University of Southern California Dissertations and Theses

Analysis of the function and regulation of the 94kDa glycoprotein of the glucose-regulated protein family.

(USC Thesis Other)

Analysis of the function and regulation of the 94kDa glycoprotein of the glucose-regulated protein family.

PDF

Download

Open document

Flip pages

Download a page range

Download transcript

Copy asset link

Request this asset

Transcript (if available)

Content INFORMATION TO USERS This manuscript has been reproduced from the microfilm master. UMI films the text directly from the original or copy submitted. Thus, some thesis and dissertation copies are in typewriter face, while others may be from any type of computer printer. The quality of this reproduction is dependent upon the quality of the copy submitted. Broken or indistinct print, colored or poor quality illustrations and photographs, print bleedthrough, substandard margins, and improper alignment can adversely affect reproduction. In the unlikely event that the author did not send UMI a complete manuscript and there are missing pages, these will be noted. Also, if unauthorized copyright material had to be removed, a note will indicate the deletion. Oversize materials (e.g., maps, drawings, charts) are reproduced by sectioning the original, beginning at the upper left-hand comer and continuing from left to right in equal sections with small overlaps. Each original is also photographed in one exposure and is included in reduced form at the back of the book. Photographs included in the original manuscript have been reproduced xerographically in this copy. Higher quality 6” x 9” black and white photographic prints are available for any photographs or illustrations appearing in this copy for an additional charge. Contact UMI directly to order. UMI A Bell & Howell Information Company 300 North Zeeb Road, Ann Arbor MI 48106-1346 USA 313/761-4700 800/521-0600 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. R eproduced with permission of the copyright owner. Further reproduction prohibited without permission. Analysis of the Function and Regulation of the 94 kDa Glycoprotein of the Glucose Regulated Protein Family by M eera Ramakrishnan A Dissertation Presented to the FACULTY OF TP£E GRADUATE SCHOOL UNIVERSITY OF SOUTHERN CA LIFO RN IA In Partial Fulfillm ent o f the Requirem ent for the Degree D O CTO R OF PHILOSOPHY (Biochem istry and M olecular Biology) A ugust 1996 Copyright 1996 M eera Ram akrishnan Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. UMI Number: 9705167 UMI Microform 9705167 Copyright 1996, by UMI Company. All rights reserved. This microform edition is protected against unauthorized copying under Title 17, United States Code. UMI 300 North Zeeb Road Ann Arbor, MI 48103 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. UNIVERSITY OF SOUTHERN CALIFORNIA THE GRADUATE SCHOOL UNIVERSITY PARK LOS ANGELES. CALIFORNIA 90007 This dissertation, written by MEERA RAMAKRISHNAN under the direction of 1£L....... Dissertation Committee, and approved by aU its members, has been presented to and accepted by The Graduate School, in partial fulfillment of re quirements for the degree of DOCTOR OF PHILOSOPHY Dean of Graduate Studies Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. DEDICATION To my beloved parents for their love, encouragem ent and prayers. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. ACKNOWLEDGEMENTS I would like to thank my thesis advisor Dr. Am y S. Lee for her advice, guidance and encouragem ent during my w ork on this dissertation project. I would also like to thank my dissertation committee members: Drs. Robert Stellwagen, M ichael Stallcup and Pradip Roy-Burman for their time and insightful comments. I would also like to thank my friends and colleagues in the laboratory. Finally, I w ould like to thank my best friend and husband Shankar Krishnan for his love, support and unending patience. m Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. TABLE OF CONTENTS D ED IC A TIO N .................................................................................................................ii A C K N O W L E D G E M E N T S.......................................................................... iii LIST OF F I G U R E S ....................................................................................... vii LIST OF T A B L E S ...................................................................................................ix A B S T R A C T .................................................................................................................x O V E R V I E W ................................................................................................................. 1 CHAPTER I: G RP94: A M OLECULAR C H A PERO N E IN THE ENDOPLASM IC R E T I C U L U M ............................................................................8 1.1 IN T R O D U C T IO N ..............................................................................................8 1.2 M A TERIA LS AN D M ETHOD S........................................................ 13 1.2.1 Cell line and culture c o n d itio n s.................................................. 13 1.2.3 T ransient cotransfections.............................................................. 15 1.2.4 M easurem ent o f grp94 prom oter activ ities............................... 16 1.2.5 A ssay o f J3-galactosidase a c tiv itie s ............................................ 17 1.3 R E S U L T S ............................................................................................. 17 1.3.1 Transactivation o f the grp94 prom oter by m alfolded protein and glycosylation b lo c k .................................................................... 17 1.3.2 L ocalization o f the grp94 regulatory regions m ediating the effect o f m alfolded proteins and glycosylation block . . 20 1.4 D IS C U S S IO N ....................................................................................... 21 CHAPTER II: DN A-PRO TEIN INTERACTIONS A T THE CORE AND C 1 ELEM ENTS OF THE GRP94 P R O M O T E R ...................................... 31 2.1 IN T R O D U C T IO N ................................................................................. 31 2.2 M A TERIA LS AN D M ETHOD S........................................................ 34 iv Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 2.2.1 Cell lines and culture conditions........................................ 34 2.2.2 C otransfection w ith CTF/NF-1 expression vectors . . . 35 2.2.3 Preparation o f Sim plified Nuclear Extract (SN E). . . . 35 2.2.4 L abeling o f oligonucleotides.............................................. 36 2.2.5 Gel M obility Shift A s s a y s .............................................. 37 2.2.6 U ltra-violet cross-linking E x p e rim e n t............................ 38 2.3 R E S U L T S ............................................................................................. 39 2.3.1 N uclear factors binding to the 94 core elem ent . . . . 39 2.3.2 Factor binding to the 94 core from uninduced and induced K12 nuclear e x t r a c t s ................................................................. 41 2.3.3 N uclear factors binding to the 94 C l e le m e n t............... 42 2.3.4 In vitro C l binding activities in control and induced K12 nuclear e x t r a c t s ................................................................. 45 2.3.5 R adiolabeling o f protein species that form com plexes with 94 C l .......................................................................................... 45 2.3.6 Identification o f the CCAAT factor binding to the 94C1 element 46 2.3.7 C om parison o f the effects o f divalent m etal ions on 94 C l and CBF binding a c tiv itie s .................................................... 48 2.4 D IS C U S S IO N ....................................................................................... 49 CHAPTER III: A SSO CIA TIO N OF GRP94 W ITH A M g2 + DEPENDENT K IN A SE A C T IV IT Y ........................................................ 66 3.1 IN T R O D U C T IO N ................................................................................. 66 3.2 M A TERIA LS AN D M ETH O D S........................................................ 69 3.2.1 Cell line and culture c o n d itio n s........................................ 69 3.2.2 In vivo labeling o f cell e x tr a c ts ........................................ 70 3.2.3 In vitro im m une com plex kinase a s s a y ............................ 70 3.2.4 Phosphoam ino acid a n a ly sis............................................... 72 3.2.5 W estern blot a n a ly s is ........................................................... 73 3.2.6 Staining o f the protein g e l s ............................................... 73 v Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 3.2.7 Subcellular fractionation using discontinuous sucrose gradient 74 3.2.8 C hrom atographic purification o f G R P 9 4 ................................ 74 3.2.9 In situ denaturation/renaturation a s s a y ...................................... 75 3.2.10 Phosphopeptide m a p p i n g ........................................................ 76 3.2.11 A ctivity gel a ssa y .......................................................................... 76 3.3 R E S U L T S ............................................................................................. 77 3.3.1 Phosphorylation o f G RP94 by an associating kinase activity 77 3.3.2 Tight association betw een GRP94 and its kinase activity . 81 3.3.3 GRP94 is phosphorylated at serine r e s i d u e s ......................... 81 3.3.4 The 94-kinase activity is present in enriched E R m em branes 82 3.3.5 The 94-kinase exhibits similarities and differences w ith casein kinase I I ....................................................................................... 83 3.3.6 The 94-kinase activity is distinct from casein kinase II and other com m only know n k in a s e s ........................................................ 84 3.3.7 Inhibition o f the M g2+ dependent 94-kinase activity by Ca2+ 87 3.3.8 The 94-kinase activity is sensitive to heat and denaturation 88 3.3.9 Phosphopeptide m ap o f in vitro phosphorylated G RP94 resem bles in vivo labeled G R P 9 4 ............................................ 90 3.3.10 The 94-kinase activity is stimulated by G RP78/BiP . . 91 3.4 D IS C U S S IO N ....................................................................................... 94 S U M M A R Y .................................................................................................... 117 R E F E R E N C E S ............................................................................................. 123 vi Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. LIST OF FIGURES Figure 1.1 Properties o f the viral glycoprotein from HSV-1 . . . 25 Figure 1.2 The sequence o f the hum an grp94 prom oter......................... 26 Figure 1.3 Activation o f grp94 prom oter by HSV-1 viral glycoprotein and glycosilation b l o c k ................................................................................. 27 Figure 1.4 Regulatory elem ents o f the grp94 prom oter m ediating the induction response to HSV-1 glycoprotein synthesis and glycosilation block...................................................................................................................... 28 Figure 1.5 Model for the grp94 in d u ctio n .................................................. 30 Figure 2.1 Features o f the conserved regulatory elem ents o f the human grp94 and rat grp 78 p ro m o te rs .................................................................... 55 Figure 2.2 Binding specificity o f factors interacting w ith the grp94 core 56 Figure 2.3 Comparison o f the in vitro core binding activities o f grp94 prom oter in control and induced K.12 nuclear e x tr a c ts ........................ 58 Figure 2.4 Effect o f CTF/NF-1 expression on grp94 and grp78 prom oters 59 Figure 2.5 Binding specificity o f com plexes formed w ith grp94 94 C l e le m e n t............................................................................................................... 60 Figure 2.6 Comparison o f the in vitro C l binding activities o f grp94 prom oter in control and induced K12 nuclear e x tr a c ts ........................ 61 Figure 2.7 Ultraviolet cross-linking analysis o f the m olecular sizes o f the factors binding to the 94 C 1 e l e m e n t .......................................... 62 Figure 2.8 Identification o f factors binding to the 94 C 1 elem ent. . 63 Figure 2.9 Effect o f divalent m etal ions on the CBF and 94 C l binding a c t i v i t i e s ......................................................................................................... 64 Figure 2.10 Sequence required for high affinity CBF binding . . . 65 Figure 3.1 Phosphorylation o f G R P 9 4 .......................................... 103 Figure 3.2 Tight association o f 94-kinase w ith G R P94............ 105 Figure 3.3 Phosphoamino acid analysis o f G R P 9 4 .................. 106 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Figure 3.4 Isolation o f ER fraction using discontinuous sucrose gradient 107 Figure 3.5. Com parison o f properties o f the 94-kinase and CKII . . 108 Figure 3.6 A nalysis o f the 94-kinase and CKII activities w ith casein and CKII substrate peptide...................................................................................... 109 Figure 3.7 The effect o f M g2+ and Ca2+ on the 94-kinase activ ity . . I l l Figure 3.8 Sensitivity o f the M g2+ -dependent 94-kinase to denaturing reagents and heat................................................................................................ 112 Figure 3.9 Purification and Phosphopeptide m apping o f GRP94 . . 113 Figure 3.10 Effect o f rG R P78 on the 94-kinase activity . . . . 115 Figure 3.11 Quantitative interpretation o f the rGRP78 effect on 9 4 - k i n a s e ......................................................................................................... 116 V lll Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. LIST OF TABLES Table 2.1 Sequence o f oligonucleotides used in gel m obility shift assay 54 Table 3.1 Properties o f the 9 4 -k in a s e ........................................................ 102 ix Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. ABSTRACT GRP94 is an abundant, 94 kDa glycoprotein in the endoplasmic reticulum (ER). It belongs to the family of stress inducible and ubiquitous proteins known as the glucose regulated proteins or GRPs. GRP94 is coordinately regulated with another ER protein and a member of the GRP family known as GRP78 or BiP. Both these proteins are simultaneously induced with identical kinetics on treatment with a wide variety of agents which cause stress in the ER. GRP78 has been studied extensively and is found to be a molecular chaperone that helps in protein folding and assembly in ER. Recent reports have suggested GRP94 to be another chaperone in the ER that binds to unassembled forms of multimeric proteins and peptides. Through collaborative efforts, we found GRP94 to also associate with a malfolded viral protein from herpes simplex virus-1. GRP94, both in glycosylated and in unglycosylated forms, associates stably with the mutated form of the protein (gBm ) that is retained in the ER. The transient expression of gBm also induced the expression of the GRP94 protein in the cell. This induction was found to be due to the transcriptional activation of the grp94 promoter by the accumulation o f the nonsecretable form of malfolded viral protein in the ER. This effect was similar to that caused by a block in cellular glycosylation which x Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. is a potent inducer of grp94. Further analysis of the promoter revealed two cis- elements, a highly conserved element termed as the core and a CCAAT motif (Cl), present in the immediate upstream region o f TATA element, to mediate this induction in grp94 transcription. Using in vitro DNA-protein binding analysis, these elements were analyzed to search for the nuclear factors binding to them. Both core and C 1 elements formed complexes either unique to grp94 promoter or shared with the core and C 1 elements of the coordinately regulated grp78 promoter. The heteromeric CCAAT-binding protein (CBF) was identified to be one of the components binding to the C 1 element of the grp94 promoter. We found the GRP94 protein to be tightly associated with a Mg2 '- dependent serine kinase activity (termed as 94-kinase). The 94-kinase can be recovered from ER membrane fraction and is able to phosphorylate both the constitutive (glycosylated) and stress-induced (nonglycosylated) forms of GRP94. Analysis using inhibitors and peptide substrates o f many well known kinases has suggested the 94-kinase activity to be novel. Recently, GRP94 was reported to be autophosphorylating kinase with a Mg2 + - and Ca2 + -dependent activity. The 94-kinase shares similarities with the Mg2+ -dependent GRP94 autokinase. Both activities have similar ionic requirement, heat sensitivity, sensitivity to monovalent ion and are activated by histone H I. Further, they were found to utilize ATP as well as GTP as the phosphate donor, a xi Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. characteristic not very common amongst kinases. Phosphopeptide mapping analysis shows that some o f the peptide sites phosphorylated in GRP94 by 94- kinase are identical to those reported for the GRP94 phosphorylated by autophosphorylation. The Mg2 + -dependent 94-kinase activity is inhibited by the presence of increasing concentrations o f Ca2 + in the kinase reaction. The 94- kinase could be physiologically important in view o f the finding that the phosphopeptide maps of GRP94 phosphorylated by the 94-kinase in vitro and the in vivo labeled GRP94 are identical, suggesting similar sites on GRP94 to have been phosphorylated. A further point of interest is the observation that the 94-kinase activity is modulated by GRP78, a protein known to interact with GRP94 in vivo. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. OVERVIEW Glucose regulated proteins (GRPs) were initially identified as proteins which are induced when eukaryotic cells are depleted o f glucose (Shiu et al., 1977). Subsequent studies have shown GRPs to be induced by a wide variety of reagents which disrupt the ER function. These include the glycoyslation blockers like tunicamycin, reducing agents like p-mercaptoethanol, oxidative stress, malfolded proteins, glucose deprivation and agents perturbing Ca2 ~ homeostasis such as the ionophore A23187 and ER Ca2 + / ATPase blocker thapsigargin, (Gomer et al., 1991; Kozutsumi et al., 1988; Lee, 1987; Li et al., 1993; Ramakrishnan et al., 1995; Resendez et al., 1985; Roll et al., 1991; Wooden et al., 1991). Most o f these agents which stress the ER, cause a transcriptional activation o f grp genes in the nucleus. This pathway o f induction o f grps represents a unique example of intracellular signaling where the signal generated in the ER results in the sustained increase in the rate of the transcription of the grp genes in the nucleus. The GRPs, which include GRP94, GRP78, ERp72, GRP58 and calreticulin (Lee, 1981; Lee, 1992; Mazzerella and Green, 1987; Resendez et al., 1985), occur in the endoplasmic reticulum (ER) and have the ER signal 1 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. retention peptide KDEL at their carboxy-termini (Haugejorden et al., 1991; Munro and Pelham, 1986; Pelham, 1989). These are ubiquitous proteins, highly related to another family o f stress proteins known as the heat shock proteins (HSPs) which occur in the cytosol (Watowich and Morimoto. 1988; Wooden and Lee, 1992). Both GRPs and HSPs are found to play an important role of protecting and enhancing the survival chances of mammalian cells under adverse physiologic or metabolic conditions. GRP94, also referred as endoplasmin, ERp99, gp96, hsp 108 or hsplOO. is an acidic protein with a pi of 5.0 to 5.1 (Koch et al., 1986; Lee, 1987; Lewis et al., 1985). It is a major glycoprotein encoded by a single copy gene in mammalian cells (Lee et al., 1983). GRP94 has a native molecular size of 192 kDa with about 50% of the GRP94 protein existing as a homodimer linked by disulphide bonds (Chang et al., 1989). Analysis of the predicted amino acid sequence o f GRP94 shows the presence of (a) an amino-terminal ER signal sequence, (b) two long stretches of acidic amino acids near the carboxy- terminus (c) a number o f potential N-glycosylation sites, only one of which is glycosylated under normal condition (d) a 20 amino acid long hydrophobic region that could serve as a transmembrane domain with less hydrophobic regions scattered all over the protein and (e) the ER retention signal, KDEL (Kang and Welch, 1991; Lee, 1992; Mazzerella and Green, 1987). 9 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. The acidic domains of GRP94 have low affinity but high capacity to bind Ca2+ , for which ER is the major intracellular storage organelle (Koch et al., 1986). GRP94 is also present in sarcoplasmic reticulum o f cardiac and skeletal muscles which are known to contain high levels of Ca2 T (Cala and Jones, 1994). GRP94, in conjunction with other ER Ca2 + binding proteins (Nigam et al., 1994), is suggested to play an important role under conditions that perturb the Ca2 + homeostasis in the cell. GRP94 is also important for cell survival following Ca2 + stress ( Li and Lee, 1991; Little and Lee, 1995). GRP94 also has the unusual property of existing both as a transmembrane and a luminal protein (Kang and Welch, 1991). Owing to the presence of a putative transmembrane domain, it has been suggested that GRP94 spans the ER membrane with its amino terminus present within the ER lumen and a large portion present within the cytosol. At the same time GRP94 has the KDEL retention signal which is a characteristic of proteins in the ER lumen. The topology of GRP94 has been ascertained using the usual biochemical analysis. By using limited proteolysis and labeling with lactoperoxidase mediated iodination, GRP94 was categorized as a transmembrane protein. However, following the sodium carbonate extraction, where all the luminal proteins of ER partition into the soluble phase and most integral membrane proteins are left behind as the insoluble pellet. GRP94 fractionated within both the soluble and Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. insoluble phases (Kang and Welch, 1991). This suggested that the protein behaves both as a luminal and an integral membrane protein. Finally, an explanation for this unusual behavior o f GRP94 was provided by the identification of two pause-transfer regions in its amino acid sequence (Qu et al., 1994). Proteins having the pause-transfer regions are not cotranslationaly translocated, but are found to pause while translocating through the ER membrane (Chuck et al., 1992). Thus an ER fraction isolated at any point will have some of the GRP94 proteins which have paused in the membrane and some which have already translocated into the lumen. Inspite o f the characterization o f all these physical properties of GRP94, its cellular function was not well known until recently. The goal o f my dissertation work was to elucidate the functional importance of the GRP94 glycoprotein and to further understand the regulation of its promoter in response to stress inducing agents. GRP94 is now a well established molecular chaperone that complexes with unfolded, underglycosylated and malfolded proteins. In the ER, GRP78 and GRP94 act in tandem on folding intermediates of the newly synthesized immunoglobulin chains (Melnick et al., 1994). GRP94 is also reported to be involved in peptide loading of MHC class I for antigen presentation and provides tumor specific immunogenecity (Li and Srivatsava, 1993, Suto and Srivastava, 1996). GRP94 also associates with actin filaments (Koyasu et al.. 4 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 1989). In a rat colon carcinoma model, enhanced expression of GRP94 caused increased tumorigenicity (Menoret et al., 1994). The importance o f GRP94 function was also realized by generation of mammalian cell lines deficient in GRP94 stress induction (Little and Lee, 1995). The tool used to modulate the GRP94 expression was a ribozyme, which is a small catalytic RNA that cleaves the phosphodiester bond in the target mRNA (Koizumi et al., 1988; Little and Lee, 1995). A stable cell line expressing ribozyme targeted against grp94 showed increased sensitivity to stress caused by Ca2 + -depleting agents like A23187 and thapsigargin, and the secretion of proteins out of ER was also affected (Little and Lee, 1995). I have studied the ability of GRP94 to function as a chaperone following accumulation of malfolded viral protein in the ER. Presence of the malfolded protein in the ER caused an increase in the expression of GRP94. To explain this induction I have analyzed the grp94 promoter to see if the effect was at the transcriptional level and compared this to the effect o f blocking glycosylation, a potent inducer of grps. I also tried to define the regulatory cis-elements of the grp94 promoter and the nuclear factors that bind to them to mediate the stress response following malfolded protein accumulation and blocks in glycosylation. I have found GRP94 to be tightly associated with a Mg2 + -dependent serine kinase activity (94-kinase). GRP94 shares 50% amino acid sequence 5 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. identity with the 90 kDa member (HSP90) o f the cytosolic heat shock protein family ( Koch et al., 1986; Mazzerella and Green, 1987). HSP90 is an ATP- binding protein, reported to have a Ca2 + -dependent autophosphorylation activity, and is also known to associate with many serine/threonine and tyrosine kinases (Csermely and Kahn, 1991). GRP94 also has two consensus ATP- binding domains and was shown to bind ATP, using azido-ATP labeling (Li and Srivatsava, 1993; Nigam et al., 1994). It was therefore interesting to find a kinase activity associated with GRP94, similar to the case with HSP90. The 94- kinase I have been studying phosphorylates GRP94 most efficiently and this seems to be the best substrate so far. The 94-kinase also phosphorylates both the control (glycosylated) and stress induced (nonglycosylated) forms of GRP94. Using multiple inhibitors, substrates, and activator of known kinases, I have concluded that the 94-kinase is a novel activity. The 94-kinase shares similarities with the recently reported Mg2 + -dependent autophosphorylation activity of GRP94 (Csermely et al., 1995). Under our assay conditions (using GRP94 in nanogram amount) the 94-kinase activity is inactive or below the detection limit in the presence of Ca2 ~ . Furthermore Ca2t is inhibitory to the Mg2 + -dependent 94-kinase activity. The 94-kinase displays some interesting properties which could be physiologically significant. Firstly, the peptide sites phosphorylated in GRP94 6 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. in vivo were identical to the sites phosphorylated in GRP94 by the 94-kinase in vitro. Also, the finding that the GRP94 phosphorylation is activated by recombinant GRP78 is interesting as these two proteins are known to interact in vivo. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. CHAPTER I: GRP94: A MOLECULAR CHAPERONE IN THE ENDOPLASMIC RETICULUM l.I IN TRO DUC TIO N The complex phenomenon o f protein folding in the cell occurs very efficiently with >95% of the newly synthesized polypetides eventually attaining their native three-dimensional structures. Polypeptide misfolding and aggregation, which occur when proteins are folded in vitro, rarely occur in vivo. except under conditions o f stress in the cell. Under normal conditions two classes of proteins have been identified to be involved in polypeptide folding and assembly in the cell (Gething and Sambrook, 1992; Rothman, 1989). The first class includes enzymes like protein disulfide isomerase (PDI) which catalyze specific isomerization steps and help to increase the rate of folding. The second class of proteins, termed chaperones, stabilizes the unfolded or partially folded polypeptide structures, thereby preventing the formation of inappropriate intra- and inter- chain interactions. Chaperones also play a major role under conditions of stress in the cell which result in denaturation or unfolding of polypeptides. The chaperone binds to the interactive surface of the unfolded protein, preventing aggregation of proteins until favorable conditions for correct folding return (Gething and Sambrook, 1992). GRP78, also known 8 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. as BiP or heavy chain binding protein, is the most extensively studied chaperone in the ER. Although, it was originally discovered as a protein that binds to immunoglobulin heavy chains, it has become apparent that the repertoire of proteins to which GRP78 can bind is much broader (Gething et al., 1986; Nakaki et al., 1989). GRP78 is now known to be involved in protein translocation into ER, protein folding and assembly and in protein secretion from ER (Hendershot, 1990; Lee, A.S., 1992; Sanders etal., 1992), although the exact mechanism of its interaction with the target proteins is still unknown. Abnormal and misfolded proteins bind very stably with GRP78 and as a consequence are retained in the ER (Gething et al, 1986; Nakaki et al, 1989; Ng et al., 1990). Recent reports have suggested GRP94, another major protein in ER to have protein binding activity. The identification of ATP binding sites and an inherent ATPase activity in GRP94 (Li and Srivatsava, 1993) adds support to the suggestion of its role as a chaperone, since the chaperone function is thought to be ATP dependent. GRP94 along with ERp72, another ER resident protein, binds to the human class II major histocompatibility DR molecules (HLA-DR) in the absence of the invariant chain, which is a molecule that binds to HLA-DR soon after its synthesis (Schaiff et al., 1992). This binding of invariant chain to HLA-DR helps to prevent the class II molecule from exiting the ER with endogenous 9 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. peptides in their peptide binding cleft, and therefore minimizes the chance of autoimmune response to endogenously processed self peptides. GRP94 has been shown to associate with a wide variety of peptides and is actually involved in the peptide loading of the MHC class I complex for antigen presentation (Li and Srivatsava, 1993). GRP94 along with GRP78 is also involved in immunoglobulin assembly. Both these GRP members are found complexed to the unassembled immunoglobulin heavy and light chain folding intermediates (Melnick et al., 1992). Interestingly, this function is biochemically, kinetically and structurally very different for GRP78 and GRP94 (Melnick et al., 1994). While GRP78 is found to be complexed transiently with the early protein intermediates of folding pathway, GRP94 is found to bind more stably to the oxidized and mature forms of polypeptides. This finding also suggests that the multiple chaperones in the ER may not simply be functionally redundant. Through a collaborative work (Drs L. Pereira and S. Tugizov, UCSF), we found GRP94 to associate tightly with a malfolded viral envelope protein from herpes simplex virus type-1, but no such binding was observed with the wild type protein, from which the mutant was derived (Ramakrishnan et al., 1995). Interestingly, the GRP94 expression was elevated in cells where the malfolded proteins were expressed. 10 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Under normal conditions GRP94 and GRP78 are constitutively expressed in many different tissues and cell types (Lee, 1987; Lee, 1992). When the ER is stressed, both grp94 and grp78 genes are transactivated simultaneously with identical kinetics (Lee, 1987; Liu and Lee, 1991). Although the pathway of activation is not known, a majority of the stress conditions which induce grps are found to cause an increased accumulation of underglycosylated or malfolded proteins in the ER. These proteins are hypothesized to serve as a primary trigger for the signaling from ER to nucleus and have also been shown to cause induction of GRP level (Kozutsumi et al., 1988; Wooden et al., 1991). I have focused on the mechanism o f induction of GRP94 expression following accumulation o f a mutant protein (gBm ) derived from herpes simplex virus type 1 in the ER (Ramakrishnan et al., 1995). The HSV-1 glycoprotein (gB) is an envelope protein which is required for the virion infectivity (Norrild, 1980) and promotes fusion of the virion envelope with the cell membrane (Sarmiento et al., 1979). The mutant protein was derived by insertion of four amino acids at the ectodomain of the wild type protein (gB'v t). When expressed in COS-1 cells, the mutant protein (gBm ) was very sensitive to endogiycosidase and was not detected on the cell surface by immunoflouresence, suggesting that it is not transported beyond the ER (Norrild et al., 1980). The K12 cell system was used for all the analysis described in this chapter I. K12 cells are a well- 11 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. defined temperature sensitive (t.s) mutant line in which the transfer of oligosaccharide cores to proteins is blocked at the nonpermissive temperature (39.5°C) in ER (Lee, 1981). Since block in glycosylation is a very potent and well established inducer o f grps, I was able to compare the effects of glycosylation block versus the effects of malfolded proteins using the K12 cell system. I have analyzed the effect of gBm on grp94 promoter to check if the elevation in GRP94 expression was due to transcriptional activation. The human grp94 promoter fragment fused to a CAT reporter was used for this analysis. The human grp94 promoter contains several putative sites for eukaryotic transcription factors, such as Sp I and Ap2, has six CCAAT sequences, with five of them in an inverted orientation and also contains a highly conserved region referred to as the core element, within 300 nucleotides o f its 5' flanking sequence (Fig. 1.2). A previous study has shown that a 386 bp fragment (spanning -357 to +29) o f the grp94 promoter contains the regulatory elements required for basal level expression, as well as all of the elements required for induction under stress conditions (Chang et al., 1989). The expression of conformationally defective glycoprotein (gBm ) was found to activate the transcription of this grp94 promoter fragment (94 (-357)CAT). The effect of gBm on the grp promoter was found to be a very selective. 12 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. The conformation defective protein gBm has also been shown to transactivate the grp78 promoter. This effect was found to be mediated through two cis-elements, a conserved element termed as core and a CCAAT motif that occurs proximal to the TATA box o f the grp78 promoter. GRP78 is coregulated with GRP94, both at the transcriptional and at the protein level (Chang et al., 1989; Li and Lee, 1991; Liu and Lee, 1991; Li et al., 1992). The promoter elements are also highly conserved between these grp genes (Chang et al., 1989; Liu and Lee, 1991). In the grp94 promoter, using a combination of DNase I footprinting and 5' deletion analyses, the core region spanning -195 to -168, has been shown to contribute to promoter’s basal level expression and partial inducibility by the calcium ionophore A23187 and K12 t.s. glycosylation block (Chang et a l, 1989). I have used deletion and linker scanning mutants of grp94 promoter to ascertain if the core and the inverted CCAAT motif (C l) most proximal to TATA element of the grp94 promoter are important in mediating the induction response to malfolded proteins and glycosylation block. 1.2 M ATERIALS AND M ETH O DS 1.2.1 Cell line and culture conditions The temperature sensitive (t.s.) mutant cell line K12 is derived from the parental Chinese hamster lung fibroblast line W glA (Resendez et al., 1985). K12 cells are maintained in Dulbecco’s modified eagle’s medium (GIBCO 13 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Laboratories) supplemented with 10% cadet calf serum. These cells grow o ° normally at 35 C while shifting them to a higher temperature (39.5 C) results in the expression of the mutant phenotype. 1.2.2 Plasmid constructs The eukaryotic expression vector pMT2 containing the adenovirus major late promoter, the SV40 origin and both the tetracycline and ampicillin resistance genes was used to express the HSV-1 protein gB. While plasmid pRB9221 expressed the wild-type HSV-1 gB (gB% v t ), plasmid pSB479 expressed the mutated form gB (gBm ) and was constructed by insertion mutagenesis (Qadri et al., 1991). The chloroamphenicol acetyltranferase (CAT) gene fusion constructs (-357)CAT and (-164)CAT have fragments of the human grp94 5' region (BamHl-BamHl fragment from -357 to +29 and BstEII-BamHI fragment from (-164 to +29) subcloned into a unique Hindlll site of pSVOCAT (Chang et al., 1989). The pGRP94 (-219)CAT construct was generated by digestion of pGRP94 (-357)CAT with Ndel and BstXI, followed by religation o f the vector. The linker-scanning (LS) mutant o f the grp94 promoter p94LS75CAT was constructed by oligonucleotide-directed mutagenesis. LS primers were synthesized with an 8-nucleotide mutation flanked by the wild-type grp94 sequence. The two LS primers had an overlap region 10 base pairs (bp) long. LS 14 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. primer 5’ CCtgtcgactCGCCGCACCACGCAC-3? (lower case denotes mutated sequence) and an upstream CAT primer (Wooden et al., 1991) were used with pGRP94 (-357) CAT as template to amplify a 200-bp region of the promoter by polymerase chain reaction (PCR). By using LS primer 5r-CGagtcgacaGGGTT CATGTTCCC 3’ and a CAT 22-nucleotide oligonucleotide primer (Wooden et al., 1991), a 300-bp region was similarly amplified. The two amplified fragments were then mixed together and reannealed, generating a template where the CCAAT site contained within -18 to -71 was mutated and was flanked by the wild-type promoter sequence. Using this as template and the CAT and reverse CAT primers, we amplified a 500-bp region in which the grp94 C 1 CCAAT motif was mutated. This fragment was cloned into the Hind III site of the pSVOCAT vector as previously described (Resendez et al., 1985). The 94 C 1 mutation and orientation were confirmed by restriction mapping with the Sal 1 site introduced in the mutated sequence. 1.2.3 Transient cotransfections In these transfection experiments, 10 pg o f the grp-promoter/CAT fusion plasmids were co-transfected with 5 pg of either pMT2, pSB479 or pRB9221 per dish using the calcium phosphate precipitation method. In each transfection mixture, 3 pg of HeLa carrier DNA was added. Cells were shocked with 15% glycerol for 4 h following transfection, to optimize for the transfection 15 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. efficiency. The cell extracts were harvested 40 h after transfection. Sixteen h prior to harvesting, the transfectants were all changed to fresh medium and were either incubated at 35°C or shifted to 39.5°C for the K12 t.s. mutation effect. Each construct was transfected 4 to 5 times independently and each transfection was performed in duplicate sets. In some experiments, 3 jig of pCHllO, containing the bacterial (5-gaIactosidase gene driven by SV40 promoter was also cotransfected and served as an internal control for transfection efficiency (Hall etaL 1983). 1.2.4 Measurement of grp94 promoter activities Following the harvest o f the cells 48 h after transfection the whole cell extract was prepared by freezing and thawing the cells in a hypotonic buffer containing 0.25 M Tris-HCl (pH 7.8). The protein concentration of the cell extract was measured using the biorad protein assay reagent (Biorad Laboratories, Richmond, CA). CAT assays was performed using 10-50 fig of protein for I h at 37°C (Resendez et al., 1985). In experiments where (3 - galactosidase was also cotransfected, equal enzyme units were used for the CAT assay. The CAT activities were assessed within the linear range of the assay and the percentage of chloramphenicol conversion was obtained by an AMBIS Radioanalytic Imaging System (Ambis Systems, San Diego, CA). 16 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 1.2.5 Assay of P-galactosidase activities Extracts from cells co-transfected with pCHllO were assayed for (J- galactosidase activity as described before (Sambrook et al., 1989) with the following modifications. Equal amounts of extract (— 15 pg) were adjusted to 200 pi (with 0.25M Tris, pH 7.8). Each sample was mixed with 500 pi of solution A (60 mM NaH7P 0 4, 10 mM KC1, 1 mM MgCE, 50 mM p- mercaptoethanol) and 100 pi of ONPG solution (60 mM NajHPO^ 40 mM NaH7P 0 4, 2 mg/ml o-nitrophenyl-/?-D-gaIactopyranoside). The samples were incubated for 20 min at 37°C, until a yellow color appeared after which the reaction was stopped by addition of 500 pi of 1 M Na2C C >3. The OD4 2 0 readings were measured. Equal (3-gaIactosidase units were used for the CAT assays. 1.3 RESULTS 1.3.1 Transactivation of the grp94 promoter by malfolded protein and glycosylation block Recent studies have shown GRP94 to have protein binding activity, and to interact with many unassembled proteins in the ER, an important characteristics of molecular chaperones. Our collaborative work (Ramakrishnan et al., 1995) has determined the ability o f GRP94 to bind with a malfolded viral protein that is trapped in the ER. The HSV-1 gB is a 874 amino acid long 17 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. glycoprotein in the virion envelope that functions in virion penetration and fusion to the host cells (Sarmiento et al., 1979; Navarro et al., 1992). HSV-1 gB contains a hydrophilic ectodomain having six potential N-linked glycosylation sites, a hydrophobic transmembrane domain, and a charged intracellular carboxy terminus (Pellett et al., 1985). When transiently expressed in COS-1 cells, the wild type HSV-1 gB (termed gB'v t) folds and oligomerizes well and can be detected on the cell surface by immunohistochemical staining using mAbs to the native protein ( Fig. 1.1; Pereira et al., 1989; Navarro et al., 1991). Insertion of four amino acids (Gly-Asp-Leu-Pro) at position 479 of this viral protein gave rise to a mutant form (gB-LK479), where the protein (gBm ) oligomerizes but is unable to attain the wild type conformation. Instead of exiting to the cell surface, gBm was no longer recognizable by the subset of antibodies against the native protein and was arrested in the ER (Fig. 1.1). To study this association of the viral proteins with GRP94, hamster fibroblast cells (K 12 t.s.) were transiently transfected with the expression plasmids for the production of gBw t or gBm ( Qadri et al., 1991). Total cell lysate prepared from the transfected cells labeled with [j5S]methionine were then immunoprecipitated with antibodies specific to HSV-1 gB. GRP94 did not coprecipitate with gBM protein however, a pool of mAbs against gBm coimmunoprecipitated a 94 kDa protein that was confirmed to be GRP94 by a 18 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. western blot analysis using specific anti-GRP94 antibodies. This experiment suggested a preferential and stable binding of GRP94 to the malfolded protein which is unable to exit ER; in contrast, the binding to wild type proteins fold correctly and exit to the cell surface. Interestingly, the transient expression of the mutant viral protein was observed to elicit an induction in GRP94 expression (Ramakrishnan et al., 1995). I have analyzed the grp94 promoter to check if the GRP94 induction observed is due to a transcriptional activation. The hamster fibroblast cell line (K12) was cotransfected with expression plasmids for the HSV-l glycoprotein and grp94 promoter linked to CAT reporter gene. In the human grp94 promoter a region with the 5' sequence up to -357 contains the sequence required for basal level expression and inducibility (Fig. 1.2; Chang et al., 1989). I have tested the effect of gBm and glycosylation block on this grp94 promoter fragment. Transient expression of the mutant protein (gBm ) caused a transcriptional activation o f the grp94 promoter by 4 to 5 fold (Fig. 1.3 A), while the cotransfection o f the vector alone, used to express gB, has no effect on the promoter (MT2, Fig. 1.3 A). The grp94 promoter was also induced 5-fold when the glycosylation is blocked in K12 cells (MT2 + t.s., Fig. 1.3 A). Simultaneous induction with malfolded protein and glycosylation block did not result in a synergistic activation of the promoter (gBm + t.s. Fig. 1.3 A). This 19 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. observation suggests that these two grp inducers probably have a common mechanism o f promoter activation. Further, it was important to find if this gBm mediated induction of grp94 was a selective effect. For this, I cotransfected the pSV2CAT plasmid containing the SV40 promoter fused to a CAT reporter, instead o f the grp promoter, along with gBm . Unlike the case of grp94 promoter, the mutant viral protein gBm had no effect on the SV40 promoter (Fig. 1.3 B). 1.3.2 Localization of the grp94 regulatory regions important for activation of the promoter following synthesis of malfolded proteins and glycosylation block Both grp94 and grp78 promoters have multiple CCAAT elements and a highly conserved region termed as core. The important regions in the grp78 promoter which mediate the effects of malfolded protein and effects of A23187 and glycosylation block have been identified as the core region and a CCAAT element proximal to the transcription initiation site (Wooden et al., 1991; Li et al., 1993). I therefore, analyzed the importance of the core (spanning -195 to - 168) and Cl CCAAT element (around -75) o f the grp94 promoter (Fig. 1.4 A), following stress caused by accumulation o f malfolded protein and glycosylation block. Three grp94 promoter constructs were tested in cotransfection experiments ( Fig. 1.4 B). These are (i) 94 (-219) CAT which contains both the core and C l, (ii) in 94 (-164) CAT, a deletion mutant which retains the C l. but 20 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. has a 54 bp region containing the core element deleted, and (iii) LS 75 CAT, a linker scanning mutant which is identical to the 94 (-357) CAT promoter except for a 8-bp region spanning the C l element which is mutated. K.12 cells were transfected with either MT2, gBw t, or gBm in addition to the respective CAT constructs. The expression vector for (3-gaIactosidase was cotransfected in some of these experiments to normalize for transfection efficiency. The relative CAT activities of cells blocked in protein glycosylation by the K.12 ts mutation were measured and summarized (Fig. 1.4 C). Mutation of either core or C l caused a significant loss o f promoter inducibility. The fold induction by gBM and gBm as measured by the CAT activities in relation to MT2 was quantitated and summarized in Fig. 1.4 D. After normalization for transfection efficiency the fold induction o f 94(-357) CAT was about 13-fold. Elimination of core or Cl reduced the gBm induction to 5- and 3-fold respectively. Expression of gBv v t caused a slight increase in the grp94 promoter activity. This analysis showed that similar cis-elements on the grp94 promoter are mediating the stress response to gBm and glycosylation block. 1.4 DISCUSSIO N Proteins belonging to the molecular chaperone family with affinities for nascent and abnormal proteins provide important information about the process of protein targeting across membranes and about assembly, oligomerization and 21 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. secretion of proteins to cell surface (Deshaies et al., 1988). A wide spectrum of stress conditions both in ER and in cytosol cause the production of unfolded and malfolded proteins. The chaperones play an important role here by binding to these proteins, preventing their aggregation and also probably helping to clear the abnormal proteins from ER. GRP78 is one o f the better characterized chaperone that has been shown to bind with many different cellular and viral proteins in the ER, although the mechanism of their interaction is not known. GRP94 has been discovered to be a major glycoprotein in the ER with ability to bind Ca2 + and as a protein whose expression is induced following stress. The important physiological functions of GRP94 have started to be determined only in the last few years. Recent evidence suggests that GRP94 is another chaperone in the ER. However, the functions of the two ER chaperones GRP94 and GRP78 might be unique rather than redundant (Melnick et al., 1994). Since a majority o f proteins stably associating with GRP94 are membrane proteins and GRP94 itself is thought to be an integral membrane protein (Kang and Welch, 1991), it is tempting to speculate that GRP94 has higher affinity for membrane proteins than other ER chaperones that are luminal. To resolve this issue more protein targets capable of interacting with GRP94 have to be identified. 22 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. GRP94 is found to stably associate with the mutated viral protein ( gBm ), that is unable to exit the ER (Ramakrishnan et al., 1995). The fully processed viral protein gBv v t which is secreted to the cell surface did not associate with GRP94. In contrast to GRP78. where only dephosphorylated molecules are found in complexes with unfolded or unassembled proteins (Hendershot et al., 1988, Freiden et al., 1992), both the glycosylated and unglycosylated GRP94 were capable o f complexing with the malfolded protein (Ramakrishnan et al., 1995). I have analyzed the grp94 promoter to see if it is sensitive to the accumulation of gBm in the ER. I also compared the grp94 promoter transactivation by gBm with that caused by glycosylation block, a well established inducer o f GRPs The conformation defective HSV-1 protein (gBm ) is found to selectively transactivate the grp94 promoter. The slight transactivation of the promoter with gB'rt could be due to the fact that over-expression o f this viral proteins probably requires more chaperoning activity for its processing. The promoter induction by gBm is comparable to that following glycosylation block, a well studied inducer of GRPs. We find that the simultaneous induction of grp94 promoter with gBm and glycosylation block is not additive and that these two agents mediate the activation through common cis-regulatory elements. So, probably Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. these inducers of grp94 activate the same signal cascade from ER to nucleus or that their activated pathways merge before they affect the promoter. The highly conserved core region and the proximal CCAAT element of the grp94 promoter were found to mediate the transcriptional activation of the promoter by gBm and glycosylation block. When either one of the promoter elements was mutated, it caused a dramatic effect on the induction response. This suggests that the upstream accessory proteins binding to the core probably act in concert with the CCAAT binding factor (at -75) to cause induced expression of grp94 (Fig. 1.5). Further, since now we know that the grp94 and grp78 promoters utilize similar cis-regulatory elements (core and C l) to mediate the transactivation of the promoter in response to glycosylation block and malfolded proteins it raises an interesting question as to whether this mechanism o f induction is general among other grp family members and genes encoding for other ER proteins, particularly those responding to similar ER stress as GRPs. 24 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. AdMLp Start TM Stop PolyA HSV-1 gB = = — T~i fBM I nm= I ---------------- gBM----------------- 1 Stop PolyA zni m= B Conformation Localization Binding to GRP94 . . Normal (gB'vt) Cell Surface - Abnormal (gBm ) Endoplasmic Reticulum + Fig. 1.1 Properties of the viral glycoprotein from HSV-1. (A) Schematic diagrams of the plasmid used for the expression of HSV-1 gB (gB'u) and gB-(Lk479) (gBm ) with a 4 amino acid linker insertion. The locations of AdMLp (adenovirus major late promoter), start site for translation, transmembrane domain (TM) of gB, the stop codon and poly A addition signal are indicated. (B) Description of the properties of gB% v t and gBm and their ability to bind with GRP94. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. AdMLp gB-(Lk479) -357 Y -299 TAGGATCCGG AAGTAGTTCC GCCGCGACCT CTCTAAAAGG ATGGATGTGT TCTCTGCTTA CATTCATTGG -229 ACGTTTTCCC TTAGAGGCCA AGGCGCCAGG AAAGGGCGTC CCACGTGTGA GGGGCCCGCG GAGCCATTTG -219 -164 T ^ ---------------------------------] r l TTGGAGAAA a g c t g c a a a c c c t g a c c a a t c g g a a g g a g c c a c g c t t c g g GCATCGG1 A -89 ACAGCTCCGA TTGGTGGACT TCCGCCCCCC CTCACGAATC CTCQTTGGGT GCCGTGGGTG CGTGGTGCGG CGCGATTGGT GGGTTCATGT TTCCCGTCCC CCGCCCGCGG GAAGTGGGGG TGAAAAGCGG CCCGACCTGC TTGCGGTGTA GTGGCGGACC GCGCGGCTGG AGGTGTGAGG Fig 1.2 The sequence of the human grp94 promoter. Nucleotide bases are numbered with the transcriptional initiation site ( ) set at +1. The 5' positions of the various grp94-CAT fusion constructs that were analyzed are indicated by arrows. Symbols : ^—-s , CCAAT ; v . > , reverse CCAAT ; ^ ,Ap2-binding site ; ^ , putative Spl-binding site. The TATA or the goldberg-hogness box is shown as the shaded rectangle region. The linker scanning mutant used is at -75. shown as a shaded ellipse. The bracketed region contains the conserved core region. 26 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 94<-3s 7K :AT PSV2CAT r l.s MT2 gB lu 3Ac ► I Ac ^ Fig. 1.3 Activation of grp94 promoter by HSV-1 viral glycoprotein and glycosylation block. (A) The test plasmid grp94 (-357)CAT was cotransfected with plasmid vector pMT2 (MT2) or with the expression vector coding for gBm (mutant form). The transfected cells were maintained at 35 °C. Sixteen hours prior to harvesting, the medium was changed and some K12 cells were shifted to 39.5 °C (MT2 + t.s., gBm + t.s.). (B) The test plasmid pSV2CAT containing the SV40 promoter was cotransfected with MT2 or gBm . In each set, equal amounts of protein wee used in CAT assays. The autoradiograms are shown. The positions of acetylated (3Ac and lAc) and nonacetylated chloroamphenicol (Cm) are indicated. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 27 Fig. 1.4 Regulatory elements of the grp94 promoter mediating the induction response to HSV-1 glycoprotein synthesis and glycosylation block. (A) Features of the human grp94 promoter is shown. (B) Schematic drawings of the 5' deletion mutants of the grp94 promoter/CAT fusion genes and grp94 LS75CAT. which has a linker scanning mutation at the 94 Cl element are shown. Their 5' end points are also indicated. (C) Relative CAT activities of extracts from K12 cell transiently transfected with the grp94 promoter/CAT fusion genes shown in B. Cells were either untreated (basal level) or subjected to glycosylation block by K12 t.s. mutation. The basal level for grp94 (-357)CAT was set at 100. (D) The fold induction was measured by the ratio of the CAT activities in cell cotransfected with the grp94 promoter/CAT fusion genes with either gBM or gBm to the activities of cells cotransfected with the expression vector MT2. The CAT activities were determined after normalization for transfection efficiency with p-galactosidase activity. The CAT activity in the MT2 sample was set as 1 . 28 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. w * £ ► = & C D 5 03 03 □ □ ■ — . 1 * ---------- -------------1 ---------- -------------- 1 ------------------------ 1 . — —. i o id o C M O 03 O (0 O C O uoijonpuj p to j C 0 o o to o o C O o o CM o © o > ft u 0 1 o C O ,o C O 05 C M fS 2 O ^r 05 o o 05 O • O O O CM O O t 09 H H 1- < < < O O o r - 05 I C 5 C O C O C M T — s i . ■ W ' r r M " 05 05 05 Q . 0 . C L K c e oc C D C D C D Q . Q . C L t < o in h - C /D - J 05 Q . 29 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. TATA Fig. 1.5 Model for the grp94 induction. The factors binding to the core region (spanning -195 to -168) of the promoter interacts with the CCAAT factor binding at the Cl element proximal to the TATA box, to activate the transcription intiation of the grp94 promoter. 30 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. CHAPTER II: DNA-PROTEIN INTERACTIONS AT THE CORE AND C l ELEMENTS OF THE GRP94 PROMOTER 2.1 IN TRO DUC TIO N The GRP gene system provides a unique model for studying coordinate gene expression o f a set of ER protein genes. The well studied ubiquitous GRP family members, GRP78 and GRP94 are expressed constitutively at a basal level under normal growth conditions in many different tissues and cell types (Resendez et al., 1985). Both the genes are transcriptionally activated and coordinately induced with identical kinetics under a variety of stress conditions (Chang et al., 1989; Lee, 1987; Liu and Lee, 1991). Inducers o f GRPs include malfolded proteins, glycosylation blockers, agents causing the depletion of the ER Ca2 + stores and reducing agents (Gomer et al., 1991; Kozutsumi et al., 1988; Lee, 1987; Li et al., 1993; Ramakrishnan et al., 1995; Wooden et al., 1991). The grp promoters have unique characteristics in that they contain a large number of CCAAT and CCAAT-like elements flanked by GC-rich motifs (Chang et al., 1989; Wooden et al., 1991). Using DNasel footprint, deletion and site-directed mutagenesis approaches, promoter elements of grp94 and grp78 31 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. which are required for their basal and induced expression have been ascertained (Chang et al., 1989; Li et al., 1993; Liu and Lee 1991; Ramakrishnan et al., 1995; Wooden et al., 1991). For both grp78 and grp94 promoters two very crucial elements, the core and a CCAAT motif, out of the multiple array of regulatory elements are found to be very important for stress inducibility (Wooden et al., 1991; Ramakrishnan et al., 1995). The core element is highly conserved among GRP promoters from many species, including S. Cervesiae, C. elegans, chick, rat and human (Fig. 2.2C; Chang et al., 1989; Mori et al., 1992; Resendez et al., 1988). The importance of the grp core element has also been implied from many different analyses, (i) Stable integration and amplification o f the core in CHO cells coordinately down regulated the endogenous grp gene expression (Li and Lee, 1991). (ii) The grp core element also confers partial stress inducibility to a heterologous promoter (Lee et al.. 1993). (iii) Interestingly, using in vivo genomic footprinting, the grp78 core was found to undergo specific changes in factor occupancy when the cells were stressed (Li et al., 1994). These changes occurred within a cluster of bases located in the 3’ half of the grp78 core region and could be responsible for the elevation in grp expression following stress. The important CCAAT element (Cl) o f the grp94 promoter occurs in the immediate upstream of the TATA box, in a reverse orientation. In the past, CCAAT binding factors which consist of 32 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. many different families o f proteins, have been implicated in gene regulation. For instance the CCAAT/enhancer factor (C/EBP), regulates the genes involved in gluconeogenesis (McKnight et al., 1989). Using DNasel footprinting, several of the CCAAT motifs o f the grp78 promoter were found to be protected and some of them are found to be important for the promoter regulation. (Roy and Lee, 1994; Wooden etal., 1991). In order to clearly understand the mechanism of activation and regulation o f grp94 gene, it is essential to identify the nuclear factors interacting with important regulatory cis-elements, the core and C l, of its promoter. Further, although grp94 is coordinately regulated with grp78 under a majority o f stress condition, it has some subtle differences from grp78. The basal level activity of grp94 promoter is weaker than that of the grp78 promoter in unstressed cells. In response to stress-inducing reagents like A23187 and thapsigargin, the grp78 transcription in is enhanced 20-fold whereas the grp94 response is only around 5-fold (Resendez et al., 1986; Drummond et al., 1987: Li et al., 1993). Brefeldin A, a reagent which perturbs ER, specifically induces grp78 but not grp94 transcription in hamster fibroblast (Liu et al., 1992). Comparison o f the grp94 regulatory elements highlights some notable differences with the grp78 promoter, such as the presence of an atypical GTGAA element in the upstream of its cap site, instead of a canonical TATA element found in grp78 promoter. 33 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Also, most of the CCAAT elements o f grp94 promoter are in an inverted orientation. In this chapter, I have looked at the factors binding to the grp94 core and Cl elements in vitro and compared this to the binding activities of similar elements of the grp78 promoter to address the issues that I have mentioned earlier. This analysis would also help us to look for binding activities unique to grp94, that when characterized would be useful in specific modulation o f the grp94 expression. 2.2 M ATERIALS AND M ETHO DS 2.2.1 Cell lines and culture conditions K12 cells are maintained in Dulbecco’s modified eagle’s medium (GIBCO Laboratories) supplemented with 10% cadet calf serum. These cells o o grow normally at 35 C while shifting them to a higher temperature (39.5 C) results in the expression of its mutant phenotype (Resendez et al., 1985). The schneider cell line, SL-2, is a late embroynic cell line from drosophila melanogester (Schneider, 1972). It is maintained at 27°C in schneiders modified drosophila medium containing lx penicillin-streptomycin and supplemented with 10% fetal calf serum and 2 mM glutamine. 34 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 2.2.2 Cotransfection with CTF/NF-1 expression vectors The transfection conditions o f SL-2 have been well described (Di Nocera and David 1983). SL-2 cells were plated on the day o f transfection in 6-cm dishes at a density of 10? cells per 5 ml of medium. Aliquots of 300 pi of 0.25 M CaCl2, containing 5 pg of test plasmid DNA and 15 pg o f expression plasmid were added drop wise to an equal volume o f 2x IBS [275 mM NaCl, 10 mM KC1, 1.5 mM NaHP04, 0.22% glucose, and 45 mM Hepes (N-2- hydroxyethylpiperezine-N’-2-ethanesulfonic acid) pH 7.1] with aeration. No Hela Carrier DNA was used. The CaCL-IBS solution was allowed to stand for 10 h at RT. Aliquots of 600 pi were added directly to the SL-2 culture. The cells were harvested 48 h after transfection. 2.2.3 Preparation of Simplified Nuclear Extract (SNE) The nuclear extract was prepared using a modification of the method described previously (Shapiro et al., 1988). K12 cells grown to confluency were rinsed with cold phosphate buffered saline (PBS). All the steps in this procedure were carried out at 4°C. The cells were harvested in PBS and the packed cell volume (PCV) was determined after centrifuging the cells at 1000 X g for 10 min. Cells were resuspended in 5X PCV of hypotonic buffer ( 10 mM HEPES. pH 7.9, 0.75 mM spermidine, 0.15 mM spermine, 10 mM KC1, 0.1 mM EDTA. 0.1 mM ethyleneglycol bis((3-aminoethyl ether)-N,N,N',N'-tetraacetic acid, and 35 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 1 mM DTT) and allowed to swell for 10 min. The cells were pelleted for 5 min at 5000 rpm in an eppendorf microfuge. The pellet was resuspended in 2X the original PVC o f hypotonic buffer, transferred to a 1 ml dounce homogenizer, and dounced 5 times with the “A” pestle. One tenth the volume of the restore buffer (50 mM HEPES, pH 7.9, 0.75 mM spermidine, 0.15 mM spermine, 10 mM KC1, 0.2 mM EDTA, 1 mM DTT, and 67% sucrose) was added and then dounced 2 times with the "ET pestle. Nuclei were separated from lysed cells by spinning for 30 sec at 14000 rpm. The pelleted nuclei were resuspended in 50- 100 (il of nuclear resuspension buffer (20 mM HEPES, pH 7.9, 100 mM KCI, 0.2 mM EDTA , 0.2 mM ethyleneglycol bis(P-aminoethyl ether)-N.N.N'.N'- tetraacetic acid, 2 mM DTT, and 5% glycerol) and rapidly frozen and thawed three times to lyse the nuclei. Lysed nuclei were spun at 14000 rpm for 10 min. The supernatant was harvested, and protein concentrations were determined by the biorad assay. Protease inhibitor PMSF (phenyl-methyl sulfonyl flouride) was added at a final concentration of I mM and aliquots of the extracts were stored at -70°C. 2.2.4 Labeling of oligonucleotides The oligonucleotides used in gel mobility shift assays were purified using G-25 gel filtration columns. The 94C1 probe was made by freshly annealing equal amounts (150-300 ng) of the complementary oligomers which 36 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. have Sal I and Xho I sites at the ends (Table 2.1). Each time 150 to 300 ng of oligonucleotides were labeled with one unit of klenow enzyme in the presence of 200pM of dGTP, and dTTP and 30 \iCi o f [a-32P]dATP, [a-32P]dCTP and the klenow buffer containing 0.5 M Tris-Cl (pH 7.5), 0.1 M MgS04, 1 mM DTT and 500 fig/ml o f BSA. The labeling reaction was carried out RT for 30 min. The labeled probe was purified off the free nucleotides by separating it on a 12% native polyacrylamide gel. The wet gel was exposed with a Kodak X- OMAT film for 10-20 sec. The gel slice corresponding to the radiolabeled band on the autoradiograph was cut out and electroeluted. The eluted supernatant, free of the gel pieces, was isolated by filtering it using z-spin column (0.2 pm. Gelman Science). The 94 core (Table 2.1) synthetic oligomers were annealed and labeled as the 94 Cl oligomers. The labeled probe was then purified by ethanol precipitation. 2.2.5 Gel Mobility Shift Assays The binding reaction was carried out in 20pl volume in the presence of 150 ng sonicated salmon sperm DNA (SSDNA) as a nonspecific DNA, 1 pg of K12 simplified nuclear extract (SNE), I ng of purified probe (2.0 x 10^ cpm). The binding reaction contained 20 mM Tris HC1 (pH 7.5), 80 mM NaCl, 5% glycerol and 2 mM MgCl,. After 20 min incubation at room temperature, the 37 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. reaction mixture was loaded onto a 8% polyacrylamide gel and electrophoresed in IX TBE buffer containing 89 mM Tris base, 88 mM boric acid, and 2 mM EDTA. The gels were run at 158 V for 1.5 h, dried and autoradiographed. In competition studies, molar excess of the cold competitor was first added along with the labeled probe to the reaction buffer before the addition of the K 12 nuclear extract. In the antibody shift studies, 1 pi of anti-CBF rabbit polyclonal antibody generated against a peptide of CBF-A subunit (Maity and de Crombrugghe, 1992) and the K12 nuclear extract were preincubated for 10 min at RT, in the absence of probe. Following the addition of the probe the reaction was incubated further for 15 min. The reaction mixture was then loaded on the polyacrylamide gel and the gel was run following conditions described above. For the grp94 core binding studies, the reaction conditions were the same as described for 94C1 except that 150 ng of poly dl.dC was used as the nonspecific DNA. The samples were loaded onto a 6% polyacrylamide gel and the gels were run at 165 V for 1.3 h, dried and autoradiographed. 2.2.6 Ultra-violet cross-linking Experiment A bromodeoxy uridine (BrdU) substituted probe for a preparative UV cross-linking gel shift assay was generated by annealing a 10-mer oligonucleotide (Table 2.1) to the lower strand of the 94C1 oligonucleotide pair 38 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. and extended with the Klenow enzyme using [a-32p] dCTP, [a-32p] dATP, BrdU, and dGTP at 37°C for I h. The labeled probe was purified on a 12% polyacrylamide gel in lx TBE followed by electroelution in TBE. In a 50 jil binding reaction, 10 jug o f the SNE from K12 cells was incubated with 1.5 fig of SSDNA and 10 ng of probe in the binding buffer used for gel mobility shift assays. Complexes were resolved on a 8% polyacrylamide gel. The wet gel was irradiated at 302 for 15 min, exposed to X-ray film at RT for 16 h. The autoradiogram was carefully aligned to the wet gel and the complex of interest were excised out. A 100 fil of 2 X sample buffer (625 mM Tris-Cl (pH, 6.8), 10% glycerol, 2% SDS, 710 mM (3-mercaptoethanol) was then added to the eppendorf tube holding the gel piece and the gel was crushed to a fine paste with a mini-teflon pestle. The sample was then boiled for 5 min and assayed on a 10% SDS-polyacrylamide denaturing gel. The gel was dried and subjected to autoradiography. 2.3 RESULTS 2.3.1 Nuclear factors binding to the 94 core element The core and Cl elements are the two important functional regions of the grp94 and grp78 promoters, mediating stress induction (Fig. 2.1). Although the two promoters are coordinately regulated at the trancriptional and translational 39 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. levels, they do have some subtle differences. To understand further the grp94 regulation, I decided to characterize the factors binding to the core and Cl elements. Synthetic oligomers corresponding to the grp94 core and C 1 elements (Table. 2.1) were labeled and used in gel mobility-shift experiments to detect specific protein-DNA complexes. I have used hamster (K12) nuclear extract for these analyses because it does not have nonspecific DNA binding protein such as Ku autoantigen, which occurs abundantly in HeLa nuclear extracts (Li et al., 1994). Using the oligomer spanning region -197 to -163 that contains the grp core of the human grp94 promoter and K12 nuclear extracts, four protein complexes (1 through 4) were observed (Fig. 2.2A). The specificity of the complexes were determined by competition with molar excess of the cold 94 core and a nonspecific lacZ oligomers. The complexes were also competed with 78 core element to look for shared and unique factors. Complex 1 is highly abundant and could not be competed by any of the three competitors. Complex 2 exhibits slightly higher affinity for grp94 than grp78. Complex 3 is highly specific for the grp94 core, although it seems to be low in abundance, complex 4 has the highest affinity for the grp78 core sequence. Complexes 2. 3 and 4 were specific, as none of them were competed away by the nonspecific competitor, LacZ. The quantitative interpretation of the 94 core competition 40 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. data is shown in Fig. 2.2 B. This study agrees with a previous analysis of the core binding activity using HeLa cell nuclear extract (Liu and Lee, 1991) where the grp78 and grp94 core were found to share some complexes. The molecular sizes of factors binding to the grp94 core that are shared with grp78 core were also found to be very similar by UV-crosslinking analysis (Liu and Lee, 1991). The ability o f the 78 core to compete the 94 core becomes obvious when the core region from these two genes are compared (Fig. 2.2C). The GC-rich core sequence is highly conserved across species and between the grp family members. 2.3.2 Factor binding to the 94 core from uninduced and induced K12 nuclear extracts The grp94 promoter is transactivated following stress in the ER. The mechanism o f this induction at the promoter level is not clear. During the heat shock response in mammalian cells, a difference in binding property to heat shock element (HSE) was noticed following heat shock (Kingston et al., 1987) It will be interesting to see if any changes in nuclear factors binding to the grp promoter element occurs also following treatment with an inducer, that could correlate with its induction. Utilizing the grp94 core sequence as probe in gel- shift assays, the binding activities o f the complexes formed using the uninduced (control) or induced (glycosylation block) K 12 hamster cell nuclear extracts 41 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. were compared. In lanes 1 to 3 increasing concentration ( 0.5, 1.0 and 2.0 pg) of control nuclear extracts were used, while in lanes 4 to 6 increasing concentrations o f the K12 t.s induced extracts (0.5, 1.0 and 2.0 jig) were used in gel-shift assays (Fig 2.3). No obvious changes in the factor binding activity in control and induced extracts was visible using this in vitro binding analysis. Similar in vitro analysis of the grp78 core element also showed no changes in binding activities (Li, 1994). However, on using in vivo genomic footprinting specific changes in the binding activity was detected that correlated directly with the transcriptional induction o f the endogenous grp78 gene. Similar in vivo analysis o f the grp94 core region, where the DNA-protein interaction can be monitored in the context of chromatin, may be important to understand the induction o f grp94 at the promoter level. 2.3.3 Nuclear factors binding to the 94 C l element Several mammalian transcription factors which bind to CCAAT element including CCAAT/enhancer factor (C/EBP), CTF/NF-l, CPI, CP2 and several forms o f CBF are well known (Chodosh et al., 1988; Lum et al., 1990; Maity et al, 1992; Santoro et al., 1988). The grp78 promoter was shown to be transactivated with CTF/NF-l through the Cl CCAAT m otif using the drosophila schneider cell system (Wooden et a l, 1991). However, further in- 42 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. depth analysis using mammlian systems proved that the factor binding to the 78 C l element is distinct from CTF (Roy and Lee, 1995). Since the C 1 element o f grp94 promoter is also important, the identification of factors occupying this element is necessary in order to understand the promoter regulation. I have therefore analyzed the role of CTF in grp94 regulation. The CTF/NF-l is composed of a family of proteins (from 52 to 66 kDa) which arise from alternatively spliced products of the CTF gene (Santoro et al., 1988). Since the drosophila schneider cells (SL-2) are devoid of CCAAT factors that are ubiquitous in vertebrates, these were used to study the effect of expression of CTF-1 on grp94 promoter. The 78 (-456)CAT is a 422 bp fragment of the rat grp78 promoter (spanning -456 to -34) containing the cis- regulatory elements required for both basal level expression and inducibility under the stress conditions (Chang et al., 1987) has been previously shown to be activated by CTF-1 through the Cl CCAAT element (Wooden et al., 1991). This was used as the positive control for our analysis. As seen in Fig. 2.4. concurring with the previous study, the grp78 promoter was transactivated 7- fold by CTF-1, however only a 2-fold effect was seen on the grp94 promoter. Further analysis of the 94 Cl binding factor was carried out by in vitro DNA-protein binding analysis. The 94 C l element (spanning -86 to -52) containing the most proximal CCAAT element of the human grp94 promoter 43 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. was used as probe to characterize the factors binding to this region of the grp94 promoter. Using the hamster (K12) nuclear extract, three major protein complexes (I, II, III) were formed (Fig. 2.5). The specificity of the complexes was determined by competition with molar excess o f self and irrelevant or heterologous oligomers. The 94 Cl (self), 78C1, 78 LS90 (where the grp78 CCAAT site is mutated), CTF and 94 LS 75 (where the grp94 CCAAT is mutated) oligomers were used as competitors (Table 2.1). Complex I was competed both by 94 C l and 78C1, but not by 78LS 90. This complex is also not competed by CTF and 94LS75 oligomers (data not shown). The 78 C l was in fact a better competitor than 94 C l, suggesting that the protein component of complex I has higher affinity for 78C1 that for the 94C1 element. Since mutation o f CCAAT box in either 78C1 or 94 C l resulted in the loss o f their ability to compete for complex I (Fig. 2.5 and data not shown) it is likely to contain a specific CCAAT binding protein. Complex II was competed by all the oligomers either containing CCAAT element or mutated at this site. So it is either a nonspecific binding activity or the factors are binding to a region flanking the CCAAT element. A third complex that exhibited high electrophoretic mobility (Complex III) was specific to 94 Cl and was not competed by other heterologous double stranded oligonucleotides. This 44 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. complex III binding activity is however very unstable and is monitored only with freshly prepared nuclear extracts. 2.3.4 In vitro C l binding activities in control and induced K12 nuclear extracts Similar to the analysis done with the 94 core, we also compared binding activities of the factors from uninduced and K12 t.s. induced extracts, to the 94C1 element that could correlate to the promoter induction. The binding activities o f the specific complexes I, II and III obtained from the uninduced (control) and induced (K12 t.s.) hamster cell nuclear extracts were indistinguishable (Fig. 2.6). In lanes 1 to 3, increasing concentration ( 0.5, 1.0, 2.0 jig) of control nuclear extract and lanes 4 to 6, increasing concentrations of the K 12 t.s (0.5, 1.0 and 2.0 jig) were used in gel mobility shift assays. 2.3.5 Radiolabeling of protein species that form complexes with 94 C l UV cross-linking analysis was used to identify the molecular sizes of the protein that are in close contact with the 94 C l element. For this, preparative scale gel mobility shift assays were performed with radiolabeled 94 C l oligo. where dTTP was substituted by bromodeoxyuridine. The bound proteins were then cross-linked to the probe by exposing the gel to UV light. This treatment activates the incorporated BrdU bases in the labeled oligonucleotide to form free radicals which quickly form covalent linkages with the proteins that are in 45 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. close proximity. The complexes were visualized by autoradiography and excised from the gel. The proteins covalently linked to the labeled probe were subjected to SDS-PAGE and visualized by autoradiography (Fig. 2.7, A and B). Complex I, had three proteins o f molecular sizes 205, 90 and 39 kDa. Molecular sizes of many o f the CCAAT binding factors are reportedly in the range of 30 to 40 kDa. The complex II was formed by a 77 kDa species which could either be binding to a region other than CCAAT motif of the oligomer or is a nonspecific factor. Complex III, which is specific to grp94 was made o f a homogeneous population of a 26 kDa protein. 2.3.6 Identification of the CCAAT factor binding to the 94C1 element Two subunits of the multimeric CCAAT binding factor CBF (CBF-A and CBF-B) have been purified and both of them are needed for its binding activity (Maity and de Crombrugghe, 1992). CBF has been shown to be a major component binding to the C l CCAAT element of the grp78 promoter (Roy and Lee, 1995). The molecular size for the A-subunit o f CBF was determined to be around 32 kDa and that of the B subunit was ~37-40 kDa (Vuorio et al., 1990). Since the UV cross linking analysis of 94C1 showed the complex I to be composed of a 39 kDa protein, I tested to see if CBF is a component of 94C1. A consensus sequence for the CBF binding site derived from the a2 (I) collagen promoter (Table. 2.1) was used as a competitor in gel shift assays. As shown 46 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. (Fig. 2.8 A), the CBF oligomer competes the complex I of 94C1. In fact, as observed with 78C1, the CBF binding site competes the 94 C l complex I more efficiently than even the self competitor. Another CCAAT sequence containing oligomers such as the binding site for CTF, a well known CCAAT factor, showed no effect on the formation of complex I (data not shown). This agrees with the in vivo analysis in the previous section, where CTF was not able to activate the grp94 promoter. Although less efficient than self (94C1), higher molar excess o f the CBF oligomer was able to compete the complex III (Fig. 2.8 A). To prove directly the presence of CBF in complex I of 94C1, we determined the reactivity o f anti-CBF antibody towards the Cl complex. A rabbit polyclonal antisera generated against a peptide o f CBF-A, one of the subunits of CBF, has been succesfiilly used to supershift the CBF complex formed with the CBF binding site (Maity and de Crombrugghe, 1992). The synthetic oligomers of 94C1, CBF, and 78 core were used as probes in gel shift assays as described above. Complex I formed with the 94C1 probe and the CBF probe exhibited near identical electrophoretic mobility and was supershifted in the presence o f anti-CBF antibody (Fig. 2.8 B). The antisera is specific to CBF complexes. Since it did not have any effect on the complexes formed with the heterologous promoter such as the 78 core probe (Fig. 2.8 B). Conclusively, the 47 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. complex I in 94C1 contains a protein component recognizable by a specific CBF-A antibody. 2.3.7 Comparison of the effects of divalent metal ions on 94 C l and CBF binding activities The binding of CBF factor is known to be inhibited by divalent metal ion and stimulated by depletion of the divalent ions using chealtors such as EDTA and EGTA (Hatamochi et al., 1988). I analyzed the 94C1 complexes further to see if the effect o f divalent ions is the same as reported for CBF. Gel shift assays were performed with CBF probe, K12 nuclear extract and increasing concentrations o f divalent ions in the binding buffer. Addition of 5 mM of Mg2 + or Ca2 + inhibited the CBF binding activity totally ( Fig 2.9 A. lanes 3 and 5). Zn2 + was found to be the most potent inhibitor and inhibited the binding totally even at ImM concentration (Fig 2.9 A, lane 6). Identical analysis done with the 94C1 element is shown in Fig. 2.9 B. Increasing concentrations of Mg2", Ca2 " or Zn2 " caused an inhibition of the 94CI binding activity similar to CBF, with even 1 mM Zn2 + causing a significant loss o f protein binding (Fig. 2.9, lanes 1 through 12). Interestingly the 94C1 specific complex III was unaffected by Mg2 + and Ca2 + even at 20 mM concentration (Fig. 2.9 B). 48 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 2.4 DISC USSIO N The regulation o f grp genes in response to stress conditions in the ER represents a unique model o f signal transduction where following depletion of the Ca2 + stores or accumulation of malfolded and underglycosylated proteins, a signal is transmitted to the nucleus that causes an enhanced transcription of grp genes. This transcriptional regulation is mediated by the upstream promoter sequences (Wooden et al., 1991; Li et al., 1983; Ramakrishnan et al., 1995). The core and a CCAAT (C l) element that is most proximal to the TATA box of the grp94 promoter are found to mediate the transcriptional activation of the grp94 gene following stress caused by accumulation o f malfolded proteins and glycosylation block (Ramakrishnan et al., 1995). The core sequence spanning - 195 to -168, consistent with its functional importance, is highly conserved between different species from yeast to human and also between GRP94 and GRP78 (Chang et al., 1989; Resendez et al., 1985) while the CCAAT element at -75 is a consensus CCAAT factor binding site and occurs in a reverse orientation. Using the hamster nuclear extract multiple, complexes binding to the grp94 core and C l elements were observed in gel shift assays. Competition analysis has shown two o f the complexes formed by the grp94 core element to be shared with grp78. A previous analysis of the core binding activity using 49 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. HeLa cell nuclear extract (Liu and Lee, 1991) has also shown the presence of shared complexes between the grp78 and grp94 genes. Subsequent, UV-cross linking analysis o f the core element identified five proteins with the molecular sizes o f 210, 110, 90/92, 70 and 55 kDa to be present in the shared complexes. The elaborate chromatographic purification o f the grp78 core binding activity has identified a protein of a molecular size around 70 kDa (p70CORE) as the specific component of the core (Li et al., 1994). Recently the zinc finger protein Yin Yang-1 (YY1) was found to interact with the grp78 core and is probably the p70CORE (Li et al., manuscript in preparation). YY-1 is an interesting factor which plays the multiple roles of an activator, repressor and initiator o f transcription in different genes (Shrivatsava and Calame, 1994). It will be interesting to see if YY-1 is an important component of the grp94 core also. Although the core region is important, it is unable to activate the grp94 promoter if the C 1 element is destroyed (Chapter I). This suggests that the C 1 complex serves as a crucial link between the initiation complex and more distal regulatory complexes such as the core. By multiple analyses, I have identified CBF, a CCAAT-binding factor to be one of the components of the 94C1 complex (Ramakrishnan et al., 1995). CBF is a highly conserved, multimeric protein composed of at least three components that have been identified so far 50 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. (Maity et al., 1992). This factor is known to interact with the CCAAT- containing cis-elements o f the a2(I) collagen, albumin, and major histocompatibility complex II promoters (Maity et al., 1990). The C l complex of grp94 is also shared with the C l element of the grp78 promoter, which has also been shown independently to bind CBF (Roy and Lee, 1994). Collectively, all the analysis done so far on the core and C 1 suggests that the mechanism of coordinate regulation between grp94 and grp78 genes could be explained by the presence of the common set o f nuclear factors interacting with their promoters. Interestingly, the competition of the 94 C l complex I by the grp78 C l or CBF elements is much better than the self competition. Analysis of the grp78 promoter (Roy and Lee, 1994) has shown the presence o f a G-rich sequence immediately at the 3’ region of the C l CCAAT motif. The GGAGG m otif occurs as a 10-bp palindromic sequence in the grp78 promoter (Fig. 2.10) and is found to be protected in both DNase I protection and methylation interference assays (Roy and Lee, 1995). Mutation o f this GGAGG motif is observed to weaken the binding activity at the C l CCAAT m otif of the grp78 promoter. This fact suggested that the GGAGG sequence and the factors interacting with it, helps to stabilize the binding of Cl/CBF factors to the promoter. Since the GGAGG m otif is not present in the grp94 promoter, the Cl/CBF binding here is weaker as compared to the grp78 or the CBF consensus site. 51 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Such differences in the affinity of factor binding could explain why the grp94 promoter is much weaker than the grp78 promoter. Also binding activities such as the complex 3 of core and complex III o f C l, that are specific to grp94 promoter may have factors that could function as repressors or activators able to modulate grp94 response specifically. The differences in factor binding affinity and the presence of unique activities could therefore account for the subtle differences observed between the grp94 and grp78 promoters. The inductions of grps is dependent on new protein synthesis and is inhibited by treatment of cells with cyclohexamide. This inhibition could be either due to absence o f a factor required for the promoter activation or due to the lack o f synthesis of malfolded proteins which might be needed to turn on the stress induction signal from the ER (Resendez et al., 1986). I have performed gel mobility shift assays using oligonucleotides containing the core and Cl elements as probes to determine whether any differences in binding of factors could be detected in induced cell extracts compared to the non-induced extracts. The binding activities at core and Cl did not undergo any change following activation. Similar studies done in yeast cells, using the grp core homologue (Mori et al., 1992) and with the rat grp78 core element (Li, 1994), also reported no change in binding activities in vitro. However, on using in vivo footprinting 52 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. analysis a change in the binding activity at the 3’ half of the human grp78 core was reported, which correlated with the induction o f endogenous GRP78 (Li et al., 1994). Thus in order to understand the in vivo regulation of the promoter it might be important to study the DNA-protein interactions in the context of chromatin, as higher order of the chromatin configuration could play an important role in the accessibility of the factors to specific DNA elements. These analyses at least suggest that the factors responsible for induction pre exist in the nucleus and that the mechanism of promoter induction for grps is probably not due to the translocation o f an activated cytosolic factor to the nucleus. 53 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Table 2.1. Sequence of oligonucleotides used in gel mobility shift assay 94 c o r e 78 c o r e -1 9 7 ctcg a G A CT CCAAT GGTTA -1 7 0 ctcgaGCCGCTT CGGCGAA - 1 6 1 CGGAAGGAGCCACGCTTCGGGCATCGGGT GCCTTCCTCGGTGCGAAGCCCGTAGCCCAcaggtg -1 3 2 CGGCAGCGGCCAGCTTGGCTGGCAT GCCGTCGCCGGTCGAACCGACCGTAcagctg CGAAT GCTTAj L ac Z taaGCCGGGAATTCTCGACGC CGGCCCTTAAGAGCTGCatt 94 C l -86 tcgaGTGCGGCGCG CACGCCGCGC ATTGG TAACC -5 0 TGGGTTCATGTTTCCCGTCC ACCCAAGTACAAAGGGCAGGagc t -1 0 9 7 8 C l ctcgagTAGCGAGTTCA ATCGCTCAAGT CCAAT GGTTA -7 3 CGGAGGCCTCCACGACGGG GCCTCCGGAGGTGCTGCCCagctg 78 tcgaCTAGCGAGTTCg LS90 GATCGCTCAAGc taagc a ttc g tttcGGCCTCCACGACGGGC aaagCCGGAGGTGCTGCCCagct CBF t cgacCGTCTCCA gGCAGAGGT CCAAT GGTTA GGGAGGGCTGGGC CCCTCCCGACCCGagct Bold and italicized case indicate mutated sequence. The boxes highlight the CCAAT-like motifs. Bold and capital case indicate the GGAGG sequence, while lower case indicates the linker sequence. The 94CI primer used for UV cross- linking is underlined 54 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. -240 T T -210 -180 -150 -120 -90 — r -60 i -30 g rp 9 4 ccaatI g c ATTGG GTGAAA 94 C 1 TATA 94 core grp78 -70 -50 -150 -130 -110 -90 -190 -170 r \ ATATAA CGAATl GC CCAAT 78 core 78 C 1 TATA Fig. 2.1 Features of the conserved regulatory elements of the human grp94 and rat grp78 promoters. The core (U ) contains a CCAAT-like motif flanked by GC-rich conserved motif, and Cl is the most proximal motif to the TATA element ( ■ ) . The CCAAT element is indicated by (<Q ), the inverted CCAAT element by (C7) and the transcription initiation site by (p>). 55 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Fig. 2.2. Binding specificity of factors interacting with the grp94 core. (A). Autoradiogram shows the gel mobility shift assay done using labeled 94 core oligomer as probe and nuclear extracts from K12 hamster fibroblast cells. The sequences o f the oligonucleotide competitors are shown in Table 2.1. Lane 1. No competitor (-); lanes 2. 5, and 8, the fold molar excess o f competitor used is 10; for lanes 3, 6, and 9. the fold molar excess is 20; for lanes 4, 7 and 10, the fold molar excess 50. Positions o f complexes 1, 2, 3, 4 and the free probe (F) are shown. The cold competitor used in each lane is also indicated. Asterisk indicates a grp94- specific complex. B. The relative band intensities for complexes 1, 2, 3 and 4 (C l. C2, C3 and C4) shown in A were plotted against the fold molar excess o f the competitor shown on the top. (C) The core sequence conservation. The core sequences are shown for the chick grp94 (spanning from -212 to -162), the human grp94 (from -204 to -152), the human grp78 (from -135 to -83) and the rat grp78 (from -172 to -120). Conserved nucleotides are marked by a vertical line. The consensus sequence o f the conserved core region is also shown. 56 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 94 Core 78 Core Lac Z B 4 5 6 7 8 9 10 Probe: 94 core Competitors I 94 Core 1 ---- 78 Core Lac Z 2.0 n r» C O c i 0.5 Fold molar excess C H IC K G R P 9 4 C C T C C - CGG CCAATCGACGCCGGCCACGCTCCGTCCGCA------ GAAACCGCACATG II I I I I I I I I I II I I I II I I III I II I I II I I I HUMAN G R P 9 4 AAACCCTGACCA ATCGGA AGG AGCC ACGCTTCG--GGCA TCG GTCACCG CACCTG II I I I I I II I I II I I II I I I I I I I I I I III HUMAN G R P 7 8 GGGCCGCTTCGAATCGGCGGCGGCCA- G C T T G G T - GGCCTGGGCCAATGAACGGC I I I I II I I I II I I I I I I I I lllll I III I II III II II II I III I RAT G R P 7 8 AGGCCGCTTCGAA TCG GCAG CGGCCA-GCTTG GT-GGCA TG AACCA ACCAG CGGC C o Core Consensus C%AATCGa/< 7 GCCACGCTTc/(iGTCc 70GC Nuclear Extracts i -------------------------1 Control Induced 1 2 3 4 5 6 Probe: 94 Core Fig. 2.3. Comparison of the in vitro core binding activities of grp94 promoter in control and induced K12 nuclear extracts. Gel mobility shift assays were performed with the human grp94 core element as the probe and 0, 0.5 and 1.0 pg of either uninduced (control; lanes 1 through 3) or induced (K12 t.s.; lanes 4 through 6) nuclear extract from K12 cells. The autoradiogram is shown. The position of complexes 1, 2, 3,4 and free probe (F) indicated with arrows. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 94(-357)CAT 78(-456)CAT pPADH CTF1 pPADH CTF1 Fig 2.4. Effect of CTF/N F-l expression on grp94 and grp78 promoters. The reporter CAT construct 94 (-357)CAT which has the grp94 promoter and 78(-456)CAT which has the rat grp78 promoter were cotransfected with the expression vector pPADH or expression vector containing the gene for CTF1 into the drosophila schneider cell line. In the autoradiogram shown the positions o f chloroamphenicol (Cm) and its acetylated (Ac) forms are indicated. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Competitors 94 Cl 78 Cl 78 LS90 1 2 3 4 5 6 7 Probe: 94 C l Fig. 2.5. Binding specificity of complexes formed with grp94 94 Cl element. The gel mobility shift assay was performed using the 94 C1 element as probe and K12 cell nuclear extracts. The oligonucleotides used in this competition are indicated on top and their sequence is shown in Table 2.1. Lane 1. has no competitor; for lanes 2,4, and 6, the fold molar excess of the competitor used is 10; for lanes 3, 5 and 7 the fold molar excess is 50. Positions of complexes I, II. Ill and free probe (F) are shown in the autoradiogram. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Nuclear Extracts 1 Control Induced Probe: 94 C l Fig. 2.6. Comparison of the in vitro Cl binding activities of grp94 promoter in control and induced K12 nuclear extracts. Gel mobility shift assays were performed with the human grp94 Cl element as the probe and 0, 0.5 and 1.0 pg of either uninduced (control; lanes 1 through 3) or induced (K12 t.s.; lanes 4 through 6) nuclear extract from K12 cells. The autoradiogram is shown. The position of complexes I, II, III and the free probe (F) are indicated with arrows. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Fig. 2.7. Ultraviolet cross-linking analysis of the molecular sizes of the factors binding to the 94 Cl element. (A) Preparative gel-shift assays were performed using the BrdU-substituted and radiolabeled 94 Cl probe and K12 simplified nuclear extracts, followed by the separation of the bound complexes on the native gels. The preparative wet gels were subsequently UV-cross linked and autoradiographed. The complexes I, II and HI (as shown in Figures 2.4 and 2.5) were excised from the gel, and their protein components were analyzed by separating them over a 10% SDS-polyacrylamide gel. The autoradiogram is shown. Lanes 1 and 2, 3 and 4, 5 and 6 are duplicate samples of complexes I, II and in respectively. The positions of the protein size marker (k Da) and the complex being analyzed are indicated. (B). Same as lanes 5 and 6 of B, except complex III was analyzed on a 12 % SDS-PAGE gel. 62 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. h 2 2 3 i % % ^ Probe: 94 C l Fig. 2.8. Identification of factors binding to the 94 Cl element. (A) Gel-shift assay was performed as described for the 94 Cl competition analysis. The binding reaction was carried either in the absence of the competitor (-) or in the presence increasing amounts (10-, 50-, and 100-fold) of the competitor oligonucleotides as indicated. Lanes 2 through 4, 94 Cl; lanes 5 through 7, CBF. (B). Gel-shift assays were performed with three different probes and K12 nuclear extract. The reactions were carried out in the absence (- , lanes 1, 3 and 5) or the presence (+, lanes 2,4 and 6) of the anti-CBF A antibody. The positions of complex I, II, III and free probe are indicated. The sequences of the three probes that were used here are shown in Table. 2.1. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 1 2 3 4 5 6 7 P ro b e : CBF Probe : 94 C l Fig. 2.9. Effect of divalent metal ions on the CBF and 94 Cl binding activities. (A) Gel mobility shift assays were performed using the CBF probe, K12 nuclear extract and increasing concentrations of the divalent ions in the binding buffer. In lane 1, the reaction was carried out in the regular reaction buffer, while in lanes 2 to 3. 4 to 5 and 6 to 7, increasing concentrations (1 and 5 mM) of Mg2 ', Ca2 ~ and Zn2 * were used respectively. (B) Analysis similar to described in A was carried out using the 94 Cl as probe. Lane 1. used the normal binding assay condition, lanes 2, 3, 4 and 5, 6. 7, 8 and 9. the binding was carried with increasing concentrations (1,5, 10 and 20 mM ) of Mg2 ' and Ca2 ~ respectively. Lanes 10. 11 and 12. the reaction was carried in the presence of 1. 5 and 20 mM of Zn2 ' . The autoradiograms are shown. The metal ion used in the analysis are shown on top. The complexes being studied are numbered. 64 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. a 2 (I) CGTCTCCA collagen GCAGAGGT CCAAT GGTTA GGGAGGGCTGGGC CCCTCCCGACCCG grp7 c i TAGCGAGTTCA ATCGCTCAAGT CCAAT GGTTA CGGAGGCCTCCACGACGGG GCCTCCGGAGGTGCTGCCC grp94 C l GGACGGGAAACATGAACCCA CCTGCCCTTTGTACTTGGGT CCAAT GGTTA CGCGCCGCAC GCGCGGCGTG Fig 2.10 Sequence required for high affinity CB binding The position o f CCAAT binding site for CBF is boxed. The shaded rectangle shows the GGAGG motif which flanks the CCAAT element. The promoters whose CCAAT binding site were analyzed is shown on left. 65 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. CHAPTER III: ASSOCIATION OF GRP94 WITH A Mg2 * DEPENDENT KINASE ACTIVITY 3. INTRO DUCTIO N GRP94, a major representative member o f the GRP family, shares about 50% amino acid identity with 90 kDa member of the heat shock family, HSP90 (Mazzerella and Green, 1987). Both HSP90 and GRP94 have been characterized as ATP-binding proteins (Csermely and Kahn, 1991; Flynn et al., 1989). In fact, grp94 is not found in yeast or drosophila and is suggested to have emerged late in evolution by a duplication of hsp90 (Li and Srivatsava, 1993). HSP90 is an abundant cytosolic protein that is induced several fold upon heat shock (Lindquist and Craig 1988) and is functionally well defined. HSP90 forms complexes with a number o f protein kinases, including casein kinase II, double stranded DNA-activated kinase, heme-regulated elf2-a kinase, protein kinase C, and some tyrosine kinases (Csermely and Kahn, 1991). On its own, HSP90 is reported to have a Ca2 + dependent autophosphorylation activity (Csermely and Kahn, 1991). Based on the similarity of GRP94 to HSP90, the question of interest was to find if GRP94 is associated with a kinase activity. Characterization o f ER- 66 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. associated kinase activity is very important, as phosphorylation by kinases plays a key role in the regulation o f the grp genes and in regulation of some of their function. GRP genes are transactivated in the nucleus following stress in the ER. The question of interest then is how an event happening in ER is conveyed to another cellular compartment? In S. Cerveciae a cdc2 kinase homologue termed as IRE1 or Em I with a serine/threonine kinase activity is found to be important in the ER to nucleus signaling following accumulation of the malfolded protein (Cox et al., 1993; Mori et al., 1993). Although in the mammalian system the homologue o f IRE1 has not yet been identified, the importance of kinases in the expression of grps has been established by using a variety of inhibitors of kinases and phosphatases (Cao et al., 1995; Price and Calderwood, 1992; Resendez et al., 1986). Both GRP78 and GRP94 are known to exist in phosphorylated and dephosphorylated forms in vivo (Freiden et al., 1993; Lee et al., 1983; Ting, 1987; Welch et al., 1983). Under normal conditions GRP78 exist as a phosphorylated, aggregated species which is unable to function as a chaperone. On stress, the protein is dephosphorylated and occurs as a monomer that can bind to unfolded and malfolded proteins in the ER (Blonde-Elguidi et al., 1993; Freiden et 1., 1989; Hendershot et al., 1988). In contrast, GRP94 appears to be more phosphorylated in stressed cells ( Ting, 1987). 67 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Using immunopurified and concanavalin A (ConA) affinity purified GRP94 from rat and human cell extracts, I found a highly active Mg2 + - dependent serine kinase activity (termed as 94-kinase) associated with GRP94. The 94-kinase is able to phosphorylate both the constitutive and stress-induced forms of GRP94, correlating with their induction kinetics. This activity is tightly associated with GRP94 and can be recovered from the ER membrane fractions. The kinase activity persisted even after the purification of GRP94 by ConA affinity chromatography, where this high mannose glycoprotein is specifically purified away from other cellular proteins. This further suggested that either the 94-kinase is inherent to GRP94 or else it is a very tightly associated novel protein kinase. Since ER-associated CKII-like activity has been implicated in the phosphorylation of calnexin and signal sequence receptor a, two major Ca2 + -binding ER proteins with chaperone function (Ou et al., 1992) and since hsp90 is also found in tight association with CKII ( Miyata and Yahara, 1992), I have analyzed the kinase for CKII like properties. Although the 94-kinase has some common properties with CKII, it is not CKII. Using inhibitors, activator and peptide substrates o f serine/threonine kinases that are known to associate with HSP90, I concluded that the 94-kinase is not any one of these also. Recently, GRP94 was reported to possesses a labile Mg2 + dependent autokinase activity (Csermely et al., 1995; Dechert et al., 1994), and using microgram 68 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. quantities o f highly purified GRP94, an unusually stable Ca2 + dependent autophosphorylation activity was also identified (Csermely et al., 1995). The 94-kinase, described in this chapter, shares some similarities with the Mg2 + dependent GRP94 autophosphorylation activity. However, the 94-kinase activity 0 * O ' is inhibited by the addition of increasing amounts o f Ca"T to the Mg~~ containing reaction buffer. Although, the identity of the 94-kinase is not clear so far, its properties suggest that it could be physiologically significant. The peptide sites phosphorylated in GRP94 in vivo were found to be identical to the sites phosphorylated in GRP94 by the 94-kinase in vitro. Further, the 94-kinase activity is modulated by GRP78, a protein that is coordinately regulated with GRP94 which is known to interact with it in vivo. 3.2 M A TER IA LS AND M ETHODS 3.2.1 Cell line and culture conditions The NRK cell lines and their culture conditions have been previously described (Little and Lee, 1995). These cells are grown in DMEM (high glucose) media supplemented with 10% CCS. The myeloid leukemia cells THP-1 were grown in RPMI 1640 medium supplemented with 10% fetal calf serum. For stress treatment, the cells were incubated with tunicamycin (1.5 |ig/ml) or A 23187 (7 pM) for various periods of time at 35°C. 69 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 3.2.2 In vivo labeling of cell extracts Subconfluent NRK cells were labeled with 100 pCi of [35S]methionine (NEN) for 16 h in methionine-free medium containing 10% cadet calf serum. The cells were rinsed well with PBS and lysed in RIPA buffer containing 50 mM Tris (pH 8.0), 150 mM NaCl, 1% (v/v) NP-40, 0.5% sodium deoxycholate, 0.1% sodium dodecyl sulfate, I mM phenylmethylsulfonyl fluoride (PMSF). and 1 pg/ml mix o f aprotinin, leupeptin, and benzamidine. For in vivo phosphate labeling, subconfluent NRK cells were grown under normal culture conditions or treated with tunicamycin for 12 h prior to changing to phosphate-free medium containing 10% dialyzed fetal calf serum. The cells were labeled in 100 (iCi/ml o f [32P] orthophosphate for 8 h in the absence or presence of tunicamycin. Following the labeling period, the cells were rinsed in PBS and lysed in RIPA buffer. 3.2.3 In vitro immune complex kinase assay Several anti-GRP94 antibody preparations were used: (I) a polyclonal rabbit antiserum directed against a synthetic peptide corresponding to the N-terminal 16 residues of mouse GRP94 (gift o f Dr. M. Green, St. Louis University School of Medicine, Schaiff et al., 1992); (ii) a polyclonal rabbit antiserum against the N-terminal 18 residues of the hamster GRP94 (Lee et al.. 1984); and (iii) a rat monoclonal antibody (mAb) against chicken GRP94 70 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. (StressGen, Victoria, Canada). The anti-cdc2 is a mouse mAb (Santa Cruz Biotech, Santa Cruz, CA). The anti-CKII is a rabbit polyclonal antiserum made against the Drosophila CKII holoenzyme (a gift from Dr. Claiborne V. Glover, University of Georgia, Bidwai et al., 1992). Dephosphorylated casein and the kinase substrate peptides (cAMP kinase, Ca2+ -Calmodulin kinase and Protein kinase C) were purchased from Sigma and the CKII substrate decapeptide (RRREEETEEE) was purchased from Peninsula Laboratories, Inc., Belmont, CA. Histone HI was obtained from Boehringer Mannheim Biochemicals. Recombinant GRP78 protein (gift of Dr. D. Jarvis, Texas A&M University, 19) was expressed in a baculovirus system and chromatographically purified on a Superose 12 column. NRK and THP-1 cells were washed once with cold PBS and lysed at 4°C in RIPA buffer. Insoluble material was removed by centrifugation at 4°C for 10 min at 10,000 g. The protein amount in the lysates was determined using the Bicinchoninic acid (BCA) protein assay (Pierce. Rockford, IL). For most immunoprecipitations, about 150 pg of protein lysate was incubated with the appropriate antibodies for 2 h at 4°C. The immune complexes were incubated with protein A-sepharose CL4B beads (Sigma) for 1 h at 4°C. For GRP94 immunoprecipitation with the rat mAb, the immune complex was conjugated to a secondary rabbit anti-rat antibody before the addition o f protein A sepharose. The immunoprecipitates were washed four 71 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. times with RIPA and two times with the kinase buffer (50 mM Tris, pH 7.4, 10 mM MgCl,, and 1 mM DTT). In a standard kinase reaction, the immune complexes were resuspended in 20 to 25 pi o f kinase buffer, followed by addition o f 100 jxM ATP and 12 fj-C i of [y-3 2 P]ATP, and when used, exogenous substrates were added to the immunoprecipitates. The reaction mixtures were incubated at 30°C for 15 to 45 min and stopped by the addition of equal volumes o f Laemmli buffer (8% SDS, 0.2 M Tris, pH 6.8, 35% glycerol, and 0.2 M p-mercaptoethanol). The reaction mixtures were boiled for 10 min and then analyzed by 8.5% or 10% SDS-PAGE. Sometimes the gels were stained with Coomassie blue and dried. The phosphoproteins were visualized by autoradiography. The intensity of the labeled bands were quantitated using an LKB ultrascan XL laser densitometer. 3.2.4 Phosphoamino acid analysis The phosphoproteins were resolved by SDS-PAGE. The wet gel was exposed to an x-ray film and the labeled band o f interest was excised from the gel. The protein was electroeluted from the gel piece and was precipitated using 20% TCA. The pellet was washed two times with 50% TCA followed by acetone, dried well, and hydrolyzed with 6 N HC1 for 1 h at 110°C. The recovered phosphoamino acids were analyzed at pH 1.9 and pH 3.5 as described (Boyle et al., 1991). Unlabeled phosphotyrosine, phosphothreonine, and 72 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. phosphoserine markers were added and run along with the hydrolyzed protein sample. 3.2.5 Western blot analysis Proteins from the ER fraction (10 pg) were separated by an 8.5% SDS-PAGE, transblotted onto the immun-lite membrane (Bio-Rad, Hercules. CA) overnight at 15 V followed by another hour o f transfer at 50 V in the Bio-Rad trans-blot cell. The immunoblot was performed according to the Immun-lite assay kit (Bio-Rad). The blot was preincubated with 2% nonfat dry milk for 1 h at room temperature (RT). After washing with IX TBS (20 mM Tris, 500 mM NaCl, pH 7.5), the anti-GRP94 mAb (StressGen) at a dilution of 1:500 was incubated with the membrane for 2 h at RT. The goat anti-rat secondary antibody conjugated to alkaline phosphatase (at 1:3000 dilution) was then used to detect the primary antibody in the presence o f a chemiluminiscent substrate. The bands were visualized by autoradiography. 3.2.6 Staining of the protein gels The protein samples were electrophoresed on an 8.5% SDS-PAGE and subjected to silver staining using the Biorad silver stain kit. For Coomasie staining, the gel was incubated with the staining solution containing 25% methanol, 7% acetic acid and 0.25% Coomasie blue. The gel was destained in the same solution in the absence of the stain . 73 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 3.2.7 Subcellular fractionation using discontinuous sucrose gradient NRK cells grown in 15 cm dishes were rinsed once with IX PBS and twice with buffer A (0.2 M sucrose in 0.025 M Hepes, pH 7.5). The cells were harvested and dounced in buffer A containing 1 fag/ml of protease inhibitor aprotinin, using a dounce homogenizer. The lysates were centrifuged at 200 x g for 5 min at 4°C to remove cell debris. The cell lysate was then layered on top of a sucrose gradient containing 1.5 ml of 2.0 M, 3.4 ml of 1.3 M, 3.4 ml of 1.0 M, and 2.2 ml of 0.6 M sucrose solution. The gradient was centrifuged at 40,000 rpm for 2 h in a Beckman SW41 rotor at 4°C. The interface of 2.0 and 1.3 M sucrose solutions which had the ER fraction was isolated with a needle syringe (Wang et al., 1991). The ER fraction was then dialyzed against buffer A to remove excess sucrose and concentrated on a centricon-3 microconcentrator (Amicon, Beverly, MA). Protein concentration was measured using the Bio-Rad assay. 3.2.8 Purification of GRP94 The protein was purified by concanavalin A-sepharose (ConA; Pharmacia Biotech) affinity chromatography from HeLa whole cell extracts devoid of nucleus. The ConA column was equilibrated with a buffer containing 20 mM Tris-HCl, pH 7.4, and 0.2 M NaCl. The column was washed several times with 74 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. the binding buffer and GRP94 was eluted using an increasing gradient of a-D- methylmannoside. 3.2.9 In situ denaturation/renaturation assay The assay was performed as previously described (Shackelford et al.. 1993). Baculo-expressed mouse brain Ca2 + -calmodulin kinase II alpha subunit (CamKII) and the ConA purified GRP94 were separated by SDS-PAGE. The gel was transblotted onto the Immobilon-P membrane (Millipore) in transfer buffer (192 mM glycine, 25 mM Tris base, and 20% methanol), using the transblotter (Bio-Rad) for 3 h at 60 V. The membrane was then denatured in 7 M guanidinium-HCl containing 50 mM Tris-HCl, pH 8.3, 50 mM dithiothreitol (DTT), and 2 mM EDTA for I h at room temperature (RT). The membrane was rinsed with Tris-buffered saline (10 mM Tris-HCl, pH 7.5, and 0.14 M NaCl). The renaturation was performed in buffer containing 140 mM NaCl, 10 mM Tris-HCl, pH 7.5, 2 mM DTT, 2 mM EDTA, and 0.1% NP40 at 4°C for 16 h. The membrane was rinsed in 30 mM Tris-HCl, pH 7.5 for 30 min at RT. The renatured 94-kinase activity on the membrane was determined using the standard in vitro kinase assay described already. The CamKII assay was performed at RT for 30 min in a buffer containing 40 mM Hepes, pH 7.3. 0.1 mM EGTA, 5 mM MgCl,, 0.15 mM CaCl2 , 14 ng calmodulin, and 10 nCi/ml of 75 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. [y-32P]ATP. Following the reaction, the membranes were washed and subjected to autoradiography. 3.2.10 Phosphopeptide mapping The assay was performed as described before (Gaut and Hendershot, 1993). Proteins phosphorylated in vitro or in vivo were separated by SDS- PAGE. Following autoradiography o f the dried gel, the phosphorylated GRP94 band was excised. The slices were then placed into sample wells of a 15% SDS- PAGE, allowed to hydrate in situ for 15 min in 20 pi of sample buffer (0.12 M Tris-HCl, pH 6.8, 0.1% SDS, 10% glycerol, I mM EDTA, 40 mM (3 - mercaptoethanol), followed by digestion with the protease in the sample well. Electrophoresis was carried out at 60 V through the stacking gel and at 150 V through the separating gel for 4 h. 3.2.11 Activity gel assay This assay is used to detect the activity of protein kinase in situ after elctrophoresis on SDS-polyacrylamide gel (Kameshita and Fujisawa, 1989). The dephosphorylated casein at a concentration of 0.5 mg/ml was added to the separating gel just before its polymerization. GRP94 or the CKII immunoprecipitates were electrophoresed on 8.5% SDS-PAGE gels. The SDS was removed by washing the gel with 20% isopropanol in 50 mM Tris-HCl (pH 8.0) for 1 h at RT with two changes. The gel was then rinsed with 50 mM Tris- 76 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. HCl (pH 8.0) containing 5 mM p-mercaptoehanol (Buffer A) for 1 h at RT. The gel was denatured by treating it with 6 M guanidinium-HCl for lh at RT and renatured back at 4°C for 16h in buffer A containing 0.04% tween-20. The gel was subsequently rinsed in the kinase buffer used for the 94-kinase analysis. The gel was incubated in the kinase buffer containing [y-3 2 P] ATP for 45 min at 30°C in a water bath. Following this, the gel was washed well with a 5% trichloroacetic acid solution containing 1% sodium pyrophosphate, till the radioactivity of the wash solution was negligible, dried and exposed to a X-ray film. The kinase activity was not observed with Ca2 + alone in the reaction buffer and on using 50 to 200 ng of GRP94. 3.3 R ESU LTS 3.3.1 Phosphorylation of GRP94 by an associating kinase activity The GRP94 glycoprotein has some interesting features in its primary sequence as discussed in detail in the introduction. It has a high sequence identity with HSP90. GRP94 from many different species also show a very high conservation at the ATP binding domains. GRP94 is induced to high levels on treatment o f cells with tunicamycin or A 23187 treatment, with majority of it in a non-glycosylated form. To test whether GRP94 is associated with a kinase activity, NRK cells were either grown under normal culture conditions or treated with tunicamycin. A Coomassie stained SDS-PAGE gel of the NRK 77 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. lysates from control (Fig. 3.1 A, lane 1) and cells treated for 2, 4, 8, and 16 h with tunicamycin (lanes 2 to 5) revealed GRP94 induction. The gradual appearance o f induced levels o f a 94 kDa protein band corresponding to its non-glycosylated form is an unique characteristic of GRP94 in the tunicamycin- treated cells (Little and Lee, 1995; Ramakrishnan et al., 1995). The 16 h treatment of NRK cells with tunicamycin (lane 5), commonly used to induce the GRPs, resulted in a 2- to 3-fold increase in the steady state level of GRP94 protein, predominantly in its non-glycosylated form. The GRP78 protein that is coordinately regulated with GRP94 (Lee, 1987) was also induced at 16 h (Fig. 3.1A). GRP94 was immunopurified from the NRK lysates using a rabbit polyclonal antibody directed against the N-terminal aminopeptide of murine GRP94. This antibody should be unique as the N-terminus of GRP94 is not shared with HSP90 or other members of the heat shock or GRP protein family. The immunoprecipitate was subjected to in vitro kinase assays in the presence of Mg2 + and [y-j2P]ATP. In the control cells, a 94 kDa labeled band was detected (Fig. 3.IB, lane I). Following 2, 4, and 8 h o f tunicamycin treatment, the level o f phosphorylation was relatively unchanged in comparison to the control cells (lanes 2 to 4). At 16 h, in correlation to the increase in GRP94 observed in the Coomassie stained gel, the phosphorylation level of the 94-kDa 78 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. band was increased by 3- to 4-fold (Fig. 3 .IB, lane 5). To confirm that the 94-kDa phosphorylated protein band is GRP94, a Western blot was performed on the immunoprecipitated protein samples used in the in vitro kinase assays. In agreement with the Coomassie blue stained gel, the level o f GRP94, as verified by immunoblot, was relatively low in the control cells and gradually increased following tunicamycin treatment with the highest level accumulated after 16 h o f treatment (Fig. 3.1C). The electrophoretic mobility o f the phosphorylated band was the same as that of the Western blotted GRP94 band. These combined results indicate that the kinase associated with GRP94 (termed the 94-kinase) is capable of phosphorylating the non-glycosylated form of GRP94, which accumulates in the cell following tunicamycin treatment. These results are consistent with the previous in vivo observation where the phosphorylation level of GRP94 was found to be upregulated in hamster cells blocked in protein glycosylation (Ting, 1987). To confirm further that the phosphorylated band is GRP94,1 repeated the in vitro kinase reactions with cell extracts prepared from NRK cells with suppressed GRP94 stress induction response due to the stable expression of a ribozyme targeted against GRP94 (Little and Lee, 1995). In the ribozyme expressing cell line, the level of GRP94 phosphorylation in tunicamycin treated cells was correspondingly reduced as compared to cells transfected with the 79 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. vector alone (Fig. 3 .ID). To test whether GRP94 from other cell types treated with other stress conditions is also associated with a kinase activity, the myeloid leukemic cells, THP-l were treated with A23187. Here also an increase in phosphorylation o f the stress-induced GRP94 was observed (Fig. 3.IE). Thus, GRP94 induced by diverse stress reagents can be efficiently phosphorylated by the 94-kinase in different cell lines. The next point o f interest was to see whether the 94-kinase from stressed cells had undergone changes itself, such that its kinase activity was enhanced. For this purpose, a constant amount of HI was added as an exogenous substrate to the kinase reaction performed with the 94-kinase immunopurified from control and stress treated NRK and THP-l cells. In contrast to GRP94 which was phosphorylated to high levels in the stress treated samples, the level of HI phosphorylation was minimally increased in the tunicamycin treated samples (Fig. 3 .IF, lanes 1 and 2) and no increase in the A23187 treated samples was observed (Fig. 3 .IF, lanes 3 and 4). These results suggest that the 94-kinase from stressed cells does not have enhanced activity towards exogenous substrates such as H I. Since the GRP94 protein expression goes up following stress, the increase in GRP94 phosphorylation could be simply because of this availability of more substrate (GRP94) for the 94-kinase. However, it is also possible that different kinases are acting upon GRP94 and HI. 80 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 3.3.2 Tight association between GRP94 and its kinase activity To investigate further the stringency o f association between GRP94 and its kinase activity, two experimental schemes were devised. Instead of directly precipitating the lysate with the anti-GRP94 antisera (Fig. 3.2, scheme A), the cell extract was first precleared with protein A to remove non-specific protein binding (Fig. 3.2, scheme B). Both methods yielded equally efficient labeling of GRP94 (Fig. 3.2, lanes 1 and 2). The GRP94 labeling was also observed when the experiments were repeated with a rat monoclonal antibody against GRP94 (Fig. 3.2, lane 3). The GRP94 protein band was the major species immunoprecipitated by this monoclonal anti-GRP94 antibody, from total cell extracts metabolically labeled with [j5S]methionine, and this band was not observed using a heterologous rat monoclonal antibody (Fig. 3.2, lanes 4 and 5). Our results indicated that two independent preparations of antibody specifically directed against GRP94, using two different schemes, were capable of immunoprecipitating the 94-kinase activity. 3.3.3 GRP94 is phosphorylated at serine residues The labeling of the GRP94 band in the in vitro kinase assay could have been either due to a phosphorylation reaction or to a non-covalent but tight association of the radiolabeled ATP with GRP94. To distinguish between the two possibilities, I repeated the in vitro kinase assay with immunopurified 81 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. GRP94 in the presence o f either [a-j2P]ATP (Fig 3.3A, lane 1) or [y-3 2 P]ATP (Fig. 3.3 A, lane 2). If the GRP94 labeling was due to tight binding o f ATP to GRP94, then both forms of radioactive ATP would label GRP94 equally well. However, if the labeling was due to phosphorylation o f GRP94 by transfer of the y-phosphate group from ATP to GRP94, then only [y-j2P]ATP would label GRP94. The results here indicated that only [y-j2P]ATP, but not [a-j2P]ATP. was able to label GRP94. To prove further that the main label at GRP94 was due to the transfer of the y-phosphate to the protein substrate, the amino acid residues being phosphorylated in GRP94 was determined. The in vitro phosphorylated GRP94 band was gel purified and the amino acids were analyzed by 2-dimensional thin layer chromatography, following acid hydrolysis o f the protein. Within our detection limit the GRP94 was found to be phosphorylated on the serine residues (Fig. 3.3B). This observation is consistent with the in vivo finding that GRP94 is phosphorylated at serine residues (Ting. 1987). 3.3.4 The 94-kinase activity is present in enriched ER membranes Since GRP94 is an ER protein, it was important to determine whether the 94-kinase activity is associated with the ER. For this purpose, ER membranes were purified from the cell lysate using a sucrose gradient centrifugation (Fig. 3.4A) and assayed for the 94-kinase activity. Silver stain analysis of the proteins 82 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. in the ER membrane fraction showed a band similar in size to the 97-kDa protein marker to be substantially enriched. This was identified as GRP94 in an immunoblot analysis using the rat monoclonal antibody against GRP94 (Fig. 3.4B, lane 4). To test whether the 94-kinase activity can be recovered from this purified ER fraction, the dialyzed and reconcentrated (by ultrafiltration) ER fraction was immunoprecipitated with anti-GRP94 antibody and added to the standard kinase reaction mixture. The same band which immunoreacted with the GRP94 antibody was phosphorylated in vitro (Fig. 3.4B, lane 5). However, I noted that in multiple ER preparations, while the 94-kinase activity was always recovered, its specific activity was weakened. This loss o f the kinase activity could be due to the ER purification and its subsequent reconcentration which might affect a labile protein kinase that phosphorylates GRP94. 3.3.5 The 94-kinase exhibits similarities and differences with casein kinase II Membrane associated CKII has been implicated in the GTP phosphorylation of two major ER Ca2 _ r -binding proteins, the signal sequence receptor a, and the associated membrane chaperone calnexin (Ou et al., 1992). HSP90 is also found to be tightly associated with CKII (Miyata and Yahara, 1992) and both HSP90 and GRP94 have been shown to be in vitro substrates for CKII (Shi et al., 1994). Distinctive features of CKII from other well 83 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. characterized kinases includes its ability to use ATP as well as GTP as phosphate donors, inhibition by heparin, and stimulation by monovalent cations (Gatica et al., 1993; Pinna, 1990). Two properties of the 94-kinase activity suggest that it shares some similarity with CKII. It is inhibited by heparin (Fig. 3.5A, lanes I, 5, and 6) and, although ATP is more efficient, GTP can also be used as phosphate donor (Fig. 3.5B, lanes 1 and 2). However, in contrast to CKII, monovalent cations such as K+ ion which optimize the CKII activity, (Crate et al., 1992; Gatica et al., 1993; Zandomeni and Weinmann, 1984) inhibits the phosphorylation o f GRP94 by the 94-kinase (Fig. 3.5A, lanes 1 to 4). The inhibitive effect is severe for GRP94 but less for HI. 3.3.6 The 94-kinase activity is distinct from casein kinase II and other commonly known kinases To determine more precisely the relationship between the 94-kinase and CKII activity, the following competition assays were performed. First, increasing amounts o f dephosphorylated casein were used as a competing substrate in a 94-kinase reaction. The results, as shown in Fig. 3.6A, showed that addition of excess amounts of casein had no effect on the ability of the 94-kinase to phosphorylate GRP94. While the casein substrate was moderately phosphorylated by the 94-kinase in a dosage dependent manner, the preferred substrate for the 94-kinase was GRP94. 84 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Next, I used a synthetic peptide substrate for casein kinase II as competitor in a 94-kinase reaction. The decapeptide RRREEETEEE is a highly specific substrate for CKII and is often used as a diagnostic tool to assay for CKII or CKII-like activities (Kuenzel and Krebs, 1985). Addition of increasing amounts of this peptide had minimal effect on the ability o f the 94-kinase to phosphorylate GRP94 (Fig. 3.6B). In contrast, the same decapeptide added to a CKII kinase reaction was highly effective as a competing substrate (Fig. 3.6C). In this experiment, CKII activity was immunoprecipitated from the NRK total cell lysate using a polyclonal anti-CKII antiserum. Casein was added as an exogenous substrate in a kinase reaction and it was effectively phosphorylated by the immunoprecipitated CKII enzyme. The phosphorylation of the casein substrate was reduced by 70% and 90% respectively when 10 and 20 ng of the peptide were added as competing substrates. These results were further confirmed using peptide kinase assays (Kuenzel and Krebs, 1985) where we observed 10-fold higher counts incorporated directly into the decapeptide by CKII than the 94-kinase (data not shown). I also performed an in-gel kinase activity assay to examine if the CKII activity was coimunoprecipitating along with GRP94. The GRP94 or CKII immunoprecipitates were separated over a polyacrylamide gel embedded with dephosphorylated casein substrate (Fig. 3.6D, lanes 2 and 3). Following electrophoresis, all the proteins in the 85 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. immunoprecipitate are separated over the SDS-polyacrylamide gel, while the casein stayed embedded uniformly all over the gel. The protein gel was renatured and subjected to a kinase assay. Any region of the gel containing the protein kinase that can phosphorylate casein would have been labeled and could be visualized by autoradiography. Standard molecular size markers run along with the samples can establish the size o f the kinase. As shown in Fig. 3.6D, using CKII for which casein is a good substrate, as positive control a labeled band corresponding to the catalytic a-subunit of CKII, which has a molecular size o f ~ 40 kDa was seen (lane 3). No labeling was seen in lane 2 where the GRP94 immunoprecipitate was separated, suggesting that GRP94 does not coprecipitate with a kinase which can use casein as substrate. In lanes 1 preimmune sera instead of specific antibody was used in the immunoprecipitation. All these combined results establish that the kinase activity associated with GRP94 is distinct from CKII. To further characterize the 94-kinase, the effect o f several well characterized protein kinase inhibitors were tested. Essentially, the phosphorylation of GRP94 by the 94-kinase was not affected by hemin (10 pM) and H7 (100 pM) which modify the activities of the heme-regulated eIF-2-a- kinase and protein kinase C, respectively (Table 3.1). Double-stranded DNA molecules (50 pg/ml) which are known to activate the double-stranded DNA- 86 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. activated protein kinase, severely inhibited the 94-kinase activity. Competition analysis using peptide substrates o f cAMP dependent kinase, calmodulin activated kinase and PKC also failed to compete the 94-kinase activity at 10 jig concentrations (Table 3.1). Histone appears to be a potent stimulator of the 94- kinase and seems to enhance its activity up to 10-fold. 3.3.7 Inhibition of the Mg2 + dependent 94-kinase activity by Ca2 + A Mg2 + -dependent protein kinase isolated from porcine brain microvessels has been matched to GRP94 (Dechert et al., 1994). Recently, it was reported that chromatographically purified GRP94 has a autokinase activity (Csermely et al., 1995) that requires the presence of either Ca2 + or Mg2 *. The Mg2- dependent activity was recovered more efficiently than the Ca2 "-dependent activity from GRP94 purified by immunoprecipitation and was found to be heat labile and was greatly diminished in renatured GRP94. The Ca2 " dependent autokinase activity was unusually stable and was observed using microgram amounts of purified GRP94. The 94-kinase activity shared similarities with the Mg2 * dependent autokinase activity, with both having similar ionic requirement, inhibition by monovalent ions, lesser resistance to heat treatment, inability to renature and activation by histone H I. However we find that the kinase activity associated with nanogram amounts of immunopurified or ConA purified GRP94 is active only in the presence of Mg2 " 87 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. and not in a buffer containing Ca2 + alone (Fig. 3.7A, lanes 1 and 2). The 94- kinase was active even at 1 mM Mg2 + concentration (Fig. 3.7B, lane 2), while an efficient GRP94 phosphorylation was obtained with 10 mM of Mg2 + (Fig. 3.7B) The lumen o f the ER is a major Ca2 + store with concentrations of Ca2 ~in the mM range (Campbell, 1983; Drummond et al., 1987). These metal ions seem to play an important role in GRP94 function and expression. GRP94 is known to bind with Ca~T and its conformation, is affected by Ca" ions (Kang and Welch, 1991). Depletion of ER Ca2 _ r by thapsigargin, an inhibitor of the ER Ca2 ^-ATPase pump, induces grp transcription (Li et al., 1993). The importance of Ca2 + prompted us to find what effect it had on the 94-kinase activity. As shown in Fig. 3.7C, increasing the Ca2 T concentration to 2.5 mM resulted in a reduction o f the 94-kinase activity. This effect appeared to be substrate-dependent as the phosphorylation o f GRP94 was inhibited 4-fold compared to the 2-fold effect observed for H I. Thus, in correlation with the induction o f grp transcription in cells depleted o f ER Ca2 + , the 94-kinase activity is modulated by the physiological concentrations o f ER Ca.2 + 3.3.8 The 94-kinase activity is sensitive to heat and denaturation Although no known consensus serine/threonine kinase domain exists in GRP94 protein, the 94-kinase activity is very tightly associated with GRP94. 88 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Even purification o f GRP94, utilizing the high affinity binding o f this mannose rich protein to ConA (Fig 3.9A), failed to remove the associated kinase activity totally and the GRP94 phosphorylation was found to follow a monomolecular kinetics (data not shown). Therefore it was important to analyze if the 94-kinase was inherent to GRP94. An in situ renaturation assay was performed. The Ca2 + - calmodulin kinase (CamKII), an autophosphorylating kinase, was used as a positive control (Shackelford et al.. 1993). Recombinant CamKII and ConA purified GRP94 were separated by SDS-PAGE, transblotted onto a membrane and were subjected to denaturation and renaturation prior to in vitro kinase assay on the membrane. The alpha subunit of CamKII was phosphorylated following renaturation; in contrast, no label was detected in the gel lane containing GRP94 (Fig 3.8A). In another test, increasingly stringent buffers were used to immunoprecipitate GRP94 from NRK cell lysates. Kinase activity was retained in buffer A and B (Fig. 3.8B, lane 1 and 2); however, when the detergent concentration was substantially increased in buffer C, the 94-kinase activity was abolished (Fig. 3.8B, lane 3). The temperature dependence of the 94-kinase was also investigated. The optimal activity was detected at 30°C. with the activity progressively decreasing with higher temperatures, and only partial activity was retained at 50°C (Fig. 3.8C). Thus, the Mg2 + -dependent activity was found to be heat sensitive. These experiments suggests that the 94- 89 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. kinase phosphorylating GRP94 could be an associated protein. However, again it could not totally rule out the possibility that this activity was due to GRP94 autophosphorylation, since a labile autokinase can be easily destroyed on denaturation or on treatments with detergents. 3.3.9 Phosphopeptide map of in vitro phosphorylated GRP94 resembles in vivo labeled GRP94 The 94 kinase activity was monitored in GRP94 which was either immunoprecipitated or was purified by ConA affinity chromatography. For ConA purification HeLa total cell extracts were passed over ConA lectin affinity column. Since GRP94 has a high mannose oligosaccharide side chain, it binds to the lectin column with very high affinity. High salt wash o f the column gets rid of all the non-specific proteins. As shown in Fig. 3.9A, a single round of purification from total cell extract could purify GRP94 significantly. The 94- kinase activity was always detected in all the ConA fractions which contained GRJP94. To determine whether the same kinase activity was associated with GRP94 isolated by immuno- or ConA purification, I compared the phosphopeptide maps of phosphorylated GRP94 obtained from the two preparations. The protease chymotrypsin was used to cleave the labeled GRP94. As shown in Fig. 3.9B, both GRP94 preparations yielded nearly identical phosphopeptide maps with two major bands at 18- and 16-kDa. Further. 90 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. phospholabeled GRP94 from both NRK and HeLa cells exhibited the same pattern using chymotrypsin. The in vitro pattern (Fig. 3.9C, lane I) was highly similar to that derived from in vivo labeled GRP94 purified by immunoprecipitation or ConA affinity column (Fig. 3.9C, lanes 2 and 3). Similar phosphopeptide mapping of labeled GRP94 using V8 protease is shown (Fig. 3.9D). Interestingly, two of the labeled peptides (18- and 16- kDa) have molecular size similar to that reported for the autophosphorylated GRP94 map (Csermely et al., 1995). This analysis has to be repeated to acertain if the higher molecular weight peptides seen (25- and 21-kDa; Fig. 3.9D) have been completely digested. 3.3.10 The 94-kinase activity is stimulated by GRP78/BiP GRP78 is a major ER phosphoprotein modified at serine and threonine residues (Hendershot et al., 1988; Leustek et al., 1991) and phosphorylation plays an important role in regulation of its function as a chaperone in the ER. Expression o f GRP78 is coordinately regulated with GRP94 and these two proteins are known to associate with each other in multiprotein complexes in the ER. Thus, it is possible that GRP78 is a substrate of the 94-kinase. Since previously published results indicated a Ca2+ -dependent autophosphorylating activity of GRP78 from bovine liver (Leustek et al., 1991), I first determined whether this would also occur under our experimental conditions and potentially 91 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. compromise the interpretation of our data. The optimal Ca2 + concentration for GRP78 autophosphorylation was reported to be around 10 to 50 fiM and this activity was inhibited by Mg2 + For this study, I utilized recombinant GRP78 (rGRP78) expressed in the baculovirus system (Jarvis et al., 1993) and purified by HPLC. Addition of rGRP78 to the in vitro kinase reaction containing Mg2 + did not exhibit any autophosphorylating activity, nor was it able to phosphorylate an exogenous substrate such as histone HI (data not shown). Having established that rGRP78 does not autophosphorylate itself under our experimental conditions and that the chromatographically purified rGRP78 is unlikely to contain contaminating kinase activity, I tested whether GRP78 was a substrate for the 94-kinase. The in vitro kinase assays were performed in the presence of a constant amount of immunopurified GRP94 from THP-1 cells, histone H I, and increasing amounts (0.5 to 4 jag) of rGRP78. The results, as shown in Fig. 3.10A, lanes 1 to 4, indicated that rGRP78 is not a good substrate for the 94-kinase. Its phosphorylation could hardly be detected, or at best was seen at a very low level. However, the most striking result of this experiment is that increasing amounts of added rGRP78 results in a corresponding increase in the phosphorylation of GRP94 (Fig. 3.10A). The stimulative effect appears to be substrate-specific since the phosphorylation o f HI was minimally affected. The stimulative effect was also observed with increasing amounts of bacterially 92 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. expressed GRP78 (StressGen, Canada), however the magnitude of stimulation was slightly lower (Fig. 3.10A, lanes 8 to 10). Since the activation o f the 94- kinase is observed with rGRP78 obtained from very different sources, it is likely to be a genuine effect. To determine whether the observed stimulatory effect of rGRP78 is specific for the 94-kinase, we repeated the above experiment with the cdc2 kinase immunopurified from THP-1 cells. Increasing the amount of GRP78 did not affect the cdc2 kinase activity, as the amount of labeling detected in HI (a good substrate for the cdc2 kinase) did not change (Fig. 3.10 B, lanes 1 to 5). Interestingly, in contrast to the 94-kinase, the cdc2 kinase was able to phosphorylate rGRP78 in a dosage-dependent manner (compare Fig. 3.10A, lanes 1 to 4 to Fig. 3.10B, lanes 1 to 5). Thus, increasing the amount of rGRP78 from 0 to 4 jig in the kinase assay correlates with increased rGRP78 labeling by the cdc2 kinase (from 2-fold at 0.5ng GRP78 to 14-fold at 4 pg of GRP78). The data shown in Fig. 3.10 A and B were quantitated by densitometry scanning and are summarized in Fig. 3.11 A and C. The 94-kinase and cdc2 kinase activities were measured in terms of phosphorylation of GRP94 and HI respectively. Collectively, these results indicate that: (i) rGRP78 is not a good substrate for the 94-kinase; however, it can be effectively phosphorylated in a dosage-dependent manner by the cdc2 kinase; (ii) rGRP78 specifically 93 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. stimulates the phosphorylation o f GRP94 by the 94-kinase; (iii) the phosphorylation of GRP94 increases linearly with increasing amounts of rGRP78; (iv) rGRP78 does not affect the phosphorylation of HI by the cdc2 kinase. Having established that rGRP78 modulates the 94-kinase, I determined if other, non-specific proteins can modulate the 94-kinase activity in a dosage-dependent manner. For this purpose, I repeated the in vitro kinase assay in the presence of increasing concentrations o f bovine serum albumin (BSA) in place o f rGRP78 (Fig. 3.10 A, lanes 5 to 7, and Fig. 3.1 IB). Addition of BSA, as in the case of casein shown in Fig. 3.6A, did not affect the 94-kinase activity towards GRP94. The phosphorylation o f HI by the 94-kinase was also unaffected by BSA. Thus, the stimulatory effect on the 94-kinase is specific for GRP78. 3.4 D ISC U SSIO N GRP94 is a unusual glycoprotein, believed to occur as a transmembrane and as a luminal protein in the ER. It binds Ca2 + in superstoichiometric amounts and probably plays an important role in maintaining the Ca2 + homeostasis in the cell. GRP94 exhibits pleiotrophic functions such as a chaperone with an unique role in the protein processing pathway (Melnick et al., 1994), protects cell against Ca2 ~ depletion stress, helps in protein sorting and secretion and possibly 94 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. in signal transduction from ER to nucleus (Little and Lee, 1995). To understand how GRP94 exerts all these effects, I investigated whether GRP94, as in the case o f related HSP90 protein, was associated with a kinase activity. GRP94, both immunopurified and concanavalinA affinity purified was found to be associated with a serine kinase activity. Subcellular fractionation analysis indicated the kinase to copurify with GRP94 in purified ER membrane fractions. The 94-kinase is able to phosphoiylate the stress-induced forms of GRP94 with high efficiency correlating with their induction kinetics. Since GRP94 does not have any known consensus serine/threonine kinase domain the initial thought was that the 94-kinase had to be a protein associated with GRP94. In the cardiac sarcoplasmic reticulum (SR) GRP94 is found to be phosphorylated by CKII (Cala et al., 1994). HSP90 has been shown to interact with CK II and to help in enhancing its kinase activity (Miyata and Yahara, 1992). Further, both HSP90 and GRP94 have also been shown to be in vitro substrates for recombinant CKII (Shi e ta l., 1994). Therefore, I analyzed the 94-kinase for CKII like properties. Similar to CKII, the 94-kinase showed sensitivity to heparin and the ability to use GTP as well as ATP as phosphate donors, however, unlike CKII the 94-kinase was not stimulated by monovalent cations. Most importantly, the CKII substrate peptide and casein, two established CKII substrates used routinely to assay for CKII activity, are not substrates for the 94-kinase. Also, the in-gel 95 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. kinase analysis using casein as substrate failed to show CKII coprecipitating with GRP94. Using inhibitors, activator and peptide substrates of some other well known serine/threonine kinases I ascertained that the 94-kinase was a novel activity. The 94-kinase activity is very tightly associated with GRP94 and it persists even after chromatographic purification of GRP94 over ConA. All our analysis done so far shows GRP94 to be the best substrate of the 94-kinase and most efficiently phosphorylated by it. This raises the question as to whether GRP94 itself is a kinase. A 80-kDa, Mg^-dependent protein kinase isolated from porcine brain microvessels is reported to share high sequence identity with GRP94 (Dechert et al., 1994). Another work reported recently suggests that purified GRP94 is associated with a autophosphorylation activity that functions in the presence of Ca-~ or Mg-' (Csermely et al.. 1995). The Mg" -dependent autokinase activity is labile but can phosphorylate GRP94 much more efficiently than the heat stable Ca-_ r-dependent activity. However, this Mg'~- dependent autophosphorylation activity is severely impaired in gel purified and renatured GRP94. The 94-kinase activity reported here has similarities to this Mg2 ^-dependent autokinase activity of GRP94. Both are negatively affected by heat, denaturation, and high monovalent cations. Both activities can use ATP as well as GTP as phosphate donors. Both require millimolar concentrations of 96 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Mg2 *, are stimulated by histone, and not affected by hemin or H7. The phosphopeptide mappings o f GRP94 using V8 protease show some o f the labeled peptides of molecular size similar to that reported for the GRP94 autokinase activity (Csermely et al., 1995). This suggested that similar peptide substrates were phosphorylated by the kinases. The 94-kinase activity also seems to follow monomolecular kinetics (data not shown). However, unlike the Mg2" dependent autokinase activity, the 94-kinase is severely inhibited by double stranded DNA and heparin and persists even up to 20 mM o f Mg.2" Collectively, the evidence accumulated thus far is consistent with the hypothesis that GRP94 is associated with an efficient Mg2"-dependent, serine kinase activity, possibly due to autophosphorylation. If it is indeed autophosphorylation then this would be a kinase with a novel catalytic domain. The 94-kinase could be physiologically significant as the phosphopeptide map of GRP94 phosphorylated in vitro by the 94-kinase is highly similar to the in vivo labeled GRP94 and both are phosphorylated at the serine residue. Some o f the properties o f the 94-kinase I have identified may be relevant to the physiological role of GRP94 as a Ca2 + binding protein and molecular chaperone in vivo. First it is observed that the specific phosphorylation of GRP94 by the 94-kinase is negatively affected by high concentrations of Ca.2 + While the molecular basis for this is unknown, it could 97 permission of the copyright owner. Further reproduction prohibited without permission. be related to the observation that GRP94 exhibits differences in its conformation as a function of Ca2 + (Kang and Welch, 1991), which could affect the availability of its phosphorylation sites as well as the kinase activity. ER Ca2 + has also been implicated in the regulation of folding and maturation of some proteins transiting through the ER (Lodish et al., 1992). The phosphorylation state of GRP94, as regulated by the 94-kinase, can be coordinately regulated by ER Ca2 + through the 94-kinase, resulting in modulation of its molecular chaperone activity. GRP78 has been shown to act in tandem with GRP94 in the folding and assembly of multimeric proteins (Melnick et al., 1994). Our finding that GRP78 modulates the 94-kinase activity could be similar to the role of the E. coli stress proteins DnaK (heat-shock protein 70), DnaJ, and GroEL (heat shock protein 60) as part of a sequential collaboration along the pathway of chaperone-mediated protein folding (Langer etal., 1992). Is it possible that the 94-kinase is involved in ER to nucleus signaling? Depletion of ER Ca2 ~ store is a very potent inducer of the grp system (Drummond et al., 1987; Li et al., 1993). One could speculate that the 94-kinase or its downstream targets could mediate the signal from the ER to the nucleus. One possible mechanism is that the 94-kinase, which can be modulated by Ca2+ , could serve as a monitor for the ER Ca2+ concentration. When the Ca2 + 98 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. concentration is high inside the ER, there is no need to activate the GRP system mediated by the 94-kinase, thus its activity is suppressed. However, when the Ca2 ~ level is reduced, its kinase activity would be stimulated. This is consistent with in vitro observation that the 94-kinase activity is high in reactions with no Ca2 ^ but low in the presence o f high Ca2 + . For the signal to be transmitted out of the ER to the nucleus, the 94-kinase or its downstream target would need to modulate a transmembrane substrate, so that the signal is either transmitted out to the cytoplasm or directly to the nucleus. The intriguing property o f GRP94 as an ER localized protein which could also exist in a transmembrane configuration (Kang and Welch, 1991) raises the possibility that GRP94 could serve such a signaling function. This could explain why a reduction in the level of GRP94 in a ribozyme expressing cell line resulted in reduced expression of other coordinately regulated grp genes (Little and Lee, 1995). Alternatively, the major substrates for the 94-kinase may be other proteins and the signaling pathways are mediated through these yet unidentified proteins. The modulation of the 94-kinase activity by GRP78 could also be hypothesized to be part of the ER to nucleus signal cascade. Under normal conditions in a cell much of the GRP78 occurs as a phosphorylated, aggregated protein which is not bound to polypeptides. Under conditions of stress in the cell when malfolded and abnormal proteins are made, the GRP78 is converted to a dephosphorylated, 99 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. monomeric species that actively binds to the proteins accumulating in the ER. It is hypothesized that the ratio of GRP78 actively bound to proteins to its inactive, unbound form serves as a sensor that could turn on the ER to nucleus signaling. Since GRP78 is known to interact with GRP94 in vivo, any fluctuation in GRP78 interaction with GRP94 could be relayed to the GRP94 associated kinase activity. Thus the 94-kinase associated with GRP94 could be directly controlled by the amount of GRP78 present at any time. The current study has also revealed that in comparison to GRP94 and HI. recombinant GRP78 is not a preferred substrate for the 94-kinase. In contrast, the cdc2/cyclin A kinase can phosphorylate GRP78 efficiently in a dosage dependent manner. GRP78 is known to be associated with a Ca2 + dependent autophosphorylation activity (Leustek et al., 1991 ). However, recent evidence suggests that the in vivo phosphorylation of GRP78 cannot be attributed to its autophosphorylation (Gaut and Hendershot, 1993). Since GRP78 is a ER resident protein and is phosphorylated in the ER lumen, a cdc2-like activity in the ER is a likely candidate kinase for GRP78. While the yeast IRE1 protein is known to share sequence homologies with the cdc2 kinase protein family, it is difficult to envision how a transmembrane kinase with the kinase domain exposed to the cytoplasmic side could phosphorylate an ER lumen protein such as GRP78. So far a mammalian homologue of IRE 1 has not been identified. The identification 100 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. of the 94-kinase and other kinases such as the one responsible for GRP78 phosphorylation in mammalian cells will provide valuable information on how these ER proteins are modified and regulated. 101 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Table 3.1. Properties of the 94-kinase: Activation Inhibition No Effect Cation Dependence Mg2 + Ca2 + + + K+ + Effect of Kinase inhibitors / activators Heparin Double stranded DNA + + H7 + Hemin + Histone + Competition with Peptide Substrates Casein kinase II + Cyclic AMP dependent kinase + Ca--Calmodulin kinase + Protein Kinase C + Effect of Proteins GRP78 + Casein + BSA + 102 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Fig. 3.1. Phosphorylation of GRP94. (A) NRK total cell lysate were prepared from control (0), and tunicamycin treated cells for various duration as indicated on top (in h) (lanes 1 to 5). The proteins were separated by SDS-PAGE (8.5%) and stained with Coomassie Blue. (B) GRP94 was immunoprecipitated from 150 /xg NRK lysates described in A (lanes I to 5). The 94-kinase activity was measured by incubation with [y-32P]ATP in the presence of Mg2 + . The kinase reaction products were analyzed by SDS-PAGE (10%) followed by autoradiography. (C) Western blot analysis of the GRP94 protein immunoprecipitated from the NRK total cell lysate that were used in the kinase assay in B (lanes 1 to 5). (D) Phosphorylation of GRP94 in cells expressing ribozyme targeted against it. GRP94 was immunoprecipitated from either pRc/GRP cells stably transfected with the vector alone (v), or pRc/ribo-1 cells expressing the ribozyme (ribo). The cells were either grown under normal culture conditions (control) (lanes 1 and 2) or treated with tunicamycin (tuni) (lanes 3 and 4). Following in vitro kinase reaction in the presence of HI, the labeled protein were applied onto SDS-PAGE. (E) In vitro kinase assay of immunopurified GRP94 prepared from THP-1 control cells (0) (lane 1) or treated with A23187 for 2 and 8 h (lanes 2 and 3). (F) Immunopurified GRP94 from control and tunicamycin treated NRK cells (lanes 1 and 2) and from control and A23187 treated THP-1 cells (lanes 3 and 4) were subjected to in vitro kinase assays in the presence of 1.5 /xg of HI added as an exogenous substrate. The positions of GRP94, GRP78 and HI are indicated. 103 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. X - * .• I i - 90 rn n < U 3 O N ▼ o A e A © L U 09 104 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Ceil Lysate Protein A ▼ 1 Supernatant ▼ Ab Ab ▼ ▼ Protein A Protein A ▼ ▼ ppt ppt ▼ ▼ Kinase Kinase Rxn Rxn ▼ ▼ Sample A Sample B a-942 m 94 MH1 1 2 H94 3 a -1 a-942 i«Hl -215 ;*r-- 4 5 Fig. 3.2. Tight association of 94-kinase with GRP94. The two schemes used for the immunoprecipitation o f GRP94 are shown. Sample in B differed from A in that it was subjected to preclearing with protein A prior to immunoprecipitation. The immunoprecipitates were subjected to in vitro kinase assays in the presence o f Mg2+ and histone HI. Lanes 1 and 2. rabbit polyclonal anti-GRP94 (a-941 ) was used following schemes A and B, respectively. Lane 3, rat monoclonal anti-GRP94 (a-942) was used following scheme A, and rabbit anti-rat antibody was coupled to the primary antibody prior to the addition o f protein A. Lanes 4 and 5, rat monoclonal anti-integrin antibody (a-I) and (a-942) were used to immunoprecipitate [35S]methionine labeled NRK cell lysate, respectively. The immunoprecipitates were subjected to SDS-PAGE along with protein size markers. The positions o f GRP94, HI, and the protein size markers are indicated. 105 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. I 1 Fig.3.3. Phosphoamino acid analysis of GRP94. (A) Immunopurified GRP94 was incubated with either 12 (iCi o f [a-32P]ATP (lane 1) or [y-3 2 P]ATP (lane 2) in an in vitro kinase assay. The products were resolved by SDS-PAGE. The labeled GRP94 band is indicated. (B) The GRP94 protein band as shown in A, lane 2, was purified and subjected to phosphoamino acid analysis. The autoradiogram is shown. Positions o f phosphoserine, (P. Ser); phosphothreonine, (P. Thr); phosphotyrosine, (P. Tyr) are indicated. 106 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Sucrose Gradient 0.25 0.6 M 1.0 M 1.5 M 2.0 M Silver Stain Immunoblot Kinase Rxn I ------ 1 I I I IV f * kDa 1 & a Enriched membrane <494 4 94 1 2 3 Fig. 3.4. Isolation of ER fraction using discontinuous sucrose gradient. (A) Profile o f the sucrose gradient which was used to fractionate the ER membrane and the concentration o f sucrose in different layers is displayed. (B) In lanes 1, 2 and 3, the protein marker, total cell lysate and ER enriched membrane fraction was separated on a 8.5% polyacrylamide gel were silver stained. In lane 4, the ER fraction was subjected to Western blot analysis with monoclonal anti-GRP94 antibody. In lane 5, the ER fraction was first immunoprecipitated with anti-GRP94 antibody, the immunoprecipitate was then subjected to an in vitro kinase assay and the labeled products analyzed on SDS- PAGE. The positions o f phosphorylated GRP94 and HI are indicated by arrows. 107 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. K+ Heparin i -----------1 i 1 50 150 300 0.1 1.0 f'2 ‘ 3 4 5 6 l 2 Fig. 3.5. Comparison of properties of the 94-kinase and CKII. (A) In vitro kinase assays were performed with GRP94- immunoprecipitates in the presence o f a constant amount o f Mg2+ (10 mM) and HI (2.5 ^g), but increasing concentrations (0, 50,150 or 300 mM) o f K+ (lanes 1 to 4), 0.1 or 1.0 /ig/ml o f heparin (lanes 5 and 6). (B) The 94-kinase associated with the GRP94 immunoprecipitate was assayed in vitro using either ATP (lane 1) or GTP (lane 2) as phosphate donors. HI was not added as exogenous substrate in this analysis. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Fig. 3.6. Analysis of the 94-kinase and CKII activities with casein and CKII substrate peptide. (A) The 94-kinase activity derived from immunoprecipitation o f NRK total cell lysate with the anti-GRP94 antibody was assayed in the presence o f the indicated amounts (in g.g) o f dephosphorylated casein added as exogenous substrates. (B) The 94-kinase activity was assayed in the presence o f the indicated amounts (in fig) o f the CKII substrate peptide (RRREEETEEE). (C) The CKII activity derived from immunoprecipitation o f the NRK total cell lysate with the anti-CKII antibody was assayed in the presence o f a constant amount o f dephosphorylated casein (6 fig) and the indicated amounts (in fig) o f the CKII substrate peptide. The positions o f the phosphorylated GRP94 and casein are indicated.(D) The GRP94 (lane 2) and the CKII (lane 3) immunoprecipitates were separated over a 8% SDS-polyacrylamide gel, embedded with casein (0.5 mg/ml). Following renaturation o f the gel, the kinase activity was assayed on the gel. The arrow shows the position o f a protein kinase that phosphorylated the casein substrate. Lane 1, preimmune sera was used in the immunoprecipitation. The molecular size markers are positioned on the left side o f the autoradiogram. 109 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Casein B ~ „ C >_ Antibodies a-94 a-C K II O used in IP CKH-substrate CKII-substrate Competitor used 94 nentide 0 10 20 S.S-SETS 94 t H Casein 1 2 3 1 2 3 pentide i • 0 5 10 20 Casein 1 2 3 4 D Immunoprecipitation 1 1 p i 0 4 CKTI Antibodies kDa F1 “4 ^ used in IP CKII 1 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. • • * * *HI 1 ~2 1 2 3 4 5 6 Fig 3.7. The effect o f Mg2 + and Ca2 + on the 94-kinase activity. (A) Immunopurified GRP94 from NRK cells was subjected to in vitro kinase reaction in a buffer containing Ca2 + (50 mM Hepes, pH 7.4, 5 mM CaCl2 , and 0.1 mM ATP) (Csermely et ai, 1995) (lane 1) or in a buffer containing Mg2 + used throughout this study (50 mM Tris, pH 7.4, 10 mM MgCl,, 1 mM DTT, and 0.1 mM ATP) (lane 2). (B) In vitro kinase assays were performed using different concentrations o f Mg2 + as indicated on top. (C) Same as (B) except varying concentrations o f Ca2 + was added to the Mg2 + containing buffer. The positions of GRP94, and histone H 1 are indicated in the autoradiograms. HI I 2 3 R eproduced with perm ission o f the copyright owner. Further reproduction prohibited without perm ission. In situ Renatu ration B IP Wash Temperature 105 — 70- g * 43- B 21 30 37 50 °C >94 194 Fig 3.8. Sensitivity of the Mg2 + -dependent 94-kinase to denaturating reagents and heat. (A) Phosphorylation assays following in situ denaturation and renaturation o f recombinant CamKII (lane 2) and ConA purified GRP94 on Immobilon-P membranes (lane 3). The protein size markers are indicated (lane 1). (B) Increasingly stringent buffers were used to immunoprecipitate GRP94. Buffer A contained 0.15 M NaCl, 0.05 M Tris, pH 7.5, and 0.5% NP40 (lane 1); buffer B contained 0.15 M NaCl, 0.05 M Tris, pH 7.5, 1% NP40, 0.5% deoxycholate, and 0.1% SDS (lane 2); buffer C was the same as buffer B except that the concentration o f SDS was increased to 0.4% (lane 3). (C) Effect o f temperature on the 94-kinase. GRP94 immunoprecipitated from NRK cells were subjected to in vitro kinase assay at the various temperatures indicated for 45 min. The position o f phosphorylated GRP94 is indicated. 112 R eproduced with perm ission of the copyright owner. Further reproduction prohibited without perm ission. Fig. 3.9. Purification and Phosphopeptide mapping of GRP94. (A) HeLa total cell extracts devoid o f nucleus were purified using the scheme shown using ConA affinity chromatography. A silver stained gel showing the protein profile of the ConA bound fraction is shown. Lane 1 is the crude lysate while in lanes 2 to 5 increasing concentration o f ct-methyl-D-mannoside was used to elute the proteins that were bound to ConA. The arrow shows the position o f GRP94 protein. (B) GRP94 immunopurified from NRK (lane 1) or ConA purified from HeLa cell extracts (lane 2) were used in in vitro kinase reactions. The phosphorylated GRP94 was digested with the protease chymotrypsin (10 gg). The position o f the peptides and size markers are indicated (C) Comparison o f in vitro and in vivo phosphopeptides generated by chymotrypsin digestion o f GRP94 purified from NRK cell extracts. Lane 1, phosphopeptides o f in vitro labeled Con A purified GRP94; lane 2, phosphopeptides of GRP94 immunopurified from in vivo 3 2 P labeled cell extracts; lane 3, phosphopeptides o f ConA affinity purified GRP94 from in vivo labeled cell extract. The protein size markers and the two predominant phosphopeptides are indicated. (D) GRP94 was immunopurified from NRK cell lysates and phosphorylated in vitro. The labeled GRP94 were recovered from SDS-PAGE and digested with increasing concentartions ( lanes 1 and 2 have 6 and 10 gg respectively) o f the V8 protease and separated by a 15% SDS-PAGE along with protein size markers. The position o f peptides are indicated. perm ission of the copyright owner. Further reproduction prohibited without perm ission. A GRP94 Purification HeLa Cell Extract ConA Fractions I Concanavalin A Chromatography I Elution with a-D-M ethvlmannoside V ^ ® ® V ft' V N* kDa 94) - 1 6 1 2 3 4 5 Chymotrypsin Digest V8 Protease Digest I --------------------1 B In vitro c 1 £ In vivo kD a IP ConA kDa IP ConA 45 28 D In vitro kDa1 R eproduced with perm ission of the copyright owner. Further reproduction prohibited without perm ission. Anti-GRP94 B Anti-Cdc2 Baculo GRP78 BSA i ------------------ 1 i ---------------1 0 0.5 1.0 4.0 0.5 1.0 4.0 1 Bacterial GRP78 1 0 1.0 2.0 Baculo GRP78 0 0.51.0 2.0 4.0 941 Hll 1 78 1 2 3 4 5 6 7 8 9 10 HI 1 2 3 4 5 Fig. 3.10. Effect of rGRP78 on the 94-kinase activity. (A) GRP94 was immunoprecipitated from the THP-1 cells and subjected to in vitro kinase assay. Two exogenous substrates, increasing amounts o f baculo-expressed rGRP78 (lanes 1 through 4 have 0, 0.5, 1.0, and 4.0 /zg, respectively) and a constant amount o f histone HI (2 /zg) throughout, were used in the kinase assay along with [y-3 2P]ATP. Similar analysis was done in lanes 5 to 7 (0.5, 1.0, and 4.0 /zg respectively) using BSA instead o f GRP78. In lanes 8 through 10 the effect of bacterial rGRP78 (0, 1.0 and 2.0 pg) was tested on the 94-kinase activity (B) cdc2 kinase was immunoprecipitated from THP-1 cells and was subjected to the in vitro kinase assay, performed with increasing concentrations o f rGRP78 as described in panel B. Lanes 1 through 5 have 0, 0.5,1, 2, and 4 /zg o f rGRP78, respectively, and histone HI (2 /zg throughout). The phosphoproteins were analyzed by 12% SDS- PAGE. The positions of GRP94 (94), GRP78 (78), and histone (HI) are indicated. 115 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 15 10 ■ a rGRP78 (|ag) BSA(pg) 0 1 2 3 4 rGRP78 (|ag) Fig. 3.11. Quantitative interpretation of the rGRP78 effect on 94-kinase (A), (B) and (C) are the graphical presentation of data shown in Fig. 3.10. In A and B the 94-kinase activity was measured by quantifying the intensity of the labeled 94 protein band. In panel A the 94-kinase activity is plotted against the increasing concentration of bacterial (.....) or baculo (----- ) rGRP78, while in panel B increasing amounts of BSA was used instead. The 94-kinase activity, without the addition of rGRP78 or BSA was set at 1. (C) The cdc2 kinase activity as measured by quantitation of the labeled HI band is plotted against the increasing concentration of baculo-rGRP78. 116 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. SUMMARY The growing understanding of the functions and regulation of the glucose regulated protein family has helped to underscore the importance of these proteins in mammalian cells. The grps in the ER along with the cytosolic hsps serve as molecular sensors which helps the cells to survive under many adverse conditions. Many of the stress protein can bind to other cellular proteins and function as. chaperones. These chaperones are emerging as important molecules that are involved at all stages in cellular metabolism including protein synthesis and maturation, in rearrangements of cellular macromolecules, during functional cycles of assembly and disassembly and finally in targeting proteins for degradation (Gething and Sambrook, 1992). GRP94, an abundant ER protein and a member of the grp family, which is the focus of this dissertation is also found to have all the required characteristics of a molecular chaperone. It has been found to interact with many different target protein. In fact many o f the protein being processed in ER are found to interact with multiple chaperones. A well studied example of this is the assembly of immunoglobulin chains where both GRP94 and GRP78 are involved (Melnick et al., 1992). Both these chaperones were however found to have an unique role in this folding process (Melnick et al., 1994) with GRP78 assisting in the early steps 117 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. of the polypeptide folding and GRP94 is involved in the more advanced steps in the folding pathway. Since GRP94 is found to interact with a wide variety of target proteins in conjunction with other GRP family members in the ER, it is conceivable that the general mechanism of protein folding could involve a step where other chaperones in the ER including GRP78, pass on their partially folded target proteins to GRP94 for final assembly and release. The function of GRP94 as a chaperone has started unraveling only in the last 3 years or so. Identification of more target proteins and generation and characterization of more systems with modulated levels of GRP94 will enable further testing of these hypothetical models. Another interesting aspect of the grp family is the coordinate regulation of their genes. The classical example of such a regulation are grp94 and grp78 genes, which are induced with identical kinetics by a wide variety of agents disrupting ER function (Lee et al., 1987). The reasons for such a regulation have been speculated, but not well understood. The analysis done so far on grp94 and grp78 promoters, including my study here, collectively suggests that two regions, the core and the proximal CCAAT motif, out o f the multiple array of regulatory elements are important for their basal level expression and inducibility ( Chang et al., 1989; Ramakrishnan et al., 1995; Wooden et al., 1991). In correlation with its importance, the core region is highly conserved among the family members. Both 118 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. in vitro and in vivo analyses of the grp78 and grp94 promoters have shown that some of the factors binding to the conserved core region and the proximal CCAAT motif are common to both the promoters. This suggested a common mechanism of regulation of the two gene promoters where similar cis- regulatory elements of the grp78 and grp94 promoters bind similar factors and are coordinately regulated. The subtle differences observed between grp94 and grp78 promoters could be explained to be either due to binding of factors unique to the two promoter which could modulate their activity specifically or due to differences in the binding capacity of a common factor. For example, the CCAAT binding factor CBF binds with much higher affinity to grp78 rather than grp94 (Ramakrishnan et al., 1995; Roy and Lee, 1994) and could account for grp94 being a weaker promoter of the two. Since other grp promoters are found to have similar promoter organization with GC rich sequence, multiple CCAAT motifs and a region of high homology amongst *hem, it will be interesting to see if other members of this family are also regulated similarily. Widely different inducers of grps like Ca2 + depleting agents, glycosylation blockers, etc. do not show a synergistic activation when used in combination, suggesting that either they activate a single signal transduction pathway or that multiple pathways are activated which ultimately converge together before it affects the gene. GRP inducers including tunicamycin, glucose starvation and 119 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. even calcium ionophore interfere with the protein glycosylation which is required for proper folding o f proteins. Other grp inducing agents like amino acid analogues, DTT, p-mercaptoethanol cause accumulation o f abnormal protein in ER. It is therefore thought the malfolded proteins, synthesized by all the grp inducers, serve as the primary trigger for the signal cascade from ER which results in increased transcription of grp genes in the nucleus. This hypothesis was put to test by directly by expressing abnormal or malfolded proteins in cells and studying the effect of this on grp promoters. The malfolded proteins were found to induce the expression of grps and this effect was found to be at the transcriptional level (Kozutsumi et al., 1988; Ramakrishnan et al., 1995; Wooden e ta i, 1991). Although some knowledge of what happens following an ER stress has been gained at the grp promoter level, the components of the intra-cellular signaling cascade from ER to nucleus are not known in the mammalian system. Through genetic complementation analysis in S. Cerevesiae a transmembrane serine/threonine kinase (IREl/Em l) was identified to mediate the malfolded protein response to KAR2 gene which is a homologue of GRP78 in yeast (Cox et al., 1993; Mori et al., 1993). Although the IREl homologue in mammalian cells is not yet identified, the importance of both serine/threonine and tyrosine kinases was shown by using specific inhibitors of kinases and phosphatase. 120 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. The characteristics of 94-kinase which are described in chapter III, suggests that it could be physiologically relevant. The peptide sites phosphorylated in GRP94 by the 94-kinase in vitro are similar to the sites phosphorylated in GRP94 in vivo. This observation underscores the importance of identifying the 94-kinase. GRP94 was recently identified to have an inherent kinase activity (Csermely et al., 1995). Also, many other ATP binding stress proteins have been found to have autophosphorylation activity. Although we observed the 94-kinase to have some similarities with the GRP94 autophosphorylation activity, we could not positively conclude that the 94-kinase is inherent to GRP94. To resolve this issues, it is important to have very pure or recombinant GRP94. GRP94 is a good candidate for being one of the components of the ER to nuclear signal cascade as it is a transmembrane protein. It is therefore conceivable that the status of GRP94 phosphorylation could be sensed by a cytosolic or nuclear component of the cascade which would then govern the turning on/off of the signaling. The importance of the 94-kinase is suggested by the modulation of its activity by Ca2 + and GRP78 which are thought to play a role in signaling in v/vo.The 94-kinase activity decreases with increasing concentrations of Ca2 + and is inhibited totally at concentrations known to exist in vivo in the ER. This correlates with the observation that the signal for induction is turned on following the depletion of the Ca2 + store. Similarity, GRP78 known to interact with GRP94 121 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. serves as a sensor for ER stress. Thus the 94-kinase activity could be directly controlled by amounts of GRP78 present at any time. Our study showing phosphorylation o f GRP78 by cdc2 kinase, gives a clue to search for the kinase phosphorylating GRP78 (78-kinase) in vivo. The phosphorylation of GRP78 plays a major role in regulation of its chaperone function. The inactive form of GRP78 is in a phosphorylated, aggregated form, while the active form is a monomeric, dephosphorylated species (Hendershot et al., 1988). Although GRP78 was found to be autophosphorylating kinase, this activity does not phosphorylate GRP78 in vivo (Gaut and Hendershot, 1994). So, the search for the kinase phosphorylating GRP78 is still ensuing. It will be interesting to search for a cdc2 like kinase that could phosphorylate GRP78, in the ER. 122 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. REFERENCES Bidwai, A.P., Hanna, D.E. and Glover, C.V.C. (1992) Purification and characterization of casein kinase II (CKII) from Acka-l, Acka-2 Saccharomyces cerevisiae rescued by Drosophila CBCII subunit. J. Biol. Chem. 267 : 18790- 18796. Blond-Elguindi, S., Fourie, A.M., Sambrook, J.F., and Gething, M-J.H. (1993) Peptide dependent stimulation of the ATPase activity of the molecular chaperone BiP is a result of conversion o f oligomers to active monomers. J. Biol. Chem. 268 : 12730-12735. Boyle, W.J., Vander-beer, P., Hunter, T. (1991) Phosphopeptide mapping and phosphoamino acid analysis by two-dimensional separation on a thin-layer cellulose plates. Meth. inEnz. 201: 110-149. Cala, S. E. and Jones, L.R. (1994) GRP94 residues within cardiac sarcoplasmic reticulum vesicles is phosphorylated by casein kinase II. J. Biol. Chem. 269 : 5926-5931. Campbell, A.K. (1983) Intracellular calcium: its universal role as regulator. John Wiley & sons, Inc., New York. Cao, X., Zhou, Y. and Lee, A.S. (1995) Requirement of tyrosine- and serine/threonine kinases in the transcriptional activation of the mammalian grp78/BiP promoter by thapsigargin. J. Biol. Chem. 270 : 494-502. Chang, S.C., Erwin, A. and Lee, A.S. (1989) The glucose regulated protein genes (GRP94 and GRP78) share common regulatory domains and are coordinately regulated by common trans-acting factors. Mol. Cell. Biol. 9 : 2153-2162. Chang, S.C., Wooden, S.K., Nakaki, T., Kim, Y. K., Lin, A.Y., Kung, L.. Attenello, J.W. and Lee, A.S. (1987) Rat gene encoding the 78 kDa glucose regulated protein GRP78 : its regulatory sequence and effect of glycosylation on its expression . Proc. Natl. Aca. Sci. 84 : 680-684. Chodosh, L.A., Baldwin, A.S., Carthew, R.W. and Sharp, P.A. (1988) Human CCAAT-binding proteins have heterologous subunits. Cell 53 : 11-24. 123 permission of the copyright owner. Further reproduction prohibited without permission. Chuck, S.L. and Lingappa, V.R. (1992) Pause transfer : a topogenic sequence in apolipoprotein B mediates stopping and restarting o f translocation. Cell 68 : 9- 21. Cox, J.S., Shamu, C.E. and Walter, P. (1993) Transcriptional induction of genes encoding endoplasmic reticulum resident proteins requires a transmembrane protein kinase. Cell 73 : 1197-1206. Crute, B.E. and Buskirk, R.G.V. (1992) A casein kinase II-like kinase phosphorylates (3-tubulin and may be a microtubule-associated protein. J. Neurochem. 59 : 2017-2023. Cseremely, P. and Kahn, R.C. (1991) The 90-kDa heat shock protein (hsp90) possesses an ATP binding site and autophosphorylating activity. J. Biol Chem. 266 : 4943-4950 Csermely, P., Miyata, Y., Schnaider, T. and Yahara, I. (1995) Autophosphorylation of grp94 (endoplasmin). J. Biol. Chem. 270 : 6381-6388. Dechert, U., Weber, P., Konig, B., Ortwein, C., Nilson, I., Linxweiler, W., Wollny, E. and Gassen, H.G. (1994) A protein kinase isolated from porcine brain microvessels is similar to a class of heat shock proteins. Eur. J. Biochem. 225 : 805-809. Deshaies, R.J., Koch, B. D., Wemer-Washbume, M., Craig, E. A. and Schekman, R. (1988) A subfamily of stress proteins facilitates translocation of secretory and mitochondrial precursor polypeptides. Nature 332 : 800-805. Di Nocera, P.P. and David, I.B. (1983) Transient expression of genes introduced into cultured cells of drosophila. Proc. Natl. Aca. Sci. 80 : 7095- 7098. Drummond, I.A.S., Lee, A.S., Resendez, E. and Steinhardt, R.A. (1987) Depletion o f intracellular calcium stores by calcium ionophore A23187 induces the genes for glucose regulated proteins in hamster fibroblasts. J. Biol. Chem. 262: 12801-12805. 124 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Flynn , G.C., Chappell, T.G. and Rothman, J.E. (1989) Peptide binding and release by proteins implicated as catalyst of protein assembly. Science 245 : 385-390. Freiden, P.J., Gaut, J.R. and Hendershot, L. (1992) Interconversion of three differentially modified and assembled forms o f BiP. EMBOJ. 11 : 63-70. Gatica, M., Hinrichs, M.V., Jedilcki, A., Allende, C.C. and Allende, J. E. (1993) Effect o f metal ions on the activity of casein kinase II from Xenopus laevis. FEBS Letters 315 : 173-177. Gaut, J. R. and L. M. Hendershot. (1993) The immunoglobulin-binding protein in vitro autophosphorylation site maps to a threonine within the ATP binding cleft but is not a detectable site o f in vivo phosphorylation. J. Biol. Chem. 268 : 12691-12698. Gething, M-J., McCammon, K. and Sambrook, J. (1986) Expression of wild type and mutant forms o f influenza hemagglutinin: the role o f folding in intracellular transport. Cell 46 : 939-950. Gething, M-J. and Sambrook, J. (1992) Protein folding in the cell. Nature 355 : 33-45. Gomer, C.J., Ferrario, A., Rucker, N., Wong, S. and Lee, A.S. (1991) Glucose regulated protein induction and cellular resistance to oxidative stress mediated by porphyrin photosensitization. Cancer Res. 51 : 6574-6574. Gorman, C.M., Moffat, L.F. and Howard, B.H. (1982) Recombinant genomes which express chloroamphenicol acetyltransferase in mammalian cells. Mol. Cell. Biol. 2 : 1044-1051. Haugejorden, S.M., Srinivasan, M. and Green, M. (1991) Analysis of the retention signal o f the two resident luminal endoplasmic reticulum proteins by in vitro mutagenesis. J. Biol. Chem. 266 : 6015-6018. Hall, C.V., Jacob, P.E., Ringold, G.M. and Lee, F. (1983) Expression and regulation o f escherichia coli lacZ gene fusions in mammalian cells. J. Mole. Appl. Genet. 2 : 101-109. 125 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Hatamochi, A., Golumbek, P.T., Schatingen, E.V. and de Crombrugghe, B. (1988) A CCAAT DNA binding factor consisting of two different componenets that are both required for DNA binding. J. Biol. Chem. 263 : 5940-5947. Hendershot, L.M. (1990) Immunoglobulin heavy chain and binding protein are dissociated in vivo by light chain addition. J. Cell. Biol. I l l : 829-837. Hendershot, L., Ting, J. and Lee, A.S. (1988) Identity of the immunoglobulin heavy chain binding proteins with the 78000 dalton glucose regulated protein and the role of post-translational modification in its binding function. Mol. Cell. Biol. 8 : 4250-4256. Hou, M.C., Shen, C.H., Lee, W.C. and Lai, Y.K. (1993) Okadaic acid as an inducer o f the 78 kDa glucose regulated protein in 9L rat brain tumor cells. J. Cell. Biochem. 51 : 91-101. Jarvis, D., Summers , M.D., Garcia , Jr.A. and Bohlmeyer, D.A. (1993) Influence o f different signal peptides and prosequences on expression and secretion o f human tissue plasminogen activator in the baculovirus system. J. Biol. Chem. 268 : 16754-16762. Kameshita, I. and Fujisawa, H. (1989) A sensitive method for detection of calmodulin dependent protein kinase II activity in sodium dodecyl-sulfate polyacrylamide gel. Anal. Bioc. 183 : 139-143. Kang, H. and Welch, W.J. (1991) Characterization and purification of the 94 kDa glucose regulated protein. J. Biol. Chem. 266 : 5643-5649. Kingston, R.E., Schuetz, J J . and Larin, Z. (1987) Heat-inducible human factor that binds to a human hsp70 promoter. Mol. Cell. Biol. 7 : 1530-1534 Koch, G., Smith, M., Macer, D., Webster, P. and Mortara, R. (1986) Endoplasmic reticulum contains a common, abundant calcium binding glycoprotein, Endoplasmin. J. Cell. Sci. 86 : 217-232. Koizumi, M., S. Iwai and E. Ohtsuku. (1988) Construction of a series of several self cleaving RNA duplexes using synthetic 21-mers. FEBS Lett. 228 : 228- 230. 126 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Koyasu, S., Nishida, E., Miyata, Y., Sakai, H. and Yahara, I. (1989) HSP 100, a 100 kDa heat shock protein is a Ca2 + -calmodulin regulated actin binding protein. J. Biol. Chem. 264 : 15083-15087. Kozutsumi, Y., Segal, M., Normington, K., Gething, M.J. and Sambrook, J. (1988) The presence of malfolded proteins in the endoplasmic reticulum signals the induction o f glucose-regulated proteins. Nature 332 : 462-464. Kuenzel, E. A. and E. G. Krebs. (1985). A synthetic peptide substrate specific for casein kinase II. Proc. Natl. Acad. Sci. USA 82 : 737-741. Langer, T., Lu, C., Flanagan, J., Hayer, M. K. and Hartl, F. U. (1992) Successive action of DnaK, DnaJ and GroeL along the pathway o f chaperone mediated protein folding. Nature 356 : 683-689. Lee, A.S. (1981). The accumulation of three specific proteins related to glucose- regulated proteins in temperature-sensitive hamster mutant cell line. J. Cell. Physiol. 106: 119-125. Lee, A.S. (1987) Coordinated regulation of a set of genes by glucose and calcium ionophores in mammalian cells. Trend. Biochem. 12 : 20-23. Lee, A.S. (1992) Mammalian stress response: induction of the glucose regulated protein family. Curr.Opi.CellBiol. 4 : 267-273. Lee, A.S., Bell, J. and Lin, A.Y. (1984) Biochemical characterization of two hamster glucose regulated proteins. J. Biol. Chem. 259 : 4616-4621. Lee, A. S., Delegeane, A.M., Baker, V. and Chow, P.C. (1983) Transcriptional regulation of two genes specifically induced by glucose starvation in a hamster mutant fibroblast cell line. J. Biol. Chem. 258 : 597-603. Lee, A.S., Wells, S., Kim, K.S. and Scheffler, I.E. (1986) Enhanced synthesis of the glucose/calcium regulated proteins in a hamster cell mutant deficient in transfer of oligosaccharide core to polypeptides. J.Cell Physiol. 129 : 277-282. Leustek, T., Lu, C., Flanagan, J., Hayer, M.K. and Hartl, F.U. (1992) Successive action of DnaK, DnaJ, and GroEL along the pathway of chaperone-mediated protein folding. Nature 356 : 683-689. 127 R eproduced with perm ission of the copyright owner. Further reproduction prohibited without perm ission. Leustek, T., Toledo, H., Brot, N. and Weissbach, H. (1991) Calcium-dependent autophosphorylation of the glucose-regulated protein, Grp78. Arch. Biochem. Biophy. 289 : 256-261. Lewis, M.J., Mazzerella, R.A. and Green, M. (1985) Structure and assembly of the endoplasmic reticulum. The synthesis o f three major endoplasmic reticulum proteins during lipopolysaccharide induced differentiation of murine lymphocytes. J. Biol. Chem. 260 : 3050-3057. Li, W.W. (1994) Thesis. University o f Southern California, Los Angeles, CA. Li, W.W., Alexandre, S., Cao, X. and Lee, A.S. (1993) Transactivation of grp78 promoter by Ca2 + depletion. J. Biol. Chem. 268 : 12003-12009. Li, X.A. and Lee, A.S. (1991) Competitive inhibition of a set of endoplasmic reticulum protein genes (GRP78, GRP94 and Erp72) retards cell growth and lowers viability after ionophore treatment. Mol. Cell. Biol. 11 : 3446-3453. Li, Z. and Srivatsava, P.K. (1993) Tumor rejection antigen gp96/grp94 is an ATPase : implication for protein folding and antigen presentation. EMBO J. 12 : 3143-3151. Lindquist, S. and Craig, E.A. (1988) The heat shock proteins. Ann. Rev. Genet. 22: 631-677. Little, E. and A. S. Lee. (1995) Generation of a mammalian cell line deficient in glucose regulated protein stress induction through targeted ribozyme driven by a stress-inducible promoter. J. Biol. Chem. 270 : 9526-9534. Liu, E.S. and Lee, A.S. (1991) Common sets of nuclear factors binding to the conserved promoter sequence m otif o f two coordinately regulated ER protein genes , GRP78 and GRP94. Nucl. Aci. Res. 19 : 5425-5431. Liu, E.S., Ou, J.H. and Lee, A.S. (1992) Brefeldin A as a regulator of grp78 gene expression in mammalian cells. J. Biol. Chem. 267 : 7128-7133. Lodish, H. F., Kong, N. and Wikstroem, L. (1992) Calcium is required for folding o f newly made subunits o f the asialoglycoprotein receptor within the endoplasmic reticulum. J. Biol. Chem. 267 : 12753-12760. 128 R eproduced with perm ission of the copyright owner. Further reproduction prohibited without perm ission. Lum, L.S.Y., Sultzman, L.A., Kaufman, R.J., Linzer, D.I.H. and Wu, B.J. (1990) A cloned human CCAAT-box-binding factor stimulates transcription from the human hsp70 promoter. Mol. Cell. Biol. 10 : 6709-6717. Maity, S.N. and de Crombrugghe, B. (1992) Biochemical analysis of the subunit of the heteromeric CCAAT binding factor. J. Biol. Chem. 267 : 8286-8296. Maity, S.N., Vuorio, T. and de Crombrugghe, B. (1990) The P subunit of a rat heteromeric CCAAT-binding transcription factor shows striking sequence identity with the yeast Hap-2 transcription factor. Proc. Natl. Aca. Sci. USA 87 : 5378-5382. Mazzerelia, R.A. and Green, M. (1987) ERp99, an abundant, conserved glycoprotein of the endoplasmic reticulum is homologous to the 90 kDa heat shock protein (hsp90) and the 94 kDa glucose regulated protein (GRP94). J. Biol. Chem. 262 : 8875-8883. McKnight, S.L., Lane, M.D. and Gluecksohn-waelsch, S. (1989) Is CCAAT/enhancer-binding protein a central regulator of energy metabolism? Genes and Devel. 3 : 2021-2024. Melnick, J., Ariel, S. and Argon, Y. (1992) The endoplasmic reticulum stress protein GRP94 in addition to BiP, associates with unassembled immunoglobulin chains. J. Biol. Chem. 267 : 21303-21306. Melnick, J., Dul, J. L. and Argon, Y. (1994) Sequential interaction o f the chaperones BiP and GRP94 with immunoglobulin chains in the endoplasmic reticulum. Nature 370 : 373-375. Menoret, A., K. Meflah. and J. Le-Pendu. (1994) Expression of the 100-kDa glucose regulated protein (GRPlOO/endoplasmin) is associated with tumorigenicity in a model of rat colon adenocarcinoma. Intl. J. Cancer. 56 : 400-405. Miyata, Y. and Yahara, I. (1992) The 90-kDa heat shock protein, HSP90, binds and protects casein kinase II from self aggregation and enhances its kinase activity. J. Biol. Chem. 267 : 7042-7047. 129 R eproduced with perm ission of the copyright owner. Further reproduction prohibited without perm ission. Mori, K., Ma, W., Gething, M.J., and Sambrook, J. (1993) A transmembrane protein with a cdc2/CDC28 related kinase activity is required for signaling from the ER to the nucleus. Cell 73 : 1197-1206. Mori, K., Sant, A., Kohno, K., Normington, K., Gething, M.J. and Sambrook, J. (1992) A 22 bp cis-acting element is necessary and sufficient for the induction o f the yeast KAR2 (BiP) gene by unfolded proteins. EMBOJ. 11 : 2583-2593. Munro, S. and Pelham, H.R.B. (1987) A C-terminal signal prevents secretion of luminal ER proteins. Cell 48 : 899-907. Nakaki, T., Deans, R. and Lee, A.S. (1989) Enhanced transcription of the glucose regulated protein (GRP78) gene and the association of GRP78 with immunoglobulin light chains in non-secreting B cell myeloma line (NS-1). Mol. Cell. Biol. 9 : 2233-2238. Navarro, D., Paz, P. and Pereira, L. (1992) Domains of herpes simplex virus I glycoprotein B that function in virus penetration, cell-cell spread, and cell fusion. Virology 186 : 99-112. Navarro, D., Qadri, I. and Pereira, L. (1991) A mutation in the ectodomain of herpes simplex virus I glycoprotein B causes defective processing and retention in the endoplasmic reticulum. Virology 184 : 253-264. Ng, D.T.W., Randall, R.E. and Lamb, R.A. (1989). Intracellular maturation and transport of the SV5 type II glycoprotein hemagglutinin-neuraminidase: specific and transient association with GRP78-BiP in the endoplasmic reticulum and extensive internalization from cell surface. J. Cell. Biol. 109 : 3273-3289. Nigam, S.K., Goldberg, A.L., Ho, S., Rhode, M.F., Bush, K.T. and Sherman, M. Y. U. (1994). A set of endoplasmic reticulum proteins possessing properties of molecular chaperone includes Ca2 + binding proteins and member of the thioredoxin superfamily. J. Biol. Chem. 269 : 1744-1749. Norrild, B. (1980) Immunochemistry o f herpes simplex virus glycoprotein. Curr. Top. Micro. Immuno. 90 : 67-106. Ou, W.-J., Thomas, D.Y., Bell, A.W. and Bergeron, J. J. M. (1992) Casein kinase II phosphorylation of signal sequence receptor a and the associated membrane chaperone calnexin. J. Biol. Chem. 267 : 23789-23796. 130 R eproduced with perm ission of the copyright owner. Further reproduction prohibited without perm ission. Pelham, H.R.B. (1989) Control of protein exit from the endoplasmic reticulum. Ann. Rev. Cell. Biol. 5 : 1-23. Pellet, P. E., Kousoulas, K.G., Pereira, L. and Roizman, B. (1985) Anatomy of the her mnpes simplex virus 1 strain F glycoprotein B gene: primary sequence and predicted protein structure o f the wild type and of monoclonal antibody resistant mutants. J. Virol. 53 : 243-253. Pereira, L., Ali, M., Kousoulas, K., Huo, B. and Banks , T. (1989) Domain structure of herpes simplex virus 1 glycoprotein B: neutralizing epitopes map in regions of continuous and discontinuous residues. Virology 172 : 11-24. Pinna, L. A. (1990) Casein kinase 2: 'an eminence grise’ in cellular regulation? Biochem. Biophys. Acta. 1054 : 267-284. Price, B. D. and S. K. Calderwood. (1992) Gadd45 and Gaddl53 messenger RNA levels are increased during hypoxia and after exposure of cells to agents which elevate the levels o f the glucose-regulated proteins. Cancer Res. 52 : 3814-3817. Qadri, I., Gimeno, C., Navarro, D. and Pereira, L. (1991) Mutation in conformation-dependent domains of herpes simplex virus 1 glycoprotein B affect the antigenic properties, dimerization, and cell-surface transport of the molecule. Virology 180 : 135-152. Qu, D., R. A. Mazzarella. and Green, M. (1994) Analysis o f the structure and synthesis of GRP94, an abundant stress protein of the endoplasmic reticulum. DNA and Cell Biol. 13 : 117-124. Ramakrishnan, M., Tugizov, S., Pereira, L. and Lee, A. S. (1995) Conformation defective herpes simplex virus 1 glycoprotein B activates the promoter of the grp94 gene that codes for the 94-kD stress protein in the endoplasmic reticulum. DNA and Cell Biology. 14 : 373-384. Resendez, E. Jr., Attenello, J.W., Grafsky, A., Chang, C.S. and Lee, A.S. (1985) Calcium ionophore A23187 induces expression of the glucose-regulated genes and their heterologous fusion genes. Mol. Cell. Biol. 5 : 1212-1219. 131 R eproduced with perm ission of the copyright owner. Further reproduction prohibited without perm ission. Resendez, E., Jr., Ting, J., Kim, K. S., Wooden, S. K. and A. S. Lee. (1986) Calcium ionophore A23187 as a regulator o f gene expression in mammalian cells. J. Cell. Biol. 103 : 2145-2152. Roll, D.E., Murphy, B.J., Laderoute, K.R., Sutherland, R.M. and Smith, H.C. (1991) Oxygen regulated 80 kDa protein and glucose regulated 78 kDa protein are identical. Mol. Cell. Biochem. 103 : 141- 148. Rothman, J.E. (1989) Peptide chain binding proteins: Catalysts of protein folding and related processes in cells. Cell 59 : 591-601. Roy, B. and Lee, A.S. (1995) Transduction o f calcium stress through interaction of the human transcription factor CBF with the proximal CCAAT regulatory element of the grp78/BiP promoter. Mol. Cell. Biol. 15 : 2263-2274. Sambrook, J., Fritsch, E.F. and Maniatis, T. (1989) Molecular cloning: a laboratory manual, 2 nd ed. Cold Spring Harbour Laboratory, Cold Spring Harbour, N.Y. Sanders, S.L., Whitfield, K.M., Vogel, J.P., Rose, M.D. and Schekman, R.W. (1992) Sec61p and BiP directly facilitate polypeptide translocation into the ER. Cell 69 : 353-365. Santoro, C., Mermod, N., Andrews, P.C. and Tijian, R. (1988) A family of human CCAAT binding proteins active in transacription and DNA replication: cloning and expression o f multiple cDNAs. Nature 334 : 218-224. Sarmiento, M., Haffey, M. and Spear, P.G. (1979) Membrane proteins specified by herpes simplex viruses III. Role o f glycoprotein VP7 (B2) in virion infectivity. J. Virol. 29 : 1149-1158. Schaiff, W.T., Hruska, K.A., McCourt, W.D., Green, M., and Schwartz B.D. (1992) HLA-DR associates with specific stress proteins and is retained in endoplasmic reticulum in invariant chain negative cells. J. Exp. Med. 176 : 657- 666. Schneider, I. (1972) Cell lines derived from late embryonic stages o f drosophila melanogester. J. Embryol. Exp. Morphol. 27 : 353-365. 132 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Shackelford, D. and Zivin, J.A. (1993) Renaturation of the calcium/calmodulin- dependent kinase activity after electrophoretic transfer from sodium dodecyl- sulfate-polyacrylamide gels to membrane. Anal. Biochem. 211: 131-138. Shapiro, D.J., Sharp, P. A., Wahli, W. W. and Keller, M. J. (1988). A high efficiency HeLa nuclear transcription extract. DNA 7 : 47-55. Shi, Y., E. D. Brown., and Walsh, C.T. (1994) Expression o f recombinant human casein kinase II and recombinant heat shock protein 90 in Escherichia coli and characterization of their interaction. Proc. Natl. Acad. Sci. USA 91 : 2767-2771. Shiu, R.P.C., Pouyssegur, J. and Pastan, I. (1977) Glucose depletion accounts for the induction o f two transformation sensitive membrane proteins in rous sarcoma virus transformed chick embryo fibroblasts. Proc. Natl. Aca. Sci. USA 74 : 3840-3844. Shrivatsava, A. and Calame, K. (1994) An analysis of genes regulated by the multi-functional transcriptional regulator Yin Yang-1. Nuc. Aci. Res. 22 : 5151- 5155. Suto, R. and Srivastava, P.K. (1996) A mechanism for the specific immunogenecity of heat shock protein-chaperoned peptides. Science 269 : 1585-1588. Ting, J. (1987) Thesis. University of Southern California, Los Angeles, CA. Vuorio, T., Maity, S.N. and de Crombrugghe, B. (1990) Purification and molecular cloning o f the A-chain of a rat heteromeric CCAAT-binding protein. J. Biol. Chem. 265 : 22480-22486. Wang, J., Lee, A.S. and Ou, J.-H. (1991) Proteolytic conversion o f hepatitis B virus antigen precursor to end-product occurs in a post-endoplasmic reticulum compartment. J. Virol. 1 ^ 1 JJ Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Welch, W.J., Garrels, J.I., Thomas, G.P., Li, J.C. and Feramisco, J. (1983) Biochemical characterization of the mammalian stress proteins as glucose- and Ca2 + - ionophore-regulated proteins. J. Biol. Chem. 258 : 7102-7111. Wooden, S.K. and Lee, A.S. (1992) Comparison o f the genomic sequence organization of the rat grp78 and hsc73 gene and their evolutionary implications. DNA sequence 3 : 41-48. Wooden, S.K., Li, L.J-., Navarro, D., Qadri, I., Pereira, L. and Lee, A.S. (1991) Transactivation o f the grp78 promoter by malfolded proteins, glycosylation block and calcium ionophore is mediated through a proximal region containing a CCAAT motif which interacts with CTF/NF-1. Mol. Cell. Biol. 11 : 5612- 5623. Zandomeni, R. and Weinmann, R. 1984. Inhibitory effect of 5, 6-dichioro-l-p- D-ribofuranosylbenzimidazole on a protein kinase. J. Biol. Chem. 259 : 14804- 14811. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.

Linked assets

University of Southern California Dissertations and Theses

Conceptually similar

PDF

A coactivator complex among GRIP1, CARM1, and TIF1alpha contributes to gene activation directed by androgen receptor

PDF

Biochemical and molecular analysis of two glucose-regulated proteins (GRPs)

PDF

Anomalies at NGX6 locus: Potential involvement in feline lymphomas

PDF

Characterization of the interactions between cellular proteins and hepatitis C virus core protein.

PDF

Biochemical factors determining tumor response to 5,10-dideazatetrahydrofolate, a folate antimetabolite inhibitory to de novo purine biosynthesis

PDF

Cell cycle regulation of histone gene expression

PDF

Development of replication -competent retroviral vectors for efficient, targeted gene therapy of cancer

PDF

An in vivo study of G protein coupled receptor mediated signaling

PDF

Analysis of multistep mammary tumorigenesis in Wnt1 transgenic mice: The role of fibroblast growth factor-8 in oncogenesis and apoptosis

PDF

Transcriptional induction of the 78 kiloDalton glucose regulated protein (grp78) gene through depletion of intracellular calcium ion from endoplasmic reticulum

PDF

Molecular mechanism of genomic imprinting in somatic cell cultures

PDF

A Study Of The Mechanism Of Lead Chromate Induced Neoplastic Transformation Of C3H/10T1/2 Mouse Embryo Cells

PDF

Characterization of H3abp and its binding site: A complex that specifically binds a cell cycle regulatory element of the hamster histone H3.2 promoter

PDF

A POU gene expressed in the early sea urchin embryo: Structure, evolution and requirement for embryonic development

PDF

Characterization of signal input and signal output domains of phosphorus 160 coactivators

PDF

An E2F-independent mechanism in transcriptional control of the hamster histone H3.2 gene expression

PDF

Changes of DNA methylation patterns during human development and transformation.

PDF

Characterization of the physiological ligand and function of a novel opsin RGR from the retinal pigment epithelium

PDF

Analysis of Sonic hedgehog/Patched-1 downstream genes in embryonic feather morphogenesis and the development of novel biotechnologies thereof

PDF

A model for the mechanism of agonism and antagonism in steroid receptors

Asset Metadata

Creator Ramakrishnan, Meera (author)

Core Title Analysis of the function and regulation of the 94kDa glycoprotein of the glucose-regulated protein family.

Degree Doctor of Philosophy

Publisher University of Southern California (original), University of Southern California. Libraries (digital)

Tag biology, cell,biology, molecular,OAI-PMH Harvest

Language English

Contributor Digitized by ProQuest (provenance)

Advisor Lee, Amy S. (committee chair), Roy-Burman, Pradip (committee member), Stallcup, Michael R. (committee member), Stellwagen, Robert H. (committee member)

Permanent Link (DOI) https://doi.org/10.25549/usctheses-c17-528472

Unique identifier UC11352970

Identifier 9705167.pdf (filename),usctheses-c17-528472 (legacy record id)

Legacy Identifier 9705167.pdf

Dmrecord 528472

Document Type Dissertation

Rights Ramakrishnan, Meera

Type texts

Source University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Access Conditions The author retains rights to his/her dissertation, thesis or other graduate work according to U.S. copyright law. Electronic access is being provided by the USC Libraries in agreement with the au...

Repository Name University of Southern California Digital Library

Repository Location USC Digital Library, University of Southern California, University Park Campus, Los Angeles, California 90089, USA