University of Southern California Dissertations and Theses

Three antibody-based immunotherapeutic modalities for malignancies

(USC Thesis Other)

Three antibody-based immunotherapeutic modalities for malignancies

PDF

Download a page range

Download transcript

Copy asset link

Request this asset

Transcript (if available)

Content

THREE ANTIBODY-BASED IMMUNOTHERAPEUTIC MODALITIES
FOR MALIGNANCIES

by

Nan Zhang

A Dissertation Presented to the
FACULTY OF THE GRADUATE SCHOOL
UNIVERSITY OF SOUTHERN CALIFORNIA
In Partial Fulfillment of the
Requirements for the Degree
DOCTOR OF PHILOSOPHY
(PATHOBIOLOGY)

May 2006

Copyright 2006 Nan Zhang
UMI Number: 3237188
3237188
2007
UMI Microform
Copyright
All rights reserved. This microform edition is protected against
unauthorized copying under Title 17, United States Code.
ProQuest Information and Learning Company
300 North Zeeb Road
P.O. Box 1346
Ann Arbor, MI 48106-1346
by ProQuest Information and Learning Company.
DEDICATION
To my husband, Fa Li

ii
ACKNOWLEDGEMENTS
I would like to deeply thank my mentors, Dr. Alan L. Epstein, Dr. Peisheng Hu,
and Dr. Leslie Khawli, for their guidance, support, valuable advice, and patience
throughout my entire training.
I also want to sincerely thank the members of my graduate committee, Dr. Alan
L Epstein, Dr. Leslie Khawli, Dr. Frank Markland, and Dr. Louis Dubeau for their
valuable suggestions for all of my projects.
I would also like to thank James Pang, for his tireless efforts in all my animal
studies.
I am always deeply grateful for being able to work with Meg Flanagan, Robyn
Arias, Rebecca Sadun, and Amy Liu, whom I have spent most time with during my
graduate training. These graduate students supported me in every aspect. I am also
very fortunate to have such great opportunities to interact with them and learn from
them.
I would also like to thank Lisa Doumak, for her consistent care for the graduate
students throughout the whole training process.
Lastly, I want to thank my husband Fa Li, for his love, support, and company.

iii
TABLE OF CONTENTS

DEDICATION----------------------------------------------------------------------------------ii

ACKNOWLEDGEMENTS ------------------------------------------------------------------iii

LIST OF TABLES-----------------------------------------------------------------------------vi

LIST OF FIGURES---------------------------------------------------------------------------vii

ABSTRACT-------------------------------------------------------------------------------------ix

CHAPTER 1:INTRODUCTION------------------------------------------------------------- 1
REFERENCES----------------------------------------------------------------12

CHAPTER 2: GENERATION OF RITUXIMAB POLYMER MAY CAUSE
HYPER-CROSSLINKING-INDUCED APOPTOSIS IN NON-HODGKIN’S
LYMPHOMAS--------------------------------------------------------------------------------13

ABSTRACT-----------------------------------------------------------------13
INTRODUCTION-----------------------------------------------------------14
MATERIALS AND METHODS-------------------------------------------17
RESULTS---------------------------------------------------------------------27
DISCUSSION-------------------------------------------------------------39
REFERENCES-------------------------------------------------------------44

CHAPTER 3: LYM-1 INDUCED CASPASE-INDEPENDENT APOPTOSIS IN
NON-HODGKIN’S LYMPHOMA---------------------------------------------------------48

ABSTRACT-------------------------------------------------------------------48
INTRODUCTION------------------------------------------------------------49
MATERIALS AND METHODS ------------------------------------------53
RESULTS---------------------------------------------------------------------58
DISCUSSION-----------------------------------------------------------------69
REFERENCES---------------------------------------------------------------73

iv
CHAPTER 4: TNT-3/CD137L AND FC/CD137L FUSION PROTEINS FOR THE
IMMUNOTHERAPY OF EXPERIMENTAL SOLID TUMOR------------------------83

ABSTRACT-------------------------------------------------------------------83
INTRODUCTION------------------------------------------------------------84
MATERIALS AND METHODS ------------------------------------------86
RESULTS---------------------------------------------------------------------94
DISCUSSION---------------------------------------------------------------110
REFERENCES--------------------------------------------------------------115

CHAPTER 5: SUMMARY AND FUTURE DIRECTIONS---------------------------122

BIBLIOGRAPHY---------------------------------------------------------------------------132

v
LIST OF TABLES

Table 1: Summary of monoclonal antibodies used for immunotherapy 3

Table 2: Induction of apoptosis in CD20
+
and CD20
–
cell lines by Rituximab
monomer, dimer, and polymer preparations

35

Table 3: Percentage of lymphocyte populations among all detected tumor
infiltrating lymphocytes at day 23 post tumor implantation

105

vi
LIST OF FIGURES

Figure 1-1: Mechanisms of mAb-mediated killing

4
Figure 1-2: Apoptosis: the 'extrinsic' and 'intrinsic' pathways to caspase activation

7
Figure 2-1: Rituximab hyper-cross-linking–induced apoptosis of Raji
lymphoma cells

28
Figure 2-2: Analysis of Rituximab polymer and dimer preparations

30

Figure 2-3: Extent of CD20 clustering on Raji cell surface shown by
immunofluorescence microscopy

36
Figure 2-4: Tissue biodistribution and tumor uptake of Rituximab polymer,
dimer, and monomer at 72 hours postinjection in Raji
lymphoma–bearing nude mice

38
Figure 2-5: Rituximab polymer, dimer, and monomer immunotherapy in Raji
xenograft model

39

Figure 3-1: Lym-1 and chLym-1 induced apoptosis of human B lymphoma
cells

59
Figure 3-2: Mitochondrial depolarization induced by Lym-1

61
Figure 3-3: Lym-1 induced apoptosis is not inhibited by caspase inhibitors
zV AD-FMK and zDEVD-FMK

63

Figure 3-4: Flow cytometric analysis of caspase-3 activation in Raji lymphoma
cells following treatment with Lym-1 at different time points

66
Figure 3-5: Comparison of Lym-1 and Rituximab staining patterns shown by
indirect immunofluorescence microscopy

68
Figure 3-6: Lym-1 and Rituximab immunotherapy in Raji xenograft model 69

vii
Figure 4-1: Schematic diagram of the construction and final assembly of the
murine TNT-3/CD137L and Fc/CD137L fusion protein

95
Figure 4-2: In vitro stimulation of IL-2 production by CD137L fusion proteins
and tissue biodistribution and tumor uptake of TNT-3/CD137L
and Fc/CD137L

99
Figure 4-3: Dose response of TNT-3/CD137L, Fc/CD137L, and 2A in Colon
26-bearing BALB/C mice.

102
Figure 4-4: Survival study of TNT-3/CD137L and Fc/CD137L in Colon 26
tumor-bearing BALB/C mice

103
Figure 4-5: H&E staining of tumors from control, TNT-3/CD137L, and
Fc/CD137L treated mice.

106
Figure 4-6: Immunohistochemical staining of gramzyme B-positive cells

107
Figure 4-7: Combinational immunotherapy of CD137L fusion proteins with
CD4
+
and CD8
+
cells depletion.

109

viii
ABSTRACT

The major goal of this thesis is to generate novel reagents for the
immunotherapy of cancer using three different antibody-based strategies.
The induction of apoptosis has been regarded as one of the most important
mechanisms that cause tumor regression. Based on the observation that the induction
of apoptosis in lymphoma

cells requires proper presentation of anti-CD20, we have
generated a novel Rituximab Polymer that induces apoptosis in non-Hodgkin’s
lymphoma cells. Biodistribution study has shown that this polymer targeted Raji
tumor, and immunotherapeutic study has demonstrated that systemic delivery of
Rituximab Polymer induced tumor regression in vivo.
Anti-HLA-DR monoclonal antibody Lym-1 and its mouse human chimeric
version, chLym-1, have shown to be potent apoptosis inducers. The apoptosis
induced by Lym-1 in Raji cells involves mitochondria and is caspase-independent.
In vivo, Lym-1 induced significant tumor regression in Raji-bearing nude mice.
A TNT-3/CD137L fusion protein was genetically constructed, purified, and
characterized. In vitro bioactivity of the CD137L moiety was confirmed. This
TNT-3/CD137L fusion protein showed increased tumor uptake over 48 hours in
colon 26 tumor-bearing mice. Our results indicated that systemic administration of

ix
TNT-3/CD137L induced tumor regression significantly and prolonged the survival of
treated mice. Such anti-tumor effects of CD137L fusion proteins are achieved
primarily through the activation of CD8
+
T cells.
In conclusion, the three antibody-based immunotherapeutic strategies described
have shown great anti-tumor potential that may be translated into future clinical
treatments for cancer.

x
CHAPTER 1
INTRODUCTION
Despite a century of advances in the understanding and treatment of cancer,
improving cancer therapy remains one of the most critical challenges facing
scientists and physicians. Cancer cells are characterized by six different hallmarks,
including self-sufficiency in growth signals, insensitivity to growth-inhibitory signals,
evasion of apoptosis, limitless replicative potential, sustained angiogenesis, and
tissue invasion with metastasis (1). Although traditional chemotherapy and radiation
therapy have met with some success ，the need remains for treatment modalities with
lower toxicity and increased specificity and effectiveness. Over the past 50 years,
strategies of using immunological approaches to attack tumors have emerged and
have significantly advanced modern cancer therapy.
In the 1950s, the first application of immunotherapy to cancer imaging and
treatment involved the use of polyclonal antibodies, even though they were poorly
defined due to their heterogeneous nature. It was not until the seminal discovery of
hybridoma technology by Kohler and Milstein in 1975 that the use of monoclonal
antibodies (mAbs) became a practicable reality, making it possible to produce large
quantities of identical antibodies directed against specific antigens (2). Over the past
20 years, the identification and molecular characterization of tumor antigens has
progressed dramatically. More than 2,000 tumor antigens have been identified, many
of which are capable of eliciting an anti-tumor immune responses in patients (3).

1
In contrast to chemotherapy (and to some degree to radiotherapy), antibodies
with sufficient antigen specificity can preferentially bind to tumor cells over normal
tissues. This specificity may allow for targeted killing of malignant cells and relative
sparing of unbound normal tissues. Recent years have witnessed the development of
a variety of promising immunotherapies for treating patients with malignancies
(Table 1). Foremost among these advances is the exciting success of monoclonal
antibodies directed against lymphocyte surface antigens.
Monoclonal antibodies bind to antigens specifically and with high affinity, via
the complementary determining regions of the Fab arms. mAbs achieve therapeutic
effects through indirect and direct mechanisms. Indirect effects include recruiting
cytotoxic effector cells (antibody-dependent cell mediated cytotoxicity, ADCC) and
complement (complement dependent cytotoxicity, CDC) using the antibody’s Fc arm,
resulting in phagocytosis and cytolysis of tumor cells. Direct effects of mAbs include
blockage of growth factor receptors on the cell surface, which leads to the arrest of
tumor cell proliferation (4), and induction of apoptosis, by triggering a cascade of
intracellular signaling events (5-7) (Figure 1-1).

2
Table 1. Summary of monoclonal antibodies used for immunotherapy (8).

Antibody
Specificity
(antigen)
Target cell/
disease
Type
(chimerized, etc)
Edrecolomab
(Panorex®)
17-1A antigen

Colon/rectal
cancer
Murine IgG2a

Trastuzumab
(Herceptin®)
HER2
oncoprotein

Breast
cancer
Humanized
murine IgG1
Anti-idiotype
antibodies

Individual
patients' B-cell
tumor antigens
B-cell
lymphoma

Customized
murine mAb

CAMPATH-1 CD52 antigen CLL Humanized IgG1
Rituximab
(Rituxan®)
CD20 antigen

NHL

Chimeric human/
murine IgG1
Anti-B1
(Tositumomab)
a

B1 antigen

NHL

Mouse IgG

LYM-1
a
HLA-DR
antigen
NHL Murine IgG2a
LL2
(Epratuzumab)
a,
b

CD22 antigen

NHL

Murine IgG2a

Anti-CD33
(Hu-M195)
a

CD-33 antigen

Acute/chronic
myelogenous
leukemia
Humanized
mAb

Hu1D10
(Remitogen)
HLA-DR NHL Humanized mAb
Ibritumomab
Tiuxetan
b, c

(Zevalin
TM

IDEC-Y2B8)
CD20 antigen

NHL

Chimeric human/
murine IgG1

a
131
I-conjugated; b
90
Y-conjugated;

c
111
In-conjugated; CLL: chronic lymphocytic
leukemia

3
Figure 1-1. Mechanisms of mAb-mediated killing. Binding of mAbs to antigens on
the target cell can induce complement binding (via C1), trigger ADCC by
macrophages, or natural killer cells or initiate signaling; the latter may cause
apoptosis or growth arrest (9).

Apoptosis, or programmed cell death, plays a crucial role in physiological
growth control and regulation of tissue homeostasis. It is also known as a cellular
control mechanism by which cells died if damage to DNA can not be repaired
successfully. In the immune system, apoptosis is also essential throughout the whole
process of lymphoid development, generation and termination of immune response.
For example, T and B lymphocytes during development are destined to die, unless a
rescue signal was engaged to the cell through a functional antigen receptor after gene

4
rearrangements (10). The lymphocytes with functional receptors are further screened
by individual receptor specificity, and cells bearing ‘self-reactive’ receptors undergo
apoptosis to protect the body from inappropriate assault. After a normal immune
response, mature lymphocytes are still subjected to apoptotic death primarily via
homeostatic mechanisms to balance the relative representation of various
components of the immune system (10).
By nature, apoptosis is the non-inflammatory removal of cells. It is achieved by
the activation of various intracellular pathways leading to the self-destruction of cells.
Classically, two major pathways to apoptosis have been identified: the death receptor
‘extrinsic’ pathway and the mitochondrial ‘intrinsic’ pathway (Figure 1-2) (5, 9,
11-13). The extrinsic pathway is triggered by the engagement of death receptors,
which includes CD95 and TNF-related apoptosis-inducing ligand (TRAIL)-R1/-R2,
resulting in the recruitment of an adaptor protein Fas-associated Death Domain
(FADD) to the death receptor within the cytoplasm. FADD further recruits and
activates initiator caspase-8, followed by caspase-3 activation. By contrast, the
intrinsic pathway is triggered by various stress signals that lead to the perturbation of
mitochondria and the subsequent release of proteins, such as cytochrome c, second
mitochondria-derived activator of caspase (Smac), and DIABLO from the
inter-mitochondrial membrane space into the cytoplasm. The release of these
proteins from mitochondria is partially controlled by the balance of Bcl-2 family
members, with anti-apoptotic (Bcl-2 and Bcl-XL) and pro-apoptotic (Bax and Bak)
members inhibiting or promoting the release, respectively. Once released,

5
cytochrome c binds to apoptotic protease-activating factor 1 (Apaf1), resulting in the
formation of the Apaf1 −caspase-9 apoptosome complex and the activation of the
initiator caspase-9. Smac/DIABLO indirectly activates caspase-9 by inhibiting the
inhibitor of apoptosis protein (IAP) which negatively regulates the activation of
caspase-9 and caspase-3. The activated initiator caspases-9 then activates the effector
caspases, which are responsible for the degradation of a variety of cellular proteins
necessary to maintain cell survival and integrity. Cross-talk exists between these two
pathways. For example, activated caspase-8 can cleave a cytoplasmic protein called
Bid followed by the ligation of a death receptor. The truncated Bid (tBid) further
translocates into mitochondria inner membrane and upregulates Bax and Bak, thus
activating the mitochondria pathway. However, irrespective of how apoptosis is
initiated, the intracellular signals always converge at the steps of caspases activation.
Caspases are a family of cysteine proteases that cleave their substrate after
aspartidyl residues, playing a crucial role during the execution phase of apoptosis.
They are divided into initiator caspases and effector caspases. Initiator caspases
(includes caspase-2,-8,-9, and -10) exert a regulatory role during apoptosis by
activating the effector caspases, and effector caspases (includes caspase-3,-6, and -7)
are responsible for the cleavage of important cellular substrates resulting in the
classical biochemical and morphological changes associated with the apoptotic
phenotype. Those changes include the exposure of phosphatidylserine (PS) to the
outer leaflet of the cytoplasmic membrane, compaction of chromatin, DNA
Laddering caused by inter-nucleosomely cuts by activated endonucleases, and finally,

6
cell shrinkage and fragmentation into apoptotic bodies which are subject to
phagocytosis and digestion by macrophages or neighboring reticuloendothelial cells.

Figure 1-2. Apoptosis: the 'extrinsic' and 'intrinsic' pathways to caspase activation
(13).

Chapters 2 and 3 discuss immunotherapeutic strategies which promote the
apoptosis of cancer cells. Apoptosis, as discussed above, is a natural process that
enables the deletion of excess cells or cells that have undergone excessive rounds of
replication. Importantly, it is evident that physiologic pathways leading to apoptosis

7
in normal cells are redundant (14-18). This redundancy may hold important
implications for the development of anti-tumor strategies, since the loss of one
apoptotic pathway in cancer cells may be compensated for by another. Apoptosis
appears to be triggered by different mechanisms in diverse cell types. In the human B
lymphocyte, apoptosis is normally induced by binding of anti-idiotypic antibodies to
surface B cell receptors. The appearance of anti-idiotypic antibodies in the
circulation is caused by the overproduction of antibody necessitating a decrease in
the number of antibody producing cells as a homeostatic response. In Chapter 2, a
new formulation of the anti-lymphoma antibody, Rituximab, is described which
utilizes this normal apoptosis induction pathway of B cells. In comparison with
native Rituximab, this new formulation induces apoptosis of lymphoma cells directly
upon binding to the cell surface by presenting a high valency reagent capable of
mobilizing CD20 into lipid rafts, a pre-requisite for apoptosis induction in B cells. In
Chapter 3, another anti-lymphoma antibody, Lym-1, originally generated in our
laboratory, is studied for its therapeutic effects in vitro and in vivo. This antibody,
which is directed against cell surface HLA-Dr, binds antigen already present in lipid
rafts and therefore induces apoptotic cell death directly upon binding to lymphoma
cells. This characteristic of Lym-1 is responsible for its increased immunotherapeutic
efficacy in tumor-bearing nude mice. Detailed characterization of apoptosis by
Lym-1 is described in an attempt to identify the major apoptotic pathways associated
with lymphoma cell death by this antibody.

8
While Chapter 2 and 3 focus on the usage of mAb by itself for the treatment of
malignancies through the induction of apoptosis, Chapter 4 describes a completely
different immunotherapeutic approach that harnesses the existing immunologic
mechanisms. In this approach, a novel antibody fusion protein was generated that
binds to necrotic regions of tumors and delivers a key co-stimulatory molecule to
activate an effective anti-tumor response.
In an attempt to target a common antigen associated with solid tumors, our
laboratory has developed a new approach that exploits the permeability of necrotic
cells to enable entry and binding of anti-nuclear antibodies, designated Tumor
Necrosis Treatment (TNT) (19, 20), this approach relies on the accumulation of
necrotic debris is characteristically found in all solid tumors (20), Tumor Necrosis
Treatment is therefore has the potential for diagnosing and targeting to most human
malignancies. To date, various cytokines including IL-2 (21), IL-12 (22), IFN- γ (23),
a chemokine molecule LEC (24, 25), and a costimulatory molecule H60 for NK cells
(in press) have been conjugated to TNT-3 antibody through genetic engineering, and
these fusion proteins have shown optimal tumor targeting over time with varying
levels of immunotherapeutic effectiveness. In an effort to improve upon these results,
a novel fusion protein was developed consisting of the TNT antibody and the potent
T cell costimulator CD137L. This particular fusion protein is designed to break T cell
tolerance in the tumor microenvironment. The genetic engineering, purification, and
characterization of this reagent are discussed in Chapter 4.

9
Finally, Chapter 5 summarizes current studies and discusses future directions
for these novel antibody-based immunotherapeutic modalities. Concluding remarks
discuss the clinical potential of the three antibody-based tumor targeting strategies
which may in the future be developed for the treatment of cancers and related
diseases.

CHAPTER 1 REFERENCES:

1. Hanahan, D. and Weinberg, R. A. The hallmarks of cancer. Cell, 100: 57-70,
2000.
2. Kohler, G. and Milstein, C. Continuous cultures of fused cells secreting
antibody of predefined specificity. Nature, 256: 495-497, 1975.
3. Yang, F. and Yang, X. F. New concepts in tumor antigens: their significance
in future immunotherapies for tumors. Cell Mol Immunol, 2: 331-341, 2005.
4. Albanell, J., Codony, J., Rovira, A., Mellado, B., and Gascon, P. Mechanism
of action of anti-HER2 monoclonal antibodies: scientific update on
trastuzumab and 2C4. Adv Exp Med Biol, 532: 253-268, 2003.
5. Strasser, A., O'Connor, L., and Dixit, V . M. Apoptosis signaling. Annu Rev
Biochem, 69: 217-245, 2000.
6. Wyllie, A. H. Apoptosis: an overview. Br Med Bull, 53: 451-465, 1997.
7. Saikumar, P., Dong, Z., Mikhailov, V ., Denton, M., Weinberg, J. M., and
Venkatachalam, M. A. Apoptosis: definition, mechanisms, and relevance to
disease. Am J Med, 107: 489-506, 1999.

10

8. White, C. A., Weaver, R. L., and Grillo-Lopez, A. J. Antibody-targeted
immunotherapy for treatment of malignancy. Annu Rev Med, 52: 125-145,
2001.
9. Cragg, M. S., French, R. R., and Glennie, M. J. Signaling antibodies in cancer
therapy. Curr Opin Immunol, 11: 541-547, 1999.
10. Sohn, S. J., Rajpal, A., and Winoto, A. Apoptosis during lymphoid
development. Curr Opin Immunol, 15: 209-216, 2003.
11. Fulda, S. and Debatin, K. M. Apoptosis signaling in tumor therapy. Ann N Y
Acad Sci, 1028: 150-156, 2004.
12. Martin, D. A. and Elkon, K. B. Mechanisms of apoptosis. Rheum Dis Clin
North Am, 30: 441-454, vii, 2004.
13. Mak, T. W. and Yeh, W. C. Signaling for survival and apoptosis in the
immune system. Arthritis Res, 4 Suppl 3: S243-252, 2002.
14. Haura, E. B., Cress, W. D., Chellappan, S., Zheng, Z., and Bepler, G.
Antiapoptotic signaling pathways in non-small-cell lung cancer: biology and
therapeutic strategies. Clin Lung Cancer, 6: 113-122, 2004.
15. Zakeri, Z. and Lockshin, R. A. Cell death during development. J Immunol
Methods, 265: 3-20, 2002.
16. Cheng, L. E., Chan, F. K., Cado, D., and Winoto, A. Functional redundancy
of the Nur77 and Nor-1 orphan steroid receptors in T-cell apoptosis. Embo J,
16: 1865-1875, 1997.
17. Susin, S. A., Daugas, E., Ravagnan, L., Samejima, K., Zamzami, N., Loeffler,
M., Costantini, P., Ferri, K. F., Irinopoulou, T., Prevost, M. C., Brothers, G .,
Mak, T. W., Penninger, J., Earnshaw, W. C., and Kroemer, G. Two distinct
pathways leading to nuclear apoptosis. J Exp Med, 192: 571-580, 2000.

11

18. Kinchen, J. M., Cabello, J., Klingele, D., Wong, K., Feichtinger, R., Schnabel,
H., Schnabel, R., and Hengartner, M. O. Two pathways converge at CED-10
to mediate actin rearrangement and corpse removal in C. elegans. Nature, 434:
93-99, 2005.
19. Epstein, A. L., Chen, F. M., and Taylor, C. R. A novel method for the
detection of necrotic lesions in human cancers. Cancer Res, 48: 5842-5848,
1988.
20. Epstein, A. L., Khawli, L. A., Chen, F. M., Hu, P., Glasky, M. S., and Taylor,
C. R. Tumor necrosis imaging and treatment of solid tumors. In: V. P.
Torchilin (ed.), Handbook of Targeted Delivery of Imagng Agents., V ol. 16,
pp. 259. Boca Raton: CRC Press, 1995.
21. Hornick, J. L., Khawli, L. A., Hu, P., Sharifi, J., Khanna, C., and Epstein, A.
L. Pretreatment with a monoclonal antibody/interleukin-2 fusion protein
directed against DNA enhances the delivery of therapeutic molecules to solid
tumors. Clin Cancer Res, 5: 51-60, 1999.
22. Lee, S. J., Myers, L., Muralimohan, G., Dai, J., Qiao, Y ., Li, Z., Mittler, R. S.,
and Vella, A. T. 4-1BB and OX40 dual costimulation synergistically stimulate
primary specific CD8 T cells for robust effector function. J Immunol, 173:
3002-3012, 2004.
23. Mizokami, M. M., Hu, P., Khawli, L. A., Li, J., and Epstein, A. L. Chimeric
TNT-3 antibody/murine interferon-gamma fusion protein for the
immunotherapy of solid malignancies. Hybrid Hybridomics, 22: 197-207,
2003.
24. Li, J., Hu, P., Khawli, L. A., and Epstein, A. L. Complete regression of
experimental solid tumors by combination LEC/chTNT-3 immunotherapy
and CD25(+) T-cell depletion. Cancer Res, 63: 8384-8392, 2003.
25. Li, J., Hu, P., Khawli, L. A., and Epstein, A. L. LEC/chTNT-3 fusion protein
for the immunotherapy of experimental solid tumors. J Immunother, 26:
320-331, 2003.

12
CHAPTER 2
GENERATION OF RITUXIMAB POLYMER MAY CAUSE HYPER-
CROSSLINKING-INDUCED APOPTOSIS IN NON-HODGKIN’S
LYMPHOMAS
ABSTRACT
Although Rituximab has produced significant tumor regressions

in lymphoma
patients, only 50% respond. Clinically, it has been

shown that the major mechanism
of action of Rituximab is antibody-dependent

cytotoxicity requiring presentation by
Fc-bearing cells. To

improve the clinical efficacy of Rituximab for the treatment

of
CD20
+
lymphomas, we now describe a new formulation of Rituximab,

which, on
direct binding to target, can induce apoptosis. In this report, enhanced apoptosis was
observed by

treating CD20
+
lymphoma cells with a new polymer formulation

of
Rituximab. The polymer was produced by formation of a peptide

bond using the
sugar moiety of dextran (MW 6,000) to generate

a clinically relevant reagent for use
in vivo. Comparison of Rituximab with a previously described

dimer and the newly
generated polymer shows that the polymer

induced apoptosis more effectively in
CD20
+
cells as shown by

the terminal deoxyribonucleotidyl transferase–mediated

dUTP nick end labeling assay (Rituximab, 3%; dimer, 3%; polymer,

58%).
Consistent with these results, the polymer produced marked

regression in CD20
+

lymphoma xenografts, whereas the dimer and

monomer reagents showed little effect.
In addition, we were

able to show that the level of apoptosis induced in human

13
lymphoma

cell lines was in accordance with the extent of both surface

CD20
clustering and caspase-3 activation. These data suggest that hyper-cross-linking–
induced

apoptosis can be simulated by the use of a dextran polymer of

Rituximab,
which, when used in vivo, can directly kill CD20
+
lymphoma cells and improve the
clinical efficacy of this important

therapeutic for human B-cell lymphomas.

INTRODUCTION
The development and Food and Drug Administration approval of

the
monoclonal antibody Rituximab has provided physicians with

an effective new
weapon against Non-Hodgkin's lymphomas. This

human-mouse chimeric antibody
targets CD20, a common cell surface

marker of human malignant B-cell lymphomas
[see review by Cartron

et al. (1)]. CD20 is a 33 to 35 kDa nonglycosylated protein

consisting of four-membrane spanning domains with both NH
2
and

COOH termini
located within the cytoplasm (2–4). At the

present time, no CD20 ligand has been
described and CD20 does

not display the usual structure of a receptor. Instead,
several

lines of evidence exist to suggest that CD20 may play a crucial

role in the
regulation of cell cycle progression in B cells

(5) and is associated with the control of
Ca
2+
influx across

plasma membranes (6).

Whereas Rituximab treatment has produced tumor regressions in

patients with
relapsed B-cell non-Hodgkin's lymphoma, 52% of

those patients do not respond (7).
To understand the differential

responses to Rituximab, efforts have been made to
investigate

the mechanisms underlying the antitumor activity of Rituximab

and the

14
relative contributions of each mechanism. In this regard,

several mechanisms have
been implicated including antibody-dependent

cellular cytotoxicity, complement-
dependent cytotoxicity, and

signaling-induced apoptosis [reviewed by Cartron et al.
(1)].

Of these mechanisms, the role of complement-dependent cytotoxicity

has been
questionable because despite in vitro studies that

show that Rituximab is able to bind
complement and effectively

initiate complement-dependent cytotoxicity in vitro (8–
12)

and in vivo (13), no correlation between in vitro complement

sensitivity and
therapeutic response has been described (14).

However, an increase in complement
activation products is observed

during Rituximab treatment, which may contribute to
clinical

side effects seen after the first infusion of antibody (15).

Hence, it is clear
that complement-dependent cytotoxicity plays

some role in vivo but its contribution
to effective therapy

requires further confirmation. Likewise, signaling-induced
apoptosis

remains controversial because direct binding of Rituximab to

CD20
+

lymphoma cells fails to induce apoptosis to any significant

extent (16). To evoke this
mechanism, Rituximab must be hyper-cross-linked

either by the binding of goat anti-
human/mouse immunoglobulin

G (IgG) or Fc receptor–bearing cells, or by
immobilization

on plastic in vitro (16–19). Hyper-cross-linking of Rituximab

redistributes CD20 into Triton X–insoluble cell membrane

signaling-processing
centers (20, 21), followed by lipid raft

clustering and transactivation of Src-family
tyrosine kinases

such as Lyn, Fyn, and Lyc, which further lead to apoptosis of

the
lymphoma cells (19, 22–24). Only antibody-dependent

cellular cytotoxicity,
specifically Fc:Fc receptor interaction,

is now regarded as a predominant effector

15
mechanism of Rituximab

(25, 26). Fc receptors on effector cells seem to be
responsible

for the in vivo activity of anti-CD20 antibodies in mice as

evidenced by
the use of knockout mouse models in which it has

been shown that Fc:Fc receptor
interaction is required for the

depletion of circulating and extravasated B
lymphocytes (25).

Current clinical studies are focusing on a dimorphism of the

FCGR3A gene that encodes Fc receptor IIIa with either a phenylalanine

or a valine
at residue 158 which specifically reacts with the

lower hinge region of IgG1 with
different affinities (phenylalanine

> valine; refs. 27–29). It is observed that
homozygous

FCGR3A-158V patients have a greater probability of experiencing

clinical responses, supporting the critical function of the

Fc:Fc receptor interaction
(27, 29). For antibody-dependent

cellular cytotoxicity to be effective, it is assumed
that Fc

receptor–bearing cells must enter the tumor microenvironment

to come in
direct contact with its target. If so, then Fc receptor–bearing

cells may function as
mediators of antibody-dependent cellular

cytotoxicity and hyper-cross-linking–
induced apoptosis

to destroy the tumor. A lack of tumor-associated effector cells

may
therefore be responsible for Rituximab failure if these

mechanisms are critical in
patients. If this is the case, the

availability of a Rituximab-like reagent to induce
apoptosis

directly on binding to the surface of CD20
+
lymphoma cells would

provide
a more potent reagent for clinical use.
Recognizing that hyper-cross-linking in vivo is impractical,

Ghetie et al. (30)
reported that tetravalent homodimers of Rituximab

could induce higher apoptosis
rates in human malignant lymphoma

cell lines compared with monomer preparations

16
obtained from

the pharmacy. In their studies, they were able to produce apoptosis

rates comparable to those obtained by goat anti-mouse hyper-cross-linking

and, when
tested in combination with chemotherapeutic agents

such as doxorubicin, homodimer
preparations produced significantly

better tumor cell killing. These promising results
suggested

that an increased valency of Rituximab could initiate apoptosis

in the
absence of Fc-receptor–bearing cells and may be

a method of improving the clinical
efficacy of Rituximab therapy.

Although in vivo data were lacking, this report
stimulated the

current study in which we tested a new formulation of Rituximab

that
consisted of a high valency reagent produced by the conjugation

of Rituximab to a
dextran polymer. When tested both in vitro

and in vivo, this new polymer formulation
was found to be a

more potent inducer of apoptosis than monomer or dimer
preparations.

Because of its soluble characteristics, Rituximab polymer is

a clinically
relevant reagent and has shown good tumor targeting

and therapeutic potential in
CD20
+
Raji xenografts. It is our

belief that this newly formulated Rituximab may
provide a significant

improvement in anti-CD20 therapy, especially in patients with

low-affinity Fc receptor allotypes.

MATERIALS AND METHODS
Antibodies
Rituxamab (Rituxan, Genentech, Inc., San Francisco, CA) was

purchased from
the University of Southern California Norris

Cancer Center Pharmacy; goat anti-
human IgG (Fc specific) was

purchased from Caltag Laboratories (Burlingame, CA);

17
FITC-labeled

goat anti-mouse F(ab')
2
was purchased from ICN-Cappel (Aurora,

OH);
and phycoerythrin-labeled anti-CD20 antibody was purchased

from BD PharMingen
(San Diego, CA). Isotype control antibody,

chTV-1, is a mouse human chimeric
IgG1 that was developed in

our laboratory (31).

Cell lines
Raji, B35M, Ramos, Chevallier, and DG-75 cell lines were obtained

from the
American Type Culture Collection (Manassas, VA). Farage

and Granda 519 cell
lines were purchased from Deutsche Sammlung

von Mikroorganismen und
Zellkulturen GmbH (German Collection

of Microorganisms and Cell Cultures,
Braunschweig, Germany).

The SU-DHL-4, SU-DHL-6, SU-DHL-10, and SU-DHL-
16 cell lines

were established in our laboratory (32). All cell lines were

grown in
RPMI 1640 (Life Technologies, San Diego, CA) supplemented

with 10%
characterized FCS (Hyclone, Logan, UT), 1% glutamine,

and penicillin (100
units/mL) and streptomycin (100 µg/mL;

Gemini Bio-Products, Woodland, CA), and
cultured in a humidified

5% CO
2
incubator at 37°C as stationary suspension cultures.

Conjugation of antibodies to Dynabeads
Rituximab was coated on Dynabeads M-280 Tosylactivated (Dynal

Biotech,
Inc., Brown Deer, WI) according to the protocol of

the manufacturer to study the
hyper-cross-linking effect of

Rituximab on Raji cells. Briefly, 7 x 10
8
Dynabeads
were washed

twice with PBS and incubated with continuous rotation with 200

µg of

18
Rituximab or isotype control antibody in 500 µL

at 30°C for 18 to 20 hours.
Dynabeads were subsequently

pelleted using the magnetic bead attractor (Dynal
Biotech),

and the unconjugated antibody in the supernatant was quantified

by
measuring absorbance at 280 nm with a UV spectrophotometer

(Ultraspec 2000,
Pharmacia, Piscataway, NJ). The total amount

of antibody conjugated to the
Dynabeads was calculated by the

equation (total antibody – unconjugated antibody =
conjugated

antibody on the beads). Dynabeads coated with antibodies were

washed
twice with PBS and 1% (w/v) bovine serum albumin (BSA),

and free tosyl groups
were then treated with blocking solution

[0.2 mol/L Tris-HCl (pH 8.5), 0.1% BSA] at
37°C for 3 to

4 hours using end-to-end rotation, washed twice with PBS (0.1%

BSA,
1% Tween 20), followed by another two washes with PBS (0.1%

BSA). Finally,
Dynabeads conjugated with antibodies were resuspended

in PBS and stored at 4°C.

Generation of dextran-Rituximab polymer
One-hundred-milligram dextran (average MW 6,000; Fluka Chemie

AG, Buchs,
Switzerland) and 120 mg sodium periodate (Sigma,

St Louis, MO) were dissolved in
5 mL of 0.9% NaCl solution and

incubated for 18 hours in the dark at room
temperature. The

mixture was passed through a preequilibrated PD-10 column
(Amersham

Biosciences, Piscataway, NJ), eluted in 0.9% NaCl, and stored

at 4°C in
the dark. Two milliliters of Rituximab (10 mg/mL)

were passed through a
preequilibrated PD-10 column and eluted

with 0.1 mol/L sodium bicarbonate buffer
(pH 8.1; Sigma). The

eluted Rituximab was diluted to 5 mg/mL with 0.1 mol/L

19
sodium

bicarbonate buffer (pH 8.1), and mixed with 480 µg oxidized

dextran at a
molar ratio of 1:2.4 (Rituximab/oxidized dextran).

After continuous shaking for 6
hours in the dark, the reaction

was reduced with 5 mg sodium borohydride (Sigma)
for 1 hour

followed by dialysis in PBS. The dialysate was then passed through

a 0.22
µm nonpyrogenic syringe filter (Costar, Corning,

NY), and a Pharmacia AKTA
System (fast protein liquid chromatography;

Amersham Pharmacia Biotech,
Piscataway, NJ) was used to fractionate

the dextran Rituximab mixture through a
preequilibrated Superose

6 column in PBS at a flow rate of 0.5 mL/min. The polymer
had

a retention time of 16 minutes. The polymer fraction was further

concentrated
using Centricon YM-100 (Millipore, Billerica, MA),

sterilized by 0.22 µm filtration,
and analyzed by SDS-PAGE

and agarose electrophoresis. Proteins were analyzed
under nonreducing

conditions by SDS-PAGE on a 4% stacking, 5% separating gel
and

a 2% agarose gel. Protein bands were visualized by Coomassie

blue staining.

Generation of Rituximab homodimer
Two heterobifunctional cross-linkers, N-succinimidyl S-acethylthio-acetate

(SATA; Pierce, Rockford, IL) and succinimidyl 4-(maleimidomethyl)

cyclohexane-
1-carboxylate (SMCC; Pierce), were used to generate

homodimers of Rituximab with
modifications (30, 33).

Step 1: Derivatization with succinimidyl 4-(maleimidomethyl)

cyclohexane-1-
carboxylate. Five milligrams of Rituximab at a

concentration of 5 mg/mL in 0.05

20
mol/L phosphate buffer containing

3 mmol/L Na
2
EDTA (PBE; pH 7.5) and 2.5 µL of
SMCC (9.3

mg/mL DMSO) were incubated with continuous rotation at room

temperature for 1 hour using a SMCC/Rituximab molar ratio of

4.5. Conjugated
protein was purified by chromatography on a

PD-10 column in PBE buffer.

Step 2: Derivatization with N-succinimidyl S-acethylthio-acetate.

Five milligrams
of Rituximab (5 mg/mL PBE) were mixed with 2.5

µL of SATA (5.8 mg/mL DMSO)
and incubated at room temperature

for 1 hour using a SATA/Rituximab molar ratio
of 4.0. The excess

SATA was then removed by chromatography on a PD-10 column
and

the purified protein was deacetylated with 5 mg of hydroxylamine-HCl

(Sigma)
for 5 minutes at room temperature. Excess hydroxylamine-HCl

was removed by
chromatography on a PD-10 column.

Step 3: Reaction of SMCC- and SATA-derived rituximab. SMCC-

and SATA-
derived proteins were mixed together and incubated

with continuous rotation at room
temperature for 1 to 2 hours.

The preparation was dialyzed overnight in PBS at 4°C,
sterilized

by filtration through a 0.22 µm nonpyrogenic filter (Costar),

and further
fractionated on a Superose 6 Column using the Pharmacia

AKTA described above at
flow rate of 0.5 mL/min. The dimer had

a retention time of 29 minutes. The protein
fractions purified

by fast protein liquid chromatography were further concentrated

using Centricon YM-100, filter sterilized, and analyzed by SDS/PAGE

as described
above.

21
In vitro Studies
Serum stability.
In vitro serum stability was evaluated using

an immunoblotting assay. Briefly,
Rituximab polymer was incubated

for up to 10 days in goat serum at 37°C. At
different times

after incubation, samples were separated by SDS-PAGE and
transferred

to a polyvinylidene difluoride membrane. A horseradish peroxidase–
conjugated

polyclonal goat anti-human IgG (Fc specific) was used to detect

the
human Fc portion of Rituximab.

CD20 expression determination.
CD20 expression was determined

by fluorescence-activated cell sorting
analysis using anti-CD20

antibody labeled with phycoerythrin as previously
described

(11).

Rituximab avidity constant determination.
Rituximab monomer,

dimer, and polymer were radiolabeled with radioiodine
using

a modified chloramine-T method developed in our laboratory (34).

To
determine the avidity constant of each Rituximab preparation,

a fixed cell RIA was
done using the method of Frankel and Gerhard

(35) as previously described. The
avidity constant K
a
was calculated

by the equation K = –(slope/n), where n is the
valence

of the antibody (n = 2 for the monomer; n = 4 for the dimer;

n = 10 for the
polymer).

22
Apoptosis induction and detection.
(a) Annexin V/propidium iodide

staining. Two micrograms of Rituximab
monomer, dimer, and polymer,

and Rituximab-conjugated Dynabeads (equivalent to
2 µg)

were added to 5 x 10
4
Raji cells in 200 µL media and incubated

for 18 hours in
a 5% CO
2
incubator at 37°C. For hyper-cross-linking,

5 x 10
4
Raji cells in 200 µL
media were incubated with

2 µg of Rituximab for 1 hour at 37°C. The cells were

then
washed twice with PBS (1% BSA) and then incubated with

5 µg of goat anti-human
antibody (Caltag) for 18 hours

at 37°C in a 5% CO
2
incubator. The percentage of
apoptosis

induced by each antibody preparation was then determined by

the Annexin
V/propidium iodide staining assay, which directly

detects phosphotidylserine
exposure on apoptotic cells and the

loss of the cellular membrane integrity. Annexin
V and propidium

iodide stainings were done using the RAPID protocol provided

by
the manufacturer (Oncogene Research Product, Boston, MA).

(b) Terminal deoxyribonucleotidyl transferase–mediated

dUTP nick end
labeling (TUNEL) assay. Induction of DNA strand

breaks by each antibody
preparation was determined by the TUNEL

assay using an APO-DIRECT Kit
(Phoenix Flow Systems, San Diego,

CA) following the protocol of the manufacturer.
For these studies,

5 x 10
5
Raji cells were incubated with each antibody preparations

(20 µg) in 1.5 mL for 18 hours at 37°C in a 5% CO
2

incubator. For the hyper-cross-
linking studies, 5 x 10
5
Raji

cells were incubated with 20 µg of Rituximab in 1.5 mL

for 1 hour at 37°C. Cells were then washed twice with PBS

and further incubated

23
with 50 µg of goat anti-human antibody

(Caltag) in 1.5 mL for 18 hours at 37°C in a
5% CO
2
incubator.

The cells were then washed with PBS, fixed in 2%
paraformaldehyde

at room temperature, and permeabilized in 70% ethanol for
storage

overnight at –20°C.

Caspase-3 activity assays.
Two micrograms of Rituximab monomer,

dimer, and polymer, and Rituximab-
and isotype control antibody–conjugated

Dynabeads were incubated with 5 x 10
4

Raji cells. After 5 and

24 hours, the cells were washed with PBS, resuspended in 40

µL of the fluorogenic protease substrate Phiphilux (OncoImmunin,

Inc., Gaithersburg,
MD), and incubated in a 30°C water bath

for 40 minutes. Lastly, the cells were
resuspended in media

provided by the manufacturer and immediately analyzed by
flow

cytometry.

Immunofluorescence microscopy.
The pattern of antigen cross-linking

on the surfaces of cells treated with
different antibody preparations

was observed by immunofluorescence microscopy.
For these studies,

5 x 10
5
Raji cells were treated with 20 µg of each antibody

preparations at 37°C, fixed with 2% paraformaldehyde (Polysciences,

Inc.,
Warrington, PA), diluted in PBS at room temperature, followed

by two washes with
PBS (1% BSA). Fixed cells were then incubated

with 25 µg of goat anti-mouse
antibody F(ab')
2
(ICN-Cappel)

at 4°C for 30 minutes and subsequently washed twice

24
with

PBS (1% BSA). For the hyper-cross-linking studies by a secondary

goat-anti-
mouse IgG F(ab')
2
, 5 x 10
5
Raji cells were treated

with 20 µg of Rituximab for 1 hour
at 37°C. The cells

were washed with PBS twice and incubated with 25 µg of

goat
anti-mouse antibody F(ab')
2
for 30 minutes at 4°C.

Cells were then washed twice and
fixed as above. Cytospin preparations

were mounted in Vectorshield with 4',6-
diamidino-2-phenylindole

(Vector Laboratories, Burlingame, CA) for observation
under

a phase-contrast fluorescence microscope using a 50x water immersion

lens.

In vivo studies
Pharmacokinetic and biodistribution studies.
Six-week-old female

athymic nude mice were used to determine the
pharmacokinetic

clearance of the radiolabeled Rituximab monomer, dimer, and

polymer preparations as previously described (34, 36). Significance

levels (P values)
were determined using the Wilcoxon rank-sum

test.

Tissue biodistribution studies were done in Raji tumor–bearing

nude mice to
examine the targeting ability of the Rituximab

monomer, dimer, and polymer. Six-
week-old female athymic nude

mice (Harlan, Indianapolis, IN) were irradiated with
350 rad

from a cesium source to suppress innate natural killer activity,

and 3 days
later were injected s.c. with a 0.2 mL inoculum containing

5 x 10
6
Raji lymphoma
cells and 10
5
human fetal fibroblast feeder

cells in the left flank using a University
Animal Care Committee–approved

protocol. The human fetal fibroblast feeder cells
established

in our laboratory provide growth factors that promote a high

tumor take

25
rate (>90%). Tumors were grown for 10 to 15 days

until they reached 0.5 cm in
diameter. In each group (n = 5),

individual mice were injected i.v. with a 0.1 mL
inoculum containing

30 to 40 µCi of
125
I-labeled antibody preparations. Mice

were
then sacrificed by sodium pentobarbital overdose at 72

hours postinjection, and
tissues were removed, weighed, and

measured in a counter. For each mouse, data
were expressed

as percentage injected dose per gram (% ID/g) and as tumor/organ

ratio (cpm per gram tumor/cpm per gram organ). Significance

levels were
determined using a Wilcoxon's rank-sum test.

Immunotherapy studies.
Six-week-old female athymic nude mice

were heterotransplanted with Raji
lymphoma cells as described

above. When tumors reached 0.5 cm in diameter,
groups of mice

(n = 5) were injected i.v. with 0.1 mL inoculum containing 25

µg of
the Rituximab monomer, dimer, or polymer. All groups

were treated every other day
five times and tumor volumes were

monitored thrice a week by caliper measurement
in three dimensions

using the formula length x width x height. All data were
presented

as means of tumor volume (cm
3
) and significance levels were

determined
using the Wilcoxon's rank-sum test. All mice were

sacrificed by sodium
pentobarbital overdose.

26
RESULTS
Direct induction of apoptosis by Rituximab preparations
Raji lymphoma cells were treated with Rituximab alone or hyper-cross-linked

Rituximab for 18 to 20 hours at 37°C. The amount of apoptosis

was measured by
Annexin V/propidium iodide staining (Fig. 2-1A),

which detects phosphotidylserine
exposure on the extracellular

membrane and loss of membrane integrity, and by
TUNEL assay

(Fig. 2-1B), which quantitates DNA strands breaks, a phenomenon

downstream of endonuclease activation. In addition to Rituximab

hyper-cross-linked
with traditional secondary goat anti-human

antibody, Rituximab was also conjugated
to Tosyl-activated Dynabeads

(2.8 µm in diameter) to simulate in vitro Fc
presentation

of antibody by Fc-receptor–bearing cells (Fig. 2-1). These

studies
showed that Rituximab alone induced only a minimal level

of apoptosis in Raji cells
(26% in the Annexin V assay and 2.99%

in the TUNEL assay). By comparison,
Rituximab hyper-cross-linked

with goat anti-human antibody caused a higher level of
apoptosis

(50% in the Annexin assay and 30% in the TUNEL assay). Interestingly,

Rituximab conjugated to Dynabeads was found to induce the best

apoptosis levels
detected by both Annexin V/propidium iodide

staining and TUNEL assays (96% and
83%, respectively).

27
Figure 2-1. Rituximab hyper-cross-linking–induced apoptosis of Raji lymphoma
cells as assessed by Annexin V/propidium iodide staining (A) and TUNEL assay (B).

A

B

28
Generation and characterization of Rituximab dimer and polymer
SATA and SMCC were used to generate homodimers of Rituximab

following
the method developed by Ghetie et al. (30, 33). To

prevent precipitation of
Rituximab dimers in the chemical reaction,

the concentration of Rituximab used was
decreased from 10 to

5 mg/mL. Rituximab polymer was generated using aldehyde-
activated

dextran (average M
r
6,000). Both the Rituximab homodimer and

polymer
preparations were dialyzed overnight and fractionated

using a fast protein liquid
chromatography. The polymer revealed

a retention time of 16 minutes whereas the
dimer revealed a

retention time of 29 minutes by fast protein liquid chromatography.

The purity of each preparation was >99%. The molecular weights

of the Rituximab
polymer and dimer were shown by nonreducing

SDS-PAGE (Fig. 2-2A). Under these
conditions, the molecular weight

of the polymer was found to be beyond the SDS-
PAGE measurement

capabilities due to the fact that the polymer did not enter

the gel.
To solve this problem, a 2% agarose gel was used along

with murine
immunoglobulin M, which has a known molecular weight

of 970 kDa (Fig. 2-2B).
By this method, one band was resolved

for the Rituximab polymer, which was
slightly higher than that

of immunoglobulin M, corresponding to the molecular
weight of

5 immunoglobulin molecules. Additional studies are under way

to
determine the degree of heterogeneity of the polymer.

29
Figure 2-2. Analysis of Rituximab polymer and dimer preparations. A,
electrophoretic analysis of Rituximab dimer and polymer using 4% to 15%
nonreducing SDS-PAGE (left) and 2% agarose (right). B, immunoblotting assay of
Rituximab polymer incubated in serum over a 10-day period at 37°C. C, TUNEL
assay demonstrating apoptosis of Raji lymphoma cells induced by Rituximab dimer
and polymer. D, fluorescence-activated cell sorting analysis of caspase-3 activation
in Raji lymphoma cells following treatment with different Rituximab preparations.
Baseline values are shown on top in which data are presented for the isotype control
antibody.

A

30
Figure 2-2: Continued

B

C

31
Figure 2-2: Continued

D

32
In vitro studies
Serum stability.
Rituximab polymer was examined for stability

in goat serum over a 10-day
incubation period at 37°C. The

result showed no degradation over this time period
(Fig. 2-2B)

or over a 6-month incubation period at 4°C.

Avidity studies.
Avidity binding studies were conducted in which
125
I-labeled Rituximab
preparations were incubated with Raji

lymphoma cells and the bound radioactivity
was used to calculate

the avidity constant (K
a
) by Scatchard analysis. Using this

method, the Rituximab polymer was found to have an avidity constant

of 3.16 x 10
8

(mol/L)
–1
, whereas the monomer and dimer

had avidity constants of 3.6 x 10
8
and
2.09 x 10
8
(mol/L)
–1
,

respectively. These studies show that the Rituximab polymer

and dimer have similar binding avidities to antigen as Rituximab

monomer,
facilitating subsequent direct comparisons in vitro

and in vivo.

Induction of apoptosis by Rituximab dimer and polymer.
Apoptosis

assays were used to analyze the ability of the Rituximab polymer

and
dimer to induce apoptosis. TUNEL assays showed that the

Rituximab polymer
induced 57.8% apoptosis whereas the dimer

produced only 2.99% (Fig. 2-2C). To
investigate whether these

results would be similar with other human malignant
lymphoma

cell lines, 12 different cell lines were studied including 10

CD20
+
and 2

33
CD20
–
(Table 2). In the CD20
+
cell lines,

apoptosis was significantly increased in the
cells treated with

Rituximab polymer compared with those treated with the dimer

or
monomer. However, not all CD20
+
cells treated with Rituximab

polymer showed
significant apoptosis. It is assumed that some

of these lymphoma cell lines may have
different intracellular

pathways associated with CD20 ligation. As expected, no
significant

apoptosis was detected in any of the CD20
–
cell lines

treated with the
different Rituximab preparations.

Caspase-3 activation studies.
As shown in Fig. 2-2D, Raji lymphoma

cells treated with Rituximab monomer
or dimer were found to

have basal levels of caspase-3 activity similar to controls.

By
contrast, Raji cells treated with Rituximab polymer or Rituximab-coated

Dynabeads
showed significant caspase-3 activation. For polymer

treated cells, caspase-3 activity
started to elevate at 5 hours

after treatment and reached a peak at 24 hours. For those
cells

treated with Rituximab-coated Dynabeads, caspase-3 activity

peaked at 5 hours
after treatment and declined at 24 hours.

From these experiments, it seems that early
induction of apoptosis

correlated with a more vigorous activation of caspase-3 as
seen

with the samples treated with Rituximab-coated Dynabeads.

Immunofluorescence microscopy studies.
To investigate further

whether there is any correlation between surface hyper-
cross-linking

of CD20 and apoptosis, immunofluorescence staining was done

to

34
study the Rituximab and CD20 antigen distribution on the

cell surface. As shown in
Fig. 2-3, Rituximab monomer and dimer

treatments produced a ring pattern of
immunofluorescence, indicating

that CD20 is evenly distributed on the surface of the
lymphoma

cells. By contrast, cells treated with Rituximab polymer or

Rituximab +
goat anti-mouse antibody were found to have a more

segregated polar staining
pattern consistent with the movement

and fixation of CD20 into lipid rafts.

Table 2. Induction of apoptosis in CD20
+
and CD20
–
cell lines by Rituximab
monomer, dimer, and polymer preparations

Lymphoma
Cell Lines

CD20
Expression
(MFI
1
)
Untreated Rituximab Rituximab
Dimer
Rituximab
Polymer
CD20
+

Raji 514.34 4.56
2
27.86 26.97 66.07
B35M 349.33 6.02 13.13 8.92 56.36
RAMOS 374.44 5.04 7.66 6.08 24.68
SU-DHL-4 672.19 4.78 10.67 7.31 11.54
SU-DHL-6 685.64 28.16 45.36 42.50 55.89
SU-DHL-
10
631.97 7.01 27.85 25.69 36.88
SU-DHL-
16
585.14 15.07 27.28 23.06 31.43
Farage 643.63 19.22 21.25 20.56 46.11
Granda 519 495.48 11.78 20.27 18.61 48.30
Chevallier 408.99 18.18 18.80 16.80 40.70
CD20
-

DG-75 180.78 6.82 8.04 6.85 7.85
L540 196.37 16.23 16.54 16.02 16.00

1
Mean fluorescence intensity.
2
Percent non-viable cells.

35
Figure 2-3. Extent of CD20 clustering on Raji cell surface shown by
immunofluorescence microscopy. Cells were treated with Rituximab monomer (A),
dimer (B), or polymer (C), and then fixed with 2% paraformaldehyde and stained
with a secondary goat anti-mouse IgG-FITC. D, cells were treated with Rituximab
and secondary goat anti-mouse IgG-FITC, followed by fixation with 2%
paraformaldehyde. Results show ring patterns of staining with Rituximab monomer
and dimer but more speckled and segregated polar staining patterns with polymer
and Rituximab + goat anti-mouse antibody.

36
In vivo studies
Pharmacokinetic and biodistribution studies.
Whole-body radioactivity

studies in athymic nude mice showed that
radiolabeled Rituximab

had a T
1/2
of 96 hours (P < 0.01) whereas the dimer and
polymer

had half-lives of 120 and 144 hours, respectively (P < 0.01).

These results
are consistent with prior data showing polymeric

antibodies to have longer half-lives
than native antibodies

(37). As shown in Fig. 2-4, biodistribution studies with all
three

Rituximab preparations illustrate effective localization to

the Raji xenografts
resulting in approximately similar tumor-to-organ

ratios. The data further show the
specificity of tumor targeting

with all three Rituximab preparations as indicated by
the high

tumor uptake observed.

Immunotherapy studies.
As shown in Fig. 2-5, the antitumor activity

of the Rituximab preparations was
studied in Raji tumor–bearing

nude mice. As described above, treatment did not
commence until

day 10 when the tumors were palpable in size. In those groups

of
mice receiving the monomer or dimer, tumor growth was either

unaffected or slightly
slower than that seen in the untreated

control group. By contrast, the group of mice
receiving the

polymer treatment showed marked tumor regression (Fig. 2-5). These

results show that the average tumor volume of the polymer-treated

group on the 28th
day after tumor implantation was <30% of

the tumor volume in the PBS-treated
control group (P < 0.01).

These findings are notable in view of the fact that all these

37
preparations had comparable avidity constants and biodistribution

characteristics in
this same tumor model.

Figure 2-4. Tissue biodistribution and tumor uptake of Rituximab polymer, dimer,
and monomer at 72 hours postinjection in Raji lymphoma–bearing nude mice. A,
tumor uptake measured by percent injected dose per gram of
125
I-labeled Rituximab
polymer, dimer, or monomer. B, tumor/normal organ ratios; columns, mean; bars,
SD.

A

B

38
Figure 2-5. Rituximab polymer, dimer, and monomer immunotherapy in Raji
xenograft model.

DISCUSSION
As previously shown (16–19), direct induction of apoptosis

by Rituximab is
very ineffective unless the antibody is hyper-cross-linked

by secondary antibody or
immobilized on plastic. The goal of

the present work was to determine if higher
valency preparations

of Rituximab could be used to simulate hyper-cross-linking
events

using formulations that are applicable in vivo. This goal was

achieved by the
generation of a polymer of Rituximab that consisted

of 5 immunoglobulins per
dextran molecule. To show its potency

in vitro and in vivo, the polymer preparation

39
was compared with

Rituximab monomer and with a previously published dimer (30),

which showed some improved activity when tested in apoptosis

assays. Our results
clearly showed that the polymer is able

to induce apoptosis of CD20
+
human
lymphoma cell lines directly

on binding, distinguishing it from both the monomer
and dimer

preparations using the TUNEL assay (Rituximab, 3%; dimer, 3%;

polymer,
58%; see Figs. 2-1B and 2-2B). These findings were obtained

despite the fact that all
three preparations had essentially

equal avidity constants against CD20 antigen and
had similar

pharmacokinetic properties and biodistribution characteristics

in tumor-
bearing nude mice. In addition, the Rituximab polymer

was found to be much more
effective in vivo against implanted

Raji lymphomas using dosages in which the
monomer and dimer

preparations had little effect. In contrast to the results of

Ghetie
et al. (30), the dimer preparation produced in our laboratory

(99% pure) induced no
noticeable increase in apoptosis in vitro.

This may have been due to the presence of
polymers contaminating

their dimer preparations, which were reported to be only
80%

pure.

In this report, various methods of CD20 hyper-cross-linking–induced

apoptosis
were quantified by both Annexin V and TUNEL assays.

Of note, Rituximab-coated
Dynabeads induced maximum levels of

apoptosis in Raji cells in which >90% of
cells were shown

to become apoptotic. Several factors may have contributed to

the
induction of such a high apoptosis percentage. First, Rituximab

was conjugated to
Dynabeads by peptide bonding which produced

a more rigid presentation of antibody
to the lymphoma cells

than that obtained with secondary antibodies or plastic

40
substrata.

Second, the Dynabeads have a rounded surface, allowing multiple

contact
points to facilitate maximum interaction with target,

and are small enough to have
several beads attach to each target

cell. Under the microscope, the Rituximab-coated
Dynabeads often

produced cell aggregation due to their attachment to multiple

lymphoma cells. Finally, a high concentration of antibody was

attached to the beads
providing an optimal binding surface for

cross-linking. By contrast, Rituximab
immobilized to a plastic

surface or hyper-cross-linked with secondary antibody either

has a limited interactive interface or is not as efficient in

fixing CD20 in hydrophobic
regions once the CD20 has migrated

into the lipid rafts, the latter being a requirement
for optimal

induction of apoptosis according to data presented by Deans

et al. (38),
but not according to the data of Chan et al. (39).

Because of these results, we
hypothesize that the Dynabead presentation

is more likely to be that obtained with Fc
receptor–bearing

cells in vivo. Regardless, antibody-coated Dynabeads may represent

a new and simple method for identifying antibodies and antigens

in which apoptosis
induction via Fc receptor–bearing cell

presentation is an important mechanism of
action.

To further investigate whether there is any correlation between

surface hyper-
cross-linking of CD20 and apoptosis, immunofluorescence

staining was done to
study antibody and antigen distribution

on the cell surface. As shown in Fig. 2-3,
treatment with Rituximab

monomer and dimer produced a ring pattern of staining,
indicating

that these reagents reacted with antigen that was evenly distributed

on the
surface of the cell. By contrast, those cells treated

with Rituximab polymer or hyper-

41
cross-linked with secondary

antibody showed a more segregated polar staining
pattern, a

finding which correlated with higher apoptosis induction and

the movement
of antigen into lipid rafts (38). From these experiments,

we concluded that CD20
antigen clustering is associated with

superior induction of apoptosis and that
immunofluorescence

microscopy is a good method for observing the effects of
various

antibody preparations on the induction of apoptosis.

As described above, many mechanisms have been proposed to explain

the
effectiveness of Rituximab treatment both in animal models

and man. The notion that
antibody-dependent cellular cytotoxicity

plays a major role in vivo is the current
prevailing hypothesis

and several articles have already addressed the importance of

antibody presentation via Fc receptors (25, 26, 29). In mouse

models, Fc receptor II
has an inhibitory role in the therapeutic

effect of Rituximab (26), but some studies
produced contradictory

results (40). Specifically, mouse fibroblast Ltk– cells

that
were transfected with Fc receptor II still facilitated

signaling-induced apoptosis (16).
In the present study, the

fact that the polymer preparation effectively suppressed Raji

lymphoma growth in vivo emphasizes the point that apoptosis

alone can be a
powerful mechanism for treating lymphomas. In

support of this concept, clinical
studies by Byrd et al. (41)

found caspase-3 cleavage in lymphoma cells of patients
treated

with Rituximab as evidence of the induction of apoptosis after

treatment. In
this situation, apoptosis was most likely due

to presentation of antibody via Fc
receptor–bearing cells.

In our experiments, caspase-3 induction was found to occur

42
with

Rituximab-coated Dynabeads and polymer (Fig. 2-2C). By contrast,

Rituximab
monomer and dimer treatments produced only basal levels

of caspase-3 activity.

In summary, it seems that the induction of apoptosis in lymphoma

cells requires
proper presentation of anti-CD20 to induce CD20

movement into lipid rafts and
subsequent fixation of the antigen

in these polar regions of the cell surface. The high
valency

afforded by the Dynabeads preparation in vitro and the polymer

preparation
in vivo may facilitate fixation and trapping (hyper-cross-linking)

of CD20 on the cell
surface, thereby providing a strong signal

to initiate apoptosis pathways resulting in
the activation of

caspase 3. In vitro, amplified apoptosis can be achieved using

secondary antibodies, Fc receptor–bearing cells, or Rituximab-coated

Dynabeads. In
vivo, hyper-cross-linking seems to require presentation

by Fc receptor–bearing cells
(25), a mechanism which apparently

can be simulated by the polymer preparation.
Not requiring the

presence of effector cells for the induction of apoptosis, the

polymer preparation may be especially useful in lymphoma patients

who have the
low Fc receptor phenotype and who are nonresponsive

to Rituximab monotherapy
(27). Finally, because Rituximab-coated

Dynabeads treatment produced >90%
apoptosis, it is conceivable

that additional formulation work on Rituximab polymers
can achieve

higher levels, rendering this new form of treatment optimally

effective
above the current 58% apoptosis rate (in vitro) presently

obtained.

43
CHAPTER 2 REFERENCES

1. Cartron G, Watier H, Golay J, Solal-Celigny P. From the bench to the
bedside: ways to improve Rituximab efficacy. Blood 2004;104:2635–42.

2. Ishibashi K, Suzuki M, Sasaki S, Imai M. Identification of a new multigene
four-transmembrane family (MS4A) related to CD20, HTm4 and ß subunit of
the high-affinity IgE receptor. Gene 2001;264:87–93.

3. Einfeld DA, Brown JP, Valentine MA, Clark EA, Ledbetter JA. Molecular
cloning of the human B cell CD20 receptor predicts a hydrophobic protein
with multiple transmembrane domains. EMBO J 1988;7:711–7.

4. Stashenko P, Nadler LM, Hardy R, Schlossman SF. Characterization of a
human B lymphocyte-specific antigen. J Immunol 1980;125:1678–85.

5. Golay JT, Clark EA, Beverley PC. The CD20 (Bp35) antigen is involved in
activation of B cells from the G
0
to the G
1
phase of the cell cycle. J Immunol
1985;135:3795–801.

6. Li H, Ayert LM, Lytton J, Deans JP. Store-operated cation entry mediated by
CD20 in membrane rafts. J Biol Chem 2003;278:42427–34.

7. McLaughlin P, Grillo-Lopez AJ, Link BK, et al. Rituximab chimeric anti-
CD20 monoclonal antibody therapy for relapsed indolent lymphoma: half of
patients respond to a four-dose treatment program. J Clin Oncol
1998;16:2825–33.

8. Reff ME, Carner K, Chambers KS, et al. Depletion of B cells in vivo by a
chimeric mouse human monoclonal antibody to CD20. Blood 1994;83:435–
45.

9. Flieger D, Renoth S, Beier I, Sauerbruch T, Schmidt-Wolf I. Mechanism of
cytotoxicity induced by chimeric mouse human monoclonal antibody IDEC-
C2B8 in CD20-expressing lymphoma cell lines. Cell Immunol 2000;204:55–
63.

10. Harjunpaa A, Junnikkala S, Meri S. Rituximab (anti-CD20) therapy of B-cell
lymphomas: direct complement killing is superior to cellular effector
mechanisms. Scand J Immunol 2000;51:634–41.

44
11. Golay J, Lazzari M, Facchinetti V, et al. CD20 levels determine the in vitro
susceptibility to Rituximab and complement of B-cell chronic lymphocytic
leukemia: further regulation by CD55 and CD59. Blood 2001;98:3383–9.

12. Bellosillo B, Villamor N, Lopez-Guillermo A, et al. Complement-mediated
cell death induced by Rituximab in B-cell lymphoproliferative disorders is
mediated in vitro by a caspase-independent mechanism involving the
generation of reactive oxygen species. Blood 2001;98:2771–7.

13. Di Gaetano N, Cittera E, Nota R, et al. Complement activation determines the
therapeutic activity of Rituximab in vivo. J Immunol 2003;171:1581–7.

14. Weng WK, Levy R. Expression of complement inhibitors CD46, CD55, and
CD59 on tumor cells does not predict clinical outcome after Rituximab
treatment in follicular non-Hodgkin lymphoma. Blood 2001;98:1352–7.

15. Van der Kolk LE, Grillo-Lopez AJ, Baars JW, Hack CE, van Oers MH.
Complement activation plays a key role in the side effects of Rituximab
treatment. Br J Haematol 2001;115:807–11.

16. Shan D, Ledbetter JA, Press OW. Apoptosis of malignant human B cells by
ligation of CD20 with monoclonal antibodies. Blood 1998;91:1644–52.

17. Shan D, Ledbetter JA, Press OW. Signaling events involved in anti-CD20-
induced apoptosis of malignant human B cells. Cancer Immunol Immunother
2000;48:673–83.

18. Van der Kolk LE, Evers LM, Omene C, et al. CD20-induced B cell death can
bypass mitochondria and caspase activation. Leukemia 2002;16:1735–44.

19. Hofmeister JK, Cooney D, Coggeshall KM. Clustered CD20 induced
apoptosis: src-family kinase, the proximal regulator of tyrosine
phosphorylation, calcium influx, and caspase 3-dependent apoptosis. Blood
Cells Mol Dis 2000;26:133–43.

20. Semac I, Palomba C, Kulangara K, et al. Anti-CD20 therapeutic antibody
Rituximab modifies the functional organization of rafts/microdomains of B
lymphoma cells. Cancer Res 2003;63:534–40.

21. Polyak MJ, Tailor SH, Deans JP. Identification of a cytoplasmic region of
CD20 required for its redistribution to a detergent-insoluble membrane
compartment. J Immunol 1998;161:3242–8.

45
22. Deans JP, Schieven GL, Shu GL, et al. Association of tyrosine and serine
kinases with the B cell surface antigen CD20. Induction via CD20 of tyrosine
phosphorylation and activation of phospholipase C- 1 and PLC
phospholipase C- 2. J Immunol 1993;151:4494–504.

23. Deans JP, Kalt L, Ledbetter JA, Schieven GL, Bolen JB, Johnson P.
Association of 75/80-kDa phosphoproteins and the tyrosine kinases Lyn, Fyn,
and Lck with the B cell molecule CD20. Evidence against involvement of the
cytoplasmic regions of CD20. J Biol Chem 1995;270:22632–8.

24. Deans JP, Robbins SM, Polyak MJ, Savage JA. Rapid redistribution of CD20
to a low density detergent-insoluble membrane compartment. J Biol Chem
1998;273:344–8.

25. Uchida J, Hamaguchi Y, Oliver JA, et al. The innate mononuclear phagocyte
network depletes B lymphocytes through Fc receptor-dependent mechanisms
during anti-CD20 antibody immunotherapy. J Exp Med 2004;199:1659–69.

26. Clynes RA, Towers TL, Presta LG, Ravetch JV. Inhibitory Fc receptors
modulate in vivo cytoxicity against tumor targets. Nat Med 2000;6:443–6.

27. Weng WK, Levy R. Two immunoglobulin G fragment C receptor
polymorphisms independently predict response to Rituximab in patients with
follicular lymphoma. J Clin Oncol 2003;21:3940–7.

28. Sondermann P, Huber R, Oosthuizen V, Jacob U. The 3.2-A crystal structure
of the human IgG1 Fc fragment-Fc RIII complex. Nature 2000;406:267–73.

29. Cartron G, Dacheux L, Salles G, et al. Therapeutic activity of humanized
anti-CD20 monoclonal antibody and polymorphism in IgG Fc receptor Fc
RIIIa gene. Blood 2002;99:754–8.

30. Ghetie MA, Bright H, Vitetta ES. Homodimers but not monomers of Rituxan
(chimeric anti-CD20) induce apoptosis in human B-lymphoma cells and
synergize with a chemotherapeutic agent and an immunotoxin. Blood
2001;97:1392–8.

31. Epstein AL, Khawli LA, Hornick JL, Taylor CR. Identification of a tumor
vessel-specific monoclonal antibody, TV-1, and its use to enhance the
delivery of macromolecules to tumors after conjugation with interleukin 2.
Cancer Res 1995;55:2673–80.

46
32. Epstein AL, Levy R, Kim H, et al. Biology of the human malignant
lymphomas. IV. Functional characterization of ten diffuse histiocytic
lymphoma cell lines. Cancer 1978;42:2379–91.

33. Ghetie MA, Podar EM, Ilgen A, et al. Homodimerization of tumor-reactive
monoclonal antibodies markedly increases their ability to induce growth
arrest or apoptosis of tumor cells. Proc Nat Acad Sci U S A 1997;94:7509–
14.
34. Hornick JL, Hu P, Khawli LA, et al. chTNT-3/B, a new chemically modified
monoclonal antibody directed against DNA for the tumor necrosis treatment
of solid tumors. Cancer Biother Radiopharm 1998;13:255–68.

35. Frankel ME, Gerhard W. The rapid determination of binding constants for
antiviral antibodies by a radioimmunoassay. An analysis of the interaction
between hybridoma proteins and influenza virus. Mol Immunol 1979;16:101–
6.

36. Sharifi J, Khawli LA, Hu P, King S, Epstein AL. Characterization of a phage
display-derived human monoclonal antibody (NHS76) counterpart to
chimeric TNT-1 directed against necrotic regions of solid tumors. Hybrid
Hybridomics 2001;20:305–12.

37. Coloma MJ, Clift A, Wims L, Morrison SL. The role of carbohydrate in the
assembly and function of polymeric IgG. Mol Immunol 2000;37:1081–90.

38. Deans JP, Li H, Polyak MJ. CD20-mediated apoptosis: signaling through
lipid rafts. Immunology 2002;107:176–82.

39. Chan HT, Hughes D, French RR, et al. CD20-induced lymphoma cell death is
independent of both caspases and its redistribution into triton X-100 insoluble
membrane rafts. Cancer Res 2003;63:5480–9.

40. Camilleri-Broet S, Mounier N, Delmer A, et al. Fc RIIB expression in
diffuse large B-cell lymphomas does not alter the response to
CHOP+Rituximab (R-CHOP). Leukemia 2004;18:2038–40.

41. Byrd JC, Kitada S, Flinn IW, et al. The mechanism of tumor cell clearance by
Rituximab in vivo in patients with B-cell chronic lymphocytic leukemia:
evidence of caspase activation and apoptosis induction. Blood 2002;99:1038–
43.

47
CHAPTER 3
LYM-1 INDUCED CASPASE-INDEPENDENT APOPTOSIS IN NON-
HODGKIN’S LYMPHOMA

ABSTRACT

Lym-1 was one of the first antibodies to be used successfully for the
radioimmunotherapy of the human malignant lymphomas. This antibody, which
recognizes the HLA-DR10 antigen preferentially expressed in lymphomas, was
recently shown to induce apoptosis upon binding to lymphoma cells. In this study,
Lym-1 induced apoptosis was studied to identify potential molecular pathways of
programmed cell death. Immunofluorescence microscopy revealed that Lym-1
stained focal areas of the cell surface consistent with the fact that HLA-DR10
antigen is associated with lipid rafts, a known prerequisite for apoptosis signaling.
Likewise, Annexin V/propidium iodide staining and TUNEL assays demonstrated
that Lym-1 induced both early and late apoptosis, respectively, unlike anti-CD20
Rituximab. Furthermore, Lym-1 was found to produce rapid loss of mitrochondrial
membrane potential and, although it was found to activate caspase-3, inhibitors to
caspase pathways showed that Lym-1 induced apoptosis in lymphoma cell lines was
caspase independent. Finally, treatment studies in vivo demonstrated that, unlike
Rituximab, Lym-1 induced profound regression of human lymphoma xenografts.
Because of its ability to induce apoptosis in vivo, the chimeric version of Lym-1 may

48
have added therapeutic potential in patients where the effector functions of the
chimeric antibody are also operative.

INTRODUCTION
Tumor immunotherapy now plays an important role in the treatment of Non-
Hodgkin’s Lymphomas (NHL) especially since the approval of rituximab (1).
Despite the addition of rituximab as a treatment modality, 52% of patients with
refractory lymphoma still do not respond (2) and additional treatment options are
needed to improve the recurrence and survival rates of this disease. For antibody
immunotherapy, several antigenic targets for NHL have been explored including
CD19 (3, 4), CD20 (1, 2, 5-10), CD22 (11-13), CD37 (14, 15), CD45 (16, 17), and
HLA-DR (18-21). Relatively unique for B-cell antigens, CD22 is rapidly
internalized, a property which confers upon anti-CD22 antibodies some advantages
for tumor cell killing (22-24). Equally unique, only anti-HLA-DR antibodies have
been found to induce apoptosis upon binding to lymphoma cells in contrast to
antibodies against other B-cell antigens which require immune interaction such as
ADCC, CDC, or Fc-mediated binding to produce effective cytotoxic responses.
Consistent with these findings, we and others have shown that the anti-HLA-DR
antibody, Lym-1, does cause rapid apoptosis without the assistance of other immune
cells or modulators (25). To characterize further this antibody for its clinical
potential in the treatment of HLA-DR positive lymphomas, new data are presented to
show its in vivo therapeutic effects in human lymphoma-bearing nude mice, a model

49
which restricts the cytotoxic effects of the antibody to apoptosis. In addition, data
are presented to explore the possible pathways of apoptosis induced by Lym-1 in an
effort to discern its mechanism of action.
Lym-1 is a murine IgG2a monoclonal antibody generated against Raji Burkitt’s
lymphoma cells. (21). ChLym-1, the mouse/human chimeric version of Lym-1 with
murine variable and human gamma1 and kappa constant regions (26), was designed
to provide a more relevant reagent for clinical use. Both Lym-1 and chLym-1 bind to
HLA-DR, a major histocompatibility complex (MHC) class II molecule that is
expressed on mature B cells and a variety of other cell types (27). Since there are
more than 100 subtypes of HLA-DR, the binding between the antibody and antigen
actually depends on whether the HLA-DR contains critical binding residues
recognized by Lym-1, and whether the reactive HLA-DR on the cell surface reaches
a threshold antigen density. Originally, it was found that Lym-1 binds selectively to
a discontinuous epitope on the beta chain of HLA-DR10 (28). Further studies have
identified four critical binding residues of Lym-1 on the HLA-DR molecule and have
shown that Lym-1 also cross-reacts with other HLA-DR subtypes (29). In clinical
studies of NHL and chronic lymphocytic leukemia (CLL), >80% of patients have
been found to be Lym-1 reactive (30) (31) despite the relative rarity of the HLA-
DR10 subtype in normal populations. Moreover, Lym-1 has shown a profound
preference of binding to tumor cells than normal B cells due to the fact that normal
human B-cells have dramatically lower expression of this epitope by affinity studies
(21, 29).

50
In the past several years, Lym-1 has been used extensively as an
131
I and
67
Cu-
2IT-BAT radio-labeled product to treat resistant intermediate and high-grade
lymphomas and has shown excellent efficacy in the treatment chemotherapy resistant
tumors (31-42). Despite these successes, several problems are associated with
radiolabled products, including inconsistency in radio-labeling procedures, radiolysis
(43), and limitation of treatment dosage and frequency due to bone marrow toxicity.
Therefore, the search for a treatment modality that has inherent killing characteristics
is highly desirable. Before genetic engineering methods were available to construct
chimeric, humanized, or fully human antibodies, a clinical trial using low doses of
unconjugated murine Lym-1 was performed and resulted in very limited therapeutic
effects in 10 patients with refractory B-cell lymphomas (44). Because of these early
results, naked Lym-1 received little attention except for its effects on neutrophil
killing via FC γRII receptors by Ottonelli et al. (45-48), and its ability to mediate
ADCC and CDC effectively (25). Recently, however, B lymphoma cells treated by
Lym-1 have been shown to display many of the characteristics of apoptosis,
including cellular shrinkage and chromatin condensation and fragmentation (25). It
has also been reported that caspase-3 activation and PARP cleavage are involved in
Lym-1 induced apoptosis (25).
Besides Lym-1, several other anti-HLA-DR antibodies are able to induce
apoptosis in B-cell malignancies, including 1D10 and L243 as examples (20, 49-52).
Apoptosis via HLA-DR is somewhat unique since it appears to involve mitochondria
(50) and the final execution of apoptosis, in many cases, does not depend on caspase

51
enzymes (50, 51). In lymphocytes, signaling elicited in the cells through surface
antigens leading towards programmed cell death very often involves the
redistribution of these antigens into lipid rafts, which are plasma membrane
microdomains that act as signal transduction platforms constitutively associated with
various kinases and adaptor proteins (53-55). It is interesting to note that a
significant amount of HLA-DR constitutively resides in lipid rafts of healthy and
malignant B cells and monocytes (56). Compared to CD20 antibodies, direct
apoptosis induction through HLA-DR normally results in a higher percentage of
apoptosis (25), since anti-CD20 requires antigen recruitment into lipid rafts after
hyper-crosslinking by secondary antibody or Fc-bearing cells (23, 57-59). Because
of this, anti-HLA-DR antibodies have a distinct advantage over anti-CD20 reagents
especially in patients with decreased function for Fc presentation (60, 61).
In this report, we show that both Lym-1 and chLym-1 are potent inducers of
apoptosis in several human lymphoma cell lines and that apoptosis is associated with
a loss of mitochondrial membrane potential. Importantly, even though caspase-3
activation is involved, Lym-1 induced apoptosis is caspase-independent by
comparison with caspase-dependent Fas-mediated apoptosis. Lym-1 produces a
unique speckled staining pattern on the surface of B lymphoma cells, which may
relate to the presence of its antigen in lipid rafts required for apoptosis induction. To
test the effects of apoptosis induction on the growth of lymphoma xenograft, tumor-
bearing nude mice were tested with lym-1 and rituximab with identical protocols.
The results of these in vivo experiments demonstrate that unlike anti-CD20, Lym-1

52
can produce significant tumor regression by direct apoptosis. These data provide
convincing evidence that the unique epitope identified by Lym-1 on the surface of
human lymphoma cells may be an excellent target for lymphoma therapy by nature
of its ability to induce apoptosis after antibody binding without the necessity of
immune intervention.

MATERIALS AND METHODS
Antibodies
Lym-1, a murine IgG2a, was generated in our laboratory (21). ChLym-1 is a
mouse/human chimeric version of Lym-1 developed in our laboratory (26). The anti-
CD20 mAb rituximab (Rituxan, Genentech, Inc., San Francisco, CA) was purchased
from the University of Southern California Norris Cancer Center Pharmacy. FITC-
labeled goat anti-mouse F(ab’)
2
was purchased from ICN-Cappel (Aurora, OH).
Anti-Fas IgM (clone 7C11) was purchased from Immunotech (Marseille, France) and
the isotype matched control antibody (clone 141.1) is a murine IgG2a that was
developed in our laboratory.

Cell lines
Raji, B35M, DG75, and Jurkat cell lines were obtained from the American
Type Culture Collection (Manassas, V A). All cell lines were grown in RPMI 1640
medium (Life Technologies, San Diego, CA) supplemented with 10% characterized
fetal calf serum (FCS) (Hyclone, Logan, UT), 1% glutamine (200 mM), penicillin

53
(10,000 units/mL), and streptomycin (10,000 μg/mL) (Gemini Bio-Products,
Woodland, CA), and cultured in a humidified 5% CO
2
incubator at 37
o
C as stationary
suspension cultures.

Apoptosis induction and quantitation
a. Annexin V/propidium iodide staining. Five micrograms of Lym-1,
chLym-1, or isotype matched control mAb were added to 1.25 × 10
5
B lymphoma
cells (Raji, B35M, and DG75) in 500 μL media and incubated in 48-well flat bottom
plate for 18 hours in a 5% CO
2
incubator at 37 °C. The percentage of apoptosis
induced by each antibody was then determined by the annexin V/propidium iodide
staining assay, which directly detects phosphotidylserine exposure on apoptotic cells
and the loss of the cellular membrane integrity, respectively. Annexin V/propidium
iodide staining was done using the RAPID protocol provided by the manufacturer
(Oncogene Research Product, Boston, MA). In brief, Media Binding Reagent was
added to the cells, followed by 15 min incubation with FITC-labeled annexin V at
room temperature. The cells were then resuspended in 1x Binding Buffer and
propidium iodide was added just prior to reading of the samples by flow cytometry.
For each sample, 10,000 cells were analyzed.

b. Terminal deoxyribonucleotidyl transferase–mediated dUTP nick end
labeling (TUNEL) assay. Induction of DNA strand breaks by Lym-1 was
determined by the TUNEL assay using an APO-DIRECT Kit (Phoenix Flow Systems,

54
San Diego, CA) following the protocol of the manufacturer. For these studies, 5 ×
10
5
Raji cells were treated with 20 μg Lym-1 or isotype matched control mAb in 1.5
mL media and incubated in 24-well flat bottom plate for 18 hours at 37 °C in a 5%
CO
2
incubator. The cells were washed with PBS, fixed in freshly prepared 2%
paraformaldehyde (Polysciences, Inc., Warrington, PA, #4018) at room temperature,
and permeabilized in 70% ethanol. The cells were then stored in 70% ethanol
overnight at -20
o
C. Bromodeoxyuridine triphosphate (BrdU) was incorporated into
the DNA strand breaks in treated Raji cells using terminal deoxynucleotidyl
transferase (TdT). FITC-labeled anti-BrdU antibody was then used to stain the DNA
strand breaks and the total DNA in the cells were counterstained with propidium
iodide/RNase. For each sample, 10,000 cells were analyzed by flow cytometry.

Measurement of loss of mitochondrial membrane potential (ΔΨm)
The loss of mitochondrial membrane potential was determined by using the
fluorescent probe tetramethylrhodamine ethyl ester (TMRE) (Invitrogen, Carlsbad,
CA) (62, 63). Briefly, Raji cells (1.25×10
5
cells in 500 μL media) were incubated
with 5 μg Lym-1 or isotype matched control mAb for different amount of time.
TMRE was added to the cells at a final concentration of 1 μM and incubated for 20
min at 37
o
C in the dark. The cells were washed once with PBS and analyzed by flow
cytometry (FACS-diva, Becton Dickinson, San Jose, CA). For each sample, 10,000
cells were analyzed.

55
Caspase inhibitors
Two caspase inhibitors, benzyloxycarbonyl-Asp-Glu-Val-Asp-
fluoromethylketone (zDEVD-fmk) and benzyloxycarbonyl-Val-Ala-Asp
fluoromethylketone (zV AD-fmk), were purchased from BD PharMingen (San Diego,
CA). Both inhibitors are cell membrane permeable and may irreversibly bind to the
catalytic site of caspase proteases to inhibit apoptosis. Specifically, zDEVD-fmk is a
pan-caspase inhibitor and zV AD-fmk is a caspase-3 inhibitor. Cells were
preincubated with the inhibitors at a final concentration ranging between 20 μM and
150 μM 3 hours before adding each antibody preparations. For the positive control,
Jurkat cells (2.5 × 10
5
/mL) were incubated with anti-Fas IgM (Immunotech) at 0.8
μg/mL. For the experimental samples, Raji, B35M, and DG75 cells (2.5 × 10
5
/mL)
were treated with Lym-1 antibody at 10 μg/mL. All cells were incubated for 18
hours at 37 °C in a 5% CO
2
incubator. Annexin V/propidium iodide staining was used
to quantitate apoptosis as described above.

Measurement of caspase-3 activity
Raji cells (2.5 × 10
5
/mL) were incubated with Lym-1 in 96-well plate at a final
concentration of 20 μg/ml for 3, 5, or 24 hours. The cells then were washed with
PBS and stained with a cell permeable caspase-3 substrate, Phiphilux-G1D2, as
described previously (57).

56
Indirect Immunofluorescence microscopy
The pattern of antigen distribution on the surfaces of cells treated with Lym-1
and rituximab was observed by indirect immunofluorescence microscopy. For these
studies, 5 × 10
5
Raji cells were treated with 20 μg of each antibody preparations at
37
o
C for 1 hour, fixed with freshly prepared 2% paraformaldehyde diluted in PBS at
room temperature, followed by two washes with PBS containing 1% BSA. Fixed
cells were then incubated with 25 μg of FITC-conjugated goat anti-mouse antibody
F(ab’)
2
(ICN-Cappel) at 4
o
C for 30 min and subsequently washed twice with PBS
(1% BSA). Finally, cytospin preparations were made at 1,250 × g for 10 min, and
slides were mounted in Vectorshield with 4’,6’-diamino-2-phenylindol (DAPI,
Vector Laboratories, Burlingame, CA) for observation under a phase-contrast
fluorescence microscope (Leitz Orthoplan, Wetzlar, Germany) using a 50× water
immersion lens.

Immunotherapy studies
Six-week-old female, athymic, nude mice (Harlan, Indianapolis, IN) were
irradiated with 350 rads from a cesium source to suppress innate NK activity and
three days later were injected subcutaneously with a 0.2 mL inoculum containing 5 ×
10
6
Raji lymphoma cells and 10
5
human fetal fibroblast feeder cells in the left flank
using a University Animal Care Committee-approved protocol. The human fetal
fibroblast feeder cells established in our laboratory provide growth factors that
promote a high tumor take rate (>90%). Tumors were grown for 10-15 days until

57
they reached 0.5 cm in diameter at which time, groups of mice (n=5) were injected
i.v. with 0.1 mL inoculum containing 100 μg of Lym-1 or rituximab. All groups were
treated every other day ×3 and tumor volumes were monitored 3x/week by caliper
measurement in three dimensions using the formula: length × width × height. All
data were presented as means of tumor volume (cm
3
) and significance levels were
determined using the Wilcoxon’s rank-sum test. All mice were sacrificed by sodium
pentobarbital overdose.

RESULTS
Direct induction of apoptosis by Lym-1 and chLym-1
Raji, B35M, and DG75 cells were treated with Lym-1 or chLym-1 for 18 hours
at 37
o
C. The amount of early and late apoptosis was measured by annexin
V/propidium iodide staining (Figure 3-1A) and the TUNEL assay (Figure 3-1B),
respectively. These studies showed that both Lym-1 and chLym-1 were potent
apoptosis inducers on these three cell lines. In the annexin V/propidium iodide
staining studies, Lym-1 induced 77.1%, 82.84%, and 61.81% overall apoptosis on
Raji, B35M, and DG75 cells, respectively. Chlym-1 induced a similar level of
apoptosis (73.53%, 84.72%, and 73.41%, respectively). Moreover, Lym-1 was also
found to induce a high level of DNA strands breaks in Raji cells (89.9%) by the
TUNEL assay.

58
Figure 3-1. Lym-1 and chLym-1 induced apoptosis of human B lymphoma cells.
(A) AnnexinV/propidium iodide (PI) staining. Lym-1 induced a mixture of early
(annexin V
+
/ PI
–
) and late apoptosis (annexin V
+
/PI
+
, annexin V
–
/PI
+
). For Raji cells,
the overall apoptotic percentage induced by the isotype matched control, Lym-1, and
chLym-1, respectively, was 5.45%, 77.1%, and 73.53%; for B35M cells, it was
11.66%, 82.84%, and 84.72%, respectively; and for DG75 cells, it was 4.94%,
61.81%, and 73.41%, respectively. (B) Lym-1 induced DNA strands breaks of Raji
cells assessed by TUNEL assay.

A

59
Figure 3-1: Continued
B

Loss of mitochondrial membrane potential ( ΔΨm) observed in Lym-1 treated B
lymphoma cells
To understand the intracellular pathways in HLA-DR mediated apoptosis, we
investigated whether loss of mitochondrial membrane potential was involved in
treated B lymphoma cells. Briefly, cells were incubated with Lym-1 for either 30 min
or 120 min, followed by staining with a fluorescent probe tetramethylrhodamine
ethyl ester (TMRE). As shown in Figure 3-2, significant mitochondrial membrane
depolarization was detected in Raji, B35M, and DG75 cells. Interestingly, the
mitochondrial membrane depolarization occurred as early as 30 min after Lym-1
treatment, with 44% of Raji cells, 22% of DG75 cells, and 56% of B35M cells losing
their mitochondrial membrane potential. A similar percentage of cells with
disruption of mitochondrial membrane potential were observed 2 hours post
treatment.

60
Figure 3-2. Mitochondrial depolarization induced by Lym-1. Raji, DG75, and
B35M cells were incubated with Lym-1 or the isotype matched control for 30 or 120
min, followed by TMRE staining and flow cytometry. Cells showing a loss of
mitochondrial membrane potential are shown below the drawn line in each sample.

Lym-1 induced apoptosis is caspase-independent but caspase-3 activation is still
present.
To explore the molecular mechanisms whereby Lym-1 triggers cell death, we
investigated whether caspase activation was a requirement for the apoptosis induced
in Raji and B35M cells. For these studies, the caspase-3 inhibitor zDEVD-fmk and
pan-caspase inhibitor zV AD-fmk were used to determine whether such apoptosis
induced by Lym-1 is caspase dependent or independent. As shown in Figure 3, anti-

61
Fas IgM induced apoptosis of Jurkat cells was completely inhibited by both
inhibitors at concentrations as low as 20 μM (zV AD-fmk) and 50 μM (zDEVD-fmk).
By contrast, apoptosis was not inhibited by either inhibitor using the same range of
concentrations in the Lym-1-treated Raji and B35M cells. Although a slight
inhibition of apoptosis (p<0.05) was detected at a high concentration (150 μM) of
zV AD-fmk in Lym-1-treated Raji cells (Figure 3-3), no further level of inhibition
was observed at 300 μM of zV AD-fmk (data not shown). Interestingly, even though
these studies showed that Lym-1 induced apoptosis is caspase independent, when we
examine caspase-3 activity using a cell-permeable caspase-3 substrate, Phiphilux-
G1D2, activation of caspase-3 was observed in Lym-1 treated Raji cells (Figure 3-4).
Caspase-3 activity reached peak activity at 5 hours after Lym-1 treatment and
decreased at 24 hours. Caspase-3 activation in B35M cells 4 hours after Lym-1
incubation was also found by these methods (data not shown). These data seem to
suggest that different apoptotic pathways are involved in human lymphoma cells
treated with Lym-1. Figures 3-3 and 3-4 together indicate that the caspase pathways
are contributing to Lym-1 induced apoptosis, but only as optional apoptotic executors.

62
Figure 3-3. Lym-1 induced apoptosis is not inhibited by caspase inhibitors zV AD-
FMK and zDEVD-FMK. Apoptosis was quantified by annexin V/propidium iodide
staining. (A) Anti-Fas IgM induced apoptosis in Jurkat cells pre-incubated with
caspase inhibitors. Lym-1 induced apoptosis in (B) Raji, (C) B35M, and (D) DG75
cells pre-incubated with both caspase inhibitors.

A

63
Figure 3-3: Continued
B

C

64
Figure 3-3: Continued
D

65
Figure 3-4. Flow cytometric analysis of caspase-3 activation in Raji lymphoma
cells following treatment with Lym-1 at different time points.

66
Indirect immunofluorescence microscopy studies.
Lym-1 binding of HLA-DR in human lymphoma cells has a unique staining
pattern shown by indirect immunofluorescence microscopy. For these studies, Lym-
1 and an anti-CD20 mAb, rituximab, were incubated with Raji cells and then fixed
with 2% paraformaldehyde before being stained with secondary FITC-conjugated
goat anti-mouse F(ab’)
2
. Fixation before staining with secondary antibody
eliminates the possibility that secondary antibodies may hyper-crosslink primary
antibodies, and thus change the distribution pattern. The results shown in Figure 3-5
demonstrate that anti-CD20 staining produced a ring pattern of immunofluorescence,
indicating that CD20 is evenly distributed on the surface of Raji cells. By contrast,
cells stained with Lym-1 were found to have a unique speckled, segregated pattern of
immunofluorescence, which indicated that HLA-DR is highly clustered on the cell
surface. Since it is known that HLA-DR is constitutively associated with lipid rafts
(56), direct binding of Lym-1 on the lymphoma cell surface appears to be all that is
necessary to trigger a cascade of intracellular signaling events leading towards
apoptosis.

67
Figure 3-5. Comparison of Lym-1 and Rituximab staining patterns shown by
indirect immunofluorescence microscopy. Note speckled membrane pattern
produced by Lym-1.

Immunotherapy studies
The antitumor activity of Lym-1 was compared to rituximab in Raji tumor-
bearing nude mice. As described above, treatment did not commence until day 15
when the tumors were palpable in size. As shown in Figure 3-6, the group of mice
receiving Lym-1 treatment showed marked tumor regression and the average tumor
volume of the Lym-1-treated group on the 29
th
day after tumor implantation was 15%
of the tumor volume in the PBS-treated control group (P < 0.01). By contrast, tumor
growth was only slightly reduced in the group of mice receiving rituximab compared
to the PBS treated control group. These data suggest that the induction of apoptosis
by Lym-1 treatment, unlike rituximab therapy, has the ability to produce tumor
regression in this lymphoma model.

68
Figure 3-6. Lym-1 and Rituximab immunotherapy in Raji xenograft model. Δ,
Lym-1; ○, Rituximab; ■, PBS control.

DISCUSSION
HLA-DR has been shown to be an ideal target for immunotherapy, since it is
not shed, internalized, or modified after antibody ligation (30). For this reason, many
anti-HLA-DR mAbs have been generated and evaluated for their potential as
therapeutic reagents. Lym-1, a monoclonal anti HLA-DR antibody that was
generated in 1987, has been extensively studied as a radiolabeled antibody for the
treatment of Non-Hodgkin’s Lymphoma (31-42). While unlabeled Lym-1 has
always been deemed to have very limited anti-tumor effects, it has recently been

69
shown to be a potent inducer of apoptosis (25). In our hands, both Lym-1 and
chLym-1 were able to induce significant levels of apoptosis in different human B
lymphoma cell lines in vitro as shown by both annexin V/propidium iodide staining
and TUNEL assays. To characterize the pathways involved in Lym-1 induced
apoptosis, depolarization of mitochondrial membrane potential and caspase-3
activation were investigated. Data from these studies showed that both of them were
involved after Lym-1 treatment. When compared with Fas-induced caspase
dependent apoptosis, however, Lym-1 induced apoptosis was found to be caspase-
independent. Indirect immunofluorescence microscopy showed that the staining
pattern of Lym-1 on Raji cells was speckled while that of rituximab produced a ring
pattern. These results demonstrate that unlike CD20, which is evenly distributed on
the cell surface of lymphoma cells, HLA-DR is concentrated in specific regions on
the cell membrane. Finally, data are presented to compare the anti-tumor effects of
Lym-1 and rituximab on Raji xenografts in nude mice. The results of these studies
show that Lym-1 can effectively induce significant tumor regressions unlike control
or rituximab treated mice.
The concept that anti-tumor treatment kills tumor cells by interfering with
essential biological functions or by immunological intervention, now needs to be
modified by the notion that the treatment itself may initiate programmed cell death.
In support of this, the occurrence of apoptosis in tumor cells has been confirmed and
correlated with the therapeutic efficacy of the treatment used (64-69). One classic
apoptosis executor is the family of cysteine proteases called caspases. These

70
cytoplasmic enzymes are now known to be mainly responsible for the final execution
of apoptosis in most instances. In Lym-1 treated human lymphoma cells, caspase-3
activation was observed in association with morphological changes associated with
apoptosis induced cell death (25). In accordance with these data, we have also
confirmed caspase-3 activation in Raji cells as early as 3 hours post Lym-1 treatment.
However, when both caspase-3 and pan-caspase inhibitors were used, Lym-1 induced
apoptosis was found not to depend on the activation of caspase-3, compared with
known Fas-mediated caspase-3 dependent apoptosis. In these experiments, however,
there was a slight decrease in the amount of apoptosis (p<0.05) in Raji cells treated
by Lym-1 plus caspase inhibitors, indicating that caspase-3 activation appears to
contribute to a small portion of apoptosis in Raji cells. These findings were not
observed in DG75 or B35M cells, however. For other anti-HLA-DR antibodies,
such as 1D10 and L243, apoptosis occurs with no activation of caspase, a finding
different than that seen with Lym-1. These observations suggest, that in the majority
of instances, anti-HLA-DR treatment induces caspase-independent apoptosis.
Actually Leist et al has suggested that multiple apoptotic pathways may be triggered
simultaneously upon induction of apoptosis and that the final outcome and form of
cell death would depend on the relative speed of each pathway (70). In anti-HLA-
DR induced apoptosis, it is possible that a caspase-independent pathway may occur
first and dominate over other pathways.
Among various pathways leading toward apoptosis, mitochondria play a
significant role in HLA-DR mediated apoptosis (50). We have studied depolarization

71
of mitochondrial membrane potential, which is a good indicator of involvement of
mitochondria in such apoptotic pathways. It was observed that only 30 minutes post
Lym-1 binding, a significant percentage of cells showed loss of mitochondrial
membrane potential, suggesting that mitochondrial depolarization could be one of
the earliest events after Lym-1 treatment. Despite these results, it is still unknown
which major pathway is involved, especially regarding the downstream execution of
apoptosis. Additional studies are underway to examine this issue further.
When we compared the cell surface staining by Lym-1 and rituximab using
immunofluorescence microscopy, different staining patterns were observed.
Interestingly, a similar speckled staining pattern as that seen with Lym-1 could be
observed by rituximab staining after it was hyper-crosslinked by secondary goat anti-
mouse antibodies (57). After redistribution of CD20 into lipid rafts where it comes
juxtaposed to cell signaling molecules, the anti-CD20 induces rapid apoptosis (54).
Based upon these findings, we believe that the ability of Lym-1 to induce apoptosis
upon binding to lymphoma cells may be due to the constitutive expression of the
HLA-DR antigen in the lipid rafts.
Consistent with the above in vitro results, Lym-1 was shown to produce
significant and profound anti-tumor effects in vivo. In these studies, Lym-1
treatment was found to inhibit tumor growth by 85% compared to PBS treated
controls. By contrast, rituximab showed little anti-tumor activity using a similar
treatment regimen and dosing levels. Since nude mice were used to grow the Raji
xenografts, the immunocompromised nature of these mice would limit the killing

72
function of antibody treatment to apoptosis alone since ADCC at the dosage used is
not operative in these animals. Hence, the in vivo results are in accordance with the
ability of Lym-1 to induce apoptosis upon binding to the lymphoma xenografts.
From these data, it is expected that chLym-1, which has identical capabilities to
induce apoptosis as its murine counterpart, is a promising reagent for the treatment of
human malignant lymphomas. Since chLym-1 is a mouse/human chimeric mAb, we
expect it to have a longer biological half-life and higher tumor uptake in patients than
murine Lym-1. With improved pharmacokinetics in patients, chLym-1 may be
especially effective since, unlike anti-CD20, it will possess the ability to induce
apoptosis in addition to ADCC and CDC activities to destroy lymphoma cells in situ.

CHAPTER 3 REFERENCES

1. Grillo-Lopez, A. J., White, C. A., Dallaire, B. K., Varns, C. L., Shen, C. D.,
Wei, A., Leonard, J. E., McClure, A., Weaver, R., Cairelli, S., and Rosenberg,
J. Rituximab: the first monoclonal antibody approved for the treatment of
lymphoma. Curr Pharm Biotechnol, 1: 1-9, 2000.
2. McLaughlin, P., Grillo-Lopez, A. J., Link, B. K., Levy, R., Czuczman, M. S.,
Williams, M. E., Heyman, M. R., Bence-Bruckler, I., White, C. A., Cabanillas,
F., Jain, V ., Ho, A. D., Lister, J., Wey, K., Shen, D., and Dallaire, B. K.
Rituximab chimeric anti-CD20 monoclonal antibody therapy for relapsed
indolent lymphoma: half of patients respond to a four-dose treatment program.
J Clin Oncol, 16: 2825-2833, 1998.

73

3. Hekman, A., Honselaar, A., Vuist, W. M., Sein, J. J., Rodenhuis, S., ten
Bokkel Huinink, W. W., Somers, R., Rumke, P., and Melief, C. J. Initial
experience with treatment of human B cell lymphoma with anti-CD19
monoclonal antibody. Cancer Immunol Immunother, 32: 364-372, 1991.
4. Scheuermann, R. H. and Racila, E. CD19 antigen in leukemia and lymphoma
diagnosis and immunotherapy. Leuk Lymphoma, 18: 385-397, 1995.
5. Manches, O., Lui, G., Chaperot, L., Gressin, R., Molens, J. P., Jacob, M. C.,
Sotto, J. J., Leroux, D., Bensa, J. C., and Plumas, J. In vitro mechanisms of
action of rituximab on primary non-Hodgkin lymphomas. Blood, 101: 949-
954, 2003.
6. Maloney, D. G., Grillo-Lopez, A. J., C.A., W., and al, e. IDEC-C2B8
(Rituximab) anti-CD20 monoclonal antibody therapy in patients with
relapsed low-grade non-Hodgkin's lymphoma. Blood, 90: 2188-2195, 1997.
7. Demidem, A., Lam, T., Alas, S., Hariharan, K., Hanna, N., and Bonavida, B.
Chimeric anti-CD20 (IDEC-C2B8) monoclonal antibody sensitizes a B cell
lymphoma cell line to cell killing by cytotoxic drugs. Cancer Biother
Radiopharm, 12: 177-186, 1997.
8. Press, O. W., Appelbaum, F., Ledbetter, J. A., Martin, P. J., Zarling, J., Kidd,
P., and Thomas, E. D. Monoclonal antibody 1F5 (anti-CD20) serotherapy of
human B cell lymphomas. Blood, 69: 584-591, 1987.
9. Reff, M. E., Carner, K., Chambers, K. S., Chinn, P. C., Leonard, J. E., Raab,
R., Newman, R. A., Hanna, N., and Anderson, D. R. Depletion of B cells in
vivo by a chimeric mouse human monoclonal antibody to CD20. Blood, 83:
435-445, 1994.
10. McLaughlin, P., Hagemeister, F. B., and Grillo-Lopez, A. J. Rituximab in
indolent lymphoma: the single-agent pivotal trial. Semin Oncol, 26: 79-87,
1999.

74
11. Leonard, J. P. and Link, B. K. Immunotherapy of non-Hodgkin's lymphoma
with hLL2 (epratuzumab, an anti-CD22 monoclonal antibody) and Hu1D10
(apolizumab). Semin Oncol, 29: 81-86, 2002.
12. Cesano, A. and Gayko, U. CD22 as a target of passive immunotherapy. Semin
Oncol, 30: 253-257, 2003.
13. Coleman, M., Goldenberg, D. M., Siegel, A. B., Ketas, J. C., Ashe, M., Fiore,
J. M., and Leonard, J. P. Epratuzumab: targeting B-cell malignancies through
CD22. Clin Cancer Res, 9: 3991S-3994S, 2003.
14. Buchsbaum, D. J., Wahl, R. L., Normolle, D. P., and Kaminski, M. S.
Therapy with unlabeled and 131I-labeled pan-B-cell monoclonal antibodies
in nude mice bearing Raji Burkitt's lymphoma xenografts. Cancer Res, 52:
6476-6481, 1992.
15. Kaminski, M. S., Fig, L. M., Zasadny, K. R., Koral, K. F., DelRosario, R. B.,
Francis, I. R., Hanson, C. A., Normolle, D. P., Mudgett, E., Liu, C. P., and et
al. Imaging, dosimetry, and radioimmunotherapy with iodine 131-labeled
anti-CD37 antibody in B-cell lymphoma. J Clin Oncol, 10: 1696-1711, 1992.
16. Pagel, J. M., Hedin, N., Subbiah, K., Meyer, D., Mallet, R., Axworthy, D.,
Theodore, L. J., Wilbur, D. S., Matthews, D. C., and Press, O. W. Comparison
of anti-CD20 and anti-CD45 antibodies for conventional and pretargeted
radioimmunotherapy of B-cell lymphomas. Blood, 101: 2340-2348, 2003.
17. de Kroon, J. F., de Paus, R. A., Kluin-Nelemans, H. C., Kluin, P. M., van
Bergen, C. A., Munro, A. J., Hale, G., Willemze, R., and Falkenburg, J. H.
Anti-CD45 and anti-CD52 (Campath) monoclonal antibodies effectively
eliminate systematically disseminated human non-Hodgkin's lymphoma B
cells in Scid mice. Exp Hematol, 24: 919-926, 1996.
18. Shi, J. D., Bullock, C., Hall, W. C., Wescott, V ., Wang, H., Levitt, D. J., and
Klingbeil, C. K. In vivo pharmacodynamic effects of Hu1D10 (remitogen), a
humanized antibody reactive against a polymorphic determinant of HLA-DR
expressed on B cells. Leuk Lymphoma, 43: 1303-1312, 2002.

75

19. Longo, D. L. DR's orders: human antibody kills tumors by direct signaling.
Nat Med, 8: 781-783, 2002.
20. Nagy, Z. A., Hubner, B., Lohning, C., Rauchenberger, R., Reiffert, S.,
Thomassen-Wolf, E., Zahn, S., Leyer, S., Schier, E. M., Zahradnik, A.,
Brunner, C., Lobenwein, K., Rattel, B., Stanglmaier, M., Hallek, M., Wing,
M., Anderson, S., Dunn, M., Kretzschmar, T., and Tesar, M. Fully human,
HLA-DR-specific monoclonal antibodies efficiently induce programmed
death of malignant lymphoid cells. Nat Med, 8: 801-807, 2002.
21. Epstein, A. L., Marder, R. J., Winter, J. N., Stathopoulos, E., Chen, F. M.,
Parker, J. W., and Taylor, C. R. Two new monoclonal antibodies, Lym-1 and
Lym-2, reactive with human B-lymphocytes and derived tumors, with
immunodiagnostic and immunotherapeutic potential. Cancer Res, 47: 830-
840, 1987.
22. Chan, C. H., Wang, J., French, R. R., and Glennie, M. J. Internalization of the
lymphocytic surface protein CD22 is controlled by a novel membrane
proximal cytoplasmic motif. J Biol Chem, 273: 27809-27815, 1998.
23. Shan, D. and Press, O. W. Constitutive endocytosis and degradation of CD22
by human B cells. J Immunol, 154: 4466-4475, 1995.
24. Carnahan, J., Wang, P., Kendall, R., Chen, C., Hu, S., Boone, T., Juan, T.,
Talvenheimo, J., Montestruque, S., Sun, J., Elliott, G., Thomas, J., Ferbas, J.,
Kern, B., Briddell, R., Leonard, J. P., and Cesano, A. Epratuzumab, a
humanized monoclonal antibody targeting CD22: characterization of in vitro
properties. Clin Cancer Res, 9: 3982S-3990S, 2003.
25. Liu, C., DeNardo, G., Tobin, E., and DeNardo, S. Antilymphoma effects of
anti-HLA-DR and CD20 monoclonal antibodies (Lym-1 and Rituximab) on
human lymphoma cells. Cancer Biother Radiopharm, 19: 545-561, 2004.

76
26. Hu, P., Glasky, M. S., Yun, A., Alauddin, M. M., Hornick, J. L., Khawli, L. A.,
and Epstein, A. L. A human-mouse chimeric Lym-1 monoclonal antibody
with specificity for human lymphomas expressed in a baculovirus system.
Hum Antibodies Hybridomas, 6: 57-67, 1995.
27. Lechler RI., S. E., and Bach F Major and minor histocompatibility antigens.
In: Transplantation Immunology., p. 1-34. New York: Wiley-Liss, 1995.
28. Rose, L. M., Gunasekera, A. H., DeNardo, S. J., DeNardo, G. L., and Meares,
C. F. Lymphoma-selective antibody Lym-1 recognizes a discontinuous
epitope on the light chain of HLA-DR10. Cancer Immunol Immunother, 43:
26-30, 1996.
29. Rose, L. M., Deng, C. T., Scott, S. L., Xiong, C. Y ., Lamborn, K. R.,
Gumerlock, P. H., DeNardo, G. L., and Meares, C. F. Critical Lym-1 binding
residues on polymorphic HLA-DR molecules. Mol Immunol, 36: 789-797,
1999.
30. DeNardo, G. L. The next generation of imaging and therapeutic agents for
lymphoma and chronic lymphocytic leukemia. Meniscus, 3: 76, 1995.
31. DeNardo, G. L., DeNardo, S. J., Lamborn, K. R., Goldstein, D. S., Levy, N.
B., Lewis, J. P., O'Grady, L. F., Raventos, A., Kroger, L. A., Macey, D. J.,
McGahan, J. P., Mills, S. L., and Shen, S. Low-dose, fractionated
radioimmunotherapy for B-cell malignancies using 131I-Lym-1 antibody.
Cancer Biother Radiopharm, 13: 239-254, 1998.
32. DeNardo, S. J., DeNardo, G. L., O'Grady, L. F., Macey, D. J., Mills, S. L.,
Epstein, A. L., Peng, J. S., and McGahan, J. P. Treatment of a patient with B
cell lymphoma by I-131 LYM-1 monoclonal antibodies. Int J Biol Markers, 2:
49-53, 1987.
33. DeNardo, S. J., DeNardo, G. L., O'Grady, L. F., Hu, E., Sytsma, V . M., Mills,
S. L., Levy, N. B., Macey, D. J., Miller, C. H., and Epstein, A. L. Treatment
of B cell malignancies with 131I Lym-1 monoclonal antibodies. Int J Cancer
Suppl, 3: 96-101, 1988.

77

34. DeNardo, G. L., DeNardo, S. J., O'Grady, L. F., Levy, N. B., Adams, G. P.,
and Mills, S. L. Fractionated radioimmunotherapy of B-cell malignancies
with 131I-Lym-1. Cancer Res, 50: 1014s-1016s, 1990.
35. DeNardo, G. L., Lewis, J. P., DeNardo, S. J., and O'Grady, L. F. Effect of
Lym-1 radioimmunoconjugate on refractory chronic lymphocytic leukemia.
Cancer, 73: 1425-1432, 1994.
36. Denardo, G. L., Denardo, S. J., Kukis, D. L., O'Donnell, R. T., Shen, S.,
Goldstein, D. S., Kroger, L. A., Salako, Q., Denardo, D. A., Mirick, G. R.,
Mausner, L. F., Srivastava, S. C., and Meares, C. F. Maximum tolerated dose
of 67Cu-2IT-BAT-LYM-1 for fractionated radioimmunotherapy of non-
Hodgkin's lymphoma: a pilot study. Anticancer Res, 18: 2779-2788, 1998.
37. DeNardo, G. L., DeNardo, S. J., Lamborn, K. R., Goldstein, D. S., Levy, N.
B., Lewis, J. P., O'Grady, L. F., Raventos, A., Kroger, L. A., Macey, D. J.,
McGahan, J. P., Mills, S. L., and Shen, S. Low-dose, fractionated
radioimmunotherapy for B-cell malignancies using 131I-Lym-1 antibody
(100% lym-1 reactive). Cancer Biother Radiopharm, 13: 239-254, 1998.
38. DeNardo, G. L., DeNardo, S. J., Goldstein, D. S., Kroger, L. A., Lamborn, K.
R., Levy, N. B., McGahan, J. P., Salako, Q., Shen, S., and Lewis, J. P.
Maximum-tolerated dose, toxicity, and efficacy of (131)I-Lym-1 antibody for
fractionated radioimmunotherapy of non-Hodgkin's lymphoma. J Clin Oncol,
16: 3246-3256, 1998.
39. DeNardo, S. J., DeNardo, G. L., Kukis, D. L., Shen, S., Kroger, L. A.,
DeNardo, D. A., Goldstein, D. S., Mirick, G. R., Salako, Q., Mausner, L. F.,
Srivastava, S. C., and Meares, C. F. 67Cu-2IT-BAT-Lym-1 pharmacokinetics,
radiation dosimetry, toxicity and tumor regression in patients with lymphoma.
J Nucl Med, 40: 302-310, 1999.

78

40. DeNardo, G. L., DeNardo, S. J., Shen, S., DeNardo, D. A., Mirick, G. R.,
Macey, D. J., and Lamborn, K. R. Factors affecting 131I-Lym-1
pharmacokinetics and radiation dosimetry in patients with non-Hodgkin's
lymphoma and chronic lymphocytic leukemia. J Nucl Med, 40: 1317-1326,
1999.
41. DeNardo, G. L., Kukis, D. L., Shen, S., DeNardo, D. A., Meares, C. F., and
DeNardo, S. J. 67Cu-versus 131I-labeled Lym-1 antibody: comparative
pharmacokinetics and dosimetry in patients with non-Hodgkin's lymphoma.
Clin Cancer Res, 5: 533-541, 1999.
42. DeNardo, G. L., O'Donnell, R. T., Rose, L. M., Mirick, G. R., Kroger, L. A.,
and DeNardo, S. J. Milestones in the development of Lym-1 therapy.
Hybridoma, 18: 1-11, 1999.
43. DeNardo, G. L., DeNardo, S. J., Wessels, B. W., Kukis, D. L., Miyao, N., and
Yuan, A. 131I-Lym-1 in mice implanted with human Burkitt's lymphoma
(Raji) tumors: loss of tumor specificity due to radiolysis. Cancer Biother
Radiopharm, 15: 547-560, 2000.
44. Hu, E., Epstein, A. L., Naeve, G. S., Gill, I., Martin, S., Sherrod, A., Nichols,
P., Chen, D., Mazumder, A., and Levine, A. M. A phase 1a clinical trial of
LYM-1 monoclonal antibody serotherapy in patients with refractory B cell
malignancies. Hematol Oncol, 7: 155-166, 1989.
45. Ottonello, L., Epstein, A. L., Dapino, P., Barbera, P., Morone, P., and Dallegri,
F. Monoclonal Lym-1 antibody-dependent cytolysis by neutrophils exposed
to granulocyte-macrophage colony-stimulating factor: intervention of
FcgammaRII (CD32), CD11b-CD18 integrins, and CD66b glycoproteins.
Blood, 93: 3505-3511, 1999.
46. Ottonello, L., Morone, P., Mancini, M., Amelotti, M., Dapino, P., and Dallegri,
F. FMLP- and TNF-stimulated monoclonal Lym-1 antibody-dependent lysis
of B lymphoblastoid tumour targets by neutrophils. Br J Cancer, 80: 331-337,
1999.

79
47. Ottonello, L., Epstein, A. L., Mancini, M., Amelotti, M., Dapino, P., and
Dallegri, F. Monoclonal Lym-1 antibody-targeted lysis of B lymphoma cells
by neutrophils. Evidence for two mechanisms of FcgammaRII-dependent
cytolysis. J Leukoc Biol, 68: 662-668, 2000.
48. Ottonello, L., Epstein, A. L., Mancini, M., Tortolina, G., Dapino, P., and
Dallegri, F. Chimaeric Lym-1 monoclonal antibody-mediated cytolysis by
neutrophils from G-CSF-treated patients: stimulation by GM-CSF and role of
Fc gamma -receptors. Br J Cancer, 85: 463-469, 2001.
49. Mone, A. P., Huang, P., Pelicano, H., Cheney, C. M., Green, J. M., Tso, J. Y .,
Johnson, A. J., Jefferson, S., Lin, T. S., and Byrd, J. C. Hu1D10 induces
apoptosis concurrent with activation of the AKT survival pathway in human
chronic lymphocytic leukemia cells. Blood, 103: 1846-1854, 2004.
50. Bains, S. K., Mone, A., Yun Tso, J., Lucas, D., Byrd, J. C., Weiner, G. J., and
Green, J. M. Mitochondria control of cell death induced by anti-HLA-DR
antibodies. Leukemia, 17: 1357-1365, 2003.
51. Drenou, B., Blancheteau, V ., Burgess, D. H., Fauchet, R., Charron, D. J., and
Mooney, N. A. A caspase-independent pathway of MHC class II antigen-
mediated apoptosis of human B lymphocytes. J Immunol, 163: 4115-4124,
1999.
52. Kostelny, S. A., Link, B. K., Tso, J. Y ., Vasquez, M., Jorgensen, B. H., Wang,
H., Hall, W. C., and Weiner, G. J. Humanization and characterization of the
anti-HLA-DR antibody 1D10. Int J Cancer, 93: 556-565, 2001.
53. Muppidi, J. R. and Siegel, R. M. Ligand-independent redistribution of Fas
(CD95) into lipid rafts mediates clonotypic T cell death. Nat Immunol, 5:
182-189, 2004.
54. Deans, J. P., Li, H., and Polyak, M. J. CD20-mediated apoptosis: signalling
through lipid rafts. Immunology, 107: 176-182, 2002.

80
55. Brown, D. A. and London, E. Structure and function of sphingolipid- and
cholesterol-rich membrane rafts. J Biol Chem, 275: 17221-17224, 2000.
56. Bouillon, M., El Fakhry, Y ., Girouard, J., Khalil, H., Thibodeau, J., and
Mourad, W. Lipid raft-dependent and -independent signaling through HLA-
DR molecules. J Biol Chem, 278: 7099-7107, 2003.
57. Zhang, N., Khawli, L. A., Hu, P., and Epstein, A. L. Generation of rituximab
polymer may cause hyper-cross-linking-induced apoptosis in non-Hodgkin's
lymphomas. Clin Cancer Res, 11: 5971-5980, 2005.
58. Hofmeister, J. K., Cooney, D., and Coggeshall, K. M. Clustered CD20
induced apoptosis: src-family kinase, the proximal regulator of tyrosine
phosphorylation, calcium influx, and caspase 3-dependent apoptosis. Blood
Cells Mol Dis, 26: 133-143, 2000.
59. van der Kolk, L. E., Evers, L. M., Omene, C., Lens, S. M., Lederman, S., van
Lier, R. A., van Oers, M. H., and Eldering, E. CD20-induced B cell death can
bypass mitochondria and caspase activation. Leukemia, 16: 1735-1744, 2002.
60. Cartron, G., Dacheux, L., Salles, G., Solal-Celigny, P., Bardos, P., Colombat,
P., and Watier, H. Therapeutic activity of humanized anti-CD20 monoclonal
antibody and polymorphism in IgG Fc receptor FcgammaRIIIa gene. Blood,
99: 754-758, 2002.
61. Weng, W. K. and Levy, R. Two immunoglobulin G fragment C receptor
polymorphisms independently predict response to rituximab in patients with
follicular lymphoma. J Clin Oncol, 21: 3940-3947, 2003.
62. O'Reilly, C. M., Fogarty, K. E., Drummond, R. M., Tuft, R. A., and Walsh, J.
V ., Jr. Quantitative analysis of spontaneous mitochondrial depolarizations.
Biophys J, 85: 3350-3357, 2003.
63. Scaduto, R. C., Jr. and Grotyohann, L. W. Measurement of mitochondrial
membrane potential using fluorescent rhodamine derivatives. Biophys J, 76:
469-477, 1999.

81
64. Byrd, J. C., Kitada, S., Flinn, I. W., Aron, J. L., Pearson, M., Lucas, D., and
Reed, J. C. The mechanism of tumor cell clearance by rituximab in vivo in
patients with B-cell chronic lymphocytic leukemia: evidence of caspase
activation and apoptosis induction. Blood, 99: 1038-1043, 2002.
65. Fisher, D. E. Apoptosis in cancer therapy: crossing the threshold. Cell, 78:
539-542, 1994.
66. Friesen, C., Herr, I., Krammer, P. H., and Debatin, K. M. Involvement of the
CD95 (APO-1/FAS) receptor/ligand system in drug-induced apoptosis in
leukemia cells. Nat Med, 2: 574-577, 1996.
67. Fulda, S., Susin, S. A., Kroemer, G., and Debatin, K. M. Molecular ordering
of apoptosis induced by anticancer drugs in neuroblastoma cells. Cancer Res,
58: 4453-4460, 1998.
68. Held, K. D. Radiation-induced apoptosis and its relationship to loss of
clonogenic survival. Apoptosis, 2: 265-282, 1997.
69. Kroger, L. A., DeNardo, G. L., Gumerlock, P. H., Xiong, C. Y ., Winthrop, M.
D., Shi, X. B., Mack, P. C., Leshchinsky, T., and DeNardo, S. J. Apoptosis-
related gene and protein expression in human lymphoma xenografts (Raji)
after low dose rate radiation using 67Cu-2IT-BAT-Lym-1
radioimmunotherapy. Cancer Biother Radiopharm, 16: 213-225, 2001.
70. Leist, M. and Jaattela, M. Four deaths and a funeral: from caspases to
alternative mechanisms. Nat Rev Mol Cell Biol, 2: 589-598, 2001.

82
CHAPTER 4
TNT-3/CD137L AND FC/CD137L FUSION PROTEINS FOR THE
IMMUNOTHERAPY OF EXPERIMENTAL SOLID TUMOR
ABSTRACT
CD137L is a member of the TNF superfamily and provides a costimulatory
signal to T cells. A tumor-targeting TNT-3/CD137L and a control Fc/CD137L fusion
proteins were constructed, expressed, purified, and examined for their tumor
targeting ability and anti-tumor activity in experimental mouse tumor model. TNT-
3/CD137L fusion protein showed a much higher tumor uptake than Fc/CD137L over
48 hours in colon 26 tumor-bearing mice. Immunotherapeutic data indicated that
administration of tumor-targeting TNT-3/CD137L induced tumor regression
significantly and prolonged the survival of treated mice. Both CD137L fusion
proteins induced massive central necrosis inside of tumor and broadly infiltration of
granzyme B-positive cells in central necrotic areas and viable peripheral region of
tumor. Cell depletion study indicated that such CD137L mediated tumor regression
is completely CD8+ T cells-dependent. In conclusion, TNT-3/CD137L fusion
protein has demonstrated good tumor-targeting and effective anti-tumor activity. It
may eventually serve as a potentially effective strategy for generating immune
responses to tumors in clinical settings.

83
INTRODUCTION
T cell anergy is one of the major impediments to the immune system’s ability
to eradicate established tumors. In order to elicit an effective T cell response, two
signals are required: the first signal is the engagement of the T-cell receptor (TCR)
by MHC-peptide complex, while the second signal is through costimulation. The
B7/CD28 interaction has been widely studied as the primary pathway for
costimulatory activation of resting T cells. Recently, signaling relayed through
CD137 has received broad attention as another major costimulatory pathway that
stimulates potent T-cell effector functions.
CD137 (4-1BB) and its natural ligand CD137L (4-1BBL) are members of the
TNFR/TNF superfamily (1-3). CD137 is transiently expressed primarily on activated
T cells (4, 5), while its natural ligand, CD137L, has been found on activated antigen
presenting cells (1, 6-8). Although the engagement of CD137 by CD137L provides
costimulation to both CD4
+
and CD8
+
T cells (9-11), collective evidence has shown
that the costimulation has a more profound impact on CD8
+
T cells (12). In
experiments using CD137 agonist antibody or cells constitutively expressing
CD137L (9, 12-22), CD137 engagement was shown to regulate T cell number and
functions, including cytokine secretions (10, 12, 13, 23, 24), prevention and
reversion of established anergy in CD8
+
CTLs (19), and prevention of activation-
induced cell death (AICD) through NF-kB activation, which further induces Bcl-xl,
Bfl-1, and c-FLIP via phosphatidylinositol 3-kinase and AKT/protein kinase B
pathway (25, 26). Importantly, systemic administration of agonistic anti-CD137 mAb

84
can eradicate established subcutaneous tumors in mice (16), and tumor cells
expressing CD137L have sustained tumor lytic T cells and facilitated T-cell-
mediated antitumor immunity in different mouse models (15, 17, 22, 27).
Given the usefulness of CD137 signaling in tumor immunotherapy, successful
delivery and retention of CD137L may lead to potent anti-tumor effect in many or all
solid tumors. Over the past 15 years, our laboratory has developed a new approach to
the immunotherapy of solid tumors, designated Tumor Necrosis Treatment (TNT),
which exploits the release of nuclear components from permeablized necrotic cells
within tumors by utilizing monoclonal antibodies directed against universal nuclear
antigens (28, 29). Because accumulation of necrotic debris is characteristic of almost
all solid tumors (29), Tumor Necrosis Treatment is expected to have potential
diagnostic and therapeutic applications to most human malignancies. The first-
generation TNT antibody, murine TNT-1, with specificity for DNA/histone complex
was shown to localize specifically to tumor sites in both animal models (28) and
imaging studies of patients (30, 31). Murine TNT-3 is the latest generation of TNT
antibodies. It targets single-stranded DNA with three-fold higher tumor uptake than
TNT-1 (32). Various cytokines including IL-2 (33), IL-12 (34), IFN- γ (35), a
chemokine molecule LEC (36, 37), and a costimulatory molecule H60 for NK cells
(in press) have been conjugated to TNT-3 antibody through genetic engineering, and
some of these fusion antibody conjugates have shown optimal tumor targeting in
biodistribution studies and pronounced immunotherapeutic potential by eliciting
immune reaction in the tumor microenvironment (36, 37).

85
In this study, a murine TNT-3/CD137L fusion protein was genetically
constructed, purified, and characterized as compared with a non-tumor-targeting
murine Fc/CD137L fusion and a CD137 agonist antibody. In vitro bioactivity of the
CD137L moiety was confirmed. This TNT-3/CD137L fusion protein showed
increased tumor uptake over 48 hours in colon 26 tumor-bearing mice.
Immunotherapeutic studies of these fusion proteins were performed and mechanisms
that account for tumor regression were explored. Our results indicate that
administration of tumor-targeting TNT-3/CD137L induced tumor regression
significantly and prolonged the survival of treated mice.

MATERIALS AND METHODS
Antibodies and Cell Lines
Anti-CD3 (145-11C clone), PE-anti CD4 (RM4-5 clone), PE-anti CD8 α (53-
6.7 clone), PE-anti CD25 (PC61 clone), PE-anti CD11c (HL3 clone), PE-anti-CD49b
(DX5 clone) mAb, and HRP-streptavidin were purchased from BD Pharmingen (San
Diego, CA). Hybridomas, including rat anti-mouse CD4 (GK1.5), anti-CD8 β (H35),
and anti-CD25 (PC-61) mAbs were purchased from American Type Culture
Collection (ATCC, Manassas ,VA). The hybridoma of anti-CD137 agonist antibody
2A was a kind gift from Dr. Lieping Chen (38). For immunohistochemical staining,
both primary rabbit anti-mouse granzyme B polyclonal antibody and secondary
biotinylated goat anti-rabbit IgG polyclonal antibody were purchased from Abcam
Inc. (Cambridge, MA).

86
The NS0 murine myeloma cell line was obtained form Lonza Biologics
(Slough, UK). The Colon 26 murine colorectal adenocarcinoma was obtained from
ATCC.

Reagents and Mice
The Glutamine Synthetase Gene Amplification System with expression
plasmids pEE6/hCMV-B and pEE12 was purchased from Lonza Biologics (Slough,
U.K.). The plasimid pORF, containing the murine CD137L cDNA, was purchased
from Invivogen (San Diego, CA). Restriction endonucleases, T4 DNA ligase, Vent
polymerase, and other molecular biology reagents were obtained from either New
England Biolabs (Beverly, MA) or Boehringer Mannheim (Indianapolis, IN).
Characterized and dialyzed fetal calf sera (FCS) were purchased from Hyclone Corp.
(Logan, UT), and RPMI 1640 medium, Hybridoma Selective Medium without L-
glutamine, MEM non-essential amino acids solution (100×), and phosphate-buffered
saline (PBS) were purchased from GIBCO LifeTechnologies. (San Diego, CA).
Iodine-125 was obtained from DuPont/New England Nuclear (North Billerica, MA)
as sodium iodide in 0.1N sodium hydroxide. Murine IL-2 ELISA kit was purchased
from BD Biosciences (San Jose, CA).
Six-week-old female BALB/c mice were obtained from Harlan Sprague-
Dawley (Indianapolis, IN). All experiments were performed in accordance with
Institutional Animal Care and Use Committee (IACUC) protocols and institutional
guidelines for the proper humane care and use of animals in research.

87
Construction of TNT-3/CD137L
The heavy chain of mTNT-3, preceded by an antibody leader sequence, was
amplified by PCR using primers 5’ AGCTCTAGAGCCGCCACCATG
GGATGGAGCGGGATCTTT 3’ and 5’ GGAATTCAGGCGGCCGCTTTT
ACCCGGAGTCCGGGAGAA 3’. The whole cDNA sequence was inserted into a
pEE12 vector by Xba I and EcoR I. The murine CD137L cDNA was purchased from
Invivogen (San Diego, California). The cDNA sequence of the extracellular region
of murine CD137L (excluding the transmembrane region) was amplified by PCR
using primers 5’ AAGGAAAAAAGCGGCCGCACCGAGCCTCGGCCAG
CG 3’ and 5’ GGCGAATTCTCATTCCCATGGGTTGTC 3’, and this sequence was
then inserted into the pEE12 vector, 3’ to the mTNT-3 heavy chain, by Not I and
EcoR I. Using electroporation, the resultant fusion gene in the pEE12 vector was co-
transfected with mTNT-3 light chain in pEE6 vector into NS0 cells.

Construction of Fc/CD137L
The antibody leader sequence was amplified using primers 5’
AGCTCTAGAGCCGCCACCATGGGATGGAGCGGGATCTTT 3’ and 5’
ATTGTGGGCCCTCTGGGCTCGGAGTGGACACCTCCAGTTA 3’.
The Fc/CD137L cDNA sequence (including hinge region, CH2, CH3 domain, and
CD137L extracellular domain) was amplified using primers 5’ TAACTGG
AGGTGTCCACTCCGAGCCCAGAGGGCCCACAAT 3’ and 5’ GGCGAATT
CTCATTCCCATGGGTTGTC 3’. An assembly PCR was performed to align the

88
previous two PCR products using primers 5’ AGCTCTAGAGCCGCCA
CCATGGGATGGAGCGGGATCTTT 3’ and 5’ GGCGAATTCTCATTC
CCATGGGTTGTC 3’. The resultant fusion gene was inserted to a pEE12 vector by
Xba I and EcoR I and transfected by electroporation into NS0 cells.

Expression and Purification of TNT-3/CD137L and Fc/CD137L
The TNT-3/CD137L and Fc/CD137L were expressed in NS0 murine myeloma
cells for long-term stable expression as per the manufacturer’s protocol (Lonza
biologics). The highest producing clones, determined by indirect ELISA screening
for murine Fc, were scaled up for incubation in an aerated 3-L stir flask bioreactor
using 5% heat-inactivated dialyzed fetal calf serum to eliminate the induction of
proteolytic enzymes by the NS0 cells during incubation and to protect against the
fusion protein breakage. The secreted fusion protein was then purified from clarified
cell culture supernatant by tandem protein-A affinity and ion-exchange
chromatography, as described previously (39). The fusion protein was confirmed to
produce a single peak by HPLC analysis (data not shown). The fusion proteins were
analyzed by ELISA to verify the presence and proper folding of CD137L
extracellular domain. The fusion proteins were analyzed by SDS-PAGE to ensure
proper assembly and purity.

89
In Vitro Activity Assay
The bioactivity of the CD137L moiety was determined by ELISA measurement
of IL-2 production. Spleens were aseptically removed from six-week-old female
BALB/c mice, red blood cells were lysed using the BD Pharm Lyse
TM
Lysing buffer
(BD Pharmingen) and single cell suspension of lymphocytes was washed twice in
PBS. The cells were incubated in a 24-well plate (1.5 × 10
6
cells/well) pre-coated
with 5 μg/ml anti-CD3 (145-11C clone) in the presence of 2 μg/ml TNT-3/CD137L,
Fc/CD137L, or 2A. After a 48 h incubation, IL-2 production was determined by
sandwich ELISA (BD Biosciences) for the above culture supernatants according to
the manufacture’s protocol.

Pharmacokinetics and Biodistribution Studies
For whole-body clearance studies, groups of six-week-old female BALB/c
mice (n=5) were provided drinking water with potassium iodide beginning 1 week
prior to the administration of radioiodine in order to block thyroid uptake. Each
group received an intravenous injection of
125
I-labeled fusion protein (30 μCi/10
μg/mouse). The whole body radioactivity of each mouse was then measured at
various time intervals, beginning with the immediate post-injection period, using a
CRC-7 microdosimeter (Capintec Inc, Pittsburg, PA). The data were analyzed, as
previously described (39), to calculate the whole body half-life of TNT-3/CD137L
and Fc/CD137L.

90
For the biodistribution studies, groups of BALB/c mice (n=5) were
subcutaneously injected in the left flank with a 0.2 ml inoculum of 5×10
6
Colon 26
cells. The tumors were allowed to grow until they reached approximately 1 cm in
diameter (about 13 days post tumor implantation). Each mouse then received an i.v.
injection of 0.1 ml
125
I-labeled fusion protein (30 μCi/10 μg/mouse). Groups of mice
(n=5) were then sacrificed by sodium pentobarbital overdose at 24 and 48 h after
injection, and tumors and normal organs were dissected, weighed, and measured for
radioisotope activity with a gamma counter. Data were expressed for each mouse as
the % injected dose/gram of tissue (%ID/g), and the tumor to normal organ ratio was
determined. From these data, the mean ± standard deviation was calculated for each
group. Significance levels (P values) were determined using the Wilcoxon rank-sum
test.

Immunotherapeutic Studies
Six-week-old female BALB/c mice were subcutaneously (s.c.) injected in the
left flank with a 0.2 ml inoculum containing approximately 5×10
6
Colon 26 cells.
When the tumor reached 0.5 cm in diameter, at approximately the 5
th
day after tumor
implantation, groups of mice (n=5) were intravenously (i.v.) treated with a 0.1 ml
inoculum containing various concentration of TNT-3/CD137L or Fc/CD137L fusion
proteins. A dosing study was performed for doses ranging from 10 pmol/dose to 1
nmol/dose daily ×5. All groups of mice were treated daily ×5 and tumor growth was
monitored every other day by caliper measurement in three dimensions. Tumor

91
volume was calculated by the formula length × width × height. The results were
expressed as the mean ± SD. Significance levels (P values) were determined using
the Wilcoxon rank-sum test.

Survival Study
Group of BALB/c mice (n=5) were injected with Colon 26 cells as described
previously. Five days after tumor implantation, mice were treated with 1 nmol/dose
Fc/CD137L and TNT-3/CD137L daily ×5, and survival of the mice was recorded for
120 days. Significance levels (P values) were determined using the Wilcoxon rank-
sum test.

Depletion of Lymphocyte Subsets in vivo
To deplete CD4
+
and CD8
+
T cells, at day 5 post tumor implantation and every
5 days thereafter, 0.5 mg anti-CD4 antibody (GK1.5) and 0.5 mg anti-CD8 (H35)
were injected i.p. using a 1 mL inoculum in PBS. Depletion of specific T-cell subsets
was confirmed by FACS analysis of lymph nodes of inoculated mice by use of
antibody clones that differ from those used for depletion (data not shown).

Tumor Infiltrating Lymphocytes Staining by FACS
Mice from the control group, the TNT-3/CD137L (500pmol/dose) treated
group, and the Fc/CD137L (500pmole/dose) treated group were sacrificed by sodium
pentobarbital overdose 23 days following tumor implantation. Tumors were weighed

92
and tumor infiltrating lymphocytes were isolated as described previously (36). PE-
labled anti-CD4, anti-CD8, anti-CD11c, anti-CD25, and anti-CD49b antibodies were
used to stain the tumor infiltrating lymphocytes for FACS analysis. After gating on
lymphocytes, the percentages of all lymphocyte populations were calculated.

Histological Studies
Tumors and tumor draining lymph nodes from treated and control Colon 26-
bearing mice were removed on day 15 post-tumor implantation. Tumors were fixed
in 10% neutral buffered formalin (VWR Scientific, West Chester, PA) and paraffin-
embedded sections from Colon 26 tumor-bearing mice were stained with
Hematoxylin and Eosin (H&E) for morphologic studies. For immunohistochemical
studies, unstained sections of paraffin-embedded tissues were mounted on poly-L-
lysine coated slides, deparaffinized in histoclear and rehydrated using 100% and 95%
alcohol. Endogenous hydrogen peroxidase was quenched with 3% hydrogen
peroxide in absolute methanol for 20 minutes. Slides were then subjected to antigen
retrieval for 30 minutes in a microwave oven (citrate buffer solution, pH 6.0) and
subsequently cooled at room temperature for 15 minutes. Normal horse serum was
added for 20 minutes to block nonspecific binding in tissue sections. This was
followed by incubation with primary antibody overnight at room temperature and
biotinylated secondary antibody for 30 minutes thereafter. Avidin-biotin peroxidase
(ABC) was added for 30 minutes, followed by color development with 0.03%
diaminobenzidine (DAB) for 10 minutes. A wash step with phosphate buffer solution

93
for 10 minutes was performed between each step. Finally, slides were counterstained
with hematoxylin for 2 minutes and dehydrated using 95% and 100% alcohol, alpha-
terpineol xylene and xylene. Microscopic findings were recorded by an Optronix
digital camera.

RESULTS
Construction, Expression, and Purification of TNT-3/CD137L and Fc/CD137L
Taking into account the importance of the extracellular C-terminus of CD137L
for its bioactivity, we fused the N-terminus of the extracellular CD137L gene to the
C-terminus of the mTNT-3 heavy chain gene to engineer both TNT-3/CD137L and
Fc/CD137L fusion genes (Figure 4-1A and 4-1B). Both TNT-3/CD137L and
Fc/CD137L were translated under an antibody leader sequence.
Proper assembly of the TNT-3/CD137L and Fc/CD137L fusion proteins was
demonstrated by 4-15% reducing SDS-PAGE (Figure 4-1C): Two well-defined
bands were resolved for TNT-3/CD137L at approximately 28 kD and 85 kD,
corresponding to the molecular weights of the immunoglobulin light chain and heavy
chain plus the CD137L extracellular region after proper glycosylation (1). For the
Fc/CD137L, >97% of this fusion protein resolved at 70 kD, which corresponds to the
molecular weight of Fc plus the CD137L extracellular region after glycosylation.
One weak band was resolved at the molecular weight of 40 kD, indicating that less
than 3% of Fc/CD137L is being cleaved during expression.

94
Figure 4-1. Schematic diagram of the construction and final assembly of the murine
TNT-3/CD137L (A) and Fc/CD137L (B) fusion protein. C, electrophoretic analysis
of the purified TNT-3/CD137L and Fc/CD137L. Coomassie blue-stained 4%-15%
reducing SDS-PAGE.

A

95
Figure 4-1: Continued

B

96
Figure 4-1: Continued

C

97
Bioactivity of CD137L Moiety of the Fusion Protein
To determine whether the CD137L moiety of the fusion protein retained its
biological activity, lymphocyte IL-2 production was measured by ELISA. As shown
in Figure 4-2A, CD137L fusion proteins enhanced IL-2 production in the presence of
bound anti-CD3 compared with anti-CD3 alone. 2A (38), TNT-3/CD137L, and
Fc/CD137L were each able to provide the costimulatory second signal needed to
induce the production of similar levels of IL-2. These data indicate that the NS0-
expressed CD137L fusion proteins are is biologically active.

In Vivo Pharmacokinetics and Biodistribution Studies
Whole-body clearance studies were performed in healthy BALB/c mice to
establish the in vivo half-life of TNT-3/CD137L and Fc/CD137L. Mice were injected
intravenously with the radiolabeled fusion protein and whole-body radioactivity was
measured at various time points using a microdosimeter. The whole-body half-life of
TNT-3/CD137L and Fc/CD137L was found to be 18 h ± 15 min (P ≤ 0.01) and 24 h
± 20min (P ≤ 0.01), respectively.
Tissue biodistribution studies in Colon 26 tumor-bearing BALB/c mice were
performed to determine relative tumor uptake of each fusion protein. Tumor and
normal tissue uptake was measured 24 and 48 h after i.v. administration of
radiolabeled TNT-3/CD137L and Fc/CD137L. As shown in Figure 4-2B, the uptake
of TNT-3/CD137L per gram of tumor was significantly higher than the uptake in
normal organs at 24 h (P ≤ 0.01) and showed even higher retention at 48 h (P ≤ 0.01)

98
post injection. As expected, Fc/CD137L demonstrated low tumor retention over time
despite its relatively longer half-life. Examination of the tumor draining lymph nodes,
an important site for tumor immunotherapy, revealed that TNT-3/CD137L
demonstrates slightly better uptake than Fc/CD137L at 24 and 48 h post injection.
However, the average tumor draining lymph node retention of TNT-3/CD137L was
still much lower than that in tumor.

Figure 4-2. A, In vitro stimulation of IL-2 production by TNT-3/CD137L,
Fc/CD137L, and 2A. B, Tissue biodistribution and tumor uptake of TNT-3/CD137L
and Fc/CD137L at 24 and 48 hours postinjection in Colon 26–bearing BALB/C mice.
Tumor uptake measured by percent injected dose per gram of
125
I-labeled TNT-
3/CD137L or Fc/CD137L (upper); tumor/normal organ ratios (lower); columns,
mean; bars, SD.

A

99
Figure 4-2: Continued

B

100
Immunotherapeutic Dosing Studies
A dosing study was performed on Colon 26-bearing BALB/c mice with doses
ranging from 10 pmol/dose to 1 nmol/dose of TNT-3/CD137L, Fc/CD137L, and an
anti-CD137 agonist antibody 2A (Figure 4-3). At 10 pmol/dose, no significant tumor
reduction was observed in any of the treatment groups. At 100 pmol/dose and 250
pmol/dose, 2A treated mice demonstrated 95% tumor volume reduction, while TNT-
3/CD137L and Fc/CD137L treatment resulted in 30-40% tumor reduction at day 19
post tumor implantation. However, at 500 pmol/dose, the TNT-3/CD137L group
showed 70% tumor reduction, whereas Fc/CD137L-treated mice achieved only 30%
tumor reduction. This difference potentially indicates that at this particular dosage,
TNT-3/CD137L has better tumor retention than Fc/CD137L. At 1 nmol/dose, both
TNT-3/CD137L and Fc/CD137L treated groups showed 80% tumor reduction, and
2A treated groups demonstrated 95% tumor reduction. All 2A treated groups (except
10pmol/dose group) eventually became tumor free (data not shown). The mice
treated with any dose of fusion proteins did not show any signs of toxicity
throughout the 140-day experiment.

101
Figure 4-3. Dose response of TNT-3/CD137L, Fc/CD137L, and 2A in Colon 26-
bearing BALB/C mice.

102
Survival Studies
In the 1 nmol/dose treatment groups, survival of mice was recorded for up to
140 days post tumor implantation (Figure 4-4). Sixty percent of mice in the TNT-
3/CD137L treated group survived, and 40% of mice in the Fc/CD137L treated group
survived, whereas 100% mice from control group died at around day 50 post tumor
implantation. Mice from all of the three treated groups survived significantly longer
than the control group (P < 0.05).

Figure 4-4. Survival study of TNT-3/CD137L and Fc/CD137L in Colon 26 tumor-
bearing BALB/C mice.

103
Studies of the tumor infiltrating lymphocytes
Since 500 pmol/dose treatment groups in the dosing experiment demonstrated
the most difference in tumor volume, an analysis of the relative composition of
tumor infiltrating lymphocytes by flow cytometry was performed. At day 23 post
tumor implantation, mice from 500 pmol/dose treatment groups were sacrificed,
tumors were weighed and tumor infiltrating lymphocytes were stained for different
lymphocyte markers. The stained cells were analyzed by flow cytometry, and
percentage of lymphocyte populations among all detected tumor infiltrating
lymphocytes were calculated (Table 3). Comparing the lymphocytes populations
among the four different treatment groups, CD8
+
T cell percentage was demonstrated
to be inversely proportional to tumor volume and weight, indicating that CD8+ T
cells play an important role in eradicating the Colon 26 tumor. Interestingly, in the
2A treated mice, CD8+ T cells were the predominated lymphocytes population.
CD25
+
T cells percentages, varying from 1.52% to 13.2 %, were proportional to
tumor volume and weight, suggesting that CD25+ T cells were negatively associated
with the effectiveness of treatment.

104
Table 3. Percentage of lymphocyte populations among all detected tumor infiltrating
lymphocytes at day 23 post tumor implantation

% Control Fc/CD137L
treated
TNT-
3/CD137L
treated
2A treated
CD4 24.01 33.03 11.92 8.61
CD8a 27.99 27.44 45.96 83.91
CD11c 12.64 8.73 23.81 1.13
CD25 13.02 8.37 1.52 2.36
CD49b 22.34 22.43 16.79 3.99
Tumor
weight
1.00g 0.51g 0.16g 0.02g

Immunohistochemistry
Tumor masses were removed from Colon 26-bearing mice treated with daily ×5
injections of 1 nmol/dose TNT-3/CD137L and Fc/CD137L 6 days after the treatment.
As shown in Figure 4-5, H&E staining of the tumors revealed extensive central
necrosis in those groups of mice treated with TNT-3/CD137L and Fc/CD137L; such
necrosis was also present in PBS control mice, but much more localized and smaller.
A similar percentage of granzyme B-positive cells were seen in all tumor draining
lymph nodes in all treatment groups (Figure 4-6A). However, granzyme B-positive
cells broadly infiltrated central necrotic areas and viable peripheral tumor in mice
treated with CD137L fusion proteins, whereas these cells were much fewer in
number in tumors from control mice (Figure 4-6B).

105
Figure 4-5. H&E staining of tumors from control, TNT-3/CD137L, and Fc/CD137L
treated mice.

106
Figure 4-6. A, Immunohistochemical staining of gramzyme B-positive cells in tumor
draining lymph nodes from control, TNT-3/CD137L, and Fc/CD137L treated mice.
B, Immunohistochemical staining of of gramzyme B-positive cells in tumors from
control, TNT-3/CD137L, and Fc/CD137L treated mice.

A

B

107
Combination Treatment Studies with CD4
+
and CD8
+
T Cell Depletion
In order to assess the role of CD4+ and CD8+ T cells in this fusion protein
immunotherapy, T-subset depletion studies were performed with cytotoxic
antibodies against CD4
+
and CD8
+
cells. Anti-CD4 antibody (Clone GK1.5) and
anti-CD8 antibody (Clone H35) were delivered i.p. on the 5
th
day after tumor
implantation, and these procedures were repeated every 5 days. The depletion was
confirmed by FACS (data not shown). As shown in Figure 4-7, CD8+ T cell
depletion completely abrogated TNT-3/CD137L and Fc/CD137L’s anti-tumor
effects, indicating that both fusion molecules’ therapeutic effects were dependent on
CD8+ T cells. In contradistinction, CD4+ T cell depletion alone caused significant
tumor regression. Similar anti-tumor effects were achieved in the group treated wtih
CD4+ T cell depletion alone and the group receiving CD4+ T cell depletion in
combination with CD137L fusion proteins.

108
Figure 4-7. Combinational immunotherapy of CD137L fusion proteins with CD4
+

and CD8
+
cells depletion.

109
Figure 4-7: Continued

DISCUSSION
CD137L is a member of the TNF superfamily and provides a costimulatory
signal to T cells. It is expressed on dendritic cells, activated macrophages, and B
cells (1, 7, 14, 40, 41). The interaction between CD137L and CD137 on activated T
cells is essential for a T cell response that potentially leads to successful elimination
of tumor.
In this paper, CD137L was genetically linked to murine TNT-3 antibody,
which targets necrotic regions of solid tumors, and to the Fc region of murine TNT-3,
which serves as a non-targeting control. An in vitro activity assay confirmed the

110
biological activity of the CD137L moiety on both fusion proteins, and
immunotherapeutic studies indicated that both CD137L fusion proteins exerted anti-
tumor effects and prolonged the survival of Colon-26-bearing mice. In terms of
biodistribution, several differences exist between the two fusion proteins.
Fc/CD137L primarily distributed to mouse liver, with limited tumor uptake that
further decreased from 24 hours to 48 hours (Figure 4-2B). By contrast, TNT-
3/CD137L showed a 5-fold higher tumor uptake versus Fc/CD137L at 24 hours, with
a 40 % increase in tumor uptake at 48 hours. Their differential distribution in tumor
likely resulted in the requirement of a larger dosage of Fc/CD137L (1 nmol/dose) to
achieve levels of tumor regression similar to those induced by TNT-3/CD137L (500
pmol/dose). When both fusion proteins saturated in tumor, the therapeutic effects of
the two did not differ significantly. At 140 days post-tumor implantation, the survival
rates of tumor-bearing mice treated with TNT-3/CD137L (1nmol/dose) and
Fc/CD137L (1nmol/dose) were 60% and 40%, respectively (Figure 4-4). At the same
dosage, both CD137L fusion proteins induced 80% tumor regression (Figure 4-3)
and similar amounts of tumor necrosis and infiltration by granzyme B-secreting cells
(Figure 4-6).
Necrosis inside of solid tumor has been observed consistently. H & E staining
of the tumors at day 15 post-implantation (Figure 4-5) showed massive central
necrosis in tumors from mice treated with CD137L fusion proteins, compared with
much less extensive and more focal necrosis in tumors from the control group. This
finding suggests that the extent of central necrosis is indicative of effectiveness of

111
anti-tumor treatment in the Colon-26 tumor model. Using other tumor models,
Blohm et al. were also able to associate necrosis with the effectiveness of anti-tumor
therapy (42). They have reported that destruction of tumor structures and significant
central necrosis occurred after antigen-specific CD8
+
T cell attack. It is well accepted
that the major effector cells that actually destroy the tumor and cause necrosis are
activated, antigen-specific CD8
+
T cells. Various mechanisms exist by which CD8
+

T cells destroy tumors cells, including induction of apoptosis through CD95 ligation,
secretion of lytic granules containing perforin and granzyme B, and production of
pro-inflammatory cytokines. Interestingly, when comparing the granzyme B-
secreting T cells in the tumor draining lymph node to the ones in tumor, clear
differences are noted. Clusters of granzyme B-secreting cells were seen in all tumor
draining lymph nodes in all treatment groups, with a similar percentage of granzyme
B-positive cells (Figure 4-6A). However, granzyme B-positive cells broadly
infiltrated central necrotic areas and viable peripheral tumor in mice treated with
CD137L fusion proteins, whereas these cells were much fewer in number in tumors
from control mice (Figure 4-6B). These observations suggest that even though
activated CD8
+
T cells are present in tumors from mice in all groups, the actual
number of activated CD8
+
T cells inside of the tumor is the most important factor,
which directly correlates with effective treatment. These results clearly show that the
biological function of CD137L in vivo is recruitment of activated T cells to the tumor
site, rather than initial priming of CD8
+
T cells.

112
Further studies in this paper have confirmed that tumor regression of the
Colon-26 model is CD8
+
-dependent. In the study of tumor infiltrating lymphocytes,
we confirmed the presence of CD4
+
T cells, CD8
+
T cells, dendritic cells, CD25
+

cells (including CD4
+
CD25
+
T regulatory cells and a tiny percentage of CD25
+

activated T cells), and NK cells (Table 3). Only the relative percentage of CD8
+
T
cells correlated with the effectiveness of treatment, such that the higher this
percentage, the greater the tumor regression. The critical role of CD8
+
T cells was
confirmed systemic CD8
+
T cell depletion (Figure 4-7), which completely abrogated
the anti-tumor effects of both CD137L fusion proteins. Moreover, in the CD8
+
-
depleted mice, tumors grew even larger in volume than control mice, suggesting anti-
tumor efficacy by the limited number of CD8
+
T cells in control mice. Unlike
depletion of CD8
+
T cells, depletion of CD4
+
cells resulted in suppression of Colon-
26 tumor growth, suggesting that CD4
+
T cells (or a subpopulation therein) may
negatively regulate CTL in the Colon-26 model. The results presented here challenge
the traditional view that CD4
+
T cells play a critical role in anti-tumor
immunotherapy. One possible explanation is that depletion of CD4
+
cells included
the depletion of naturally occurring and/or induced CD4
+
CD25
+
T regulatory cells,
which suppress the activation of CD8
+
T cells. The removal of CD4
+
CD25
+
T
regulatory cells might result in a more active population of CD8
+
T cells leading to a
better therapeutic effect. To further support this point, the combinatory treatment of
TNT-3/CD137L and systemic depletion of CD25
+
cells using PC61 has achieved
higher levels of tumor regression than TNT-3/CD137L alone (data not shown).

113
In the study of tumor infiltrating lymphocytes, 2A-treated mice bore the
highest percentage of CD8
+
T cells in tumor among all the treatment groups (Table
3), correlating with the immunotherapeutic dosing study that complete tumor
regression occurs with relatively small doses of 2A (Figure 4-3). These studies
showed that 2A was able to elicit greater immune response than CD137L fusion
proteins in vivo. Interestingly, previous studies using sarcoma Ag104-bearing mice
made similar observations that CD137 agonist antibody demonstrated greater anti-
tumor effects than did tumor cells transfected to express CD137L (15, 16). The
differential therapeutic response induced by CD137 agonist antibody and natural
ligands may be attributed to the fact that different intracellular signaling pathways
are triggered upon CD137 ligation. In our laboratory, we have observed the
intracellular production of both IFN- γ and TNF- α in murine T cells induced by 2A,
while only IFN- γ production was triggerd by CD137L fusion proteins (data not
shown).
In the past, collective evidence has shown that many of the surface-bound
receptor/ligand pairs of the TNFR/TNF superfamily (including CD137/CD137L,
CD134/CD134L (OX40/OX40L), GITR/GITRL, and CD27/CD27L) are integral to
the successful generation and preservation of abundant T cells that carry out various
effector functions in an anti-tumor immune response. Together, they provide signals
essential for T cell function and survival through independent or overlapping
pathways. It is evident that members of the TNF family of proteins synergize with
each other under certain circumstances. CD137L is shown to have synergistic effects

114
with OX40L in generating the clonal expansion and effector function of CD8
+
T
cells (43). Similarly, studies conducted in our laboratory showed that CD137L and
GITRL have synergistic immunotherapeutic effects in Colon-26-bearing mice.
Future studies to optimize the current treatment modality using CD137L fusion
proteins will include combinatory treatment with OX40L or GITRL. First,
concomitant injection of CD137L fusion proteins and OX40L or GITRL fusions will
be undertaken. Further, new fusion proteins incorporating mTNT-3 antibody plus
two different ligands at both C-terminus and N-terminus will be generated.
In conclusion, we have described the generation and characterization of
CD137L fusion proteins that induced CD8
+
T cell-dependent anti-tumor responses in
the Colon-26 tumor model. These studies provide insights for the outcome of
CD137L signaling in the tumor microenvironment in vivo. Such TNT-3/CD137L
fusion protein could be further converted into a mouse-human chimeric fusion
protein using an already established chimeric TNT-3 backbone and human CD137L.
Ultimately, this new fusion protein will serve as a potentially effective strategy for
generating immune responses to tumors in clinical settings.

CHAPTER 4 REFERENCES
1. Goodwin, R. G., Din, W. S., Davis-Smith, T., Anderson, D. M., Gimpel, S.
D., Sato, T. A., Maliszewski, C. R., Brannan, C. I., Copeland, N. G., and
Jenkins, N. A. Molecular cloning of a ligand for the inducible T cell gene 4-
1BB: a member of an emerging family of cytokines with homology to tumor
necrosis factor. Eur J Immunol, 23: 2631-2641, 1993.

115

2. Gruss, H. J., Duyster, J., and Herrmann, F. Structural and biological features
of the TNF receptor and TNF ligand superfamilies: interactive signals in the
pathobiology of Hodgkin's disease. Ann Oncol, 7 Suppl 4: 19-26, 1996.

3. Kwon, B. S., Kozak, C. A., Kim, K. K., and Pickard, R. T. Genomic
organization and chromosomal localization of the T-cell antigen 4-1BB. J
Immunol, 152: 2256-2262, 1994.
4. Kwon, B. S. and Weissman, S. M. cDNA sequences of two inducible T-cell
genes. Proc Natl Acad Sci U S A, 86: 1963-1967, 1989.
5. Schwarz, H., Valbracht, J., Tuckwell, J., von Kempis, J., and Lotz, M. ILA,
the human 4-1BB homologue, is inducible in lymphoid and other cell
lineages. Blood, 85: 1043-1052, 1995.
6. Alderson, M. R., Smith, C. A., Tough, T. W., Davis-Smith, T., Armitage, R.
J., Falk, B., Roux, E., Baker, E., Sutherland, G. R., and Din, W. S. Molecular
and biological characterization of human 4-1BB and its ligand. Eur J
Immunol, 24: 2219-2227, 1994.
7. Futagawa, T., Akiba, H., Kodama, T., Takeda, K., Hosoda, Y., Yagita, H.,
and Okumura, K. Expression and function of 4-1BB and 4-1BB ligand on
murine dendritic cells. Int Immunol, 14: 275-286, 2002.
8. Pollok, K. E., Kim, Y. J., Hurtado, J., Zhou, Z., Kim, K. K., and Kwon, B. S.
4-1BB T-cell antigen binds to mature B cells and macrophages, and
costimulates anti-mu-primed splenic B cells. Eur J Immunol, 24: 367-374,
1994.
9. Cannons, J. L., Lau, P., Ghumman, B., DeBenedette, M. A., Yagita, H.,
Okumura, K., and Watts, T. H. 4-1BB ligand induces cell division, sustains
survival, and enhances effector function of CD4 and CD8 T cells with similar
efficacy. J Immunol, 167: 1313-1324, 2001.

116
10. Gramaglia, I., Cooper, D., Miner, K. T., Kwon, B. S., and Croft, M. Co-
stimulation of antigen-specific CD4 T cells by 4-1BB ligand. Eur J Immunol,
30: 392-402, 2000.
11. Lee, H. W., Nam, K. O., Park, S. J., and Kwon, B. S. 4-1BB enhances CD8+
T cell expansion by regulating cell cycle progression through changes in
expression of cyclins D and E and cyclin-dependent kinase inhibitor p27kip1.
Eur J Immunol, 33: 2133-2141, 2003.
12. Shuford, W. W., Klussman, K., Tritchler, D. D., Loo, D. T., Chalupny, J.,
Siadak, A. W., Brown, T. J., Emswiler, J., Raecho, H., Larsen, C. P., Pearson,
T. C., Ledbetter, J. A., Aruffo, A., and Mittler, R. S. 4-1BB costimulatory
signals preferentially induce CD8+ T cell proliferation and lead to the
amplification in vivo of cytotoxic T cell responses. J Exp Med, 186: 47-55,
1997.
13. Cooper, D., Bansal-Pakala, P., and Croft, M. 4-1BB (CD137) controls the
clonal expansion and survival of CD8 T cells in vivo but does not contribute
to the development of cytotoxicity. Eur J Immunol, 32: 521-529, 2002.
14. Diehl, L., van Mierlo, G. J., den Boer, A. T., van der Voort, E., Fransen, M.,
van Bostelen, L., Krimpenfort, P., Melief, C. J., Mittler, R., Toes, R. E., and
Offringa, R. In vivo triggering through 4-1BB enables Th-independent
priming of CTL in the presence of an intact CD28 costimulatory pathway. J
Immunol, 168: 3755-3762, 2002.
15. Melero, I., Bach, N., Hellstrom, K. E., Aruffo, A., Mittler, R. S., and Chen, L.
Amplification of tumor immunity by gene transfer of the co-stimulatory 4-
1BB ligand: synergy with the CD28 co-stimulatory pathway. Eur J Immunol,
28: 1116-1121, 1998.
16. Melero, I., Shuford, W. W., Newby, S. A., Aruffo, A., Ledbetter, J. A.,
Hellstrom, K. E., Mittler, R. S., and Chen, L. Monoclonal antibodies against
the 4-1BB T-cell activation molecule eradicate established tumors. Nat Med,
3: 682-685, 1997.

117
17. Mogi, S., Sakurai, J., Kohsaka, T., Enomoto, S., Yagita, H., Okumura, K.,
and Azuma, M. Tumour rejection by gene transfer of 4-1BB ligand into a
CD80(+) murine squamous cell carcinoma and the requirements of co-
stimulatory molecules on tumour and host cells. Immunology, 101: 541-547,
2000.
18. Wilcox, R. A., Flies, D. B., Zhu, G., Johnson, A. J., Tamada, K., Chapoval, A.
I., Strome, S. E., Pease, L. R., and Chen, L. Provision of antigen and CD137
signaling breaks immunological ignorance, promoting regression of poorly
immunogenic tumors. J Clin Invest, 109: 651-659, 2002.
19. Wilcox, R. A., Tamada, K., Flies, D. B., Zhu, G., Chapoval, A. I., Blazar, B.
R., Kast, W. M., and Chen, L. Ligation of CD137 receptor prevents and
reverses established anergy of CD8+ cytolytic T lymphocytes in vivo. Blood,
103: 177-184, 2004.
20. Wilcox, R. A., Tamada, K., Strome, S. E., and Chen, L. Signaling through
NK cell-associated CD137 promotes both helper function for CD8+ cytolytic
T cells and responsiveness to IL-2 but not cytolytic activity. J Immunol, 169:
4230-4236, 2002.
21. Yan, X., Johnson, B. D., and Orentas, R. J. Murine CD8 lymphocyte
expansion in vitro by artificial antigen-presenting cells expressing CD137L
(4-1BBL) is superior to CD28, and CD137L expressed on neuroblastoma
expands CD8 tumour-reactive effector cells in vivo. Immunology, 112: 105-
116, 2004.
22. Zhang, H., Merchant, M. S., Chua, K. S., Khanna, C., Helman, L. J., Telford,
B., Ward, Y., Summers, J., Toretsky, J., Thomas, E. K., June, C. H., and
Mackall, C. L. Tumor expression of 4-1BB ligand sustains tumor lytic T cells.
Cancer Biol Ther, 2: 579-586, 2003.
23. Chu, N. R., DeBenedette, M. A., Stiernholm, B. J., Barber, B. H., and Watts,
T. H. Role of IL-12 and 4-1BB ligand in cytokine production by CD28+ and
CD28- T cells. J Immunol, 158: 3081-3089, 1997.

118
24. Nam, K. O., Kang, H., Shin, S. M., Cho, K. H., Kwon, B., Kwon, B. S., Kim,
S. J., and Lee, H. W. Cross-linking of 4-1BB activates TCR-signaling
pathways in CD8+ T lymphocytes. J Immunol, 174: 1898-1905, 2005.
25. Lee, H. W., Park, S. J., Choi, B. K., Kim, H. H., Nam, K. O., and Kwon, B. S.
4-1BB promotes the survival of CD8+ T lymphocytes by increasing
expression of Bcl-xL and Bfl-1. J Immunol, 169: 4882-4888, 2002.
26. Starck, L., Scholz, C., Dorken, B., and Daniel, P. T. Costimulation by
CD137/4-1BB inhibits T cell apoptosis and induces Bcl-xL and c-FLIP(short)
via phosphatidylinositol 3-kinase and AKT/protein kinase B. Eur J Immunol,
35: 1257-1266, 2005.
27. Guinn, B. A., DeBenedette, M. A., Watts, T. H., and Berinstein, N. L. 4-
1BBL cooperates with B7-1 and B7-2 in converting a B cell lymphoma cell
line into a long-lasting antitumor vaccine. J Immunol, 162: 5003-5010, 1999.
28. Epstein, A. L., Chen, F. M., and Taylor, C. R. A novel method for the
detection of necrotic lesions in human cancers. Cancer Res, 48: 5842-5848,
1988.
29. Epstein, A. L., Khawli, L. A., Chen, F. M., Hu, P., Glasky, M. S., and Taylor,
C. R. Tumor necrosis imaging and treatment of solid tumors. In: V. P.
Torchilin (ed.), Handbook of Targeted Delivery of Imagng Agents., Vol. 16,
pp. 259. Boca Raton: CRC Press, 1995.
30. Chen, S., Yu, L., Jiang, C., Zhao, Y., Sun, D., Li, S., Liao, G., Chen, Y., Fu,
Q., Tao, Q., Ye, D., Hu, P., Khawli, L. A., Taylor, C. R., Epstein, A. L., and
Ju, D. W. Pivotal study of iodine-131-labeled chimeric tumor necrosis
treatment radioimmunotherapy in patients with advanced lung cancer. J Clin
Oncol, 23: 1538-1547, 2005.
31. Epstein, A., Chen, D., Ansari, A., Najafi, A., Siegel, M., Lee, K., Hu, E.,
Rosen, P., Watkins, K., Stain, S., Weaver, F., and Taylor, C.
Radioimmunodetection of necrotic lesions in human tumors using I-labeled
TNT-1 F(ab') 2 monoclonal antibody. Antibody Immunoconjugates
Radiophar 4: 151-161, 1991.

119
32. Hornick, J. L., Sharifi, J., Khawli, L. A., Hu, P., Biela, B. H., Mizokami, M.
M., Yun, A., Taylor, C. R., and Epstein, A. L. A new chemically modified
chimeric TNT-3 monoclonal antibody directed against DNA for the
radioimmunotherapy of solid tumors. Cancer Biother Radiopharm, 13: 255-
268, 1998.
33. Hornick, J. L., Khawli, L. A., Hu, P., Sharifi, J., Khanna, C., and Epstein, A.
L. Pretreatment with a monoclonal antibody/interleukin-2 fusion protein
directed against DNA enhances the delivery of therapeutic molecules to solid
tumors. Clin Cancer Res, 5: 51-60, 1999.
34. Li, J., Hu, P., Khawli, L. A., Yun, A., and Epstein, A. L. chTNT-3/hu IL-12
fusion protein for the immunotherapy of experimental solid tumors. Hybrid
Hybridomics, 23: 1-10, 2004.
35. Mizokami, M. M., Hu, P., Khawli, L. A., Li, J., and Epstein, A. L. Chimeric
TNT-3 antibody/murine interferon-gamma fusion protein for the
immunotherapy of solid malignancies. Hybrid Hybridomics, 22: 197-207,
2003.
36. Li, J., Hu, P., Khawli, L. A., and Epstein, A. L. Complete regression of
experimental solid tumors by combination LEC/chTNT-3 immunotherapy
and CD25(+) T-cell depletion. Cancer Res, 63: 8384-8392, 2003.
37. Li, J., Hu, P., Khawli, L. A., and Epstein, A. L. LEC/chTNT-3 fusion protein
for the immunotherapy of experimental solid tumors. J Immunother, 26: 320-
331, 2003.
38. May, K. F., Jr., Chen, L., Zheng, P., and Liu, Y. Anti-4-1BB monoclonal
antibody enhances rejection of large tumor burden by promoting survival but
not clonal expansion of tumor-specific CD8+ T cells. Cancer Res, 62: 3459-
3465, 2002.
39. Sharifi, J., Khawli, L. A., Hu, P., Li, J., and Epstein, A. L. Generation of
human interferon gamma and tumor Necrosis factor alpha chimeric TNT-3
fusion proteins. Hybrid Hybridomics, 21: 421-432, 2002.

120

40. Laderach, D., Wesa, A., and Galy, A. 4-1BB-ligand is regulated on human
dendritic cells and induces the production of IL-12. Cell Immunol, 226: 37-
44, 2003.
41. Summers, K. L., Hock, B. D., McKenzie, J. L., and Hart, D. N. Phenotypic
characterization of five dendritic cell subsets in human tonsils. Am J Pathol,
159: 285-295, 2001.
42. Blohm, U., Potthoff, D., van der Kogel, A. J., and Pircher, H. Solid tumors
"melt" from the inside after successful CD8 T cell attack. Eur J Immunol, 36:
468-477, 2006.
43. Lee, S. J., Myers, L., Muralimohan, G., Dai, J., Qiao, Y., Li, Z., Mittler, R. S.,
and Vella, A. T. 4-1BB and OX40 dual costimulation synergistically
stimulate primary specific CD8 T cells for robust effector function. J
Immunol, 173: 3002-3012, 2004.

121
CHAPTER 5
SUMMARY AND FUTURE DIRECTIONS
The discovery of a wide variety of tumor-related antigens expressed on
multiple cancer cells has facilitated the rapid development of antibody-based tumor
immunotherapy. Traditionally, it is believed that antibody-mediated killing of tumor
cells is through immunological intervention, or interfering with essential biological
functions of tumor cells. In fact, collective evidence has shown that such treatment
itself may also initiate apoptosis. Apoptosis, or programmed cell death, plays a
crucial role in physiological growth control, tissue homeostasis, and surveillance of
tumor formation. It is characterized by typical morphological and biochemical
changes such as cell shrinkage, membrane blebbing, exposure of phosphatidyl serine
(PS) to the outer leaflet of the cytoplasmic membrane, chromatin condensation, and
DNA fragmentation. In cancer therapy, the occurrence of apoptosis in tumor cells
has been confirmed and correlated with the therapeutic efficacy of the treatment used
(1-5). Many of the cytotoxic therapies, such as chemotherapy, γ-irradiation, and
suicide gene therapy, achieved their therapeutic effects predominantly by induction
of apoptosis in cancer cells (1-14).
Two antibody-based therapeutic strategies that lead to apoptosis induction have
been described in previous chapters. One is the use of Rituximab Polymer that
induces apoptosis in non-Hodgkin’s lymphoma cells (15). This novel invention is
based on the observation that the induction of apoptosis in lymphoma

cells requires

122
proper presentation of anti-CD20. More specifically, Rituximab must be hyper-cross-
linked either by the binding of goat anti-human/mouse IgG or Fc receptor-bearing
cells, or by immobilization on plastic in vitro, in order to induce apoptosis at a
significant level in target cells. This Rituximab Polymer consists of approximately
five immunoglobulins per dextran molecule, and has proved to be very stable in
serum for at least 10 days at 37
o
degree. Biodistribution study has shown that this
polymer target Raji tumor, and immunotherapeutic studies have demonstrated that
systemic delivery of this polymer induced tumor regression in vivo. The other
therapeutic modality that has been extensively studied is an anti-HLA-DR
monoclonal antibody, Lym-1. Both Annexin V/propidium iodide staining and
terminal deoxyribonucleotidyl transferase-mediated dUTP nick end labeling
(TUNEL) assays have shown that Lym-1 and its mouse human chimeric version,
chLym-1, are potent apoptosis inducers. The apoptosis induced by Lym-1 in Raji
cells involves mitochondria and are caspase-independent. In vivo, Lym-1 induced
significant tumor regression in Raji-bearing nude mice.
In the past, two major intracellular apoptotic pathways have been identified: the
transmembrane ‘extrinsic’ pathway that is initiated by the ligation of death receptors
on cell surface and the mitochondrial ‘intrinsic’ pathway that is activated by various
stress signals. Irrespective of whether apoptosis is initiated by the extrinsic or
intrinsic pathway, in most cases, executions of apoptosis converge at the level of
caspases activation. Caspases are a family of cysteine proteases that are synthesized
as inactive proforms and, upon activation by adaptor proteins, they cleave next to

123
aspartate residues on their substrates. Once activated, initiator caspases can activate
effector caspases, which act on a wide range of substrates to cause apoptosis.
Initiator caspases include caspase 2, 8, 9, and 10, wherease effector caspases are
caspase 3, 6, and 7 (16-26). In our experiments, both of Lym-1 and Rituximab
Polymer caused caspase 3 activation. However, when using caspase 3 and pan
caspase inhibitors, Lym-1 induced apoptosis still occurs, indicating that such
apoptosis is caspase-independent. In fact, many of other anti-HLA-DR-mediated
apoptosis is also caspase-independent (27). Interestingly, Leist et al has suggested
that multiple apoptotic pathways may be triggered simultaneously upon induction of
apoptosis and that the final outcome and form of cell death would depend on the
relative speed of each pathway (28). In anti-HLA-DR induced apoptosis, it is
possible that a caspase-independent pathway may occur first and dominate over other
pathways. Such a caspase-independent pathway in B lymphocytes has not been
elucidated to date. Identification and characterization of this pathway will be a major
focus of research in the near future.
In our experiments, it has been shown that whether apoptosis is induced or not
by signaling antibodies is largely dependent on the actual location of the antigen on
cell membrane. In lymphocytes, signaling elicited through surface antigens leading
towards programmed cell death very often involves the redistribution of these
antigens into lipid rafts, which are plasma membrane microdomains that act as signal
transduction platforms constitutively associated with various kinases and adaptor
proteins (29-33). When we compared the cell surface staining by different Rituximab

124
preparations and Lym-1 using immunofluorescence microscopy, different staining
patterns were observed. Treatment with Rituximab

monomer and dimer produced a
ring pattern of staining, indicating

that these reagents reacted with antigen that was
evenly distributed

on the surface of the cell. By contrast, those cells treated

with
Rituximab polymer or hyper-cross-linked with secondary

antibody showed a more
segregated polar staining pattern, a

finding which correlated with higher apoptosis
induction and

the movement of antigen into lipid rafts (34). Interestingly, Lym-1
treated Raji cells also demonstrated a similar speckled staining pattern. This agrees
with previous findings that a significant amount of HLA-DR constitutively resides in
lipid rafts of healthy and malignant B cells (29). Thus without the need to be hyper-
cross-linked, Lym-1 by itself can induce significant level of apoptosis.
Several questions regarding apoptosis induction in antibody-based cancer
therapy still need to be answered. First of all, it is important to understand the
differential susceptibility to apoptosis triggered by the same antibodies when
presented in different forms. In the in vitro experiment, Rituximab, when
immobilized to a plastic

surface or hyper-crosslinked by secondary antibodies,
induced approximately 50% apoptosis in Raji cell suspentions. When Rituximab is
conjugated to Dynabeads, 95% apoptosis was induced. In our opinion, several
factors may contribute to this. First, Rituximab

was conjugated to Dynabeads by
peptide bonding which produced

a more rigid presentation of antibody to the
lymphoma cells

than that obtained with secondary antibodies or plastic substrata.

Second, the Dynabeads have a rounded surface, allowing multiple

contact points to

125
facilitate maximum interaction with target,

and are small enough to have several
beads attach to each target

cell. Under the microscope, the Rituximab-coated
Dynabeads often

produced cell aggregation due to their attachment to multiple

lymphoma cells. Finally, a high concentration of antibody was

attached to the beads
providing an optimal binding surface for

cross-linking. By contrast, Rituximab
immobilized to a plastic

surface or hyper-cross-linked with secondary antibody either

has a limited interactive interface or is not as efficient in

fixing CD20 in hydrophobic
regions once the CD20 has migrated

into the lipid rafts. We also need to understand
the differential susceptibility to apoptosis among different individuals, in order to
understand why patients are susceptible or resistant to treatment. To answer this
question, complete understanding of the apoptosis resistance mechanisms will be
required.
In Chapter 4, a TNT-3/CD137L fusion protein was genetically constructed,
purified, and characterized. In vitro bioactivity of the CD137L moiety was
confirmed. This TNT-3/CD137L fusion protein showed increased tumor uptake over
48 hours in Colon 26 tumor-bearing mice. Our results indicated that systemic
administration of tumor-targeting TNT-3/CD137L induced significant tumor
regression significantly and prolonged the survival of treated mice. Such anti-tumor
effects of this anti-CD137L fusion are achieved primarily through the activation of
CD8
+
T cells.
Many of the surface-bound receptor/ligand pairs of the TNFR/TNF superfamily
(including CD137/CD137L, CD134/CD134L (OX40/OX40L), GITR/GITRL, and

126
CD27/CD27L) are integral to the successful generation and preservation of abundant
T cells that carry out various effector functions in an anti-tumor immune response.
Together, they provide signals essential for T cell function and survival through
independent or overlapping pathways. It is evident that members of the TNF family
of proteins synergize with each other under certain circumstances. CD137L is shown
to have synergistic effects with OX40L in generating the clonal expansion and
effector function of CD8
+
T cells (35). Similarly, studies conducted in our laboratory
showed that CD137L and GITRL have synergistic immunotherapeutic effects in
Colon-26-bearing mice. Future studies to optimize the current treatment modality
using CD137L fusion proteins will include combinatory treatment with OX40L or
GITRL. First, concomitant injection of CD137L fusion proteins and OX40L or
GITRL fusions will be undertaken. Further, new fusion proteins incorporating
mTNT-3 antibody plus two different ligands at both C-terminus and N-terminus may
also be effective treatment options.
In conclusion, the three antibody-based therapeutic strategies described have
shown great anti-tumor potential that may be translated into future clinical treatments
for cancer.

127

CHAPTER 5 REFERENCES

1. Desoize, B. and Sen, S. [Apoptosis or programmed cell death: concepts,
mechanisms and contribution in oncology]. Bull Cancer, 79: 413-425, 1992.
2. Fukuoka, K. and Saijo, N. [Anticancer agents and apoptosis]. Nippon Rinsho,
54: 250-258, 1996.
3. Hickman, J. A. Apoptosis induced by anticancer drugs. Cancer Metastasis
Rev, 11: 121-139, 1992.
4. Kaufmann, S. H. and Gores, G. J. Apoptosis in cancer: cause and cure.
Bioessays, 22: 1007-1017, 2000.
5. Mow, B. M., Blajeski, A. L., Chandra, J., and Kaufmann, S. H. Apoptosis
and the response to anticancer therapy. Curr Opin Oncol, 13: 453-462, 2001.
6. Debatin, K. M. The role of CD95 system in chemotherapy. Drug Resist
Updat, 2: 85-90, 1999.
7. Eastman, A. Activation of programmed cell death by anticancer agents:
cisplatin as a model system. Cancer Cells, 2: 275-280, 1990.
8. Guchelaar, H. J., Vermes, A., Vermes, I., and Haanen, C. Apoptosis:
molecular mechanisms and implications for cancer chemotherapy. Pharm
World Sci, 19: 119-125, 1997.
9. Herr, I. and Debatin, K. M. Cellular stress response and apoptosis in cancer
therapy. Blood, 98: 2603-2614, 2001.
10. Hu, W. and Kavanagh, J. J. Anticancer therapy targeting the apoptotic
pathway. Lancet Oncol, 4: 721-729, 2003.
11. Kaufmann, S. H. and Earnshaw, W. C. Induction of apoptosis by cancer
chemotherapy. Exp Cell Res, 256: 42-49, 2000.

128
12. Lowe, S. W. and Lin, A. W. Apoptosis in cancer. Carcinogenesis, 21: 485-
495, 2000.
13. Reed, C. J. Apoptosis and cancer: strategies for integrating programmed cell
death. Semin Hematol, 37: 9-16, 2000.
14. Solary, E., Droin, N., Bettaieb, A., Corcos, L., Dimanche-Boitrel, M. T., and
Garrido, C. Positive and negative regulation of apoptotic pathways by
cytotoxic agents in hematological malignancies. Leukemia, 14: 1833-1849,
2000.
15. Zhang, N., Khawli, L. A., Hu, P., and Epstein, A. L. Generation of rituximab
polymer may cause hyper-cross-linking-induced apoptosis in non-Hodgkin's
lymphomas. Clin Cancer Res, 11: 5971-5980, 2005.
16. Debatin, K. M. Apoptosis pathways in cancer and cancer therapy. Cancer
Immunol Immunother, 53: 153-159, 2004.
17. Jaattela, M. Programmed cell death: many ways for cells to die decently. Ann
Med, 34: 480-488, 2002.
18. Martin, D. A. and Elkon, K. B. Mechanisms of apoptosis. Rheum Dis Clin
North Am, 30: 441-454, vii, 2004.
19. Nalepa, G. and Zukowska-Szczechowska, E. [Caspases and apoptosis: die
and let live]. Wiad Lek, 55: 100-106, 2002.
20. Oliver, L. and Vallette, F. M. The role of caspases in cell death and
differentiation. Drug Resist Updat, 8: 163-170, 2005.
21. Philchenkov, A., Zavelevich, M., Kroczak, T. J., and Los, M. Caspases and
cancer: mechanisms of inactivation and new treatment modalities. Exp Oncol,
26: 82-97, 2004.
22. Roy, S. Caspases at the heart of the apoptotic cell death pathway. Chem Res
Toxicol, 13: 961-962, 2000.

129

23. Saikumar, P., Dong, Z., Mikhailov, V., Denton, M., Weinberg, J. M., and
Venkatachalam, M. A. Apoptosis: definition, mechanisms, and relevance to
disease. Am J Med, 107: 489-506, 1999.
24. Shiozaki, E. N. and Shi, Y. Caspases, IAPs and Smac/DIABLO: mechanisms
from structural biology. Trends Biochem Sci, 29: 486-494, 2004.
25. Strasser, A., O'Connor, L., and Dixit, V. M. Apoptosis signaling. Annu Rev
Biochem, 69: 217-245, 2000.
26. Wyllie, A. H. Apoptosis: an overview. Br Med Bull, 53: 451-465, 1997.
27. Bains, S. K., Mone, A., Yun Tso, J., Lucas, D., Byrd, J. C., Weiner, G. J., and
Green, J. M. Mitochondria control of cell death induced by anti-HLA-DR
antibodies. Leukemia, 17: 1357-1365, 2003.
28. Leist, M. and Jaattela, M. Four deaths and a funeral: from caspases to
alternative mechanisms. Nat Rev Mol Cell Biol, 2: 589-598, 2001.
29. Bouillon, M., El Fakhry, Y., Girouard, J., Khalil, H., Thibodeau, J., and
Mourad, W. Lipid raft-dependent and -independent signaling through HLA-
DR molecules. J Biol Chem, 278: 7099-7107, 2003.
30. Harder, T., Scheiffele, P., Verkade, P., and Simons, K. Lipid domain
structure of the plasma membrane revealed by patching of membrane
components. J Cell Biol, 141: 929-942, 1998.
31. Helms, J. B. and Zurzolo, C. Lipids as targeting signals: lipid rafts and
intracellular trafficking. Traffic, 5: 247-254, 2004.
32. Hoessli, D. C., Ilangumaran, S., Soltermann, A., Robinson, P. J., Borisch, B.,
and Nasir Ud, D. Signaling through sphingolipid microdomains of the plasma
membrane: the concept of signaling platform. Glycoconj J, 17: 191-197,
2000.

130

33. Young, R. M., Holowka, D., and Baird, B. A lipid raft environment enhances
Lyn kinase activity by protecting the active site tyrosine from
dephosphorylation. J Biol Chem, 278: 20746-20752, 2003.
34. Deans, J. P., Li, H., and Polyak, M. J. CD20-mediated apoptosis: signalling
through lipid rafts. Immunology, 107: 176-182, 2002.
35. Lee, S. J., Myers, L., Muralimohan, G., Dai, J., Qiao, Y., Li, Z., Mittler, R. S.,
and Vella, A. T. 4-1BB and OX40 dual costimulation synergistically
stimulate primary specific CD8 T cells for robust effector function. J
Immunol, 173: 3002-3012, 2004.

131
BIBLIOGRAPHY
Alas, S., Emmanouilides, C., and Bonavida, B. Inhibition of interleukin 10 by
rituximab results in down-regulation of bcl-2 and sensitization of B-cell
non-Hodgkin's lymphoma to apoptosis. Clin Cancer Res, 7: 709-723, 2001.
Alas, S., Ng, C. P., and Bonavida, B. Rituximab modifies the cisplatin-mitochondrial
signaling pathway, resulting in apoptosis in cisplatin-resistant non-Hodgkin's
lymphoma. Clin Cancer Res, 8: 836-845, 2002.
Albanell, J., Codony, J., Rovira, A., Mellado, B., and Gascon, P. Mechanism of
action of anti-HER2 monoclonal antibodies: scientific update on trastuzumab and
2C4. Adv Exp Med Biol, 532: 253-268, 2003.
Alderson, M. R., Smith, C. A., Tough, T. W., Davis-Smith, T., Armitage, R. J., Falk,
B., Roux, E., Baker, E., Sutherland, G. R., and Din, W. S. Molecular and biological
characterization of human 4-1BB and its ligand. Eur J Immunol, 24: 2219-2227,
1994.
Anolik, J. H., Campbell, D., Felgar, R. E., Young, F., Sanz, I., Rosenblatt, J., and
Looney, R. J. The relationship of FcgammaRIIIa genotype to degree of B cell
depletion by rituximab in the treatment of systemic lupus erythematosus. Arthritis
Rheum, 48: 455-459, 2003.
Ansell, S. M., Witzig, T. E., Kurtin, P. J., Sloan, J. A., Jelinek, D. F., Howell, K. G.,
Markovic, S. N., Habermann, T. M., Klee, G. G., Atherton, P. J., and Erlichman, C.
Phase 1 study of interleukin-12 in combination with rituximab in patients with B-cell
non-Hodgkin lymphoma. Blood, 99: 67-74, 2002.
Bains, S. K., Mone, A., Yun Tso, J., Lucas, D., Byrd, J. C., Weiner, G. J., and Green,
J. M. Mitochondria control of cell death induced by anti-HLA-DR antibodies.
Leukemia, 17: 1357-1365, 2003.

132
Berinstein, N. L., Buckstein, R., Imrie, K., Spaner, D., Mangel, J., Tompkins, K.,
Pennell, N., Reis, M., Pavlin, P., Lima, A., Couvadia, A., Robinson, J., and
Richardson, P. Bcl-2 clearance: optimising outcomes in follicular non-Hodgkin's
lymphoma. Bone Marrow Transplant, 29 Suppl 1: S14-17, 2002.
Bertolini, F., Fusetti, L., Mancuso, P., Gobbi, A., Corsini, C., Ferrucci, P. F.,
Martinelli, G., and Pruneri, G. Endostatin, an antiangiogenic drug, induces tumor
stabilization after chemotherapy or anti-CD20 therapy in a NOD/SCID mouse model
of human high-grade non-Hodgkin lymphoma. Blood, 96: 282-287, 2000.
Bouillon, M., El Fakhry, Y., Girouard, J., Khalil, H., Thibodeau, J., and Mourad, W.
Lipid raft-dependent and -independent signaling through HLA-DR molecules. J Biol
Chem, 278: 7099-7107, 2003.
Brown, D. A. and London, E. Structure and function of sphingolipid- and
cholesterol-rich membrane rafts. J Biol Chem, 275: 17221-17224, 2000.
Buchsbaum, D. J., Wahl, R. L., Normolle, D. P., and Kaminski, M. S. Therapy with
unlabeled and 131I-labeled pan-B-cell monoclonal antibodies in nude mice bearing
Raji Burkitt's lymphoma xenografts. Cancer Res, 52: 6476-6481, 1992.
Byrd, J. C., Kitada, S., Flinn, I. W., Aron, J. L., Pearson, M., Lucas, D., and Reed, J.
C. The mechanism of tumor cell clearance by rituximab in vivo in patients with
B-cell chronic lymphocytic leukemia: evidence of caspase activation and apoptosis
induction. Blood, 99: 1038-1043, 2002.
Cannons, J. L., Lau, P., Ghumman, B., DeBenedette, M. A., Yagita, H., Okumura, K.,
and Watts, T. H. 4-1BB ligand induces cell division, sustains survival, and enhances
effector function of CD4 and CD8 T cells with similar efficacy. J Immunol, 167:
1313-1324, 2001.
Cardarelli, P. M., Quinn, M., Buckman, D., Fang, Y., Colcher, D., King, D. J.,
Bebbington, C., and Yarranton, G. Binding to CD20 by anti-B1 antibody or F(ab')(2)
is sufficient for induction of apoptosis in B-cell lines. Cancer Immunol Immunother,
51: 15-24, 2002.

133
Carnahan, J., Wang, P., Kendall, R., Chen, C., Hu, S., Boone, T., Juan, T.,
Talvenheimo, J., Montestruque, S., Sun, J., Elliott, G., Thomas, J., Ferbas, J., Kern,
B., Briddell, R., Leonard, J. P., and Cesano, A. Epratuzumab, a
humanizedmonoclonal antibody targeting CD22: characterization of in vitro
properties. Clin Cancer Res, 9: 3982S-3990S, 2003.
Cartron, G., Dacheux, L., Salles, G., Solal-Celigny, P., Bardos, P., Colombat, P., and
Watier, H. Therapeutic activity of humanized anti-CD20 monoclonal antibody and
polymorphism in IgG Fc receptor FcgammaRIIIa gene. Blood, 99: 754-758, 2002.
Cesano, A. and Gayko, U. CD22 as a target of passive immunotherapy. Semin Oncol,
30: 253-257, 2003.
Chan, C. H., Wang, J., French, R. R., and Glennie, M. J. Internalization of the
lymphocytic surface protein CD22 is controlled by a novel membrane proximal
cytoplasmic motif. J Biol Chem, 273: 27809-27815, 1998.
Cheng, L. E., Chan, F. K., Cado, D., and Winoto, A. Functional redundancy of the
Nur77 and Nor-1 orphan steroid receptors in T-cell apoptosis. Embo J, 16:
1865-1875, 1997.
Chow, K. U., Sommerlad, W. D., Boehrer, S., Schneider, B., Seipelt, G., Rummel, M.
J., Hoelzer, D., Mitrou, P. S., and Weidmann, E. Anti-CD20 antibody (IDEC-C2B8,
rituximab) enhances efficacy of cytotoxic drugs on neoplastic lymphocytes in vitro:
role of cytokines, complement, and caspases. Haematologica, 87: 33-43, 2002.
Coleman, M., Goldenberg, D. M., Siegel, A. B., Ketas, J. C., Ashe, M., Fiore, J. M.,
and Leonard, J. P. Epratuzumab: targeting B-cell malignancies through CD22. Clin
Cancer Res, 9: 3991S-3994S, 2003.
Cooper, D., Bansal-Pakala, P., and Croft, M. 4-1BB (CD137) controls the clonal
expansion and survival of CD8 T cells in vivo but does not contribute to the
development of cytotoxicity. Eur J Immunol, 32: 521-529, 2002.
Cragg, M. S., French, R. R., and Glennie, M. J. Signaling antibodies in cancer
therapy. Curr Opin Immunol, 11: 541-547, 1999.

134
Dawicki, W. and Watts, T. H. Expression and function of 4-1BB during CD4 versus
CD8 T cell responses in vivo. Eur J Immunol, 34: 743-751, 2004.
de Kroon, J. F., de Paus, R. A., Kluin-Nelemans, H. C., Kluin, P. M., van Bergen, C.
A., Munro, A. J., Hale, G., Willemze, R., and Falkenburg, J. H. Anti-CD45 and
anti-CD52 (Campath) monoclonal antibodies effectively eliminate systematically
disseminated human non-Hodgkin's lymphoma B cells in Scid mice. Exp Hematol,
24: 919-926, 1996.
Deans, J. P., Li, H., and Polyak, M. J. CD20-mediated apoptosis: signalling through
lipid rafts. Immunology, 107: 176-182, 2002.
Debatin, K. M. Apoptosis pathways in cancer and cancer therapy. Cancer Immunol
Immunother, 53: 153-159, 2004.
Debatin, K. M. The role of CD95 system in chemotherapy. Drug Resist Updat, 2:
85-90, 1999.
DeBenedette, M. A., Wen, T., Bachmann, M. F., Ohashi, P. S., Barber, B. H.,
Stocking, K. L., Peschon, J. J., and Watts, T. H. Analysis of 4-1BB ligand
(4-1BBL)-deficient mice and of mice lacking both 4-1BBL and CD28 reveals a role
for 4-1BBL in skin allograft rejection and in the cytotoxic T cell response to
influenza virus. J Immunol, 163: 4833-4841, 1999.
Demidem, A., Lam, T., Alas, S., Hariharan, K., Hanna, N., and Bonavida, B.
Chimeric anti-CD20 (IDEC-C2B8) monoclonal antibody sensitizes a B cell
lymphoma cell line to cell killing by cytotoxic drugs. Cancer Biother Radiopharm,
12: 177-186, 1997.
DeNardo, G. L. The next generation of imaging and therapeutic agents for
lymphoma and chronic lymphocytic leukemia. Meniscus, 3: 76, 1995.
DeNardo, G. L., DeNardo, S. J., Goldstein, D. S., Kroger, L. A., Lamborn, K. R.,
Levy, N. B., McGahan, J. P., Salako, Q., Shen, S., and Lewis, J. P.
Maximum-tolerated dose, toxicity, and efficacy of (131)I-Lym-1 antibody for
fractionated radioimmunotherapy of non-Hodgkin's lymphoma. J Clin Oncol, 16:
3246-3256, 1998.

135
Denardo, G. L., Denardo, S. J., Kukis, D. L., O'Donnell, R. T., Shen, S., Goldstein, D.
S., Kroger, L. A., Salako, Q., Denardo, D. A., Mirick, G. R., Mausner, L. F.,
Srivastava, S. C., and Meares, C. F. Maximum tolerated dose of
67Cu-2IT-BAT-LYM-1 for fractionated radioimmunotherapy of non-Hodgkin's
lymphoma: a pilot study. Anticancer Res, 18: 2779-2788, 1998.
DeNardo, G. L., DeNardo, S. J., Lamborn, K. R., Goldstein, D. S., Levy, N. B.,
Lewis, J. P., O'Grady, L. F., Raventos, A., Kroger, L. A., Macey, D. J., McGahan, J.
P., Mills, S. L., and Shen, S. Low-dose, fractionated radioimmunotherapy for B-cell
malignancies using 131I-Lym-1 antibody (100% lym-1 reactive). Cancer Biother
Radiopharm, 13: 239-254, 1998.
DeNardo, G. L., DeNardo, S. J., O'Grady, L. F., Levy, N. B., Adams, G. P., and
Mills, S. L. Fractionated radioimmunotherapy of B-cell malignancies with
131I-Lym-1. Cancer Res, 50: 1014s-1016s, 1990.
DeNardo, G. L., DeNardo, S. J., Shen, S., DeNardo, D. A., Mirick, G. R., Macey, D.
J., and Lamborn, K. R. Factors affecting 131I-Lym-1 pharmacokinetics and radiation
dosimetry in patients with non-Hodgkin's lymphoma and chronic lymphocytic
leukemia. J Nucl Med, 40: 1317-1326, 1999.
DeNardo, G. L., DeNardo, S. J., Wessels, B. W., Kukis, D. L., Miyao, N., and Yuan,
A. 131I-Lym-1 in mice implanted with human Burkitt's lymphoma (Raji) tumors:
loss of tumor specificity due to radiolysis. Cancer Biother Radiopharm, 15: 547-560,
2000.
DeNardo, G. L., Kukis, D. L., Shen, S., DeNardo, D. A., Meares, C. F., and DeNardo,
S. J. 67Cu-versus 131I-labeled Lym-1 antibody: comparative pharmacokinetics and
dosimetry in patients with non-Hodgkin's lymphoma. Clin Cancer Res, 5: 533-541,
1999.
DeNardo, G. L., Lewis, J. P., DeNardo, S. J., and O'Grady, L. F. Effect of Lym-1
radioimmunoconjugate on refractory chronic lymphocytic leukemia. Cancer, 73:
1425-1432, 1994.
DeNardo, G. L., O'Donnell, R. T., Rose, L. M., Mirick, G. R., Kroger, L. A., and
DeNardo, S. J. Milestones in the development of Lym-1 therapy. Hybridoma, 18:
1-11, 1999.

136
DeNardo, S. J., DeNardo, G. L., Kukis, D. L., Shen, S., Kroger, L. A., DeNardo, D.
A., Goldstein, D. S., Mirick, G. R., Salako, Q., Mausner, L. F., Srivastava, S. C., and
Meares, C. F. 67Cu-2IT-BAT-Lym-1 pharmacokinetics, radiation dosimetry, toxicity
and tumor regression in patients with lymphoma. J Nucl Med, 40: 302-310, 1999.
DeNardo, S. J., DeNardo, G. L., O'Grady, L. F., Hu, E., Sytsma, V. M., Mills, S. L.,
Levy, N. B., Macey, D. J., Miller, C. H., and Epstein, A. L. Treatment of B cell
malignancies with 131I Lym-1 monoclonal antibodies. Int J Cancer Suppl, 3: 96-101,
1988.
DeNardo, S. J., DeNardo, G. L., O'Grady, L. F., Macey, D. J., Mills, S. L., Epstein,
A. L., Peng, J. S., and McGahan, J. P. Treatment of a patient with B cell lymphoma
by I-131 LYM-1 monoclonal antibodies. Int J Biol Markers, 2: 49-53, 1987.
Desoize, B. and Sen, S. [Apoptosis or programmed cell death: concepts, mechanisms
and contribution in oncology]. Bull Cancer, 79: 413-425, 1992.
Diehl, L., van Mierlo, G. J., den Boer, A. T., van der Voort, E., Fransen, M., van
Bostelen, L., Krimpenfort, P., Melief, C. J., Mittler, R., Toes, R. E., and Offringa, R.
In vivo triggering through 4-1BB enables Th-independent priming of CTL in the
presence of an intact CD28 costimulatory pathway. J Immunol, 168: 3755-3762,
2002.
Drenou, B., Blancheteau, V., Burgess, D. H., Fauchet, R., Charron, D. J., and
Mooney, N. A. A caspase-independent pathway of MHC class II antigen-mediated
apoptosis of human B lymphocytes. J Immunol, 163: 4115-4124, 1999.
Eastman, A. Activation of programmed cell death by anticancer agents: cisplatin as a
model system. Cancer Cells, 2: 275-280, 1990.
Epstein, A. L., Chen, F. M., and Taylor, C. R. A novel method for the detection of
necrotic lesions in human cancers. Cancer Res, 48: 5842-5848, 1988.
Epstein, A. L., Khawli, L. A., Chen, F. M., Hu, P., Glasky, M. S., and Taylor, C. R.
Tumor necrosis imaging and treatment of solid tumors. In: V. P. Torchilin (ed.),
Handbook of Targeted Delivery of Imagng Agents., Vol. 16, pp. 259. Boca Raton:
CRC Press, 1995.

137
Epstein, A. L., Marder, R. J., Winter, J. N., Stathopoulos, E., Chen, F. M., Parker, J.
W., and Taylor, C. R. Two new monoclonal antibodies, Lym-1 and Lym-2, reactive
with human B-lymphocytes and derived tumors, with immunodiagnostic and
immunotherapeutic potential. Cancer Res, 47: 830-840, 1987.
Fisher, D. E. Apoptosis in cancer therapy: crossing the threshold. Cell, 78: 539-542,
1994.
Friesen, C., Herr, I., Krammer, P. H., and Debatin, K. M. Involvement of the CD95
(APO-1/FAS) receptor/ligand system in drug-induced apoptosis in leukemia cells.
Nat Med, 2: 574-577, 1996.
Fukuoka, K. and Saijo, N. [Anticancer agents and apoptosis]. Nippon Rinsho, 54:
250-258, 1996.
Fulda, S. and Debatin, K. M. Apoptosis signaling in tumor therapy. Ann N Y Acad
Sci, 1028: 150-156, 2004.
Fulda, S., Susin, S. A., Kroemer, G., and Debatin, K. M. Molecular ordering of
apoptosis induced by anticancer drugs in neuroblastoma cells. Cancer Res, 58:
4453-4460, 1998.
Futagawa, T., Akiba, H., Kodama, T., Takeda, K., Hosoda, Y., Yagita, H., and
Okumura, K. Expression and function of 4-1BB and 4-1BB ligand on murine
dendritic cells. Int Immunol, 14: 275-286, 2002.
G., D., Maloney, J., A., and Grillo-L 髉ez, C. A. W., David Bodkin, Russell J.
Schilder, James A. Neidhart, Nalini Janakiraman, Kenneth A. Foon, Tina-Marie
Liles, Brian K. Dallaire, Ken Wey, Ivor Royston, Thomas Davis, and Ronald Levy
IDEC-C2B8 (Rituximab) Anti-CD20 Monoclonal Antibody Therapy in Patients
With Relapsed Low-Grade Non-Hodgkin's Lymphoma. Blood, 90: 2188-2195, 1997.
Gaffar, S. A., Chen, F. M., Liu, C., and Epstein, A. L. Cell based radioimmunoassays
to quantitate the immunoreactivity of TNT monoclonal antibodies directed against
intracellular antigens. J Immunoassay, 12: 1-14, 1991.

138
Garnier, J. L., Stevenson, G., Blanc-Brunat, N., Touraine, J. L., Milpied, N., Leblond,
V., and Blay, J. Y. Treatment of post-transplant lymphomas with anti-B-cell
monoclonal antibodies. Recent Results Cancer Res, 159: 113-122, 2002.
Ghetie, M. A., Bright, H., and Vitetta, E. S. Homodimers but not monomers of
Rituxan (chimeric anti-CD20) induce apoptosis in human B-lymphoma cells and
synergize with a chemotherapeutic agent and an immunotoxin. Blood, 97: 1392-1398,
2001.
Golay, J., Zaffaroni, L., Vaccari, T., Lazzari, M., Borleri, G. M., Bernasconi, S.,
Tedesco, F., Rambaldi, A., and Introna, M. Biologic response of B lymphoma cells
to anti-CD20 monoclonal antibody rituximab in vitro: CD55 and CD59 regulate
complement-mediated cell lysis. Blood, 95: 3900-3908, 2000.
Goodwin, R. G., Din, W. S., Davis-Smith, T., Anderson, D. M., Gimpel, S. D., Sato,
T. A., Maliszewski, C. R., Brannan, C. I., Copeland, N. G., and Jenkins, N. A.
Molecular cloning of a ligand for the inducible T cell gene 4-1BB: a member of an
emerging family of cytokines with homology to tumor necrosis factor. Eur J
Immunol, 23: 2631-2641, 1993.
Gramaglia, I., Cooper, D., Miner, K. T., Kwon, B. S., and Croft, M. Co-stimulation
of antigen-specific CD4 T cells by 4-1BB ligand. Eur J Immunol, 30: 392-402, 2000.
Grillo-Lopez, A. J. Rituximab: an insider's historical perspective. Semin Oncol, 27:
9-16, 2000.
Grillo-Lopez, A. J., White, C. A., Dallaire, B. K., Varns, C. L., Shen, C. D., Wei, A.,
Leonard, J. E., McClure, A., Weaver, R., Cairelli, S., and Rosenberg, J. Rituximab:
the first monoclonal antibody approved for the treatment of lymphoma. Curr Pharm
Biotechnol, 1: 1-9, 2000.
Grillo-Lopez, A. J., White, C. A., Varns, C., Shen, D., Wei, A., McClure, A., and
Dallaire, B. K. Overview of the clinical development of rituximab: first monoclonal
antibody approved for the treatment of lymphoma. Semin Oncol, 26: 66-73, 1999.
Gruss, H. J., Duyster, J., and Herrmann, F. Structural and biological features of the
TNF receptor and TNF ligand superfamilies: interactive signals in the pathobiology
of Hodgkin's disease. Ann Oncol, 7 Suppl 4: 19-26, 1996.

139
Guchelaar, H. J., Vermes, A., Vermes, I., and Haanen, C. Apoptosis: molecular
mechanisms and implications for cancer chemotherapy. Pharm World Sci, 19:
119-125, 1997.
Guinn, B. A., DeBenedette, M. A., Watts, T. H., and Berinstein, N. L. 4-1BBL
cooperates with B7-1 and B7-2 in converting a B cell lymphoma cell line into a
long-lasting antitumor vaccine. J Immunol, 162: 5003-5010, 1999.
Hanahan, D. and Weinberg, R. A. The hallmarks of cancer. Cell, 100: 57-70, 2000.
Harder, T., Scheiffele, P., Verkade, P., and Simons, K. Lipid domain structure of the
plasma membrane revealed by patching of membrane components. J Cell Biol, 141:
929-942, 1998.
Harjunpaa, A., Junnikkala, S., and Meri, S. Rituximab (anti-CD20) therapy of B-cell
lymphomas: direct complement killing is superior to cellular effector mechanisms.
Scand J Immunol, 51: 634-641, 2000.
Harjunpaa, A., Wiklund, T., Collan, J., Janes, R., Rosenberg, J., Lee, D.,
Grillo-Lopez, A., and Meri, S. Complement activation in circulation and central
nervous system after rituximab (anti-CD20) treatment of B-cell lymphoma. Leuk
Lymphoma, 42: 731-738, 2001.
Haura, E. B., Cress, W. D., Chellappan, S., Zheng, Z., and Bepler, G. Antiapoptotic
signaling pathways in non-small-cell lung cancer: biology and therapeutic strategies.
Clin Lung Cancer, 6: 113-122, 2004.
Heelan, B. T., Tormey, V., Amlot, P., Payne, E., Mehta, A., and Webster, A. D.
Effect of anti-CD20 (rituximab) on resistant thrombocytopenia in autoimmune
lymphoproliferative syndrome. Br J Haematol, 118: 1078-1081, 2002.
Hekman, A., Honselaar, A., Vuist, W. M., Sein, J. J., Rodenhuis, S., ten Bokkel
Huinink, W. W., Somers, R., Rumke, P., and Melief, C. J. Initial experience with
treatment of human B cell lymphoma with anti-CD19 monoclonal antibody. Cancer
Immunol Immunother, 32: 364-372, 1991.

140
Held, K. D. Radiation-induced apoptosis and its relationship to loss of clonogenic
survival. Apoptosis, 2: 265-282, 1997.
Helms, J. B. and Zurzolo, C. Lipids as targeting signals: lipid rafts and intracellular
trafficking. Traffic, 5: 247-254, 2004.
Herr, I. and Debatin, K. M. Cellular stress response and apoptosis in cancer therapy.
Blood, 98: 2603-2614, 2001.
Hickman, J. A. Apoptosis induced by anticancer drugs. Cancer Metastasis Rev, 11:
121-139, 1992.
Hoessli, D. C., Ilangumaran, S., Soltermann, A., Robinson, P. J., Borisch, B., and
Nasir Ud, D. Signaling through sphingolipid microdomains of the plasma membrane:
the concept of signaling platform. Glycoconj J, 17: 191-197, 2000.
Hofmeister, J. K., Cooney, D., and Coggeshall, K. M. Clustered CD20 induced
apoptosis: src-family kinase, the proximal regulator of tyrosine phosphorylation,
calcium influx, and caspase 3-dependent apoptosis. Blood Cells Mol Dis, 26:
133-143, 2000.
Hornick, J. L., Khawli, L. A., Hu, P., Sharifi, J., Khanna, C., and Epstein, A. L.
Pretreatment with a monoclonal antibody/interleukin-2 fusion protein directed
against DNA enhances the delivery of therapeutic molecules to solid tumors. Clin
Cancer Res, 5: 51-60, 1999.
Hornick, J. L., Sharifi, J., Khawli, L. A., Hu, P., Bai, W. G., Alauddin, M. M.,
Mizokami, M. M., and Epstein, A. L. Single amino acid substitution in the Fc region
of chimeric TNT-3 antibody accelerates clearance and improves immunoscintigraphy
of solid tumors. J Nucl Med, 41: 355-362, 2000.
Hornick, J. L., Sharifi, J., Khawli, L. A., Hu, P., Biela, B. H., Mizokami, M. M., Yun,
A., Taylor, C. R., and Epstein, A. L. A new chemically modified chimeric TNT-3
monoclonal antibody directed against DNA for the radioimmunotherapy of solid
tumors. Cancer Biother Radiopharm, 13: 255-268, 1998.

141
Hu, E., Epstein, A. L., Naeve, G. S., Gill, I., Martin, S., Sherrod, A., Nichols, P.,
Chen, D., Mazumder, A., and Levine, A. M. A phase 1a clinical trial of LYM-1
monoclonal antibody serotherapy in patients with refractory B cell malignancies.
Hematol Oncol, 7: 155-166, 1989.
Hu, P., Glasky, M. S., Yun, A., Alauddin, M. M., Hornick, J. L., Khawli, L. A., and
Epstein, A. L. A human-mouse chimeric Lym-1 monoclonal antibody with
specificity for human lymphomas expressed in a baculovirus system. Hum
Antibodies Hybridomas, 6: 57-67, 1995.
Hu, W. and Kavanagh, J. J. Anticancer therapy targeting the apoptotic pathway.
Lancet Oncol, 4: 721-729, 2003.
Illidge, T. M. and Bayne, M. C. Antibody therapy of lymphoma. Expert Opin
Pharmacother, 2: 953-961, 2001.
Jaattela, M. Programmed cell death: many ways for cells to die decently. Ann Med,
34: 480-488, 2002.
Juweid, M., Sharkey, R. M., Markowitz, A., Behr, T., Swayne, L. C., Dunn, R.,
Hansen, H. J., Shevitz, J., Leung, S. O., Rubin, A. D., and et al. Treatment of
non-Hodgkin's lymphoma with radiolabeled murine, chimeric, or humanized LL2, an
anti-CD22 monoclonal antibody. Cancer Res, 55: 5899s-5907s, 1995.
Kaminski, M. S., Fig, L. M., Zasadny, K. R., Koral, K. F., DelRosario, R. B., Francis,
I. R., Hanson, C. A., Normolle, D. P., Mudgett, E., Liu, C. P., and et al. Imaging,
dosimetry, and radioimmunotherapy with iodine 131-labeled anti-CD37 antibody in
B-cell lymphoma. J Clin Oncol, 10: 1696-1711, 1992.
Kaufmann, S. H. and Earnshaw, W. C. Induction of apoptosis by cancer
chemotherapy. Exp Cell Res, 256: 42-49, 2000.
Kaufmann, S. H. and Gores, G. J. Apoptosis in cancer: cause and cure. Bioessays, 22:
1007-1017, 2000.

142
Kim, H. H., Kwack, K., and Lee, Z. H. Activation of c-jun N-terminal kinase by
4-1BB (CD137), a T cell co-stimulatory molecule. Mol Cells, 10: 247-252, 2000.
Kim, J. A., Averbook, B. J., Chambers, K., Rothchild, K., Kjaergaard, J., Papay, R.,
and Shu, S. Divergent effects of 4-1BB antibodies on antitumor immunity and on
tumor-reactive T-cell generation. Cancer Res, 61: 2031-2037, 2001.
Kinchen, J. M., Cabello, J., Klingele, D., Wong, K., Feichtinger, R., Schnabel, H.,
Schnabel, R., and Hengartner, M. O. Two pathways converge at CED-10 to mediate
actin rearrangement and corpse removal in C. elegans. Nature, 434: 93-99, 2005.
Kohler, G. and Milstein, C. Continuous cultures of fused cells secreting antibody of
predefined specificity. Nature, 256: 495-497, 1975.
Kostelny, S. A., Link, B. K., Tso, J. Y., Vasquez, M., Jorgensen, B. H., Wang, H.,
Hall, W. C., and Weiner, G. J. Humanization and characterization of the
anti-HLA-DR antibody 1D10. Int J Cancer, 93: 556-565, 2001.
Kroger, L. A., DeNardo, G. L., Gumerlock, P. H., Xiong, C. Y., Winthrop, M. D.,
Shi, X. B., Mack, P. C., Leshchinsky, T., and DeNardo, S. J. Apoptosis-related gene
and protein expression in human lymphoma xenografts (Raji) after low dose rate
radiation using 67Cu-2IT-BAT-Lym-1 radioimmunotherapy. Cancer Biother
Radiopharm, 16: 213-225, 2001.
Lechler RI., S. E., and Bach F Major and minor histocompatibility antigens. In:
Transplantation Immunology., p. 1-34. New York: Wiley-Liss, 1995.
Lee, H. W., Nam, K. O., Park, S. J., and Kwon, B. S. 4-1BB enhances CD8+ T cell
expansion by regulating cell cycle progression through changes in expression of
cyclins D and E and cyclin-dependent kinase inhibitor p27kip1. Eur J Immunol, 33:
2133-2141, 2003.
Lee, H. W., Park, S. J., Choi, B. K., Kim, H. H., Nam, K. O., and Kwon, B. S. 4-1BB
promotes the survival of CD8+ T lymphocytes by increasing expression of Bcl-xL
and Bfl-1. J Immunol, 169: 4882-4888, 2002.

143
Lee, S. J., Myers, L., Muralimohan, G., Dai, J., Qiao, Y., Li, Z., Mittler, R. S., and
Vella, A. T. 4-1BB and OX40 dual costimulation synergistically stimulate primary
specific CD8 T cells for robust effector function. J Immunol, 173: 3002-3012, 2004.
Leist, M. and Jaattela, M. Four deaths and a funeral: from caspases to alternative
mechanisms. Nat Rev Mol Cell Biol, 2: 589-598, 2001.
Leist, M. and Jaattela, M. Four deaths and a funeral: from caspases to alternative
mechanisms. Nat Rev Mol Cell Biol, 2: 589-598, 2001.
Leonard, J. P. and Link, B. K. Immunotherapy of non-Hodgkin's lymphoma with
hLL2 (epratuzumab, an anti-CD22 monoclonal antibody) and Hu1D10 (apolizumab).
Semin Oncol, 29: 81-86, 2002.
Li, J., Hu, P., Khawli, L. A., and Epstein, A. L. Complete regression of experimental
solid tumors by combination LEC/chTNT-3 immunotherapy and CD25(+) T-cell
depletion. Cancer Res, 63: 8384-8392, 2003.
Li, J., Hu, P., Khawli, L. A., and Epstein, A. L. LEC/chTNT-3 fusion protein for the
immunotherapy of experimental solid tumors. J Immunother, 26: 320-331, 2003.
Li, J., Hu, P., Khawli, L. A., Yun, A., and Epstein, A. L. chTNT-3/hu IL-12 fusion
protein for the immunotherapy of experimental solid tumors. Hybrid Hybridomics,
23: 1-10, 2004.
Liu, C., DeNardo, G., Tobin, E., and DeNardo, S. Antilymphoma effects of
anti-HLA-DR and CD20 monoclonal antibodies (Lym-1 and Rituximab) on human
lymphoma cells. Cancer Biother Radiopharm, 19: 545-561, 2004.
Longo, D. L. DR's orders: human antibody kills tumors by direct signaling. Nat Med,
8: 781-783, 2002.
Lowe, S. W. and Lin, A. W. Apoptosis in cancer. Carcinogenesis, 21: 485-495,
2000.

144
Mak, T. W. and Yeh, W. C. Signaling for survival and apoptosis in the immune
system. Arthritis Res, 4 Suppl 3: S243-252, 2002.
Maloney, D. G. Mechanism of action of rituximab. Anticancer Drugs, 12 Suppl 2:
S1-4, 2001.
Maloney, D. G., Grillo-Lopez, A. J., C.A., W., and al, e. IDEC-C2B8 (Rituximab)
anti-CD20 monoclonal antibody therapy in patients with relapsed low-grade
non-Hodgkin's lymphoma. Blood, 90: 2188-2195, 1997.
Maloney, D. G., Liles, T. M., Czerwinski, D. K., Waldichuk, C., Rosenberg, J.,
Grillo-Lopez, A., and Levy, R. Phase I clinical trial using escalating single-dose
infusion of chimeric anti-CD20 monoclonal antibody (IDEC-C2B8) in patients with
recurrent B-cell lymphoma. Blood, 84: 2457-2466, 1994.
Maloney, D. G., Smith, B., and Rose, A. Rituximab: mechanism of action and
resistance. Semin Oncol, 29: 2-9, 2002.
Manches, O., Lui, G., Chaperot, L., Gressin, R., Molens, J. P., Jacob, M. C., Sotto, J.
J., Leroux, D., Bensa, J. C., and Plumas, J. In vitro mechanisms of action of
rituximab on primary non-Hodgkin lymphomas. Blood, 101: 949-954, 2003.
Martin, D. A. and Elkon, K. B. Mechanisms of apoptosis. Rheum Dis Clin North Am,
30: 441-454, vii, 2004.
May, K. F., Jr., Chen, L., Zheng, P., and Liu, Y. Anti-4-1BB monoclonal antibody
enhances rejection of large tumor burden by promoting survival but not clonal
expansion of tumor-specific CD8+ T cells. Cancer Res, 62: 3459-3465, 2002.
McLaughlin, P., Grillo-Lopez, A. J., Link, B. K., Levy, R., Czuczman, M. S.,
Williams, M. E., Heyman, M. R., Bence-Bruckler, I., White, C. A., Cabanillas, F.,
Jain, V., Ho, A. D., Lister, J., Wey, K., Shen, D., and Dallaire, B. K. Rituximab
chimeric anti-CD20 monoclonal antibody therapy for relapsed indolent lymphoma:
half of patients respond to a four-dose treatment program. J Clin Oncol, 16:
2825-2833, 1998.

145
McLaughlin, P., Hagemeister, F. B., and Grillo-Lopez, A. J. Rituximab in indolent
lymphoma: the single-agent pivotal trial. Semin Oncol, 26: 79-87, 1999.
Melero, I., Bach, N., Hellstrom, K. E., Aruffo, A., Mittler, R. S., and Chen, L.
Amplification of tumor immunity by gene transfer of the co-stimulatory 4-1BB
ligand: synergy with the CD28 co-stimulatory pathway. Eur J Immunol, 28:
1116-1121, 1998.
Melero, I., Shuford, W. W., Newby, S. A., Aruffo, A., Ledbetter, J. A., Hellstrom, K.
E., Mittler, R. S., and Chen, L. Monoclonal antibodies against the 4-1BB T-cell
activation molecule eradicate established tumors. Nat Med, 3: 682-685, 1997.
Miller, G. K., Naeve, G. S., Gaffar, S. A., and Epstein, A. L. Immunologic and
biochemical analysis of TNT-1 and TNT-2 monoclonal antibody binding to histones.
Hybridoma, 12: 689-698, 1993.
Miller, R. E., Jones, J., Le, T., Whitmore, J., Boiani, N., Gliniak, B., and Lynch, D.
H. 4-1BB-specific monoclonal antibody promotes the generation of tumor-specific
immune responses by direct activation of CD8 T cells in a CD40-dependent manner.
J Immunol, 169: 1792-1800, 2002.
Mizokami, M. M., Hu, P., Khawli, L. A., Li, J., and Epstein, A. L. Chimeric TNT-3
antibody/murine interferon-gamma fusion protein for the immunotherapy of solid
malignancies. Hybrid Hybridomics, 22: 197-207, 2003.
Mone, A. P., Huang, P., Pelicano, H., Cheney, C. M., Green, J. M., Tso, J. Y.,
Johnson, A. J., Jefferson, S., Lin, T. S., and Byrd, J. C. Hu1D10 induces apoptosis
concurrent with activation of the AKT survival pathway in human chronic
lymphocytic leukemia cells. Blood, 103: 1846-1854, 2004.
Mow, B. M., Blajeski, A. L., Chandra, J., and Kaufmann, S. H. Apoptosis and the
response to anticancer therapy. Curr Opin Oncol, 13: 453-462, 2001.
Muppidi, J. R. and Siegel, R. M. Ligand-independent redistribution of Fas (CD95)
into lipid rafts mediates clonotypic T cell death. Nat Immunol, 5: 182-189, 2004.

146
Nagy, Z. A., Hubner, B., Lohning, C., Rauchenberger, R., Reiffert, S.,
Thomassen-Wolf, E., Zahn, S., Leyer, S., Schier, E. M., Zahradnik, A., Brunner, C.,
Lobenwein, K., Rattel, B., Stanglmaier, M., Hallek, M., Wing, M., Anderson, S.,
Dunn, M., Kretzschmar, T., and Tesar, M. Fully human, HLA-DR-specific
monoclonal antibodies efficiently induce programmed death of malignant lymphoid
cells. Nat Med, 8: 801-807, 2002.
Nalepa, G. and Zukowska-Szczechowska, E. [Caspases and apoptosis: die and let
live]. Wiad Lek, 55: 100-106, 2002.
Nam, K. O., Kang, H., Shin, S. M., Cho, K. H., Kwon, B., Kwon, B. S., Kim, S. J.,
and Lee, H. W. Cross-linking of 4-1BB activates TCR-signaling pathways in CD8+
T lymphocytes. J Immunol, 174: 1898-1905, 2005.
Nam, K. O., Shin, S. M., and Lee, H. W. Cross-linking of 4-1BB up-regulates IL-13
expression in CD8(+) T lymphocytes. Cytokine, 2006.
Oliver, L. and Vallette, F. M. The role of caspases in cell death and differentiation.
Drug Resist Updat, 8: 163-170, 2005.
O'Reilly, C. M., Fogarty, K. E., Drummond, R. M., Tuft, R. A., and Walsh, J. V., Jr.
Quantitative analysis of spontaneous mitochondrial depolarizations. Biophys J, 85:
3350-3357, 2003.
Ottonello, L., Epstein, A. L., Dapino, P., Barbera, P., Morone, P., and Dallegri, F.
Monoclonal Lym-1 antibody-dependent cytolysis by neutrophils exposed to
granulocyte-macrophage colony-stimulating factor: intervention of FcgammaRII
(CD32), CD11b-CD18 integrins, and CD66b glycoproteins. Blood, 93: 3505-3511,
1999.
Ottonello, L., Epstein, A. L., Mancini, M., Amelotti, M., Dapino, P., and Dallegri, F.
Monoclonal Lym-1 antibody-targeted lysis of B lymphoma cells by neutrophils.
Evidence for two mechanisms of FcgammaRII-dependent cytolysis. J Leukoc Biol,
68: 662-668, 2000.

147
Ottonello, L., Epstein, A. L., Mancini, M., Tortolina, G., Dapino, P., and Dallegri, F.
Chimaeric Lym-1 monoclonal antibody-mediated cytolysis by neutrophils from
G-CSF-treated patients: stimulation by GM-CSF and role of Fc gamma -receptors.
Br J Cancer, 85: 463-469, 2001.
Ottonello, L., Morone, P., Mancini, M., Amelotti, M., Dapino, P., and Dallegri, F.
FMLP- and TNF-stimulated monoclonal Lym-1 antibody-dependent lysis of B
lymphoblastoid tumour targets by neutrophils. Br J Cancer, 80: 331-337, 1999.
Pagel, J. M., Hedin, N., Subbiah, K., Meyer, D., Mallet, R., Axworthy, D., Theodore,
L. J., Wilbur, D. S., Matthews, D. C., and Press, O. W. Comparison of anti-CD20
and anti-CD45 antibodies for conventional and pretargeted radioimmunotherapy of
B-cell lymphomas. Blood, 101: 2340-2348, 2003.
Pangalis, G. A., Dimopoulou, M. N., Angelopoulou, M. K., Tsekouras, C.,
Vassilakopoulos, T. P., Vaiopoulos, G., and Siakantaris, M. P. Campath-1H
(anti-CD52) monoclonal antibody therapy in lymphoproliferative disorders. Med
Oncol, 18: 99-107, 2001.
Pedersen, I. M., Buhl, A. M., Klausen, P., Geisler, C. H., and Jurlander, J. The
chimeric anti-CD20 antibody rituximab induces apoptosis in B-cell chronic
lymphocytic leukemia cells through a p38 mitogen activated
protein-kinase-dependent mechanism. Blood, 99: 1314-1319, 2002.
Philchenkov, A., Zavelevich, M., Kroczak, T. J., and Los, M. Caspases and cancer:
mechanisms of inactivation and new treatment modalities. Exp Oncol, 26: 82-97,
2004.
Pimm, M. V., Perkins, A. C., Armitage, N. C., and Baldwin, R. W. The
characteristics of blood-borne radiolabels and the effect of anti-mouse IgG antibodies
on localization of radiolabeled monoclonal antibody in cancer patients. J Nucl Med,
26: 1011-1023, 1985.
Pollok, K. E., Kim, Y. J., Hurtado, J., Zhou, Z., Kim, K. K., and Kwon, B. S. 4-1BB
T-cell antigen binds to mature B cells and macrophages, and costimulates
anti-mu-primed splenic B cells. Eur J Immunol, 24: 367-374, 1994.

148
Press, O. W., Appelbaum, F., Ledbetter, J. A., Martin, P. J., Zarling, J., Kidd, P., and
Thomas, E. D. Monoclonal antibody 1F5 (anti-CD20) serotherapy of human B cell
lymphomas. Blood, 69: 584-591, 1987.
Rastetter, W., Molina, A., and White, C. A. Rituximab: expanding role in therapy for
lymphomas and autoimmune diseases. Annu Rev Med, 55: 477-503, 2004.
Reed, C. J. Apoptosis and cancer: strategies for integrating programmed cell death.
Semin Hematol, 37: 9-16, 2000.
Reed, J. C. Mechanisms of apoptosis avoidance in cancer. Curr Opin Oncol, 11:
68-75, 1999.
Reff, M. E., Carner, K., Chambers, K. S., Chinn, P. C., Leonard, J. E., Raab, R.,
Newman, R. A., Hanna, N., and Anderson, D. R. Depletion of B cells in vivo by a
chimeric mouse human monoclonal antibody to CD20. Blood, 83: 435-445, 1994.
Rose, A. L., Smith, B. E., and Maloney, D. G. Glucocorticoids and rituximab in vitro:
synergistic direct antiproliferative and apoptotic effects. Blood, 100: 1765-1773,
2002.
Rose, L. M., Deng, C. T., Scott, S. L., Xiong, C. Y., Lamborn, K. R., Gumerlock, P.
H., DeNardo, G. L., and Meares, C. F. Critical Lym-1 binding residues on
polymorphic HLA-DR molecules. Mol Immunol, 36: 789-797, 1999.
Rose, L. M., Gunasekera, A. H., DeNardo, S. J., DeNardo, G. L., and Meares, C. F.
Lymphoma-selective antibody Lym-1 recognizes a discontinuous epitope on the light
chain of HLA-DR10. Cancer Immunol Immunother, 43: 26-30, 1996.
Roy, S. Caspases at the heart of the apoptotic cell death pathway. Chem Res Toxicol,
13: 961-962, 2000.
Rummel, M. J., Chow, K. U., Hoelzer, D., Mitrou, P. S., and Weidmann, E. In vitro
studies with bendamustine: enhanced activity in combination with rituximab. Semin
Oncol, 29: 12-14, 2002.

149
Sacchi, S., Federico, M., Dastoli, G., Fiorani, C., Vinci, G., Clo, V., and Casolari, B.
Treatment of B-cell non-Hodgkin's lymphoma with anti CD 20 monoclonal antibody
Rituximab. Crit Rev Oncol Hematol, 37: 13-25, 2001.
Saikumar, P., Dong, Z., Mikhailov, V., Denton, M., Weinberg, J. M., and
Venkatachalam, M. A. Apoptosis: definition, mechanisms, and relevance to disease.
Am J Med, 107: 489-506, 1999.
Saoulli, K., Lee, S. Y., Cannons, J. L., Yeh, W. C., Santana, A., Goldstein, M. D.,
Bangia, N., DeBenedette, M. A., Mak, T. W., Choi, Y., and Watts, T. H.
CD28-independent, TRAF2-dependent costimulation of resting T cells by 4-1BB
ligand. J Exp Med, 187: 1849-1862, 1998.
Scaduto, R. C., Jr. and Grotyohann, L. W. Measurement of mitochondrial membrane
potential using fluorescent rhodamine derivatives. Biophys J, 76: 469-477, 1999.
Scheuermann, R. H. and Racila, E. CD19 antigen in leukemia and lymphoma
diagnosis and immunotherapy. Leuk Lymphoma, 18: 385-397, 1995.
Selenko, N., Maidic, O., Draxier, S., Berer, A., Jager, U., Knapp, W., and Stockl, J.
CD20 antibody (C2B8)-induced apoptosis of lymphoma cells promotes phagocytosis
by dendritic cells and cross-priming of CD8+ cytotoxic T cells. Leukemia, 15:
1619-1626, 2001.
Selenko, N., Majdic, O., Jager, U., Sillaber, C., Stockl, J., and Knapp, W.
Cross-priming of cytotoxic T cells promoted by apoptosis-inducing tumor cell
reactive antibodies? J Clin Immunol, 22: 124-130, 2002.
Shan, D., Gopal, A. K., and Press, O. W. Synergistic effects of the fenretinide
(4-HPR) and anti-CD20 monoclonal antibodies on apoptosis induction of malignant
human B cells. Clin Cancer Res, 7: 2490-2495, 2001.
Shan, D., Ledbetter, J. A., and Press, O. W. Apoptosis of malignant human B cells
by ligation of CD20 with monoclonal antibodies. Blood, 91: 1644-1652, 1998.

150
Shan, D., Ledbetter, J. A., and Press, O. W. Signaling events involved in
anti-CD20-induced apoptosis of malignant human B cells. Cancer Immunol
Immunother, 48: 673-683, 2000.
Shan, D. and Press, O. W. Constitutive endocytosis and degradation of CD22 by
human B cells. J Immunol, 154: 4466-4475, 1995.
Sharifi, J., Khawli, L. A., Hu, P., Li, J., and Epstein, A. L. Generation of human
interferon gamma and tumor Necrosis factor alpha chimeric TNT-3 fusion proteins.
Hybrid Hybridomics, 21: 421-432, 2002.
Shi, J. D., Bullock, C., Hall, W. C., Wescott, V., Wang, H., Levitt, D. J., and
Klingbeil, C. K. In vivo pharmacodynamic effects of Hu1D10 (remitogen), a
humanized antibody reactive against a polymorphic determinant of HLA-DR
expressed on B cells. Leuk Lymphoma, 43: 1303-1312, 2002.
Shiozaki, E. N. and Shi, Y. Caspases, IAPs and Smac/DIABLO: mechanisms from
structural biology. Trends Biochem Sci, 29: 486-494, 2004.
Shuford, W. W., Klussman, K., Tritchler, D. D., Loo, D. T., Chalupny, J., Siadak, A.
W., Brown, T. J., Emswiler, J., Raecho, H., Larsen, C. P., Pearson, T. C., Ledbetter, J.
A., Aruffo, A., and Mittler, R. S. 4-1BB costimulatory signals preferentially induce
CD8+ T cell proliferation and lead to the amplification in vivo of cytotoxic T cell
responses. J Exp Med, 186: 47-55, 1997.
Sohn, S. J., Rajpal, A., and Winoto, A. Apoptosis during lymphoid development.
Curr Opin Immunol, 15: 209-216, 2003.
Solary, E., Droin, N., Bettaieb, A., Corcos, L., Dimanche-Boitrel, M. T., and Garrido,
C. Positive and negative regulation of apoptotic pathways by cytotoxic agents in
hematological malignancies. Leukemia, 14: 1833-1849, 2000.
Starck, L., Scholz, C., Dorken, B., and Daniel, P. T. Costimulation by CD137/4-1BB
inhibits T cell apoptosis and induces Bcl-xL and c-FLIP(short) via
phosphatidylinositol 3-kinase and AKT/protein kinase B. Eur J Immunol, 35:
1257-1266, 2005.

151
Stockmeyer, B., Schiller, M., Repp, R., Lorenz, H. M., Kalden, J. R., Gramatzki, M.,
and Valerius, T. Enhanced killing of B lymphoma cells by granulocyte
colony-stimulating factor-primed effector cells and Hu1D10--a humanized human
leucocyte antigen DR antibody. Br J Haematol, 118: 959-967, 2002.
Strasser, A., O'Connor, L., and Dixit, V. M. Apoptosis signaling. Annu Rev Biochem,
69: 217-245, 2000.
Susin, S. A., Daugas, E., Ravagnan, L., Samejima, K., Zamzami, N., Loeffler, M.,
Costantini, P., Ferri, K. F., Irinopoulou, T., Prevost, M. C., Brothers, G., Mak, T. W.,
Penninger, J., Earnshaw, W. C., and Kroemer, G. Two distinct pathways leading to
nuclear apoptosis. J Exp Med, 192: 571-580, 2000.
Takahashi, C., Mittler, R. S., and Vella, A. T. Cutting edge: 4-1BB is a bona fide
CD8 T cell survival signal. J Immunol, 162: 5037-5040, 1999.
Takahashi, C., Mittler, R. S., and Vella, A. T. Differential clonal expansion of CD4
and CD8 T cells in response to 4-1BB ligation: contribution of 4-1BB during
inflammatory responses. Immunol Lett, 76: 183-191, 2001.
Tan, J. T., Whitmire, J. K., Ahmed, R., Pearson, T. C., and Larsen, C. P. 4-1BB
ligand, a member of the TNF family, is important for the generation of antiviral CD8
T cell responses. J Immunol, 163: 4859-4868, 1999.
Tobinai, K. Clinical trials of a mouse-human chimeric anti-CD20 monoclonal
antibody (rituximab) for B cell non-Hodgkin's lymphoma in Japan. Cancer
Chemother Pharmacol, 48 Suppl 1: S85-90, 2001.
Treon, S. P., Mitsiades, C., Mitsiades, N., Young, G., Doss, D., Schlossman, R., and
Anderson, K. C. Tumor cell expression of CD59 is associated with resistance to
CD20 serotherapy in patients with B-cell malignancies. J Immunother, 24: 263-271,
2001.
van der Kolk, L. E., de Haas, M., Grillo-Lopez, A. J., Baars, J. W., and van Oers, M.
H. Analysis of CD20-dependent cellular cytotoxicity by G-CSF-stimulated
neutrophils. Leukemia, 16: 693-699, 2002.

152
van der Kolk, L. E., Evers, L. M., Omene, C., Lens, S. M., Lederman, S., van Lier, R.
A., van Oers, M. H., and Eldering, E. CD20-induced B cell death can bypass
mitochondria and caspase activation. Leukemia, 16: 1735-1744, 2002.
Vilpo, J., Hulkkonen, J., Hurme, M., and Vilpo, L. Surface membrane antigen
expression changes induced in vitro by exogenous growth factors in chronic
lymphocytic leukemia cells. Leukemia, 16: 1691-1698, 2002.
Weng, W. K. and Levy, R. Two immunoglobulin G fragment C receptor
polymorphisms independently predict response to rituximab in patients with
follicular lymphoma. J Clin Oncol, 21: 3940-3947, 2003.
White, C. A., Weaver, R. L., and Grillo-Lopez, A. J. Antibody-targeted
immunotherapy for treatment of malignancy. Annu Rev Med, 52: 125-145, 2001.
Wilcox, R. A., Flies, D. B., Zhu, G., Johnson, A. J., Tamada, K., Chapoval, A. I.,
Strome, S. E., Pease, L. R., and Chen, L. Provision of antigen and CD137 signaling
breaks immunological ignorance, promoting regression of poorly immunogenic
tumors. J Clin Invest, 109: 651-659, 2002.
Wilcox, R. A., Tamada, K., Flies, D. B., Zhu, G., Chapoval, A. I., Blazar, B. R., Kast,
W. M., and Chen, L. Ligation of CD137 receptor prevents and reverses established
anergy of CD8+ cytolytic T lymphocytes in vivo. Blood, 103: 177-184, 2004.
Wilcox, R. A., Tamada, K., Strome, S. E., and Chen, L. Signaling through NK
cell-associated CD137 promotes both helper function for CD8+ cytolytic T cells and
responsiveness to IL-2 but not cytolytic activity. J Immunol, 169: 4230-4236, 2002.
Wilson, W. H. Chemotherapy sensitization by rituximab: experimental and clinical
evidence. Semin Oncol, 27: 30-36, 2000.
Wilson, W. H., Gutierrez, M., O'Connor, P., Frankel, S., Jaffe, E., Chabner, B. A.,
and Grossbard, M. L. The role of rituximab and chemotherapy in aggressive B-cell
lymphoma: a preliminary report of dose-adjusted EPOCH-R. Semin Oncol, 29:
41-47, 2002.
Wyllie, A. H. Apoptosis: an overview. Br Med Bull, 53: 451-465, 1997.

153
Xu, D. P., Sauter, B. V., Huang, T. G., Meseck, M., Woo, S. L., and Chen, S. H. The
systemic administration of Ig-4-1BB ligand in combination with IL-12 gene transfer
eradicates hepatic colon carcinoma. Gene Ther, 12: 1526-1533, 2005.
Yan, X., Johnson, B. D., and Orentas, R. J. Murine CD8 lymphocyte expansion in
vitro by artificial antigen-presenting cells expressing CD137L (4-1BBL) is superior
to CD28, and CD137L expressed on neuroblastoma expands CD8 tumour-reactive
effector cells in vivo. Immunology, 112: 105-116, 2004.
Yang, F. and Yang, X. F. New concepts in tumor antigens: their significance in
future immunotherapies for tumors. Cell Mol Immunol, 2: 331-341, 2005.
Yoshida, H., Katayose, Y., Unno, M., Suzuki, M., Kodama, H., Takemura, S., Asano,
R., Hayashi, H., Yamamoto, K., Matsuno, S., and Kudo, T. A novel adenovirus
expressing human 4-1BB ligand enhances antitumor immunity. Cancer Immunol
Immunother, 52: 97-106, 2003.
Young, R. M., Holowka, D., and Baird, B. A lipid raft environment enhances Lyn
kinase activity by protecting the active site tyrosine from dephosphorylation. J Biol
Chem, 278: 20746-20752, 2003.
Zakeri, Z. and Lockshin, R. A. Cell death during development. J Immunol Methods,
265: 3-20, 2002.
Zhang, N., Khawli, L. A., Hu, P., and Epstein, A. L. Generation of rituximab
polymer may cause hyper-cross-linking-induced apoptosis in non-Hodgkin's
lymphomas. Clin Cancer Res, 11: 5971-5980, 2005.

154

Linked assets

University of Southern California Dissertations and Theses

Conceptually similar

PDF

Colorectal cancer: genomic variations in insulin-like growth factor-1 and -2

PDF

Experimental and computational analysis of microsatellite repeat instability in mismatch-repair-deficient mice

PDF

Engineering antibodies and antibody /cytokine fusion proteins for the treatment of human malignancies

PDF

B7.1 fusion proteins for cancer immunotherapy

PDF

Elevated inflammation in late life: predictors and outcomes

PDF

Imaging and prodrug -activating derivatives of chTNT-3 (tumor necrosis therapy) monoclonal antibody

PDF

Localization and function of activin in tumor cell lines

PDF

Novel phenylpolyene-bridged second-order nonlinear optical chromophores and new thermally stable polyurethanes for electro-optic applications

PDF

The role of the vasti in patellar kinematics and patellofemoral pain

PDF

Spatial distribution of neuroendocrine motoneuron pools in the hypothalmic paraventricular nucleus

PDF

Antibody-cytokine/chemokine fusion proteins in the immunotherapy of solid tumors

PDF

Molecular genetic alterations in breast cancer

PDF

Prolactin and prolactin-like proteins in rabbit lacrimal gland

PDF

Initiation mechanism of estrogen neuroprotection pathway

PDF

Moloney murine leukemia virus (MoMuLV) envelope protein: Interaction with receptor and engineering for targeted gene transfer

PDF

The role of host proteins in retroviral cDNA integration

PDF

The ecology and behavior of the California moray eel Gymnothorax mordax (Ayres, 1859) with descriptions of its larva and the leptocephali of some other east Pacific muraenidae

PDF

Molecular classification, diagnosis and prognosis of pediatric rhabdomyosarcoma by oligonucleotide microarray analyses

PDF

Phylogenetics of the cutlassfishes (Scombroidei: Trichiuridae)

PDF

Adaptation of a novel electrochemical detection methodology to immunochemical -based assays

Asset Metadata

Creator Zhang, Nan (author)

Core Title Three antibody-based immunotherapeutic modalities for malignancies

School Graduate School

Degree Doctor of Philosophy

Degree Program Pathobiology

Degree Conferral Date 2006-05

Publisher University of Southern California (original), University of Southern California. Libraries (digital)

Tag health sciences, immunology,health sciences, oncology,health sciences, pathology,OAI-PMH Harvest

Language English

Contributor Digitized by ProQuest (provenance)

Permanent Link (DOI) https://doi.org/10.25549/usctheses-c17-112747

Unique identifier UC11351086

Identifier 3237188.pdf (filename),usctheses-c17-112747 (legacy record id)

Legacy Identifier 3237188.pdf

Dmrecord 112747

Document Type Dissertation

Rights Zhang, Nan

Type texts

Source University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Access Conditions The author retains rights to his/her dissertation, thesis or other graduate work according to U.S. copyright law. Electronic access is being provided by the USC Libraries in agreement with the au...

Repository Name University of Southern California Digital Library

Repository Location USC Digital Library, University of Southern California, University Park Campus, Los Angeles, California 90089, USA