University of Southern California Dissertations and Theses

Isolation and characterization of mouse GRIP1, a novel transcriptional coactivator of steroid receptors

(USC Thesis Other)

Isolation and characterization of mouse GRIP1, a novel transcriptional coactivator of steroid receptors

PDF

Download

Open document

Flip pages

Download a page range

Download transcript

Copy asset link

Request this asset

Transcript (if available)

Content ISOLATION AND CHARACTERIZATION OF MOUSE GRIP1, A NOVEL TRANSCRIPTIONAL COACTIVATOR OF STEROID RECEPTORS by HENG HONG A Dissertation Presented to the FACULTY OF THE GRADUATE SCHOOL UNIVERSITY OF SOUTHERN CALIFORNIA In Partial Fulfillment of the Requirements for the Degree DOCTOR OF PHILOSOPHY (Biochemistry) December 1996 Copyright 1996 HENG HONG Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. UNIVERSITY OF SOUTHERN CALIFORNIA THE GRADUATE SCHOOL UNIVERSITY PARK LOS ANGELES. CALIFORNIA 90007 This dissertation, written by Heng Hong under the direction of ft.h?. Dissertation Committee, and approved by all its members, has been presented to and accepted by The Graduate School, in partial fulfillment of re quirements for the degree of DOCTOR OF PHILOSOPHY ; W ? Dean o f Graduatt Studies Date DISSERTATION COMMITTEE Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. ACKNOWLEDGMENTS I would like to express my special thanks to my mentor Michael Stallcup for giving me the chance to work with such an exciting project and to spend the most wonderful time in his lab. I sincerely appreciate his guidance and support through every step of this project. Without him, the success of my graduate course would not be possible. I also would like to thank my committee members Dr. Deborah Johnson and Dr. Robert Maxson for their advice and support since the early beginning of this project. I will also thank all of my coworkers in the lab for their advice and assistance, especially Kay Kohli for her excellent technical support. I also appreciate the support from our collaborators Dr. Alpa Trivedi, Dr. Mark Danielsen and Dr. Michael Garabedian. Finally I would like to thank my wife Jianfen Lu for her love and support, and my daughter Christine, who grew up at almost the same time as this project, for all the enjoyment she brings to my life. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. TABLE OF CONTENTS LIST OF FIGURES.....................................................................................iv ABSTRACT................................................................................................vii CHAPTER 1 : Introduction............................................................................1 CHAPTER 2: Molecular Cloning of mouse GRIP1 cDNA sequence............................................................................ 1 2 CHAPTER 3: Interaction of GRIP1 with members of nuclear receptor family..................................................................... 50 CHAPTER 4: GRIP1 is a coactivator for the HBD of nuclear receptors in yeast................................................................89 CHAPTER 5: Conclusions.......................................................................142 BIBLIOGRAPHY...................................................................................... 148 III Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. LIST OF FIGURES Figure Page 2-1. Yeast two-hybrid system..................................................................... 14 2-2 Screen of the mouse 17 day embryo cDNA library by using the yeast two-hybrid system .............................................................. 16 2-3 The Gal4-DBD/GR-HBD fusion protein by itself did not activate the reporter gene............................................................................... 23 2-4 Exclusion of false postives in yeast two-hybrid system ......................27 2-5 Classification of GRIP1, GRIP2 and GRIP3 sequences.....................29 2-6 DNA and protein sequences of GRIP1............................................... 32 2-7 Northern b lo t....................................................................................... 36 2-8 Screening of mouse brain cDNA library for the full-length sequence of GRIP1.............................................................................39 2-9 Amino acid sequence comparison of GRIP1 and SRC-1 a.................42 2-10 Amino acid sequence alignment of TIF2, GRIP1 and SRC-1 a .......... 44 3-1 Construction of the full length coding region of GRIP1........................ 52 3-2 Interaction of GRIP 1 with steroid receptor HBDs in a yeast two-hybrid system assay.................................................................... 59 3-3 Interaction of GR1P1 with steroid receptor HBDs in vitro....................62 3-4 Identification of the GR interaction domain in GRIP1 by yeast two-hybrid assays..............................................................................65 3-5 Interaction of GRIP1 with non-steroid receptor HBDs In a yeast two-hybrid system assay.................................................................... 6 8 3-6 Ability of agonists and antagonists to stimulate GR interaction with GRIP1 in yeast two-hybrid system...............................................71 iv Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 3-7 in vitro assays for the effect of agonists and antagonists on the GR Interaction with GRIP1 and GR association with hsp90............... 73 3-8 Interaction of GRIP1 with ER HBDs containing AF-2 domain mutations in the yeast two-hybrid system assays................................77 3-9 in vitro interaction of GRIP1 with ER HBDs containing AF-2 domain mutations................................................................................79 3-10 GR mutant GA11 interacts with GRIP1 at lower hormone concentration than wild type GR in the yeast two-hybrid system assay................................................................................... 83 4-1 Construction of a mammalian expression vector for GRIP1 fragment.............................................................................................. 91 4-2 Excision of the Gal4 AD from the Gal4-AD/GRIP1322.1121 fusion protein in yeast expression vector...................................................... 94 4-3 Effect of GRIP1 overexpression on expression of cotransfected reporter genes................................................................................... 1 0 0 4-4 Transcriptional activation by GRIP1 fragment fused with heterologous DBDs...........................................................................103 4-5 A model for the transcriptional coactivation effect of GRIP1 for the GR HBD in yeast........................................................................ 106 4-6 GRIP1 can function as a coactivator for GR HBD in yeast 108 4-7 GRIP1 can function as a coactivator for steroid receptor HBDs in yeast..................................................................................................I l l 4-8 Effect of GRIP1 on the transactivation activity of ER HBDs containing mutations in the AF-2 domain......................................... 114 4-9 Localization of the functional domains in GRIP1 for its GR interaction, transactivation activity, and coactivation activity............ 116 4-10 Effect of GRIP1 on the transactivation activity of the HBDs of non-steroid receptors..................................................................119 4-11 GRIP1 can serve as a coactivator for full length G R ......................... 122 V Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 4-12 GRIP1 can serve as a coactivator for full length E R ........................124 4-13 GRIP1 serves as a coactivator for the GR AF-2 domain, but not for the GRAF-1 dom ain................................................................ 127 4-14 Western blot for GR expression in yeast in the presence and absence of GRIP 1 ......................................................................... 129 4-15 in vitro assays for the interaction between GRIP1 and GR AF-1 and AF-2 domains..........................................................................132 VI Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. ABSTRACT Steroid receptors are a group of conditional transcription factors which require transcriptional coactivators to mediate their stimulation of transcription initiation. To search for the coactivators for the glucocorticoid receptor (GR), we used the yeast two-hybrid system to identify a novel mouse protein GRIP1 (Glucocorticoid Receptor-interacting Protein), which contains 1462-amino acids, and shares partial sequence homology with SRC-1, a recently isolated transcriptional coactivator for nuclear receptors. In the yeast two-hybrid system and in vitro, GRIP1 interacted with the HBDs of all the steroid receptors in the presence of agonists, but not in the absence of agonists or in the presence of antagonists RU486 and ZK299, although both antagonists caused GR to dissociate from hsp90. GRIP1 can also interact with the HBDs of VDR, TRa, RARa and RXRa, but with different degrees of hormone dependency. Point mutations in the AF-2 transactivation domain of the estrogen receptor (ER) HBD which eliminated the transactivation activity of ER also prevented interaction with GRIP1, while a GR HBD mutant GA11, which showed increased transactivation activity, exhibited enhanced ability to interact with GRIP1. When fused to the DNA binding domain (DBD) of a heterologous protein, GRIP1 exhibited transactivation activity both in yeast and mammalian cells. More interestingly, while a steroid receptor HBD fused with a Gal4 DBD could not, vii Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. by itself, activate a reporter gene controlled by a Gal4 enhancer site in yeast, co-expression of this fusion protein with GRIP1 strongly activated the reporter gene in a hormone dependent manner. GRIP1 also enhanced the hormone dependent transactivation activity of intact GR and estrogen receptor in yeast with a reporter gene controlled by their cognate enhancer elements. Further tests indicated that while GRIP1 can function as a coactivator of the GR HBD (containing AF-2 transactivation domain), it did not interact with the GR N-terminal domain (containing AF-1 transactivation domain) and had no effect on its transactivation activity in yeast either. These results demonstrated directly that AF-1 and AF-2 domains accomplish their transactivation activities through different mechanisms. V III Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. CHAPTER 1: INTRODUCTION The nuclear receptors are a group of conditional transcription factors that play important roles in various aspects of cell growth, development, and homeostasis by controlling expression of specific genes (Evans, 1988; Tsai and O'Malley, 1994; Beato et al. 1995). The activity of nuclear receptors can be regulated by binding of extracellular signaling molecules, which are usually small and lipophilic, and can easily enter the target cell. Thus, unlike membrane-bound receptors, the nuclear receptors are intracellular molecules. They are naturally transcription factors, and can function to control the activity of target genes directly by binding to specific enhancer elements. So nuclear receptors are the central element of a type of signal transduction pathway, which is quite different from the pathway mediated by the membrane-bound receptors. Now it is known that the nuclear receptor family is composed of more than 150 different proteins, among which the best studied are five steroid hormone receptors, including glucocorticoid receptor (GR), estrogen receptor (ER), androgen receptor (AR), progesterone receptor (PR) and mineralocorticoid receptor (MR). Other nuclear receptors include thyroid hormone receptors (TR), vitamin D receptor (VDR), retinoic acid receptor (RAR), retinoid X receptor (RXR), and a diverse group of so-called "orphan receptors" for which the cognate ligands are unknown. 1 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. In spite of their diverse biological functions, all the members of the nuclear family are composed of three different functional domains: an N- terminal transcriptional activation domain (AD), a central DNA binding domain (DBD), and a C-terminal hormone binding domain (HBD) (Tsai and O'Malley, 1994; Evans, 1988). The C-terminal hormone binding domains of nuclear receptors are about 250 amino acids long, and the sequence identity in this domain is in the range of 10-60% between different members of the family. The DNA binding domain consists of about 70 amino acids, and is the most highly conserved domain among different family members (40-90% identity). The N-terminal domains are not conserved between different family members, either in sequence or in size. The different parts of the receptors play different roles in the biological function of the receptors. The C-terminal domain is most important in controlling the activation status of nuclear receptors. Before binding of the hormone, the C-terminal region seems to exert inhibitory effects on the other parts of the receptor, since a truncated nuclear receptor without the C-terminal domain, such as a GR AD/DBD fragment, can express constitutive transactivation activity regardless the presence of hormone (Godowski et al. 1987). Although the N-terminal domains are traditionally thought to be important for the transcriptional activation function of the receptors, it is now found that in nuclear receptors the HBDs contain at least two other transactivation domains: the AF-2 activation domain near the C-terminal end of the HBD and the t 2 region at Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. the N-terminal end of the HBD (Pierrat et al. 1994; Hcllenberg and Evans, 1988; Danielian et al. 1992). Although all the members of the nuclear receptor family share a common structural organization and common mechanisms of action within their respective signaling pathways, it appears that there are two major functional subfamilies of nuclear receptors: the steroid receptors and the non-steroid receptors. Before the binding of hormone, steroid receptors remain inactive in a large inhibitory complex with a highly abundant heat shock family protein, hsp90, and apparently several other heat shock family proteins. The binding of hormone causes the receptors to dissociate from the inhibitory complex, bind as homodimers to specific DNA enhancer elements associated with target genes, and modulate their transcription (Parker, 1993; Ham and Parker, 1989). The non-steroid nuclear receptor subfamily members are not complexed with hsp90 in the absence of hormone. They can bind tightly to a specific cognate DNA sequence, and some act as repressors for the transcription of the associated gene until hormone binding transforms them into transcriptional activators. Many of the non-steroid nuclear receptors can function as homodimers or heterodimers, especially with the retinoid X receptors (Chin, 1991; Parker, 1993). Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. The nuclear receptors share a lot of common features with other transcriptional activators, among which the most important is that they all contain a DNA binding domain, which can recognize the specific enhancer elements, and one or more transactivation domains. In nuclear receptors the activity of the transactivation domain is tightly controlled by the presence of their extracellular signal: their ligands. As in the cases for most other transcriptional activators, the mechanism by which the enhancer bound nuclear receptors regulate the efficiency of transcriptional initiation is not fully understood yet. However, some evidence has suggested that after binding to the enhancer element, nuclear receptors, like other transcriptional activators, may probably facilitate the assembly of the preinitiation complex that forms prior to the transcription of all mRNA-encoding genes (Klein-Hitpass et al. 1990; Elliston et al. 1990; Tsai et al. 1990). The preinitiation complex is composed of RNA polymerase II and seven basal transcription factors (TFIIA, IIB, IIP, H E, IIP, IIH, and IIJ), and the assembly of the complex occurs in a specific order, beginning with the binding of TFIID to the TATA box, followed by the recruitment of TFIIB (Simons, Jr. et al. 1989). These first two steps are believed to be rate-limiting in the formation of the transcription initiation complex. As the best studied nuclear receptors, steroid receptors have been proposed to utilize two possible mechanisms to affect the formation of the Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. preinitiation complex. The first possible mechanism is the remodeling of chromatin structure. In this model, an activated steroid receptor can bind to its enhancer element, and then induce a local rearrangement of chromatin around the steroid response element (SRE) to allow the exposure of hidden specific binding sites on the DNA for other transcription factors (Archer et al. 1992; Cordingley et al. 1987). In a study with the mouse mammary tumor virus (MMTV) promoter, which contains SREs and can be assembled into six precisely phased nucleosomes when stably incorporated into cells, the activated GR and PR disrupted the nucleosome structure and allowed the binding of other transcription factors to the promoter region (Archer et al. 1992). Additionally, transactivation by GR in yeast requires the presence of three proteins, SWI1, SWI2 and SWI3, which may be involved in lifting chromatin-mediated gene repression (Yoshinaga etal. 1992). Activated GR appears to form a complex with those proteins. In an in vitro test, a complex containing human SWI2 can disrupt nucleosomal structure, and permit the binding of two transcription factors onto nucleosomal DNA (Kwon et al. 1994). However, this model seems not be able to explain all the transactivation activities of the steroid receptors, since in some experiments where chromatin structure is clearly not involved, the steroid receptors can still exhibit their activity (Freedman et al. 1989; Bagchi et al. 1990; Archer et al. 1994). Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. The second possible mechanism for steroid receptor transactivation, which will become the theme of this thesis, is that the DNA bound steroid receptors may exert direct or indirect protein-protein interactions with the basal transcription apparatus, thus helping the formation of the pre-initiation complex. Direct protein-protein interactions between other transcriptional activators and the basal transcription factors have been reported , and such interactions were found to be related to the transactivation activity of the activators (Godowski et al. 1988; Ham and Parker, 1989; Lin et al. 1991). VP16, a viral transactivator, has been shown most clearly to activate target genes by interacting with TFIIB. Mutation of amino acids in TFIIB, which eliminated the VP 16-dependent activity of TFIIB but did not affect its basal activity, also prevent TFIIB from interacting with VP16 (Roberts et al. 1993). Other cases of the direct interaction with the basal transcription factors have also been reported for the nuclear receptors. COUP-TF, a member of the nuclear receptor superfamily, can interact specifically with TFIIB (Ing et al. 1992). This interaction probably occurs directly between those two molecules because renaturated COUP-TF from a single gel band was able to bind specifically to TFIIB. Similar observations were made for PR, TR and VDR (MacDonald et al. 1995; Ing et al. 1992; Baniahmad et al. 1993). But in most cases, the biological relevance of such direct interactions between basal transcription factors and nuclear receptors has not been well proved yet. ER has been shown to interact in vitro with basal transcription factors Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. TFIIB (Ing et al. 1992) and TATA-box binding protein (TBP) (Sadovsky et al. 1995), but these interactions occurred in the presence and absence of hormone and were unaffected by mutations in receptor which abolish transcriptional activity of the receptor in mammalian cells (Cavaillès et al. 1995; Sadovsky et al. 1995). In recent years, people are more interested in searching for the indirect protein-protein interactions between the enhancer bound nuclear receptors and the basal transcription factors, which need the help of "adaptor" proteins or "coactivators", and could possibly provide an explanation for the mechanism by which the nuclear receptors can regulate gene expression. It has been found that overexpression of one transcription factor leads to diminished activity of another transcriptional activator with a related activation domain. This process, referred to as squelching or transcriptional interference, implies that the availability of such coactivators is limited and that the regulation of their production can have an impact on the transactivation potential of an upstream activator. Transcriptional interference experiments for steroid receptors suggested that in some cell and promoter contexts, specific coactivators may be required for receptor transcriptional activity (Hoeck et al. 1992; Meyer et al. 1989; Tasset et al. 1990). Some in vitro transcription assays (Brou et al. 1993) also suggested that the HBDs of steroid receptors were likely to interact with additional targets distinct from basal transcription factors, such as transcriptional coactivators. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. A transcriptional coactivator Is neither a member of the basal transcriptional apparatus nor a transcriptional activator by Itself, since It lacks a DNA binding domain. Coactivators are defined functionally by their ability to enhance selectively the stimulatory activity of specific subsets of enhancer-binding transcriptional activators. Among the best characterized general transcriptional coactivators are TAFs (TBP associated factors), which are subunits of TFIID and now believed to be the direct contacts and functional mediators for many enhancer-bound activators (Tjlan and Manlatls, 1994). TAFs apparently function as a bridge between enhancer- bound transcriptional activators and the basal transcription factors, and different TAFs mediate the activity of different transcriptional activators (Goodrich and Tjlan, 1994; Sauer etal. 1995; Chlang and Roeder, 1995). It has been demonstrated that the glutamlne-rlch activation domain of Spl Interacts directly and specifically with TAF„110 (Hoey et al. 1993), while the acidic activation domain of VP16 Interacts specifically with TAF„40 (Parker, 1993; Ham and Parker, 1989). The significance of these Interactions was supported by the correlation between binding activity and transcriptional activation (Gill et al. 1994; Goodrich et al. 1993). However, although estrogen receptor has been shown to Interact with hTAF„30 (Jacq et al. 1994), the Interaction was unaffected by binding of either 173-estradlol or antl-estrogens, such as 4-hydroxytamoxlfen, and mapped to a region In the ER that Is not required for the receptor's transactlvatlon activity in 8 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. mammalian cells (Pierrat et al. 1994). So no TAP has been successfully proved to be the transcriptional coactivator for the steroid receptors yet. As mentioned above, steroid receptors have two distinct transactivation domains: AF-1 located in the N-terminal AD and AF-2 located in the HBD (Hollenberg and Evans, 1988; Lees et al. 1989). Each of these AF domains may exhibit transactivation activity independently, and the relative contribution of each varies with promoter and cell type (Tzukeiman et al. 1994). However, in most cases both transactivation domains are required for full transcriptional activity of the receptors. Differences in the promoter and cell type specificities of AF-1 and AF-2 and the fact that some partial agonists activate AF-1 but not AF-2 suggested that these two transactivation domains may function through different mechanisms (McDonnell et al. 1995; Tzukerman et al. 1994), i.e., each may interact with a different component of the transcription machinery. To date, little is known about the transactivation mechanism of the AF-1 domain; the search for transcriptional coactivators for the AF-2 domain of nuclear receptors has made quite solid progress during the last two years. ERAP160 was one of the earliest proteins which were found able to interact with the nuclear receptors with potential biological relevance (Halachmi et al. 1994). ERAP160 can interact with the HBD of ER in a hormone dependent manner, and the interaction can be destroyed by the ER mutations which eliminate Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. the transactivation activity of ER. Antiestrogens are unable to promote ERAP160 binding and can block the estrogen-dependent interaction of the receptor and ERAP160 in a dose-dependent manner. Thus ERAP160 has some important features expected for a transcriptional coactivator, but there has not been direct evidence to indicate the ability of ERAP160 to enhance the transactivation activity of the nuclear receptors yet. A lot of other putative transcriptional coactivators have also been reported during the last two years (Cavaillès et al. 1995; Seol et al. 1995; Lee et al. 1995a; Lee et al. 1995b; Gill et al. 1994), but most of them did not show any more direct evidence than ERAP160 did to support their roles in helping the transactivation activity of nuclear receptors. So far GRIP1/TIF2 and SRC-1 are the only proteins which show substantial ability to enhance the transactivation activity of steroid receptors (Hong et al. 1996; Voegel et al. 1996; Oriate et al. 1995). The isolation and characterization of GRIP1 will be discussed in this thesis. Besides transcriptional coactivators, quite a few transcriptional corepressors for nuclear receptors, mostly non-steroid receptors, have also been reported (Horlein et al. 1995; Sande and Privalsky, 1996; Kurokawa et al. 1995; Chen and Evans, 1995). Those corepressors may play as important a role as the coactivators in the regulation of the activity of nuclear receptors, and may possibly interfere with the function of nuclear receptor coactivators. More interestingly, in a recent report (Kamei et al. 1996), some nuclear receptors and their coactivators were found in a same complex with CBP, a 10 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. transcriptional coactivator originally found for its role in enhancing the transactivation activity of CREB (Kwok et al. 1994). CBP interacts with nuclear receptors in a hormone regulated manner, and also can interact with SRC-1 a, a mouse variant of human SRC-1. CBP may serve as an integrator of multiple signal transduction pathways within the nucleus (Kamei et al. 1996). When we started this project two years ago, not too much was known about the transcriptional coactivators of nuclear receptors. But it was assumed that a potential transcriptional coactivator for the nuclear receptors should be able to interact with the receptors. We decided to isolate proteins which can interact with the HBD of GR in a hormone regulated manner by using the yeast two-hybrid system. Some of the GR interacting proteins may become good candidates for its transcriptional coactivator. In this thesis, I will present the work about the isolation and characterization of GRIP1, a novel mouse protein and a putative transcriptional coactivator for steroid receptors. I will provide evidence from the yeast system to support GRIPTs biological function, and discuss the significance of our findings, both about the identification of a novel transcriptional coactivator of steroid receptors, and about the utilization of the yeast system in the study of the transcriptional coactivators of steroid receptors. 11 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. CHAPTER 2: MOLECULAR CLONING OF MOUSE GRIP1 cDNA SEQUENCE INTRODUCTION The glucocorticoid receptor (GR) is one of the best understood members of the nuclear receptor superfamily, but the mechanism by which GR can regulate gene expression after it binds to the enhancer elements is still mostly unknown. Some evidence has suggested that enhancer-bound GR may stabilize the formation of a transcriptional initiation complex through direct or indirect protein-protein interactions with the basal transcriptional apparatus. It is now believed that, like other transcriptional activators, GR needs the help of transcriptional coactivators to support its transactivation activity. In order to isolate and study the transcriptional coactivators for GR, we decided to search for proteins which can interact with the hormone binding domain (HBD) of GR, since GR HBD contains several important transactivation domains, such as t 2 and AF-2. We expected some of those GR HBD interacting proteins to be good candidates for the transcriptional coactivators of the receptor. The yeast two-hybrid system was used to isolate GR HBD interacting proteins. As a powerful tool to test in vivo protein-protein interactions (Fig. 12 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 2-1) (Fields and Song, 1989), the yeast two-hybrid system is based on the fact that the yeast Gal4 protein is composed of two physically separable modular domains; a DNA binding domain (DBD) which can localize Gal4 to its enhancer site, and an activation domain (AD) which can contact other components of the transcriptional machinery required to initiate transcription (Fig. 2-1 A). When the DBD and AD of Gal4 are separately fused to two different proteins, neither of the fusion proteins can activate the reporter gene which is controlled by a Gal4 enhancer site (Fig. 2-1 B & C). But if the two bound proteins can interact with each other, the DBD and AD of Gal4 can be brought together by such protein-protein interaction, and result in the reconstitution of a functional Gal4 protein, which can subsequently activate the reporter gene (Fig. 2-1 D). In order to identify proteins that interact with a specific target protein, the GR HBD in our case, the target protein can be fused with the Gal4 DBD, and used as "bait" to screen a cDNA library whose inserts were fused with the Gal4 AD (Fig. 2-2). Any candidate proteins which interact with the target protein can be identified by the activation of the reporter gene. In this chapter, I will discuss the identification of proteins that can interact with the GR HBD in a hormone regulated manner, by using the yeast two-hybrid system to screen a mouse 17-day embryo cDNA library. And I will also discuss the isolation of the full coding region sequence of GRIP1, one 13 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Fig. 2-1. Yeast two-hybrid system. An in vivo system for detecting protein- protein interactions. A. Gal4 is composed of a ONA binding domain (DBD) and an activation domain (AD). Intact Gal4 can activate the reporter gene controlled by a Gal4 enhancer site. B&C. Each fusion proteins by itself can not activate the reporter gene. D. Interaction between the fusion proteins may result in the reconstitution of a functional Gal4, and the subsequent activation of the reporter gene. 14 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. B I aw 4.it. I 15 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Fig. 2-2 Screen of the mouse 17 day embryo cDNA library by using the yeast two-hybrid system. A Gal4 DBD and GR HBD fusion structure was made by introducing a PCR amplified cDNA for GR HBD into the 3' end of a Gal4 DBD sequence in the yeast expression vector pGBT9. This fusion structure was made to be used as a "bait" in screening a mouse 17-day embryo cDNA library, whose cDNA inserts were fused with the GAL4 AD in yeast expression vector pGADI 0. The protein-protein interaction between GR HBD and candidate proteins may result in the activation of a HIS3 reporter gene controlled by a Gal4 enhancer site (see top of the figure), and allow the positive yeast clones to grow in his growth medium. 16 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. I Gal 4 s i t e GR A F -1 r D B D H B D I Smal Smal I Salt PCR Sail cDNA library 3 P«W pGBT9 pGADIO A m p r A m p r TRP1 I B J 2 cm E l o r f cm E l 17 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. of the identified proteins from the yeast two-hybrid screening, by using its cDNA fragment isolated from the yeast two hybrid system as a probe to screen a mouse brain cDNA library. The sequence homology between GRIP1 and other transcriptional coactivators will also be discussed. MATERIALS AND METHODS Construction of plasmids: Yeast expression vector for the Gal4 DBD and GR HBD fusion protein, pGBT9.GR-HBD, was made by inserting PCR amplified cDNA fragment encoding mouse GR513.783 (Danielsen et al. 1986) into Smal/Sall sites in pGBT9 (Clontech). Yeast expression vector for the Gal4 AD and GRIP1 fusion protein, pGADIO.GRIPI, was isolated from the mouse 17-day embryo cDNA library. pVA3 (murine p S S y g ^ g g in pGBT9) used in the control test for exclusion of false positive clones was provided with the Matchmaker Two-Hybrid System kit (Clontech). Isolation of GRIP cDNA clones by yeast two-hybrid system: The Matchmaker Two-Hybrid System kit (Clontech) was used to screen a mouse 17-day embryo cDNA Matchmaker library (Clontech), by following the manufacturer's protocol. The yeast cell HF7c, which contains a P- galactosidase (P-gal) reporter gene and a HIS3 reporter gene, both controlled by a Gal4 enhancer site, were transformed with pGBT9.GR-HBD 18 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. and the library cDNA plasmids, in which all the cDNA inserts are cloned as Gal4 AD fusion structures in pGADIO, and then plated on SO (-leu, -trp, -his) plates which contained 10 pM deoxycorticosterone (DOC), a glucocorticoid agonist Yeast transformation was performed by a LiAc method, and the transformation efficiency was determined by growing an aliquot of the transformants in SD (-leu, -trp) medium. After screening of 4 x 1 0 ® yeast transformants, the putative positive clones, which grew faster in the plates than the background colonies, were selected and retested for (3-gal activity by filter assay. The library cDNA plasmids (which contain a LEU2 gene) from the positive clones were isolated from yeast by transforming yeast DNA into HB101, a leuB' E. coli strain, and growing the cells in leu' M9 medium. The isolated library cDNA was then tested in yeast strain SFY526 with different control DMAs for their ability to activate the (3-gal reporter gene, to exclude false positive clones (see Results). cDNAs from true positive clones were sequenced by using a Sequenase Version 2.0 DNA Sequencing kit (US Biochemicals). 3 -galactosidase filte r assay was performed basically according to Clontech's protocol (PT1265-1). Yeast colonies were grown in proper SD plates, and then lifted onto Protran nitrocellulose membrane (Schleicher & Schuell). The membrane bound cells were then broken by freeze-and-thaw, and tested for p-galactosidase activity by incubation at 37 °C on the top of 19 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. filter paper which was soaked with X-gal solution. The positive results were judged by the blue color shown in the yeast colony. Northern blot was performed on a premade Multiple Tissue Northern (MTN) Blot (Clontech) which contains mouse mRNAs from eight different tissues. The 2.4 kb GRIP1 fragment was labeled with “ P by using a Random Primed DNA Labeling Kit (Boehringer Mannheim). Total 5x10® cpm of probe was used with the ExpressHyb Hybridization Solution (Clontech) in the hybridization at 60 °C for 1 hr, and then the blot was washed with 2 x SSC, 0.1% SDS (2x15 min at room temperature) followed by 0.1 X SSC, 0.1% SDS (20 min at 60 °C), before being exposed to Hyperfilm (Amersham). The blot was rehybridized with a human 3-actin cDNA (Clontech) as a control. Isolation o f the full coding region sequence of GRIP1; The 2.4-kb GRIP1 cDNA fragment isolated by yeast two hybrid screening was used as a probe to screen a Lambda ZAP II mouse brain cDNA library (Stratagene #936909) by following manufacturer's protocols. Briefly, the library lambda phages were transfected into XLI-Blue cells and grown in LB agar plates at a density of 5 x 10“ cfu per plate. A total number of 1 x 10® phages were grown on the plates at 37 °C for 9 hrs, and then lifted in duplication onto Optitran supported nitrocellulose membranes (Schleicher & Schuel). After 20 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. lysing phage and fixing phage DNA on the membrane, the membranes were hybridized at 60 “C overnight with the labeled 2.4-kb GRIP1 fragment. The membranes were washed with 2 x SSC, 0.1% SDS (2x15 min at room temperature) and 0.1 x SSC, 0.1 % SDS (20 min at 60 ® C ), and then exposed to Biomax MR film (Kodak). The agar plugs containing plaques with duplicated positive signals were collected for the secondary screening with the same probe, and positive isolates were picked up. The pBlueScript SK(-) phagemids which contain the inserted cDNAs were excised from the lambda ZAP II vector by in vivo excision with the help of ExAssist phage (Stratagene). The cloned cDNAs were sequenced by using a Sequenase Version 2.0 DNA Sequencing kit (US Biochemicals). RESULTS 2.1 Isolation of proteins which can interact with the HBD of GR by yeast two-hybrid system. In order to screen for proteins which can interact with the HBD of GR by the yeast two hybrid system, I constructed a plasmid encoding a fusion protein containing a Gal4 DBD and the mouse GR HBD as "bait" for the screening. A PCR amplified mouse GR513.783 fragment was inserted into a yeast expression vector pGBT9 at the C-terminal side of a Gal4 DBD (Fig. 21 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 2-2). To be a successful bait, the Gal4-DBD/GR-HBD fusion protein should not activate the reporter gene by itself. So we transformed the Gal4- DBD/GR-HBD structure into yeast cell HF7c, which was the host cell for yeast two-hybrid screening, to check whether this fusion protein can activate the reporter gene by itself or not. Since one of the reporter genes in HF7c is a HIS3 reporter gene controlled by a Gal4 enhancer site, the HF7c cells would not be able to grow on his selection medium unless the reporter gene was activated. Our result showed that the Gal4-DBD/GR-HBD fusion protein did not activate the HIS3 reporter gene, even in the presence of DOC, a glucocorticoid agonist (Fig. 2-3a). Since not all the glucocorticoid agonists can act as well in yeast as they do in mammalian cells, we also checked if DOC can be a functional ligand for GR in yeast. In a test with the full length GR and a GRE-controlled P-gal reporter gene, we found that DOC can successfully induce the activation of the reporter gene (Fig. 2-3b). The Gal4-DBD/GR-HBD fusion protein was used as a "bait" to screen a mouse 17-day embryo cDNA library whose cDNA sequences were all fused with the GAL4 AD in a yeast expression vector pGADIO (Fig. 2-2). The reason to choose the mouse 17-day embryo cDNA library in this screening was mainly based on the fact that GR was known to be functional in that stage of development, and any potential transcriptional coactivators for GR should also be present in cells of that stage too. Also, the embryo 22 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Fig. 2-3 The Gal4-DBD/GR-HBD fusion protein by ifseif did not activate the reporter gene. A. pGBT9.GR-HBD, coding for Gal4-DBD/GR-HBD fusion protein and with a TRP1 marker, was transformed into yeast (strain HF7c), which contains a HIS3 reporter gene controlled by a Gal4 enhancer site. The yeast transformants were then transferred to SD (-trp) plates and SD (-trp, - his) plates, with or without DOC. (+) yeast transformants grow; (-) yeast transformants do not grow. B. The full length rat GR was expressed in yeast (strain wSOSa) containing a (3-gal reporter gene controlled by GREs, in the presence and absence of DOC. The P-gal activity was tested with filter assay. (+) blue color in yeast colonies; (-) white color in yeast colonies. 23 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Gal4-DBD 1 GR-HBD G all UAS Gall TATA & HIS3 -DOC + DGC Growth in SD(-trp) + + Growth in SD(-trp,-hls) AO DBD HBD B G R C GREs CYC1 TATA B Œ S m — — P-galactosidase U . p-yoiaviuoiu -DOC + DOC P-gal - + 24 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. cDNA library may have a broader range of sequences than a cDNA library from a single adult organ. After the "bait" plasmid and the library oDNA were co-transformed into yeast cells, the interaction of Gal4-DBD/GR-HBD with any Gal4 AD-bound proteins from the library may result in the activation of reporter genes, which are a HIS3 gene and a (3-gal gene, each controlled by a slightly different Gal4 enhancer site, in the host cell HF7c. Since only the yeast clones with positive protein-protein interaction between bait and target proteins can survive well on the his' selection medium, a large amount of cDNA clones could be screened in a limited number of grown medium plates. We screened about 4x10® yeast transformants in the presence of 10 pM DOC, and around 100 putatively positive yeast colonies, which grew much faster over the background transformants, were picked up. Those yeast clones were tested for (3-gal activity in the presence of DOC to confirm the protein-protein interaction, and among them 16 clones were selected because of their relatively strong (3-gal activity. In the following procedure to segregate and isolate the library cDNA plasmids from yeast, some of them were lost because of technical problems, and finally 9 clones of cDNAs were purified for further study. Those library cDNAs were isolated in the form of Gal4 AD fusion structures in the yeast expression vector pGADIO. In order to exclude false positive cDNA clones (Bartel et al. 1993), those purified cDNA plasmids were 25 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. retested with different control plasmids in another yeast strain SFY526, which contains only a 3 -gal reporter gene but with stronger inducible 3 -gal activity. In those control tests, two cDNA clones failed in test 4, because their proteins can interact with Gal4 DBD; and one clone failed in test 3, because its protein for some reasons did not interact with GR HBD in the final test. Six other clones showed specific interaction with the GR HBD (Fig. 2-4). It's very interesting to find that all the six positive clones showed the ability to interact with GR HBD only in the presence of hormone, but not in the absence of hormone. The hormone-dependent manner of interaction strongly supported the potential roles of those proteins as transcriptional coactivators for GR HBD. The six isolated cDNA plasmids were tested by restriction enzyme digestion and exhibited three different digestion patterns (Fig. 2-5a): clones 1, 3 and 4 belonged to type one with no EcoRI site within the insert, clones 5 and 6 belonged to type two with one EcoRI site within the insert, and clone 2 by itself belonged to type three with two EcoRI sites within the insert. Digestion of those cDNAs with another restriction enzyme PstI supported the existence of those three types (Fig. 2-5a). Preliminary sequencing analysis of the 5' region of those cDNA sequences finally confirmed that those six cDNA plasmids contained three different cDNA sequences (Fig. 2-5b). The type one cDNA was named as GRIP1 (Glucocorticoid Receptor interacting 26 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Fig. 2-4 Exclusion of false postives in yeast two-hybrid system. Different combinations of plasmids (see the description of each plasmid bellow), as indicated, were transformed into yeast (strain SFY526) containing a 3-gal reporter gene controlled by a Gal4 enhancer site, in the presence or absence of DOC. Yeast transformants were grown on proper selection medium plates, and 3-gal activity was tested by filter assays. Test 1, to exclude the proteins which can activate the reporter gene by itself; Tests 2 and 3, to test the interaction between target protein (GR-HBD) and candidate protein, and the hormone dependency of the interaction; Test 4, to exclude the proteins which can interact with the Gal4 DBD; Test 5, to reconfirm Test 4, and is more sensitive in some cases for unknown reason. Tests 6 and 7, to reconfirm the lack of activity of Gal4-DBD/GR-HBD fusion protein by itself. The 3-gal activity results shown are for the proteins with true positive interaction. Yeast expression vectors: pGBT9, encoding Gal4 DBD; pGBT9.GR, encoding Gal4- DBD/GR-HBD fusion protein; pVAS, encoding Gal4-DBD/p53 fusion protein; pGADIO.proteinY, cDNA clones from the two-hybrid screening, encoding candidate proteins fused with Gal4 AD. 27 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. i feaUsiteT Plasmid 1 Plasmid 2 DOC (3-gai activity 1 pGADIO.proteIn Y + 2 pGBT9.GR pGADIO.protein Y — — 3 pGBT9.GR pGADIO.proteIn Y + + 4 pGBT9 pGADIO.protein Y + — 5 pVA3 pGADIO.protein Y + — 6 pGBT9.GR ------- — — 7 pGBT9.GR + 2 8 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Fig. 2-5 Classification of GRIP1, GRIP2 and GRIPS sequences. A. The 6 purified cDNA clones were digested with EcoRI and PstI, and three different digestion patterns were observed. B The 5 'ends of the 6 isolated cDNA inserts were sequenced, and confirmed that the isolated cDNAs belonged to three types. 29 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. EcoR I 1 2 3 4 5 6 f y P stI 1 2 3 4 5 6 B GRIPl (Clone 1, 3 f i 4) GAAITCGCGGCCG6TCGACATCACCATGAA6TTCT6AGACAAGGGTTGGCGTTCAGTCA6ATC E F A A G R H H H E V L R Q G L A F S QI TATC6TTTTTCTTT6TCTGATGGCACTCTCGTTGCTGCACAAACCAAGAGCAAACTCATCC6T Ï R F S L S D 6 T L V A A Q T K S K L I R TCTCAGACTACTAATGA6CCTCA6CTT6TAATATCTTTACACATGCTTCACAGA6AGCAGAAT. S Q T T M E P Q L V I S L H M L H R E QN... GRIP2 (clone 5 S 6) GAATTCGCGGCCG6TCGACTTTTTTTTTTTTTTTTTTTTTTT6TACAGAGAGTGTAAAGTAG<3A E F A A G R L F F F F F F F V Q R V * GAAATTCCTAAGTATGACTTGCAAGAGTCTTGGGAAA6GACACNCTGTCCCATGAGGTATTGAC CATCTCTCT6TCATTCCTCAGCCTGGGAACACGTTACCTGCGCAAGTTCTCTGAGCTTCCTTCA GTAAACTATCAAAATCCAGAGA6TCATACTTGCTCTTG6TGGA. . . . GRIP3 (Clone 2) E F A A G R L F F F F F F * 6CAGCACAGAGACAAGAA6TCAAAT6TTTAAAGAAAXITGT6TTCCTTA6GGTGTTGATTTTACA CCAACAGAAAAGATGAGTCCTGAGTCTTCATGTCTTTTTTTCTCAGGGTAGCCTGAGAAGGTTGT GGTT6TGATGTGTTTAGGCTAAGGCGTCTTGCATCTAGTGACAA66. . . . 30 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Protein 1, and the type two and three as GRIP2 and GRIPS respectively. The partial sequencing of GRIP2 and 3 showed that both cDNA sequences contained a polyT sequence in the early beginning of 5' region (Fig 2-5b), indicating that they are probably reversely inserted cDNA sequences during the construction of the library. According to the reading frame continuing from the Gal4 AD sequence, either GRIP2 or GRIPS encoded only a very short piece of polypeptide sequence, which was unlikely to be a part of the native sequence of a transcriptional coactivator for GR. So far we do not have a satisfactory explanation for the hormone-dependent interaction of GRIP2 and GRIPS with the GR HBD. GRIP2 and GRIPS will not be further discussed in detail in this thesis. The insert of GRIP1 is a 2.4 kb cDNA fragment which encodes a protein sequence of 800 amino acids (Fig 2-6). Since the open reading frame of GRIP1 was continuous from that of Gal4 AD and spanned the full length of the cDNA sequence, the GRIP1 fragment was clearly only a partial sequence. The comparison of the DNA and protein sequences of GRIP1 with the data in Genbank by using National Institutes of Health BLAST program (Altschul et al. 1990) showed no significant homology between GRIPl and any published DNA or protein sequences, indicating that GRIPl was a novel protein at the time when it was isolated. The comparison of S1 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Fig. 2-6 DNA and protein sequences of GRIP1 The 4878 bp DNA sequence of GRIP1 cDNA and the predicted 1462 amino-acid protein sequence are shown. The open reading frame of GRIP 1 was defined by the multiple stop codons in both ends of the sequence. The in-frame stop codons were shown as and out-of-frame stop codons were shown as "#" in both 5' and 3' untranslated regions. The range of the 2.4 kb GRIPl cDNA sequence originally cloned from the yeast two-hybrid system (nucleotides 1167-3566) was marked by “T ”. 32 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. X A3?TGIÜüÆüÜ^aUlCCaGSaiCOUSTTKTtK»CACSGGimClkTGCCflGCCG(agCCTGCGCTCCCGCGgCGGCGGCGGAfiGTauSCGCCGACGSCTGCCC * • * 1 0 1 GCACCTGACC6CSTGACG @ CO lC A lT G fim T LC TCSCATCT6GCTTCACTU C »TG G C TCTTCTGCACTGTGTACAGGCACAgT?GCTGMAlGTGTTC I * * * K 8 6 l f 6 S N T 8 D P 8 R A S T R R R R S C P D Q L 6 P 8 P l C R S 3 0 1 G C A C T O R C H ü a C g G a R C C G C G A S a M M R G K R I A A C P t f M R G R C G R g C T G G C C G R I C t G R T C t g C G C a R R C T T T R A T G M R g T G A C A A C T T C R A C T T C A R TSKRNRXQRIIR<IKSLA.DLIPAVriroiDNrRrR 4 0 1 ACCTGACJUUiXGTGCaaCCXMUUlGAMCIGTGAAGCAGRXCCGCCRaRTCAMGRGClUlSRSRAAGCRGCAGCTGCClUVCRXAGATGIUUnGCAGAAG P D K C A I & R S t V K Q Z R Q I K K Q K l C X A . R R I f I D S V Q K S O I TC R G AIG rG TC StC C ACggG GCÂCggTG TO aCgRC?iASGRTGCRCtG GGGCCCATGRtG CTTtfRgGCCCTCGRg GGGIïC IT CIT CGCTGÏ GAACCTOG S D V 88 ¥G Q6 VX DR DA Z. 6 PK MZ .S XI .D 6r rr VV HL e G S V V r V S B N V T Q T L R T R Q K K L l C R R S V t S l L B V G 7 0 1 G G A C C R C R C T G A A g T T G T C A A G A A C C T G C T G C C A A R G T C C R T G G T G R A T G G A g G A T C C T G S T C T G G A G A A C C T C C C A G G C g G A C G a ^ f i C C A I A C C T T C A A C O B r s r V K N L L P R S K V H S O S i r O G X P P R R T S B t P H 801 TGTCGCAJGCTGGÏGMU3CCCTTGCCAGATTCAGIÜ«3AGGAACGCCATCMASCCABCaUUSCCCATCAGAAATACGAGGCgRTGCAGTSCTTCSCrGTGT C R M L V R P L P D S X K B S B D S Q X A B Q I C r i A K Q C r A V S 9 0 1 C T C A a C C C A R S T C C R T C R A A G A G G R A G G C S M G A T T T G C R ü T C C T G C C T G A W T G I G I G G C A C G A A G A G T C C C C A T G A A G S l V A A G R C C R A e r C T T C C C Ï C QP R8Z RB B6E DLQ SCLZCVARRVPKRKRPTLP S 10 0 1 AICAGIUUUSCTTTACCACCCGCCAGGACCTCCMGGCAAGASCACTTCRCTGGIUS^CZRGCRCCAZGIUSAGCCGCCASGMGCCGGGCTGGGIUUSACCTG S E 8 r T T R Q D I . Q 6 R Z T 8 L D T S T K R A A I f R P G f r K D L ▼ 11 0 1 GTAAGRAgATGCAgTCASAAGTTCCACACACASCAJGAAGGGGAGTCTCTAICMATGCCAAGASGCATCACCATGIÜUSIt CI GAGACRAGGGTTGGCGT V R R C Z Q K F B T 0 B R 6 E 8 L S r A R R B B B E V L R Q 6 I . A r 1 3 0 1 TG tRAgAgCrm CAC ATG CTTCACAgm a^fiCR G R AgSTM gtG tR ATG RAgCC G G ATCtG AC gG G ACAAG C G AIG Q G G M U SCC AgtG R AtCC AR gTASC VZ 8L8 M X. BR K QH VC VM HP D LT G QA MG RP Z. B PI S 1 4 0 1 TCSAGCAGCCCt6CCCACCA56CCCT6TGCA6TGGGRACCC|U:6TCRfiGACRIGACCClCG6TRfiCIÜUEAX]ÜVASTTTCCCAXGARSGGCCCRARGGAAC 8SSPABQAZ.C8GBP6QDKrLG8KIBrPKBGPREQ 15 0 1 AAATGGGCAXGCCTAIGGGCAGGTTTGGTGGTTCTGGGGGCASGAACCATGTGTCAGGCATGCRfiGCAACCACTCCTCAGGGTAGZRACTAXGCACICAA H G K P M G R P G G S G G K H B V B G K Q A T T P Q G S K T A L R 16 0 1 AAXGUClUSTCCCTCGCAIÜUSauSCCCCGGaUCGRJUIXCGGGGCMUSCCAGCTCCGTGCtCTCCCCAAGGCASCGCRSGRGCCCCGGCGTGGCTGGCAGT K N S P S Q 8 8 P G M N P G Q A 8 8 V L 8 P R Q R 1 C S P G V A 6 S 1 7 0 1 CCTCGCAICCCACCCASTC JU 3TTTTCCCCTGCItf3GIÜU5CTTgC Ag T CCCCTGWSGAGTITGCRflC3Æ CJMSASGAARTAfiCCAIAStTACACCAACaGTT P R I P P 8 Q F 8 P A G 6 LBS PV GV CS8 T G B 8 B 8 Z T H 8 8 1 8 0 1 CCCTCAAIGCACTGCMUSCCCTCAGCGIU3GGCCASGGGGTCTCACTC6G6TCCTCGCXGGCZTCACCGGACCCAAAIAXGGGCAAITTGCAAAAC1CCCC I.KALQA L8 EG BGV 8 L G 8 S Z . A 8 P D Z * R K 6 B L Q K S P 1 9 0 1 AGTTMmiTGARICCTCCCCCACTCAGCAAGRIGGGRAGCTTQGRCTCCARAGACTGTTTTGGRCmATGGGQAGCCCTCRGAAGGlACAACTGQACRA V N M M P P P L S R M G S L D S R 0 C r G L T 6 E P 8 E 6 T t G Q 2 0 0 1 GCASAGGCOUSCTGCCMCCCGIAGRAaüüAGGGGCCCAAXGAXTCCAGCUGCCCCXGGCGGCCAGCGGGGACAGGGCrGXGGGACACAGCCGGCTGC A E A 8 C B P B S Q K G P K D 8 8 M P Q A A 8 6 D R A X G B S R L B 2 1 0 1 ASGACRGCAAAGGGCASACCAAACSCCTGCAGCTGCXGACCACCAMStCCGACCAGAXGGASCCTZCACCCTTGCCCAGCTCCTTGTCGGACACAAACAA D 8 K 6 Q T R L L Q I . L T T R 8 0 0 M B P 8 P L P 8 8 L 8 D T R R 2 2 0 1 GGACTCMUCAGGGM3CTTGCCTGGGCCSGGGICCACGCAIGGCACCTCGCTCAAGGASMGCM1AASXXTITGCACA6RCTCITRCASGRCRGCA6TTCC D 8 9 G 8 L P G P G 8 T H G T 8 L R S R B K Z L B R L L Q 0 8 S S 2 3 0 1 CCTGTGGACTTGGCCRAGCTGACASCAGkACCCACRGGCRAAGAGCTGAGCCAGQAGTCCAGCAGCACAQCTCCIGGGTCGGRAGTGACTGTCAAACAGG P V D L A R L T A E A T G R X L 8 Q E 8 8 8 T X P G 8 S V T V R Q B 2 4 0 1 ASCCAgCgAGCCCCAAGARGAAAGRSAAaGCRCtACTGCG C IA aTTG Ct CGRCIÜSAG ATG AIR CTAAAG AlAITGGT tT ACCSGAAAgEACCCCCMACT P A S P R R R E R X L L R X Z i L O K D D T R D I G L P E Z T P R L 2 5 0 1 CGAGCGACTGGtoAfiTAAGACAGMCCTGCCAGIAACACAAAGTlAATTGCIAIGAAAACTGTGAAGGAGGAGGTGAGCTTTGRGCCCASTGACCAGCCT E R t . D S R T D P A S H T R L Z X M R T V K E B V 8 r E P S D Q P 2 6 0 1 GOCAGCGAGCIGGACAACTTGGAASAGATTTTGGAIGATTTGCAGAACAGTCAGIIACCRCXGCTTITCCCAGACAOIAGGCCAGGAGCTCCIACTGGGT 6 8 B L D K L E E Z L D D L Q B B Q L P Q L P P D T R P G A P I Q S (To be continued) 33 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. (Continued) 2 7 0 1 CAGTTGACAAGCMGCCAICAICAATGACCTCAIGCM CTOICACCTGACAGCAGTCCCGTCCCACCTGCCGGACCCCAGAAGGCAGCACTGCGCATGTC VDK QX X Ii rD Z . MQ Lt AD S 8P V PP A 6A QR A A. I. RM 8 2 8 0 1 ACRGkGCaCITTTAAaACCCkCGACCAGGGCRACTGGCCAGGT T R IT GCCAAACCASAACmACCACZTGACAIOlCTTTGCAAAGCCCAACTGGTGCT Q S T F N i r p R P e Q L 6 R I . L P H Q V I . P L 0 Z t L Q S P T 6 A 6PrpPZRH88PT8VZPQpeUHGRQCKIiG8Q6NL6 3 0 0 1 GGRACauaAGCACACGAATGAITGGCAGCASCRCTTCCCgGCCCAGCATGCCTTCTGGGGRRTGGGCACCACAGAGTCCASCTGTGASASTQCTTGTGC ltH8T6MZ688T8RP8KP8aSfrAPQ8PAVRVTCA 3 1 0 1 TGCSRCCACTG6T6CC3iXGIUUX6ACCAGTCCMGGRSGCRS6RXTCSGAACCCAACAGCaU3CRICCCCAIGCGAGCCRACRGCCRGCCTGGCCMAGA A T T G A M N R P V Q 6 G M Z R H P T A 8 Z P K R A H 8 Q P G Q R 3 2 0 1 G A G R T G C I T C R S T C T C R G G T C R T G R A C M A G G C C C T T C T G A G T T A g R G A r G R A C A T G G G R G g ^ C C T C R O T R g X A T C A A C R g C A G G C C C C T C C S R A C C R A A Q M L Q 8 Q V M K Z 6 P 8 S 1 K M R H 6 6 P Q T H Q Q Q A P P R Q T 3 3 0 1 CTGCCCCGTGGCCTGRGA5CAICCTGCCZRXA6ACCAGGCAICGTTTGCCAGCCRGMCAGGC1U3CCCZTCG6CASCTCCCCTGAX6ACCZGCT6T6TCC A P * P Z 8 Z L P Z D Q A S F A S Q R R Q P P G S S PD Dt LC P 3 4 0 1 ACRTCCTGCAGCAfiAGTCGaaAGCGRTGRGGGCGCTCCTCTTGRCCRGCTGIA J CT GGCCTTGCGGRACTTCGRTGGCCTTGAGGASRTTCMAGAGCT R P A A B 8 P 8 D K 6 A L L D Q L T L A I . R ! r r D G Z . E B Z D R A ▼ 3 5 0 1 CTGGGGAgRCCAgRACTGGTCIUXCASAGCCRRCCTGTGGRTGCRGRGCAGT g CK AAGTCAGGKGTCCRGCRPUeCGCTGGRGCAGRAGCCCCCCGZTT I.GZPBLV8Q8QAVDABQr88QBSSZtfI.BQKPPVr 3 6 0 1 TCCCRCAGCAGTACGCASCTClURSCRCMASGGCCCRGGGTGGCZAZAATCCCAfGCJUUSRZCCMACTTTCACACCAZGGGACAGCGGCCMAIlACAC P Q Q T A O Q A Q M A Q G G T K P K Q D P N P B T M G Q R P N Z T 3 7 0 1 CRCACTCCSTRXGCAGCCIUZGGCCIUSGCCtCRSGCCCACAGGCAXTGÏACAGAACCASCCXMCCMCTGRfiACSTCAGCTTCAGCACCGCCTCCMGCA T L R K Q P R P G L R P T G Z V Q H Q P B Q L R L Q L Q R R L Q A 3 8 0 1 CM CAGAArCG CCAG CCG CTTM GARICACM CASCtoTGlTTCCAAIG TG AACCTGACTCTGAGG CCTGG AG TG CCCXCTCASG CTCClAITXAIG CAC Q Q K R Q P t « K H Q I 8 8 V 8 K V H L T L R P 6 V P T Q A P Z N A Q 3 9 0 1 AGAIGCTGGCCCAGRGGCAGAGGGJMICCTCMCCAACACCTTCGGC1USAGGCR6RZGCAGCA6CRG6TGCAGCAGCG6ACTCTGRTGAIGAGRGGACA M L A Q R Q R B Z L K Q B L R Q R Q K Q Q Q V Q Q R T L K M R G Q 4 0 0 1 GGGCTTGRATGTGACCCCAAGCRIGGTGGCtCCCGCTGGCCIRCCAGCRGCCATGAGCAATCCCCGGATCCCCCASGCCAATGCCCRGCIUS TTCCCRW T G L K V T P S K V A P A 6 t . P A A M 8 H P R Z P Q A K A Q Q r P r 4 1 0 1 CCTCCGARCTACGGRRIAAGTCIUtfAACCTGArCCTGGCTtTRCTGGGGCTRCGRCTCCCCAG RG tC CTC IAAtG TC TC CCC G G AIG G CACR IR CTaiG A P P t l F 6 ZS Q Q PD PG FT G A TT P Q 8P I. K8 P RI CA aT Q 8 4 2 0 1 GTCCCATGRTGCAGCAGTCTCAAGCCAACCCAGCCTRCCRgCCCACCTCACRCAgGRATGGRgGGGCACRGGGGAGCATGGGTGGIUUlCRSCRyGTTCgC P M M Q Q S Q A N P A T Q P T S D K R G i r A Q G S M G G K S M F S 4 3 0 1 ACASCAGTCCCCACCACRCTTTGGGCAACAAGCaUUUaiCCAGCATGZRZAGBAACRACATGRACAICRGTGTGTCGAIGGCAACCAACACGGGTGGCTZG Q Q 8 P P H F G Q Q A K T 8 H T S N H M K Z 8 V 8 K A T N Z G G L 4 4 0 1 AGCAGCAIGRACCAGATGACATGCCAGATGAGCAIGACCTCAGTGACCTCCGTGCCIACGTCAGGACTGCCCTCCArGGGTCCCGAGCAGGTCAAIGACC 8 S M M Q K t C Q K 8 K T 8 V T 8 V P T S G L P 8 M G P B Q V N D P 4 5 0 1 CTGCTCTGAGGGGAGGCAACCTTTTCCCAAACCAACIGCCTGGAAIGGACAIGAlCXAGCAGGMGGAfiAIGCArCTCGGAAAIACTGCTGACCCTGGAG A L R 6 G N L F P N Q L P G M D M Z K Q B 6 D A 8 R K r C * * 4 7 0 1 CCCAGGACRIRGCAgCRGRCRGTCGGGCCCTGGGCCCGCAGCAIAGRGCGTGCTGGCCTGGCTGHmCMGGRAGAGTTGCCTCTCCCGRCAGCCTGCAGC * # 4 8 0 1 TCGCCTCCAgRCCAACCCGCRGTCTGT TCACTGCATTCRCCGTRGTGCAAeTTAgRTCTCCTGCRfiAGtlU^CTGTCCC (4 8 7 8 ) i f * 34 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. GRIP1 with SRC-1, a human transcriptional coactivator of steroid receptors which was reported after the GRIPl sequence had been submitted for publication(Oriate et al. 1995), will be discussed later in this chapter. It is Important to point out here that although the 2.4 kb GRIPl fragment only contains a partial cDNA sequence, it is a fragment with almost all the most important features for a transcriptional coactivator of steroid receptors, as we will discuss in chapter 3 and 4 of this thesis. 2.2 GRIPl is widely expressed in different tissues The expression of GRIPl in different tissues was tested by Northern blot analysis by using the 2.4 kb GRIPl fragment as a probe. A premade Multiple Tissue Northern Blot from Clontech, which contains mRNAs from mouse heart, brain, spleen, lung, liver, skeletal muscle, kidney and testis, was used in the Northern blot. The result indicated that GRIPl RNA was widely expressed in all the tested tissues, although the expression level varies among different tissues, with the highest expression in the testis, and the lowest in the spleen (Fig 2-7). At the same time, the control hybridization with a-actin as a probe showed a relatively consistent signal in all the tested samples. In most tissues, GRIPl exhibited two different transcripts, with sizes of around 9.0 kb and 7.0 kb respectively, possibly resulting from alternative splicing of the original transcript. It is also interesting to note that 35 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Fig. 2-7 Northern blot. The expression patterns of GRIP1 and (3-actin (control) were analyzed in a premade multiple mouse tissue mRNA blot from Clontech. The blot was first hybridized with the original 2.4 kb mouse GRIP cDNA and then rehybridized with human p-actin cDNA. Sizes of RNA markers provided by Clontech in the blot are indicated on the left. 36 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. S t A 1 2 3 4 5 6 7 8 kb 9.5 - 7.5 — 4.4 — 2.4 1.35 GRIP1 p-actin 37 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. in testis GRIP1 exhibited an extra 5.0-kb transcript, indicating that GRIPl might utilize a different splicing mechanism in that tissue. Rehybridization of this blot with probes from the extreme 5' and 3' ends of the full-length GRIP1 coding region (see below) produced the same pattern of bands (data not shown), suggesting that the different transcripts share a common coding region and may differ only in the lengths of their 5' or S' untranslated regions. 2.3 Isolation of the full coding region sequence of GRIP1 from a mouse brain cDNA library In order to isolate the full coding region sequence of GRIP1, we used the original 2.4-kb GRIP1 cDNA fragment as a probe to screen a ZAP II lambda phage mouse brain cDNA library, since GRIP1 is also well expressed in mouse brain (Fig. 2-7). The first screening of 1 0 ® lambda phage plaques resulted in the isolation of three cDNA sequences which heavily overlapped with the original GRIP1 sequence, and extended the sequence by 0.9 kb from the 5' end and 0.7 kb from the S' end (Fig 2-8). Two DNA fragments from the extended regions (about 0.8 and 0.6 kb each) were used as probes for further screening of the same library. Ten different overlapping cDNA sequences were isolated and represented a total length of 4.9 kb (Fig. 2-8). The 4.9 kb GRIPl sequence contains an open reading frame of 1462 amino acids for the full coding region of GRIPl, which has a calculated molecular S8 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Fig. 2-8 Screening of mouse brain cDNA library for the full-length sequence of GRIP1. The 2.4 kb GRIP1 fragment from the yeast two-hybrid system screening was used as a probe to screen a mouse brain cDNA library. The cDNA sequences from the extended regions were used as probes to screen the same library again. The length and relative positions of the cloned cDNA sequences are shown. The cDNA regions used for probes were marked. The 4 cDNA sequences marked with “*" were sequenced in both directions, and represented, together with the original 2.4 kb sequence, a total length of 4.9 kb cDNA sequence. 39 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 2.4 kb GRIP1 sequence (probe) t Screen 1 (probe) (probe) t Screen 2 t Alignment 4.9 kb GRIP1 sequence 40 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. weight of 158.5 kDa (Fig. 2-6). The full reading frame of GRIP1 was defined by multiple stop codons on the 5' and 3' ends. The protein sequence of GRIP1, predicted from its cDNA sequence, was compared with the sequences from GenBank by using the National Institutes of Health BLAST program (Altschul et al. 1990). It was found that GRIP1 shares significant homology with SRC-1, a human transcriptional coactivator for steroid receptors (Onate et al. 1995). Although GRIP1 contains an N-terminal region that extends beyond the N-terminus of the originally reported human SRC-1 sequence, the original SRC-1 sequence was subsequently found to be incomplete at the N-terminal end. The recently reported SRC-1 a, one of the SRC-1 variants in mouse, contains a longer N-terminal region which shares very high homology with GRIP1 (Kamei et al. 1996). The amino acid identity between full-length GRIP1 and SRC-1 a is 43.1 % (excluding regions that are opposite gaps in the alignment), with the highest homologous region located in the N-terminus of both proteins (59.4% amino acid identity) (Fig. 2-9 & 2-10). The extensive collinear sequence homology between GRIP1 and SRC-1 a indicates that both proteins may belong to a new transcriptional coactivator family. In a recent report, Voegel et al. reported the isolation of TIF2, a 160 kDa transcriptional mediator for the ligand-dependent AF-2 activation domain 41 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Fig. 2-9 Amino acid sequence comparison of GRIP1 and SRC-1 a. Corresponding regions of strong homology between GRIP1 and SRC-1 a determined with the National Institutes of Health BLAST program (Altschul et al, 1990) are indicated by open boxes connected by vertical or slanted lines. Percent amino acid identity for specified regions are indicated above the GRIP1 sequence. The following regions of GRIP1 are indicated at the top for reference; amino acids 322-1121, encoded by the originally isolated 2.4 kb GRIP1 cDNA clone: amino acids 730-1121, which retained steroid receptor binding, transactivation, and coactivation activity. The following regions of SRC-1 a (Kamei et al. 1996) are indicated at the bottom: amino acids 381- 1148, corresponding to the originally reported SRC-1 sequence (Oriate et al. 1995), now known to be a partial sequence; amino acids 1243-1448, corresponding to the original SRC-1 clone from two-hybrid screen, which is a dominant negative protein fragment (dnSRC-1) when expressed in mammalian cells because of its interaction with nuclear receptors but lack of coactivator activity (Oriate et al. 1995). 42 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. I E H , g' g' O ) s 5 I ■ o % Ü Û C o (0 I o o n 0 3 43 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Fig. 2-10 Amino acid sequence alignment of TIF2, GRIP1 and SRC-1 a The complete predicted amino acid sequences of TIF2, GRIP1 and SRC-1 a were aligned with Gap program of Genetics Computer Group (University of Wisconsin) software (Devereux et al. 1984). Sequence alignment is shown with amino acid identity (|), conservative substitutions (.) and highly conservative substitution (:) indicated in the line between each pair of protein sequences: gaps introduce between amino acids for optimum alignment are indicated (...) within the sequences. 44 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. il iiiiiiiiiiiinitiiiiiiiMiM I uiiiiMii 1 1 1 1 1 1 1 1 1 :1 1 1 1 1 1 1 1 INI il HUM iiiniiiiiii III mil Mil 1 1 1 1 1 MSflMGPiT8DPSWaTiqgUgCPDQLSP8PiqiaTKiqO iKlQgNICTllgJU)LI«ttiIWDIBHgM W DI C CAILKITVlC0CTQIKlQ«gUÜUmiDgVQK8 II1:1:.Jll..::.:|||::l : :| 1 1 1 1 1 M 1 1 1 1 1 I : 1 : 1 1 :1 : 1 1 :>11M: . . 1 1 1 1 I III.Mil. :| I .. 1 0 0 1 : 1 1 1 1 S R C -la HSCLGD88SDPW PP8HKW CGSPCDTL88.. .S m O U U Ig Q B N K g H f ir A CT.TJUWIS D IO S LS V K P D K C K lLlllLTVD Q IQ U flW lg gMCSTTDDDVOKS 97 sac- 1# DVSSTGQGVZOKDALGPMOJUaOCFFPVVMLBGMWFVSKNVTQTUmiQBSlMlKSVTSZLBVGDSTSfVRHLLPICSZVMGGSIISGSPPRaHSBTRtC IIIIIIIIIIIIIIIIIIMMIIIIIIIIIIII.IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIlltllllllllllMlllllllllllll.llllll DV8 STGQgPIPKPALGPI1 LBJUJ)GPPPW HLKCSW FV8K H V T O T ta » O ttI> a a C S V T S IL a VGPBTEPV10ILLPKSMVHGG8lf 8CgPPRRTSHtfW C |:|).;ni|:l:.MI::|liniMIMI II MIIIIIII II 1 1 1 1 1 M 1.1 1 U IIII111.1 M II M 1 1 1 : III.. I.. I :. I I. It 1 1 1 1 DZSSS8QG VZXXBSL6PLLLKAI0GFr?VVNCEG RXVFVSBNVT8TL6niQnU81TSVT8ZX.BVG 0RaKFVKM LLPX8Z.VN6VPIfpQEaSRaH8BTR(C 200 197 aKLVKPLPD8SSI68miQSaBQICZSTMQCIAVSQPIC8XKUCS0LQ8CLZCVauaiypHRERPVLP88S8PTTllQDLQGXZTSZAT8tM RM MKPGNB0LV III iiiiiiiiiiiii.il III iii.iiiiii 1 1 iiiiiiiiii mill I iiiiiiiiiii.il Mini I III iiiiiiiiiiii I III I III III 1 1 300 taXPl aiC.VKPI.PPa m GHD80E3g0ianaH0CgKysOPK8X»BMDli08CLICV3üUWPMKIRPTLP888SPTTRQPlOTOT8Iiyr8ngUÜtt«PGIIBDLV 300 111:1 .1 :.| : . M I I : M . I I I I . I 11 I I I I . I : III : IIII11 : III : I . . 1 . : . : M l l : | | I I I . M i l l . : I M : . M M M sac-1# BMLZH9... PBOPGTEKQSACQaZCVMQCFTVSQPKSZQKDGSDPQSCLZCZAIIRX^.. PPAZTGVESnfZKQDTTOaZSZOTSSLiUUUSaTGIIEOLV 292 T IF 2 aRCigKFHAQBZGBSVSTAXaBBBEVIAQ6LAPSQITRFSLSDGTLVM0TKSXLZaSQnNBPQZ.VZSLBM LBaE9IVCVM IPDLTGQ1MGXPU<PZ. MMMM.MIMMMMMMMMMMMMMMIMMMMMMMMMMMMIMMMMMMMIMMMMMMMM RRCIQKFBTQBB(Z8I.STJUCRBBBKVLRQ GUlPSQ Z71tFSI.SDG TLVM gnCSKLZasgm iBPQ LVZSLBM LBaEaNVCVItlPDLTO0aM SKPUIPZ. Mil I l.:l . MM. :IM .| I I . Ml 1. 1 1 M :. M I M 11. I . . : ..:|| 398 398 sac-1# RKCZTAPP.QPQGaEPStJUIQLPQEVICrRGTASSPSTllPZZllDGIMLSABTKClCLCTPQSPDMQPPIMSZBZIOaEflSGLSaQOOSHSGMSZPaZMPSVN 391 SSMSPABOaLCSOI. .PG Q 0M TL8SNIN............. FPZKGPKBQHGMPMGRPOGSGatlBVSGK---------- 08TTPQ 68N tAEA8ISPSQ SSPO tlPG Q PTSKL 486 M.lllllilllll MMMMMM I M I I I I I 1 1 1 I I111 I I I I I 11 111III 1111 1 1 I I I I I I I1 1 I I I I I I I I1 1II M. M I SSSSPABQaLCSGN.. PGQDKTLGSMIN............. PPWGPKEQMGMPWStPGGSGOMmVSGM______Q aSTPQ G SN tA IAtlS PS Q SS PQ ftlP G gJlSS VL 486 . : H I M . I:. | : . : : : . . : | : : I. I I . I . I . I . . : I .1 . 1. : I .. . : I .: P6ZSPAB(3mSSTLPPSKmiMVSAaVMKQQSSDZ2l8SSSH7NSSKNQ(aiPGCSPGMQZVJUIVWlQG0aGSQTTNPSLNIi<N8PHBGT6ZAZ.SQ. . . EH 488 TZF2 SPRBaHSPGVXGSFRZPPSQPSPA. GSZASPVGVC88T. . GW8H8rïW 88XHaLQIU.SgG8gVSU58SLASPDLKHSHLQNSPVMW PPPL8KHSSIJ)SK M M M M I I M M M M M M M M M M M I I M I I I I I I I I 1 1 I I I I I I I I I I I I I I I I I I I I I I I I M 111II1111II1111 M I I I I I M I < a U P l S P R Q a K S P G V a C S P R Z P P S Q F S P A . G S L B S P V S V C S S T .. G N S B a t T N S 8 U I A L Q ] a 8 S C T S V S t a S 8 I A S P D Z J M G N X a i S P V ) M I P P P L S m 6 S I J > S K M M . . . | : M . : M . . M M ..I M I M . M . . M : I M I . : . . M : : . I M . M l I : | l M . M i l .:. .1 .1 :| Ml 8 a C -l# SPRB0AKS(3LATaAaMSMNSFPPNZPTZ.S8PV6ITSG3kCMNHMBST8KZFVTSZQa«K6PIQfSV6FSJU38PVLRgHS89l8PSaLSMQP.AICUSKDSK 583 D C FG LI6 BP8EGTTOOIi£88 CaPGEQKETMDPNZ.PPAVSSXa]U}OQ8aLHD8 KGQTXLLQU.TTRSO. @ 48PSPLAS8___ LS0 TMKDST6 SLP6 SGST I M i l l l l l l l l l l l l l l . l l l l : | l | : . I M . : M I . I : : | M I : I I I I I I I I I I I I I I I I I I I M M M M M I I I I 11II II I I II I I . I I I DCF6 LTCZPS8 GTTGQAEASCHpa8 QKSPMD8 SHP0 aASG0 RAB6 aSaLHDSXGQTKLLQU.TTKSD .QHEPSPLPSS L 8DTMKDST6 SZ.P6 PGST :. : :.. I I . :. I :. : : I I M : : .. : . II . M . I .. 11 : 11 II M . : M . . . : . . I II I . .. I. : I . . M l BZASZIM B...........MZQSDNSDNSANBGKPtDSGLLH. NNDRLSEGDSKZ. . SQTSaXLVQU.TTl!AEQQLRBaDZ0TSCXDVLSCTGTS8SASSNPSGGT 679 B6 . . .TSLXERBXZLBRLLQOSSBPVDZAXLTAXATGBDLSQESS.. II IMIIMMMMMMMMMMMMIMMMMM H O .. . TStKBKHKZLHIlLLQ DS88 PVDZAKLTAgATGKBl.SQ8 8 S . . .IMMIIIIMMM :|| M..| .1:. I : ..|. .81ÜAP6SBVTIKQ BPVSPKKXB.. .M A LLaiLLO X D O ........... T K D IG LP E IT IMMIMMMIMIIMM MMIIilllM Mllllllll .8TAPG8EVTVRQ XPASFI0CXB.. .KALLRTLZDKDO........... TK D Z 6LP E IT I :... ; I I .. : I III :. II11111II : 763 763 S R C -1# CPS5BS8LTBRBKILHRLLQ B. cgpgP T «rT T .gV K P gpm gvp##T #vw aÆ Q aQ eg#gT gT jgT .n##inof#«m w Q T .T .avT .T .ngni»frpT ,pyT »p^.^,ppvy 770 T IF 2 PiaxaL0SXTDPASMTKLZAHKTBXEBHSFBPG0QP68BLDHZ.BEZL0DLgH.8QLPQI.FPDTR.P<SAPAG8VDX0AZINDIMQZ.ZaENSPVTPVGAQICr 861 IIIIII Mill III Mlllllll MMMIMIIMMMMMMIIIM M Mill MM I III. II1 1 II1 1 1 1 1 1 1 1 1 1 M . 1 1 1 .1.1II M G R IP l PXLSaLOSKTDPASNTKLZAMICrVXBBVSFBPSOQPGSSLDMZBSZLDOLaK.SQLPQLFPDTR.PGAPTGSVDKOAZZllDlMQLZAOSSFVPPAGAQKA 861 .1:1: : . II I... II I . : M • I .. : I I.: : : :M . M . . I M I ... I . I M II I..:: . :| I.. : I 8R C -1# VKVSXXB.CHDPOmiPTPHrKPAPKBVXLBSQSQFTADUQPDQZXPTLBKAAQLPSLCBTDRMDOAVrGVSZKAEVIPASLQPTTA........................RA 867 TZP2 AUaSQSTmtlPaPOQZÆ RLZPNOILPIAZTIQSPTGASPFPPZRHSSPTSVXPQPQM aïQGM ZGNQCaiIAISSTGMIGKSASRPIHPSGEIIAPQSSAV 961 IIMIIIIIIIIimiMIIIIIIIIIIIIMIIMIIimillllillMllimilllMI.IIIIII.IIIIIMMIIMIIIIIMMMM G R IP l ALaM8Q8TmHPRPGQLGRLLPNQHLPtDZTL0SPTGASPPPPXRHS8PY8VIPQPGW4GWQQ4tgS0G«LGMW8TOgG88TSRP8MP8<gWAPQ8PAV 961 I I:|. s a c - 1 * A P R I.8R ......................................................................................................................................................................................................................................... 873 TZF2 RVTCAAITSMftlRPVQGGMiaHPAASZPKRPSSQPGQRQTLQSQVIftfXOPSBlMlMGGPQTSQQQAPPNQTAPirPBSZLPIDQASFASQNRQPFOSSPD 1061 I II IIIIMIIMIIIIMMIMIMMM.il I MMMMIMMIIMMMMMM III IIIIIIIIIIIIIIIIIIIIIIIIIIIIII11II G R IP l RVTCAATTGMftlRPVgGGKZaHPIASZPHRAHSQPGQRQHt^SQVMKIOPSSIMlMGOPQZNQQOAPPNQTAPHFSSILPIDOASPASaMRQPFOSSPD 1061 MM: : I:. M . I . : I M :.. I : I . : : I I S R C -1# ........................................................................................................................ LPBLKIRAIOHQFGQPGA. .GO Q IFNM Q ITLTTIM Q H. .KPBDQCISSQLO 920 (T o b e c o n t in u e d ) 45 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. ( C o n tin u é e ) T IF 2 D L L C P B F JU « S C S 0 S G M X 0 < lL ..X IA L ia ire G L B ID lU l;G IP C I.V .8 a sa )W D P B g P S S a D ..8 H IM L E Q IC ftF V n Q Q X A S a A g ta Q ..G S T S IM . .g 11 5 2 l l l l l i n i K M M I I I I I I I II M l l l l l l l N l l l l l l l l l l l l l l l l | : | l l l l l ; 1. 111111: 111111111111111 | : | . | l I s R iP l D L L C s a p A M S P s o K G M io g i,..x iA u ia c s iJ C B iD iw U 2 iP B L V .s a 8 O iw s M g rs s 0 i..s s iM tx g K P P v n g g n s g ii9 a Q .-G e n < m ..g ilS 2 :l1 1I | : . . l l l l | : | | :|. :: .: I . I : I1111I.. I I .1 . 1 1 . 1 : .. : I : I : ; I .: ; . I . I . I .. . |. | . ; . . l | S R C -la » L L C B P tT V 1 6 la n )« lg ttL tg L V 8 fIJ C a ttH T» l*llD IU > Ig IB K L V g G C B 1 0 V M M > P P g u » T P P m « D R P T l.T 8 g g T 8 8 P 8 g T 3 > C L 3 G P ta a iV llg 1020 T IP 2 OPHFHTM..............G Q P P S T A T .IjlM gP R P C L R P T G LV W gP N g U IlgLg m U gig ...........g N R g P I*e ig iS N V a N V N I.T I*P G _____V P TgkP IH A gK LA g 12 3 7 i i i i i i i i i i i . i . i i i i i i i i i i i i i i : i i i i i i i t i i i i i i i i i i i i i i i u i t i t i . i i i i i u i i i i i i i i i u u n i n G R IP l DPNPHTM..............egR P N TTT.U IM O P R P G lR P TG IV O N gP N glR tgLgB R ItlgM IC 9ISM r8VTSVPTSatPSHG PC gVM >PALRG G H UPIigi.PG M SM I](Q ZG DASR)CXC..................... 146 2 : . . . | . . : : | 111 . 1 . 1111. .. :.: I I I .11 I .1:. .1 : . : .. 11: 111 111 . . | : . I I I . : I : : | : : l : . . S R C -la g.PAP A gP G V T.M R M S ITV S K R G G M M IIQ M m M G C M K . ..S S LO IP aW T V C S X attlO P A U taT G tT C IlgLS S T D LLIC ID A D O T igvggH V gV P R D V 14 0 3 S R C -la gC TVR LVG G O PTU igPG PLG TgKPTSG PgTPgRggKSUggU TE 1 4 4 8 46 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. of nuclear receptors (Voegel et al. 1996). TIF2 shares 93.9% amino acid identity with the full-length GRIPl, and thus TIF2 is the probable orthologue, i.e. the human version, of GRIPl (Fig. 2-10). DISCUSSION The mechanism by which transcriptional activator proteins, including steroid receptors, interact with the transcription machinery to activate the expression of adjacent genes is one of the most important unanswered questions in the field of gene regulation. It is now believed that the DNA- bound transcriptional activators may exert their effects by making crucial contacts with basal transcription factors, transcriptional coactivators, or chromatin components. It is important to notice that all the possible mechanisms are based on protein-protein interactions. The direct protein- protein interaction between steroid receptors and basal transcription factors was first found in ER, since ER can specifically interact with TFIIB and TBP in vitro (Sadovsky et al. 1995; Ing et al. 1992). However, those interactions are hormone-independent, and do not correlate with the transactivation activity of the receptor (Cavaillès et al. 1995; Sadovsky et al. 1995). So the significance of these direct interactions remain to be evaluated. In recent years, more and more attention has been focused on the search for the 47 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. protein-protein interactions between steroid receptors and their transcriptional coactivators. Although in early studies some putative transcriptional coactivators for steroid receptors were identified by biochemical methods, the newly developed yeast two-hybrid system provides a powerful tool for the search for such coactivators based on protein-protein interactions (Hong et al. 1996; Oriate et al. 1995; Le Douarin et al. 1995; Lee et al. 1995a; Lee et al. 1995b). We successfully utilized the yeast two-hybrid system to isolate the partial cDNA sequence of GRIPl based on its ability to interact with the HBD of GR in a hormone dependent manner. Like most of other cDNA sequences isolated by the yeast-two hybrid system, the original GRIPl sequence is not a full-length sequence, although this 2.4 kb GRIPl contains almost all of the most important features for a transcriptional coactivator, as I will discuss in Chapter 3 and 4. The screening of a mouse brain cDNA with the 2.4-kb GRIPl fragment resulted in the isolation of a 4.9-kb GRIPl sequence. When compared with the 9.0-kb and 7.0-kb GRIPl transcripts observed by Northern blot analysis, the 4.9 kb GRIPl sequence is clearly not a full-length GRIPl cDNA, but it contains the entire coding sequence of GRIPl and makes it possible to study the biological function of the intact molecule of GRIPl. The full coding frame of GRIPl was defined by the finding of multiple stop codons on the 5' and S' ends of the sequence, with 48 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. the initial ATG codon mainly identified by its first in-frame appearance after the 5' stop codon. However, the real coding frame of GRIP1 remains to be finally confirmed by the analysis of purified native GRIP1 protein and by Western blot once the antl-GRIP1 antibody is available. Sequence comparison revealed that GRIP1 shares extensive homology with SRC-1, a human transcriptional coactivator for steroid receptors (Onate et al. 1995). Since the amino acid identity between those two proteins is only 43% and some large gaps exist in their sequence alignment, GRIPl and SRC-1 would not be the same protein from different species. With the discovery of TIF2, the probable human version of GRIPl (Voegel et al. 1996), it was clearly confirmed that SRC-1 and GRIPl are just structurally and functionally related proteins. They may represent a new transcriptional coactivator family, and the existance of other members of this family remains to be investigated. In the recently reported mouse SRC-1 family, there are 5 different variants of SRC-1 (Kamei et al. 1996). But they are more likely to be the products of alternative splicing of the same transcripts. Since both GRIPl and SRC-1 are novel protein sequences which do not exhibit any significant known motifs to indicate their biological functions, the homology between those two sequence may provide interesting information for the discovery of new motifs which will support the function of transcriptional coactivation. 49 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. CHAPTER 3: INTERACTION OF GRIP1 WITH HBDs OF NUCLEAR RECEPTORS. INTRODUCTION We have successfully isolated the mouse GRIP1 cDNA sequence based on the ability of GRIP 1 to interact with the HBD of GR in a hormone- dependent manner. According to the current understanding of the biological role of a transcriptional coactivator, the ability to exert physical interaction with the enhancer bound transcriptional activator is one of the most important features for a transcriptional coactivator, and GRIP1 is clearly qualified in this respect. However, the physical protein-protein interaction by itself is far from being enough to define a transcriptional coactivator. In this chapter, I will discuss the biological significance of the interaction between GRIP1 and the HBDs of GR and other nuclear receptors. My goal was to reveal the correlation between the steroid receptors' ability to interact with GRIP1 and their transactivation activity. In fact, the hormone-dependent property of the interaction between GRIP1 and GR, as I have described in Chapter one, has provided the first evidence for the biological relevance of such interaction, since the interaction with GRIP1 correlated well with the activation status of GR. However, in this chapter I will extend the test for the hormone- dependent interaction with GRIPl to other members of the nuclear receptor 50 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. superfamily. Furthermore, since agonists, antagonists and specific mutations can also affect, either enhance or decrease, the transactivation activity of steroid receptors, I will also discuss their effects on the interaction between GRIP1 and the HBDs of steroid receptors. MATERIAL AND METHODS Construction of plasmids: The cDNA sequence coding for the full length GRIP1 (1462 amino acids) was constructed in pBlueScript (Stratagene) by linking four overlapping GRIPl clones through proper restriction enzyme sites, as indicated in Fig 3-1, into two different kinds of 4.7 kb fragments. An EcoRI site was introduced into the 5' end of the fragment at slightly different positions during the construction (see below). The yeast expression vector for the Gal4 AD and GRIPl fusion protein, pGAD424.GRIP1/fl, was made by first using PCR to create an EcoRI site in GRIPl codon 5, and the EcoRI fragment coding for GRIPl5.1462 was inserted in the proper reading frame in pGAD424 (Clontech). pGBT9.GRIP1/fl, coding for Gal4 DBD and GRIPl fusion protein, was made by subcloning the same GRIPl 5.1452 coding fragment into the EcoRI site of pGBT9. Yeast expression vectors for Gal4 DBD and nuclear receptor HBD fusion proteins, named pGBT9.ER-HBD, pGBT9.AR-HBD, pGBT9.MR-HBD, pGBT9.PR- HBD, and pGBT9.VDR-HBD, were made by inserting PCR amplified cDNA 51 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Fig. 3-1 Construction of the full length coding region of GRIPl. Four overlapping GRIPl cDNA sequences cloned from the mouse 17-day embryo cDNA library and the mouse brain cDNA library were linked through proper restriction enzyme sites as indicated. The corresponding positions of each cDNA sequence are labeled at both ends of each sequence. The inset for the 5' end region of the sequence shows the original GRIPl sequence in the top with the protein reading frame, and two different modified 5' ends of GRIPl sequence. In sequence A, which will be used to construct pGRIPI/fl, an EcoRI site (GAATTC) was introduced at nucleotide -9 relative to the first potential ATG initiation codon of the GRIPl open reading frame. This new EcoRI site also prevents the use of an upstream out-frame ATG (underlined), which may allow protein translation to start at the wrong reading frame in yeast cells. In sequence B, which will be used to construct the yeast expression vector for the Gal4-AD/GRIPl fusion protein, pGAD424.GRIP1/fl, an EcoRI site was introduced before GRIPl codon 5. 52 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 182 203 212 221 TGC TGA TATGTG TTC AAG ATG AGT GGG ATG GGA GGA AAC.... Met Ser Gly Met Gly Glu Asn.... A: GAA TTC GTG TTC AAG ATG AGT GGG ATG GGA GGA AAC.... _ t B: G M TTC GGA GGA AAC.... Smal 1695 BspHI 1 1 6 7 3566 BamHI 2 5 0 1 4292 3 7 5 8 1 I EcoRI EcoRI 4.7 kb GRIP1 sequence 53 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. fragments coding for human estrogen receptor (ER274. 595) (Greene et al. 1986), human androgen receptor (A R g ^w -e ig ) (Lubahn et al. 1988), rat mlneralocortlcoid receptor (M R g g g .g 8i) (Patel etal. 1989), human progesterone receptor (PR661. 933) (MIsrahi et al. 1987), and human vitamin D receptor (VDRgs^27) (Baker et al. 1988) into EcoRI/Sall, BamHI/PstI, Smal/Sall, EcoRI/Sall, and EcoRI/BamHI sites, respectively, of pGBT9. Yeast expression vector coding for fusion proteins of Gal4 DBD and HBDs of human thyroid receptor (TRa), retinoic acid receptor a (RARa), retinoid X receptor (RXRa), named pG6 H/hTRa(LBD), pG6 H/hRARa(LBD), and pG6 H/hRXRa(LBD), were kindly provided by Dr. Ronald Evans (Salk Institute, La Jolla, CA). pGEXI.GRIPl, a bacterial expression vector coding for a GST-GRIP1 fusion protein, was made by inserting a PCR amplified fragment coding for GRIPl730.H 21 into the EcoRI site in pGEXI (Amrad, Kew, Victoria, Australia). Yeast vectors coding for fusion proteins of Gal4 DBD and the HBD of mouse ER containing various AF-2 mutations were constructed by inserting PCR amplified fragments of mouse ER279^ g g into the EcoRI/Sall sites in pGBT9. The mutant ER coding sequences used in PCR, including pJS.MOR, pJ3.D542A, pJ3.D549A, pJ3.L543A/L544A, PJ3.M547A/L548A, and pJ3.D542N/E546Q/D549N (Danielian et al. 1992) were kindly provided by Dr. Malcolm Parker (Imperial Cancer Research Fund, UK). Yeast expression vectors for the fusion protein of Gal4 DBD and the HBD of GR mutant GA11 (Zhang et al. 1996), named pGBT9.GA11- 54 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. HBD, was made by inserting PCR amplified GA11 HBD fragment (amino acid 513-783) into Smal/Sall sites in pGBT9. pG A II, used as template in PCR, was kindly provided by Dr. Mark Danielsen (Georgetown University, Washington, D C) in a collaboration for the study of GA11. P-galactosidase liquid assay was performed basically according to Clontech's protocol (PT1265-1). Yeast colonies were grown on proper SD medium overnight, and then diluted 1:5 in YPD for further incubation at 30 °C for 4 hrs, with appropriate hormones if required. Yeast cells from 100 pi culture were collected and broken by freeze-and-thaw before incubation with the substrate o-nitrophenyl (3-D-galactosidase (ONPG) at 37 °C. Units of ( 3 - galactosidase (P-gal) activity are defined by the formula, 1000 x OD^zo/it x V X O D goo). where O D ^go is absorbance at 420 nm from the ONPG-hydrolysis reaction; f, time of incubation in min; V, volume of yeast culture in ml, from which the assayed extract sample was prepared; and O D g o o , absorbance at 600 nm of 1 ml of the yeast culture. In vitro transcription and in vitro translation: GR, ER, and AR protein fragments containing their DBD and HBD were synthesized in a cell- free system and used in GST pull-down assay and immunoprécipitation. The mRNAs for the receptor fragments were made in the in vitro transcription reaction with T7 RNA polymerase by using a mMessage mMachine kit 55 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. (Ambion) and following the manufacturer's protocol. The DNA templates used in the transcription were PCR products. In those PCR products, a nucleotide sequence GAGACAGATCTAATACGACTCACTATAGGGACA TGAACCGCCGCCATGGNN. which contains a T7 promoter and a strong eukaryotic translation initiation signal (both underlined; GNN in the 3' end of the sequence was assigned as the first codon or a codon before the start of the amplified sequence), were introduced with the upstream primer into the 5' end of the amplified sequences. The cDNA sequences of wild type and mutant receptors were used as templates in the PCR reaction. The capped mRNA synthesized in the in vitro transcription system was then used for in vitro synthesis of “ S-methionine labeled receptor fragments by using Promega (Madison, Wl) nuclease-treated rabbit reticulocyte lysate, and following the manufacturer's protocol. The reactions were performed in the presence and absence of different ligands as required for different experiments. GST pull-down assay was performed according to Kaelin et al (Kaelin, Jr. et al. 1991). Glutathione S-transferase (GST) and GST-GRIP1 fusion proteins were produced in E. colicarrying pGEXI or pGEXI.GRIPl, respectively, and then purified as glutathione-Sepharose bead bound proteins. The beads were incubated with in vitro synthesized ^®S-labeled steroid receptor fragments at 4 °C for 30 min. The beads were washed with 56 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. NETN (100 mM NaCI, 1 mM EDTA, 0.01% Nonidet P-40,20 mM Tris-HCI pH 8.0) three times. All the bound proteins were eluted by electrophoresis loading buffer, and analyzed by SDS-PAGE and autoradiography. Immunoprécipitation with anti hsp90 antibodies was performed according to Dalman et a! (Dalman et al. 1991). Protein A-Sepharose 4B beads were incubated with goat anti-mouse IgM antibody before the incubation with anti-hsp90 antibody 8D3 (monoclonal IgM, kindly provided by Dr. Gary Perdew). The anti-hsp90 antibody bound beads were then incubated with in vitro synthesized “ S-labeled GR fragment at 4 °C overnight. After washing with TEGM (10 mM TES, 4 mM EDTA, 10% glycerol, 5 mM NaCI, 20 mM NaMoO^, pH 7.6) for three times, the bead bound proteins were analyzed by SDS-PAGE and autoradiography. RESULTS 3.1 GRIPl can interact with the HBDs all the steroid receptors in a hormone-dependent manner As I have mentioned above, GRIPl was originally isolated from a mouse 17-day embryo cDNA library based on its ability to interact with the 57 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. HBD of GR in a hormone regulated manner. This is one of the most important features for GRIP1 to be a candidate for a transcriptional coactivator of GR. However, since different members of the steroid receptor family may share a similar mechanism in transactivation, it would be very interesting to test if GRIP1 can interact with other steroid receptors or not. I used the yeast two-hybrid system to test the interaction between the full- length GRIP1 and the HBDs of all the steroid receptors, including GR, estrogen receptor (ER), androgen receptor (AR), progesterone receptor (PR) and mineralocorticoid receptor (MR). The HBDs of steroid receptors were fused with the Gal4 DBD in a yeast expression vector, and then each fusion protein was expressed in yeast either by itself or with the coexpression of Gal4-AD/GRIP1 fusion protein. While the fusion proteins of Gal4 DBD and steroid receptor HBDs showed little or very weak ability to activate a Gal4 enhancer site linked p-gal reporter gene, even in the presence of appropriate hormone agonists (Fig. 3-2, columns 1-2), the coexpression of Gal4- AD/GRIP1 resulted in the hormone-dependent activation of the reporter gene (column 3-4). However, when either GRIP1 or steroid receptor HBD sequences were replaced by an irrelevant protein in this testing system, the reporter gene was not activated (data not shown). Those results indicated that GRIPl can interact with the HBDs of all the steroid receptors in vivo in a hormone regulated manner. 58 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Fig. 3-2 Interaction of GRIP1 with steroid receptor HBDs in a yeast two- hybrid system assay. The indicated fusion proteins were stably expressed in yeast (strain SFY526) grown in solution culture in the absence or presence of the appropriate steroid hormone (10 pM DOC for GR, 100 nM estradiol for ER, 100 nM dihydrotestosterone for AR, 10 pM corticosterone for MR, and 10 pM progesterone for PR). Interaction of the two proteins reconstituted the two functional Gal4 domains and resulted in activation of an endogenous P-gal reporter gene with a Gal4 enhancer element, p-gal activity of cell extracts from liquid yeast cultures is shown. Each point is the mean and standard deviation from three independent yeast transformants. AD, Gal4 AD; DBD, Gal4 DBD; HBD, the HBD of steroid receptors as indicated at the bottom. 59 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. I — E S S S S S S S S I — o o -» + + CO I + CM + I V - I I ^ + + CO I + CM + I T - I I - 4 - + + CO I + CM + I T - I I + + CO I + CM + I T - I I v + + CO I + C M + I T - I I (n) AjiAjPV |BO-{j 0 } c 0 1 o . c 0. I Q < + + + + + + + + + + + + + + + + + + + + Q C O X Q C O Q X 0. a: 1 1 1 o 60 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. The interactions between GRIP1 and the HBDs of some steroid receptors were also confirmed in vitro when we performed GST-pull down assays to test the interaction between GRIP1 and HBDs of GR, ER, and AR. In this assay, a functional fragment of GRIP1 (amino acids 730-1121, see below) was expressed in E. coli as a glutathione S-transferase (GST) fusion protein, and then purified with glutathione-Sepharose beads. “ S-labeled mouse GR, ER, or AR fragments containing their DBD and HBD were synthesized in vitro in the presence and absence of appropriate hormones, and then incubated with beads bound by GST or GST-GRIP1. The results showed that GR, ER and AR fragments did not bind to GST protein alone, but could bind strongly to GST-GRIP1 in the presence of an appropriate hormone or agonist, while only a weak interaction was visible in the absence of hormone (Fig. 3-3). The basal interaction between GRIPl and steroid receptors in the absence of hormone was different from the strictly hormone- dependent Interaction shown in the yeast two-hybrid system, and the reason was unknown. But a similar basal interaction was also observed by Cavailles et al. in their GST-pull down assay for the interaction between RIP140 and ER, although in their far-Westem blotting no interaction was observed in the absence of hormone (Cavailles et al. 1995). From the result of the yeast two-hybrid screening, we knew that the 800-amino acid GRIPl fragment (amino acids 322-1121) encoded by the 2.4 61 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Fig. 3-3 Interaction of GRIP1 with steroid receptor HBDs in vitro. ^^S- labeled steroid receptor fragments, including the complete DBD and HBD, were synthesized in vitro in the presence or absence of an appropriate steroid agonist (see Fig. 3-2) and then incubated with Sepharose beads containing bound GST/GRIP1 or GST protein. The beads were washed and bound protein was eluted and analyzed by SDS/PAGE and autoradiography. 62 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. GST/GRIPl hormone: GR ER GST AR 63 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. kb cDNA sequence was sufficient to interact with the HBD of GR in a hormone dependent manner. In a preliminary effort to localize the functional domains within the 800-amino acid GRIP1 fragment, we used the yeast two- hybrid system to test the interaction between GR HBD and different truncated GRIP1 fragments in the presence of DOC (Fig. 3-4). Because of the lack of proper antibodies, we could not test the protein expression levels of all the truncated GRIP1 fragments, so some of those results, especially the negative ones, may not be conclusive. But the clear information offered by those tests was that the region of amino acids 730-1121 was sufficient to support the interaction with GR HBD. A further effort to narrow that region only showed reduced GR interacting activity in the region of amino acids 730-933. 3.2 GRIP1 can also interact with the HBDs o f non-steroid receptors Non-steroid receptors are another group of receptors in the nuclear receptor superfamily. Since GRIP1 can interact with the HBDs of all the steroid receptors, it would be very interesting to test if GRIP1 can also interact with the HBDs of non-steroid receptors. We used the yeast two- hybrid system to test the interaction between GRIP1 and the HBDs of vitamin D receptor (VDR), retinoic acid receptor a (RARa), retinoid-X receptor (RXRa), and thyroid hormone receptor a (TRa), using the same strategy as 64 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Fig. 3-4 Identification of the GR interaction domain in GRIP1 by yeast two-hybrid assays. Different truncated fragments of GRIP1 within the region of amino acids 322-1121, which is the original GRIP1 sequence isolated from yeast two-hybrid screen, were constructed as Gal4 AD fusion proteins and coexpressed with Gal4-DBD/GR-HBD in yeast (strain SFY526) in the presence of 10 pM DOC. The interaction between GR HBD and the GRIP1 fragment was judged by the activation of a P-gal reporter gene controlled by a Gal4 enhancer site. (+), blue color in the filter assay; (±), weak blue color in the filter assay; (-), white color in the filter assay. 65 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. G R I P 1 fra g m en ts Interaction with G R 322 322 322 510 1121 766 730 1121 730 1019 730 933 883 1121 883 1019 6 6 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. that for the HBDs of steroid receptors. The results showed that different non-steroid receptors exhibited quite different behaviors in interacting with GRIP1 (Fig. 3-5). While GRIP1 can interact with the HBD of VDR in a strictly hormone-dependent manner (as with steroid receptor HBDs), GRIP1 unexpectedly interacted with the HBDs of TRa, RARa, and RXRa to varying degrees even in the absence of added ligand (columns 3). The interaction of GRIP1 with TRa HBD was still stimulated strongly by addition of agonist (TRa columns 3-4). In contrast, the RAR ligand all-trans retinoic acid reproducibly caused an apparent decrease in GRIP1 interaction with the RARa HBD (RARa columns 3-4). The fusion protein of Gal4 DBD and RXRa HBD activated the two-hybrid system reporter gene strongly in the presence of 9-cis-retinoic acid, even in the absence of a second fusion protein (RXRa column 2), thus this test for GRIP1/RXRa interaction in the presence of ligand was not informative. 3.3 Interaction between GRIP1 and GR HBD is stimuiated by agonist but not antagonist Both agonists and antagonists can bind with high affinity to steroid receptors, cause their dissociation from hsp90, and promote binding of steroid receptors as homodimers to the hormone response element associated with target genes. However, only agonist can induce the ability 67 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Fig. 3-5 Interaction of GRIP1 with non-steroid receptor HBDs in a yeast two-hybrid system assay. The Indicated fusion proteins were stably expressed in yeast (strain SFY526) grown in solution culture in the absence or presence of the appropriate hormone (1 pM 1,25-dihydroxy-vitamin D3 for VDR, 10 pM all-trans-retinoic acid for RARa, 10 pM 9-cis-retinoic acid for RXRa, and 10 pM triiodothyronine for TRa). p-gal activity of cell extracts from liquid yeast cultures is shown. Each point is the mean and standard deviation from three independent yeast transformants. AD, Gal4 AD; DBD, Gal4 DBD; HBD, the HBD of non-steroid receptors as indicated at the bottom. 6 8 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. ¥ 7 7 7 7 7 7 7 7 / / / / 7 77 77 } i- c : y — 7 Z 7 7 7 7 7 7 / / 7 / 7 7 7 / / 7 , o o CO o C > 4 O O + CO I C N i + T- I CO C M + I (n) Miaipv |BO-d ^ + CO I CM + T- I Tf + CO I CM + T- I 0) c o E o x: + + I I + + I I + + I I + + I I Q - 9 o < + + + + + + + + + + + + + + + + Q 0 0 I I Q 0 0 Q S 0: D C X D C D C g D C Q > 69 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. of steroid receptors to activate transcription of target genes, while antagonist can not. The different effects on the transactivation activity of steroid receptors by agonist and antagonist are probably due to the difference in the conformational changes of the receptors caused by the binding of agonist and antagonist, since physical evidence has confirmed such a conformational difference (Weigel et al. 1992; El-Ashry et al. 1989). The antagonist bound receptors are presumably unable to interact productively with the transcription initiation complex; for example, this could be due to an inability to interact with a required transcriptional coactivator, such as GRIP1. We therefore used the yeast two-hybrid system to test the interaction between GRIP1 and GR HBD in the presence of different ligands. The results indicated that agonist DOC promoted a strong interaction between GR HBD and GRIP1, but antagonists RU486, which sometimes acts as a partial agonist, and ZK98.299, which behaves as a pure antagonist (Zhang and Danielsen, 1995), did not (Fig. 3-6). The ability of these ligands to promote GR/GRIP1 interactions was also tested in vitro by GST pull-down assay. In this assay, the ability of a GR DBD-HBD fragment translated in vitro to interact specifically with GRIP1 was stimulated several-fold by agonist DOC (Fig 3-7a, lanes 1-2), but not by antagonists RU486 or ZK98.299 (lanes 3-4). The failure of these antagonists to stimulate GR binding to GRIP1 could theoretically be due to 70 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Fig. 3-6 Ability of agonists and antagonists to stimulate GR interaction with GRIP1 in yeast two-hybrid system. Gal4-DBD/GR-HBD and Gal4- AD/GRIP1322.1121 fusion proteins were coexpressed in yeast (strain SFY526), which contains a (3-gal reporter gene controlled by a Gal4 enhancer site, in the presence of the indicated ligand (10 pM). (3-gal activity of cell extracts from liquid yeast cultures is shown. Each point is the mean and standard deviation from three independent yeast transformants. 71 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. ^ 20 - > I CO C D I CO. 72 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Fig. 3-7 in vitro assays for the effect of agonists and antagonists on the GR interaction with GRIP1 and GR association with hsp90. A labeled GR fragment containing DBD and HBD was synthesized in vitro in the presence of the indicated ligands (10 pM), and used for two assays. A. The labeled GR fragments were incubated with Sepharose beads containing bound GST or GST-GRIP 1 7 3 0 .1 1 2 1 - Bound GR fragment was visualized by SDS-PAGE and autoradiography. Input, 1/10 of original incubation; GST, the GR fragment bound to GST beads; GST-GRIP1, GR bound to GST-GRIP1 beads. B. The labeled GR fragments were incubated with antibody 8D3 against hspQO or no primary antibody, and precipitation was achieved with a secondary antibody bound to protein A-Sepharose beads. Precipitated GR fragments were visualized by SDS-PAGE and autoradiography. (The work in this figure was performed with help from Kulwant Kohli in our lab). 73 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. input GST GST-GRIP1 1 2 3 4 1 2 12 3 4 — # # — •GR 395-783 B no antibody + anti-hsp90 Ab # GR 395-783 1. no hormone 2. + DOC 3. + RU486 4. + ZK299 74 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. their failure to cause GR dissociation from hsp90; alternatively, the antagonists could cause dissociation of GR from hsp90 but fail to induce a GR conformation that can interact with a coactivator like GRIP1. To discriminate between these two possibilities in our testing system, we examined the association between GR and hsp90 under the same conditions used for the GST pull-down assay. GR fragment translated in the absence of ligand was specifically co-precipitated by an antibody against hsp90, as compared with a control reaction lacking anti-hsp90 antibody (Fig. 3-7b, lanes 1). However, when GR was translated in the presence of agonist or antagonist, little if any GR specifically co-precipitated with hsp90 (lanes 2-4). Thus, all three ligands caused GR to dissociated from hsp90, but only the agonist promoted a GR conformation that could interact with GRIP1. 3.4 Point mutations that eliminate the transactivation activity of the ER HBD also prevented its interaction with GRIP1. A major transactivation domain in the HBD of steroid receptors, called AF-2, has been defined by point mutations that eliminate the transactivation activity of this domain but do not affect hormone binding (Danielian et al. 1992). This region, which corresponds to mouse ER amino acids 538-552, is highly conserved among many nuclear receptors, and theoretically it might be involved in the interaction with the transcriptional coactivators. We thus 75 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. tested a panel of single and multiple point mutations in this region of mouse ER for their ability to interact with GRIP1. It was previously shown that two double mutations, L543A/L544A and M547A/L548A, completely eliminated transactivation by ER; the triple mutant, D542N/E546Q/D549N, caused substantial but not complete loss of function; and two single mutations, D542A and D549A, had little if any effect on ER activity (Danielian et al. 1992). In the yeast two-hybrid system, GRIP1 did not interact with the two double mutants but interacted normally in a hormone dependent manner with the other mutants (Fig 3-8). GST pull-down assays produced identical results for all of the mutants except the triple mutant, which failed to Interact with GRIP1 (Fig. 3-9). The divergent behavior of the triple mutant observed here in the two different GRIP1 interaction assays may reflect the partial loss of function it exhibited previously in reporter gene activation assays (Danielian et al. 1992). We used an hsp90-ER co-immunoprecipitation assay similar to that in Fig. 3-7b to demonstrate that all of these ER AF-2 mutants dissociate normally from hsp90 in response to estradiol (data not shown). Thus, lack of GRIP1 binding by some of the ER mutants was not due to failure to dissociate from hsp90. These studies demonstrated that the transactivation activity of various ER AF-2 mutants correlates strongly with the ability to interact with GRIP1. 76 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Fig. 3-8 Interaction of GRIP1 with ER HBDs containing AF-2 domain mutations in the yeast two-hybrid system assays. Gal4 AD/GRIP1 and different Gal4 DBD/ER-HBD fusion proteins which contained the indicated AF- 2 region amino acid substitutions were coexpressed in yeast (strain SFY526) containing a P-gal reporter gene controlled by Gal4 enhancer elements, p-gal activity of cultures grown 4 hrs with or without estradiol (100 nM) was determined. Each point is the mean and standard deviation from three independent yeast transformants. AD, Gal4 AD; DBD, Gal4 DBD. 77 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. h-ESSSSSSSSSSSSS iSSSSSSSSSSSS I — ESSSSSSSSSS c s s s s s s s s s s s T f C O + I + I 8 rr + m I CM + T - I • M - + m I CM + r - I ^ + CO I CM + T - I ' t + CO I CM + T - I + CO I CM + T - I a > § (n) AjiAiPv |BO-t) + + + + I + I + + + + + I + I + + + + + I + I + + + + + I + I + + + + + I + I + + + + + I + I + a C O £ I 9 S a C O < Q I I 0 1 z i s 9 9 a I I 78 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Fig. 3-9 in vitro interaction of GRIP1 with ER HBDs containing AF-2 domain mutations. The labeled ER DBD/HBD fragments containing the indicated AF-2 region amino acid substitutions were synthesized in vitro in the presence or absence of estradiol (100 nM), and then incubated with Sepharose beads containing bound GST or GST-GRIPl73o.i,2v Bound ER fragment was visualized by SDS-PAGE and autoradiography. Input, 1/10 of the original incubation; GST, the GR fragment bound to GST beads; GST- GRIP1, GR bound to GST-GRIP1 beads. (The work in this figure was performed with help from Kulwant Kohli in our lab). 79 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. D549A input G ST GST-GRIP1 estradiol wt m ER L543A/L544A M547A/L548A D542N/E546Q /D549N D542A + — + — + 80 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 3.5 G A ll, a GR HBD mutant with super-transcriptional activity, exhibited enhanced ability to interact with GRIP1. In a study of the biological function of the HBD of GR, Dr. Danielsen's lab has constructed a series of chimeric receptors in which small regions of the mouse GR HBD were replaced by the equivalent region of the AR, so that the overall three-dimensional structure of GR HBD would not be dramatically affected, while the function of the replaced region of the receptor could be studied (Zhang et al. 1996). In one of these chimeras, GA11, amino acids 619 to 628 in the mouse GR HBD were replaced by the equivalent region of AR (amino acids 734 to 743); the transcriptional activity of GA11 was greatly increased relative to wild type GR, while its hormone binding activity was still nearly normal. The increased transcriptional activity of GA11 resulted in a 10-100 fold left shift in the dose response curve when compared with the wild type GR in C0S7 cells, although similar levels of wild type GR and GA11 proteins were expressed. In HeLa cells the GA11 mutation caused a dramatic increase in the maximum reporter gene activity observed at saturating hormone concentration (Zhang et al. 1996). The mechanism for the increased transcriptional activity of GA11 has not been fully understood yet, but one of the possible explanations is that the modified HBD of GA11 changes its ability to interact with transcriptional coactivators and/or corepressors. We used the yeast two-hybrid system to test the 81 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. interaction between GRIP1 and the HBD of GA11 in the presence of different amounts of DOC. The results showed that GA11 had stronger interaction with GRIP1 than wild type GR, and could interact with GRIP1 efficiently at lower concentration of hormone than what is required for wild type GR (Fig. 3-10). The more than 10 fold leftward shift of the dose response curve for the GRIP1/GA11 interaction provided a good correlation between the enhanced GRIP1 interacting ability and the increased transactivation activity o fG A II. DISCUSSION The protein-protein interaction between the enhancer-bound transcriptional activators, including steroid receptors, and their coactivators is one of the most important elements in the regulation of activated transcription. As a candidate for the transcriptional coactivator of steroid receptors, GRIP1 was identified because of its ability to interact with the HBD of GR in a hormone regulated manner. Further studies indicated that the hormone dependent interaction ability of GRIP1 can be extended into all the members of the steroid receptor family. The wide spectrum of GRIP1 interaction within the steroid receptor family may reflect the fact that all the steroid receptors not only share a common general structure, but also share 82 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Fig. 3-10 GR mutant GA11 interacts with GRIP1 at lower hormone concentration than wild type GR in the yeast two-hybrid system assay A. GA11, a GR mutant with super-transcriptional activity, had 9 amino acids in its HBD replaced by the equivalent region of the AR. The inset shows the replaced amino acids in GA11. Top, sequence of mouse GR; bottom, sequence of mouse AR. represents the identical amino acids to mouse GR (Zhang et al. 1996). B. The Gal4-DBD/GA11-HBD and Gal4-DBD/GR-HBD were separately coexpressed with Gal4-AD/GRIPI322.1121 in yeast (strain SFY526) grown in solution culture with increasing concentration of DOC. (3-gal activity was determined after yeast cells grew with DOC for 4 hrs. (This work was done as a collaboration with Dr. Mark Danielson’s lab, who made the GR mutant GA11 and provided pGA11 for our assay. Zhang et al. 1996). 83 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 619 YRQASOILLC 628 734 FmVNSBM*Y 743 GA11 Transactivation DNA B in d in g Hormone Binding B wtGR GA11 < 40 — en. DOC (M) 84 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. a similar pathway in all the known steps in the transactivation procedure (Evans, 1988). It is not too surprising to see that all the steroid receptors share the ability to interact with a common transcriptional coactivator. However, it is still interesting to note that the sequence homology among the HBDs of some steroid receptors is not very high. For example, the sequence homology of HBDs between ER and other four steroid receptors is only about 25% (Koelle et al. 1991), but they still share the property to interact with the same putative transcriptional coactivator, indicating that GRIP1 may interact with a highly conserved region among the HBDs of steroid receptors. In addition to steroid receptors, GRIP1 also interacted specifically with the HBDs of some other nuclear receptors. But in contrast to the strictly hormone dependent interaction with steroid receptors, the interactions between GRIP1 and other nuclear receptors exhibited extremely variable degrees of hormone dependence: the VDR interaction was completely hormone dependent, the TRa interaction was partially hormone dependent, and RARa surprisingly exhibited hormone independent interaction with GRIP1 which was reduced in the presence of agonist. The differences for GRIP1 interaction with steroid receptors and other nuclear receptors may reflect the different biology of these two subgroups of nuclear receptors. Unlike steroid receptors, the thyroid/retinoid receptors do not complex stably with hsp90 and can bind their response elements even in the absence of 85 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. hormone. In contrast to our results obtained with thyroid/retinoid receptors, TIF2, the probable human orthologue of mouse GRIP1, interacted with HBDs of RARa, RXRa, and TRa in a hormone-dependent manner (Voegel et al. 1996). Further studies will be required to resolve these differences. It is noteworthy that GRIP1 studies were conducted in yeast, which apparently lack coactivators and may also lack corepressors for the HBDs of steroid receptors, while TIF2 was examined in mammalian cells or their extracts which contain endogenous coactivators and corepressors, both known and unknown. The hormone dependent feature of the GRIP1 interaction for steroid receptors provided strong correlation between such interaction and the transactivation activity of the receptors, since all the steroid receptors are transcriptionally active only after the binding of hormone. However, antagonist can also bind the receptors with high affinity, but can not induce their transactivation activity. The different effects of agonist and antagonist on the transactivation activity of steroid receptors have been explained by their different abilities to induce the conformational change in the receptors, and such conformational difference has been proved by physical evidence (Weigel et al. 1992; El-Ashry et al. 1989). However, what the subsequent effect of such conformational change could be has not been fully understood yet. Our results indicated a correlation between the GRIP1 interaction and 86 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. the conformational changes of GR In the presence of agonist and antagonist, which may probably explain the Inability of antagonist to Induce successfully the transactlvatlon activity of steroid receptors. Our results were also the first to provide side-by-slde evidence to Indicate that the dissociation of hsp90 might be necessary, but not sufficient to support the Interaction between GRIP1 and steroid receptors. The HBD of steroid receptors Is responsible for different Important functions for the receptors. Including hormone binding, hsp90 binding, and transactlvatlon (Beato, 1989). However, since those functions are closely related and their functional domains overlap. Interpretation of experimental data should be made with careful consideration for all the possible Influences on all the different functions. For example, a mutation in the HBD of the receptor which prevents the receptor from activating its reporter gene could be due to the elimination of hormone binding activity of the receptor, rather than the Inactivation of its transactlvatlon domain. The AF-2 domain in the HBD Is required for the normal function of the receptor, and Its location was defined by point mutations which can eliminate the transactlvatlon activity of ER but do not affect the hormone binding activity of the receptor (Danielian et al. 1992). The fact that the AF-2 mutations which eliminated the transactlvatlon activity of the ER HBD also prevented its interaction with GRIP1 strongly supported the biological significance of the Interaction 87 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. between GRIP1 and steroid receptors. Since those ER AF-2 mutants have normal hormone binding and hsp90 dissociation activities (Danielian et al. 1992, and our unpublished data), their failure in transactivation can be explained by the disrupted ability to interact with their transcriptional coactivators, like GRIP1. The elimination of the GRIP1 interaction ability by some of the ER AF- 2 mutations also raises the interesting question about whether those mutated residues in that region are directly involved in the interaction with GRIP1. However, the location of AF-2 domain of ER corresponds to a region with the seqeunce features of an amphipathic a-helix motif which are conserved between all known transcriptionally active members of the nuclear receptor superfamily (Danielian et al. 1992). At the amino acid sequence level, the major features of the conservation were an invariant glutamic acid residue (residue 546 in mouse ER) flanked by two pairs of hydrophobic residues (residues 543/544 and 547/548 in mouse ER). The amino acid pairs L543/L544 and M547/L548, both required for normal GRIP1 interaction, are supposed to be located on the hydrophobic side of the a-helix, and face the interior of the ER molecule. They are unlikely to have direct interaction with GRIP1. Those amino acids may play important roles in maintaining the proper protein structure to support the interaction with GRIP1, rather than being involved in the direct protein-protein interaction. 88 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. CHAPTER 4: GRIP1 IS A COACTIVATOR FOR THE HBDs OF NUCLEAR RECEPTORS IN YEAST. INTRODUCTION Transcriptional coactivator is a functional definition for the proteins which can selectively enhance the stimulatory activity of specific subsets of enhancer-binding transcriptional activators. According to the current understanding for transcriptional coactivators, a lot of coactivators could also be described as the proteins which can mediate the interaction between the enhancer bound transcriptional activators and the basal transcriptional machinery. In Chapter 3 ,1 discussed the ability of GRIP1 to interact with the HBDs of steroid receptors, and the biological significance of those interactions. However, it remains to be proven if GRIP1 can physically and functionally interact with the basal transcriptional machinery, and more importantly, if it can enhance the transactivation activity of the steroid receptors in an appropriate testing system. In this chapter, I will discuss the other side of the story: the interaction between GRIP1 and the basal transcriptional machinery. I will also present the direct evidence to support the role of GRIP1 as the transcriptional coactivator for the HBDs of steroid receptors in yeast. 89 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. MATERIAL AND METHODS Construction of plasmids: Mammalian cell expression vector for the 800-amino acid GRIP1 fragment, named pCMV.HA/GRIP1, was made in several steps (Fig. 4-1). First, a double-strand oligonucleotide which contains an EcoRI cohesive end, a BamHI site, a translation start signal, the hemagglutinin epitope tag YPYDVPDYA coding sequence (Wilson et al. 1984), a new EcoRI site, and a BamHI cohesive end, was inserted into the EcoRI/BamHI sites in pBlueScript (Stratagene); this destroyed the original EcoRI and BamHI sites. Second, the 2.4 kb GRIP1 fragment from pGADIO.GRIPI was inserted into the new unique EcoRI site. Third, the BamHI/Xbal fragment from this modified pBlueScript plasmid was inserted into Bglll/Nhel sites of pCMV, which was derived from pCMV.Neo (Ma et al. 1992). Yeast expression vector for the fusion protein of Gal4 DBD and the 800-amino acid GRIP1 fragment, named pGBT9.GRIP1, was made by subcloning the 2.4 kb GRIP1 fragment into the EcoRI site in pGBT9 (Clontech). Mammalian expression vectors for the GR DBD and a fusion protein of GR DBD and the 800-amino acid GRIP1 fragment, named pCMV.GR-DBD and pCMV.GR-DBD/GRIPI respectively, were made as follows: PCR was used to generate a DMA fragment with Xhol site, BamHI site, translation start signal, coding region for mouse GR DBD and nuclear localization signal (GR393.512), EcoRI site, stop codons in all three reading 90 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Fig. 4-1 Construction of a mammalian expression vector for GRIP1 fragment A double-strand oligonucleotide as shown in the shadowed area contains an EcoRI cohesive end, a BamHI site, a translation start signal (underlined, with the starting ATG indicated), the hemagglutinin epitope tag YPYDVPDYA coding sequence, a new EcoRI site, and a BamHI cohesive end. This sequence was Inserted into the EcoRI/BamHI sites in pBlueScript, and destroyed the original EcoRI and BamHI sites. The 2.4 kb GRIP1 fragment from pGADIO.GRIPI was inserted into the new unique EcoRI site. Finally, the BamHI/Xbal fragment from this modified pBlueScript plasmid was inserted into Bglll/Nhel sites of pCMV which contains the CMV promoter. 91 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 2.4 kb GRIP1 fragment & » R I EcoRI I® T7 promoter pBlueScript SK EcoRI BamHI Xbal I pCMV CMV promoter Bglll Nhel 92 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. frames, and Xbal site. This fragment was inserted into Xhol/Xbal sites in pBlueScript, generating pBS.GR-DBD. The EcoRI fragment of 800-amino acid GRIP1 sequence was then inserted into the new EcoRI site in pBS.GR- DBD, generating pBS.GR-DBD/GRIP1. The BamHI/Xbal fragments from pBS.GR-DBD and pBS.GR-DBD/GRIPI were subcloned into the Bglll/Nhel sites in pCMV to create pCMV.GR-DBD and pCMV.GR-DBD/GRIP1. Yeast expression vector for the 800-amino acid GRIP1 fragment, pGRIPI, was made in two steps (Fig. 4-2): the KpnI/EcoRI fragment (coding for Gal4 AD, but not including the translation start signal and the nuclear localization signal) of yeast expression vector pGAD424 (Clontech) was replaced with CGCCGCCCTCGAGG, and then the EcoRI fragment of GRIP1 from pGADIO.GRIPI was subcloned into the new EcoRI site of the modified vector. Yeast expression vector for the full-length GRIP1, pGRIP1/fl, was made by first using PCR to create an EcoRI site at -9 relative to the first potential ATG Initiation codon of the GRIP1 open reading frame (Fig. 3-1) and then inserting the resulting 4.7-kb EcoRI fragment containing the entire open reading frame into the new EcoRI site of a modified pGAD424. This modified pGAD424 vector was created by replacing the Hindlll fragment (containing the nuclear localization signal, Gal4 AD, and multiple cloning site, see Fig. 4-2) with AGCTTGGATCCCGGGAATTCTCG. Yeast expression vectors pRS314-GR N795 (encoding full length rat GR), pRS314-GR N556 (encoding rat GR AD and DBD), p2T/407-795 (encoding rat GR DBD and 93 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Fig. 4-2 Excision of the Gal4 AD from the Gal4-AD/GRIP13221121 fusion protein in yeast expression vector. The KpnI/EcoRI fragment (coding for Gal4 AD) of yeast expression vector pGAD424 (Clontech) was replaced with the indicated double stranded oligonucleotide. The modified plasmid still retains the original translation start signal, and the nuclear localization signal; the new EcoRI sequence is in the original reading frame. The EcoRI fragment of GRIP1 from pGADIO.GRIPI was subcloned into the new EcoRI site of the modified vector. 94 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 2.4 kb GRIP1 fragment EcoRI EcoRI I ( 2 ) Insert I (J ) Replace EcoRI Hindlll Kpnl Gal4 AD G a H a d MCS r Hindlll pGAD424 Aitipr L B J 2 A SV40 large T antigen nuclear localization signal CdEI 95 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. HBD), pRS314-hER (encoding human full length ER), and reporter genes GRE3-CYC'lacZ and ERE1-cyc-LacZ were kindly provided by Dr. Michael Garabedian. Mammalian cell transient transfection was performed as described before (Chen and Stallcup, 1994). Cells were grown in 10% COg in Dulbecco's modified Eagle's medium (with pyruvate and high glucose) supplemented with 10% fetal bovine serum. Transfections were performed by the low pH calcium phosphate method. 5x10^ cells were seeded in each 34-mm diameter well of 6-well culture dishes, transfected the following day, and harvested 48-72 hrs after transfection; when appropriate, hormones were added 18-24 hrs before harvest. Expression vectors for reporter genes were pMMTV-CAT; pCMV-Pgai, which was derived from pCMV.Neo (Ma et al. 1992); and pArg-maxigene, a derivative of a tRNA^^ gene containing an additional 12 bp inserted between the intemal promoter regions (Dingermann etal. 1983). Chloramphenicol acetyitransferase (CAT) assays were performed by a phase-separation method as described by Zhang and Danielsen (Zhang and Danielsen, 1995). The harvested cell extracts were heated at 65 °C for 10 min to inactivate deacetylases in the cell samples, and then incubated with chloramphenicol and acetyl CoA at 37 °C in the presence of water- 96 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. immiscible scintillation fluid Econofluor-2 (New England Nuclear). The amount of acetylated forms of chloramphenicol, which can diffuse into the scintillation fluid, were measured in a liquid scintillation counter. 3-galactosidase assays for the transfected mammalian cell samples were performed as described by Liu & Lee in a ONPG hydrolysis assay (Liu and Lee, 1991). The units of g-galactosidase were derived by comparing the OD420 of the tested samples with the standard curve made by assaying purified P-galactosidase. Ribonuclease protection assays were performed by using an RPA II kit (Ambion) as described by Wang et al. (Wang et al. 1995). RNA was extracted from the transfected cells by using TRIzol reagent (GIBCO). 0.5 pg of total cell RNA from each sample was hybridized with an excess of a ^^P-labeled antisense pArg-maxigene riboprobe and yeast tRNA as a carrier at 42 °C overnight. The hybridized RNAs were digested with 200 pi of a 1:100 dilution of an RNase A-RNase T1 mixture at 37 °C for 30 min. The digestion was terminated by adding 300 pi of solution Dx and 250 pi of ethanol. The RNAs were precipitated and resuspended in 8 pi of RNA loading buffer and electrophoresed on 8 M urea-8 % polyacrylamide gels. The transcripts were quantitated by optical densitometry of the resultant autoradiography. 97 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. RESULTS 4.1 Overexpression o f GRIP1 fragment in mammalian ceils inhibited expression from RNA polymerase li promoters but not from RNA polymerase Hi promoters If GRIP1 Is a transcriptional coactivator for the steroid receptors, overexpression of GRIP1, even its partial sequence, in mammalian cells might be able to affect the expression of steroid hormone-regulated genes, either positively or negatively. This possibility was tested by the overexpression of the 800-amino acid GRIP1 fragment (amino acids 322- 1121) which was originally identified from the yeast two-hybrid system screening. In order to express the partial GRIP1 fragment in mammalian cells, we put the 2.4 kb GRIP1 cDNA fragment after an artificial translation start signal and under the control of a cytomegalovirus (CMV) promoter in a mammalian cell expression plasmid. This expression vector was transfected into mouse L cells along with three plasmids containing reporter genes: MMTV-CAT, which could be activated by the endogenous L cell GR in the presence of hormone; CMV-P-gal, which should be expressed constitutively; and pArg-maxigene, a modified tRNA gene that should be expressed constitutively by RNA polymerase III. Expression of both MMTV-CAT and CMV-p-gal was severely inhibited by the overexpressed GRIP1 fragment in 98 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. a dose-dependent manner; however, in the same transfected cultures, expression from the RNA polymerase III promoter was not affected by the GRIP1 fragment (Fig. 4-3). Because it was unaffected, expression of the pArg-maxigene also served as an intemal control for transfection efficiency. These results suggested that GRIP1 fragment overexpression generally interfered with transcription by RNA polymerase II, but not by RNA polymerase III. Such an effect could be due to squelching by excess GRIP1 fragment, i.e., binding of GRIP1 to an essential RNA polymerase ll-specific transcription factor. Overexpression of a wide variety of transcription factors, including steroid receptors, has been shown to cause this type of squelching (Tassetetal. 1990). 4.2 GRIP1 exhibited transactivation activity in both yeast and mammaiian celis The suggestion that GRIP1 may interact with essential transcription factors raised the question of whether GRIP1 may contain a transactivation domain by itself. Such an activity is generally identified by fusing the protein in question to the DBD of another protein and testing whether the fusion protein can activate a reporter gene containing an enhancer site recognized by the DBD. We first fused the 2.4 kb GRIP1 sequence with the Gal4 DBD sequence in a yeast expression vector. When the Gal4-DBD/GRIP1332-1121 99 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Fig 4-3 Effect of GRIP1 overexpression on expression of cotransfected reporter genes. Mouse L cells were simultaneously cotransfected with the three indicated reporter genes and variable amounts of pCMV.HA/GRIPl Cells were grown with 1 pM dexamethasone for the last 20 hrs before harvest and were harvested 48 hrs after transfection. Extracts from one set of transfected cells were assayed for CAT and (3-gal activity, while RNA preparations from a parallel set were subjected to RNase protection assays for the modified tRNA encoded by pArg-maxigene. Each bar represents the average of two independent transfections. CAT activity was completely dependent on glucocorticoid addition, while activity of the other two reporter genes was glucocorticoid independent. (This experiment was performed in collaboration with Dr. Alpa Trivedi, Dr. Deborah Johnson, and Ms. Kulwant Kohli). 1 0 0 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. E 3 E X (0 o 1 0 0 - 50 — I I MMTV-CAT m u CMV-pgal tRNA maxigene 0.15 0.5 Amount of pCMV.HA/GRIPI used in transfection (ng) 101 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. fusion protein was expressed in yeast, the 3 -gal reporter gene controlled by a Gal4 enhancer site was strongly activated, whereas neither the Gal4 DBD nor GRIP1 alone was able to activate 3-gal expression (Fig. 4-4a). To further confirm If GRIP1 fragment has transactlvatlon activity In mammalian cells, we constructed a fusion protein composed of the GR DBD and GRIPI322-1121 fragment, and transiently expressed It In CV-1 cells. A cotransfected MMTV- CAT reporter gene was strongly activated by GR-DBD/GRIP1, but not by either GRIP1 or the GR DBD alone (Fig 4-4b). In a similar experiment, the GRIP1 full-length protein also exhibited transactlvatlon In yeast cells (result not shown). Those results clearly Indicated that GRIP1 contains a transactlvatlon domain In Its original 2.4 kb fragment, and the transactlvatlon activity can be successfully exhibited by the full-length GRIP1. 4.3 GRIP1 can function as a coactivator for the HBDs o f ali the steroid receptors in yeast Because GRIP1 can both Interact with steroid receptor HBDs and exhibit transactlvatlon activity In yeast cells. It Is likely to be able to serve as a coactivator for the HBDs of steroid receptors In yeast, but we still need direct evidence to prove It. As mentioned before, Gal4-DBD/GR-HBD, one of the fusion proteins In the two-hybrid system, by Itself did not activate a Gal4 enhancer site linked 3-gal reporter gene In yeast, even In the presence 102 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Fig.4-4 Transcriptional activation by GRIP1 fragment fused with heterologous DBDs. A. Liquid yeast cultures stably expressing the indicated fusion or control protein and containing a (3-gal reporter gene controlled by a Gal4 enhancer site were harvested, and extracts were assayed for 3-gal activity. DBD, Gal4 DBD; GRIP1, GRIP1 fragment (amino acids 322- 1121). Each point is the average from three independent yeast transformants. B. CV-1 cells were transiently cotransfected with expression plasmids for the indicated fusion or control protein and for the reporter genes MMTV-CAT and CMV-3gal. After 48 hrs, cell extracts were made and assayed for CAT and 3- gal activity. Each point represents the average of two or three independent transfections, and each experiment has been reproduced independently with essentially identical results. 3-gal activity did not vary more than 2-fold among all transfected cultures. GRIP1, GRIP1 fragment (amino acid 322-1121). 103 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. ( g _ 0 L X L uda) ivo C O — r- — r- (N — T— Q . K O . 3 T - : c o + -• u ( U s— < n c 2 k m ^ o c ■o 0) (0 3 < ^ z d Q CO # < o g c 3 o E o < IdldO idiao/aaa 0 8 0 o CN 00 (n) /C liA ip v |d6 £ / 104 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. of an appropriate hormone (Fig. 4-5 A). The silent nature of the Gal4- DBD/GR-HBD fusion protein in yeast made this protein suitable for a "bait" in the two-hybrid screening. When Gal4-AD/GRIP1 fusion protein was coexpressed with Gal4-DBD/GR-HBD in the yeast two-hybrid system, the reporter gene was activated in a hormone dependent manner (Fig. 4-5 B). After we realized that GRIP1 also contains its own transactivation activity (Fig. 4-5 C), our next question was to ask whether GRIP1 by itself can function as a real transcriptional coactivator for the HBD of GR in yeast, depending on its own transactivation activity but not that of Gal4 AD. To answer this question, we excised the Gal4 AD from the pGAD424.GRIP1 expression vector (Fig. 4-2), and expressed the GRIPI322. 1121 fragment with Gal4 DBD/GR-HBD in yeast. While the GRIP1 fragment and the Gal4-DBD/GR-HBD fusion protein were inactive when expressed individually, their coexpression in yeast dramatically activated the (3-gal reporter gene in a hormone dependent manner (Fig. 4-6). This result proved that GRIP1 can function as a transcription coactivator for the HBD of GR in yeast cells. It is notable that our first experiment was performed with the 800-amino acid GRIP1 fragment. The 2.4 kb GRIP1 cDNA sequence isolated from the yeast two-hybrid screening clearly encoded a functional fragment with transcriptional coactivator activity, although its length finally turned out to be only 54.7% of the full-length GRIP1. 105 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Fig. 4-5 A model for the transcriptional coactivation effect of GRIP1 for the GR HBD in yeast. A. The Gal4-DBD/GR-HBD by itself can not activate a 3-gal reporter gene controlled by a Gal4 enhance site in yeast, indicating that yeast lacks the transcriptional coactivator for the HBD of GR. B. In yeast two-hybrid system, the Gal4-AD/GRIP1 fusion protein acts as a bridge between GR HBD and the yeast basal transcriptional machinery. The interaction between GRIP1 and GR HBD is hormone dependent. C. When fused to Gal4 DBD, GRIP1 can activate the 3-gal reporter gene, indicating that GRIP1 can functionally interact with the yeast basal transcriptional machinery. D. After the removal of Gal4 AD (compared with B), GRIP1 can act by itself as a bridge between the GR HBD and the yeast basal transcriptional machinery, functioning as a transcriptional coactivator for the GR HBD in yeast. 106 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. I Q al4ate I B GaUsHa I OR P I I G al* «Ne I GMP1 I GaWmNa I 107 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Fig. 4-6 GRIP1 can function as a coactivator for GR HBD in yeast. The indicated proteins were stably expressed in yeast (strain SFY526), which had a P-gal reporter gene controlled by a Gal4 enhancer site, in the presence and absence of 10 pM DOC. P-gal activity was determined by liquid assays. Each point is the mean and standard deviation from three independent yeast transformants. DBD, Gal4 DBD; GRIP1, GRIP1 fragment (amino acids 322- 1121); H, hormone agonist DOC. 108 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. DBD/GR-HBD DBD/GR-HBD + GRIP1 DBD/GR-HBD + GRIP1 GRIP1 DBD + GRIP1 DBD/P53 + GRIP1 7ZZZ////////À p-gal Activity (u) 109 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. After the Isolation of the full-length sequence of GRIP1, we retested the coactivation activity in full-length GRIP1, and also extended the test to the HBDs of all the steroid receptors, since we had known that GRIP1 can interact with the HBDs of all the members of the steroid receptor family. Our results indicated that the fusion proteins of Gal4 DBD and steroid receptor HBDs by themselves showed little or very weak activity in yeast for P-gal reporter gene with a Gal4 enhancer site, even in the presence of appropriate hormones (Fig. 4-7, columns 1-2). The coexpression of GRIP1 with those fusion proteins of Gal4-DBD and steroid receptor HBDs can greatly enhance the activity of the P-gal reporter gene in a hormone-dependent manner (column 3-4), indicating that GRIP1 can function as the transcriptional coactivator for the HBDs of all the steroid receptors. In Chapter 3, we have tested the interaction between GRIP1 and a panel of ER mutants with single or multiple point mutations in the AF-2 region, and found very good correlation between the GRIP1 interaction and the transactivation activity in those ER AF-2 mutants (see Fig. 3-8). In order to test the effect of GRIP1 on the transactivation activity of those ER AF-2 mutants in yeast, we expressed Gal4-DBD/ER-HBD fusion proteins (with AF- 2 mutations) in yeast with or without GRIP1. In the absence of GRIP1, none of those Gal4-DBD/ER-HBD fusion proteins can activate the reporter gene, but in the presence of GRIP1, all of the ER mutants, except the triple mutant, 110 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Fig. 4-7 GRIP1 can function as a coactivator for steroid receptor HBDs in yeast. The indicated proteins were stably expressed in yeast (strain SFY526) and their ability to activate the endogenous (3-gal reporter gene was determined Yeast culture, hormone treatment, and p-gal assays were performed as described in Fig. 3-2. Each point is the mean and standard deviation from three independent yeast transformants. DBD, Gal4 DBD; HBD, the HBD of steroid receptors as indicated at the bottom. 111 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. o C O o o ^ + CO I C 'J + r - I ^ + C O I C M + r - I ^ + CO I CM + t - I + CO I C M + T - I + + + + I + I + + + + + I + I + + + + + I + I + + + + + I + I + Tf + + + CO I + + CM + I + T - I I + (n) Â Ü A I.P V |B9-{I g o E Q C D ii O Q 0: a. tr < q : HI 0: o 112 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. can exhibit their transactivation activities in yeast in the same way as they do in mammalian cells (Fig. 4-8). Those results were also consistent with the abilities of those ER mutants to interact with GRIP1 (see Fig. 3-8). In an effort to localize the functional domains of GRIP1, we tested the transactivation activity and the coactivation activity for a series of truncated fragments of GRIP1 in yeast cells (Fig. 4-9). Our preliminary results showed that the transactivation activity of GRIP1 is located in the amino acids 730- 1121, which is the same region responsible for the interaction with the GR HBD. More interestingly, this fragment of GRIP1 is also capable of enhancing the transactivation activity of GR HBD in yeast cells. Those results supported our assumption that the coactivation activity of GRIP1 is based on both its ability to interact with the HBDs of steroid receptors, and its ability to interact with and stimulate the transcription machinery. 4.4 GRIP1 can enhance the transactivation activity of HBDs of non steroid receptors in yeast Based on the fact that GRIP1 can also interact with the HBDs of non steroid receptors, we predicted that GRIP1 may also act as a transcriptional coactivator for the non-steroid receptors in yeast. However, since the interaction between GRIP1 and non-steroid receptors exhibited quite diverse 113 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Fig. 4-8 Effect of GRIP1 on the transactivation activity of ER HBDs containing mutations in the AF-2 domain. Different Gal4-DBD/ER-HBD fusion proteins which contain the indicated AF-2 region amino acid substitutions were expressed with or without the coexpression of GRIP1 in yeast (strain SFY526) containing a (3-gal reporter gene controlled by Gal4 enhancer element. P-gal activity of cultures grown 4 hrs with or without estradiol (100 nM) was determined. Each point is the mean and standard deviation from three independent yeast transformants. DBD, Gal4 DBD. 114 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. h - GSSSSSSSSSSS m KSS co C M co C M co co C M o o CM o ( D c + + + + I + I + + + + + I + I + + + + + I + I + + + + + l + I + + + + + I + I + + + + + I + I + Q 03 i Q 03 o I i L lu 2 3 C 3 z s o i I a. g 115 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Fig. 4-9 Localization of the functional domains in GRIP1 for its GR interaction, transactivation activity, and coactivation activity. The GRIP1 fragments with the indicated length were tested in yeast (strain SFY526), which has a (3-gal reporter gene controlled by Gal4 enhancer site, for different activities. A. GR interaction was tested by coexpressing Gal4-DBD/GR-HBD and the Gal4-AD/GRIP1 fragment fusion proteins in the presence of 10 pM DOC, and 3-gal activity was determined. B. Transactivation activity was tested by expressing Gal4-DBD/GRIP1 fragment fusion proteins in yeast, and measuring 3-gal activity. C. Coactivation activity was tested by coexpressing Gal4-DBD/GR-HBD and the different sizes of GRIP1 fragments in the presence of 10 pM DOC, and measuring 3-gal activity. Yeast transformants were grown on selection plates, and 3-gal activity tested with filter assays. (+) blue color in the yeast colonies; (-) white color in the yeast colonies. 116 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. G R I P 1 fr a g m e n ts 322 322 1 1 2 1 766 730 1 1 2 1 A B C A: G R interaction B: Transactivation activity C: Coactivation activity 117 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. degrees of dependence on hormone, we expected that GRIP1 would show different effects on the transactivation activity of each non-steroid receptor too. Like the HBDs of the steroid receptors, the VDR HBD by itself showed no transactivation activity in yeast when fused with a Gal4 DBD, either in the presence or absence of hormone (Fig. 4-10, VDR column 1-2). But when GRIP1 is coexpressed, the Gal4-DBDA/DR-HBD fusion protein exhibited strong hormone-dependent activity (VDR column 3-4). The Gal4- DBD/RARa-HBD fusion protein was inactive by itself in yeast too, but the presence of GRIP1 can make it active in a hormone-independent manner (RARa column 3-4). The Gal4-DBD/RXRa-HBD fusion protein exhibited hormone-dependent activity in yeast cells in the absence of GRIP1. However, the presence of GRIP1 allowed the Gal4-DBD/RXRa-HBD fusion protein to show activity in the absence of hormone, but no effect by GRIP1 could be observed in the presence of hormone (RXRa column 3-4). The Gal4-DBD/TRa-HBD fusion protein showed weak activity by itself in yeast in the presence of hormone. The presence of GRIP1 enhanced its activity, either in the presence or in the absence of hormone (TRa column 3-4). The hormone-independent feature of the transactivation activity by the HBDs of RARa, RXRa and TRa in yeast in the presence of GRIP is consistent with the fact that those receptor HBDs could interact with GRIP1 in the absence of hormone, as we have shown earlier (see Fig. 3-5). 118 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Fig. 4-10 Effect of GRIP1 on the transactivation activity of the HBDs of non-steroid receptors. The Indicated proteins were stably expressed in yeast (strain SFY526) and their ability to activate the endogenous p-gal reporter gene was determined. Yeast culture, hormone treatment, and p-gal assays were performed as described in Fig. 3-5. Each point is the mean and standard deviation from three independent yeast transformants. DBD, Gal4 DBD; HBD, the HBD of non-steroid receptors as indicated at the bottom. 119 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. \ - ^ Z Z Z Z Z Z Z Z Z Z Z Z Z Z Z Z Z Z ^ \ - ^ Z Z Z Z Z Z Z Z Z Z Z Z Z Z Z l o CO o C N J o o + CO I CM + " M " + CO I CM + r - I (n) A;!A!PV | bo-ç | + + + + I + I + ^ + + + CO ' + + C M + I + T - I I + + + + + I + I + + + + CO I + + CM + I + ' « - 1 1 + g m III s q; q: X q: I Û: o > 120 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 4.5 GRIP1 can function as a coactivator for the full length GR and ER in yeast. We have demonstrated the coactivator effect of GRIP1 on the transactivation activity of Gal4-DBD/steroid receptor-HBD fusion proteins at a Gal4 enhancer site-linked 3-gal reporter gene. Although this is a convenient and reliable way to test the transactivation activity of the HBDs of steroid receptors, it would be more physiologically relevant to test the effect of GRIP1 on the ability of intact steroid receptors to activate transcription through their cognate enhancer elements. When full length GR was expressed in yeast and tested for its ability to activate a 3-gal reporter gene controlled by three tandem GRE elements, the presence of GRIP1 resulted in a leftward shift of the dose-response curve obtained with agonist □AC (Fig. 4-11). In a similar system with the full-length ER and a 3-gal reporter gene controlled by a single ERE, we also observed the same effect of GRIP1 on the transactivation activity of ER (Fig. 4-12). Those results clearly indicated that GRIP1 can act as a transcriptional coactivator for the intact steroid receptors in yeast. However, it was also very interesting to notice that the full-length steroid receptors showed quite strong transactivation activity in yeast without the presence of GRIP1. This contrasted dramatically with the complete 121 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Fig. 4-11 GRIP1 can serve as a coactivator for full length GR. The full length rat GR was expressed in yeast (strain w303a) containing a GRE3-CYC- LacZ reporter plasmid in the presence and absence of GRIP1, and 3-gal activity was determined after 4 hrs of culture with the indicated concentration of DAC. Each point is the mean and standard deviation from three independent yeast transformants. 122 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. in - b - b CO 0: o: ü ü (>-b o o o o o o co s CNJ (n) AiiAjPV |B O -e J 123 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Fig. 4-12 GRIP1 can serve as a coactivator for full length ER. The full length human ER was expressed in yeast (strain w303a) containing a ERE1- CYC-LacZ reporter plasmid in the presence and absence of GRIP1, and P-gal activity was determined after 4 hrs of culture with the indicated concentration of estradiol. Each point is the mean and standard deviation from three independent yeast transformants. 124 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 400 ER ER + GRIP1 300 a 3 200 w C D CO. 100 0 Estradiol (M) 125 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. dependence on GRIP1 exhibited by the Gal4 DBD and steroid receptor HBD fusion proteins. The different behaviors of the intact steroid receptors and their HBDs in yeast may be explained by the existence of multiple transactivation domains in the full-length receptors (Hollenberg and Evans, 1988). While the AF-2 domain located in the HBD of the receptors could not exhibit its transactivation activity in yeast without the presence of exogenous transcriptional coactivators, the N-terminal AF-1 domain may still be active in yeast cells. To investigate this hypothesis and the mechanism of GRIP1 coactivation of intact GR in yeast, we examined the ability of GRIP1 to activate the individual AF-1 and AF-2 activation domains of GR, with each linked in its native position to the GR DBD (Fig. 4-13a). The GR DBD/HBD fragment, like the previously examined fusion protein of Gal4 DBD and GR HBD, was inactive in yeast by itself, but co-expression of GRIP1 restored its hormone dependent activation of the GRE-controlled reporter gene (Fig. 4- 13b). The enhancement of the transactivation activity of GR HBD by GRIP1 in yeast was not due to stabilization of the protein expression of the GR DBD-HBD fragment by GRIP1, since immunoblots with a GR-specific antibody indicated that neither hormone nor GRIP1 affected the levels of the GR DBD-HBD protein in yeast (Fig. 4-14). In contrast, the GR AD/DBD fragment containing the AF-1 activation domain (Fig. 4-13a) was constitutively active in yeast, and this activity was 126 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Fig. 4-13 GRIP1 serves as a coactivator for the GR AF-2 domain, but not for the GR AF-1 domain. A. Rat GR species: full length GR (amino acids 1- 795); AF-1/DBD (amino acids 1-556); DBD/AF-2 (amino acids 407-795). B. The indicated truncated GR fragments were expressed in yeast (strain wSOSa) containing a GRE3-CYC-LacZ reporter plasmid, with or without GRIP1. Cells were grown with or without 10 pM DOC for 4 hrs, and g-gal activity was determined. Each point is the mean and standard deviation from three independent yeast transformants. 127 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. B GR r AF-1/DBD C DBD/AF-2 Transacth/afa'on A F - 1 DNA B in d in g Hormone Binding t2 A F - 2 GRIP1 - + - + GR AF-1/DBD 300 - 3 > 200 - I . c c i 100- hormone + + + + - + - + GR DBD/AF-2 128 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Fig. 4-14 Western blot for GR expression in yeast in the presence and absence of GRIP1. Yeast cultures expressing the GR DBD/HBD fragment with or without GRIP1 were grown with or without 10 pM DOC. Extracts were analyzed by immunoblot with BuGR2 antibody against GR. h, hormone agonist DOC. 129 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. GR only GR + GRIP1 2 1 .5 - GR 395-783 130 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. not stimulated by hormone or GRIP1 (Fig. 4-13b). This result was consistent with the observation in mammalian cells that GR AD/DBD fragment can act as a constitutive transcriptional activator (Godowski et al. 1987), and more interestingly, it indicated that the AF-1 domain of GR can exhibit transactivation activity in yeast without the presence of GRIP1. The different dependence on GRIP1 by the GR AF-1 and AF-2 domains was also confirmed by in vitro tests: GST pull-down assays showed that while the GR DBD/HBD fragment can interact with GRIP1 in a hormone-dependent manner, no interaction between GRIP1 and the GR AD/DBD fragment was detectable (Fig. 4-15). Thus GRIP1 acted as an obligatory transcriptional coactivator for the AF-2 transactivation domain but had no effect on the activity of the AF-1 domain, when each domain was expressed independently from the other. DISCUSSION It is now widely believed that transcriptional coactivators play a key role in the regulation of activated transcription. One of the popularly accepted models for the transcriptional coactivators is that they can function as a bridge to mediate the interaction between the enhancer-bound transcriptional activator and the basal transcription apparatus. This kind of interaction may promote the formation of a basal transcription initiation 131 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Fig. 4-15 in vitro assays for the interaction between GRIP1 and GR AF-1 and AF-2 domains. The labeled GR AD/DBD fragment (reaction 1) and DBD/HBD fragment (reaction 2 and 3) were translated In vitro with 10 |jM DOC (reaction 2) or without DOC (reactions 1 and 3), and then incubated with Sepharose beads containing bound GST or GST-GRIPI730.1121 Bound GR fragments were visualized by SDS-PAGE and autoradiography. Input, 1/10 of the original incubation; GST, the GR fragment bound to GST beads; GST- GRIP1, GR bound to GST-GRIP1 beads. 132 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Input GST GST-GR1P1 2 3 2 3 1 2 3 * 1. AF-1/D BD 2,3. DBD/AF-2 (2. +DOC) (3. -DOC) 133 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. complex, stabilize such a complex after it is formed, or somehow convert the preformed complex to an active state, thus enhancing the efficiency of transcription. All our data thus far strongly supported the role of GRIP1 as a transcriptional coactivator for steroid receptors: (1) GRIP1 can specifically interact with the HBDs of all the steroid receptors in a hormone-dependent manner, and such interactions have been proven to correlate well with the transactivation activity of the receptors; (2) When tethered to a heterologous DNA binding domain, GRIP1 exhibits transactivation activity both in yeast and in mammalian cells, indicating that GRIP1 can functionally interact with the basal transcriptional machinery: (3) Most importantly, GRIP1 can greatly enhance in yeast the hormone dependent transactivation activity of steroid receptors, either their DBD bound HBD fragments or the intact molecules; (4) The sequence homology between GRIP1, TIF2 (the probable human version of GRIP1) and SRC-1 indicated that they may belong to a new transcriptional coactivator family. SRC-1 and TIF2 exhibit coactivation activity in mammalian cells (Onate et al. 1995; Voegel et al. 1996). The properties of GRIP1 are all consistent with the "bridge" model for transcriptional coactivators; e.g. GRIP1 is able to interact with both the transactivation domain of the steroid receptors and the basal transcriptional machinery, and those two abilities seem to contribute directly to GRIPTs cotransactivation activity. While a lot of putative transcriptional coactivators 134 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. for steroid receptors have been Isolated based on their ability to interact with the receptors, so far only GRIP1, TIF2, and SRC-1 have showed substantial ability to enhance the transactivation activity of steroid receptors; at the same time, they are also the only proteins which exhibited transactivation activity in addition to their ability to interact with the receptors (Voegel et al. 1996; Hong et al. 1996; Onate et al. 1995). Furthermore, we found that a small fragment of GRIP1 (amino acid 730-1121), which retains both GR interaction ability and transactivation activity, is sufficient to enhance the transactivation activity of the GR HBD, while dnSRC-1, a fragment of SRC-1 which can interact with the steroid receptor but lacks transactivation activity, only showed a dominant negative effect on the activity of steroid receptors (Onate et al. 1995). Based on those discussions, it seems safe to predict that a protein with both the ability to interact with transcriptional activator and transactivation activity has fulfilled the basic requirement for a transcriptional coactivator, although we do not mean to exclude other models for the action of transcriptional coactivators. However, this model is clearly oversimplified, since the real physiological condition is much more complex. The transactivation procedure of the steroid receptors presumably involves the effect of multiple known and unknown transcription coactivators and corepressors, as well as other transcriptional integrators, like GBP (see below). The complexity of the 135 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. mechanism may also explain our results for non-steroid receptors. We have found that in yeast GRIP1 can interact with some of the non-steroid receptors in a hormone independent manner; in accordance, the presence of GRIP1 can also allow those receptors to show hormone independent transactivation activity in yeast. Those results supported our "bridge" model about GRIP1, because once the interaction with GRIP1 is established, GRIP1 can act as a transcriptional coactivator for those enhancer bound proteins, even though the interaction happens in a non-physiological condition, e.g.. in the absence of homone. We can not predict the real physiological role of GRIP1 in the activity of non-steroid receptors at this time. But one possibility is that in mammalian cells, the interaction between those receptors and GRIP1 may be affected by some other proteins such as corepressors, which are probably missing from the yeast system. It will be challenging to realize how those different proteins can work together in gene regulation. Although we believe that GRIP1 enhances the transactivation activity of steroid receptors by mediating the interaction between the steroid receptors and the basal transcriptional machinery, theoretically GRIP1 could also enhance the activity of steroid receptors by stabilizing steroid receptors, or stabilizing the receptor-hormone complex. However, immunoblot data demonstrated directly that GRIP1 did not affect the levels of receptor protein 136 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. in yeast, either in the presence or in the absence of hormone. Furthermore, while the leftward shift in the dose response cun/e for intact GR caused by GRIP1 could theoretically be due to a stabilization of hormone binding to GR, other evidence argues indirectly against this interpretation. If GRIP1 were acting solely by stabilization of hormone binding to GR, we would expect to see similar effects by GRIP1 on intact steroid receptors and on DBD-HBD fragments. However, the activity of the DBD-HBD fragments was almost completely dependent on GRIP1, even at saturating concentrations of hormone. So those two possible mechanisms could both be excluded. Our data presented here indicated that yeast has an endogenous mechanism to support the transactivation activity of the AF-1 domain, but not the AF-2 domain of steroid receptors. This observation, together with the different promoter and cell type specificities exhibited by the AF-1 and AF-2 transactivation domains in mammalian cells (Tzukerman et al. 1994; McDonnell et al. 1995), provided indirect evidence suggesting that these two domains utilized different mechanisms of transactivation. Our demonstration that AF-2 function in yeast requires GRIP1 as a coactivator, while AF-1 is GRIP1 independent, provides direct evidence to support this hypothesis and establishes a specific and distinct molecular mechanism for the AF-2 transactivation activity. Although GRIP1 does not appear to enhance the activity of an independent AF-1 domain, our results do not preclude the 137 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. possibility that GRIP1 might contribute to the demonstrated synergistic effect between AF-1 and AF-2 (Hollenberg and Evans, 1988; Metzger et al. 1992; Lees et al. 1989). GRIP1, TIF2 and SRC-1 are the three best characterized transcriptional coactivators for steroid receptors (Voegel et al. 1996; Onate et al. 1995; Hong et al. 1996). The fact that these three proteins share extensive sequence homology indicates that they belong to a new transcriptional coactivator family. Although GRIP1 and TIF2 share many regions of partial homology with SRC-1, current data suggested some notable differences in their functional domains. A small region of GRIP1 (amino acid 730-1121) retains steroid binding activity, transactivation activity, and coactivator activity. However, this region of GRIP1 exhibits quite poor homology with SRC-1. More interestingly, the dominant negative fragment dnSRC-1, which is reported to be the major nuclear receptor interaction domain of SRC-1, does not overlap with the originally identified fragments of GRIP1 (amino acids 322-1121) or TIF2 (amino acids 368- 1306), which contain the only demonstrated nuclear receptor interaction domain from GRIP1/TIF2. It remains to be determined if SRC-1 and GRIP1/TIF2 have different nuclear receptor interaction domains, or alternatively there are multiple nuclear receptor interaction domains in these proteins. 138 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. The originally reported sequence for SRC-1 protein apparently was Incomplete, lacking the 380 N-termlnal amino acids (Ohate et al. 1995). With the Identification of SRC-1 a, we found that the region of highest homology between GRIP1 and SRC-1 a Is located In the N-termlnus of those proteins. This region In SRC-1 a was reported to Interact with CBP (Kamel etal. 1996). CBP was Initially Identified as a coactivator for the CREB transcriptional activator protein (Kwok et al. 1994), and has subsequently been Implicated as the core element of a larger complex of coactivators. Including SRC-1 (Kamel et al. 1996). CBP has also been shown to Interact with the HBDs of nuclear receptors In a hormone-dependent manner and with SRC-1 a at the same time. Thus the CBP coactivator complex has been proposed to serve as an Integrator of multiple signal transduction pathways within the nucleus. It will be Interesting to test for an Interaction between CBP and GRIP1 and the biological relevance of this kind of Interaction. Our study on the functions of GRIP1 has been greatly helped by the use of the yeast system. It has been known that the basic mechanisms controlling Initiation of transcription appear to be conserved throughout eukaryotes. Several subunits of RNA polymerase II are highly conserved from yeast to human (Young, 1991; Sawadogo and Sentenac, 1990), and the yeast TATA-blndIng protein can to some extent functionally replace the corresponding HeLa cell factor (Cavalllnl et al. 1988; BuratowskI et al. 1988). 139 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Moreover, yeast transcriptional activators can function in animal and plant cells (Ma etal. 1996; Fischer etal. 1988; Webster etal. 1988; Kakidani and Ptashne, 1988), and many mammalian transcriptional activators, including the full length steroid receptors have been shown to activate transcription in yeast (Garabedian, 1993). But the yeast transcriptional system also exhibits some clearly different features from the mammalian system. The most important one in our case is the lack of transcriptional coactivators for the HBDs of steroid receptors in yeast cells (Hong et al. 1996). Although the yeast system has long been used for the study of the biological function of steroid receptors (Garabedian, 1993), it is now clear that a lot of the earlier data on the function of full length steroid receptors in yeast are mainly the results of the activity from the AF-1 domain in the receptors, since our data has shown that the AF-2 domains of the steroid receptors are inactive in yeast without the presence of exogenous transcriptional coactivators, such as GRIP1. As we have discussed above, yeast probably do not have corepressor for the nuclear receptors or CBP-like protein either, which are also involved in the normal biological function of the steroid receptors. However, those unique features of the yeast transcriptional system provide a good system to study the function of the coactivator/corepressors of steroid receptors, because yeast is virtually a natural knock-out system for those factors. While the ultimate goal must obviously be to understand the action of coactivators in the context of mammalian cells, we can still utilize the yeast 140 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. system as a powerful tool to study the dissected features of the transcriptional coactivator/corepressors of steroid receptors. In mammalian cells, GRIP1/TIF2 and SRC-1 are expressed relatively ubiquitously (Voegel et al. 1996; Hong et al. 1996; Onate et al. 1995); the possible presence of additional, currently unknown, AF-2 coactivators must also be considered. This undoubtedly explains why detection of coactivator activity by overexpression in mammalian cells has thus far required overexpression of the steroid receptors, and why the requirement for the added coactivators is not absolute (Voegel et al. 1996; Oriate et al. 1995). Furthermore, apparent differences in the ability of the overexpressed coactivator to enhance the activity of different steroid receptors are difficult to interpret. For example, overexpression of TIF2 in HeLa cells enhanced the activity of PR, ER and AR, but not GR, although TIF2 can interact with all the receptors in a hormone dependent manner (Voegel et al. 1996), and in yeast the orthologous coactivator GRIP1 dramatically stimulated AF-2 activity for all of the steroid receptors. Thus, the lack of stimulation of GR activity in mammalian cells is not due to inability of TIF2 to support GR function, but may be due to a complex combination of differing relative specificities and efficiencies of painwise cooperation between different steroid receptors and various endogenous coactivators in HeLa cells. 141 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. CHAPTER 5: CONCLUDING REMARKS In this thesis, I reported the isolation and characterization of mouse GRIP1, a transcriptional coactivator for steroid receptors. Like most of the other putative transcriptional coactivators for the steroid receptors, GRIP1 was identified by its ability to exert protein-protein interaction with the HBDs of steroid receptors. However, the physical interaction by itself is not enough to define a transcriptional coactivator; it is more important to prove the physiological relevance of such an interaction. In this thesis, I provided evidence to support the close correlation between the GRIP1 interaction and the transactivation activity of steroid receptors: (1) The interaction is hormone-dependent. GRIP1 can interact with all the members of steroid receptors, and all the interactions are strictly regulated by relevant hormones. (2) The interaction is only inducible by hormone agonists, but not by the antagonists. Our data also suggested that the dissociation of hsp90 from steroid receptors, which could be induced by agonist and antagonist, is not sufficient to support GRIP1 interaction, and that the failure to induce the interaction between steroid receptor and GRIP1 by antagonists may explain their inability to induce transactivation by steroid receptors. (3) The interactions closely correlate with the transactivation activity of different steroid receptor mutants, including cases of decreased activity, like the case for ER AF-2 mutations, or enhanced activity, like the case for the GR mutant 142 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. GA11. The altered abilities to interact with GRIP1 may also provide an explanation for the change of transactivation activities of those mutants. Besides the interaction with the HBDs of steroid receptors, our data also suggested that GRIP1 can functionally interact with the basal transcriptional machinery, because when fused with a heterologous DMA binding domain, GRIP1 can exhibit transactivation both in yeast and in mammalian cells. Furthermore, our data directly proved that in yeast GRIP1 can greatly enhance the hormone dependent transactivation activity of steroid receptors, for either the intact receptors or their HBDs. Those findings strongly supported the model that GRIP1 may function as a bridge between the enhancer bound steroid receptors and the basal transcriptional apparatus, and may help us to understand the mechanism for the transactivation activity of steroid receptors. The inactivity of the AF-2 domain of steroid receptors in yeast in the absence of exogenous transcriptional coactivators, like GRIP1, greatly helped us in the study of the biological functions of GRIP1, since yeast obviously does not have GRIP1, in contrast to the ubiquitous expression of GRIP1 and other possible transcriptional coactivators in mammalian cells. Thus yeast could provide an excellent system for the study of the transcriptional coactivators and corepressors of steroid receptors. We also 143 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. found that in yeast, GRIP1 can only affect the activity of the GR HDB (containing AF-2 domain), but did not Interact with GR N-terminal domain (containing AF-1 domain) or affect its transactivation activity. This finding provided the most direct evidence to support the long-lasting hypothesis that the AF-1 and AF-2 domains of the steroid receptors may function through different mechanisms. At the same time, it also reminded us to interpret carefully the earlier data from the study of steroid receptors in yeast cells, since a lot of these data may only represent the function of the AF-1 domain, but not the AF-2 domain of the receptors. Besides the work we have reported in this thesis, there still is a lot to do in the GRIP1 study. One of the interesting observations in our study is that GRIP1 can bind with and enhance the transactivation activities of some non-steroid receptors with diverse hormone dependent features. Those data suggested that GRIP1 can support the transactivation activity of non-steroid receptors in yeast, but some of those effects are not really controlled by the presence of hormone, in contrast to what happens in physiological conditions. A possible explanation is that yeast may also lack other required proteins involved in the regulation of the transactivation activity of nuclear receptors, such as corepressors. To test this hypothesis, we can introduce the corepressors of nuclear receptors, among which at least SMRT and N- CoRI are available to us at this moment, into the yeast system to 144 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. reconstitute a more physiological environment for those non-steroid receptors. Such experiments may improve our understanding for the transactivation mechanisms of nuclear receptors, and the roles of coactivators and corepressors. The fact that a GRIP1 fragment containing only a small portion of the molecule (amino acids 730-1121) contains almost all the known functions of GRIP1 strongly suggested that there must be other functions of GRIP1 to be discovered in the other regions of GRIP1. The far C-terminal region of GRIP1 is a region which has not been well studied yet. Although the steroid receptor interaction domain in GRIP1 has been found to be located in the amino acids 730-1121, this region does not overlap with the major interaction domain (dnSRC-1) in SRC-1 (Oriate, 1995). It would be interesting to test if that region of GRIP1 also has the ability to interact with steroid receptors. More interestingly, the N-terminal region of GRIP1 shares strikingly high homology with the same region in SRC-1 a (Kamei et al, 1996), but we still don’t know the exact function in that region of GRIP1 yet. It was indicated that the N-terminal region of SRC-1 a is involved in the interaction with CBP, which is now assumed to be an integrator for multiple signal transduction pathways (Kamai, 1996). Recent unpublished results from Dr. Kushner's lab also indicated that full length GRIP1 and SRC-1 a can increase the ability of ER to enhance the action of CBP, while a truncated SRC-1, 145 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. which lacked the N-termlnus, did not. Those results suggested the importance of the N-terminus of GRIP1. We can start to test the interaction between the N-terminal region of GRIP1 and CBP, either by the yeast two- hybrid system or by in vitro assays. The effect of steroid receptors and hormone on such interactions will also be tested. We can also test the effect of CBP on coactivation activity of GRIP1 in the yeast system, which probably lacks endogenous CBP too. We have identified the transactivation activity of GRIP1, which means that GRIP1 can functionally interact with the basal transcription apparatus. However, further evidence is still needed to prove the physical interaction between GRIP1 and basal transcription factors or TAFs. In our preliminary work, GRIP1 did not show interaction with either TBP or TFIIB, but showed weak interaction with TFIIF (data not shown). In this moment, we can not tell if such a weak interaction is artificial or is biologically significant. Further experiments will be done to confirm those possible interactions, and their physiological relevance will be seriously considered too. Another ongoing study on GRIP1 is to test if GRIP1-facilitated transactivation by AF-2 in yeast requires a functional SWI/SNF complex. As I have mentioned in the Introduction, the transcriptional activity of steroid receptors requires the presence of a functional SWI/SNF complex, i.e. 146 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. mutations In swi1, swi2 or swi3 dramatically reduced the transactlvatlcn activity of steroid receptors (Yoshlnaga et al. 1992). Since we have shown that the AF-2 domain Is Inactive In yeast In the absence of GRIP1, those original experiments In swi mutants really only demonstrated that AF-1 transactlvatlcn depends on those SWI/SNF. With GRIP1, we now can test If the transactlvatlcn activity of AF-2 domain also requires the SWI/SNF complex. Transactlvatlcn activity of the Intact GR, GR lacking the AF-1 domain, and GR lacking the HBD (AF-2 domain) will be compared In these swI mutant strains In the presence and absence of GRIP1 and hormone. The result of these experiments will conclusively show whether AF-2 activity Is dependent on or Independent of SWI/SNF function. In conclusion, the study on GRIP1 Is still a new research field, and further study on the biological function of GRIP1 will greatly Improve our understanding of the mechanism by which steroid receptors, as well as other enhancer bound transcriptional activators, can exert their transactlvatlcn activity. 147 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. BIBLIOGRAPHY Altschul, S.F., W. Gish, W. Miller, E.W. Myers, and DJ. Lipman. 1990. Basic local alignment search tool. J. Mol. Biol. 215:403-410. Archer, T.K., P. Lefebvre, R.G. Wolford, and G.L. Hager. 1992. Transcription factor loading on the MMTV promoter: a bimodal mechanism for promoter activation. Science 2SS: 1573-1575. Archer, T.K., H.-L. Lee, M.G. Cordingley, J.S. Mymryk, G. Fragoso, D.S. Berard, and G.L. Hager. 1994. Differential steroid hormone induction of transcription from the mouse mammary tumor virus promoter. Mol. Endocrinol. 8: 568-576. Bagchi, M.K., S.Y. Tsai, M.-J. Tsai, and B.W. O'Malley. 1990. Identification of a functional intermediate in receptor activation in progesterone-dependent cell-free transcription. Nature 345: 547-550. Baker, A.R., D P. McDonnell, M. Hughes, T.M. Crisp, D.J. Mangelsdorf, M.R. Haussier, J.W. Pike, J. Shine, and B.W. O'Malley. 1988. Cloning and expression of full-length cDNA encoding human vitamin D receptor. Proc. Natl. Acad. Sci. USA 85: 3294-3298. Baniahmad, A., I. Ha, D. Reinberg, S. Tsai, M.-J. Tsai, and B.W. O'Malley. 1993. Interaction of human thyroid hormone receptor | 3 with transcription factor TFIIB may mediate target gene derepression and activation by thyroid hormone. Proc. Natl. Acad. Sci. USA 90: 8832-8836. Bartel, P., C.-t. Chien, R. Sternglanz, and S. Fields. 1993. Elimination of false positives that arise in using the two-hybrid system. BioTechniques 14: 920-924. Beato, M. 1989. Gene regulation by steroid hormones. Cell 56: 335-344. 148 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Beato, M., P. HerrIIch, and G. Schütz. 1995. Steroid hormone receptors: many actors in search of a plot. Cell 83: 851-857. Brou, C., J. Wu, S. All, E. Scheer, C. Lang, I. Davidson, P. Chambon, and L. Tora. 1993. Different TBP-associated factors are required for mediating the stimulation of transcription in vitro by the acidic transactivator GAL-VP16 and the two nonacidic activation functions of the estrogen receptor. Nucleic Acids Res. 21: 5-12. Buratowski, S., S. Hahn, P.A. Sharp, and L. Guarente. 1988. Function of a yeast TATA element-binding protein in a mammalian transcription system. Nature 334: 37-42. Cavaillès, V., S. Dauvois, F. L'Horset, G. Lopez, S. Hoare, P.J. Kushner, and M.G. Parker. 1995. Nuclear factor RIP140 modulates transcriptional activation by the estrogen receptor. EMBO J. 14: 3741-3751. Cavallini, B., J. Huet, J.L Plassat, A. Sentenac, J.M. Egly, and P. Chambon. 1988. A yeast activity can substitute for the HeLa cell TATA box factor. Nature 334: 77-80. Chakraborti, P.K., M.J. Garabedian, K.R. Yamamoto, and S.S. Simons, Jr. 1991. Creation of "super" glucocorticoid receptors by point mutations in the steroid binding domain. J. Biol. Chem. 266: 22075-22078. Chen, D. and M.R. Stallcup. 1994. The hormone binding role of two cysteines near the C-terminus of the mouse glucocorticoid receptor. J. Biol. Chem. 269: 7914-7918. Chen, J.D. and R.M. Evans. 1995. A transcriptional co-repressor that interacts with nuclear hormone receptors. Nature 377: 454-457. Chiang, C.-M. and R.G. Roeder. 1995. Cloning of an intrinsic human TFIID subunit that interacts with multiple transcriptional activators. Science 267: 531-536. 149 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Chin, W.W. 1991. Nuclear thyroid hormone receptors. Nuclear hormone receptors: Molecular mechanisms, cellular functions, clinical abnormalities. Parker, M.G. pp.79-102. Academic Press. London. Cordingley, M.G., A.T. Riegel, and G.L. Hager. 1987. Steroid-dependent interaction of transcription factors with the inducible promoter of mouse mammary tumor virus in vivo. Cell 48: 261-270. Dalman, F.C., L.C. Scherrer, L.P. Taylor, H. Akil, and W.B. Pratt. 1991. Localization of the 90-kDa heat shock protein-binding site within the hormone-binding domain of the glucocorticoid receptor by peptide competition. J. Biol. Chem. 266: 3482-3490. Danielian, P.S., R. White, J.A. Lees, and M.G. Parker. 1992. Identification of a conserved region required for hormone dependent transcriptional activation by steroid hormone receptors. EMBO J. 11:1025-1033. Danielsen, M., J.P. Northrop, and G.M. Ringold. 1986. The mouse glucocorticoid receptor: mapping of functional domains by cloning, sequencing and expression of wild-type and mutant receptor proteins. EMBO J. 5: 2513-2522. Dingermann, T., S. Sharp, J. Schaack, and D. Soil. 1983. Stable transcription complex formation of eukaryotic tRNA genes is dependent on a limited separation of the two intragenic control regions. J. Biol. Chem. 258: 10395-10402. El-Ashry, D., S.A. Oriate, S.K. Nordeen, and P.P. Edwards. 1989. Human progesterone receptor complexed with the antagonist RU486 binds to hormone response elements in a structurally altered form. Mol. Endocrinol. 3: 1545-1558. Eiliston, J.F., S.E. Fawell, L. Klein-Hitpass, S.Y. Tsai, M.-J. Tsai, M.G. Parker, and B.W. O'Malley. 1990. Mechanism of estrogen receptor- dependent transcription in a cell-free system. Mol. Cell. Biol. 10: 6607-6612. 150 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Evans, R.M. 1988. The steroid and thyroid hormone receptor superfamily. Science 240: 889-895. Fields, S. and O.-k. Song. 1989. A novel genetic system to detect protein-protein interactions. Nature 340: 245-246. Fischer, J.A., E. Giniger, T. Maniatis, and M. Ptashne. 1988. GAL4 activates transcription in Drosophila. Nature 332: 853-856. Freedman, L.P., S.K. Yoshinaga, J.N. Vanderbilt, and K.R. Yamamoto. 1989. In vitro transcription enhancement by purified derivatives of the glucocorticoid receptor. Science 245: 298-301. Garabedian, M.J. 1993. Genetic approaches to mammalian nuclear receptor function in yeast. Methods: A companion to Methods in Enzymoiogy 5: 138-146. Gill, G., E. Pascal, Z.H. Tseng, and R. Tjian. 1994. A glutamine-rich hydrophobic patch in transcription factor Spl contacts the dTAF„110 component of the Drosophila TFIID complex and mediates transcriptional activation. Proc. Natl. Acad. Sci. USA 91:192-196. Godowski, P.J., S. Rusconi, R. Miesfeld, and K.R. Yamamoto. 1987. Glucocorticoid receptor mutants that are constitutive activators of transcriptional enhancement. Nature 325: 365-368. Godowski, P.J., D. Picard, and K.R. Yamamoto. 1988. Signal transduction and transcriptional regulation by glucocorticoid receptor-LexA fusion proteins. Science 241: 812-816. Goodrich, J.A., T. Hoey, C.J. Thut, A. Admon, and R. Tjian. 1993. Drosophila TAFII40 interacts with both a VP16 activation domain and the basal transcription factor TFIIB. Cell 75: 519-530. Goodrich, J.A. and R. Tjian. 1994. TBP-TAF complexes: selectivity factors for eukaryotic transcription. Curr. Opin. Cell Biol. 6:403-409. 151 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Greene, G.L, P. Gilna, M. Waterfield, A. Baker, Y. Hort, and J. Shine. 1986. Sequence and expression of human estrogen receptor complementary DNA. Science 231: 1150-1154. Halachmi, S., E. Marden, G. Martin, H. MacKay, C. Abbondanza, and M. Brown. 1994. Estrogen receptor-associated proteins: possible mediators of hormone-induced transcription. Science 264:1455-1458. Ham, J. and M.G. Parker. 1989. Regulation of gene expression by nuclear hormone receptors. Curr. Opin. Cell Biol. 1: 503-511. Hoeck, W.,P. Hofer, and B. Groner. 1992. Overexpression of the glucocorticoid receptor represses transcription from hormone responsive and non-responsive promoters. J. Steroid Biochem. Mol. Biol. 41:283-289. Hoey, T., R.G. Weinzier, G. Gill, J.L. Chen, B.D. Dynlacht, and R. Tjian. 1993. Molecular cloning and functional analysis of Drosophila TAF11 0 reveal properties expected of coactivators. Cell 72: 247-260. Hollenberg, S.M. and R.M. Evans. 1988. Multiple and cooperative transactivation domains of the human glucocorticoid receptor. Cell 55: 899-906. Hong, H., K. Kohli, A. Trivedi, D.L. Johnson, and M.R. Stallcup. 1996. GRIP1, a novel mouse protein that serves as a transcriptional co-activator in yeast for the hormone binding domains of steroid receptors. Proc. Natl. Acad. Sci. USA 93: 4948-4952. Horlein, A.J., A.M. Naar, T. Heinzel, J. Torchia, B. Gloss, R. Kurokawa, A. Ryan, Y. Kamei, M. Soderstrom, O.K. Glass, and M.G. Rosenfeld. 1995. Ligand-independent repression by the thyroid hormone receptor mediated by a nuclear receptor co-repressor. Nature 377: 397-404. Ing, N.H., J.M. Beekman, S.Y. Tsai, M.-J. Tsai, and B.W. O'Malley. 1992. Members of the steroid hormone receptor superfamily interact directly with 152 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. TFIIB (830011) to mediate transcriptional induction. J. Biol. Chem. 267: 17617-17623. Jacq, X., C. Brou, Y. Lutz, I. Davidson, P. Chambon, and L. Tora. 1994. Human TAF„30 is present in a distinct TFIID complex and is required for transcriptional activation by estrogen receptor. Cell 7 9 :107-117. Kaelin, W.G., Jr., D C. Pallas, J.A. DeCaprio, F.J. Kaye, and D.M. Livingston. 1991. Identification of cellular proteins that can interact specifically with the T/E1A-binding region of the retinoblastoma gene product. Ce//64: 521-532. Kakidani, H. and M. Ptashne. 1988. GAL4 activates gene expression in mammalian cells. Cell 52:161-167. Kamel, Y., L. Xu, T. Heinzel, J. Torchia, R. Kurokawa, B. Gloss, S.-C. Lin, R.A. Heyman, D.W. Rose, C.K. Glass, and M.G. Rosenfeld. 1996. A CBP integrator complex mediates transcriptional activation and AP-1 inhibition by nuclear receptors. Cell 85: 403-414. Klein-Hitpass, L., S.Y. Tsai, N.L. Weigel, G.F. Allan, D. Riley, R. Rodriguez, W.T. Schrader, M.-J. Tsai, and B.W. O'Malley. 1990. The progesterone receptor stimulates cell-free transcription by enhancing the formation of a stable preinitiation complex. Cell 60:247-257. Koelle, M.R., W.S. Talbot, W.A. Segraves, M.T. Bender, P. Cherbas, and D.S. Hogness. 1991. The Drosophila EcR gene encodes an ecdysone receptor, a new member of the steroid receptor superfamily. Cell 67: 59-77. Kurokawa, R., M. Soderstrom, A. Horlein, S. Halachmi, M. Brown, M.G. Rosenfeld, and C.K. Glass. 1995. Polarity-specific activities of retinoic acid receptors determined by a co-repressor. Nature 377:451-454. Kwok, R.P.S., J R. Lundblad, J.C. Chrivia, J.P. Richards, H.P. Bachinger, R.G. Brennan, S.G.E. Roberts, M.R. Green, and R.H. Goodman. 1994. Nuclear protein CBP is a coactivator for the transcription factor CREB. Nature 370: 223-229. 153 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Kwon, H., A N. Imbalzano, P.A. Khavari, R.E. Kingston, and M.R. Green. 1994. Nucleosome disruption and enhancement of activator binding by a human SWI/SNF complex. Nature 370; 477-481. Le Douarin, B., C. Zechel, J.-M. Gamier, Y. Lutz, L. Tora, B. Pierrat, D. Heery, H. Gronemeyer, P. Chambon, and R. Losson. 1995. The N-terminal part of TIPI, a putative mediator of the ligand-dependent activation function (AF-2) of nuclear receptors, is fused to B-raf in the oncogenic protein TIB. EMBO J. 14: 2020-2033. Lee, J.W., H.-S. Choi, J. Gyuris, R. Brent, and D.D. Moore. 1995a. Two classes of proteins dependent on either the presence or absence of thyroid hormone for interaction with the thyroid hormone receptor. Mol. Endocrinol. 9: 243-254. Lee, J.W., F. Ryan, J.C. Swaffield, S.A. Johnston, and D.D. Moore. 1995b. Interaction of thyroid-hormone receptor with a conserved transcriptional mediator. Nature 374: 91-94. Lees, J.A., S.E. Fawell, and M.G. Parker. 1989. Identification of two transactivation domains in the mouse oestrogen receptor. Nucleic Acids Res. 17: 5477-5489. Lin, Y.-S., I. Ha, E. Maldonado, D. Reinberg, and M.R. Green. 1991. Binding of general transcription factor TFIIB to an acidic activating region. Nature 353: 569-571. Liu, E.S. and A S. Lee. 1991. Common sets of nuclear factors binding to the conserved promoter sequence motif of two coordinately regulated ER protein genes, GRP78 and GRP94. Nucleic Acids Res. 19: 5425-5431. Lubahn, D.B., D.R. Joseph, M. Sar, J. Tan, H.N. Higgs, R.E. Larson, F.S. French, and E.M. Wilson. 1988. The human androgen receptor: complementary deoxyribonucleic acid cloning, sequence analysis and gene expression in prostate. Mol. Endocrinol. 2: 1265-1275. 154 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Ma, J., E. Przibilla, J. Hu, L Bogorad, and M. Ptashne. 1996. Yeast activators stimulate plant gene expression. Nature 334: 631-633. Ma, W.-J., R.W. Holz, and M.D. Uhler. 1992. Expression of a cDNA for a neuronal calcium channel a l subunit enhances secretion from adrenal chromaffin cells. J. Biol. Chem. 267: 22728-22732. MacDonald, P.N., D.R. Sherman, D.R. Dowd, S.C.J. Jefcoat, and R.K. DeLlsle. 1995. The vitamin D receptor Interacts with general transcription factor IIB. J. Biol. Chem. 270: 4748-4752. McDonnell, D.P., D.L. Clemm, T. Hermann, M E. Goldman, and J.W. Pike. 1995. Analysis of estrogen receptor function In vitro reveals three distinct classes of antiestrogens. Mol. Endocrinol. 9: 659-669. Metzger, D., R. Losson, J.-M. Bomert, Y. Lemolne, and P. Chambon. 1992. Promoter specificity of the two transcriptional activation functions of the human oestrogen receptor In yeast. Nucleic Acids Res. 20: 2813-2817. Meyer, M.-E., H. Gronemeyer, B. Turcotte, M.-T. Bocquel, D. Tasset, and P. Chambon. 1989. Steroid hormone receptors compete for factors that mediate their enhancer function. Cell 57:433-442. MIsrahl, M., M. Atger, L. d'Aurlol, H. Loosfelt, C. Merlel, F. Fhdlansky, A. Gulochon-Mantel, F. Gallbert, and E. Mllgrom. 1987. Complete amino acid sequence of the human progesterone receptor deduced from cloned cDNA. Biochem. Biophys. Res. Commun. 143: 740-748. Onate, S.A., S.Y. Tsai, M.-J. Tsai, and B.W. O'Malley. 1995. Sequence and characterization of a coactivator for the steroid hormone receptor superfamily. Science 270: 1354-1357. Parker, M.G. 1993. Steroid and related receptors. Curr. Opin. Cell Biol. 5: 499-504. 155 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Patel, P.O., T.G. Sherman, D.J. Goldman, and S.J. Watson. 1989. Molecular cloning of a mlneralocorticold (type I) receptor complementary DNA from rat hippocampus. Mol. Endocrinol. 3:1877-1885. Picard, D. and K.R. Yamamoto. 1987. Two signals mediate hormone-dependent nuclear localization of the glucocorticoid receptor. EMBO J. 6 : 3333-3340. Pierrat, B., D.M. Heery, P. Chambon, and R. Losson. 1994. A highly conserved region In the hormone-binding domain of the human estrogen receptor functions as an efficient transactlvatlon domain In yeast. Gene 143: 193-200. Roberts, S.G., I. Ha, E. Maldonado, D. Reinberg, and M.R. Green. 1993. Interaction between an acidic activator and transcription factor TFIIB Is required for transcriptional activation. Nature 363: 741-744. Sadovsky, Y., P. Webb, G. Lopez, J.D. Baxter, P.M. Fitzpatrick, E. GIzang-Glnsberg, V. Cavaillès, M.G. Parker, and P.J. Kushner. 1995. Transcriptional activators differ In their responses to overexpression of TATA-box-blndIng protein. Mol. Cell. Biol. 15: 1554-1563. Sande, S. and M. Privalsky. 1996. Identification of TRACs (T3 receptor-associating cofactors), a family of cofactors that associate with, and modulate the activity of, nuclear hormone receptors. Mol. Endocrinol. 10: 813-825. Sauer, F., S.K. Hansen, and R. Tjian. 1995. Multiple TAF„s directing synergistic activation of transcription. Science 270:1783-1788. Sawadogo, M. and A. Sentenac. 1990. RNA polymerase B (II) and general trasncrlptlon factors. Annu. Rev. Biochem. 59: 711-754. Seol, W., H.-S. Choi, and D.D. Moore. 1995. Isolation of proteins that interact specifically with the retinoid X receptor: two novel orphan receptors. Mol. Endocrinol. 9: 72-85. 156 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Simons, S.S., Jr., F.D. Sistare, and P.K. Chakraborti. 1989. Steroid binding activity is retained in a 16-kDa fragment of the steroid binding domain of rat glucocorticoid receptors. J. Biol. Chem. 264:14493-14497. Tasset, D., L. Tora, 0. Fromental, E. Scheer, and P. Chambon. 1990. Distinct classes of transcriptional activating domains function by different mechanisms. Cell 6 2 :1177-1187. Tjian, R. and T. Maniatis. 1994. Transcriptional activation; a complex puzzle with few easy pieces. Cell 77: 5-8. Tsai, M.-J. and B.W. O'Malley. 1994. Molecular mechanisms of action of steroid/thyroid receptor superfamily members. Annu. Rev. Biochem. 63: 451-486. Tsai, S.Y., G. Srinivasan, G.F. Allan, E.B. Thompson, B.W. O'Malley, and M.-J. Tsai. 1990. Recombinant human glucocorticoid receptor induces transcription of hormone response genes in vitro. J. Biol. Chem. 265: 17055-17061. Tzukerman, M.T., A. Esty, D. Santiso-Mere, P. Danielian, M.G. Parker, R.B. Stein, J.W. Pike, and D P. McDonnell. 1994. Human estrogen receptor transactivational capacity is determined by both cellular and promoter context and mediated by two functionally distinct intramolecular regions. Mol. Endocrinol. 8 : 21-30. Voegel, J.J., M.J.S. Heine, C. Zechel, P. Chambon, and H. Gronemeyer. 1996. TIF2, a 160 kDa transcriptional mediator for the ligand-dependent activation function AF-2 of nuclear receptors. EMBO J. 15: 3667-3675. Wang, H.-D., C.-H. Yuh, C.V. Dang, and D.L. Johnson. 1995. The hepatitis B virus X protein increases the cellular level of TATA-bindIng protein which mediates transactivation of RNA polymerase III genes. Mol. Cell. Biol. 15: 6720-6728. 157 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Webster, N., J.R. Jin, S. Green, M. Hollis, and P. Chambon. 1988. The yeast UASG is a transcriptional enhancer in human HeLa cells in the presence of the GAL4 trans-activator. Ce//52:169-178. Weigel, N.L., C.A. Beck, P.A. Estes, P. Prendergast, M. Altmann, K. Christensen, and D P. Edwards. 1992. Ligands induce conformational changes in the carboxy-terminus of progesterone receptors which are detected by a site-directed antipeptide monoclonal antibody. Mol. Endocrinol. 6: 1585-1597. Wilson, I A., H.L. Niman, R.A. Houghten, A.R. Cherenson, M.L. Connolly, and R.A. Lerner. 1984. The structure of an antigenic determinant in a protein. Cell 37: 767-778. Yoshinaga, S.K., C.L. Peterson, I. Herskowitz, and K.R. Yamamoto. 1992. Roles of S W I, SW2, and SW3 proteins for transcriptional enhancement by steroid receptors. Science 258:1598-1604. Young, R.A. 1991. RNA polymerase II. Annu. Rev. Biochem. 60: 689-715. Zhang, S., X. Liang, H. Hong, M.R. Stallcup, and M. Danielsen. 1996. Identification of a region of the hormone binding domain of the glucocorticoid receptor that is important for the interaction with the transcriptional coactivator GRIP1. Submitted. Zhang, S. and M. Danielsen. 1995. Selective effects of 8-Br-cAMP on agonists and antagonists of the glucocorticoid receptor. Endocrine 3: 5-12. 158 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. ^FO R M A TIO N TO USERS This manuscript has been reproduced from the microfilm master. UMI films the text directly from the original or copy submitted. Thus, some thesis and dissertation copies are in typewriter face, while others may be from any type of computer printer. The quality of this reproduction is dependent upon the quality of the copy submitted. Broken or indistinct print, colored or poor quality illustrations and photographs, print bleedthrough, substandard margins, and improper alignment can adversely afreet reproduction. k the unlikely event that the author did not send UMI a complete manuscript and there are missing pages, these will be noted. Also, if unauthorized copyright material had to be removed, a note will indicate the deletion. Oversize materials (e.g., maps, drawings, charts) are reproduced by sectioning the original, beginning at the upper left-hand comer and continuing from left to right in equal sections with small overlaps. Each original is also photographed in one exposure and is included in reduced form at the back of the book. Photographs included in the original manuscript have been reproduced xerographically in this copy. Higher quality 6” x 9” black and white photographic prints are available for any photographs or illustrations appearing in this copy for an additional charge. Contact UMI directly to order. UMI A Bell & Howell Infonnation Company 300 North Zed) Road, Ann Aibor MI 48106-1346 USA 313/761-4700 800/521-0600 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. UMI Number: 9720237 UMI Microform 9720237 Copyright 1997, by UMI Company. All rights reserved. This microform edition is protected against unauthorized copying under Title 17, United States Code. UMI 300 North Zeeb Road Ann Arbor, MI 48103 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.

Linked assets

University of Southern California Dissertations and Theses

Conceptually similar

PDF

The isolation and characterization of rat plasma albumins

PDF

Molecular cloning and characterization of msx2 interacting proteins

PDF

Isolation and characterization of intestinal alkaline phosphatase

PDF

Moloney murine leukemia virus (MoMuLV) envelope protein: Interaction with receptor and engineering for targeted gene transfer

PDF

A novel reaction of mismatched cytosine-cytosine pairs associated with Fragile X

PDF

Isolation and characterization of mouse Zac1, a novel co-regulator for transcriptional activation by nuclear receptors and p53

PDF

Characterization of zebularine: A novel inhibitor of DNA methylation with clinical potential

PDF

In vivo evolution of recombinant feline leukemia viruses (FeLV) toward FeLV subgroup B viruses in thymic lymphomagenesis

PDF

Pattern and mechanism of troponin C-Fast gene expression during tongue myogenesis

PDF

Function and regulation of Vav as a guanine nucleotide exchange factor

PDF

The mechanism of alpha-chymotrypsin acylation by N-acylimidazoles

PDF

The incorporation of radioactive carbons of glucose into the protein-bound amino acids of one-day-old mouse brain

PDF

A new approach to the problem of measuring the properties of micelles

PDF

Studies of Drosophila sex-lethal protein interactions and cloning of a novel interactor, SIN

PDF

Expression and characterization of recombinant collagen targeting TGF-beta and application in osteogenesis

PDF

Transcriptional regulation in osteoblasts

PDF

Interactions of diazene homologues with Azotobacter vinelandii nitrogenase enzyme and model systems

PDF

Identification and characterization of cis-elements that regulate tropomodulin gene expression during muscle differentiation

PDF

The metabolism in vitro of 4-C¹⁴-cytidine

PDF

Purification and characterization of the Escherichia coli mutagenesis complex UmuD'C

Asset Metadata

Creator Hong, Heng (author)

Core Title Isolation and characterization of mouse GRIP1, a novel transcriptional coactivator of steroid receptors

School Graduate School

Degree Doctor of Philosophy

Degree Program Biochemistry

Degree Conferral Date 1996-12

Publisher University of Southern California (original), University of Southern California. Libraries (digital)

Tag biology, molecular,chemistry, biochemistry,OAI-PMH Harvest

Language English

Contributor Digitized by ProQuest (provenance)

Permanent Link (DOI) https://doi.org/10.25549/usctheses-c17-549038

Unique identifier UC11353105

Identifier 9720237.pdf (filename),usctheses-c17-549038 (legacy record id)

Legacy Identifier 9720237.pdf

Dmrecord 549038

Document Type Dissertation

Rights Hong, Heng

Type texts

Source University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Access Conditions The author retains rights to his/her dissertation, thesis or other graduate work according to U.S. copyright law. Electronic access is being provided by the USC Libraries in agreement with the au...

Repository Name University of Southern California Digital Library

Repository Location USC Digital Library, University of Southern California, University Park Campus, Los Angeles, California 90089, USA