University of Southern California Dissertations and Theses

RUNX2 & sex steroids: molecular mechanisms in regulating bone turnover

(USC Thesis Other)

RUNX2 & sex steroids: molecular mechanisms in regulating bone turnover

PDF

Download a page range

Download transcript

Copy asset link

Request this asset

Transcript (if available)

Content

RUNX2 & SEX STEROIDS:
MOLECULAR MECHANISMS IN REGULATING BONE TURNOVER

by

Anthony Martin

A Dissertation Presented to the
FACULTY OF THE GRADUATE SCHOOL
UNIVERSITY OF SOUTHERN CALIFORNIA
In Partial Fulfillment of the
Requirements of the Degree
DOCTOR OF PHILOSOPHY
(BIOCHEMISTRY AND MOLECULAR BIOLOGY)

December 2014

Copyright 2014 Anthony Martin

ii
Dedication
My dissertation dedication is especially reserved for my parents, Joe and Vina Martin,
who raised me with grace, taught me how to ride a bike, and supported my every dream.
I dedicate this dissertation to my younger sister, Therese Martin, who will always be my
dearest friend. Lastly, I dedicate this work to my late grandmother, Mommy Patao, who
inspired me in life and who continues to do so even in her absence.

iii
Acknowledgements
I would like to acknowledge all those, past and present, who have helped nurture my
training as a scientist and human being.
(I) Dr. Baruch Frenkel – for taking me under his wing and graciously providing
me mentorship and guidance in (and outside) the lab; for his optimism,
insightful conversation, patience, and generosity
(II) The Frenkel Lab – for creating an environment that fueled my scientific
curiosity and their support in my scientific training with special thanks to Jian
Xiong, Dr. Gillian Little, Dr. Chimge Nyam-Osar, Dr. Sanjeev Baniwal, Dr.
Theodora Koromila, Dr. Helty Adisetiyo, and Samantha Shi
(III) Committee Members – for their support, insightful critique, and contribution
to my scientific development
(IV) To my colleagues and collaborators at UCLA who have been gracious with
their time and reagents especially Dr. Susan Krum, Emmanuelle, and Brooke
Bogan
(V) I would like to acknowledge my colleagues and friends at USC, with
particular thanks to the administrators in PIBBS (past and present), CCMB
(especially Elsa Miranda, Michael Paine, Magdalena Morales), and those
involved in the Department of Biochemistry
(VI) Lastly, I would like to thank my undergraduate mentor, Dr. David Moffet,
who prepared me for graduate school with his encouragement, training, and
guidance in the lab.

iv
Table Of Contents
Dedication ii
Acknowledgements iii
List of Figures vi
Abstract vii
Chapter 1: Introduction
1.1 Skeletal Function & Architecture 1
1.2 The Cellular Composition of the Skeleton 2
1.2.A Bone Formation: Osteoblasts & More 3
1.2.B Bone Resorption: Osteoclasts 4
1.3 Bone Remodeling: A Developmental Narrative 5
1.4 Osteoporosis: Disruptions in Bone Remodeling 6
1.5 Sex Steroids: Mechanisms in Regulating Bone Homeostasis 7
1.5.A Proskeletal Effects of Estrogens 7
1.5.B Proskeletal Effects Androgens 9
1.6 The Duality of RUNX2 Function 11
1.7 RANKL: A Cellular Conversation 12
1.8 Dissertation Overview 14

Chapter 2: Materials & Methods

2.1 Animals 15
2.2 Reagents 15
2.3 Cell Culture 16
2.4 RNA Extraction and Analysis 17
2.5 RANKL Fluorescence Microscopy 18
2.6 Western Blot and ELISA 18

Chapter 3: Molecular Mechanisms of Estrogens

3.1 Introduction 20
3.2 Dox-inducible Runx2 expression in Newborn Mouse Calvarial
Osteoblasts (NeMCO) 21
3.3 Estradiol Antagonizes RUNX2-Mediated Osteoblast-Driven
Osteoclastogenesis 24
3.4 RUNX2 Driven RANKL Secretion 26
3.5 RUNX2-Driven RANKL Membrane Association and Attenuation
by E2 29
3.6 Selective Estrogen Receptor Modulators (SERMs) Mimic
Antagonistic Action of E2 on RUNX2-Induced Osteoclastogenesis 31

v
3.7 Discussion 33

Chapter 4: Molecular Mechanisms of Androgens

4.1 Introduction 34
4.2 DHT-Mediated Inhibition of RUNX2 Target Genes 35
4.3 DHT Counteracts Osteoclastogenesis Driven by RUNX2
Overexpressing Osteoblasts 38
4.4 Effect of DHT on RANKL Secretion in RUNX2-Overexpressing
Osteoblasts 41
4.5 Effect of DHT on RUNX2-Driven RANKL Membrane Association and
Attenuation 44
4.6 Discussion 46

Chapter 5: Overall Discussion

5.1 Summary 47
5.2 Estrogens & Osteoclastogenesis: Regulation of RANKL Trafficking 48
5.3 Androgens & Osteoclastogenesis:Regulation of RANKL Trafficking 50
5.4 Osteogenic Expression of RANKL & RUNX2 52
5.5 Effect of DHT on RUNX2-Driven RANKL Membrane Association
and Attenuation 53

References 55

vi
List of Figures

Table 2.1 Primers used for RT-qPCR 18

Figure 3.1 Characterization of NeMCO/Rx2
dox
cells 23

Figure 3.2 Estradiol Antagonizes RUNX2-Mediated Osteoblast-Driven
Osteoclastogenesis 25

Figure 3.3 RUNX2 Promotes RANKL Secretion 28

Figure 3.4 RUNX2 Promotes and E2 Antagonizes RANKL Association with the
Osteoblast Membrane 30

Figure 3.5 SERMs Attenuate RUNX2-Mediated Osteoblast-Driven
Osteoclastogenesis 32

Figure 4.1 DHT Mediated Inhibition of RUNX2 Target Genes 37

Figure 4.2 DHT Counteracts Osteoclastogenesis Driven by RUNX2
Overexpressing Osteoblasts 40

Figure 4.3 DHT Effect on RUNX2 Driven RANKL Secretion 43

Figure 4.4 RUNX2 Promotes and DHT Antagonizes RANKL Association with the
Osteoblast Membrane 45

vii
ABSTRACT
In addition to its thoroughly investigated role in bone formation, the osteoblast master
transcription factor RUNX2 also promotes osteoclastogenesis and bone resorption. Here
we demonstrate that 17β-estradiol (E2) and dihydrotestosterone (DHT), which are known
to attenuate bone turnover in vivo and RUNX2 activity in vitro, strongly inhibit RUNX2-
mediated osteoblast-driven osteoclastogenesis in co-cultures. Towards deciphering the
underlying mechanism, we induced premature expression of RUNX2 in primary murine
pre-osteoblasts, which resulted in robust differentiation of co-cultured splenocytes into
mature osteoclasts. This was attributable to RUNX2-mediated increase in RANKL
secretion, determined by ELISA, as well as to RUNX2-mediated increase in RANKL
association with the osteoblast membrane, demonstrated using confocal fluorescence
microscopy. The increased association with the osteoblast membrane was recapitulated
by transiently expressed GFP-RANKL. E2 and DHT abolished the RUNX2-mediated
increase in membrane-associated RANKL and GFP-RANKL, as well as the concomitant
osteoclastogenesis. RUNX2-mediated RANKL cellular redistribution was attributable in
part to a decrease in Opg expression with attenuation by DHT to restore Opg expression.
E2, however, did not influence Opg expression either in the presence or absence of
RUNX2. Diminution of RUNX2-mediated osteoclastogenesis by E2 occurred regardless
of whether the pre-osteoclasts were derived from wild type or estrogen receptor alpha
(ERα)-knockout mice, suggesting that activated ERα inhibited osteoblast-driven
osteoclastogenesis by acting in osteoblasts, possibly targeting RUNX2. Furthermore, the
selective ER modulators (SERMs) tamoxifen and raloxifene mimicked E2 in abrogating
the stimulatory effect of osteoblastic RUNX2 on osteoclast differentiation in the co-

viii
culture assay. Thus, E2 and DHT antagonize RUNX2-mediated RANKL trafficking and
subsequent osteoclastogenesis. Targeting RUNX2 and/or downstream mechanisms that
regulate RANKL trafficking may lead to the development of improved SERMs,
androgenic, and possibly other non-hormonal therapeutic approaches to high turnover
bone disease.

1

CHAPTER 1: INTRODUCTION

1.1 Skeletal Function & Architecture
Vertebrates characteristically possess dynamic, multifunctional endoskeletal structures
that are composed of specialized connective tissue known as bone. The mammalian
skeleton is responsible for maintaining anatomical integrity while protecting other vital
internal organs and plays an important role in facilitating locomotion (1). Furthermore,
bone functions as a reservoir for hematopoietic progenitors and organic ions, such as
calcium and phosphate, to support the production of blood and sustain mineral
homeostasis within the body (2). Bone tissue is primarily composed of mineralized
organic matrix that contains type-I collagen and a variety of non-collagenous proteins (3-
5). The deposition of collagen-based matrices within osseous tissue confers structural
flexibility while mineralization of the bone by organic material ensures tensile strength.
There are two major types of bone within the skeletal compartment including (I) cortical
and (II) trabecular bone, both of which possess unique structural properties. Cortical
bone, also known as compact bone, predominates the human skeleton’s composition
accounting for roughly 80% of the total skeletal mass and is compromised of tightly
packed cylindrical collagen fibrils known as lamellae (6,7). Osteons are the basic
structural unit of compact bone and are composed of organized concentric layers of
lamellae that surround the Haversian canal (7,8). Cortical bone porosity is limited by
nature of its condensed microarchitecture and relies on the vessels of the hematopoietic
and nervous system contained in the Haversian canal to facilitate nutrient transfusion and

2
cellular communication (7,8). Ultimately, compact bone provides the durability and
mechanical strength required to support the body.
Trabecular bone, or spongy bone, makes up the remaining portion of the skeleton and is
typically found at the ends of long bones and within the skeletal vertebrae (9). Unlike
cortical bone, the hallmark of trabecular bone structure relies on its highly developed and
porous bone matrices. Spongy bone is also composed of lamellae but is only several cell
layers thick and protrudes from the endocortical surface of compact bone into the
medullary cavity to create a branched network of osseous tissue. In comparison,
trabecular bone is significantly weaker than compact bone but the porosity of the
trabecular matrix allows for skeletal flexibility (9). Additionally, the trabecular space is
often highly vascularized and contains bone marrow serving as a site for hematopoiesis
(2). The unique characteristic of spongy bone provides an opportunity for increased
metabolic activity due to its higher surface area to mass ratio (9) . Although different, the
two types of osseous tissue work cooperatively to address the mechanical and metabolic
needs of the body.
1.2 The Cellular Composition of the Skeleton
The cells responsible for the skeletogenesis of cortical and trabecular bone include (I)
Osteoblasts (II) Osteocytes (III) Bone Lining Cells and (IV) Osteoclasts. Each cell type
possesses unique functional characteristics and contributes to the coordinated balance of
bone formation and bone resorption. Osteoblasts, bone lining cells, and osteocytes are of
mesenchymal origin and are responsible for bone formation while osteoclasts
differentiate from hematopoietic stem cells and facilitate bone resorption (7).

3
1.2.A Bone Formation: Osteoblasts & More
The process of bone formation is orchestrated by terminally differentiated osteoblasts.
These cells are derived from mesenchymal stem cells originating from the neural crest or
the mesoderm to develop craniofacial and appendicular/axial bone, respectively (10).
Osteoblasts are responsible for inducing intramembranous ossification that involves the
secretion of type-I collagen and other non-collagenous proteins, such as osteocalcin and
bone salioprotein, to generate templates of the organic bone matrix known as osteoid (3-
5). Type-I collagen accounts for 90% of the total osteoid matrix while the remaining
10% are composed of the non-collagenous proteins (7) . Osteoblasts deposit calcium and
phosphate in the form of hydroxyapatite, Ca
10
(PO
4
)
6
(OH)
2
, once the organic scaffold is
formed to generate mineralized bone tissue (3-5,7). . Active bone formation is commonly
oriented toward the bone surface. However, osteoblasts that begin to mineralize bone
with no polarized directionally will be buried within the matrix. These buried osteoblasts
are thus regarded as osteocytes and undergo further differentiation and morphological
changes to accommodate itself into the densely mineralized osteoid space (11,12).
The osteocyte is the most abundant cell in the skeleton and resides within the lacunae
where they characteristically develop elongated dendritic processes that extend through
bone canaliculi to sustain contact with neighboring cells (13). Additionally, osteocytes
establish gap junctions with adjacent cells to further establish a method for cellular
communication (14,15). Their anatomical location within the bone matrix has ascribed
their role as cellular mechanosensors that are sensitive to alterations in the bone
microenvironment (16-18). Thus, osteocytes can detect mechanical strain and
subsequently deliver signals to recruit the appropriate cells types to initiate the bone

4
remodeling process. For example, bone-lining cells behave as quiescent, naïve
osteoblasts that saturate the surfaces of the periosteal and endosteal compartments of
cortical bone and the osteonic matrix of spongy bone (7). These cells are primed by
osteocytes in response to environmental perturbations, such as microfracture, and are
activated to differentiate into mature osteoblasts to induce bone formation as described
above (16-18).
During embryogenesis, a large portion of the skeleton is generated through a process
known as endochondral ossification and is initiated by chondrocytes to produce a
majority of the long and short bones within the body (19). Chondrocytes, much like
osteoblasts, differentiate from mesenchymal progenitors but employ an alternative
method to induce skeletogenesis. Endochondral ossification begins with the biosynthesis
of cartilage templates that are later mineralized by hypertrophic chondrocytes.
Cardiovascular invasion of the mineralized cartilage matrix allows for the recruitment of
osteogenic cells, which are responsible for replacing the cartilage template with bone
(20,21).
1.2.B Bone Resorption: Osteoclasts
Bone resorption serves as a complementary process to bone formation to help manage
skeletogenesis throughout development. Osteoclasts are bone-resorbing cells that are
morphologically characterized as being large, multinucleated cells that highly express
tartrate-resistant acid phosphatase (TRAP) (22). Activated osteoclasts facilitate bone
resorption by tightly associating itself to the bone surface in a region known as the clear
zone. Here, the osteoclast utilizes adhesion molecules to associate with non-collagenous

5
proteins, such as osteopontin, in the bone matrix to properly seal off the resorption cavity
(23,24). Once bound, the osteoclast initiates the polarized invagination of its cell
membrane to form a ruffled border oriented toward the bone surface . In this region,
osteoclasts activate their secretory machinery resulting in the compartmentalized
deposition of proteases, such as Cathepsin K and other matrix metalloproteinases (MMP-
9, MMP-13), and establish a highly acidic environment to degrade the mineralized bone
matrix (24) . Bone resorption is particularly beneficial as it provides as opportunity for
the body to mobilize essential minerals to nearby organs while supporting the process of
longitudinal bone growth (25).
1.3 Bone Remodeling: A Developmental Narrative
The coordinated balance of bone formation mediated by osteoblasts and bone resorption
by osteoclasts is known as the process of bone remodeling. However, the balance of these
two processes varies markedly throughout a human’s lifespan. In early development,
bone formation and bone resorption are uncoupled and skewed in favor of increased bone
formation (7,26). This early stage of skeletogenesis is known as “bone modeling” and
occurs roughly within the first twenty years of life.
The bone remodeling process occurs during adulthood (20-50 years of age) when the rate
of bone formation and resorption are coupled and approximately equal (27). At this stage
of development, osteoblasts and osteoclasts work cooperatively in microanatomical
structures known as basic multicellular units (BMU) (27,28). Typically, the bone
remodeling process is initiated by osteoclast-mediated resorption of an existing bone
surface. Osteoblasts become primed by soluble factors locally released from the bone

6
matrix upon bone resorption and are recruited to replace the degraded extracellular matrix
with new bone. The primary objective of the skeletal system at this point in life is to
maintain bone in response to mechanically induced microfractures and sustain mineral
homeostasis in the body (25). However, in the adult life, the process of resorption
moderately exceeds that of formation accounting for a minor reduction in bone mass per
year.
The skeletons of individuals over the age of fifty continue to undergo bone remodeling
but the process becomes uncoupled to favor bone resorption (29). During this stage, the
osteoblastic potential to induce bone formation is surpassed by the osteoclastic capacity
to resorb bone. Therefore, the magnitude of bone loss per year increases significantly
resulting in pathological complications due to reduced skeletal strength and is commonly
known as osteoporosis (29).
1.4 Osteoporosis: Disruptions in Bone Remodeling
Perturbations in bone remodeling can have detrimental affects on skeletal integrity.
Latent uncoupling of bone resorption and bone formation often lead to compromised
bone strength as the rate of resorption often dominates the bone turnover process.
Osteoporosis is a disorder that is attributed to excessive bone loss in both men and
women and is characterized by weakened skeletal structure and increased susceptibility
to injury by fracture (30). Furthermore, the diagnosis of osteoporosis is commonly
measured in bone mineral density (BMD) and is generally defined as a value ≥2.5
standard deviations below the standard mean of a young female adult (29).

7
The pathogenesis of primary osteoporosis is age-dependent and often begins
subsequently after the development of peak bone mass in early adulthood with continued
bone loss throughout life (31). Additionally, environmental and behavioral factors such
as alcohol abuse, exposure to certain medications, and disease can exacerbate the onset of
osteoporosis in older adults (32). The incidence of osteoporosis in the United States is
growing and is projected that in a decade from now nearly half the American population
over the age of fifty will develop osteoporosis predominately in the hip or vertebrae (34).
An additional factor that contributes a significant risk for a pathological decrease of
BMD in adults is gender, where women are more likely to develop skeletal complications
in comparison to men (29). The gender imbalance of osteoporosis prevalence in women
is associated with the decline of estrogen levels at menopause providing evidence for the
contribution that sex steroids make to manage skeletal health (35,36).
1.5 Sex Steroids: Mechanisms in Regulating Bone Homeostasis
The molecular constraints imposed by the body to regulate adult bone turnover often
involve sex hormones including estrogens and androgens (33,37,38). Both these sex
steroids possess bone sparing properties and loss of either, particularly estrogen in
women; have adverse affects on skeletal maintenance.
1.5.A Proskeletal Effects of Estrogens
Estrogens provide potent molecular signals that are responsible for ensuring coordinated
skeletogenesis in early development while protecting adult osseous tissue from
unregulated bone formation and resorption (37-39). The proskeletal mechanisms of
estrogens rely on the activation of estrogen receptor (ER) in various bone-specific cell

8
types. There are two unique classes of nuclear hormone estrogen receptors (ERα, ERβ)
that are ubiquitously expressed and have distinct (sometimes exclusive) properties in
various tissues (40,41). Both ERα and ERβ are expressed in bone cells but estrogen
receptor knockout studies in ovariectomized (OVX) female mice revealed that activated
ERα is specifically responsible regulating bone metabolism (42,43).
Postmenopausal osteoporosis, a hypogonadism-induced disorder, inflicts a pathological
fracture on two in every five women over the age of fifty (34). Accelerated loss of
trabecular and cortical bone mass upon the dramatic decrease in circulating estrogen
levels in postmenopausal women clearly demonstrate the bone sparing properties of
estrogens (44). The diminished skeletal strength in these women is mostly attributable to
reduced activity of estrogen receptor α (ERα) in osteoblasts and osteoclasts (45).
Accordingly, estrogens and selective estrogen receptor modulators (SERMs) constitute
viable therapeutic options for the preservation of bone mass in postmenopausal women,
and some SERMs have beneficial effects on the skeleton when used for the management
of breast cancer (46).
The estrogenic mechanisms that restrict bone turnover involve both genomic and non-
genomic actions that either directly limits the proliferative and differentiation potential of
osteoblasts and osteoclasts, respectively, or indirectly targets other downstream
molecular signals emanating from the cells. Notably, loss of estrogen in ovariectomized
mice unleashed the aberrant proliferation of osteoblast progenitors while 17β-estradiol
(E2) treatment restrained the self-renewing capacity of these cells (47,48). These
findings are consistent with the physiological observation made in postmenopausal

9
women that showed an increase in both bone resorption and bone formation (37,39). The
regulation of mesenchymal progenitor proliferation by estrogens to manage the influence
osteoblasts have on stimulating osteoclastogenesis further illustrating the coupling of
bone formation to bone resorption.
An additional osteoblastic mechanism induced by estrogens that affects the survival of
osteoclasts involves the production of the pro-apoptotic molecule, Fas Ligand (FasL).
ERα activation by E2 treatment stimulates the expression of FasL in primary osteoblasts
resulting in increased cell death of co-cultured osteoclasts (49). However, it is important
to acknowledge the contribution that estrogens have on osteoclasts to induce expression
FasL themselves to initiate an autocrine, self-apoptotic mechanism (50,51).
1.5.B Proskeletal Affects of Androgens
Reduced occurrence of osteoporosis in men in comparison to postmenopausal women is
attributable to their sustained hormonal balance throughout life (52). In fact, protection
of the male skeleton from excessive bone loss relies on the dualistic action of androgens
to stimulate aromatase-dependent and independent mechanisms.
The aromatase-dependent approach that supports skeletal integrity in males depends on
the activation of ERα through the enzymatic conversation of testosterone to estradiol
(52). Observations of osteoporosis resulting from defective ERα activity (53) or from
deficiency of aromatase (54-59) further highlight the importance of ERα-mediated
regulation of bone turnover in males. Additionally, osteoporotic men with abrogated

10
aromatase activity benefit from estrogen treatment resulting in the reconstitution of bone
mass (60,61).
The proskeletal mechanisms of ERα activation observed in women, as previously
discussed, are also relevant to male skeletal physiology. The phenomenon of
postmenopausal osteoporosis was mimicked in men through the induction of
hypogonadism by drug treatment followed by hormone replacement therapy to observe
how AR or ERα could alter bone metabolism (33). The study concluded that the
combinatorial reactivation of both AR and ERα most effectively improved the
compromised skeletal phenotype, thus illustrating the necessity of both hormones to
preserve bone in adult males (33).
Validation for the aromatase-independent actions of androgens that maintain male
skeletons comes from studies that revealed that testosterone was capable in preventing
bone loss in orchiectomized, aromatase deficient male mice (62,63). Furthermore,
conditional knockout of AR in mouse osteoblasts driven by Type-1 Collagen-Cre (64) or
Osteocalcin-Cre (65) showed significant loss of bone while male mice engineered to
overexpress AR in osteoblasts experienced normal bone metabolism (66). Therefore, AR
can potentially attenuate bone turnover by regulating osteoblast activity through (1)
analogous mechanisms employed by ERα involving a transcription factor known as
Runx2 (67) or through (2) other unique molecular actions.

11
1.6 The Duality of RUNX2 Function
RUNX2, a mammalian transcription factor, is a member of the Runt-related gene family
and shares homology with RUNX1 and RUNX3, which are involved in hematopoietic
and gastrointestinal development, respectively (68). Expression of RUNX2 is essential
in facilitating the lineage commitment of mesenchymal progenitors to differentiate into
mature osteoblasts (69-71). RUNX2 contains a Runt-DNA binding domain that is
capable of forming heterodimers with CBFB, a co-activator, to initiate target gene
transcription (72-74). The C-terminal region of RUNX2 contains the PST domain that
serves as a docking site for co-repressors such as estrogen receptor alpha (ERα) and
androgen receptor (AR) (75,76). Lastly, the QA domain is located at the N-terminal
region of RUNX2 and acts to stabilize RUNX2’s transcriptional potential (72-74) .
Runx2, also known as Cbfa1, Pebp2aA, or AML-3, is classically identified as an
osteoblast master regulator that is required for bone formation. Initially identified based
on its interaction with the bone-specific Osteocalcin promoter in vitro (69,77,78), the
pivotal role of Runx2 in osteogenesis in vivo was demonstrated by the absence of
differentiated osteoblasts and failure of skeletal mineralization in Runx2-deficient mice
(70,71). Furthermore, inhibition of Runx2 in vitro abrogates expression of osteoblast
markers, and its forced expression in non-osteoblasts induces bone-like cellular
phenotypes (69,78).
Contrasting the role of Runx2 as a master regulator of osteoblast differentiation and
embryonic bone development, its function in bone resorption is less appreciated. Over-
expression of Runx2 in mouse osteoblasts in vivo resulted in low bone mass and

12
spontaneous fractures (79,80). Conversely, inhibition of Runx2 in osteoblasts by
expression of a dominant-negative (DN) isoform led to a high bone mass phenotype (81).
Although the Komori lab provided evidence suggesting cell autonomous inhibition of
terminal osteoblast differentiation by improper levels and timing of Runx2 expression
(68,79), evidence from this and other groups demonstrate that the negative effect of
Runx2 on bone mass is attributable at least in part to RUNX2-mediated osteoblast-driven
osteoclastogenesis (79-83).
1.7 RANKL: A Cellular Conversation
Regulation of osteoclastogenesis by osteoblasts constitutes a fundamental principle in the
coupling of bone resorption to bone formation (84). Among osteoblast-borne signals
mediating this coupling is the quintessential factor, RANK ligand (RANKL) (85-87).
RANKL, a member of the tumor necrosis factor (TNF) cytokine superfamily, is a type II
transmembrane protein that is expressed in skeletal and various extraskeletal cells
including osteoblasts (87,88) and lymphocytes (89), respectively. The primary function
of RANKL is associated with osteoclast formation and is required to sustain osteoclast
differentiation and survival (85,86). Osteoclastogenesis is also supported by macrophage
colony-stimulating factor (M-CSF) whose role is involved in stimulating hematopoietic
progenitor proliferation and osteoclast lineage commitment (90).
RANKL exists in two forms: (I) membrane-bound and (II) soluble form (86,91). The
latter form of RANKL is produced upon proteolyic cleavage of membrane-bound
RANKL by proteinases including MMP14 through a process known as RANKL shedding
(92). Additionally, RANKL has also been shown to sequester into lysosomal organelles

13
within osteoblastic cells but is destined for secretion upon stimulation by RANKL’s
corresponding receptor, RANK, found on the osteoclast plasma membrane (93). Both the
membrane-bound and soluble form of RANKL can induce osteoclastogenesis (86,91) but
cell-to-cell contact between osteoblastic and osteoclast precursors through membrane-
bound RANKL/RANK, respectively, most effectively facilitates osteoclast activation
(94).
Regulation of osteoclastogenesis occurs through the binding of RANKL to a soluble
decoy receptor known as Osteoprotegrin (OPG) and is produced by cells of the
osteoblastic lineage (86). In certain instances, estrogens (95) and androgens (96,97) have
been shown to attenuate osteoclastogenesis by stimulating the production of OPG or
inhibiting RANKL synthesis. Specifically, the increased RANKL presentation on the
surface of osteoblasts from postmenopausal women is opposed by estrogen therapy and
in premenopausal women (89).
Because RUNX2 plays a critical role in osteoblast-driven osteoclastogenesis, further
understanding of the link between RUNX2 and RANKL might help elucidate
mechanistic explanations for the coupling of bone formation to bone resorption.
Although RUNX2 can increase RANKL mRNA levels in smooth muscle cells (98),
stimulation of osteoclastogenesis by RUNX2 does not appear to involve the regulation of
Rankl mRNA levels in osteoblasts (83,99,100). Indeed, using primary osteoblast
cultures, the present work demonstrates that RUNX2 influences RANKL through
regulating its trafficking to the cell membrane without affecting its mRNA expression.

14
1.8 Dissertation Overview
A common physiological phenomenon of early bone loss following menopause is the
mirrored increase in both bone resorption and formation (37,39). Based on our previous
study demonstrating direct inhibition of RUNX2 activity by ERα (75), I hypothesized
that activation of ERα in osteoblasts attenuates RUNX2-driven osteoclastogenic signal(s)
and that loss of estrogens at menopause unleashed RUNX2 in osteoblasts to drive
exaggerated osteoclastogenesis. In support of this hypothesis, expression of a DN
RUNX2 isoform in murine osteoblasts resulted not only in increased bone mass as
described above, but also in resistance to ovariectomy-induced bone loss (81).
Furthermore, the activation of androgen receptor (AR) by testosterone can also provide
additional molecular constraints to regulate bone turnover (37,39). Similar to our report
on ERα (75), I previously showed that AR also interacts directly with RUNX2 (76) to
abrogate its activity and hypothesized that osteoblastic AR can attenuate RUNX2-
mediated osteoblast-driven osteoclastogenesis. Indeed, this dissertation shows that both
estrogen and androgen signaling in osteoblasts abrogates RUNX2-mediated RANKL
membrane association and differentiation of co-cultured splenocytes into mature
osteoclasts.

15

CHAPTER 2: MATERIALS & METHOD

2.1 Animals
C57BL/6; JAX® mice from Jackson Laboratory (Sacramento, CA) were used for the
extraction of both osteoblasts and splenocytes without regard to mouse gender.
Splenocytes were isolated from either wild type or ERα knockout (ERKO)
animals. Mice were housed in microisolator-type cages at the vivaria of University of
Southern California (USC) or University of California Los Angeles (UCLA). All
experimental procedures with animals were approved by the respective Institutional
Animal Care and Use Committees.
2.2 Reagents
Doxycycline (dox) was purchased from Calbiochem (La Jolla, CA) and used at a final
concentration of 0.5 µg/ml. Estradiol (E2), dihydrotestosterone (DHT), and 1α,25-
dihydroxy-vitamin D3 [1,25(OH)2D3], both from Sigma-Aldrich (St Louis, MO), were
used at a final concentration of 10 nM. Tamoxifen (Tam) and raloxifene (Ral) were
purchased from R&D Systems (Minneapolis, MN) and used at a final concentration of
100 nM. Collagenase P (1 mg/ml) and protease inhibitor cocktail tablets were purchased
from Roche Diagnostics (Indianapolis, IN) and dissolved in phosphate-buffered saline
(PBS). M-70 anti-RUNX2 antibody, FL-317 anti-RANKL antibody, I-19-R anti-ACTIN
antibody, and goat anti-rabbit IgG-HRP secondary antibody were purchased from Santa
Cruz Biotechnology (Dallas, Texas). The goat anti-rabbit IgG-DyLight 488 secondary
antibody was purchased from Jackson ImmunoResearch (West Grove, Pennsylvania).

16
Tissue culture media, penicillin/streptomycin (1% final concentration) and trypsin were
purchased from Gibco (Carlsbad, CA). Fetal bovine serum (FBS), as well as Charcoal-
Stripped FBS (CSS) were purchased from Gemini Bioproducts (West Sacramento, CA).
2.3 Cell culture
Newborn Mouse Calvarial Osteoblasts (NeMCO) were extracted from 1- to 2-day old
newborn wild-type mice by digestion of parietal bones, free of sutures, as previously
described (101). Cells were maintained in alpha minimal essential medium (αMEM)
supplemented with 20% FBS. For treatment with estrogens, cells were cultured in phenol
red-free αMEM containing 10% CSS. Primary splenocytes were prepared from 4 to 6-
week old mice by digestion with 1 mM Tris-HCl lysis buffer containing 0.74% NH4Cl as
previously described (102).
For conditional expression of RUNX2, NeMCO were transduced with lentiviruses
encoding doxycycline (dox)-inducible FLAG-RUNX2, which were produced as
previously described (67) at the Vector Core of the UCLA Geffen School of Medicine.
The GFP-RANKL plasmid (93), a gift from Dr. Masashi Honma and Dr. Hiroshi Suzuki,
University of Tokyo, was introduced into the so-called NeMCO/Rx2dox cells using the
Lipofectamine LTX with PLUS reagent and buffer (Invitrogen, Carlsbad, CA) according
to the manufacturer’s protocol. For functional analysis of osteoblast-driven activation of
NFkB in osteoclasts, a RAW264.7/NFkB-Luc reporter cell line was constructed
essentially as previously described (103). Briefly, RAW 264.7 cells were stably
transfected with an NFκB-luciferase plasmid, a gift from Dr. Ebrahim Zandi (USC) using
10 µg/mL puromycin for selection and the RAW264.7/NFkB-Luc reporter cells were
added (30,000 cells per well in 24-well plates) to NeMCO cultures and subjected to

17
luciferase assay after 24 hours. For long-term osteoblast/osteoclast co-cultures, NeMCO
were seeded in 96-well plates (5,000 cells/well) for at least 3 hours before splenocytes
were added (150,000 cells/well). On Day 1, medium was supplemented with
1,25(OH)2D3 along with estrogens and/or dox as indicated, and the cell culture medium
was replaced every 3 days. At the end of the culture period, osteoclasts were enumerated
based on the activity of tartrate-resistant acid phosphatase (TRAP; detected with the
TRAP assay kit from Sigma-Aldrich) and the presence of at least three nuclei.
2.4 RNA Extraction and Analysis
Total RNA was extracted using Aurum total RNA mini kit (Bio-Rad Laboratories,
Hercules, CA) according to the manufacturer’s protocol and 1 µg RNA was reverse-
transcribed using iScript cDNA synthesis kit (Bio-Rad). The cDNA was subjected to
quantitative PCR (qPCR) analysis using the CFX96 real time PCR system (Bio-Rad) and
the iQTM SYBR Green Supermix (Bio-Rad) according to the manufacturer’s protocol.
The primers used for qPCR are listed in Table 1. Data was normalized for the 18S rRNA
levels, which themselves were not significantly affected by treatment.

18
Table 1: Primers used for RT-qPCR
Primer Sequences (5’à3’)
Runx2 F TCT TCC CAA AGC CAG AGT GG
R ATC AGT TCC ATA GGT TGG ATT C
Rankl F GGG GGC CGT GCA GAA GGA AC
R CTC AGG CTT GCC TCG CTG GG
Osteocalcin F ACA AGT CCC ACA CAG CAG CTT
R GCC GGA GTC TGT TCA CTA CCT
Osterix F GTACGGCAAGGCTTCGCATCTG
R CTGATGTTTGCTCAAGTGGTCGC
Fasl F CTGGGTTGTACTTCGTGTATTCC
R TGTCCAGTAGTGCAGTAGTTCAA
TFF1 F TTGTGGTTTTCCTGGTGTCA
R CCGAGCTCTGGGACTAATCA
18S F GTA ACC CGT TGA ACC CCA TT
R CCA TCC AAT CGG TAG TAG CG

2.4 RANKL Fluorescence Microscopy
Cells were fixed with formaldehyde, incubated with the FL-317 primary antibody (1:50)
followed by the DyLight 488 secondary antibody (1:200) and mounted with Vectashield
mounting medium (Vector Laboratories, Burlingame, CA) containing DAPI, and images
were captured using a ZEISS LSM 510 confocal system. A GFP-RANKL fusion protein
was transiently expressed and visualized using a Nikon Eclipse Ti microscope. The
proportion of the cell perimeter with RANKL or GFP-RANKL was quantified double-
blindedly using the NIS-Elements AR 3.2 software.
2.5 Western and ELISA
For Western blot analysis, cells were washed 3 times with PBS and lysed in a 50 mM
Tris-HCl buffer (pH=7.0) containing 150 mM NaCl, 1 mM EDTA, 1% Triton X-100 and
a protease inhibitor cocktail. Cell lysates were subjected to SDS-PAGE and proteins

19
were transferred to Amersham Hybond-P PVDF membranes (Piscataway, NJ). After
blocking with 5% milk, RUNX2 or RANKL were detected with the M-70 antibody
(1:500 dilution) or the FL-317 antibody (1:200), respectively, and visualized using the
Thermo Scientific ECL detection system (Waltham, MA). ACTIN was detected as a
loading control using the I-19-R antibody (1:200). For RANKL ELISA,
NeMCO/Rx2dox were cultured in 10 cm plates (500,000 cells/plate), initially in 10 ml of
10% CSS for 48 hours and then in 5 ml of 1% CSS for 12 hours. ELISA was performed
using a mouse RANKL single plex Milliplex kit (MBN-41K-1RANKL; Millipore;
Billerica, MA, USA).

20

CHAPTER 3: MOLECULAR MECHANISMS OF ESTROGENS

3.1 Introduction
The systemic hormone most associated with the regulation of bone homeostasis in
women emanates from the mechanistic behavior of estrogens. There are three forms of
steroidal estrogens including (I) estrone (II) estradiol and (III) estriol . These estrogenic
compounds are synthesized naturally and are commonly produced in the ovaries of
women. However, the proskeletal properties of estrogens are not limited to women only.
Males are also capable of reaping the benefits of estrogen signaling in the skeletal
network by enzymatically converting testosterone into estrogens through a process
known as aromatization (52) . Of the three estrogenic compounds, estradiol (17β-
estradiol; E2) provides the most profound influence in skeletal maintenance in both men
and women (37,39).
Estrogen receptor belongs to the nuclear hormone receptor family and is encoded, in
humans, by ESR1 and ESR2 to produce the two receptor forms: ERα and ERβ,
respectively (40,41). Activation of ER has similar and often opposing effects in different
tissues. The most recognized action of ER occurs in osseous and breast epithelial tissue.
Specifically, activation of ERα by E2 regulates osteoblast proliferation (47,48) and
osteoclastogenesis through processes that include FasL and RANKL/RANK signaling
(49,51). Conversely, activation of ERα in breast tissue often fuels the progression of
breast cancer as observed in postmenopausal women undergoing hormone replacement
therapy (104). However, the properties of ER in both these tissues often involve
repressive mechanisms that keep RUNX2 activity in check (75).

21
Estrogen receptor has a N-terminal transactivation domain (NTD), a DNA-binding
domain (DBD), and a ligand-binding domain (LBD). The binding of E2 to ERα leads to
the dimerization of the receptor resulting in its recruitment to estrogen response elements
(EREs) commonly found on the promoters of genes and can assist in their transactivation
or their transcriptional repression (40,41) . In the context of bone, ERα behaves as a co-
repressor that inhibits the osteoblastic differentiation regulator gene, RUNX2, resulting in
the repression of its target gene transcription. Our lab previously demonstrated that in
both osteoblastic and breast cancer cells that activated ERα binds directly to RUNX2
resulting in the repression of RUNX2’s osteoblastic and tumor suppressing properties,
respectively (75) . Furthermore, the study investigated the properties of tamoxifen, a
selective estrogen receptor modulator (SERM), and demonstrated that it has similar
repressive properties to E2 on RUNX2 (75). Based on these previous studies, this
chapter will focus on the naturally occurring, E2, and synthetic estrogenic ligands,
Tamoxifen (Tam) and Raloxifene (Ral), and their binding to estrogen receptor alpha
(ERα) to activate genomic and non-genomic mechanisms that attenuate bone turnover.

3.2 Dox-inducible Runx2 expression in Newborn Mouse Calvarial Osteoblasts
(NeMCO)
RUNX2 promotes not only osteoblast differentiation and bone formation, but also
osteoblast-driven osteoclastogenesis (79-83,105). Because estrogens inhibit RUNX2
activity (75), I asked whether they would inhibit osteoclast differentiation driven by
expression of RUNX2 in co-cultured osteoblasts. First, we transduced Newborn Mouse
Calvarial Osteoblasts (NeMCO) with lentiviruses encoding doxycycline (dox)-inducible

22
FLAG-RUNX2 (67) and treated the so-called NeMCO/Rx2
dox
cells in isolation with dox
and/or estradiol (E2) for 48 hours. As demonstrated by Western blot analysis, dox
induced RUNX2 expression in day-2 NeMCO/Rx2
dox
cultures from a hardly detectable
level to a level several fold higher than that of endogenous RUNX2 on day 6 (Figure
3.1A). As expected, the induction of RUNX2 was accompanied with stimulation of the
osteoblast marker genes Osteocalcin (Oc; Figure 3.1C) and Osterix (Osx; Figure 3.1D).
RUNX2-mediated stimulation of these target genes was significantly attenuated by E2
(Figure 3.1C, D), consistent with previous reports on inhibition of RUNX2 activity and
impediment of osteoblast differentiation (75,106). The inhibition by E2 occurred without
any significant change to RUNX2 mRNA or protein levels (Figure 3.1B). Thus, we
established a system for conditional, robust RUNX2 induction in primary osteoblast
cultures, and documented antagonism of RUNX2-mediated stimulation of its target genes
by E2.

0
25
50
75
100
0
60
120
180
240
0
2
4
6
C. Oc
D. Osx
B. Runx2
C D E DE
C D E DE C D E DE
A.
*
C D E DE
C D C D
Day 6 .

Relative mRNA
*
*
*
*

Relative mRNA
Day 2 .
Fig 3.1 Characterization of NeMCO/Rx2
dox
cells. Newborn Mouse Calvarial Osteoblasts (NeMCO) were transduced
with lentiviruses encoding dox-inducible RUNX2. NeMCO/Rx2
dox
cultures were treated for 48 hours with 0.5 µg/mL
dox, 10 nM E2, and/or vehicle as indicated. (A) Western blot analyses with anti-RUNX2 antibody (top), demonstrating
FLAG-RUNX2 (arrow) and endogenous RUNX2 (arrowhead). ACTIN was used as a loading control (bottom). (B-D)
The mRNA levels of Runx2 (B), Osteocalcin (C) and Osterix (D) were determined by RT-qPCR (Mean±SD; n=3; *p <
0.05). Inset in B is Western blot performed with anti-RUNX2 antibodies as in A with Actin used as loading control
(bottom panel). Abbreviations: C, Control; D, Dox; E, Estradiol; DE, Dox plus Estradiol. Data obtained in collaboration
with Jian Xiong and Jon Miller.

Relative mRNA
FLAG-RUNX2
ACTIN
RUNX2
FLAG-RUNX2
ACTIN
23

24
3.3 Estradiol Antagonizes RUNX2-Mediated Osteoblast-Driven Osteoclastogenesis
Inhibition of bone resorption by E2 in vivo could be mediated in part by antagonism of
RUNX2-mediated osteoblast-driven osteoclastogenesis. I addressed this notion using the
NeMCO/Rx2
dox
system by asking whether E2 would antagonize dox-driven
osteoclastogenesis from co-cultured splenocytes. Consistent with previous observations
(79-81), induction of RUNX2 in the pre-osteoblasts resulted in an increase in the number
of differentiated osteoclasts, defined as TRAP-positive cells with ≥3 nuclei (Figure
3.2A,B). Remarkably, the RUNX2-mediated osteoblast-driven osteoclastogenesis was
not observed in the presence of E2 (Figure 3.2A,B). Specifically, the number of
osteoclasts that differentiated from their splenocytic precursors was increased by 2.7-fold
in response to dox, and this stimulation was completely abolished in the presence of E2
(Figure 3.2C).
Inhibition of osteoclastogenesis by E2 may involve activation of ERα not only in
osteoblasts but also in cells of the osteoclast lineage (51). To test the potential
contribution of ERα signaling in pre-osteoclasts, I re-examined the effect of E2 on
RUNX2-mediated osteoblast-driven osteoclastogenesis in co-cultures of NeMCO/Rx2
dox

with splenocytes isolated from ERα knockout mice (107). As shown in Figure 3.2D,
treatment of these co-cultures with E2 again blocked RUNX2-mediated osteoblast-driven
osteoclastogenesis even though ERα was absent in the splenocytes. These results suggest
that E2 blocked RUNX2-mediated osteoclastogenesis specifically through crosstalk
between osteoblastic RUNX2 and osteoblastic ERα.

Osteoclasts/Well
ERKO Splenocytes
Wild Type Splenocytes
-dox +dox
-E2 +E2
B
C Runx2
dox
0
5
10
15
20
25
30
0
5
10
15
20
25
*
*
C D E DE
C D E DE
D
DE E
*
*
A
D
C
C D E DE
Fig 3.2 Estradiol Antagonizes RUNX2-Mediated Osteoblast-Driven Osteoclastogenesis. NeMCO/Rx2
dox
were co-cultured with
splenocytes from WT (A-C) or ERKO (D) mice in the presence of 0.5 µg/mL dox and/or 10 nM E2 as indicated. (Osteoclasts were
identified by TRAP staining (A; scale bar = 100 µm) and values in C and D represent their numbers per well. Results are from one of 3
experiments with similar results (Mean ± SD; n=3; *p < 0.05). Abbreviations: C, Control; D, Dox; E, Estradiol; DE, Dox plus
Estradiol. Data obtained collaboration with Dr. Yankel Gabet and Jian Xiong.

Osteoclasts/Well
25

26
3.4 RUNX2-Driven RANKL Secretion
RANKL is a quintessential factor for osteoblast-driven osteoclastogenesis. However,
RUNX2 did not stimulate Rankl mRNA or protein levels in our (Figure 3.3A,C) and
other osteoblast systems (81,83). Opg mRNA, encoding the only identified endogenous
RANKL antagonist, decreased by ~2-fold in response to RUNX2 in both the presence
and absence of E2. However, unlike in other osteoblastic culture systems (95,108), E2
did not significantly influence Opg expression in NeMCO (Figure 3.3B). In pursuit of an
inclusive model that may explain both RUNX2-mediated osteoblast-driven
osteoclastogenesis and its antagonism by E2, I considered the role recently ascribed to
RUNX2 in protein trafficking and secretion (83,109), and also the evidence that E2
inhibits RANKL presentation on human bone marrow stromal cells in vivo (89). First,
we performed ELISA of medium conditioned by cells treated with dox and/or E2.
Although RUNX2 did not significantly affect Rankl mRNA or protein expression (Figure
3.3A, C), the ELISA disclosed a remarkable 8-fold increase in RANKL accumulation in
medium conditioned by dox-treated as compared to control osteoblasts (Figure 3.3D).
We then treated NeMCO/Rx2
dox
with dox and/or E2 for two days and added
RAW264.7/NFκB-Luc reporter cells to the culture wells for the last 24 hours prior to
harvest and luciferase assay. Dox-treated NeMCO/Rx2
dox
over-expressing RUNX2
stimulated luciferase activity in the RAW264.7/NFκB-Luc reporter cells to levels 8-fold
greater than control NeMCO cultured without dox (Figure 3.3E). Both the ELISA and
the luciferase results suggest that RUNX2 stimulates RANKL mobilization, contributing
to the stimulation of osteoblast-mediated osteoclastogenesis (Figure 3.2). The anti-
RUNX2 effect of E2, however, was only minimal in the ELISA (Figure 3D) and absent

27
in the luciferase assay (Figure 3E). Thus, the robust RUNX-mediated osteoblast-driven
osteoclastogenesis (Figure 2) is attributable to stimulation of RANKL secretion, but
neither the ELISA nor the RAW 264.7/NFkB-Luc reporter assay provided an explanation
for the 2.6-fold inhibition of osteoclastogenesis by E2 (Figure 3.2).

Rankl mRNA
0
0.5
1
1.5
C
A
0
0.5
1
1.5
B
Opg mRNA
*
RANKL (pg/mL)
*
D
C D E DE
RANKL
ACTIN
E
C D E DE
Relative Light Units
C D E DE
*
*
0
4
8
12
0
2000
4000
6000
C D E DE
Fig 3.3 RUNX2 Promotes RANKL Secretion. NeMCO/Rx2
dox
were treated for 48 hours with
0.5 µg/ml dox and/or 10 nM E2 as indicated. (A,B) Rankl and Opg mRNA levels were measured
using RT-qPCR. (C) RANKL expression was assessed by Western blot analysis using ACTIN as
loading control. (D) RANKL concentration in conditioned medium was determined by ELISA.
(E) RAW264.7/NFκB-Luc reporter cells were added to NeMCO for additional 24 hours and
luciferase assay was performed as previously described (21). Abbreviations: C, Control; D, Dox;
E, Estradiol; DE, Dox plus Estradiol. Data obtained in collaboration with Dr. Paul Kostenuik, Dr.
Elaine Han, Jian Xiong and Jon Miller.

28

29
3.5 RUNX2-Driven RANKL Membrane Association and Attenuation by E2
It is believed that osteoblast-borne RANKL promotes osteoclastogenesis primarily
through cell-cell interaction (110). We therefore employed confocal
immunofluorescence microscopy to address the possibility that E2 inhibited RUNX2-
mediated RANKL association with the osteoblast membrane. As shown in Figure 3.4A,
RUNX2 promoted localization of RANKL at the cell perimeter, with a 6-fold increase in
membrane association in response to dox (Figure 3.4B). Furthermore, the RUNX2-
mediated enrichment of the cell membrane for RANKL was diminished by E2 (Figure
3.4A,B). To confirm that the effects of RUNX2 and E2 on RANKL trafficking were
post-translational, and not related to mechanisms of alternative RANKL transcription or
mRNA splicing, we assessed by fluorescence microscopy the effects of RUNX2 and E2
on a transiently expressed GFP-RANKL fusion protein. Similar to the effects on
endogenous RANKL, RUNX2 stimulated GFP-RANKL membrane association by 4-fold
and again this was diminished by E2 (Figure 3.4C,D).

0
10
20
30
40
50
GFP-RANKL-Occupied
Cell Perimeter (%)
GFP-RANKL
*
C D E DE
RANKL-Occupied
Cell Perimeter (%)
*
C. GFP-RANKL A. Endogenous RANKL B
D
C D
DE E
C D
DE E
*
*
0
10
20
30
40
C D E DE
Fig 3.4 RUNX2 Promotes and E2 Antagonizes RANKL Association with the Osteoblast Membrane. NeMCO/Rx2
dox
were treated for 48 hours with 0.5
µg/ml dox and/or 10 nM E2 as indicated, and endogenous RANKL (A,B) or transiently expressed GFP-RANKL (C,D) were imaged by indirect or direct
immunofluorescence, respectively. (A,C) Representative microcgraphs (Scale bar = 50 µm), with arrows marking membrane-associated RANKL. (B,D)
Percentage of cell perimeter containing RANKL or GFP-RANKL was determined in a double-blinded fashion for ≥10 randomly selected cells per condition.
Results are from one of 3 experiments with similar results (Mean±SD; *p < 0.05). Abbreviations: C, Control; D, Dox; E, Estradiol; DE, Dox plus Estradiol.
Data obtained in collaboration with Jian Xiong.
30

31
3.6 Selective Estrogen Receptor Modulators (SERMs) Mimic Antagonistic Action of
E2 on RUNX2-Induced Osteoclastogenesis
The efficacy of SERMs such as tamoxifen (Tam) and raloxifene (Ral) for the treatment of
breast cancer is predicated on their ability to antagonize estrogen signaling in mammary
epithelial cells (46). SERMs also have the unique feature of acting in osteoblasts as
partial ER agonists, accounting for their bone-sparing properties (29). We therefore set
out to test the effects of SERMs on RUNX2-mediated osteoblast-driven
osteoclastogenesis. First, we confirmed the transcriptional regulatory properties of
SERMs in NeMCO and in MCF7 breast cancer cells. Tam and Ral antagonized E2-
mediated stimulation of the classical ER target gene TFF1 (pS2) in MCF7 cells without
significantly regulating gene expression on their own (Figure 3.5A, B). In contrast, Tam
and Ral did not have a lasting anti-estrogenic effect on the ERα target gene Fasl in
NeMCO cultures (Figure 3.5D). In fact, they mimicked E2 in NeMCO (Figure 3.5C),
similar to observations previously made in U2OS-ERα cells (49). Next, to test whether
the established bone-sparing properties of SERMs could be mediated in part by
mimicking E2 in attenuating RUNX2-mediated osteoblast-driven osteoclastogenesis, we
treated co-cultures of splenocytes and NeMCO/Rx2
dox
cells with dox and/or SERMs.
Similar to E2, both Tam and Ral abolished osteoclast differentiation when driven by
RUNX2 expression in the co-cultured NeMCO (Figure 3.5E), and this was not associated
with alterations to expression of Runx2 itself (Figure 3.5F). These results suggest that the
bone sparing properties of SERMs are attributable in part to antagonism of RUNX2-
mediated osteoblast-driven osteoclastogenesis.

1
2
3
4
5
6
7
8
0 10 20 30 40 50
E2
Ral
Tam
FasL mRNA
1
11
21
31
41
51
61
0 10 20 30 40 50
E2
Ral
Tam
Hrs
TFF1 mRNA
D C
0
5
10
15
20
25
30
Osteoclasts/Well
Runx2 mRNA
B A
F
E
C D E DE R DR T DT
Hrs 0 10 20 30 40 50
E2
E2+Ral
E2+Tam
0 10 20 30 40 50
E2
E2+Ral
E2+Tam
*
*
*
*
*
0
2
4
6
8
C D E DE R DR T DT
Fig 3.5 SERMs Attenuate RUNX2-Mediated Osteoblast-Driven Osteoclastogenesis. (A-D) MCF7 (A,B) and NeMCO/Rx2
dox

cultures (C,D) were treated for 6, 14, 24 and 48 hours with E2, Raloxifene, or Tamoxifen, alone (A, C) or with the indicated
combinations (B, D), and expression of the indicated ER-target genes was measured by RT-qPCR (Mean ± SD; n=3). (E) Co-
cultures of NeMCO/Rx2
dox
with splenocytes were treated as indicated, and differentiated osteoclasts were enumerated on day 14.
Results are from one of 3 experiments with similar results (Mean ± SD; n=3). (F) NeMCO/Rx2
dox
were treated as indicated and
Runx2 mRNA levels were measured by RT-qPCR (Mean ± SD, n=3; *p < 0.05). Abbreviations: C, Control; D, Dox; E, Estradiol;
R, Raloxifene; T, Tamoxifen. Data obtained in collaboration with Dr. Theodora Koromila and Stephanie Chan.

32

33
3.7 Discussion
This chapter highlighted the establishment of an in vitro culture system that sought to
understand the mechanistic properties of ERα in protecting the bone that are potentially
lost in the pathogenesis of the hypogonadism induced disorder known as post-
menopausal osteoporosis. Our results suggest that expression of RUNX2 in osteoblasts
promotes osteoclastogenesis by increasing membrane association and/or secretion of
RANKL, and that E2 antagonizes RUNX2-mediated osteoblast-driven osteoclastogenesis
primarily by attenuating the presentation of RANKL on the osteoblast membrane.
Furthermore, we demonstrate the effectiveness of tamoxifen and raloxifene in attenuating
bone resorption through mechanisms that mimic the naturally occurring action of E2 on
ERα. Specifically, these SERMs were capable of inhibiting RUNX2-driven
osteoclastogenesis. Therefore, pharmacological treatment of post-menopausal
osteoporosis should rely on therapeutics that target RANKL trafficking or focus on
hormone replacement options that specifically target the bone and while having no
stimulatory effect on fueling the oncogenesis of breast cancer.

34

CHAPTER 4: MOLECULAR MECHANISMS OF ANDROGENS

4.1 Introduction

There are a variety of androgenic hormone subsets that have unique responsibilities in
varying tissues throughout the body. One of the most common circulating androgens
found in both men and women is known as testosterone, but plays a more prominent role
in the male physiology. During embryogenesis, testosterone is critically involved in
gender assignment as it coordinates the development of male reproductive tissue and
continues to have anabolic properties that promote muscle and bone growth throughout
adulthood (52). Enzymatic conversion of testosterone into other androgenic metabolites
helps to activate different cellular processes that provide additional regulatory functions.
As previously discussed, the human CYP19 gene encodes an aromatase enzyme that
actively converts testosterone into 17β-estradiol that activates the bone sparing properties
of ERα (54-59) . 5α-reductase, a cytochrome P
450
enzyme, produces a metabolite called
dihydrotestosterone (DHT) that binds with higher affinity to androgen receptor (AR) than
testosterone and is immune to conversion into 17β-estradiol (52) . Therefore, DHT
serves as a potent initiator of the aromatase-independent, proskeletal mechanisms of
androgens mediated by androgen receptor. Undoubtedly, the AR mediated effects that
restrain bone turnover are complex and involve molecular regulation of multiple
processes that often emanate from osteoblasts.
Androgen receptor, similar to ERα, possesses three domains: (1) N-terminal domain
(NTD) (2) zinc-finger DNA-binding domain (DBD) and (3) Ligand-binding domain. The

35
NTD contains the activation function-1 domain (AF1) while the activation function-2
(AF2) domain resides in the LBD (40,41). Our lab previously showed a direct interaction
between AR and RUNX2 in osteoblastic and prostate cancer cells through GST pull-
down assays and indirect immunofluorescence confocal microscopy (76). Furthermore, it
was determined that AR binds more tightly to RUNX2 than ERα through association
with RUNX2’s PST and DBD (76). Ultimately, the interaction between the two
transcription factors resulted in diminished RUNX2 activity in osteoblasts and prostate
cancer cells potentially explaining the AR mediated regulation of bone turnover and
prostate cancer progression, respectively (76). Based on these findings, this chapter
highlights the regulatory contribution of AR on RUNX2-mediated osteoblast-driven
osteoclastogenesis and proposes a RANKL-centric mechanism for the resulting
attenuation.

4.2 DHT-Mediated Inhibition of RUNX2 Target Genes
Much like estrogens (75), androgens have been implicated in abrogating RUNX2 activity
(76). Therefore, I sought to determine if androgens could also regulate
osteoclastogenesis in our established in vitro NeMCO/Rx2
dox
system. These lentivirally
transduced primary osteoblasts were cultured in the presence of doxycycline (dox) and/or
DHT for 48 hours. Western blot analysis confirmed robust induction of FLAG-RUNX2
upon dox treatment with complementary results demonstrating an increase in Runx2
mRNA levels (Figure 4.1.A,B). Interestingly, co-treatment of dox and DHT increased
FLAG-RUNX2 protein levels in comparison to dox alone (Figure 4.1A). However, the
increase in FLAG-RUNX2 protein by treatment with both dox and DHT was not
attributable to alterations in Runx2 mRNA levels (Figure 4.1B).

36
The expression of classical RUNX2 target genes, Osteocalcin (Oc; Figure 4.1C) and
Osterix (Osx; Figure 4.1D), were measured to test whether the established inhibition of
RUNX2 activity by DHT (76) was mirrored in our NeMCO/Rx2
dox
culture system. Not
surprisingly, as previously demonstrated, RUNX2 induction had transcriptional influence
on Oc and Osx mRNA levels resulting in significant stimulation of their gene expression
(Figure 4.1C,D). DHT inhibited RUNX2-driven expression of Oc (Figure 4.1C), despite
its contribution in increasing FLAG-RUNX2 protein levels by dox treatment (Figure
4.1A). Conversely, Osx was unaffected by DHT treatment (Figure 4.1D), which is
inconsistent with the observation made in Figure 3.1D where E2 significantly repressed
its expression. This could be partially explained by the observed stabilization of dox-
induced FLAG-RUNX2 protein by DHT (Figure 4.1A). However, it has been well
established that Osteocalcin is RUNX2’s primary target gene (69,77,78). Since DHT can
inhibit this potent indicator of RUNX2 activity, I utilized this NeMCO/Rx2
dox
system to
determine the role of DHT in antagonizing RUNX2-mediated osteoblast-driven
osteoclastogenesis.

0
20
40
60
80
C D A DA
FLAG-RUNX2
ACTIN
B. Runx2

Relative mRNA
C D A DA
A.
C. Oc
0
30
60
90
120
C D A DA
0
1
2
3
4
5
D. Osx
C D A DA
* *
*
*
Fig 4.1 DHT Mediated Inhibition of RUNX2 Target Genes. Newborn Mouse Calvarial Osteoblasts (NeMCO) were
transduced with lentiviruses encoding dox-inducible RUNX2. NeMCO/Rx2
dox
cultures were treated for 48 hours with
0.5 µg/mL dox, 10 nM DHT, and/or vehicle as indicated. (A) Western blot analyses with anti-RUNX2 antibody
demonstrating FLAG-RUNX2. ACTIN was used as a loading control . (B-D) The mRNA levels of Runx2 (B),
Osteocalcin (C) and Osterix (D) were determined by RT-qPCR (Mean±SD; n=3; *p < 0.05). Abbreviations: C,
Control; D, Dox; A, Dihydrotestosterone; DA, Dox plus Dihydrotestosterone. Data obtained in collaboration with Jian
Xiong and Jon Miller.

37

38
4.3 DHT Counteracts Osteoclastogenesis Driven by RUNX2 Overexpressing
Osteoblasts
Numerous studies have implicated aromatase-independent, AR-mediated mechanisms
that serve to protect the bone. Specifically, there is no question in the importance of
osteoblastic AR in the proskeletal processes of androgens. Conditional ablation of AR in
the osteoblasts of mice using Type-1 Collagen and Osteocalcin as drivers for Cre
recombination demonstrated adverse affects on trabecular bone mass owing to the
increase in bone resorption (64,65). Therefore, I speculate that AR interaction with
RUNX2 might provide regulatory constraints on osteoblast-driven osteoclastogenesis.
Similar to our E2 study, we tested the potential of DHT to attenuate the role of RUNX2
in facilitating aberrant osteoclast formation in vitro (79-81) utilizing co-cultured
osteoclast progenitors from mouse spleens. The induction of RUNX2 expression in
NeMCO/Rx2
dox
once again accelerated the maturation of osteoclast precursors into
differentiated, TRAP-positive cells with ≥3 nuclei (Figure 4.2.A,B). Osteoclastogenesis
influenced by RUNX2 over-expression was 3-fold greater in comparison to control
osteoblasts (Figure 4.2.C). Furthermore, the combinatorial treatment of dox and DHT in
the co-culture system resulted in the antagonism of RUNX2-mediated osteoblast-driven
osteoclastogenesis (Figure 4.2.A-C).
These results illustrate the role of DHT in regulating osteoclastogenesis in vitro.
Furthermore, these findings suggest that the interaction of activated AR with RUNX2
might be a critical mechanism involved in inhibiting bone resorption in vivo through
attenuation of osteoclast differentiation and survival. However, there are additional
considerations to be made particularly regarding the presence of AR on the osteoclasts

39
themselves. The proposed mechanism of the cell autonomous, FasL-induced apoptosis of
osteoclasts by activated ERα signaling does not apply to AR as androgens were reported
to have no affect on stimulating FasL expression (49,51). However, other mechanisms
that involve osteoblastic RANKL (96,97) or OPG (66,95,111) might be helpful in
elucidating the AR action in protecting the skeleton.

0
8
16
24
32
40
Osteoclasts/Well
Wild Type Splenocytes
C
-dox +dox
-DHT +DHT
A
Runx2
dox
C
DA A
C D A DA
B
C D A DA
*
*
Fig 4.2 DHT Counteracts Osteoclastogenesis Driven by RUNX2 Overexpressing Osteoblasts. NeMCO/Rx2
dox
were co-
cultured with splenocytes from WT mice in the presence of 0.5 µg/mL dox and/or 10 nM DHT as indicated. (A,B) Osteoclasts
were identified by TRAP staining (A; scale bar = 100 µm) and values in C represent their numbers per well. Results are from
one of 3 experiments with similar results (Mean ± SD; n=3; *p < 0.05). Abbreviations: C, Control; D, Dox; A,
Dihydrotestosterone; DA, Dox plus Dihydrotestosterone. Data obtained in collaboration with Dr. Yankel Gabet and Jian Xiong.

40

41
4.4 Effect of DHT on RANKL Secretion in RUNX2-Overexpressing Osteoblasts
The utmost critical molecule required for osteoclast commitment, survival, and
differentiation is RANKL and is produced by cells of the osteoblastic lineage. Analogous
to our investigation on the affect of E2 on RANKL, we observed no significant
alterations in Rankl mRNA upon RUNX2 stimulation and/or DHT treatment (Figure
4.3.A). Similarly, we demonstrated by western blot analysis that RANKL protein levels
were also unaffected under the same treatment conditions (Figure 4.3.C). Because OPG
regulates osteoclastogenesis by competitively binding to RANKL to interrupt
RANKL/RANK signaling, we sought to discover the affect of DHT on its expression.
We recapitulated the decrease in Opg mRNA levels (2-fold) in response to RUNX2 only
when DHT was absent (Figure 4.3.B). However, unlike E2, DHT attenuated the
RUNX2-mediated loss of Opg expression by resorting Opg mRNA to levels comparable
to that found in control (Figure 4.3.B). This observation implies that ERα and AR might
possess unique and exclusive mechanisms that operate to maintain skeletal integrity.
Furthermore, I hypothesize that AR employs additional distinctive molecular restraints
that likely involve regulation of osteoclastogenesis that does not include Opg.
Previously, we performed ELISA to quantify the amount of RANKL in conditioned
media to measure osteoblastic RANKL secretion in response to dox and/or E2 (Figure
3.3.D). We report parallel results that demonstrate an 8-fold increase in RANKL
deposition into the conditioned media in RUNX2 over-expressing osteoblasts in
comparison to control (Figure 4.3.D). However, these same osteoblast

cultures responded
differently when co-treated with dox and DHT providing a synergistic 2-fold increase in
RANKL secretion on top of the dox-mediated affect (Figure 4.3.D). The

42
RAW264.7/NFκB-Luc reporter assay was utilized to indirectly measure the amount of
osteoblastic RANKL and its potential to stimulate RANK signaling in the engineered
RAW264.7 osteoclastic cell line. Stimulation of RUNX2 over-expression in
NeMCO/Rx2
dox
accounted for a robust 12-fold increase in luciferase activity with no
significant change with the introduction of DHT (Figure 4.3.E). The resulting synergistic
affect from RUNX2 stimulation and DHT treatment to increase the accumulation of
RANKL in conditioned media from osteoblast cultures was not represented in the
RAW264.7/NFκB-Luc reporter assay (Figure 4.3.D,E). However, the unperturbed
stimulation of NFκB-luciferase activity by dox after DHT treatment could be explained
by the restorative properties of DHT to counteract the RUNX2-mediated decline in Opg
expression (Figure 4.3. B,D,E). As expected, AR behaved differently from ERα in the
context of Opg expression and RANKL secretion demonstrating differences in their bone
sparing molecular actions. However, similar to E2, the results from the ELISA and RAW
264.7/NFkB-Luc reporter assay cannot explain the inhibitory role of DHT in
antagonizing RUNX2-mediated osteoblast-driven osteoclastogenesis (Figure 4.2).

0
0.4
0.8
1.2
1.6
0
5
10
15
20
0
0.4
0.8
1.2
1.6
0
1500
3000
4500
Rankl mRNA
C
A
B
Opg mRNA
C D A DA
C D A DA
RANKL
ACTIN
RANKL (pg/mL)
D
E
Relative Light Units
C D A DA
C D A DA
*
*
*
*
Fig 4.3 DHT Effect on RUNX2 Driven RANKL Secretion. NeMCO/Rx2
dox
were treated for
48 hours with 0.5 µg/ml dox and/or 10 nM DHT as indicated. (A,B) Rankl and Opg mRNA
levels were measured using RT-qPCR. (C) RANKL expression was assessed by Western blot
analysis using ACTIN as loading control. (D) RANKL concentration in conditioned medium
was determined by ELISA. (E) RAW264.7/NFκB-Luc reporter cells were added to NeMCO for
additional 24 hours and luciferase assay was performed as previously described (21).
Abbreviations: C, Control; D, Dox; A, Dihydrotestosterone; DA, Dox plus
Dihydrotestosterone. Data obtained in collaboration with Dr. Paul Kostenuik, Dr. Elaine Han,
Jian Xiong and Jon Miller.

43

44
4.5 Effect of DHT on RUNX2-Driven RANKL Membrane Association
Because RANKL is critical in promoting osteoclastogenesis, we sought to investigate
more closely its membrane-bound properties since soluble RANKL could not clarify the
anti-osteoclastogenic behavior of DHT (Figure 4.2,3). RUNX2-driven osteoclastogenesis
is undoubtedly mediated by the preferential migration of RANKL to the osteoblast
membrane periphery, which was observed utilizing confocal immunofluorescence
microscopy (Figure 4.4.A). We demonstrate a 4-fold increase in RANKL membrane
association in response to RUNX2 (Figure 4.4.B). However, the increase in RANKL
localization by RUNX2 was significantly reduced with DHT treatment (Figure 4.4.A,B).
To further validate the observed phenomenology of RANKL trafficking, we utilized a
GFP-RANKL fusion protein that was transiently expressed in osteoblasts. RUNX2 over-
expressing osteoblasts redistributed GFP-RANKL to the cellular membrane, reminiscent
of endogenous RANKL, to levels 4-fold greater than control cells with attenuation by
DHT (Figure 4.4.C,D).

0
10
20
30
40
0
8
16
24
32
GFP-RANKL-Occupied
Cell Perimeter (%)
RANKL-Occupied
Cell Perimeter (%)
B
D
C D A DA
C D A DA
A. Endogenous RANKL
C D
A DA
C. GFP-RANKL
C D
DA A
*
*
*
*
Fig 4.4 RUNX2 Promotes and DHT Antagonizes RANKL Association with the Osteoblast Membrane. NeMCO/Rx2
dox
were treated for 48 hours
with 0.5 µg/ml dox and/or 10 nM DHT as indicated, and endogenous RANKL (A,B) or transiently expressed GFP-RANKL (C,D) were imaged by
indirect or direct immunofluorescence, respectively. (A,C) Representative microcgraphs (Scale bar = 50 µm), with arrows marking membrane-associated
RANKL. (B,D) Percentage of cell perimeter containing RANKL or GFP-RANKL was determined in a double-blinded fashion for ≥10 randomly selected
cells per condition. Results are from one of 3 experiments with similar results (Mean±SD; *p < 0.05). Abbreviations: C, Control; D, Dox; A,
Dihydrotestosterone; DA, Dox plus Dihydrotestosterone. Data obtained in collaboration with Jian Xiong.
45

46
4.6 Discussion
Androgens have remarkable and versatile properties that are important for the
maintenance of skeletal physiology. In this chapter, I demonstrate the significance of the
testosterone metabolite, DHT, in controlling osteoblast function. I illustrate a new
property assigned to androgens that involves the attenuation RUNX2-mediated
osteoblast-driven osteoclastogenesis. Furthermore, I come to a deeper appreciation for
the invaluable AR-mediated approach in regulating RANKL trafficking and propose a
novel molecular method that includes attenuating RANKL presentation at the osteoblast
membrane (Figure 4.4). While control of the intracellular locality of osteoblastic
RANKL by DHT serves as a prime example of its proskeletal behavior, I cannot ignore
its action in antagonizing the RUNX2-mediated decrease in Opg expression (Figure
4.2.B). Taken together, activation of osteoblastic AR by DHT initiates equivalent anti-
osteoclastogenic outcomes similar to ERα but also employs some of its own unique
actions to facilitate balanced bone turnover.

47

CHAPTER 5: Overall Discussion

5.1 Summary
It is well established that high bone turnover increases fracture risk, with postmenopausal
osteoporosis serving a prime example. Bone loss that occurs at physiological turnover
rates is slow and usually transpires without pathological consequences because coupling
mechanisms secure the replacement of most of the resorbed bone with newly deposited
material. Adding to classical coupling mechanisms of signaling from osteoblasts to
osteoclasts and back, the regulation of both osteoblast differentiation and osteoblast-
driven osteoclastogenesis by the same transcription factor, RUNX2, likely contributes to
balanced bone remodeling. Our results suggest that estrogens and androgens may
regulate bone turnover rate by antagonizing RUNX2-mediated osteoblastogenesis and
osteoclastogenesis. If this is correct, then attenuation of bone turnover and bone loss in
postmenopausal women and osteoporotic men may be achieved through novel therapeutic
approaches that restore the anti-RUNX2 function of sex hormones.
RUNX2-mediated osteoblast-driven osteoclastogenesis has been well documented (79-
83,105), but does not necessarily involve regulation of Rankl gene expression in
osteoblasts (81,100). In the present study, induction of RUNX2 in primary pre-
osteoblasts strongly stimulated differentiation of co-cultured splenocytes into mature
osteoclasts (Figure 3.2; Figure 4.2) without significantly increasing Rankl mRNA (Figure
3.3A; Figure 4.3A) or protein levels (Figure 3.3C; Figure 4.3C). We demonstrate,
however, a marked increase in RANKL secretion (Figure 3.3D; Figure 4.3D) and

48
membrane association in response to RUNX2 (Figure 3.4; Figure 4.4), consistent with the
recently suggested role of RUNX2 in regulating membrane trafficking (83,109). Given
that RANKL trafficking is regulated by OPG (110), the RUNX2-mediated increase in
RANKL membrane association could be mediated by the demonstrated inhibition of Opg
expression (Figure 3.3B; Figure 4.4B). I cannot rule out additional RUNX2-driven
osteoclastogenic mechanisms such as stimulation of Sema7a and Ltc4s expression (83).
It will also be interesting to investigate whether RUNX2 controls RANKL trafficking in
non-osteoblasts, such as breast cancer and vascular smooth muscle cells, in which ectopic
expression of these two regulators has been linked to human disease (98,112,113).
5.2 Estrogens & Osteoclastogenesis: Regulation of RANKL Trafficking
RUNX2-mediated osteoblast-driven osteoclastogenesis may have important implications
for postmenopausal osteoporosis. Indeed, E2 diminished the RUNX2-mediated
differentiation of co-cultured splenocytes into mature osteoclasts (Figure 3.2). This anti-
osteoclastogenic effect of E2 must now be further investigated, as it may represent a
fundamental mechanism underlying the bone-sparing property of estrogens in vivo. In
the present study, E2 antagonized RUNX2-mediated membrane association of both
endogenous RANKL and transiently expressed GFP-RANKL (Figure 3.4), but it did not
antagonize RUNX2-mediated inhibition of Opg expression (Figure 3.3B). Thus, whereas
RUNX2-mediated RANKL membrane localization and secretion may be mediated by
inhibition of Opg expression, other mechanisms remain to be delineated that explain the
anti-RUNX2 effect of E2 with respect to RANKL membrane association. The E2-
faciliated decrease in RANKL membrane association (Figure 3.4) and osteoclastogenesis
(Figure 3.2) without significantly decreasing RANKL in conditioned media (Figure 3.3D)

49
is consistent with the idea that RANKL is most effective in promoting osteoclastogenesis
when anchored in the membrane of presenting cells (114). Indeed, RANKL presentation
was greater on the surface of pre-osteoblasts isolated from the bone marrow of
hypogonadal postmenopausal women as compared to either age-matched eugonadal pre-
menopausal or hormone-repleted postmenopausal controls (89).
Future studies that seek to explain the anti-RUNX2 mechanistic action of E2 in
antagonizing RANKL membrane association might investigate (I) the transcriptional
regulation of E2 on RUNX2-induced protein trafficking genes including Rab3b, Rab35,
and Rab45 (Gillian, NAR, REF) (II) the non-genomic properties of ER through
preferential activation of membrane-bound ER by EDC. Since E2 has no effect on
altering the repression of Opg expression by RUNX2 (Figure 3.3B), other mechanisms
might involve repression of protein trafficking genes that serve to limit the anchoring of
RANKL to the osteoblast membrane. However, it is also possible that E2 acts to regulate
RANKL trafficking independently of nuclear ER initiated genomic regulation.
Therefore, utilization of the membrane impenetrable macromolecule, estrogen dendrimer
conjugate (EDC), that possesses E2 conjugate tails would help delineate the genomic and
non-genomic actions of ER. Furthermore, EDC-mediated activation of membrane bound
ER might stimulate the activity of known mellatoproteinases, such as Mmp14, to actively
truncate and solubilize RANKL found at the membrane.
The bone sparing property of E2 in vivo is mediated by activation of ERα in cells of both
the osteoblast and the monocyte/osteoclast linages, with the latter responsible particularly
for protection of female trabecular bone (44,45,115). In our in vitro co-culture assay, E2
antagonized RUNX2-mediated osteoblast-driven osteoclastogenesis by activating ERα in

50
osteoblasts, not osteoclasts, because the antagonism was recapitulated with ERα-deficient
osteoclast precursors (Figure 3.2D). In addition, RUNX2-mediated osteoclastogenesis in
vivo primarily occurred at the endosteal aspect of cortical bone (79,80), although the
sparing of trabecular bone might have been mouse strain-dependent (116). Thus, the
anti-RUNX2 activity of estrogens with respect to regulating RANKL membrane
association and osteoclastogenesis is likely most relevant to protection of cortical bone in
females and both bone compartments in males.
5.3 Androgens & Osteoclastogenesis: Regulation of RANKL Trafficking
The androgenic hormone contribution to secured skeletal maintenance in vivo could also
involve the regulation of RUNX2-driven osteoclastogenesis to manage bone resorption.
The current study utilized an un-aromatizable metabolite of testosterone known as DHT
to demonstrate the anti-RUNX2 properties specifically associated with AR. Similar to
ERα, AR activation by DHT inhibited the osteoclastogenic potential of RUNX2-over
expressing NeMCO/Rx2
dox
to stimulate differentiation of co-cultured splenocytes (Figure
4.2). Furthermore, DHT inhibited the resulting increase in RANKL membrane
association by RUNX2 (Figure 4.4) serving as a likely explanation for its role in
attenuating osteoclastogenesis (Figure 4.2). However, there were additional differences
in the mechanism of action of DHT in comparison to E2. A distinctive characteristic of
androgens in our system involved the attenuation of RUNX2-mediated repression of Opg
expression (Figure 4.3B) serving as a potential DHT-specific mechanism for regulating
osteoclastogenesis.
The anti-osteoclastogenic nature of OPG relies on its binding to RANKL to limit
activation of RANK found on hematopoietic progenitors, thus controlling osteoclast

51
differentiation and survival. As previously discussed, OPG has been reported to
influence RANKL trafficking and is proposed to be involved in the preferential
sequestration of RANKL into vacuoles known as secretory lysosomes (93). The
packaging of RANKL into these secretory vesicles is regarded as the “major” pathway of
RANKL trafficking. Conversely, the absence or inhibition of OPG accelerates the
“minor” pathway that involves the redistribution of RANKL onto the osteoblast
membrane (93). This secondary pathway is critically important in optimizing the micro-
anatomical conditions necessary for cell-to-cell communication between osteoblasts and
osteoclasts (110). Furthermore, it is proposed that activation of the RANKL/RANK
signaling cascade by membrane-bound RANKL primes the osteoblast to actively secrete
the intracellular packaged RANKL (93). Based on this work, a conceivable mechanism
that could further explain the anti-RUNX properties of DHT to inhibit osteoclastogenesis
involves the stabilization of Opg expression (Figure 4.3B) to minimize RANKL
membrane association (Figure 4.4). However, in vivo studies that utilize osteoblasts from
OPG knockout mice would help determine definitively whether DHT employs an anti-
RUNX2 mechanism that requires the restoration of Opg expression.
An additional, unique androgenic characteristic was identified using ELISA that
demonstrated a cooperative mechanism involving DHT and RUNX2 to synergistically
induce the secretion of RANKL 2-fold larger than observed by RUNX2 alone (Figure
4.3D). Although unexpected, the anti-RUNX2 behavior of DHT could also engage a
process known as RANKL shedding. This approach involves the proteolytic cleavage of
membrane-anchored RANKL on osteoblasts to produce the truncated, soluble form of
RANKL (92). The elimination of membrane-bound RANKL might have increased the

52
amount of RANKL in conditioned media but ultimately made osteoblasts less effective at
stimulating osteoclastogenesis. Therefore, the observation made in Figure 4.3D likely
demonstrates another mechanism of DHT-mediate repression of RUNX2-driven
osteoclastogenesis (Figure 4.2).
The contribution of AR signaling in osteoclasts was not determined in the present study.
Therefore, unlike with ERα (Figure 3.2), I cannot definitively rule out the possibility that
DHT selectively or cooperatively attenuated RUNX2-mediated osteoblast driven
osteoclastogenesis through regulation that targets osteoblasts alone or together with
osteoclasts. Regardless, the present work provides strong evidence for the importance of
AR activation in osteoblasts to regulate osteoclastogenesis.
5.4 Osteogenic Expression of RANKL & RUNX2
RANKL is expressed in cells of different stages of the osteoblast lineage, from early bone
marrow mesenchymal progenitors to matrix-embedded osteocytes (88,117,118).
Expression of RANKL is predominant in earlier cells in the lineage, those not expressing
DMP-1 (119). Accordingly, early ablation of RANKL in vivo (with Prx1-Cre, Osx1-Cre
and Osteocalcin-Cre) completely abrogated osteoclastogenesis, whereas DMP-1-Cre-
driven ablation of RANKL from mature osteoblasts and osteocytes (120), resulted in
partial loss of osteoclastogenesis (119). Like RANKL, RUNX2 is also expressed in pre-
osteoblasts, mature osteoblasts and osteocytes (121-123), and although it does not
necessarily control RANKL gene expression (83,99,100), the present study suggests that
it could control RANKL trafficking in these cells. As a result, RUNX2-driven RANKL
trafficking on the surface of a bone marrow pre-osteoblast (89), for example, could
engage its receptor, RANK, on a neighboring monocytic cell to promote osteoclast

53
differentiation. RUNX2 in matrix-embedded osteocytes could also drive RANKL-
mediated osteoclastogenesis, although in this case it is easier to imagine a mechanism
involving RANKL secretion rather than cell-cell contact. If indeed RUNX2-mediated
osteoblast-driven osteoclastogenesis differentially depends on RANKL membrane
presentation in non-embedded pre/osteoblasts versus RANKL secretion by osteocytes,
our data would further suggest that estrogens and androgens might specifically attenuate
the former (Figure 3.4; Figure 4.4 versus Figure 3.3D,E; Figure 4.3D,E). RUNX2 may
also regulate RANKL trafficking in hypertrophic chondrocytes, which express both
proteins (88,118,121,122), potentially contributing to growth plate remodeling.
5.5 Therapeutics for Osteoporosis: Targeting RUNX2
As stated above, our working model attributes the anti-RUNX2, anti-osteoclastogenic
effect of E2 and DHT to the antagonism of RUNX2-driven presentation of RANKL on
the osteoblast membrane. This may result from the direct interaction and the global
inhibition of RUNX2’s transcriptional activity by ERα (75) and AR (76) in osteoblasts.
Such a mechanism is consistent with (i) E2 and DHT-mediated decrease in the expression
of RUNX2 target gene(s) and inhibition of extracellular mineralized matrix formation
reported herein and previously (124), and (ii) our observation that both sex hormones
inhibit RUNX2-mediated osteoblast-driven RANKL presentation and osteoclastogenesis.
Finally, one must consider additional mechanisms that potentially contribute to
antagonism of RUNX2-mediated osteoblast-driven osteoclastogenesis by E2 and DHT,
including the stimulation of Fasl, Mmp3 (49,125) and Opg (Figure 4.3B), respectively.
The present and previous studies demonstrating RUNX2-mediated osteoblast-driven
osteoclastogenesis (79-83) advocate the development of therapeutic approaches for the

54
treatment of high turnover bone disease by targeting either RUNX2 or downstream
mechanisms by which it regulates bone resorption. Although such anti-RUNX2 agents
might be deleterious at high doses and during accelerated bone formation in young
individuals, their pursuit for the treatment of high-turnover osteoporosis is justifiable by
the low and high bone mass phenotypes observed in mice where RUNX2 activity is
manipulated upwards and downwards, respectively (70,79,80,126). In fact, our work
suggests that the bone-sparing effect of E2 and DHT is attributable in part to antagonism
of RUNX2-mediated osteoblast-driven osteoclastogenesis. Future targeting of RUNX2,
or the RUNX2-regulated mechanisms responsible for RANKL membrane association,
may therefore provide tissue-specific solutions to functionally amplify the protective
roles of E2 and DHT in the skeleton. Furthermore, we have shown that SERMs inhibit
both RUNX2-driven transcription (75) and RUNX2-mediated osteoblast-driven
osteoclastogenesis (Figure 5), suggesting that their anti-RUNX2 activity may facilitate
their bone sparing properties.

55

REFERENCES

1. Harada S, Rodan GA. Control of osteoblast function and regulation of bone mass.
Nature. 2003;423(6937):349-355.
2. Taichman RS. Blood and bone: two tissues whose fates are intertwined to create
the hematopoietic stem-cell niche. Blood. 2005;105(7):2631-2639.
3. Beresford JN, Graves SE, Smoothy CA. Formation of mineralized nodules by
bone derived cells in vitro: a model of bone formation? American journal of
medical genetics. 1993;45(2):163-178.
4. Buckwalter JA, Glimcher MJ, Cooper RR, Recker R. Bone biology. I: Structure,
blood supply, cells, matrix, and mineralization. Instructional course lectures.
1996;45:371-386.
5. Sandberg MM. Matrix in cartilage and bone development: current views on the
function and regulation of major organic components. Annals of medicine.
1991;23(3):207-217.
6. Langdahl BL, Mortensen L, Vesterby A, Eriksen EF, Charles P. Bone
histomorphometry in hypoparathyroid patients treated with vitamin D. Bone.
1996;18(2):103-108.
7. Clarke B. Normal bone anatomy and physiology. Clinical journal of the American
Society of Nephrology : CJASN. 2008;3 Suppl 3:S131-139.
8. Robling AG, Stout SD. Morphology of the drifting osteon. Cells, tissues, organs.
1999;164(4):192-204.
9. Eriksen EFA, D.W.; Melsen, F. Bone Histomorphometry. New York: Raven
Press; 1994.
10. Jiang X, Iseki S, Maxson RE, Sucov HM, Morriss-Kay GM. Tissue origins and
interactions in the mammalian skull vault. Dev Biol. 2002;241(1):106-116.
11. Nefussi JR, Sautier JM, Nicolas V, Forest N. How osteoblasts become osteocytes:
a decreasing matrix forming process. Journal de biologie buccale. 1991;19(1):75-
82.
12. Palumbo C, Palazzini S, Marotti G. Morphological study of intercellular junctions
during osteocyte differentiation. Bone. 1990;11(6):401-406.
13. Parfitt AM. The cellular basis of bone turnover and bone loss: a rebuttal of the
osteocytic resorption--bone flow theory. Clinical orthopaedics and related
research. 1977(127):236-247.
14. van der Plas A, Nijweide PJ. Isolation and purification of osteocytes. J Bone
Miner Res. 1992;7(4):389-396.
15. Aarden EM, Nijweide PJ, van der Plas A, Alblas MJ, Mackie EJ, Horton MA,
Helfrich MH. Adhesive properties of isolated chick osteocytes in vitro. Bone.
1996;18(4):305-313.
16. Frost HM. Bone "mass" and the "mechanostat": a proposal. Anat Rec.
1987;219(1):1-9.
17. Aarden EM, Burger EH, Nijweide PJ. Function of osteocytes in bone. J Cell
Biochem. 1994;55(3):287-299.

56
18. Manolagas SC, Parfitt AM. For whom the bell tolls: distress signals from long-
lived osteocytes and the pathogenesis of metabolic bone diseases. Bone.
2013;54(2):272-278.
19. Hunziker EB. Mechanism of longitudinal bone growth and its regulation by
growth plate chondrocytes. Microscopy research and technique. 1994;28(6):505-
519.
20. Thesingh CW, Groot CG, Wassenaar AM. Transdifferentiation of hypertrophic
chondrocytes into osteoblasts in murine fetal metatarsal bones, induced by co-
cultured cerebrum. Bone and mineral. 1991;12(1):25-40.
21. Roach HI, Erenpreisa J, Aigner T. Osteogenic differentiation of hypertrophic
chondrocytes involves asymmetric cell divisions and apoptosis. J Cell Biol.
1995;131(2):483-494.
22. Suda T, Takahashi N, Udagawa N, Jimi E, Gillespie MT, Martin TJ. Modulation
of osteoclast differentiation and function by the new members of the tumor
necrosis factor receptor and ligand families. Endocr Rev. 1999;20(3):345-357.
23. Ross FP, Teitelbaum SL. alphavbeta3 and macrophage colony-stimulating factor:
partners in osteoclast biology. Immunological reviews. 2005;208:88-105.
24. Teitelbaum SL, Abu-Amer Y, Ross FP. Molecular mechanisms of bone
resorption. J Cell Biochem. 1995;59(1):1-10.
25. Burr DB. Targeted and nontargeted remodeling. Bone. 2002;30(1):2-4.
26. Marks SC, Jr., Popoff SN. Bone cell biology: the regulation of development,
structure, and function in the skeleton. The American journal of anatomy.
1988;183(1):1-44.
27. Parfitt AM. Osteonal and hemi-osteonal remodeling: the spatial and temporal
framework for signal traffic in adult human bone. J Cell Biochem.
1994;55(3):273-286.
28. Parfitt AM. Targeted and nontargeted bone remodeling: relationship to basic
multicellular unit origination and progression. Bone. 2002;30(1):5-7.
29. Das S, Crockett JC. Osteoporosis - a current view of pharmacological prevention
and treatment. Drug Des Devel Ther.7:435-448.
30. Hui SL, Slemenda CW, Johnston CC, Jr. Age and bone mass as predictors of
fracture in a prospective study. J Clin Invest. 1988;81(6):1804-1809.
31. Almeida M, Han L, Martin-Millan M, Plotkin LI, Stewart SA, Roberson PK,
Kousteni S, O'Brien CA, Bellido T, Parfitt AM, Weinstein RS, Jilka RL,
Manolagas SC. Skeletal involution by age-associated oxidative stress and its
acceleration by loss of sex steroids. J Biol Chem. 2007;282(37):27285-27297.
32. Walker-Bone K. Recognizing and treating secondary osteoporosis. Nature
reviews Rheumatology. 2012;8(8):480-492.
33. Falahati-Nini A, Riggs BL, Atkinson EJ, O'Fallon WM, Eastell R, Khosla S.
Relative contributions of testosterone and estrogen in regulating bone resorption
and formation in normal elderly men. J Clin Invest. 2000;106(12):1553-1560.
34. Services USDoHaH. Bone Health and Osteoporosis: A Report Of The Surgeon
General. 2010/10/15 ed. Rockville, MD: U.S. Department of Health and Human
Services, Office of the Surgeon General; 2004:
http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed
&dopt=Citation&list_uids=20945569. Accessed 2014/01/07.

57
35. Manolagas SC. From estrogen-centric to aging and oxidative stress: a revised
perspective of the pathogenesis of osteoporosis. Endocr Rev. 2010;31(3):266-300.
36. Khosla S, Melton LJ, 3rd, Riggs BL. The unitary model for estrogen deficiency
and the pathogenesis of osteoporosis: is a revision needed? J Bone Miner Res.
2011;26(3):441-451.
37. Riggs BL, Khosla S, Melton LJ, 3rd. Sex steroids and the construction and
conservation of the adult skeleton. Endocr Rev. 2002;23(3):279-302.
38. Frenkel B, Hong A, Baniwal SK, Coetzee GA, Ohlsson C, Khalid O, Gabet Y.
Regulation of adult bone turnover by sex steroids. J Cell Physiol.
2010;224(2):305-310.
39. Syed F, Khosla S. Mechanisms of sex steroid effects on bone. Biochem Biophys
Res Commun. 2005;328(3):688-696.
40. Beato M, Klug J. Steroid hormone receptors: an update. Human reproduction
update. 2000;6(3):225-236.
41. Kumar R, Thompson EB. The structure of the nuclear hormone receptors.
Steroids. 1999;64(5):310-319.
42. Lindberg MK, Weihua Z, Andersson N, Moverare S, Gao H, Vidal O, Erlandsson
M, Windahl S, Andersson G, Lubahn DB, Carlsten H, Dahlman-Wright K,
Gustafsson JA, Ohlsson C. Estrogen receptor specificity for the effects of
estrogen in ovariectomized mice. J Endocrinol. 2002;174(2):167-178.
43. Sims NA, Clement-Lacroix P, Minet D, Fraslon-Vanhulle C, Gaillard-Kelly M,
Resche-Rigon M, Baron R. A functional androgen receptor is not sufficient to
allow estradiol to protect bone after gonadectomy in estradiol receptor-deficient
mice. J Clin Invest. 2003;111(9):1319-1327.
44. Manolagas SC, O'Brien CA, Almeida M. The role of estrogen and androgen
receptors in bone health and disease. Nat Rev Endocrinol. 2013;9(12):699-712.
45. Manolagas SC, O'Brien CA, Almeida M. The role of estrogen and androgen
receptors in bone health and disease. Nat Rev Endocrinol.9(12):699-712.
46. Khosla S. Update on estrogens and the skeleton. J Clin Endocrinol
Metab.95(8):3569-3577.
47. Jilka RL, Takahashi K, Munshi M, Williams DC, Roberson PK, Manolagas SC.
Loss of estrogen upregulates osteoblastogenesis in the murine bone marrow.
Evidence for autonomy from factors released during bone resorption. J Clin
Invest. 1998;101(9):1942-1950.
48. Di Gregorio GB, Yamamoto M, Ali AA, Abe E, Roberson P, Manolagas SC, Jilka
RL. Attenuation of the self-renewal of transit-amplifying osteoblast progenitors in
the murine bone marrow by 17 beta-estradiol. J Clin Invest. 2001;107(7):803-812.
49. Krum SA, Miranda-Carboni GA, Hauschka PV, Carroll JS, Lane TF, Freedman
LP, Brown M. Estrogen protects bone by inducing Fas ligand in osteoblasts to
regulate osteoclast survival. EMBO J. 2008;27(3):535-545.
50. Kameda T, Mano H, Yuasa T, Mori Y, Miyazawa K, Shiokawa M, Nakamaru Y,
Hiroi E, Hiura K, Kameda A, Yang NN, Hakeda Y, Kumegawa M. Estrogen
inhibits bone resorption by directly inducing apoptosis of the bone-resorbing
osteoclasts. J Exp Med. 1997;186(4):489-495.
51. Nakamura T, Imai Y, Matsumoto T, Sato S, Takeuchi K, Igarashi K, Harada Y,
Azuma Y, Krust A, Yamamoto Y, Nishina H, Takeda S, Takayanagi H, Metzger

58
D, Kanno J, Takaoka K, Martin TJ, Chambon P, Kato S. Estrogen prevents bone
loss via estrogen receptor alpha and induction of Fas ligand in osteoclasts. Cell.
2007;130(5):811-823.
52. Sinnesael M, Boonen S, Claessens F, Gielen E, Vanderschueren D. Testosterone
and the male skeleton: a dual mode of action. Journal of osteoporosis.
2011;2011:240328.
53. Smith EP, Boyd J, Frank GR, Takahashi H, Cohen RM, Specker B, Williams TC,
Lubahn DB, Korach KS. Estrogen resistance caused by a mutation in the
estrogen-receptor gene in a man. N Engl J Med. 1994;331(16):1056-1061.
54. Bouillon R, Bex M, Vanderschueren D, Boonen S. Estrogens are essential for
male pubertal periosteal bone expansion. J Clin Endocrinol Metab.
2004;89(12):6025-6029.
55. Gennari L, Nuti R, Bilezikian JP. Aromatase activity and bone homeostasis in
men. J Clin Endocrinol Metab. 2004;89(12):5898-5907.
56. Rochira V, Zirilli L, Madeo B, Aranda C, Caffagni G, Fabre B, Montangero VE,
Roldan EJ, Maffei L, Carani C. Skeletal effects of long-term estrogen and
testosterone replacement treatment in a man with congenital aromatase
deficiency: evidences of a priming effect of estrogen for sex steroids action on
bone. Bone. 2007;40(6):1662-1668.
57. Lanfranco F, Zirilli L, Baldi M, Pignatti E, Corneli G, Ghigo E, Aimaretti G,
Carani C, Rochira V. A novel mutation in the human aromatase gene: insights on
the relationship among serum estradiol, longitudinal growth and bone mineral
density in an adult man under estrogen replacement treatment. Bone.
2008;43(3):628-635.
58. Oz OK, Zerwekh JE, Fisher C, Graves K, Nanu L, Millsaps R, Simpson ER. Bone
has a sexually dimorphic response to aromatase deficiency. J Bone Miner Res.
2000;15(3):507-514.
59. Miyaura C, Toda K, Inada M, Ohshiba T, Matsumoto C, Okada T, Ito M, Shizuta
Y, Ito A. Sex- and age-related response to aromatase deficiency in bone. Biochem
Biophys Res Commun. 2001;280(4):1062-1068.
60. Carani C, Qin K, Simoni M, Faustini-Fustini M, Serpente S, Boyd J, Korach KS,
Simpson ER. Effect of testosterone and estradiol in a man with aromatase
deficiency. N Engl J Med. 1997;337(2):91-95.
61. Bilezikian JP, Morishima A, Bell J, Grumbach MM. Increased bone mass as a
result of estrogen therapy in a man with aromatase deficiency. N Engl J Med.
1998;339(9):599-603.
62. Vandenput L, Swinnen JV, Van Herck E, Verstuyf A, Boonen S, Bouillon R,
Vanderschueren D. The estrogen receptor ligand ICI 182,780 does not impair the
bone-sparing effects of testosterone in the young orchidectomized rat model.
Calcif Tissue Int. 2002;70(3):170-175.
63. Vandenput L, Swinnen JV, Boonen S, Van Herck E, Erben RG, Bouillon R,
Vanderschueren D. Role of the androgen receptor in skeletal homeostasis: the
androgen-resistant testicular feminized male mouse model. J Bone Miner Res.
2004;19(9):1462-1470.
64. Notini AJ, McManus JF, Moore A, Bouxsein M, Jimenez M, Chiu WS, Glatt V,
Kream BE, Handelsman DJ, Morris HA, Zajac JD, Davey RA. Osteoblast

59
deletion of exon 3 of the androgen receptor gene results in trabecular bone loss in
adult male mice. J Bone Miner Res. 2007;22(3):347-356.
65. Chiang C, Chiu M, Moore AJ, Anderson PH, Ghasem-Zadeh A, McManus JF, Ma
C, Seeman E, Clemens TL, Morris HA, Zajac JD, Davey RA. Mineralization and
bone resorption are regulated by the androgen receptor in male mice. J Bone
Miner Res. 2009;24(4):621-631.
66. Wiren KM, Zhang XW, Toombs AR, Kasparcova V, Gentile MA, Harada S,
Jepsen KJ. Targeted overexpression of androgen receptor in osteoblasts:
unexpected complex bone phenotype in growing animals. Endocrinology.
2004;145(7):3507-3522.
67. Baniwal SK, Khalid O, Gabet Y, Shah RR, Purcell DJ, Mav D, Kohn-Gabet AE,
Shi Y, Coetzee GA, Frenkel B. Runx2 transcriptome of prostate cancer cells:
insights into invasiveness and bone metastasis. Mol Cancer.9:258.
68. Komori T. Signaling networks in RUNX2-dependent bone development. J Cell
Biochem.112(3):750-755.
69. Ducy P, Zhang R, Geoffroy V, Ridall AL, Karsenty G. Osf2/Cbfa1: a
transcriptional activator of osteoblast differentiation. Cell. 1997;89(5):747-754.
70. Komori T, Yagi H, Nomura S, Yamaguchi A, Sasaki K, Deguchi K, Shimizu Y,
Bronson RT, Gao YH, Inada M, Sato M, Okamoto R, Kitamura Y, Yoshiki S,
Kishimoto T. Targeted disruption of Cbfa1 results in a complete lack of bone
formation owing to maturational arrest of osteoblasts. Cell. 1997;89(5):755-764.
71. Otto F, Thornell AP, Crompton T, Denzel A, Gilmour KC, Rosewell IR, Stamp
GW, Beddington RS, Mundlos S, Olsen BR, Selby PB, Owen MJ. Cbfa1, a
candidate gene for cleidocranial dysplasia syndrome, is essential for osteoblast
differentiation and bone development. Cell. 1997;89(5):765-771.
72. Kania MA, Bonner AS, Duffy JB, Gergen JP. The Drosophila segmentation gene
runt encodes a novel nuclear regulatory protein that is also expressed in the
developing nervous system. Genes Dev. 1990;4(10):1701-1713.
73. Ogawa E, Inuzuka M, Maruyama M, Satake M, Naito-Fujimoto M, Ito Y,
Shigesada K. Molecular cloning and characterization of PEBP2 beta, the
heterodimeric partner of a novel Drosophila runt-related DNA binding protein
PEBP2 alpha. Virology. 1993;194(1):314-331.
74. Wang S, Wang Q, Crute BE, Melnikova IN, Keller SR, Speck NA. Cloning and
characterization of subunits of the T-cell receptor and murine leukemia virus
enhancer core-binding factor. Mol Cell Biol. 1993;13(6):3324-3339.
75. Khalid O, Baniwal SK, Purcell DJ, Leclerc N, Gabet Y, Stallcup MR, Coetzee
GA, Frenkel B. Modulation of Runx2 activity by estrogen receptor-alpha:
implications for osteoporosis and breast cancer. Endocrinology.
2008;149(12):5984-5995.
76. Baniwal SK, Khalid O, Sir D, Buchanan G, Coetzee GA, Frenkel B. Repression
of Runx2 by androgen receptor (AR) in osteoblasts and prostate cancer cells: AR
binds Runx2 and abrogates its recruitment to DNA. Mol Endocrinol.
2009;23(8):1203-1214.
77. Ducy P, Karsenty G. Two distinct osteoblast-specific cis-acting elements control
expression of a mouse osteocalcin gene. Mol Cell Biol. 1995;15(4):1858-1869.

60
78. Banerjee C, McCabe LR, Choi JY, Hiebert SW, Stein JL, Stein GS, Lian JB. Runt
homology domain proteins in osteoblast differentiation: AML3/CBFA1 is a major
component of a bone-specific complex. J Cell Biochem. 1997;66(1):1-8.
79. Liu W, Toyosawa S, Furuichi T, Kanatani N, Yoshida C, Liu Y, Himeno M,
Narai S, Yamaguchi A, Komori T. Overexpression of Cbfa1 in osteoblasts
inhibits osteoblast maturation and causes osteopenia with multiple fractures. J
Cell Biol. 2001;155(1):157-166.
80. Geoffroy V, Kneissel M, Fournier B, Boyde A, Matthias P. High bone resorption
in adult aging transgenic mice overexpressing cbfa1/runx2 in cells of the
osteoblastic lineage. Mol Cell Biol. 2002;22(17):6222-6233.
81. Maruyama Z, Yoshida CA, Furuichi T, Amizuka N, Ito M, Fukuyama R,
Miyazaki T, Kitaura H, Nakamura K, Fujita T, Kanatani N, Moriishi T, Yamana
K, Liu W, Kawaguchi H, Komori T. Runx2 determines bone maturity and
turnover rate in postnatal bone development and is involved in bone loss in
estrogen deficiency. Dev Dyn. 2007;236(7):1876-1890.
82. Enomoto H, Shiojiri S, Hoshi K, Furuichi T, Fukuyama R, Yoshida CA, Kanatani
N, Nakamura R, Mizuno A, Zanma A, Yano K, Yasuda H, Higashio K, Takada K,
Komori T. Induction of osteoclast differentiation by Runx2 through receptor
activator of nuclear factor-kappa B ligand (RANKL) and osteoprotegerin
regulation and partial rescue of osteoclastogenesis in Runx2-/- mice by RANKL
transgene. J Biol Chem. 2003;278(26):23971-23977.
83. Baniwal SK, Shah PK, Shi Y, Haduong JH, Declerck YA, Gabet Y, Frenkel B.
Runx2 promotes both osteoblastogenesis and novel osteoclastogenic signals in
ST2 mesenchymal progenitor cells. Osteoporos Int.23(4):1399-1413.
84. Suda T, Takahashi N, Martin TJ. Modulation of osteoclast differentiation. Endocr
Rev. 1992;13(1):66-80.
85. Kong YY, Yoshida H, Sarosi I, Tan HL, Timms E, Capparelli C, Morony S,
Oliveira-dos-Santos AJ, Van G, Itie A, Khoo W, Wakeham A, Dunstan CR,
Lacey DL, Mak TW, Boyle WJ, Penninger JM. OPGL is a key regulator of
osteoclastogenesis, lymphocyte development and lymph-node organogenesis.
Nature. 1999;397(6717):315-323.
86. Lacey DL, Timms E, Tan HL, Kelley MJ, Dunstan CR, Burgess T, Elliott R,
Colombero A, Elliott G, Scully S, Hsu H, Sullivan J, Hawkins N, Davy E,
Capparelli C, Eli A, Qian YX, Kaufman S, Sarosi I, Shalhoub V, Senaldi G, Guo
J, Delaney J, Boyle WJ. Osteoprotegerin ligand is a cytokine that regulates
osteoclast differentiation and activation. Cell. 1998;93(2):165-176.
87. Yasuda H, Shima N, Nakagawa N, Yamaguchi K, Kinosaki M, Mochizuki S,
Tomoyasu A, Yano K, Goto M, Murakami A, Tsuda E, Morinaga T, Higashio K,
Udagawa N, Takahashi N, Suda T. Osteoclast differentiation factor is a ligand for
osteoprotegerin/osteoclastogenesis-inhibitory factor and is identical to
TRANCE/RANKL. Proc Natl Acad Sci U S A. 1998;95(7):3597-3602.
88. Kartsogiannis V, Zhou H, Horwood NJ, Thomas RJ, Hards DK, Quinn JM,
Niforas P, Ng KW, Martin TJ, Gillespie MT. Localization of RANKL (receptor
activator of NF kappa B ligand) mRNA and protein in skeletal and extraskeletal
tissues. Bone. 1999;25(5):525-534.

61
89. Eghbali-Fatourechi G, Khosla S, Sanyal A, Boyle WJ, Lacey DL, Riggs BL. Role
of RANK ligand in mediating increased bone resorption in early postmenopausal
women. J Clin Invest. 2003;111(8):1221-1230.
90. Tanaka S, Takahashi N, Udagawa N, Tamura T, Akatsu T, Stanley ER, Kurokawa
T, Suda T. Macrophage colony-stimulating factor is indispensable for both
proliferation and differentiation of osteoclast progenitors. J Clin Invest.
1993;91(1):257-263.
91. Itoh K, Udagawa N, Matsuzaki K, Takami M, Amano H, Shinki T, Ueno Y,
Takahashi N, Suda T. Importance of membrane- or matrix-associated forms of M-
CSF and RANKL/ODF in osteoclastogenesis supported by SaOS-4/3 cells
expressing recombinant PTH/PTHrP receptors. J Bone Miner Res.
2000;15(9):1766-1775.
92. Hikita A, Yana I, Wakeyama H, Nakamura M, Kadono Y, Oshima Y, Nakamura
K, Seiki M, Tanaka S. Negative regulation of osteoclastogenesis by ectodomain
shedding of receptor activator of NF-kappaB ligand. J Biol Chem.
2006;281(48):36846-36855.
93. Kariya Y, Honma M, Aoki S, Chiba A, Suzuki H. Vps33a mediates RANKL
storage in secretory lysosomes in osteoblastic cells. J Bone Miner Res.
2009;24(10):1741-1752.
94. Takahashi N, Akatsu T, Udagawa N, Sasaki T, Yamaguchi A, Moseley JM,
Martin TJ, Suda T. Osteoblastic cells are involved in osteoclast formation.
Endocrinology. 1988;123(5):2600-2602.
95. Hofbauer LC, Khosla S, Dunstan CR, Lacey DL, Spelsberg TC, Riggs BL.
Estrogen stimulates gene expression and protein production of osteoprotegerin in
human osteoblastic cells. Endocrinology. 1999;140(9):4367-4370.
96. Bellido T, Jilka RL, Boyce BF, Girasole G, Broxmeyer H, Dalrymple SA, Murray
R, Manolagas SC. Regulation of interleukin-6, osteoclastogenesis, and bone mass
by androgens. The role of the androgen receptor. J Clin Invest. 1995;95(6):2886-
2895.
97. Hofbauer LC, Ten RM, Khosla S. The anti-androgen hydroxyflutamide and
androgens inhibit interleukin-6 production by an androgen-responsive human
osteoblastic cell line. J Bone Miner Res. 1999;14(8):1330-1337.
98. Byon CH, Sun Y, Chen J, Yuan K, Mao X, Heath JM, Anderson PG, Tintut Y,
Demer LL, Wang D, Chen Y. Runx2-upregulated receptor activator of nuclear
factor kappaB ligand in calcifying smooth muscle cells promotes migration and
osteoclastic differentiation of macrophages. Arterioscler Thromb Vasc
Biol.31(6):1387-1396.
99. O'Brien CA, Kern B, Gubrij I, Karsenty G, Manolagas SC. Cbfa1 does not
regulate RANKL gene activity in stromal/osteoblastic cells. Bone.
2002;30(3):453-462.
100. O'Brien CA. Control of RANKL gene expression. Bone.46(4):911-919.
101. Gabet Y, Noh T, Lee C, Frenkel B. Developmentally regulated inhibition of cell
cycle progression by glucocorticoids through repression of cyclin A transcription
in primary osteoblast cultures. J Cell Physiol.226(4):991-998.
102. Udagawa N, Takahashi N, Akatsu T, Tanaka H, Sasaki T, Nishihara T, Koga T,
Martin TJ, Suda T. Origin of osteoclasts: mature monocytes and macrophages are

62
capable of differentiating into osteoclasts under a suitable microenvironment
prepared by bone marrow-derived stromal cells. Proc Natl Acad Sci U S A.
1990;87(18):7260-7264.
103. Singh PP, van der Kraan AG, Xu J, Gillespie MT, Quinn JM. Membrane-bound
receptor activator of NFkappaB ligand (RANKL) activity displayed by
osteoblasts is differentially regulated by osteolytic factors. Biochem Biophys Res
Commun. 2012;422(1):48-53.
104. Persson I. Estrogens in the causation of breast, endometrial and ovarian cancers -
evidence and hypotheses from epidemiological findings. The Journal of steroid
biochemistry and molecular biology. 2000;74(5):357-364.
105. Adhami MD, Rashid H, Chen H, Clarke JC, Yang Y, Javed A. Loss of Runx2 in
Committed Osteoblasts Impairs Postnatal Skeletogenesis. J Bone Miner Res.
2014.
106. Almeida M, Martin-Millan M, Ambrogini E, Bradsher R, 3rd, Han L, Chen XD,
Roberson PK, Weinstein RS, O'Brien CA, Jilka RL, Manolagas SC. Estrogens
attenuate oxidative stress and the differentiation and apoptosis of osteoblasts by
DNA-binding-independent actions of the ERalpha. J Bone Miner Res.
2010;25(4):769-781.
107. Dupont S, Krust A, Gansmuller A, Dierich A, Chambon P, Mark M. Effect of
single and compound knockouts of estrogen receptors alpha (ERalpha) and beta
(ERbeta) on mouse reproductive phenotypes. Development. 2000;127(19):4277-
4291.
108. Saika M, Inoue D, Kido S, Matsumoto T. 17beta-estradiol stimulates expression
of osteoprotegerin by a mouse stromal cell line, ST-2, via estrogen receptor-alpha.
Endocrinology. 2001;142(6):2205-2212.
109. Little GH, Noushmehr H, Baniwal SK, Berman BP, Coetzee GA, Frenkel B.
Genome-wide Runx2 occupancy in prostate cancer cells suggests a role in
regulating secretion. Nucleic Acids Res.40(8):3538-3547.
110. Jimi E, Nakamura I, Amano H, Taguchi Y, Tsurukai T, Tamura M, Takahashi N,
Suda T. Osteoclast function is activated by osteoblastic cells through a
mechanism involving cell-to-cell contact. Endocrinology. 1996;137(8):2187-
2190.
111. Chen Q, Kaji H, Kanatani M, Sugimoto T, Chihara K. Testosterone increases
osteoprotegerin mRNA expression in mouse osteoblast cells. Hormone and
metabolic research = Hormon- und Stoffwechselforschung = Hormones et
metabolisme. 2004;36(10):674-678.
112. Chimge NO, Frenkel B. The RUNX family in breast cancer: relationships with
estrogen signaling. Oncogene.32(17):2121-2130.
113. Schramek D, Leibbrandt A, Sigl V, Kenner L, Pospisilik JA, Lee HJ, Hanada R,
Joshi PA, Aliprantis A, Glimcher L, Pasparakis M, Khokha R, Ormandy CJ,
Widschwendter M, Schett G, Penninger JM. Osteoclast differentiation factor
RANKL controls development of progestin-driven mammary cancer.
Nature.468(7320):98-102.
114. Nakashima T, Kobayashi Y, Yamasaki S, Kawakami A, Eguchi K, Sasaki H,
Sakai H. Protein expression and functional difference of membrane-bound and
soluble receptor activator of NF-kappaB ligand: modulation of the expression by

63
osteotropic factors and cytokines. Biochem Biophys Res Commun.
2000;275(3):768-775.
115. Windahl SH, Borjesson AE, Farman HH, Engdahl C, Moverare-Skrtic S, Sjogren
K, Lagerquist MK, Kindblom JM, Koskela A, Tuukkanen J, Divieti Pajevic P,
Feng JQ, Dahlman-Wright K, Antonson P, Gustafsson JA, Ohlsson C. Estrogen
receptor-alpha in osteocytes is important for trabecular bone formation in male
mice. Proc Natl Acad Sci U S A. 2013;110(6):2294-2299.
116. Schiltz C, Prouillet C, Marty C, Merciris D, Collet C, de Vernejoul MC, Geoffroy
V. Bone loss induced by Runx2 over-expression in mice is blunted by osteoblastic
over-expression of TIMP-1. J Cell Physiol. 2010;222(1):219-229.
117. Mueller RJ, Richards RG. Immunohistological identification of receptor activator
of NF-kappaB ligand (RANKL) in human, ovine and bovine bone tissues. J Mater
Sci Mater Med. 2004;15(4):367-372.
118. Silvestrini G, Ballanti P, Patacchioli F, Leopizzi M, Gualtieri N, Monnazzi P,
Tremante E, Sardella D, Bonucci E. Detection of osteoprotegerin (OPG) and its
ligand (RANKL) mRNA and protein in femur and tibia of the rat. J Mol Histol.
2005;36(1-2):59-67.
119. Xiong J, Onal M, Jilka RL, Weinstein RS, Manolagas SC, O'Brien CA. Matrix-
embedded cells control osteoclast formation. Nat Med. 2011;17(10):1235-1241.
120. Kalajzic I, Matthews BG, Torreggiani E, Harris MA, Divieti Pajevic P, Harris SE.
In vitro and in vivo approaches to study osteocyte biology. Bone. 2013;54(2):296-
306.
121. Inada M, Yasui T, Nomura S, Miyake S, Deguchi K, Himeno M, Sato M,
Yamagiwa H, Kimura T, Yasui N, Ochi T, Endo N, Kitamura Y, Kishimoto T,
Komori T. Maturational disturbance of chondrocytes in Cbfa1-deficient mice.
Dev Dyn. 1999;214(4):279-290.
122. Bronckers AL, Sasaguri K, Engelse MA. Transcription and immunolocalization
of Runx2/Cbfa1/Pebp2alphaA in developing rodent and human craniofacial
tissues: further evidence suggesting osteoclasts phagocytose osteocytes.
Microscopy research and technique. 2003;61(6):540-548.
123. Amir LR, Jovanovic A, Perdijk FB, Toyosawa S, Everts V, Bronckers AL.
Immunolocalization of sibling and RUNX2 proteins during vertical distraction
osteogenesis in the human mandible. J Histochem Cytochem. 2007;55(11):1095-
1104.
124. Almeida M, Iyer S, Martin-Millan M, Bartell SM, Han L, Ambrogini E, Onal M,
Xiong J, Weinstein RS, Jilka RL, O'Brien CA, Manolagas SC. Estrogen receptor-
alpha signaling in osteoblast progenitors stimulates cortical bone accrual. J Clin
Invest.123(1):394-404.
125. Garcia AJ, Tom C, Guemes M, Polanco G, Mayorga ME, Wend K, Miranda-
Carboni GA, Krum SA. ERalpha signaling regulates MMP3 expression to induce
FasL cleavage and osteoclast apoptosis. J Bone Miner Res.28(2):283-290.
126. He N, Xiao Z, Yin T, Stubbs J, Li L, Quarles LD. Inducible expression of Runx2
results in multiorgan abnormalities in mice. J Cell Biochem.112(2):653-665.

Abstract (if available)

Abstract In addition to its thoroughly investigated role in bone formation, the osteoblast master transcription factor RUNX2 also promotes osteoclastogenesis and bone resorption. Here we demonstrate that 17β-estradiol (E2) and dihydrotestosterone (DHT), which are known to attenuate bone turnover in vivo and RUNX2 activity in vitro, strongly inhibit RUNX2- mediated osteoblast-driven osteoclastogenesis in co-cultures. Towards deciphering the underlying mechanism, we induced premature expression of RUNX2 in primary murine pre-osteoblasts, which resulted in robust differentiation of co-cultured splenocytes into mature osteoclasts. This was attributable to RUNX2-mediated increase in RANKL secretion, determined by ELISA, as well as to RUNX2-mediated increase in RANKL association with the osteoblast membrane, demonstrated using confocal fluorescence microscopy. The increased association with the osteoblast membrane was recapitulated by transiently expressed GFP-RANKL. E2 and DHT abolished the RUNX2-mediated increase in membrane-associated RANKL and GFP-RANKL, as well as the concomitant osteoclastogenesis. RUNX2-mediated RANKL cellular redistribution was attributable in part to a decrease in Opg expression with attenuation by DHT to restore Opg expression. E2, however, did not influence Opg expression either in the presence or absence of RUNX2. Diminution of RUNX2-mediated osteoclastogenesis by E2 occurred regardless of whether the pre-osteoclasts were derived from wild type or estrogen receptor alpha (ERα)-knockout mice, suggesting that activated ERα inhibited osteoblast-driven osteoclastogenesis by acting in osteoblasts, possibly targeting RUNX2. Furthermore, the selective ER modulators (SERMs) tamoxifen and raloxifene mimicked E2 in abrogating the stimulatory effect of osteoblastic RUNX2 on osteoclast differentiation in the co-culture assay. Thus, E2 and DHT antagonize RUNX2-mediated RANKL trafficking and subsequent osteoclastogenesis. Targeting RUNX2 and/or downstream mechanisms that regulate RANKL trafficking may lead to the development of improved SERMs, androgenic, and possibly other non-hormonal therapeutic approaches to high turnover bone disease.

Linked assets

University of Southern California Dissertations and Theses

Conceptually similar

PDF

Preosteoblast-specific RUNX2 promotes RANKL membrane association: antagonism by sex steroids through a non-genomic mechanism

PDF

RUNX2 stimulates osteoblast-driven osteoclastogenesis by RANKL presentation

PDF

Inhibitory effects of estradiol and SERMs on RUNX2-driven osteoblast differentiation and gene expression

PDF

Runx2 interactions with the osteoblast genome

PDF

Glucocorticoids and Runx2 synergistically stimulate Wif1 and compromise pre-osteoblats in vitro

PDF

Study of the role of bone morphogenetic proteins in prostate cancer progression

Asset Metadata

Creator Martin, Anthony (author)

Core Title RUNX2 & sex steroids: molecular mechanisms in regulating bone turnover

School Keck School of Medicine

Degree Doctor of Philosophy

Degree Program Genetic, Molecular and Cellular Biology

Publication Date 09/23/2014

Defense Date 09/03/2014

Publisher University of Southern California (original), University of Southern California. Libraries (digital)

Tag androgen,AR,bone,DHT,E2,ER,Estrogen,Menopause,OAI-PMH Harvest,osteoblasts,osteoclastogenesis,osteoclasts,osteoporosis,protein trafficking,RANKL,remodeling,RUNX2,SERMs,sex steroids

Format application/pdf (imt)

Language English

Contributor Electronically uploaded by the author (provenance)

Advisor Hacia, Joseph G. (committee chair), Frenkel, Baruch (committee member), Mariani, Francesca (committee member)

Creator Email martinan@usc.edu,milligrams@gmail.com

Permanent Link (DOI) https://doi.org/10.25549/usctheses-c3-484441

Unique identifier UC11286977

Identifier etd-MartinAnth-2984.pdf (filename),usctheses-c3-484441 (legacy record id)

Legacy Identifier etd-MartinAnth-2984.pdf

Dmrecord 484441

Document Type Dissertation

Format application/pdf (imt)

Rights Martin, Anthony

Type texts

Source University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Access Conditions The author retains rights to his/her dissertation, thesis or other graduate work according to U.S. copyright law. Electronic access is being provided by the USC Libraries in agreement with the a...

Repository Name University of Southern California Digital Library

Repository Location USC Digital Library, University of Southern California, University Park Campus MC 2810, 3434 South Grand Avenue, 2nd Floor, Los Angeles, California 90089-2810, USA