University of Southern California Dissertations and Theses

Role of the bone marrow niche components in B cell malignancies

(USC Thesis Other)

Role of the bone marrow niche components in B cell malignancies

PDF

Download a page range

Download transcript

Copy asset link

Request this asset

Transcript (if available)

Content
1

ROLE OF THE BONE MARROW NICHE COMPONENTS IN
B CELL MALIGNANCIES

by
Sapna Shah Jain

A Dissertation presented to the
FACULTY OF USC GRADUATE SCHOOL
UNIVERSITY OF SOUTHERN CALIFORNIA
In partial fulfillment of the requirements for the Degree
DOCTOR OF PHILOSOPHY
(GENETIC, CELLULAR AND MOLECULAR BIOLOGY)

DECEMBER 2015

Copyright © 2015 Sapna Shah Jain

2

Acknowledgments

“It takes a village to raise a child” is a common African proverb. I believe this idea also
applies to the achievement of a Ph.D. It has been a long and demanding but fun journey
and I wouldn’t be where I am today if it wasn’t for the guidance and encouragement of
some amazing individuals.

I will forever be grateful to my mentor Dr. Gregor Adams for his support and confidence
in me. Gregor is a brilliant and patient mentor whose door was always open for my
questions. His ability to look at data comprehensively and connect it to the big picture is
something I hope to emulate in my professional life. I will never forget something that
Gregor told me when we were discussing my graduation - “My goal is to equip you with
the thinking skills and training to tackle any intellectual project you might take on
because your training does not stop here.” Because of Gregor’s support, I was able to
achieve the Diploma in Innovation and attain a part-time internship with the Alfred Mann
Institute which has led to my full-time employment there as a Project Manager upon
graduation. Thank you for everything Gregor, you are the best mentor I could have
wished for.

I also want to thank my wonderful committee members – Dr. QiLong Ying, Dr.
Krzysztof Kobielak, Dr. Vinod Pullarkat and Dr. Akil Merchant - for all their valuable
suggestions, guidance and for keeping my best interests at heart. I feel fortunate that I
could approach any of them without hesitation to learn more about topics of their
expertise. Each of them was always willing to lend any chemicals or equipment I might

3

need for experiments. I am a better scientist today because of their guidance and
mentorship. I also want to thank Dr. Henry Sucov, Dr. Cheng-Ming Chuong and Julena
Lind from the NIH T32 Executive Committee for their support and funding my work for
two years. Thanks also to the USC Regenerative Medicine Initiative for their financial
support.

My time in lab would have been very lonely without the company of Dr. Xiaoying Zhou,
the senior postdoc in our lab. She is one of the most intelligent and yet humble scientists I
have met and I am so glad to have worked beside her for the last four years. She was
always willing to teach me new techniques and never demonstrated any “postdoc ego”
towards a graduate student and always made me feel competent. She took on the role of
my lab mom and I am going to truly miss her as we go our separate ways. I also want to
thank the former members of our lab - Dr. Narges Rashidi, Dr. Ben Lam and Tassja
Spindler - for their guidance and encouragement.

Research is a very collaborative process and my projects were no different. The in vivo
work for the Multiple Myeloma project would not have been possible without the support
of Dr. Amy Lee and members of her lab. Thanks also to Dr. Uckun at Children’s Hospital
of Los Angeles and specifically Erika and Anoush for being flexible and willing to drive
over to HSC to drop off samples. Thanks to Lora Barsky and Bernadette Masinsin from
the USC Flow Cytometry Core who have been immensely helpful and understanding in
setting up sorts. I appreciate the help of Gohar Saribekyan, the former Histology Core
Manager, who spent hours assisting me in obtaining the best tibial sections for my

4

immunohistochemistry experiments. Thanks also to Ashley Flinn and Marisela Zuniga in
the PIBBS office for being on top of things and always being a great sounding board for
any issues I faced during graduate school.

Going through graduate school was akin to surfing, one moment I was soaring in
exhilaration with exciting data and another second I was under the water unsure if I
would ever graduate. It is because of my amazing family and friends that I came out of
graduate school without any scars. No words can be enough to express my appreciation
for my best friend and husband Rishi Jain’s support over the last five years. Rishi, thank
you for taking care of household and family matters when I was too tired or busy to do so
and accompanying me to lab over weekends so I wouldn’t be by myself. In hindsight,
graduate school feels like a breeze because you kept me grounded and sane. I want to
thank my parents Dr. Nikhil Shah and Mrs. Smita Shah and my sister Nirali Shah for
their unconditional love and encouragement. They are my role models and I wouldn’t be
where I am today without their support. I also want to thank my husband’s parents – Mr.
Bhanu Jain and Mrs. Sangeeta Jain – for their love and support during this journey. Our
experiences of a place are very much defined by the people we are there with and I am
grateful that I went through graduate school with the friendship and encouragement of
wonderful and intelligent friends at and outside of USC.

Thanks a lot everyone and Fight On!

5

Table of Contents

Acknowledgments ............................................................................................................. 2

Table of Contents .............................................................................................................. 5

List of Tables ..................................................................................................................... 7

List of Figures .................................................................................................................... 8

Abbreviations .................................................................................................................... 9

Abstract ............................................................................................................................ 12

Chapter 1: Introduction ................................................................................................. 14
1.1 Hematopoietic Stem Cells .................................................................................... 14
1.2 Role of the BM niche in hematopoiesis and cancer ............................................. 17
1.3 B cell development and cancers ........................................................................... 22
1.4 CXCR4 in Multiple Myeloma ............................................................................. 24
1.5 CD22 in B-cell Precursor Leukemia .................................................................... 27

Chapter 2: CRISPR/Cas9 Knockout of CXCR4 Reveals Its Essential Role in the
Retention of Multiple Myeloma Cells in the Bone Marrow Microenvironment ....... 31
2.1 Abstract ................................................................................................................... 31
2.2 Introduction ............................................................................................................. 32
2.3 Materials and Methods ............................................................................................ 33
2.3.1 Animals ............................................................................................................ 33
2.3.2 Cells ................................................................................................................. 34
2.3.3 Knockdown of CXCR4 using lentiviral shRNA .............................................. 34
2.3.4 Generation of lentiCRISPR virus with sgRNA towards mCXCR4 ................. 35
2.3.5 Transduction of cells ........................................................................................ 36
2.3.6 Methods to detect mutations in genomic DNA ................................................ 36
2.3.7 Cell Surface Expression of CXCR4 ................................................................. 37
2.3.8 Chemotaxis Assay ............................................................................................ 38
2.3.9 Calcium Flux Assay ......................................................................................... 38
2.3.10 Cell Adhesion Assay ...................................................................................... 39
2.3.11 Apoptosis Assay ............................................................................................ 39
2.3.12 Cell Cycle Analysis ........................................................................................ 40
2.3.13 In Vivo Homing ............................................................................................. 40
2.3.14 In Vivo Lodgment .......................................................................................... 40
2.3.15 MM cell injection and induction of multiple myeloma ................................. 41
2.3.16 Analytical methods for disease detection ...................................................... 41
2.3.17 Overexpression of CXCR4 in 5TGM1 cells .................................................. 42
2.4 Results ..................................................................................................................... 43
2.4.1 CXCR4 is expressed on 5TGM1 multiple myeloma cells ............................... 43

6

2.4.2 shRNA knockdown of CXCR4 in 5TGM1 cells slows down MM while
AMD3100 administration speeds up disease development. ..................................... 44
2.4.3 Lentiviral delivery of CRISPR/Cas9 enables the knockout of CXCR4 from
the surface of 5TGM1 cells. ...................................................................................... 46
2.4.4 Lack of expression of CXCR4 decreases cell migration towards SDF-1α in
vitro. .......................................................................................................................... 49
2.4.5 CXCR4 KO does not affect adhesion to ECM molecules. .............................. 50
2.4.6 CXCR4 KO does not affect cell survival, cell growth or cell cycle status. ..... 50
2.4.7 CXCR4 KO affects the specific localization and retention of 5TGM1 cells in
the bone marrow. ...................................................................................................... 52
2.4.8 Inoculation of CXCR4 KO 5TGM1 cells in C57bl/Kalwrij mice fails to cause
MM disease ............................................................................................................... 55
2.4.9 Overexpression of CXCR4 in 5TGM1-CRISPR cells partially rescues disease
phenotype. ................................................................................................................. 58
2.5 Discussion ............................................................................................................... 60

Chapter 3: The Impact of the CD22ΔE12 Genetic Mutation in the Leukemic Stem
Cell Niche ......................................................................................................................... 63
3.1 Abstract ................................................................................................................... 63
3.2 Introduction ............................................................................................................. 63
3.3 Materials & Methods .............................................................................................. 65
3.3.1 Animals ............................................................................................................ 65
3.3.2 Euthanasia ........................................................................................................ 69
3.3.3 Bone Harvesting and Flushing ......................................................................... 69
3.3.4 Hematopoietic Stem Cell Staining and Analysis ............................................. 69
3.3.5 Stromal Cell Staining ....................................................................................... 71
3.3.6 Cell Cycle Analysis .......................................................................................... 72
3.3.7 c-Kit Cell Enrichment using Magnetic Beads ................................................. 73
3.3.8 Fluorescence Activated Cell Sorting (FACS) .................................................. 73
3.3.9 Engraftment Assay ........................................................................................... 75
3.3.10 Competitive Repopulation Assay .................................................................. 76
3.4 Results ..................................................................................................................... 78
3.4.1 CD22ΔE12 mutation results in increased HSPC populations in the bone
marrow. MLL-AF4 mutation does not show the same effect. .................................. 78
3.4.2 Cell cycle analysis suggests that there is an increased proportion of active
LSK cells in CD22ΔE12-Tg mice. ........................................................................... 79
3.4.3 Increased number of MSC like cells in the CD22ΔE12 Tg mice .................... 80
3.4.4 Results of Competitive Repopulation Assay ................................................... 81
3.4.5 Reduced engraftment in CD22ΔE12-Tg mice ................................................. 83
3.4.6 CD22ΔE12 mutation is present only in cells of B-lineage .............................. 83
3.5 Discussion ............................................................................................................... 84

Chapter 4: Concluding Remarks ................................................................................... 87

References ........................................................................................................................ 92

7

List of Tables

Table 3.1. Description of transgenic mouse models used in our studies. ......................... 68
Table 3.2. Primary antibodies used for mouse hematopoietic stem cell analysis. ............ 71
Table 3.3. Primary antibodies used for mouse stromal cell analysis. ............................... 72
Table 3.4. Cell surface marker profile of sorted cells. ...................................................... 74
Table 3.5. Antibodies used for FACS to investigate CD22ΔE12 expression in cell
populations. ............................................................................................................... 75

8

List of Figures

Figure 1.1. The hierarchy of hematopoietic cells………………………………..………17
Figure 1.2. Development of B-cells in the bone marrow and peripheral
lymphoid organs…………………………………………………………………….24
Figure 2.1 CXCR4 is expressed in 5TGM1 cells ............................................................. 43
Figure 2.2 Effects of CXCR4 knockdown using shRNA..................................................46
Figure 2.3 CXCR4 knockout using CRISPR/Cas9 ........................................................... 48
Figure 2.4 CXCR4 KO reduces cell migration towards SDF-1α ..................................... 49
Figure 2.5 CXCR4 KO does not affect cell adhesion to Fibronectin and Collagen I ....... 50
Figure 2.6 CXCR4 KO does not affect cell survival, proliferation or cell cycle status. ... 52
Figure 2.7 CXCR4 KO affects the localization and lodgment of 5TGM1 cells in the
bone marrow. ............................................................................................................ 55
Figure 2.8 Inoculation of CXCR4 KO 5TGM1 cells in C57BL/KaLwRij mice fails
to cause MM disease. ................................................................................................ 57
Figure 2.9 Rescue of CXCR4 KO using FUIGW-human CXCR4 lentiviral construct….59
Figure 3.1 Schematic of engraftment assay set up……………………………………….75
Figure 3.2 Schematic of competitive repopulation assay set up ………………………...76
Figure 3.3 CD22ΔE12-Tg pre-leukemic mice have increased numbers of HSPCs in
their bone marrow…………………………………………………………………..79
Figure 3.4 Higher percentage of active cells in the LSK sub-population of
CD22ΔE12-Tg mice……..………………………………………..………………...80
Figure 3.5 Increased number of MSCs in BM of CD22ΔE12-Tg mice ………………...81
Figure 3.6 Stromal cells from CD22ΔE12-Tg mice release factors that negatively
affect the engraftment capacity of WT LSK cells in normal recipient mice………..82
Figure 3.7 Engraftment of normal HSCs is impaired in CD22ΔE12-Tg mice ………….83
Figure 3.8 CD22ΔE12 mutation is not present in primitive LTHSCs of young
and old transgenic mice……………………………………………………………..84

9

Abbreviations

7-AAD 7-Amino-Actinomycin
AF700 Alexa Fluor 700
ALL Acute Lymphoblastic Leukemia
APC Allophycocyanin
BCR B-Cell Receptor
BM Bone Marrow
BPL B-Precursor Leukemia
BPL B-Precursor Acute Lymphoblastic
Leukemia
BSA Bovine Serum Albumin
CFSE Carboxyfluorescein Diacetate Succinimidyl
Ester
CLP
CMP
DAPI
Common Lymphoid Progenitor
Common Myeloid Progenitor
4’,6-diamidino- 2-phenylindole
DMEM Dulbecco's Modified Eagle Medium
DNA Deoxyribonucleic Acid
FACS Fluorescence Activated Cell Sorting
FBS Fetal Bovine Serum
FITC Fluorescein isothiocyanate
GMP Granulocyte Macrophage Progenitor

10

HSC Hematopoietic Stem Cell
HSPC Hematopoietic Stem and Progenitor Cells
IACUC Institutional Animal Care and Use
Committee
IMDM Iscove's Modified Dulbecco's Medium
LPC Leukemic Progenitor Cell
LSC Leukemic Stem Cell
LSK Lin-ckit+sca1+ cells
LT-HSCs Long Term HSCs
Mac-1 Macrophage-1
MEP
MGUS
Megakaryocyte/Erythroid Progenitor
Monoclonal Gammopathy Of
Undetermined Significance
MM Multiple Myeloma
MNC Mono nuclear cell
MOI Multiplicity Of Infection
MPP Multipotent Progenitor
MSC Mesenchymal Stem Cell
Mt1 Metallothionein-1
NS NOD/SCID
OBC Osteoblastic Lineage Cells
PBS Phosphate Buffered Saline
PCR Polymerase Chain Reaction

11

PE Phycoerythrin
PE-Cy5 Phycoerythrin-Cyanine5
PE-Cy7 Phycoerythrin-Cyanine7
RBC Red Blood Cell
RNA Ribonucleic Acid
SC Stem Cell
SDF-1α Stromal Cell-Derived Factor – 1 Alpha
SEM Standard Error of Mean
SLAM Signaling Lymphocyte Activation Molecule
ST-HSCs Short Term HSCs
TCR T-Cell Receptor
TRACP Tartrate-Resistant Acid Phosphatase
WT Wild Type

12

Abstract
Hematopoietic stem cells (HSCs) are pluripotent stem cells that balance self-renewal and
differentiation in order to support lifelong hematopoiesis. HSCs are able to maintain this
balance through cues from the bone marrow (BM) stem cell niches in which they reside.
Recently, it has been shown that abnormal cells in hematological malignancies can utilize
and manipulate the same signals in order to promote disease development. We
investigated the role of the BM microenvironment components in B-cell malignancies. B
cell tumors are composed of normal B cells that have gone awry at different stages of
differentiation, maturation and activation. It is hypothesized that these abnormal B cells
utilize the same mechanisms as their normal counterparts to promote disease. We used
mouse models of two types of B-cell cancers which involve B cells at different stages of
development: multiple myeloma (MM), which affects differentiated plasma cells and B-
precursor acute lymphoblastic leukemia (BPL), which affects immature B cell precursors.
In MM, the peripheral lymphoid organs are spared and the disease is mainly restricted to
the BM, even though the clonal founder cell is of peripheral origin. This could be because
the malignant cells remember pathways and microenvironments preferred by their normal
counterparts or because the BM microenvironment actively recruits and restricts
malignant cells irrespective of what happens under homeostasis. In either case, the BM
destination clearly underlies the specific need of these malignant cells for an external
supportive environment. The stromal cell derived factor-1α (SDF-1α)/CXCR4 axis is one
of the most studied interactions in hematopoiesis and has been shown to be essential for
the retention of HSCs in the BM as well as play a role in the localization of normal
plasma cells in the BM. Previous studies have shown that the SDF-1α/CXCR4 interaction

13

is important in the homing of MM cells to the bone marrow but this data was acquired
using xenograft models. We hypothesized that MM cells use the SDF-1α/CXCR4 axis to
retain abnormal plasma cells in the BM which leads to development of incurable disease.
Using CRISPR/Cas9 genome engineering technology and a syngeneic mouse model of
MM, we showed that CXCR4 is not necessary for the homing of MM cells to the BM.
Instead, the SDF-1α/CXCR4 interaction is necessary for the retention of MM cells in the
BM and inoculation of CXCR4 knock-out (KO) MM cells in recipient mice failed to
cause disease. Next, we showed that the BM microenvironment plays an active role in the
development of cancers such as BPL that involves immature, and hence more primitive,
B cells. Previous work has shown that leukemic stem cells (LSCs) in BPL are
characterized by a CD22 frameshift mutation in exon 12 (CD22ΔE12) that makes them
resistant to chemotherapy. Forced expression of the mutant CD22ΔE12 protein in
transgenic mice perturbs B-cell development, as evidenced by B-precursor/B-cell
hyperplasia and corrupts the regulation of gene expression. We showed that the presence
of this mutation in pre-leukemic mice affects the number of mesenchymal stem cells
(MSCs) and the BM is unable to support normal HSCs leading to lower engraftment in
transplantation experiments. Taken together, our studies showcase the role of the BM
microenvironment in B-cell malignancies and highlight the importance of developing
therapies that target the interaction of the malignant cells with their surrounding
microenvironment.

14

Chapter 1: Introduction
1.1 Hematopoietic Stem Cells
Hematopoietic stem cells (HSCs) are the building blocks of the hematopoietic system in
all animals and were the first adult stem cells to be discovered. The hematopoietic system
is first formed from the primitive streak mesoderm during embryogenesis and the
emerging HSCs go through a series of distinct temporal and anatomically distinct steps to
establish a fully functional hematopoietic system in adult animals. HSCs first arise in the
aorta-gonad-mesonephros region, migrate to the placenta and fetal liver, and then to the
spleen. Eventually, HSCs settle down in the BM where homeostatic blood formation is
maintained postnatally (Mikkola, Orkin 2006). In mouse and human, HSCs represent up
to 0.05% of all BM cells. Under normal physiological conditions, adult human HSCs are
responsible for generating ~1×10
9
red blood cells and ~1×10
8
white blood cells every
hour, as well as platelets and other mature blood lineages (Wang, Wagers 2011). A
constant pool of quiescent HSCs is maintained in the BM during homeostasis and is
called upon in times of injury and disease. Hence, there is a delicate balance of
quiescence, self-renewal and differentiation at play in the hematopoietic system.

Historical background
In the late 1950s, scientists McCulloch and Till began to explore how ionizing radiation
affects mammalian cells in treatment regimens for disease conditions such as cancer and
under injury such as whole-body irradiation from nuclear weapons. By using serial
dilutions of unirradiated donor bone marrow cells and varying amounts of radiation, Till
and McCulloch showed that a population of rare clonogenic BM cells was responsible for

15

the formation of nodules (which were later discovered to be myeloerythroid colonies) on
the spleens of lethally irradiated recipient mice (Till and McCulloch, 1961). Andrew
Becker, a graduate student working with them, discovered that these colonies arose from
a single primitive cell and the term “colony-forming unit (CFU)” was coined (Becker et
al., 1963). Siminovitch and his team showed that these colony-forming cells were capable
of self-renewal and differentiation as they formed nodules and reconstituted all blood
lineages in secondary recipients (Siminovitch et al., 1963).

These experimental observations provided the functional criteria for defining HSCs as
progenitors that could self-renew, proliferate enough to repopulate the bone marrow of an
entire animal, and give rise to specialized or differentiated cells that have limited life
spans. The restorative powers of bone marrow transplantation after radiation injury were
finally understood. Using in vivo limiting dilutions, it was later discovered that there are
two sets of HSCs that meet this definition: long-term reconstituting progenitors which
were named long-term HSCs (LT-HSCs) and some transiently reconstituting short-lived
progenitors which were named short-term HSCs (ST-HSCs). The long-term subset self-
renews for the life of the host, while the short-term subset retained self-renewal capacity
for approximately 8 weeks (Morrison and Weissman, 1994). Recent data shows that ST-
HSCs are the main contributors to hematopoiesis during homeostatic conditions and LT-
HSCs are called upon after injury such as irradiation (Sun et al., 2014).

Once the origins of the hematopoietic system were better understood, work began to
define HSCs genetically and phenotypically and to fill in the gaps between HSCs and

16

fully differentiated red cells, white cells and platelets. Using physical or cell surface
characteristics and techniques such as flow cytometry based on monoclonal antibodies
and fluorescent dyes, candidate stem cell populations were discovered in the mouse
(Visser et al., 1984; Muller-Sieburg et al., 1986; Spangrude et al., 1988; Goodell et al.,
1996; Osawa et al., 1996). It was discovered that the process of hematopoiesis is a
hierarchical one with the rare HSCs at the top giving rise first to progenitors and then to
precursors with single lineage commitment and ending in terminally differentiated mature
cells of various lineages (Ogawa, 1993; Orkin, 2000) (Figure 1). There is a continuum of
progenitors at different stages in between the primitive HSCs and terminally
differentiated cells, and these progenitors can divide and progress towards certain
lineages depending on stimuli and physiological requirements. It is generally believed
that hematopoietic development divides at an early stage into a myeloid and a lymphoid
branch. The lymphoid branch gives rise to B, T and natural killer cells, while the myeloid
branch differentiates to all other cell types including erythrocytes (Kondo et al., 1997;
Akashi et al., 2000).

17

Figure 1.1. The hierarchy of hematopoietic cells. Taken from Larsson & Karlsson,
2005.

1.2 Role of the BM niche in hematopoiesis and cancer
The stem-cell niche is defined as a multicomponent environment that protects the stem
cells from exhaustion or death and contains cellular and extracellular elements which are
necessary for the regulation of stem cell quiescence, proliferation and differentiation
(Adams, Scadden, 2006; Jones and Wagers, 2008). In 1978, based on the observations of
Till and McCulloch that CFUs from the spleen were less robust than their counterparts
from the bone marrow, Richard Schofield published his concept of a stem cell niche for
HSCs. As discussed earlier, the dependence of HSCs on their microenvironment for
robust survival and functioning is present from embryogenesis as they go through various
anatomical sites during development. Schofield proposed a specific bone

18

microenvironment for postnatal HSCs where in HSCs are in intimate contact with bone,
and that cell–cell contact was responsible for the apparently unlimited proliferative
capacity and inhibition of maturation of HSCs (Schofield, 1978). This was the first time
that a link between bone marrow formation (hematopoiesis) and bone formation
(osteogenesis) was proposed. Follow up studies have shown that HSCs can maintain
hematopoiesis during the whole life of an organism as long as they are present in the BM.
However, they lose the ability for self-renewal when they are removed from the BM and
this indicates their dependence on extrinsic signals provided by the microenvironment
(Lilly et al., 2011).

Within the BM microenvironment, HSCs are proposed to reside in two different niches:
the endosteal niche, which is thought to maintain HSC quiescence over the long term, and
the vascular niche which is believed to regulate the proliferation and entry of HSCs into
peripheral circulation (Mitsiades et al., 2007). Both niches have been shown to act
together to maintain hematopoietic homeostasis or to restore it after damage
(Guerrouahen et al., 2011).

The Endosteal BM HSC Niche
Bone tissue is constantly undergoing a process of remodeling via a tight coupling
between bone formation from mesenchymal stem cell derived osteoblasts and bone
resorption by osteoclasts which are hematopoietic in origin (Martin and Sims, 2005). The
endosteum is the inner surface of the bone marrow cavity and is lined by osteoblasts and
osteoclasts.

19

The first evidence of the involvement of the endosteal surface in regulating HSCs was
provided by the team of Brian Lord when they observed that the distribution of primitive
hematopoietic stem and progenitor cells (HSPCs) was not uniform throughout the mouse
BM, but enriched in the endosteal region (Lord, Testa, Henry, 1975).
A series of studies
by Taichman and collaborators showed that mouse and human osteoblasts could support
HSCs in ex vivo culture systems (Taichman and Emerson, 1994; Taichman et al., 1996).
Nilsson et al. demonstrated that a primitive population of less metabolically active HSCs
preferentially localized to the endosteal region after transplantation which supports the
idea that primitive HSCs prefer to localize close to the osteoblasts in the endosteum
(Nilsson et al., 2001). Genetic mouse models in which the osteoblast numbers were
manipulated experimentally provided in vivo proof for a direct role of osteoblasts in HSC
regulation and/or maintenance. In the first study, there was a direct increase in the
number of HSCs in the BM when numbers of osteoblasts were increased by constitutive
active expression of parathyroid hormone (PTH) or the PTH/PTH-related protein receptor
(PPR) under the type 1 collagen α1 (Col1a1) promoter in osteoblastic-specific cells
(Calvi et al., 2003). In the second study, a bone morphogenetic receptor type 1A
(BMPR1A) conditional knockout mouse model was used to show that an increase in
osteoblastic cells is accompanied by an increase in the number of HSCs in the BM
(Zhang et al., 2003). These results suggest that osteoblastic cells lining the bone surface
are a key cellular component of the niche to support HSCs. However, recent data has
called this into question by suggesting that primitive cells of the osteoblastic lineage such
as mesenchymal stem cells and osteoprogenitors are actually the key players in

20

establishing hematopoiesis and mature osteoblasts are not as important as previously
postulated (Mendez-Ferrer et al., 2010; Raajimakers et al, 2010).

The Vascular BM HSC Niche
Both HSCs and endothelial cells arise from a common embryonic precursor, the
haemangioblast (Huber et al., 2004). It has been shown that cell lines or purified primary
endothelial cells derived from the yolk sac or the AGM are able to maintain and expand
adult LSK cells in vitro, a supportive quality that is not possessed by vascular endothelial
cells isolated from adult non-hematopoietic organs (Ohneda et al., 1998; Li et al., 2003;
Li, Johnson, Shelley & Yoder, 2004). This indicates that BM sinusoidal endothelial cells
(BMECs) are functionally and phenotypically distinct from microvasculature-endothelial
cells of other organs (Kopp, Avecilla, Hooper & Rafii, 2005).

Transplantation experiments using labeled HSCs showed that most
CD150
+
CD48
−
CD41
−
lineage
−
cells in the bone marrow and spleen localize adjacent to
sinusoid vessels, and nearly all are within five cell diameters of a sinusoid (Kiel et al.,
2005; Ellis et al., 2011). In fact, it was observed that HSCs are five times more likely
than other hematopoietic cells to be immediately adjacent to a sinusoid. This frequent
localization of HSCs adjacent to blood vessels suggested that HSCs might be maintained
in a perivascular niche by endothelial or perivascular cells. It was believed that this
second specialized microenvironment termed the vascular niche only existed after
myeloablation when quiescent HSCs detached from the endosteal niche and migrated to
the vascular zone to re-establish hematopoiesis (Heissig et al., 2002; Avecilla et al.,

21

2004). However, soon after it was observed that a large proportion of CD150
+
HSCs are
attached to the BM sinusoidal endothelium even during homeostasis (Kiel et al., 2005).

This raises the question of the importance of having two distinct niches for HSCs in the
BM microenvironment. While it is generally believed that the endosteal niche contains
dormant HSCs (Zhang et al., 2003), recent imaging studies have indicated that the
endosteal niche can convert to a stimulatory niche under stress (Lo Celso et al., 2009; Xie
et al., 2009). What is increasingly evident is that there is constant interaction between
both the niches to control HSC quiescence and self-renewing activity as well as the
production of early progenitors to maintain homeostasis or re-establish hematopoiesis
after injury and the temporal and anatomical demarcation may not be as obvious as
previously believed.

BM niche in cancer
The idea of a cancer niche was first proposed by Stephen Paget in 1889 as a "seed and
soil" hypothesis according to which metastatic cancer cells (seeds) can only propagate
disease in a favorable microenvironment (the soil) (Paget, 1889). After more than a
century’s work, we have experimental evidence that confirms the role of non-autonomous
microenvironment factors such as aberrant bone marrow stroma in the development,
progression and drug resistance of different hematological malignancies at the expense of
normal HSCs (Lane et al., 2009; Raaijmakers et al., 2010; Walkley et al., 2007). While it
was previously believed that hematopoietic malignancies arise from cell-intrinsic
mutations that inappropriately activate HSC proliferation and survival pathways, recent

22

data demonstrates that niche alterations can be the primary trigger for disease
development with defects in HSCs themselves arising secondarily (Wang et al., 2012).
For example, osteoblastic cells are an important component of the HSC niche and mice
with defective microRNA processing in the osteoblastic lineage have been shown to
develop severe myelodysplasia and sometimes leukemia (Raaijmakers et al., 2010).

In hematologic malignancies such as leukemia, the cancer cells sometimes acquire the
ability to respond differently to physiological niche signals as compared to normal HSCs
and manipulate normal microenvironmental cues in order to promote disease. For
example, in normal conditions, transforming growth factor β (TGFβ) is thought to
contribute to the dormancy of quiescent HSCs (Yamazaki et al., 2009) but it flips roles
and pushes the survival and proliferation of leukemia-initiating cells in a model of
chronic myelogenous leukaemia (Naka et al., 2010). A “chicken-or-egg” situation exists
in the case of HSCs and the niche in hematologic malignancies and the interesting
question now is whether their interaction can be pharmacologically modulated to
selectively eliminate malignant cells and support normal HSCs (Colmone et al., 2008).

1.3 B cell development and cancers
During the process of differentiation, primitive HSCs form the common lymphoid
progenitor which eventually gives rise to naïve B cells in the BM. By way of V(D)J
rearrangement of the immunoglobulin genes, these naïve B cells collectively express
highly variable B cell receptors (BCRs). The B cell differentiation pathway to memory B
cells and plasma cells is a highly regulated process so that a timely and appropriate

23

response to a broad array of immune challenges can be mounted while avoiding
autoimmunity (Scott & Gascoyne, 2014).

B-cell development occurs in both the BM and peripheral lymphoid tissues such as the
spleen (Figure 2). In the BM, immature B cells go through various stages of development
and eventually result in the generation of B cells with functional antigen (Ag) receptors
(BCRs). During this developmental process, B cells also undergo a stringent selection
process to prevent any development of self-reactive cells that can cause autoimmune
reactions or cancerous conditions (Cambier, Gauld, Merrell, & Vilen, 2007). After the
BM, mature B cells migrate to secondary lymphoid organs and continue their
development as antigen specific B cells within the germinal centers (GCs) of secondary
lymphoid follicles (LeBien, Tedder, 2008). The supportive microenvironment within GCs
promotes the interaction of maturing BM cells with CD4
+
T-cells and specialized stromal
cells such as follicular dendritic cells (Cyster et al., 2000; Harwood & Batista, 2008).
Depending on the kind of immune response mounted by the organism during times of
distress, these antigen-specific B cells develop into either memory B cells or antibody-
secreting plasma cells. Hence, similar to HSC development, components of the
microenvironment play a very important role in the selection of Ag-specific B cells at all
stages of development.

24

Figure 1.2. Development of B-cells in the bone marrow and peripheral lymphoid
organs. Taken from Cambier, Gauld, Merrell, & Vilen, 2007.
Hence, B cell development is a highly complex process and it is speculated that
mutations acquired at any step of the development can lead to malignant conditions.
There are two broad types of hematological malignancies affecting B cells: lymphomas
and lymphocytic leukemias. The main difference between the two is the primary site of
disease: B-cell lymphomas are predominantly restricted to lymphoid structures and
extranodal tissues whereas lymphocytic leukemias are limited to the BM. For the purpose
of our studies, we have focused on multiple myeloma (MM), a hematological malignancy
characterized by the clonal expansion of abnormal plasma cells in the bone marrow and
B-precursor acute lymphoblastic leukemia, which is a cancer of pre-B cells.

1.4 CXCR4 in Multiple Myeloma
Multiple myeloma (MM) is a B-cell malignancy caused by the clonal expansion of
malignant plasma cells and is associated with bone disease and hypercalcemia. It is the

25

second most common hematological malignancy with a median survival time of 7 to 8
years (Anderson et al. 2011). Despite therapeutic advances, MM is still incurable because
of chemotherapeutic resistance due to the interaction between MM cells and the BM
milieu (Kumar et al., 2008; Hazlehurst et al., 2000). The specific BM localization of MM
cells is reminiscent of the strict dependence of the precursors of plasma cells, i.e. the
HSCs, upon specific BM niches.

5T model of MM
There is constant cross talk between the malignant and normal cells in a
microenvironment dependent disease such as multiple myeloma. In order to accurately
investigate the mechanisms responsible for the pathogenesis of MM, an in vivo model
that recapitulates the complexity of tumor-host cell interactions is necessary. The 5T
mouse model of MM is the only syngeneic mouse model and is confirmed to mimic
human MM closely (Radl, Glopper, & Schuit, 1979). 5TGM1 is a subclonal cell line
established from the 5T33 MM model that was originally described by Radl and
colleagues (Radl, Zurcher, 1988). The 5TGM1 variant of 5T33MM grows more
aggressively and causes more bone destruction in vivo. In contrast to 5T33MM this
variant grows well in vitro, and doesn’t require supplementation with IL-6 or stromal
cell- conditioned media. The 5TGM1 development is largely confined to BM and the
spleen like the other 5TMM Radl myeloma models. Because 5TGM1 cells can be
maintained continuously as a cell line in vitro, a precise number of cells can be injected
into mice thereby facilitating the preclinical evaluation of efficacy of potential anti-
osteolytic and anti-myeloma agents.

26

Localization of MM cells in the BM
Experimental evidence shows that MM cells propagate pathophysiology of the disease by
closely interacting with osteoblasts and osteoclasts in the BM to cause osteolytic bone
lesions and hypercalcemia (Roodman, 2001). Based on these results and the prevalence
of bone-forming and resorbing cells near the endosteal surface of the bone, it is suspected
that myeloma cells are also attracted to the endosteal region in the BM. A recent study
using a xenograft model of MM showed that human MM cells specifically localize to the
metaphyseal region of the mouse BM endosteum and are not found in the spleen which
also serves as a hematopoietic organ in mice (Iriuchishima et al., 2012).

CXCR4/SDF-1α in MM
In MM, abnormal plasma cells accumulate in the BM to the detriment of normal
hematopoietic cells. Perhaps this is due to, in context of the “seed and soil” hypothesis,
the BM microenvironment providing favorable conditions for the development of MM.
Increasingly, it is being discovered that metastatic cancer cells utilize several chemokine-
chemokine receptor axes involved in the trafficking of normal cells (Kucia et al., 2004).
The SDF-1α/CXCR4 interaction is perhaps the most extensively studied axis in the
localization of normal and malignant hematopoietic cells as well as metastatic cancers
such as breast and prostrate cancer to the BM (Teicher & Fricker, 2010).
SDF- 1α is a chemokine secreted by BM stromal cells as well as many epithelial cells
(Nagasawa, Tachibana & Kishimoto, 1998). CXCR4 is a G-protein coupled receptor that
is expressed on the surfaces of normal cells such as HSCs, T and B lymphocytes and on

27

malignant cells such as breast cancer cells and aberrant cells of lymphoid malignancies
(Ponomaryov et al., 2000; Juarez, Bendall, 2004, Smith et al., 2004). The SDF-
1α/CXCR4 pathway function in adults is integral to the retention of HSCs in the BM
microenvironment and lymphocyte trafficking and has also been shown to play an
important role in the metastasis of tumors to the bone marrow (Teicher, Fricker, 2010). In
xenograft models of MM, SDF-1α secreted by BM stromal cells has been shown to
regulate the migration and homing of MM cells to the BM microenvironment by
interacting with CXCR4 expressed on myeloma cells (Alsayed et al., 2007; Hideshima et
al., 2002; Hideshima et al., 2007). Higher levels of SDF-1α have been detected in the
BM of MM patients (Zannettino et al., 2005), and this is suspected to play a role in the
attraction of MM cells to the BM. When growth factors such as cyclophosphamide,
granulocyte-macrophage colony-stimulating factor (GM-CSF) and AMD3100 were
administered to patients, a decrease in the surface expression of CXCR4 was observed on
the MM cells that were pushed into circulation compared to the premobilized cells
(Gazitt et al., 2000; Gazitt et al., 2004).

1.5 CD22 in B-cell Precursor Leukemia
Acute Lymphoblastic Leukemia (ALL) is the most common childhood cancer,
accounting for approximately 30% of all childhood malignancies, with peak incidence at
the age of 3-4 years (Kaatsch 2010). There are two main types of ALL based on the type
of lymphoid cell that is affected: B lymphoblastic leukemia (traditionally termed B-cell
precursor ALL) and T lymphoblastic leukemia/lymphoma (T-ALL). B cell Precursor

28

Acute Lymphoblastic Leukemia (BPL) is the largest subset of ALL and is the most
prevalent form of childhood cancer (Trigg et al, 2008; Stanulla and Schrappe, 2009).

Despite great progress in the development of curative therapies, BPL remains the leading
cause of pediatric cancer-related morbidity as patients tend to relapse after traditional
treatment regimens (Gloeckler et al., 1999; Ko et al., 2010; Oeffinger et al., 2006). The
BM milieu provides protection from chemotherapy, which can explain why these cells
escape current treatment modalities. It has been shown that blasts from patients with BPL
have a survival advantage when co-cultured with stroma versus when cultured in media
alone. Co-culture with stroma also provided chemotherapeutic protection when the cells
were treated with asparaginase, a mainstay of pediatric ALL therapy (Manabe et al,
1992). There is an urgent need for BPL therapies that can overcome chemotherapy
resistance and reduce non-specific treatment-associated side effects.

Alterations of the MLL gene (mixed –linage leukemia) and chromosomal abnormalities
at 11q23 are some of the most well studied mutations in BPL and are regarded as a
hallmark of infant ALL (Meyer et al., 2009; Tamai and Inokuchi, 2010; Pieters et al.
2007). The MLL-AF4 rearrangement characterized by t(4;11) is the most well-
characterized translocation and the resulting MLL-AF4 fusion protein is related to a poor
outcome in infant BPL (Pieters et al., 2007). However, recent data obtained using rodent
models has challenged the key role of MLL translocations in infant BPL. Specifically,
these defects failed to cause leukemia in transgenic or knock-in mice, and BPL in infant
monozygotic twins with MLL rearrangements was shown to progress in different

29

manners (Uckun et al., 1998; Sun et al., 1999; Russell et al., 2008; Chuk et al., 2009;
Yamaguchi et al., 2009). These data and analysis of the anti-apoptotic and pro-mitogenic
gene expression profiles of infant BPL cells indicates that a network of multiple
constitutively active signaling pathways contributes to the aggressive nature of these
malignant cells which contribute to the chemoresistant nature of infant BPL (Law et al.,
1996).

CD22 is a 140kDa B-lineage differentiation antigen that has emerged as a leading
therapeutic target in B cell malignancies because of its inhibitory role in normal B-cell
growth (Clark, 1993; Law et al., 1995; Tedder et al., 1997; Tedder et al., 2005). Under
normal conditions, CD22 is an inhibitory co-receptor of B-cells and B-cell precursors and
acts as a negative regulator of B-cell proliferation (Tedder et al, 2005). When CD22 is
mutated, its inhibitory function is affected and the B-lineage lymphoid cells are kicked
into overdrive leading to uncontrolled proliferation and clonal growth. Recent
experiments by Uckun et al showed that the CD22 co-receptor protein is unable to bind to
the SRC-1 domain when the cytoplasmic part of the protein is missing. This truncated
CD22 protein is functionally defective and is unable to transmit apoptotic signals which
leads to abnormal growth of primary leukemic cells in infants with newly diagnosed B-
lineage ALL (Uckun et al, 2010). They conducted further experiments and showed that
this mutated protein was formed because of aberrant mRNA arising from a splicing
defect that causes the deletion of exon 12 (c.2208–c.2327) (CD22ΔE12) and results in a
truncating frameshift mutation. By expressing this structurally and functionally abnormal
CD22 protein in severe combined immunodeficient mice, they showed the role of the

30

CD22ΔE12 protein in the very aggressive nature of some infant leukemia (Uckun et al,
2010). Recent work shows that this mutation is a promising therapeutic target for B-
precursor acute lymphoblastic leukemia (Uckun et al., 2015).

31

Chapter 2: CRISPR/Cas9 Knockout of CXCR4 Reveals Its
Essential Role in the Retention of Multiple Myeloma Cells in
the Bone Marrow Microenvironment

2.1 Abstract
Hematological malignancies such as leukemia and multiple myeloma proliferate in the
bone marrow (BM) to the detriment of the normal hematopoietic cells. It is hypothesized
that these malignant cells use similar mechanisms as normal hematopoietic stem cells
(HSCs) to localize in the BM and propagate disease. We investigated the role of the HSC
niche in multiple myeloma (MM) by using the 5T syngeneic mouse model of MM. We
hypothesized that the interaction of the chemokine stromal cell-derived factor – 1 alpha
(SDF- 1α) with its receptor CXCR4 plays a major role in the homing and retention of
MM cells to the BM. In order to test this, we knocked out CXCR4 in the 5TGM1 MM
cell line using CRISPR/Cas9 genome engineering technology. After knockout, there was
a significant reduction in the number of 5TGM1 cells migrating towards SDF1α in vitro.
CXCR4 knockout did not affect cell survival, growth or cell cycle status. Homing
experiments showed no significant decrease in the ability of CXCR4 knockout 5TGM1
cells to home to the bone marrow and the spleen. Analysis of cell lodgment in vivo
demonstrated a significant difference in the specific localization of the cells within the
BM microenvironment. Inoculation of CXCR4 KO MM cells in C57Bl/KaLwRijHsd
mice did not cause disease after 12 weeks of incubation. Hence, we demonstrate the
essential role of CXCR4 in the development of MM, in particular the specific localization
of the MM cells in the BM to cause disease.

32

2.2 Introduction

Multiple Myeloma (MM) is the second most common hematologic malignancy and is
characterized by the proliferation and accumulation of malignant plasma cells in the bone
marrow (BM) that leads to the development of osteolytic bone lesions and an
overproduction of a monoclonal immunoglobulin (Ig) in the serum (Bataille &
Harousseau, 1997; Kuehl & Bergsagel, 2002). Despite therapeutic advances and the
relative success of proteasome inhibitors such as bortezomib, MM remains an incurable
disease with a median survival of 7-8 years (Anderson, 2011). One of the key
contributing factors is that MM cells reside in the BM, which provides an optimal growth
environment for the MM cells and provides protection against current therapies (Hu et
al., 2010; Azab et al., 2012). Therefore, there is a need to understand the factors involved
in the interaction of MM cells with the BM milieu and design therapies to disrupt them.
The BM microenvironment is a complex microenvironment that contains both cellular
and non-cellular components that interact with normal and malignant cells. The
chemokine Stromal Cell-Derived Factor-1 (SDF-1 or CXCL12) and its receptor, CXCR4,
are known to be necessary for the retention of hematopoetic stem cells. CXCR4
-/-
and
CXCL12
-/-
embryos have severely reduced B-cell lymphopoiesis, reduced myelopoiesis
in fetal liver and nearly complete loss of myelopoiesis in the BM (Nagasawa et al.,1996;
Tachibana et al., 1998; Zou et al., 1998; Ma et al., 1998). Studies on HSC homing to the
adult BM showed that CXCR4
-/-
fetal liver cells were able to migrate to the BM and
reconstitute hematopoiesis in lethally irradiated recipients, though with decreased homing
efficiency in more differentiated cells compared to progenitor cells (Ma et al., 1999;
Kawabata et al., 1999; Foudi et al., 2006). This suggests that CXCR4 may be dispensable

33

for the homing of hematopoietic progenitor cells to the adult BM. Using a xenograft
model of multiple myeloma, Alsayed et al showed that the SDF1a/CXCR4 axis plays an
important role in the homing of MM cells to the bone marrow (Alsayed et al., 2007).
However, we speculated that the results applied only to xenograft models and that the
CXCR4/SDF1a axis is actually necessary in the specific localization and retention of MM
cells in the BM as was discovered to be the case in the localization of HSCs to the BM.
To test the necessity of CXCR4 in the development of MM, we utilized CRISPR/Cas9
genome editing technology and monitored MM development in the well-characterized 5T
syngeneic model of MM first described by Radl et al. The 5T model is a syngeneic
mouse model of MM that first arose spontaneously in aging inbred C57Bl/KaLwRijHsd
mice, and has been propagated by inoculation of the 5T myeloma cells into syngeneic
mice(J Radl & Zurcher, 1988). The 5TGM1 cell line closely mimics myeloma disease in
humans, with monoclonal gammopathy, marrow replacement, osteolytic bone lesions,
hindlimb paralysis, and occasionally hypercalcemia (Manning et al., 1992; Garrett et al.,
1997; Dallas et al., 2014) Upon knocking out CXCR4 in the 5TGM1 cell line and
inoculation of these cells in non-irradiated C57Bl/KaLwRijHsd mice, we observed that
CXCR4 KO MM cells localize further away from the endosteal bone surface and these
recipient mice do not develop MM disease.

2.3 Materials and Methods
2.3.1 Animals

7- to 16-week-old C57BL/KaLwRij mice (gift from Dr. B. Oyajobi University of Texas
Health Science Center) were obtained and used in accordance with the University of

34

Southern California Institutional Animal Care and Use Committee guidelines. Mice were
housed in sterilized microisolator cages and received autoclaved food and water ad
libitum.

2.3.2 Cells

5TGM1 cells (gift from Dr. B. Oyajobi, University of Texas Health Science Center) were
grown in Iscove's Modified Dulbecco's medium (IMDM; Mediatech, Herndon, VA)
supplemented with 20% FBS. All media contained penicillin-streptomycin antibiotics.

2.3.3 Knockdown of CXCR4 using lentiviral shRNA

Glycerol stocks for the pGIPZ lentiviral shRNAmir constructs (6 clones) targeting mouse
CXCR4 were purchased (Open Biosystems, Lafayette, CO, USA). The pGIPZ lentiviral
shRNAmir constructs contain the turboGFP reporter driven by the CMV promoter to
track shRNAmir expression as shown below:

The glycerol stock was inoculated into a 100x25mm petri dish (VWR International)
containing solidified LB agar (EMD Chemicals, Inc., Gibbstown, NJ, USA)
supplemented with 100µg/ml of carbenicillin (EMD Chemicals, Inc.). The petri dish was
incubated for approximately 16 hours at 37°C. Individual colonies were picked using an
inoculating loop and transferred to 3ml of LB broth (EMD Chemicals, Inc.)
supplemented with 100µg/ml of carbenicillin. These individual colonies were cultured at

35

37°C for approximately 8 hours with vigorous shaking (225rpm), then transferred to a
larger culture vessel containing 250ml of LB broth supplemented with 100µg/ml of
carbenicillin. The larger cultures were incubated at 37°C for approximately 16 hours with
vigorous shaking, then the plasmids were extracted using the Plasmid Maxi kit
(QIAGEN, Valencia, CA, USA). For all loss of function studies, the GFP non-silencing
vector, which carries a sequence that has been verified to contain no homology to known
mammalian genes, was used as the control.
For lentivirus production, 4ug of the vesicular stomatitis virus envelope protein G
expression construct pMD.G2, 10ug of the packaging vector pSPAX2 and 6ug of the
transfer vector pGIPZ-mCXCR4 was diluted in 1000ul Jetprime buffer with 40ul
Jetprime (Polyplus) and transfected into HEK 293T cells. Virus was collected 48 and 72
hours after transduction and concentrated by ultracentrifugation at 28,000rpm for 2 hours
at 4 degrees.
5TGM1 cells were transduced with this lentivirus as described in 2.3.5.

2.3.4 Generation of lentiCRISPR virus with sgRNA towards mCXCR4

sgRNA design
Mouse CXCR4 has two transcript variants and the common exon
ENSMUSE00000802770 was chosen as target sequence. The genomic DNA sequence
was input into the online CRISPR Design Tool (http://tools.genome-engineering.org),
which identified and ranked suitable target sites and computationally predicted off-target
sites for each intended target. All possible S. pyogenes Cas9 sgRNA sequences of the
form (N)20NGG were generated using this tool. The top 6 candidates with the least off

36

target activity were chosen. sgRNA sequences are listed in the table below.
Cloning of sgRNA into lentiCRISPR backbone and lentivirus production
For lentivirus production, 4ug of the vesicular stomatitis virus envelope protein G
expression construct pMD.G2, 10ug of the packaging vector pSPAX2 and 6ug of the
transfer vector lentiCRISPRv1 (Addgene) was diluted in 1000ul Jetprime buffer with
40ul Jetprime (Polyplus) and transfected into HEK 293T cells. Virus was collected 48
and 72 hours after transduction and concentrated by ultracentrifugation at 28,000rpm for
2 hours at 4 degrees.

2.3.5 Transduction of cells

5TGM1 cells were resuspended in 1ml of growth medium then transduced with the
concentrated lentiviral particles at a multiplicity of infection (MOI) of 10 in the presence
of 4µg/ml polybrene (Sigma-Aldrich). The transduction was performed in a 15ml
centrifuge tube (VWR International) by spinning the cells with the lentiviral particles at
800g for 30 minutes at 32°C. Then, the cells were resuspended in the lentivirus-
containing medium and cultured at 5x10
5
cells/ml overnight at 37°C in a humidified, 5%
CO
2

atmosphere. The cells were replenished with fresh complete growth medium the
next day and cultured for an additional 72 hours before starting puromycin selection.

2.3.6 Methods to detect mutations in genomic DNA

PCR
Genomic DNA was extracted from all groups of 5TGM1 cells using Zymo kit. Forward
primer 5’ CCGGGATGAAAACGTCCATT 3’ and reverse primer 5’

37

GCAGGCAAAGAAAGCTAGGA 3’ were used to detect indels in CXCR4 target exon.
PCR was performed using GoTaq Green Master Mix (Promega, Madison, WI) and
according to the manufacturer’s conditions. A final 15 minute extension step at 74
degrees was added to the PCR to improve TA cloning. (The PCR mix per sample was
composed of 25 µl of GoTaq Green Master Mix 1 µl of 100 µM CXCR4-F, 1 µl of
100 µM CXCR4-R, 200ng of genomic DNA and water to 50ul total volume.) Amplicon
production was detected by gel electrophoresis, with PCR product and a DNA ladder
(NEB 100bp ladder) run for 60 minutes at 125 V on a 1.2% low-melting point agarose
gel and visualised by UV transillumination. For the gRNAs that generated alleles of
different sizes, both bands were extracted using Zymo gel-extraction kit and sequenced
using the forward and reverse primers (Genewiz) to detect effects of gRNA on both
alleles.

TOPO Cloning and Sequencing to detect allele-specific mutations
TOPO-TA cloning was performed for the transduced 5TGM1 cells whose genomic DNA
produced only one ~700bp band in gel electrophoresis. Briefly, the PCR product was
cleaned using Zymo kit and ligated into TOPO vector (Invitrogen, Carlsbad, CA). 2ul of
the ligated product was transformed into 50ul Dh5a bacteria. Individual colonies were
screened for the insert and the region of interest was sequenced using the previously
mentioned CXCR4 forward and reverse primers.

2.3.7 Cell Surface Expression of CXCR4

Cells (5x10
5
) were stained with phycoerythrin (PE )anti-mouse CXCR4 antibody (pre-

38

diluted for use at 20µl/test) (eBioscience) in 200µl of 1X PBS for 15 minutes on ice in the
dark. For control, cells (5x10
5
) were stained with PE Rat IgG
2b
isotype control
(eBioscience) following the same procedure. After staining, the cells were washed with
5ml of 1X PBS and resuspended in 300µl of 1X PBS for flow cytometric analysis on the
LSR II. 7AAD was added just before analysis for detecting cell-viability. CXCR4
expression was quantified based on isotype control and using FlowJo software.

2.3.8 Chemotaxis Assay

Cells (1x10
5
) suspended in 150µl growth medium were seeded on the upper transwell
insert (8µm pore size) in a 12-well plate (Corning, Inc., Corning, NY, USA). The bottom
well was added with 500µl of medium containing 100ng/ml murine SDF-1α (Peprotech,
Inc., Rocky Hill, NJ). Cell migration was allowed to continue for 3 hours at 37°C in a
humidified, 5% CO
2
atmosphere. Nonspecific migration was quantified through the
analysis of chemokinesis of the cells in response to medium or SDF-1α. Cells were
harvested from the lower well and counted on a hemacytometer.

2.3.9 Calcium Flux Assay

Cells were incubated with 2µg/ml indo-1 (Molecular Probes, Carlsbad, CA, USA) in 1ml
of 1X PBS for 30 minutes in a 37°C water bath, protected from light. Calcium flux was
measured using the LSR II flow cytometer (Becton Dickinson) equipped with a UV laser,
a violet bandpass filter centered at 390±30nm, and a blue bandpass filter centered at
530±30nm. The calcium flux response was determined by a ratio of violet (short) to blue
(long) wavelengths. The instrument setup and cellular loading was checked by adding

39

2µg/ml of ionomycin (Invitrogen, Carlsbad, CA, USA) to indo-1-loaded cells suspended
in Hank’s Balanced Salt Solution (HBSS) containing calcium so that maximum flux
response could be observed. For the measurement of SDF-1α-induced calcium flux
response, the treated cells were resuspended in approximately 300µl of HBSS containing
calcium (Invitrogen). The baseline response is measured and recorded for about 20
seconds, then 100ng/ml of SDF- 1α (PeproTech Inc., Rocky Hill, NJ, USA) was quickly
added as the stimulus. The response was measured for about 5 minutes. FlowJo software
(TreeStar, Stanford, CA, USA) was used to analyze the calcium flux response.

2.3.10 Cell Adhesion Assay

Cells (75x10
3
) were added to wells coated with fibronectin (10µg/ml) or collagen I
(50µg/ml) (both from Becton Dickinson) in non-cell culture treated 96-well plates
(Becton Dickinson) and incubated for 3 hours at 37°C in a humidified, 5% CO
2

atmosphere. To control for nonspecific binding, adhesion to 1% BSA (Sigma- Aldrich)
was quantified. Non-adherent cells were washed off five times with 1X PBS, and
adherent cells were visually counted under a microscope.

2.3.11 Apoptosis Assay

5TGM1 cells were stained with 7-Amino-Actinomycin (7-AAD) and PE Annexin V
(both from Becton Dickinson) according to manufacturer’s instructions. Using the LSR II
flow cytometer (BD), the percentage of apoptotic 5TGM1 cells was determined as 7-
AAD negative and PE Annexin V positive.

40

2.3.12 Cell Cycle Analysis

Cells (1x10
6

cells/ml) suspended in growth medium were fixed using cold 70% ethanol
and incubated overnight at 4 degrees. 30 minutes before analysis, cells were treated with
10% TritonX-100 and 1:1000 dilution of 1mg/ml DAPI. Cell cycle status was examined
using the LSR II flow cytometer and analyzed using ModFit.

2.3.13 In Vivo Homing

In order to track the cells in vivo after injection into the same mouse recipient, 5TGM1
cells (~10x10
6
) were labeled with a green fluorescent dye carboxyfluorescein diacetate
succinimidyl ester (CFSE) (Invitrogen) according to manufacturer’s instructions. The
labeled cells were resuspended in 0.3ml of 1X PBS and injected into the tail vein of a
non-irradiated C57Bl/6 Kalwrij mouse. Mice were sacrificed after 16 hours, and the
number of labeled cells was measured in the BM and spleen through the detection of
CFSE+ cells by flow cytometry.

2.3.14 In Vivo Lodgment

Cells were labeled with 5µM CFSE cell-labeling solutions and injected into the tail vein
of non-irradiated C57Bl/6 Kalwrij mice, as described above. Tibias and femurs were
dissected from the recipient mice 16 hours after injection, decalcified for 3 days in
Immunocal (Decal Chemical Corporation, Tallman, NY, USA), and embedded in paraffin
blocks after processing. Bone sections of 5µm thickness were cut and mounted with
Vectashield containing 4’,6-diamidino-2-phenylindole (DAPI; Vector Laboratories). To
assess the lodgment of injected cells to the endosteal niche, the number of CFSE
+

(green)

41

cells within two cell diameters from the endosteal surface were counted on a total of 40-
60 tibial sections per mouse. Each experiment was performed with 3 mouse recipients.

2.3.15 MM cell injection and induction of multiple myeloma

Non-irradiated C57BL/KaLwRij mice were injected intravenously with 10
6
5TGM1 cells
transduced with lentiCRISPR control or lentiCRISPR containing gRNA against CXCR4.
Uninjected mice served as controls. From day 5 after cell injection, the animals were
examined twice daily for the development of paraplegia. At the time of disease
development, the mice were killed by CO
2
inhalation and cervical dislocation. Femurs,
tibias and the spleens were excised and used for further analysis. Bone marrow from
femora and tibiae were obtained by flushing cell culture media into the cavity of bones.

2.3.16 Analytical methods for disease detection

Percentage of CD138+ cells in BM and spleen
Femurs and spleens from mice were harvested for disease analysis. The bone marrow was
flushed using a 27G syringe and spleen was crushed using back of a syringe. Red cells
were lysed using ACK lysis buffer. Cells were stained with 2ul PE anti-mouse CD138
antibody (eBioscience) in 100µl of 1X PBS for 15 minutes on ice in the dark. After
staining, the cells were washed with 5ml of 1X PBS and resuspended in 300µl of 1X PBS
for flow cytometric analysis on the LSR II.

Immunohistochemistry
Tibias were dissected from C57Bl/6 Kalwrij mice and fixed in 10% neutral buffered

42

formalin overnight at 4°C. The bones were then decalcified with 18% EDTA
(ethylenediaminetetraacetic acid) over a 2-week period and were processed and
embedded in paraffin. Whole bone sections were cut 7um thick, deparaffinized by
standard histologic procedures and osteoclasts were detected by incubation with Tartrate-
resistant acid phosphatase (TRACP) solution (Clontech) for 30-45 minutes at 37 degrees.

2.3.17 Overexpression of CXCR4 in 5TGM1 cells

The transfer vector containing human CXCR4 construct was a kind gift from Dr. Paula
Cannon’s laboratory. The FUIGW-hCXCR4-FLAG overexpression lentiviral vector is
shown in the diagram below:

For all gain of function studies, the empty FUIGW lentiviral vector was used as the
control.
For lentivirus production, 4ug of the vesicular stomatitis virus envelope protein G
expression construct pMD.G2, 10ug of the packaging vector pSPAX2 and 6ug of the
transfer vector FUIGW-hCXCR4 was diluted in 1000ul Jetprime buffer with 40ul
Jetprime (Polyplus) and transfected into HEK 293T cells. Virus was collected 48 and 72
hours after transduction and concentrated by ultracentrifugation at 28,000rpm for 2 hours
at 4 degrees.
5TGM1 cells transduced with lentiCRISPR were transduced again with the hCXCR4
lentivirus as described in 2.3.5 in order to perform rescue of phenotype experiments.
Human

CXCR4
IRES eGFP
Ubi-C
FUIGW

43

2.4 Results
2.4.1 CXCR4 is expressed on 5TGM1 multiple myeloma cells

To verify that our mouse model would be feasible for examining the role of CXCR4 in
MM, we first examined the expression of CXCR4 in the 5TGM1 MM cell line.
Quantitative RT-PCR revealed the expression of the CXCR4 on the mRNA level (Figure
2.1A). To examine the cell surface expression of the CXCR4, we performed flow
cytometry using a fluorescent antibody specific for CXCR4. These data confirmed that
the 5TGM1 MM cell line did express CXCR4 on their cell surface (Figure 2.1B)
A.

B.

Figure 2.1 CXCR4 is expressed in 5TGM1 cells. Quantitative RT-PCR revealed the
expression of the CXCR4 on the mRNA level (A). To examine the cell surface
expression of the CXCR4, we performed flow cytometry using a PE-conjugated antibody
specific for CXCR4. These data confirmed that the 5TGM1 cells express CXCR4 on their
cell surface (B).
0

0.1

0.2

0.3

0.4

0.5

0.6

0.7

0.8

0.9

1

HPRT1
CXCR4

Relative
CXCR4
mRNA

expression

HPRT1

CXCR4

44

2.4.2 shRNA knockdown of CXCR4 in 5TGM1 cells slows down MM while
AMD3100 administration speeds up disease development.
To investigate the role of CXCR4 in MM, we used shRNA to knock down the surface
expression of CXCR4 on 5TGM1 cells. Using RT-PCR and flow cytometry, we showed
that CXCR4 expression was reduced by 75% (Fig 2.2 A & B). Functional effect on the
CXCR4-SDF-1α axis was shown using the calcium flux assay (Fig 2.2C). After checking
CXCR4 knockdown using in vitro methods, we inoculated 10
6
5TGM1-CRCR4-KD cells
in non-irradiated C57bl/Kalwrij mice and allowed 12 weeks for disease development.
Mice injected with PBS served as negative controls while mice injected with 5TGM1 WT
served as positive controls. We also inoculated a group of mice with 5TGM1 WT cells,
allowed for three weeks for the cells to settle down in the BM and then administered
AMD3100 at regular intervals as outlined by Alsayed et al. (Alsayed et al., 2007). The
5TGM1-WT recipient mice developed disease at 5 weeks as expected. We expected the
AMD3100 cohort and 5TGM1-CXCR4-KD recipient group to exhibit the same
symptoms however the mice that were given AMD3100 got sick at a much faster pace
and had to be sacrificed 4 weeks after inoculation. We believe this occurred because
AMD3100 affected all the cells that express CXCR4 and not only the MM cells. In
comparison, the 5TGM1-CXCR4-KD group did not show signs of disease development
until week 9 which we believe is a result of the extended time these cells spent in vitro
while undergoing the shRNA knockdown process.

45

A.

B.

C.

100.00

41.29

32.98

26.87

0.00

20.00

40.00

60.00

80.00

100.00

NSC
Clone
3-‐1
Clone
4-‐2
Clone
3+4

(10)

Relative CXCR4 mRNA level
(%)

46

D.

Figure 2.2 Effects of CXCR4 knockdown using shRNA. (A) RT-PCR analysis of
5TGM1 cells after knockdown of CXCR4 using shRNA. (B) Flow cytometry analysis
after CXCR4 KD. (C) Calcium flux assay to confirm the knockdown functionally. (D) In
vivo experiments showing the contradictory results from mice inoculated with 5TGM1
WT cells and treated with AMD3100 and mice transplanted with 5TGM1-CXCR4-KD
cells. Pink cells are TRACP stained osteoclasts and show disease progression.

2.4.3 Lentiviral delivery of CRISPR/Cas9 enables the knockout of CXCR4 from the
surface of 5TGM1 cells.
Since partial knockdown produced unreliable results, we used CRISPR/Cas9 technology

47

to knock out CXCR4 expression completely in 5TGM1 cells. We used a lentiviral Cas9
and single guide RNA methodology, and confirmed CXCR4 knockout by flow cytometry
(Figure 2.3 A&B). Mutations at the genomic DNA level were confirmed by PCR and
sequencing (Figure 2.3C). Both guide RNAs (gRNA) were generated using the Zhang lab
software as described earlier and both generated homozygous mutations at the genomic
level as shown by sequencing. gRNA1 was able to delete only a few nucleotides (NTs) in
both alleles while gRNA4 deleted a 120NT segment in one allele and 1NT in the other
allele (Figure 2.3D). We believe this genotypic difference in the effects of both the
gRNAs is responsible for the different phenotypic effects we observed during MM
disease development.
A.

48

B.

C.

D.

Figure 2.3 CXCR4 knockout using CRISPR/Cas9. Using a lentiviral Cas9 and single
guide RNA methodology, we knocked out CXCR4 in 5TGM1 cells and this was
confirmed by flow cytometry (A & B). Mutation at the genomic DNA level was
confirmed by PCR (C) and sequencing (D).
0.451

43.1

0.257
0.994
0.193
0.44

-‐5

5

15

25

35

45

%PE+
cells

CT G1 G4

WT

CT

g1

g4

water

49

2.4.4 Lack of expression of CXCR4 decreases cell migration towards SDF-1α in
vitro.
To examine the functional effects of reduced expression of CXCR4 on cell migration
towards SDF-1α, we performed a transwell migration assay. Cell migration towards
100ng/ml SDF-1α was allowed to continue for 3 hours at 37°C in a humidified, 5% CO
2
atmosphere. Nonspecific migration of the cells in response to medium or SDF-1α served
as controls. As expected, there was a significant decrease in the specific migration of
CXCR4 KO MM cells towards SDF-1α. (Figure 2.4) It was interesting to note that even
though gRNA1 cells show no expression of CXCR4 on their cell surface like gRNA4
cells, the gRNA1 cells showed only a slight decrease in their ability to migrate towards
SDF-1α. This indicates that maybe the gRNA1 cells are able to recycle CXCR4 on the
cell surface in response to SDF-1α and might not be true knockout cells.

Figure 2.4 CXCR4 KO reduces cell migration towards SDF-1α. In vitro chemotaxis
assay of control transduced and CXCR4 KO 5TGM1 cells towards 100ng/ml SDF-1α
after a 3 hour incubation. Blue columns represent chemokinesis controls, red columns
represent chemotaxis.

50

2.4.5 CXCR4 KO does not affect adhesion to ECM molecules.
Since MM cells are restricted to the BM microenvironment, we tested the ability of
5TGM1 WT and CXCR4 KO cells to adhere to extracellular matrix (ECM) components
such as fibronectin and collagen 1. As shown in Figure 2.5, there was no significant
impairment in the ability of MM cells to adhere to fibronectin and collagen I. This might
be because lack of expression of CXCR4 on its own does not affect the ability of cells to
adhere to fibronectin and collagen I but a difference might be observed if the cells are
pre-treated with SDF-1α before examining differences in cell adhesion.

Figure 2.5 CXCR4 KO does not affect cell adhesion to Fibronectin and Collagen I.
Cells were incubated in wells coated with fibronectin and collagen I for 3 hours at 37°C
and 5% CO2. Bovine serum albumin (BSA; 1%) was used as a control for nonspecific
binding (**P < .05; n = 3 from 3 independent experiments; error bars represent SEMs).

2.4.6 CXCR4 KO does not affect cell survival, cell growth or cell cycle status.
We compared apoptosis of CXCR4 KO 5TGM1 cells and 5TGM1 cells transduced with
non-silencing lentiCRISPR control. Using 7-AAD and Annexin V staining, we were
0

2

4

6

8

10

12

14

Fibronectin
Collagen
I
BSA

%
of
seeded
cells

CT

G1

G4

51

unable to detect a significant difference in the apoptotic status of CXCR4 KO MM cells
as compared to control cells (Figure 2.6A). To examine if CXCR4 KO results in
increased proliferation, we performed an in vitro cell growth assay over a period of 4
days in which cells were counted every 24 hours. We did not observe any significant
differences in cell growth in vitro after CXCR4 KO (Figure 2.6B). This correlates with
the fact that we did not see any significant changes in cell cycle status after CXCR4 KO
(Figure 2.6C). These results indicate that the ability and rate of 5TGM1 cells to
proliferate is not affected after CXCR4 KO. Hence, any results observed in disease
development in vivo are unlikely to be because the CXCR4 KO MM cells are not able to
survive as well as WT MM cells.
A.

0

1

2

3

4

5

6

7

CT
G1
G4

%
of
all
cells

7AAD
Annexin V

52

B.

C.

Figure 2.6 CXCR4 KO does not affect cell survival, proliferation or cell cycle status.
(A) Percentage of cells undergoing apoptosis after CXCR4 KO. The percentage of
apoptotic cells was determined as 7-amino-actinomycin (7-AAD) negative and PE
Annexin V positive (n = 3 from 3 independent experiments). (B) To investigate cell
proliferation, we performed an in vitro cell growth assay over a period of 4 days in which
cells were counted every 24 hours. (C) Cell cycle profiles of control transduced 5TGM1
and CXCR4 KO cells.

2.4.7 CXCR4 KO affects the specific localization and retention of 5TGM1 cells in
the bone marrow.
Next, we investigated the effects of CXCR4 KO on MM cell function in vivo. For our
homing studies, control and CXCR4 KO 5TGM1 cells were labeled with fluorescent dyes
0

20

40

60

80

100

1
2
3
4
5

Cell
Number
(x
10
4
)

Time
(days)

CT

gRNA1

gRNA4

0%

20%

40%

60%

80%

100%

CT
gRNA1
gRNA4

G2/M

S

G0/G1

53

to track the cells in vivo. These cells were coinjected into nonirradiated C57bl/Kalwrij
recipient mice, and the frequency of cells homing to the BM and spleen was calculated
with the use of flow cytometric analysis. Our results showed that CXCR4 KO does not
lead to a significant change in the ability of the injected cells to home to the BM and the
spleen (Figures 2.7A&B). However, upon statistical analysis, we discovered that these
differences are not significant.
Following homing is a process called lodgment when hematopoietic cells localize to a
specific BM microenvironment through mechanisms involving activation of adhesive
interactions (Wolf, 1974; Lapidot et al., 2005). Most injected cells can home to the BM
because of normal vasculature patterns but it has been shown that only HSCs that can
lodge in the stem cell niche can initiate long term hematopoiesis. We believed that a
similar mechanism is at work in MM cells and that only the MM cells that can localize to
the endosteal niche can cause disease. Histologic assessment of the femur and tibia
showed that CXCR4 KO 5TGM1 cells preferentially localized to the central bone
marrow space as compared to control 5TGM1 cells that localized closer to the endosteal
bone surface (Figures 2.7 C&D).
A.

54

B.

C.

D.

0

20

40

60

80

100

CT
G1
G4

%
of
all
detected
CFSE+

cells

More
than

250um
from

bone
surface

250um
or
less

from
bone

surface

CT G4

55

E.

Figure 2.7 CXCR4 KO affect localization and lodgment of 5TGM1 cells in the bone
marrow. (A&B) Control transduced or CXCR4 KO 5TGM1 cells were labeled with
green fluorescent dye CFSE. The percentage of labeled cells present in the BM after
transplantation was determined by flow cytometric analysis. Representative flow plots
(A) and percentage of labeled cells present in the BM and spleen (B) are shown. (C) A
representative picture of the anatomical localization of a CFSE+ cell (green) away from
the endosteal region is shown. Cells were also stained with 4’,6-diamidino- 2-
phenylindole (blue) present in Vectashield. (D) Quantification of the percentage of cells
labeled with CFSE present in the BM within 250um or 25 cell diameters of the endosteal
surface in tibial sections. (E) Quantification of the percentage of cells labeled with CFSE
present in compact bone vs trabecular bone in tibial sections.

2.4.8 Inoculation of CXCR4 KO 5TGM1 cells in C57bl/Kalwrij mice fails to cause
MM disease
To investigate if CXCR4 KO affects disease development, we injected non-irradiated
C57BL/KaLwRij mice intravenously with 10
6
5TGM1 cells transduced with
lentiCRISPR control or lentiCRISPR containing gRNA against CXCR4. Uninjected mice
0

20

40

60

80

100

CT
gRNA1
gRNA4

%
of
all
detected
CFSE+

cells

Compact
Bone

Trabecular
Bone

56

served as controls. Mice were monitored for disease development and they were
sacrificed when they suffered from hind limb paralysis and hunching. Mice injected with
5TGM1-control cells developed disease in 7-8 weeks while the mice injected with
CXCR4 KO cells remained healthy up to 12 weeks when they were sacrificed for
analysis. Comparison of CD138+ MM cells in the femurs, tibias and the spleens showed
that mice injected with CXCR4 KO had no indication of MM and looked like control
healthy mice (Figure 2.8C). TRACP staining of tibia sections also confirmed this as
control mice had an increased percentage of osteoclasts as well as bone lesions while
bone sections from mice injected with CXCR4 KO cells had normal histology (Fig 2.8D).
A.

B.

C.

0 20 40 60 80
0
50
100
150
Control
GRNA1
GRNA4
Days Elapsed
Percent survival

57

D.

Figure 2.8 Inoculation of CXCR4 KO 5TGM1 cells in C57BL/KaLwRij mice fails to
cause MM disease. (A) 10
6
control transduced or CXCR4 KO 5TGM1 cells were
inoculated in recipient mice which were monitored for disease development. (B) Kaplan-
Meier curve showing when mice were sacrificed because they developed hindlimb
paralysis. Mice that received gRNA4 cells did not develop paralysis and were sacrificed
at 12 weeks. (C) Quantification of malignant CD138+ cells present in the bone marrow
and spleen of recipient mice using flow cytometry. (D) TRACP staining of tibial sections
from sacrificed mice shows a proliferation of osteoclasts and development of bone
lesions in mice that were inoculated with 5TGM1 control transduced cells and gRNA1
cells. TRACP staining of gRNA4 mice shows that their tibia matches the one from
healthy uninjected controls. Splenomegaly is observed in mice that developed MM while
spleens from gRNA4 mice matched the ones from untreated mice in size.
USC Stem Cell
Inoculation of CXCR4 KO 5TGM1 cells
fails to cause MM in C57Bl/KalWrij mice
No treatment
Control
Transduced
gRNA1 gRNA4
TRACP&staining:&Osteoclasts&(pink)&

58

2.4.9 Overexpression of CXCR4 in 5TGM1-CRISPR cells partially rescues disease
phenotype.
In order to confirm that our results from the CRISPR studies were because of CXCR4
knockout and not off target effects, we performed CXCR4 gain of function experiments
in the 5TGM1-CRISPR cells and investigated if this rescued the CXCR4-KO phenotype.
We confirmed the overexpression of CXCR4 on the cell surface using flow cytometry
(Fig 2.9A). Then, we performed calcium flux assay to investigate if the CXCR4
overexpression reinstates the ability of CXCR4-/- 5TGM1 cells to respond to SDF1α
stimulus (Fig 2.9 B). Last, we inoculated the 5TGM1-CRISPR-FUIGW cells into non-
irradiated C57BL/KaLwRij mice to examine effects of the CXCR4 overexpression on
MM disease development (Fig 2.9 C). We observed that even though CXCR4 was
expressed at the surface, the recipient mice did not develop disease. This might be
because the hCXCR4 is unable to respond to the mouse SDF-1α or because the CRISPR
CXCR4 KO process had other unknown intrinsic effects of the biology of the MM cells.
A.

59

B.

C.

Figure 2.9 Rescue of CXCR4 KO using FUIGW-humanCXCR4 lentiviral construct.
(A) Flow cytometry analysis of CXCR4 expression on 5TGM1 cell surface after FUIGW
transduction. (B) Calcium flux assay (C) % of CD138+ cells in C57bl/Kalwrij mice
inoculated with 5TGM1-FUIGW control or 5TGM1-CRISPR-FUIGW cells.

0

10

20

30

40

50

60

70

80

BM

FUIGW CT
gRNA1 FUIGW
gRNA4 FUIGW
0

10

20

30

40

50

60

70

spleen

60

2.5 Discussion
Despite therapeutic advances, multiple myeloma (MM) remains incurable. The main
reason for this is restricted localization of the malignant cells in the BM. This
microenvironment provides the appropriate signals for growth and survival of the tumor
cells and confers chemotherapeutic resistance. Several mechanisms by which these
malignant plasma cells home to the BM have been proposed (Alsayed et al., 2007;
Asosingh et al., 2001). Once in the BM, adhesion of MM cells to the BM
microenvironment as well as cytokines released in the BM milieu provide resistance to
standard chemotherapeutic agents (Sanz-Rodríguez et al., 1999). With this study, we
sought to investigate if the general localization of MM cells to the BM is enough for
disease development or if they need to be confined to a specific region. Our results help
us in understanding which part of the BM milieu needs to be targeted using therapies.
MM can occur de novo or evolve from benign monoclonal gammopathy of undetermined
significance (MGUS). Approximately 1% of individuals with MGUS evolve to multiple
myeloma per year. Despite the presence of a variety of chromosomal aberrations,
translocations and mutations in essential growth and tumor suppressor genes in multiple
myeloma (MM) cells, oncogenomic studies have identified few differences distinguishing
MGUS from MM (Podar, Chauhan, & Anderson, 2009) Several studies have highlighted
the essential role of the BM microenvironment in disease maintenance and progression
and suspect that differences in the BM microenvironment decide whether MGUS leads to
MM or not.

We used the well-established 5T mouse model of MM that recapitulates human MM in a

61

syngeneic mouse model (Radl & Zurcher, 1988; Radl, Glopper, & Schuit, 1979). Using
the CRISPR/Cas9 system developed by Zhang lab (Ran et al., 2013; Shalem et al., 2013)
we knocked out CXCR4 in the 5TGM1 cell line. We tested two sgRNAs to knock out
CXCR4 and expanded clonal populations after transduction and puromycin selection.
Flow cytometry analysis showed that CXCR4 is knocked out at the cell surface in both
populations but gRNA1 still managed to cause disease, with a lower intensity than the
control. This might be because even though it was a homozygous mutation at the
genomic level in both populations, there was a 120NT deletion in one allele in gRNA4
while the longest deletion in gRNA1 was 4 NTs. gRNA1 cells are able to localize to the
BM and a higher percentage of cells localize close to the bone marrow surface as
compared to g4. This suggests that lodgment of the MM cells in the endosteal niche is
important for disease development.

To investigate if the in vivo effects were because of differences in intrinsic cell behavior,
we performed apoptosis, cell growth and cell cycle assays and observed no significant
differences between the control transduced and CXCR4 KO cells. This implies that the in
vivo effects we observed were not because the cells are active and proliferating faster but
because of an interruption in the CXCR4-SDF1α interaction.

The results from homing were obtained 16 hours after injection of the cells. Homing is a
dynamic process and hence we conducted longer disease development experiments to
determine if CXCR4 plays a role in homing or retention of cells in the bone marrow.
These studies showed that the there is only a slight non-significant decrease in homing

62

after CXCR4 KO but an obvious and significant decrease in the lodgment of CXCR4 KO
cells in the BM which resulted in a decreased (or completely absent) myeloma tumor load
in the BM.

Whether there is a stem cell population in MM still remains under debate. However, our
study shows that MM cells prefer to localize close to the endosteal bone surface and
hence MM cells might prefer to be in a niche environment to establish disease. When
CXCR4 is knocked out, the lodgment of cells to the bone marrow is affected and this has
been shown by previous studies. What is novel about our study is that it shows that
blocking the preferential localization of MM cells to the endosteal surface stops MM
disease development. There is a possibility that the MM cells closer to the endosteal
niche might be the disease causing cells that escape chemotherapy and cause relapse.

63

Chapter 3: The Impact of the CD22ΔE12 Genetic Mutation in
the Leukemic Stem Cell Niche

3.1 Abstract
It is becoming increasingly apparent that hematological malignancies influence the bone
marrow (BM) microenvironment in order to promote the pathophysiology of the
malignant stem cell, while at the same time become detrimental to the normal HSCs.
Specifically, recent studies have proposed that myeloid leukemias in the BM influence the
mesenchymal stem cell (MSC) populations to differentiate into stromal cells that are
unable to support HSCs, but are able to maintain the support of the leukemic stem cell
(LSC) population. Here, we examined the influence of B-precursor leukemia (BPL), the
largest subset of acute lymphoblastic leukemia (ALL), on the HSC niche. Forced
expression of the mutant CD22ΔE12 protein in transgenic mice perturbs B-cell
development, as evidenced by B-precursor/B-cell hyperplasia and corrupts the regulation
of gene expression. Our data demonstrates that MSCs are expanded in the BM of
CD22ΔE12-Tg mice which leads to a higher percentage of more active and proliferative
HSCs in their BM. Understanding the adverse effects of the pre-leukemic BPL cells on
the microenvironment has great importance in designing rational therapeutic strategies for
the treatment of leukemia and the recovery of the normal hematopoietic system.

3.2 Introduction
B precursor acute lymphoblastic leukemia (BPL), the largest subset of acute
lymphoblastic leukemia, is the most common childhood cancer (Trigg et al, 2008; Siebel
et al, 2008; Stanulla and Schrappe, 2009). Rapid progress has been made in

64

understanding the genetics of BPL in recent years which has led to the development of
specific targeted therapy. However, the main cause of mortality in BPL patients is relapse
after intensive chemotherapy and supralethal radiochemotherapy in the context of HSC
transplantation (Reaman et al, 1999; Chessels et al, 2002; Kosaka et al, 2004; Hilden et
al, 2006; Tomizawa et al, 2009).

CD22 is a 140kDa B-lineage differentiation antigen that is expressed on the surface of B-
lineage cells from the early progenitor stage of development until prior to terminal
differentiation into plasma cells, which are CD22 negative (Law et al, 1995; Tedder et al,
1997). CD22 is an inhibitory co-receptor that works in conjunction with the B-cell
receptor (BCR) to negatively regulate multiple signal transduction pathways critical for
B-cell homeostasis, survival, activation, and differentiation (Tedder et al, 2005). Our
collaborator, Dr. Uckun and his team, demonstrated that therapy-refractory BPL clones
are characterized by a genetic defect involving CD22 that causes abnormal proliferation
and clonal growth. The abnormal CD22 co-receptor is encoded by a profoundly aberrant
mRNA arising from a splicing defect that causes the deletion of exon 12 (c.2208–c.2327)
(CD22ΔE12) and results in a truncating frameshift mutation. CD22ΔE12 transgenic mice
develop B-precursor hyperplasia in their bone marrow (BM) at 6 weeks followed by fatal
BPL at 6 months (Uckun et al, 2010). We hypothesize that the abnormal B cells in BPL
“hijack” the normal BM microenvironment, promoting disease to the detriment of normal
hematopoiesis. It has been shown that leukemic myeloid cells in myeloproliferative
neoplasms stimulate MSCs to overproduce functionally altered osteoblastic cells, which
accumulate in the BM cavity as inflammatory myelofibrotic cells (Schepers et al., 2013).

65

In this project, we demonstrate that stromal cells as well as hematopoietic stem and
progenitor cells are expanded in the BM of CD22ΔE12-Tg mice as compared to WT
mice. We hypothesized that CD22ΔE12 expression renders lymphoid-biased SC and
early B-lineage LPCs hyper-responsive to the chemokine CXCL12 and causes the
CD22ΔE12 cells to overpopulate the BM which results in less BM space for normal
HSCs. Using engraftment assays, we show that there is 2.0 fold reduction in engraftment
of wild-type cells in the BM of transgenic mice that were yet to develop leukemia. This
indicates that the presence of the CD22ΔE12 mutation creates a pre-leukemic state in
which BM niche signals are adjusted to promote disease development and impair normal
hematopoiesis.

A better understanding of BM stem cell niche biology and delineation of the
discriminating differences between LSC and their normal counterparts in normal B-cell
ontogeny are critical for a rational design of personalized treatments for LSC-derived
aggressive leukemias. By using multiple assay platforms and unique genetic mouse
models of BPL, we have determined the unique immunobiologic features of CD22ΔE12
leukemic stem cells (LSCs) in BPL and gained fundamental insights into the molecular
basis of their selective survival/growth advantage in the BM stem cell niche.

3.3 Materials & Methods
3.3.1 Animals
Six- to eight-week-old male C57Bl/6 and B6.SJL mice (Taconic Farms Inc, Oxnard, CA,

66

USA) were obtained and used in accordance with the University of Southern California
Institutional Animal Care and Use Committee (IACUC) guidelines. Mice were housed in
sterilized microisolator cages and received autoclaved food and water ad libitum.
Transgenic mouse models were generated in Dr. Uckun’s lab at Children’s Hospital of
Los Angeles. Following is a description of the models used in our studies:
Strain Description
BCR-ABL-Tg "Transgenic mice contain the truncated murine metallothionein-1
(Mt1) promoter driving expression of the human p190 form of
the BCR/ABL1 fusion protein cDNA. This fusion gene produces
the p190 protein, which results from the chromosomal
translocation of the alb proto-oncogene with breakpoint cluster
region sequences. P190 is a deregulated tyrosine kinase that is
associated with the onset of acute lymphoblastic leukemia (ALL)
in humans. This strain expresses p190 in bone marrow, brain,
liver, kidney, muscle, and spleen. These mice develop
hematologic malignancies at 3 months of age. When this strain is
bred to RAC3 null mice, development of leukemia is delayed
only in female mice. Females carrying both mutations live twice
as long as mice carrying only the BCR/ABL Tg. When bred to
CRKL Tg mice), leukemogenesis is accelerated in double
transgenic mice." (http://jaxmice.jax.org/strain/017833.html)

67

C57Bl/6 Wild-type
CD22ΔE12-Tg
(referred as CD22Tg
from here on)
Bl/6 mice with the mutated form of CD22 in pre-B cells.
CD22 KI Mutant CD22 delta E12 human inserted in place of mouse CD22
(can be Cre+ or Cre-).
CD22 KI Het Mutant CD22 delta E12 human inserted in place of mouse
CD22, heterozygous.
CD22 KI Hom Cre- Mutant CD22 delta E12 human inserted in place of mouse
CD22, homozygous, doesn't have Cre therefore human CD22 is
not expressed, essentially a KO.
CD22 KI Hom Cre+ Mutant CD22 delta E12 human inserted in place of mouse
CD22, homozygous, Cre cleaves out mouse CD22 and inserts
mutated human CD22).
CD22 KO
Bl/6 mice with a stop codon before CD22ΔE12 so no CD22 in
produced.
CD22, BCR Double transgenic of CD22 and BCR, has both CD22+ and
BCR+.
CD22, MLL Double transgenic of CD22 and MLL-AF4, has both CD22+ and

68

MLL-AF4+.
CD22, MYC Double transgenic of CD22 and MYC, has both CD22+ and
MYC+.
CD22+ VS CD22
(hom)
CD22+ has at least one parent who is CD22+, where as
homozygous, both parents were positive for CD22. Essentially,
same.
MLL-AF4-Tg Bl/6 mice with a well-known BPL mutation.
MLL-AF4(hom) Both parents were MLL-AF4-Tg. Same as above.
MYC-Tg "Expression of the mouse Myc transgene is restricted to the B
cell lineage. Hemizygotes show increased pre-B cells in the bone
marrow throughout life and a transient increase in large pre-B
cells in the blood at 3-4 weeks of age. Spontaneous pre-B and B
cell lymphomas reach an incidence of 50% at 15-20 weeks in
hemizygous progeny of a wildtype female mated with a
hemizygous male. The transgene synergizes with an
TgN(BCL2)22Wehi transgene to produce primitive lymphoid
tumors within 5 weeks of birth, and with an Emu-v-abl transgene
to produce plasmacytomas by 8 weeks."
(http://jaxmice.jax.org/strain/002728.html)
Table 3.1. Description of transgenic mouse models used in our studies.

69

3.3.2 Euthanasia
Mice were sacrificed by placing them in a standard CO
2

chamber attached a pressurized
CO
2

tank and exposing them to the CO
2

gas for approximately 5 minutes to attain
complete asphyxia, narcosis, complete unconsciousness, and death. To ensure death of
the mice, cervical dislocation was used as the secondary method.

3.3.3 Bone Harvesting and Flushing
Sacrificed mice were pinned down to the dissection board and doused in 70% ethanol.
All the surgical tools were sterilized using 70% ethanol. The hindlimb was removed by
cutting above the hip joint. The cleaned bones were placed in Dulbecco's Modified Eagle
Medium (DMEM) supplemented with 10% fetal bovine serum (FBS) and 1X penicillin-
streptomycin (P/S) (all from Mediatech Inc., Manassas, VA, USA). The two ends of the
bones were cut using a scalpel (Becton Dickinson, Franklin Lakes, NJ, USA), and the
BM was flushed out using a 1ml syringe attached to a 25-gauge needle (Becton
Dickinson). To remove any remaining bone fragments or hair, the BM solution was
filtered using a 70µm cell strainer (Becton Dickinson).

3.3.4 Hematopoietic Stem Cell Staining and Analysis
BM MNCs were stained in 100µl of 1X phosphate buffered saline (PBS; Mediatech Inc.)
with appropriate volumes of primary anti-mouse antibodies (Table 2.1) (all from
eBioscience) for 15 minutes on ice, protected from light. Following primary antibody
incubation, cells were washed with 5ml of 1X PBS, centrifuged at 400g for 5 minutes,
and resuspended in 100µl of 1X PBS. Next, the resuspended cells were stained with 2µl

70

of APC-eFluor 780 streptavidin (eBioscience) as the secondary antibody for 10 minutes
on ice, protected from light.
Primary Antibody Antigen Recognized Clone Conjugate
B220 B-cell Specific
CD45R Isoform
RA3-6B2
Biotin (Biotinylated
Lineage Panel)
CD3e T-Cell Receptor
(TCR)
145-2C11
CD11b Macrophage-1
(Mac-1) Antigen
M1/70
Gr-1 Myeloid
Differentiation
Antigen
RB6-8C5
TER119 Ter-119 Antigen TER-119
CD117 (c-Kit) Stem Cell Factor 2B8 Allophycocyanin
[APC]
Ly6A/E (Sca-1) Stem Cell Antigen-1 E13-161.7 Alexa Fluor 700
[AF700]
CD150 Signaling
Lymphocyte
mShad150 Phycoerythrin-
Cyanine7 [PE-Cy7]

71

Activation Molecule
(SLAM)
CD48 BCM1 HM48-1 Fluorescein
isothiocyanate
[FITC] or
Phycoerythrin-
Cyanine5 [PE-Cy5]
Table 3.2. Primary antibodies used for mouse hematopoietic stem cell analysis.
3.3.5 Stromal Cell Staining
BM MNCs were stained in 100µl of 1X phosphate buffered saline (PBS; Mediatech Inc.)
with appropriate volumes of primary anti-mouse antibodies (Table 2.2) (all from
eBioscience) for 15 minutes on ice, protected from light. Following primary antibody
incubation, cells were washed with 5ml of 1X PBS, centrifuged at 400g for 5 minutes,
and resuspended in 100µl of 1X PBS. Next, the resuspended cells were stained with 2µl
of APC-eFluor 780 streptavidin (eBioscience) as the secondary antibody for 10 minutes
on ice, protected from light.
Primary Antibody Antigen Recognized Clone Conjugate
B220 B-cell Specific CD45R
Isoform
RA3-6B2
Biotin (Biotinylated
Lineage Panel)
CD3e T-Cell Receptor (TCR) 145-2C11

72

CD11b Macrophage-1 (Mac-1)
Antigen
M1/70
Gr-1 Myeloid Differentiation
Antigen
RB6-8C5
TER119 Ter-119 Antigen TER-119
Leukocyte Common
Antigen or CD45
Protein tyrosine
phosphatase, receptor
type, C (PTPRC)
30-F11 Phycoerythrin (PE)
Ly6A/E (Sca-1) Stem Cell Antigen-1 E13-161.7
Alexa Fluor 700
[AF700]
CD31
Platelet Endothelial Cell
Adhesion Molecule
390 Fluorescein
isothiocyanate
[FITC]
Table 3.3. Primary antibodies used for mouse stromal cell analysis.
3.3.6 Cell Cycle Analysis
To stain for DNA content, cells were incubated with 10µg/ml Hoechst 33342 (Sigma-
Aldrich) and 25µg/ml of verapamil at 37°C for 45 minutes, then stained with lineage and
stem cell antibodies as described in 2.3.4. The stained cells were resuspended and fixed
in 10% paraformaldehyde (EMD Chemicals, Inc.) and incubated at 4°C overnight,

73

wrapped in foil. To stain for RNA content, Pyronin Y (Polysciences Inc, Warrington, PA)
was added to the cells at a final concentration of 0.75µg/ml and incubated at 4°C for 30
minutes wrapped in foil. Cell cycle status was examined using the LSR II flow cytometer.
Both Pyronin Y and Hoechst were analyzed on a linear scale. The gating scheme for cell
cycle analysis is shown in Figure 2.4.

3.3.7 c-Kit Cell Enrichment using Magnetic Beads
RBCs from flushed BM were lysed using 1ml of 1X ACK Lysis Buffer. Next, they were
incubated with c-Kit magnetic beads (Miltenyi) at a concentration of 10ul per 2 x10
7
cells. 40ul of 1X PBS was added for every 10ul of beads (1:4 beads to PBS ratio) and the
cells were incubated for 15 minutes in the refrigerator in the dark. Then the cells were
washed with 4ml of 1X PBS, and centrifuged at 400g for 5 minutes. The magnetic
enrichment stand was set up in this time and a magnetic column (Miltenyi) was pre-
washed with 1ml of 1X PBS. The cells were resuspended in 1ml of 1X PBS and put
through a 70um filter into the magnetic column. c-Kit positive cells were retained in the
column while c-Kit negative cells were collected in the waste tube. After the cell
suspension has gone through the column, it was washed twice with 1ml 1X PBS. Lastly,
the c-Kit enriched cells were collected in a sterile 15ml tube by plunging 2ml of 1X PBS
through the column with the provided syringe. These cells were spun down and stained
with different fluorescent antibodies as required.

3.3.8 Fluorescence Activated Cell Sorting (FACS)
To investigate which HSC populations and differentiated cells carry the CD22ΔE12
mutation in transgenic mice, we sorted different cell populations and examined for

74

expression of the truncated CD22 protein using Western Blot. Cells from young and old
mice of CD22ΔE12-Tg, CD22 KI (het), and CD22 KI (hom) backgrounds were first
enriched for c-Kit cells as described in 2.3.7. c-Kit+ cells were sorted for HSC
populations and c-Kit- cells were sorted for differentiated cell types.
Cell Population Cell Surface Marker Profile
Long Term HSCs (LT-HSCs) LSK CD48- CD150+
Short Term HSCs (ST-HSCs) LSK CD48- CD150-
Multipotent Progenitors (MPP) LSK CD48+ CD150-
Monocytes c-Kit- CD11b+
T Cells c-Kit- CD3e+
B cells c-Kit- B220+
Table 3.4. Cell surface marker profile of sorted cells.

Primary Antibody Conjugate
Lineage panel Biotin and APC-eFluor 780 secondary
c-Kit PE (Miltenyi)
Sca1 AF700

75

CD48 FITC
CD150 PE-Cy7
CD11b PE-Cy7
CD3e APC
B220 Biotin and APC-eFluor 780 secondary
Table 3.5. Antibodies used for FACS to investigate CD22ΔE12 expression in cell
populations.
After sorting, the cells were spun down and counted. Dry cell pellets were frozen down
and used for Western Blot analysis.

3.3.9 Engraftment Assay

Figure 3.1 Schematic of engraftment assay setup.

To investigate if the CD22ΔE12 mutation affects the ability of the BM microenvironment
to support HSCs, we set up an engraftment experiment. 2,50,000 BM MNCs from
B6SJ.L mice (CD45.1) were harvested as described in 2.3.3 and injected into either WT
C57BL/6 (CD45.2) or CD22ΔE12-Tg mice (CD45.2) that were sub-lethally irradiated 24

76

hours before transplantation. Contribution of CD45.1 cells to hematopoiesis was
monitored for two months to assess the ability of CD22ΔE12-Tg mice to support
hematopoiesis as compared to healthy WT C57Bl/6 mice.
After the mice were sacked, BM MNCs from femurs were harvested as described in 2.3.3
and RBCs were lysed using 1ml of 1X ACK Lysing Buffer. The cells were then stained
with PE anti-mouse CD45.1, FITC anti-mouse CD45.2, biotin anti-mouse Lineage panel,
APC anti-mouse c-kit, AF700 Sca1, PE-Cy5 CD48 and PE-Cy7 anti-mouse CD150 (all
from eBioscience) for 15 minutes on ice in the dark. Next, the cells were washed with
3ml of 1X PBS, then centrifuged at 400g for 5 minutes. The cells were resuspended in
100µl of 1X PBS and stained with 2µl of APC-eFluor 780 streptavidin (eBioscience) for
10 minutes on ice in the dark. The cells were washed with 3ml of 1X PBS, then
centrifuged at 400g for 5 minutes. The samples were then fixed in 400µl of 10% neutral
buffered formalin and analyzed by flow cytometry using the LSR II cell flow cytometer.

3.3.10 Competitive Repopulation Assay

Figure 3.2 Schematic of competitive repopulation assay setup.
Day 0: Irradiate and
seed BM stromal
cells in 48 well plate
Day 1: Enrich and sort
LSK cells from C57Bl/
6 mice. Co-culture with
stromal cells
Day 4: Inject cocultured
cells into recipient
B6SJL mice along with
competitor cells

77

BM from femurs of transgenic mice was flushed as detailed in 2.3.3 and red blood cells
were lysed using 1ml of ACK Lysis Buffer. Stromal cells were expanded in T25 flasks
for 12 days and then irradiated on day of seeding to avoid growth after seeding. 50,000
stromal cells/well were seeded in a TC treated 48 well plate and allowed to adhere
overnight.
24 hours after the stromal cells were seeded, c-Kit

cells from C57BL/6 were enriched as
described in 2.3.7. The c-Kit enriched cells were resuspended in 100ul 1X PBS and
stained with with 15ul biotin anti-mouse Lineage panel, 10ul PE c-Kit (Miltenyi) and 2ul
AF700 Sca1 (eBioscience) for 15 minutes on ice covered with foil. Next, the cells were
washed with 3ml of 1X PBS, then centrifuged at 400g for 5 minutes. The cells were
resuspended in 100µl of 1X PBS and stained with 2µl of APC-eFluor 780 streptavidin
(eBioscience) for 10 minutes on ice in the dark. Cells were spun down and resuspended
in 500ul PBS for sorting. LSK cells were sorted using a FACSAria or Aria II flow
cytometer and collected in cell culture media. 30,000 LSK cells/well were co-cultured
with the transgenic stromal cells for 3 days. Following co-culture, stromal cells and LSK

cells (CD45.2) and 225,000 BM MNCs (CD45.1) were co-injected into the tail vein of
B6SJ.L mice (CD45.1) that were lethally irradiated at 10Gy approximately 24 hours
before transplantation.
Engraftment levels and multilineage reconstitution were measured every month in
peripheral blood samples obtained from the tail of recipients. 50µl of blood was mixed
50µl of 1X PBS in polystyrene flow tubes (Becton Dickinson), then PE anti-mouse
CD45.1, FITC anti-mouse CD45.2, APC anti-mouse CD3e, PE-Cy7 anti-mouse CD11b,

78

and biotin anti-mouse B220 antibodies (2µl each) (all from eBioscience) were added to
stain the peripheral blood samples. The cells were stained for 15 minutes on ice in the
dark and then washed with PBS. The cells were resuspended in 100µl of 1X PBS and
stained with 2µl of APC-eFluor 780 streptavidin (eBioscience) for 10 minutes on ice in
the dark. After staining, the red blood cells were lysed in 1ml of 1X FACS lysing solution
(Becton Dickinson) for 1 minute at room temperature and washed. The samples were
then fixed in 400µl of 10% neutral buffered formalin and analyzed by flow cytometry
using the LSR II cell flow cytometer. The data was analyzed using FlowJo.

3.4 Results
3.4.1 CD22ΔE12 mutation results in increased HSPC populations in the bone
marrow. MLL-AF4 mutation does not show the same effect.
We hypothesized that the hyperproliferative pre-B cells in the pre-leukemic mice secrete
factors that increase levels of hematopoietic stem and progenitor cells in the BM of
CD22ΔE12-Tg mice and this contributes to their pre-leukemic state. In order to test this
hypothesis, we analyzed levels of stem and progenitor cells in the transgenic mice
described in table 2.1 using established cell surface markers and flow cytometry. Levels
of LSK, LT-HSC and ST-HSC were significantly higher in the BM of pre-leukemic
CD22ΔE12-Tg mice as compared to WT C57Bl/6 and mice with MLL-AF4 genotype, a
well-known BPL mutation.

79

Figure 3.3. CD22ΔE12-Tg pre-leukemic mice have increased numbers of HSPCs in
their bone marrow.

3.4.2 Cell cycle analysis suggests that there is an increased proportion of active LSK
cells in CD22ΔE12-Tg mice.
Next, we investigated if an altered cell cycle status was responsible for the increased
numbers of hematopoietic stem and progenitor cells in the CD22ΔE12-Tg mice. In order
to do so, we stained for stem and progenitor markers as described earlier and performed
specific analysis of each sub-population to detect any significant alteration in the number
of cells residing in G
0
, G
1
, or S/G
2
/M phase of the cell cycle. No significant difference
was observed in LT and ST HSCs. However, a higher number of LSK cells are present in
G1 state as compared to WT cells. This implies that CD22ΔE12 cells in the BM niche of

80

the transgenic mice are influencing the LSK cells in the microenvironment to be more
active.

Figure 3.4 Higher percentage of active cells in the LSK sub-population of
CD22ΔE12-Tg mice.

3.4.3 Increased number of MSC like cells in the CD22ΔE12 Tg mice
It has been shown that leukemic myeloid cells in myeloproliferative neoplasia can
stimulate mesenchymal stem cells in the bone marrow to overproduce functionally
altered osteoblastic lineage cells (OBCs). This leads to a remodeling of the endosteal BM
niche into a self-inforcing leukemic niche that impairs normal hematopoiesis, favors
leukemic stem cell function, and contributes to BM fibrosis (Schepers et al, 2013). We

81

suspected that a similar mechanism was at play in the CD22ΔE12-Tg pre-leukemic mice
where the CD22 mutation in pre-B cells stimulated them to secrete factors that activated
the HSC supportive cells in the BM microenvironment to an over-proliferative state. We
analyzed BM stromal populations for endothelial cells (Lin-/CD45-/CD31+/Sca1-),
endosteal MSCs (Lin-/ CD45-/CD31-/ Sca-1+), their OBC derivatives (Lin-/ CD45-
/CD31-/ Sca-1-) and found that there is a significant increase in the percentage of MSCs
in the BM of CD22ΔE12-Tg mice as compared to WT mice.

Figure 3.5 Increased numbers of MSCs in BM of CD22ΔE12-Tg mice.

3.4.4 Results of Competitive Repopulation Assay
We suspected that the hyperproliferative multipotent stromal cells in the CD22ΔE12-Tg

82

mice exert factors that negatively impact HSCs. To investigate this, we expanded stromal
cells from different transgenic mice and co-cultured CD45.2 WT LSK cells with them.
After 3 days, the CD45.2 LSK cells were collected and injected into lethally irradiated
recipient CD45.1 mice along with competitor BM-MNCs. Engraftment levels were
monitored through tail vein bleeding every 4 weeks after transplantation until mice
reached 6 months of age. At that point, mice were sacrificed and engraftment of CD45.2
LSK cells in the bone marrow was investigated using flow cytometry. As seen in Figure
3.6, WT LSK cells co-cultured with stromal cells from the CD22ΔE12-Tg mice
demonstrated reduced engraftment and contribution to hematopoiesis in the recipient
mice. Surprisingly, stromal cells from MLL-AF4 transgenic mice don’t have a similar
effect on HSCs which implies that the MLL-AF4 mutation does not affect the BM
microenvironement.

Figure 3.6 Stromal cells from CD22ΔE12-Tg mice release factors that negatively
affect the engraftment capacity of WT LSK cells in normal recipient mice.
0

10

20

30

40

50

60

70

80

90

100

1
2
3
4
5
6

%

Time
(months)

Percentage of CD45.2 cells in peripheral blood
MLL-‐AF4

CD22ΔE12-‐Tg

WT

83

3.4.5 Reduced engraftment in CD22ΔE12-Tg mice

Based on our results from the competitive repopulation assay, we hypothesized that the
BM microenvironment of the CD22ΔE12-Tg mice is unfavorable for HSC engraftment
and survival. In order to test this hypothesis in vivo, we injected CD45.1+ WT BM-
MNCs into either CD45.2+ C57Bl/6 or CD45.2+ CD22ΔE12-Tg recipient mice that were
sub-lethally irradiated 24 hours before transplantation. We monitored contribution of the
CD45.1+ cells to hematopoiesis at one and two months after transplantation. As observed
in figures, the WT BM-MNCs survive and engraft better in the WT recipient mice as
compared to CD22ΔE12-Tg mice.

Figure 3.7 Engraftment of normal HSCs is impaired in CD22ΔE12-Tg mice.

3.4.6 CD22ΔE12 mutation is present only in cells of B-lineage
In order to confirm that the CD22ΔE12 mutation is present only in cells of the B lineage
in young and old transgenic mice, we sorted for different HSC populations and
downstream differentiated cells using FACS. The CD22ΔE12 mutation was linked to a
GFP marker and our FACS showed that primitive LT-HSCs from the transgenic mice did
not express GFP and hence, the mutation.

84

Figure 3.8 CD22ΔE12 mutation is not present in primitive LT-HSCs in young and
old transgenic mice.

3.5 Discussion

In the last decade, CD22 has emerged as a leading therapeutic target in B cell
malignancies, including childhood B-precursor acute lymphoblastic leukemia.
Epratuzumab (Raetz et al, 2008), inotuzumab ozogamicin (Kantarjian et al, 2013),
moxetumomab pasudotox (Kreitman et al, 2012) and anti-CD22 chimeric antigen
receptor transduced T cells (Haso et al, 2013) are some of the promising anti-CD22
monoclonal antibody-based therapies under development. The main cause of mortality in
BPL is relapse after chemotherapy and there is an urgent need to understand the
physiological reasons for this relapse. Dr. Uckun’s work is the first time homozygous
mutations of the CD22 gene have been linked to a human disease. Interestingly, this
mutation in exon 12 of the gene is present in 100% of the therapy-refractory clones and

85

we suspect that this mutation is a marker for BPL leukemic stem cells (LSCs) that are
able to escape chemotherapy. We hypothesized that the CD22ΔE12 LSCs are able to
“hijack” the normal BM microenvironment to promote disease and deter normal
hematopoiesis.

Using well established cell surface markers and flow cytometry, we demonstrated a 1.5
fold increase in the primitive hematopoietic stem/progenitor cell sub-populations in the
BM of the transgenic mice expressing the CD22ΔE12 mutation as compared to WT mice.
Analysis of the stromal cell compartments showed a 1.85 fold increase in the percentage
of osteoblastic cells and a 4.5 fold increase in the percentage of mesenchymal stem cells
in the bone marrow of the CD22ΔE12 Tg mice as compared to WT mice. This hyper
proliferation of HSC supportive cells has been shown to remodel the endosteal niche into
a self-reinforcing leukemic niche that impairs normal hematopoiesis, and favors leukemic
stem cell (LSC) function. Not only are the stromal cells more proliferative, but their
ability to support normal HSCs is also impaired as evidenced by a decrease in the ability
of the stromal cells to support long-term engrafting cells in in vitro expansion assays as
well as a 2.0 fold reduction in engraftment of wild-type cells in the BM of transgenic
mice that were yet to develop leukemia. Hence, our data shows that CD22ΔE12 pre-B
cells manipulate normal cues of the BM microenvironment to initiate disease
development.

The BM milieu provides protection from chemotherapy, which can explain why these
cells escape current treatment modalities. Evidence for this is provided by studies that

86

show blasts from patients with BPL have an enormous survival advantage when co-
cultured with stroma versus when cultured in media alone. Co-culture with stroma also
provided chemotherapeutic protection when the cells were treated with asparaginase, a
mainstay of pediatric ALL therapy (Manabe et al, 1992). A series of experiments
utilizing in vivo imaging demonstrated that the transplantation of human leukemic cells
in immunodeficient mice specifically disrupts the niches of normal HSCs. These
experiments suggest that the bone marrow stromal microenvironment plays a significant
role in the development of hematologic malignancy. A greater understanding of the exact
mechanisms at play in the BPL pre-leukemic BM microenvironment will aid in the
development of better therapies for BPL.

87

Chapter 4: Concluding Remarks
The role of the microenvironment on stem cells and tumor cells are active areas of
research today (Yin, Li, 2006; Kiel, Morrison, 2008; Shiozawa et al., 2008; Schepers,
Campbell, & Passegué, 2015). Cancer cells have been shown to use mechanisms similar
to those used by HSCs to migrate to the BM (Sun et al., 2005; Taichman, 2005; Shiozawa
et al., 2008; Sun et al., 2008; Wang et al., 2008). The SDF-1α /CXCR4 signaling pathway
is perhaps the most well studied pathway in directing this migration (Kollet et al., 2001;
Taichman et al., 2002). In the normal hematopoietic system, it has been shown that this
pathway is not essential in the homing of HSCs but only for their retention in the BM
(Ma et al, 1999). MM cells also home to the BM and establish themselves there to the
detriment of normal HSCs. They thrive in this protective niche and are able to evade
chemotherapeutic agents while promoting disease development (Anderson et al. 2000).

Using MM as a disease model, we investigated whether the SDF-1α /CXCR4 pathway
plays a role in the homing of MM cells or their retention within the BM. Our results
contradict previous studies (Alsayed et al., 2007) because we show that CXCR4 is
dispensable for the homing of MM cells to the BM but is necessary to retain the cells in
the BM microenvironment and cause disease. We also show that within the BM, it is
necessary for the MM cells to localize close to the endosteal bone surface in order to
develop disease and interruption of the SDF-1α /CXCR4 pathway disrupts this specific
localization and disease development. We believe our results shed light on one of the
possible reasons why some MGUS patients develop MM and some do not.

88

Novel therapeutic agents such as the proteasome inhibitor bortezomib and HSC
transplantation have led to a significant advancement in the treatment of patients with
MM (Richardson 2004; Richardson, Mitsiades, Hideshima, Anderson 2005; Harousseau
2005). However, these therapeutic approaches are futile on many patients and hence
further advances are required (Ghobrial et al., 2007). Extensive amount of data highlights
the importance of the interaction of MM cells with components of the BM
microenvironment such as stromal cells, extracellular matrix proteins and factors such as
cytokines and chemokines in MM pathogenesis and drug resistance (Pagnucco,
Cardinale, Gervasi 2004; Damiano et al. 1999; Hideshima et al. 2002; Damiano, Dalton,
2000). This sparked interest in investigating if the CXCR4 inhibitor AMD3100 could
mobilize MM cells out of the BM and sensitize them to drugs such as bortezomib (Azab
et al., 2009). However, when we repeated the AMD3100 pretreatment modality in our
syngeneic mouse model of MM the mice got sicker faster and had to be sacrificed before
the untreated control group. This shows that there is still a lot to be understood about
AMD3100 and its mechanism. We believe that the results of the previous studies are only
applicable in xenograft systems and pre-treatment of humans with AMD3100 might have
the same effects that we observed in our syngeneic disease model.

Our observations open the door for the development of more targeted therapies for MM
and metastatic cancers. We believe that since AMD3100 targets CXCR4 on all cells, it
acts at a systemic level and there is no way to know if it affected normal HSCs or the
malignant cells. We believe that the next step would be to develop a drug that specifically
targets CXCR4 on malignant cells and spares normal cells. One possible candidate for

89

recognition of MM cells is CD138 (syndecan-1), which we and others have shown is
expressed by majority of malignant plasma cells (O’Connell, Pinkus J, Pinkus G, 2004).
This drug can be designed to specifically bind to MM cells using CD138 and then block
CXCR4 to mobilize the cells out from the BM. With the development of CRISPR/Cas9
therapy, there is also the possibility of developing gene therapy to specifically target
CXCR4 in malignant cells. In summary, our work in MM highlights the importance of
using syngeneic models to study interactions of malignant cells with their
microenvironment and shows that CXCR4 is necessary for the retention of MM cells in
the BM.

Apart from utilizing the same signaling mechanisms as normal HSCs to establish
themselves in the BM microenvironment, malignant cells have also been shown to
remodel the BM microenvironment itself in order to promote disease development.
Prostate cancer cells have been shown to compete with normal HSCs and to directly and
indirectly drive HSC maturity so they vacate the niche (Luo et al., 2014). Disseminated
tumor cells alter the self-renewal ability of HSCs and speed up their cell cycle rate so
they emerge from dormancy and exit the niche (Shiozawa et al., 2011). Malignancies that
first arise because of intrinsic genetic changes in hematopoietic cells have been shown to
remodel the BM niche and promote disease progression (Colmone et al., 2008; Lane et
al., 2009; Raaijmakers et al., 2010; Zhang et al., 2012; Schepers et al., 2013). Live
imaging and xenotransplantation data support the idea of the leukemia induced BM niche
remodeling the normal BM microenvironment to propagate disease (Sipkins et al., 2005;
Colmone et al., 2008). Understanding the differences between normal and malignant BM

90

niches may therefore hold the key to developing non-cell-autonomous therapies for a
broad range of disorders.

B-precursor acute lymphoblastic leukemia (BPL) is a blood disorder in which pre-B cells
acquire mutations and over proliferate to cause B-cell hyperplasia. A frameshift mutation
in exon 12 of CD22 (CD22ΔE12) BPL cells has been shown to be a marker for a
leukemic stem cell (LSC) population in BPL that can escape traditional chemotherapy
(Uckun, Goodman, Ma, Dibirdik, & Qazi, 2010; Ma et al., 2012). Using CD22 transgenic
mice, we show that the BPL cells with the CD22ΔE12 mutation are able to remodel the
BM microenvironment in the pre-leukemic state to cause fatal leukemia at 6 months.
Specifically, we demonstrated a 1.5 fold increase in the primitive hematopoietic
stem/progenitor cell sub-populations in the BM of the transgenic mice expressing the
CD22ΔE12 mutation as compared to WT mice. This increase corresponded with a higher
percentage of pre-leukemic HSCs in the G1 phase as compared to WT HSCs. Analysis of
the stromal cell compartments showed a 1.85 fold increase in the percentage of
osteoblastic cells and a 4.5 fold increase in the percentage of mesenchymal stem cells in
the bone marrow of the CD22ΔE12 Tg mice as compared to WT mice. In vivo, we show
that there is 2.0 fold reduction in engraftment of wild-type cells in the BM of transgenic
mice that were yet to develop leukemia. Hence, our data shows that CD22ΔE12 pre-B
cells manipulate normal cues of the BM microenvironment to initiate disease
development to the detriment of normal hematopoiesis.

91

Many aspects of the contribution of the BM microenvironment to myeloid and lymphoid
malignancies remain to be investigated. An interesting question to investigate for the
CD22ΔE12 BPL model is whether the HSCs from these transgenic mice function
normally and are able to repopulate the hematopoietic system in serial transplantation
assays. We suspect that CD22ΔE12 BPL cells secrete factors that alter the
microenvironment which in turn affects the physiology of HSCs in that nice. Another
aspect to investigate is whether these BPL cells reside in specific niches in the BM. What
has clearly emerged from current studies in murine models and correlative evidence in
human subject samples is that BM stromal changes and the formation of a self-
reinforcing malignant niche is more than a mere bystander effect of disease development
and can directly contribute to hematological malignancies.

Collectively, findings from our studies further support the importance of understanding
and identifying the interplay between cancer cells and the supportive BM
microenvironment in developing new chemotherapeutic agents for bone metastatic
cancers and hematological malignancies.

92

References

Adams, G.B. & Scadden, D.T. The hematopoietic stem cell in its place. Nature
Immunology 7, 333–337 (2006).

Alsayed, Y., Ngo, H., Runnels, J., Leleu, X., Singha, U.K., Pitsillides, C.M., Spencer,
J.A., Kimlinger, T., Ghobrial, J.M., Jia, X., Lu, G., Timm, M., Kumar, A., Côté, D.,
Veilleux, I., Hedin, K.E., Roodman, G.D., Witzig, T.E., Kung, A.L., Hideshima, T.,
Anderson, K.C., Lin, C.P. & Ghobrial, I.M. Mechanisms of regulation of CXCR4/SDF-1
(CXCL12)-dependent migration and homing in multiple myeloma. Blood 109, 2708–
2717 (2007).

Anderson, K.C. New insights into therapeutic targets in myeloma. Hematology Am Soc
Hematol Educ Program 2011, 184–190 (2011).
Anderson K.C., Kyle R.A., Dalton W.S., et al. Multiple Myeloma: new insights and
therapeutic approaches. Hematology Am Soc Hematol Educ Program 2000, 147-165
(2000).
Azab, A.K., Runnels, J.M., Pitsillides, C., Moreau, A., Azab, F., Jia, X., Ghobrial, I.M.
CXCR4 inhibitor AMD3100 disrupts the interaction of multiple myeloma cells with the
bone marrow microenvironment and enhances their sensitivity to therapy. Blood 113(18),
4341–4351 (2009).

Bataille R., Harousseau J.L.. Multiple myeloma. N Engl J Med 336, 1657–1664 (1997).

Becker, A., McCulloch, E., Till, J. Cytological demonstration of the clonal nature of
spleen colonies derived from transplanted mouse marrow cells. Nature 197, 452–454
(1963).

Brassesco M.S., et al. Cytogenetic and molecular analysis of MLL rearrangements in
acute lymphoblastic leukemia survivors. Mutagenesis 24,153–60 (2009).
Bydlowski, S.P., Levy, D., Ruiz, J.M.L., & Pereira, J. Hematopoietic Stem Cell Niche :
Role in Normal and Malignant Hematopoiesis. 2010.
Calvi, L.M., Adams, G.B., Weibrecht, K.W., Weber, J.M., Olson, D.P., Knight, M.C.,
Martin, R.P., Schipani, E., Divieti, P., Bringhurst, F.R., Milner, L.A., Kronenberg, H.M.
& Scadden, D.T. Osteoblastic cells regulate the haematopoietic stem cell niche. Nature
425, 841–846 (2003).
Cambier, J. C., Gauld, S. B., Merrell, K. T., & Vilen, B. J. B-cell anergy: from transgenic
models to naturally occurring anergic B cells? Nat Rev Immunol 7(8), 633–643 (2007).

93

Chessels J.M., Harrison C.J., Watson S.L., Vora A.J., Richards S.M. Treatment of infants
with lymphoblastic leukemia: Results of the UK Infant Protocols 1987–1999. Brit J
Haematol 117, 306–314 (2002).

Chuk M.K., McIntyre E., Small D., Brown P. Discordance of MLL-rearranged (MLL-R)
infant acute lymphoblastic leukemia in monozygotic twins with spontaneous clearance of
preleukemic clone in unaffected twin. Blood 113, 6691–6694 (2009).

Clark E.A. CD22, a B cell-specific receptor, mediates adhesion and signal transduction. J
Immunol 150, 4715–4718 (1993).
Colmone, A., Amorim, M., Pontier, A. L., Wang, S., Jablonski, E., & Sipkins, D.
Leukemic Cells Create Bone Marrow Niches That Disrupt the Behavior of Normal
Hematopoietic Progenitor Cells. Science 322, 1861–1865 (2008).
Cornall R.J., et al. Polygenic autoimmune traits: Lyn, CD22 and SHP-1 are limiting
elements of a biochemical pathway regulating BCR signaling and selection. Immunity 8,
497–508 (1998)

Cyster J.G., Ansel K.M., Reif K., et al. Follicular stromal cells and lymphocyte homing
to follicles. Immunol Rev. 176, 181-193 (2000).
Damiano J.S., Cress A.E., Hazlehurst L.A., Shtil A.A., Dalton W.S. Cell adhesion
mediated drug resistance (CAM-DR): role of integrins and resistance to apoptosis in
human myeloma cell lines. Blood 93,1658-1667 (1999).
Damiano J.S., Dalton W.S. Integrin-mediated drug resistance in multiple myeloma. Leuk
Lymphoma 38, 71-81 (2000).
Ellis, S. L. et al. The relationship between bone, hemopoietic stem cells, and vasculature.
Blood 118, 1516–1524 (2011).
Foudi, A., Jarrier, P., Zhang, Y., Wittner, M., Geay, J.-F., Lecluse, Y., Nagasawa, T.,
Vainchenker, W. & Louache, F. Reduced retention of radioprotective hematopoietic cells
within the bone marrow microenvironment in CXCR4-/- chimeric mice. Blood 107,
2243–2251 (2006).
Garrett I.R., Dallas S., Radl J., Mundy G.R. A murine model of myeloma bone disease.
Bone 20, 515 (1997).

Gazitt Y., Callander N., Freytes C.O., et al. Peripheral blood stem cell mobilization with
cyclophosphamide in combination with G-CSF, GM-CSF, or sequential GM-CSF/G-CSF
in non-Hodgkin’s lymphoma patients: a randomized prospective study. J Hematother
Stem Cell Res. 9(5), 737–748 (2000).

Gazitt Y., Freytes C.O., Akay C., Badel K., Calandra G. Improved mobilization of
peripheral blood CD34+ cells and dendritic cells by AMD3100 plus granulocyte-colony-

94

stimulating factor in non-Hodgkin’s lymphoma patients. Stem Cells Dev. 16(4), 657–666
(2007).
Ghobrial I.M., Leleu X., Hatjiharissi E., et al. Emerging drugs in multiple myeloma.
Expert Opin Emerg Drugs 12,155-163 (2007).
Gloeckler Ries L, Mortality CC, In: Reis LAG, Smith SM, Gurney JG, et al (eds). Cancer
Incidence and Survival among Children and Adolescents: SEER Program 1975-1995.
NIH 99–4649, 165–170 (1999).

Guerrouahen B.S., Al-hijji I.,Tabrizi A.R.. Osteoblastic and vascular endothelial niches,
their control on normal hematopoietic stem cells, and their consequences on the
development of leukemia. Stem Cells Int. 2011.
Harousseau J.L. Stem cell transplantation in multiple myeloma (0, 1, or 2). Curr Opin
Oncol. 17, 93-98 (2005).
Harwood N.E., Batista F.D. Early events in B cell activation. Annu Rev Immunol 28,
185–210 (2010).
Hazlehurst L., Damiano J., Buyuksal I., Pledger W., Dalton W. Oncogene 19, 4319-4327
(2000).
Hideshima T., Chauhan D., Hayashi T., et al. The biological sequelae of stromal cell-
derived factor-1alpha in multiple myeloma. Mol Cancer Ther. 1, 539-544 (2002).
Hilden J.M., et al. Analysis of prognostic factors of acute lymphoblastic leukemia in
infants: Report on CCG 1953 from the Children’s Oncology Group. Blood 108, 441–451
(2006).

Huber, T.L., Kouskoff, V., Fehling, H.J., Palis, J. & Keller, G. Haemangioblast
commitment is initiated in the primitive streak of the mouse embryo. Nature 432, 625–
630 (2004).

Iriuchishima H., Takubo K., Miyakawa Y., Nakamura-Ishizu A., Miyauchi Y., Fujita N.,
et al. Neovascular Niche for Human Myeloma Cells in Immunodeficient Mouse Bone.
PLoS ONE 7(2), e30557 (2012).

Jones D.L., Wagers A.J. No place like home: anatomy and function of the stem cell
niche. Nat Rev Mol Cell Biol. 9(1), 11–21 (2008).

Juarez J. and Bendall L. SDF-1 and CXCR4 in normal and malignant hematopoiesis.
Histol Histopathol 19, 299–309 (2004).

Kaatsch P. Epidemiology of childhood cancer. Cancer Treat Rev 36, 277–285 (2010).

95

Kawabata, K., Ujikawa, M., Egawa, T., Kawamoto, H., Tachibana, K., Iizasa, H.,
Katsura, Y., Kishimoto, T. & Nagasawa, T. A cell-autonomous requirement for CXCR4
in long-term lymphoid and myeloid reconstitution. Proc. Natl. Acad. Sci. U.S.A. 96,
5663–5667 (1999).
Kiel M.J., Morrison S.J. Uncertainty in the niches that maintain haematopoietic stem
cells. Nat Rev Immunol. 8, 290–301 (2008).

Ko R.H., Ji L., Barnette P., Bostrom B., Hutchinson R., Raetz E., Seibel N.L., Twist C.J.,
Eckroth E., Sposto R., Gaynon P.S., Loh M.L. Outcome of patients treated for relapsed or
refractory acute lymphoblastic leukemia: A Therapeutic Advance in Childhood Leukemia
Consortium study. J Clin Oncol 28, 648–654 (2010).

Kollet O., Spiegel A., Peled A., Petit I., Byk T., Hershkoviz R., et al. Rapid and efficient
homing of human CD34(+)CD38(-/low)CXCR4(+) stem and progenitor cells to the bone
marrow and spleen of NOD/ SCID and NOD/SCID/B2m(null) mice. Blood 97, 3283–91
(2001).

Kosaka Y., et al. Infant acute lymphoblastic leukemia with MLL gene rearrangements:
outcome following intensive chemotherapy and hematopoietic stem cell transplantation.
Blood 104, 3527–3534 (2004).

Kumar, S.K., Rajkumar, S.V., Dispenzieri, A., Lacy, M.Q., Hayman, S.R., Buadi, F.K.,
Zeldenrust, S.R., Dingli, D., Russell, S.J., Lust, J.A., Greipp, P.R., Kyle, R.A. & Gertz,
M.A. Improved survival in multiple myeloma and the impact of novel therapies. Blood
111, 2516–2520 (2008).

Larsson, J., & Karlsson, S. The role of Smad signaling in hematopoiesis. Oncogene 24,
5676–5692 (2005).
Lane, S.W., Scadden, D.T., and Gilliland, D.G. The leukemic stem cell niche: current
concepts and therapeutic opportunities. Blood 114, 1150–1157 (2009).
Lapidot, T., Dar, A. & Kollet, O. How do stem cells find their way home? Blood 106,
1901–1910 (2005).
Law CL, Aruffo A, Chandran KA, Doty RT, Clark EA. Ig domains 1 and 2 of murine
CD22 constitute the ligand-binding domain and bind multiple sialylated ligands
expressed on B and T cells. J Immunol 155, 3368–3376 (1995).

Law CL, et al. CD22 associates with protein tyrosine phosphatase 1C, Syk, and
phospholipase C-gamma(1) upon B cell activation. J Exp Med 183, 547–60 (1996).

LeBien TW, Tedder TF. B lymphocytes: how they develop and function. Blood 112,
1570-80 (2008).

96

Li, W. et al. Primary endothelial cells isolated from the yolk sac and para-aortic
splanchnopleura support the expansion of adult marrow stem cells in vitro. Blood 102,
4345–4353 (2003).

Li, W., Johnson, S. A., Shelley, W. C. & Yoder, M. C. Hematopoietic stem cell
repopulating ability can be maintained in vitro by some primary endothelial cells. Exp.
Hematol. 32, 1226–1237 (2004).

Lilly, J., Johnson, W.E., Bunce, C.M. The haematopoietic stem cell niche: new insights
into the mechanisms regulating haematopoietic stem cell behaviour. Stem Cells Int.
(2011).

Lo Celso, Lo., Fleming, H.E., Wu, J.W., Zhao, C.X., Miake-Lye, S., Fujisaki, J., Côté,
D., Rowe, D.W., Lin, C.P. & Scadden, D.T. Live-animal tracking of individual
haematopoietic stem/progenitor cells in their niche. Nature 457, 92–96 (2009).

Lord, B.I., Testa, N.G., Hendry, J.H. The relative spatial distributions of CFUs and CFUc
in the normal mouse femur. Blood 46, 65–72 (1975).

Luo, J., Lee, S., Liang, L., Huang, C.K., Li, L., Wen, S., et al. Infiltrating bone marrow
mesenchymal stem cells increase prostate cancer stem cell population and metastatic
ability via secreting cytokines to suppress androgen receptor signaling. Oncogene 33,
2768–78 (2014).

Ma, Q., Jones, D., Borghesani, P.R., Segal, R.A., Nagasawa, T., Kishimoto ,T. et al.
Impaired B-lymphopoiesis, myelopoiesis, and derailed cerebellar neuron migration in
CXCR4- and SDF-1-deficient mice. Proc Natl Acad Sci USA 95, 9448–9453 (1998).

Ma, Q., Jones, D., Springer, T.A. The chemokine receptor CXCR4 is required for the
retention of B lineage and granulocytic precursors within the bone marrow
microenvironment. Immunity 10, 463–471 (1999).

Ma, H., Qazi, S., Ozer, Z., Gaynon, P., Reaman, G. H., & Uckun, F. M. CD22 Exon 12
deletion is a characteristic genetic defect of therapy-refractory clones in paediatric acute
lymphoblastic leukaemia. British Journal of Haematology 156(1), 89–98 (2012).

Manning, L.S., Berger, J.D., O’Donoghue, H.L., Sheridan, G.N., Claringbold, P.G.,
Turner, J.H. A model of multiple myeloma: Culture of 5T33 murine myeloma cells and
evaluation of tumorigenicity in the C57BL/KaLwRij mouse. Br J Cancer 66, 1088
(1992).

Martin, T.J., Sims, N.A. Osteoclast-derived activity in the coupling of bone formation to
resorption. Trends Mol Med 11, 76-81 (2005).

Mendez-Ferrer, S., Michurina, T. V., Ferraro, F., Mazloom, A. R., Macarthur, B. D., Lira,
S. A., Scadden, D. T., Ma'ayan, A., Enikolopov, G. N. and Frenette, P. S. Mesenchymal

97

and haematopoietic stem cells form a unique bone marrow niche. Nature 466, 829-834
(2010).

Mikkola, H. K. & Orkin, S. H. The journey of developing hematopoietic stem cells.
Development 133, 3733–3744 (2006).

Mitsiades CS, Mitsiades NS, Richardon PG et al. Multiple myeloma: a prototypic disease
model for the characterization and therapeutic targeting of interactions between tumor
cells and their local microenvironment. J Cell Biochem 101 (4), 950-968 (2007).

Morrison, SJ, Weissman, IL. The long-term repopulating subset of hematopoietic stem
cells is deterministic and isolatable by phenotype. Immunity 1, 661–673 (1994).

Naka, K. et al. TGF-β–FOXO signalling maintains leukaemia-initiating cells in chronic
myeloid leukaemia. Nature 463, 676–680 (2010).

Nagasawa T, Hirota S, Tachibana K, Takakura N, Nishikawa S, Kitamura Y et al.
Defects of B-cell lymphopoiesis and bone-marrow myelopoiesis in mice lacking the CXC
chemokine PBSF/SDF-1. Nature 382, 635–638 (1996).

Nilsson, S. K., Johnston, H. M. & Coverdale, J. A. Spatial localization of transplanted
hemopoietic stem cells: inferences for the localization of stem cell niches. Blood 97,
2293–2299 (2001).

O'Connell FP, Pinkus JL, Pinkus GS. CD138 (syndecan-1), a plasma cell marker
immunohistochemical profile in hematopoietic and nonhematopoietic neoplasms. Am J
Clin Pathol. 121(2), 254–63 (2004).

Oeffinger KC, Mertens AC, Sklar CA, Kawashima T, Hudson MM, Meadows AT,
Friedman DL, Marina N, Hobbie W, Kadan-Lottick NS, Schwartz CL, Leisenring W,
Robison LL. Chronic health conditions in adult survivors of childhood cancer. N Engl J
Med 355, 1572–1582 (2006).

Ohneda, O. et al. Hematopoietic stem cell maintenance and differentiation are supported
by embryonic aorta-gonad-mesonephros region-derived endothelium. Blood 92, 908–919
(1998).
Paget, S. The distribution of secondary growths in cancer of the breast. Lancet 1, 571–
573 (1889).
Pagnucco G, Cardinale G, Gervasi F. Targeting multiple myeloma cells and their bone
marrow microenvironment. Ann N Y Acad Sci. 1028, 390-399 (2004).
Podar K, Chauhan D, Anderson KC. Bone marrow microenvironment and the
identification of new targets for myeloma therapy. Leuk Off J Leuk Soc Am Leuk Res
Fund, UK. 23(1), 10-24. (2009)

98

Ponomaryov, T., Peled, A., Petit, I., Taichman, R.S., Habler, L., Sandbank, J., Arenzana-
Seisdedos, F., Magerus, A., Caruz, A., Fujii, N., Nagler, A., Lahav, M., Szyper-Kravitz,
M., Zipori, D. & Lapidot, T. Induction of the chemokine stromal-derived factor-1
following DNA damage improves human stem cell function. J. Clin. Invest. 106, 1331–
1339 (2000).
Raaijmakers, M.H., Mukherjee, S., Guo, S., Zhang, S., Kobayashi, T., Schoonmaker,
J.A., Ebert, B.L., Al-Shahrour, F., Hasserjian, R.P., Scadden, E.O., et al. Bone progenitor
dysfunction induces myelodysplasia and secondary leukaemia. Nature 464, 852–857
(2010).
Radl J, Glopper E De, Schuit HRE. Idiopathic Paraproteinemia : II . Transplantation of
the Paraprotein-Producing Clone from Old to Young C57BL / KaLwRij Mice. J Immunol
(1979).
Radl J, Zurcher C. Animal model of Multiple Myeloma. Am J Pathol. 132(3) (1988).
Ran FA, Hsu PD, Wright J, Agarwala V, Scott D a, Zhang F. Genome engineering using
the CRISPR-Cas9 system. Nat Protoc. 8(11), 2281-2308 (2013).
Reaman GH, et al. Treatment outcome and prognostic factors for infants with acute
lymphoblastic leukemia on two consecutive trials of the Children’s Cancer Group. J Clin
Oncol 17,445–455 (1999).
Richardson PG, Mitsiades CS, Hideshima T, Anderson KC. Novel biological therapies
for the treatment of multiple myeloma. Best Pract Res Clin Haematol. 18, 619-634
(2005).
Richardson PG. A review of the proteasome inhibitor bortezomib in multiple myeloma.
Expert Opin Pharmacother. 5,1321-1331 (2004).

Roodman, G.D. Biology of osteoclast activation in cancer. J. Clin. Oncol. 19, 3562–3571
(2001).

Russell T, et al. Differential expression of Ikaros isoforms in monozygotic twins with
MLL-rearranged precursor-B acute lymphoblastic leukemia. J Pediat Hematol Onc 30,
941–4 (2008).

Sanz-Rodríguez, F., Ruiz-Velasco, N., Pascual-Salcedo, D. & Teixidó, J.
Characterization of VLA-4-dependent myeloma cell adhesion to fibronectin and VCAM-
1. Br. J. Haematol. 107, 825–834 (1999).
Schepers, K., Campbell, T. B., & Passegué, E. Normal and Leukemic Stem Cell Niches:
Insights and Therapeutic Opportunities. Cell Stem Cell 16(3), 254–267 (2015).

99

Schepers, K., Pietras, E. M., Reynaud, D., Flach, J., Binnewies, M., Garg, T., …
Passegué, E. Myeloproliferative neoplasia remodels the endosteal bone marrow niche
into a self-reinforcing leukemic niche. Cell Stem Cell 13(3), 285–299 (2013).
Schofield, R. The relationship between the spleen colony-forming cell and the
haemopoietic stem cell. Blood Cells 4, 7–25 (1978).
Scott, D. W., & Gascoyne, R. D. The tumour microenvironment in B cell lymphomas.
Nature Reviews Cancer 14(8), 517–534 (2014).
Seibel NL, et al. Early postinduction intensification therapy improves survival for
children and adolescents with high risk acute lymphoblastic leukemia: A report from the
Chilren’s Oncology Group. Blood 111, 2548–2555 (2008).
Shalem O, Sanjana NE, Hartenian E, et al. Genome-Scale CRISPR-Cas9 Knockout
Screening in Human Cells. Science 343, 84-87 (2013).
Shiozawa Y, Havens AM, Jung Y, Ziegler AM, Pedersen EA, Wang J, et al. Annexin
II/annexin II receptor axis regulates adhesion, migration, homing, andgrowth of prostate
cancer. J Cell Biochem. 105, 370–80 (2008).
Shiozawa Y, Pedersen EA, Havens AM, Jung Y, Mishra A, Joseph J, et al. Human
prostate cancer metastases target the hematopoietic stem cell niche to establish footholds
in mouse bone marrow. J Clin Invest. 121, 1298–312 (2011).
Siminovitch, L, McCulloch E, Till J. The distribution of colony-forming cells among
spleen colonies. J. Cell. Comp. Physiol. 62, 327–336 (1963).
Sipkins, D.A., Wei, X., Wu, J.W., Runnels, J.M., Coˆ te´ , D., Means, T.K., Luster, A.D.,
Scadden, D.T., and Lin, C.P. In vivo imaging of specialized bone marrow endothelial
microdomains for tumour engraftment. Nature 435, 969–973 (2005).
Smith MC, Luker KE, Garbow JR, et al. CXCR4 regulates growth of both primary and
metastatic breast cancer. Cancer Res 64, 8604–8612 (2004).
Spangrude GJ, Heimfeld S, Weissman IL. Purification and characterization of mouse
hematopoietic stem cells. Science 241, 58–62 (1988).

Stanulla M, Schrappe M. Treatment of childhood acute lymphoblastic leukemia. Semin
Hematol 46(1), 52–63M (2009).

Sun L, et al. Expression of dominant-negative and mutant isoforms of the antileukemic
transcription factor Ikaros in infant acute lymphoblastic leukemia. Proc Natl Acad Sci
USA 96, 680–685 (1999).

100

Sun, J., Ramos, A., Chapman, B., Johnnidis, J.B., Le, L., Ho, Y.J., Klein, A., Hofmann,
O., Camargo, F.D. Clonal dynamics of native haematopoiesis. Nature 514, 322–327
(2014).

Sun YX, Schneider A, Jung Y, Wang J, Dai J, Wang J, et al. Skeletal localization and
neutralization of the SDF-1(CXCL12)/CXCR4 axis blocks prostate cancer metastasis and
growth in osseous sites in vivo. J Bone Miner Res. 20, 318–29 (2005).

Sun YX, Wang J, Shelburne CE, Lopatin DE, Lopatin DE, Chinnaiyan AM, Rubin MA,
et al. Expression of CXCR4 and CXCL12 (SDF-1) in human prostate cancers (PCa) in
vivo. J Cell Biochem. 89, 462–73 (2003).

Tachibana K, Hirota S, Iizasa H, Yoshida H, Kawabata K, Kataoka Y et al. The
chemokine receptor CXCR4 is essential for vascularization of the gastrointestinal tract.
Nature 393: 591–594 (1998).

Taichman RS. Blood and bone: two tissues whose fates are intertwined to create the
hematopoietic stem-cell niche. Blood 105,2631–9 (2005).

Taichman RS, Cooper C, Keller ET, Pienta KJ, Taichman NS, McCauley LK. Use of the
stromal cell-derived factor-1/CXCR4 pathway in prostate cancer metastasis to bone.
Cancer Res 62,1832–7 (2002).

Taichman R.S., Emerson S.G. Human osteoblasts support hematopoiesis through the
production of granulocyte colony-stimulating factor. J. Exp. Med. 179, 1677–1682
(1994).

Taichman, R.S., Reilly, M.J. & Emerson, S.G. Human osteoblasts support human
hematopoietic progenitor cells in vitro bone marrow cultures. Blood 87, 518–524 (1996).

Tedder TF, Poe JC, Haas KM. CD22:Amultifunctional receptor that regulatesB
lymphocyte survival and signal transduction. Advances in immunology 88, 1–50 (2005).

Tedder TF, Tuscano J, Sato S, Kehrl JH. CD22, a B lymphocyte-specific adhesion
molecule that regulates antigen receptor signaling. Annual review of immunology 15,
481–504 (1997).

Tedder TF, Poe JC, Haas KM. CD22: A multifunctional receptor that regulates B
lymphocyte survival and signal transduction. Advances in immunology 88, 1–50. 7
(2005).

Teicher, B. a, & Fricker, S. P. CXCL12 (SDF-1)/CXCR4 pathway in cancer. Clinical
Cancer Research : An Official Journal of the American Association for Cancer Research,
16(11), 2927–31 (2010).

101

Tomizawa D, et al. Outcome of recurrent or refractory acute lymphoblastic leukemia in
infants with MLL gene rearrangements: A report from the Japan Infant Leukemia Study
Group. Pediatr Blood Cancer 52, 808–13 (2009).

Trigg ME, et al. Ten-year survival of childrenwith acute lymphoblastic leukemia: A
report from the Children’s Oncology Group. Leukemia Lymphoma 49,1142–54 (2008).

Uckun FM, et al. Clinical significance of MLL-AF4 fusion transcript expression in the
absence of a cytogenetically detectable t (4; 11)(q21; q23) chromosomal translocation.
Blood 92, 810–821 (1998).

Uckun, F. M., Goodman, P., Ma, H., Dibirdik, I., & Qazi, S. CD22 EXON 12 deletion as
a pathogenic mechanism of human B-precursor leukemia. Proceedings of the National
Academy of Sciences of the United States of America 107(39), 16852–7 (2010).

Uckun, F. M., Ma, H., Cheng, J., Myers, D. E., & Qazi, S. CD22ΔE12 as a molecular
target for RNAi therapy. British Journal of Haematology (2015).

Walkley C.R, Olsen G.H, Dworkin S, Fabb S.A, Swann J, McArthur G.A, Westmoreland
S.V, Chambon P, Scadden D.T, Purton L.E. A Microenvironment-Induced
Myeloproliferative Syndrome Caused by Retinoic Acid Receptor gamma Deficiency.
Cell 129, 1097–1110 (2007).

Wang J, Shiozawa Y, Wang Y, Wang Y, Jung Y, Pienta KJ, et al. The role of
CXCR7/RDC1 as a chemokine receptor for CXCL12/SDF 1 in prostate cancer. J Biol
Chem. 283,4283–94 (2008).
Wang L. D., Wagers A. J. Dynamic niches in the origination and differentiation of
haematopoietic stem cells. Nat. Rev. Mol. Cell Biol. 12, 643–655 (2011).
W.M. Kuehl, P.L. Bergsagel. Multiple myeloma: evolving genetic events and host
interactions. Nat Rev Cancer 2, 175–187 (2002).

Wolf, N.S. Dissecting the hematopoietic microenvironment. I. Stem cell lodgment and
commitment, and the proliferation and differentiation of erythropoietic descendants in the
S1-S1d mouse. Cell Tissue Kinet 7, 89–98 (1974).
Xie, Y., Yin, T., Wiegraebe, W., He, X.C., Miller, D., Stark, D., Perko, K., Alexander,
R., Schwartz, J., Grindley, J.C., Park, J., Haug, J.S., Wunderlich, J.P., Li, H., Zhang, S.,
Johnson, T., Feldman, R.A. & Li, L. Detection of functional haematopoietic stem cell
niche using real-time imaging. Nature 457, 97–101 (2009).
Yamaguchi H, et al. Multistep pathogenesis of leukemia via the MLL-AF4 chimeric
gene/Flt3 gene tyrosine kinase domain (TKD)-mutation-related enhancement of S100A6
expression. Exp Hematol 37, 701–714 (2009).

102

Yamazaki S, Iwama A, Takayanagi S et al. TGF-β as a candidate bone marrow niche
signal to induce hematopoietic stem cell hibernation. Blood 113(6), 1250–1256 (2009).

Yin T, Li L. The stem cell niches in bone. J Clin Invest. 116, 1195–201 (2006).
Zhang, B., Ho, Y.W., Huang, Q., Maeda, T., Lin, A., Lee, S.U., Hair, A., Holyoake, T.L.,
Huettner, C., and Bhatia, R. Altered microenvironmental regulation of leukemic and
normal stem cells in chronic myelogenous leukemia. Cancer Cell 21, 577–592 (2012).
Zhang, J., Niu, C., Ye, L., Huang, H., He, X., Tong, W.-G., Ross, J., Haug, J., Johnson,
T., Feng, J.Q., Harris, S., Wiedemann, L.M., Mishina, Y. & Li, L. Identification of the
haematopoietic stem cell niche and control of the niche size. Nature 425, 836–841
(2003).

Zou YR, Kottmann AH, Kuroda M, Taniuchi I, Littman DR. Function of the chemokine
receptor CXCR4 in haematopoiesis and in cerebellar development. Nature 393, 595–599
(1998).

Zuna J, et al. Covert preleukemia driven by MLL gene fusion. Genes Chromosomes
Cancer 48, 98–107 (2009).

Abstract (if available)

Abstract Hematopoietic stem cells (HSCs) are pluripotent stem cells that balance self-renewal and differentiation in order to support lifelong hematopoiesis. HSCs are able to maintain this balance through cues from the bone marrow (BM) stem cell niches in which they reside. Recently, it has been shown that abnormal cells in hematological malignancies can utilize and manipulate the same signals in order to promote disease development. We investigated the role of the BM microenvironment components in B-cell malignancies. B cell tumors are composed of normal B cells that have gone awry at different stages of differentiation, maturation and activation. It is hypothesized that these abnormal B cells utilize the same mechanisms as their normal counterparts to promote disease. We used mouse models of two types of B-cell cancers which involve B cells at different stages of development: multiple myeloma (MM), which affects differentiated plasma cells and B-precursor acute lymphoblastic leukemia (BPL), which affects immature B cell precursors. In MM, the peripheral lymphoid organs are spared and the disease is mainly restricted to the BM, even though the clonal founder cell is of peripheral origin. This could be because the malignant cells remember pathways and microenvironments preferred by their normal counterparts or because the BM microenvironment actively recruits and restricts malignant cells irrespective of what happens under homeostasis. In either case, the BM destination clearly underlies the specific need of these malignant cells for an external supportive environment. The stromal cell derived factor-1α (SDF-1α)/CXCR4 axis is one of the most studied interactions in hematopoiesis and has been shown to be essential for the retention of HSCs in the BM as well as play a role in the localization of normal plasma cells in the BM. Previous studies have shown that the SDF-1α/CXCR4 interaction is important in the homing of MM cells to the bone marrow but this data was acquired using xenograft models. We hypothesized that MM cells use the SDF-1α/CXCR4 axis to retain abnormal plasma cells in the BM which leads to development of incurable disease. Using CRISPR/Cas9 genome engineering technology and a syngeneic mouse model of MM, we showed that CXCR4 is not necessary for the homing of MM cells to the BM. Instead, the SDF-1α/CXCR4 interaction is necessary for the retention of MM cells in the BM and inoculation of CXCR4 knock-out (KO) MM cells in recipient mice failed to cause disease. Next, we showed that the BM microenvironment plays an active role in the development of cancers such as BPL that involves immature, and hence more primitive, B cells. Previous work has shown that leukemic stem cells (LSCs) in BPL are characterized by a CD22 frameshift mutation in exon 12 (CD22ΔE12) that makes them resistant to chemotherapy. Forced expression of the mutant CD22ΔE12 protein in transgenic mice perturbs B-cell development, as evidenced by B-precursor/B-cell hyperplasia and corrupts the regulation of gene expression. We showed that the presence of this mutation in pre-leukemic mice affects the number of mesenchymal stem cells (MSCs) and the BM is unable to support normal HSCs leading to lower engraftment in transplantation experiments. Taken together, our studies showcase the role of the BM microenvironment in B-cell malignancies and highlight the importance of developing therapies that target the interaction of the malignant cells with their surrounding microenvironment.

Linked assets

University of Southern California Dissertations and Theses

Conceptually similar

PDF

The calcium-sensing receptor in the specification of normal and malignant hematopoietic cell localization in the bone marrow microenvironment

PDF

Regional localization and regulation of hematopoietic stem cells in the bone marrow stem cell niche

PDF

The role of endoplasmic reticulum chaperones in regulating hematopoietic stem cells and hematological malignancies

PDF

Effects of parathyroid hormone analogues on hematopoietic stem cell niche potential of bone-marrow mononuclear cells

PDF

Identification and characterization of adult stem cells in the oral cavity

PDF

Generation and characterization of anti-CD138 chimeric antigen receptor T (CAR-T) cells for the treatment of hematologic malignancies

PDF

Dissecting the heterogeneity of mouse hematopoietic stem cells in vivo

PDF

Study of bone morphogenetic protein-2 and stromal cell derived factor-1 in prostate cancer

PDF

The role of miRNA and its regulation in pulmonary hypertension in sickle cell disease

PDF

Rational selection of CRISPR/Cas9 guide RNAs for homology directed genome editing and its utility in the development of gene therapies

PDF

Interaction of epigenetics and SMAD signaling in stem cells and diseases

PDF

Exploration of the roles of cancer stem cells and survivin in the pathogenesis and progression of prostate cancer

PDF

The cancer stem-like phenotype: therapeutics, phenotypic plasticity and mechanistic studies

PDF

The role of a novel integrin activator in the maintenance of stem cell niche and activity-induced synaptic structural modifications in Drosophila

PDF

From mesenchymal stem cell therapy to discovery of drug therapy for systemic sclerosis

PDF

The role of endoplasmic reticulum protein GRP78 in normal hematopoeises and PTEN-null leukemogenesis

PDF

The noncanonical role of telomerase in prostate cancer cells: exploring a non-telomeric signaling role for telomerase protein (TERT) in a cancer cell line

PDF

Role of integrin α4 in drug resistant acute lymphoblastic leukemia

PDF

The role of adipocytes in acute lymphoblastic leukemia cell migration and survival against daunorubicin

PDF

A novel role for hypoxia-inducible factor-1alpha (HIF-1alpha) in the regulation of inflammatory chemokines and leukotriene expression in sickle cell disease

Asset Metadata

Creator Jain, Sapna Shah (author)

Core Title Role of the bone marrow niche components in B cell malignancies

School Keck School of Medicine

Degree Doctor of Philosophy

Degree Program Genetic, Molecular and Cellular Biology

Publication Date 09/24/2015

Defense Date 06/03/2015

Publisher University of Southern California (original), University of Southern California. Libraries (digital)

Tag B cell,Bone Marrow,CD22,CRISPR/Cas9,CXCR4,hematopoietic stem cells,leukemia,multiple myeloma,niche,OAI-PMH Harvest,SDF1

Format application/pdf (imt)

Language English

Contributor Electronically uploaded by the author (provenance)

Advisor Ying, Qilong (committee chair), Adams, Gregor B. (committee member), Kobielak, Krzysztof (committee member), Merchant, Akil (committee member)

Creator Email sapnasha@usc.edu

Permanent Link (DOI) https://doi.org/10.25549/usctheses-c40-186866

Unique identifier UC11274350

Identifier etd-JainSapnaS-3952.pdf (filename),usctheses-c40-186866 (legacy record id)

Legacy Identifier etd-JainSapnaS-3952.pdf

Dmrecord 186866

Document Type Dissertation

Format application/pdf (imt)

Rights Jain, Sapna Shah

Type texts

Source University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Access Conditions The author retains rights to his/her dissertation, thesis or other graduate work according to U.S. copyright law. Electronic access is being provided by the USC Libraries in agreement with the a...

Repository Name University of Southern California Digital Library

Repository Location USC Digital Library, University of Southern California, University Park Campus MC 2810, 3434 South Grand Avenue, 2nd Floor, Los Angeles, California 90089-2810, USA