-001 inhibits self-renewal genes in hepatic cancer stem cell line P0…………...30
ICG-001 significantly inhibits proliferation of CD 133+ hepatic cancer stem
cell line P0 in vitro…………………………………………………………………...33

Chapter IV: The role of LKB1 deletion in hepatic Pten mediated carcinogenesis……...36
Phenotypic characteristics of LKB1
L/+
/Pten
-/-
double mutant mice…………….38
Dm mice do not exhibit greater steatosis or liver injury than Pm mice…………41
Heterozygous deletion of LKB1 causes an earlier onset of bilineage tumors
in Pm mice……………………………………………………………………....44
LKB1 deletion in Pten null MEFs causes reduction of cell cycle inhibitor
p21 message……………………………………………………………………...47

Chapter V: Discussion…………………………………………………………………...49

vi

Chapter VI: Materials and Methods……………………………………………………..56

Bibliography……………………………………………………………………………..61

vii

LIST OF TABLES

Table 1. Tumor spectrum in LKB1/Pten (DM) and Pten mutants (PM)……………......46

Table 2. Real time qPCR primers used in studies………………………………………60

viii

LIST OF FIGURES
Figure 1. Signaling network regulated by PTEN………………………………………..5
Figure 2. Akt2 deletion inhibits tumor growth in Pten null mice……………………….9
Figure 3. Akt2 deletion inhibits liver injury induced by Pten deletion in the liver…….12
Figure 4. Deletion of Akt2 inhibits expansion of liver progenitor cells observed in
Pten null mice……………………………………………………………………………16

Figure 5. Proliferation and differentiation of progenitor cells in the Pten null mice…...18

Figure 6. Deletion of Akt2 does not alter the mixed cell tumor phenotype in liver
specific Pten null mice…………………………………………………………………..20

Figure 7. Deletion of Akt2 in the Pten null liver does not hinder the proliferation of
progenitor cells in response to DDC treatment………………………………………....23

Figure 8. PDGF is a potential growth factor mediating the progenitor cell expansion
in Pten null mice………………………………………………………………………..26

Figure 9. Activation of Wnt signaling pathway in Pten mutant mice is induced during
hepatic progenitor cell proliferation…………………………………………………….29

Figure 10. ICG-001 inhibits mRNA and protein expression of self-renewal genes…...32

Figure 11. ICG-001 inhibits proliferation of Pten null/CD 133
+
hepatic tumor initiating
cell line P0……………………………………………………………………………...35

Figure 12. Phenotypic characterization of LKB1
L/+
/Pten
-/-
(DM) mice…………….....40
Figure 13. Liver LKB1
L/+
/Pten
-/-
mice do not exhibit greater steatosis or liver injury
than mice with hepatic Pten deletion alone……………………………………...…......43

Figure 14. Hepatic LKB1
L/+
/Pten
-/-
deletion in mice causes an accelerated onset of
tumor development…………………………………………………………………......46

Figure 15. Pten/LKB1 -/- MEFS demonstrate reduced p21 expression……………….48

ix

ABSTRACT

Progenitor or tumor initiating cells (TICs) are “altered” stem cells with the capacity to
form solid tumors. Tumor suppressor PTEN (phosphatase and tensin homologue deleted
on chromosome ten) and its downstream target Protein Kinase B (AKT2) are aberrantly
expressed in liver cancers. The focus of my doctoral studies is to use liver specific Pten
(Pm) and Pten/Akt2 deletion (Dm) murine models to investigate the role of hepatic TICs
in vivo. Proliferation of hepatic progenitor cells in has been reported in various murine
models of hepatotoxin induced liver injury. Pm mice develop liver cancer following an
extensive phase of chronic lipid accumulation and demonstrate escalating levels of
hepatic injury markers from 6-12M, prior to TIC proliferation. In addition, TUNEL
analysis revealed that hepatocytes from Pm mice undergo extensive apoptosis relative to
control mice. We hypothesize that hepatocyte cell death induced by hepatic injury
presents an opportunity for TICs to proliferate and consequently form mixed lineage
tumors. Based on these findings, I sought to investigate different strategies employed by
TICs for liver tumor development. The first is taking advantage of an injured niche which
is addressed in chapter two. Attenuation of hepatic injury by Akt2 deletion reduces
progenitor cell proliferation and delays tumor development. Treatment of double mutant
mice with 3,5-dietoxycarbonyl-1,4 dihydrocollidine (DDC) shows that the primary effect
of AKT2 loss is attenuation of hepatic injury and not inhibition of progenitor cell
proliferation in response to injury. My primary study also revealed that the Wnt/β-
Catenin signaling pathway is the likely molecular mediator of cancer stem cell
proliferation in our Pm model. In chapter three we explore inhibition of the Wnt/β-
x

Catenin signaling pathway as a means to inhibit TIC proliferation. We demonstate that
Wnt/β-Catenin inhibitor ICG-001 attenuates proliferation of hepatic tumor initiating cell
line P0. Lastly, we explore evasion of cell cycle regulation by cancer stem cells using
hepatic LKB1/Pten deletion (DM). This study revealed that monoallelic deletion of
LKB1 in Pm mice causes an earlier onset of bilineage liver cancer development. This
acceleration of tumor formation is associated with disregulation of cell cycle inhibitor
p21. The findings from these studies are not only relevant to liver cancer research, but to
multiple organ cancer stem cell systems which may employ similar tactics for malignant
transformation.

1
CHAPTER I

Tumor Suppressor PTEN and its cellular functions

PTEN (phosphatase and tensin homolog deleted on chromosome 10) is one of the
most frequently mutated genes in human cancer. Located on chromosome 10q23, the
PTEN locus harbors high susceptibility for mutations. Monoallelic mutations occur at a
50-80% frequency in sporadic tumors, including endometrial and prostate cancers as well
as glioblastomas (Salmena, Carracedo et al. 2008). Complete loss of PTEN is associated
with advanced cancers and metastases (Ali, Schriml et al. 1999). PTENs tumor
suppressor role is further substantiated by the discovery of various PTEN hamartoma
tumor syndromes (PHTS) including; Cowden syndrome, Lhermitte-Duclos disease,
Bannayan-Riley-Ruvalcaba syndrome and Proteus/Proteus-like syndromes. These
autosomal dominant disorders are primarily characterized by the development of multiple
hamartomas with a high risk of progressing towards malignancy. Other disease
characteristics include developmental disorders and neurological deficits. In addition,
several PTEN deletion mouse models corroborate its crucial tumor suppressor function in
various organ systems (Di Cristofano, Pesce et al. 1998; Suzuki, de la Pompa et al. 1998;
Podsypanina, Ellenson et al. 1999; Trotman, Niki et al. 2003).
The most characterized function of PTEN is that of a cytoplasmic lipid
phosphatase. PTEN dephosphoryaltes lipid substrate phosphatidylinositol-3,4,5(PIP
3
)

at
the third position (Downes, Ross et al. 2007). By converting second messenger PIP3 into
phosphatidylinositol 4,5-bisphosphate (PIP2), PTEN negatively regulates the
phosphatidylinositol-3- kinase(PI3K)/Protein kinase B (Akt) signaling pathway.
Activation of the AKT pathway leads to a number of cellular responses including cell
2
growth, survival, and metabolism (Manning and Cantley 2007). AKT mediates survival
via inactivating phosphorylations of the pro-apoptotic proteins BAD, as well as caspases
3 and 9. AKT also mediates cell growth and proliferation. Phosphorylation of the
tuberous sclerosis complex 2 (TSC2) reverses its inhibitory signal to the mammalian
target of rapamicin (mTOR) proliferation pathway. In addition cell cycle modulators p21,
p27 and cyclin D are directly regulated by AKT (Liang and Slingerland 2003). Finally,
AKT mediated changes in cellular metabolism by phosphorylation of the Forkhead
transcription factors (FOXO) (Fig. 1), (Stiles 2009).
Pten and Liver Cancer
The inhibition of the PI3K/AKT mitogenic pathway may account for PTEN’s
tumor suppressor functions. In humans, PTEN loss is highly associated with liver cancer
(Kawamura, Nagai et al. 1999; Dong-Dong, Xi-Ran et al. 2003; Hu, Huang et al. 2003;
Xu, Sakon et al. 2004; Bae, Rho et al. 2007). Our group and others have developed a liver
cancer mouse model that carries hepatic deletion of tumor suppressor phosphatase and
tensin homologue deleted on chromosome ten (Pten) (Stiles, Wang et al. 2004; Xu,
Kobayashi et al. 2006). Deletion of Pten in mouse liver results in hepatosteatosis and
inflammation followed by liver cancer (Horie, Suzuki et al. 2004; Stiles, Wang et al.
2004; Xu, Kobayashi et al. 2006). This two-phase progression paradigm is similar to
human liver cancers in which steatohepatitis is a common pre-condition and co-morbidity
to hepatocellular carcinoma (HCC) development.
Liver cancer is one of the most common malignant tumors, it is reported as 5
th
in
incidence and third in mortality worldwide (Bruix J). The five year survival rate for liver
cancer is less than 13%, second only to pancreatic cancer among all other cancer malignancies.
3
Furthermore, the prevalence of liver cancer is on the rise in western countries, highlighting the
importance of research in liver cancer treatment and prevention. Initially identified for leukemia,
putative tumor progenitor/tumor initiating cells (TICs) have been identified in many solid
tumors including liver cancers (Roskams, Libbrecht et al. 2003; Alison 2005; Visvader
and Lindeman 2008). In humans and rodents, facultative markers for liver progenitor cells have
been identified (Petersen, Goff et al. 1998; Wang, Foster et al. 2003; Schmelzer, Wauthier et al.
2006; Yovchev, Grozdanov et al. 2008). In rodents, facultative liver progenitors are found to
be multipotent and express phenotypic markers of hepatocytes, such as epithelial cell
adhesion molecule EpCAM, α-fetoprotein (AFP) and ductal lineage markers such as
keratins (Germain, Goyette et al. 1985; Dunsford, Karnasuta et al. 1989). Moreover, these
progenitor cells can differentiate into hepatocytes and cholangiocytes, the two major cell
lineages in the liver (Alison 2005; Mishra, Banker et al. 2009).
Our group has established a liver cancer stem cell line using membrane protein
Prominin 1 (CD133). Our study demonstrated that a CD133
+
/CD45
-
non-parenchymal cell
population isolated from livers of mice lacking PTEN is capable of grafting multilineage
tumors, and shows resistance to chemotherapy, two hallmarks of progenitor induced tumors
(Rountree, Ding et al. 2009). In humans, liver cancer patients with a “progenitor cell”
phenotype demonstrate poor prognosis compared to patients with differentiated
“hepatocyte” cancers (Lee, Heo et al. 2006). Other investigations have identified a
population of chemo-resistant and tumorigenic TICs within established
hepatocellularcarcinoma (HCC) cell lines (Ma, Chan et al. 2007). Despite these new
findings, the mechanism driving the activation of TICs is still not clear. The focus of my
4
doctoral studies is to elucidate the downstream mechanisms leading to the expansion of
TICs and tumor formation in vivo using the liver specific PTEN null mouse model.

5

Figure 1. Signaling network regulated by PTEN. Lipid phosphatase PTEN negatively
regulates the PI3K signaling pathway. Pten deletion activates AKT, a proto-oncoprotein
that controls proliferation, cell survival, translation, cell size, and cell metabolism. AKT
phosphorylation of GSK3α/β blocks its inhibitory effect on glycogen synthase and β-
catenin. Phosphorylation of TSC2 prevents mTOR inhibition, allowing downstream
translational events to propagate. Cell survival is prominent function of AKT signaling
and is mediated by direct phosphorylation of caspases 3 and 9 as well as proapoptotic
factor BAD. Phosphorylation of the forkhead transcription factor FOXO blocks ligand
dependent cell death as well as having an effect on cell proliferation. Phosphorylation of
MDM2 by AKT leads to its cytoplasmic translocation and thus blocks its effects on p53
degradation. AKT also has direct effects on cell cycle regulators p21, p27 and cyclin D1.

6
CHAPTER II
Expansion of hepatic tumor progenitor cells in Pten-null mice requires liver injury
and is reversed by loss of AKT2
Recent studies have identified a novel metabolic role for Akt2 in the liver.
Leavens et. al reported that Akt2 is required for hepatic lipid accumulation in models of
insulin resistance. Leptin deficient obese (ob/ob) mice lacking hepatic Akt2 failed to
amass triglycerides in their livers, associated with a decrease in lipogenic gene expression
and de novo lipogenesis (Leavens, Easton et al. 2009). Similarly, Akt2 was found to play
a critical role in hepatic steatosis induced by PTEN loss.(He, Hou et al.) These findings
are significant because the first phase of disease progression for liver cancer is the
development of fatty liver. In fact upregulation of Akt2, the primary AKT isoform in the
liver, is highly associated with human liver cancer (Kawamura, Nagai et al. 1999; Dong-
Dong, Xi-Ran et al. 2003; Hu, Huang et al. 2003; Xu, Sakon et al. 2004; Bae, Rho et al.
2007).
In this study, we elucidate the downstream mechanisms leading to the expansion
of TICs and tumor formation in vivo using two unique genetic models, the liver specific
Pten null (Pm) mice and a newly developed Pten/Akt2 double mutant (Dm) model. Our
study demonstrates that proliferation of liver progenitor cells is a consequence of chronic
hepatic injury resulting from Pten deletion in hepatocytes. Akt2 deletion does not inhibit
progenitor cell proliferation. But rather, deletion of Akt2 abrogates hepatic injury induced
by Pten deletion, resulting in the delay of tumor development. Our findings suggest that
without the selection pressure from chronic hepatic injury, loss of PTEN in TICs is not
sufficient to drive the progression of liver cancer. In addition to the 40-50% human liver
7
cancers that carry Pten mutation (Kawamura, Nagai et al. 1999; Dong-Dong, Xi-Ran et
al. 2003; Hu, Huang et al. 2003; Bae, Rho et al. 2007), our findings are relevant to the
majority of liver cancer patients in which chronic liver injury precedes cancer
development.
RESULTS
Deletion of Akt2 inhibits liver cancer development in the Pten null mice
Overexpression of AKT2 is associated with human liver carcinogenesis (Xu,
Sakon et al. 2004). How AKT2 contributes to liver cancer development is unclear
because germline deletion of Akt2 produced a metabolic but not growth/survival
phenotype (Cho, Mu et al. 2001). We analyzed tumor spectrums in Pten null (Pm) and
Pten/Akt2 double mutant (Dm) mice to assess the function of AKT2 in liver
carcinogenesis. Pm mice develop tumors starting at approximately 8-9 months of age
(Stiles, Wang et al. 2004) without significant differences between males and females. A
6-month delay in tumor onset is observed when Akt2 is deleted simultaneously with Pten
in Dm mice (Fig 2A, left panel). Between 9-12 months of age, 50% of the Pm mice
(5/10) developed tumors compared to 0% (0/14) of the Dm mice (Fig 2A). 100% of Pm
mice 12 months and older (10/10) developed tumors. Only 25% of Dm mice older than
12 months developed liver nodules (4/16), and only 2 had visible tumors.
Paradoxical Roles of PTEN and AKT2 in proliferation and survival of liver cells
The observation that Akt2 deletion delays tumor development in the Pm model is
not surprising since the canonical role of AKT kinases is pro-growth and pro-survival.
We evaluated cell proliferation and survival in Pm and Dm livers. At 12 months of age,
we observed a significantly higher Ki67 positive proliferation index in Pm compared to
8
Dm and Control livers (Fig 2B, top panel). Because Dm and Controls are not tumor
bearing at this age, we also analyzed the mitotic index in pre-malignant 3-month old
mice. Interestingly, we discovered very limited proliferation activity in the Pm liver (Fig
2B, bottom panel) whereas concurrent deletion of Akt2 had no effect on the proliferation
index. Moreover, TUNEL staining showed that simultaneous deletion of Akt2 with Pten
inhibits apoptosis rather than causing more apoptotic cells (Fig 2C). Furthermore, Pten
deletion leads to progressive hepatocyte cell death as the phenotype progress from
steatosis to premalignancy phase. By 9 months of age, the majority of the hepatocytes are
TUNEL positive indicating massive hepatocyte death in the Pm liver (Fig 2C).

Figure 2. Akt2 deletion inhibits tumor growth in Pten null mice. A. Left panel, tumor
spectrum. Each red circle represents one Pten null (Pm) mouse. Each green circle
represents one Pten/Akt2 double mutant (Dm) mouse. The solid circles represent mice
with tumors and open circles represent mice with tumors. Right panel, tumor data
presented as percentage of the total number of animals evaluated. B. Liver sections were
stained with a cell proliferation marker Ki67 (brown nuclei staining). Top panel, 12
month old mice. Bottom panel, 3 month-old mice. C. Liver sections were stained with
TUNEL (brown nuclei staining) to identify apoptotic cells. All sections were
counterstained with hematoxylin for nuclei identification. Black arrows: TUNEL
positive cells. Red arrow: TUNEL negative cell.

9
Figure 2.

C. TUNEL
0
20
40
60
80
100
120
0 6 9-12 15-18
Con
Pm
Dm
Percent Tumor Free (%)
Age (months)
Pten null without tumor
Dm without tumor
Pten null with tumor
Dm with tumor
A
B 。 Ki 67
Control Pten null
Control Pten null
12 Months
10 µM
3 Months
20 µM
10 µM
Pten/Akt2 double Mutant
Pten/Akt2 double Mutant
8 9 10 11 12 13 14 15 16
Age (months)

10
Pten null liver sustains chronic liver injury that is relieved by Akt2 deletion

These observations are inconsistent with the roles of AKT as an anti-and PTEN, a
pro-apoptotic molecule. Given the presence of progressive and massive steatosis in Pm
mice (Stiles, Wang et al. 2004) and the lack thereof in the Dm liver (Fig 3A), we
hypothesized that steatosis may be causing liver injury in the Pm model. In Dm mice,
injury is attenuated due to the inhibitory effect of AKT2 loss on lipogenesis (He, Hou et
al.). Liver injury is often accompanied by the loss of liver function and increase in
oxidative stress (Rountree, Barsky et al. 2007; Cohen, Roychowdhury et al. 2009). Pm
livers exhibited high H
2
O
2
contents (Horie, Suzuki et al. 2004) (data not shown). H
2
O
2

can transcriptionally activate enzymes responsible for reducing oxidative stress.
Expressions of H
2
O
2
scavenger GPx and antioxidant enzyme GST are significantly higher
in Pm mice compared to Controls from 6-12 months of age (Fig 3B). In Dm mice, the
mRNA expression of GPx and GST are significantly reduced compared to Pm mice. We
performed immunostaining for 4-HNE, a lipid peroxidation product and identified 4-
HNE aggregates in Pm livers, particularly surrounding lipid droplets (Fig 3C, middle
panel inset). Consistent with GPx and GST expression analysis, 4-HNE positive staining
is significantly reduced in Control and Dm livers, suggesting oxidative stress and injury
conditions are present in the Pm liver.
We measured the serum levels of ALT, a clinical marker for liver function and
found that it increases progressively as Pm mice age, reaching levels 5 fold higher levels
than Controls at 12 months of age (Fig 3D). Continuously rising ALT indicates
progressive and chronic liver injury. In contrast, serum ALT levels of Dm mice remained
at control levels (approximately 50U/L) until 12 months of age when levels began to
11
increase (Fig 3D). Low levels of serum ALT prior to 12 months of age (Fig 3D) is
concurrent with the delayed onset of hepatosteatosis observed in Dm mice(data not
shown). Together, these findings suggest that the Pm liver is undergoing chronic injury.

Figure 3. Akt2 deletion inhibits liver injury induced by Pten deletion in the liver. A.
Representative H&E image show liver steatosis in 3 months old Pten null (Pm) mice and
not in the Pten/Akt2 double mutant (Dm) mice. B. qPCR analysis reveals higher
expression of GPx and GST in Pm than in Dm and Controls. Values are expressed as fold
change vs. Controls (set as 1). C. Immunostaining with anti-4-HNE shows accumulation
of lipid peroxidation aggregates (green fluorescent stained spots) in the Pm liver. The
sections are also stained with DAPI (blue) for nuclei. D. Liver injury is measured by
serum ALT quantification. All values are expressed as the mean + SEM. * indicates
significant difference from Controls (p≤0.05). ** indicates significant difference from Pm
(p≤0.05). n=5.

12
Figure 3.
A.
B.
C.
D.
Pten null
200 µM
Pten/Akt2
double mutant
Plasma ALT( U/L)
Age (Months)
0
50
100
150
200
250
300
1M 3M 6M 9M 12M
*
*
*
*
*
*
Con
Pm
Dm
Age (Months)
Fold Change
GPx
0
4
8
12
16
*
*
6M 12M
Con
Pm
** **
Dm
Fold Change
GST
0
4
8
12
*
*
6M 12M
Age(Months)
**
**
Con
Pm
Dm
Con Pm Dm
25 µM

13
Accumulation of hepatic progenitor cells in Pten null mice is inhibited by AKT2 loss
Concomitant with hepatosteatotic injury, we observed an accumulation of cells in
the periductal region of Pm livers from 9-12 months of age. These cells are
morphologically similar to liver progenitor cells observed in hepatotoxin DDC induced
liver injury models (Wang, Foster et al. 2003), (Fig 4A, dotted areas). Similar to DDC
treatment models, the message levels of several hepatic progenitor markers including K-
19, EpCAM, and AFP (Schmelzer, Wauthier et al. 2006; Yamashita, Ji et al. 2009) is
significantly higher in Pm mice compared to Controls (Fig 4B). Protein expression of
pan-keratins and AFP are also higher in Pm mice compared to Controls (Fig 3B). In
addition, Wnt7a, and 10a have been identified as inducible mediators of hepatic
progenitor cells (Itoh, Kamiya et al. 2009). Expression of Wnt7a and 10a are also
upregulated in Pm mice (Fig 4C). Increased protein expression of β-Catenin from cell
lines isolated from Pm mice corroborates upregulation of Want/β-Catenin Pathway
components (Fig 4C, right panel). The histological similarities between Pm and DDC
mice and the gene expression profiles suggest that hepatic progenitor cells are present in
the livers of the Pm mice. We analyzed Dm liver sections and found significantly reduced
progenitor cell accumulation in the periductal region, the putative progenitor cell niche
(Fig 4, left panel). Accumulation of progenitor cells occurs later when injury conditions
are present in mice 12 months and older (supplemental Fig4), indicating that the effect of
AKT2 on progenitor cell activation may be secondary to liver injury. Expression of
progenitor cell markers K-19, EpCAM, and AFP are also significantly reduced by 5, 5
and 2 fold respectively in the Dm vs. Pm mice (Fig 4D, right panel). Expression of
Wnt7a and 10a is reduced approximately by 10 fold (Fig 4C, right panel). The
14
morphological and expression analysis suggests that deletion of Akt2 inhibits progenitor
cell accumulation.
Hepatic progenitor cells undergo proliferation and differentiation
In Pm liver sections, we observed multiple layers of progenitor cells surrounding
a single layer of ductal cells. These progenitor cells exhibit high mitotic activity
indicated by Ki-67 staining (Fig 5A). This phenotype becomes prominent after 9 months
of age, after extensive hepatocyte apoptosis occurs. We investigated the differentiation
of progenitor cells to cholangiocytes using keratin staining (Fig 5B) and observed a
simultaneous increase of keratin positive ductal cells when extensive progenitor cell
proliferation occurs (Fig 5B). Transient progenitors can give rise to the two major liver
cell types and are expected to express markers for both. To identify the hepatic
progenitor cells in vivo, we performed keratin and Hep Par-1 (hepatocyte marker) double
staining. In Pm liver sections, we found large clusters of as well as isolated progenitor
cells co-expressing both lineage markers (Fig 5C).

15
Figure 4. Deletion of Akt2 inhibits expansion of liver progenitor cells observed in
Pten null mice. A. H&E stains of liver sections from DDC treated mice demonstrate
progenitor cell accumulation at the portal vein (circled, left panel). Pten deletion (Pm)
causes a similar accumulation of progenitor cells in portal areas at 9 months of age
(circled, right panel). B. Left panel, qPCR analysis of hepatic progenitor markers
EpCAM (left), AFP (middle), and K-19 (right). Top, DDC treated vs. vehicle; Bottom,
Pm vs. Controls (Con). Right panel, Western analysis of AFP and Keratin protein levels
in Control and Pm mice. Tubulin is detected as loading control. C. Left panel, qPCR
analysis of Wnt 7a and 10a in DDC vs. vehicle treated mice. Middle panel, qPCR
analysis of Wnt 7a and 10a in Pm vs. Control (Con) mice. Right panel, analysis of β-
catenin protein levels in cells isolated from livers of Con and Pm mice. β-actin is
detected as loading control. D. Left panel, H&E staining shows multiple layers of
progenitor cells surrounding the ductal structures in the Pm liver (left). Progenitor cells
accumulation is limited in the Dm liver (middle). Expression of EpCAM, AFP, K-19,
and Wnt7a/10a are reduced in Dm vs. Pm livers (right). Data expressed as fold change
over Pm (set as 1). All values expressed as the mean + SEM. * indicates significant
difference between the two groups (p≤0.05). n=5.

16
Figure 4.

Hepatic progenitor cells are undergoing proliferation and differentiation

A. DDC Treated
50 µM
Pten null
B.
AFP
0
3
6
9
Veh DDC
*
K-19
Veh DDC
0
5
15
25
*
EpCAM
Fold Change
10
15
20
0
5
Veh DDC
*
0
2
4
6
Con Pm
*
Pm Con
0
20
40
60
*
Fold Change
Pm
0
10
20
30
Con
*
D.
Fold Change
K-19
EpCAM
AFP
0.2
0.4
0.6
0.8
1.0
*
0
*
*
*
*
Wnt 7a
Wnt 10a
Pm
Dm
Pten/Akt2 Double Mutant Pten null
25 µM
Con Pm
β-catenin
Actin
Keratins
Tubulin
AFP
Tubulin
Control Pten null
Wnt 10a
*
0
2
4
6
8
10
Veh DDC
0
20
40
60
80
Wnt 7a
Fold Change
*
Veh DDC
Fold Change
*
Con Pm
0
20
40
60
Wnt 7a
Con Pm
*
0
4
8
12
16
Wnt 10a
C.

17
Figure 5. Proliferation and differentiation of progenitor cells in the Pten null mice.
A. Immunohistochemical staining with Ki67 (brown stained nucleus) shows that mitotic
activity is predominantly found in the peri-ductal region (arrows) in the liver progenitor
cell niche (dotted circle) in Pm mice (middle). Arrow heads, ductal cells. Control livers
contain few proliferating hepatocytes (arrow in left panel), and low mitotic activity at the
portal triad (circled area, left panel). Right, quantification of ki67 positive cells. Values
expressed as the mean + SEM. * indicates values that are significantly different at
p≤0.05. n=5. B. Immunohistochemical staining with keratin (brown stain) revealed an
increase in ductal lineage cells associated with the expansion of hepatic progenitors. C.
Identification of bi-lineage progenitor cells (arrows) coexpressing hepatocyte (HepPar-1)
and cholangiocyte (keratin) markers in the Pm liver. Red, Hep-Par; Green, Keratin; Blue,
DAPI.

18
Figure 5.

A.
Control Pten null
dc
hc
lm
hc
12M 12M
B.
12M 12M
50 µM
C.
# of Ki67
+
cells/10 view fields
40
80
120
3M 6M 9M
0
*
*
Con
Mut
Age (Months)
20 µM
Keratin+ Hep Par-1 +DAPI
Pten null
10 µM
50 µM
Control Pten null

19
Deletion of Akt2 does not alter the mixed cell characteristics of the tumors
The tumors developed in Pm mice displayed mixed cell characteristics (Fig 6A).
Staining of tumor sections with HepPar-1 and keratin confirmed that the tumors are
composed of three major cell types: cholangiocytes, hepatocytes, and bi-lineage cells (Fig
6A, bottom panels). Histologic and immunohistochemical analysis of HepPar-1 and
keratin demonstrate that deletion of Akt2 did not alter the mixed cell characteristics of the
tumor in Dm mice (Fig 6B). In addition, we found cells coexpressing HepPar-1 and
keratin (Fig 6B, right panel), suggesting that bi-lineage progenitors are also the likely
sources of tumors in the Dm mice. In addition, expression of hepatic progenitor markers
AFP, K-19 and EpCAM from the two Dm mice that developed macroscopic tumors is
similar to Pm mice (data not shown), supporting the progenitor cell characteristics of the
tumors.

Figure 6. Deletion of Akt2 does not alter the mixed cell tumor phenotype in liver
specific Pten null mice. A. Top, H&E images of tumors developed in the Pten null mice
demonstrate compact trabecular growth patterns and pseudoglandular structures of HCC
(arrows, left panel); and tubular features of CC (arrows, right panel). Bottom,
Immunohistochemistry of liver tissue with HepPar-1 (red) and keratin (green) in Pm mice
identifies HCC and CC respectively. Blue, DAPI. B. H&E section of one of the two
tumors formed in the Pten/Akt2 double mutant liver (left panel). Immunochemical
staining confirms bilineage tumor development with both Hep Par-1 (red) and keratin
(green) (right two panels). Arrow points to bilineage cells expressing both markers.

20
Figure 6.

Galicia et al Figure 4
HCC
CC
HCC CC
100 µM
Keratin+ Hep Par-1 +DAPI
CC
HCC
100 µM
A. Pten null tumors
50 µM
B. Pten/Akt2 Double Mutant tumors
Keratin+ Hep Par-1 +DAPI
100 µM
100 µM

21
Chemical injury in Dm mice leads to activation of liver progenitors and
development of premalignant lesions
Our observations suggest that liver injury may be a crucial component for tumor
development in the Pten deletion model. To determine if liver injury is necessary for the
development of tumors, we treated the Dm mice with DDC to induce liver injury. Our
data demonstrates that deletion of Akt2 in the Dm model does not inhibit the ability of
hepatic progenitors to respond to liver injury. DDC treatment in 3 month-old Dm mice
induced massive expansion of hepatic progenitor cells and premalignant lesions (Fig 7A).
These lesions are morphologically similar to those observed in the premalignant 9-12-
month livers. Comparison of DDC treatment in Dm and Pm mice showed identical
morphology with focal expansion of progenitors and cholangiocytes. This data suggest
that Akt2 deletion does not inhibit the ability of progenitor cells to proliferate.
Expression of AFP, K-19 and EpCAM is also robustly induced by 7, 226 and 116 fold
respectively in Dm mice treated with DDC vs. vehicle (Fig 6B, top panel). Expression of
Wnt7a and 10a and receptor Fzd2 are all significantly elevated in DDC vs. vehicle
treated Dm mice (Fig 7B, bottom), correlating with the activation of hepatic progenitor
niche. These expression data support the notion that the ability of hepatic progenitors to
respond to injury is not inhibited by AKT2 loss.

22
Figure 7. Deletion of Akt2 in the Pten null liver does not hinder the proliferation of
progenitor cells in response to DDC treatment. A. Three months Pten null (Pm) and
Pten/Akt2 double mutant (Dm) mice were treated with DDC to induce the expansion of
progenitor cells. Both groups of mice responded to DDC treatment with progenitor cell
expansion phenotypes. Top panel, low magnification images showing the extent of liver
damage and progenitor cell expansion. Bottom panel, high magnification images show
progenitor cell morphology. B. Markers for progenitor cells, AFP, K-19 and EpCAM are
induced when Dm mice are treated with DDC vs. vehicle (Veh, top panel). The markers
for progenitor cell niche Wnt 7a and 10a and Fzd2, a receptor for Wnt are also induced in
the DDC treated Dm mice (bottom panel). Data presented as mean+SEM. * indicates
values that are significantly different from that of vehicle controls at p≤0.05. n=5.

23
Figure7.

A.
Pten/Akt2 Double Mutant: 3 Months
20 µM
Vehicle treated DDC treated
Pten null mice: 3 Months
DDC treated
50 µM
*
0
200
400
600
*
0
20
40
60
80
Veh DDC Veh DDC
*
0
1
2
3
4
5
6
Veh DDC
*
0
2
4
6
8
10
Veh DDC
*
0
50
100
150
200
250
300
Veh DDC
*
0
40
80
120
160
Veh DDC
Fold Change Fold Change
AFP K-19 EpCAM
Wnt 7a Wnt 10a Fzd 2
B.

24
Growth factors may mediate the activation of hepatic progenitor cells
To determine the potential molecular mechanism leading to the activation of
hepatic progenitors, we performed transcriptome profile analysis of 9 month- old Control
and Pm mice. This analysis revealed that PDGF, a mesenchymal growth factor is
robustly upregulated in the Pm compared to Control mice (Fig 8A). qPCR analysis
confirmed that PDGF expression is 50% higher in Pm mice vs. Control mice (Fig 8B).
Furthermore, we treated the liver progenitor cells that we established from the Pm mice
with PDGF. Our data showed that addition of PDGF stimulated the growth of these
progenitor cells (Fig 8C) and validate that PDGF is one of the factors that stimulate the
growth of progenitor cells in this model. PDGF has received significant attention
recently for its association with liver carcinogenesis (Maass, Thieringer et al. ; Stock,
Monga et al. 2007). Our findings suggest that PDGF may be one of the promoting
factors for the growth and expansion of liver progenitor cells. Other growth factors such
as IGF, HGF and EGF were not robustly induced by PTEN loss (Fig 8A).

25
Figure 8. PDGF is a potential growth factor mediating the progenitor cell expansion
in Pten null mice. A. Heatmap of microarray analysis of expression for IGF, PDGF,
EGF and HGF. Expression of PDGF is robustly induced in the Pten null (Pm) mice vs.
the Controls. Each square represents one mouse. Relative level of expression is
indicated with color intensity. Color scale (log scale) is provided as reference. B.
Quantitative PCR data confirming the upregulation of PDGF in the Pm liver. C. Growth
curve of PDGF and vehicle treated progenitor cell cultures. Solid circle, PDGF
(25ng/ml) treated culture; Open circle, vehicle treated culture. D. Schematic
representation of tumor progression in Pten null mice.

26
Figure 8.

A Con Pm
1024
512
256
128
64
IGF
PDGF
EGF
HGF
B C
Death of
hepatocytes
PTEN
X
In hepatocytes In progenitors
Expansion of
mutant
progenitors
Tumors composed
of both
differentiated liver
cells and
progenitors
Priming event
Initiation event
Fold Change
1
2
3
0
Con Mut
Vehicle
PDGFA
0
40
80
120
160
200
0 1 2 3
Cell Number (X10
3
)
Days in Culture
D

27
CHAPTER III

Proliferation of hepatic TICs are inhibited in vitro by Wn t/ β-Catenin inhibitor ICG-001

Wnt/ β-Catenin signaling has been shown to maintain pluripotency in embryonic stem
cells (Miyabayashi, Teo et al. 2007). More recently, the self-renewal properties of breast
and colon tumor initiating cells have been found to be regulated by the PTEN/Akt/β-
catenin signaling pathway (Vermeulen, De Sousa et al. ; Korkaya, Paulson et al. 2009). In
the liver, Wnt/β-Catenin signaling regulates the proliferative response of hepatic progenitor
cells under conditions of hepatotoxin mediated liver injury (Hu, Kurobe et al. 2007). In our
previous study, we found that hepatic progenitor cells in Pten mutant (Pm) mice begin
proliferating at six months of age. Proliferation of hepatic progenitors increases progressively
as Pm mice age and peaks at 12-15 months of age during liver cancer development.
Moreover, mRNA analysis also revealed that expression of Wnt ligands and receptors are
robustly induced during progenitor cell proliferation in Pten mutant mice. Pten null cell lines
developed from mutant mice also exhibit high levels of β-catenin compared to control cells
(Fig. 9), (Galicia, He et al.). Taken together these data suggest that activation of Wnt/β-
catenin pathway may similarly mediate the proliferation of hepatic tumor initiating cells in
our Pten mouse model as has been shown in other cancer systems. These findings make our
Pten deletion model ideal model to study targeting of the Wnt signaling pathway as a
therapeutic approach to prevent hepatic stem cell mediated carcinogenesis.
In this study, we will investigate the role of the Wnt/β-Catenin pathway in the activation
of hepatic progenitor cells in the Pten deletion liver cancer model using novel Wnt/β-catenin
inhibitor ICG-001. ICG-001 is a selective low weight inhibitor that antagonizes β-
Catenin/TCF-mediated transcription. ICG-001 binds specifically to transcriptional
coactivator CREB-binding protein (CBP) and not p300 (Emami, Nguyen et al. 2004).
28
Coactivator CBP/β-Catenin/T cell factor (TCF) mediated transcription has been reported as
critical for stem cell/progenitor cell proliferation (Teo, Ma et al. 2005). Our study
demonstrates that ICG-001 significantly inhibits proliferation of CD 133+ hepatic tumor
initiating cell line P0 (Ding, You et al.) in vitro.

Figure 9. Activation of Wnt signaling pathway in Pten mutant mice is induced
during hepatic progenitor cell proliferation. A. Expression of Wnt isoforms 7a and
10a (top and middle panel) are both elevated in mutant mice compared to controls.
Expression of Frizzled 2 (Fzd2, bottom panel), a Wnt ligand receptor is also significantly
higher at 12M in mutant mice compared to controls Values are expressed as the mean +
SEM. * indicates p≤0.05. n=5 for control and mutant cohorts. B. Top panel, image
showing accumulation and proliferation (brown nuclei) of progenitors. Progenitor cell
accumulation and proliferation are both induce in 12 M old mice vs. 6 M old mice ；
Bottom panel, b-catenin expression in Pten null progenitor cells lines vs. control cell line.

29
Figure 9.

Con Mut
β-catenin
Actin
dc
12M
6M
dc
Con
Mut
0
4
8
12
16
*
*
*
6M 9M 12M 15M
Months
0
20
40
60
6M 9M 12M 15M
Con
Mut
*
Months
Con
Mut
0
1
2
3
*
6M 9M 12M 15M
Months
Wnt 10a mRNA
Expression
Wnt 7a mRNA
Expression
Fzd 2 mRNA
Expression

30
RESULTS

ICG-001 inhibits self-renewal genes in hepatic cancer stem cell line P0

Inhibitor ICG-001 blocks CBP/β-Catenin interaction and disrupts a subset of
genes implicated in stem cell self-renewal including survivin, cyclin D1, oct 4, and
increases coactivator p300 dependant genes such as c-jun and fra (Fig. 10A),(Teo and
Kahn). A switch from β-Catenin/CBP to β-Catenin/p300 is associated with a change from
a gene expression profile associated with proliferation (cancer stem cells/progenitor cells)
to the initiation of a differentiative program (Emami, Nguyen et al. 2004; Teo, Ma et al.
2005; Miyabayashi, Teo et al. 2007). Treatment of tumor initiating cell line P0 with 40
µM ICG-001 significantly inhibited transcription of self-renewal genes cyclin D1(cyc
D1) and survivin (Fig. 10B). Cyclin D1 mRNA expression levels were reduced to 28%
and 9% compared to controls after 24 and 48 hours respectively. Treatment with ICG-001
caused a similar inhibition pattern for Survivin mRNA expression. Survivin message
levels were reduced to 12% and 4% relative to controls after 24 and 48 hour treatments
respectively. In addition, we analyzed Cyc D1 and Survivin protein expression in P0
cells after 24 hour treatment with ICG-001(Fig.10C). Cyc D1 protein expression was
serially reduced with 40 µM and 60 µM ICG treatments respectively. Survivin protein
expression was modestly reduced with 20 µM ICG treatment. A more significant
reduction of survivin protein expression was obtained with 40 µM ICG-001 treatment.
These data demonstrate that ICG-001 specifically inhibits CBP/β-Catenin dependent
transcription in hepatic TIC line P0.

31
Figure 10. ICG-001 inhibits mRNA and Protein expression of self-renewal genes. A.
Model of coactivator usage. Antagonizing the CBP/β-Catenin interaction leads to the
downregulation of genes that are critical for stem cell/progenitor cell maintenance and
proliferation (left side). B. Cyclin D1 and Survivin mRNA expression are serially
reduced after 24 and 48 hour treatment with 40 µM ICG-001. Values are expressed as the
mean + SEM. * indicates p≤0.05. n=3 for vehicle and inhibitor treatment groups C.
Western blot analysis of Cyclin D1 and Survivin protein after 24 hour treatment of 0-60
µM ICG-001. β-actin is used as a loading control.

32
Figure 10.

Relative mRNA Expression
1.5
1.0
0.5
0
0µM ICG-001 40µM ICG -001
D1 D1 D2
Cyclin D1
*
*
1.5
1.0
0.5
0
*
*
Relative mRNA Expression 0µM ICG-001 40µM ICG -001
D1 D1 D2
A.
B.
Cyclin D1
ICG-001 (µM)
20 0 60 40
Survivin
β-Actin
C.
Survivin

33
ICG-001 significantly inhibits proliferation of CD 133+ hepatic cancer stem cell line P0
in vitro
In our previous study we found that Wnt/β-catenin pathway is significantly
upregulated during the proliferation of hepatic tumor initiating cells in Pten mutant mice. To
test the effect of inhibition of the Wnt β-Catenin pathway in vitro we treated Pten
-/-
hepatic
cancer stem cell line P0
78
with ICG-001 or vehicle and analyzed cell proliferation.
Proliferation curve analysis demonstrates that ICG-001 significantly inhibits proliferation of
hepatic cancer stem cell line P0 (Fig 11A). P0 cells treated with vehicle nearly doubled in
cell number every 24 hours while P0 cells treated with 40µM ICG-001 remained arrested for
72 hrs. In addition to proliferation curve analysis we also examined the mRNA expression of
several hepatic progenitor markers including EpCAM, AFP, and K19 (Fig.11B). EpCAM
message levels were reduced to 36% and 38% compared to controls after 24h and 48h
treatment with 40µM ICG respectively. Such a significant decrease in message expression is
particularly noteworthy because EpCAM is directly activated by the Wnt/β-Catenin
signaling pathway (Yamashita, Budhu et al. 2007; Munz, Baeuerle et al. 2009). AFP
message was not affected after 24 hour treatment with ICG-001, but was modestly
decreased to 69% expression compared to controls after 48 hours of treatment. Finally,
K19 message was the most inhibited by ICG-001, demonstrating 77% and 90% reduction
relative to controls after 24 and 48hr treatment respectively. Taken together these data
demonstrate that ICG-001 is an effective inhibitor of hepatic tumor initiating cell
proliferation in vitro.

34
Figure 11. ICG-001 inhibits proliferation of Pten null/CD 133+ hepatic tumor initiating
cell line P0. A. Proliferation curve of hepatic cancer stem cell line P0 with after four days of
vehicle or 40µM ICG-001 inhibitor treatment. Black line represents vehicle treated group, red
line is inhibitor treatment group. B. Hepatic cancer stem cell line P0 demonstrates message
reduction of hepatic progenitor cell markers EpCAM, AFP, and K19 after 24 and 48 hour
treatments with 40µM ICG-001 inhibitor treatment. All values are expressed as the mean +
SEM. * indicates p≤0.05. n=3 for vehicle and inhibitor treatment groups.

35
Figure 11.

Days in Culture
Hepatic Progenitor Cells (P0)
0
1 2 3 4
250
200
150
100
50
Cell Number (X10
4
)
Vehicle
ICG-001
Relative mRNA Expression
40µM
ICG-001
K19
0µM
ICG-001
24H 24H 48H
1.5
0.5
0
1.0
*
*
0µM
ICG-001
40µM
ICG-001
24H 24H 48H
0.5
0
1.0
Relative mRNA Expression
*
AFP
1.5
0µM
ICG-001
40µM
ICG-001
24H 24H 48H
0.5
0
1.0
Relative mRNA Expression
*
*
EpCAM
1.5
A.
B.
*
*
*

36
CHAPTER IV

The role of LKB1 deletion in hepatic Pten mediated carcinogenesis

LKB1 is a serine/threonine protein kinase (STK11). Spontaneous germ line
mutations in the LKB1 gene are associated with the development of Peutz-Jeghers
syndrome (PJS). PJS is an autosomal dominant disorder in which patients develop benign
hamartomatous polyps in the gastrointestinal tract, as well as increased melanin
pigmentation of mucous membranes. In addition, patients with PJS possess a significant
risk of developing cancer in multiple tissues (Tomlinson and Houlston 1997; Hemminki
1999; Westerman, Entius et al. 1999). At the cellular level, LKB1 is identified as a tumor
suppressor for its inhibitory effect on proliferation. Overexpression of wild type LKB1
protein suppressed proliferation of Hela and G361 cancer cell lines by induction of G1
cell cycle arrest (Tiainen, Ylikorkala et al. 1999). Subsequent studies demonstrated that
LKB1 induces cell cycle inhibitor p21 in a p53-dependant manner (Tiainen, Vaahtomeri
et al. 2002).
The tumor suppressor properties of LKB1 have been further characterized by the
discovery that it is the upstream kinase responsible for phosphorylation and activation of
the AMP activated protein kinase (AMPK) (Shaw, Kosmatka et al. 2004). AMPK is
essentially a cellular fuel gage. It is activated when ATP levels are low, and AMP levels
are high, as is the case during conditions of cellular stress such as glucose depravation,
ischemia, and hypoxia. AMPK inhibits cellular proliferation by direct phosphorylation of
tuberin (TSC2) (Inoki, Zhu et al. 2003). TSC2 forms an inhibitory complex with tuberous
sclerosis complex 1 (TSC1), and together they negatively regulate the mammalian target
of rapamycin (mTOR) (van Slegtenhorst, Nellist et al. 1998). MTOR is a key regulator of
37
protein translation/synthesis and cell growth (Schmelzle and Hall 2000; Fingar, Salama et
al. 2002). By directly phosphorylating TSC2, AMPK essentially switches off mTOR
signaling, thereby solidifying the role of its upstream kinase LKB1 as a tumor suppressor
(Shaw, Bardeesy et al. 2004).
The Pten and LKB1 signaling pathways converge at the p53/p21 cell cycle
inhibitory axis. Studies have shown that AKT, the major signaling factor upregulated by
Pten deletion, can directly phosphorylate the cyclin dependant kinase inhibitor p21
(Rossig, Jadidi et al. 2001). Phosphorylation of p21 causes cytoplasmic accumulation,
thereby preventing access to its nuclear CDK targets (Liang and Slingerland 2003). The
net effect of PTEN or LKB1 loss is disregulation of cell cycle inhibition via p21, which
may in part explain the phenotypical similarities between Cowden syndrome and PJS
(Liaw, Marsh et al. 1997).
One of the consequential effects of Pten deletion is disregulation of the signaling
pathways downstream of LKB1. Therefore, in this study we examine the effect of hepatic
LKB1 deletion in liver Pten null mice (Pm). LKB1 loss causes increased lipogenic gene
expression (Shaw, Lamia et al. 2005). In addition, germline heterozygous LKB1
+/-
mice
develop hepatocellular carcinoma (HCC) at 11.5 months (Nakau, Miyoshi et al. 2002).
The study in chapter 2 revealed that most Pm mutant mice develop liver cancer by 12
months of age. We hypothesize that concomitant deletion of tumor suppressors Pten and
LKB1 (Dm) will cause a synergistic effect and accelerate the disease progression of liver
cancer. We demonstrate that Pten/LKB1 (Dm) mice begin to develop mixed lineage liver
tumors at 6M of age, nearly half the time for tumor onset observed for individual gene
deletions. In addition, the accelerated onset of liver cancer does not correlate with
38
increased liver injury, but rather the synergistic effect of Pten and LKB1 on cell cycle
disregulation via p21.
RESULTS
Phenotypic characteristics of LKB1
L/+
/Pten
-/-
double mutant mice (Dm)
The external phenotypic characteristics of LKB1
L/+
/Pten
-/-
(Dm), Pm and Control
(Con) mice are indistinguishable. All three groups display similar body weights from 3-
12 months of age (Fig.12A). Macroscopic examination revealed that livers of Dm mutant
mice display hepatomegaly and are pale in comparison to controls (Fig 12D), a feature
previously described in Pm mice (Stiles, Wang et al. 2004). Livers from Dm mice are
significantly heavier than controls from 3-12 months of age. Dm and Pm mouse livers are
comparable from 3-6 months of age. At nine months Pm mouse livers are twice the
weight of Dm livers. By 12 months of age the trend is reversed, Dm mouse livers are
approximately twice the weight of Pm livers (Fig.12B). The liver to body percent ratio
displays parallel trends to liver weight quantification, with the highest ratio being
displayed by Pm and Dm mice at 9 and 12 months, respectively (Fig12C).

39
Figure 12. Phenotypic characterization of LKB1 L/+/Pten -/- (DM) mice. A. 3-12
month body weight (g) in hepatic LKB1 L/+/Pten -/- (Dm), hepatic Pten -/- (Pm) and
Control mice are not statistically different. B. 3-12M Liver weights (g) in all three
experimental groups. Pm mice display the highest liver mass at 9M, Dm mice
demonstrate the highest liver weight at 12M. C. 3-12M liver to body percent ratio for all
three experimental cohorts. L/B ratios demonstrate parallel trends to liver weight
quantification. D. Dm mice exhibit liver hepatomegaly compared to control mice. All
values are expressed as the mean + SEM. * indicates p≤0.05 for Dm vs Con mice. *
indicates p≤0.05 for Dm vs Pm mice. n=6-9 for all three experimental groups.

40
Figure 12.
0
10
20
30
40
3M 6M
9M 12M
Body Weight
Dm
Pm
Con
Grams (g)
Age (months)
A.
D.
0
4
8
12
3M 6M 9M
12M
Liver Weight
*
*
*
*
*
Dm
Pm
Con
Grams (g)
Age (months)
B.
* *
*
*
Age (months)
0
0.05
0.15
0.25
0.35
L/B Ratio
3M 6M 9M 12M
* *
*
Percent (%)
Dm
Pm
Con
C.
*
*

41
Dm mice do not exhibit greater steatosis or liver injury than Pm mice
Our previous study demonstrated that Pm mice exhibit extensive fatty liver
development which is associated with liver injury and oval cell accumulation (Galicia,
He et al.). This study revealed that Lkb1/Pten Dm mice exhibit hepatic triglyceride (TG)
levels indistinguishable from Pm mice from 3-12 months (Fig. 13A). We also analyzed
serum ALT levels, a clinical assay for liver injury. Dm serum ALT levels increase
progressively from 3-12m of age compared to controls, but are not statistically different
from Pm mice ALT levels. These data demonstrate that hepatic steatosis and liver injury
is primarily driven by Pten mutation alone because concomitant heterozygous LKB1
deletion does not significantly increase hepatic TGs or serum ALT levels (Fig. 13B).
Histological examination of liver sections reveals oval cells at periductal regions in Dm
mice as early as 3 months of age. Dm mice continue to progressively accumulate oval
cells as shown by a representative 6M liver section (Fig. 13C). Pm mice display extensive
fatty liver accumulation from 3-6 months of age, and they demonstrate comparable
hepatic oval cell accumulation to Dm mice until 9-12 months of age (Galicia, He et al.).
Taken together these observations demonstrate that a key difference in this Dm mouse
model is that it exhibits an accelerated timeframe of disease progression, but not a
compounded effect on hepatic injury conditions.

42
Figure 13. Liver LKB1
L/+
/Pten
-/-
mice do not exhibit greater steatosis or liver injury
than mice with hepatic Pten deletion alone. A. 3-12M liver triglyceride (TG)
quantification for hepatic LKB1
L/+
/Pten
-/-
(Dm), Pten
-/-
(Pm) and Control mice. Hepatic
TGs in Dm and Pm mice are not statistically different. B. 3-12M serum ALT levels for all
three experimental groups. Dm ALT levels increase progressively with time, but are no
statistically different from Pm Alt levels. C. Representative H&E stains of liver sections
from all three experimental groups demonstrate progenitor cell accumulation at the portal
vein of DM mice at 3 months of age which increases significantly by 6M. Pm mice
exhibit increasing fatty liver development during the same 3-6M time frame.

43
Figure 13.

0
20
40
60
80
3M 6M 9M 12M
µg TG/µg Protein
HEPATIC TG Dm
Pm
Con
*
*
*
Age (months)
A.
*
*
ALT
0
100
200
300
3M 6M 9M 12M
Plasma ALT( U/L)
Dm
Pm
Con
*
*
*
*
*
B.
*
*
*
Age (months)
*
3M 6M
LP-DM
PM
CON
C.

44
Heterozygous deletion of LKB1 causes an earlier onset of bilineage tumors in Pm
mice

The tumors developed in Pm mice displayed mixed cell characteristics (Fig 5A).
Staining of tumor sections with HepPar-1 and keratin confirmed that the tumors are
composed of three major cell types: cholangiocytes, hepatocytes, and bi-lineage cells (Fig
5A, bottom panels). Histologic and immunohistochemical analysis of HepPar-1 and
keratin demonstrate that concomitant heterozygous deletion of LKB1 does not alter the
mixed cell characteristics of tumors in Dm mice. In addition, we found cells
coexpressing HepPar-1 and keratin (Fig. 14A), suggesting that bi-lineage progenitors are
also the likely sources of tumors in the Dm mice. Tumor analysis spectrum revealed that
Dm mice display an accelerated onset of liver cancer (Fig.14B, Table 1) Nineteen
percent of Dm mice developed macroscopic tumors from 3-6 months of age, compared to
0% in age matched Pm and control mice. From 9-12 months of age, 85%, 40% and 0% of
Dm, Pm and Con mice develop tumors, respectively. Furthermore, 100% of Dm mice
analyzed at 12 months of age had multiple gross macroscopic tumors (data not shown).
That tumor incidence was not reached in Pm mice until 13-15 months of age. These
observations indicate that hepatic Lkb1/Pten deletion in mice causes an earlier onset of
tumor development (6-9M), nearly half the time exhibited by liver Pten mutation alone
(12-15M).

45
Figure 14. Hepatic LKB1
L/+
/Pten
-/-
deletion in mice causes an accelerated onset of
tumor development. A. Top, Immunohistochemistry of liver tissue with HepPar-1 (red)
and keratin (green) in Dm mice identifies HCC and CC respectively. Blue, DAPI.
Bottom, H&E images of tumors developed in Dm mice demonstrate compact trabecular
growth patterns and pseudoglandular structures of HCC (left); and tubular features of CC
(right). C. Tumor spectrum of the three experimental mouse groups demonstrates an
earlier onset of cancer development in Dm mice.

46
Figure 14.

CC
Genotype
3-6M 6-9M
L
L/+
P
L/L
C
+
(DM) 3/16 11/13
L
+/+
P
L/L
C
+
(PM) 0/13 4/10
L
L/+
P
L/L
C
-
(Cont) 0/14 0/13
HCC
A.
B.
Keratin+ Hep Par-1 +DAPI
A.
Lkb/Pten Double Mutant tumors
Table 1. Tumor spectrum in LKB1/Pten (DM) and Pten mutants (PM)
CC

47
LKB1 deletion in Pten null MEFs causes reduction of cell cycle inhibitor p21
message

To explore a rationale for the accelerated onset of tumor development observed
in LKB1/Pten mutant mice, we created a genetic model in vitro using mouse embryonic
fibroblasts (MEFs). Wildtype (wt) and Pten null MEFs were transfected with short
hairpin LKB1 ( shLKB1) plasmids to study the effects of Pten/LKB1 gene deletions on
cell cycle regulator p21. Transfection efficiency of the shLKB1 plasmid was verified by
real time quantitative polymerase chain reaction (qPCR). LKB1 mRNA expression of wt
and Pten null Mefs was reduced 81% and 89% respectively, compared to control MEFS
transfected with sh scramble sequences (Fig. 15A) Next we examined the mRNA
expression of cell cycle inhibitor p21 on all four experimental groups; control, LKB1 null,
Pten null, and LKB1/Pten null MEFs. LKB1 and Pten deletion alone caused a 35% and
45% reduction in p21 mRNA levels respectively. LKB1/Pten double mutant MEFs on the
other hand displayed a 75% reduction of p21 message (Fig.15B). These data indicate that
the accelerated onset of tumor development in LKB1/Pten double mutant mice may be
mediated by synergistic effects on downregulation of cell cycle inhibitor p21.

48

0
0.5
1.0
1.5
WT LKB
-/-
PTEN
-/-
PTEN/LKB1
-/-
Relative mRNA Expression
LKB1
*
*
Relative mRNA Expression
WT LKB
-/-
PTEN
-/-
PTEN/LKB1
-/-
0
0.5
1.0
1.5
p21
*
*

Figure 15. Pten/LKB1
-/-
double mutant MEFs demonstrate reduced p21 expression.
A. LKB1 mRNA expression of wt MEFs trasfected with shscramble, and shLKB1
plasmids, Pten null MEFs transfected with shscramble and shLKB1 plasmids. B. p21
mRNA expression is reduced in LKB1 and Pten null MEFs. Pten/LKB1 null MEFs
demonstrate a 75% reduction in p21 message. All values are expressed as the mean +
SEM. * indicates p≤0.05. n=3 for vehicle and inhibitor treatment groups.

49
CHAPTER V

Discussion

For my primary study (Chapter II), we investigated AKT2, a major downstream
effector molecule of PTEN regulated pathways and its role in the activation of TICs.
Using in vivo markers identified in human liver cancer (EpCAM, AFP, and K-19)
(Yamashita, Forgues et al. 2008; Yamashita, Ji et al. 2009) and morphological analysis
(Preisegger, Factor et al. 1999; Roskams, Yang et al. 2003; Roskams, Libbrecht et al.
2003; Roskams 2006), we analyzed the accumulation and activation of liver progenitor
cells. Our analyses demonstrate that the activation of TICs and development of liver
tumors in our model system is a multi-stage process that requires two critical events (Fig
8D). The first is transformation of progenitor cells after deletion of Pten, an event that is
NOT inhibited by AKT2 loss in our model. This primary transformation provides a
growth advantage for the mutant progenitors and primes them for proliferation when the
proper signals are present. The second event is chronic injury and impaired hepatocyte
regeneration, which is due to liver steatohepatitis in the Pten null model. This second
event is inhibited by AKT2 loss. This inflammation and impaired hepatocyte replication
response provides the impetus for progenitor cells to proliferate.
Our analysis shows that PTEN may have distinct functions in hepatocytes vs.
liver progenitors. In hepatocytes, deletion of Pten leads to lipid accumulation and cell
death. In humans, hepatocyte cell death is a morphological and pathological feature of
non-alcoholic steatohepatitis (Malhi and Gores 2008). It is conceivable that the anti-
apoptosis effect of PTEN loss in hepatocytes is overshadowed by the toxicity effects of
lipid accumulation resulting in hepatocyte death as a net effect. Experimentally, free
50
fatty acids have been shown to induce death of multiple cell types including hepatocytes
(Malhi, Barreyro et al. 2007). In our model, lipid accumulation is the immediate and
primary effect of PTEN loss (Stiles, Wang et al. 2004). AKT2 is the major regulatory
molecule for hepatic lipogenesis when Pten is deleted (He, Hou et al.). AKT2 loss
inhibited lipogenesis and cell death, suggesting that lipid toxicity is the primary cause of
hepatocyte death in the Pm mice. Among the AKT kinases, AKT2 is characterized for its
role in metabolic regulation. Genetic manipulation of AKT2 by itself has failed to show
any effect on cell growth and survival (Cho, Mu et al. 2001). However, upregulation of
AKT2 is associated with human HCC suggesting that AKT2 may have a pro-growth and
pro-survival role in tumor transformation (Xu, Sakon et al. 2004). Our analysis showed
that in a tumor model where PI3K/AKT signaling is upregulated by Pten loss, Akt2
deletion does not induce any cell death. On the contrary, we observed reversion of fatty
liver, recovery of injury, and inhibition of apoptosis determined by TUNEL analysis.
Thus, the primary function of AKT2 in this context of tumor transformation is still not
pro-survival or pro-growth but rather metabolic regulation.
In liver progenitor cells, PTEN loss resulted in induction of proliferation as
predicted. However, this effect was preceded by chronic liver injury. In Pm mice, this
condition is evident at 9-12 months of age after a period of massive lipid accumulation
and severe liver damage. Chemical injury in young mice (3 months of age) with
hepatotoxin DDC induces expansion of progenitor cell populations and the development
of premalignant lesions. This observation suggests that progenitor cells in the Pm mice
are primed for proliferation and that their proliferation is initiated only after injury is
induced either by lipid toxicity in older Pm mice or DDC treatment in young mice.
51
Similarly, DDC treatment also led to expansion of progenitor cells in the Dm mice.
Indeed, the phenotypes of the DDC treated Pm and Dm mice are identical, suggesting
that pro-growth signals downstream of PTEN in progenitors are not compromised by
AKT2 loss. These observations are consistent with loss of function studies of AKT2
versus other AKT kinases (Cho, Mu et al. 2001; Cho, Thorvaldsen et al. 2001; Tuttle,
Gill et al. 2001; Easton, Cho et al. 2005). Thus, the fact that Akt2 deletion attenuated
tumor growth is not due to inhibition of cell growth/survival but rather its effect on liver
injury, a key element for the activation of the primed progenitor cells.
As hypothesized by Sell and others, liver injury creates a niche for the activation
of liver progenitor cells (Sell 1998). In DDC induced injury models, Wnt7a and 10a are
upregulated and may contribute to the activation of hepatic progenitor cells (Hu, Kurobe
et al. 2007). We demonstrate here that these Wnt ligands are also induced in the Pm liver.
Wnt/ β-catenin is a signaling pathway associated with maintenance of progenitor cell
niche. It is upregulated when liver progenitor cell marker (keratin 7) is induced (Spee,
Carpino et al.). Topical expression of constitutively active β-catenin, the core molecule in
Wnt signaling, promotes the expansion of OV6 positive liver progenitor cells (Yang, Yan
et al. 2008). Thus, Wnt/ β-catenin signaling likely regulates the liver progenitor cell
compartment in our Pm model.
In addition, our microarray analysis identified PDGF as a potential growth factor
that may induce progenitor cell proliferation. Expression of PDGF receptor is associated
with HCC in humans (Stock, Monga et al. 2007). Furthermore, expression of PDGF in
the liver accelerated chemical carcinogen induced tumor growth (Maass, Thieringer et
al.). Upregulation of PDGF in the Pm mice likely alters the progenitor cell niche and
52
allows the proliferation of hepatic progenitor cells and their subsequent progression to
liver cancer.
My primary study revealed that TICs adapt several strategies to promote their
malignant activation. The first is that TICs take advantage of an injured cellular
environment. The primary effect of hepatic PTEN loss in mice is the development of
severe fatty liver. Our findings demonstrate that in Pm mice, fatty liver development is
associated with an increase in oxidative stress and chronic liver injury. This toxic
environment causes hepatocyte apoptosis. Hepatocytes are the primary replicative cell
type in the liver. But in the face of significant hepatocyte cell death, TICs can step in and
proliferate. Aberrant proliferation of these TICs is most likely the source for the bilineage
tumors observed in Pm mice. It remains to be studied if treatment with antioxidants such
as N-Acetyl Cysteine (Baumgardner, Shankar et al. 2008) can “heal” the injured niche,
and maintain healthy hepatocytes, thus preventing activation of TICs. One potential
pitfall is that traditional antioxidant therapies may not be tolerated by livers of Pm mice,
since hepatic injury is evident as early one month of age.
A second strategy used by TICs in our mouse model is upregulation of the Wnt/β-
Catenin pathway. Previous studies report that Wnt/β-Catenin signaling regulates the
proliferative response of hepatic progenitor cells under conditions of liver injury (Hu, Kurobe
et al. 2007). Our primary study revealed that upregulation of Wnt ligands and Wnt receptor
expression is correlated TIC proliferation in Pten mutant mice. These data suggest that
activation of Wnt/β-catenin pathway may similarly mediate the proliferation of hepatic
progenitor cells in our Pten mouse model as it does in liver injury models. Based on these
findings, the focus of our second study (chapter III) is to target the Wnt/β-catenin pathway
53
to prevent tumor formation in Pm mice. Our results demonstrate that small molecule
ICG-001 significantly inhibits proliferation of hepatic tumor initiating cell line P0 in
vitro. ICG-001 disrupts the protein interaction of β-catenin and coactivator CBP. This
protein complex has been shown to specifically mediate transcription of genes involved
in stem cell/progenitor cell proliferation.
Several other preclinical agents have been developed which specifically target the
Wnt pathway. These include inhibitors of Wnt production, monoclonal antibodies against
Wnt ligands and Frizzled receptors, compounds that transport β-catenin out of the nucleus,
among others (Takebe, Harris et al.).

ICG-001 is a more promising candidate for cancer
clinical trials because it is downstream of receptor/ligand activation and nuclear
transportation, which can be evaded all together by signaling pathways such as
PI3K/AKT. AKT has been shown to directly phosphorylate GSK3β leading to β-catenin
stabilization. Furthermore AKT can directly phosphorylate β-catenin on serine 552 which
facilitates nuclear translocation (Korkaya and Wicha). Inhibiting transcription of self-
renewal genes confers a direct approach for targeting tumor initiating cells. The major
caveat of an ICG-001 therapeutic approach is that to compensate for Wnt/β-Catenin
pathway inhibition other signaling pathways may become activated to support TIC
proliferation such as hedgehog, or notch (Takebe, Harris et al.). Further studies in the
Pten mutant model need to address whether treatment with ICG-001 in vivo causes
compensatory upregulation of hedgehog or notch signaling pathways to support TIC
mediated tumorigenesis. Another major concern is that patients with chronic liver injury
may not tolerate any drug treatment, since the liver is the key organ involved in drug
54
detoxification. Further studies need to address whether liver cancer patients can be safely
approved for clinical trials using ICG compounds.
The study in chapter IV revealed that hepatic monoallelic LKB1 deletion in Pten
conditional knockout mice causes an accelerated onset of tumor development. Pten
deletion mediated Akt activation has been shown to cause cytoplasmic accumulation of
p21, thereby preventing access to its nuclear CDK targets. Likewise, subsequent studies
have demonstrated that LKB1 deletion causes reduced transcription of cell cycle inhibitor
p21 in a p53-dependant manner. We hypothesize concomitant deletion of these two
tumor suppressors may cause a synergistic effect on p21 downregulation. And thus a
potential third strategy employed by TICs is evasion of normal cell cycle check points to
support aggressive tumor development. Further studies are required to determine the
effect of hepatic LKB1/Pten deletion on other cell cycle inhibitors such as p21, and cell
cycle inducers such as cyclin D1. We suspect that additive effects on these other cell
cycle mediators may also contribute to the accelerated onset of tumor development
observed in this model.
Overall, my doctoral studies revealed three strategies employed by Pten deletion
induced TICs to support their malignant progression towards liver cancer. It is
remarkable a simple hepatic Pten deletion has so many extrinsic and intrinsic effects on
the liver’s cellular environment. This is likely only the tip of the iceberg, we suspect that
there are a dozens more yet to be discovered. One important consideration is that
therapies addressing single gene mutations may be unsuccessful, based on the numerous
55
signaling pathways affected by Pten deletion. Cancer therapies need to address the net
effects imposed on a cellular environment by a genetic mutation to achieve more
effective tumor eradication.

56
CHAPTER VI
Materials and Methods
Animals. Targeted deletion of Pten was reported previously (Stiles, Wang et al. 2004).
Pten/Akt2 double mutant (Pten
loxP/loxP
; Akt2
-/-
; Alb-Cre
+
) (Dm) were generated by
crossing the Pten
loxP/loxP
; Alb-Cre
+
(Pm) with the Akt2
-/-
mice (Bae, Cho et al. 2003).
Control animals are Pten
loxP/loxP
; Albumin (Alb)-Cre
-
(chapter II). LKB1
+/+
;Pten
loxP/loxP
;
Alb-Cre
+
(Pm) mice were crossed with LKB1
loxP/loxP
; Pten
+/+
mice to obtain LKB1
loxp/+
;Pten
loxp/+
mice (F2). The F2 cohort was crossed with each other to achieve LKB1
loxp/+
; Pten
loxP/loxP
;Alb-Cre
+
(Dm) mice. Control animals for this study are LKB1
loxp/+
;
Pten
loxP/loxP
;Alb-Cre
-
(chapter IV).Blood samples are collected via cardiac puncture prior
to tissue collection. 3,5-dietoxycarbonyl-1,4 dihydrocollidine (DDC, 0.1% w/w diet)
treatment was performed in 3-month old mice for 5 weeks (chapter II). Male animals of
C57BL/6 and J129svj background were used for all experiments. Experiments were
conducted according to IACUC guidelines of the University of Southern California.

Cell lines. Hepatic progenitor cell line P0 was established and cultured from Pm liver as
described.

For growth curve analysis, (chapter II) cells were seeded at 20K cells per well,
and allowed to attach overnight. Cells were then serum starved overnight before addition
of 25 ng/ml platelet derived growth factor (PDGFA) (Invitrogen, Camarillo, CA). Cell
growth was quantified by counting the number of cells in vehicle vs. PDGFA treated
cultures. For growth curve analysis, (chapter III) P0 cells were seeded at 75K per well
and allowed to attach overnight. Cells were then treated with progenitor cell media (Veh)
or with progenitor media supplemented with 40 μM ICG-001 (Kahn Lab) for 72 hrs.
57
Inhibitor treatment was replenished every 48 hrs. Wt and Pten null mouse embryonic
fibroblasts (MEFs) were transfected with pSilencer 2.1-U6 puro plasmid containing
annealed hairpin siLKB1 forward 5’-GATCCGTATCTACAAGCTCTTTGAGTTCA
AGAGACTCAAAGAGCTTGTAGATATTTTTTGGAAA-3’ and siLKB1 reverse 3’-
AGCTTTTCCAAAAAATATCTACAAGCTCTTTGAGTCTCTTGAACTCAAAGAGC
TTGTAGATACG-5’ primers, according to manufacturer’s recommendations (Bioland,
La Palma, CA), (chapter IV).

Immunohistochemistry. Liver sections were stained with hematoxylin and eosin (H&E)
for morphology analysis, anti-human trans-4-hydroxy-2-nonenal (4-HNE, Cosmo Bio
Co. Ltd. Tokyo, Japan) for lipid peroxidation product, and hepatocyte paraffin (Hep-
Par1) & keratin (DakoCytomation, Denmark A/S) to identify hepatocytes and
cholangiocytes respectively. Apoptosis was determined using TUNEL staining (Roche
Diagnostics, Manheim Germany). Cell proliferation was evaluated by Ki67 staining
(Thermo Fisher Scientific,Fremont,CA). Six sections per group were stained.

Serum alanine aminotransferase (ALT) and liver hydrogen peroxide (H
2
O
2
)
quantification. Serum ALT was determined using ALT Reagent (Raichem, San Diego,
CA). Liver H
2
O
2
was assayed using Amplex Red Hydrogen Peroxide kit (Molecular
Probes, Eugene, OR) (Horie, Suzuki et al. 2004). H
2
O
2
levels were normalized by
protein concentration.
Quantitative PCR. Total RNA (2 µg) from liver tissues was extracted with Trizol
(Invitrogen) and used for first strand synthesis of cDNA (Promega). Maxima SYBR
58
Green qPCR Master Mix (Fermentas, Glen Burnie, MD) was used for the qPCR reaction
and quantification was determined using the ∆ ∆Ct method. Primers used are: AFP,
EpCAM, K-19, Wnt7a and 10a, Fizzled receptor 2 (Fzd2), glutathione peroxidase (GPx),
glutathione-S-transferase (GST), PDGFA and GAPDH (Table 2), (Foretz, Ancellin et al.
2005; Chaudhari, Jayaraj et al. 2009). For qprc results obtained from P0 cell lines
(chapter III), total RNA was extracted from 6-well plates using Trizol (Invitrogen) after a
48 hour incubation with vehicle or 40 μM ICG-001 treatment (Kahn Lab). Followed by
production of first strand synthesis of cDNA (Promega) Additional primers used are
cyclin D1 (F:TCCGCAAGCATGCACAGA & R:GGTGGGTTGGAAATGAACTTCA),
survivin (F:GTACCTCAAGAACTACC & R:GTCATCGGGTTCCCAGCCTTCC), and
p21 (F:TGAGCGCATCGCAATCAC & R:TGAGCGCATCGCAATCAC).

Protein Electrophoresis Protein lysates (40 µg) were loaded for each sample for
electrophoresis using polyacrylamide gels. Membranes were probed with antibodies for
keratin (Millipore, Billerica, MA), AFP (Epitomics, Burlingame, CA), and β-catenin
(Sigma-Alderich, St. Louis, MO). Tubulin and β-actin (Sigma) protein expression are
used as loading controls.

Microarray RNA isolated from 9 month-old mice was analyzed using the Illumina
Mouse gene chip (Illumina, San Diego, CA). Data analysis was conducted with 2-fold or
greater change in expression considered to be different.

59
Statistics Data were subjected to Student’s t tests for two sample comparisons. In cases
of more than 2 groups, multivariate ANOVA were used to determine the statistical
differences followed by pairwise comparison using Fischer’s LSD test. P≤0.05 is
considered to be statistically significant. Data are presented as mean+SEM.

60

Gene Primer Sequence
Amplicon size
(bp)
Ck19 Fwd CCGGACCCTCCCGAGATTA
179

Rev CTCCACGCTCAGACGCAAG

EpCAM Fwd AGGGGCGATCCAGAACAACG
223
Rev ATGGTCGTAGGGGCTTTCTC

AFP Fwd ATCGACCTCACCGGGAAGAT
143
Rev GAGTTCACAGGGCTTGCTTCA

Wnt10a Fwd GACTCCACAACAACCGTGTG
133
Rev CCTACTGTGCGGAACTCAGG

Wnt7a Fwd CGACTGTGGCTGCGACAAG
205
Rev CTTCATGTTCTCCTCCAGGATCTTC

GPx Fwd ACATTCCCAGTCATTCTACC
151
Rev TTCAAGCAGGCAGATACG

GST Fwd TCTGCCTATATGAAGACC
174
Rev AGAGAAGTTACTGGAAGC

PDGFA Fwd GTCCAGGTGAGGTTAGAGG
210
Rev CACGGAGGAGAACAAAGAC

GAPDH Fwd GTCGGTGTGAACGGATTTGG
278
Rev GACTCCACGACATACTCAGC

Table 2. Real time qPCR primers used in studies.
61
BIBLIOGRAPHY

Ali, I. U., L. M. Schriml, et al. (1999). "Mutational spectra of PTEN/MMAC1 gene: a
tumor suppressor with lipid phosphatase activity." J Natl Cancer Inst 91(22): 1922-1932.

Alison, M. R. (2005). "Liver stem cells: implications for hepatocarcinogenesis." Stem
Cell Rev 1(3): 253-260.

Bae, J. J., J. W. Rho, et al. (2007). "Loss of heterozygosity on chromosome 10q23 and
mutation of the phosphatase and tensin homolog deleted from chromosome 10 tumor
suppressor gene in Korean hepatocellular carcinoma patients." Oncol Rep 18(4): 1007-
1013.

Bae, S. S., H. Cho, et al. (2003). "Isoform-specific regulation of insulin-dependent
glucose uptake by Akt/protein kinase B." J Biol Chem 278(49): 49530-49536.

Baumgardner, J. N., K. Shankar, et al. (2008). "N-acetylcysteine attenuates progression
of liver pathology in a rat model of nonalcoholic steatohepatitis." J Nutr 138(10): 1872-
1879.

Bruix J, B. L., Sala M et al. Focus on hepatocellular carcinoma. Cancer Cell 2004; 5:
215-219. Links

Chaudhari, M., R. Jayaraj, et al. (2009). "Oxidative damage and gene expression profile
of antioxidant enzymes after T-2 toxin exposure in mice." J Biochem Mol Toxicol 23(3):
212-221.

Cho, H., J. Mu, et al. (2001). "Insulin resistance and a diabetes mellitus-like syndrome in
mice lacking the protein kinase Akt2 (PKB beta)." Science 292(5522): 1728-1731.

Cho, H., J. L. Thorvaldsen, et al. (2001). "Akt1/PKBalpha is required for normal growth
but dispensable for maintenance of glucose homeostasis in mice." J Biol Chem 276(42):
38349-38352.

Cohen, J. I., S. Roychowdhury, et al. (2009). "Exogenous thioredoxin prevents ethanol-
induced oxidative damage and apoptosis in mouse liver." Hepatology 49(5): 1709-1717.

Di Cristofano, A., B. Pesce, et al. (1998). "Pten is essential for embryonic development
and tumour suppression." Nat Genet 19(4): 348-355.

Ding, W., H. You, et al. "Epithelial-to-mesenchymal transition of murine liver tumor
cells promotes invasion." Hepatology 52(3): 945-953.

Dong-Dong, L., Z. Xi-Ran, et al. (2003). "Expression and significance of new tumor
suppressor gene PTEN in primary liver cancer.[erratum appears in J Cell Mol Med. 2003
62
Apr-Jun;7(2):1 p proceeding table of contents]." Journal of Cellular & Molecular
Medicine 7(1): 67-71.

Downes, C. P., S. Ross, et al. (2007). "Stimulation of PI 3-kinase signaling via inhibition
of the tumor suppressor phosphatase, PTEN." Adv Enzyme Regul 47: 184-194.

Dunsford, H. A., C. Karnasuta, et al. (1989). "Different lineages of chemically induced
hepatocellular carcinoma in rats defined by monoclonal antibodies." Cancer Res 49(17):
4894-4900.

Easton, R. M., H. Cho, et al. (2005). "Role for Akt3/protein kinase Bgamma in
attainment of normal brain size." Mol Cell Biol 25(5): 1869-1878.

Emami, K. H., C. Nguyen, et al. (2004). "A small molecule inhibitor of beta-
catenin/CREB-binding protein transcription [corrected]." Proc Natl Acad Sci U S A
101(34): 12682-12687.

Fingar, D. C., S. Salama, et al. (2002). "Mammalian cell size is controlled by mTOR and
its downstream targets S6K1 and 4EBP1/eIF4E." Genes Dev 16(12): 1472-1487.

Foretz, M., N. Ancellin, et al. (2005). "Short-term overexpression of a constitutively
active form of AMP-activated protein kinase in the liver leads to mild hypoglycemia and
fatty liver." Diabetes 54(5): 1331-1339.

Galicia, V. A., L. He, et al. "Expansion of hepatic tumor progenitor cells in Pten-null
mice requires liver injury and is reversed by loss of AKT2." Gastroenterology 139(6):
2170-2182.

Germain, L., R. Goyette, et al. (1985). "Differential cytokeratin and alpha-fetoprotein
expression in morphologically distinct epithelial cells emerging at the early stage of rat
hepatocarcinogenesis." Cancer Res 45(2): 673-681.

He, L., X. Hou, et al. "The critical role of AKT2 in hepatic steatosis induced by PTEN
loss." Am J Pathol 176(5): 2302-2308.

Hemminki, A. (1999). "The molecular basis and clinical aspects of Peutz-Jeghers
syndrome." Cell Mol Life Sci 55(5): 735-750.

Horie, Y., A. Suzuki, et al. (2004). "Hepatocyte-specific Pten deficiency results in
steatohepatitis and hepatocellular carcinomas." J Clin Invest 113(12): 1774-1783.

Hu, M., M. Kurobe, et al. (2007). "Wnt/beta-catenin signaling in murine hepatic transit
amplifying progenitor cells." Gastroenterology 133(5): 1579-1591.

63
Hu, T. H., C. C. Huang, et al. (2003). "Expression and prognostic role of tumor
suppressor gene PTEN/MMAC1/TEP1 in hepatocellular carcinoma." Cancer 97(8):
1929-1940.

Inoki, K., T. Zhu, et al. (2003). "TSC2 mediates cellular energy response to control cell
growth and survival." Cell 115(5): 577-590.

Itoh, T., Y. Kamiya, et al. (2009). "Inducible expression of Wnt genes during adult
hepatic stem/progenitor cell response." FEBS Lett 583(4): 777-781.

Kawamura, N., H. Nagai, et al. (1999). "PTEN/MMAC1 mutations in hepatocellular
carcinomas: somatic inactivation of both alleles in tumors." Jpn J Cancer Res 90(4): 413-
418.

Korkaya, H., A. Paulson, et al. (2009). "Regulation of mammary stem/progenitor cells by
PTEN/Akt/beta-catenin signaling." PLoS Biol 7(6): e1000121.

Korkaya, H. and M. S. Wicha "Cancer stem cells: nature versus nurture." Nat Cell Biol
12(5): 419-421.

Leavens, K. F., R. M. Easton, et al. (2009). "Akt2 is required for hepatic lipid
accumulation in models of insulin resistance." Cell Metab 10(5): 405-418.

Lee, J. S., J. Heo, et al. (2006). "A novel prognostic subtype of human hepatocellular
carcinoma derived from hepatic progenitor cells." Nat Med 12(4): 410-416.

Liang, J. and J. M. Slingerland (2003). "Multiple roles of the PI3K/PKB (Akt) pathway in
cell cycle progression." Cell Cycle 2(4): 339-345.

Liaw, D., D. J. Marsh, et al. (1997). "Germline mutations of the PTEN gene in Cowden
disease, an inherited breast and thyroid cancer syndrome." Nat Genet 16(1): 64-67.

Ma, S., K. W. Chan, et al. (2007). "Identification and characterization of tumorigenic
liver cancer stem/progenitor cells." Gastroenterology 132(7): 2542-2556.

Maass, T., F. R. Thieringer, et al. "Liver specific overexpression of platelet-derived
growth factor-B accelerates liver cancer development in chemically induced liver
carcinogenesis." Int J Cancer.

Malhi, H., F. J. Barreyro, et al. (2007). "Free fatty acids sensitise hepatocytes to TRAIL
mediated cytotoxicity." Gut 56(8): 1124-1131.

Malhi, H. and G. J. Gores (2008). "Molecular mechanisms of lipotoxicity in nonalcoholic
fatty liver disease." Semin Liver Dis 28(4): 360-369.

64
Manning, B. D. and L. C. Cantley (2007). "AKT/PKB signaling: navigating
downstream." Cell 129(7): 1261-1274.

Mishra, L., T. Banker, et al. (2009). "Liver stem cells and hepatocellular carcinoma."
Hepatology 49(1): 318-329.

Miyabayashi, T., J. L. Teo, et al. (2007). "Wnt/beta-catenin/CBP signaling maintains
long-term murine embryonic stem cell pluripotency." Proc Natl Acad Sci U S A 104(13):
5668-5673.

Munz, M., P. A. Baeuerle, et al. (2009). "The emerging role of EpCAM in cancer and
stem cell signaling." Cancer Res 69(14): 5627-5629.

Nakau, M., H. Miyoshi, et al. (2002). "Hepatocellular carcinoma caused by loss of
heterozygosity in Lkb1 gene knockout mice." Cancer Res 62(16): 4549-4553.

Petersen, B. E., J. P. Goff, et al. (1998). "Hepatic oval cells express the hematopoietic
stem cell marker Thy-1 in the rat." Hepatology 27(2): 433-445.

Podsypanina, K., L. H. Ellenson, et al. (1999). "Mutation of Pten/Mmac1 in mice causes
neoplasia in multiple organ systems." Proc Natl Acad Sci U S A 96(4): 1563-1568.

Preisegger, K. H., V. M. Factor, et al. (1999). "Atypical ductular proliferation and its
inhibition by transforming growth factor beta1 in the 3,5-diethoxycarbonyl-1,4-
dihydrocollidine mouse model for chronic alcoholic liver disease." Lab Invest 79(2): 103-
109.

Roskams, T. (2006). "Liver stem cells and their implication in hepatocellular and
cholangiocarcinoma." Oncogene 25(27): 3818-3822.

Roskams, T., S. Q. Yang, et al. (2003). "Oxidative stress and oval cell accumulation in
mice and humans with alcoholic and nonalcoholic fatty liver disease." Am J Pathol
163(4): 1301-1311.

Roskams, T. A., L. Libbrecht, et al. (2003). "Progenitor cells in diseased human liver."
Semin Liver Dis 23(4): 385-396.

Rossig, L., A. S. Jadidi, et al. (2001). "Akt-dependent phosphorylation of p21(Cip1)
regulates PCNA binding and proliferation of endothelial cells." Mol Cell Biol 21(16):
5644-5657.

Rountree, C. B., L. Barsky, et al. (2007). "A CD133-expressing murine liver oval cell
population with bilineage potential." Stem Cells 25(10): 2419-2429.

65
Rountree, C. B., W. Ding, et al. (2009). "Expansion of CD133-expressing liver cancer
stem cells in liver-specific phosphatase and tensin homolog deleted on chromosome 10-
deleted mice." Stem Cells 27(2): 290-299.

Salmena, L., A. Carracedo, et al. (2008). "Tenets of PTEN tumor suppression." Cell
133(3): 403-414.

Schmelzer, E., E. Wauthier, et al. (2006). "The phenotypes of pluripotent human hepatic
progenitors." Stem Cells 24(8): 1852-1858.

Schmelzle, T. and M. N. Hall (2000). "TOR, a central controller of cell growth." Cell
103(2): 253-262.

Sell, S. (1998). "Comparison of liver progenitor cells in human atypical ductular
reactions with those seen in experimental models of liver injury." Hepatology 27(2): 317-
331.

Shaw, R. J., N. Bardeesy, et al. (2004). "The LKB1 tumor suppressor negatively regulates
mTOR signaling." Cancer Cell 6(1): 91-99.

Shaw, R. J., M. Kosmatka, et al. (2004). "The tumor suppressor LKB1 kinase directly
activates AMP-activated kinase and regulates apoptosis in response to energy stress."
Proc Natl Acad Sci U S A 101(10): 3329-3335.

Shaw, R. J., K. A. Lamia, et al. (2005). "The kinase LKB1 mediates glucose homeostasis
in liver and therapeutic effects of metformin." Science 310(5754): 1642-1646.

Spee, B., G. Carpino, et al. "Characterisation of the liver progenitor cell niche in liver
diseases: potential involvement of Wnt and Notch signalling." Gut 59(2): 247-257.

Stiles, B., Y. Wang, et al. (2004). "Liver-specific deletion of negative regulator Pten
results in fatty liver and insulin hypersensitivity [corrected]." Proc Natl Acad Sci U S A
101(7): 2082-2087.

Stock, P., D. Monga, et al. (2007). "Platelet-derived growth factor receptor-alpha: a novel
therapeutic target in human hepatocellular cancer." Mol Cancer Ther 6(7): 1932-1941.

Suzuki, A., J. L. de la Pompa, et al. (1998). "High cancer susceptibility and embryonic
lethality associated with mutation of the PTEN tumor suppressor gene in mice." Curr
Biol 8(21): 1169-1178.

Takebe, N., P. J. Harris, et al. "Targeting cancer stem cells by inhibiting Wnt, Notch, and
Hedgehog pathways." Nat Rev Clin Oncol 8(2): 97-106.

66
Teo, J. L. and M. Kahn "The Wnt signaling pathway in cellular proliferation and
differentiation: A tale of two coactivators." Adv Drug Deliv Rev 62(12): 1149-1155.

Teo, J. L., H. Ma, et al. (2005). "Specific inhibition of CBP/beta-catenin interaction
rescues defects in neuronal differentiation caused by a presenilin-1 mutation." Proc Natl
Acad Sci U S A 102(34): 12171-12176.

Tiainen, M., K. Vaahtomeri, et al. (2002). "Growth arrest by the LKB1 tumor suppressor:
induction of p21(WAF1/CIP1)." Hum Mol Genet 11(13): 1497-1504.

Tiainen, M., A. Ylikorkala, et al. (1999). "Growth suppression by Lkb1 is mediated by a
G(1) cell cycle arrest." Proc Natl Acad Sci U S A 96(16): 9248-9251.

Tomlinson, I. P. and R. S. Houlston (1997). "Peutz-Jeghers syndrome." J Med Genet
34(12): 1007-1011.

Trotman, L. C., M. Niki, et al. (2003). "Pten dose dictates cancer progression in the
prostate." PLoS Biol 1(3): E59.

Tuttle, R. L., N. S. Gill, et al. (2001). "Regulation of pancreatic beta-cell growth and
survival by the serine/threonine protein kinase Akt1/PKBalpha." Nat Med 7(10): 1133-
1137.

van Slegtenhorst, M., M. Nellist, et al. (1998). "Interaction between hamartin and tuberin,
the TSC1 and TSC2 gene products." Hum Mol Genet 7(6): 1053-1057.

Vermeulen, L., E. M. F. De Sousa, et al. "Wnt activity defines colon cancer stem cells
and is regulated by the microenvironment." Nat Cell Biol 12(5): 468-476.

Visvader, J. E. and G. J. Lindeman (2008). "Cancer stem cells in solid tumours:
accumulating evidence and unresolved questions." Nat Rev Cancer 8(10): 755-768.

Wang, X., M. Foster, et al. (2003). "The origin and liver repopulating capacity of murine
oval cells." Proc Natl Acad Sci U S A 100 Suppl 1: 11881-11888.

Westerman, A. M., M. M. Entius, et al. (1999). "Peutz-Jeghers syndrome: 78-year
follow-up of the original family." Lancet 353(9160): 1211-1215.

Xu, X., S. Kobayashi, et al. (2006). "Induction of intrahepatic cholangiocellular
carcinoma by liver-specific disruption of Smad4 and Pten in mice." J Clin Invest 116(7):
1843-1852.

Xu, X., M. Sakon, et al. (2004). "Akt2 expression correlates with prognosis of human
hepatocellular carcinoma." Oncol Rep 11(1): 25-32.

67
Yamashita, T., A. Budhu, et al. (2007). "Activation of hepatic stem cell marker EpCAM
by Wnt-beta-catenin signaling in hepatocellular carcinoma." Cancer Res 67(22): 10831-
10839.

Yamashita, T., M. Forgues, et al. (2008). "EpCAM and alpha-fetoprotein expression
defines novel prognostic subtypes of hepatocellular carcinoma." Cancer Res 68(5): 1451-
1461.

Yamashita, T., J. Ji, et al. (2009). "EpCAM-positive hepatocellular carcinoma cells are
tumor-initiating cells with stem/progenitor cell features." Gastroenterology 136(3): 1012-
1024.

Yang, W., H. X. Yan, et al. (2008). "Wnt/beta-catenin signaling contributes to activation
of normal and tumorigenic liver progenitor cells." Cancer Res 68(11): 4287-4295.

Yovchev, M. I., P. N. Grozdanov, et al. (2008). "Identification of adult hepatic progenitor
cells capable of repopulating injured rat liver." Hepatology 47(2): 636-647.

Abstract (if available)

Abstract Progenitor or tumor initiating cells (TICs) are “altered” stem cells with the capacity to form solid tumors. Tumor suppressor PTEN (phosphatase and tensin homologue deleted on chromosome ten) and its downstream target Protein Kinase B (AKT2) are aberrantly expressed in liver cancers. The focus of my doctoral studies is to use liver specific Pten (Pm) and Pten/Akt2 deletion (Dm) murine models to investigate the role of hepatic TICs in vivo. Proliferation of hepatic progenitor cells in has been reported in various murine models of hepatotoxin induced liver injury. Pm mice develop liver cancer following an extensive phase of chronic lipid accumulation and demonstrate escalating levels of hepatic injury markers from 6-12M, prior to TIC proliferation. In addition, TUNEL analysis revealed that hepatocytes from Pm mice undergo extensive apoptosis relative to control mice. We hypothesize that hepatocyte cell death induced by hepatic injury presents an opportunity for TICs to proliferate and consequently form mixed lineage tumors. Based on these findings, I sought to investigate different strategies employed by TICs for liver tumor development. The first is taking advantage of an injured niche which is addressed in chapter two. Attenuation of hepatic injury by Akt2 deletion reduces progenitor cell proliferation and delays tumor development. Treatment of double mutant mice with 3,5-dietoxycarbonyl-1,4 dihydrocollidine (DDC) shows that the primary effect of AKT2 loss is attenuation of hepatic injury and not inhibition of progenitor cell proliferation in response to injury. My primary study also revealed that the Wnt/β-Catenin signaling pathway is the likely molecular mediator of cancer stem cell proliferation in our Pm model. In chapter three we explore inhibition of the Wnt/β-Catenin signaling pathway as a means to inhibit TIC proliferation. We demonstate that Wnt/β-Catenin inhibitor ICG-001 attenuates proliferation of hepatic tumor initiating cell line P0.

Linked assets

University of Southern California Dissertations and Theses

Conceptually similar

PDF

Steatosis induces Wnt/β-catenin pathway to stimulate proliferation of hepatic tumor initiating cells and promote liver cancer development

PDF

Calorie restriction reduces liver steatosis in liver specific Pten deleted mouse model

PDF

Roles of epithelial-mesenchymal transition and niche in tumorigenesis of tumor-initiating cells

PDF

Pten deletion in adult pancreatic beta-cells induces cell proliferation and G1/S cell cycle progression

PDF

The roles of endoplasmic reticulum chaperones in regulating liver homeostasis and tumorigenesis

PDF

Exploration of the roles of cancer stem cells and survivin in the pathogenesis and progression of prostate cancer

PDF

Regulation of mitochondrial bioenergetics via PTEN (phosphatase and tensin homolog deleted on chromosome 10)/estrogen-related receptor alpha (ERRα) signaling

PDF

Inhibition of NR3B1 attenuates the progression of NAFLD and NASH in liver-specific Pten knockout mice

PDF

Phosphatase and tensin homolog deleted on chromosome 10 (PTEN) signaling regulates fatty acid beta-oxidation

PDF

Tri-specific T cell engager immunotherapy targeting tumor initiating cells

PDF

PTEN loss antagonizes aging through promoting regeneration and prevents oxidative stress induced cell death

PDF

Homologous cell systems for the study of progression of androgen-dependent prostate cancer to castration-resistant prostate cancer

PDF

Studies of murine prostate cancer stem / progenitor cells

PDF

Mechanisms of nuclear translocation of pyruvate dehydrogenase and its effects on tumorigenesis of hepatocellular carcinoma…

PDF

Study of bone morphogenetic protein-2 and stromal cell derived factor-1 in prostate cancer

PDF

Hepatitis B virus X protein regulation of β-catenin and NANOG and co-regulatory role with YAP1 in HCC malignancy

PDF

Maf1 is a novel target of the tumor suppressor PTEN and a negative regulator of lipid metabolism

PDF

Eicosanoids in the progression of liver steatosis to cancer

PDF

The role of glucose-regulated proteins in endometrial and pancreatic cancers

PDF

The role of endoplasmic reticulum chaperones in adipogenesis, liver cancer and mammary gland development

Asset Metadata

Creator Galicia Medina, Vivian A. (author)

Core Title PTEN deletion induced tumor initiating cells: Strategies to accelerate the disease progression of liver cancer

School Keck School of Medicine

Degree Doctor of Philosophy

Degree Program Systems Biology

Publication Date 05/07/2011

Defense Date 03/18/2011

Publisher University of Southern California (original), University of Southern California. Libraries (digital)

Tag liver cancer,OAI-PMH Harvest,PTEN,tumor initiating cells

Language English

Contributor Electronically uploaded by the author (provenance)

Advisor Stiles, Bangyan (committee chair), Ou, James (committee member), Roy-Burman, Pradip (committee member)

Creator Email vgalicia@usc.edu,vivgalici@hotmail.com

Permanent Link (DOI) https://doi.org/10.25549/usctheses-m3926

Unique identifier UC1422661

Identifier etd-Galicia-4520 (filename),usctheses-m40 (legacy collection record id),usctheses-c127-470211 (legacy record id),usctheses-m3926 (legacy record id)

Legacy Identifier etd-Galicia-4520.pdf

Dmrecord 470211

Document Type Dissertation

Rights Galicia Medina, Vivian A.

Type texts

Source University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Repository Name Libraries, University of Southern California

Repository Location Los Angeles, California

Repository Email cisadmin@lib.usc.edu