University of Southern California Dissertations and Theses

Transcriptional co-activation functions of Msx homeodomain proteins by activating Hsf proteins

(USC Thesis Other)

Transcriptional co-activation functions of Msx homeodomain proteins by activating Hsf proteins

PDF

Download

Open document

Flip pages

Download a page range

Download transcript

Copy asset link

Request this asset

Transcript (if available)

Content
TRANSCRIPTIONAL CO-ACTIVATION FUNCTIONS OF MSX HOMEODOMAIN
PROTEINS BY ACTIVATING HSF PROTEINS

by
Fengfeng Zhuang

A Dissertation Presented to the
FACULTY OF THE GRADUATE SCHOOL
UNIVERSITY OF SOUTHERN CALIFIRNIA
In Partial Fulfillment of the
Requirements for the Degree
DOCTOR OF PHILOSOPHY
(CRANIAOFACIAL BIOLOGY)

May 2008

Copyright 2008 Fengfeng Zhuang

ii
Table of Contents

List of Figures iii
Abbreviations iv
Abstract v
Chapter 1: Background and Significance 1
1.1 Hypothesis and Significance
1.2 Developmental and cellular function of Msx1 and Msx2
1.3. Biochemical properties of Msx proteins
1.4 Biochemical properties and physiological Function of Heat
shock factor (HSFs)
1.5 Possible physiological relevance of interaction between Msx and Hsf.

Chapter 2: Establishing an activation model system by Msx proteins 26
2.1 Rationale for Experiment
2.2 Experimental results
2.3 Conclusion and Discussion

Chapter 3: Molecular characterization of protein domain required for
transactivation function 37
3.1 Rationale for Experiment
3.2 Experimental results
3.3 Conclusion and Discussion

Chapter 4: Mechanisms of Activation regulated by Msx protein 46
4.1 Rationale for Experiment
4.2 Experimental results
4.3 Conclusion and Discussion

Conclusion and future direction 66

Chapter 5: Experiment Methods and Materials 68
5.1 Plasmid construction.
5.2 Cell culture and DNA transfection.
5.3. ?-galactosidase and luciferase assays.
5.4. Immunoprecipitation and immunoblotting assays.
5.5. Immunofluorescence.
5.6. Electrophoretic Mobility Shift Assays (EMSA)

References 87

iii

List of Figures:

Figure1: Development of the craniofacial primordia. 5
Figure2: Msx protein structure and their binding partners. 13
Figure3: HSF protein structure and its functional Domain. 17
Figure4: Msx generally function as transcriptional suppressor. 26
Figure5: Activation of Hsp70 promoter by the Msx1 and Msx2. 30
Figure6: The transactivation of Hsp70 promoter by Msx1is independent of Cyclin D1. 31
Figure7: Msx1-dependent activation of the Hsp70 promoter does not require its DNA 33
binding activity.
Figure8: Heat Shock Elements are required for msx1-dependent activation 35
of the Hsp70 promoter.
Figure9: The transcriptional activation activity resides in the C-terminal 39
domain of Msx proteins.
Figure10: Identify the key amino acids required for the Msx activation 42
function in C-terminal domain.
Figure11: Homeodomain provides transcriptional enhancement. 43
Figure12: The Msx-dependent activation of the Hsp70 promoter is similar to
the Heat Shock response. 48
Figure13: Msx proteins and Hsfs physically interact in vivo. 51
Figure14: Overexpression of Msx2 facilitated nuclear translocation 53
of Hsf2 and enhanced nuclear accumulation and distribution of Hsf1.
Figure15: DNA binding activity of Hsf1 regulated by Msx protein. 55
Figure16: C/EBP-beta DNA binding activity is not involved in 57
enhancement of Hsp70 promoter activity by Msx protein.
Figure17: The transactivation function of Msx protein is not required Pias1 and 60
sumoylation on Hsfs.
Figure18: Pax6 synergy with Msx protein to activate transcription activity. 62
iv
Figure19: Model for activation of Heat shock transcriptional Factors 64
regulated by Msx protein.
Abbreviations

HSF: Heat Shock transcriptional Factor
HSP: Heat Shock Protein
HSE: Heat Shock Element
KO: Knockout
TBP: TATA binding Protein
H1b: Histone 1b
MEF: Mouse Embryonic Fibroblasts
TBP: TATA binding protein
KO: knock out
CNS: Central nervous system

v

Abstract
The importance of Msx genes in regulating development of ocular, neuronal,
cardiac, ectodermal and oro-craniofacial structures has been well established. Previous
studies have shown that Msx proteins regulate gene transcription predominantly through
repression by forming transcriptionally inactive heteromeric complexes. In contrast to
their known suppressor activities, gene expression studies using either the gain-of-
function or the loss-of-function mutants revealed many gene targets whose expression
requires functional Msx proteins. Here we present data demonstrating for the first time
that Msx proteins function as activators of transcription by controlling the intracellular
distribution and by modulating the transcriptional activity of partnering molecules. Msx
proteins activate the Hsp70 promoter through a mechanism in which Msx protein
physically interacts with and modify Heat shock transcriptional factors (Hsfs) to facilitate
their nuclear translocation, accumulation and subsequent transcriptional activation. The
fact that Msx1 and Msx2 can stimulate Hsf mediated transcriptional activation of Hsp70
promoter in the absence of chemical, physical or physiological stress suggests that Msx1
and Msx2 may provide a critical and novel pathway in activating Hsf1 and Hsf2 and
hence transcriptional induction of their target genes under normal physiological
conditions.
1
Chapter 1: Background and Significance
1.1 Hypothesis and Significance
The development of vertebrate embryos requires precise regulation of gene
expression in the right place, at the right time, with the right level. Any disruption in
these key regulations will result in developmental defects. The importance of Msx1 and
Msx2 genes in regulating development of craniofacial structures as well as in epidermal
organs has been well established, but the mechanism of Msx proteins regulating
transcriptional activity is not entirely clear. It was believed that Msx proteins function as
transcriptional repressors. However, suppression function alone cannot completely
explain the phenotype of Msx mutant in mice, in humans, and the gene expression profile
regulated by Msx protein.
Null mutations in the Msx1 can result in facial and palatal cleft along with adontia.
Loss-of-function mutations in the Msx2 gene could lead to the delayed closure of parietal
foramina, defects in endochondral bone formation, cyclic alopecia, malformation of the
cerebellum and delayed mammary gland development. Over-expression and ectopic
expression of the Msx2 gene in transgenic animals accelerates membraneous bone
formation and causes colobomatous microphthalmia by altering gene expression.
Msx1/Msx2 double mutant mice exhibit synergistic defects in calvaria, tooth, ear, limb,
hair follicle, abdominal wall, and mammary gland development. Many of these defects
in null mutants were attributed to the reduction in expression of key regulator genes in
contrast to the suppression function of Msx protein in vitro studies, which have shown
that Msx genes represses target gene expression by forming heteromeric complexes with
2
other protein partners. Therefore, we hypothesize that Msx1/2 can function as
transcriptional co-activators.
Of the many promoters that have been analyzed, Msx genes have consistently
displayed its suppressor activities. The suppressor function of Msx genes has also been
shown to be required in blocking myogenic differentiation and terminal differentiation of
osteoblasts in culture. Although numerous examples of Msx-dependent induction of gene
expressions have been reported, no direct experimental evidence exists showing direct
transcriptional activation by Msx genes. How Msx proteins achieve their activation
function has not been investigated.
To fill this apparent knowledge gap, a promoter system needs to be established to
allow further study in activation activities of Msx proteins. Based on this model promoter,
we can identify the cis-DNA element on this promoter and trans-factors binding with this
DNA element to mediate the transcriptional activation of Msx protein, and further define
a unique activation mechanism regulated by Msx proteins.
By defining Hsp70 promoter as an activation model system, I have
demonstrated for the first time that Msx proteins can function as transcriptional activators
by modulating the transcriptional activity of partnering molecules. Msx proteins interact
with Hsf proteins through its homeodomain to facilitate translocation and accumulation
of Hsf proteins in nuclear. In addition, Msx modify and activate Hsf by recruiting co-
factors from the C-terminus of Msx to subsequently transcriptional activation
The experimental works that I will be describing in this thesis were to address two
broad questions:
3
(1) How does Msx1/2 function as a transcriptional co-activator besides its
transcriptional suppressor activities?
(2) How can Hsfs be activated in norm physiological condition, such as during
embryonic developmental process in the absence of stress?

1.2 Developmental and cellular function of Msx1 and Msx2
The Msx vertebrate HOX genes were originally isolated by homology to the
Drosophila msh (muscle segment homeobox) gene, which forms one of the most highly,
conserved families of homeobox-containing genes. A vertebrate muscle segment
homeobox (Msx) gene encodes homeodomain transcription factors which have three
members: Msx1, Msx 2, and Msx3, while only one msh gene exists in Drosophila.
In Drosophila, msh expression was first detected in the mesoderm of the
developing somatic musculature of the embryo and later in the central nervous system
and in specific muscles (D'Alessio et al., 1996; Isshiki et al., 1997). In the mouse, Msx1
and Msx2 are expressed in multiple organs during embryogenesis. Msx1 and Msx2 are
expressed with overlapping patterns, at many sites of epithelial¨ mesenchymal inductive
interactions, such as the limb, tooth buds, eye, heart, branchial arches, and craniofacial
processes. Additionally, Msx1 and Msx2 are also expressed in the roof plate and cells
adjacent to the dorsal neural tube and neural crests (Davidson et al., 1995). On the other
hand, Msx3 is exclusively expressed in the dorsal aspect of the neural tube in the mouse,
caudally to the isthmus (Shimeld et al., 1996).
4
Msx proteins play a crucial role in embryogenesis, especially in the development
of craniofacial organs.
1.2.1 Embryology of craniofacial development
The development of the head is the most sophisticated morphological process.
This process is initiated when the anteroposterior axis of an embryo is established. The
vertebrate head exhibits an exceedingly complex morphology; initially, the cranioprocess
has a simple geometry, consisting of a series of swellings or prominences that undergo
growth, fusion and expansion. There are seven prominences that consist of the vertebrate
face: the midline frontonasal prominence and three paired structures derived from the
first pharyngeal (branchial) arch (Fig. 1). The forehead, the middle of the nose, the
philtrum of the upper lip, and the primary palate were derived from the frontonasal
prominence, while the sides of the nose are derived from the lateral nasal prominence
(Fig 1) (Larson, 2001; Helms et al., 2005)
5

Neural crest is the main contributor of craniofacial development (Wilkie et al.,
2001; Helms et al., 2005) besides the neural ectoderm which gave rise to the brain
(Creuzet et al., 2004) and the surface epithelium that forms the facial skin (Hu et al.,
2003).
The formation of neural crest cells begins at mouse embryonic day E8.0 when the
neural tube undergoes folding. The major part of the neural tissue presented at this stage
is the location of the future brain region; the preotic sulcus divides the future brain into
two parts: forebrain plus midbrain plus rostral hindbrain (future rhombomeres 1 and 2)
and the more caudal hindbrain (future rhombomeres 3¨ 8). At about E9.0, neural-tube
closure is initiated at the seven-somite stage in the region of the brain¨ spinal cord
junction; it then progresses in both rostral and caudal directions. As neural crest cells
enter, the branchial arch enlarges (Wilkie et al, 2001).
Figure1. Development of the craniofacial
primordia. (A-D) A frontal view of the
prominences that gives rise to the main
structures of the face. The frontonasal (or
median nasal) prominence (red) contributes
to the forehead (A), the middle of the nose
(B), the philtrum of the upper lip (C) and the
primary palate (D), while the lateral nasal
prominence (blue) forms the sides of the
nose (B,D). The maxillomandibular
prominences (green) give rise to the lower
jaw (specifically from the mandibular
prominences), to the sides of the middle and
lower face, to the lateral borders of the lips,
and to the secondary palate (from the
maxillary prominences) (Larson,

2001;
Helms et al., 2005).
6
The mammalian face develops mainly by fusion of the first and second branchial
arches. Coordinated growth of the first branchial arch gives rise to a pair of maxillary
processes and a pair of mandibular processes. Together, with the single medial
frontonasal process these facial swellings create the primitive mouth or stomodeum. As
development proceeds in the frontonasal process, localized thickenings of the surface
ectoderm called nasal placodes develop. These placodes invaginate while their margins
thicken, to form the nasal pits and the lateral and medial nasal prominences. The
maxillary processes of the first branchial arch grow toward the future midline of the face.
They fuse with the lateral nasal processes on each side, then fuse with the medial nasal
processes, and finally with the inter-maxillary segment of the frontonasal process to form
the upper jaw and lip. The mandible and the lower lip are formed by the paired
mandibular processes fused along their medial edge. The frontonasal prominence forms
the forehead and nose. Failure of the maxillary prominence to merge with the medial
nasal prominence on one or both sides will result in an upper lip cleft. Cleft in the lower
lip and jaw occurs when the fusion of the paired mandibular prominence fails.
The skull is a composite of multiple bones that are organized primarily into the
neurocranium (or the cranial vault) and the viscerocranium (or the cranial base). The
neurocranium functions to protect the brain and sensory organs and is derived from
neural crest cells and mesodermal origin. The neurocranium is formed by intra-
membraneous ossification over the expanding brain. Fibrous joints known as sutures
separate the resulting calvarial bones. To accommodate the constant expansion of the
brain, further growth of the skull occurs by apposition at the lateral edged of the sutures
or osteogenic fronts, which are populated by highly proliferating preosteoblasts. Failure
7
of the inception, nonsynchronous growth or untimely ossification results in
craniosynostosis which is the dysmorphic development of the skull.

1.2.2 Role of Msx genes in regulating craniofacial development

1.2.2.1 Mutations in Msx1 cause oro-craniofacial deformities
Mutations in the MSX1 gene causes orofacial cleft and tooth agenesis in
humans (Vastardis et al., 1996; Van den Boogaard et al., 2000; Blanco et al., 2001;
Jumlongras et al., 2001; Hu et al., 1998). A missense mutation, the substitution from an
arginine to proline within the homeodomain of MSX1 causes agenesis of second
premolars and third molars (Vastardis et al., 1996). The mutant protein exhibited reduced
stability as a result of structural perturbations and failed to interact with DNA or its
cognate protein factors (Hu et al., 1998). Accordingly, its ability to function as a
transcriptional repressor was greatly impaired. Furthermore, a nonsense mutation in
MSX1 accounts for the genetic etiology of Witkop syndrome characterized by tooth
agenesis and nail dysgenesis (Jumlongras et al., 2001).
In contrast to the haploinsufficiency of MSX1 in humans, mice carrying MSX1
null mutations die at birth, and exhibit severe craniofacial abnormalities (Satokata et al.,
1994; Houzelstein et al., 1997; Vastardis et al., 1996; van den Boogaard et al., 2000).
These craniofacial anomalies include cleft palate, absence of alveolar processes, parietal
foramina, accelerated ossification of palatal bones and an arrest in tooth development at
the bud stage. Zhang et al. rescued neonatal lethality and repaired the cleft palate defect
in some Msx1-/- mice by simply over-expressing Bmp4 in the developing tooth and palate,
8
thus suggesting that the cleft palate phenotype is independent of the tooth phenotype
(Zhang et al., 2002). Interestingly, two substitution mutations (G267C and P178S) were
recently mapped to the C-terminus of Msx1 which were found in the patients suffering
from non-syndromatic cleft lip and cleft palate, which suggests functional importance of
the C-terminal domain in lip and palatal development (Tongkobpetch et al, 2006).

1.2.2.2 Mutations in the Msx2 cause abnormal development in multiple organs
Msx2 was involved in different developmental stages of multiple organs: to
induce placode formation during interaction between epithelium and mesenchyme, to
control the proliferation of cells which then affects the morphology and shape of tissue
and to regulate specific gene expression to control the final differentiation of the
functional cell.
The role of Msx genes in craniofacial development was initially revealed by a
mutation in the MSX2 gene causing Boston-type craniosynostosis in humans (Jabs et al.,
1993). Craniosynostosis is characterized by the premature fusion of the skull. A mutation
in the region adjacent to the homeodomain of the MSX2 protein was shown to increase its
binding affinity to DNA (Ma et al., 1996). Conversely, haploinsufficiency of MSX2
results in a delayed ossification of the anterior fontanel in the skull vault or parietal
foramina (Wilkie et al., 2000). These craniofacial defects were replicated in animal
studies using knock-out and transgenic strategies (Satokata et al., 2000; Liu et al., 1995;
Liu et al., 1999). In a normal developing cranium, Msx2 is required to maintain a
proliferating population of osteoblast progenitors at the osteogenic front. Overexpression
9
of Msx2 impedes osteoblast differentiation while anti -sense inhibition promotes
differentiation (Dodig et al., 1999).
Besides the skull, Msx2 knockout causes foliation and lamination defects in
cerebellum, abnormal cartilage, endochondral bone formation , along with defects in
three ectodermal organs (the tooth, hair follicle and mammary gland ) (Satokata et al.,
2000; Marianna et al., 2004). Overexpression of Msx2 results in abnormal eye
development (Wu et al 2003).
Ectodermal organs, such as hair, tooth, mammary gland and eye, utilize similar
morphogenetic processes, including induction, invagination, and cytodifferentiation. The
induction between epithelium and mesenchyme causes the formation of epithelial placode.
As the epithelial placode invaginates into the mesenchyme, it will grow to form the
specific morphology of tissues and decide the fate of differentiating cells. Finally, the
differentiated cell product of the specific gene produces proteins such as keratin in hair,
enamel and dentin in tooth, to function normally. Bone formation also requires
interactions between epithelium and mesenchyme. This type of interaction causes the
condensation of the mesenchyme. When the condensed mesenchyme forms the
osteogenic center, the osteoblast would then differentiate. Finally, bone matrix proteins
such as collagens and osteocalcin will be secreted by osteoblasts which mineralize to
form the bone.
Msx2 is required for induction of these organs in early development. In the double
KO (Msx1-/-; Msx2-/-), not only does the tooth development arrest during the induction
stages or early bud stages, but also mammary epithelial invagination fails to occur. In
skin, early hair follicle induction also requires Msx2 or Msx1 since one-third of hair
10
follicles are lost in double KO mice. In Msx1/2 double knockout mice (unpublished, from
communication), the induction of lens formation in the eye was found to be defected.
The induction of teeth requires molecular signal interactions of Msx and Bmp4 between
epithelium and mesenchyme.
After induction and invagination, cells of epithelium and mesenchyme need to
proliferate and differentiate resulting in the morphogenesis of specific tissues in later
stage. Msx2 controls cell proliferation. Overexpression of Msx2 driven by its own
promoter causes overgrowth of the skull vault (Liu et al, 1999). Overexpressed Msx2
under the control of the CMV promoter causes hyperkeratosis as a result of hyper-
proliferation in the skin (Jiang et al, 1999). In Msx2 knockout mice, the proliferation of
osteogenic cells in the frontal bone of skull was reduced and resulted in a large foramen
(Satokata et al., 2000; Ishii, et al., 2003). The modification of proliferation can also be
observed in the teeth which results in defect of cusp morphogenesis in Msx2 mutant mice.
Interestingly in hair, there was no significant difference in proliferation of hair follicles
and matrix cells between Msx2 KO mice and wild type (Ma et al., 2003). Thus, regulation
of cell proliferation by Msx2 is highly dependent on the context of the tissue or the cell.
Finally, the differentiated functional cells secrete the extra-cellular products to
form the functional tissues such as teeth, bone and hair. In teeth, Msx2 is required for
Laminin5 alpha 3 expressions in the ameloblast. In cell culture, Msx2 suppresses
expression of Amelogenin in ameloblast, and Osteocalcin in odontoblast. In the long bone,
although the Osteocalcin is suppressed by Msx2 in vitro osteoblast cell culture, the Msx2
inactive mutant mice also share a decreased Osteocalcin expression. Msx2 can suppress
the Col2a1 and Col1a1 expression, the extra-cellular matrix protein important for
11
cartilage and bone formation (Dodig et al., 1996; Takahashi et al., 2001). In hair, Msx2
KO mice are presented with short hair and hair shaft differentiation is defective. The
AE13 (marker for low sulfur hair keratin) and AE 14 (marker for high sulfur hair keratin)
are reduced in the hair cortex. Additionally, Foxn1 as well as keratin HA3 (a terminal
differentiation marker of hair cortex cell which acts downstream of Foxn1) are reduced
(Ma et al., 2003). Therefore, Msx2 regulates the expression of extra-cellular molecules to
control the terminal differentiation of specific cells in teeth, bone and hair.
By comparing the development of various organs regulated by Msx genes would
help us understand the principle of organogenesis shared by different organs and
conserved function of Msx1/2 in development. The different conserved domains of Msx
protein may control these processes in different stages of embryonic development.

1.2.2.3 Functions of Msx genes in controlling tissue regeneration
Msx1 can induce cell dedifferentiation. In the cell culture system, terminally
differentiated murine myotubes can be dedifferentiated by the inducible expression of
Msx1. Approximately 9% of the terminally differentiated myotubes cleave to produce
either smaller multinucleated myotubes or proliferate to form mononucleated cells.
Finally, clonal populations of the mononucleated cells derived from myotube
differentiate into other cell types (Odelberg et al., 2000). In axolotl limbs, Msx2
expression is down-regulated at late stages of limb development, but is re-expressed
within one hour after limb amputation. Msx-2 is also re-expressed during wound healing,
and may be essential in the early stages of initiation of the limb regeneration cascade
(Carlson et al., 1998; Koshiba et al., 1998). Msx1 null mutant mice display a regeneration
12
defect in limb regeneration (Han et al., 2003). Replacement of the repression domain of
the Xenopus Msx1 protein with the potent repression domain from Drosophila creates a
hyperactive form of the protein-eve Msx1 which promotes tail regeneration (Beck et al.,
2003; Yamamoto et al., 2000). During the regeneration process, Msx protein shuts down
the expression of a panel of genes while activates expression other target genes. Both of
the transcriptional functions- suppression and activation, regulated by Msx protein, are
required for dedifferentiation or regeneration. Failure of either may not induce
regeneration.

1.3. Biochemical properties of Msx proteins

1.3.1 Molecular structures of Msx proteins
Msx proteins are a group of highly conserved homeodomain proteins. Besides the
conserved homeodomain which share 98% homology among Msx proteins, there are
other domains of amino acid conservation between Msx1 and Msx2 proteins. Msx
proteins can recognize and bind to the DNA motif 5'-AATTAG-3' through the
homeodomain (Catron et al., 1993; Catron et al., 1995). Homeodomains of Msx proteins
can bind with other protein partners, such as Dlx2/5 (Zhang et al., 1997), TBP or
CBP( Catron et al., 1995; Shetty et al., 1999), and P53 (Park, et al., 2005). One conserved
domain aa105-aa139 located in N-terminus of Msx1, forms complexes with Histone 1b
(Lee et al., 2004). The conserved C-terminal domain interacts with PIAS1 (Lee et al.,
2006).The structure of Msx proteins and their partner's binding domain is shown in
Figure 2.
13

1.3.2 Transcriptional properties of Msx proteins

1.3.2.1 Repressor activities of Msx proteins
The Msx proteins are believed to function as transcriptional repressors in vitro
and in vivo (Catron et al., 1993, 1995, 1996; Semenza et al., 1995; Zhang et al., 1996,
1997; Newberry et al., 1997). The repressor function of the Msx protein does not require
its DNA binding activity although protein-protein interaction is essential for its repressor
activity. The Msx homeodomain interacts directly with the TATA binding protein (TBP),
the core component of the general transcription complex to accomplish transcriptional
repression. The ability to interact with members of the basal transcription machinery is
important because it affects transcription by not depending on their ability to bind to
DNA (Catron et al., 1995; Shetty et al., 1999). Msx proteins also interact with other
homeodomain proteins to regulate transcription. Heterodimers formed between Msx1 and
other homeodomain proteins including Dlx2, Dlx5, Lhx2 and Pax3. These interactions
always resulted in mutual functional antagonism in vitro.
Figure2. Msx protein structure and their binding partners. Schematic
representations of Msx1/2 protein structure. Areas that shaded gray represent Msx
conserved regions and area that shaded black corresponds to the homeodomain.
Below are a list of Msx binding partners and their corresponding binding region on
the Msx protein above.

14
It is well known that Msx proteins inhibit myblast differentiation in culture. This
differentiation inhibitory activity is mediated by transcriptional repression. Results from
several studies have shown that Msx proteins can block myogenesis through repression of
MyoD (Song et al., 1992; Woloshin et al., 1995; Bendall et al., 1999). The way that Msx
proteins achieve the repression of MyoD expression is by forming heteromeric
complexes with Histone1b (H1b). The Msx-H1b complex binds to the core enhancer
region (CER) of the MyoD gene and renders it transcriptionally inactive at the level of
chromatin, thereby inhibiting terminal differentiation of myoblasts (Lee et al., 2004).
This suppressor function of Msx1 is enhanced by its interaction through its C-terminus
domain with Pias1 (Lee et al. 2006). Interestingly, Necdin and MAGE-D1 can release
Msx-dependent transcriptional repression and permit myogenic differentiation to
completion. Again, protein-protein complexes containing Necdin, MAGE-D1, and Msx
proteins cancel the suppressive activity of the Msx protein (Kuwajima et al., 2004).
Msx2 also delays terminal differentiation of osteoblasts as shown by the
suppression of the osteocalcin gene

in teeth and calvarial osteoblasts (Hoffmann et al.,
1994; Bidder et al., 1998; Newberry et al., 1997a, b). To inhibit terminal differentiation
of osteoblasts, Msx2 selectively inhibits the stable

association of Runx2 with OC
chromatin by forming complexes with Runx2 or by displacing Runx2 from its DNA
recognition site (Shirakabe et al., 2001; Sierra et al., 2004).

1.3.2.2 Msx genes can suppress and induce gene expression during development
15
Msx genes are common to multiple growth factor signaling pathways, including
Bmp, Fgf, Endothelin and Shh signaling pathways. Bmp2, Bmp4, Fgf2, Fgf4, Fgf8, and
Fgf9 represent growth factors from the oral and/or the dental epithelia that are capable of
inducing Msx1 expression in the subjacent mesenchyme of the mandible and maxilla
(Vainio et al., 1993; Kettunen et al., 1998). In the mouse, Msx1-deficiency leads to a
significant reduction in the expression of Bmp4. Msx-1deficiency also leads to the
ablation of Fgf3 expression and down-regulation of Lef1, Ptc, Dlx2, and syndecan-1
expression in the dental mesenchyme of arrested tooth germs (Chen et al., 1996; Bei et al.,
1998; Zhang et al., 1999). The bud stage arrest can be pushed to pass the cap stage upon
the addition of exogenous BMP4 or by forced expression of Bmp4 thereby bypassing the
need for Msx1 function (Zhang et al., 2000; Zhao et al., 2000). Lef1, Dlx2, Shh and Bmp2
expression are restored following ectopic or exogenous Bmp-4 expression.
While Bmps induce both Msx1 and Msx2, in vitro experiments suggest that Msx1
and Msx2 mediate the inductive effects of Bmp7 on mandibular morphogenesis as well as
the initiation phase of odontogenesis (Wang et al., 1999). The induction of Ptc, a
downstream target of Shh signaling, in the dental mesenchyme is contingent upon Msx1
(Zhang et al., 1999).
Msx2 mutants presented themselves with decreased cancellous bone and reduced
numbers of osteoblasts and chondrocytes. The numbers of resting, proliferating and
hypertrophic chondrocytes were decreased and the cell size of hypertrophic chondrocytes
was reduced, resulting in a smaller growth plate. Cortical bone thickness in mutants was
also reduced (Satokata et al., 2000). Expression of the bone differentiation markers
16
Runx2, alkaline phosphatase, bone sialoprotein and osteocalcin in the distal femur and
proximal tibia was reduced, suggesting that Msx2 is required for osteoblast formation. In
the Msx2 mutant, the expression of the chondrocyte differentiation marker, Pthr, was
reduced which explains the reduction in trabecular bone volume in these particular mice
(Satokata et al., 2000).
Msx2 induces alkaline phosphatase activity in

C3H10T1/2 and C2C12 cells. This
activity promotes mineralization of

murine primary osteoblasts. Msx2 enhances
osteoblast function independent of Runx2 by inducing Osx expression (Cheng et al.,
2003; Ichida et al., 2004). This was proven by transfecting Msx2 into mesenchymal cells
isolated from Runx2-deficient mice. Msx2 inhibits the transcriptional

activity of PPAR ,
C/EBP , and

C/EBP and blocked adipocyte differentiation of mesenchymal cells

induced by the overexpression of PPAR, C/EBPα, C/EBPβ, or C/EBPδ. Together these
results support the hypothesis that Msx2 promotes osteoblast differentiation

independent
of Runx2 and negatively regulate adipocyte differentiation (Cheng et al., 2003; Ichida et
al., 2004).
In the developing optic vesicle, over- expression of Msx2 suppresses the
expression of Bmp4 in the dorsal retina and simultaneously up-regulates Bmp7 expression
(Wu et al., 2003; and unpublished data).
Together, these results strongly suggest that Msx proteins not only functions
as repressors but also activates transcription.
1.4 Biochemical properties and physiological Function of Heat shock factor (Hsfs)

17
1.4.1 Structure of HSF protein
Heat shock

transcription factors are a family of transcription factors response to
stress stimulation such as heat shock, oxidants, heavy metals, and bacterial and viral
infections. They have highly conserved homology from yeast C.elegans, Drosophila,
mice, and humans. Vertebrates have four HSFs. HSF1 and HSF2 are the most studied
factors of the group because of their ubiquitous expression in most tissue and cell lines.
Hsf3 is unique to avian species, and Hsf4 is the most recently identified member in
mammals and is expressed in the cells of the lens and brain (Fujimoto et al., 2004)
HSF is structurally a winged, helix-turn helix DNA binding protein (Fig 3). The
amino-terminal helix-turn-helix DNA binding domain (DBD) is the most conserved
functional domain of HSFs and is capable of recognizing and binding the Heat shock
element (HSE) present in the promoter of heat shock protein (HSP) and downstream
target genes. HSE contains at least three TTC or GAA (reversed) motifs. Activation-
induced trimerization of HSFs is mediated by three arrays of hydrophobic heptad repeats
(HR-A/B and HR-C). Sequence alignment show that all Hsfs have a long interrupted,
hydrophobic repeat sequence (HR-A and HR-B) located next to the DNA binding domain.
This domain mediates trimerization of Hsfs. In addition, hydrophobic repeat sequence
(HR-C) prevents Hsfs oligomerization in the un-induced state. This is located in the C-
terminal region of HSFs. The HR-C domain is a transcriptional activation domain
situated in the C-terminus. A transcriptional repression domain is found in the center
portion of the molecule. Hsf4 does not contain the HR-C domain; it is believed to exist as
18
a trimeric unit that constitutively binds to DNA (Morimoto et al., 1998; Pirkkala et al.,
2001).

1.4.2 The Activation mechanism of HSFs by heat shock
HSFs are key transcriptional factors in initiating cellular stress protection by
inducing gene expression of Heat shock proteins (HSPs). HSPs function as molecular
chaperones in protecting cells against proteotoxic damage. HSF activation is a multi-step
process upon induction by stress stimuli. Such stress stimuli includes monomer-to-trimer

transition, accumulation in the cell nucleus, inducible phosphorylation,

and the binding of
heat shock element

(HSE) on the promoters of target genes to initiate transcription of heat
shock genes. HSFs also bind to repetitive

chromosomal loci that serve as platforms for
the formation of

nuclear stress bodies (nSBs) (Biamonti et al., 2004). In the absence of
stress, HSF1 exists predominantly as monomers and is held in an inactive conformation
by interaction with a protein complex that include chaperone proteins Hsp90, p23,
RalBP1 and immunophilin (Hu et al., 2003). In the presence of stress stimulation, the
concentration of denatured protein rises resulting in a reduction and subsequent
Figure 3. The HSF protein structure and its functional Domain. Schematic
representation of the HSF protein structure. The functional domains as well as the
modification of HSFs are indicated.

19
disappearance of the HSF1-Hsp90-p23-immunophilin heterocomplex. The dissociated
Hsf1from the chaperone-based complex is recruited into a protein-RNA complex that
consists of eEF1a and HSR1 (heat shock RNA 1). The formation of a protein-RNA
complex is critical for HSF1 trimerization and transcriptional activity in response to heat
shock (Shamovsky et al., 2006).
However, trimeric Hsf1 can also exist in a transcriptional inactive complex.
Repression is due to sequestration of trimeric Hsf1 by the Hsp90-p23-Fkbp52 complex.
In addition to exogenous stress stimuli, Hsf1 can be activated by introducing a Lys 298
Ala point mutation. Other means of activating Hsf1 include over-expression of an E3
ubiquitin ligase, Chip (Dai et al et al., 2003), Daxx (Boellmann et al., 2004), and Ral-
biding proteins (Hu et al., 2003). Interactions with Hsc70 and Asc-2 have also been
shown to activate HSF1 (Ahn et al., 2005; Hong et al., 2004). It has been reported
concerning avian Hsf3 that C-Myb can activate Hsp70 transcription during G1-to S
transition by directly binding to Hsf3 via the DNA binding domains (Kanei-Ishii et al.,
1997).
Posttranslational modification may also contribute to Hsf1 activation. The
transcriptional activity of HSF1 can be modulated by phosphorylation, dephosphorylation
and sumoylation (Chu et al., 1996, 1998; Dai et al., 2000; Xavier et al., 2000; Conde et
al., 2005; Kim et al., 2005; Wang et al., 2006).
So far,

four phosphorylated serine residues (S230, S303, S307, and S363)

on
HSF1 have been identified. Constitutive phosphorylation of two specific serine/proline
motifs, S303 and S307, is important for the function of the RD and may be critical for
20
negative regulation of HSF1 transcriptional activity at normal temperatures, since
substitution of serine to alanine causes transcriptional suppression (Chu et al 1996, 1998;
Knauf et al., 1996; Kline et al., 1997). In contrast to the repressive role of S303, S307,
S363,

and S230, it was recently demonstrated to be inducibly phosphorylated

upon heat
shock and to positively contribute to the transcriptional

activity of HSF1 (Holmberg et al.,
2001). Phosphorylation of S230 is enhanced upon heat shock and, consequently, a
mutation of S230 to alanine correlates with decreased transcriptional activity of the
human HSF1.
HSF1 can be modified by SUMO-1 and SUMO-2 in a stress-inducible manner.
Sumoylation is rapidly and transiently enhanced on lysine 298, located in the regulatory
domain of HSF1 (Hietakangas et al., 2003). The stress-inducible SUMO modification of
HSF 1 requires the phosphorylation of serine 303. HSF2 is readily modified by SUMO
on K82 (Goodson et al., 2001; Anckar et al., 2006). The significance of SUMO
modification on HSF2 activity remains controversial as the two research groups provided
us with results that contradicted each other. Anckar et al. reported that HSF2 is
sumoylated

on K82 and sumoylation of this residue would dramatically impair the ability
of HSF2 to bind HSE. On the other hand, Goodson and coworkers reported

that
sumoylation on K82 of HSF2 would convert HSF2 into a DNA-binding

form.
1.4.3 Physiological Function of HSFs protein
Stress protection: Heat shock factor 1 (HSF1) is the master regulator of the heat
shock response in eukaryotes, a highly conserved protective mechanism throughout
metazoan. In contrast to a normal stress response in Hsf2 null cells to heat shock, cells
21
from Hsf1-/- mice lost their tolerance to thermal stress and lost their ability to induce
HSP expression (Ostling et al., 2007). In mice and Drosophila, HSF1 is dispensable for
growth and survival under controlled laboratory conditions, but essential for survival
following stresses such as high temperature and endotoxin challenge (Jedlicka et al., 1997;
Xiao et al., 1999). Hsf2 has been regarded as functionally distinct from the stress-
activated HSf1. Previous studies utilize antibody super gel shift electrophoresis and
mobility shift assay to identify the factor that binds to the Hsp70 HSE in response to
different treatment. Hsf1 was found to be the main factor responsible for the HSF-HSE
complex upon heat shock signal, whereas HSF2 was more prominently activated upon
hemin treatment. So far, no experimental evidence indicates the role of HSF4 in stress
response. Its importance in lens formation and maintenance of olfactory epithelium has
been well documented (Fujimoto et al., 2004).
Cancer: Recent data demonstrate that HSF1 is a potent modifier of tumorigenesis
and is required for tumor initiation and maintenance in a variety of cancer models.
Knockout HSF1 will protect mice from tumors induced by mutations of the RAS
oncogene or a hot spot mutation in the tumor suppressor p53. In cell culture, HSF1
supports malignant transformation by orchestrating a network of core cellular functions
including proliferation, survival, protein synthesis, and glucose metabolism. While HSF1
enhances animal survival and longevity under most circumstances, it has the opposite
effect in enhancing the lethal cancer (Dai et al., 2007)
Immune response: In addition to responding to cellular protection, Hsf1 plays an
important role in immune response. Hsf1 null mice display impaired T-cell dependent
22
humoral response (Inouye et al., 2004). In mouse spleen cells, HSF1 was found to
directly bind to an IL-6 promoter. IL-6 is a pro-inflammatory cytokine that is produced
by T-cells to stimulate B cell maturation. Hsf-deficient mice exhibit 50% reduction in the
production of IgG2a in response to immunization with sheep red cells. An expression
profile of Hsf1-/- MEF reveals that HSF1 regulate immunological responsive genes
including interleukins, interferon-related genes, and chemokines. This profile strongly
links HSF1 to immune response. In C.elegans, heat shock proteins enhance immunity to
resist bacterial infection. The enhanced resistance required HSF-1 mediated activation of
Hsp90 and several small heat shock proteins that are known to be effectors of immune
protection (Singh et al., 2006).
Reproduction: A developmental role for HSFs was first demonstrated when the
Drosophila HSF was found to be required for early larval development and oogenesis
(Jedlicka et al., 1997). Subsequent loss-of function studies in mice revealed function
beyond heat shock response. In developing HSF1 null embryos, an abnormal architecture
of the placenta was observed at E11.5, suggesting a failure in the development of extra-
embryonic tissue. When HSf1 null female was mated to a wildtype male, very few
fertilized oocytes developed past 1-cell stage (Christians et al., 2000). This indicates the
critical importance of maternal HSF1 for the initiation of zygotic cleavage.
Overexpression of an active form of HSF1 causes apoptosis of pachytene permatocytes
(Nakai et al., 2000). Hsf1 null mice exhibit normal spermatogenesis. However, HSF2
deficiency resulted in low fertility due to the reduced size of the testis, increased
apoptosis and decreased sperm count of double knockout HSf1 and Hsf2 resulted in a
more severe form of male infertility (Kallio et al., 2002; Wang et al., 2003, 2004).
23
CNS (Central nervous system) Development: During CNS development, Hsf2 is
highly expressed in the neuroepithelium among the proliferating neuronal progenitors of
the ventricular zone and in the cortical plate (Kallio et al., 2002; Wang et al., 2003; Rallu
et al., 1997). In two separate knockout mice, Hsf2 null mice exhibit enlarged ventricles
and reduction of hippocampus, striatum, and the width of the cortex. Inactivation of Hsf2
affected the migration of cortical neurons resulting in reduced number of radial glia and
Cajal-Retzius cells (Chang et al., 2006). The expression of p35, an activator of cyclin-
dependent kinase 5 (CDK5) and an essential regulatory component for radial migration,
was reduced. It was shown by CHIP analysis that HSF2 directly binds to the promoter of
p35. In accordance with CNS defects in Hsf2 null mice, disruption of Hsf1 also resulted
in the enlargement of ventricles. Astrogliosis and neurodegeneration occurred in specific
domain. The expression of Hsp27 and alpha ?- crystallin was reduced in Hsf1 knockout
brain regions (Santos et al., 2004).
Sensory Organ and Eye Development. During the early post-natal period, the
Hsf1 null mice display severe atrophy of the olfactory epithelium, increased cell death of
olfactory sensory neurons, and increased expression of the Lif gene. In contrast, this
phenotype was rescued to some extent by the inactivation of Hsf4. Decreased expression
of levels of Hsp25, Hsp70, and Hsp90 were detected in the Hsf1 null olfactory epithelium
(Takaki et al., 2006). Hsf4 is required for normal cell growth and differentiation during
mouse lens development. Hsf4-null mice had abnormal lens fiber cells containing
inclusion-like structures, due to the decreased expression of gamma-crystallin, which
maintains protein stability. Lens epithelial cells of in null Hsf4 mice increased
24
proliferation and premature differentiation, which is associated with increased expression
of growth factors, Fgf-1, Fgf-4, and Fgf-7. The fact that Hsf1 competes with Hsf4 for the
expression of Fgfs not only in the lens but also in other tissues, indicates that HSF1 and
Hsf4 are involved in regulating expressions of growth factor genes, which are essential
for cell growth and differentiation (Fujimoto et al., 2004).
1.5 Possible physiological relevance of interaction between Msx and Hsf.
Tissue regeneration and wound healing: Msx plays an important role in limb
regeneration and wound healing. Msx2 expression is down-regulated at late stages of
limb development, but is re-expressed within one hour after limb amputation. Msx-2 is
also re-expressed during wound healing (Carlson et al., 1998; Koshiba et al., 1998).
Interestingly when linear incisions were introduced on the skin of rats, all heat shock
proteins (hsp72, hsp47, and hsp32) increased expression both in the dermis and epidermis
(Keagle et al, 2001).
CNS development: Msx1 disruption leads to a defective SCO (subcommissural organ)
(i.e. lack of glycoprotein synthesis), and subsequent hydrocephalus in ventricles. The
hydrocephalus phenotype also occurs in the absence of aqueduct stenosis in the Msx1
homozygote (Bach et al., 2003; Ramos et al., 2004). Interestingly, Hsf2 null mice were
shown to exhibit enlarged ventricles (Chang et al., 2006). It is possible that the
hydrocephalus in ventricles in Msx1 null mice could be caused by the compensatory
enlargement of cerebral ventricles as a consequence of brain parenchymal hypoplasia

Lens development: In Msx2 null mice, the lens is absent or small (unpublished). The
proliferation of the lens cell was modulated by Msx2 resulting in premature
25
differentiation of the lens. Hsf4-null mice had abnormal lens fiber cells containing
inclusion-like structures. Association of increased expression of growth factors Fgfs,
cause increased proliferation and premature differentiation (Fujimoto et al., 2004). The
relationship of Msx and Hsfs, especially with Hsf4 based on the similar phenotype in lens
development remains to be explored?
The developmental role of Hsfs proteins demonstrates that a distinct regulatory
mechanism is in place to activate Hsfs under non-stressed physiological conditions.
However, it is unclear how Hsfs can be activated under non-stressed conditions in cell
cycle, during cell differentiation and in embryonic development. The coincidence of
shared similarities in developmental phenotypes among Msx and Hsfs mutants and co-
expression pattern in response to tissue damage may indicate a genuine molecular
interaction between these two protein families in regulating normal physiological
processes.
In the current study, I present evidence demonstrating that, by modifying Hsf1
and Hsf2, Msx1 and Msx2 are potent transcriptional activators of the stress response
pathway in the absence of any stress stimuli. To achieve transcriptional activation, Msx
proteins would bind to Hsf1 and Hsf2 with their homeodomain. Binding Msx to Hsf1
and Hsf2 would facilitate nuclear import of Hsfs and recruitment of additional co-
activator(s) by employing their conserved carboxyl termini, in order to modify, activate,
and initiate Hsfs to their downstream target gene expression.

26
Chapter 2: Establishing an transcriptional model system for studying
Msx activation function
2.1 Rationale for Experiment
The current view on the Msx is that Msx genes control the developmental
processes through transcriptional suppression. However, given the fact that Msx proteins
have been shown to suppress as well as to activate transcription of many gene targets in
the Msx knockout and over-expression mice, it is most likely that Msx proteins can also
function as transcriptional activators. To test this hypothesis, we first need to identify a
promoter system that will respond positively to Msx induction. We studied several gene
promoters for their transcriptional activities in responding to Msx1. Most of them showed
transcriptional repression up to 70-80 % (Fig.4).

Figure4 Msx generally functions as transcriptional suppressor.
Co-transfection of Msx1 expression plasmids with Msx2, perp1, or SV40 promoter
reporter plasmids into C2C12 cells resulted in about significant repression of
transcriptional activity in individual promoters.
27
It has been shown that Msx1 and Msx2 can activate cyclinD1 expression as a
strategy to maintain cells in an undifferentiated state by preventing cells from exiting the
cell cycle (Hu et al., 2001). Hsp70 is one of the downstream target genes of CyclinD1
(Lamb et al., 2003). The Hsp70 promoter has been widely used as a basal promoter for
studying enhanced activity in transgenic mice (Kothary et al., 1989). Therefore, I tested
transcriptional activities of Hsp70 promoter with and without the Msx1 protein.
Intriguingly, I found that this Hsp70 promoter positively responded to the induction by
Msx1. By utilizing the Hsp70 promoter system, I characterized cis- DNA elements that
mediated transcriptional activation by Msx1 proteins, and further identified the trans-
factor, transcriptional factors that cooperate with Msx proteins to activate transcription.
2.2 Experimental results
2.2.1 Msx enhances transcriptional activity of Hsp70 promoter
To measure the transcriptional response of mouse Hsp70 gene promoter induced
by Msx1 protein, I transfected a LacZ reporter vector which was driven by a 650bp DNA
fragment of Hsp70 promoter (Fig 5A), with Msx1 expressing plasmids in C2C12 cells.
The transcriptional activity of Hsp70 promoter was enhanced by Msx1 protein (Fig 5B,
5C). This Msx1-induced Hsp70 promoter activation could also be duplicated when we
co-transfected into C2C12 cells the Msx2 expression plasmid and the Hsp-650 reporter
although Msx2 induced transcriptional activity was slightly reduced in magnitude. The
transcriptional activation by Msx proteins occurred not only in C2C12 cells, but also in
primary Mouse Embryonic Fibroblasts (MEFs) (Fig 5C).
28
In order to understand the underlying molecular mechanism of Msx-dependent
gene activation, we examined the transcriptional response of this 650bp DNA promoter
fragment of the mouse Hsp70 gene to Msx induction. To determine if Msx1-induced
gene activation is gene dosage dependent, we co-transfected into C2C12 cells the 650bp
Hsp70-lacZ reporter plasmid (Hsp-650) with increasing amounts of Msx1 expression
plasmid. Results from this co-transfection experiment revealed that Msx1 can directly
influence Hsp70 promoter activity in a gene dosage dependent manner. A remarkable
linear correlation between the magnitude of promoter activation and the amount of
exogenous Msx1 introduced is depicted in (Fig 5D). Every two-fold increase in the
amount of transfected Msx1 induces a corresponding doubling in the reporter gene
activity.
In order to determine the mechanism of Msx-dependent gene activation, a series
of nested deletion was then constructed to determine cis-regulatory sequences that are
required for Msx-dependent trans-activation (Fig 5E). Two major cis-regulatory domains
were identified: the first one is embedded between nucleotides -650 and -310 and the
other spans between nucleotides -205 and -90. An approximately 66-fold increase in
beta-galactosidase reporter activity was observed when the full-length (Hsp-650)
construct was co-transfected with the Msx1 expression plasmid. Removal of 290bp (Hsp-
310) from the 5¡ end of Hsp-650 resulted in about 2.5 fold reduction in transcriptional
activity (Figure 4E), suggesting that one or more positive cis-acting regulatory element(s)
are embedded between nucleotides -650 and -310. Deletion of either 395bp or 445bp
from the 5¡ end of Hsp-650 (Hsp-260 or Hsp-205, respectively) did not significantly alter
the Msx1-dependent transcriptional activity in comparison to the Hsp-310 reporter
29
construct. Further deletion of 50bp from nucleotide -205 (Hsp-160) resulted in an
approximately 4.3 fold reduction in transcriptional activity, hinting the existence of
additional positive cis-regulatory sequences between nucleotides -205 and -156. Further
deletion of 66bp from -156 (Hsp-90) totally abolished Msx-dependent transcriptional
activity (Fig 5E). This 90bp Hsp70 promoter fragment (Hsp-90) was thus designated as
the basal promoter (Fig 5E).

30

Figure5. Activation of Hsp70 promoter by the Msx1 and Msx2. (A) Schematic of the
650bp Hsp70 promoter-LacZ reporter construct used in transient transfection assays. (B)
The Hsp70 promoter responded robustly to the induction by Msx1 and Msx2 in C2C12
cells. (C) Co-transfection of Msx1 with the Hsp70-reporter construct also resulted in the
transcriptional induction of the Hsp-70 promoter in primary MEFs. (D) The Hsp70
promoter showed dose-dependent response to Msx1. (E) A series of promoter deletion
constructs (left) was made to map cis regulatory sequences that responded to Msx
induction (right). A 205bp hsp70 promoter fragment was found to be sufficient in
responding to the induction by the Msx1. C2C12 cells were co-transfected with 100 ng of
individual Hsp70 deletion-reporter plasmids and 300 ng Msx1-3xFlag expression
plasmids or an empty control plasmid. Beta-galactosidase activities were normalized to an
internal control expressing luciferase. Each transfection was performed in triplicates with the
standard error shown.

31

Once we identify Hsp70 promoter as positively response target of Msx proteins,
we verified if this response is directly regulated by Msx protein or secondly regulated by
CyclinD1. Msx1 can induce the expression of Cyclin D1 (Hu et al., 2000) and Cyclin D1
was shown to activate the expression of HSP70 (Lamb et al., 2003). To study the
possibility that Cyclin D1 may be involved in Msx1-dependent transcriptional activation
of Hsp70, co-transfection experiment was performed in wildtype (Cyclin +/+) MEFs and
Cyclin D1 deficient (Cyclin D1-/-) MEFs (Sicinski et al., 1995). Although Msx1-
dependent activation of the Hsp-650 promoter in these MEFs showed a significant
reduction in the magnitude of induction, presumably due to cell-type specific
transcriptional response, the absence of Cyclin D1 did not alter the magnitude of the
response to transactivation by Msx1 when comparing to transcriptional response in the
Cyclin D1+/+ MEFs(Fig 6). Thus, the transactivation of Hsp70 promoter by Msx1 is
independent of Cyclin D1.

Figure6. The transactivation of Hsp70 promoter by Msx1 is independent of
Cyclin D1. 100 ng of Hsp205-LacZ reporters with 300 ng Msx1 or pIRES-hrGFP-1a
were co-transfected into wild and cyclinD1 (-/-) cells. The experiments were
performed in triplicate, and the standard error is shown.

32

2.2.2 Msx1-dependent trans-activation does not require direct DNA binding by
Msx1
To further define cis-acting elements between nucleotides -205 and -90 that may
function in synergy with Msx1, we focused on several known transcriptional factor
binding sites: two heat shock elements (HSE) (from nucleotides -206 to -177 and -118 to
-97), one potential Msx consensus binding site (between nucleotides -154 and -146) and a
NF-KappaB binding site (between nucleotides -137 to -123) (Fig 6A).
Msx protein can bind DNA through its consensus binding site. It is possible that
Msx1 may transactivate Hsp70 promoter via a mechanism that is depended on DNA
binding of Msx1 homeoprotein on the single Msx-like consensus binding site (from
position -157 to -152) in the Hsp70-210 promoter.
To determine if DNA binding is required for transcriptional activation by Msx1,
the Msx consensus binding site between nucleotides -154 and -146 was removed from
Hsp-160 to generate the Hsp-150 reporter constructs. Co-transfection of either the Hsp-
160 reporter construct with intact Msx consensus binding site or the Hsp-150 reporter
constructs that lacked the Msx consensus binding site produced similar transcriptional
response (Figure 7A, 7B). This means that the Msx DNA binding site is not required for
the transactivation of the Hsp70 promoter.
To further rule out the possibility of cryptic binding activity, a Msx1 mutant
(Msx1-A) (Shang et al., 1994) that lacks the DNA binding activity was generated and co-
33
transfected with Hsp-205. The Msx1 mutant could still function as a potent
transcriptional activator (Fig 7C).
These results imply that Msx1 can activate transcription through interaction with
other molecular partners.

Figure7. Msx1-dependent activation of the Hsp70 promoter does not
require its DNA binding activity. (A) Sequence and putative factor binding
elements within the 205bp upstream of the Hsp70 promoter. Two HSF elements,
one Msx putative binding site, and one NF-kappaB binding site are shown. (B)
The Msx binding site is not required for the induction of Hsp70 promoter
activity by Msx1. Removal of the Msx consensus binding site didn¡t affect the
transcriptional response of the Hsp70 promoter as transcriptional activities
between the Hsp-160 and Hsp-150 failed to show significant difference. (C) Co-
transfection of a non-DNA binding Msx1 mutant (Msx1-A) did not alter the
ability of the mutant protein to transactivate the 205bp Hsp70 promoter-reporter.
All transfections were performed in triplicates.

34

2.3.3 Msx1-dependent trans-activation requires heat shock response elements
The Hsp70 promoter contains two heat shock elements (HSEs), one is designated
distant HSE (dHSE) and the other proximal HSE (pHSE) (Fig 8A). Unexpectedly, a
deletion of the distal HSE (Hsp-180) resulted in a 50% reduction in Msx1-dependent
transcriptional activity (compare Hsp-205 with Hsp-180, Figure 8B). Removal of both
of these Heat Shock elements (Hsp150-120) totally abolished Msx1-dependent activation
(Figure 8B). These results indicated that HSEs are critically important in mediating
Msx1-dependent transcriptional response.
Moreover, mutations that destroyed the NF-kappaB binding site (Hsp-150m) by
three nucleotide mutations (GGG->AAT) resulted in a greater than two-fold reduction in
Msx1-dependent activation of the Hsp70 promoter (Figure 8A, 8B). So NF-KappaB site
also contributes to the Hsp70 promoter activation by Msx1.

35

2.3 Conclusion and Discussion
We demonstrated that Msx proteins can be potent transcriptional activators in the
context of the murine Hsp70 promoter. We also demonstrated that Msx-dependent
transactivation does not require its DNA binding function. Subsequent analysis of the
Hsp70 promoter uncovered a critical need for heat shock factor binding sites and NF-
kappaB binding sites to mediate the transactivation function of Msx proteins.
Figure 8. Heat Shock Elements are required for msx1-dependent activation of
the Hsp70 promoter. (A) A schematic representations of Hsp70 promoter reporter
deletion constructions. HSE1 and HSE2 correspond to Heat shock factor binding
sites. Three nucleotide were changed in the NF-kappa B site indicated by lower-case
letters. The striped rectangle indicates the position of the TATA box. (B). Deletion
of the distal HSE (Hsp-180) lead to a 50% reduction in Msx1-stimulated transcriptional
activity; removal of both HSEs (Hsp150-120) totally abolished the Msx1-dependent
promoter activity. Three nucleotide replacement in NF-Kappa B binding site resulted in
an approximately 3 fold reduction in Msx1-dependent activation of the Hsp70 promoter. All
transfections were performed in triplicates.

36
We ruled out Cyclin D1 as a mediator in Msx-dependent transcriptional activation.
Although in the beginning, we reasoned that the Hsp70 promoter may serve as an
activation system through Cyclin D1. We also ruled out the role of DNA binding activity
of Msx proteins in transactivation. Therefore, Msx proteins must form a protein complex
with other factors to activate the transcription. What is/are the protein co-factor(s)
involved in Msx transactivation? What protein domains in Msx proteins are required for
the transcriptional activation and the interaction with the co-factors?
Based on results from promoter analysis, heat shock factors are required for
transcriptional activation by Msx proteins. Several transcriptional factors can recognize
and bind to HSE. HSFs are one of the potent factors; C/EBP alpha and beta also bind to
this cis-element through the DNA motif over-lading with HSE. Besides HSE, the NF-
kappaB binding site also contributes to the activation of Msx. In order to get a better
understanding of the mechanism behind the Msx activation function, it is necessary to
identify which protein(s) co-operates with Msx and activates the Hsp70 promoter.

37
Chapter 3: Molecular characterization of Msx protein domain required
for the transactivation function
3.1 Rationale for Experiment

Since the transcriptional activation function of Msx1 and its DNA binding
function are separable, it is most likely that these functional domains are mirrored on its
primary structure. Previous studies have mapped the suppression function of Msx
proteins to different conserved domains. The homeodomain of Msx was shown to
physically interact with TBP, the core component of the RNA polymerase II complex.
The binding of Msx to TBP directly suppresses RNA polymerase II activity (Catron et al.,
1995) which may explain the generalized suppression activity of Msx proteins. An N-
terminal conserved domain of Msx1 binds to Histone 1b. Msx1/H1b complexes alter the
chromatin structure surrounding the MyoD promoter and render it transcriptionally
inactivate (Lee et al., 2004). The binding of the Msx C-terminus domain with Pias1
enhances the suppressor function of Msx1 on the MyoD (Lee et al. 2006).
What protein domains in Msx proteins are required for the transcriptional
activation function? Based on the transcriptional activation on the Hsp70 promoter
system, I further dissected the Msx protein to identify protein domains that contribute to
transcriptional activation of the protein.
3.2 Experimental results
3.2.1 The Msx1 activation domain resides in its C-terminus
38
To identify a functional domain that is required for transcriptional trans-activation,
a series of Msx1 deletion mutants was constructed (Fig 9A). These deletion mutants
were co-transfected into C2C12 cells along with the Hsp-205 reporter. Removal of N-
terminal domains (Msx1 163-303) failed to induce significant changes in Hsp-205
reporter activities (Fig 9A). This means that only homeodomain and C-terminus is
sufficient to promoter transcriptional activation. And deletion of the homeodomain
(Msx1 1-172) or removal of 67 to 25 residues (Msx1 1-236 or Msx1 1-278) beyond the
homeodomain resulted in a major reduction in transcriptional activity (Fig 9A), indicating
the critically importance of the C-terminus in conferring transactivation activity.

39

3.2.2 The transactivation domain is highly conserved
In order to further define the activation domain, a Clustal W multi-sequence
alignment was performed by aligning together all vertebrate Msx homologous protein
Figure 9. The transcriptional activation activity resides in the C-terminal domain
of Msx proteins. (A) Schematic representations of the full-length and deletion
mutants of Msx1 and Msx2. Areas that shaded gray represent Msx conserved regions
and areas that shaded black correspond to the homeodomain. Removal of the C-
terminal domain in both Msx1 and Msx2 protein leaded to a significant reduction in
reporter activity. (B)The C-terminal domains are highly conserved among Msx1 and
Msx2 proteins in vertebrates. Vertebrate Msx1 and Msx2 protein sequences from
lamprey to human were aligned using Cluster W algorithm. Identical amino acids were
highlighted in gray. (C) Msx mutants that were transfected into C2C12 cells were
stably translated. To demonstrate that transfected Msx mutants were expressed and
presented stably in cell lysates, Flag-tagged Msx1 mutants were detected on western
blots using the anti-Flag antibody. All transfection experiments were performed in
triplicates.

40
sequences ranging from lamprey to human. Besides the homeodomain, a highly
conserved 26 amino acid sequence was identified in the C-termini of all Msx1 and Msx2
proteins (Fig 9B). Alignment with the mouse Msx3 revealed less evolutionary sequence
conservation within this 26 amino acid sequence. Thus this is a unique feature shared
among Msx1 and Msx2 proteins. Unlike common acidic activation domains, the Msx1/2
activation domain is sparse in charged amino acids and is rich in Proline and
Tyrosine. We designated this highly conserved domain the Msx activation domain (C-
terminal). To demonstrate its conserved role in conferring transcriptional activation
function, 34 amino acids inclusive of C-terminal was removed from the mouse Msx2
protein (Fig 9A). Removal of C-terminal from Msx2 caused a 38-fold reduction in
transcriptional activity in comparison to the full length Msx2, demonstrating the necessity
of the C-terminal in the transcriptional induction of the Hsp70 promoter (Figure 9A).
3.2.3 Identify the key amino acid required for the transactivation in activation
domain.

To identify the key amino acids located in C-terminus of Msx proteins that are
required for activation, we generated point mutations in the activation domain of human
MSX1 on the basis of the Msx1/Msx2 domain comparison. Relying on recent findings
from human genetic study that G267C and P278S point mutations in the C-terminus may
cause cleft plate in human, we tested to determine if these mutants have any effect on the
transcriptional function of MSX1 protein. Unfortunately, we failed to detect any
difference in ability of these mutants to transactivate the Hsp70 promoter (Fig 10A).
41
The conserved activation domain has a repetitive amino acid pattern:
LP¡.PGLY¡ .GY¡Y.L. We use PELE, a protein secondary structure prediction
program in San Diego Supercomputer Center¡s Biology Workbench (Subramaniam, 1998)
to guide our selections for point mutations that will potentially change structural
conformations. The C-terminus of Msx protein will form coil and beta-strands predicted
by the program. Disruption of the secondary structure may affect the protein-protein
interaction and result in decreasing transcriptional activity.
We deleted the last thirteen amino acids (MSX1-290) to disrupt the repeat pattern
in order to alter domain structure. Disruption of this repeating pattern led to a reduction in
transcriptional activity by 2/3 (Fig 10B), so the key amino acids required for
transactivation should be located in the last thirteen amino acids of the C- terminus of
MSX1 protein. We also replaced conserved Proline residues (Pro284 and Pro287) with
Alanine to alter protein folding from Coil to Alpha-helices (named Msx1-2PA), but both
Proline residues are not required for activation (Fig 10B). Three hydrophilic Tyrosine
residues are bordered by nearby hydrophobic amino acids, and Tyr is important for
hydrophilic interactions between proteins by forming the hydrogen bond. We introduced
three amino acid changes (Tyr291Phe, Tyr297Phe, Tyr300Phe) (named Msx1-3YF) to
alter hydrogen bonds, but these changes didn¡t alter the transcriptional activity of HSP70
promoter when compared with wild type Msx1 protein (Fig 11B).
42

3.2.4 Homeodomain acts in synergy with the C-terminus in transactivation
Previous studies have shown that Msx homeodomain tethers to variety of protein
complexes in addition to providing nuclear localization signal and DNA binding activity
(Shang et al., 1994; Catron et al., 1995; Zhang et al., 1996, 1997; Newberry et al., 1997;
1999; Bendall et al., 1998; Shetty et al., 1999; Zhou et al. 2000; Hassan et al., 2004; Park
et al., 2005; Rave-Harel et al., 2005; Lee et al., 2005, 2006; Ogawa et al., 2006). In order
Figure 10. Identifying the key amino acids in the C-terminal domain required for
the Msx activation function. (A) Hsp-205 LacZ was co-transfected with wild-type
Msx1, hMSX1 and hMSX1 mutant plasmids into C2C12 cells. Both G267C and
P278S are not required for transactivation of Hsp70 promoter. (B) Hsp-205 LacZ was
co-transfected with wild-type Msx1, Msx1-290, Msx1-2PA, or Msx1-3YF mutant
plasmids into C2C12 cells. Deletion of last thirteen amino acids from the C- terminus
of Msx1 protein resulted in almost 3 fold reduction in transcriptional activation, while
Msx1-2PA and Msx1-3YF mutants did not alter the transcriptional activation activity.
All transfection experiments were performed in triplicates.

43
to determine the role of homeodomain in conferring trans-activation function and in
bestowing the specificity of activation, we replaced the Msx1 homeodomain with the
Dlx5 homeodomain (Msx1-DLX5HD) since Dlx5 was shown to dimerize with with Msx
proteins through its homeodomain (Zhang et al., 1997). Co-transfection of Msx1-
DLX5HD with the Hsp-205 reporter showed increased potency of the chimeric protein in
activating the Hsp70 promoter (Figure 11A, 11B). Since the homeodomains of Dlx5 and
Msx1 are evolutionarily divergent as they only shared 57% amino acid identity, this
protein domain may not be providing specificity for interaction with partnering proteins
but rather in controlling the magnitude of transcriptional response.

Figure 11. Homeodomain provides transcriptional enhancement. (A) Schematic of
replacement of Msx homeodomain (black) with Dlx5 homeodomain (striped rectangle).
(B) Removal of the homeodomain (Msx1 232-303) resulted in a significant reduction in
the magnitude of transcriptional stimulation in comparison to Msx1 163-303 which
contains the homeodomain. Replacement of the Msx1 homeodomain with the Dlx5
homeodomain restored the activation potency. 100 ng of Hsp205-LacZ reporters with
300 ng Msx1 mutant derivatives, Msx1-Dlx5HD or pIRES-hrGFP-1a were co-transfected
into C2C12 cells. Transfections were performed in triplicates, and the standard error is
shown.

44
3.3 Conclusion and Discussion

In contrast to their suppressor functions that was previously mapped to the N-
termini and the homeodomain of Msx1 and Msx2 (Towler et al., 1994; Catron et al., 1006;
Ryoo, et al ,1997; Bendall et al. 2000; Lee et al., 2004; ), our study placed the activation
domain in the C-termini of Msx proteins. The C-terminal domain is critical for Hsp70
promoter activation. This was demonstrated by the lack of promoter activity when the
Msx1 C-terminal deletion mutants (Msx1 1-172, Msx1 1-236 and Msx 1 1-278) were co-
transfected with the Hsp70 promoter-reporter. It is necessary for the activation function
of Msx proteins to embody the homeodomain, since a truncated version of Msx protein
with only the homeodomain and the C-terminus can fully transactivate the Hsp70
promoter. The role of the homeodomain in boosting transcription was further
demonstrated by the replacement of Msx homeodomain with its counterpart from Dlx5.
The C-terminal domain consists of 26 amino acid residues and is uniquely
conserved among Msx1 and Msx2 members of the broader Msh gene family. Results
from co-transfection experiments did not show significant differences between Msx1 and
Msx2 in activating the Hsp70 promoter. This indicates that these proteins are
functionally equivalent in the context of the Hsp70 promoter activation.
To analyze the C-terminal domain, we tried to identify the key amino acids
required for the activation function by deletion and point mutations based on the
conserved sequence alignment. Because a deletion of a short sequence at the C-terminus
greatly diminished the ability of Msx to transactivate, it was concluded that the key
amino acids had to exist within the last thirteen amino acids.
45
The point mutant on Proline 284 and 287 was predicted to disrupt the secondary
structure of C-terminus, but they failed to affect the transcriptional activation, indicating
that these Prolines may be involved in other functions of the C- terminus (the interaction
with Pias1, or in palatogenesis). To our surprise, no change in transcription had occurred
when we replaced three Tyrosine residues with Phenoalanine. The reason is perhaps due
to the 6-carbon aromatic ring in Tyr and Phe. The six carbon aromatic ring in Tyr may
have more importance than the hydroxyl group, although the hydroxyl group can be
phosphorylated and sulfated. To further demonstrate this hypothesis, point mutants need
be induced by replacing the aromatic ring with alanine.
Interestingly, Abate-Shen and coworkers (Lee et al 2006) recently localized a
Pias1 interaction surface to the Msx C-terminal domain. Pias proteins function as an E3
ligase for sumoylation (Kahyo et al 2001). They demonstrated that Pias1 selectively
forms complex with Msx1. This complex enhances Msx1¡s ability to seek and bind its
cognate DNA binding sites to the core enhancer region of the MyoD promoter in order to
suppress MyoD transcription (Lee et al 2006). Thus, the deletion of the Pias1 interaction
domain, the equivalence of the C-terminal domain disrupted the transcriptional
suppressor function of Msx1 and interfered with its ability to inhibit myoblast
differentiation. This demonstrates the critical importance of the C-terminus in
modulating transcriptional events as well as in controlling differentiation (Lee et al
2006). Human genetic studies have shown that two mutations, G267 and P287 exist in
individuals with nonsyndromic cleft lip/palate (Tongkobpetch et al 2006). These
evidences support the significant role of the C-terminus of Msx protein in regulating
developmental processes.
46
Chapter 4: Mechanisms of Activation regulated by Msx protein
4.1 Rationale for Experiment

Results from the Hsp70 promoter system clearly indicated that Msx1/2 activate
transcription via a mechanism that is not dependent on their binding to the Msx binding
site on the promoter. Removal of the Msx consensus binding site from the Hsp70
promoter did not abolish transcription. Additionally, transfection of a DNA binding
defective mutant (Msx1-A) also did not abolish transcription. These indicate that Msx
proteins activate Hsp70 promoters by forming activator complexes with other nuclear
proteins. Identification of the binding target for Msx proteins would significantly
contribute to the understanding of the mechanism that involves transcriptional
activation by Msx.
Msx1-induced transcription was dependent on functional HSEs. At least two
transcriptional factors can bind with HSEs. One of which was Heat shock transcriptional
factor (Hsfs), and the other was C/EBP-beta (Lamb et al., 2003). I had conducted a series
of experiments to demonstrate that Hsfs interact with Msx to perform transcriptional
activation function and the role of C/EBP-beta protein was ruled out in Msx activation
function.
4.2 Experimental results

4.2.1 Msx stimulated Hsp70 transcriptional response is identical to heat induced
response
47
Since Msx1-induced transcription was dependent on functional HSEs, it is likely
that Msx1 evoked a heat shock-like transcriptional response in the context of the Hsp70
promoter. To confirm this possibility, various Hsp70-reporters were transfected with or
without the Msx1 expression plasmid. Transfected cells were then grown either at 37
o
C
or 42.5
o
C. Intriguingly, cells that have received heat shock treatment exhibited virtually
identical sets of transcriptional response to cells that were transfected with Msx1 but
cultured at 37
o
C (Figure 12A). Based on these results we hypothesized that Msx proteins
induce Hsp70 promoter activity by evoking a similar transcriptional mechanism as the
heat shock response.

48

4.2.2 Inhibiting the Hsf1 transactivation function blocking the Msx transcriptional
activation.
To determine if Msx-dependent activation of Hsp70 promoter is mediated through
Heat Shock Factors (Hsfs) that are known to activate transcription of Hsp70 through
Figure 12. The Msx-dependent activation of the Hsp70 promoter is similar to
the Heat Shock response. (A). To Heat shock C2C12 cells, 12 hours after
transfection of reporter plasmids, transfected cells were incubated in 42
o
C for 6
hours. Cells were then harvested and cell lysate were used for measuring the reporter
activity. The beta-galatosidase reporter activities showed remarkable correlations
between Msx1-stimulated activation and heat shock induced activation. The heat
shock induced transcriptional response is presented as a ratio of reporter activities
due to the heat shock vs reporter activity without exposure to heat shock. The
Msx1-induced transcriptional response is presented as a ratio of reporter activities
from cells that received Msx1 transfection vs. cells that received vector only
transfection. (B). Addition of Triptolide abrogated the Msx1-induced transcriptional
activity. C2C12 cells were co-transfected with the Hsp-650-LacZ reporter and
pMsx1-3xflag, and were then sequentially treated with the indicated concentrations
of triptolide. Msx1 lost virtually all of its transcriptional inductive function in the
presence of 100nM Triptolide.

49
HSEs, we decided to use a known chemical inhibitor of Hsf1, triptolide, to block Hsf1
mediated transcriptional activity without impinging on its ability to move to the cell
nucleus. Triptolide has previously been shown to specifically inhibit the transactivation
function of Hsf1 on the Hsp70 promoter without affecting the DNA binding activity of
trimeric Hsf1 to the HSEs (Westerheide et al., 2006). In the presence of triptolide, Msx1-
dependent transactivation of Hsp70 promoter (Hsp-650) was thwarted
considerably. Only a residual amount of transcriptional activity remained when Msx1
was co-transfected with Hsp-650 in the presence of 100nM Triptolide (Figure 12B).
4.2.3 Msx proteins stimulate Hsp70 promoter activity by interacting with and
modifying Heat Shock Factors.
Because Msx1-dependent activation of Hsp70 promoter requires heat shock
elements, and Msx stimulated Hsp70 transcriptional response is identical to heat induced
response, it is highly likely that Msx1 activates transcription by forming activating
complexes with Heat Shock Factors, such as Hsf1 and/or Hsf2. Co-immunoprecipitation
was performed to demonstrate physical interactions between Msx proteins and Hsf
proteins in vivo. Immunoprecipitation by using an anti-Hsf1 antibody and western
blotting using the anti-Flag antibody demonstrated that both the full-length Msx1 and
Msx1 (1-278), which is the activation domain deletion mutant, could bind Hsf1 (Fig 13A).
We found that the anti-Hsf1 antibody pulled down the full-length as well as Msx1
mutants that contained the homeodomain (Fig 13A), while Msx1 (1-172) which is
without the homeodomain failed to immunoprecipitate Hsf1. These results indicate that
Msx1 interact with Hsf1 through its homeodomain. We also performed
50
immunoprecipitation using the anti-Flag antibody and probed using the anti-Hsf1
antibody to reconfirm the physical interactions between Hsf1 and Msx proteins, (Fig
13B).
To explore why the full length Msx protein could activate Hsp70 promoter while
the activation-domain deletion mutant of Msx could not, we transfected plasmids
carrying a Flag-tagged full-length or truncated Msx cDNAs and then performed
immunoprecipitation using the anti-flag antibody and probed western blots to detect Hsf1
proteins (Fig 13B). We detected a unique 95kD Hsf1 band corresponding to the activated
form of Hsf1 when we performed pulled down using Msx1 full length and Msx1 163-303
protein; whereas a smaller 75kD band that corresponds to the unmodified Hsf1 monomer
was pulled down by its binding to Flag-tagged Msx1 activation-domain deletion mutant
(Fig 13B). These results demonstrated that the physical contact between Msx1-Hsf1 is
mediated by the Msx homeodomain and that only the full length Msx protein can interact
with Hsf1 and activate it. Moreover, these results suggest that C-terminal domain may be
involved in the activation of Hsf1 perhaps by recruiting cofactors that are required for
Hsf1 activation.
Besides binding to Hsf1, we found that both Msx1 and Msx2 also physically
interact with Hsf2. To demonstrate this, C2C12 cells were transfected with Flag-tagged
Msx1 or Msx2 mutant expression plasmids. This was followed by immunoprecipitation
using a rat anti-Hsf2 antibody (Fig 13C). Immunoprecipitated proteins were blotted and
probed with the anti-Flag antibody. Hsf2 pulled down Msx1 and Msx2 with similar
efficiency, indicating that Hsf2 can also physically interact with Msx1 and Msx2.
51

Figure 13. Msx proteins and Hsfs physically interact in vivo. C2C12 cells were
transfected with expression plasmids encoding Msx1-3xflag, Msx1 mutants, or Msx2-
3xflag. Cell lysate were immunoprecipitated with the anti-HSF1 or the anti-HSF2 antibody
and resulting western blots were then probed with anti-Flag antibody. Simultaneously,
immunoprecipitation using the anti-Flag antibody and immunoblotting employing the anti-
HSF1 and the anti-HSF2 antibody were also performed. (A) Msx1 binds to Hsf1 through its
homeodomain. Msx1 mutants that contain the homeodomain without either the N-terminal
domain (Msx1 163-303) or the C-terminal domain (Msx1-1-236) immunoprecipitated
endogenous Hsf1, while a mutant without the homeodomain (Msx1 1-172) failed to
immunoprecipitate endogenous Hsf1. (B) The Msx1 wildtype protein (Msx1 wt) and the
Msx1 163-303 mutant which contains both the homeodomain and the C-terminal domain
immunoprecipitated both the modified Hsf1 (activated) and unmodified Hsf1 (inactivated).
However, the Msx11-278 and Msx1 1-172 that lack the C-terminal domain failed to
immunoprecipitate activated Hsf1. (C) Hsf2 physically interacts with both Msx1 and Msx2.
Flag-tagged Msx1 and Msx2 can be immunoprecipitated using the anti-HSF2 antibody.

52
4.2.4 Nuclear translocation of Hsfs stimulated by Msx proteins.
The stress-induced re-localization of Hsf1 into nuclear stress granules in nucleoli
has been suggested to be an important control step in the regulation of stress response and
cellular homeostasis. Stress-induced Hsf1 granules have been

found in all investigated
primary and transformed human cells

but not in rodent cells. The appearance

of stress
granules correlates positively with the inducible phosphorylation

and transcriptional
activity of HSF1(Sarge et al., 1993; Mivechi et al.,

1994; Cotto et al., 1997; Jolly et al.,
1999, Holmberg et al., 2000 ; Alastalo, 2003). Becaue Msx protein can transactivate the
Hsp70 promoter through Hsfs, Hsfs had to be shuttled into the cell nucleus in the
presence of increased amount of Msx proteins. In C2C12 cells, immunofluorescence
staining with anti-Hsf1 antibody showed that Hsf1 is present in the cytoplasm as well as
in the cell nucleus but is excluded from nucleoli in the absence of exogenous Msx2 or
stress stimuli (Fig 14A). Expression of exogenous Msx2-GFP resulted in an increased
accumulation of Hsf1 in cell nuclei, similar to the effect when cells received heat shock
(Fig 14A). In contrast to the intracellular distribution patterns of Hsf1, Hsf2, which is
exclusively a cytoplasmic protein in the absence of stress stimuli or exogenous Msx2,
became translocated from cytoplasm into the cell nucleus and co-localized with the
Msx2-GFP fusion protein (Fig 14C 14D), which was similar to the translocation of Hsf2
from cytoplasm to nucleus after 2hours heat shock (Fig 14E). The ability of Hsf2 to move
from the cytoplasm into the nucleus does not require the C-terminal domain for the
forced expression of the C-terminal domain deletion mutant, Msx2-233-GFP, did not
block nuclear translocation of Hsf2 (Fig 14F).
53

Figure 14. Overexpression of Msx2 facilitated nuclear translocation of Hsf2
and enhanced nuclear accumulation and distribution of Hsf1.
54

4.2.5 DNA binding activity of Hsfs can be enhanced by Msx proteins.
Msx proteins can enhance Hsfs transcriptional activity by modifying Hsfs, and
facilitate their nuclear translocation, accumulation in the cell nucleus. Next we analyzed
the DNA binding activity of Hsfs regulated by Msx protein by gel shift assay. C2C12
cells were transfected with GFP; Msx1-wt, Msx1-278, and 3 g nuclear extracts was
incubated with radio-labeled HSE and DNA-HSE complexes were fractionated in a non-
denaturing PAGE gel. In the absence of heat shock treatment, Hsfs-HSE complexes were
readily formed (Fig 15 lane 1, 2, 3) while heat shock treatment enhanced their DNA
binding ability (Fig 15 lane 7, 8, 9). We also observed an enhancement in DNA binding
when we transfected cells with Msx1-wt or Msx1-278 (Fig 15 lane 2, 3 comparing with
lane 1). Unfortunately, Msx1 protein may not be binding with HSE through Hsfs
Figure 14: Continued

C2C12 cells were transfected with plasmids expressing Msx2-GFP or Msx2-233-GFP
(green), visualized by immunofluorescence with the anti-Hsf1 or the anti-HSF2
antibody (red). (A).The endogenous Hsf1 is normally present in the cell nucleus but
excluded from nucleoli (arrowhead). In the presence of Msx2, the distribution of Hsf1
became more diffused throughout the nucleus including the nucleoli (arrow). (B) In
cells exposed to heat shock, Hsf1 immuno-fluorescence in cell nucleus showed greater
intensity indicating increased nuclear translocation (arrowhead). In comparison, Msx2
over-expressing cells also displayed greater intensity of Hsf1 immunofluorescence and
less defined nucleoli in the absence of heat shock (arrow). (C) In C2C12 cells, Hsf2
proteins are mostly localized in the cytoplasm (arrowhead). Overexpression of Msx2-
GFP resulted in the translocation of Hsf2 to the cell nucleus (arrow) reminiscence of
Hsf2 redistribution following heat shock (E). (D) Overexpression of Msx2-GFP
resulted in a co-distribution of Msx2-GFP and Hsf2 in discrete structures of the cell
nucleus. (F) Msx2-233 which lacks the C-terminal domain can also facilitate nuclear
import of Hsf2.

55
complex since we failed to observe a supper shift when we apply the anti-Flag antibody
into the incubation mixture (Fig 15 land 4, 5, 6).

4.2.6 C/EBP-beta DNA binding activity is not required for the activation of Msx
Figure 15. DNA binding activity of Hsf1 regulated by Msx protein. C2C12 cells
were transfected with GFP (lane 1, 4, 7), Msx1-278 (lane 2, 5, 8), Msx1-wt (lane 3, 6,
9). After 24 hours, 3 g nuclear extract were used to perform gel shift assay. Hsfs are
constitutively bound to HSE without heat shock in C2C12 cells (lane 1, 2, 3), and heat
shock treatment will enhance DNA binding (lane 7, 8, 9). Both Msx1-wt and Msx1 and
Msx-278 can weakly enhance the Hsfs DNA activity (lane 2, 3 comparing with lane1;
lane 5, 6 comparing with lane 4). No super gel-shift was observed when anti-Flag
antibody were added (lane 4, 5 , 6). Mixture of nuclear extract and radio-labeled HSE
were incubated for 45 min at room temperature
56
Msx protein induces Hsp70 promoter transcriptional activity and this enhancement
required HSE element on the HSP70 promoter. Beside Hsfs, there some transcriptional
factor with can binding the DNA element overlapping with HSE and stimulate HSP70
promoter activity. We want to know if those transcriptional factors would be involved in
the transcriptional activation by Msx. One of these candidates is C/EBP-alpha and
C/EBP-beta. C/EBP-alpha and C/EBP-beta can bind the Hsp70 promoter; its binding site
overlaps with the Heat shock element. We found that C/EBP-alpha can enhance Hsp70
promoter activity too (Fig 16). Msx2 can bind to C/EBP-alpha to release the C/EBP-
alpha from the promoter of the amelogenin gene and antagonizes C/EBP-alpha¡s activity
on the amelogenin promoter (Zhou et al., 2000). The domain that Msx2 binds to C/EBP-
alpha is located in the C-terminus (spanning the activation domain and the
homeodomain). So that it is possible that the C/EBP alpha or C/EBP-beta binds to the
promoter of Hsp70 and recruits the Msx protein to the promoter resulting the activation
of Hsp70. To address this question, we applied a C/EBP-beta mutant- C/EBP-betaΔspl,
which have DNA binding activity while lacking the activation domain, to compete with
the wild type C/EBP-beta to check if it can reduce the transactivation function of Msx
protein. C/EBP-betaΔspl does compete with wild type C/EBP-beta activity on the Hsp70
promoter, but has no effect on the Msx protein. Our results suggest that the Msx
activation of the Hsp70 promoter does not need the C/EBP DNA binding site on the
Hsp70 promoter (Fig16).
57

4.2.7 Pias1 and the sumoylation regulated by Pias1 didn¡t contribute to the Msx1-
dependent transactivation.
Pias1 is the only known protein that binds to the C-terminal activation domain of
the Msx protein. The interaction of Msx1 with Pias1 is required for Msx1 to function as
an inhibitor of myoblast differentiation through repression of myogenic regulatory genes.
Pias1 enables Msx1 to bind selectively to CER in MyoD promoter (Lee et al., 2006).
Figure 16. C/EBP-beta DNA binding activity is not involved in enhancement of
Hsp70 promoter activity by Msx protein. C/EBP-betaΔspl, a mutant with the
DNA binding domain but without the activation domain, was co-transfected with
Msx1 or C/EBP-beta as well as Hsp210-LacZ reporter. Both Msx1and C/EBP-beta
can enhance the Hsp70 promoter activity. Increase the dose of C/EBP-betaΔspl,
which will compete with the wild C/EBP-beta to bind the promoter, led to decreased
activation by C/EBP-beta, while this competition have not effect on Msx1-induced
activation.
58
Pias1 proteins can function as

E3 ligase for sumoylation by which msx1 can be
sumoylated.
Since the Msx C-terminal domain was shown to physically interact with Pias1 and
Pias2 was shown as a

protein partner for Msx2 (Lee et al 2006; Wu et al 1997), it is
possible that Pias1, recruited by the Msx1 C-terminal domain, may sumoylate the
homeodomain-bound HSF. Previous studies have shown that SUMO-1 modifies HSF1 at
lysine 298 and converts HSF1 to the DNA-binding form (Hong et al., 2001; Hietakangas
et al., 2006; Hilgarth et al., 2004). SUMO-1 can sumoylate HSF2 at Lysine 82 to alter its
DNA binding activity (Goodson et al., 2001; Anckar et al. 2006).
Thus, whether Pias1 is required for the Msx activation on Hsp70 promoter
and whether the modification of Hsfs by Msx proteins is sumoylation need to be
determined.
But Co-transfection Msx1 with Pias1 didn¡t show any synergy between Pias1 and
Msx1 even when increasing dosage of Pias1 were transfected (Fig. 17A). We performed
two experiments to verify if Hsfs have been sumoylated by Mx1 protein. If Hsfs were
sumoylated and if sumoylation is required for transcriptional activation, removal of
SUMO modification will cause a reduction in Hsfs transactivation. A de-sumoylation
factor, Senp1, which is SUMO-specific protease that removes SUMO from substrate
protein, was co-transfected with Msx1. Senp1 did not affect Msx1 ability to transactivate
(Fig 17B). We also didn¡t see any enhancement by co-transfection of Msx1 and SUMO-1
or SUMO-1GG, a non-functional SUMO (Fig 16 B).
59
Next we immunoprecipitated Msx1-Hsfs complex by anti-flag antibody, then detect
the sumoylated protein by using anti-SUMO-1 and anti-SUMO-2 antibodies on western
blots. We detected a unique high molecular weight band on the western blot, but the size
of this SUMOlate protein substrate (about 150 -180kDa) is larger than the modified Hsfs
band (90 kDa) (Fig 17C). Msx1-278 mutant did not precipitate similar SUMOlated
protein substrate. So at lease one protein can be sumoylated by Pias1 recruited by C-
terminals of Msx1. Unfortunately, we didn¡t detect the sumoylation on Hsfs by Msx1.
Thus, Hsfs may be modified by other means.

60

4.2.8 Pax6 co-operate with Msx protein to activate transcription activity

Figure 17. The transactivation function of Msx protein is not required Pias1
and sumoylation on Hsfs. (A) Pias1 and Msx1 were co-transfected into C2C12
cells. Pias1 didn¡t enhance the transcriptional activation of Msx1 protein. (B) Senp1,
SUMO-1 and SUMO-1GG were co-transfected with Msx1 into C2C12 cells. De-
sumoylation by Senp1 failed to reduce Msx1-mediated transactivation activity, and
SUMO-1 also didn¡t enhance Msx1-dependent transactivation function. (C) Western
blotting to detect sumoylation. C2C12 cells were transfect with Msx1(land 1,3,5,7)
and Msx1-278 (2,4,6,8), then immunoprecipitated with the anti-Flag antibody, the IP
products (land 1,2 and land 5,6) and crude cell lysates (land 3,4 and land 7,8) were
run on SDS-PAGE gel, and detect with anti-SUMO-1 antibody (land 1,2,3,4) and
anti-SUMO-2 antibody (land 5,6,7,8). One protein (about 150 kDa) that was co-
immunoprecipitated with Msx1 was sumoylated by SUMO-1. Msx1-278 failed to
pull-down the same sumoylated product.

61
4.2.8 Pax6 acts in synergy with Msx to activate transcription
The finding that Msx and Hsfs function together as coactivators to enhance
transcription led us to wonder if other transcriptional factors could also act in synergy
with Msx protein to activate transcription. The answer is yes. Pax9, are known to be
essential for the switch in odotogenic potential from the epithelium to the mesenchyme.
Pax9 interacts with Msx1 to corporately activate the promoter of Msx1 and BMP4 during
tooth development (Ogawa et al., 2006). It is possible that Pax protein interacts with Msx
protein through homeodomain and utilizes the C-terminal domain of Msx protein to
activate target gene transcription. We found that the Pax6, essential for lens induction,
indeed enhances Msx1-dependent activation of the Hsp70 promoter (Fig 18.). Without
Pax6, Msx1 does not show any activation activity on the Hsp70 minimal promoter, Hsp-
90-LacZ. When Pax6 is present, Msx1 enhances the promoter activity. Further more, this
Pax6 dependent transcriptional activation requires the C-terminal domain of the Msx
protein. So that Msx may apply similar mechanism described for Hsfs to enhance the
transcriptional activity of other transcriptional factors.
62

4.3 Conclusion and Discussion

The data presented here provides a new insight into transcriptional regulatory
mechanisms of Msx proteins. The analysis of the Hsp70 promoter system uncovered a
critical need for heat shock factor binding sites and heat shock factors in mediating the
transactivation functions of Msx proteins. The Hsf-Msx interaction is specific in
stimulating transcriptional activity of the Hsp70 promoter. The addition of triptolide,
blocking the function of the HSF1 transactivation domain without disrupting the ability
of HSF1 trimmers to bind DNA, specifically inhibits HSF1 mediated transcription of
Hsp70 regulated by Msx protein. The results suggest that Msx proteins, similar to
triptolide, may also target the transactivation domain of Hsf1.
Figure 18. Pax6 acts synergistically with Msx protein to activate transcription.
Msx1 and Msx1-278 was co-transfected with Hsp90-lacZ and with or without Pax6.
With Pax6 (150 ng), Msx1 can activate the Hsp90-Lacz activity which shows no
transcriptional enhancement by Msx1 alone. The co-operation between Msx1 and Pax6
requires the C-terminal domain of Msx protein.

63
By what general mechanism(s) might Msx proteins contribute to the activation of
Hsp70 promoter? Our domain deletion analysis showed unambiguously that the N-
terminus is dispensable for the Msx activation function. The homeodomain in
combination with the C-terminal domain appeared to be involved in two distinct but
critical steps in Hsf activation: (i) to mobilize Hsfs from the cytoplasm to the nucleus and
(ii) to activate transcription (Figure 19). The homeodomain is essential for facilitating
nuclear import/accumulation of Hsfs by binding with Hsfs. Cells that were transfected
with the Msx2 wildtype-GFP fusion expression plasmid (Msx2-GFP) and the C-terminal
truncation Msx2 mutant (Msx2-233-GFP) showed increased levels of Hsf1 and Hsf2
immunofluorescence in their nuclei. In addition, the Msx homeodomain also provides the
contact surface for HSF1 and HSF2 binding. This physical association between Hsf1/2
and the Msx homeodomain as demonstrated by immunoprecipitation is also essential for
producing a robust transcriptional response in the context of the Hsp70 promoter because
removal of the homeodomain from Msx resulted in a significant reduction in its
transactivation activity.

64

The finding that Hsf1 and Hsf2 bind exclusively to the homeodomain of Msx
proteins further points to a possibility that the homeodomain may serve as a docking site
for Hsfs such that additional co-activators can be recruited by the Msx C-terminal domain
and placed in the proximity of the homeodomain-bound Hsfs. The co-factor recruited by
the C-terminal domain of Msx protein will modify the Hsfs and cause the activation of
Hsfs. The modification of Hsfs by Msx protein is not exactly the same as the post-
translational modification induced by heat shock. Western blot analysis shows that Hsfs
after heat shock exhibit diffused bands that migrate close together. This means that the
Figure 19. Model for activation of Heat shock transcriptional Factors regulated
by Msx protein. Msx proteins activate Hsf1 and Hsf2 in multiple steps: (1) The
homeodomain of the Msx protein bind to Hsf1 or Hsf2 which is located in the cell
cytoplasm as inactive monomers. This physical interaction between Msx and Hsfs
results in the translocation of Hsf2 or accumulation of Hsf1 in the cell nucleus,
respectively. (2) Then the C-terminal domain of the Msx protein may recruit other
co-activators that may modify Hsf1/2 to stimulate its transcriptional function. (3)
Activated Hsf1/2 then binds to the HSE on the Hsp gene promoter resulting in the
induction of heat shock gene transcription. In the absence of Msx C-terminal
domain, Hsfs can enter the cell nucleus aided by the Msx homeodomain, but their
transcriptional activity remains at the basal level.

65
activation of Hsfs by heat shock needs multiple modifications. However, the modified
Hsfs induced by co-expression of Msx showed only one clear slow migrating band. So
we believe that only one modification on Hsfs is induced by Msx and this specific
modification may be sufficient to activate Hsfs.
There are two kind of modifications with Hsfs when it is activated; one is
phosphorylation, and the other is sumoylation. The unique and large band shift of Hsf1
by Msx protein makes sumoylation medication highly possible. The binding of the C-
terminus of Msx1 with SUMO ligase-Pias1 led to the hypothesis that the C-terminus of
Msx1 will recruit Pias1 to sumoylate Hsfs and activate Hsfs.
Currently, we cannot find evidence to support this hypothesis. Co-transfection of
Pias1 and Msx1 did not show co-operativity on Hsp70 promoter activity while the de-
sumoylation factor-Senp1 did not reduce any transcriptional activation function of Msx1.
We could not detect sumoylated Hsf1 on the western blot using the anti-SUMO
antibodies to detect pulled-down products immunoprecipitated by the anti-Flag antibody.
The reason for this negative result may be because our experimental condition was not
sensitive enough to detect sumoylated Hsf1 after immunoprecipitation. An alternative
possibility is that the Msx C-terminal domain may recruit other co-activators, kinases, or
phosphotases to modify Hsfs in order to stimulate their transcriptional activity. The type
of co-factor that modifies recruited Hsfs by Msx will be identified in future by affinity
purification with the C-terminal of Msx and Mass spectrometric analysis or by yeast two
hybrid screening using the C-terminal domain of Msx as the bait.

66
Conclusion and future direction
Our findings revealed a novel activation function for Msx1 and Msx2
proteins. We demonstrated that Msx proteins are potent transcriptional transactivators in
the context of the murine Hsp70 promoter. The fact that Msx-dependent transactivation
require HSE on the promoter, but not its DNA binding function lead us to identify that
Hsfs are the molecular partners with which Msx form the heteromeric activation complex
to achieve the complete activation. The C-terminal domain in combination with the
homeodomain is involved in two distinct steps of Hsfs activation: the binding between
Homeodomain with Hsfs facilitate Hsfs from the cytoplasm to the nucleus, and the C-
terminal domain is required for modification and activation of Hsfs.
How does this thirty amino acid peptide on the C-terminus of Msx cause the
modification of Hsfs? What modification on Hsfs is used to activate them? Our
experiments ruled out the possibility of sumoylation of Hsfs. To ask these questions, two
parallel approaches may be applied in the future: identifying the co-factor(s) recruited by
C-terminus of Msx by immuno-affinity purification or by yeast two hybrid screening;
identifying the modified region on the Hsfs using different truncation or point mutant of
Hsfs to further identify the specific modification on Hsfs.
The important role in the development of Hsfs is that Hsfs are activated in the
normal, cellular, and embryonic conditions without stress stimulation, but how are Hsfs
activated in these conditions? The activation of Hsfs by Msx provides a new insight about
that question. To address the question, we need to further analyze the status of Hsfs on
the Msx null background (Msx1 or Msx2 knockout, or both). Crossing the Hsf2 knockout
67
with Msx knockout mice may provide some information about the genetic interaction
between these two proteins. If Hsfs are one of the downstream targets of Msx proteins,
over-expression of Hsfs may rescue some developmental defects in Msx knockout mice.
Morphological development of a variety of organ systems including craniofacial
structures depends on the precise combination of transcriptional activators and repressors.
A precise understanding of gene activity at the biochemical and molecular level is a
prerequisite for integrating various signaling mechanisms that control cellular and
morphological processes in order to advance our understanding of genetic control
mechanisms that govern normal embryonic development and pathogenesis. This insight
is essential for the development of new approaches to disease management and rational
therapies. The fact that Msx1 and Msx2 can stimulate Hsfs-mediated transcriptional
activation of Hsp70 promoter in the absence of chemical, physical, or physiological stress
suggests that Msx1 and Msx2 may provide a critical and novel pathway in activating
Hsf1 and Hsf2 and thus transcriptional induction of their gene targets under normal
developmental and physiological conditions. Further characterization of Msx co-
activator complexes involved in the activation of Hsfs shall shed new light on their
regulatory functions in directing cell division, cell differentiation, and morphogenesis
during embryonic development.

68
Chapter 5: Experimental Methods and Materials
5.1 Plasmid construction.
5.1.1 Hsp70 promoter reporter construction
The heat shock promoter lacZ reporter plasmid (pHsp70-LacZ) was kindly
provided by Dr. Alexandra Joyner (Kothary et al, 1989).
In general, to construct serial deletions and introduce point mutations into the
HSP70 promoter, DNA fragments were generated by performing PCR using
specific primer pairs (Table 1). PCR products were then cloned into the pDrive
vector (Qiagen, Valencia, CA) and were subsequently inserted into the
HindIII/Nco I site of pHsp70-LacZ. The reporter plasmid pHsp-90 was
constructed by removing DNA sequences between Stu I and Sma I sites of
pHsp70-lacZ.
5.1.1.1 PCR amplification
To PCR the Heat shock promoter DNA fragment, specific primer pairs of
primer is synthesized from the USC DNA Core Facility, and diluted to 10mM
final concentration before using. The components were mixed as follows: 19.5 l
ddH
2
O, 2.5 l 10X PCR reaction buffer, 1 l each of the forward and reverse
primer, 0.5 l 10mM dNTP, 0.5 l Taq DNA polymerase (Qiagen, CA) and 0.5
l DNA template. PCR conditions were: first step template denaturation was
carried out at 95
o
C for 5 min; this is followed by 35 repetitive cycles of 95
o
C for
1 min, 56-60
o
C for 1min, 72
o
C for 1 min and a final cycle at 72
o
C for 10 min.
69
After the reaction, the PCR products were kept at 4
o
C until further use.
5.1.1.2 Gel purification of PCR products
All of DNA PCR products were loaded onto 1.5% agarose gel since DNA
fragment is less than 600 bps. Electrophoresis was carried out for 30-45 min at a
constant voltage of 100 V. PCR fragments were cut out of the gel. We used
Qiagen gel extraction kit or sigma Gene-elute Gel extraction kit to isolate the
PCR product from the gel. The procedure is as follows:
The DNA fragments were excised from the agarose gel with a clean, sharp
blade. 3 gel volumes of the Gel Solubilization Solution were added to the tube of
the gel slice. Then the gel mixture were incubated at 50-60 ¡C for 10 minutes, or
until the gel slice is completely dissolved, vortexing briefly every 2-3 minutes
during incubation to help dissolve the gel. During this time, the binding column
was prepared by adding 500 ul of the Column Preparation Solution to each
binding column and centrifuged for 1 minute. 1 gel volume of 100% isopropanol
was added into the gel mixture after the gel was completely dissolved. Then the
dissolved gel solution was loaded into the binding column that was assembled in a
2 ml collection tube. Centrifuge for 1 minute at 3000 rpm after loading the
column each time. Put the flow-through back to the binding column and
Centrifuge for 1 minute again. Reloading the flow through will maximize binding
of DNA to the column. Discard the flow-through liquid. Wash the column by
adding 700 ul of Wash Solution to the binding column. Centrifuge for 1 minute.
Remove the binding column from the collection tube and discard the flow-
70
through liquid. Place the binding column back into the collection tube and
centrifuge again for 3 minutes without any additional wash solution to remove
excess ethanol. Transfer the binding column to a fresh collection tube. Add 25 ul
of Elution Solution to the center of the membrane and incubate for 1 minute.
Centrifuge for 1 minute. The DNA in flow-through is ready to use now or store at
-20
o
C
5.1.1.3 Ligation of the PCR product with pDrive vector
We used the Qiagen PCR cloning Kit to do the ligation reaction. Briefly, 1
¦l pDrive Cloning Vector (50 ng/¦l) was mixed with 1¨ 4 ¦l of the PCR product
and 5 ¦l 2X Ligation Master Mix in a final total volume of 10 ¦l . The ligation-
reaction mixtures were incubated overnight at 4¨ 16¡C. Ligation mix were then
used for transformation immediately or stored at ¨ 20¡C until use.
5.1.1.4 Transformation of the ligated DNA into E.coli.
The competent cells were taken out from -70 ¡C and put on ice for 5 min
to thaw. 5-10 ul ligation mixtures were added into the competent cells, and
incubated for 30 min on ice. The competent cells were then subjected to heat
shock by putting the tube into a 42
o
C water bath for 90s. After heat shock, cells
were then put back on the ice. 500 ul LB without any anti-biotic was added into
the tube and shaked for 45 min at 37
o
C. The cells were plated on the appropriate
antibiotic selection plate with X-gal and incubated overnight at 37
o
C.
5.1.1.5 Recombinant plasmid screening.
71
After the E.coli clones grow on the plate, clones were picked up and
cultured overnight in a shaking incubator at 37
o
C. The plasmids were isolated
from the E.coli by performing alkaline lysis, and purified plasmids were then
digested with restriction enzyme EcoR I and fractionated through an agarose gel
to identify correct recombinants. Plasmids were sequenced to verify the DNA
sequences.
5.1.1.6 Insertion of the PCR fragments into Hsp70 promoter.
The cloned PCR products of the Hsp70 promoter and Hsp70-LacZ
reporter vector were linearized with HindIII and NcoI for 2 hours and gel
fractionated. The DNA fragments of interest were excised from the agarose gel
and purified by following the gel extraction protocol mentioned above. Ligation
were then performed according to following conditions: 1 ¦l (about 10 ng) of the
reporter vector was combined with 1¨ 4 ¦l (about 5 ng) of the Hsp70 promoter
fragment in a reaction buffer that contains 1.5 l T4 ligase buffer, 0.5 l T4 ligase
(New England Biolab, MA) and variable amounts of ddH
2
O to bring the final
reaction volume to 15 ¦l . Ligation reactions were allowed to proceed overnight at
4
o
C. Then the ligated DNA was transformated into E.coli according to the
protocol mentioned above. Transformed cells were then plated onto the antibiotic
plate. After overnight growth, bacterial clones were picked up and grown
overnight. Plasmids were then isolated and recombinants were determined by
performing restriction enzyme digestion. All DNA constructions were confirmed
72
by sequencing. Transfection-grade plasmids were column purified according to
the protocol supplied by the manufacturer.
5. 1.2 Constructions of Msx1 and Msx2 expression mutants
In general, to generate Msx1 and Msx2 mutant expression plasmids,
specific primer pairs (Table 1.) were used to produce PCR fragments that were
then subcloned into the pDrive vector (Qiagen, Valencia, CA). These subcloned
Msx deletion mutants were subsequently released from pDrive and ligated in-
frame to the 3x Flag tag in the pIRES-hrGFP-1a vector (Stratagene, La Jolla, CA)
to create various Msx-3xFlag expression plasmids. To create the Dlx5-
homeodomain Msx C-terminal domain chimeric construct, a PCR fragment
spanning the Dlx5 homeodomain was inserted in-frame upstream of pMsx1-236-
303. Msx2-GFP and Msx2-233-GFP were constructed by inserting PCR
fragments into XhoI and BamH I sites of pEGFP-c1 (Clontech, Pola Alto, CA).
To construct the point mutation of Msx1-G267C and Msx1-P278S, the
PCR product were first cloned into pDrive vector by TA-cloning (see Primer
sequences in Table1), then subcloned into KasI /BamH I site of the hmsx1-3xflag
vector.
To construct the point mutations of Msx1-2PA and Msx1-3YF, forward
and reverse oligos were synthesized (Table1) and annealed. Annealed oligos
were ligated into the BssH II/ XhoI site of Msx1-3xflag plasmids.
Annealing: The newly synthesized complementary oligonucleotide pairs
were resuspended in TE to a final concentration 10 pmole/ l (10 M). 2 l each
73
of forward and reverse oligo, 2 l of TE and 14 l ddH2O were mixed together in
a 1.5 mL microcentrifuge tube. The mixture was heated to 95¡C for 5 minutes and
was allowed to cool down gradually to room temperature. Annealed duplexes
(final concentration 1.0 pmole/ l) can be stored at -20¡C for a few months.
The Msx1-3xflag plasmid was digested with BssH II and XhoI, gel
purified and ligated with ? pmole / l mutant duplexes. Then the BssH II fragment
of Msx1 was introduced into the mutant construct to complete the construction of
Msx1 mutant expression plasmid. Mutant expression plasmids were verified by
sequencing.
5.2 Cell culture and DNA transfection.
5.2.1 Cell culture
C2C12 mouse myofibroblasts were purchased from the American Type
Culture Collections (Manassas, VA). Cells were cultured in DMEM
supplemented with 10% fetal bovine serum (Hyclone, Logan, UT). Cyclin D1 (-/-)
and Cyclin D1 (+/+) MEFs were obtained from Dr. Piotr Sicinski (Dana-Farber
Cancer Institute, Boston, MA).
Primary mouse MEF cells were prepared accordingly to the protocol of
Nagy et al. (2003). In belief, mouse embryos at E15 were dissected; the internal
organs, limb, and head were removed. The carcasses were washed with 1xPBS 3
times and cut into very small pieces with sharp blade, then treated with
trypsin/EDTA in PBS at 37
o
C for 30 minutes with stirring. Decanted cell
suspension was transferred into a 50 ml tube, and centrifuged at 1000rpm for 5
74
minutes. The cell pellet was resuspended in DMEM with 10% FBS and plated in
10 cm cell culture plates.
To heat shock cells, 12 hours after transfection, plates were incubated at
42
o
C for 6 hours, then the ?-galactosidase and luciferase assays were performed.
To inhibit HSF1 mediated transcription, triptolide, (Calbiochem,
Darmstadt, Germany) which was dissolved in dimethyl sulfoxide to make a stock
solution at a concentration of 10mM, was added to cells at indicated
concentrations at a time immediately following DNA transfection. Triptolide
treated cells were harvested 24 hours later.
5.2.2 Transfection
Before transfection, cells were seeded in 12 well plates. When cells
reached a density of approximately 2x10
5
cells per well, cells were ready for
transfection. Each well received a total of 800ng plasmid DNA that consisted of
100ng of individual Hsp70-lacZ reporter plasmid, 300ng Msx expression plasmid,
50ng CMV-luciferase used as the internal standard to control for transfection
efficiency and a variant amount of pIRES-hrGFP-1a to adjust for the deficit in
total amount of DNA. For each Hsp70-lacZ reporter, transfections were
performed in triplicates.
Transfections were performed using Lipofectamine and Plus reagent
according to manufacturer¡s protocol (Invitrogene, Carlsbad, CA) with
modifications for 12 well plates: Two1.5 ml tubes were prepared: tube A and tube
B. In each tube, 100 l pre-warmed DMEM free of FBS was added. A total of
75
700 ng of plasmid combinations was added into tube A and mixed well, and then
5 l Plus reagent was added into the mixture. 2 l of lipofectamine were added
into tube B and mixed well. Two tube mixtures were combined, and incubated at
room temperature for 15 min. While the transfection mixture was incubating, the
DMEM culture media was removed from the well, and was washed one time with
DPBS. 400 l of fresh 10 % FBS DMEM was added into the well. The
transfection mixtures were added into the well, mixed, and incubated in 37
o
C for
2-3 hours. Media was changed once more and transfected cells were cultured until
harvested.
5.3. ?-galactosidase and luciferase assays.
Luciferase and beta-galactosidase assays were performed using the Dual-
light Assay kit (Applied Biosystems, Bedford, MA) following manufactures
recommendations with a few modifications. Reporter activities as a function of
photon emissions were measured using a Berthold luminometer (Lumat LB9507,
Berthold). Before the assay, Buffer B was prepared by adding Galacton-plus
substrate (1:100) into Buffer B.
Twenty-four hours after transfection, cell lysis was performed directly in
12-well plates by adding 80 ul of lysis buffer per well, then transferred into tubes
and cell debris was pelleted by centrifugation. Keep the supernatant for analysis
or store at -70
o
C.
10 ul of individual lysates were added into luminometer tube for
enzymatic activity assay. 12.5 ul of Buffer A was added into the tubes. Within 10
76
min, 50 ul Buffer B was injected into the mixture, after 1-2 sec delay, the
luciferase signal were read for 5 sec/well. After reading luciferase signal, the
mixture were incubated for 30 min at room temperature, then 50 ul of
Accelerator-II was injected into the tube to read the ?-galactosidase signal for 5
sec/well after 1-2 sec delay. The data was analyzed with Microsoft Excel.
5.4. Immunoprecipitation and immunoblotting assays.
C2C12 cells were transfected with Msx1 or Msx2 mutant plasmids when
cells reached a density of about 70% confluency in one well plate. Preferrably, the
transfection efficiency is about 20%-30% for immunoprecipitation to succeed.
Cells were harvested by trypsinization.
For immunoprecipitation of Hsfs from heat shocked cells, prior to
havesting heat shocked cells, culture plates were sealed in a heat-sealed pouch
and submerged in a water bath at 42 ¡C for 2 hours. Cells were harvested by
trypsinization.
5.4.1 Immunoprecipitation by anti-HSF1 and HSF2
Harvested cells were placed in 1ml of ice-cold lysis buffer (50mM Tris-
HCl pH 8.0, 150mM NaCl; 1% NP-40) containing 1X Protease Inhibitor Cocktail
(Sigma-Aldrich) and incubated on ice for 1 hours. Cell debris was spun down at
10,000xg for 15 minutes at 4¡C. To preclear cell lysate, 50¦l of anti-rabbit IgG
beads (eBioscience, San Diego, CA) or anti-rat IgG beads (Sigma-Aldrich, St.
Louis, MO) were added into the cell lysate and was allowed to incubate on ice for
30 minutes. The supernatant was separated by centrifugation at 3000 rpm for 1
77
min and then transferred into a new tube. 2 g of rabbit anti-HSF1 (Stressgen,
Victoria, BC, Canada) or rat anti-HSF2 (Lab Vision, Fremont, CA) antibody was
added into the supernatant and was allowed to incubate overnight at 4
o
C. On the
next day, additional 50¦l of anti -rabbit IgG beads or anti-rat IgG beads was added
into the sample and incubate for 60 minutes. Beads were then spun down by
centrifugation at 3,000 rpm for 1 minute. Supernatant was completely removed.
Beads were washed 4 times each with 1000¦l of TBS Buffer (50mM Tris -HCl pH
8.0, 150mM NaCl, 0.1% tween 20). After the last wash, 100¦l of 2X SDS
Reducing Sample Buffer with DTT and protease inhibitor (6% SDS; 50mM DTT;
25mM Tris base PH 6.5; 10%glycrol; Bromphenol blue;) was added to re-suspend
the bead pellet and then boiled for 10 minutes. Boiled beads were spun down by
centrifugation and the supernatant was store at -70
o
C or loaded onto a PAGE gel
and analyzed by Western blot.
5.4.2 Western Blot
45 l of immunoprecipitated sample and 10 l whole cell lysate samples
were loaded on the 12% PAGE gel. Gel electrophoresis was performed at a
constant voltage of 60 V for 2-3 hours. Proteins in the gel were blotted onto the
membrane by applying a constant voltage of 15 V overnight at 4
o
C. The
membrane was blocked with 10% fat free milk in Tris buffer (Sigma-Aldrich) for
1 hour. After blocking, the membrane was placed into a ? pint size bag with 5 ml
PBS containing 5% fat free milk. Primary antibody (usually 1:1000 or 1-3000)
was added into the bag, incubated in room temperature for 2 hours or 4
o
C
78
overnight on a shaking platform. The membrane was washed with PBST (PBS
with 0.1%tween 20) twice for 10 min each, and then washed with PBST (PBS
with 0.1%tween 20) with 5% fat free milk twice for 10 min each. Secondary
antibody (1:3000 or 1:5000) diluted in 5 ml PBS with 5% fat free milk was then
added into the bag. The membranes were washed with PBST (PBS with
0.1%tween 20) three or four times for 6 min each. (Careful! over wash may
reduce the signal on the western blot, especially for immunoprecipitated samples).
The film was exposed in a dark room with variable time depending on the signal
intensity. Since signals for immunoprecipitated samples tend to be week, 1 hour
exposure time may be applied if the background is not too high. The molecular
weight of individual bands can be sized by comparing with the protein marker.
Flag-tagged Msx proteins were detected using a mouse monoclonal anti-
Flag M2 antibody that has been conjugated to HRP (1:2000 dilution; Sigma-
Aldrich, St. Louis, MO). Therefore, no additional secondary antibody was used
for detection.
5.4.3 Immunoprecipitation by anti-Flag beads
Harvested cells were placed in 1ml of ice-cold lysis buffer (50mM Tris-
HCl pH 8.0, 150mM NaCl; 1% NP-40) containing 1X Protease Inhibitor Cocktail
and incubated on ice for 1 hours. Cell debris was spun down at 10,000 rpm for 15
minutes at 4¡C. To preclear cell lysate, 50¦l anti -rabbit IgG beads (eBioscience,
San Diego, CA) or anti-rat IgG beads (Sigma-Aldrich, St. Louis, MO) was added
into the cell lysate and was allowed to incubate on ice for 30 minutes. The
79
supernatant was separated by centrifugation at 3000 rmp for 1 min and then
transferred to a new tube. 40 ul anti-Flag (M2) antibody conjugated agarose-beads
(Sigma-Aldrich, St. Louis, MO) were added into precleared lysates, and was
allowed to incubate at 4
o
C for 6 hours. Beads were then spun down by
centrifugation at 3,000rpm for 1 minute. Supernatant was completely removed.
Beads were washed 4 times each with 1000¦l of TBS Buffer (50mM Tris -HCl pH
8.0, 150mM NaCl, and 0.1% tween 20). After last wash, 100¦l of 1X SDS
Reducing Sample Buffer with DTTT and protease inhibitor (6% SDS; 50mM
DTT; 25mM Tris base PH 6.5; 10%glycrol; Bromphenol blue;) was added to re-
suspend the bead pellet and then boiled for 10 minutes. Boiled beads were spun
down by centrifugation and the supernatant was stored at -70
o
C or loaded onto a
PAGE gel and analyzed by Western blotting.
During the western blot a rabbit anti-HSF1antibody (1:5000 dilution;
Stressgen, Victoria, BC, Canada) or a rat anti-HSF2 antibody (1:1000 dilution;
Lab Vision, Fremont, CA) was used. Following the protocol mentioned above.
And primary anti-HSFs antibody incubation condition is -4
o
C overnight. Do not
over-wash the membrane before exposure.
5.5. Immunofluorescence.
Twenty-four hours following transfection, C2C12 cells were fixed in 4%
PFA for 10 minutes and washed with 1X PBS and blocked with 1% BSA for 30
min. Rabbit anti-HSF1 antibody (1:200 dilution; Stressgen, Victoria, BC, Canada)
or a rat anti-HSF2 antibody (1:200 dilution; Lab Vision, Fremont, CA) diluted in
80
1x PBS with 0.2% NP40 and 1%BSA was added into the well and incubated for 2
hours at room temperature. The wells were washed three times with 1x PBS. To
probe for primary antibodies, a goat anti-rabbit secondary antibody conjugated to
Rhodamine Red (1:400 dilution; Molecular Probes, Eugene, OR) or a goat anti-rat
secondary antibody conjugated to Texas Red (1:400 dilution; Santa Cruz, Santa
Clara, CA) was added into the well and incubated for 30 minutes. The wells were
washed in 1x PBS three times. Images were acquired using an Olympus inverted
fluorescent microscope equipped with a SPOT CCD camera.
5.6. Electrophoretic Mobility Shift Assays (EMSA)
5.6.1 Cells treatment
C2C12 cells were transfected with a GFP expression plasmid together
with Msx1-wt or Msx1-278 in 6 well plates. After 24 hours, one plate was heat
shocked for 2 hours by submerging the plate into water bath at 42
o
C for 2 hours.
The cells were collected by trypinization and centrifuging for further nuclear
protein extraction
5.6.2 Nuclear protein extraction.
Nuclear protein extraction was performed using NE-PER Nuclear and
Cytoplasmic Extraction Reagents according to the manufacturer¡s protocol
(Pierce, Rockford, IL).
20 packed cell volumes (~40 mg) of cells were briefly isolated in a 1.5 ml
microcentrifuge tube by centrifugation at 500 x g for 2-3 minutes. A pipette was
used to carefully remove and discard the supernatant, leaving cell pellet as dry as
81
possible. 200 ¦l of ice -cold CER I was added to the cell pellet. The mixture was
vortexed vigorously on the highest speed for 15 seconds to fully resuspend the
cell pellet, then incubated on ice for 10 minutes. 11 ¦l of ice -cold CER II was
added to the tube. The tube was vortexed for 5 seconds on the highest setting, and
incubated on ice for 1 minute and vortexed again for 5 seconds on the highest
setting. Centrifuge the tube for 5 minutes at maximum speed in a microcentrifuge
(~16,000 x g). The supernatant (cytoplasmic extract) fraction was immediately
transferred to a clean pre-chilled tube. Place this tube on ice until use or storage.
The insoluble (pellet) fraction which contains nuclei was resuspended in 100 ¦l of
ice-cold NER. The tube was vortexed on the highest setting for 15 seconds, and
then returned to ice; continue vortexing for 15 seconds every 10 minutes, for a
total of 40 minutes. The tube was centrifuged at maximum speed (16,000 x g) in a
microcentrifuge for 10 minutes. The supernatant (nuclear extract) fraction was
immediately transferred to a clean pre-chilled tube on ice. Using the proteins
immediately or store all extracts at -80¡C until use.
5.6.3 Probe labeling
5.6.3a. Probe design
The Distance HSE on Hsp70 was used as a probe. The oligo sequence:
HSE-FP: TTTTGACGCGAAACTGCTGGAAGATTCCTGGCCC; HSE-RP:
TTTTGGGCCAGGAATCTTCCAGCACTTTCGCGTC.
5.6.3b. Primer annealing
82
Primers were resuspended in TE to a final concentration of 10 pmole/ l
(10 uM), and 4 l of each of the forward and reverse oligo were mixed together in
4 l of 10X TE and 28 l ddH2O in a 1.5 mL Eppendorf tube. The mixture was
heated at 95¡C for 5 minutes and cooled down gradually to room temperature.
Annealed duplexes (final concentration 1.0 pmole/ l) were used for end-labelling
and remainder stored at -70
o
C.
5.6.3c. Probe labelling with radionucleotide
Two l of annealed oligonucleotide duplex was added into a 20 ul reaction
mixture that included 1 l of dNTPs (3mM each of dCTP, dGTP, dTTP), 2 l of
10X Klenow buffer, 13 l of ddH2O, 1 l Klenow enzyme (NEB, MA), and 1 l
32P-dATP. The Klenow fill-in reaction was allow proceeding for 30 minutes at
room temperature.
5.6.3d. Probe purification
Probe purification was performed using Sephadex G-50 columns (Cat:
11273965001, Roch, Piscataway, NJ). The column was placed into a provided
tube and was spun at 3000 rpm for 5 min to remove excess storage buffer. The
dry column was placed into a new tube and the labelling reaction was loaded
into centre of column. The column was spun for 5 minutes at 3000 rpm. The
eluted product was used for DNA binding assay.
5.6.4 DNA Binding reaction
83
Radio-labeled DNA duplex (2 l corresponding to 2000-5000 cpm) was
added into a DNA binding reaction tube containing 4 l of 5X binding buffer
(20% glycerol; 100 mM Tris-HCl pH8 @ 25 degrees; 300 mM KCl; 25 mM
MgCl2; 500 mg/ml BSA), 0.2 l 0.1M DTT, 0.123 g poly[dG-dC] and 3 g
nuclear protein extracts to a final reaction volume of 20 l. The nuclear protein
extract was added to the reaction last. The binding reaction was allowed to
proceed for 15 minutes at room temperature, and then 1 l anti-Flag antibody was
added for further 30-minute incubation.
5.6.5 Native gel running and gel drying
The DNA binding reaction was stopped by the addition of 1 l 10x TBE
gel loading buffer with bromophenyl blue. Samples were then loaded onto a
native gel and subjected to electrophoresis at a constant voltage of 160V (12 cm
long) for 1 or 2 hours. At the end of electrophoresis, the gel was washed with
ddH2O and placed on a Whatman filter paper. The gel was then dried in the Gel
Dryer (Bio-rad) for about 2 hours at 80
o
C. When the gel became completely dry,
it was exposed to an X-ray film.

84
Table 1: primer Pairs used in experiments

Construction Primers pairs
Hsp-314 FP: TATATATAAAGCTTTGTCCATTCCACACAGGCCTTAG
RP: TATATCGCGAGCCATGGTGGCCTCC
Hsp-260 FP: TATATATAAAGCTTAGCACCAGCACTTCCCCACAC
RP: TATATCGCGAGCCATGGTGGCCTCC
Hsp-205

FP: TATATATAAAGCTTTGAACCCCAGAAACCTCTGGAGAG
RP: TATATCGCGAGCCATGGTGGCCTCC
Hsp-180 FP:TATATATAAAGCTTACAAGGGCGGAACCCACAACTC
RP: TATATCGCGAGCCATGGTGGCCTCC
Hsp-160 FP: TATATATAAAGCTTTCCGATTACTCAAGGGAGGCGG
RP: TATATCGCGAGCCATGGTGGCCTCC
Hsp-150 FP: TATATATAAAGCTTCAAGGGAGGCGGGGAAGCTCC
RP: TATATCGCGAGCCATGGTGGCCTCC
Hsp-120 FP: TATATATAAAGCTTTGAACCCCATCAACCTCTGGAGAG
RP: TATATCGCGAGCCATGGTGGCCTCC
Hsp-150-120

FP :TAAAGCTTCAAGGGAGGCGGGGAAGCTCCACCAGACGC
CCTCCTCCGGCTCGCTGATTGG
RP: TATATCGCGAGCCATGGTGGCCTCC
Hsp-150m FP: TAAAGCTTCAAGGGAGGCAATGAAGCTCCACCAG
RP: TATATCGCGAGCCATGGTGGCCTCC
Msx1-43-303 FP: TATACGGATCCTCACCATGGGCACAGATGAGGAGGGG
RP: TATCTCGAGAGTCAGGTGGTACATGCTGTAGCCTAC
85
Table 1: Continued

Msx1-74-303 FP:
TATACGGATCCTCACCATGGGGGCCAAGGAGAGCGTCCTG
RP: TATCTCGAGAGTCAGGTGGTACATGCTGTAGCCTAC
Msx1-105-303 FP:TATACGGATCCTCACCATGGCCCCGGATGCGCCCTCCTC
RP: TATCTCGAGAGTCAGGTGGTACATGCTGTAGCCTAC
Msx1-139-303 FP:TATACGGATCCTCACCATGAAACTAGATCGGACCCCGTG
GATG
RP: TATCTCGAGAGTCAGGTGGTACATGCTGTAGCCTAC
Msx1-163-303 FP:
TATACGGATCCTCACCATGGCATGCACCCTACGCAAGCAC
RP: TATCTCGAGAGTCAGGTGGTACATGCTGTAGCCTAC
Msx1-1-172 FP: TATACGGATCCTCACCATGGCCCCGGCTGCTGCTATG
RP:TATCTCGAGGTTGGTCTTGTGCTTGCGTAGGG
Msx1-1-232 FP: TATACGGATCCTCACCATGGCCCCGGCTGCTGCTATG
RP: TATACGGATCCGAGAGGCGGAGCTGGAGAAGCTG
Msx1-1-278 FP: TATACGGATCCTCACCATGGCCCCGGCTGCTGCTATG
RP:TATCTCGAGAGGGCCAGAGGCACTGTAGAGTGAG
Msx1-232-303 FP: TATACGGATCCGAGAGGCGGAGCTGGAGAAGCTG
RP: TATCTCGAGAGTCAGGTGGTACATGCTGTAGCCTAC
Dlx5-
Homedoamain
FP:TATACGGATCCGACTCGAGCCAAAGAAAGTTCGTAAACC
CAGG
RP: TCGGATCCGTTTCATGATCTTCTTGATCTTGGATCTT
Msx2-3xflag FP: TATACGGATCCTCACCATGGCTTCTCCGACTAAAGGCGG
RP: TATCTCGAGGGATACATGGTAGATGCCATATCCAAC
86
Table 1: Continued

Msx2-233-
3xflag
FP: TATACGGATCCTCACCATGGCTTCTCCGACTAAAGGCGG
RP: TATCTCGAGTGCTTGCAGGGGTGAGTTGATAGG
Msx2-GFP FP: TATACTCGAGCTGCTTCTCCGACTAAAGGCGGTGAC
RP:TATAGGATCCGTCGACTTAGGATACATGGTAGATGCCAT
ATC
Msx2-233-GFP FP: TATACTCGAGCTGCTTCTCCGACTAAAGGCGGTGAC
RP:ATAGGATCCGTCGACTTATGCTTGCAGGGGTGAGTTGAT
AGG
Msx1-2PA FP:CGCGCCGCGCTGGCTGTAGCGGCCGTGGGACTCTACACC
GCCCATGTAGGCTACAGCATGTACCACCTGACTC
RP:TCGAGAGTCAGGTGGTACATGCTGTAGCCTACATGGGCG
GTGTAGAGTCCCACGGCCGCTACAGCCAGCGCGG
Msx1-3YF FP:CGCGCCGCGCTGCCTGTGGCGCCCGTGGGACTCTTCACG
GCCCATGTGGGCTTCAGCATGTTCCACCTGACAC
RP:TCGAGTGTCAGGTGGAACATGCTGAAGCCCACATGGGCC
GTGAAGAGTCCCACGGGCGCCACAGGCAGCGCGG
hmsx1-290 FP:TATACGGATCCTCACCATGGGGGCCAAGGAGAGCGTCCT
G
RP: TATCTCGAGGCCCACATGGGCCGTGTAGAG
hmsx1-G267C FP:TATACGGATCCTCACCATGGGGGCCAAGGAGAGCGTCCT
G
RP: AGCGAGGCACCCGCCGCGGCCGC
hmsx1-P278S FP:TATACGGATCCTCACCATGGGGGCCAAGGAGAGCGTCCT
G
RP: CGGGCGCCACAGACAGCGCGGCGCGCTGGAAGGGGCC
87
Reference:
Ahn SG, Kim SA, Yoon JH, Vacratsis P. (2005) Heat-shock cognate 70 is required for
the activation of heat-shock factor 1 in mammalian cells. Biochem J. 392(Pt 1):145-52.
Alastalo TP, Hellesuo M, Sandqvist A, Hietakangas V, Kallio M, Sistonen L. (2003)
Formation of nuclear stress granules involves HSF2 and coincides with the nucleolar
localization of Hsp70. J Cell Sci. 116(Pt 17):3557-70.
Anckar J, Hietakangas V, Denessiouk K, Thiele DJ, Johnson MS, Sistonen L. (2006)
Inhibition of DNA binding by differential sumoylation of heat shock factors. Mol Cell
Biol. 26(3):955-64.
Bach A, Lallemand Y, Nicola MA, Ramos C, Mathis L, Maufras M, Robert B. ( 2003)
Msx1 is required for dorsal diencephalon patterning. Development. 130(17):4025-36
Beck C.W. Beck, B. Christen and J.M.W. Slack. (2006) Molecular pathways needed for
regeneration of spinal cord and muscle in a vertebrate, Dev. Cell 5:429¨ 439.
Bei M, Maas R. (1998). FGFs and BMP4 induce both Msx1-independent and Msx1-
dependent signaling pathways in early tooth development. Development 125:4325-33.
Bendall AJ, Abate-Shen C. (2000 ) Roles for Msx and Dlx homeoproteins in vertebrate
development.Gene. 247(1-2):17-31
Bendall AJ, Ding J, Hu G, Shen MM, Abate-Shen C. (1999). Msx1 antagonizes the
myogenic activity of Pax3 in migrating limb muscle precursors. Development 126:4965-
76.
Bendall AJ, Rinc¨n -Limas DE, Botas J, Abate-Shen C. (1998) Protein complex
formation between Msx1 and Lhx2 homeoproteins is incompatible with DNA binding
activity. Differentiation. 63(3):151-7.
Biamonti G. (2004) Nuclear stress bodies: a heterochromatin affair? Nat Rev Mol Cell
Biol. 5(6):493-8
Bidder M, Latifi T, Towler DA. (1998) Reciprocal temporospatial patterns of Msx2 and
Osteocalcin gene expression during murine odontogenesis. J Bone Miner Res. 13(4):609-
19.
Blanco R, Chakraborty R, Barton SA, Carre?o H, Paredes M, Jara L, Palomino H, Schull
WJ. (2001) Evidence of a sex-dependent association between the MSX1 locus and
nonsyndromic cleft lip with or without cleft palate in the Chilean population. Hum Biol.
73(1):81-9.
88
Boellmann F, Guettouche T, Guo Y, Fenna M, Mnayer L, Voellmy R. (2004) DAXX
interacts with heat shock factor 1 during stress activation and enhances its transcriptional
activity. Proc Natl Acad Sci U S A. 101(12):4100-5.
Carlson MR, Bryant SV, Gardiner DM. (1998) Expression of Msx-2 during development,
regeneration, and wound healing in axolotl limbs. J Exp Zool. 282(6):715-23.
Catron KM, Iler N, Abate C. (1993) Nucleotides flanking a conserved TAAT core dictate
the DNA binding specificity of three murine homeodomain proteins. Mol Cell Biol
13:2354-65.
Catron KM, Wang H, Hu G, Shen, MM, Abate-Shen C. (1996). Comparison of MSX-1
and MSX-2 suggests a molecular basis for functional redundancy. Mech Dev 55:185-99.
Catron KM, Zhang H, Marshall SC, Inostroza JA, Wilson JM, Abate C. (1995).
Transcriptional repression by Msx-1 does not require homeodomain DNA-binding sites.
Mol Cell Biol 15:861-71.
Chang Y, Ostling P, Akerfelt M, Trouillet D, Rallu M, Gitton Y, El Fatimy R, Fardeau V,
Le Crom S, Morange M, Sistonen L, Mezger V. (2006) Role of heat-shock factor 2 in
cerebral cortex formation and as a regulator of p35 expression. Genes Dev. 20(7):836-47.
Chen Y, Bei M, Woo I, Satokata I, Maas R. (1996). Msx1 controls inductive signaling in
mammalian tooth morphogenesis. Development 122:3035-44.
Cheng SL, Shao JS, Charlton-Kachigian N, Loewy AP, Towler DA. (2003) MSX2
promotes osteogenesis and suppresses adipogenic differentiation of multipotent
mesenchymal progenitors. J Biol Chem. 278(46):45969-77.
Christians E, Davis AA, Thomas SD, Benjamin IJ. (2000) Maternal effect of Hsf1 on
reproductive success. Nature. 407(6805):693-4.
Chu B, Zhong R, Soncin F, Stevenson MA, Calderwood SK. (1998) Transcriptional
activity of heat shock factor 1 at 37 degrees C is repressed through phosphorylation on
two distinct serine residues by glycogen synthase kinase 3 and protein kinases Calpha
and Czeta. J Biol Chem. 273(29):18640-6.
Chu, B., Soncin, F., Price, B. D., Stevenson, M. A., and Calderwood, S. (1996)
Sequential phosphorylation by mitogen- activated protein kinase and glycogen synthase
kinase 3 represses transcriptional activation by heat shock factor 1.J. Biol. Chem. 271,
30847¨ 30857
Conde, R., Xavier, J., McLoughlin, C., Chinkers, M. & Ovsenek, N. (2005) Protein
phosphatase 5 is a negative modulator of heat shock factor 1. J Biol Chem 280, 28989-96.
Cotto J, Fox S, Morimoto R. (1997) HSF1 granules: a novel stress-induced nuclear
compartment of human cells. J Cell Sci. 110 ( Pt 23):2925-34.
89
Creuzet, S., Schuler, B., Couly, G. and Le Douarin, N. M. (2004). Reciprocal
relationships between Fgf8 and neural crest cells in facial and forebrain development.
Proc. Natl. Acad. Sci. USA 101:4843 -4847
D'Alessio M, Frasch M. (1996) msh may play a conserved role in dorsoventral
patterning of the neuroectoderm and mesoderm. Mech Dev. 58(1-2):217-31.
Dai C, Whitesell L, Rogers AB, Lindquist S. (2007) Heat shock factor 1 is a powerful
multifaceted modifier of carcinogenesis.Cell. 130(6):1005-18.
Dai Q, Zhang C, Wu Y, McDonough H, Whaley RA, Godfrey V, Li HH, Madamanchi N,
Xu W, Neckers L, Cyr D, Patterson C.( 2003) CHIP activates HSF1 and confers
protection against apoptosis and cellular stress. EMBO J. 22(20):5446-58.
Dai R, Frejtag W, He B, Zhang Y, Mivechi NF. (2000) c-Jun NH2-terminal kinase
targeting and phosphorylation of heat shock factor-1 suppress its transcriptional activity.
J Biol Chem. 275(24):18210-8.
Davidson D (1995) The function and evolution of Msx genes: pointers and paradoxes,
Trends Genet. 11:405¨ 411
Dodig M, Kronenberg MS, Bedalov A, Kream BE, Gronowicz G, Clark SH, Mack K, Liu
YH, Maxon R, Pan ZZ, Upholt WB, Rowe DW, Lichtler AC. (1996) Identification of a
TAAT-containing motif required for high level expression of the COL1A1 promoter in
differentiated osteoblasts of transgenic mice.J Biol Chem. 271(27):16422-9,
Dodig M, Tadic T, Kronenberg MS, Dacic S, Liu YH, Maxson R, Rowe DW, Lichtler
AC. (1999) Ectopic Msx2 overexpression inhibits and Msx2 antisense stimulates
calvarial osteoblast differentiation. Dev Biol. 209(2):298-307.
Fujimoto M, Izu H, Seki K, Fukuda K, Nishida T, Yamada S, Kato K, Yonemura S,
Inouye S, Nakai A. (2004) HSF4 is required for normal cell growth and differentiation
during mouse lens development. EMBO J. 23(21):4297-306.
Goodson, M. L., Y. Hong, R. Rogers, M. J. Matunis, O-K. Park-Sarge, and K. D. Sarge.
(2001) SUMO-1 modification regulates the DNA-binding activity of heat shock
transcription factor 2, a promyelocytic leukemia nuclear body associated transcription
factor. J. Biol. Chem. 276:18513-18518
Han M, Yang X, Farrington JE, Muneoka K. (2003). Digit regeneration is regulated by
Msx1 and BMP4 in fetal mice. Development. 130:5123-32.
Hassan MQ, Javed A, Morasso MI, Karlin J, Montecino M, van Wijnen AJ, Stein GS,
Stein JL, Lian JB.( 2004) Dlx3 transcriptional regulation of osteoblast differentiation:
temporal recruitment of Msx2, Dlx3, and Dlx5 homeodomain proteins to chromatin of
the osteocalcin gene. Mol Cell Biol. 24(20):9248-61.
90
Helms JA, Cordero D, Tapadia MD. (2005) New insights into craniofacial
morphogenesis. Development. 132(5):851-61.
Hietakangas V, Ahlskog JK, Jakobsson AM, Hellesuo M, Sahlberg NM, Holmberg CI,
Mikhailov A, Palvimo JJ, Pirkkala L, Sistonen L. (2003) Phosphorylation of serine 303 is
a prerequisite for the stress-inducible SUMO modification of heat shock factor 1.Mol
Cell Biol. 23(8):2953-68.
Hietakangas V, Anckar J, Blomster HA, Fujimoto M, Palvimo JJ, Nakai A, Sistonen
L.( 2006) PDSM, a motif for phosphorylation-dependent SUMO modification. Proc Natl
Acad Sci U S A. 103(1):45-50.
Hilgarth RS, Murphy LA, O'Connor CM, Clark JA, Park-Sarge OK, Sarge KD. (2004)
Identification of Xenopus heat shock transcription factor-2: conserved role of
sumoylation in regulating deoxyribonucleic acid-binding activity of heat shock
transcription factor-2 proteins. Cell Stress Chaperones. 9(2):214-20
Hoffmann HM, Catron KM, van Wijnen AJ, McCabe LR, Lian JB, Stein GS, Stein JL.
(1994) Transcriptional control of the tissue-specific, developmentally regulated
osteocalcin gene requires a binding motif for the Msx family of homeodomain proteins.
Proc Natl Acad Sci U S A. 91(26):12887-91.
Holmberg CI, Hietakangas V, Mikhailov A, Rantanen JO, Kallio M, Meinander A,
Hellman J, Morrice N, MacKintosh C, Morimoto RI, Eriksson JE, Sistonen L. (2001)
Phosphorylation of serine 230 promotes inducible transcriptional activity of heat shock
factor 1. EMBO J. 20(14):3800-10.
Holmberg CI, Illman SA, Kallio M, Mikhailov A, Sistonen L. (2000) Formation of
nuclear HSF1 granules varies depending on stress stimuli. Cell Stress Chaperones.
5(3):219-28.
Hong S, Kim SH, Heo MA, Choi YH, Park MJ, Yoo MA, Kim HD, Kang HS, Cheong J.
(2004) Coactivator ASC-2 mediates heat shock factor 1-mediated transactivation
dependent on heat shock. FEBS Lett. 559(1-3):165-70.
Hong Y, Rogers R, Matunis MJ, Mayhew CN, Goodson ML, Park-Sarge OK, Sarge KD.
(2001) Regulation of heat shock transcription factor 1 by stress-induced SUMO-1
modification. J Biol Chem. 276(43):40263-7.
Houzelstein D, Cohen A, Buckingham ME, Robert B. (1997) Insertional mutation of the
mouse Msx1 homeobox gene by an nlacZ reporter gene. Mech Dev. 65(1-2):123-33.
Hu G, Lee H, Price SM, Shen MM, Abate-Shen C. (2001) Msx homeobox genes inhibit
differentiation through upregulation of cyclin D1. Development. 128(12):2373-84.
91
Hu G, Vastardis H, Bendall AJ, Wang Z, Logan M, Zhang H, Nelson C, Stein S,
Greenfield N, Seidman CE, Seidman JG, Abate-Shen C. (1998) Haploinsufficiency of
MSX1: a mechanism for selective tooth agenesis. Mol Cell Biol. 18(10):6044-51.
Hu Y, Mivechi NF. (2003) HSF-1 interacts with Ral-binding protein 1 in a stress-
responsive, multiprotein complex with HSP90 in vivo. J Biol Chem. 278(19):17299-306.
Hu, D., Marcucio, R. S. and Helms, J. A. (2003). A zone of frontonasal ectoderm
regulates patterning and growth in the face. Development 130,1749 -1758.
Ichida F, Nishimura R, Hata K, Matsubara T, Ikeda F, Hisada K, Yatani H, Cao X,
Komori T, Yamaguchi A, Yoneda T. (2004) Reciprocal roles of MSX2 in regulation of
osteoblast and adipocyte differentiation. J Biol Chem. 279(32):34015-22.
Inouye S, Izu H, Takaki E, Suzuki H, Shirai M, Yokota Y, Ichikawa H, Fujimoto M,
Nakai A. (2004) Impaired IgG production in mice deficient for heat shock transcription
factor 1. J Biol Chem. 279(37):38701-9.
Ishii M, Merrill AE, Chan YS, Gitelman I, Rice DP, Sucov HM, Maxson RE Jr. (2003)
Msx2 and Twist cooperatively control the development of the neural crest-derived
skeletogenic mesenchyme of the murine skull vault. Development. 130(24):6131-42.
Isshiki T, Takeichi M, Nose A. (1997) The role of the msh homeobox gene during
Drosophila neurogenesis: implication for the dorsoventral specification of the
neuroectoderm, Development 124:3099¨ 3109
Jabs, E. W., Muller, U., Li, X., Ma, L., Luo, W., Haworth, I. S., Klisak, I., Sparkes, R.,
Warman, M. L., Mulliken, J. B. & et al. (1993) A mutation in the homeodomain of the
human MSX2 gene in a family affected with autosomal dominant craniosynostosis. Cell
75, 443-50.
Jedlicka P, Mortin MA, Wu C. (1997) Multiple functions of Drosophila heat shock
transcription factor in vivo. EMBO J. 16(9):2452-62.
Jiang TX, Liu YH, Widelitz RB, Kundu RK, Maxson RE, Chuong CM. (1999) Epidermal
dysplasia and abnormal hair follicles in transgenic mice overexpressing homeobox gene
MSX-2.J Invest Dermatol. 113(2):230-7,
Jolly C, Usson Y, Morimoto RI. (1999) Rapid and reversible relocalization of heat shock
factor 1 within seconds to nuclear stress granules. Proc Natl Acad Sci U S A.
96(12):6769-74.
Jumlongras D, Bei M, Stimson JM, Wang WF, DePalma SR, Seidman CE, Felbor U,
Maas R, Seidman JG, Olsen BR. (2001) A nonsense mutation in MSX1 causes Witkop
syndrome. Am J Hum Genet. 69(1):67-74.
92
Kahyo T, Nishida T, Yasuda H. (2001) Involvement of PIAS1 in the sumoylation of
tumor suppressor p53. Mol Cell. 8(3):713-8.
Kallio M, Chang Y, Manuel M, Alastalo TP, Rallu M, Gitton Y, Pirkkala L, Loones MT,
Paslaru L, Larney S, Hiard S, Morange M, Sistonen L, Mezger V. (2002) Brain
abnormalities, defective meiotic chromosome synapsis and female subfertility in HSF2
null mice. EMBO J. 21(11):2591-601.
Kanei-Ishii C, Tanikawa J, Nakai A, Morimoto RI, Ishii S. (1997) Activation of heat
shock transcription factor 3 by c-Myb in the absence of cellular stress. Science.
277(5323):246-8.
Keagle JN, Welch WJ, Young DM. (2001) Expression of heat shock proteins in a linear
rodent wound. Wound Repair Regen. 9(5):378-85.

Kettunen P, Thesleff I. (1998) Expression and function of FGFs-4, -8, and -9 suggest
functional redundancy and repetitive use as epithelial signals during tooth morphogenesis.
Dev Dyn. 211(3):256-68.
Kim SA, Yoon JH, Kim DK, Kim SG, Ahn SG. (2005) CHIP interacts with heat shock
factor 1 during heat stress. FEBS Lett. 579(29):6559-63.
Kline, M. P., and Morimoto, R. I. (1997) Repression of the heat shock factor 1
transcriptional activation domain is modulated by constitutive phosphorylation. Mol. Cell.
Biol. 17, 2107¨ 2115
Knauf, U., Newton, E. M., Kyriakis, J., and Kingston, R. E. (1996) Repression of human
heat shock factor 1 activity at control temperature by phosphorylation. Genes Dev. 10,
2782¨ 2793
Koshiba K, Kuroiwa A, Yamamoto H, Tamura K, Ide H. (1998) Expression of Msx
genes in regenerating and developing limbs of axolotl. J Exp Zool. 282(6):703-14.
Kothary R, Clapoff S, Darling S, Perry MD, Moran LA, Rossant J. (1989). Inducible
expression of an hsp68-lacZ hybrid gene in transgenic mice. Development. 105:707-14.
Kuwajima T, Taniura H, Nishimura I, Yoshikawa K. (2004). Necdin interacts with the
Msx2 homeodomain protein via MAGE-D1 to promote myogenic differentiation of
C2C12 cells. J Biol Chem. 279:40484-93.
Lamb J, Ramaswamy S, Ford HL, Contreras B, Martinez RV, Kittrell FS, Zahnow CA,
Patterson N, Golub TR, Ewen ME. (2003) A mechanism of cyclin D1 action encoded in
the patterns of gene expression in human cancer. Cell.114:323-34.
Larson, W. J. (2001). Human Embryology. London, UK: Churchill Livingston.
93
Lee, H., Habas, R. & Abate-Shen, C. (2004) MSX1 cooperates with histone H1b for
inhibition of transcription and myogenesis. Science 304, 1675-8.
Lee, H., Quinn, J. C., Prasanth, K. V., Swiss, V. A., Economides, K. D., Camacho, M. M.,
Spector, D. L. & Abate-Shen, C. (2006) PIAS1 confers DNA-binding specificity on the
Msx1 homeoprotein. Genes Dev 20, 784-94.
Liu YH, Kundu R, Wu L, Luo W, Ignelzi MA Jr, Snead ML, Maxson RE Jr. (1995)
Premature suture closure and ectopic cranial bone in mice expressing Msx2 transgenes in
the developing skull. Proc Natl Acad Sci U S A. 92(13):6137-41.
Liu YH, Tang Z, Kundu RK, Wu L, Luo W, Zhu D, Sangiorgi F, Snead ML, Maxson
RE.( 1999) Msx2 gene dosage influences the number of proliferative osteogenic cells in
growth centers of the developing murine skull: a possible mechanism for MSX2-
mediated craniosynostosis in humans. Dev Biol. 205(2):260-74.
M. D'Alessio and M. Frasch, (2003) msh may play a conserved role in dorsoventral
patterning of the neuroectoderm and mesoderm, Mech. Dev. 58 :217¨ 231
Ma L, Liu J, Wu T, Plikus M, Jiang TX, Bi Q, Liu YH, Muller-Rover S, Peters H,
Sundberg JP, Maxson R, Maas RL, Chuong CM. (2003) 'Cyclic alopecia' in Msx2
mutants: defects in hair cycling and hair shaft differentiation. Development.130 (2):379-
89.
Ma, L., Golden, S., Wu, L. & Maxson, R. (1996) The molecular basis of Boston-type
craniosynostosis: the Pro148-->His mutation in the N-terminal arm of the MSX2
homeodomain stabilizes DNA binding without altering nucleotide sequence preferences.
Hum Mol Genet 5, 1915-20.
Marianna Bei, Stephanie Stowell, Richard Maas (2004) Msx2 controls ameloblast
terminal differentiation. Dev Dyn. 231(4):758-65.
Mivechi NF, Murai T, Hahn GM. (1994) Inhibitors of tyrosine and Ser/Thr phosphatases
modulate the heat shock response. J Cell Biochem. 54(2):186-97.
Morimoto RI. (1998) Regulation of the heat shock transcriptional response: cross talk
between a family of heat shock factors, molecular chaperones, and negative regulators.
Genes Dev. 12(24):3788-96
Nagy A, Gertsenstein M, Vintersten K, Behringer R. (2003) Manipulating the Mouse
Embryo-a laboratory manual 3
rd
version. Cold spring harbor laboratory press.
Nakai A, Suzuki M, Tanabe M. (2000) Arrest of spermatogenesis in mice expressing an
active heat shock transcription factor 1.EMBO J. 19(7):1545-54.
94
Newberry EP, Boudreaux JM, Towler DA. (1997) Stimulus-selective inhibition of rat
osteocalcin promoter induction and protein-DNA interactions by the homeodomain
repressor Msx2. J Biol Chem. 272(47):29607-13.
Newberry EP, Latifi T, Battaile JT, Towler DA. (1997). Structure-function analysis of
Msx2-mediated transcriptional suppression. Biochemisty. 36:10451-62.
Odelberg SJ, Kollhoff A, Keating MT. (2000) Dedifferentiation of mammalian myotubes
induced by msx1. Cell. 103(7):1099-109.
Ogawa T, Kapadia H, Feng JQ, Raghow R, Peters H, D'Souza RN. (2006) Functional
consequences of interactions between Pax9 and Msx1 genes in normal and abnormal
tooth development. J Biol Chem. 281(27):18363-9.
Ostling P, Bj?rk JK, Roos-Mattjus P, Mezger V, Sistonen L. (2007) Heat shock factor 2
(HSF2) contributes to inducible expression of hsp genes through interplay with HSF1. J
Biol Chem. 282(10):7077-86.
Park K, Kim K, Rho SB, Choi K, Kim D, Oh SH, Park J, Lee SH, Lee JH. (2005)
Homeobox Msx1 interacts with p53 tumor suppressor and inhibits tumor growth by
inducing apoptosis. Cancer Res. 65(3):749-57.
Pirkkala L, Nyk?nen P, Sistonen L. (2001) Roles of the heat shock transcription factors in
regulation of the heat shock response and beyond. FASEB J. 15(7):1118-31
Rallu M, Loones M, Lallemand Y, Morimoto R, Morange M, Mezger V. (1997) Function
and regulation of heat shock factor 2 during mouse embryogenesis. Proc Natl Acad Sci U
S A. 94(6):2392-7.
Ramos C, Fern¨ndez-Llebrez P, Bach A, Robert B, Soriano E. (2004) Msx1 disruption
leads to diencephalon defects and hydrocephalus. Dev Dyn. 230(3):446-60.
Rave-Harel N, Miller NL, Givens ML, Mellon PL. (2005) The Groucho-related gene
family regulates the gonadotropin-releasing hormone gene through interaction with the
homeodomain proteins MSX1 and OCT1. J Biol Chem. 280(35):30975-83.
Ryoo HM, Hoffmann HM, Beumer T, Frenkel B, Towler DA, Stein GS, Stein JL, van
Wijnen AJ, Lian JB. (1997) Stage-specific expression of Dlx-5 during osteoblast
differentiation: involvement in regulation of osteocalcin gene expression. Mol Endocrinol.
11(11):1681-94.
Santos SD, Saraiva MJ. (2004) Enlarged ventricles, astrogliosis and neurodegeneration in
heat shock factor 1 null mouse brain. Neuroscience. 126(3):657-63.
Sarge KD, Murphy SP, Morimoto RI. (1993) Activation of heat shock gene transcription
by heat shock factor 1 involves oligomerization, acquisition of DNA-binding activity,
95
and nuclear localization and can occur in the absence of stress. Mol Cell Biol.
13(3):1392-407.
Satokata I, Maas R. (1994) Msx1 deficient mice exhibit cleft palate and abnormalities of
craniofacial and tooth development. Nat Genet. 6(4):348-56.
Satokata, I., Ma, L., Ohshima, H., Bei, M., Woo, I., Nishizawa, K., Maeda, T., Takano,
Y., Uchiyama, M., Heaney, S., Peters, H., Tang, Z., Maxson, R. & Maas, R. (2000) Msx2
deficiency in mice causes pleiotropic defects in bone growth and ectodermal organ
formation. Nat Genet. 24(4):391-5.
Semenza GL, Wang GL, Kundu R. (1995). DNA binding and transcriptional properties of
wild-type and mutant forms of the homeodomain protein Msx2. Biochem Biophys Res
Commun. 209:257-62.
Shamovsky I, Ivannikov M, Kandel ES, Gershon D, Nudler E. (2006) RNA-mediated
response to heat shock in mammalian cells. Nature. 440(7083):556-60.
Shang Z, Ebright YW, Iler N, Pendergrast PS, Echelard Y, McMahon AP, Ebright RH,
Abate C. (1994) DNA affinity cleaving analysis of homeodomain-DNA interaction:
identification of homeodomain consensus sites in genomic DNA.Proc Natl Acad Sci U S
A. 91(1):118-22.
Shetty S, Takahashi T, Matsui H, Ayengar R, Raghow R.. (1999) Transcriptional
autorepression of Msx1 gene is mediated by interactions of Msx1 protein with a multi-
protein transcriptional complex containing TATA-binding protein, Sp1 and cAMP-
response-element-binding protein-binding protein (CBP/p300). Biochem J 339:751-8.
Shimeld S.M. et al., (1996) The murine homeobox gene Msx-3 shows highly restricted
expression in the developing neural tube, Mech. Dev. 55:201¨ 210
Shirakabe, K., Terasawa, K., Miyama, K., Shibuya, H., and Nishida, E. (2001)
Regulation of the activity of the transcription factor Runx2 by two homeobox proteins,
Msx2 and Dlx5. Genes Cells 6, 851-856.
Sicinski P, Donaher JL, Parker SB, Li T, Fazeli A, Gardner H, Haslam SZ, Bronson RT,
Elledge SJ, Weinberg RA. (1995) Cyclin D1 provides a link between development and
oncogenesis in the retina and breast. Cell. 82(4):621-30.
Sierra OL, Cheng SL, Loewy AP, Charlton-Kachigian N, Towler DA. (2004). MINT, the
Msx2 interacting nuclear matrix target, enhances Runx2-dependent activation of the
osteocalcin fibroblast growth factor response element. J Biol Chem. 279:32913-23.
Singh V, Aballay A. (2006) Heat shock and genetic activation of HSF-1 enhance
immunity to bacteria.Cell Cycle. 5(21):2443-6.
96
Song WK, Wang W, Foster RF, Bielser DA, Kaufman SJ. (1992). H36-alpha 7 is a novel
integrin alpha chain that is developmentally regulated during skeletal myogenesis. J Cell
Biol. 117:643-57.
Takahashi K, Nuckolls GH, Takahashi I, Nonaka K, Nagata M, Ikura T, Slavkin HC,
Shum L. (2001) Msx2 is a repressor of chondrogenic differentiation in migratory cranial
neural crest cells. Dev Dyn. 222(2):252-62.
Takaki E, Fujimoto M, Sugahara K, Nakahari T, Yonemura S, Tanaka Y, Hayashida N,
Inouye S, Takemoto T, Yamashita H, Nakai A. (2006) Maintenance of olfactory
neurogenesis requires HSF1, a major heat shock transcription factor in mice. J Biol Chem.
281(8):4931-7.
Tongkobpetch S, Siriwan P, Shotelersuk V. (2006). MSX1 mutations contribute to
nonsyndromic cleft lip in a Thai population. J Hum Genet. 51, 671-6.
Towler DA, Rutledge SJ, Rodan GA. (1994) Msx-2/Hox 8.1: a transcriptional regulator
of the rat osteocalcin promoter. Mol Endocrinol. 8(11):1484-93.
Vainio S, Karavanova I, Jowett A, Thesleff I. (1993) Identification of BMP-4 as a signal
mediating secondary induction between epithelial and mesenchymal tissues during early
tooth development. Cell. 75(1):45-58.
Van den Boogaard, M. J., Dorland, M., Beemer, F. A. & van Amstel, H. K. (2000) MSX1
mutation is associated with orofacial clefting and tooth agenesis in humans. Nat Genet 24,
342-3.
Vastardis, H., Karimbux, N., Guthua, S. W., Seidman, J. G. & Seidman, C. E. (1996) A
human MSX1 homeodomain missense mutation causes selective tooth agenesis. Nat
Genet 13, 417-21.
Wang G, Ying Z, Jin X, Tu N, Zhang Y, Phillips M, Moskophidis D, Mivechi NF. (2004)
Essential requirement for both hsf1 and hsf2 transcriptional activity in spermatogenesis
and male fertility. Genesis. 38(2):66-80.
Wang G, Zhang J, Moskophidis D, Mivechi NF. (2003) Targeted disruption of the heat
shock transcription factor (hsf)-2 gene results in increased embryonic lethality, neuronal
defects, and reduced spermatogenesis. Genesis. 36(1):48-61.
Wang X, Khaleque MA, Zhao MJ, Zhong R, Gaestel M, Calderwood SK. (2006)
Phosphorylation of HSF1 by MAPK-activated protein kinase 2 on serine 121, inhibits
transcriptional activity and promotes HSP90 binding. J Biol Chem. 281(2):782-91.
Wang YH, Rutherford B, Upholt WB, Mina M. (1999). Effects of BMP-7 on mouse tooth
mesenchyme and chick mandibular mesenchyme. Dev Dyn 216:320-35.
97
Wilkie AO, Morriss-Kay GM. (2001) Genetics of craniofacial development and
malformation. Nat Rev Genet. 458-68.
Woloshin P, Song K, Degnin C, Killary AM, Goldhamer DJ, Sassoon D, Thayer MJ.
(1995). MSX1 inhibits myoD expression in fibroblast x 10T1/2 cell hybrids.
Cell. 82:611-20.
Wu L, Wu H, Ma L, Sangiorgi F, Wu N, Bell JR, Lyons GE, Maxson R. (1997) Miz1, a
novel zinc finger transcription factor that interacts with Msx2 and enhances its affinity
for DNA. Mech Dev. 65(1-2):3-17.
Wu LY, Li M, Hinton DR, Guo L, Jiang S, Wang JT, Zeng A, Xie JB, Snead M, Shuler C,
Maxson RE Jr, Liu YH. (2003) Microphthalmia resulting from MSX2-induced apoptosis
in the optic vesicle. Invest Ophthalmol Vis Sci. 44(6):2404-12.
Xavier IJ, Mercier PA, McLoughlin CM, Ali A, Woodgett JR, Ovsenek N. (2000 )
Glycogen synthase kinase 3beta negatively regulates both DNA-binding and
transcriptional activities of heat shock factor 1. J Biol Chem. 15;275(37):29147-52.
Xiao X, Zuo X, Davis AA, McMillan DR, Curry BB, Richardson JA, Benjamin IJ. (1999)
HSF1 is required for extra-embryonic development, postnatal growth and protection
during inflammatory responses in mice. EMBO J. 18(21):5943-52.
Yamamoto, T.S., Takagi, C. and Ueno, N., (2000). Requirement of Xmsx-1 in the BMP-
triggered ventralization of Xenopus embryos. Mech. Dev. 91, pp. 131¨ 141.
Zhang H, Catron KM, Abate-Shen C. (1996). A role for the Msx-1 homeodomain in
transcriptional regulation: residues in the N-terminal arm mediate TATA binding protein
interaction and transcriptional repression. Proc Natl Acad Sci USA 93:1764-9.
Zhang H, Hu G, Wang H, et al. (1997). Heterodimerization of Msx and Dlx
homeoproteins results in functional antagonism. Mol Cell Biol 17:2920-32.
Zhang Y, Zhang Z, Zhao X, et al. (2000). A new function of BMP4: dual role for BMP4
in regulation of Sonic hedgehog expression in the mouse tooth germ. Development
127:1431-43.
Zhang Y, Zhao X, Hu Y, et al. (1999). Msx1 is required for the induction of Patched by
Sonic hedgehog in the mammalian tooth germ. Dev Dyn 215:45-53.
Zhang Z, Song Y, Zhao X, Zhang X, Fermin C, Chen Y. (2002) Rescue of cleft palate in
Msx1-deficient mice by transgenic Bmp4 reveals a network of BMP and Shh signaling in
the regulation of mammalian palatogenesis. Development. 129(17):4135-46.
Zhao X, Zhang Z, Song Y, et al. (2000). Transgenically ectopic expression of Bmp4 to
the Msx1 mutant dental mesenchyme restores downstream gene expression but represses
Shh and Bmp2 in the enamel knot of wild type tooth germ. Mech Dev 99:29-38.
98
Zhou YL, Lei Y, Snead ML. (2000). Functional antagonism between Msx2 and
CCAAT/Enhancer-binding protein a¨ in regulating the mouse amelogenin gene
expression is mediated by protein-protein interaction. J Biol Chem 275:29066-75.

Abstract (if available)

Abstract The importance of Msx genes in regulating development of ocular, neuronal, cardiac, ectodermal and oro-craniofacial structures has been well established. Previous studies have shown that Msx proteins regulate gene transcription predominantly through repression by forming transcriptionally inactive heteromeric complexes. In contrast to their known suppressor activities, gene expression studies using either the gain-of-function or the loss-of-function mutants revealed many gene targets whose expression requires functional Msx proteins. Here we present data demonstrating for the first time that Msx proteins function as activators of transcription by controlling the intracellular distribution and by modulating the transcriptional activity of partnering molecules. Msx proteins activate the Hsp70 promoter through a mechanism in which Msx protein physically interacts with and modify Heat shock transcriptional factors (Hsfs) to facilitate their nuclear translocation, accumulation and subsequent transcriptional activation. The fact that Msx1 and Msx2 can stimulate Hsf mediated transcriptional activation of Hsp70 promoter in the absence of chemical, physical or physiological stress suggests that Msx1 and Msx2 may provide a critical and novel pathway in activating Hsf1 and Hsf2 and hence transcriptional induction of their target genes under normal physiological conditions.

Linked assets

University of Southern California Dissertations and Theses

Conceptually similar

PDF

Modulation of C/EBP alpha in the regulation of mouse amelogenin transcription during tooth formation

PDF

Global analysis of the molecular activities defining maturation-stage amelogenesis

PDF

Functions of Msx2 and Msx1 during mouse skull and hair follicle development

PDF

Extracellular heat shock protein-90alpha (eHsp90α): mechanisms of secretion, quantitation and function

PDF

Amelogenin-ameloblastin protein interaction and function in dental enamel formation

PDF

The function of TGF-beta signaling in palatal and dental epithelium during embryogenesis

PDF

Tissue-specific action of Msx genes in the regulation of skull vault development

PDF

Functionalization of scaffolds with anti-BMP-2 antibody: role in antibody mediated osseous regeneration (AMOR)

PDF

Ameloblastin-protein interactions pattern enamel matrix

PDF

CCNL1, EWS, TFIP11, and RNA splicing

PDF

Role of MMP-20 in preventing protein occlusion in enamel apatite crystals: relevance in enamel biomineralization and biomimetics

PDF

The role of parathyroid hormone-related protein in regulating neonatal lung development

PDF

Integrin expression and signaling during palatal fusion

PDF

A Western blot analysis and immunohistochemical study of 4-day old mice teeth over-expressing amelotin during amelogenesis

PDF

Protein arginine methyltransferases in murine skull development

PDF

The effect of leucine-rich amelogenin peptide on mouse bone density by histological analysis

PDF

Amelogenin peptides for biomimetic remineralization of enamel and dentin

PDF

Characterizing the protein expression of S1P receptors in T-cell acute lymphoblastic leukemia (T-ALL) cell lines

PDF

TGF-β signaling regulates gingival epithelial wound healing and barrier function

PDF

Chitosan‐amelogenin hydrogel‐saliva interactions: towards optimization of a protocol for enamel repair

Asset Metadata

Creator Zhuang, Fengfeng (author)

Core Title Transcriptional co-activation functions of Msx homeodomain proteins by activating Hsf proteins

School School of Dentistry

Degree Doctor of Philosophy

Degree Program Craniofacial Biology

Publication Date 03/05/2008

Defense Date 12/17/2007

Publisher University of Southern California (original), University of Southern California. Libraries (digital)

Tag Craniofacial Biology,Hsf,Msx1,OAI-PMH Harvest

Language English

Advisor Shuler, Charles (committee chair), Kwfong, Henry (committee member), Liu, Yi-hsin (committee member), Oldak, Janet Moradian (committee member), Paine, Michael L. (committee member)

Creator Email fzhuang@usc.edu

Permanent Link (DOI) https://doi.org/10.25549/usctheses-m1041

Unique identifier UC1139103

Identifier etd-zhuang-20080305 (filename),usctheses-m40 (legacy collection record id),usctheses-c127-23229 (legacy record id),usctheses-m1041 (legacy record id)

Legacy Identifier etd-zhuang-20080305.pdf

Dmrecord 23229

Document Type Dissertation

Rights Zhuang, Fengfeng

Type texts

Source University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Repository Name Libraries, University of Southern California

Repository Location Los Angeles, California

Repository Email cisadmin@lib.usc.edu