University of Southern California Dissertations and Theses

Canonical and non-canonical Wnt signaling in the patterning of multipotent stem cells during feather development

(USC Thesis Other)

Canonical and non-canonical Wnt signaling in the patterning of multipotent stem cells during feather development

PDF

Download a page range

Download transcript

Copy asset link

Request this asset

Transcript (if available)

Content

CANONICAL AND NON-CANONICAL WNT SIGNALING IN THE PATTERNING

OF MULTIPOTENT STEM CELLS DURING FEATHER DEVELOPMENT

by

Cathleen Tsz Ka Chiu

A Thesis Presented to the
FACULTY OF THE GRADUATE SCHOOL
UNIVERSITY OF SOUTHERN CALIFORNIA
In Partial Fulfillment of the
Requirements for the Degree
MASTER OF SCIENCE
(EXPERIMENTAL AND MOLECULAR PATHOLOGY)

August 2008

Copyright 2008 Cathleen Tsz Ka Chiu
ii
Table of Contents

List of Figures iii
Abstract iv
A. Introduction 1
B. Materials and Methods 10
C. Results
1. Interaction of β-catenin with CBP 14
2. Interaction of β-catenin with p300 16
3. Characterization of the phenotype 18
4. Verification of the effectiveness of the β-catenin inhibitors 26
5. Myc overexpression 27
6. Cloning of PCP genes 28
7. Expression and localization of PCP gene expression 29
a. Table 1: PCR primers 29
D. Discussion
1. β-catenin inhibition perturbs normal feather bud development 35
2. Myc overexpression affects organ size 38
3. PCP in feather bud development 39
4. Future direction 39
E. References 41
iii
List of Figures

Figure 1: Embryonic feather bud development 2

Figure 2: IQ-1 treatment dose curve 15

Figure 3: IQ-1 treatment withdrawal 16

Figure 4: ICG-001 treatment dose curve 17

Figure 5: ICG-001 treatment withdrawal 18

Figure 6: Whole mount in situ hybridization of skin explants 19

Figure 7: SHH in situ hybridization of sectioned skin explants 20

Figure 8: β-catenin in situ hybridization of sectioned skin explants 21

Figure 9: NCAM immunostaining of sectioned skin explants 22

Figure 10: Tenascin-C immunostaining of sectioned skin explants 23

Figure 11: PCNA immunostaining of sectioned skin explants 24

Figure 12: BrdU staining of sectioned skin explants 25

Figure 13: CBP immunostaining of sectioned skin explants 27

Figure 14: RCAS Myc feather phenotype 28

Figure 15: Semi-quantitative PCR of PCP genes 30

Figure 16: Whole mount Dsh1 in situ hybridization 31

Figure 17: Whole mount Dsh3 in situ hybridization 33

Figure 18: Whole mount Stbm in situ hybridization 34

iv
ABSTRACT
The formation of complex ectodermal organs begins with multipotent stem cells
that undergo many basic cellular events. During the formation of a complex organ, there
are many factors that need to be considered such as patterning, size, and shape in order to
maintain proper organ function. Feather development is a good model. The feather field
must be patterned to establish how many feathers, the size must be determined, and the
shape of the feather must be appropriate for its function. Canonical and non-canonical
Wnt signaling has been implicated in many crucial steps in feather bud development.
Canonical Wnt signaling involves the stabilization and accumulation of β-catenin,
which is subsequently translocated to the nucleus. There, β-catenin interacts with various
coactivators including CREB-binding protein (CBP) and p300, which results in the
expression of different genes downstream of β-catenin/TCF that may direct cells towards
a path of pluripotency or differentiation. One of the genes downstream of β-catenin/p300
interaction is Myc. Myc activation has been shown to deplete epidermal stem cells and
has been found to be important in the regulation of cell growth and cell size. The last
consideration of shape can be addressed by non-canonical Wnt signaling. Planar cell
polarity (PCP) genes have been identified in Drosophila to be important for establishing
polarity in various processes, including hair follicle orientation.
Through perturbation of normal embryonic chicken dorsal skin explant, it has
been found that β-catenin interaction with p300 is indispensable for proper development
of feather buds, Myc activation results in enlargement of forming feather buds, and PCP
genes have great potential for involvement in polarity.

1
INTRODUCTION
Every great masterpiece begins with a blank canvas. In the formation of complex
ectodermal organs, it is a canvas of multipotent stem cells. To explore the developmental
demands in the regeneration of such an organ, the obvious place to start is in
development. In the chicken, the feather field likewise begins as a blank canvas
composed of multipotent cells. During early stages of feather bud development, the
multipotent cells of the pteric regions have the potential to assume one of two fates – bud
and interbud. As development continues, the bud and interbud regions become more
sophisticated and the number of cell types understandably increases to form the very
complex ectodermal organ, the feather.
The formation of these complex ectodermal organs begins with very basic cellular
events – adhesion, migration, proliferation, and differentiation. Feather development
begins with induction of competency in the field, which leads to the formation of dermal
condensations. Changes in adhesion and migration of the cells are responsible for the
formation of dermal condensations, which establishes the feather pattern in the field. In
response to other signals, the condensations develop into short buds. As the buds
elongate, anterior-posterior (A-P) and proximal-distal (P-D) asymmetries are established
and marked molecular heterogeneity can be observed (Fig. 1) (Lin, Jiang, Widelitz, &
Chuong, 2006). One family of molecules that play an integral role in all the steps of
embryonic feather bud development is the Wnt family.

2
Figure 1: Embryonic feather bud development

The history of the Wnt family can be traced back to the wingless (Wg) gene, a
segment polarity gene that was first discovered in Drosophila melanogaster, and Int-1, a
protooncogene discovered to be activated in response to a mouse mammary tumor virus
(Siegfried & Perrimon, 1994). The homology found between Int-1 and wingless resulted
in a combination of the names to form Wnt. Many Wnts have since been characterized in
skin morphogenesis to have a profound role, both positive and negative, in the formation
of the dermis, establishment of feather tracts and interbud spacing, and regulating the
growth and shape of individual feather buds (Chang et al., 2004).
Members of the Wnt family signal through Frizzled (Fz) family transmembrane
receptors, a subset of which is important for the stabilization of cytoplasmic β-catenin. β-
catenin can associate with adhesion molecules in the cell membrane, such as cadherins,
and function in intercellular adhesion (Nagafuchi & Takeichi, 1988). Uncommitted β-
catenin located in the cytoplasm are targeted for degradation through the ubiquitin-
proteasome pathway after phosphorylation by GSK-3 β. Once ligands, such as Wnts, bind
to the frizzled receptors, cytoplasmic β-catenin degradation is inhibited. This results in
the accumulation and translocation of the cytoplasmic β-catenin to the nucleus where it
3
binds to transcript factors of the T-cell factor/lymphoid enhancer binding factor-1
(TCF/Lef-1) family and effects gene expression downstream.
β-catenin is one of the earliest skin morphogenesis markers, appearing prior to the
formation of feather placodes. Uniform distribution of β-catenin in the feather field is
followed by restrictive expression during the formation of various skin appendages
(Widelitz, Jiang, Lu, & Chuong, 2000). The regulation of β-catenin protein can be
attributed to transcriptional regulation as well as post-translational mechanisms. The
increase and decrease of β-catenin mRNA expression in response to activators and
inhibitors of feather morphogenesis emphasizes the importance of β-catenin in feather
bud morphogenesis. The mediation of periodic patterning by the aforementioned
molecules suggests that skin appendage morphogenesis may be dependent upon a critical
threshold of β-catenin.
Stem cell studies have shown that Wnt/ β-catenin signaling is necessary for the
maintenance of pluripotency and the expansion of progenitors. In addition, Wnt/ β-
catenin signaling is also involved in neural differentiation of embryonic stem cells
(ESCs) and neural stem cells (Miyabayashi et al., 2007; Otero, Fu, Kan, Cuadra, &
Kessler, 2004). The contrasting events resulting from the activation of Wnt/ β-catenin
signaling has been attributed to the interaction of β-catenin with different cofactors.
Studies to identify cofactors that facilitate the positive effect of β-catenin on transcription
revealed a role for nuclear histone acetyltransferases (HATs), specifically CREB-binding
protein (CBP) and adenoviral transforming protein E1A-associated p300. Nuclear HATs
catalyze reversible acetylation of histones in order to bypass chromatin-mediated
promoter inhibition by loosening the chromatin structure.
4
The histone acetyltransferases, CBP and p300, are global regulators of
transcription. While there is significant homology between the two HATs, they are not
identical (Arany, Sellers, Livingston, & Eckner, 1994). They function by linking various
transcription factors to the basal transcription machinery in response to developmental or
extracellular cues (Goldman, Tran, & Goodman, 1997; Shiama, 1997). β-catenin directly
interacts with CBP and p300 at multiple contact points within the C-terminal region,
residues 630-781 (Hecht, Vleminckx, Stemmler, van Roy, & Kemler, 2000). Other
residues within the C-terminus that do not interact with CBP and p300 may act as
transactivating elements (Hecht, Litterst, Huber, & Kemler, 1999).
p300 and CBP are promoter-specific coactivators of β-catenin and their
stimulatory effect on their respective genes require the presence of a β-catenin/TCF
complex (Hecht et al., 1999). Studies have shown that the interaction of β-catenin with
CBP mediates cell proliferation without differentiation while the interaction of β-catenin
with p300 initiates differentiation (Miyabayashi et al., 2007). This was demonstrated by
the use of small molecule inhibitors developed by Dr. Michael Kahn that disrupt the β-
catenin/CBP and β-catenin/p300 interaction independently (Emami et al., 2004;
Miyabayashi et al., 2007).
IQ-1, a small molecule inhibitor of β-catenin/p300 interaction, imposes its
negative effect in two ways. First, IQ-1 binds to the PR72/130 subunit of PP2A, a
serine/threonine phosphatase than can form a complex with Naked cuticle (Nkd)
(Miyabayashi et al., 2007). Nkd is a protein that negatively regulates the canonical
Wnt/ β-catenin signaling pathway (Zeng et al., 2000). Secondly, it disrupts the
phosphorylation of p300 Ser-89, a residue important in enhancing the affinity of β-
5
catenin to p300 (Miyabayashi et al., 2007). Thus, the overall effect is a decrease in β-
catenin/p300 interaction and an increase in β-catenin/CBP interaction. The disruption of
the interactions demonstrated that the proliferative state lacking differentiation, a result of
increased β-catenin/CBP interaction, led to increased expression of Oct4 and Sox2, two
known stem/progenitor markers.
The other small molecule inhibitor, ICG-001, inhibits β-catenin interaction with
CBP. ICG-001 disrupts this interaction by binding specifically to CBP. The disruption
also leads to the down-regulation of the expression of a subset of TCF/ β-catenin
transcriptional events and, consequently, important downstream genes involved in cell
proliferation, differentiation, and homeostasis (Emami et al., 2004). One of the
downstream genes that is expressed as a result of β-catenin/p300 interaction is Myc.
MYC (myelocytomatosis oncogene) is a protooncogene involved in directing
proliferation, growth, differentiation, and apoptosis. A helix-loop-helix leucine zipper
protein (bHLH-ZIP), Myc binds to E-boxes (CACGTG) when dimerized with MAX
(Luscher & Eisenman, 1990). MYC-MAX activity is antagonized by MAD or MNT,
which also heterodimerize with MAX, and act on enlisting histone deacetylase complexes
(Gallant, 2006). MYC is positively enforced by chromatin remodeling complexes that
activate gene expression.
Fluorescent immunohistochemical analysis of c-Myc performed on normal Gallus
gallus embryos has shown that c-Myc protein present in the ectoderm at early stages
practically disappears by embryonic day 6 but appears in ectodermal nuclei at E6.5 in
ectodermal areas concurrent with positive mesodermal areas (Jaffredo, Vandenbunder, &
Dieterlen-Lievre, 1989). c-Myc can be observed strongly in groups of mesodermal cells
6
where feather buds will form. This same pattern is also true for c-myc mRNA in the
spinal pteryla at E8. c-Myc reappearance progress in accordance with the spatial
sequence of feather bud formation. In pteric regions, c-Myc is often positive in the
mesoderm and weak in the ectoderm while in apteric regions, it is positive in the
ectoderm. In formed feather, however, c-Myc is located in the pulp (Jaffredo et al.,
1989). c-Myc transcripts first appear in the epidermal placode during the formation of
dermal condensations. Transcripts do not appear in the dermis until the onset of
asymmetrical feather outgrowth, specifically localized in the apical region of the
outgrowth (Desbiens, Queva, Jaffredo, Stehelin, & Vandenbunder, 1991).
Feathers undergo cycling as hairs do. The loss of a feather results in the
regeneration of a similar appendage. The regenerative ability is maintained by
multipotent stem cells. A multipotent stem cell is able to undergo asymmetrical division
to self-renew and to produce daughter cells that can undergo differentiation along
different lineages (Jones & Watt, 1993). A daughter cell that is destined for terminal
differentiation can actively cycle to increase the number of differentiated cells before
withdrawing from the cell cycle, thus earning them the name of “transit-amplifying”
(TA) cells (Arnold & Watt, 2001). TA cells are restricted to specific cell lineages and
have predetermined futures when they undergo terminal differentiation.
It has been demonstrated in mouse epidermis that c-Myc is involved in driving the
transition of cells from the stem cell compartment into the transit-amplifying
compartment. This exit is followed by a few rounds of cell division before initiation of
terminal differentiation (Arnold & Watt, 2001; Gandarillas & Watt, 1997). Stimulation
of differentiation is restricted to epidermal and sebaceous lineages (Arnold & Watt,
7
2001). The depletion of the epidermal stem cell compartment in mice is due in part to
modulations in the adhesive interactions with the local microenvironment (Waikel,
Kawachi, Waikel, Wang, & Roop, 2001). In vivo studies of the induction of c-Myc
expression in epidermal stem cells showed a repression of integrin expression,
specifically β1 integrin expression (Waikel et al., 2001). Integrins are cell surface
molecules involved in keratinocyte migration and cell attachment. High surface
expression of β1 integrins and a rapid adhesion to extracellular matrix (ECM) proteins
characterize keratinocytes with stem cell characteristic while proliferation and slow
adhesion characterize TA cell (Jones & Watt, 1993). Thus, it has been suggested that the
loss of stem cells in Myc-induced mice may be due to a reduction of cell adherence to
stem cell niches within the epidermis and hair follicles (Frye, Gardner, Li, Arnold, &
Watt, 2003; Waikel et al., 2001; Watt & Hogan, 2000).
In mammalian epidermis, Myc also has an important role in cellular growth.
Kockout studies in vivo have shown that mice lacking endogenous Myc exhibit reduced
keratinocyte cell size and growth, premature differentiation, and impaired stem cell
amplification (Zanet et al., 2005). Induction of Myc in vitro leads to an increase in DNA
replication in the absence of cell division, also known as endoreplication, and cell size
following ectopic Myc expression (Gandarillas, Davies, & Blanchard, 2000). It can
therefore be suggested that Myc may play a role in establishing organ size.
Following determination of identity and size, the next issue to be considered
during the formation of an organ is shape. As mentioned earlier, canonical Wnt signaling
consists of Frizzled family members binding Wnt ligands to mediate a signal that
regulates β-catenin levels and activates TCF/Lef transcription factors in the nucleus.
8
There also exists a non-canonical pathway that acts through new molecules foreign to the
canonical pathway. The Wnt signal by way of Fz is transduced through Dishevelled
(Dsh). The divergence occurs at Dsh with the canonical pathway progressing through β-
catenin and TCF/Lef activity while the non-canonical pathway involves planar cell
polarity (PCP) genes (Fanto & McNeill, 2004). While the non-canonical, PCP pathway
is very similar between Drosophila and vertebrates, there is one key difference – the
involvement of Wnts. There is as yet no evidence for a direct role for Wnt molecules in
PCP signaling in Drosophila. However, in vertebrates, there is a discernible difference in
Wnts that function in the canonical pathway and Wnts that function in the non-canonical
pathway. For example, Wnt5a and Wnt11 have been found to be important in PCP
signaling (Heisenberg et al., 2000).
Though the non-canonical pathway is separate from the canonical pathway, the
pathways are not mutually exclusive; there is in fact much crosstalk. Some genes have
similar effects on both pathways while others have opposite effects. Previously
mentioned Nkd, which is able to negatively regulate canonical Wnt/ β-catenin signaling,
can also interfere with PCP (Rousset et al., 2001). Alternatively, other genes that
promote canonical Wnt signaling, such as casein kinase I ε, negatively regulate PCP
(Saburi & McNeill, 2005).
In recent years, the importance of PCP has become very obvious. PCP genes
have been defined as genes involved in governing cell and tissue movements and patterns
in both vertebrates and invertebrates. Consequently, PCP processes include any process
that affects cell polarity within an epithelial plane and involves one or more of the core
PCP genes. Processes include but are not limited to convergent extension, neural tube
9
closure, hair follicle orientation, and hair bundle orientation of inner ear sensory cells
(Wang & Nathans, 2007).
Polarization is a quality intrinsic to all cells that grow and is an indispensable part
of tissue organization. Its involvement can be seen in the earliest of cell divisions,
playing a part in the polarized localization of cell fate determinants. Proper spindle
orientation, which also depends on polarization, is necessary for correct segregation of
these determinants. Failing to do so may result in tumor formation, suggesting a
connection between cell polarity pathways and tumor suppression. Drosophila studies
have also shown a relationship between intracellular cell polarity, intercellular adhesion,
and organ polarity (Lee & Vasioukhin, 2008).
PCP genes were first identified in Drosophila as acting in two distinct stages.
First, a global planar polarity is established by genes such as four-jointed (Fj), Dachsous
(Ds), Atrophin (atro), Widerborst (Wbd), and Fat (Ft). This global planar polarity
asymmetrically localizes a subsequent set of cell-surface proteins that includes Fz, Dsh,
Flamingo/starry night (Fmi, Stan), Strabismus/Van Gogh (Stbm/Vang), prickle (Pk) and
diego (Dgo) (Klein & Mlodzik, 2005; Tree, Ma, & Axelrod, 2002). The two stages may
function in series or in parallel (Wang & Nathans, 2007). While each gene mainly exerts
its effect cell-autonomously, mutant studies in Drosophila have shown that some genes
exhibit “domineering non-autonomy” and effect adjacent, wild-type cells (Karner,
Wharton, & Carroll, 2006; Strutt & Strutt, 2002). Therefore, the proteins can interact
with each other directly or indirectly and in cis (on the surface of the same cell) or in
trans (with a protein on the surface of a neighboring cell) (Wang & Nathans, 2007).
10
The asymmetric distribution of the PCP proteins in Drosophila has been clearly
defined with Fmi, Dgo, Fz, and Dsh localizing distally and Stbm and Pk localizing
proximally (Wang & Nathans, 2007). Based on studies of hair cells in Drosophila, PCP
genes are great candidates for establishing the polarity of feather buds that are currently
unexplored.
Studies of canonical and non-canonical Wnt signaling have revealed some of their
importance in the formation of ectodermal organs. The feather field presents an ideal
system for study because it is readily available, it is easily manipulated, both surgically
and molecularly, and the innate growth gradient allows for effortless observation of many
stages of development in the same field. In this study, I will seek to elucidate the
difference between β-catenin interaction with CBP compared to p300 in feather bud
formation and its role in determining the exit of cells from a stem cell status, the role of
Myc in regulating the exit of cells from the stem cell niche and establishing organ size,
and the possible involvement of PCP genes in resolving the issue of polarity during the
organization of developing feather buds.
MATERIALS AND METHODS
Primer Design. Gene sequence retrieved from EMBL nucleotide sequence
database. MRNA sequence used when possible, but when not available, cDNA sequence
was used. Sequence within a single coding sequence was submitted to web-based PCR
design program, Primer3. Parameters of 20nt, 40-60% GC content, and product size of
600-1000nt were used. The specificity of the generated primers were analyzed with the
basic local alignment search tool (BLAST) available on the National Center for
11
Biotechnology Information (NCBI) website. Primers without >70% homology to a gene
other than the gene of interest were used.
RT-PCR. Dorsal skin samples were peeled and collected from chicken embryos
of various stages – from E7 to E14. RNA was extracted with the QIAGEN RNA Mini
Kit. cDNA was generated using the extracted RNA and the Invitrogen Superscript III
RT-PCR kit.
Probes. Gene products of around 800bp were cloned out of chicken embryo
cDNA. PCR products were ligated into the pDrive vector and transformed into
competent DH5 α E. coli cells. Transformed cells were plated and selected for on
ampicillin LB agar plates. The vectors were amplified in LB liquid culture and isolated
with a QIAGEN MaxiPrep kit. Vectors were digested with appropriate restriction
enzymes and probe were transcribed with appropriate RNA polymerases, T7 and SP6, to
obtain the proper antisense probe, and labeled with digoxigenin.
Culturing Chicken Embryonic Fibroblasts (CEFs). E7 chicken embryos were
collected and the head, limbs, and internal organs were removed. The remaining tissue
was sheared with forceps and trypsinized with trypsin and EDTA. The disassociated
cells were then plated on 100mm plates and cultures in DMEM with 10% fetal bovine
serum (FBS), and 2% chicken serum (CS).
Transfection of Chicken Embryonic Fibroblasts. 80-90% confluent plates of
CEFs were passaged 1:4 and incubated overnight at 37ºC before transfection with RCAS
and RCAS cMyc plasmids, separately. DNA was precipitated with 250mM CaCl
2
and
2X HeBS and incubated on the plated CEFs for 4 hours. The fibroblasts are then briefly
12
treated with 15% glycerol, washed with PBS, and incubated overnight at 37ºC in DMEM
with 10% FBS, and 2% CS.
Virus Collection. Once RCAS and RCAS cMyc transfected cells reached 90%
confluence, the cells were passaged 1:4 with a restrictive media consisting of DMEM
with 1% FBS, 0.2% CS, and 1:1000 gentamycin. After 24 hours, the media is collected
and filtered through syringe filters with 0.45 μm pores and stored in 1mL aliquots at –
80ºC until use. Media is replaced with more restrictive media and virus is collected for
up to 5 days.
Virus Injection. 1mL of aliquoted virus is thawed briefly at 37ºC and centrifuged
at maximum speed at 4ºC for 30 minutes. 900 μL is aspirated off the top and the
remaining 100 μL is mixed with 10 μL Trypan Blue. Volumes of 3 to 8 μL were injected
into the cavity adjacent to the E3 chicken embryo.
β-catenin Inhibitor Treatment. The small molecule inhibitors IQ-1 and ICG-001
were dissolved in DMSO at a concentration of 100mM. The concentrated stock was
diluted in DMEM with 10% FBS and 2% CS to make 100 μM working stocks. At the
time of skin explant and treatment, the working stocks are then applied directly to the
culture media in which the skin explants are cultured to produce the appropriate final
concentrations (1.25 μM, 2.5 μM, 5.0 μM, 10 μM, 20 μM, and 40 μM).
Sample Processing. Whole mount samples were collected in RNase-free
phosphate-buffered saline (PBS), fixed with 4% paraformaldehyde (PFA) at 4ºC
overnight, and then subsequently dehydrated through a methanol gradient. Dehydrated
samples were stored at –20ºC. Samples to be sectioned were collected, fixed, dehydrated
13
through an ethanol gradient, cleared in xylene, and embedded in paraffin. 6 μm sections
were collected on glass slides.
In situ Hybridization (ISH). Collected whole mount and sectioned samples are
rehydrated through methanol and ethanol gradients, respectively. Following bleaching
with 6% H
2
O
2
in PBS with 0.1% Tween 20 (PBT), 20 μg/mL Proteinase K treatment,
post-fixation in a 4% PFA and 0.25% glutaraldehyde incubation, and normalization of the
tissue in hybridization buffer, the digoxigenin-labeled probe is applied at 65ºC overnight.
The samples then undergo 2X SSC (300mM NaCl and 30mM sodium citrate) and 0.2X
SSC washes before being pre-blocked with 10% goat serum (GS) that had been heat
inactivated at 65ºC. Then antibody to detect digoxigenin is applied at 4ºC overnight.
The samples are then washed in PBT containing 0.5mg/mL levamisole followed by
NTMT (100mM NaCl, 100mM Tris-HCl, 50mM MgCl, and 0.1% Tween 20) washes
containing 0.5mg/mL levamisole. For visualization, color is developed with NBT/BCIP
chromogen substrate until desired color intensity.
Immunohistochemistry (IHC). Collected sectioned samples are rehydrated
through an ethanol gradient and endogenous peroxidase is blocked with 0.6% H
2
O
2

diluted in methanol. When necessary, antigen retrieval is performed by submerging the
sectioned samples in 10mM citrate buffer (pH 6.0), heated to just below boiling, and
allowed to cool to room temperature. 20% GS diluted in PBT is then used to pre-block
before primary antibody against the desired antigen is applied at 4ºC overnight. A biotin-
linked secondary antibody is then applied for 1 hour followed by application of
streptavidin-horseradish peroxidase for 30 minutes at room temperature. Visualization is
achieved with aminoethylcarbazole (AEC) or Nova Red Substrate (Vector Laboratories).
14
RESULTS
Interaction of β-catenin with CBP
To investigate the interaction of β-catenin with CBP, the small molecule inhibitor,
IQ-1, was used to treat chicken explant organs. A dose response curve was performed
and compared to a control sample treated solely with the drug vehicle, DMSO (Fig. 2).
Control cultures in the presence of DMSO developed normally (Fig. 2a-e). In the
presence of IQ-1, a perturbation of normal bud development could be observed. The
effects of IQ-1 were found to be dose dependent. A concentration of 5 μM was found to
produce the most profound effect (Fig. 2p-t). At the time of explant, the dorsal skin
already has a few primary rows of dermal condensations established (Fig. 2a, f, k, p).
Buds resulting from dermal condensations that were already established at the time of
explant and IQ-1 treatment developed to an extent before fusing with neighboring feather
buds (Fig. 2j, o, t). Subsequent feather bud rows lateral to the more medial rows failed to
develop resulting in an empty feather field (Fig. 2 j, o, t). An unusual phenotype was the
development of two stripes near the lateral edges of the treated skin explants (Fig. 2o,
2h).

Figure 2: IQ-1 treatment dose curve

To determine whether the cells in the IQ-1 treated skin organs had indeed
maintained pluripotency, the small molecule inhibitor was withdrawn after 24 hours of
treatment (Fig. 3). Normal feather bud development failed to be restored comparably to
control skins explants (Fig. 3a-d, i-l). However, the number of feather bud fusions
decreased when IQ-1 was withdrawn (Fig. 3i-l). Additionally, the previously observed
lateral stripes were present despite drug withdrawal (Fig. 3h, l).

15
Figure 3: IQ-1 treatment withdrawal

Interaction of β-catenin with p300
The small molecule inhibitor, ICG-001, was used to explore the effect of β-
catenin interaction with p300. A dose response curve showed that a 40 μM concentration
of the inhibitor was necessary to obtain a significant phenotype (Fig. 4). While all the
appropriate feather bud rows were able to develop, the feather buds failed to exhibit as
great an outgrowth in comparison to normally developing feather buds and appear
smaller in size (Fig. 4a-e, p-t).

16
Figure 4: ICG-001 treatment dose curve

A withdrawal experiment was also performed with ICG-001 to examine whether
there was an observable induction of premature differentiation (Fig. 5). Skin explants
cultured in regular media following 24 hours of drug treatment exhibit development
comparable to control skin explants (Fig. 5a-d, i-l).

17
Figure 5: ICG-001 treatment withdrawal

Characterization of the phenotype
The development of the treated explants was assessed by sonic hedgehog (SHH)
expression, a marker for feather bud development (Chuong, Patel, Lin, Jung, & Widelitz,
2000; Nohno et al., 1995). Normal feather buds have strong apical SHH expression (Fig.
5d). Whole mount ISH with a probe against SHH revealed that when the β-catenin/p300
interaction is inhibited by IQ-1, the fused feather buds that form express diminished
levels to no SHH compared to control skin explants (Fig. 6e). When β-catenin/CBP
interaction is inhibited by ICG-001, the feather buds successfully express SHH (Fig 6f).
There also seems to be a positive SHH signal in the interbud regions, though it is not
consistent across the entire skin sample (Fig. 6f). The signal may partially be due to
background signal that also appears slightly in the in situ hybridization negative control
where probe was not applied (Fig. 6c).

18
Figure 6: Whole mount in situ hybridization of skin explants

ISH with SHH probes on sectioned samples produced similar results to whole
mount samples (Fig. 7). Control samples exhibited strong SHH signal in the apical
developing feather bud (Fig. 7a-d). IQ-1 treated samples that should theoretically be
maintained in a more immature state fail to express SHH (Fig. 7e-h). There are a few
rare buds that escaped fusion with neighboring feather buds that do express SHH, though
at diminished levels (Fig. 7f). Samples that should theoretically be induced to
differentiate prematurely due to ICG-001 treatment express SHH in the apical developing
feather bud, though the section reveals that the expression of SHH, while greater than IQ-
1 treated skins, is still at a lesser extent compared to control samples (Fig. 7i-l). No SHH
is observed in the interbud regions.

19

Figure 7: SHH in situ hybridization of sectioned skin explants

β-catenin expression is known to be observable throughout a competent feather
field and becomes restricted to forming feather bud regions (Lin et al., 2006). ISH of
skin explant sections probed for β-catenin shows that control samples exhibited
appropriate β-catenin expression in the posterior part of the developing feather bud (Fig.
8a-d). While the feather field failed to form normal, individual feather buds following
IQ-1 treatment, the regions that are fused feather buds resulting in plateau-like regions
were able to express low levels of β-catenin (Fig. 8e-h). Expression in ICG-001 treated
20
skin explants, on the other hand, appeared to be comparable to the control skin explants
despite the fact that the feather buds did not elongate to the same extent (Fig. 8i-l). β-
catenin expression was appropriately localized to the posterior bud, though at diminished
levels (Fig. 8j).
Figure 8: β-catenin in situ hybridization of sectioned skin explants

Further characterization of the phenotype involved analysis of the skin explant
sample sections by IHC. An antibody against neural cell-adhesion molecule (NCAM)
shows NCAM localizes to the basal part of normal developing feather buds (Fig. 9a-d).
NCAM has been shown to be indicative of cells that are destined to become the dermal
21
papillas of feather follicles (Chuong & Edelman, 1985). IQ-1 treated skins showed a
positive NCAM signal in areas of fused feather bud formation but was completely absent
in regions that lacked bud development (Fig. 9e-h). The NCAM signal presented itself in
a fused patch basal to the fused feather bud regions (Fig. 9g). In ICG-001 treated skins,
NCAM signal was found basal to each of the forming feather buds (Fig. 9i-l). However,
there were also regions where the NCAM signal was fused beneath an extended patch of
feather buds that failed to elongate properly (Fig. 9i).
Figure 9: NCAM immunostaining of sectioned skin explants

22
Immunostaining for Tenascin, known to localize to the anterior feather bud
mesenchyme, was absent in IQ-1 treated skin explants (Fig. 10a-h) (Jiang & Chuong,
1992). There was, however, a faint positive signal found in the small fused bud region at
the anterior end of the skin explant (Fig. 10f). Tenascin was properly localized in the
anterior feather bud mesenchyme in ICG-001 treated skin explants (Fig. 10i-l). The
Tenascin signal is much more closely spaced and accentuates the abnormality of the
alleged increase of β-catenin/p300-associated differentiation (Fig. 10i).
Figure 10: Tenascin-C immunostaining of sectioned skin explants

23
Proliferating cell nuclear antigen (PCNA) is a nuclear antigen that is expressed
during DNA replication and is indicative of proliferating cells (Jonsson & Hubscher,
1997). In control skin explants, PCNA signal is found throughout the skin explant, but
much more in the epithelium (Fig. 11a-d). IQ-1 treated skin explants show a marked
decrease in PCNA positivity throughout the sample, both in the epithelium and
mesenchyme (Fig. 11e-h). In contrast to both, ICG-001 treated skin explants display
similar levels of PCNA positivity in the mesenchyme as control skin explants, but a
significant decrease in positivity in the epithelium (Fig. 11i-l).
Figure 11: PCNA immunostaining of sectioned skin explants

24
Short term labeling with bromodeoxyuridine (BrdU) can be used to reveal the
cells which are actively cycling, also known as TA cells. BrdU staining revealed actively
cycling cells dispersed throughout the mesenchyme and epithelium of the control skin
explants (Fig. 12a-d). Upon observation of the BrdU staining of the treated skins, both
IQ-1 and ICG-001 treatment resulted in a decrease in the number of BrdU-labeled cells
(Fig. 12e-l).
Figure 12: BrdU staining of sectioned skin explants

25
26
Verification of the effectiveness of the β-catenin inhibitors
Immunostaining for CBP in the control skin explant showed positivity dispersed
in the mesenchyme with a stronger signal in the epithelium (Fig. 13a-d). IQ-1 treatment
should interfere with β-catenin/p300 interaction and increase β-catenin/CBP interaction
while ICG-001 treatment should produce the inverse condition. In concurrence with this,
immunostaining for CBP in treated skin explants exhibited the expected localization.
Following IQ-1 treatment, regions of the skin explant that failed to develop feather buds
showed decreased CBP signal but in regions of fused feather buds, CBP was clearly
expressed in the mesenchyme and at a greater level in the epithelium (Fig. 13e-h). ICG-
001 treatment resulted in a decrease of CBP in the mesenchyme and an even more
dramatic decrease of CBP positivity in the epithelium (Fig. 13i-l).

Figure 13: CBP immunostaining of sectioned skin explants

Myc overexpression
Overexpression of Myc induced by the generated RCAS Myc produced a
dramatic phenotype. Regions of larger feather buds were observed (Fig. 14). Some of
the enlarged feather buds maintained an elongated shape though with a larger girth while
other enlarged feathers were more bulbous in shape (Fig. 14a-b, c-d respectively). There
is also a noticeable increase in vasculogenesis in the enlarged feathers.
27
Figure 14: RCAS Myc feather phenotype

Cloning of PCP genes
Primers for each of the PCP genes were designed Flamingo-1 (Fmi1) has been
previously studied in the hair cells of the chick inner ear (Davies, Formstone, Mason, &
Lewis, 2005). However, the available sequence on NCBI is the sequence predicted by
automated computational analysis. Dishevelled-1 (Dsh1) primers were designed from the
Gallus gallus mRNA sequence of the Drosophila dishevelled homolog (Table 1).
Primers for Dishevelled-3 (Dsh3), Frizzled-3 (Fz3), Frizzled-6 (Fz6), and Strabismus
(Stbm), were designed from the chicken mRNA sequence that was predicted by
automated computational analysis and provided on NCBI (Table 1). The prediction was
based on homology to the already identified Drosophila sequences. The 799bp Dsh1
product, the 791bp Dsh3 product, the 882bp Fmi1 product, the 894bp Fz3 product, the
28
29
962bp Fz6 product, and the 662bp Stbm product were all sequenced to be 99%
homologous to the expected predicted sequence.
Table 1: PCP primers
Gene Sense Primer Antisense Primer
Dsh1 TTATGAAAGGAGGGGCTGTG CTGGGTCTTGGTATGCTGGT
Dsh3 TGCTCTTGCAGGTGAATGAC CCCTCCGTAGCTGTAGCTTG
Fmi1 GCTACAAAACGCCACCAAAT AGCTCACACCCTCTGGAAGA
Fz3 AGCAATGGAGCCATTTCATC ACGCCGCTAATATTGTCACC
Fz6 TGTTGCGAAAAGCTTCATTG TGATTTGTTGTGCCACCTGT
Stbm CTACAATCCTGCCCTCCTCA GTCCACAAACTCCTCCGAGA

Expression and localization of PCP gene expression
Semi-quantitative PCR of the PCP genes Dsh1, Dsh3, Fmi1, Fz3, Fz6, and Stbm
from embryonic day 6 through 14 dorsal skin cDNA verified the presence of all the genes
of interest (Fig. 15). Whole mount ISH of normal E8 chicken embryos with RNA probes
against Dsh1 does not show significant expression on the dorsal skin where feather buds
have yet to bud out (Fig. 16a-b). However, on the tail feathers, which develop earlier and
are thus more advanced, Dsh1 expression can be observed in the most apical part of the
larger feather buds (Fig. 16c-e). At E10, Dsh1 expression is evident in the distal half of
the elongated feather buds (Fig. 16f-j).

Figure 15: Semi-quantitative PCR of PCP genes

30

Figure 16: Whole mount Dsh1 in situ hybridization

31
32
Examination of Dsh3 ISH reveals that expression appears to be very low if not
absent in the dorsal skin (Fig. 17a-b). Faint expression can be seen in the tail feather
buds (Fig. 17c-e). E10 feather buds, however, have an observable signal in the
epithelium of the distal elongated feather buds (Fig. 17f-h). Dsh3 expression seems to
increase with the maturity of the elongating feather buds, as can be seen in the stronger
signal in the distal epithelium of the more mature elongating tail feather buds (Fig. 17h-j).
Lastly, normal chicken embryos probed with Stbm RNA probes shows a positive
signal at E8, displaying a pattern in the midline that suggests asymmetrical localization to
the posterior part of the feather bud (Fig. 18a-f, h). E8 tail feather buds show a distinct
circular spot on the apical region (Fig. 18g). At E10, Stbm expression is similar to Dsh1
and Dsh3, appearing distally in the elongating feather bud (Fig. 18i-m).

Figure 17: Whole mount Dsh3 in situ hybridization

33

Figure 18: Whole mount Stbm in situ hybridization

34
35
DISCUSSION
β-catenin inhibition perturbs normal feather bud development
As mentioned earlier, the β-catenin inhibitors IQ-1 and ICG-001 have been shown
to maintain pluripotency and induce differentiation, respectively, in murine studies.
When chicken embryonic skin explants were treated with IQ-1, a perturbed phenotype
was observable at 1.25 μM. However, 5 μM treated explants were used in subsequent
analyses by ISH and IHC because the inhibition of feather bud development is more
profound. Buds that are able to form ultimately fuse together to form large feather
plaques. The failure of the feather buds to resume normal development even after the
withdrawal of the drug indicates that while the inhibition of β-catenin interaction with
p300 may be important in the normal development of the feather field, it alone is not the
main switch. Other signals are likely required and the inhibition of the interaction may
have set the signals in the skin explant in an asynchronous state. Thus, the signals that
usually act in concert with β-catenin/p300 and its downstream signals are no longer
present when β-catenin/p300 interaction is able to resume following drug withdrawal.
ICG-001 treatment, on the other hand, did not interfere with the development of
the feather bud rows. Only at the higher concentration of 40 μM did the phenotype appear
perturbed. Regions of the skin explant appear thicker given the opacity of the interbud
regions (Fig. 4p-t). Sectioning of the ICG-001 treated samples did reveal smaller buds
that did not elongate to the extent of the control explants so the illusion may be attributed
to the decrease in contrast between the feather buds and the interbud regions because
upon sectioning of the samples, the increase in thickness in the interbud region was not
immediately obvious. It is also possible that the thicker appearance may be due to an
36
increase in density. To verify this, additional IHC staining against extracellular matrix
proteins such as collagen, fibronectin, and laminin will need to be performed. A last
consideration for the abnormal phenotype is toxicity of the drug, which will need to be
investigated by checking for apoptosis or necrosis.
The withdrawal of the drug shows a return to normal development. The feather
buds elongate to lengths comparable to the control feather buds. This is not surprising
considering the inhibition of β-catenin/CBP interaction should push the cells to a more
differentiative state. The development of the lateral feather buds, which occurs at a later
time than medial feather buds, would not experience any interference in their
development but would experience a promotive push if anything.
Analysis of the skin explants by whole mount and section ISH revealed that the
inhibited feather field of IQ-1-treated explants failed to express SHH, a later marker of
feather bud morphogenesis. This confirms that the inhibition of the feather bud
development following IQ-1 treatment is in fact due to the skin being held at an earlier
stage as opposed to expressing all appropriate signals but simply failing to exhibit
outgrowth. Feather buds that developed in ICG-001 expressed SHH appropriately in the
apical epithelium, which was to be expected.
ISH probing for β-catenin, which, as mentioned earlier, is expressed uniformly in
the feather field during the formation of feather placodes followed by restrictive
expression during the formation of the feather bud. The control skin exhibits normal β-
catenin expression with some asymmetry in localization to the posterior mesenchyme.
The same expression can be found in ICG-001-treated skins, which suggests that
development is progressing normally. The complete lack of β-catenin expression in the
37
areas of the explant that fail to develop any buds suggests that the feather field was
inhibited and held at a stage prior to feather placode establishment before β-catenin is
expressed in the feather field uniformly. The diminished levels of β-catenin expression in
the buds that do form in IQ-1-treated explants introduces the possibility that the buds may
have lost some of their identity and are instead a kind of degenerate feather bud since β-
catenin expression is such an important part of skin appendage morphogenesis.
Examination of NCAM and Tenascin-C localization showed similarities between
control explants and ICG-001 explants. NCAM was present beneath forming feather
buds while Tenascin-C denoted the anterior mesenchyme of the feather buds. In regions
of the IQ-1-treated explants where feather buds failed to form, the complete lack of
NCAM supports the fact that the feather field has been held back at an earlier stage. In
the fused feather bud regions, there is NCAM expression present even in the interbud
region and a significantly decreased level of Tenascin-C, which further indicates the loss
of normal feather bud identity. It also suggests a perturbation in cell migration ability,
which can further exacerbate the issue of abnormal development.
The inhibition of development by IQ-1 treatment resulted in a decrease of
proliferation in both the epithelium and the mesenchyme, as exhibited by the decrease in
PCNA staining. ICG-001-treated explants exhibited a decrease in proliferation in the
epithelium, though failed to exhibit an increase in proliferation in the mesenchyme as
would have been expected given the illusion of thickening of the explant compared to
control. There is, however, consistent PCNA signal in the mesenchyme of the interbud
region, which may partially explain the slight presence of SHH expression as shown in
the whole mount ISH staining (Fig. 7f). Increased SHH has been found to be associated
38
with increased proliferation as demonstrated by studies that produced enlarged feather
buds in response to SHH overexpression (Ting-Berreth & Chuong, 1996). As mentioned
before, further characterization to determine the exact reason for the appearance is still
necessary. Examination of TA cells with short term BrdU labeling showed the expected
decrease in labeling in IQ-1-treated explants, which would correlate with the expected
inhibition of differentiation that IQ-1 demonstrated in murine studies. It is presumed that
IQ-1 inhibition of differentiation would also mean an inhibition of TA cells. The
expected increase of TA cells in ICG-001 was not found, however, there was also no
decrease.
Immunostaining for CBP confirmed the decrease in CBP following ICG-001, as
was expected. Following IQ-1 treatment, which should promote β-catenin interaction
with CBP, CBP presence is found in the regions where feather buds formed but fused
abnormally. However, upon examination of the regions where feather buds failed to
form, the presence of CBP is on par with that of ICG-001-treated explants. Further
verification of this, as well as levels of p300, by Western blot and co-
immunoprecipitations is still necessary.
Myc overexpression affects organ size
The application of viral particles produced by transfected CEFs to chicken
embryos resulted in a significant increase in feather bud size, as expected. The increase
in vascularization within the enlarged feather buds is not unusual considering the
resources that are necessary to support a larger organ. The similarity in phenotype to a
previously mentioned study of SHH introduces an interesting question as to what, if any,
39
relationship may exist between Myc and SHH (Ting-Berreth & Chuong, 1996).
Characterization of the phenotype is yet to come as well as silencing experiments of Myc.
PCP in feather bud development
Semi-quantitative PCR of the PCP genes of interest confirms the presence of the
gene and shows a slight fluctuation of expression peaking at approximately embryonic
day 11. ISH showed the appearance of Dsh1 and Dsh3 to be more prominent at later
stages and asymmetrically so, appearing more apically. Stbm appears to be expressed at
a higher level at early stages compared to Dsh1 and Dsh3. Feather buds on the dorsal
tract also has a pattern with Stbm localizing asymmetrically, exhibiting a stronger signal
in the posterior half of the bud. Thus far, localization concurs with previous studies of
PCP genes in Drosophila. However, contrary to previous Drosophila findings, at later
stages, Stbm expression can be found in the apical region of the feather bud.
Future direction
The progress thus far has shown that β-catenin interaction with p300 is crucial for
the maturation of the feather field and proper feather bud development.
Characterization of the achieved phenotype from β-catenin inhibitor treatment is still
incomplete. It is still difficult to conclude whether the status of the feather field
following IQ-1 treatment is an issue of competency, cell migration, or both. It has been
suggested that the switch between β-catenin interacting with CBP or p300 may occur
more than once, thus complicating the matter. Further examination is necessary to
discover if interaction of β-catenin with CBP is responsible for a holding position in the
multipotent stem cell population, the TA cell population, or the differentiating cell
population characterized by cell proliferation without progression to the subsequent cell
40
state while interaction of β-catenin with p300 is the signal for cells to progress from one
state to the next. The issue of cell migration must also be elucidated because it is
possible for the cells to be in the correct state but unable to organize properly to from the
appropriate structures.
The enlarged feather bud phenotype from Myc overexpression also needs to be
characterized, in addition to silencing experiments. Similarities to studies of SHH
proposes an interesting question of the relationship between Myc and SHH as well as
SHH and canonical Wnt signaling.
Lastly, Dsh1 and Dsh3 act in later stages of feather bud development while Stbm
appears earlier and continues to be expressed as feather buds elongate. Their asymmetric
localization breathes possibility into the hypothesis that PCP genes have similar function
in feather buds as they do in Drosophila hair cells. The confirmation of some of the PCP
gene expression in feather buds is only the beginning to understanding the signals
involved in establishing polarity. PCP perturbation studies will glean the role of each of
the PCP genes and lead to better understanding of the directing signals necessary to
organize the 3-dimensional pattern. Exploration of Nkd, a negative regulator of both
canonical and noncanonical Wnt signaling, may open a window into understanding the
relationship between the canonical and noncanonical pathways.
41
REFERENCES
Arany, Z., Sellers, W. R., Livingston, D. M., & Eckner, R. (1994). E1A-associated p300
and CREB-associated CBP belong to a conserved family of coactivators. Cell, 77(6),
799-800.
Arnold, I., & Watt, F. M. (2001). c-myc activation in transgenic mouse epidermis results
in mobilization of stem cells and differentiation of their progeny. Current Biology :
CB, 11(8), 558-568.
Chang, C. H., Jiang, T. X., Lin, C. M., Burrus, L. W., Chuong, C. M., & Widelitz, R.
(2004). Distinct wnt members regulate the hierarchical morphogenesis of skin
regions (spinal tract) and individual feathers. Mechanisms of Development, 121(2),
157-171.
Chuong, C. M., & Edelman, G. M. (1985). Expression of cell-adhesion molecules in
embryonic induction. I. morphogenesis of nestling feathers. The Journal of Cell
Biology, 101(3), 1009-1026.
Chuong, C. M., Patel, N., Lin, J., Jung, H. S., & Widelitz, R. B. (2000). Sonic hedgehog
signaling pathway in vertebrate epithelial appendage morphogenesis: Perspectives in
development and evolution. Cellular and Molecular Life Sciences : CMLS, 57(12),
1672-1681.
Davies, A., Formstone, C., Mason, I., & Lewis, J. (2005). Planar polarity of hair cells in
the chick inner ear is correlated with polarized distribution of c-flamingo-1 protein.
Developmental Dynamics : An Official Publication of the American Association of
Anatomists, 233(3), 998-1005.
Desbiens, X., Queva, C., Jaffredo, T., Stehelin, D., & Vandenbunder, B. (1991). The
relationship between cell proliferation and the transcription of the nuclear oncogenes
c-myc, c-myb and c-ets-1 during feather morphogenesis in the chick embryo.
Development (Cambridge, England), 111(3), 699-713.
Emami, K. H., Nguyen, C., Ma, H., Kim, D. H., Jeong, K. W., Eguchi, M., et al. (2004).
A small molecule inhibitor of beta-catenin/CREB-binding protein transcription
[corrected]. Proceedings of the National Academy of Sciences of the United States of
America, 101(34), 12682-12687.
Fanto, M., & McNeill, H. (2004). Planar polarity from flies to vertebrates. Journal of Cell
Science, 117(Pt 4), 527-533.
Frye, M., Gardner, C., Li, E. R., Arnold, I., & Watt, F. M. (2003). Evidence that myc
activation depletes the epidermal stem cell compartment by modulating adhesive
42
interactions with the local microenvironment. Development (Cambridge, England),
130(12), 2793-2808.
Gallant, P. (2006). Myc/Max/Mad in invertebrates: The evolution of the max network.
Current Topics in Microbiology and Immunology, 302, 235-253.
Gandarillas, A., Davies, D., & Blanchard, J. M. (2000). Normal and c-myc-promoted
human keratinocyte differentiation both occur via a novel cell cycle involving
cellular growth and endoreplication. Oncogene, 19(29), 3278-3289.
Gandarillas, A., & Watt, F. M. (1997). c-myc promotes differentiation of human
epidermal stem cells. Genes & Development, 11(21), 2869-2882.
Goldman, P. S., Tran, V. K., & Goodman, R. H. (1997). The multifunctional role of the
co-activator CBP in transcriptional regulation. Recent Progress in Hormone
Research, 52, 103-19; discussion 119-20.
Hecht, A., Litterst, C. M., Huber, O., & Kemler, R. (1999). Functional characterization of
multiple transactivating elements in beta-catenin, some of which interact with the
TATA-binding protein in vitro. The Journal of Biological Chemistry, 274(25),
18017-18025.
Hecht, A., Vleminckx, K., Stemmler, M. P., van Roy, F., & Kemler, R. (2000). The
p300/CBP acetyltransferases function as transcriptional coactivators of beta-catenin
in vertebrates. The EMBO Journal, 19(8), 1839-1850.
Heisenberg, C. P., Tada, M., Rauch, G. J., Saude, L., Concha, M. L., Geisler, R., et al.
(2000). Silberblick/Wnt11 mediates convergent extension movements during
zebrafish gastrulation. Nature, 405(6782), 76-81.
Jaffredo, T., Vandenbunder, B., & Dieterlen-Lievre, F. (1989). In situ study of c-myc
protein expression during avian development. Development (Cambridge, England),
105(4), 679-695.
Jiang, T. X., & Chuong, C. M. (1992). Mechanism of skin morphogenesis. I. analyses
with antibodies to adhesion molecules tenascin, N-CAM, and integrin.
Developmental Biology, 150(1), 82-98.
Jones, P. H., & Watt, F. M. (1993). Separation of human epidermal stem cells from
transit amplifying cells on the basis of differences in integrin function and
expression. Cell, 73(4), 713-724.
Jonsson, Z. O., & Hubscher, U. (1997). Proliferating cell nuclear antigen: More than a
clamp for DNA polymerases. BioEssays : News and Reviews in Molecular, Cellular
and Developmental Biology, 19(11), 967-975.
43
Karner, C., Wharton, K. A.,Jr, & Carroll, T. J. (2006). Planar cell polarity and vertebrate
organogenesis. Seminars in Cell & Developmental Biology, 17(2), 194-203.
Klein, T. J., & Mlodzik, M. (2005). Planar cell polarization: An emerging model points in
the right direction. Annual Review of Cell and Developmental Biology, 21, 155-176.
Lee, M., & Vasioukhin, V. (2008). Cell polarity and cancer - cell and tissue polarity as a
non-canonical tumor suppressor. Journal of Cell Science, 121(8), 1141-1150.
Lin, C. M., Jiang, T. X., Widelitz, R. B., & Chuong, C. M. (2006). Molecular signaling in
feather morphogenesis. Current Opinion in Cell Biology, 18(6), 730-741.
Luscher, B., & Eisenman, R. N. (1990). New light on myc and myb. part I. myc. Genes
and Development, 4(12a), 2025-2035.
Miyabayashi, T., Teo, J. L., Yamamoto, M., McMillan, M., Nguyen, C., & Kahn, M.
(2007). Wnt/beta-catenin/CBP signaling maintains long-term murine embryonic
stem cell pluripotency. Proceedings of the National Academy of Sciences of the
United States of America, 104(13), 5668-5673.
Nagafuchi, A., & Takeichi, M. (1988). Cell binding function of E-cadherin is regulated
by the cytoplasmic domain. The EMBO Journal, 7(12), 3679-3684.
Nohno, T., Kawakami, Y., Ohuchi, H., Fujiwara, A., Yoshioka, H., & Noji, S. (1995).
Involvement of the sonic hedgehog gene in chick feather formation. Biochemical
and Biophysical Research Communications, 206(1), 33-39.
Otero, J. J., Fu, W., Kan, L., Cuadra, A. E., & Kessler, J. A. (2004). Beta-catenin
signaling is required for neural differentiation of embryonic stem cells. Development
(Cambridge, England), 131(15), 3545-3557.
Rousset, R., Mack, J. A., Wharton, K. A.,Jr, Axelrod, J. D., Cadigan, K. M., Fish, M. P.,
et al. (2001). Naked cuticle targets dishevelled to antagonize wnt signal transduction.
Genes & Development, 15(6), 658-671.
Saburi, S., & McNeill, H. (2005). Organising cells into tissues: New roles for cell
adhesion molecules in planar cell polarity. Current Opinion in Cell Biology, 17(5),
482-488.
Shiama, N. (1997). The p300/CBP family: Integrating signals with transcription factors
and chromatin. Trends in Cell Biology, 7(6), 230-236.
Siegfried, E., & Perrimon, N. (1994). Drosophila wingless: A paradigm for the function
and mechanism of wnt signaling. BioEssays : News and Reviews in Molecular,
Cellular and Developmental Biology, 16(6), 395-404.
44
Strutt, H., & Strutt, D. (2002). Nonautonomous planar polarity patterning in drosophila:
Dishevelled-independent functions of frizzled. Developmental Cell, 3(6), 851-863.
Ting-Berreth, S. A. & Chuong, C. M. (1996). Sonic hedgehog in feather morphogenesis:
Induction of mesenchymal condensation and association with cell death.
Developmental Dynamics, 207, 157-170.
Tree, D. R., Ma, D., & Axelrod, J. D. (2002). A three-tiered mechanism for regulation of
planar cell polarity. Seminars in Cell & Developmental Biology, 13(3), 217-224.
Waikel, R. L., Kawachi, Y., Waikel, P. A., Wang, X. J., & Roop, D. R. (2001).
Deregulated expression of c-myc depletes epidermal stem cells. Nature Genetics,
28(2), 165-168.
Wang, Y., & Nathans, J. (2007). Tissue/planar cell polarity in vertebrates: New insights
and new questions. Development (Cambridge, England), 134(4), 647-658.
Watt, F. M., & Hogan, B. L. (2000). Out of eden: Stem cells and their niches. Science
(New York, N.Y.), 287(5457), 1427-1430.
Widelitz, R. B., Jiang, T. X., Lu, J., & Chuong, C. M. (2000). Beta-catenin in epithelial
morphogenesis: Conversion of part of avian foot scales into feather buds with a
mutated beta-catenin. Developmental Biology, 219(1), 98-114.
Zanet, J., Pibre, S., Jacquet, C., Ramirez, A., de Alboran, I. M., & Gandarillas, A. (2005).
Endogenous myc controls mammalian epidermal cell size, hyperproliferation,
endoreplication and stem cell amplification. Journal of Cell Science, 118(Pt 8),
1693-1704.
Zeng, W., Wharton, K. A.,Jr, Mack, J. A., Wang, K., Gadbaw, M., Suyama, K., et al.
(2000). Naked cuticle encodes an inducible antagonist of wnt signalling. Nature,
403(6771), 789-795.

Abstract (if available)

Abstract The formation of complex ectodermal organs begins with multipotent stem cells that undergo many basic cellular events. During the formation of a complex organ, there are many factors that need to be considered such as patterning, size, and shape in order to maintain proper organ function. Feather development is a good model. The feather field must be patterned to establish how many feathers, the size must be determined, and the shape of the feather must be appropriate for its function. Canonical and non-canonical Wnt signaling has been implicated in many crucial steps in feather bud development.

Linked assets

University of Southern California Dissertations and Theses

Conceptually similar

PDF

Shifting topology of stem cells and molecular expression during feather regenerative cycling

PDF

Epigenetic and genetic reprogramming during embryonic chicken feather bud morphogenesis, hair morphogenesis, and de novo hair regeneration

PDF

Exploring the molecular and cellular underpinnings of organ polarization using feather as the model system

PDF

Cross-species comparison of non-canonical Wnt signaling in the developing retina

PDF

Characterization of the progenitor cell zone in feather follicles

PDF

The role of insulin-like growth factors in size regulation during embryonic feather development

PDF

Constitutively active canonical BMP signaling in the apical ectodermal ridge disrupts dorsal-ventral and anterior-posterior axes resulting in impaired development of the distal (autopod) limb domain

PDF

Morphoregulation and cycling of ectodermal organs

PDF

Role of FGFR2b signaling pathway in the development of ectodermal derivatives

PDF

The role of Prkci in stem cell maintenance and cell polarity using a 3-D culture system

PDF

Characterizing the role of Dnmt1 and its downstream factors in progressive alopecia

PDF

Implications of constitutively active bone morphogenetic protein (BMP) signaling in skin morphogenesis and skin postnatal homeostasis

PDF

Adaptive patterning during skin formation: assembly of vasculature and adipose tissue

PDF

β-catenin couples self-renewal, induction and epithelial morphogenesis and patterning at the outset of mammalian nephrogenesis

PDF

Roles of Hox B genes in the development of chicken skin

PDF

Proliferation and maturation events in second heart field cells during cardiovascular development activated by the Delta like ligand-4 mediated notch signaling

PDF

The impact of genetic pleiotropy on heterogeneity in the developing forebrain and hindbrain

PDF

Dissecting the role of a non-canonical interleukin-6 cytokine signaling in systemic chronic inflammation and multimorbidity induced by a high-fat diet

Asset Metadata

Creator Chiu, Cathleen Tsz Ka (author)

Core Title Canonical and non-canonical Wnt signaling in the patterning of multipotent stem cells during feather development

School Keck School of Medicine

Degree Master of Science

Degree Program Experimental and Molecular Pathology

Publication Date 07/29/2010

Defense Date 06/30/2008

Publisher University of Southern California (original), University of Southern California. Libraries (digital)

Tag OAI-PMH Harvest,Wnt

Language English

Advisor Chuong, Cheng-Ming (committee chair), Kahn, Michael (committee member), Widelitz, Randall B. (committee member)

Creator Email cathletc@usc.edu

Permanent Link (DOI) https://doi.org/10.25549/usctheses-m1446

Unique identifier UC1122180

Identifier etd-Chiu-20080729 (filename),usctheses-m40 (legacy collection record id),usctheses-c127-89175 (legacy record id),usctheses-m1446 (legacy record id)

Legacy Identifier etd-Chiu-20080729.pdf

Dmrecord 89175

Document Type Thesis

Rights Chiu, Cathleen Tsz Ka

Type texts

Source University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Repository Name Libraries, University of Southern California

Repository Location Los Angeles, California

Repository Email cisadmin@lib.usc.edu