University of Southern California Dissertations and Theses

CCNL1, EWS, TFIP11, and RNA splicing

(USC Thesis Other)

CCNL1, EWS, TFIP11, and RNA splicing

PDF

Download

Open document

Flip pages

Download a page range

Download transcript

Copy asset link

Request this asset

Transcript (if available)

Content

CCNL1, EWS, TFIP11, AND RNA SPLICING

by

Sissada Tannukit

A Dissertation Presented to the
FACULTY OF THE GRADUATE SCHOOL
UNIVERSITY OF SOUTHERN CALIFORNIA
In Partial Fulfillment of the
Requirements for the Degree
DOCTOR OF PHILOSOPHY
(CRANIOFACIAL BIOLOGY)

December 2009

Copyright 2009 Sissada Tannukit

ii
Acknowledgments
First and foremost, I wish to thank my supervisor, Dr. Michael L. Paine for giving
me the opportunity to work in his lab. I am greatly indebted for his guidance and
encouragement. He is one of the rare advisors that students dream of. I could not have
gone through this long and arduous journey without his enduring patience and relentless
support. My heartfelt thanks also go to dissertation committee members: Dr. Malcolm L.
Snead, Dr. Yang Chai, Dr. Elizabeth Lawlor, and Dr. Charles F. Shuler for their helpful
suggestions.
I am grateful to my friends and colleagues at Center for Craniofacial Molecular
Biology. In particular, I owe a debt of gratitude that would never be repaid to Yaping
Lei. Her unwavering support has been a blessing and a source of strength during the
difficult times. I am also thankful to Hong Jun Wang, Zhan Huang, and Xin Wen for
their tremendous help throughout the time it took me to complete my research.
Special thanks and appreciation must go to Dr. Klemens Hertel who gave me the
opportunity to work in his lab at University of California Irvine. I wish to thank all
members in the Hertel lab for their help and friendly atmosphere. I especially thank Tara
Crabb who taught me to do in vitro splicing assay and provided me the necessary
assistance during approximately 8-month period in the Hertel lab.
Last but not least, I’m deeply grateful to my parents and brothers for their love,
unflinching support, and belief in me.

iii
Table of Contents
Acknowledgments ii
List of Figures iv
Abbreviations v
Abstract ix
Chapter 1: Introduction 1
Pre-mRNA splicing 1
Alternative splicing and SR proteins 6
TFIP11 and its potential role in pre-mRNA splicing 8
TFIP11-interacting proteins 15
CCNL1 is a component of splicing factor compartment 17
EWS, a multifunctional protein 18

Chapter 2: Function of TFIP11 in pre-mRNA splicing 23
Introduction 23
Materials and methods 24
Results 28
Discussion 32

Chapter 3: Identification of nuclear localization signal and speckle-targeting 35
sequence of TFIP11
Introduction 35
Materials and methods 36
Results 37
Discussion 41

Chapter 4: Intracellular colocalization of TFIP11 with CCNL1 and EWS, 43
and physical association of TFIP11 and EWS
Introduction 43
Materials and methods 44
Results 47
Discussion 52

Conclusion 55
References 59
iv
List of Figures
Figure 1: Schematic diagram of the chemical reactions catalyzed by 3
the spliceosome

Figure 2: The in vitro-derived spliceosome assembly cycle 5
Figure 3: Two alternatively spliced isoforms of human TFIP11. 9
Figure 4: ClustalW Formatted Alignment of TFIP11 and related 10
proteins amongst various species.
Figure 5: Effect of transcription inhibition on TFIP11 localization. 11
Figure 6: A model for the post-splicing intron turnover pathway. 15
Figure 7: Accumulation of lariat intron in TFIP11-depleted extract. 30
Figure 8: Reconstitution assay. 31
Figure 9: TFIP11 stimulates splicing activity in vivo. 32
Figure 10: Molecular strategy for the identification of a novel NLS, 39
and a sequence element directing TFIP11 to distinct nuclear
speckles

Figure 11: Identification of an NLS and a sequence element directing 40
TFIP11 to distinct nuclear speckles using confocal microscopy

Figure 12: Subcellular localization of CCNL1 and EWS with SC35 49
Figure 13: Colocalization of TFIP11 and CCNL1, and TFIP11 and EWS 50
Figure 14: EWS interacts with TFIP11. 51

v
Abbreviations
ATP Adenosine triphosphate

Brr2 Bad response to refrigeration 2

CCNL1 Cyclin L1

CCNL2 Cyclin L2

CDK Cyclin-dependent kinase

cDNA Complementary DNA

CMV Cytomegalovirus

CTD C-terminal domain

CTP Cytidine triphosphate

DAPI 4′-6-Diamidino-2-phenylindole

DEAD Aspartate, Glutamate, Alanine, Aspartate

DHX15 DEAH polypepetide 15

DMEM Dulbecco’s modification of Eagle’s medium

Dnl4p DNA ligase 4 protein

DSB Double-strand break

dsRBD Double-stranded RNA binding domain

EDTA Ethylenediaminetetraacetic acid

ETS Erythroblastostosis virus-transformed sequence

EWS Ewing sarcoma

FCS Fetal calf serum

FLI1 Friend leukemia virus integration 1

FUS Fusion in liposarcoma
vi
G Glycine

GFP Green fluorescent protein

GST Glutathione-S-transferase

GTP Guanosine triphosphate

h hour

HEK Human embryonic kidney

HEPES 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid

hnRNP Heterogeneous ribonucleoprotein

IGC Interchromatin granule cluster

kb kilobase

Lif1 Ligase interacting factor 1

LIG4 DNA ligase 4

min minute

mRNA Messenger RNA

MWCO Molecular weight cut-off

NaAc Sodium acetate

NHEJ Non-homologous end-joining

NLS Nuclear localization signal

NP-40 Nonidet P-40

NTC Nineteen complex

Ntr1 Nineteen complex related protein 1

Ntr2 Nineteen complex related protein 2

ORF Open reading frame
vii
Pabpc1 Poly-A binding protein cytoplasmic 1

PAGE Polyacrylamide gel electrophoresis

PBS Phosphate-buffered saline

PCR Polymerase chain reaction

Pol Polymerase

Prp2 Pre-mRNA processing 2

Prp16 Pre-mRNA processing 16

Prp22 Pre-mRNA processing 22

Prp43 Pre-mRNA processing 43

RFP Red fluorescent protein

RGG Arginine, Glycine, Glycine

Rnasin Rnase inhibitor

rpm Revolutions per minute

RRM RNA recognition motif

RT Room temperature

SC35 Splicing component, 35 kDa; splicing factor, arginine/serine-rich 2

SDS Sodium dodecyl sulfate

SF1 Splicing factor 1

siRNA Small interfering RNA

SMN Survival motor neuron

snRNA Small nuclear RNA

snRNP Small nuclear ribonucleoprotein particle

Snu114 Snurp 114 kDa
viii
Spp2 Suppressor of Prp2

SR protein Serine/Arginine-rich protein

STIP Septin/tuftelin-interacting protein

SV40 Simian virus 40

TAF TBP-associated factor

TASR TLS-associated SR

TBP TATA-box binding protein

TFIP11 Tuftelin-interacting protein 11

TFIID Transcription factor II D

TLS Translocated in liposarcoma

UTP Uridine triphosphate

UTR Untranslated region

U1C U1-specific protein C

v/v volume per volume

XRCC4 X-ray repair complementing defective repair in Chinese hamster
cells 4

YB-1 Y-box binding

Y2H Yeast two-hybrid

ZNF Zinc finger motif

ix
Abstract
Pre-mRNA splicing is an essential step of gene expression in the vast majority of
eukaryotic genes. The splicing is carried out by spliceosome, a multicomponent
ribonucleoprotein complex, containing five uridine-rich small nuclear RNAs and numerous
associated proteins. Tuftelin-interacting protein 11 (TFIP11) is a protein component of
spliceosome complex that promotes the release of the lariat intron during late stage of
splicing process. Furthermore, overexpression of TFIP11 enhances the splicing activity,
which is likely related to a more efficient recycling of splicing factors.
TFIP11 contains a G-patch domain, which is an RNA-binding domain found in
several RNA-processing proteins. The G-patch domain of TFIP11 was shown to be a
DHX15-interacting domain and this interaction is critical for the functional role of
TFIP11 during spliceosome disassembly. Apart from the G-patch, no other functional
domains within TFIP11 have been described in the literature. In this study, sequential C-
terminal deletions and mutational analyses identify two novel protein elements in mouse
TFIP11. The first domain covers amino acids 701-706 (VKDKFN) and is an atypical
nuclear localization signal. The second domain is contained within amino acids 711-735
and defines the distinct speckled nuclear localization. Interestingly, the G-patch domain
plays no role in determining TFIP11’s nuclear localization.
Previous studies using the yeast two-hybrid assay have identified cyclin L1
(CCNL1) and Ewing sarcoma protein (EWS) as being interacting partners of TFIP11. All
three proteins are functionally related to the spliceosome and involved in pre-mRNA
x
splicing activities. The precise roles of CCNL1 and EWS in the spliceosome are poorly
understood. Using fluorescently-tagged proteins and confocal microscopy it was shown
that TFIP11 displays speckled pattern in the nucleus and that TFIP11 colocalizes with
CCNL1 and EWS. Protein interaction of TFIP11 and EWS was confirmed by a
coimmunoprecipitation assay. These findings suggest that all three proteins participate in
a common cellular activity related to RNA splicing events.

1
Chapter 1
Introduction
Pre-mRNA splicing
Most eukaryotic genes, particularly in higher eukaryotes, are present as
interrupted genes, which require processing in order to generate the functional mRNA
prior to translation. The coding regions of DNA, called exons, are separated by the
intervening (noncoding) sequences, which are referred to as introns. Pre-mRNA splicing
is a process by which the introns are removed and the exons are ligated together. The
splicing reaction is carried out by spliceosome, a dynamic multicomponent complex
composed of small nuclear ribonucleoproteins (snRNPs) and a large number of associated
proteins. The snRNPs that make up the spliceosome are named U1, U2, U4/U6, and U5;
and each contains one or two small nuclear RNAs, common Sm proteins, and its own
specific proteins. Spliceosomes recognize conserved sequences at the exon-intron
junctions of the 5’ and 3’ splice sites. The human exons average 145 nucleotides in
length, whereas introns average 3,365 nucleotides (Lander et al., 2001). Introns vary
substantially in length with some being tens of thousand nucleotide long. Therefore, the
spliceosome must recognize the correct pair of 5’ and 3’splice sites that are located within
large intron sequences. The splicing signals that contribute to defining the intron
boundary are short conserved sequences located at the 5’ splice site, 3’ splice site, and the
branch site. The branch site is located 20-40 nucleotides upstream of the 3’ splice site.
The mammalian consensus sequence is YNCURAY, where R is purine (A, G), Y is
2
pyrimidine (C, U), and N is any nucleotide. In addition to these cis-elements provided by
the splicing substrate, a large number of trans-acting factors are involved in recognition of
the correct splice sites and the catalysis of pre-mRNA splicing.
Unlike the other ribonucleoprotein complexes such as the ribosome, the proteins
are the major constituents of the spliceosome mass. The protein components of
spliceosome include the snRNP proteins, the non-snRNP, and proteins involved in other
aspects of RNA metabolism such as mRNA export. Several comprehensive proteomic
analyses using affinity selection and mass spectrometry have identified more than 140
proteins comprising the spliceosome (Jurica and Moore, 2003; Rappsilber et al., 2002;
Zhou et al., 2002). RNA splicing is very dynamic process that involves two consecutive
transesterification reactions. In the first reaction, the 2’ OH of adenosine at the branch
site nucleophilically attacks the phosphodiester bond at the 5’ splice site, creating cleaved
5’ exon and a lariat intermediate (Figure 1). In the second reaction, the 3’ OH of the 5’
exon attacks the 3’ splice site, producing spliced exons and lariat intron. After
completion of exon ligation, the spliceosome disassembles and releases its components for
recycling in the next round of spliceosome assembly. After dissociated from the
spliceosome, the lariat intron is linearized by debranching enzyme and subsequently
degraded by nuclear nucleases (Moore, 2002). The mechanism of spliceosome
disassembly is currently poorly understood.
The spliceosome undergoes several structural rearrangements involving dynamic
RNA-RNA, RNA-protein, and protein-protein interactions during the splicing process.
3

Figure 1. Schematic diagram of the chemical reactions catalyzed by the spliceosome.
(Patel and Steitz, 2003)

Many proteins transiently interact within the spliceosome at certain stages. For example,
splicing factor 1 (SF1) binds to the branch point sequence during the earliest step of
spliceosome assembly. Upon binding of the U2snRNP to the pre-mRNA at the branch
point sequence, SF1 is displaced by structural rearrangements of the spliceosomal
components (Gozani et al., 1998). Prior to the first transesterification reaction, the
spliceosome undergoes extensive remodeling, creating catalytically active site for intron
excision and exon ligation (Staley and Guthrie, 1998). A family of DExD/H box RNA
helicases plays essential roles in the ATP-dependent remodeling processes. These
remodeling processes occur during spliceosome assembly, catalytic activation of the
splice site, and spliceosome disassembly, which entails release of the mature RNA and
lariat intron (Staley and Guthrie, 1998). A growing body of evidence revealed that several
members of this protein family play key roles in extensive remodeling during splicing
process (Tanner and Linder, 2001). For example, ATP hydrolysis of Prp2 is essential for
the first transesterification reaction (Kim and Lin, 1996), whereas Prp16 is critical for the
second transesterification reaction (Zhou and Reed, 1998). Prp22 is required for release of
4
spliced RNA (Wagner et al., 1998) and Prp43 is critical for release of the lariat intron
from the spliceosome (Martin et al., 2002).
RNA helicases generally utilize the energy from ATP hydrolysis to unwind RNA
duplex or dissociate the RNA-protein complex. This protein family is characterized by a
structurally conserved core element, which consists of eight motifs (I, Ia, Ib, and II-VI)
required for helicase activity. RNA helicases are primarily classified into two groups:
DEAD-box and DEAH-box. The single-letter designation signifies amino acid sequence of
motif II, which is an NTP binding motif. In contrast to DNA helicases, RNA helicase
generally do not require processive unwinding activity since a long stretch of double-
stranded RNA is not common in biological systems (Tanner and Linder, 2001). In vitro
studies showed that RNA helicases possess very little substrate specificity, mostly
involved base stacking and the sugar-phosphate backbone (Tanner and Linder, 2001).
Therefore, these RNA helicases often work in concert with other proteins. It has been
proposed that the interaction between associated protein factor and flanking sequences
adjacent to the catalytic core of RNA-protein complex may contribute to substrate
specificity (Wang and Guthrie, 1998).
Spliceosome is a highly dynamic molecular machine, consisting of various
conformational states created by extensive structural rearrangements of intricate network
of RNA-RNA, RNA-protein, and protein-protein interactions. The spliceosome
assembles onto the pre-mRNA rapidly after the nascent transcript is synthesized by
RNA polymerase II (Das et al., 2006). Thus far, two models have been proposed for the
5
spliceosome assembly, the stepwise assembly and the pre-assembled spliceosome. The
stepwise model has gained extensive supporting evidence from biochemical experiments
(Brow, 2002; Gornemann et al., 2005; Reed, 2000). In this model, the spliceosome
assembles by sequential interaction of U1, U2, and U4/U6.U5 snRNP with the pre-
mRNA. The U1 snRNP binds to the 5’ splice site and the U2 snRNP associates with the
branch site sequences, forming the A complex (Figure 2). Subsequently, the pre-
assembled U4/U6.U5 snRNP is recruited to the spliceosome, creating the spliceosomal B
complex. The spliceosome, in turn, undergoes extensive remodeling, leading to the
formation of the activated spliceosome. Alternatively, it was shown that a large RNP
complex representing all of the snRNPs can assemble on a short RNA, suggesting that the
preformed spliceosome may be recruited to the pre-mRNA (Malca et al., 2003; Stevens et
al., 2002).

Figure 2. The in vitro-derived spliceosome assembly cycle. (Makarov et al., 2003)
6
Alternative splicing and SR proteins
Alternative splicing is a mechanism in which a single gene can generate multiple
mRNA isoforms with the different combination of splice site selection. Alternative
splicing results in proteomic diversity by expanding the coding capacity of the genome.
It is currently estimated that at least two-thirds of the human genes are alternatively
spliced (Johnson et al., 2003). The splice site selection of alternative exons, which often
have suboptimal splicing signals, is modulated by trans-acting factors that recognize
positive or negative cis-acting exonic/intronic elements (Sanford and Caceres, 2004). A
combination of splicing factors determines how pre-mRNA is constitutively or
alternatively spliced. A family of protein called SR proteins has been extensively studied
with regard to its essential roles in constitutive and regulated splicing. SR proteins
contain one or two N-terminal RNA recognition motifs (RRM) and a C-terminal
arginine/serine-rich (RS) domain. The RRM determines substrate specificity, whereas the
RS domain mediates protein-protein interaction and directs the protein to the nuclear
speckles (Cazalla et al., 2002). The RS domain is also found in a family of protein termed
SR protein-related polypeptides or SR-like proteins. This family of splicing factors is
involved in various aspects of nuclear events such as transcription, splicing regulation,
mRNA 3’ end processing, and mRNA export (Graveley, 2000). The activity of SR
proteins can be regulated by phosphorylation at multiple serine residues within the RS
domain, which alters the subcellular localization and affects the interaction with RNA or
other proteins (Yeakley et al., 1999). Generally, SR proteins act as splicing activators,
7
whereas heterogenous ribonucleoproteins (hnRNPs) function as splicing repressors in
constitutive splicing. In alternative splicing, it is well known that the SR proteins
function in a concentration-dependent manner. Increased level of SR proteins usually
promotes the utilization of proximal 5’ splice site. This effect is antagonized by
hnRNPs, which promote the selection of distal 5’ splice site. The relative abundance of
these two protein families is believed to be critical for regulated splicing events during
development or in different tissues (Sanford and Caceres, 2004). These splicing
regulators involve promotion or inhibition of spliceosome assembly at early stage.
However, SR proteins also appear to play roles in later stages of RNA splicing such as
recruitment of the U4/U6.U5 snRNP into the spliceosome (Graveley, 2000). In addition
to function in pre-mRNA splicing, SR proteins are also involved in other aspects of RNA
metabolism. Some SR proteins have been shown to continuously shuttle between the
nucleus and the cytoplasm, suggesting their roles in mRNA transport or other
cytoplasmic events (Caceres et al., 1998).
The SR proteins primarily localize to the nuclear speckles, also known as splicing
factor compartments or SC35 domain. Nuclear speckles are subnuclear domains located
in the interchromatin regions of mammalian nucleus. Nuclear speckles are believed to be
storage/assembly/modification sites for pre-mRNA splicing factors (Lamond and Spector,
2003). During interphase they appear as irregular, punctate structure under the
fluorescence microscope. The punctate pattern seen by fluorescence microscopy appears
to correspond to the interchromatin granule clusters (IGCs), which contain little or no
8
DNA at the level of electron microscopy. However, nuclear proteins that show a speckle-
like pattern at the level of fluorescence microscopy do not always localize to IGCs. Like
other nuclear proteins, splicing factors are highly dynamic. Several lines of evidence
indicate that splicing factors shuttle between nuclear speckles and active transcription
sites (Misteli et al., 1998; Misteli et al., 1997; Misteli and Spector, 1999). The
accumulation of nuclear speckles is reduced in response to high transcription level during
viral infection or increased expression of intron-containing gene (Lamond and Spector,
2003). On the contrary, enlargement of nuclear speckles are observed when transcription
is inhibited by α-amanitin (Neugebauer and Roth, 1997) or when pre-mRNA splicing is
halted by antisense oligonucleotide (O'Keefe et al., 1994).

TFIP11 and its potential role in RNA splicing
TFIP11 was first identified in a yeast two-hybrid screening as a protein
interacting with tuftelin, a member of enamel matrix proteins proposed to be involved in
mineralization (Paine et al., 1998). TFIP11 is ubiquitously expressed in a wide variety of
cell types, suggesting its fundamental role in biological processes (Paine et al., 2000). The
human TFIP11 gene spans approximately 20.45 kb and has 14 exons. Two alternatively
spliced transcripts have been thus far identified (Figure 3). These two variants differ in
the 5’ UTR and give rise to the same protein. TFIP11 is highly conserved among the
different animal species with primates, dogs, rodents, pigs, and cows sharing greater than
90% homology at the protein level. Other species share significant homology to human
9
TFIP11; with chicken at 88%, frog at 79%, zebra fish at 65%, and the honey bee at 42%
(Figure 4).

Figure 3. Two alternatively spliced isoforms of human TFIP11. (Taken from National
Center of Biotechnology Institute webpage)

The remarkable conservation across the species suggests that TFIP11 has
important physiological function. TFIP11 contains a G-patch domain, which is the
highly conserved region of this protein. The G-patch domain characterized by six highly
conserved glycine residues is an approximately 48 amino acid domain. The G-patch
domain is primarily identified based on the signature hh(x)
3
Ga(x)
2
GxGhG(x)
4
G, where h
stands for a bulky, hydrophobic residue (I, L,V,M), a stands for an aromatic residue
(F,Y,W) and x is any residue (Aravind and Koonin, 1999). This putative RNA-binding
domain found in several RNA-associated proteins is commonly present among
eukaryotes but it is absent in archaea and bacteria (Aravind and Koonin, 1999). In
addition to its putative function in RNA binding, the G-patch domain also mediates
protein-protein interaction. The G-patch domain of Spp2, a protein identified as a
genetic suppressor of Prp2 mutant, was shown to interact with the C-terminal half of
Prp2, an RNA helicase required for the first transesterification reaction of pre-mRNA
splicing in Saccharomyces cerevisiae (Silverman et al., 2004). In addition to the G-patch
domain, recent analysis revealed that all metazoan TFIP11 proteins, ranging from worms
10

Figure 4. ClustalW Formatted Alignment of TFIP11 and related proteins amongst various
species (human; TFIP11, chicken; TFIP11, zebra fish; tfip11, honey bee; stip,
D.melanogaster; sip1, C.elegans; STIP, S. cerevisiae; Ntr1) . The G-patch regions of all
proteins are boxed.

11
to humans, contain unrecognized conserved motif, i.e., six short WxW(F/Y) repeats C-
terminal to the G-patch domain, suggesting that they represent a new protein motif
potentially mediating protein-protein interactions (Ji et al., 2007).
TFIP11 is localized to a distinct domain in close proximity to nuclear speckles
(Wen et al., 2005). TFIP11 was shown to reside in a novel subnuclear compartment
called TFIP11 body (Figure 5i), which diffused into the nucleoplasm following RNaseA
treatment (Wen et al., 2005). This finding suggested that the retention of TFIP11 to these
TFIP11 bodies is RNA dependent. The nuclear localization of TFIP11 is sensitive to
RNA polymerase II (pol II) transcription, but independent of translation (Wen et al.,
2005). Treatment with α-amanitin at a concentration of 50 µg/ml, which inhibits the
transcription by RNA pol II, resulted in enlarged size and reduction in number of TFIP11
speckles (Figure 5ii). Treatment with high concentration (300 µg/ml) of α-amanitin to
inhibit the transcription by RNA pol II and pol III showed no further effect (Figure 5iii).
It has been suggested that the enlargement of splicing factor compartments results from
the accumulation of splicing components in response to reduction of steady-state pre-
mRNA levels (Wen et al., 2005).

Figure 5. Effect of transcription inhibition on TFIP11 localization. (Wen et al., 2005)
12
The phosphorylation state of splicing factors is believed to be one mechanism that
drives the movement between the active splicing sites and the storage sites. Interestingly,
TFIP11 also undergoes posttranslational phosphorylation. Recent phosphoproteomic
analyses have identified at-least 4 serine and 2 tyrosine residues as phosphorylation sites
(Ballif et al., 2004; Beausoleil et al., 2004; Dephoure et al., 2008; Olsen et al., 2006; Villen
et al., 2007). This is reminiscent to the activation of SR proteins. SR proteins have been
shown to be regulated by phosphorylation, which alters their subcellular localization and
affects their ability to interact with RNA/proteins (Yeakley et al., 1999). Similarly,
phosphorylation events to TFIP11 may be critical for cytoplasmic to nuclear transport,
nuclear localization, TFIP11-protein or TFIP11-RNA interactions. In common with SR
proteins, TFIP11 was shown to regulate alternative splicing in a concentration-dependent
manner (Wen et al., 2005). In vivo splicing assay demonstrated that increased level of
TFIP11 expression can modulate the splice site selection in E1A pre-mRNA splicing,
promoting the generation of 10S isoform (Wen et al., 2005).
Nineteen complex-related protein 1 (Ntr1), the yeast homologue of TFIP11, was
first identified for its weak association with the nineteen complex (NTC), a protein
complex critical for spliceosome activation (Hazbun et al., 2003). Ntr1 was shown to
coprecipitate with intron containing post-spliceosome and function in spliceosome
disassembly (Boon et al., 2006; Tsai et al., 2005). Immunoprecipitation assay revealed
that Ntr1 forms a stable complex with Ntr2 and Prp43 in the splicing extract. Moreover,
it was shown that the presence of Ntr1 in the postsplicing excised intron complex is
13
essential for the interaction of Prp43 with the excised intron before the dissociation of the
spliceosomal components. It has been proposed that Ntr1 promotes the release of the
excised intron from splicing complexes by acting as a spliceosome receptor, or RNA-
targeting factor, for Prp43 (Boon et al., 2006). Recently, further evidence was reported to
support the role of Ntr1 as an accessory factor of Prp43 (Tanaka et al., 2007). An in
vitro study showed that addition of Ntr1 in the splicing reaction containing Prp43 with
weak helicase activity enhances the level of unwound substrate, suggesting that Ntr1 can
stimulate the helicase activity of Prp43 (Tanaka et al., 2007). The N-terminal 120 amino-
acid segment of Ntr1, which contains the G-patch domain, was shown to be sufficient to
stimulate the helicase activity. Furthermore, missense mutations in the G-patch domain
disrupted the interaction and hence impaired the ability to activate Prp43 helicase activity
(Tanaka et al., 2007). In addition to function in pre-mRNA splicing, Ntr1 is also involved
in DNA double-strand break repair (Herrmann et al., 2007b). Double-strand breaks
(DSBs) can arise in DNA through genotoxic stress or as a consequence of DNA synthesis
and cell differentiation. Non-homologous end-joining (NHEJ) is one of the mechanisms
that cells use for DSB repair. NHEJ in mammalian and yeast cells require a set of
common core factors including DNA ligase LIG4 (Dnl4p), and its associated factor
XRCC4 (Lif1p). Ntr1 interacts with Lif1p in a way that prevents binding of Dnl4p,
implicating its role in the regulation of NHEJ by sequestering the DNA ligase cofactor
into an inactive complex (Herrmann et al., 2007b). This interaction is conserved in

14
evolution because TFIP11 also interacts with XRCC4 in a way that excludes LIG4 in the
complex (Herrmann et al., 2007b).
Human TFIP11 appears to have an analogous role with its yeast homologue in
pre-mRNA splicing. TFIP11 and human homologue of Prp43 (DHX15) have been
identified as protein components of the spliceosome in a number of comprehensive
proteomic analyses (Chen et al., 2007b; Deckert et al., 2006; Hartmuth et al., 2002;
Makarov et al., 2002; Rappsilber et al., 2002; Zhou et al., 2002). A study on functional
human spliceosomes isolated under physiological condition revealed that TFIP11 is
associated with U4/U6.U5 snRNP during the precatalytic state (Deckert et al., 2006).
The most recent work using affinity purification from in vitro splicing reaction has
identified TFIP11 in post-splicing lariat-intron complexes (Yoshimoto et al., 2008). In
this study, the post-splicing lariat-intron complexes have been classified into two groups
termed the intron large (IL) and intron small (IS) complexes (Figure 6). TFIP11 was
shown as a stable component of the IL complex (40S), which is proposed to be the
precursor of IS complex (20S). After hPrp43 is recruited to the post-splicing complex by
TFIP11, the splicing factors and snRNAs (U2, U5, and U6) dissociate from the IL
complex, resulting in transition to the IS complex and subsequently efficient turnover of
excised intron (Yoshimoto et al., 2008). In addition, it was recently shown that depletion
of TFIP11 by siRNA leads to the accumulation of U4/U6 snRNPs in Cajal bodies, a
nuclear structure involved in import and biogenesis of snRNPs (Stanek et al., 2008).
These findings strongly suggest the role of TFIP11 in late stage of pre-mRNA splicing.
15

Figure 6. A model for the post-splicing intron turnover pathway. (Yoshimoto et al., 2008)

TFIP11-interacting proteins
A number of TFIP11-interacting proteins involved in RNA processing have been
identified in a yeast two-hybrid (Y2H) screening of a mouse embryonic cDNA expression
library (Wang et al., 2006). These include CCNL1, DEAD box polypeptide 47 (Ddx47),
EWS, and polyA-binding protein cytoplasmic 1 (Pabpc1). Of these TFIP11-interacting
proteins, a number of molecular-based studies have identified CCNL1 and EWS as being
either involved, or potentially involved in RNA processing (Wang et al., 2006). Cyclin
L1 is a cyclin protein related to the C-type cyclins that are involved in regulation of RNA
polymerase II transcription. Cyclin L1, previously known as Ania-6, was shown to be
highly upregulated upon dopamine stimulation in the brain tissues (Berke et al., 2001).
Subsequently, it was identified as regulatory partner for cyclin-dependent kinase 11
(CDK11), which can phosphorylate SC35 and the C-terminal domain (CTD) of pol II
(Dickinson et al., 2002). These findings suggested a link between transcription and RNA
splicing. Cyclin L1 was also characterized as a splicing factor that regulates alternative
16
splicing by interacting with CDK13/CDC2L5; however, Cyclin L1 has not been identified
in any of the proteomic studies of spliceosomal components. EWS is involved in a
number of cancers caused by chromosomal translocation either with genes of the
erythroblastostosis virus-transformed sequence (ETS) family or with other transcription
factors. The ETS family of transcription factors is characterized by a unique DNA
binding domain, winged helix-turn-helix. These transcription factors can positively and
negatively modulate gene expression, which results in diverse biological processes
(Sharrocks, 2001). In common with TFIP11, EWS has been identified as a spliceosome
component in large-scale proteomic analyses (Chen et al., 2007b; Rappsilber et al., 2002).
Furthermore, EWS has been shown to interact with several components of the
transcriptional complex and the splicing factors. For example, U1C, one of three human
U1 snRNP-specific protein and the YB-1 (Y-box binding) protein, known to be involved
in transcriptional regulation, mRNA processing, and translation, have been identified as
interacting partners of EWS (Chansky et al., 2001; Knoop and Baker, 2000). Association
of EWS with components in both transcriptional complex and the splicing machinery
imparts the functional similarities between EWS and the CTD. These reported
interactions of EWS with both transcriptional regulators and spliceosome components
suggest its potential role in linking of transcription and pre-mRNA splicing. Taken
together, the interactions of TFIP11 with cyclin L1 and EWS suggest that these three
proteins are associated with pre-mRNA splicing.

17
Cyclin L1, a component of splicing factor compartment
Cyclin L1 belongs to the cyclin family that contains C-terminal arginine- and
serine-rich (RS) domain, and a characteristic cyclin box. The RS domain is hallmark of the
serine/arginine family of splicing factors required at various steps of spliceosome
assembly and regulated splicing (Graveley, 2000). Cyclin L1 is a nuclear protein that
localizes to the splicing factor compartment (Herrmann et al., 2007a). The human
CCNL1 gene spans approximately 12.90 kb and has 11 exons. At least 3 alternatively
spliced isoforms, including cyclin L1α, and β have been identified. Cyclin L1α, the longest
isoform is a 526 amino acid cyclin comprising an N-terminal cyclin box and a C-terminal
RS domain. Cyclin L1β contains the entire cyclin box but lacks the RS domain. The long
splice variant of cyclin L1 is localized to the nuclear speckles, whereas the short isoform
is diffusely distributed to the cytoplasm and nucleus (Berke et al., 2001; de Graaf et al.,
2004). Further experiments characterized cyclin L1 and cyclin L2, a closely related
family member, as cyclin partners of CDK12, 13 (Chen et al., 2006; Chen et al., 2007a).
CDK13 displayed a diffuse nuclear distribution when transfected alone. Overexpression
of CCNL1α modulated the localization CDK13 to the nuclear speckles and showed
moderate degree of colocalization (Chen et al., 2007a). These CDK-cyclin complexes
regulate the splicing pattern of the E1A minigene in a similar manner, i.e., promoting the
usage of distal 5’ splice site (Chen et al., 2007a) and this effect is antagonized by SC35.
Despite sharing related CDK partners and similar regulatory effects on alternative
splicing, cyclin L1 and cyclin L2 have differing degrees of intranuclear mobility
18
(Herrmann et al., 2007a). Photobleaching experiments on interphase cells revealed that
cyclin L1 belongs to the immobile component of nuclear speckles, whereas cyclin L2 is
highly dynamic within the nucleus (Herrmann et al., 2007a).
Unlike other RS-domain containing splicing factors, cyclin L1 was shown to be
independent of transcriptional arrest by actinomycin D. Furthermore, over-expression of
cyclin L1 surpassed the effect of actinomycin D on alteration of speckle morphology of
SC35 (Herrmann et al., 2007a). It was proposed that cyclin L1 is integral to locally
immobilized binding sites for proteins localized to the splicing factor compartment
(Herrmann et al., 2007a). Mutational analyses demonstrated that a stretch of basic amino
acids within the RS domain is responsible for the immobility of wild-type cyclin L1.
However, the RS domain alone is not sufficient for the immobility as it appears that the
cyclin domain or intervening sequence between the cyclin domain and the RS domain is
required to fulfill this capability (Herrmann et al., 2007a).

EWS, a multifunctional protein
The EWS protein belongs to a family of RNA-binding proteins defined by the
presence of an N-terminal region rich in glutamine, serine, and tyrosine, an RRM, a zinc
finger motif and at least an RGG-repeat region. This protein family known as the TET
family, comprises TLS (translocated in liposarcoma)/FUS, EWS, and TAF15/hTAFII68
(TATA-binding protein-associated factor 15/human TATA-binding protein-associated
factor II 68). The human EWS gene spans approximately 40 kb and has 17 exons
19
(Plougastel et al., 1993). Alternative splicing of the EWS gene produces two EWS
transcripts, EWS and EWS-b. The dominant isoform, EWS, contains all identified exons,
and the other isoform lacks exons 8 and 9. An in vitro study showed that EWS-b isoform
binds to poly(G) and poly(U) RNA, whereas the truncated EWS-b lacking the C-terminal
domain only recognizes poly(G) homopolymer (Ohno et al., 1994). The C-terminal 86
amino acids, which constitute an RGG box, confer the RNA-binding activity. It has been
proposed that a key function of RGG boxes in the wild-type EWS is to restrict the
promiscuous transcriptional activation by the N-terminal region (Alex and Lee, 2005). In
addition, EWS contains an IQ domain, which is phosphorylated by protein kinase C. An
in vitro study showed that EWS can associate with calmodulin via this domain,
implicating a link between RNA processing and Ca
2+
signal transduction pathways
(Deloulme et al., 1997).
EWS was initially identified as a protein product of the fusion gene EWS-FLI1 in
biopsies from the Ewing’s sarcoma family of tumors. Subsequently, the EWS fusion
proteins have been found in a variety of cancers. In the majority of reported Ewing
sarcomas, the chromosomal breakpoint is localized in introns 7 or 8 of EWS locus. In all
cases, the N-terminus of EWS, harboring transcriptional activation domain, is fused to the
DNA-binding domain of a transcription factor, resulting in potent chimeric transcription
factor. This aberrant transcription factor exerts its neoplastic activities by altering gene
expression, leading to changes in biological processes (Xia and Barr, 2005). Several lines
of evidence have supported the notion that EWS may be involved in transcription and
20
splicing processes. A number of EWS-interaction partners have been identified by the
yeast two-hybrid assay, and in vitro GST pull-down assays. EWS was shown to interact
with TFIID complex, a DNA-binding component of the basal transcriptional machinery
(Bertolotti et al., 1998). TFIID, composed of TATA-box binding protein (TBP) and
multiple TBP-associated factors (TAFs), is critical for transcription initiation. Moreover,
EWS was also shown to associate with certain subunits of pol II complex, a key regulator
of eukaryotic gene transcription (Bertolotti et al., 1998). Further studies revealed that
EWS interacts with hyperphosphorylated pol II through its N-terminal domain and
recruits the TLS-associated SR (TASR) splicing factor through the C-terminal domain
(Yang et al., 2000). This suggests a role for EWS as an adaptor linking the transcription
and RNA splicing.
It is well established that RNA splicing is tightly coupled to transcription.
Splicing of the mRNA precursor takes place in a close vicinity of active transcription
sites. By providing a platform for various RNA processing factors, the CTD plays an
essential role in linking transcription and mRNA processing. The human CTD,
comprising 52 heptapeptide repeat with the consensus sequence YSPTSPS, can be
differentially phosphorylated. This allows the CTD to adopt different known and
hypothetical conformations, enabling interactions with multiple protein partners
(Komarnitsky et al., 2000; Meinhart et al., 2005; Phatnani and Greenleaf, 2006). In
addition to known components of transcription complex, several splicing factors have
been identified as EWS-interaction partners. For instance, U1C, an essential component
21
of the U1 snRNP, was shown to interact with the N-terminal domain of EWS both in
vitro and in vivo assays (Knoop and Baker, 2000). U1C was also shown to bind the 5’
splice site prior to binding of the U1 snRNA and interaction of U1C with the 5’ splice
site was proposed to be the earliest step in the splicing pathway (Du and Rosbash,
2002). Importantly, U1C is required for stable association of U1 snRNP with the 5’
splice site, which is critical for efficient complex formation (Heinrichs et al., 1990). Stable
association of U1 snRNP with pre-mRNA is required for the initiation of spliceosome
assembly, whereby the pre-mRNA is committed to the splicing process. Additionally,
SF1, which is involved in initial recognition of the branch point sequence, was identified
as EWS-interacting protein as well (Zhang et al., 1998). The SF1-interacting region was
mapped to the N-terminal domain of EWS. SF1 was shown to be essential for
spliceosome assembly using in vitro reconstitution assay (Kramer, 1992), but dispensable
for pre-mRNA splicing in vivo (Tanackovic and Kramer, 2005).
Recently, analysis of EWS deficient mice showed high post-natal mortality likely
due to defect in B lymphocyte development and meiosis (Li et al., 2007). Detailed
analysis of those animals revealed that the bivalent formation in meiosis is disrupted,
suggesting that EWS may participate in the annealing of homologous DNA sequences. In
support of these data, in vitro studies showed that EWS can promote pairing of
homologous DNA (Guipaud et al., 2006) which is an important step in DNA double-
strand break repair. In this gene deletion study, it also was shown that EWS is
colocalized with perinuclear and intranuclear lamin A/C to some extent and further
22
experiments showed coprecipitation of EWS and lamin A/C (Li et al., 2007).
Furthermore, EWS-deficient cells displayed marked decrease of lamin A/C expression,
which possibly results in nuclear lamina dysfunction. These findings suggested that in
addition to its roles in B cell development and meiosis, EWS is also potentially involved
in cellular senescence (Li et al., 2007).
TFIP11 has been classified as a putative RNA-binding protein based on the
presence of G-patch domain. In general, a single copy of RNA-binding domain is not
sufficient to confer substrate specificity (Lunde et al., 2007). By interacting with other
proteins, the protein-protein interaction may modulate the specificity of a given domain.
TFIP11 appears to have multiple protein partners. In protein-protein interaction
networks, protein may vary their partners spatiotemporally. The capability of a given
protein to interact with multiple partners enables that protein to serve multiple functions.
It is intriguing that TFIP11 may participate in multiple cellular activities as diverse as
pre-mRNA splicing, cell cycle activity, and tumorigenesis.

23
Chapter 2
TFIP11 is involved in spliceosome disassembly and enhances the splicing activity
in vivo double reporter assay
Introduction
The yeast homologue of TFIP11, Ntr1 shares ~ 30% amino acid similarity with
mammalian TFIP11 protein (Figure 4). Ntr1 has been shown to interact directly with
Prp43, resulting in the recruitment of Prp43 to the spliceosome (Boon et al., 2006; Tsai et
al., 2005). This interaction is a required step for the release of the lariat intron and
spliceosome disassembly in yeast (Boon et al., 2006; Tsai et al., 2005). With this yeast-
based knowledge of Ntr1 and Prp43 spliceosome-related activities, similar functional roles
for TFIP11 and DHX15 in mammalian cells have been described. TFIP11, a protein
component of the U4/U6.U5 snRNP (Deckert et al., 2006), recruits DHX15 from the
nucleoplasm (Wen et al., 2008; Yoshimoto et al., 2008) , thus enabling the release of the
lariat intron during late-stage pre-mRNA splicing (Yoshimoto et al., 2008). Failure of
TFIP11 to recruit and interact with DHX15 results in the failure of the splicing complex
to disassemble and release U2, U5, and U6 snRNPs. As a consequence, post-splicing
intron complexes accumulate, thus compromising efficient recycling of splicing factors in
the next round of pre-mRNA splicing (Yoshimoto et al., 2008). In addition, RNA
interference studies targeting STIP (septin and tuftelin-interacting proteins, the C. elegans
homologue of TFIP11), show morphological abnormalities starting at about the 16-cell
stage and 100% embryonic lethality (Ji et al., 2007). This lethal phenotype in C. elegans
24
is rescued using either a Drosophila or human TFIP11 coding sequence under the control
of the native C. elegans STIP promoter (Ji et al., 2007). These data suggest that human
TFIP11 and its homologues across a wide variety of species perform similar functions
and serves non-redundant roles in biological processes. In this chapter, I examine the
functional role of TFIP11 in pre-mRNA splicing using in vitro splicing assays and double
reporter splicing assay.

Materials and methods
Cell culture
Human embryonic kidney cells (HEK293) and HeLa cells, which are human
epithelial cell line derived from cervical carcinoma, were maintained in Dulbecco’s
modification of Eagle’s medium (DMEM) supplemented with 10% (v/v) fetal calf serum
(FCS).

Small interfering RNA transfection
Preannealed siRNAs were obtained from Ambion (Austin, TX). The control
siRNA was negative silencer1 (AM4611). The sequence of TFIP11 siRNA was 5’-
CCUGUUAAGCAGGACGACUtt. HeLa cells were plated in 100-mm culture plate so
that they reached ~50% confluency on the day of transfection. The cells were transfected
with siRNA at the concentration of 100 nM using Oligofectamine (Invitrogen
Corporation) as described by the manufacturer.
25
Preparation of nuclear extracts
HeLa cells were harvested 48 h after transfection. The cells were washed once
with phosphate-buffered saline (PBS), scraped, and centrifuged at 1000 rpm at 4
o
C for 5
min. The cell pellet was resuspended in 5x packed cell volume of hypotonic buffer (10
mM HEPES pH 7.9, 1.5 mM MgCl
2
, 10 mM KCl). The cell lysate was centrifuged again
as mentioned above, resuspended in 3x packed cell volume of hypotonic buffer, and
incubated on ice for 10 min. Subsequently, the cell pellet was lysed in Douce glass
homoginizer with type B pestle for 10-12 strokes. Lysed cells were monitored under
phase-contrast microscope. After homogenized, the cell lysate was centrifuged at 4000
rpm at 4
o
C for 5 min and the nuclear pellet was collected. Nuclei were resuspended in
½ x packed nuclear volume of low salt buffer (20 mM HEPES pH 7.9, 1.5 mM MgCl
2
,
0.2 mM EDTA, 20 mM KCl), stirred gently, followed by adding ½ x packed nuclear
volume of high salt buffer (20 mM HEPES pH 7.9, 1.5 mM MgCl
2
, 0.2 mM EDTA, 1.4
M KCl), and incubated at 4
o
C for 30 min with end-over-end rotation. The crude nuclear
extract was then cleared by centrifugation at 14,000 rpm 4
o
C for 15 min. The
supernatant, which is high salt nuclear extract, was collected, transferred into pre-chilled
mini-centricons (Amicon, Microcon Ultracel YM-3, 3000 MWCO), and spun down at
14,000 rpm 4
o
C for 1 h. The concentrated high-salt nuclear extract was then transferred
into Mini Dialysis Units (Pierce, Slide-A-Lyzer, 10,000 MWCO) and dialyzed against
250 ml dialysis buffer (20 mM HEPES pH 7.9, 0.2 mM EDTA, 100 mM KCl) for 2 h.
After dialysis, the nuclear extract was stored at -80
o
C.
26
Recombinant protein
Human TFIP11 recombinant protein was obtained from Abnova (Taipei city,
Taiwan). The full length TFIP11 was synthesized in a wheat germ in vitro transcription-
translation system (Madin et al., 2000).

In vitro transcription assay
The human β-globin minigene containing exon1, intron 1, and exon 2, was
transcribed using T7 RNA polymerase (Promega). The β-globin substrate was linearized
by EcoRI digestion, followed by ethanol precipitation. The transcription assay
containing 0.4 mM ATP and CTP, 0.1 mM UTP and GTP, 0.67 µM
32
P-UTP, and 8
units RNasin, was incubated at 37
o
C for 2½ h. The radio-labeled RNA was run on 6%
denaturing polyacrylamide gel and then briefly exposed to film. The band corresponding
to the full-length RNA was excised and eluted in RNA elution buffer (10mM Tris pH7.5,
0.5 M NaAc pH 5.6, 0.6% SDS, 1 mM EDTA) overnight. The eluted RNA was ethanol-
precipitated and stored at -20
o
C.

In vitro splicing assay
The splicing assays were carried out in a final volume of 25 µl, containing 50 µg of
nuclear extract, 50 mM KCl, 3.2 mM MgCl
2
, 1 mM ATP, 20 mM creatine phosphate, 10
units of RNasin, and 2 x 10
4
cpm of the β-globin pre-mRNA. The splicing reaction was
incubated at 30
o
C for 2½ h. After incubation, the RNA was treated with proteinase K,
27
phenol-chloroform extraction, ethanol precipitation, and resolved in 10% denaturing
polyacrylamide gel. The precipitated RNA bands were visualized and quantitated by
Phosphoimager analysis using Quantity1 (Bio-rad, Hercules, CA). Splicing efficiency is
defined as spliced products/(unspliced RNA + spliced products). The lariat-intron
fraction is defined as lariat intron/(lariat intron + spliced products + unspliced RNA).
The splicing assay was repeated at least three times. For reconstitution assay, 20 ng of
recombinant TFIP11 (Abnova, Taiwan) was added in the splicing reaction prior to the
incubation.

In vivo β-galactosidase/luciferase splicing assay
HEK293 cells were seeded at 4 x 10
5
cells/well in a 12-well plate and grown in
DMEM supplemented with 10% (v/v) FCS. Cells were transfected with the double
reporter pTN24 (Nasim and Eperon, 2006) and TFIP-FLAG (Wen et al., 2008) using
Lipofectamine 2000 (Invitrogen) as described by the manufacturer. For control, cells
were transfected with pTN24 and pCMV-3Tag-8 (Stratagene, La Jolla, CA), which is the
backbone vector of TFIP-FLAG. At 24 h after transfection, cells were washed twice with
PBS and lysed in 100 µl of lysis buffer. β-galactosidase and luciferase were measured
using Dual Light
(R)
system (Applied Biosystems). A 10-µl aliquot of cell lysate was
mixed with 25 of buffer A and incubated at RT for 10 min. Then, 100 µl of buffer B was
added to the reaction and the luciferase signal was measured after a 5-sec delay. After
incubated for 30 min, 100 µl of Accelerator-II was added and the β–galactosidase was
28
obtained after a 5-sec delay. The ratio of luciferase activity to β-galactosidase activity
represents the splicing efficiency. Transfected samples were measured in triplicate per
data point. Statistical analysis was performed using student T-test.

Western blot analysis
Nuclear extracts and cell lysates were resolved by SDS-PAGE and transferred to
Immobilon-P membrane (Millipore, Billerica, MA). The membranes were incubated with
rabbit-generated TFIP11 antibody at 1:2,000 dilution (Wen et al., 2008) and reprobed
with monoclonal β-actin antibody (Sigma-Aldrich, St Louis, MO) at 1:20,000 dilution.
Following the primary antibody incubation, the membranes were washed and incubated
with the appropriate horseradish peroxidase-conjugated secondary antibody. The
protein-antibody complexes were visualized by enhanced chemiluminescence (Amersham
Biosciences, GE Healthcare, Piscataway, NJ).

Results
TFIP11 is involved in spliceosome disassembly and enhances splicing activity in
vivo
Several studies on budding yeast have shown that Ntr1 is associated with the
postsplicing excised intron complex, and that it is essential for the release of lariat-intron
from the spliceosome (Boon et al., 2006; Tsai et al., 2005). The G-patch domain of Ntr1
was shown to interact with Prp43 and this interaction is critical for spliceosome
29
disassembly (Tsai et al., 2005). Like its yeast counterpart, TFIP11 interacts with the
mammalian homologues of Prp43 (Wen et al., 2008; Yoshimoto et al., 2008). To examine
the functional role of TFIP11 in pre-mRNA splicing, I performed in vitro splicing assays
using nuclear extracts generated from HeLa cells either transfected with negative silencer
or TFIP11 siRNA. In HeLa cells transfected with TFIP11 siRNA, TFIP11 protein was
depleted approximately 70% (Figure 7B). Depletion of TFIP11 resulted in significantly
increased amounts of the lariat intron (Figure 7A, lane 2). Importantly, this defect was
rescued by recombinant TFIP11 in add-back experiment (Figure 8A, lane 3). These results
strongly support the notion that TFIP11 is involved in the release of excised introns from
spliceosomal complexes. These observations also suggest that TFIP11 promotes pre-
mRNA splicing. To test this hypothesis, I carried out TFIP11 overexpression
experiments using a cell culture double-reporter assay, in which luciferase is expressed
only after intron removal (Nasim and Eperon, 2006). HEK cells were cotransfected with
the reporter and an expression construct encoding TFIP-FLAG. The splicing efficiency
was then quantitated relative to that of cells cotransfected with reporter and empty
FLAG vector. In support of the hypothesis that TFIP11 promotes efficient pre-mRNA
splicing, I observed that TFIP11 overexpression results in a > 2-fold activation of the
splicing efficiency (p<0.05) (Figure 9). Based on these functional assays and previous
results, I conclude that TFIP11 is involved in maintaining efficient intron removal by
accelerating the recycling of functional snRNPs.

30

Figure 7. Accumulation of lariat intron in TFIP11-depleted extract. A, human β-globin
pre-mRNA was incubated with HeLa nuclear extracts. B, TFIP11 in cell lysates of HeLa
cells transfected with either negative silencer or TFIP11 siRNA was detected by
immunoblot using rabbit TFIP11 antibody. C, Quantitation of the lariat intron fraction.
Error bars represent the standard error of mean. Statistically significant comparison data
indicated by *, p < 0.05.

31

Figure 8. Reconstitution assay. A, 20 ng of recombinant TFIP11 was added in the splicing
reaction. B, Quantitation of the lariat intron fraction. Error bar represents the standard
error of mean. Statistically significant comparison data indicated by *, p < 0.05.

32

Figure 9. TFIP11 stimulates splicing activity in vivo. A, TFIP-FLAG and empty FLAG
vectors were cotransfected with double reporter plasmid pTN24 in HEK293 cells. The
ratio of luciferase to β-galactosidase acitivities were calculated as relative splicing activity
with the activity of the empty vector set at 1. The result shown here represents three
independent experiments in which three wells of cells were transfected and each cell
lysate was measured in triplicate. Error bar represents the standard error of mean.
Statistically significant comparison data indicated by *, p < 0.05. B, Immunoblot analysis
of cell lysates from empty FLAG vector and TFIP-FLAG transfected cells.

Discussion
Using in vitro splicing assays, I have demonstrated that depletion of TFIP11 in
HeLa nuclear extract results in accumulation of the lariat intron. These data also
complement the previous studies on functional role of human TFIP11 during spliceosome
disassembly, and further solidify the notion that TFIP11 is involved in the release of
lariat intron during late stages of the pre-mRNA splicing pathway. The amount of lariat
intron in TFIP11-depleted splicing reaction shown here, while modest, is statistically
significant. This is possibly due to the efficiency of siRNA knockdown, which did not
completely abolish the TFIP11 protein. Therefore, the stoichiometric ratio of TFIP11 to
33
pre-mRNA may not be severely diminished in this in vitro assay system. In addition,
evidence that Ntr1 functions in concert with Ntr2 and Prp43 to catalyze the release of
lariat intron suggests an additional protein involved in spliceosome disassembly in
mammalian system. To date, no mammalian homologue of Ntr2 has been identified. In
yeast, Ntr2 has been proposed to mediate the interaction of the NTR complex and U5
snRNP through binding to Brr2, a U5-associated RNA helicase (Tsai et al., 2007). Brr2
was shown to function as a remodeling factor for both spliceosome activation and
disassembly (Small et al., 2006). It has been proposed that Brr2 in cooperation with
Snu114 mediate the dissociation of spliceosome components after the second step of
splicing (Small et al., 2006). This highly intricate network of protein-protein interactions
highlights the complexity of splicing event, which is subject to multiple layers of
regulation.
Using in vivo double-reporter splicing assay, I also show that TFIP11
overexpression increases the splicing activity. This increase in splicing activity is likely
related to the more efficient recycling of splicing factors. Previous study has shown that
depletion of TFIP11 results in a dramatic and specific accumulation of U4/U6 snRNP in
Cajal bodies (Stanek et al., 2008). Accumulation of U4/U6 snRNP is indicative of the
impaired U4/U6.U5 snRNP assembly and suggests that TFIP11 is implicated in this
process. As described in the previous chapter, EWS was identified as TFIP11-interaction
partner in Y2H analyses. Interestingly, EWS was reported to colocalize with SMN, a
component of Cajal bodies (Young et al., 2003) . It is conceivable that TFIP11 may
34
functionally interact with EWS in Cajal bodies and this interaction may contribute to
import and biogenesis of snRNPs. Given that TFIP11 interacts with multiple protein
partners, TFIP11 may participate in multiple aspects of RNA metabolism and cellular
activities as diverse as pre-mRNA splicing, cell cycle activity and tumorigenesis.

35
Chapter 3
Identification of nuclear localization signal and speckle-targeting sequence of
TFIP11
Introduction
The most notable feature of TFIP11 is the G-patch domain, which is a signature
motif for RNA-associated proteins. The G-patch domain characterized by six highly
conserved glycine residues is often found in combination with other RNA-binding motifs
such as RRM, ZNF (Zinc finger motif), and dsRBD (double-stranded RNA binding
domain) (Aravind and Koonin, 1999). Unlike other G-patch proteins, the G-patch
domain in TFIP11 is the only recognizable motif located in the N-terminal region. In
addition to its role in RNA binding, the G-patch domain was also shown to participate in
protein-protein interaction (Silverman et al., 2004). Similarly, the G-patch domain of
TFIP11 has been shown to be interacting domain with DHX15, an RNA helicase essential
for the spliceosome disassembly (Yoshimoto et al., 2008).
As previously described, TFIP11 shows punctate pattern in the nucleus
resembling the nuclear speckles, subnuclear compartment for most if not all splicing
factors (Wen et al., 2005). The nuclear localization signal (NLS) and speckle-targeting
sequence of TFIP11 have not been identified. A potential bipartite NLS of STIP, the C.
elegans homologue of TFIP11, was noted in the N-terminal region upstream of G-patch
domain (Ji et al., 2007). In contrast to STIP, a putative bipartite classical NLS in TFIP11
was noted between amino acids 740-753 in the C-terminal region. To determine the
36
sequence element responsible for nuclear and speckle localization, I have generated a
series of C-terminal deletion and mutant constructs fused to GFP, transfected into
mammalian cells, and visualized by confocal microscopy.

Materials and methods
Expression constructs
Mouse TFIP11 cDNA corresponding to the entire open reading frame (ORF) of
838 amino acids minus the initial ATG was cloned into the vector pEGFP-C1 (Clontech,
Mountain View, CA) and the resulting plasmid was named TFIP11-C1 (Wen et al.,
2005). All C-terminal deletions were created in an identical manner using PCR in which
the reverse primer ended as the coding sequence indicated, and this was immediately
followed by a stop codon. All mutations, including the entire G-patch deletion, were
done using the GeneEditor
TM
in vitro Site-Directed Mutagenesis System (Promega,
Madison, WI) using appropriately designed primer sets and the recommended protocols.
All PCR amplified regions were verified to be error-free by sequencing the final clones.

Cell culture
HEK293 cells were maintained in DMEM supplemented with 10% (v/v) FCS.
For transfection assays, cells were grown on four-well chamber slides (Lab-Tek). Cells
were transfected using Lipofectamine 2000 (Invitrogen Corporation, Carlsbad, CA) as
recommended by the manufacturer and incubated for 24 h. Prior to imaging cells were
37
washed with PBS, fixed with 4% paraformaldehyde, counterstained with DAPI (4′-6-
Diamidino-2-phenylindole), and mounted in VECTASHIELD medium (Vector Labs,
Burlingame, CA).

Confocal Laser Scanning Microscopy
Images were captured on a Zeiss LSM510 confocal microscope using Plan-
Apochromat 63X/1.4 oil immersion objective lens. Pinhole was set at 1 airy unit for each
channel. The excitation wavelength was set at 405 for DAPI and 488 for green
fluorescent protein (GFP).

Results
Identification of a TFIP11 speckled targeting sequence (TFIP11-STS)
Full-length TFIP11 shows a distinct nuclear speckled location (Wen et al., 2005),
but the sequences responsible have not been defined. To examine this in more detail, we
generated a range of truncation derivatives of mouse TFIP11 fused to GFP (Figure 10)
and investigated their subcellular localization in transfected HEK293 cells 24 h by
confocal laser scanning microscopy. TFIP11 amino acids 1-735 (Figure 11B) showed the
same nuclear speckle localization as previously observed for full-length TFIP11 (Figure
11A), whereas TFIP11 amino acids 1-710 localized to the cell nucleus, but was evenly
distributed throughout the nucleoplasm (Figure 11C). These results clearly suggest that
the region defined by amino acids 711-735 [I
711
MNRAVSSNVGAYMQPGARENIA
38
YL], is responsible for TFIP11’s distinctive nuclear speckle localization; I will refer to
this region as the TFIP11 nuclear speckle targeting sequence or TFIP11-STS. To
determine whether the previously identified G-patch is involved in TFIP11 localization,
two TFIP11 constructs containing mutations within the G-patch, disrupting the highly
conserved glycine residues ([G
166
RGLG] → [A
166
RALR]) and ΔG-patch, where the
entire G-patch is deleted, were generated. Analysis of both mutant constructs
demonstrated wild-type TFIP11 localization pattern (Figure 11D and not shown). These
data imply that the G-patch domain plays no role in nuclear speckle localization of
TFIP11.

Identification of an atypical TFIP11 nuclear localization signal
A sequence resembling a bipartite NLS (TFIP11 amino acids 740-753);
R
740
RK(x)
9
RR, was identified in the TFIP11 coding region and four mutant constructs
([R
752
R]→[N
752
N], [R
740]
RK]→[N
740
NT], [R
740
RK(x)
9
RR]→[N
740
NT(x)
9
NN] and
TFIP11
1-735
) were generated to test its functionality. Following transfection, all four
constructs showed distinctive nuclear speckled localization (Figure 11B, E, and data not
shown) when compared to wild-type TFIP11 (Figure 11A). Clearly, the putative NLS is
not essential for TFIP11 nuclear/nuclear speckle localization.
The fact that TFIP11 amino acids 1-710 conferred even distribution throughout
the nucleoplasm (Figure 11C), whilst TFIP11 amino acids 1-696 mediated entirely
cytoplasmic localization (Figure 11F), implied that the TFIP11 NLS is located between
amino acids 697-710. This sequence [A
697
HPSVKDKFNEALD] represents a novel
region that contains several lysine residues, but mostly non-basic polar amino acids.
39

Figure 10. Molecular strategy for the identification of a novel NLS, and a sequence
element directing TFIP11 to distinct nuclear speckles. Panel A: schematic diagram of the
TFIP11-C1 construct used in this study. Panel B: schematic of the organization of
TFIP11. Serine and tyrosine phosphorylation sites identified (*, ** respectively). G-
patch, NLS, and STS region shown, as is the [RRK(x)
9
RR] region. Panel C: brief
summary table of all constructs (wild-type and mutants) used for the analysis. Mutant
constructs identified by panels A-H in figure 11 correspond to those identified on the
right. Labeling in column 2 of panel C is used to identify images in Figure 11.
40

Figure 11. Identification of a novel NLS, and a sequence element directing TFIP11 to
distinct nuclear speckles using confocal microscope. Direct fluorescent images of TFIP11
transfected cells using either the wild-type TFIP11-C1 construct (panel A), or mutant
constructs as identified in figure 10: TFIP11
1-735
(panel B); TFIP11
1-710
(panel C);
TFIP11ΔG-patch (panel D); double mutant (panel E); TFIP11
1-696
(panel F); TFIP11
1-684

(panel G); and V
701
KDKFN→T
701
TTTT (panel H). Cells counterstained with DAPI, and
the merged image is seen in the lower right quadrant of each panel. Scale bar, 20 µm.
41
Two point mutations [V
701
KDKFN] → [T
701
TTTT] (Figure 11H), or [N
701
NNNN] (data
not shown) were generated in the full length TFIP11 sequence, both resulting in
predominantly cytoplasmic localization of GFP, which clearly indicates that V
701
KDKFN
is essential for nuclear localization of TFIP11.

Discussion
Mutational analyses of TFIP11 enabled the identification of an atypical NLS and
a region that defines a distinct speckled nuclear localization of TFIP11; the TFIP11-STS.
Both regions are well conserved across the species ranging from zebra fish to human
(Figure 4). Despite the fact that human TFIP11 can rescue the lethal phenotype of
siRNA-mediated depletion of STIP in C. elegans (Ji et al., 2007), TFIP11 and STIP
appear to have different arrangement of conserved elements responsible for nuclear
import. The sequence elements targeting STIP to the nucleus has been shown to reside in
the 1-213 amino-acid region, which contains putative bipartite NLS, whereas the atypical
NLS of TFIP11 has been identified in the C-terminal region. A database search of this
non-conventional NLS did not yield any significant homology with previously identified
NLS motifs (http://cubic.bioc.columbia.edu/db/NLSdb/). The TFIP11-STS likely
identifies a region that interacts directly with a structural component (protein or RNA) of
the storage site of TFIP11. However, it remains unknown how the structural integrity of
nuclear organelles devoid of enclosed membrane is maintained in highly organized
nuclei.
Splicing factors generally have a characteristic speckled location within the cell
nucleus, where molecular components of the spliceosome reside within these speckled
42
domains and shuttle to active sites of transcription/pre-mRNA splicing as required.
Previous studies showed that TFIP11 resides in close proximity to nuclear speckles (Wen
et al., 2005), subnuclear compartment enriched in various splicing factors including SR
proteins. The RS domain of SR proteins has been shown to be responsible for nuclear
localization (Caceres et al., 1997). Unlike other nuclear proteins, SR proteins interact
with a nuclear import receptor that is specific for this protein family (Kataoka et al.,
1999). It remains to be determined whether TFIP11 bind to specific nuclear transport
receptor and has a unique nuclear import pathway.
TFIP11 is known to undergo posttranslational modification. Phosphoproteomic
analyses have identified at least 4 serine and 2 tyrosine residues as phosphorylation sites
(Figure 10B). Interestingly, two of them reside in the G-patch domain and TFIP11-STS.
Phosphorylation has been shown to influence subcellular localization and activity of SR
proteins. Similarly, phosphorylation events may be critical for nuclear transport of
TFIP11, TFIP11-RNA, and TFIP11-protein interactions.

43
Chapter 4
Subnuclear colocalization of TFIP11 with its interacting proteins, CCNL1 and
EWS, and protein-protein interaction of TFIP11 and EWS
Introduction
Previous studies using the yeast two-hybrid assay have identified CCNL1 and
EWS as being interacting partners of TFIP11 (Wang et al., 2006). All three proteins are
functionally related to the spliceosome and involved in pre-mRNA splicing activities.
CCNL1 belongs to the cyclin family that contains C-terminal RS domain, and a
characteristic cyclin box (Dickinson et al., 2002). CCNL1 localizes to the nuclear
speckles and inhibition of cyclin L1 activity results in block of the second step of splicing
reaction (Dickinson et al., 2002). EWS is associated with various cancers that involve
chromosomal translocation, either with genes of the erythroblastosis virus-transformed
sequence (ETS) family, or with other known transcription factors (Arvand and Denny,
2001). EWS has been shown to interact with integral components of the transcriptional
complex (Bertolotti et al., 1998), SF1 (Zhang et al., 1998), and U1C (Knoop and Baker,
2000). These data imply that EWS has dual activities that span gene transcription and
RNA splicing (Law et al., 2006). To verify the biological relevance of data from Y2H, I
performed cell transfection experiments to examine the spatial relationship of these three
proteins and immunoprecipitation assay to detect the protein-protein interaction.

44
Materials and methods
Expression constructs
The TFIP11 cDNA, covering the entire ORF was released from the construct
TFIP11-N1 (Wen et al., 2005), and subcloned into the vector pCMV-3Tag-8 (Stratagene,
La Jolla, CA) using appropriate restriction enzyme sites. The resulting construct is
referred to as TFIP-FLAG. Full-length human CCNL1 cDNA was purchased from
Origene (Rockville, MD). The entire ORF of CCNL1, covering 526 amino acids and
minus its stop codon, was amplified by PCR using the forward primer 5′-
GATATCAAGACTATGGCGTCCGGGCCTC; and the reverse primer 5′-
GGCGCCTGTGCCTGCCATGTCCTG. The CCNL1 start codon is underlined. The
PCR product was directionally subcloned into the vector pcDNA3.1/CT-GFP-TOPO
(Invitrogen Corporation, Carlsbad, CA) and the resulting plasmid is called CCNL1-N1.
For EWS, a full-length human cDNA was generated by RT-PCR using total RNA from a
human lung tumor (Clontech catalogue # 636633). The primers used for PCR were
forward 5′-TCTCGAGGAGAAAATGGCGTCCACGGATTACAG; and reverse 5′-
TCCGCGGGTAGGGCCGATCTCTGCGCTCC which included an Xho I and a Sac II
restriction site respectively (underlined). The purified PCR product was then
directionally subcloned into the vector pDsRed-Express-N1 (Clontech) at the Xho I and
Sac II multicloning site. The resulting plasmid is called EWS-Red-N1. The Myc-tagged
EWS vector was prepared by removing the EWS cDNA from EWS-Red-N1 using Xho I
and Sac II restriction enzymes, and subcloning this cDNA into pcDNA3.1/myc-His
45
plasmid (Invitrogen Corporation) at the Xho I and Sac II multicloning site. This construct
is called EWS-Myc. All PCR-derived DNA products were sequenced in their entirety to
ensure no nucleotide errors affecting amino acid sequences.

Cell culture
HEK293, HeLa, and LS8 cells, which are ameloblast-like cell line established by
immortalizing the primary cultures of enamel organ epithelium with SV40 large T antigen
(Zhou and Snead, 2000), were maintained in DMEM supplemented with 10% (v/v) FCS.
Cells were grown on four-well chamber slides (Lab-Tek) for immunofluorescence or 100-
mm culture plates for coimmunoprecipitation. Lipofectamine 2000 (Invitrogen
Corporation) was used as the transfection reagent according to the manufacturer’s
instruction.

Immunofluorescence
At 24-h after transfection, cells were washed with PBS, fixed with 4%
paraformaldehyde for 10 min at room temperature (RT), permeabilized with 1% Triton
X-100 for 5 min at RT, and washed with PBS. After permeabilization, cells were
incubated with blocking solution (PBS containing 1% normal goat serum) for 1 h at RT.
Cells were then incubated with primary antibodies for 1 h at RT, washed with PBS three
times, and incubated with secondary antibodies for 1 h at RT. After incubation, cells
were washed with PBS three times and mounted with VECTASHIELD medium (Vector
46
Labs, Burlingame, CA). The primary antibodies were mouse anti-SC35 (Sigma-Aldrich,
St. Louis, MO) and rabbit anti-TFIP11 raised against the peptide LQNEFNPNRQRHW
Q (Zymed Laboratories Inc, South San Fransisco, CA). Secondary antibodies were Texas
Red-conjugated goat anti-mouse, Alexa Fluor 488 goat anti-mouse and goat anti-rabbit,
and Alexa Fluor 568 goat anti-rabbit antibodies (Molecular Probes, Invitrogen
Corporation).

Confocal Laser Scanning Microscopy
Images were captured on a Zeiss LSM510 confocal microscope using Plan-
Apochromat 63X/1.4 oil immersion objective lens. Pinhole was set at 1 airy unit for each
channel. The excitation wavelength was set at 405 for DAPI, 488 for GFP, and 543 for
red fluorescent protein (RFP).

Immunoprecipitation assay
Transfected cells were lysed with RIPA buffer (10 mM Tris-HCl pH 7.6, 150
mM NaCl, 1% NP-40, 1% sodium deoxycholate, 0.1% SDS and a protease inhibitor
cocktail). The cells were collected and sheared by passing through a 22-guage needle
repeatedly. The cell suspension was spun down at 14,000 rpm for 10 min. After
centrifugation, the protein concentration of the supernatant was measured using a Bio-
Rad protein assay kit (Bio-Rad, Hercules, CA). The cell lysate was pre-cleared by
incubation with protein G agarose beads for 1 h at 4
o
C. After pre-clearing, the cell lysate
47
was incubated for 2 h at 4
o
C with an anti-FLAG antibody conjugated to agarose beads
(Sigma-Aldrich) using constant motion. Immunoprecipitates were then collected by
centrifugation at 2,500 rpm for 5 minutes and washed three times with high-salt wash
buffer (25 mM Tris-HCl pH 7.6, 1M NaCl, 3 mM MgCl
2
, 0.3 mM EDTA, 0.05% NP-
40). The final pellet was resuspended in 2x SDS loading buffer, boiled for 4 min, and
stored at -20
o
C.

Western blot analysis
Immunoprecipitates and cell lysates were resolved by SDS-PAGE and transferred
to Immobilon-P membrane (Millipore, Billerica, MA). The membranes were incubated
with anti-FLAG antibody at 1:12,000 dilution or anti-Myc antibody at 1:1000 dilution
and washed 4 times for 20 min in TBST. The protein-antibody complexes were visualized
by enhanced chemiluminescence (Amersham Biosciences, GE Healthcare, Piscataway,
NJ).

Results
Subcellular localization of GFP-tagged CCNL1 and RFP-tagged EWS
The splicing factor SC35 is a well-characterized molecular marker for the nuclear
speckles. Nuclear speckles are subnuclear compartments for most, but not all, splicing
factors. To visualize the subcellular localization of CCNL1 and EWS, compared to SC35
nuclear speckles, fusion constructs were generated with CCNL1 fused to GFP (CCNL1-
48
N1) and EWS fused to RFP (EWS-Red-N1). Each construct was transfected into LS8
cells individually. Consistent with previous studies (Herrmann et al., 2007a), GFP-tagged
CCNL1 showed discrete, punctate nuclear localization that corresponds to SC35 nuclear
speckles (Figure 12A). Like CCNL1, EWS also displayed a speckled pattern of
expression within the nucleus (Figure 12B, ii). There was some, but not a significant
amount, of colocalization between SC35 and EWS (Figure 12B, iii). SC35, CCNL1 and
EWS all showed speckled nuclear localization, and in all cases expression is absent in the
nucleoli.

Colocalization of TFIP11 and CCNL1, and TFIP11 and EWS
CCNL1-N1 and EWS-Red-N1 were used to study the subcellular localization
within the cell nucleus, and related to the spatial nuclear expression pattern of endogenous
TFIP11. HeLa cells transfected with either CCNL1-N1 or EWS-Red-N1 were immuno-
labeled with the anti-TFIP11 antibody (Figure 13A, i and Figure 13B, i). TFIP11 was
shown to localize to distinct nuclear speckled domains, and was excluded from the
nucleoli as previously demonstrated using a fluorescently-tagged TFIP hybrid protein
(Wen et al., 2005). CCNL1-N1 and EWS-Red-N1 also showed a nuclear speckled
expression profile that did not extend into the nucleoli (Figure 13A, ii and Figure 13B, ii
respectively). The nuclear distribution of CCNL1 showed high degree of colocalization
with TFIP11 throughout the nucleus (Figure 13A, iii), while EWS displayed moderate
degree of colocalization with TFIP11 in the nucleus (indicated by arrowheads, Figure
49
13B, iii). The cell nuclei are identified using DAPI staining (Figure 13A, iv and Figure
13B, iv). These data suggest an apparent stable physical relationship between TFIP11
and CCNL1, while perhaps a fleeting or transient relationship exists between TFIP11 and
EWS.

Figure 12. Subcellular localization of CCNL1 and EWS with SC35. LS8 cells transfected
with CCNL1-N1 (panel A) or EWS-Red-N1 (panel B) and were fixed and labeled with
anti-SC35 antibody. Endogenous SC35 (SC35) localization (using Texas Red conjugated
goat anti-mouse antibody; panel Ai) was compared to transfected CCNL1 (tCCNL1)
localization (panel Aii) in the merged image (panel Aiii). Endogenous SC35 localization
(using Alexa Fluor 488 goat anti-mouse antibody; panel Bi) was compared to transfected
EWS (tEWS) localization (panel Bii) in the merged image (panel Biii). Scale bars, 10 µm.

50

Figure 13. Colocalization of TFIP11 and CCNL1, and TFIP11 and EWS. HeLa cells
transfected with CCNL1-N1 (panel A) or EWS-Red-N1 (panel B) and were fixed and
labeled with anti-TFIP11 antibody. Endogenous TFIP11 (eTFIP11) localization (using
Alexa Fluor 568 goat anti-rabbit antibody; panel Ai) was compared to transfected CCNL1
(tCCNL1) localization (panel Aii) in the merged image (panel Aiii). Endogenous TFIP11
localization (using Alexa Fluor 488 goat anti-rabbit antibody; panel Bi) was compared to
transfected EWS (tEWS) localization (panel Bii) in the merged image (panel Biii).
Cell nuclei are stained blue by DAPI (panels Aiv and Biv). Scale bars, 10 µm.

51

Figure 14. EWS interacts with TFIP11. HEK293 cells were transfected with plasmid
expressing EWS-Myc (lanes 1, 3, 5 and 7), or EWS-Myc and TFIP-FLAG (lanes 2, 4, 6
and 8). The input panels (lanes 1, 2, 5 and 6) show protein in the cell lysate prior to
immunoprecipitation. Cell lysates were immunoprecipitated using anti-FLAG monoclonal
antibody (lanes 3, 4, 7 and 8), and then immunoblotted with either the anti-FLAG (lanes
1-4) or anti-Myc antibody (lanes 5-8). The plasmid pcDNA was cotransfected as a blank
control to ensure equal concentrations of plasmid DNA being used for each transfection.
Immunoprecipitate (IP), Immunoblot (IB).

EWS interacts with TFIP11 in HEK293 cells
Previous studies reported the interaction between TFIP11 and CCNL1, as well as,
TFIP11 and EWS using Y2H assay (Wang et al., 2006). To verify the biological
relevance of data from yeast two-hybrid system, I performed coimmunoprecipitation
assay in HEK293 cells. Cells were transfected with EWS-Myc or cotransfected with
EWS-Myc and TFIP-FLAG. When immunoprecipitated with anti-FLAG antibody, EWS
was coprecipitated only when TFIP11 is present in the cell lysate (Figure 14, lanes 7 and
8). This in vitro, coimmunoprecipitation data demonstrated the interaction between
TFIP11 and EWS (arrowhead; Figure 14, lane 8). Using coimmunoprecipitation I have
52
been able to confirm the TFIP11-EWS interaction previously shown by the Y2H assay,
but have been unable to demonstrate an interaction between TFIP11 and CCNL1. The
failure to show a TFIP11-CCNL1 interaction by coimmunoprecipitation may relate to the
relative strengths of the protein-protein associations, or may relate to the relative
sensitivities of the in vitro based assay, as compared to the in vivo derived, Y2H data.

Discussion
In this study I have focused on the spatial relationship of three proteins related to
the pre-mRNA splicing: those being TFIP11, CCNL1, and EWS. Published data have
identified each of these proteins as having a nuclear localization, and each has functional
domains that identify them as being associated with RNA processing. Here I report
subcellular colocalization between TFIP11 and its interaction partners, CCNL1 and EWS,
which were previously identified by a Y2H library screening. Using
coimmunoprecipitation, I have confirmed the Y2H data identifying TFIP11 and EWS
interaction but have been unable to coimmunoprecipitate TFIP11 and CCNL1. The
current paradigm of spliceosome assembly is that spliceosome assembles by sequential
interaction of U1, U2, and U4/U6.U5 snRNP with the pre-mRNA, creating unique short-
lived intermediates of the spliceosome, designated E, A, B, and C complexes (Jurica et al.,
2002; Jurica and Moore, 2003). Recent proteomic analyses have identified TFIP11 and
EWS as components of spliceosome. TFIP11 was identified within complexes B*
(Makarov et al., 2002) and C (Jurica et al., 2002), EWS within complex C (Jurica et al.,
53
2002; Jurica and Moore, 2003), SC35 within complex A (Hartmuth et al., 2002). TFIP11
was previously described as localizing to subnuclear structures in close proximity to
SC35 domains (Wen et al., 2005). SC35 belongs to the SR protein family of splicing
factors primarily localized to the nuclear speckles, subnuclear domains largely
corresponding to the interchromatin granule clusters, which contain little or no DNA at
the level of electron microscopy (Lamond and Spector, 2003). Photobleaching
experiments revealed that CCNL1 is an immobile component of splicing factor
compartments (Herrmann et al., 2007a). Thus, our data demonstrating TFIP11 and
CCNL1 colocalization suggests that TFIP11 resides in close proximity to nuclear
speckles and/or may act as a subnuclear storage compartment for splicing components as
previously suggested (Wen et al., 2005). The intracellular distribution of EWS showed
punctate subnuclear structures resembling the nuclear speckles. It was previously
reported that EWS colocalizes with the survival motor neuron protein (SMN), which is a
component of Cajal bodies (Young et al., 2003). Despite the fact that EWS interacts with
the splicing factors SF1 and U1C, which both function at an early stage of spliceosome
assembly, native EWS has no apparent impact on the alternative splicing regulation of the
E1A minigene (Knoop and Baker, 2001). Unlike EWS, TFIP11 modulates splice site
selection in the E1A pre-mRNA splicing assay, suggesting that TFIP11 is involved in
alternative splicing regulation (Wen et al., 2005). It is therefore unlikely that the
interaction between TFIP11 and EWS contributes to the regulation of alternative splicing.
These results indicate the similar spatial expression pattern between TFIP11 and CCNL1,
54
and a less-well defined spatial overlap between TFIP11 and EWS. These findings are
complementary to previously published Y2H data showing protein-protein interactions
between TFIP11 and CCNL1, and between TFIP11 and EWS. Identifying protein-
protein interactions between the various splicing factors, and relating these to their
spatiotemporal expression profiles in vivo, will lead to a better understanding of the
molecular mechanism of RNA splicing.

55
Conclusion
Pre-mRNA splicing is a fundamental process required for eukaryotic gene
expression. Splicing reaction entails two consecutive transesterification reactions carried
out by spliceosome. The spliceosome is a highly complex RNP machine, composed of
five snRNAs and over 100 associated proteins. The spliceosome assembles by ordered
interaction of U1, U2, U4/U6.U5 snRNP with the pre-mRNA, creating distinct
spliceosomal complexes: E, A, B, C. TFIP11 has been identified as a component of
U4/U6.U5 snRNP in the spliceosomal B complex (Deckert et al., 2006) and remains
associated with the spliceosome after the splicing reaction is complete. After exons are
ligated, the mature RNA and the lariat intron are released from the spliceosome.
Subsequently, the spliceosomal components dissociate and recycle for the next round of
splicing. RNA interference targeting STIP, the C. elegans homologue of TFIP11 showed
morphological abnormalities starting at about the 16-cell stage and 100% embryonic
lethality (Ji et al., 2007). The lethal phenotype can be rescued using either a Drosophila
or human TFIP11 coding sequence under the control of the native C. elegans STIP
promoter (Ji et al., 2007), underlining the remarkable conservation of TFIP11 function
across evolution. Ntr1, the yeast homologue of TFIP11 has been shown to function in
conjunction with Ntr2, and Prp43 to catalyze the release of lariat intron from the
postsplicing intron-containing complex (Boon et al., 2006; Tsai et al., 2005). Ntr1
interacts with Prp43 through G-patch domain and this interaction is critical for
spliceosome disassembly (Tsai et al., 2005). siRNA-mediated depletion of TFIP11 in
56
HeLa cells results in a considerable accumulation of U4/U6 snRNP in Cajal bodies (Stanek
et al., 2008), suggesting that TFIP11 is implicated in snRNP recycling. Consistent with
previous studies in yeast, human TFIP11 interacts with DHX15, human homologue of
Prp43, through G-patch domain (Yoshimoto et al., 2008). These findings strongly
suggest that human TFIP11 may have similar function with its yeast counterpart in pre-
mRNA splicing. To determine the functional role of TFIP11 in RNA splicing, I
performed in vitro splicing assays using TFIP11-depleted nuclear extract generated from
HeLa cells. Depletion of TFIP11 by RNA interference resulted in significant
accumulation of the lariat intron in the splicing reaction. This defect was rescued by
recombinant TFIP11 in add-back experiment. These results suggest that TFIP11 is
involved in the release of lariat intron from the spliceosomal complexes. The observation
that TFIP11 plays a role in spliceosome disassembly suggests that TFIP11 may promote
efficient RNA splicing by accelerating the recycling of splicing factors. To test this
hypothesis, I performed in vivo double reporter assay. Overexpression of TFIP11
resulted in a > 2-fold activation of the splicing efficiency. Taken together, these results
indicate that TFIP11 is involved in spliceosome disassembly and promotes the efficient
splicing by accelerating the recycling of splicing factors.
TFIP11 contains a G-patch domain, characterized by six highly conserved glycine
residues. The G-patch domain is an RNA-binding domain, found in several RNA-
associated proteins. The G-patch in TFIP11 is responsible for TFIP11-DHX15
interaction. No other functional domains within TFIP11 have been described. TFIP11 is
57
localized to the distinct nuclear speckles in close proximity with SC35 domains, excluded
from nucleoli. To identify the domain necessary for this specific localization, I carried
out a series of truncation experiments and mutational analyses of mouse TFIP11 fused to
GFP, and detected their subcellular localization in transfected HEK293 cells by confocal
laser scanning microscopy. TFIP11 amino acids 1-735 was able to target the fusion
protein to the nuclear speckles to the same extent as full length TFIP11, whereas TFIP11
amino acids 1-710 was evenly distributed throughout the nucleoplasm. These results
clearly suggest that amino acid residues 711-735 are responsible for speckle localization.
Further deletion from the C terminus revealed that TFIP11 amino acids 1-696 was
entirely localized to the cytoplasm. This finding suggests that a hypothetical NLS is
located between amino acids 697-710. To test the functionality of this potential NLS
motif, two mutant constructs were generated. Mutations of amino acids 701-706
(VKDKFN) showed predominantly cytoplasmic localization of fusion protein, indicating
that this motif is essential for nuclear localization of TFIP11.
CCNL1 and EWS have been identified as TFIP11-interacting proteins using Y2H
assay. Both CCNL1 and EWS displayed speckled localization in the nucleus and have
been described as functionally related to pre-mRNA splicing. CCNL1 belongs to the
cyclin family that contains C-terminal RS domain, and a characteristic cyclin box
(Dickinson et al., 2002). CCNL1 localizes to the SC35 domain and is involved in
alternative splicing regulation of E1A minigene (Chen et al., 2007a). Furthermore,
blocking activity of CCNL1 resulted in inhibition of the second step of splicing reaction
58
(Dickinson et al., 2002). These data indicate that CCNL1 plays important role in pre-
mRNA splicing. EWS belongs to a family of RNA-binding protein known as TET
family. EWS has been shown to interact with several splicing factors and components of
the transcriptional complex, implying its role in linking RNA splicing and transcription
(Law et al., 2006). To confirm the protein-protein interaction of TFIP11 with CCNL1
and EWS, I performed cell transfection experiments to investigate the spatial relationship
of these three proteins and coimmunoprecipitation assay to detect protein-protein
interaction in mammalian cell system. Consistent with previous reports, all three
proteins showed speckled localization in the nucleus when transfected alone. Both
transfected CCNL1 and EWS colocalize with endogenous TFIP11. Using
coimmunoprecipitation I was able to demonstrate physical association between TFIP11
and EWS. However, I was unable to confirm the protein-protein interaction of TFIP11
and CCNL1 by this method. The failure to detect TFIP11-CCNL1 interaction may relate
to the relative strengths of protein-protein interaction.
TFIP11 is a protein component of spliceosomal complex and is directly involved
in the disassembly of snRNPs associated with lariat intron during late stage of splicing
events. TFIP11 interacts with DHX15 through G-patch domain and this interaction is
critical for spliceosome disassembly. G-patch domain plays no significant role in either
nuclear or speckle localization. It would be of interest to determine whether G-patch is
an interacting domain for other protein partners as TFIP11 may function earlier in the
pre-mRNA splicing by interacting with CCNL1 or EWS.
59
References
Alex, D., and Lee, K. A. W. (2005). RGG-boxes of the EWS oncoprotein repress a range
of transcriptional activation domains. Nucleic Acids Research 33, 1321-1331.

Aravind, L., and Koonin, E. V. (1999). G-patch: a new conserved domain in eukaryotic
RNA-processing proteins and type D retroviral polyproteins. Trends Biochem Sci 24,
342-344.

Arvand, A., and Denny, C. T. (2001). Biology of EWS/ETS fusions in Ewing's family
tumors. Oncogene 20, 5747-5754.

Ballif, B. A., Villen, J., Beausoleil, S. A., Schwartz, D., and Gygi, S. P. (2004).
Phosphoproteomic analysis of the developing mouse brain. Mol Cell Proteomics 3, 1093-
1101.

Beausoleil, S. A., Jedrychowski, M., Schwartz, D., Elias, J. E., Villen, J., Li, J., Cohn, M.
A., Cantley, L. C., and Gygi, S. P. (2004). Large-scale characterization of HeLa cell
nuclear phosphoproteins. Proc Natl Acad Sci U S A 101, 12130-12135.

Berke, J. D., Sgambato, V., Zhu, P. P., Lavoie, B., Vincent, M., Krause, M., and Hyman,
S. E. (2001). Dopamine and glutamate induce distinct striatal splice forms of Ania-6, an
RNA polymerase II-associated cyclin. Neuron 32, 277-287.

Bertolotti, A., Melot, T., Acker, J., Vigneron, M., Delattre, O., and Tora, L. (1998). EWS,
but not EWS-FLI-1, is associated with both TFIID and RNA polymerase II: interactions
between two members of the TET family, EWS and hTAFII68, and subunits of TFIID
and RNA polymerase II complexes. Mol Cell Biol 18, 1489-1497.

Boon, K. L., Auchynnikava, T., Edwalds-Gilbert, G., Barrass, J. D., Droop, A. P., Dez,
C., and Beggs, J. D. (2006). Yeast ntr1/spp382 mediates prp43 function in
postspliceosomes. Mol Cell Biol 26, 6016-6023.

Brow, D. A. (2002). Allosteric cascade of spliceosome activation. Annu Rev Genet 36,
333-360.

Caceres, J. F., Misteli, T., Screaton, G. R., Spector, D. L., and Krainer, A. R. (1997).
Role of the modular domains of SR proteins in subnuclear localization and alternative
splicing specificity. J Cell Biol 138, 225-238.

Caceres, J. F., Screaton, G. R., and Krainer, A. R. (1998). A specific subset of SR
proteins shuttles continuously between the nucleus and the cytoplasm. Genes Dev 12, 55-
66.

60
Cazalla, D., Zhu, J., Manche, L., Huber, E., Krainer, A. R., and Caceres, J. F. (2002).
Nuclear export and retention signals in the RS domain of SR proteins. Mol Cell Biol 22,
6871-6882.

Chansky, H. A., Hu, M., Hickstein, D. D., and Yang, L. (2001). Oncogenic TLS/ERG
and EWS/Fli-1 fusion proteins inhibit RNA splicing mediated by YB-1 protein. Cancer
Res 61, 3586-3590.

Chen, H. H., Wang, Y. C., and Fann, M. J. (2006). Identification and characterization of
the CDK12/cyclin L1 complex involved in alternative splicing regulation. Mol Cell Biol
26, 2736-2745.

Chen, H. H., Wong, Y. H., Geneviere, A. M., and Fann, M. J. (2007a). CDK13/CDC2L5
interacts with L-type cyclins and regulates alternative splicing. Biochem Biophys Res
Commun 354, 735-740.

Chen, Y. I., Moore, R. E., Ge, H. Y., Young, M. K., Lee, T. D., and Stevens, S. W.
(2007b). Proteomic analysis of in vivo-assembled pre-mRNA splicing complexes
expands the catalog of participating factors. Nucleic Acids Res 35, 3928-3944.

Das, R., Dufu, K., Romney, B., Feldt, M., Elenko, M., and Reed, R. (2006). Functional
coupling of RNAP II transcription to spliceosome assembly. Genes Dev 20, 1100-1109.

de Graaf, K., Hekerman, P., Spelten, O., Herrmann, A., Packman, L. C., Bussow, K.,
Muller-Newen, G., and Becker, W. (2004). Characterization of cyclin L2, a novel cyclin
with an arginine/serine-rich domain: phosphorylation by DYRK1A and colocalization
with splicing factors. J Biol Chem 279, 4612-4624.

Deckert, J., Hartmuth, K., Boehringer, D., Behzadnia, N., Will, C. L., Kastner, B., Stark,
H., Urlaub, H., and Luhrmann, R. (2006). Protein composition and electron microscopy
structure of affinity-purified human spliceosomal B complexes isolated under
physiological conditions. Mol Cell Biol 26, 5528-5543.

Deloulme, J. C., Prichard, L., Delattre, O., and Storm, D. R. (1997). The prooncoprotein
EWS binds calmodulin and is phosphorylated by protein kinase C through an IQ domain.
J Biol Chem 272, 27369-27377.

Dephoure, N., Zhou, C., Villen, J., Beausoleil, S. A., Bakalarski, C. E., Elledge, S. J., and
Gygi, S. P. (2008). A quantitative atlas of mitotic phosphorylation. Proc Natl Acad Sci U
S A 105, 10762-10767.

Dickinson, L. A., Edgar, A. J., Ehley, J., and Gottesfeld, J. M. (2002). Cyclin L is an RS
domain protein involved in pre-mRNA splicing. J Biol Chem 277, 25465-25473.

61
Du, H., and Rosbash, M. (2002). The U1 snRNP protein U1C recognizes the 5' splice site
in the absence of base pairing. Nature 419, 86-90.

Gornemann, J., Kotovic, K. M., Hujer, K., and Neugebauer, K. M. (2005).
Cotranscriptional spliceosome assembly occurs in a stepwise fashion and requires the cap
binding complex. Mol Cell 19, 53-63.

Gozani, O., Potashkin, J., and Reed, R. (1998). A potential role for U2AF-SAP 155
interactions in recruiting U2 snRNP to the branch site. Mol Cell Biol 18, 4752-4760.
Graveley, B. R. (2000). Sorting out the complexity of SR protein functions. Rna 6, 1197-
1211.

Guipaud, O., Guillonneau, F., Labas, V., Praseuth, D., Rossier, J., Lopez, B., and
Bertrand, P. (2006). An in vitro enzymatic assay coupled to proteomics analysis reveals a
new DNA processing activity for Ewing sarcoma and TAF(II)68 proteins. Proteomics 6,
5962-5972.

Hartmuth, K., Urlaub, H., Vornlocher, H. P., Will, C. L., Gentzel, M., Wilm, M., and
Luhrmann, R. (2002). Protein composition of human prespliceosomes isolated by a
tobramycin affinity-selection method. Proc Natl Acad Sci USA 99, 16719-16724.

Hazbun, T. R., Malmstrom, L., Anderson, S., Graczyk, B. J., Fox, B., Riffle, M., Sundin,
B. A., Aranda, J. D., McDonald, W. H., Chiu, C. H., et al. (2003). Assigning function to
yeast proteins by integration of technologies. Mol Cell 12, 1353-1365.

Heinrichs, V., Bach, M., Winkelmann, G., and Luhrmann, R. (1990). U1-specific protein
C needed for efficient complex formation of U1 snRNP with a 5' splice site. Science 247,
69-72.

Herrmann, A., Fleischer, K., Czajkowska, H., Muller-Newen, G., and Becker, W.
(2007a). Characterization of cyclin L1 as an immobile component of the splicing factor
compartment. Faseb J 21, 3142-3152.

Herrmann, G., Kais, S., Hoffbauer, J., Shah-Hosseini, K., Bruggenolte, N., Schober, H.,
Fasi, M., and Schar, P. (2007b). Conserved interactions of the splicing factor
Ntr1/Spp382 with proteins involved in DNA double-strand break repair and telomere
metabolism. Nucleic Acids Res 35, 2321-2332.

Ji, Q., Huang, C. H., Peng, J., Hashmi, S., Ye, T., and Chen, Y. (2007). Characterization
of STIP, a multi-domain nuclear protein, highly conserved in metazoans, and essential for
embryogenesis in Caenorhabditis elegans. Exp Cell Res 313, 1460-1472.

62
Johnson, J. M., Castle, J., Garrett-Engele, P., Kan, Z., Loerch, P. M., Armour, C. D.,
Santos, R., Schadt, E. E., Stoughton, R., and Shoemaker, D. D. (2003). Genome-wide
survey of human alternative pre-mRNA splicing with exon junction microarrays. Science
302, 2141-2144.

Jurica, M. S., Licklider, L. J., Gygi, S. R., Grigorieff, N., and Moore, M. J. (2002).
Purification and characterization of native spliceosomes suitable for three-dimensional
structural analysis. RNA 8, 426-439.

Jurica, M. S., and Moore, M. J. (2003). Pre-mRNA splicing: awash in a sea of proteins.
Mol Cell 12, 5-14.

Kataoka, N., Bachorik, J. L., and Dreyfuss, G. (1999). Transportin-SR, a nuclear import
receptor for SR proteins. J Cell Biol 145, 1145-1152.

Kim, S. H., and Lin, R. J. (1996). Spliceosome activation by PRP2 ATPase prior to the
first transesterification reaction of pre-mRNA splicing. Mol Cell Biol 16, 6810-6819.

Knoop, L. L., and Baker, S. J. (2000). The splicing factor U1C represses EWS/FLI-
mediated transactivation. J Biol Chem 275, 24865-24871.

Knoop, L. L., and Baker, S. J. (2001). EWS/FLI alters 5'-splice site selection. J Biol
Chem 276, 22317-22322.

Komarnitsky, P., Cho, E. J., and Buratowski, S. (2000). Different phosphorylated forms
of RNA polymerase II and associated mRNA processing factors during transcription.
Genes Dev 14, 2452-2460.

Kramer, A. (1992). Purification of splicing factor SF1, a heat-stable protein that functions
in the assembly of a presplicing complex. Mol Cell Biol 12, 4545-4552.

Lamond, A. I., and Spector, D. L. (2003). Nuclear speckles: a model for nuclear
organelles. Nat Rev Mol Cell Biol 4, 605-612.

Lander, E. S., Linton, L. M., Birren, B., Nusbaum, C., Zody, M. C., Baldwin, J., Devon,
K., Dewar, K., Doyle, M., FitzHugh, W., et al. (2001). Initial sequencing and analysis of
the human genome. Nature 409, 860-921.

Law, W. J., Cann, K. L., and Hicks, G. G. (2006). TLS, EWS and TAF15: a model for
transcriptional integration of gene expression. Brief Funct Genomic Proteomic 5, 8-14.

Li, H., Watford, W., Li, C., Parmelee, A., Bryant, M. A., Deng, C., O'Shea, J., and Lee,
S. B. (2007). Ewing sarcoma gene EWS is essential for meiosis and B lymphocyte
development. J Clin Invest 117, 1314-1323.

63
Madin, K., Sawasaki, T., Ogasawara, T., and Endo, Y. (2000). A highly efficient and
robust cell-free protein synthesis system prepared from wheat embryos: plants apparently
contain a suicide system directed at ribosomes. Proc Natl Acad Sci U S A 97, 559-564.

Makarov, E. M., Makarova, O. V., Urlaub, H., Gentzel, M., Will, C. L., Wilm, M., and
Luhrmann, R. (2002). Small nuclear ribonucleoprotein remodeling during catalytic
activation of the spliceosome. Science 298, 2205-2208.

Malca, H., Shomron, N., and Ast, G. (2003). The U1 snRNP base pairs with the 5' splice
site within a penta-snRNP complex. Mol Cell Biol 23, 3442-3455.

Martin, A., Schneider, S., and Schwer, B. (2002). Prp43 is an essential RNA-dependent
ATPase required for release of lariat-intron from the spliceosome. J Biol Chem 277,
17743-17750.

Meinhart, A., Kamenski, T., Hoeppner, S., Baumli, S., and Cramer, P. (2005). A
structural perspective of CTD function. Genes Dev 19, 1401-1415.

Misteli, T., Caceres, J. F., Clement, J. Q., Krainer, A. R., Wilkinson, M. F., and Spector,
D. L. (1998). Serine phosphorylation of SR proteins is required for their recruitment to
sites of transcription in vivo. J Cell Biol 143, 297-307.

Misteli, T., Caceres, J. F., and Spector, D. L. (1997). The dynamics of a pre-mRNA
splicing factor in living cells. Nature 387, 523-527.

Misteli, T., and Spector, D. L. (1999). RNA polymerase II targets pre-mRNA splicing
factors to transcription sites in vivo. Mol Cell 3, 697-705.

Moore, M. J. (2002). Nuclear RNA turnover. Cell 108, 431-434.

Nasim, M. T., and Eperon, I. C. (2006). A double-reporter splicing assay for determining
splicing efficiency in mammalian cells. Nat Protoc 1, 1022-1028.

Neugebauer, K. M., and Roth, M. B. (1997). Distribution of pre-mRNA splicing factors
at sites of RNA polymerase II transcription. Genes Dev 11, 1148-1159.

O'Keefe, R. T., Mayeda, A., Sadowski, C. L., Krainer, A. R., and Spector, D. L. (1994).
Disruption of pre-mRNA splicing in vivo results in reorganization of splicing factors. J
Cell Biol 124, 249-260.

Ohno, T., Ouchida, M., Lee, L., Gatalica, Z., Rao, V. N., and Reddy, E. S. (1994). The
EWS gene, involved in Ewing family of tumors, malignant melanoma of soft parts and
desmoplastic small round cell tumors, codes for an RNA binding protein with novel
regulatory domains. Oncogene 9, 3087-3097.

64
Olsen, J. V., Blagoev, B., Gnad, F., Macek, B., Kumar, C., Mortensen, P., and Mann, M.
(2006). Global, in vivo, and site-specific phosphorylation dynamics in signaling
networks. Cell 127, 635-648.

Paine, C. T., Paine, M. L., Luo, W., Okamoto, C. T., Lyngstadaas, S. P., and Snead, M.
L. (2000). A tuftelin-interacting protein (TIP39) localizes to the apical secretory pole of
mouse ameloblasts. J Biol Chem 275, 22284-22292.

Paine, C. T., Paine, M. L., and Snead, M. L. (1998). Identification of tuftelin- and
amelogenin-interacting proteins using the yeast two-hybrid system. Connect Tissue Res
38, 257-267;discussion 295-303.

Patel, A. A., and Steitz, J. A. (2003). Splicing double: insights from the second
spliceosome. Nat Rev Mol Cell Biol 4, 960-970.

Phatnani, H. P., and Greenleaf, A. L. (2006). Phosphorylation and functions of the RNA
polymerase II CTD. Genes Dev 20, 2922-2936.

Plougastel, B., Zucman, J., Peter, M., Thomas, G., and Delattre, O. (1993). Genomic
structure of the EWS gene and its relationship to EWSR1, a site of tumor-associated
chromosome translocation. Genomics 18, 609-615.

Rappsilber, J., Ryder, U., Lamond, A. I., and Mann, M. (2002). Large-scale proteomic
analysis of the human spliceosome. Genome Res 12, 1231-1245.

Reed, R. (2000). Mechanisms of fidelity in pre-mRNA splicing. Curr Opin Cell Biol 12,
340-345.

Sanford, J. R., and Caceres, J. F. (2004). Pre-mRNA splicing: life at the centre of the
central dogma. J Cell Sci 117, 6261-6263.

Sharrocks, A. D. (2001). The ETS-domain transcription factor family. Nat Rev Mol Cell
Biol 2, 827-837.

Silverman, E. J., Maeda, A., Wei, J., Smith, P., Beggs, J. D., and Lin, R. J. (2004).
Interaction between a G-patch protein and a spliceosomal DEXD/H-box ATPase that is
critical for splicing. Mol Cell Biol 24, 10101-10110.

Small, E. C., Leggett, S. R., Winans, A. A., and Staley, J. P. (2006). The EF-G-like
GTPase Snu114p regulates spliceosome dynamics mediated by Brr2p, a DExD/H box
ATPase. Mol Cell 23, 389-399.

Staley, J. P., and Guthrie, C. (1998). Mechanical devices of the spliceosome: motors,
clocks, springs, and things. Cell 92, 315-326.

65
Stanek, D., Pridalova-Hnilicova, J., Novotny, I., Huranova, M., Blazikova, M., Wen, X.,
Sapra, A. K., and Neugebauer, K. M. (2008). Spliceosomal small nuclear
ribonucleoprotein particles repeatedly cycle through Cajal bodies. Mol Biol Cell 19,
2534-2543.

Stevens, S. W., Ryan, D. E., Ge, H. Y., Moore, R. E., Young, M. K., Lee, T. D., and
Abelson, J. (2002). Composition and functional characterization of the yeast
spliceosomal penta-snRNP. Mol Cell 9, 31-44.

Tanackovic, G., and Kramer, A. (2005). Human splicing factor SF3a, but not SF1, is
essential for pre-mRNA splicing in vivo. Mol Biol Cell 16, 1366-1377.

Tanaka, N., Aronova, A., and Schwer, B. (2007). Ntr1 activates the Prp43 helicase to
trigger release of lariat-intron from the spliceosome. Genes Dev 21, 2312-2325.

Tanner, N. K., and Linder, P. (2001). DExD/H box RNA helicases: from generic motors
to specific dissociation functions. Mol Cell 8, 251-262.

Tsai, R. T., Fu, R. H., Yeh, F. L., Tseng, C. K., Lin, Y. C., Huang, Y. H., and Cheng, S.
C. (2005). Spliceosome disassembly catalyzed by Prp43 and its associated components
Ntr1 and Ntr2. Genes Dev 19, 2991-3003.

Tsai, R. T., Tseng, C. K., Lee, P. J., Chen, H. C., Fu, R. H., Chang, K. J., Yeh, F. L., and
Cheng, S. C. (2007). Dynamic interactions of Ntr1-Ntr2 with Prp43 and with U5 govern
the recruitment of Prp43 to mediate spliceosome disassembly. Mol Cell Biol 27, 8027-
8037.

Villen, J., Beausoleil, S. A., Gerber, S. A., and Gygi, S. P. (2007). Large-scale
phosphorylation analysis of mouse liver. Proc Natl Acad Sci U S A 104, 1488-1493.

Wagner, J. D., Jankowsky, E., Company, M., Pyle, A. M., and Abelson, J. N. (1998). The
DEAH-box protein PRP22 is an ATPase that mediates ATP-dependent mRNA release
from the spliceosome and unwinds RNA duplexes. Embo J 17, 2926-2937.

Wang, H. J., Tannukit, S., Shapiro, J. L., Snead, M. L., and Paine, M. L. (2006). Using
the yeast two-hybrid assay to discover protein partners for the leucine-rich amelogenin
peptide (LRAP) and for tuftelin-interacting protein 11 (TFIP11). Eur J Oral Sci 114
(Suppl. 1), 276-279.

Wang, Y., and Guthrie, C. (1998). PRP16, a DEAH-box RNA helicase, is recruited to the
spliceosome primarily via its nonconserved N-terminal domain. Rna 4, 1216-1229.

Wen, X., Lei, Y. P., Zhou, Y. L., Okamoto, C. T., Snead, M. L., and Paine, M. L. (2005).
Structural organization and cellular localization of tuftelin-interacting protein 11
(TFIP11). Cell Mol Life Sci 62, 1038-1046.
66
Wen, X., Tannukit, S., and Paine, M. L. (2008). TFIP11 interacts with mDEAH9, an
RNA helicase involved in spliceosome disassembly. Int J Mol Sci 9, 2105-2113.

Xia, S. J., and Barr, F. G. (2005). Chromosome translocations in sarcomas and the
emergence of oncogenic transcription factors. Eur J Cancer 41, 2513-2527.

Yang, L., Chansky, H. A., and Hickstein, D. D. (2000). EWS.Fli-1 fusion protein
interacts with hyperphosphorylated RNA polymerase II and interferes with serine-
arginine protein-mediated RNA splicing. J Biol Chem 275, 37612-37618.

Yeakley, J. M., Tronchere, H., Olesen, J., Dyck, J. A., Wang, H. Y., and Fu, X. D.
(1999). Phosphorylation regulates in vivo interaction and molecular targeting of
serine/arginine-rich pre-mRNA splicing factors. J Cell Biol 145, 447-455.

Yoshimoto, R., Kataoka, N., Okawa, K., and Ohno, M. (2008). Isolation and
characterization of post-splicing lariat-intron complexes. Nucleic Acids Res.

Young, P. J., Francis, J. W., Lince, D., Coon, K., Androphy, E. J., and Lorson, C. L.
(2003). The Ewing's sarcoma protein interacts with the Tudor domain of the survival
motor neuron protein. Brain Res Mol Brain Res 119, 37-49.

Zhang, D., Paley, A. J., and Childs, G. (1998). The transcriptional repressor ZFM1
interacts with and modulates the ability of EWS to activate transcription. J Biol Chem
273, 18086-18091.

Zhou, Y. L., and Snead, M. L. (2000). Identification of CCAAT/enhancer-binding protein
alpha as a transactivator of the mouse amelogenin gene. J Biol Chem 275, 12273-12280.

Zhou, Z., Licklider, L. J., Gygi, S. P., and Reed, R. (2002). Comprehensive proteomic
analysis of the human spliceosome. Nature 419, 182-185.

Zhou, Z., and Reed, R. (1998). Human homologs of yeast prp16 and prp17 reveal
conservation of the mechanism for catalytic step II of pre-mRNA splicing. Embo J 17,
2095-2106.

Abstract (if available)

Abstract Pre-mRNA splicing is an essential step of gene expression in the vast majority of eukaryotic genes. The splicing is carried out by spliceosome, a multicomponent ribonucleoprotein complex, containing five uridine-rich small nuclear RNAs and numerous associated proteins. Tuftelin-interacting protein 11 (TFIP11) is a protein component of spliceosome complex that promotes the release of the lariat intron during late stage of splicing process. Furthermore, overexpression of TFIP11 enhances the splicing activity, which is likely related to a more efficient recycling of splicing factors.

Linked assets

University of Southern California Dissertations and Theses

Conceptually similar

PDF

The function of TGF-beta signaling in palatal and dental epithelium during embryogenesis

PDF

Modulation of C/EBP alpha in the regulation of mouse amelogenin transcription during tooth formation

PDF

Fas-mediated apoptosis in oral squamous cell carcinomas

PDF

Integrative analysis of gene expression and phenotype data

PDF

Global analysis of the molecular activities defining maturation-stage amelogenesis

PDF

Integrin expression and signaling during palatal fusion

PDF

Leucine-rich amelogenin peptide induces osteogenesis in mouse embryonic stem cells

PDF

Non-canonical Tgf-beta signaling in craniofacial development

PDF

Transcriptional co-activation functions of Msx homeodomain proteins by activating Hsf proteins

PDF

Ameloblastin-protein interactions pattern enamel matrix

PDF

Antibody mediated osseous regeneration

PDF

A comparison of external root resorption related to orthodontic treatment among ethnic groups

PDF

Functional role of a Ewing-sarcoma-specific vlncRNA in tumor growth and progression

PDF

GM1- Ganglioside B-Galactosidase and its deficiency in mammalian parotid glands

PDF

Clinical and molecular genetic studies on families with inherited dental anomalies

PDF

The possible aberrant function of MBNL1 with insulin receptor (IR-B) mRNA in myotonic dystrophy type I

PDF

Enamelysin (MMP20) and Kallikrein 4 (KLK4) functions during enamel formation

PDF

Interaction of epigenetics and SMAD signaling in stem cells and diseases

PDF

A Western blot analysis and immunohistochemical study of 4-day old mice teeth over-expressing amelotin during amelogenesis

PDF

From mesenchymal stem cell therapy to discovery of drug therapy for systemic sclerosis

Asset Metadata

Creator Tannukit, Sissada (author)

Core Title CCNL1, EWS, TFIP11, and RNA splicing

Contributor Electronically uploaded by the author (provenance)

School School of Dentistry

Degree Doctor of Philosophy

Degree Program Craniofacial Biology

Publication Date 08/21/2009

Defense Date 06/05/2009

Publisher University of Southern California (original), University of Southern California. Libraries (digital)

Tag Cyclin L1,EWS,G-patch,nuclear speckles,OAI-PMH Harvest,RNA splicing,spliceosome,TFIP11

Language English

Advisor Paine, Michael L. (committee chair), Chai, Yang (committee member), Lawlor, Elizabeth R. (committee member), Shuler, Charles F. (committee member), Snead, Malcolm L. (committee member)

Creator Email orn345@yahoo.com,tannukit@usc.edu

Permanent Link (DOI) https://doi.org/10.25549/usctheses-m2574

Unique identifier UC11177546

Identifier etd-Tannukit-3038 (filename),usctheses-m40 (legacy collection record id),usctheses-c127-251981 (legacy record id),usctheses-m2574 (legacy record id)

Legacy Identifier etd-Tannukit-3038.pdf

Dmrecord 251981

Document Type Dissertation

Rights Tannukit, Sissada

Type texts

Source University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Repository Name Libraries, University of Southern California

Repository Location Los Angeles, California

Repository Email cisadmin@lib.usc.edu