University of Southern California Dissertations and Theses

Modulation of C/EBP alpha in the regulation of mouse amelogenin transcription during tooth formation

(USC Thesis Other)

Modulation of C/EBP alpha in the regulation of mouse amelogenin transcription during tooth formation

PDF

Download

Open document

Flip pages

Download a page range

Download transcript

Copy asset link

Request this asset

Transcript (if available)

Content MODULATION OF C/EBPα IN THE REGULATION OF MOUSE
AMELOGENIN TRANSCRIPTION DURING
TOOTH FORMATION
by
Yucheng Xu
A Dissertation Presented to the
FACULTY OF THE GRADUATE SCHOOL
UNIVERSITY OF SOUTHERN CALIFORNIA
In Partial Fulfillment of the
Requirements for the Degree
DOCTOR OF PHILOSOPHY
(CRANIOFACIAL BIOLOGY)
December 2006
Copyright 2006 Yucheng Xu
ii
Acknowledgments
I would like to thank Malcolm L. Snead for his guidance and expertise during
my entire doctoral training process. I would also like to thank my committee
members, Dr. Charles Shuler, Dr. Michael Paine, Dr. David Ann, and Dr. Henry
Sucov for their guidance and support.
I am also grateful to my colleagues: Dr. Wen Luo for his expertise in
histology; Dr. Yan Zhou for sharing his C/EBPα knowledge and his real-time PCR
techniques; Dr. Michael L. Paine, Dr. Yaping Lei, Dr. Danhong Zhu, Hongjun
Wang, Dr. Xin Wen, Dr. Jason Shapiro, Dr. Rungnapa Warotayanont, and Dr.
Sissada Tannukit for their expertise; and Dr. Qin-Shi Zhu and Dr. Daniel Levy for
their stimulating discussions. Thanks to Dr. Ormond A. MacDougald (University of
Michigan) for the C/EBPα expression vectors; Dr. David Ann for the SUMO-1-
EGFP expression vector; Dr. Hiroyoshi Ariga (Hokkaido University) for the NF-Y
expression vectors; Dr. Lillian Shum (National Institutes of Health) for the YY-1
expression vector; Dr. Timothy Osborne (University of California at Irvine) for the
dominant negative NF-YA expression vector (NF-YAm29); Dr. Sigal Gery (Cedars-
Sinai Medical Center) for the C/EBPδ expression vector; Dr. Frank J. Gonzalez
(National Cancer Institute) for the floxed C/EBPα mice; Dr. Pierre Chambon
(Institut de Genetique et de Biologie Moleculaire et Cellulaire) for the K14-Cre
mice; and Dr. Philippe Soriano (Fred Hutchinson Cancer Research Center) for the
R26R mice.
iii
Table of Contents
Acknowledgments ii
List of Tables v
List of Figures vi
Abstract viii
Chapter 1: Introduction 1
Amelogenin Gene Regulation 1
Structure and Properties of C/EBPα 3
Major function of C/EBPα 4
Post-translational Modification of C/EBPα 6
C/EBPα conditional knockout mice 8
Chapter 2: NF-Y and CCAAT/Enhancer-binding Protein α
Synergistically Activate the Mouse Amelogenin Gene 10
Introduction 10
Materials and Methods 13
Results 19
Discussion 35
Chapter 3: Antagonism between YY1 and CCAAT/Enhancer-
binding Protein α in Regulating Mouse Amelogenin
Gene Expression 39
Introduction 39
Materials and Methods 40
Results 45
Discussion 54
Chapter 4: Physical Dissection of the CCAAT/Enhancer-
binding Protein α in Regulating the Mouse
Amelogenin Gene 56
Introduction 56
Materials and Methods 57
Results 61
Discussion 67
iv
Chapter 5: Sumoylation and Transcriptional Activity of
CCAAT/Enhancer-binding Protein α 69
Introduction 69
Materials and Methods 71
Results 75
Discussion 83
Chapter 6: CCAAT/Enhancer-binding Protein α and Amelogenin
Gene Expression In Vivo 86
Introduction 86
Materials and Methods 87
Results 94
Discussion 110
Summary 115
References 123
v
List of Tables
Table 1. Real-Time PCR primer sequences and their expected product sizes. 108
Table 2. Comparison of the mRNA level for C/EBPα, C/EBPβ,
C/EBPδ, NF-YA and amelogenin among wild-type and C/EBPα
conditional knock-out mice. 109
vi
List of Figures
Fig. 1. The integrity of the C/EBPα binding site and reversed CCAAT
box is required for maintaining the basal amelogenin promoter
and C/EBPα-mediated transactivation. 25
Fig. 2. EMSA of the C/EBPα and the CCAAT box cis-elements. 28
Fig. 3. Mutational analysis of C/EBPα and NF-Y proteins binding to the
-77/-48 probe. 30
Fig. 4. C/EBPα and NF-Y synergism on the minimal amelogenin promoter. 32
Fig. 5. Co-immunoprecipitation analysis of NF-YA and C/EBPα from LS8 cells. 33
Fig. 6. A model for the mechanism underlying the synergism between
C/EBPα and NF-Y in activating the amelogenin promoter. 34
Fig. 7. Protein/DNA array to identify factors associated with C/EBPα regulation
of amelogenin gene expression. 48
Fig. 8. Dose dependent repression of mouse amelogenin promoter activity
by YY1. 49
Fig. 9. YY1 repression of C/EBPα-mediated transactivation does not occur
through DNA binding capacity. 52
Fig. 10. Effects of C/EBPα truncated isoforms on the mouse amelogenin
promoter. 64
Fig. 11. Co-immunoprecipitation of various C/EBPα truncated isoforms and
Msx2 from LS8 cells. 65
Fig. 12. C/EBPα is sumoylated in LS8 cells. 79
Fig. 13. Over-expression of SUMO-1 decreases C/EBPα-mediated amelogenin
promoter transactivation. 81
Fig. 14. Effects of sumoylation on cytoplasmic-nuclear localization of C/EBPα.82
Fig. 15. Schema of the primer design for genotyping wild-type, C/EBPα
fl/fl
, and
C/EBPα
-/-
alleles. 99
vii
Fig. 16. Characterization of Cre recombinase activity in the ameloblast cell
lineage achieved by the K14-Cre mated to R26R transgenic mice. 100
Fig. 17. The mRNA expression level of C/EBPα (A), C/EBPβ (B),
C/EBPδ (C), NF-YA (D), and amelogenin (E) among wild-type and
C/EBPα conditional knock-out mice, determined by
real-time PCR. *P<0.05, **P<0.01. 101
Fig. 18. Micro anatomy of hemotoxylin and eosin stained three-day-postnatal
wild-type ("C/EBPα
+/+
") and C/EBPα knock-out ("C/EBPα
-/-
") mutant
mouse incisor (A) and molar (B) teeth. 103
Fig. 19. Effects of C/EBPβ and NF-Y on the amelogenin promoter. 104
Fig. 20. Requirement of the C/EBP site for the basal amelogenin promoter
activity and C/EBPδ-mediated transactivation. 105
Fig. 21. C/EBPδ and NF-Y synergism on the minimal amelogenin promoter. 106
Fig. 22. C/EBPδ expression pattern in a newborn mouse mandibular incisor. 107
viii
Abstract
Amelogenin gene expression is spatiotemporally regulated during enamel
biomineralization. Studies show that C/EBPα is a transactivator of the mouse
amelogenin gene acting at the C/EBPα cis-element located in the –70/+52 minimal
promoter that also contains a reversed CCAAT box (-58/-54). Similar to the C/EBPα
binding site, this CCAAT box is required for the basal promoter activity.
Electrophoretic mobility shift assays demonstrate that NF-Y is directly bound to this
reversed CCAAT box. Co-transfection of C/EBPα and NF-Y synergistically
increases the promoter activity. Protein-protein interactions between C/EBPα with
NF-Y are identified by a co-immunoprecipitation analysis.
A protein/DNA array technique is utilized to identify a transcriptional factor
named YY1. YY1 represses both the basal amelogenin promoter activity and
C/EBPα-mediated transactivation. Furthermore, YY1 repression is independent of its
DNA binding capacity.
C/EBPα contains four highly conserved regions (CR) named CR1, CR2, CR3
and CR4. CR2 in isolation has an exceptional capacity to activate the full-length
amelogenin promoter, while the remaining conserved region, either in isolation or in
selected combinations, is less effective. Msx2 has previously been shown to
antagonize C/EBPα through protein-protein interactions with C/EBPα. Co-
immunoprecipitation analyses identify that the C-terminal domain (residues 216-
359) of C/EBPα is required for protein-protein interactions with Msx2.
ix
In LS8 cells, C/EBPα is subject to one of the post-translational modification
named sumoylation. Sumoylation decreases C/EBPα-mediated amelogenin promoter
transactivation. In addition, sumoylation of C/EBPα is not involved in regulating
C/EBPα cytoplasmic-nuclear transport.
The neonatal lethal phenotype of C/EBPα-deficient mice prevents observing
the effects of loss-of-C/EBPα on postnatal tooth formation. The Cre/loxP
recombination system is utilized to generate the conditional knock-out mice by
mating mice bearing the floxed C/EBPα alleles with hK14-Cre mice. Real-time PCR
analysis shows that removal of one C/ΕΒPα allele results in a dramatic decrease of
endogenous C/ΕΒPα levels and a coordinated marginal decrease in amelogenin
levels. However, deletion of both C/EBPα alleles fails to ablate amelogenin levels,
suggesting an alternative pathway to compensate the loss-of-C/EBPα. The fact that
C/EBPδ is able to activate the mouse amelogenin promoter and localizes in the
ameloblast cell lineage suggests a functional redundancy between C/EBPδ and
C/EBPα to produce enough amelogenin proteins.
1
Chapter 1
Introduction
Tooth enamel is the most highly mineralized tissue in vertebrates. Enamel
biomineralization occurs within an extracellular matrix where proteins are
synthesized and secreted by the ameloblast cells. Amelogenin proteins are the most
abundant protein constituents of the developing enamel matrix. During enamel
formation, amelogenin proteins are secreted extracellularly by ameloblasts to form
an organic supramolecular structural framework where inorganic crystals are
oriented and formed, while proteolytic degradation of amelogenin proteins releases
space for enamel mineralization progression (Fincham et al., 1999). This process is
dynamically regulated to achieve a balance among concurrent processes of
amelogenin expression, secretion, crystal formation and degradation that are required
for proper enamel biomineralization.
Amelogenin gene regulation
Amelogenin comprises approximately 90% of the enamel matrix protein and
plays a fundamental role during enamel mineralization. However, the molecular
mechanism underlying physiologic regulation of the amelogenin gene is still elusive.
Several studies have been performed to address the issue of amelogenin gene
regulation (Snead et al., 1996; Zhou et al., 2000; Zhou and Snead, 2000). The murine
amelogenin promoter has been isolated from the mouse X-chromosome. Based upon
2
transgenic mouse studies, it has been demonstrated that the 2263 nucleotides
upstream of amelogenin start codon fully recapitulate the endogenous amelogenin
gene expression profile within time and space (Snead et al., 1996).
In search of the cis-element(s) required for promoter activity of the mouse
amelogenin gene, a series of 5'-deletion reporter constructs were tested in
ameloblast-like LS8 cells with transient transfection assays. Sequential deletion of
the region between -2207 and -71 in mouse amelogenin promoter showed a modest
increase (less than two fold) in promoter activity. However, further deletion of a 19-
nucleotide stretch (-70 to -52) resulted in a nearly complete ablation of reporter gene
activity. Therefore, the -70/-52 bp region of mouse amelogenin promoter is required
for maintaining the promoter activity in LS8 cells. Subsequent analysis reveals a
CCAAT/enhancer-binding protein (C/EBP) binding site located in the -70/-63 region
through which C/ΕΒPα is able to recognize and activate the mouse amelogenin
promoter (Zhou and Snead, 2000).
Msx2 belongs to the Msx gene family, the mammalian counterpart of the
Drosophila msh (muscle segment homeobox) gene. Msx2 is strongly expressed in
undifferentiated inner enamel epithelia and is absent in differentiated ameloblast
cells. This dynamic change in Msx2 expression pattern for the ameloblast cell
lineage suggests a potential role for Msx2 in ameloblast cell differentiation. Data has
shown that Msx2 represses the amelogenin promoter activity and this repression is
independent of its intrinsic DNA-binding capacity (Zhou et al., 2000). Msx2 and
C/EBPα antagonize one another decreasing the regulated expression of the mouse
3
amelogenin gene. Electrophoresis mobility shift assay demonstrated that Msx2
interfered with the binding of C/EBPα to its cognate site, although Msx2 does not
bind to the same promoter fragment. Protein-protein interactions between Msx2 and
C/EBPα were identified by co-immunoprecipitation analyses. Furthermore, the C'-
terminal residues 183-267 of Msx2 are required for protein-protein interactions,
whereas the amino-terminal residues 2-97 of Msx2 play a less critical role. Among
three family members tested (C/EBPα, -β, and -γ), Msx2 preferentially interacts with
C/EBPα (Zhou et al., 2000).
Structure and properties of C/EBPα
C/EBPα belongs to a family of basic-leucine zipper transcription factors
named CCAAT enhancer binding proteins (C/EBPs). At least six members of the
family have been isolated, characterized and named: α (alpha), β (beta), γ
(gamma), δ (delta), ε (epsilon), and ζ (zeta) (Akira et al., 1990; Cao et al., 1991;
Landschulz et al., 1988; Roman et al., 1990; Ron and Habener, 1992; Williams et al.,
1991). C/EBPα is first identified as a heat-stable factor capable of interacting with
the CCAAT motif that is present in several gene promoters (Johnson and McKnight,
1989; Landschulz et al., 1988). Detailed studies of C/EBPα led to the discovery of
the basic-leucine zipper (bZIP) domain (Agre et al., 1989; Landschulz et al., 1989;
Vinson et al., 1989). The leucine zipper contains a heptad repeat of four leucine
residues which confer an α-helical configuration, with two dimer partners forming a
coiled-coil of α-helices in a parallel orientation. Dimerization is a prerequisite for
4
DNA binding, which is mediated by the basic region (Johnson, 1993). The
specificity of DNA binding is determined by the sequence of amino acids within the
basic region (Johnson, 1993). An optimal C/EBP binding site has been determined as
RTTGCGYAAY, where R is A or G, and Y is C or T (Osada et al., 1996b). One
model for DNA binding by bZIP protein shows the dimer forms as an inverted Y-
shaped structure in which each arm of the Y is made of the basic region, which binds
to one half of a palindromic recognition sequence in the DNA major groove (Ramji
and Foka, 2002). The amino-terminal domain of C/EBPα is responsible for
transcriptional regulation. The C/EBPα gene is intronless. By utilizing two
translation start codons, the C/EBPα mRNA can produce two protein isoforms, 42
kD and 30 kD, with the latter showing a less potential for transcriptional activation
(Ossipow et al., 1993).
Major function of C/EBPα
C/EBPα has been shown to play a critical role in a number of processes such
as adipocyte differentiation, liver regeneration, and myeloid differentiation.
In vitro cell transfection experiments have shown that ectopic expression of
C/EBPα in 3T3-L1 preadipocyte cells induces cells differentiation into mature fat
cells (Freytag et al., 1994; Lin and Lane, 1994). On the other hand, addition of
C/EBPα antisense RNA in 3T3-L1 cells blocks differentiation (Lin and Lane, 1992).
Furthermore, C/EBPα-deficient mice have dramatically reduced lipid accumulation
in the adipose tissue (Wang et al., 1995).
5
C/EBPα also plays an important role in hepatocyte differentiation. Several
genes involved in the maintenance of normal hepatocyte function and response to
injury can be activated by C/EBPα (Kimura et al., 1998; Lee et al., 1997; Nerlov and
Ziff, 1994). In addition, C/EBPα-deficient mice show profound derangement in liver
structure with acinar formation resembling proliferative or pseudoglandular
hepatocellular carcinoma (Flodby et al., 1996; Tomizawa et al., 1998). These results
indicate a pivotal role of C/EBPα in the regulation of terminal hepatocyte
differentiation and function.
The expression pattern of C/ΕΒPα is highly dynamic in differentiating
myelomonocytic cells. C/EBPα expression is relatively high in early myeloid
progenitor cells and decreases during granulocytic differentiation (Scott et al., 1992).
C/ΕΒPα is able to recognize its cis-element within the promoter regions of several
genes that are expressed in myeloid cells (Oelgeschlager et al., 1996; Pan et al.,
1999; Zhang et al., 1998). C/EBPα-deficient mice are devoid of mature neutrophils
because precursors fail to undergo myeloid differentiation beyond the myeloblast
stage. This defect correlates with a lack of granulocyte colony-stimulating factor (G-
CSF) receptor, and as a consequence, multi-potential myeloid progenitor cells from
the mutant fetal liver are not capable of responding to G-CSF signaling, although in
response to other growth factors they are able to form granulocyte-macrophage and
macrophage colonies in methylcellulose (Zhang et al., 1997).
Although C/EBPα is a transcription factor, intriguingly, its ability to arrest
growth does not require its DNA-binding activity, instead it is mediated via protein-
6
protein interactions. C/EBPα is able to inhibit cell proliferation by directly
interacting with and stabilizing the cell-cycle inhibitor p21 (Timchenko et al., 1997).
More recently, C/EBPα has been shown to interact with the cyclin-dependent
kinases cdk2 and cdk4 to arrest cell proliferation by sequestrating them from binding
to their respondent cyclins (Wang et al., 2001). It has also been shown that
C/EBPα represses E2F activity by forming a complex with E2F protein on the E2F
consensus binding sites in the promoters of the genes encoding for E2F-1 and
dihydrofolate reductase (Slomiany et al., 2000). In addition, C/EBPα has been
reported to stimulate promoter activity, not through its DNA binding capacity, but
through its interaction with NF-Y bound to the EPHX1 CCAAT box (Zhu et al.,
2004).
Post-translational modification of C/EBPα
Post-translational modification of proteins has been identified as playing a
key role in regulating numerous protein functions such as phosphorylation,
glycosylation, acetylation and methylation. In the case of C/EBPα, it has been
reported that protein kinase-C can phosphorylate specific sites within the basic
region of C/EBPα in vitro. High-performance liquid chromatography-peptide
mapping of
32
P-labeled C/EBPα indicates the presence of three phosphorylated
residues: S248, S277 and S299. Phosphorylation of C/EBPα by PKC resultes in an
attenuation of binding to DNA (Mahoney et al., 1992). This observation suggests
that phosphorylation plays a negative role in regulating C/EBPα. However, in
7
another case, insulin can reduce gene expression in adipocytes, in part, due to a
dephosphorylation-mediated degradation of C/EBPα (Hemati et al., 1997;
MacDougald et al., 1995). Studies to identify the insulin-sensitive sites for
phosphorylation reveal that C/EBPα is phosphorylated on T222, T226, and S230 in
vivo and that glycogen synthase kinase 3 is an insulin-regulated C/EBPα kinase
(Ross et al., 1999). In addition, phosphorylation of C/EBPα is reported to control
differentiation fate of bipotential myeloid progenitor cells into monocytes versus
granulocytes. Dephosphorylated C/EBPα is able to induce myeloid cells into
granulopoiesis, while phosphorylated C/EBPα leads myeloid cells to choose
monocyte differentiation by inhibiting granulopoiesis (Ross et al., 2004).
Among post-translational modifications of proteins, ubiquitination is a well-
characterized process in which ubiquitin is covalently attached to substrates,
followed by the targeting of these substrates to proteosome-mediated degradation.
Recently, a new post-translational modification system, named sumoylation, is
identified as biochemically analogous to, but functionally distinct from, the
ubiquitinylation pathway. Small ubiquitin-related modifier (SUMO) is a member of
the ubiquitin-like protein family that regulates various cellular functions of target
proteins (Kim et al., 2002b). These cellular functions include regulation of
transcriptional activity, control of protein stability, formation of subnuclear
structures, and cytoplasmic-nuclear transportation. A previous study showed that
C/EBPα, C/EBPβ, and C/EBPε contain the conserved recognition sequence (ΨKXE)
for attachment of the ubiquitin-like protein SUMO-1 (Kim et al., 2002a). SUMO-1
8
attachment decreases the inhibitory effect of the C/EBPε regulatory domain,
suggesting that sumoylation may play an important role in modulating C/EBPε
activity as well as that of the other C/EBP family members (Kim et al., 2002a).
C/EBPα conditional knockout mice
C/EBPα-deficient mice provide a powerful tool to investigate the role of
C/EBPα in regulating cellular response. However, C/EBPα-deficient mice die within
hours of birth due to hypoglycemia (Wang et al., 1995) or impaired function of type
II pneumocytes (Flodby et al., 1996; Linhart et al., 2001). The lethal phenotype
precludes further functional analysis of C/EBPα at later stages of postnatal
development necessary for tooth development studies of amelogenin expression. The
Cre/LoxP recombination system is developed to circumvent lethality and analyze the
potential of mutant cells to contribute to certain cell lineages (Sauer and Henderson,
1988). The C/EBPα
fl/fl
(flanked (fl) by loxP sites) mouse strain is generated, and
found to be indistinguishable from its wild-type counterparts (Lee et al., 1997).
When Cre recombinase is delivered to hepatocyte cells of adult C/EBPα
fl/fl
mice by
infusion of a recombinant adenovirus carrying the Cre gene, C/EBPα mRNA level is
reduced to 10% of that in control mice. This results in a diminished bilirubin UDP-
glucuronosyl-transferase expression in the liver. Severe jaundice is developed in
these knockout mice due to an increase in unconjugated serum bilirubin. Several
other genes, such as phosphoenolpyruvate carboxykinase, glycogen synthase, and
factor IX, are also strongly reduced in adult knockout mice (Lee et al., 1997).
9
In search of an appropriate promoter driving Cre recombinase in the
ameloblast cell lineage of developing teeth, cytokeratin 14 (K14) has been identified
as a potent marker for ameloblast cells both in vivo and in vitro (Tabata et al., 1996).
In the developing tooth of the newborn rat, immunohistochemical studies show that
the appearance of K14 is cell and differentiation stage specific. There is a weak
expression signal of K14 within inner enamel epithelial cells that are in the
proliferation stage, and there are strong signals of K14 within preameloblasts and
ameloblasts that are in the post-proliferation and amelogenesis stages. In the primary
cultured cells of the ameloblast lineage, K14 and amelogenin appear mainly in cells
considered to be in the post-proliferation stage. K14 is detected earlier than
amelogenin, and immunofluorostaining shows that K14 and amelogenin are
coexpressed in ameloblasts (Tabata et al., 1996).
Breeding C/EBPα
fl/fl
with K14-Cre mice to generate C/EBPα conditional
knockout mice confers an opportunity to investigate the effects on postnatal enamel
biomineralization caused by the loss of C/EBPα in the developing mouse teeth.
10
Chapter 2
NF-Y and CCAAT/Enhancer-binding Protein α Synergistically Activate the
Mouse Amelogenin Gene
Introduction
Tooth organogenesis is a complex developmental process that is dependent
upon a series of reciprocal and instructive signals (Jernvall and Thesleff, 2000).
These signals culminate to orchestrate expression of the amelogenin gene, the major
organic component of the enamel matrix. Amelogenin plays a key role in regulating
proper enamel mineralization (Gibson et al., 2001; Paine et al., 2002). Mutations to
the human amelogenin gene have been linked to patients with the inherited enamel
defect X-linked amelogenesis imperfecta (Lagerstrom et al., 1990). Amelogenin is
specifically expressed and secreted by ameloblast cells and this process is tightly
controlled spatiotemporally (Snead et al., 1988). The murine amelogenin promoter
has been isolated from the mouse X-chromosome. Based upon transgenic mouse
studies, our lab has demonstrated that the 2263 nucleotides upstream of amelogenin
start codon fully recapitulate the endogenous mouse amelogenin gene expression
profile within time and space (Snead et al., 1996).Deletion analysis of this 2263
nucleotide stretch demonstrates that the –70/+52 bp minimal promoter is
indispensable for maintaining transcriptional activity. In addition, this minimal
promoter contains a CCAAT/enhancer-binding site which is required for both the
basal promoter activity and C/EBPα-mediated transactivation (Zhou and Snead,
11
2000). C/EBPs (CCAAT/enhancer binding proteins) are a family of transcription
factors that include a highly conserved, basic-leucine zipper domain at the C'-
terminus for dimerization and DNA binding, and function in regulating cellular
differentiation in multiple tissues (Flodby et al., 1996; Freytag et al., 1994; Kimura et
al., 1998; Lee et al., 1997; Lin and Lane, 1994; Scott et al., 1992; Tomizawa et al.,
1998; Zhang et al., 1997; Zhou et al., 2000; Zhou and Snead, 2000). At least six
members of the family have been isolated, characterized, and named: α (alpha), β
(beta), γ (gamma), δ (delta), ε (epsilon), and ζ (zeta) (Akira et al., 1990; Cao et al.,
1991; Landschulz et al., 1988; Roman et al., 1990; Ron and Habener, 1992; Williams
et al., 1991).
Sequence analysis of the amelogenin minimal promoter also reveals a reversed
CCAAT box located in the –58/-54 region, four base pairs downstream of the
C/EBPα binding site. Several transcription factors are able to recognize the CCAAT
box, including CTF/NF1 (CCAAT Transcription Factor/Nuclear Factor 1) (Jones et
al., 1985; Osada et al., 1996a; Zorbas et al., 1992), CDP (CCAAT Displacement
Protein) (Aufiero et al., 1994; Barberis et al., 1987; Neufeld et al., 1992; Superti-
Furga et al., 1988), C/EBP (CCAAT/Enhancer Binding Protein) (Landschulz et al.,
1988; Osada et al., 1996b; Umek et al., 1991), and NF-Y (Nuclear Factor-Y) (Dorn
et al., 1987). Among these transcription factors, NF-Y is regarded as the leading
candidate based on the following: First, of all the potential CCAAT-binding proteins,
only NF-Y has been shown to be absolutely required for all CCAAT pentanucleotide
bona fide sequences (Dorn et al., 1987; Hatamochi et al., 1988; Hooft van
12
Huijsduijnen et al., 1987; Kim and Sheffery, 1990). Second, there is evidence
showing that NF-Y cooperatively interacts with C/EBPα to function in
transcriptional regulation on a variety of promoters (Milos and Zaret, 1992; Park et
al., 2004; Zhu et al., 2004). NF-Y is a heterotrimeric protein, consisting of three
subunits, NF-YA (also termed CBF-B), NF-YB (CBF-A), and NF-YC (CBF-C).
Alignment of amino acid sequences of these three subunits reveals several highly
conserved regions. NF-YA has a glutamine-rich region, a serine/threonine-rich
region, a subunit interaction domain, and a DNA-binding domain. NF-YB contains a
histone-fold motif and a TBP-binding domain. Like NF-YB, NF-YC also bears a
histone-fold motif, a TBP-binding domain, and an additional glutamine-rich region
(Matuoka and Yu Chen, 1999). All three subunits are necessary for DNA binding.
The two subunits, NF-YB and NF-YC, first form a heterodimer via their histone fold
motifs. The dimer then provides a suitable docking site for NF-YA to bind and to
form a functionally active NF-Y heterotrimeric protein (Matuoka and Chen, 2002).
In this chapter, I demonstrate that NF-Y is directly bound to the–58/-54 bp
CCAAT box within the amelogenin promoter. Moreover, NF-Y and C/EBPα
synergistically increase the minimal amelogenin promoter activity, although NF-Y
alone has only marginal effects on the promoter. I also identify protein-protein
interactions between NF-Y and C/EBPα. Taken together, these results suggest that
NF-Y and C/EBPα synergistically activate the mouse amelogenin gene and
contribute to the physiologic regulation of amelogenin expression during enamel
formation in vivo.
13
Materials and Methods
Plasmids
The reporter constructs of p70-luc, mC/EBPα-p70-luc, and p51-luc were
prepared as previously described (Zhou and Snead, 2000). To generate mp70-luc and
mC/EBPα-mp70-luc, the promoter regions were prepared by polymerase chain
reactions with p70-luc as the template and using a common 3’-primer (5’-
TATTCTCGAG TGTATGCTCA GTGAG-3’; The Xho I site is underlined) and
respective 5’-primers (5’-CGTGCTAGCT CAGAAACCTG ATCAGCTGTT
CAAA-3’; and 5’-CGTGCTAGCT TCAGTCTAGA GATCAGCTGT TCAAA-3’;
the Nhe I sites are underlined and the mutated site is in boldface). The PCR products
were digested with Nhe I and Xho I and inserted 5’ to 3’ into the Nhe I-Xho I site of
pGL3-Basic (Promega), and verified by nucleotide sequence determination and
analysis. The expression vector for C/EBPα was previously described (Ross et al.,
1999). The expression vectors for three subunits of NF-Y (NF-YA, NF-YB, NF-YC)
were provided by Dr. Hiroyoshi Ariga (Hokkaido University, Hokkaido, Japan). The
dominant negative NF-YA expression vector (NF-YAm29) was provided by Dr.
Timothy Osborne (University of California at Irvine, Irvine, CA).
Cell Culture
Mouse ameloblast-like cell line, termed LS8, was established by
immortalizing primary cultures of enamel organ epithelial cells with SV40 large T
14
antigen. It was maintained in Dulbecco’s Modified Eagle’s medium (Invitrogen)
supplemented with fetal bovine serum (10%), penicillin (100 units/ml), and
streptomycin (100 μg/ml) (Zhou and Snead, 2000).
Transient transfection and luciferase assay
Variable amounts of plasmid DNA were used for transient transfection for
each well of 12-well plates. The amounts of DNA varied based upon experimental
conditions and were documented in the figure legends. To normalize transfection
efficiency, 75 ng of pCMV-lacZ/well was co-transfected as an internal control. The
day before transfection, LS8 cells were plated in 12-well plates so that they were 50-
80% confluent at the time of transfection. At the time of plating and during
transfection, antibiotics were avoided. Three hours before transfection, cells were
washed twice with DMEM medium and subsequently cultured in serum-free DMEM
medium. Plasmid DNA (0.75 μg) was diluted into 62 μl of medium in a 5-ml Falcon
culture tube, 5 μl of Plus reagent (Invitrogen) was added, mixed, and incubated for
15 min at room temperature. In a second tube, 2.5 μl of Lipofectamine reagent
(Invitrogen) was diluted into 62 μl of medium and mixed. The contents of these two
tubes were combined, mixed, and incubated for another 15 min at room temperature.
While complexes were forming, the medium on the cells was replaced with 0.5 ml of
serum-free fresh medium. The DNA-Plus-Lipofectamine complex was added to each
well of cells and mixed gently. The cells were incubated for 3 h at 37°C and 5%
CO
2
. After removal of the medium containing DNA-Plus-Lipofectamine complex,
15
cells were incubated in 1 ml of fresh, complete medium for an additional 22 h and
were subject to luciferase assay with a Dual-Light kit (Applied Biosystems).
Cells were washed twice with phosphate-buffered saline, pH 7.4, and lysed in
100 μl of lysis buffer (100 mM potassium phosphate, pH 7.8, 0.2% Triton X-100, 0.5
mM DTT). Cell scrapers (Corning) were used to detach cells from the plate. Cell
lysates were transferred to a microfuge tube and centrifuged at 15,000 g for 2 min.
The extracts (supernatant) were transferred to a fresh tube and stored at -70°C. At the
time of chemiluminescent detection, buffer-A and -B were equilibrated to room
temperature and Galacton-Plus Substrate was added to buffer-B at the ratio 1:100. A
10 μl aliquot of cell extracts was transferred to a luminometer tube to which 25 μl of
buffer-A was added and immediately followed by the addition of 100 μl of buffer-B.
After a 15 sec delay, the luciferase signal was obtained for 5 sec in a luminometer
(Lumat). After 45 min incubation at room temperature, 100 μl of Acceleraor-II
(Applied Biosystems) was added and the β-galactosidase signal was measured for
another 5 sec in the same luminometer.
Preparation of nuclear extracts
LS8 cells (100-mm plates) were transiently transfected with 10 μg of the
C/EBPα expression vector by calcium phosphate co-precipitation method. Briefly,
10 μg of DNA was mixed with 62 μl of 2 M CaCl
2
, diluted to 500 μl with d.d.H
2
O,
and added dropwise to the 37°C prewarmed 2×HBS (HEPES Buffered Saline)
solution. After standing for 20 min at room temperature, the DNA-calcium
16
phosphate co-precipitates were added dropwise to the surface of the media covering
the cells and incubated overnight. The next day, medium containing the calcium
phosphate was removed and replaced with fresh complete medium for an additional
24 h. LS8 cells were washed twice with cold PBS, pH 7.4, and mechanically
removed by scrapping them into 1 ml of hypotonic buffer (20 mM Hepes, pH 7.6, 10
mM KCl, 1 mM MgCl
2
, 0.1% Triton X-100, 20% glycerol, 2 mM phenyl methyl
sulfonyl fluoride, 5 μl/ml aprotinin (Sigma), 5 μg/ml leupeptin, 0.5 mM
dithiothreitol). Cell lysates were Dounce-homogenized for 15 strokes with a type A
pestle on ice, transferred to a 1.5-ml tube, and centrifuged at 3,000 rpm for 5 min at
4°C. The pellet was resuspended in 100 μl of cold extraction buffer (20 mM Hepes,
pH 7.6, 10 mM KCl, 1 mM MgCl
2
, 0.1% Triton X-100, 20% glycerol, 2 mM phenyl
methyl sulfonyl, 5 μl/ml aprotinin (Sigma), 5 μg/ml leupeptin, 0.5 mM dithiothreitol,
420 mM NaCl), and mixed on a rotator for 1 h at 4°C. Nuclear debris was pelleted by
centrifugation at 15,000 rpm for 10 min at 4°C. Supernatants containing the nuclear
extracts were frozen in liquid N
2
and stored at -80°C. The protein concentration was
determined using a Bio-Rad protein assay kit with bovine serum albumin serving as
the standard.
Electrophoresis mobility shift assay (EMSA)
The oligodeoxynucleotide probes were synthesized, annealed, and
radiolabeled with [α-
32
P] (NEN Life Science Products) using the fill-in reaction and
Klenow enzyme (Roche). A mass of 8-15 μg of nuclear extract was added from
17
selected samples in the EMSA buffer at the final concentration of 40 mM Tris-Cl,
pH 7.9, 12 mM MgCl
2
, 60 mM KCl, 2 mM EGTA, 2 mM EDTA, 25% glycerol, 0.2
μg/μl Poly(dI-dC)·poly(dI-dC) (Sigma), and incubated for 2 h at 4°C. Radio-labeled
oligoncleotides (approximately 3000-6000 cpm/fmol) in 1.5 μl volume were added
and incubated for an additional 1 h at room temperature. Where indicated, 50-fold
molar excess of unlabeled competitor probe, antibody (1μg for anti-NF-Y, and 2 μg
for anti-C/EBPα, Santa Cruz Biotechnology), or normal serum was included in the
binding reaction prior to the addition of radio-labeled probes. After mixing with 1 μl
of loading buffer containing 250 mM Tris-Cl, pH 7.5, 0.2% bromophenol blue, 0.2%
xylene cyanol, and 40% glycerol, the mixture was resolved on a 5% non-denaturing
polyacrylamide gel in 0.5×TBE buffer prerun at 20 mA for at least 30 min. Gel
electrophoresis was carried out at 30 mA for 2.5 h. The gel was dried, and bands
were visualized by autoradiography. The sequences of the oligonucleotides were as
follows: wild-type (wt) sense strand, 5’-TTTTTCATTC AGAAACCTGA
TTGGCTGTTC-3’; wild-type (wt) antisense strand, 5’- GAACAGCCAA
TCAGGTTTCT GAATG-3’; mutant C/EBPα (mC/EBPα) sense strand, 5’-
TTTTTCATTC AGTCTAGAGA TTGGCTGTTC-3’; mutant C/EBPα antisense
strand, 5’- GAACAGCCAA TCTCTAGACT GAATG-3’; mutant NF-Y (mNF-Y)
sense strand, 5’- TTTTTCATTC AGAAACCTGA TCAGCTGTTC-3’; mutant NF-
Y antisense strand, 5’- GAACAGCTGA TCAGGTTTCT GAATG-3’; mutant
C/EBPα-mutant NF-Y (mC/EBPα-mNF-Y) sense strand, 5’- TTTTTCATTC
AGTCTAGAGA TCAGCTGTTC-3’; mutant C/EBPα-mutant NF-Y antisense
18
strand, 5’- GAACAGCTGA TCTCTAGACT GAATG-3’ (mutated sites are in
boldface).
Co-immunoprecipitation assay and Western blotting
LS8 cells, ~90% confluent in a 100 mm cell culture plate, were washed twice
in ice-cold phosphate-buffered saline. Ice-cold RIPA buffer (1 ml 1× PBS, 1%
Nonidet P-40, 0.1 mg/ml phenylmethylsulfonyl fluoride (Sigma), 30 μl/ml aprotinin
(Sigma), and 1 mM sodium orthovanadate) were added, and the cells were collected
using a cell scraper (Corning), lysed by passing six times through a 22-gauge needle
at 4°C. After centrifugation at 3,000 rpm for 15 min at 4°C, the protein concentration
of the supernatant was measured using a Bio-Rad protein assay kit (Bio-Rad) with
bovine serum albumin as standards. For immunoprecipitation, 500 μg of total protein
was precleaned with 50 μl of protein G-agarose beads (Sigma) prior to adding to 2
μg of primary antibody (Santa Cruz Biotechnology) for overnight incubation at 4°C
with rotation. Protein G-agarose beads (20 μl; IgG binding capacity at 10-20 μg per
μl) were added and incubated for 2 h at 4°C with rotation. Immunoprecipitates were
collected by centrifugation at 2,500 rpm for 5 min at 4°C. The pellets were washed
three times with 1 ml of PBS. After the final wash, the pellets were resuspended in
an equal volume of 2× SDS loading buffer, boiled for 5 min, and stored at -70°C.
Samples were resolved by 12% SDS-polyacrylamide gel electrophoresis and
transferred to Immobilon-P membrane (Millipore). The membranes were incubated
in blocking buffer overnight at 4°C, followed by incubation with the primary
19
antibody for 1 h and the appropriate horseradish peroxidase-conjugated secondary
antibody (Amersham) for 1 h at room temperature. Protein-antibody complexes were
visualized by enhanced chemiluminescence (ECL, Amersham).
Results
The minimal amelogenin promoter activity is dependent on both the –70/-63 bp
C/EBPα cis-element and the –58/-54 bp CCAAT box
Deletion analysis of the mouse amelogenin promoter has shown that the
–70/+51 bp region functions as a minimal promoter in LS8 cells. A C/EBPα cis-
element is identified in the –70/-63 bp, and it is through this region that C/EBPα up-
regulates the promoter activity in a dose-dependent manner (Zhou and Snead, 2000).
Sequence alignment of the –80/-40 bp of X-chromosomal amelogenin gene from
mouse, pig, bovine, horse, monkey, and human revealed a highly conserved reversed
CCAAT box located in the –58/-54 bp region (Fig. 1A). All positions aligned
matched for the pentanucleotides of ATTGG, a reversed CCAAT box. To investigate
the potential role of this cis-element in the regulation of the amelogenin promoter,
the ATTGG sequence in the p70-luc reporter construct was mutated to ATCAG to
generate the “mp70-luc” construct (Fig. 1B). Transient transfection of mp70-luc into
LS8 cells, compared to that of p70-luc, showed a complete loss of basal promoter
activity (Fig. 1C, lane 2). This suggested an important role for the CCAAT box in
maintaining the activity of the basal amelogenin promoter. Sequence alignment also
revealed that the C/EBPα binding site is just four base pairs upstream of the CCAAT
20
box (Fig. 1A). To further understand the role of the C/EBPα binding site and the
CCAAT box in regulating the amelogenin promoter and their potential relationship
with each other, a series of mutation constructs were introduced as shown in Fig. 1B.
These mutations are mC/EBPα-p70-luc (mutated C/EBPα site), mp70-luc (mutated
CCAAT site), mC/EBPα-mp70-luc (mutated C/EBPα site and mutated CCAAT
site), and p51-luc (deleted C/EBPα and deleted CCAAT sites). Each of these
mutated constructs or their wild-type counterparts were co-transfected into LS8 cells
with or without the C/EBPα expression vector, and analyzed in transient transfection
assays. The mutation of C/EBPα cis-element (mC/EBPα-p70-luc), CCAAT box
(mp70-luc), dual mutations (mC/EBPα-mp70-luc), as well as the dual deleted
C/ΕΒPα and CCAAT box construct (p51-luc), all showed a complete loss of the
basal promoter activity (Fig. 1C, lane 2-5). Furthermore, in response to the
exogenous expression of C/EBPα, the reporter activity of wild-type construct (p70-
luc) was increased dramatically (Fig. 1C, lane 6), whereas the reporter activity for
the remaining four differently altered C/EBPα and/or CCAAT box constructs were
greatly reduced (Fig. 1C, lane 7-10). The observed residual activity (Fig. 1C, lane 7-
10) may be due to other factors, induced by overexpression of
C/EBPα, nonspecifically affecting the amelogenin promoter. Taken together, these
data indicated that the integrity of the C/EBPα cis-element and the reversed CCAAT
box are required to maintain the basal promoter activity and C/EBPα-mediated
transactivation.
21
NF-Y is directly bound to the minimal amelogenin CCAAT box
While a number of transcription factors are reported to recognize the CCAAT
motif (Barberis et al., 1987; Dorn et al., 1987; Jones et al., 1985; Landschulz et al.,
1988), subsequent analyses revealed that there is divergence in the recognition
sequence of CCAAT, and that only NF-Y exclusively requires the CCAAT bona fide
pentanucleotide (Dorn et al., 1987; Hatamochi et al., 1988; Hooft van Huijsduijnen
et al., 1987; Kim and Sheffery, 1990). To test whether NF-Y is able to bind to this
reversed CCAAT box in the minimal amelogenin promoter, I performed
electrophoresis mobility shift assay (EMSA) using a probe bearing the C/EBPα cis-
element and the CCAAT motif shown in Fig. 2A. As shown in Fig. 2B, DNA-protein
complexes formed (lane 2), and the complex could be inhibited by the addition of a
50-fold molar excess of unlabeled probe (lane 3). A rabbit antibody specific to
C/EBPα was able to supershift the DNA-protein complex (lane 6), a finding
consistent with our previous study (Zhou and Snead, 2000), whereas normal rabbit
serum failed to supershift the complex (lane 7). An anti-NF-Y goat antibody
supershifted a substantial amount of the formed EMSA complex (lane 4), while no
supershift was observed with the addition of normal goat serum (lane 5). This data
demonstrates that NF-Y is a major component of the oligonucleotide bound DNA-
protein complex.
Since there are only four nucleotides between these two binding sites, it is
possible that the binding of one protein may influence the binding of the other. To
investigate this possibility, four different probes were designed, each with a different
22
combination of wild-type or mutated binding sites for C/EBPα or NF-Y (Fig. 3A).
The effects of these different probes on the C/EBPα and NF-Y binding were
assessed by EMSA as shown in Fig. 3B. As expected, a shifted band formed with
wild-type probe (lane 2), and both anti-NF-Y and anti-C/EBPα antibodies were able
to recognize their respective transcription factor to form supershift bands (lane 4 and
lane 5). In contrast, the mC/EBPα probe, in which the C/EBPα site was mutated and
NF-Y site was wild-type, resulted in the loss of supershifted band in the presence of
anti-C/EBPα antibody (lane 10). However, the addition of anti-NF-Y antibody was
still able to supershift the NF-Y-DNA complex (lane 9). When utilizing the mNF-Y
probe bearing a mutated NF-Y site and a wild-type C/EBPα binding site, the
intensity of shifted band was diminished (lane 12), and as expected, an anti-NF-Y
antibody failed to supershift the complex (lane 14). Interestingly, an anti-C/EBPα
antibody was not only able to supershift the DNA-protein complex, but increased the
intensity of the supershifted band as well (lane 15). This suggests that binding of NF-
Y proteins impairs the binding of C/EBPα to the probe. Once NF-Y no longer
recognizes its cognate site in the mNF-Y probe, its absence allows C/EBPα to form a
more stable complex. When a probe with both the C/EBPα and NF-Y sites were
mutated, no shifted band formed (lane 17), nor was a supershifted band observed
with the addition of either an anti-NF-Y or an anti-C/EBPα antibody (lane 19 and
20). The shifted bands of lower molecular weight lying below the primary shifted
products are considered to be noise and could result from other unknown factor(s)
interacting with the probe.
23
NF-Y and C/EBPα and synergistically activate the mouse amelogenin promoter
To investigate the functional relationship between NF-Y and C/EBPα in
regulating the minimal amelogenin promoter activity, NF-Y and C/EBPα expression
plasmids were co-transfected with the p70-luc reporter construct into LS8 cells.
Alternatively a mutant form of NF-YA, termed NF-YAm 29 was also tested in this
assay. NF-YAm 29 has three amino acid substitutions (R
311
-A, G
312
-A, and E
313
-A)
at its C'-terminus, and is devoid of DNA-binding capacity allowing it to act as a
dominant-negative mutant by sequestering the NF-YB/YC heterodimer into a
defective NF-Y complex (Mantovani et al., 1994). As shown in Fig. 4, C/EBPα in
isolation increased the promoter activity approximately 7-fold (lane 2), whereas
exogenous expression of wild-type NF-Y in isolation had only marginal effects on
the promoter (lane 3). Co-transfection of C/EBPα with NF-Y served to
synergistically increase the promoter activity to 16-fold (lane 5), a level that was
more than 2 times greater than that of C/EBPα only. Furthermore, the presence of
NF-YAm 29 dramatically decreased the promoter activity, either in the absence or in
the presence of exogenous C/EBPα expression (lane 4 and lane 6). These
observations demonstrate that NF-Y facilitates C/EBPα to synergistically activate
the minimal amelogenin promoter activity, although by itself, NF-Y exhibits only a
marginal effect on the minimal amelogenin promoter activity.
24
Protein to protein interactions of NF-Y with C/EBPα in LS8 cells
To examine whether NF-Y is able to interact with C/EBPα at the protein-
protein level, I performed co-immunoprecipitation analysis in LS8 cells. A C/EBPα
expression construct was co-transfected with NF-YA/YB/YC expression constructs
into LS8 cells. The proteins corresponding to NF-YA or C/EBPα were both detected
in the LS8 cell lysates by Western blot with their respective antibodies (Fig. 5, lane 1
and lane 4). When immunoprecipitated with an anti-NF-YA antibody, NF-YA
proteins were readily detected (lane 2), and the precipitated complex also contained
C/EBPα which was co-immunoprecipitated efficiently with NF-YA (lane 3). The
ability of the anti-NF-YA antibody to pull-down the C/EBPα demonstrates a protein-
protein interaction between NF-YA and C/EBPα. The reciprocal experimental
strategy was also performed and confirmed that a protein complex “pulled-down” by
an anti-C/EBPα antibody contained both C/ΕΒPα and NF-YA proteins (lane 5 and
lane 6).
25
C/EBPα C Luciferase
Murine ACATTTTTCATTCAGAAACCTGATTGGCTGTTCAAAGTGCC
Pig ACATTTTTCCTTCGGAAACCTGATTGGTTGCTCCAGATGCC
Bovine ACATTTTTCCTTCAGAAACCTGATTGGTTGCTCTAGATGCT
Horse ACATTTTTCCTCCAGACACCTGATTGGTTTTTCTTGATGCC
Monkey CAT-TTTTTCCTGCAGAAACCGGATTGGTTGTTCTAGATGCT
Human CACATTTTTCCTTTAGAAACTGGATTGGTTGTTACAGATGC
TNNNGNAA ATTGG
-80 -40
-70 -63 -58 -54 -51 +52
p70-luc TTCAGAAACCTGATTGGCTG
mC/EBPα-p70-luc TTCAGtctagaGATTGGCTG
mp70-luc TTCAGAAACCTGATcaGCTG
mC/EBPα-mp70-luc TTCAGtctagaGATcaGCTG
p51-luc G
Fig. 1A
Fig. 1B
26
p70-luc + +
mp70-luc + +
mC/EBPα-p70-luc + +
mC/EBPα-mp70-luc + +
p51-luc + +
C/EBPα + + + + +
0
1
2
3
4
5
6
7
8
123456789 10
Relative luciferase activity
Fig. 1C
27
Fig. 1. The integrity of the C/EBPα binding site and reversed CCAAT box is
required for maintaining the basal amelogenin promoter and C/EBPα-mediated
transactivation. A, Sequence alignment of the amelogenin promoter from selected
species. The –80/-40 region of the murine X-chromosomal amelogenin promoter is
aligned with corresponding regions of the pig, bovine, horse, monkey, and human
amelogenin promoters. The C/EBPα consensus sequence is shown as TNNNGNAA
in boldface. A consensus pentanucleotide sequence ATTGG is also shown in
boldface. B, Schematic representation of the 5’-proximal region of the mouse
amelogenin promoter used in the reporter construct. The sequence of –70/-51 is
shown, in which the C/EBPα binding site and the CCAAT box are included. The
CCAAT box (-58 to –54) is represented by a “C” in the diagram. The p70-luc
represents a wild-type minimal amelogenin promoter reporter construct; mC/EBPα-
p70-luc represents mutated C/EBPα binding site with wild-type CCAAT box; mp70-
luc represents wild-type C/EBPα binding site with mutated CCAAT box; mC/EBPα-
mp70-luc represents the dual mutated C/EBPα binding site and CCAAT box; p51-
luc represents deletion of the nucleotide stretch containing both C/EBPα site and
CCAAT box up to –51 bp of the promoter. The mutated nucleotides are shown in
lowercase with boldface. C, Analysis of the -70/-50 region by transient transfections.
250 ng of various reporter constructs (p70-luc, mp70-luc, mC/EBPα-p70-luc,
mC/EBPα-mp70-luc, and p51-luc) were transiently transfected into LS8 cells with
200 ng of C/EBPα expression plasmid or empty vector pcDNA3. In all cases,
pCMV-lacZ (75 ng) was included as an internal control for transfection efficiency.
The relative luciferase activity was the normalization of luciferase activity with β-
galactosidase activity. The mean ± S.D. from at least three independent experiments
was represented, and the level of p70-luc in the absence of exogenous C/EBPα was
set arbitrarily as “1”.
28
Wt: TTTTTCATTCAGAAACCTGATTGGCTGTTC
-77 -48
Fig. 2A
Fig. 2B
29
Fig. 2. EMSA of the C/EBPα and the CCAAT box cis-elements. A, The sequence of
–77/-48 region of the amelogenin promoter containing both C/EBPα and CCAAT
box sites used as the probe in EMSA is shown. The C/EBPα binding site is in
boldface. The CCAAT box is underlined and in boldface. B, Nuclear extracts were
prepared from LS8 cells transfected with the C/EBPα expression plasmid (NE/α).
EMSA was performed by adding the
32
P-labeled probe with or without nuclear
extracts, incubated for 1 h at room temperature, analyzed on a 5% nondenaturing
polyacrylamide gel, and visualized by autoradiography. Prior to the addition of the
probe, the reaction mixture was incubated, where indicated, with unlabeled
competitor, or antibodies, or normal goat or normal rabbit serum for 2 h at 4 °C.
Binding of the probe in the absence of nuclear extract (-) (lane 1), with nuclear
extract (+) (lanes 2-7) and additional 50-fold molar excess of unlabeled probe (lane
3), NF-Y antibody (lane 4, sc-7712x, Santa Cruz Biotechnology), normal goat serum
(lane 5), C/EBPα antibody (lane 6, sc-61, Santa Cruz Biotechnology), and normal
rabbit serum (lane 7).
30
Fig. 3A
Fig. 3B
Wt: TTTTTCATTCAGAAACCTGATTGGCTGTTC
mC/EBPα: TTTTTCATTCAGtctagaGATTGGCTGTTC
mNF-Y: TTTTTCATTCAGAAACCTGATcaGCTGTTC
mC/EBPα-mNF-Y: TTTTTCATTCAGtctagaGATcaGCTGTTC
-77 -48
31
Fig. 3. Mutational analysis of C/EBPα and NF-Y proteins binding to the –77/-48
probe. A, The sequence of the wild-type (wt) probe and mutated (mC/EBPα, mNF-
Y, and mC/EBPα-mNF-Y) probes are shown. The C/EBPα binding site is in bold
face, and the CCAAT box is underlined and in bold face. The mutated nucleotides
are shown in lowercase. B, EMSA analysis was performed as in Fig. 2b.
Autoradiogram from EMSA with the binding of mC/EBPα probe (lanes 6-10),
binding of mNF-Y probe (lanes 11-15), and binding mC/EBPα-mNF-Y probe (lanes
16-20).
32
Fig. 4

0
2
4
6
8
10
12
14
16
18
123456
Fig. 4. C/EBPα and NF-Y synergism on the minimal amelogenin promoter. LS8
cells were transiently transfected with 250 ng of p70-luc reporter construct in the
presence of 200 ng of empty vector (lane 1), expression vector for C/EBPα (lane 2),
NF-Y (lane 3), dominant negative form of NF-Y, NF-YAm 29 (lane 4), C/EBPα and
NF-Y (lane 5), and C/EBPα and NF-YAm 29 (lane 6). pCMV-lacZ plasmid (75 ng)
was included in all experiment groups as an internal control for transfection
efficiency. Data reflected the mean ± S.D. of three independent experiments, with
the response level of p70-luc in the absence of exogenous C/EBPα set arbitrarily as
“1”.
p70-luc + + + + + +
C/EBPα + + +
NF-Y(A+B+C) + +
NF-YAm29 + +
Relative luciferase activity
33
Fig. 5
Fig. 5. Co-immunoprecipitation analysis of NF-YA and C/EBPα from LS8 cells. 2
μg of C/EBPα expression vector was co-transfected into LS8 cells with 2 μg of each
NF-YA, NF-YB, and NF-YC expression vectors in a 100-mm cell culture plate.
Whole cell lysates were prepared and immunoprecipitated (IP) with either an anti-
NF-YA (sc-7712x, Santa Cruz Biotechnology) or an anti-C/EBPα antibody (sc-61x,
Santa Cruz Biotechnology) and protein G-agarose beads (P-7700, Sigma). The
immunoprecipitates or the total cell lysates were analyzed by SDS-PAGE, followed
by immunoblot (IB) with antibodies against NF-YA (sc-10779, Santa Cruz
Biotechnology) or C/EBPα ( sc-61, Santa Cruz Biotechnology). Total cell lysates of
20 μg were immunoblotted with an antibody against NF-YA (lane 1) or against
C/EBPα (lane 4). Cell lysates were immunoprecipitated with an anti-NF-YA
antibody, followed by immunoblotting with an anti-NF-YA (lane 3) or an anti-
C/EBPα (lane 4) antibody. Cell lysates were immunoprecipitated with an anti-
C/EBPα antibody, followed by immunoblotting with an anti-C/EBPα (lane 5) or an
anti-NF-YA (lane 6) antibody.
IP α-NF-YA + +
α-C/EBPα + +
IB α-NF-YA + + +
α-C/EBPα + + +
1 2 345 6
47.8 kD
35.9 kD
C/EBPα
NF-YA
34
Fig. 6
Fig. 6. A model for the mechanism underlying the synergism between C/EBPα and
NF-Y in activating the amelogenin promoter. NF-Y facilitates the function of
C/EBPα to synergistically activate the mouse amelogenin promoter. The postulated
activation domain of C/EBPα is represented by an “A” in the diagram. See
“Discussion” for details.
A A
YA
YC
YB
A A
35
Discussion
In this study I identify highly conserved C/EBPα and NF-Y binding motifs in
the X-chromosomal amelogenin promoter among several mammalian species (Fig.
1A). The integrity of both transcription factors binding motifs is critical for
maintaining the activity of the basal promoter and as well as for C/EBPα-mediated
transactivation (Fig. 1C). Both C/EBPα and NF-Y are able to recognize their cis-
elements respectively (Fig. 2B). In addition, C/EBPα and NF-Y form a protein-
protein interaction complex (Fig. 5). As a consequence, C/EBPα and NF-Y
synergistically activate the amelogenin promoter (Fig. 4). In contrast, NF-Y alone
has only marginal effects on the promoter.
C/EBPα has been identified to play a critical role in a number of cellular events.
In adipocytes, ectopic expression of C/EBPα in 3T3-L1 preadipocyte cells induces
the cells to differentiate into mature fat cells (Freytag et al., 1994; Lin and Lane,
1994). Induction of C/EBPα triggers transcriptional activation/repression of several
genes whose products participate in creating the adipocyte phenotype (Cornelius et
al., 1994; Lane et al., 1996; MacDougald and Lane, 1995). C/EBPα also plays an
important role in hepatocyte differentiation, as several genes that are involved in
hepatocyte maintenance and hepatocyte responses to injury are activated by
C/EBPα (Kimura et al., 1998; Lee et al., 1997; Nerlov and Ziff, 1994).
While C/EBPα is a transcription factor, intriguingly, its ability to arrest growth
does not require its DNA-binding activity, but rather is mediated via protein-protein
interactions with the cell-cycle inhibitor p21 (Timchenko et al., 1997), the cyclin-
36
dependent kinases cdk2 and cdk4 (Wang et al., 2001), or E2F (Slomiany et al.,
2000). In addition, C/EBPα has been reported to stimulate promoter activity, not
through its DNA binding capacity, but through its interaction with NF-Y bound to
the EPHX1 CCAAT box (Zhu et al., 2004).
NF-Y is a major CCAAT-binding transcription factor that has been found to
function mostly through interacting with other transcription factors (Jackson et al.,
1998; Jacobs et al., 2003; Reith et al., 1994; Ueda et al., 1998; Wright et al., 1995;
Yoshida et al., 2001; Zhu et al., 2003). One explanation for transcription factor
pairing is that NF-Y requires an associated protein, and vice versa, in order to form a
more stable complex that binds to the DNA. This may explain the mechanism of
synergism observed between C/EBPα and NF-Y that serve to cooperatively activate
the amelogenin promoter observed in this study. However, it is also reasonable to
argue that the binding of C/EBPα and NF-Y to the amelogenin promoter is mutually
exclusive because of the proximity of these two binding sites (four nucleotides
apart). Here, EMSA data showed that both C/EBPα and NF-Y were able to bind to
their cognate sites respectively (Fig. 2B, lane 4 and lane 6; Fig. 3B, lane 4 and lane
5). Interestingly, the mNF-Y probe, in which the NF-Y site was mutated and
C/EBPα site was wild-type, resulted in increased intensity of the supershifted band
by an anti-C/EBPα antibody (Fig. 3B, lane 15), suggesting that binding of NF-Y did
impair the binding of C/EBPα. In contrast, the binding of C/EBPα did not impair the
binding of NF-Y (Fig. 3B, lane 4). A mutant amelogenin reporter construct, mp70-
luc, bearing a mutant NF-Y site and a wild-type C/EBPα site showed complete loss
37
of basal promoter activity (Fig. 1C, lane 2), and was also incapable of responding to
the exogenous C/EBPα even with an intact C/EBPα cis-element (Fig. 1C, lane 7).
This suggests that NF-Y is indispensable for C/EBPα-mediated transactivation of the
mouse amelogenin gene.
Based on these observations, I propose a model explaining the mechanism
underlying the synergism between C/EBPα and NF-Y in regulating the amelogenin
promoter that is shown in Fig. 6. In the presence of NF-Y bound to its cognate site,
the space for C/EBPα to bind to its cognate site is limited due to the proximity of
these two binding motifs. The C/EBPα dimer adjusts its conformation to adopt a
favorable shape to fit the site by associating with NF-Y through protein-protein
interactions (Fig. 5). Under this circumstance, the binding of C/EBPα to its cognate
site is perturbed (Fig. 3B, lane 5) with a conformational change that allows C/EBPα
domains to be exposed and as a result to recruit additional transcriptional factors to
ensure transcriptional synergism (Fig. 4, lane 5). In the absence of NF-Y, C/EBPα
binds tightly to its cognate site (Fig. 3B, lane 15), but with a different conformation
resulting in diminished transcription activation (Fig. 1C, lane 7). In support of this
model, the mouse serum albumin promoter contains a C/EBPα site tightly
juxtaposed to a binding site for NF-Y, and this arrangement leads to strong
synergistic activation of the serum albumin promoter (Milos and Zaret, 1992).
Here, I demonstrate that there is a functional synergism between C/EBPα and
NF-Y in regulating the amelogenin gene. Both factors are required for transcriptional
activation and NF-Y is indispensable for robust expression. Furthermore, a model is
38
proposed to explain the mechanism underlying the synergism between C/EBPα and
NF-Y. These data, together with the previous identification of Msx2 as a
transcriptional repressor in regulating the mouse amelogenin gene expression (Zhou
et al., 2000), suggest that these factors may cooperatively contribute to proper
amelogenin expression in a temporally and spatially regulated fashion during tooth
formation in order to control the interaction of the enamel extracellular matrix that
regulates biomineralization.
39
Chapter 3
Antagonism between YY1 and CCAAT/Enhancer-binding Protein α in
Regulating Mouse Amelogenin Gene Expression
Introduction
YY1, also known as δ, NF-E1, UCRBP, and CF1, is a zinc-finger
transcription factor containing four zinc-finger domains in its C'-terminus (Hariharan
et al., 1991). It is generally regarded as being ubiquitously expressed and highly
conserved among species (Hahn, 1992; Pisaneschi et al., 1994; Shrivastava and
Calame, 1994; Thomas and Seto, 1999).
YY1 shows a multifunctional capability by either activating or repressing
transcription in a variety of promoters (Galvin and Shi, 1997; Gaston and Fried,
1994; Li et al., 1997; Yang et al., 1996). This dual nature of YY1 led to the
identification of functional domains in various studies, where details have proved to
be quite complicated. Although the majority of findings indicate that the activation
domain exists near the N'-terminus (Austen et al., 1997a; Bushmeyer et al., 1995;
Lee et al., 1995; Lee et al., 1994), some studies show that the activation domain also
localizes at the C'-terminus of YY1. One group identified the activation domain to be
localized to the C'-terminal 17 amino acids of YY1 (397-414) (Lee et al., 1995),
while another group mapped the activation domain of YY1 to amino acids 371 to
397 (Bushmeyer and Atchison, 1998). Similar complexity is observed with
identification of the YY1 repression domain. Most studies have shown that the YY1
40
repression domain is located in the C'-terminus. The repression domain of YY1 has
been shown to function independently of its DNA binding domain (Bushmeyer et al.,
1995; Bushmeyer and Atchison, 1998; Lewis et al., 1995). A repression domain has
also been reported, well away from the C'-terminus, being located between amino
acids 170 and 200 of YY1 (Yang et al., 1996).
In addition, YY1 exerts control over transcription by protein-protein
interactions with its partner transcription factor(s). The regions of YY1 required for
interaction with transcription factors are quite different among its associate proteins.
These transcription factors include HDAC2 (Yang et al., 1996), CBP/p300 (Austen
et al., 1997b), TAFII 55 (Austen et al., 1997b), TFII B (Austen et al., 1997b), E1A
(Lee et al., 1995; Lewis et al., 1995), c-Myc (Austen et al., 1998), Sp1 (Seto et al.,
1993), CREB (Galvin and Shi, 1997; Zhou et al., 1995) and p53 (Sui et al., 2004).
Materials and Methods
Plasmids
To generate an expression vector for YY1, polymerase chain reactions were
performed using a 15-day-postconception (dpc) mouse embryo cDNA library
(Clontech) as a template with the 5’-primer (5’-GGCGGCGGAG CCCTCAGC-3’)
and the 3’-primer (5’-GGGACCACAC TTTACAAAAA TACCTTG-3’). The PCR
products were inserted into pCR2.1-TOPO cloning vector (Invitrogen), and verified
by nucleotide sequence determination and analysis. The YY1-pCR2.1 construct was
then digested with EcoR I restriction endonuclease and inserted into the EcoR I site
41
of pcDNA3.1(+) (Invitrogen) to generate a YY1 expression vector termed YY1-
pcDNA3.1(+). To create YY1Δ334-414, a deletion to YY1 by removing amino acids
334 to 414, I used polymerase chain reactions on the YY1 expression vector as the
template using a 5’-primer (5’-GGGGTACCTG GCGGCGGAGC CCTCAG-3’;
where the Kpn I is underlined) and a 3’-primer (5’-TATTCTCGAG TCACGCTTTG
CCACACTCTG CACAGAC-3’; where the Xho I is underlined). The PCR products
were digested with Kpn I and Xho I and inserted 5’ to 3’ into the Kpn I-Xho I site of
pcDNA3.1(+) (Invitrogen), and verified by nucleotide sequence determination and
analysis. A YY1 mutation was created with Lys 339 and Arg 342 mutated to serine
residues (YY1S339/S342) by PCR with YY1-pCR2.1 as the template using a 5’-
primer (5’-GAGCTCAAGC CTAAAAAGCC ACCAGCTGGT TCATACTGGA
GAAAAGC-3’) and a 3’-primer (5’-GAGCTCGGAT CCACTAGTAA CGGCC-3’).
The PCR products were digested with Sac I and religated with the large fragment
(4.9 kb) of YY1-pCR2.1 plasmid digested by Sac I to generate YY1S339/S342-
pCR2.1, and verified by nucleotide sequence determination and analysis. The
YY1S339/S342-pCR2.1 was then digested with EcoR I and inserted into the EcoR I
site of pcDNA3.1(+) (Invitrogen). The expression vector encoding full-length
C/EBPα was described previously (Ross et al., 1999). The mouse amelogenin
promoter reporter constructs of p2207-luc, p194-luc, and p70-luc were each
described in a previous study (Zhou and Snead, 2000), and are used here without
modification.
42
Transient transfection and luciferase assay
A mouse ameloblast-like cell line (LS8) established from immortalizing
primary cultures of enamel organ epithelial cells with SV40 large “T” antigen were
used as previously described (Zhou and Snead, 2000).
Variable amounts of plasmid DNA were used for transient transfection for
each well of 12-well plates. The amounts of DNA varied based upon experimental
conditions and were documented in the figure legends. To normalize transfection
efficiency, 75 ng of pCMV-lacZ/well was co-transfected as an internal control. The
day before transfection, LS8 cells were plated in 12-well plates so that they were 50-
80% confluent at the time of transfection. At the time of plating and during
transfection, antibiotics were avoided. Three hours before transfection, cells were
washed twice with DMEM medium and subsequently cultured in serum-free DMEM
medium. Plasmid DNA (0.75 μg) was diluted into 62 μl of medium in a 5-ml Falcon
culture tube, 5 μl of Plus reagent (Invitrogen) was added, mixed, and incubated for
15 min at room temperature. In a second tube, 2.5 μl of Lipofectamine reagent
(Invitrogen) was diluted into 62 μl of medium and mixed. The contents of these two
tubes were combined, mixed, and incubated for another 15 min at room temperature.
While complexes were forming, the medium on the cells was replaced with 0.5 ml of
serum-free fresh medium. The DNA-Plus-Lipofectamine complex was added to each
well of cells and mixed gently. The cells were incubated for 3 h at 37°C and 5%
CO
2
. After removal of the medium containing DNA-Plus-Lipofectamine complex,
43
cells were incubated in 1 ml of fresh, complete medium for an additional 22 h and
were subject to luciferase assay with a Dual-Light kit (Applied Biosystems).
Cells were washed twice with phosphate-buffered saline, pH 7.4, and lysed in
100 μl of lysis buffer (100 mM potassium phosphate, pH 7.8, 0.2% Triton X-100, 0.5
mM DTT). Cell scrapers (Corning) were used to detach cells from the plate. Cell
lysates were transferred to a microfuge tube and centrifuged at 15,000 g for 2 min.
The extracts (supernatant) were transferred to a fresh tube and stored at -70°C. At the
time of chemiluminescent detection, buffer-A and -B were equilibrated to room
temperature and Galacton-Plus Substrate was added to buffer-B at the ratio 1:100. A
10 μl aliquot of cell extracts was transferred to a luminometer tube to which 25 μl of
buffer-A was added and immediately followed by the addition of 100 μl of buffer-B.
After a 15 sec delay, the luciferase signal was obtained for 5 sec in a luminometer
(Lumat). After 45 min incubation at room temperature, 100 μl of Acceleraor-II
(Applied Biosystems) was added and the β-galactosidase signal was measured for
another 5 sec in the same luminometer.
44
Nuclear Extracts and proteins/DNA array assay
LS8 cells growing on100-mm plates were transiently transfected with 20 μg
of pcDNA3 or C/EBPα expression vector by calcium phosphate coprecipitation
method. Briefly, 20 μg of DNA was mixed with 62 μl of 2 M CaCl
2
, diluted to 500
μl with distilled deionized H
2
O, and added dropwise to the 37°C prewarmed 2×HBS
(HEPES Buffered Saline) solution. After standing for 20 min at room temperature,
the DNA-calcium phosphate coprecipitates were added dropwise to the surface of the
media covering the cells and incubated overnight. The next day, medium containing
the calcium phosphate was removed and replaced with fresh complete medium for an
additional 24 hours. LS8 cells were washed twice with cold phosphate-buffered
saline, pH 7.4, and scraped off the plate and into 1 ml of hypotonic buffer containing
20 mM Hepes, pH 7.6, 10 mM KCl, 1 mM MgCl
2
, 0.1% Triton X-100, 20%
glycerol, 2 mM phenyl methyl sulfonyl fluoride, 5 μl/ml aprotinin (Sigma), 5 μg/ml
leupeptin, and 0.5 mM dithiothreitol. Cell lysates were homogenized by 15 strokes
with a Dounce type A pestle on ice, transferred to a 1.5 ml tube, and centrifuged at
3000 rpm for 5 min at 4°C. The pellet was resuspended in 100 μl of cold extraction
buffer (20 mM Hepes, pH 7.6, 10 mM KCl, 1 mM MgCl
2
, 0.1% Triton X-100, 20%
glycerol, 2 mM phenyl methyl sulfonyl, 5 μl/ml aprotinin (Sigma), 5 μg/ml
leupeptin, 0.5 mM dithiothreitol, 420 mM NaCl), and mixed by rotation for 1 h at
4°C. Nuclear debris was pelleted by centrifugation at 15,000 rpm for 10 min at 4°C.
Supernatants containing the nuclear extracts were frozen in liquid N
2
and stored at -
45
80°C. The protein concentration was determined using a Bio-Rad protein assay kit
(Bio-Rad) with bovine serum albumin as the standard.
Protein/DNA arrays were performed according to the manufacturer’s
protocol for the TranSignal Protein/DNA Array I (Panomics). In brief, 20 μg of total
nuclear extracts were mixed with biotin-labeled DNA-binding probes (TranSignal
Probe Mix), and incubated for 30 min at 15°C to allow the formation of protein-
DNA complexes. The protein-DNA complexes were loaded on a 2% agarose gel and
electrophoresed for 20 min at 120 V in 0.5× Tris-borate-EDTA (TBE) buffer. The
gel area containing the protein/DNA complex, an area above the blue dye and 2 mm
below the gel lane, was excised and the DNA probes were recovered, denatured for 3
min at 95°C before being hybridized to the array membrane overnight at 42 °C. The
membrane was washed twice in hybridization wash "I" buffer (Panomics) for 20 min
at 42 °C, twice in hybridization wash "II" buffer (Panomics) for 20 min at 42 °C, and
the signal was detected by chemiluminescence.
Results
YY1 is identified as a participant in regulating amelogenin expression
To identify potential transcriptional co-factors that interact with C/EBPα and
which might participate in regulating amelogenin expression in ameloblast cell
lineages, I performed a protein/DNA array assay using nuclear extracts from LS8
cell transfected with either C/EBPα or empty expression plasmids as controls. By
comparing data for transcription factors obtained from cells treated in the absence or
46
presence of exogenous C/EBPα, several transcription factors were identified, such as
SP1, YY1, c-Myb, and TR (thyroid hormone receptor). YY1 (Fig. 7, Boxed spots) is
regarded as a leading candidate because there is a cognate YY1 cis-element proximal
to the mouse amelogenin minimal promoter. Quantitative analysis of the
hybridization signals shown in Fig. 7 revealed that there was a 3.9-fold increase in
the YY1 activity where C/EBPα proteins were over-expressed in LS8 cells.
YY1 repression of the amelogenin basal promoter activity and C/EBPα-
mediated transactivation is not through its DNA binding capacity
To further test the role of YY1 in regulating the mouse amelogenin promoter
and functional relationships between YY1 and C/EBPα, YY1 and C/EBPα
expression plasmids were co-transfected with a mouse amelogenin promoter
construct p2207-luc into LS8 cells. As shown in Fig. 8A, exogenous YY1 proteins
could down-regulate the promoter activity in a dose-dependent manner (lane 2 and
lane 3). In addition, YY1 was also able to attenuate C/EBPα-mediated
transactivation of a p2207-luc (lane 5 and lane 6). Since YY1 is a transcription
factor, I anticipate that it would exert its inhibitory ability through binding to the
amelogenin promoter. DNA sequence analysis revealed multiple YY1 consensus
binding sites in the promoter region of the reporter construct p2207-luc (Fig. 8B). To
identify which YY1 cis-element is required for the YY1 activity, three reporter
constructs, p2207-luc, p194-luc, and p70-luc, were individually tested in LS8 cells.
The reporter construct p2207-luc responded to the exogenous expression of YY1
47
(Fig. 8A). In contrast, with the reporter construct p194-luc bearing only one YY1
cis-element, both the basal promoter activity and C/EBPα-mediated transactivation
were still down-regulated by overexpression of YY1 proteins (Fig. 8C, lane 2 and
lane 3; lane 5 and lane 6). Surprisingly, with the reporter construct p70-luc that
contains no YY1 cis-element, YY1 still showed potent inhibitory effects (Fig. 8C,
lane 8 and lane 9; lane 11 and lane 12). These results suggest that YY1 exerts its
repression not by directly binding to the amelogenin promoter, but through some
other mechanism(s). To further test this possibility, three versions of YY1 expression
plasmids were co-transfected into LS8 cells with the p70-luc construct used as a
reporter. These three YY1 expression constructs were wild-type YY1, YY1Δ334-
414, and YY1S339/S342. The mutant YY1Δ334-414 and YY1S339/S342 have been
previously shown to lack DNA binding capacity (Austen et al., 1998). As expected,
increasing amounts of YY1 proteins attenuated the basal and C/EBPα-mediated
transactivation of the p70-luc (Fig. 9A). However, even with the loss of DNA
binding capacity, YY1Δ334-414 and YY1S339/S342 were able to antagonize
C/EBPα-mediated transactivation (Fig. 9B and 9C). Taken together, these data
indicate that YY1 repression of amelogenin basal promoter activity and C/EBPα-
mediated transactivation does not occur through direct DNA binding capacity.
48
Fig. 7. Protein/DNA array to identify factors associated with C/EBPα regulation of
amelogenin gene expression. Nuclear extracts from LS8 cells transfected with an
empty plasmid (A) or a construct that over-expressed C/EBPα (B) were incubated
with biotin-labeled probe mix, and processed for chemiluminescent detection.
Differential signals were identified for YY1 (also known as NF-E1, δ, UCRBP, and
CF1) and shown as boxed spots.
A
B
Fig. 7
49
Fig. 8A
p2207-luc + + + + + +
C/EBPα - - - + + +
YY1 - -
Fig. 8B
0
1
2
3
4
5
6
123 456
p2207-luc
p194-luc
p70-luc
YY1 site: A/CCATNTT
C/EBPα site: TNNNGNAA
50
Fig. 8C
0
1
2
3
4
5
6
12 34 56 78 9 10 11 12
p194-luc + + + + + + - - - - - -
p70-luc - - - - - - + + + + + +
C/EBPα - - - + + + - - - + + +
YY1 - - - -
51
Fig. 8. Dose dependent repression of mouse amelogenin promoter activity by YY1.
A, LS8 cells were transiently transfected with 250 ng of full-length amelogenin
promoter p2207-luc reporter construct in the presence of 600 ng of empty vector
(pcDNA3, lane 1), or 200 ng of expression plasmid for YY1 with 400 ng of pcDNA3
(lane 2), or 400 ng of expression plasmid for YY1 with 200 ng of pcDNA3 (lane 3),
or 200 ng of expression plasmid for C/EBPα with 400 ng of pcDNA3 (lane 4), or
200 ng of expression plasmid for C/EBPα with 200 ng of YY1 plus 200 ng of
pcDNA3 (lane 5), or 200 ng of expression plasmid for C/EBPα with 400 ng of YY1
(lane 6). The pCMV-lacZ plasmid (75 ng) was included in all experiment groups as
an internal control for transfection efficiency. Values were the mean ± S.D. of three
independent experiments, and the level of p2207-luc in lane 1 was arbitrarily set as
“1”. B, Schematic representation of amelogenin promoter reporter constructs for
p2207-luc, p194-luc, and p70-luc. The empty boxes represent YY1 consensus
binding sites, while the solid boxes represent C/EBPα binding sites. Sequences for
YY1 and C/EBPα binding sites are shown. C, In the presence of 250 ng of p194-luc
(lanes 1-6) or p70-luc (lanes 7-12), with either 600 ng of empty vector (pcDNA3)
(lane 1 or 7), or 200 ng of expression plasmid for YY1 with 400 ng of pcDNA3 (lane
2 or 8), or 400 ng of expression plasmid for YY1 with 200 ng of pcDNA3 (lane 3 or
9), or 200 ng of expression plasmid for C/EBPα with 400 ng of pcDNA3 (lane 4 or
10), or 200 ng of expression plasmid for C/EBPα with 200 ng of YY1 plus 200 ng of
pcDNA3 (lane 5 or 11), or 200 ng of expression plasmid for C/EBPα with 400 ng of
YY1 (lane 6 or 12) were co-transfected into LS8 cells. The pCMV-lacZ plasmid (75
ng) was included in all experiment groups as an internal control for transfection
efficiency. Values shown are the mean ± S.D. of three independent experiments and
the level of p194-luc was arbitrarily set as “1”.
52
Fig. 9

0
1
2
3
4
5
6
7
8
123 456

0
1
2
3
4
5
6
7
8
123456

0
1
2
3
4
5
6
7
8
123 456
p70-luc + + + + + +
C/EBPα - - - + + +
YY1 - -
p70-luc + + + + + +
C/EBPα - - - + + +
YY1Δ334-414 - -
p70-luc + + + + + +
C/EBPα - - - + + +
YY1S339/S342 - -
Relative luciferase activity Relative luciferase activity Relative luciferase activity
A
B
C
53
Fig. 9. YY1 repression of C/EBPα-mediated transactivation occurs not through a
DNA binding capacity. A, LS8 cells were transiently transfected with 250 ng of
amelogenin promoter p70-luc reporter construct in the presence of 600 ng of empty
vector (pcDNA3, lane 1), or 200 ng of expression plasmid for YY1 with 400 ng of
pcDNA3 (lane 2), or 400 ng of expression plasmid for YY1 with 200 ng of pcDNA3
(lane 3), or 200 ng of expression plasmid for C/EBPα with 400 ng of pcDNA3 (lane
4), or 200 ng of expression plasmid for C/EBPα with 200 ng of YY1 plus 200 ng of
pcDNA3 (lane 5), or 200 ng of expression plasmid for C/EBPα with 400 ng of YY1
(lane 6). Identical parameters for transfection experiments as detailed for (A) were
used for YY1D334-414 (B) and YY1S339/S342 (C). The pCMV-lacZ plasmid (75
ng) was included in all experiment groups as an internal control for transfection
efficiency. Values shown are the mean ± S.D. of three independent experiments, and
the level of p70-luc in lane 1 was arbitrarily set as “1”.
54
Discussion
While C/EBPα has been demonstrated as a strong transactivator for
amelogenin gene expression (Zhou and Snead, 2000), I investigate other
transcriptional co-factors that might interact with C/EBPα to orchestrate amelogenin
gene expression. Towards this end, I identify the transcription factor YY1 using a
protein/DNA array system in ameloblast-like cells that has been treated by over-
expressing C/EBPα via transient transfection. YY1, also known as δ, NF-E1,
UCRBP, and CF1, is a zinc-finger transcription factor containing four zinc fingers
domains at its C'-terminus (Hariharan et al., 1991). YY1 is generally regarded as
being ubiquitously expressed and highly conserved among species (Hahn, 1992;
Pisaneschi et al., 1994; Shrivastava and Calame, 1994; Thomas and Seto, 1999).
YY1 shows a multifunctional capability by either activating or repressing
transcription in a variety of promoters (Galvin and Shi, 1997; Gaston and Fried,
1994; Li et al., 1997; Yang et al., 1996). In addition, YY1 exerted control over
transcription through protein-protein interactions with its partner transcription factor
(Lee et al., 1993; Seto et al., 1993; Shrivastava et al., 1993). In this investigation, I
show that in response to exogenous expression of C/EBPα, YY1 activity is increased
in response to C/EBPα overexpression (Fig. 7). However, YY1 repression of the
amelogenin basal promoter activity and C/EBPα-mediated transactivation are not
achieved through its DNA binding capacity (Fig. 8 and 9). Unfortunately, the
molecular mechanism by which YY1 represses amelogenin gene expression is still
unknown. There are several possibilities to account for repression of YY1 on the
55
amelogenin basal promoter and C/EBPα-mediated transactivation. YY1 may activate
Msx2 genes, a potent C/EBPα repressor that acts by protein-protein interactions
(Zhou et al., 2000). Consistent with this, it has been shown that YY1 induces Msx2
expressions by activating the Msx2 promoter in P19 embryonal cells (Tan et al.,
2002). Alternatively, YY1 may antagonize C/EBPα through direct protein-protein
interactions, since YY1 negatively regulates p53 through direct physical interactions
(Sui et al., 2004). It is also possible that YY1 may act through other unknown
mechanisms.
Essential to enamel biomineralization is the requirement to closely regulate
the amount of amelogenin protein available to direct the habit of hydroxyapatite
crystallites. Mineral formation and enamel protein assembly must be closely
regulated to achieve the largest crystals in the vertebrate body, as well as the hardest
tissue, enamel. Therefore, physiologic regulation of enamel gene expression is
essential. Here, I try to understand the molecular modulation of amelogenesis during
tooth formation by identifying YY1, a co-factor interacting with C/EBPα. This
interaction cooperatively contributes to the down-modulation of amelogenin gene
expression. Physiologic modulation of amelogenin expression could serve as the
developmental basis for proper amelogenin expression at the right place and in the
right time during enamel formation.
56
Chapter 4
Physical Dissection of the CCAAT/ Enhancer-binding Protein α in Regulating
the Mouse Amelogenin Gene
Introduction
C/EBPα is a prototypic basic region/leucine zipper transcription factor
consisting of a well-characterized C'-terminal leucine zipper that exerts dimerization
ability and has a neighboring DNA binding domain (Landschulz et al., 1988;
Landschulz et al., 1989). The remaining amino-terminal amino acids (1-273) are
organized into transactivation domains, which controls the transcriptional activity of
C/EBPα in different sets of promoters (Friedman and McKnight, 1990; Pei and Shih,
1991). In the search for the mechanism determining the ability of C/EBPα to activate
the serum albumin promoter, a study identified three separable transactivation
elements (TE-I, TE-II, and TE-III) located within the amino-terminal region of
C/EBPα. Any two of these transactivation elements are able to activate the serum
albumin promoter either in the context of the C/EBPα protein or when fused to the
Gal4-DNA-binding domain. In addition, transactivation element III contains a
negative regulatory domain, the function of which is abrogated upon C/EBPα
binding to the albumin promoter (Nerlov and Ziff, 1994). Another study has mapped
four conserved regions (CR1-4) within the C/EBPα transactivation domain based
upon the ability of C/EBPα to induce spontaneous preadipocyte differentiation. CR2
domain in isolation, when fused to the DNA binding domain, is capable of
57
stimulating spontaneous differentiation of 3T3-L1 preadipocytes. However, CR2 is
not essential for adipogenesis because a combination of CR1 and CR3 is also able to
reproduce this experimental end-point (Erickson et al., 2001).
In this chapter, I examine the role of these conserved regions (CR) of
C/EBPα in the ability to activate the mouse amelogenin promoter. Furthermore, I
identify that the C'-terminus of C/EBPα is required for protein-protein interactions
with Msx2, the transcriptional repressor of the amelogenin gene.
Materials and methods
Plasmids
The expression vectors containing different combinations of the four
conserved regions (CR1-CR4) were provided by Dr. Ormond A. MacDougald
(University of Michigan, Ann Arbor, MI).
To generate C/EBPα ΔN (Δ1-217) expression vector, full length C/EBPα
(pSER28) was digested with PstI, the 2.6 kb-PstI fragment was blunt-ended with T4
DNA polymerase (New England Biolabs), digested with ApaI to release the 0.7 kb
fragment, and inserted into the EcoRV-ApaI site of pcDNA3.1(+) (Invitrogen).
To generate C/EBPα ΔC-V5 ( Δ216-359) expression vector, pSER28 was
digested with PstI, the 0.7 kb fragment was blunt-ended with T4 DNA polymerase
(New England Biolabs), digested with EcoRI, and inserted into the EcoRV-EcoRI
site of pcDNA3.1/V5-HisA (Invitrogen).
58
Cell culture
A mouse ameloblast-like cell line (LS8) established from immortalizing
primary cultures of enamel organ epithelial cells with SV40 large “T” antigen were
used as previously described (Zhou and Snead, 2000).
Transient transfection and luciferase assay
Variable amounts of plasmid DNA were used for transient transfection for
each well of 12-well plates. The amounts of DNA varied based upon experimental
conditions and were documented in the figure legends. To normalize transfection
efficiency, 75 ng of pCMV-lacZ/well was co-transfected as an internal control. The
day before transfection, LS8 cells were plated in 12-well plates so that they were 50-
80% confluent at the time of transfection. At the time of plating and during
transfection, antibiotics were avoided. Three hours before transfection, cells were
washed twice with DMEM medium and subsequently cultured in serum-free DMEM
medium. Plasmid DNA (0.75 μg) was diluted into 62 μl of medium in a 5-ml Falcon
culture tube, 5 μl of Plus reagent (Invitrogen) was added, mixed, and incubated for
15 min at room temperature. In a second tube, 2.5 μl of Lipofectamine reagent
(Invitrogen) was diluted into 62 μl of medium and mixed. The contents of these two
tubes were combined, mixed, and incubated for another 15 min at room temperature.
While complexes were forming, the medium on the cells was replaced with 0.5 ml of
serum-free fresh medium. The DNA-Plus-Lipofectamine complex was added to each
well of cells and mixed gently. The cells were incubated for 3 h at 37°C and 5%
59
CO
2
. After removal of the medium containing DNA-Plus-Lipofectamine complex,
cells were incubated in 1 ml of fresh, complete medium for an additional 22 h and
were subject to luciferase assay with a Dual-Light kit (Applied Biosystems).
Cells were washed twice with phosphate-buffered saline, pH 7.4, and lysed in
100 μl of lysis buffer (100 mM potassium phosphate, pH 7.8, 0.2% Triton X-100, 0.5
mM DTT). Cell scrapers (Corning) were used to detach cells from the plate. Cell
lysates were transferred to a microfuge tube and centrifuged at 15,000 g for 2 min.
The extracts (supernatant) were transferred to a fresh tube and stored at -70°C. At the
time of chemiluminescent detection, buffer-A and -B were equilibrated to room
temperature and Galacton-Plus Substrate was added to buffer-B at the ratio 1:100. A
10 μl aliquot of cell extracts was transferred to a luminometer tube to which 25 μl of
buffer-A was added and immediately followed by the addition of 100 μl of buffer-B.
After a 15 sec delay, the luciferase signal was obtained for 5 sec in a luminometer
(Lumat). After 45 min incubation at room temperature, 100 μl of Acceleraor-II
(Applied Biosystems) was added and the β-galactosidase signal was measured for
another 5 sec in the same luminometer.
Co-immunoprecipitation assay and Western blotting
LS8 cells, ~90% confluent in a 100 mm cell culture plate, were washed twice
in ice-cold phosphate-buffered saline. Ice-cold RIPA buffer (1 ml 1× PBS, 1%
Nonidet P-40, 0.1 mg/ml phenylmethylsulfonyl fluoride (Sigma), 30 μl/ml aprotinin
(Sigma), and 1 mM sodium orthovanadate) was added, and the cells were collected
60
using a cell scraper (Corning), and lysed by passing six times through a 22-gauge
needle at 4°C. After centrifugation at 3,000 rpm for 15 min at 4°C, the protein
concentration of the supernatant was measured using a Bio-Rad protein assay kit
(Bio-Rad) with bovine serum albumin as standards. For immunoprecipitation, 500
μg of total protein was precleaned with 50 μl of protein G-agarose beads (Sigma)
prior to addition with 2 μg of primary antibody (Santa Cruz Biotechnology) for
overnight incubation at 4°C with rotation. Protein G-agarose beads (20 μl; IgG
binding capacity at 10-20 μg per μl) was added and incubated for 2 h at 4°C with
rotation. Immunoprecipitates were collected by centrifugation at 2,500 rpm for 5 min
at 4°C. The pellets were washed three times with 1 ml of PBS. After the final wash,
the pellets were resuspended in an equal volume of 2× SDS loading buffer, boiled for
5 min, and stored at -70°C. Samples were resolved by 12% SDS-polyacrylamide gel
electrophoresis and transferred to Immobilon-P membrane (Millipore). The
membranes were incubated in blocking buffer overnight at 4°C, followed by
incubation with the primary antibody for 1 h and the appropriate horseradish
peroxidase-conjugated secondary antibody (Amersham) for 1 h at room temperature.
Protein-antibody complexes were visualized by enhanced chemiluminescence (ECL,
Amersham).
61
Results
Physical dissection of the transactivation domain within C/EBPα responsible
for activating the amelogenin promoter
Four conserved regions of the C/EBPα transactivation domain, named CR1,
CR2, CR3, and CR4, are identified among several species (Fig. 10A), and their
functions contributing to adipogenesis have been previously analyzed (Erickson et
al., 2001). It has previously been shown that C/EBPα is a transactivator of the mouse
X-chromosomal amelogenin gene (Zhou and Snead, 2000). To further investigate the
region within the C/EBPα transactivation domain acting upon the amelogenin
promoter, different combinations of the four conserved regions (CR1-CR4) in
C/EBPα are used to examine their ability to alter amelogenin promoter activity using
transient transfection assays performed in an ameloblast-like cell line termed LS8.
Consistent with our previous findings, full length C/EBPα (CR1/2/3/4) activated
amelogenin promoter by 4.4-fold (Fig. 10B). The C/EBPα isoform (CR3/4) had little
effect on the promoter activity (1.1-fold, Fig. 10B). Interestingly, CR2 in isolation
had exceptional capacity, 11.8-fold, to enhance transcription of the amelogenin
promoter over baseline values (Fig. 10B). Moreover, CR2 in isolation was a stronger
amelogenin transactivator than full length C/EBPα (11.8-fold compared to 4.4-fold).
The remaining conserved regions of C/EBPα, either in isolation or in selected
combinations, showed little effect on amelogenin transactivation, such as 0.9-fold for
CR1, 1.2-fold for CR1/4, and 1.3-fold for CR1/3/4.
62
C'-terminus of C/EBPα is responsible for C/EBPα-Msx2 protein-protein
interactions
It has been previously shown that there is functional antagonism between
C/EBPα and Msx2 in regulating the mouse amelogenin gene expression mediated by
protein-protein interactions and the C'-terminus of Msx2 (residues 184-267) is
required for this protein-protein interaction (Zhou et al., 2000). To identify the
domain within C/EBPα responsible for the protein-protein interactions, various
C/EBPα truncated isoforms and Msx2 expression vectors were co-transfected into
LS8 cells, and co-immunoprecipitation assays were used to identify productive
interactions. Herein, two C/EBPα constructs were generated to facilitate the study,
C/EBPα ΔN (Δ1-217) and C/EBPα ΔC (Δ216-359). An amino-terminal FLAG
epitope-tagged Msx2 expression plasmid was co-transfected into LS8 cells with
CR1/2/3/4, CR2/3/4, CR1/2, CR2/4, CR2, C/EBPα ΔN, or C/EBPα ΔC expression
plasmid, respectively. Comparable amounts of both Msx2 and various C/EBPα
truncated isoforms were expressed in all transfected LS8 cell groups (Fig. 11A, lanes
1-7, 15-21). The Msx2 proteins could be readily detected when using anti-FLAG
antibody to pull down the desired target from total cell lysates (Fig. 11A, lanes 22-
28). In addition to the Msx2 proteins, the light chain and heavy chain of anti-FLAG
M2Ab antibody were also detected (Fig. 11A, lanes 22-28). For the co-
immunoprecipitation portion, the various C/EBPα truncated isoforms (CR1/2/3/4,
CR2/3/4, CR1/2, CR2/4, CR2), or the C/EBPαΔN were co-immunoprecipitated
efficiently with Msx2 (Fig. 11A, lanes 8-13). However, the C/EBPαΔC protein was
63
barely detected in the immunocomplex (Fig. 11A, lane 14). The reciprocal
experimental strategy in which immunoprecipitation with a C/EBPα antibody or V5
antibody was followed by immunoblotting using anti-C/EBPα, anti-V5 or anti-
FLAG antibody (Fig. 11B) was also performed. This data confirmed the finding that
the C'-terminal domain (residues 216-359) of C/EBPα are required for the C/EBPα-
Msx2 protein-protein interactions.
64
Fig 10. Effects of C/EBPα truncated isoforms on the mouse amelogenin promoter.
A, Schematic representation of various C/EBPα truncated isoforms. B, Expression
plasmids (200 ng) of various C/EBPα truncated isoforms are transiently
cotransfected into LS8 cells with 250 ng of p2207-luc amelogenin promoter reporter
construct. pCMV-lacZ is used as an internal control for transfection efficiency. The
relative luciferase activity is the normalization of luciferase activity with β-
galactosidase activity. The mean ± S.D. from at least three independent experiments
is represented, and the level of p2207-luc in the absence of exogenous C/EBPα was
set as 1. C, LS8 cells transfected with 1 μg of the expression vectors of various
C/EBPα truncated isoforms, are lysed 24-h as described under “Materials and
Methods”. Equal amounts of protein were separated by 12% SDS-polyacrylamide
gel electrophoresis and immunoblotted for the C/EBPα antibody.
CR1 CR2 CR3 CR4 bZIP
CR3 CR4 bZIP
CR1 bZIP
CR2 bZIP
CR4 bZIP CR2
CR1 CR3 CR4 bZIP
CR1 CR4 bZIP
CR1 CR2 bZIP
CR2 CR3 CR4 bZIP
0 2 4 6 8 10 12 14
CR2/3/4
CR1/4
CR1/3/4
CR1/2
CR2/4
CR2
CR1
CR3/4
CR1/2/3/4
mock
CR1/2/3/4
CR3/4
CR1
CR2
CR2/4
CR1/2
CR1/3/4
CR1/4
CR2/3/4
Fig. 10A Fig.10B
Fig. 10C
Relative luciferase activity of p2207-luc
65
Fig. 11A
IP: α-FLAG
IB: α-C/EBPα α-V5 IB: α-C/EBPα α-V5
IP: α-FLAG
IB: α-FLAG IB: α-FLAG
IP
IB
Plasmid
α-C/EBPα +
α-V5 +
α-C/EBPα +
α-V5 +
α-FLAG + + + +
ΔN + + +
ΔC + + +
Flag-Msx2 + + + + + +
*
Fig. 11B
1 2 3 4 5 6 7 8 9 10 11 12 13 14
15 16 17 18 19 20 21 22 23 24 25 26 27 28
*
29 30 31 32 33 34
66
Fig 11.Co-immunoprecipitation of various C/EBPα truncated isoforms and Msx2
from LS8 cells. A, In a 100-mm tissue culture dish, 2 μg of amino-terminal FLAG
tagged Msx2 expression plasmid was cotransfected into LS8 cells with 2 μg of
various C/EBPα truncated isoforms, CR1/2/3/4 (lane 1, 8, 15 and 22), CR2/3/4 (lane
2, 9, 16 and 23), CR1/2 (lane 3, 10, 17 and 24), CR2/4 (lane 4, 11, 18, and 25), CR2
(lane 5, 12, 19 and 26), C/EBPα ΔN (lane 6, 13, 20, and 27), C/EBPα ΔC (lane 7,
14, 21 and 28). After 24 h incubation, whole cell lysates were prepared as described
under “Materials and Methods”. For immunoblot (IB), 10 μg of cell lysates were
electrophoresed, transferred to Immobilon-P membrane (Millipore), and
immunoblotted with a C/EBPα antibody (Santa Cruz Biotechnolog, lane 1 to 6), a
V5 antibody (Invitrogen, lane 7), or an anti-FLAG antibody (M2Ab, Sigma, lane 15
to 21). 500 μg of cell lysates were subjected to immunoprecipitation (IP) with an
anti-FLAG antibody (lane 8 to 14). The immunoprecipitates were then
electrophoresed, transferred to Immobilon-P membrane, and immunoblotted with an
anti-C/EBPα antibody (lane 8 to 13), or an anti-V5 antibody (lane 14), or an anti-
FLAG antibody (lane 22 to 28). B, Co-immunoprecipitation analysis was performed
as in (A). Total cell lysates of 10 μg were immunoblotted with an antibody against
C/EBPα (lane 29), V5 (lane 30), or FLAG (lane 31 and 32). Cell lysates were
immunoprecipitated with an anti-C/EBPα antibody, followed by immunoblotting
with an anti-FLAG antibody (lane 33); or with an anti-V5 antibody, followed by
immunoblotting with an anti-FLAG antibody (lane 34).
67
Discussion
Here I report that the conserved region 2 of the C/EBPα transactivation
domain is best able to stimulate mouse amelogenin gene. The remainders of the
conserved regions in select combinations have little effect on the mouse amelogenin
promoter. This finding for amelogenesis is different from the observations for the
C/EBPα functions during adipogenesis, in which a combination of CR1 and CR3 can
also induce adipogenesis (Erickson et al., 2001). The difference may result from the
ability of C/EBPα to interact with selected co-activators in the context of different
physiologic requirements.
Several studies have shown that CR2 is able to interact with basal
transcription apparatus and certain co-activators. TBP and TFIIB, two essential
components of the RNA polymerase II basal transcriptional apparatus, have been
identified to co-operatively interact with the region covering CR2 domain (Nerlov
and Ziff, 1995). The retinoblastoma (Rb) protein complex has been shown to interact
with C/EBPα and to activate C/EBPα-mediated transcription (Charles et al., 2001;
Classon et al., 2000), while the Rb-binding motifs of C/EBPα (residues 67-82) are
located within the CR2 domain (residues 55-108) (Chen et al., 1996). Furthermore,
p300 is reported to co-activate C/EBPα-mediated transactivation, which is mediated,
in part, by functional interaction with CR2 domain of C/EBPα (Erickson et al.,
2001).
The expression pattern of Msx2 has been identified in murine teeth during
odontogenesis. Msx2 is expressed in undifferentiated inner enamel epithelial cells
68
but is down-regulated in differentiated ameloblast cells (MacKenzie et al., 1992).
Functional assays have demonstrated that Msx2 represses mouse amelogenin gene
expression through direct protein-protein interactions with C/EBPα, a strong
transactivator of amelogenin gene (Zhou et al., 2000). The role of Msx2 in tooth
formation has also been elucidated in Msx2-deficient mice. Msx2-deficient molar
tooth germs developed normally up to the cap stage. The defect starts to be observed
at E16.5 as a modest reduction in enamel organ volume. By the late bell stage, the
amount of the epithelial derived stellate reticulum (SR) decreases, and by the day 1
postnatal stage, highly duplicated epithelial cells reside in the intercuspal regions.
Adult Msx2-deficient mice show brittle and misaligned incisors as well as
degenerated molars (Satokata et al., 2000).
In this chapter, I have identified that the C'-terminus of C/EBPα (residues
216-359) is required for protein-protein interactions with Msx2. Since this stretch of
amino acids contains basic region leucine zipper domain that is responsible for the
DNA binding and dimer formation of C/EBPα, there are several possibilities to
account for repression of Msx2 on C/EBPα-mediated transactivation. Msx2 may
interfere with C/EBPα binding to its cis-element upon the formation of Msx2-
C/EBPα protein complexes. Alternatively, Msx2 may perturb C/EBPα dimer
formation, since dimerization is a prerequisite for C/EBPα binding (Hurst, 1995;
Vinson et al., 1989).
69
Chapter 5
Transcriptional Activity of CCAAT/ Enhancer-binding Protein α And
Sumoylation
Introduction
Post-translational modification of proteins such as phosphorylation,
glycosylation, acetylation and methylation has been identified to play a key role in
regulating numerous protein functions. In the case of C/EBPα, it has been reported
that protein kinase-C (PKC) phosphorylates specific sites within the basic region of
C/EBPα, in vitro. High-performance liquid chromatography-peptide mapping of
32
P-
labeled C/EBPα indicates the presence of three phosphorylated residues: S248, S277
and S299. Phosphorylation of C/EBPα by PKC results in an attenuation of binding to
DNA (Mahoney et al., 1992). This seems to suggest that phosphorylation plays a
negative role in regulating C/EBPα. However, in another case, insulin reduces gene
expression in adipocytes, in part due to a dephosphorylation-mediated degradation of
C/EBPα (Hemati et al., 1997; MacDougald et al., 1995). Studies to identify the
insulin-sensitive sites of phosphorylation reveal that C/EBPα is phosphorylated on
T222, T226, and S230, in vivo, and glycogen synthase kinase-3 (GSK-3) is an
insulin-regulated C/EBPα kinase (Ross et al., 1999). Nevertheless, further
experiments show that mutation of potential phosphorresidues does not change the
ability of C/EBPα to transactivate responsive promoters in reporter gene assays.
Increasing phosphorylation status of C/EBPα by co-transfection of GSK3 also does
70
not influence the ability of C/EBPα to transactivate downstream genes. Like
C/EBPα wild-type counterpart, ectopic expression of a C/EBPα mutant, in which
potential phosphoresidues are altered to alanine, is sufficient to induce spontaneous
differentiation of preadipocytes (Ross et al., 1999). This data seems to demonstrate
that phosphorylation does not significantly alter C/EBPα activity during
adipogenesis. However, C/EBPα phosphorylation inhibits granulopoiesis. It is
reported that serine 21 of C/EBPα is subject to phosphorylation by extracellular
signal regulated kinases 1 and/or 2 (ERK1/2). This phosphorylation induces a
conformational change of C/EBPα in such a way that the distance between the
amino termini of C/EBPα dimers is increased. As a consequence, C/EBPα function
is altered, and granulopoiesis is inhibited (Ross et al., 2004).
Among post-translational modifications of proteins, ubiquitination is a well-
characterized process in which ubiquitins are covalently attached to protein
substrates, followed by targeting the substrate for proteosome-mediated degradation.
Recently, a new post-translational modification system, named sumoylation, was
identified biochemically analogous to, but functionally distinct from, the
ubiquitinylation pathway. Small ubiquitin-related modifier (SUMO) is a member of
the ubiquitin-like protein family that regulates various cellular functions of target
proteins (Kim et al., 2002b). These include regulation of transcriptional activity,
control of protein stability, formation of subnuclear structures, and cytoplasmic-
nuclear transportation. A previous study showed that C/EBPα, C/EBPβ, and C/EBPε
contain the conserved recognition sequence (ΨKXE) for attachment of the ubiquitin-
71
like protein SUMO-1. SUMO-1 attachment decreases the inhibitory effect of the
C/EBPε regulatory domain, suggesting that sumoylation may play an important role
in modulating C/EBPε activity as well as that of the other C/EBP family members
(Kim et al., 2002a). In this chapter, I investigate whether C/EBPα is subject to
sumoylation and how this modification affected C/EBPα activity on the mouse
amelogenin promoter.
Materials and methods
Plasmids
To generate the expression vector for SUMO-1, polymerase chain reactions
were performed using a 15-day-postconception (dpc) mouse embryo cDNA library
(Clontech) as a template with 5’-primer (5’-CTCGAGTGAG GTTCTGCCTG C-3’)
and 3’-primer (5’-AAAAGGGCAG TATTAAGGGA GCTG-3’). The PCR products
were inserted into pCR2.1-TOPO cloning vector (Invitrogen), and verified by
nucleotide sequence determination and analysis. The SUMO-1-pCR2.1 was digested
with Sma I and Xho I and inserted into the EcoR V-Xho I site of pcDNA3.1(+)
(Invitrogen).
To generate a sumoylation-defective C/EBPα expression vector, a C/EBPα
mutant was created with a lysine 159 to alanine conversion (mC/EBPα) using the
QuickChange site-directed mutagenesis kit (Stratagene) using primers (5’-
CGGCCGCTGG TGATCGCACA AGAGCCCCGC G-3’; and 5’-CGCGGGGCTC
72
TTGTGCGATC ACCAGCGGCC G -3’; mutated sites are shown in boldface font),
and confirmed by nucleotide sequence determination and analysis.
C/EBPα was fused to the amino terminus of a red fluorescent protein
(C/EBPα-RFP) using the 1.1 kb fragment of C/EBPα obtained by digestion of the
C/EBPα expression vector with Nco I. After digestion, the fragment was filled-in by
Klenow DNA polymerase, inserted into Sal I-digested, and blunted with Klenow fill-
in the pDsRed1-N1 plasmid (Clontech). The C/EBPα Lys 159 to Ala mutant
construct was fused with the pDsRed1-N1 plasmid (Clontech) to create the fusion
construct mC/EBPα-RFP.
The expression vector encoding the full-length C/EBPα was described
previously (Ross et al., 1999). The amino acids 1 to 96 of human SUMO-1 was
cloned downstream of EGFP expressing construct (Clontech) to create EGFP-
SUMO-1. The mouse amelogenin promoter reporter constructs of p2207-luc, p194-
luc, and p70-luc were each described in a previous study (Zhou and Snead, 2000),
and are used here without modification.
Transient transfection and luciferase assay
Variable amounts of plasmid DNA were used for transient transfection for
each well of 12-well plates. The amounts of DNA varied based upon experimental
conditions and were documented in the figure legends. To normalize transfection
efficiency, 75 ng of pCMV-lacZ/well was co-transfected as an internal control. The
day before transfection, LS8 cells were plated in 12-well plates so that they were 50-
73
80% confluent at the time of transfection. At the time of plating and during
transfection, antibiotics were avoided. Three hours before transfection, cells were
washed twice with DMEM medium and subsequently cultured in serum-free DMEM
medium. Plasmid DNA (0.75 μg) was diluted into 62 μl of medium in a 5-ml Falcon
culture tube, 5 μl of Plus reagent (Invitrogen) was added, mixed, and incubated for
15 min at room temperature. In a second tube, 2.5 μl of Lipofectamine reagent
(Invitrogen) was diluted into 62 μl of medium and mixed. The contents of these two
tubes were combined, mixed, and incubated for another 15 min at room temperature.
While complexes were forming, the medium on the cells was replaced with 0.5 ml of
serum-free fresh medium. The DNA-Plus-Lipofectamine complex was added to each
well of cells and mixed gently. The cells were incubated for 3 h at 37°C and 5%
CO
2
. After removal of the medium containing DNA-Plus-Lipofectamine complex,
cells were incubated in 1 ml of fresh, complete medium for an additional 22 h and
were subject to luciferase assay with a Dual-Light kit (Applied Biosystems).
Cells were washed twice with phosphate-buffered saline, pH 7.4, and lysed in
100 μl of lysis buffer (100 mM potassium phosphate, pH 7.8, 0.2% Triton X-100, 0.5
mM DTT). Cell scrapers (Corning) were used to detach cells from the plate. Cell
lysates were transferred to a microfuge tube and centrifuged at 15,000 g for 2 min.
The extracts (supernatant) were transferred to a fresh tube and stored at -70°C. At the
time of chemiluminescent detection, buffer-A and -B were equilibrated to room
temperature and Galacton-Plus Substrate was added to buffer-B at the ratio 1:100. A
10 μl aliquot of cell extracts was transferred to a luminometer tube to which 25 μl of
74
buffer-A was added and immediately followed by the addition of 100 μl of buffer-B.
After a 15 sec delay, the luciferase signal was obtained for 5 sec in a luminometer
(Lumat). After 45 min incubation at room temperature, 100 μl of Acceleraor-II
(Applied Biosystems) was added and the β-galactosidase signal was measured for
another 5 sec in the same luminometer.
Western blot analysis
LS8 cells were transfected with one of the following constructs: empty vector
(pcDNA3, Invitrogen); C/EBPα expression vector; C/EBPα with EGFP-SUMO-1;
mC/EBPα with EGFP-SUMO-1; C/EBPα with SUMO-1; or mC/EBPα with
SUMO-1. After 24h following transfection, cells were washed twice with cold
phosphate-buffered saline (pH 7.4), and lysed in hot (85°C) 1× SDS gel-loading
buffer (50 mM Tris-Cl, pH 6.8, 100 mM dithiothreitol, 2% SDS, 0.1% bromophenol
blue, 10% glycerol). After boiling for 10 min, cell lysates were transferred to a
microfuge tube and centrifuged at 15000 rpm for 10 min at room temperature. Equal
volumes of cell extracts (supernatants) were resolved by size on 12% SDS-
polyacrylamide gels. Proteins were transferred to Immobilon-P membrane
(Millipore), and immunoblotting was performed with a rabbit polyclonal C/EBPα
antibody (Santa Cruz Biotechnology) or a mouse monoclonal GFP antibody (Santa
Cruz Biotechnology). A horseradish peroxidase-conjugated secondary antibody with
the enhanced chemiluminescence (ECL) detection system (Amersham Biosciences)
was used to detect the bound antibodies.
75
Fluorescent Microscopy
LS8 cells were grown on a Lab-Tek II slide (Nalge Nunc International), and
transfected with pDsRed1-N1 (Clontech), C/EBPα-RFP, or mC/EBPα-RFP. After
24h following transfection, cells were washed twice with cold phosphate-buffered
saline (pH 7.4), and fixed with 4% paraformaldehyde for 30 min at 4°C. After
washing twice with phosphate-buffered saline, cells were mounted in AquaMount
mounting media (Learner Laboratories), and examined by fluorescent microscopy
(Olympus).
Results
C/EBPa is sumoylated in LS8 cells
Analyses of the amino acid sequence of C/EBPα revealed a sumoylation
consensus motif, ψKXE (Fig. 12A), where ψ represents as hydrophobic amino acid
and X represents any amino acid. This motif has been shown to confer the ability to
be modified by SUMO conjugation. To determine whether C/EBPα was subject to
sumoylation in ameloblast-like LS8 cells as previously shown for several other cell
lines, such as COS-1 cells and HEK 293T cells (Kim et al., 2002a; Subramanian et
al., 2003). C/EBPα and SUMO-1 expression plasmids were transfected into LS8
cells and their lysates were analyzed by Western blot. Here, two C/EBPα expression
plasmids were used, either the wild-type C/EBPα expression plasmid, or the mutant
C/EBPα expression plasmid in which the lysine 159, a residue required for
76
sumoylation, was mutated to an alanine. As controls, a SUMO-1 expression plasmid
and an enhanced green fluorescent protein fused with SUMO-1 expression plasmid,
EGFP-SUMO-1, were included for transfections into LS8 cells. When expressed
alone, the C/EBPα protein migrated to the expected position, but in addition there
were slower migrating forms of C/EBPα detected (Fig. 12B, lane 2). These slower
migrating forms of C/EBPα were also observed in the presence of exogenous
sumoylation sources provided by overexpression of the SUMO-1 plasmid (lane 5).
As expected, expression of an engineered C/EBPα (mC/EBPα), in which the sumo
consensus motif was mutated, resulted in the loss of slower migrating C/EBPα forms
(lane 6) in the presence of the SUMO-1 expression vector. These findings suggested
that the slower migrating proteins were authentic SUMO-1 modified C/EBPα
protein. To confirm that C/EBPα was conjugated by sumoylation, the EGFP-SUMO-
1 was co-transfected with the C/EBPα expression construct into LS8 cells. Three
bands were observed which represented non-conjugated, SUMO-1-conjugated, and
EGFP-SUMO-1-conjugated C/EBPα proteins as identified by Western blot using an
anti-C/EBPα antibody (lane 3). The identity of the EGFP-SUMO-1-conjugated
C/EBPα was confirmed by Western blot using an anti-GFP antibody (lane 9). Again,
as expected, the expression of EGFP-SUMO-1 with mC/EBPα, in which the
consensus sumoylation site was altered, resulted in the loss of SUMO-conjugated
bands (lane 4 and lane 10).
77
Sumoylation decreases C/EBPα-mediated amelogenin promoter transactivation
To investigate whether sumoylation participated in the regulation of the
mouse amelogenin promoter, a SUMO-1 expression construct was co-transfected
into LS8 cells with a well-characterized amelogenin promoter reporter construct,
p2207-luc. By itself, exogenous expression of SUMO-1 had no effect on the mouse
amelogenin promoter (Fig. 13, lane 10 to lane 12). In contrast, increasing the amount
of SUMO-1 attenuated C/EBPα-mediated transactivation (lane 3 to lane 5) in a dose-
dependent manner. The C/EBPα lysine 159 to alanine sumoylation-defective mutant
showed transcriptional potency similar to that of the wild-type C/EBPα (lane 6).
However, transactivation of the p2207-luc reporter construct by mutant C/EBPα
(mC/EBPα) was still antagonized by exogenous expressions of SUMO-1 (lane 7 to
lane 9). These transfection analyses indicated that SUMO-1 decreased C/EBPα-
mediated amelogenin promoter transactivation not through direct conjugation to
C/EBPα, but rather providing through sumoylation of other transcription regulating
factors, which in turn affect C/EBPα transactivation.
Effects of sumoylation on C/EBPα cytoplasmic-nuclear transport
Sumoylation of target proteins has been shown to regulate cytoplasmic-
nuclear transport. For example, SUMO-1 modification of RanGAP1 serves to direct
the modified protein to the nuclear pore complex (Mahajan et al., 1997; Mahajan et
al., 1998; Matunis et al., 1996; Matunis et al., 1998). To analyze intracellular
localization of C/EBPα in ameloblast-like LS8 cells, I generated expression plasmids
78
for C/EBPα and mC/EBPα red fluorescent fusion proteins. As a control, LS8 cells
were transfected with a pDsRed1-N1 expression plasmid. As expected, this non-
fused red fluorescent protein was evenly distributed throughout the cell (Fig. 14A).
In the case of the C/EBPα-RFP fusion protein, the protein was predominately
localized inside the nuclei of LS8 cells (Fig. 14B). In the case of the mC/EBPα-RFP,
a nuclear localization similar to that observed for the wild-type protein was observed
(Fig. 14C). These data indicate that the sumoylation-defective lysine 159 to alanine
mutation fails to alter C/EBPα cytoplasmic-nuclear transportation, suggesting that
sumoylation alone does not affect the distribution of C/EBPα.
79
Fig. 12A
Wt C/EBPα: PALRPLVIKQEPREEDEAKQL
m C/EBPα: PALRPLVIAQEPREEDEAKQL
Consensus motif: ψKXE
Fig. 12B
158 161
1 2 3 4 5 6 7 8 9 10 11 12
Empty vector
C/EBPα+EGFP-SUMO-1
mC/EBPα+EGFP-SUMO-1
C/EBPα+SUMO-1
mC/EBPα+SUMO-1
Empty vector
C/EBPα
C/EBPα+EGFP-SUMO-1
mC/EBPα+EGFP-SUMO-1
C/EBPα+SUMO-1
mC/EBPα+SUMO-1
C/EBPα
EGFP-SUMO1-C/EBPα

SUMO-1-C/EBPα

C/EBPα
EGFP-SUMO1-
C/EBPα
EGFP-SUMO-1
IB: α-C/EBPα ΙΒ: α-GFP
80
Fig. 12. C/EBPα is sumoylated in LS8 cells. A, Partial amino acid sequences of
C/EBPα in which a potential sumoylation site is underlined, the mutated site is
shown in mC/EBPα in which lysine 159 is converted to an alanine (mutated residue
is in boldface). The consensus sumoylation motif is provided. B, Lysates were
prepared form LS8 cells transfected with various expression constructs, as indicated
in the text and legend, electrophoresed, transferred to Immobilon-P membrane, and
immunoblotted with either an anti-C/EBPα antibody (sc-61, Santa Cruz
Biotechnology) or an anti-GFP antibody (sc-9996, Santa Cruz Biotechnology).
81
Fig. 13
Fig. 13. Over-expression of SUMO-1 decreases C/EBPα-mediated amelogenin
promoter transactivation. LS8 cells were transiently transfected with 250 ng of the
full-length amelogenin promoter p2207-luc reporter construct in the presence of 600
ng of empty vector (pcDNA3, lane 1), or 200 ng of expression plasmid for C/EBPα
with 400 ng of pcDNA3 (lane 2), or 200 ng of C/EBPα with 100 ng of SUMO-1 plus
300 ng of pcDNA3 (lane 3), or 200 ng of C/EBPα with 200 ng of SUMO-1 plus 200
ng of pcDNA3 (lane 4), or 200 ng of C/EBPα with 400 ng of SUMO-1 (lane 5), or
200 ng of expression plasmid for mC/EBPα with 400 ng of pcDNA3 (lane 6), or 200
ng of mC/EBPα with 100 ng of SUMO-1 plus 300 ng of pcDNA3 (lane 7), or 200 ng
of mC/EBPα with 200 ng of SUMO-1 plus 200 ng of pcDNA3 (lane 8), or 200 ng of
mC/EBPα with 400 ng of SUMO-1 (lane 9), or 100 ng of SUMO-1 with 500 ng of
pcDNA3 (lane 10), or 200 ng of SUMO-1 with 400 ng of pcDNA3 (lane 11), or 400
ng of SUMO-1 with 200 ng of pcDNA3 (lane 12). In all cases, pCMV-lacZ plasmid
(75 ng) was included as an internal control for transfection efficiency. Data reflected
the mean ± S.D. of three independent experiments, with the response level of p2207-
luc in lane 1 set arbitrarily as “1”.
0
1
2
3
4
5
6
7
12 345 67 89 101112
Relative luciferase activity of p2207-luc
C/EBPα - + + + + - - - - - - -
mC/EBPα - - - - - + + + + - - -
SUMO-1 - - -
82
Fig. 14
Fig. 14. Effects of sumoylation on cytoplasmic-nuclear localization of C/EBPα. LS8
cells plating on a Lab-Tek II slide (Nalge Nunc International) were transfected with
pDsRed1-N1 (Clontech) (A), or C/EBPα-RFP (B), or mC/EBPα-RFP (C). Cells
were processed 24 h after transfection, and examined by fluorescent microscopy
(Olympus).
A, RFP
B, C/EBPα-RFP
C, mC/EBPα-RFP
83
Discussion
Post-translational modification of proteins play key roles in regulating the
functions of numerous proteins. In the case of C/EBPα, it has been reported to be
subject to phosphorylation (Hemati et al., 1997; MacDougald et al., 1995; Mahoney
et al., 1992). Although phosphorylation of C/EBPα seems not to significantly alter
C/EBPα activity in adipocytes (Ross et al., 1999), This is not the case for
granulopoiesis, where C/EBPα phosphorylation play an inhibitory role (Ross et al.,
2004).
Among post-translational modifications of proteins, ubiquitination is a well-
characterized process in which ubiquitins are covalently attached to protein
substrates, a step that targets the modified substrates for proteosome-mediated
degradation. Recently, a new post-translational modification system, named
sumoylation, was identified that is biochemically analogous to, but functionally
distinct from, the ubiquitinylation pathway. The small ubiquitin-related modifier
(SUMO) is a member of ubiquitin-like protein families that regulate various cellular
functions of target proteins (Kim et al., 2002b). These include regulation of
transcriptional activities, control of protein stability, formation of subnuclear
structures, and cytoplasmic-nuclear transportation. Previous investigation shows that
C/EBPα, C/EBPβ, and C/EBPε contain the conserved recognition sequence (ΨKXE)
required for attachment of ubiquitin-like protein SUMO-1 (Kim et al., 2002a).
SUMO-1 conjugation decreases the inhibitory effect of the C/EBPε regulatory
domain, suggesting that sumoylation may play an important role in modulating
84
C/EBPε activity, as well as that of other C/EBP family members (Kim et al., 2002a).
Here I identify a SUMO motif in C/EBPα that is subject to SUMO-1 modification in
LS8 cells in which amino acid lysine 159 constitutes the putative conjugation target
site for SUMO-1 attachment for C/EBPα (Fig. 12A and 12B). Sumoylation of
C/EBPα decreased its transactivation on the amelogenin promoter (Fig. 13).
Unexpectedly, transactivation of the amelogenin promoter by sumoylation-defective
C/EBPα was antagonized by exogenous expression of SUMO-1 proteins (Fig. 13,
lane 7 to lane 9). This finding suggests that SUMO-1 does not directly influence
C/EBPα activity, but rather acts through other transcription factors and/or
mechanisms, which in turn affects C/EBPα activity on the amelogenin promoter.
Immunohistochemistry of 2-day postnatal mouse incisor shows translocation
of C/EBPα from the cytoplasm of presecretory ameloblasts to the nucleus of
secretory ameloblasts (unpublished data). This shift in location for C/EBPα tightly
coincides with the onset of amelogenin expression in ameloblast cells. However, the
molecular mechanism by which cells regulate C/EBPα cytoplasmic-nuclear transport
is still unknown. I decided to examine whether sumoylation is responsible for
intracellular transport of C/EBPα by using fluorescent protein tagging techniques.
The K159A sumoylation-defective mC/EBPα-RFP showed similarly nuclear
localization as that of the wild-type C/EBPα-RFP (Fig. 14), indicating that lysine
159 to alanine mutation in C/EBPα did not alter C/EBPα subcellular localization.
Essential to enamel biomineralization is to closely regulate the amount of
amelogenin protein available to direct hydroxyapatite crystallite habit. Mineral
85
formation and enamel protein assembly must be closely regulated to achieve the
largest crystals in the vertebrate body as well as the hardest tissue, enamel.
Therefore, physiologic regulation of amelogenin gene expression is essential. Here, I
attempted to understand the molecular modulation of amelogenesis during tooth
formation from SUMO-1 modification of C/EBPα. Sumoylation of C/EBPα, and
other as yet unidentified transcription factors, could have served as the
developmental basis for proper amelogenin expression at the right time and at the
right place during enamel formation, but this hypothesis failed to be confirmed.
86
Chapter 6
CCAAT/ Enhancer-binding Protein α and Amelogenin Gene Expression In
Vivo
Introduction
In vitro, C/EBPα has been demonstrated to act as a strong transactivator for
amelogenin transcription (Zhou and Snead, 2000). However, in vivo observations
have not been reported. Mice homozygous for the targeted deletion of the C/EBPα
gene die within 8 hours of birth from either hypoglycemia (Wang et al., 1995) or
impaired function of type II pneumocytes (Flodby et al., 1996). This lethal
phenotype prevents my observation of the loss of C/EBPα on postnatal tooth
formation.
The Cre/LoxP recombination system offers a method to circumvent this
problem. The Cre/LoxP system has been successfully applied to the investigation of
the role of C/EBPα in energy metabolism in liver and adipose tissues at later stages
of postnatal development (Lee et al., 1997). The homozygous C/EBP-LoxP
(C/EBPα
fl/fl
) mice are indistinguishable from their wild-type counterparts.
In searching for a promoter useful for driving Cre recombinase to be used in
my experimental strategy, the cytokeratin 14 (K14) promoter has been found to be a
potent candidate promoter for ameloblast-lineage cells during tooth development,
both in vivo and in vitro. In the developing tooth of the newborn rat,
immunohistochemical studies show that the appearance of K14 is cell and
87
differentiation stage specific. Weak K14 expression signals within inner enamel
epithelial cells in the proliferation stage is observed. In addition, K14 is well
expressed within preameloblasts and ameloblasts that are in the post-proliferation
stages. In cultured primary ameloblast cells, K14 and amelogenin expression appear
mainly in those cells considered to be in the post-proliferation stage. K14 is detected
earlier than amelogenin, and immunofluorostaining shows that K14 and amelogenin
are co-expressed in ameloblasts (Tabata et al., 1996). Therefore, the use of the K14
promoter to drive recombination of floxed loci, is likely to result in excision with
loss of protein function.
Here, I report on the generation of C/EBPα conditional knock-out mice
created by crossing C/EBPα
fl/fl
mice with K14-Cre mice. I also investigate the
relationship between C/EBPα and amelogenin transcripts in vivo utilizing the real-
time PCR technique. In addition, I propose an alternative pathway that may explain
the activation and maintenance of amelogenin expression at wild-type levels in
C/EBPα conditional knock-out mice.
Materials and Methods
Transient transfection and luciferase assay
Variable amounts of plasmid DNA were used for transient transfection for
each well of 12-well plates. The amounts of DNA varied based upon experimental
conditions and were documented in the figure legends. To normalize transfection
efficiency, 75 ng of pCMV-lacZ/well was co-transfected as an internal control. The
88
day before transfection, LS8 cells were plated in 12-well plates so that they were 50-
80% confluent at the time of transfection. At the time of plating and during
transfection, antibiotics were avoided. Three hours before transfection, cells were
washed twice with DMEM medium and subsequently cultured in serum-free DMEM
medium. Plasmid DNA (0.75 μg) was diluted into 62 μl of medium in a 5-ml Falcon
culture tube, 5 μl of Plus reagent (Invitrogen) was added, mixed, and incubated for
15 min at room temperature. In a second tube, 2.5 μl of Lipofectamine reagent
(Invitrogen) was diluted into 62 μl of medium and mixed. The contents of these two
tubes were combined, mixed, and incubated for another 15 min at room temperature.
While complexes were forming, the medium on the cells was replaced with 0.5 ml of
serum-free fresh medium. The DNA-Plus-Lipofectamine complex was added to each
well of cells and mixed gently. The cells were incubated for 3 h at 37°C and 5%
CO
2
. After removal of the medium containing DNA-Plus-Lipofectamine complex,
cells were incubated in 1 ml of fresh, complete medium for an additional 22 h and
were subject to luciferase assay with a Dual-Light kit (Applied Biosystems).
Cells were washed twice with phosphate-buffered saline, pH 7.4, and lysed in
100 μl of lysis buffer (100 mM potassium phosphate, pH 7.8, 0.2% Triton X-100, 0.5
mM DTT). Cell scrapers (Corning) were used to detach cells from the plate. Cell
lysates were transferred to a microfuge tube and centrifuged at 15,000 g for 2 min.
The extracts (supernatant) were transferred to a fresh tube and stored at -70°C. At the
time of chemiluminescent detection, buffer-A and -B were equilibrated to room
temperature and Galacton-Plus Substrate was added to buffer-B at the ratio 1:100. A
89
10 μl aliquot of cell extracts was transferred to a luminometer tube to which 25 μl of
buffer-A was added and immediately followed by the addition of 100 μl of buffer-B.
After a 15 sec delay, the luciferase signal was obtained for 5 sec in a luminometer
(Lumat). After 45 min incubation at room temperature, 100 μl of Acceleraor-II
(Applied Biosystems) was added and the β-galactosidase signal was measured for
another 5 sec in the same luminometer.
Animal Preparation
The K14-Cre transgenic line, the R26R conditional reporter allele, and the
C/EBPa
fl/fl
(fl, flanked by loxP sites) mouse stain have been described previously
(Lee et al., 1997; Li et al., 2001; Soriano, 1999). Mating K14-Cre
+/-
with R26R
+/-
mice generated "R26R;K14-Cre" mice (double transgenic). Mating K14-Cre
+/-
with
fl/fl (C/EBPα
fl/fl
) mice generated "wt/fl;K14-Cre" mice. Subsequent mating between
"wt/fl;K14-Cre mice" generated "fl/fl;K14-Cre" homozygous conditional knock-out
mice for C/EBPα. For ease of identification, I refer to wild-type animal as
C/EBPα
+/+
, the "wt/fl;K14-Cre" animal as C/EBPα
+/-
, and the "fl/fl;K14-Cre" animal
as C/EBPα
-/-
in order to allow the C/EBPα allelic status to be easily tracked.
Genotyping of wild-type, loxP-targeted (fl), and Cre-mediated recombination (-)
for C/EBPα alleles
Genomic DNA from mouse tails was isolated by digestion in a buffer
containing 0.6 mg/ml proteinase-K, 50 mM Tris-Cl, pH 8.0, 100 mM EDTA, and 0.5
90
% SDS at 55°C overnight. The solution was subjected to extraction with phenol,
phenol/chloroform, and chloroform. DNA in the aqueous phase was precipitated by
the addition of 2 volumes of ethanol. An additional wash step in 70% ethanol was
essential to remove traces of SDS and phenol prior to biochemical manipulation.
As shown in Fig. 15, PCR primers F4, 5'-AACCTCCACC TCCCCTCG-3';
F6, 5'-TCTGATGCCG CCGTGTTC-3'; F7, 5'-CTCCAGTGTG GTCTGTGTTG G-
3'; B4, 5'-GCCAAACCCC GTGTTCAC-3'; and B6, 5'-CCCCTGATGC
TCTTCGTCCA G-3', were used to differentiate the wild-type, floxed C/EBPα, and
knock-out C/EBPα allele. F7/B4 primer pairs were used to detect the 600 bp wild-
type allele. F6/B6 primer pairs were used to detect the 400 bp floxed C/EBPα allele.
F4/B4 primer pairs were used to detect the 900 bp knock-out allele (Fig. 15). The
primer pairs used to identify the 700 bp Cre allele were forward primer, 5'-
TGCTGTTTCA CTGGTTATGC GG-3' and reverse primer, 5'-CCATTGCCCC
TGTTTCACTA TCC-3'.
Detection of Cre mediated recombination by β-galactosidase (lacZ) staining
Cells undergoing recombination were using the Cre/loxP system in which the
K14-Cre transgene mediated DNA recombination after being crossed with the
ROSA26 reporter transgene (Soriano, 1999). As a consequence to recombination, β-
gal expression was activated and restricted to the cells where the K14 promoter was
expressed at levels sufficient to cause Cre-mediated activation of the ROSA26
marker. To assess K14 promoter activity in mouse teeth, first molars were dissected
91
from newborn mice and stained for β-galactosidase activity. Molars were fixed at
4°C for overnight in 0.2% glutaraldehyde in PBS (phosphate-buffered saline),
washed three times in rinse solution (0.005% Nonidet P-40 and 0.01% sodium
deoxycholate in PBS). Tissues were stained overnight at 37°C using staining solution
containing 2 mM MgCl
2
, 5 mM potassium ferricyanide, 5 mM potassium
ferrocyanide, and 0.4% X-gal, rinsed twice in PBS and postfixed in 3.7%
formaldehyde.
Cryostat sectioning
Mandibles of newborn mice were prepared for frozen sections and stained
according to standard procedures. In brief, tissues were fixed in 0.2% glutaraldehyde
solution at 4°C overnight, immersed in 10% sucrose in PBS containing 2mM MgCl
2
for 30 min at room temperature, incubated in 30% sucrose, 50% OCT, and 2 mM
MgCl
2
in PBS at 4°C for 1.5 hrs, and embedded in Optimum Cutting Temperature
(OCT) by freezing on dry ice. Sections were cut at 10 μm thickness, mounted on
gelatin-coated slides, fixed in 0.2% glutaraldehyde for 10 minutes on ice, and rinsed
twice in PBS containing 2 mM MgCl
2
, followed by a 10 minute wash in PBS with 2
mM MgCl
2
. Tissue sections were incubated in the detergent rinse solution (2 mM
MgCl
2
, 0.005% NP-40 and 0.01% sodium deoxycholate in PBS) for 10 min at 4°C,
and chromogen developed in X-gal staining solution overnight at 37°C in the dark.
92
Hemotoxylin and Eosin (HE) Staining
Mandibles from 3-day postnatal mice were dissected and fixed in Carnoy's
fixative (10% glacial acetic acid, 60% absolute ethanol, 30% chloroform, v/v)
overnight at room temperature. Tissues were washed with absolute ethanol (30 min,
2 times), cleared with xylene (15 min, 2 times) and embeded in paraffin. Paraffin
blocks were cut into serial sections of 6 μm thickness, mounted on poly-L-lysine
coated slides. Paraffin sections were deparaffinized and stained with hemotoxylin
and eosin according to standard procedures.
Epithelial-Mesenchymal Separation of Molars from 3-day Postnatal Mice
The first and second molars were dissected free of the mandible and
incubated in 1% dispase (Gibco-BRL) in PBS for 1 h on ice. The sheets of epithelial
cells were separated from the underling extracellular matrix and mesenchymal cells,
placed into RNA-Bee RNA isolation reagent (TEL-TEST) for RNA extraction.
RNA Extraction and Reverse Transcription
Total RNA from epithelial cells of first and second molars of 3-day postnatal
mice was extracted by using the RNA-Bee reagent (TEL-TEST, Inc). First strand
cDNA was synthesized with 100 ng random decamers using a RETROscript reverse
transcription kit (Ambion).
93
Real-time PCR
PCR was carried out with the IQ SYBR green supermix kit (Bio-Rad) in a 20
μl final volume, 3-4 mM MgCl
2
and 0.2-0.4 μM each primer (final concentration).
As shown in table 1, primer sequences for each target gene are as follows: for
C/EBPα, forward primer, 5'-CGCCTTCAAC GACGAGTTCC-3' and reverse
primer, 5'-TAGTCAAAGT CACCGCCGCC AC-3'; for amelogenin, forward primer,
5'-GGGGACCTGG ATTTTGTTTG-3' and reverse primer, 5'-AACCATAGGA
AGGATACGGC TG-3'; for NF-YA, forward primer, 5'-GGCAGGGAAT
GTGGTCAAC-3' and reverse primer, 5'-TGCGGTGATA CTGTTTGGC-3'; for
C/EBPβ, forward primer, 5'-TGGACAAGCT GAGCGACGAG-3' and reverse
primer, 5'-TGTGCTGCGT CTCCAGGTTG-3'; for C/EBPδ, forward primer, 5'-
AGAACGAGAA GCTGCATCAG C-3' and reverse primer, 5'-TTGAAGAACT
GCCGGAGGC-3'; and for β-actin, forward primer, 5'-GGGAAATCGT
GCGTGACATC-3' and reverse primer, 5'-GCGGCAGTGG CCATCTC-3'. For
analyzing C/EBPβ and C/EBPδ, quantitative PCR was performed using the iCycler
iQ multicolor real-time PCR detection system (Bio-Rad) for 40 cycles at 95°C for 20
s, 59°C for 20 s, and 72°C for 20 s. For analyzing C/EBPα, amelogenin, and NF-YA,
PCR was performed for 40 cycles at 95°C for 10 s and 55°C for 45 s. Amplification
specificity was verified by using data derived from the melting curve for each sample
following the manufacturer's instructions. The iCycler iQ real-time PCR detection
system software version 3.1 was used to analyze results, and the PCR baseline
subraction curve fit function was used to automatically determine threshold cycle
94
(C
T
) values. A C
T
value of 40 was regarded as no amplification and was excluded in
the calculations.
Statistical Analysis
Statistical analysis was performed using the one-way ANOVA test and
statistical significance is defined as P < 0.05.
Results
K14-Cre transgenic mice robustly express Cre recombinase in the ameloblast
cell lineage
The K14-Cre transgenic mice were bred with R26R mice (Soriano, 1999) to
generate transgenic animals, in which expression of the β-galactosidase occurs only
upon Cre-mediated DNA excision. The first molar of newborn pups, with the
genotype of "K14-Cre; R26R", was isolated and subject to whole-mount X-Gal
staining. As expected with a K14 promoter, the lacZ expression was uniformly
distributed in epithelial cells, while no lacZ stain was observed in mesenchymal cells
(Fig. 16A). When newborn mandibles of "K14-Cre; R26R" mice were prepared for
histologic examination, X-gal positive ameloblasts were restricted to the molar teeth
(Fig. 16B). In the lower incisor, the lacZ activity was detected only in ameloblast
cells from the early stage of differentiation within the growing end and continuously
through the fully differentiated incisor tip region. When examined closely, some
95
unstained ameloblast cells were observed sporadically, suggesting an incomplete
recombination event in those cells (Fig. 16B, panel d and e).
K14-Cre-mediated C/EBPα ablation in mouse ameloblast cell lineage
To specifically disrupt C/EBPα gene expression in the ameloblast cell
lineage, C/EBPα
fl/fl
(fl, flanked by loxP sites) mice were bred with K14-Cre
transgenic mice to generate "C/EBPα
+/−
" heterozygous conditional knock-out mice.
Subsequent mating between "C/EBPα
+/−
" mice produced "C/EBPα
−/−
" homozygous
conditional knock-out mice. RNAs extracted from molar epithelial cells of 3-day
postnatal mice were reverse-transcribed, and the first strand cDNAs were subject to
real-time PCR analysis.
C/EBPα mRNA transcripts were reduced significantly upon removal of one
C/EBPα allele and upon removal of both C/EBPα alleles (P<0.01, Fig. 17A),
C/EBPα mRNA levels fell further suggesting that K14-Cre successfully mediated
C/EBPα gene excision. The level of C/EBPα in "C/EBPα
+/−
" mice was reduced to
41-55% of levels corresponding to expression levels observed in wild-type control
mice, while the level of C/EBPα in "C/EBPα
−/−
" mice was reduced to 2-32% of that
in wild-type control mice (Table 2). C/EBPα has been demonstrated as a strong
transactivator of the amelogenin gene (Zhou and Snead, 2000), and ablation of the
C/EBPα gene is expected to affect amelogenin expression. I examined the
expression level of amelogenin mRNA from each of these C/EBPα conditional
knock-out mice that varied only by C/EBPα copy number. Amelogenin was
96
marginally reduced upon removal of one C/EBPα allele (P<0.05, Fig. 17E). The
level of amelogenin in "C/EBPα
+/−
" mice was 61-85% of that in wild-type control
mice (Table 2). Surprisingly, once two C/EBPα alleles were excised, amelogenin
mRNA transcripts for the "C/EBPα
−/−
" mice returned to the wild-type level (P>0.05,
Fig. 17E). The level of amelogenin in "C/EBPα
−/−
" mice was 65-144% of that
observed in wild-type control mice (Table 2). This finding suggests that amelogenin
induction is independent of C/EBPα expression levels and is compensated by an
unknown mechanism (s) upon excision of two C/EBPα alleles.
Several studies have suggested potential roles of NF-Y and C/EBPβ in
facilitating C/EBPα-mediated transactivation (Zhou and Snead, 2000; Zhu et al.,
2004). Based upon these observations, the level of NF-YA and C/EBPβ were also
ascertained in this study. I did not observe a significant change in the level of NF-
YA among mice with either one or both C/EBPα alleles removed (P>0.05, Fig.
17D). The level of NF-YA in mice in which there was only one C/EBPα allele
("C/EBPα
+/−
") was 70-101% of the expression levels observed in wild-type control
mice. The level of NF-YA in mice with no C/EBPα allele ("C/EBPα
−/−
") was 55-
125% of that observed in wild-type control mice (Table 2). In addition, there was no
significant difference in the level of C/EBPβ in either instance in which only the
C/EBPα copy number varied (P>0.05, Fig. 17B). The expression level of C/EBPβ in
mice in which there was only one C/EBPα allele ("C/EBPα
+/−
") was 75-134% of that
observed in wild-type control mice, and the expression level of C/EBPβ in mice with
97
no C/EBPα allele ("C/EBPα
−/−
") was 100-189% of that observed in wild-type
control mice (Table 2).
Hemotoxylin and eosin stained 3-day postnatal mouse mandibles showed that
the enamel thickness of incisors (Fig. 18A) and molars (Fig. 18B) was not grossly
affected in mice with a complete absence of C/EBPα ("C/EBPα
−/−
") when compared
to enamel thickness of wild-type control mice. The absence of detectable diminution
of the enamel thickness in the C/EBPα conditional knock-out animal is not
surprising given the compensation observed that restored amelogenin expression to
approximately wild-type levels.
C/EBPδ is able to activate the mouse amelogenin promoter
The finding that the amelogenin mRNA level is restored upon excision of
CEBPα alleles prompted me to search for an alternative pathway in the regulation of
amelogenin gene. C/EBPδ was studied because both C/EBPδ and C/EBPα have
similar nucleotide sequence preferences for promoter binding (Osada et al., 1996b).
To test whether C/EBPδ could function as a transactivator of the mouse amelogenin
promoter, a C/EBPδ expression vector was co-transfected into LS8 cells with
different amelogenin promoter reporter constructs: p2207-luc (full-length
amelogenin promoter), p70-luc (minimal amelogenin promoter), mC/EBP-p2207-luc
(full-length amelogenin promoter with mutated C/EBP site), and mC/EBP-p70-luc
(minimal amelogenin promoter with mutated C/EBP site). Mutation of the C/EBP
site abolished the basal promoter activity of both mutant reporter constructs
98
(mC/EBP-p2207-luc and mC/EBP-p70-luc), whereas the reporter gene activity of
wild-type constructs (p2207-luc, and p70-luc) was increased dramatically by co-
transfection with C/EBPδ (Fig. 20). Taken together, these data indicate that the
C/EBP site is required to maintain basal amelogenin promoter activity and is
responsive to either C/EBPα or C/EBPδ.
My previous data has shown that NF-Y and C/EBPα synergistically activate
the mouse amelogenin promoter. To investigate whether C/EBPδ has similar potency
to that of C/EBPα, NF-Y and C/EBPδ expression plasmids were co-transfected with
the p70-luc reporter construct into LS8 cells. As shown in Fig. 21, C/EBPδ increased
the promoter activity about 8-fold (lane 2), whereas exogenous expression of NF-Y
in isolation had only marginal effects on the promoter (lane 3). Co-transfection of
C/EBPδ with NF-Y served to synergistically increase the promoter activity to 16-
fold (lane 5), a level that was two times more than that of C/EBPδ only.
Furthermore, the presence of mutant NF-YA (NF-YAm29) greatly reduced the
promoter activity, either in the absence or in the presence of exogenous C/EBPδ
expression (lane 4 and lane 6). These observations demonstrate that NF-Y facilitates
C/EBPδ to synergistically activate the mouse amelogenin promoter, although by
itself, NF-Y exhibits only a marginal effect. Thus, in the absence of C/EBPα, the
synergism between NF-Y and C/EBPδ compensates, restoring amelogenin
expression levels to approximately wild-type status.
99
Fig. 15
C/EBPα
+/+
allele
C/EBPα
fl/fl
allele
C/EBPα
-/-
allele
by Cre-mediated
recombination
Fig.15. Schema of the primer design for genotyping wild-type, C/EBPα
fl/fl
, and
C/EBPα
−/−
alleles. Solid triangles represent the loxP sites, and "E" represents the
EcoRI restriction endonuclease site. Primers F7 and B4 amplified the 600 bp wild-
type allele; primers F6 and B6 amplified the 400 bp C/EBPα
fl/fl
allele; primers F4
and B4 amplified the 900 bp C/EBPα
-/-
allele.
C/EBPα pGK-Neo
C/EBPα
E E
E E
E
F7 B4
F6 B6
F4 B4
Wild-type:
F7/B4, 600 bp
C/EBPα
fl/fl
:
F6/B6, 400 bp
C/EBPα
-/-
:
F4/B4, 900 bp
100
Fig. 16. Characterization of Cre recombinase activity in the ameloblast cell lineage
achieved by the "K14-Cre" mated to "R26R" transgenic mice. A, First molars of
newborn mice were dissected and subject to β-galactosidase (lacZ) staining.
Epithelial cells (E) show positive reaction for lacZ staining while mesenchymal cells
(M) are completely free of lacZ staining. B, Mandibles of newborn mice were used
to produce frozen sections and subject to β-galactosidase (lacZ) staining. M1, first
molar; M2, second molar.
Fig. 16A
Fig. 16B
a b c
M
M
E
E
E
Occlusal view Side view Apical view
M1
M2
d
e
f
Incisor
101
102
Fig. 17. The mRNA expression level of C/EBPα (A), C/EBPβ (B), C/EBPδ (C), NF-
YA (D), and amelogenin (E) among wild-type and C/EBPα conditional knock-out
mice, determined by real-time PCR. *P<0.05, **P<0.01.
103
Fig. 18A
Fig. 18B
Fig. 18. Micro anatomy of hemotoxylin and eosin stained three-day-postnatal wild-
type ("C/EBPα
+/+
") and C/EBPα knock-out ("C/EBPα
-/-
") mutant mouse incisor (A)
and molar (B) teeth.
C/EBPα
+/+
C/EBPα
-/-
C/EBPα
+/+
C/EBPα
-/-
a b
c d
e
f
g
h
104
Fig. 19
C/EBPβ + + +
NF-Y + +
NF-YAm29 + +
Fig. 19. Effects of C/EBPβ and NF-Y on the amelogenin promoter. LS8 cells were
transiently transfected with 250 ng of p70-luc reporter construct in the presence of
200 ng of empty vector (lane 1), expression vector for C/EBPβ (lane 2), NF-Y (lane
3), dominant negative form of NF-Y, NF-YAm 29 (lane 4), C/EBPβ and NF-Y (lane
5), and C/EBPβ and NF-YAm 29 (lane 6). pCMV-lacZ plasmid (75 ng) was included
in all experiment groups as an internal control for transfection efficiency. Data
reflected the mean ± S.D. of three independent experiments, with the response level
of p70-luc in the absence of exogenous C/EBPβ set arbitrarily as “1”.
0
0.5
1
1.5
2
2.5
3
3.5
4
123 456
Relative luciferase of P70-luc
105
Fig. 20
Fig. 20. Requirement of the C/EBP site for the basal amelogenin promoter activity
and C/EBPδ-mediated transactivation. Results of transient transfection experiments.
250 ng of various reporter constructs (p2207-luc, p70-luc, mC/EBP-p2207-luc, and
mC/EBP-p70-luc) were transiently transfected into LS8 cells with 200 ng of C/EBPα
expression plasmid or empty vector pcDNA3. In all cases, pCMV-lacZ (75 ng) was
included as an internal control for transfection efficiency. The relative luciferase
activity was the normalization of luciferase activity with β-galactosidase activity.
The mean ± S.D. from at least three independent experiments was represented, and
the level of p70-luc in the absence of exogenous C/EBPα was set arbitrarily as “1”.
0
5
10
15
20
Empty Vector
C/EBPδ
Relative luciferase activity
p2207-luc p70-luc mC/EBP-p2207-luc mC/EBP-p70-luc
106
Fig. 21
Fig. 21. C/EBPδ and NF-Y synergism on the minimal amelogenin promoter. LS8
cells were transiently transfected with 250 ng of p70-luc reporter construct in the
presence of 200 ng of empty vector (lane 1), expression vector for C/EBPδ (lane 2),
NF-Y (lane 3), dominant negative form of NF-Y, NF-YAm 29 (lane 4), C/EBPδ and
NF-Y (lane 5), and C/EBPδ and NF-YAm 29 (lane 6). pCMV-lacZ plasmid (75 ng)
was included in all experiment groups as an internal control for transfection
efficiency. Data reflected the mean ± S.D. of three independent experiments, with
the response level of p70-luc in the absence of exogenous C/EBPα set arbitrarily as
“1”.
0
5
10
15
20
12 3 4 5 6
Relative luciferase activity
p70-luc + + + + + +
C/EBPδ + + +
NF-Y(A+B+C) + +
NF-YAm29 + +
107
Fig. 22
Fig. 22. C/EBPδ expression pattern in a newborn mouse mandibular incisor.
Immunohistochemical analysis with a C/EBPδ antibody (sc-151, Santa Cruz
Biotechnology). Positive staining is shown in red. Upper panels are high
magnification view of the indicated areas in low panel.
108
Table 1
Gene name Accession
number
Primer sequence Product
length
C/EBPα NM_007678 5'-CGCCTTCAACGACGAGTTCC-3'
5'-TAGTCAAAGTCACCGCCGCCAC-3'
105 bp
Amelogenin NM_009666 5'-GGGGACCTGGATTTTGTTTG-3'
5'-AACCATAGGAAGGATACGGCTG-3'
161 bp
NF-YA NM_010913 5'-GGCAGGGAATGTGGTCAAC-3'
5'-TGCGGTGATACTGTTTGGC-3'
146 bp
C/EBPβ NM_009883 5'-TGGACAAGCTGAGCGACGAG-3'
5'-TGTGCTGCGTCTCCAGGTTG-3'
105 bp
C/EBPδ NM_007679 5'-AGAACGAGAAGCTGCATCAGC-3'
5'-TTGAAGAACTGCCGGAGGC-3'
70 bp
β-actin NM_007393
5'-GGGAAATCGTGCGTGACATC-3'
5'-GCGGCAGTGGCCATCTC-3'
76 bp
Table 1. Real-Time PCR primer sequences and their expected product sizes.
109
Table 2
Genotype (n) C/EBPα C/EBPβ C/EBPδ NF-YA Amel
C/EBPα
+/+
(12) 100% 100% 100% 100% 100%
C/EBPα
+/-
(12) 41-55% 75-134% 67-139% 70-101% 61-85%
C/EBPα
-/-
(9) 2-32% 100-189% 72-144% 55-125% 65-144%
Table 2. Comparison of the mRNA level for C/EBPα, C/EBPβ, C/EBPδ, NF-YA
and amelogenin among wild-type and C/EBPα conditional knock-out mice.
110
Discussion
Data from several in vitro experimental strategies have demonstrated that
C/EBPα is a strong transactivator for amelogenin gene expression (Zhou et al., 2000;
Zhou and Snead, 2000), however, no in vivo observation of the role for C/EBPα in
amelogenin expression has been reported. As a step in exploring the function of
C/EBPα in regulating amelogenin activation in vivo, and to circumvent the lethal
neonatal phenotype in the conventional C/EBPα knock-out mice (Flodby et al.,
1996; Linhart et al., 2001; Wang et al., 1995), I generated a conditional knock-out
mouse strain in which the C/EBPα alleles were removed upon the expression of Cre
recombinase under the control of K14 promoter. I used the R26R mouse to report on
the cell specific expression of Cre recombinase. The K14 promoter drove Cre
expression robustly as demonstrated by the lacZ staining in the ameloblast cell
lineage from molars and incisors. However some unstained ameloblast cells were
observed sporadically in the lower incisor. One explanation for this "sparing" is that
the expression of Cre recombinase in those cells unmarked by lacZ is below the
threshold required for recombination and results in incomplete gene excision with
the failure to express lacZ.
To prevent potential contamination from mesenchymal cells, in which K14-
Cre would not be active, molars of three-day postnatal mice were dissected, and the
epithelial cells were mechanically separated from the mesenchyme. The RNA was
recovered, reverse-transcribed to cDNA, and subjected to real-time PCR analysis to
determine transcript copy number. Theoretically, the expression level of C/EBPα
111
mRNA in the C/EBPα conditional double knock-out mice should be close to zero
because of the expected excision of both C/EBPα alleles via Cre/LoxP
recombination. However, I found the level of C/EBPα expression in the C/EBPα
knock-out mice was reduced to 2-32% of the level observed in wild-type control
mice. The C/EBPα expression level showed a fairly high variation for the
recombination event in the C/EBPα knock-out mice. This variation could be
explained by at least three possibilities. First, there was insufficient Cre expression to
drive loxP recombination in ameloblasts, a condition observed in the R26R mouse
that was used to trace Cre expression (Fig. 16B, panel d and e). Second,
mesenchymal contaminations during epithelial-mesenchymal separation resulted in a
contribution of C/EBPα mRNA from the mesenchymal cells to the C/EBPα mRNA
levels observed in ameloblasts from the knock-out mice, given the fact that the K14
promoter driving Cre functions only in epithelial cells. Third, since C/EBPα is an
intronless gene, DNase I treatment used in the preparation of RNA sample could not
guarantee the complete removal of trace amounts of genomic DNA, a condition that
would contribute to the increased levels of C/EBPα observed in the C/EBPα
conditional knock-out mice.
I examined the amelogenin expression level in these C/EBPα conditional
knock-out mice. The amelogenin mRNA transcripts marginally decreased in the
C/EBPα heterozygous conditional knock-out mice (P<0.05, Fig. 17E). Surprisingly,
in the C/EBPα homozygous conditional knock-out mice, amelogenin was restored to
112
the wild-type expression level (Fig. 17E). This finding strongly implies the existence
of an alternative pathway for the activation of the amelogenin gene.
I also examined the level of NF-YA, and C/EBPβ in these C/EBPα
conditional knock-out mice. Neither the level of NF-YA nor C/EBPβ was
significantly affected in the mice with reduced C/EBPα copy number and reduced
mRNA C/EBPα levels. This observation is correlated with the finding that C/EBPβ
and NF-Y exert only arithmetic accumulation effects in activating the amelogenin
gene (Fig. 19), not the synergistic effect on the amelogenin gene as observed by
overexpressing C/EBPα and NF-Y (Fig. 4). Therefore, NF-Y and C/EBPβ are not
capable of activating the amelogenin gene to the wild-type level in C/EBPα
conditional knock-out mice. Hemotoxylin and eosin stained 3-day postnatal mouse
mandibles failed to show that enamel thickness was affected in C/EBPα conditional
knock-out mice compared to the enamel thickness observed in wild-type control
mice.
The amelogenin expression level in the C/EBPα conditional knock-out mice
suggests an alternative mechanism to circumvent the C/EBPα-mediated activation of
amelogenin expression. In searching for the potential candidate, C/EBPδ was
analyzed because C/EBPα and C/EBPδ share the same binding site to the promoter
(Osada et al., 1996b). Data demonstrate that C/EBPδ, like C/EBPα, is able to
activate the mouse amelogenin promoter (Fig. 20 and Fig. 21).
Immunohistochemistry for C/EBPδ protein revealed a nuclear localization of
ameloblast cells in the mandibular incisor (Fig. 22). The C/EBPδ mRNA level was
113
not significantly affected in these mice in which only the C/EBPα copy number
varied (P>0.05, Fig. 17C). The C/EBPδ expression level in mice in which there was
only one C/EBPα allele ("C/EBPα
+/−
") was 67-139% of that observed in wild-type
control mice, and the C/EBPδ expression level in mice with no C/EBPα allele
("C/EBPα
−/−
") was 72-144% of that observed in wild-type control mice (Table 2).
Taken together, these data suggest that C/EBPδ and C/EBPα may have functional
redundancy in the regulation of mouse amelogenin gene.
Here, I report on the generation of C/EBPα conditional knock-out mice, in
which C/EBPα alleles are specifically excised by Cre recombinase driven by the
K14 promoter. Real-time PCR analysis demonstrated a successful Cre-mediated
C/EBPα ablation in mouse ameloblast cell lineages in vivo. Amelogenin mRNA
levels were marginally decreased in C/EBPα heterozygous conditional knock-out
mice. However, amelogenin mRNA levels returned to the wild-type level in C/EBPα
homozygous conditional knock-out mice. This finding implies an existence of an
alternative pathway bypassing the C/EBPα-amelogenin axis and compensating for
the loss of C/EBPα. In search for other transcription factor(s) for induction of the
amelogenin gene, I identified C/EBPδ, like C/EBPα, demonstrated a similar potency
to activate the mouse amelogenin promoter, suggesting a functional redundancy
between C/EBPα and C/EBPδ. This functional redundancy aspect needs to be
addressed through the use of the chromatin immunoprecipitation technique to
114
investigate the in vivo interactions of C/EBPα and C/EBPδ on the amelogenin
promoter.
115
Summary
Enamel formation is a complex developmental process that is dependent
upon a series of reciprocal and instructive signals (Jernvall and Thesleff, 2000).
These signals culminate to orchestrate expression of the amelogenin gene, the major
organic component of enamel matrix in teeth (Eastoe, 1960; Paine and Snead, 2005).
Amelogenin plays a key role in regulating proper enamel mineralization (Gibson et
al., 2001; Paine et al., 2002). During enamel formation, amelogenin proteins are
secreted to the extracellular space by ameloblasts to form an organic supramolecular
structural framework where inorganic crystals are formed and oriented, while
proteolytic degradation of amelogenin leaves space for the progression of enamel
mineralization (Fincham et al., 1999). This process is dynamically regulated to
achieve a balance among concurrent processes of amelogenin expression, secretion,
degradation and crystal formation that are required for proper enamel
biomineralization (Paine et al., 2001; Robinson et al., 1998). Mutations to the human
amelogenin gene have been linked to patients with the inherited enamel defect X-
linked amelogenesis imperfecta (Lagerstrom et al., 1990).
An understanding if the complete repertoire of signals and cellular pathways
by which amelogenin is regulated, however, still remain vague. Several studies have
been performed to address the issue of amelogenin gene regulation. Previous
investigations using transgenic animals have demonstrated that the 2263 nucleotides
upstream of amelogenin start codon fully recapitulate the gene expression
116
spatiotemporally for the endogenous amelogenin profile (Snead et al., 1996).
CCAAT/Enhancer binding protein alpha (C/EBPα) is the first transcription factor
identified as a potent transactivator acting at the C/EBPα cis-element of mouse
amelogenin promoter (Zhou and Snead, 2000), while Msx2 is shown to act on
C/EBPα via a protein-protein interaction to inhibit C/EBPα transactivation (Zhou et
al., 2000).
Deletion analysis using mouse amelogenin promoter reporter construct
reveals that the -70/+52 bp minimal promoter bearing a C/EBPα binding site is
indispensable for maintaining transcriptional activity and C/EBPα-mediated
transactivation. Interestingly, this amelogenin minimal promoter also contains a
reversed CCAAT box located in the -58/-54 bp region, four base pairs downstream
to the C/EBPα binding site. Furthermore, this reversed CCAAT box located in the
proximal amelogenin promoter is highly conserved among species. Several
transcription factors are able to recognize the CCAAT box, such as CTF/NF1
(CCAAT Transcription Factor/Nuclear Factor 1) (Jones et al., 1985; Osada et al.,
1996a; Zorbas et al., 1992), CDP (CCAAT Displacement Protein) (Aufiero et al.,
1994; Barberis et al., 1987; Neufeld et al., 1992; Superti-Furga et al., 1988), C/EBP
(CCAAT/Enhancer Binding Protein) (Landschulz et al., 1988; Osada et al., 1996b;
Umek et al., 1991), and NF-Y (Nuclear Factor-Y) (Dorn et al., 1987). Among these
transcription factors, I regarded NF-Y as a leading candidate based on the following.
First, of all the potential CCAAT-binding proteins, only NF-Y has been shown to be
absolutely required for all CCAAT pentanucleotide bona fide sequences (Dorn et al.,
117
1987; Hatamochi et al., 1988; Hooft van Huijsduijnen et al., 1987; Kim and
Sheffery, 1990). Second, there is evidence showing that NF-Y cooperatively
interacts with C/EBPα to function in transcriptional regulation on a variety of
promoters (Milos and Zaret, 1992; Park et al., 2004; Zhu et al., 2004).
Electrophoresis mobility shift assay (EMSA) demonstrated that NF-Y was
able to bind to the reversed CCAAT box in the minimal amelogenin promoter. Co-
transfection of C/EBPα and NF-Y synergistically activated the mouse amelogenin
promoter. In contrast, increased expression of NF-Y alone had only marginal effects
on the promoter. A dominant-negative DNA binding-deficient NF-Y mutant (NF-
YAm29) dramatically decreased the promoter activity, both in the absence and
presence of exogenous expression of C/EBPα. Protein-protein interactions of NF-Y
with C/EBPα were also identified in ameloblast-like LS8 cells.
Eukaryotic gene expression is regulated by transcription factors that modulate
the frequency of transcriptional initiation. The activity of transcription factors is
regulated in a cell type, tissue specific, or cell cycle-dependent manner. Regulation
may also be mediated by interactions with other proteins. Different combinations of
regulatory mechanisms will ensure that eukaryotes orchestrate gene
activation/inactivation in accord with their cellular requirements (Johnson and
McKnight, 1989; Kadonaga, 1998; Latchman, 1990). To identify potential
transcriptional co-factors that interact with C/EBPα and also might participate in
regulating expression of amelogenin in ameloblast cell lineages, I performed a
protein/DNA array assay using nuclear extracts from control empty plasmid versus
118
C/EBPα transfected LS8 cells. By comparing data for transcription factors obtained
from cells treated in the absence or presence of exogenous C/EBPα, several
transcription factors were identified, including SP1, YY1, c-Myb, and TR (thyroid
hormone receptor). YY1 (Fig. 7) was regarded as a leading candidate because there
was a cognate YY1 cis-element proximal to the amelogenin minimal promoter.
Quantitative analysis of the boxed spots in Fig. 7 showed that there was 3.9-fold
increase in YY1 activity when C/EBPα proteins were over-expressed in LS8 cells.
YY1 was able to inhibit both basal amelogenin promoter activity and C/EBPα-
mediated transactivation. Interestingly, YY1 repression was independent of DNA-
binding, as demonstrated through the use of DNA-binding deficient mutant
YY1Δ334-414 and YY1S339/S342 constructs.
C/EBPα contains a basic-leucine zipper domain at C'-terminus, while the
amino-terminal domain, named the transactivation domain, is responsible for
transcriptional regulation. C/EBPα contains four highly conserved regions named
CR1, CR2, CR3 and CR4 (Erickson et al., 2001). I investigated the function of each
conserved region to contribute to the regulation of the mouse amelogenin promoter.
Transient transfection assays have shown that conserved region 2 (CR2) in isolation
exhibits exceptionally strong transactivation, even greater than the full length
C/EBPα. The remaining conserved regions, either in isolation or in selected
combinations, have little effects on the amelogenin promoter. Previous studies have
shown that Msx2 antagonizes C/EBPα-mediated transactivation on the mouse
amelogenin promoter through protein-protein interactions with C/EBPα (Zhou et al.,
119
2000). Furthermore, the C'-terminal residues 183-267 of Msx2 are required for
protein-protein interactions with C/EBPα, whereas the amino-terminal residues 2-97
of Msx2 play a less critical role. Here, using the co-immunoprecipitation assay, I
identified that the C'-terminal domain (residues 216-359) of C/EBPα was required
for the C/EBPα-Msx2 protein-protein interactions.
Post-translational modification of proteins, such as phosphorylation,
glycosylation, acetylation and methylation, has also been shown to play an important
role in regulating numerous protein functions. It has been reported that C/EBPα is
subject to phosphorylation by protein kinase C (Mahoney et al., 1992), and glycogen
synthase kinase 3 (Ross et al., 1999). C/EBPα has also been shown to be the target
for the small ubiquitin-related modifier (SUMO) (Kim et al., 2002a; Subramanian et
al., 2003), a member of an ubiquitin-like protein family that regulates various
physiologic functions of target proteins. My data shows that C/EBPα is subject, in
vitro, to sumoylation in ameloblast-like LS8 cells. Conjugation of SUMO-1 to
C/EBPα decreased C/EBPα-mediated amelogenin promoter transactivation, however
exogenous expressions of SUMO-1 by itself had no effect on the mouse amelogenin
promoter in LS8 cells. In addition, sumoylation alone did not affect the C/EBPα
cytoplasmic-nuclear transport in the ameloblast-like cell line.
Although several in vitro studies have demonstrated C/EBPα as being a
potent transactivator of mouse amelogenin gene, in vivo observations have yet to be
reported. The fact that C/EBPα-null mice do not survive beyond the first day after
birth prevents my observation on the effects of C/EBPα levels of amelogenin
120
expression during enamel formation. To circumvent this problem, the Cre/loxP
binary recombination system was used to determine the role of C/EBPα in
amelogenesis. Mice bearing only one copy of the C/EBPα allele ("C/EBPα
+/-
")
showed a significant decrease for endogenous C/EBPα expression in epithelial cells
from 3-day postnatal molars. Amelogenin was marginally reduced in these C/EBPα
heterozygous knock-out mice. However, amelogenin expression was restored to
wild-type levels in mice having lost both C/EBPα alleles. In addition to amelogenin
and C/EBPα, the expression levels for C/EBPβ and NF-YA were also examined in
mice bearing either one or no C/ΕΒPα alleles and revealed no significant change to
their mRNA levels when compared to wild-type mice. Using hemotoxylin and eosin
stained 3-day-postnatal mouse mandibles, I found no obvious difference in the
enamel thickness of conditional knock-out mice compared to wild-type controls.
These data imply the existence of an alternative pathway(s) to C/EBPα for the
activation of the amelogenin gene. I show that another C/EBP family member,
C/EBPδ, is able to activate the amelogenin gene, suggesting that there is functional
redundancy between C/EBPα and C/EBPδ in regulating the amelogenin gene.
It remains essential to enamel biomineralization to closely regulate the
amount of amelogenin protein available to direct hydroxyapatite crystallite habit.
Mineral formation and enamel protein assembly must be closely regulated to achieve
the longest crystals in the vertebrate body that comprise the hardest tissue, enamel.
Therefore, physiologic regulation of enamel gene expression is essential. I tried to
understand the molecular modulation of amelogenesis during tooth formation from
121
several approaches that converged on the C/EBPα axis. First, I identified that NF-Y
facilitated C/EBPα acting synergistically to activate the mouse amelogenin
promoter. Second, transcription factor YY1, repressed C/EBPα-mediated
transactivation. Third, detailed analysis of transactivation domains for C/EBPα
revealed that the CR2 domain in isolation showed an exceptionally strong
transactivation for the amelogenin promoter. Fourth, the C'-terminus (residues 216-
359) of C/EBPα was required for the protein interaction between C/EBPα and Msx2.
Fifth, sumoylation of C/EBPα contributed to the down-modulation of amelogenin
gene expression. Finally, in vivo observation of conditional knock-out mice implied
the existence of an alternative pathway for the activation of the amelogenin gene
circumventing the C/EBPα-amelogenin pathway previously characterized in vitro.
C/EBPδ probably accounts for this compensation. Each of these approaches has
enhanced our understanding for the physiologic modulation of amelogenin
expression during enamel formation.
We provide convincing in vitro data to demonstrate that C/EBPα, along with
other transcription factors including NF-Y, Msx2, and YY1, orchestrates mouse
amelogenin expression in ameloblast-like LS8 cells. The ultimate test for
understanding the regulatory role of C/EBPα in amelogenin induction is to
determine the amelogenin expression levels in C/EBPα knock-out mice. Here,
amelogenin mRNA levels are not significantly affected in C/EBPα homozygous
conditional knock-out mice, implying the existence of an alternative pathway for the
activation of the amelogenin gene. In a search for a potential candidate, C/EBPδ was
122
identified to strongly activate the mouse amelogenin promoter through binding to the
same cis-element that C/EBPα recognizes, suggesting a functional redundancy
between C/EBPα and C/EBPδ in the regulation of the mouse amelogenin gene. This
pathway will be better defined by utilizing the chromatin immunoprecipitation assay
since it provides more direct information for the in vivo interactions of C/EBPα and
C/EBPδ on the amelogenin promoter. Furthermore, it will be of great interest to
generate C/EBPα-C/EBPδ double knock-out mice and investigate how the
amelogenin expression levels are affected in those mice in the absence of both
C/EBPα and C/EBPδ transactivators.
With continuing accumulation of the knowledge of gene regulation in
ameloblasts, we may able to design strategies to direct in vitro enamel formation as a
natural restorative dental material that could be used to replace human dental enamel
lost to disease or congenital defect. A clinical application would be enamel
regeneration by using engineered ameloblast cells to create an enamel material
similar in size to the area surgically prepared by the dentist. We propose using the
ameloblast cells that are engaged in amelogenesis and by overdriving certain
transcription factors for induction of the amelogenin gene such as C/EBPα and/or
C/EBPδ, a natural biomineralized enamel could be created and then placed into the
surgical site by the dentist.
123
References:
Agre, P., Johnson, P. F., and McKnight, S. L. (1989). Cognate DNA binding
specificity retained after leucine zipper exchange between GCN4 and C/EBP.
Science 246, 922-926.
Akira, S., Isshiki, H., Sugita, T., Tanabe, O., Kinoshita, S., Nishio, Y., Nakajima, T.,
Hirano, T., and Kishimoto, T. (1990). A nuclear factor for IL-6 expression (NF-IL6)
is a member of a C/EBP family. Embo J 9, 1897-1906.
Aufiero, B., Neufeld, E. J., and Orkin, S. H. (1994). Sequence-specific DNA binding
of individual cut repeats of the human CCAAT displacement/cut homeodomain
protein. Proc Natl Acad Sci U S A 91, 7757-7761.
Austen, M., Cerni, C., Henriksson, M., Hilfenhaus, S., Luscher-Firzlaff, J. M.,
Menkel, A., Seelos, C., Sommer, A., and Luscher, B. (1997a). Regulation of cell
growth by the Myc-Max-Mad network: role of Mad proteins and YY1. Curr Top
Microbiol Immunol 224, 123-130.
Austen, M., Cerni, C., Luscher-Firzlaff, J. M., and Luscher, B. (1998). YY1 can
inhibit c-Myc function through a mechanism requiring DNA binding of YY1 but
neither its transactivation domain nor direct interaction with c-Myc. Oncogene 17,
511-520.
Austen, M., Luscher, B., and Luscher-Firzlaff, J. M. (1997b). Characterization of the
transcriptional regulator YY1. The bipartite transactivation domain is independent of
interaction with the TATA box-binding protein, transcription factor IIB, TAFII55, or
cAMP-responsive element-binding protein (CPB)-binding protein. J Biol Chem 272,
1709-1717.
Barberis, A., Superti-Furga, G., and Busslinger, M. (1987). Mutually exclusive
interaction of the CCAAT-binding factor and of a displacement protein with
overlapping sequences of a histone gene promoter. Cell 50, 347-359.
Bushmeyer, S., Park, K., and Atchison, M. L. (1995). Characterization of functional
domains within the multifunctional transcription factor, YY1. J Biol Chem 270,
30213-30220.
124
Bushmeyer, S. M., and Atchison, M. L. (1998). Identification of YY1 sequences
necessary for association with the nuclear matrix and for transcriptional repression
functions. J Cell Biochem 68, 484-499.
Cao, Z., Umek, R. M., and McKnight, S. L. (1991). Regulated expression of three
C/EBP isoforms during adipose conversion of 3T3-L1 cells. Genes Dev 5, 1538-
1552.
Charles, A., Tang, X., Crouch, E., Brody, J. S., and Xiao, Z. X. (2001).
Retinoblastoma protein complexes with C/EBP proteins and activates C/EBP-
mediated transcription. J Cell Biochem 83, 414-425.
Chen, P. L., Riley, D. J., Chen, Y., and Lee, W. H. (1996). Retinoblastoma protein
positively regulates terminal adipocyte differentiation through direct interaction with
C/EBPs. Genes Dev 10, 2794-2804.
Classon, M., Kennedy, B. K., Mulloy, R., and Harlow, E. (2000). Opposing roles of
pRB and p107 in adipocyte differentiation. Proc Natl Acad Sci U S A 97, 10826-
10831.
Cornelius, P., MacDougald, O. A., and Lane, M. D. (1994). Regulation of adipocyte
development. Annu Rev Nutr 14, 99-129.
Dorn, A., Bollekens, J., Staub, A., Benoist, C., and Mathis, D. (1987). A multiplicity
of CCAAT box-binding proteins. Cell 50, 863-872.
Eastoe, J. E. (1960). Organic matrix of tooth enamel. Nature 187, 411-412.
Erickson, R. L., Hemati, N., Ross, S. E., and MacDougald, O. A. (2001). p300
coactivates the adipogenic transcription factor CCAAT/enhancer- binding protein
alpha. J Biol Chem 276, 16348-16355.
Fincham, A. G., Moradian-Oldak, J., and Simmer, J. P. (1999). The structural
biology of the developing dental enamel matrix. J Struct Biol 126, 270-299.
125
Flodby, P., Barlow, C., Kylefjord, H., Ahrlund-Richter, L., and Xanthopoulos, K. G.
(1996). Increased hepatic cell proliferation and lung abnormalities in mice deficient
in CCAAT/enhancer binding protein alpha. J Biol Chem 271, 24753-24760.
Freytag, S. O., Paielli, D. L., and Gilbert, J. D. (1994). Ectopic expression of the
CCAAT/enhancer-binding protein alpha promotes the adipogenic program in a
variety of mouse fibroblastic cells. Genes Dev 8, 1654-1663.
Friedman, A. D., and McKnight, S. L. (1990). Identification of two polypeptide
segments of CCAAT/enhancer-binding protein required for transcriptional activation
of the serum albumin gene. Genes Dev 4, 1416-1426.
Galvin, K. M., and Shi, Y. (1997). Multiple mechanisms of transcriptional repression
by YY1. Mol Cell Biol 17, 3723-3732.
Gaston, K., and Fried, M. (1994). YY1 is involved in the regulation of the bi-
directional promoter of the Surf-1 and Surf-2 genes. FEBS Lett 347, 289-294.
Gibson, C. W., Yuan, Z. A., Hall, B., Longenecker, G., Chen, E., Thyagarajan, T.,
Sreenath, T., Wright, J. T., Decker, S., Piddington, R., et al. (2001). Amelogenin-
deficient mice display an amelogenesis imperfecta phenotype. J Biol Chem 276,
31871-31875.
Hahn, S. (1992). The Yin and the Yang of mammalian transcription. Curr Biol 2,
152-154.
Hariharan, N., Kelley, D. E., and Perry, R. P. (1991). Delta, a transcription factor
that binds to downstream elements in several polymerase II promoters, is a
functionally versatile zinc finger protein. Proc Natl Acad Sci U S A 88, 9799-9803.
Hatamochi, A., Golumbek, P. T., Van Schaftingen, E., and de Crombrugghe, B.
(1988). A CCAAT DNA binding factor consisting of two different components that
are both required for DNA binding. J Biol Chem 263, 5940-5947.
Hemati, N., Ross, S. E., Erickson, R. L., Groblewski, G. E., and MacDougald, O. A.
(1997). Signaling pathways through which insulin regulates CCAAT/enhancer
binding protein alpha (C/EBPalpha) phosphorylation and gene expression in 3T3-L1
126
adipocytes. Correlation with GLUT4 gene expression. J Biol Chem 272, 25913-
25919.
Hooft van Huijsduijnen, R. A., Bollekens, J., Dorn, A., Benoist, C., and Mathis, D.
(1987). Properties of a CCAAT box-binding protein. Nucleic Acids Res 15, 7265-
7282.
Hurst, H. C. (1995). Transcription factors 1: bZIP proteins. Protein Profile 2, 101-
168.
Jackson, S. M., Ericsson, J., Mantovani, R., and Edwards, P. A. (1998). Synergistic
activation of transcription by nuclear factor Y and sterol regulatory element binding
protein. J Lipid Res 39, 767-776.
Jacobs, S. B., Coss, D., McGillivray, S. M., and Mellon, P. L. (2003). Nuclear factor
Y and steroidogenic factor 1 physically and functionally interact to contribute to cell-
specific expression of the mouse Follicle-stimulating hormone-beta gene. Mol
Endocrinol 17, 1470-1483.
Jernvall, J., and Thesleff, I. (2000). Reiterative signaling and patterning during
mammalian tooth morphogenesis. Mech Dev 92, 19-29.
Johnson, P. F. (1993). Identification of C/EBP basic region residues involved in
DNA sequence recognition and half-site spacing preference. Mol Cell Biol 13, 6919-
6930.
Johnson, P. F., and McKnight, S. L. (1989). Eukaryotic transcriptional regulatory
proteins. Annu Rev Biochem 58, 799-839.
Jones, K. A., Yamamoto, K. R., and Tjian, R. (1985). Two distinct transcription
factors bind to the HSV thymidine kinase promoter in vitro. Cell 42, 559-572.
Kadonaga, J. T. (1998). Eukaryotic transcription: an interlaced network of
transcription factors and chromatin-modifying machines. Cell 92, 307-313.
Kim, C. G., and Sheffery, M. (1990). Physical characterization of the purified
CCAAT transcription factor, alpha-CP1. J Biol Chem 265, 13362-13369.
127
Kim, J., Cantwell, C. A., Johnson, P. F., Pfarr, C. M., and Williams, S. C. (2002a).
Transcriptional Activity of CCAAT/Enhancer-binding Proteins Is Controlled by a
Conserved Inhibitory Domain That Is a Target for Sumoylation. J Biol Chem 277,
38037-38044.
Kim, K. I., Baek, S. H., and Chung, C. H. (2002b). Versatile protein tag, SUMO: its
enzymology and biological function. J Cell Physiol 191, 257-268.
Kimura, T., Christoffels, V. M., Chowdhury, S., Iwase, K., Matsuzaki, H., Mori, M.,
Lamers, W. H., Darlington, G. J., and Takiguchi, M. (1998). Hypoglycemia-
associated hyperammonemia caused by impaired expression of ornithine cycle
enzyme genes in C/EBPalpha knockout mice. J Biol Chem 273, 27505-27510.
Lagerstrom, M., Dahl, N., Iselius, L., Backman, B., and Pettersson, U. (1990).
Mapping of the gene for X-linked amelogenesis imperfecta by linkage analysis. Am
J Hum Genet 46, 120-125.
Landschulz, W. H., Johnson, P. F., Adashi, E. Y., Graves, B. J., and McKnight, S. L.
(1988). Isolation of a recombinant copy of the gene encoding C/EBP. Genes Dev 2,
786-800.
Landschulz, W. H., Johnson, P. F., and McKnight, S. L. (1989). The DNA binding
domain of the rat liver nuclear protein C/EBP is bipartite. Science 243, 1681-1688.
Lane, M. D., Lin, F. T., MacDougald, O. A., and Vasseur-Cognet, M. (1996).
Control of adipocyte differentiation by CCAAT/enhancer binding protein alpha
(C/EBP alpha). Int J Obes Relat Metab Disord 20 Suppl 3, S91-96.
Latchman, D. S. (1990). Eukaryotic transcription factors. Biochem J 270, 281-289.
Lee, J. S., Galvin, K. M., and Shi, Y. (1993). Evidence for physical interaction
between the zinc-finger transcription factors YY1 and Sp1. Proc Natl Acad Sci U S
A 90, 6145-6149.
Lee, J. S., See, R. H., Galvin, K. M., Wang, J., and Shi, Y. (1995). Functional
interactions between YY1 and adenovirus E1A. Nucleic Acids Res 23, 925-931.
128
Lee, T. C., Zhang, Y., and Schwartz, R. J. (1994). Bifunctional transcriptional
properties of YY1 in regulating muscle actin and c-myc gene expression during
myogenesis. Oncogene 9, 1047-1052.
Lee, Y. H., Sauer, B., Johnson, P. F., and Gonzalez, F. J. (1997). Disruption of the
c/ebp alpha gene in adult mouse liver. Mol Cell Biol 17, 6014-6022.
Lewis, B. A., Tullis, G., Seto, E., Horikoshi, N., Weinmann, R., and Shenk, T.
(1995). Adenovirus E1A proteins interact with the cellular YY1 transcription factor.
J Virol 69, 1628-1636.
Li, M., Chiba, H., Warot, X., Messaddeq, N., Gerard, C., Chambon, P., and Metzger,
D. (2001). RXR-alpha ablation in skin keratinocytes results in alopecia and
epidermal alterations. Development 128, 675-688.
Li, W. W., Hsiung, Y., Zhou, Y., Roy, B., and Lee, A. S. (1997). Induction of the
mammalian GRP78/BiP gene by Ca2+ depletion and formation of aberrant proteins:
activation of the conserved stress-inducible grp core promoter element by the human
nuclear factor YY1. Mol Cell Biol 17, 54-60.
Lin, F. T., and Lane, M. D. (1992). Antisense CCAAT/enhancer-binding protein
RNA suppresses coordinate gene expression and triglyceride accumulation during
differentiation of 3T3- L1 preadipocytes. Genes Dev 6, 533-544.
Lin, F. T., and Lane, M. D. (1994). CCAAT/enhancer binding protein alpha is
sufficient to initiate the 3T3- L1 adipocyte differentiation program. Proc Natl Acad
Sci U S A 91, 8757-8761.
Linhart, H. G., Ishimura-Oka, K., DeMayo, F., Kibe, T., Repka, D., Poindexter, B.,
Bick, R. J., and Darlington, G. J. (2001). C/EBPalpha is required for differentiation
of white, but not brown, adipose tissue. Proc Natl Acad Sci U S A 98, 12532-12537.
MacDougald, O. A., Cornelius, P., Liu, R., and Lane, M. D. (1995). Insulin regulates
transcription of the CCAAT/enhancer binding protein (C/EBP) alpha, beta, and delta
genes in fully-differentiated 3T3-L1 adipocytes. J Biol Chem 270, 647-654.
MacDougald, O. A., and Lane, M. D. (1995). Transcriptional regulation of gene
expression during adipocyte differentiation. Annu Rev Biochem 64, 345-373.
129
MacKenzie, A., Ferguson, M. W., and Sharpe, P. T. (1992). Expression patterns of
the homeobox gene, Hox-8, in the mouse embryo suggest a role in specifying tooth
initiation and shape. Development 115, 403-420.
Mahajan, R., Delphin, C., Guan, T., Gerace, L., and Melchior, F. (1997). A small
ubiquitin-related polypeptide involved in targeting RanGAP1 to nuclear pore
complex protein RanBP2. Cell 88, 97-107.
Mahajan, R., Gerace, L., and Melchior, F. (1998). Molecular characterization of the
SUMO-1 modification of RanGAP1 and its role in nuclear envelope association. J
Cell Biol 140, 259-270.
Mahoney, C. W., Shuman, J., McKnight, S. L., Chen, H. C., and Huang, K. P.
(1992). Phosphorylation of CCAAT-enhancer binding protein by protein kinase C
attenuates site-selective DNA binding. J Biol Chem 267, 19396-19403.
Mantovani, R., Li, X. Y., Pessara, U., Hooft van Huisjduijnen, R., Benoist, C., and
Mathis, D. (1994). Dominant negative analogs of NF-YA. J Biol Chem 269, 20340-
20346.
Matunis, M. J., Coutavas, E., and Blobel, G. (1996). A novel ubiquitin-like
modification modulates the partitioning of the Ran-GTPase-activating protein
RanGAP1 between the cytosol and the nuclear pore complex. J Cell Biol 135, 1457-
1470.
Matunis, M. J., Wu, J., and Blobel, G. (1998). SUMO-1 modification and its role in
targeting the Ran GTPase-activating protein, RanGAP1, to the nuclear pore complex.
J Cell Biol 140, 499-509.
Matuoka, K., and Chen, K. Y. (2002). Transcriptional regulation of cellular ageing
by the CCAAT box-binding factor CBF/NF-Y. Ageing Res Rev 1, 639-651.
Matuoka, K., and Yu Chen, K. (1999). Nuclear factor Y (NF-Y) and cellular
senescence. Exp Cell Res 253, 365-371.
Milos, P. M., and Zaret, K. S. (1992). A ubiquitous factor is required for C/EBP-
related proteins to form stable transcription complexes on an albumin promoter
segment in vitro. Genes Dev 6, 991-1004.
130
Nerlov, C., and Ziff, E. B. (1994). Three levels of functional interaction determine
the activity of CCAAT/enhancer binding protein-alpha on the serum albumin
promoter. Genes Dev 8, 350-362.
Nerlov, C., and Ziff, E. B. (1995). CCAAT/enhancer binding protein-alpha amino
acid motifs with dual TBP and TFIIB binding ability co-operate to activate
transcription in both yeast and mammalian cells. Embo J 14, 4318-4328.
Neufeld, E. J., Skalnik, D. G., Lievens, P. M., and Orkin, S. H. (1992). Human
CCAAT displacement protein is homologous to the Drosophila homeoprotein, cut.
Nat Genet 1, 50-55.
Oelgeschlager, M., Nuchprayoon, I., Luscher, B., and Friedman, A. D. (1996).
C/EBP, c-Myb, and PU.1 cooperate to regulate the neutrophil elastase promoter. Mol
Cell Biol 16, 4717-4725.
Osada, S., Daimon, S., Nishihara, T., and Imagawa, M. (1996a). Identification of
DNA binding-site preferences for nuclear factor I-A. FEBS Lett 390, 44-46.
Osada, S., Yamamoto, H., Nishihara, T., and Imagawa, M. (1996b). DNA binding
specificity of the CCAAT/enhancer-binding protein transcription factor family. J
Biol Chem 271, 3891-3896.
Ossipow, V., Descombes, P., and Schibler, U. (1993). CCAAT/enhancer-binding
protein mRNA is translated into multiple proteins with different transcription
activation potentials. Proc Natl Acad Sci U S A 90, 8219-8223.
Paine, M. L., Lei, Y. P., Dickerson, K., and Snead, M. L. (2002). Altered amelogenin
self-assembly based on mutations observed in human X- linked amelogenesis
imperfecta (AIH1). J Biol Chem 277, 17112-17116.
Paine, M. L., and Snead, M. L. (2005). Tooth developmental biology: disruptions to
enamel-matrix assembly and its impact on biomineralization. Orthod Craniofac Res
8, 239-251.
Paine, M. L., White, S. N., Luo, W., Fong, H., Sarikaya, M., and Snead, M. L.
(2001). Regulated gene expression dictates enamel structure and tooth function.
Matrix Biol 20, 273-292.
131
Pan, Z., Hetherington, C. J., and Zhang, D. E. (1999). CCAAT/enhancer-binding
protein activates the CD14 promoter and mediates transforming growth factor beta
signaling in monocyte development. J Biol Chem 274, 23242-23248.
Park, S. K., Oh, S. Y., Lee, M. Y., Yoon, S., Kim, K. S., and Kim, J. W. (2004).
CCAAT/enhancer binding protein and nuclear factor-Y regulate adiponectin gene
expression in adipose tissue. Diabetes 53, 2757-2766.
Pei, D. Q., and Shih, C. H. (1991). An "attenuator domain" is sandwiched by two
distinct transactivation domains in the transcription factor C/EBP. Mol Cell Biol 11,
1480-1487.
Pisaneschi, G., Ceccotti, S., Falchetti, M. L., Fiumicino, S., Carnevali, F., and
Beccari, E. (1994). Characterization of FIII/YY1, a Xenopus laevis conserved zinc-
finger protein binding to the first exon of L1 and L14 ribosomal protein genes.
Biochem Biophys Res Commun 205, 1236-1242.
Ramji, D. P., and Foka, P. (2002). CCAAT/enhancer-binding proteins: structure,
function and regulation. Biochem J 365, 561-575.
Reith, W., Siegrist, C. A., Durand, B., Barras, E., and Mach, B. (1994). Function of
major histocompatibility complex class II promoters requires cooperative binding
between factors RFX and NF-Y. Proc Natl Acad Sci U S A 91, 554-558.
Robinson, C., Brookes, S. J., Shore, R. C., and Kirkham, J. (1998). The developing
enamel matrix: nature and function. Eur J Oral Sci 106 Suppl 1, 282-291.
Roman, C., Platero, J. S., Shuman, J., and Calame, K. (1990). Ig/EBP-1: a
ubiquitously expressed immunoglobulin enhancer binding protein that is similar to
C/EBP and heterodimerizes with C/EBP. Genes Dev 4, 1404-1415.
Ron, D., and Habener, J. F. (1992). CHOP, a novel developmentally regulated
nuclear protein that dimerizes with transcription factors C/EBP and LAP and
functions as a dominant-negative inhibitor of gene transcription. Genes Dev 6, 439-
453.
132
Ross, S. E., Erickson, R. L., Hemati, N., and MacDougald, O. A. (1999). Glycogen
synthase kinase 3 is an insulin-regulated C/EBPalpha kinase. Mol Cell Biol 19,
8433-8441.
Ross, S. E., Radomska, H. S., Wu, B., Zhang, P., Winnay, J. N., Bajnok, L., Wright,
W. S., Schaufele, F., Tenen, D. G., and MacDougald, O. A. (2004). Phosphorylation
of C/EBPalpha inhibits granulopoiesis. Mol Cell Biol 24, 675-686.
Satokata, I., Ma, L., Ohshima, H., Bei, M., Woo, I., Nishizawa, K., Maeda, T.,
Takano, Y., Uchiyama, M., Heaney, S., et al. (2000). Msx2 deficiency in mice
causes pleiotropic defects in bone growth and ectodermal organ formation. Nat
Genet 24, 391-395.
Sauer, B., and Henderson, N. (1988). Site-specific DNA recombination in
mammalian cells by the Cre recombinase of bacteriophage P1. Proc Natl Acad Sci U
S A 85, 5166-5170.
Scott, L. M., Civin, C. I., Rorth, P., and Friedman, A. D. (1992). A novel temporal
expression pattern of three C/EBP family members in differentiating
myelomonocytic cells. Blood 80, 1725-1735.
Seto, E., Lewis, B., and Shenk, T. (1993). Interaction between transcription factors
Sp1 and YY1. Nature 365, 462-464.
Shrivastava, A., and Calame, K. (1994). An analysis of genes regulated by the multi-
functional transcriptional regulator Yin Yang-1. Nucleic Acids Res 22, 5151-5155.
Shrivastava, A., Saleque, S., Kalpana, G. V., Artandi, S., Goff, S. P., and Calame, K.
(1993). Inhibition of transcriptional regulator Yin-Yang-1 by association with c-
Myc. Science 262, 1889-1892.
Slomiany, B. A., D'Arigo, K. L., Kelly, M. M., and Kurtz, D. T. (2000). C/EBPalpha
inhibits cell growth via direct repression of E2F-DP- mediated transcription. Mol
Cell Biol 20, 5986-5997.
Snead, M. L., Luo, W., Lau, E. C., and Slavkin, H. C. (1988). Spatial- and temporal-
restricted pattern for amelogenin gene expression during mouse molar tooth
organogenesis. Development 104, 77-85.
133
Snead, M. L., Paine, M. L., Chen, L. S., Luo, B. Y., Zhou, D. H., Lei, Y. P., Liu, Y.
H., and Maxson, R. E., Jr. (1996). The murine amelogenin promoter:
developmentally regulated expression in transgenic animals. Connect Tissue Res 35,
41-47.
Soriano, P. (1999). Generalized lacZ expression with the ROSA26 Cre reporter
strain. Nat Genet 21, 70-71.
Subramanian, L., Benson, M. D., and Iniguez-Lluhi, J. A. (2003). A synergy control
motif within the attenuator domain of CCAAT/enhancer-binding protein alpha
inhibits transcriptional synergy through its PIASy-enhanced modification by SUMO-
1 or SUMO-3. J Biol Chem 278, 9134-9141.
Sui, G., Affar el, B., Shi, Y., Brignone, C., Wall, N. R., Yin, P., Donohoe, M., Luke,
M. P., Calvo, D., Grossman, S. R., and Shi, Y. (2004). Yin Yang 1 is a negative
regulator of p53. Cell 117, 859-872.
Superti-Furga, G., Barberis, A., Schaffner, G., and Busslinger, M. (1988). The -117
mutation in Greek HPFH affects the binding of three nuclear factors to the CCAAT
region of the gamma-globin gene. Embo J 7, 3099-3107.
Tabata, M. J., Matsumura, T., Liu, J. G., Wakisaka, S., and Kurisu, K. (1996).
Expression of cytokeratin 14 in ameloblast-lineage cells of the developing tooth of
rat, both in vivo and in vitro. Arch Oral Biol 41, 1019-1027.
Tan, D. P., Nonaka, K., Nuckolls, G. H., Liu, Y. H., Maxson, R. E., Slavkin, H. C.,
and Shum, L. (2002). YY1 activates Msx2 gene independent of bone morphogenetic
protein signaling. Nucleic Acids Res 30, 1213-1223.
Thomas, M. J., and Seto, E. (1999). Unlocking the mechanisms of transcription
factor YY1: are chromatin modifying enzymes the key? Gene 236, 197-208.
Timchenko, N. A., Harris, T. E., Wilde, M., Bilyeu, T. A., Burgess-Beusse, B. L.,
Finegold, M. J., and Darlington, G. J. (1997). CCAAT/enhancer binding protein
alpha regulates p21 protein and hepatocyte proliferation in newborn mice. Mol Cell
Biol 17, 7353-7361.
134
Tomizawa, M., Garfield, S., Factor, V., and Xanthopoulos, K. G. (1998).
Hepatocytes deficient in CCAAT/enhancer binding protein alpha (C/EBP alpha)
exhibit both hepatocyte and biliary epithelial cell character. Biochem Biophys Res
Commun 249, 1-5.
Ueda, A., Takeshita, F., Yamashiro, S., and Yoshimura, T. (1998). Positive
regulation of the human macrophage stimulating protein gene transcription.
Identification of a new hepatocyte nuclear factor-4 (HNF-4) binding element and
evidence that indicates direct association between NF-Y and HNF-4. J Biol Chem
273, 19339-19347.
Umek, R. M., Friedman, A. D., and McKnight, S. L. (1991). CCAAT-enhancer
binding protein: a component of a differentiation switch. Science 251, 288-292.
Vinson, C. R., Sigler, P. B., and McKnight, S. L. (1989). Scissors-grip model for
DNA recognition by a family of leucine zipper proteins. Science 246, 911-916.
Wang, H., Iakova, P., Wilde, M., Welm, A., Goode, T., Roesler, W. J., and
Timchenko, N. A. (2001). C/EBPalpha arrests cell proliferation through direct
inhibition of Cdk2 and Cdk4. Mol Cell 8, 817-828.
Wang, N. D., Finegold, M. J., Bradley, A., Ou, C. N., Abdelsayed, S. V., Wilde, M.
D., Taylor, L. R., Wilson, D. R., and Darlington, G. J. (1995). Impaired energy
homeostasis in C/EBP alpha knockout mice. Science 269, 1108-1112.
Williams, S. C., Cantwell, C. A., and Johnson, P. F. (1991). A family of C/EBP-
related proteins capable of forming covalently linked leucine zipper dimers in vitro.
Genes Dev 5, 1553-1567.
Wright, K. L., Moore, T. L., Vilen, B. J., Brown, A. M., and Ting, J. P. (1995).
Major histocompatibility complex class II-associated invariant chain gene expression
is up-regulated by cooperative interactions of Sp1 and NF-Y. J Biol Chem 270,
20978-20986.
Yang, W. M., Inouye, C., Zeng, Y., Bearss, D., and Seto, E. (1996). Transcriptional
repression by YY1 is mediated by interaction with a mammalian homolog of the
yeast global regulator RPD3. Proc Natl Acad Sci U S A 93, 12845-12850.
135
Yoshida, H., Okada, T., Haze, K., Yanagi, H., Yura, T., Negishi, M., and Mori, K.
(2001). Endoplasmic reticulum stress-induced formation of transcription factor
complex ERSF including NF-Y (CBF) and activating transcription factors 6alpha
and 6beta that activates the mammalian unfolded protein response. Mol Cell Biol 21,
1239-1248.
Zhang, D. E., Zhang, P., Wang, N. D., Hetherington, C. J., Darlington, G. J., and
Tenen, D. G. (1997). Absence of granulocyte colony-stimulating factor signaling and
neutrophil development in CCAAT enhancer binding protein alpha-deficient mice.
Proc Natl Acad Sci U S A 94, 569-574.
Zhang, P., Iwama, A., Datta, M. W., Darlington, G. J., Link, D. C., and Tenen, D. G.
(1998). Upregulation of interleukin 6 and granulocyte colony-stimulating factor
receptors by transcription factor CCAAT enhancer binding protein alpha (C/EBP
alpha) is critical for granulopoiesis. J Exp Med 188, 1173-1184.
Zhou, Q., Gedrich, R. W., and Engel, D. A. (1995). Transcriptional repression of the
c-fos gene by YY1 is mediated by a direct interaction with ATF/CREB. J Virol 69,
4323-4330.
Zhou, Y. L., Lei, Y., and Snead, M. L. (2000). Functional antagonism between Msx2
and CCAAT/enhancer-binding protein alpha in regulating the mouse amelogenin
gene expression is mediated by protein-protein interaction. J Biol Chem 275, 29066-
29075.
Zhou, Y. L., and Snead, M. L. (2000). Identification of CCAAT/enhancer-binding
protein alpha as a transactivator of the mouse amelogenin gene. J Biol Chem 275,
12273-12280.
Zhu, J., Giannola, D. M., Zhang, Y., Rivera, A. J., and Emerson, S. G. (2003). NF-Y
cooperates with USF1/2 to induce the hematopoietic expression of HOXB4. Blood
102, 2420-2427.
Zhu, Q. S., Qian, B., and Levy, D. (2004). CCAAT/enhancer-binding protein alpha
(C/EBPalpha) activates transcription of the human microsomal epoxide hydrolase
gene (EPHX1) through the interaction with DNA-bound NF-Y. J Biol Chem 279,
29902-29910.
136
Zorbas, H., Rein, T., Krause, A., Hoffmann, K., and Winnacker, E. L. (1992).
Nuclear factor I (NF I) binds to an NF I-type site but not to the CCAAT site in the
human alpha-globin gene promoter. J Biol Chem 267, 8478-8484.

Abstract (if available)

Abstract Amelogenin gene expression is spatiotemporally regulated during enamel biomineralization. Studies show that C/EBP alpha is a transactivator of the mouse amelogenin gene acting at the C/EBP alpha cis-element located in the -70/+52 minimal promoter that also contains a reversed CCAAT box (-58/-54). Similar to the C/EBP alpha binding site, this CCAAT box is required for the basal promoter activity. Electrophoretic mobility shift assays demonstrate that NF-Y is directly bound to this reversed CCAAT box. Co-transfection of C/EBP alpha and NF-Y synergistically increases the promoter activity. Protein-protein interactions between C/EBP alpha with NF-Y are identified by a co-immunoprecipitation analysis.

Linked assets

University of Southern California Dissertations and Theses

Conceptually similar

PDF

Leucine-rich amelogenin peptide induces osteogenesis in mouse embryonic stem cells

PDF

Integrative analysis of gene expression and phenotype data

PDF

Enamelysin (MMP20) and Kallikrein 4 (KLK4) functions during enamel formation

PDF

Transcriptional co-activation functions of Msx homeodomain proteins by activating Hsf proteins

PDF

The function of TGF-beta signaling in palatal and dental epithelium during embryogenesis

PDF

CCNL1, EWS, TFIP11, and RNA splicing

PDF

A Western blot analysis and immunohistochemical study of 4-day old mice teeth over-expressing amelotin during amelogenesis

PDF

The effect of leucine-rich amelogenin peptide on mouse bone density by histological analysis

PDF

Global analysis of the molecular activities defining maturation-stage amelogenesis

PDF

The role of parathyroid hormone-related protein in regulating neonatal lung development

PDF

Dynamics of amelogenin self-assembly during in vitro proteolysis by Mmp-20

PDF

Amelogenin-ameloblastin protein interaction and function in dental enamel formation

PDF

Non-canonical Tgf-beta signaling in craniofacial development

PDF

Alk5 mediated TGF-β signaling acts upstream of FGF10 to regulate the proliferation and maintenance of dental epithelial stem cells

PDF

Amelogenin peptides for biomimetic remineralization of enamel and dentin

PDF

TGF-β signaling regulates gingival epithelial wound healing and barrier function

PDF

A novel role for hypoxia-inducible factor-1alpha (HIF-1alpha) in the regulation of inflammatory chemokines and leukotriene expression in sickle cell disease

PDF

Protein arginine methyltransferases in murine skull development

PDF

Extracellular heat shock protein-90alpha (eHsp90α): mechanisms of secretion, quantitation and function

PDF

The role of Wnt signaling in organogenesis: limb and lung

Asset Metadata

Creator Xu, Yucheng (author)

Core Title Modulation of C/EBP alpha in the regulation of mouse amelogenin transcription during tooth formation

School School of Dentistry

Degree Doctor of Philosophy

Degree Program Craniofacial Biology

Publication Date 10/05/2006

Defense Date 08/04/2006

Publisher University of Southern California (original), University of Southern California. Libraries (digital)

Tag amelogenin,C/EBP alpha,gene regulation,OAI-PMH Harvest

Language English

Advisor Snead, Malcolm L. (committee chair), Ann, David K. (committee member), Paine, Michael (committee member), Shuler, Charles F. (committee member), Sucov, Henry (committee member)

Creator Email yuchengx@usc.edu

Permanent Link (DOI) https://doi.org/10.25549/usctheses-m83

Unique identifier UC1143720

Identifier etd-Xu-20061005 (filename),usctheses-m40 (legacy collection record id),usctheses-c127-16671 (legacy record id),usctheses-m83 (legacy record id)

Legacy Identifier etd-Xu-20061005.pdf

Dmrecord 16671

Document Type Dissertation

Rights Xu, Yucheng

Type texts

Source University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Repository Name Libraries, University of Southern California

Repository Location Los Angeles, California

Repository Email cisadmin@lib.usc.edu