University of Southern California Dissertations and Theses

The roles of endoplasmic reticulum chaperones in regulating liver homeostasis and tumorigenesis

(USC Thesis Other)

The roles of endoplasmic reticulum chaperones in regulating liver homeostasis and tumorigenesis

PDF

Download a page range

Download transcript

Copy asset link

Request this asset

Transcript (if available)

Content

THE ROLES OF ENDOPLASMIC RETICULUM CHAPERONES IN REGULATING
LIVER HOMEOSTASIS AND TUMORIGENESIS

by

Wan-Ting Chen

A Dissertation Presented to the
FACULTY OF THE USC GRADUATE SCHOOL
UNIVERSITY OF SOUTHERN CALIFORNIA
In Partial Fulfillment of the
Requirements for the Degree
DOCTOR OF PHILOSOPHY
(GENETIC, MOLECULAR AND CELLULAR BIOLOGY)

August 2014

Copyright 2014 Wan-Ting Chen

ii

DEDICATION

To my loving parents, Fei-Chin Chen and Fei-Ling Hu,
and to my dear husband, Justin Tang,
for their unconditional support along the way.

iii

ACKNOWLEDGEMENTS

This dissertation would not have been possible without all the generous help and
support of many people. First of all, I would like to sincerely thank my advisor, Dr.
Amy Lee, for her invaluable guidance and advises during my Ph.D. study at USC.
Amy inspired her students greatly on dedication, fearlessness, enthusiasm, and
discipline. I also appreciate her training in critical thinking and writing, as well as her
abundant support and encouragement.

I am grateful for my wonderful committee members throughout the years. I really
appreciate the fruitful cooperation, insightful discussions, and tremendous
encouragement from Dr. Bangyan Stiles, as well as the inspiring conversations and
perspective suggestions from Dr. Keigo Machida. I would also like to thank Dr. Gary
Kanel and Dr. Louis Dubeau for their helpful consultations on histology and pathology,
and members in Dr. Stiles’ lab for their experimental assistance and helpful discussions
on my projects.

I would like to thank all the former and current Lee lab members for making the lab
such a friendly, encouraging, and supportive environment. Former members include
Yong Fu, Risheng Ye, Miao Wang, Shiuan Wey, Dezheng Dong, Kyle Pfaffenbach, Hui
Zhou, Biquan Luo, Michelle Pong, and Kate Ott. Current members include Yi Zhang,
Genyuan Zhu, Jieli Shen, Chun-Chih Tseng, Yuan-Li Tsai, Daisy Flores, Dat Ha, and
John Johnson. I am so grateful for their great help, discussions, and the wonderful

iv

friendships that will continue to thrive for years to come.

I would like to take this opportunity to thank the technical support and core
facilities in USC: Denis Alexander Trana and Mo-Li Chen from the USC Norris
Comprehensive Cancer Center Translational Pathology Core, Michelle Mac Veigh from
the Cell and Tissue Imaging Core of the USC Research Center for Liver Diseases, and
the USC Norris Comprehensive Cancer Center Cell and Tissue Imaging Core.

I am also very thankful to my former and current classmates, especially Sheng-Fang
Su, Hui Shen, and Suhn Kyong Rhie, fellow researchers, and good friends in LA, who
not only shared all the good times and bad times with me, but also gave me
encouragement and marvelous advises.

Last but not least, I would like to express my deepest gratitude and love towards
my husband, my parents, as well as my loving family members and friends in Taiwan,
US, and Canada. They have always been standing by me and gave me strength to excel
through this journey.

v

TABLE OF CONTENTS

DEDICATION ii
ACKNOWLEDGEMENTS iii
LIST OF TABLES vii
LIST OF FIGURES
ABSTRACT
viii
x

Chapter 1: Overview and Introduction 1
1.1 ER stress and ER chaperones 1
1.2 GRP94 and its functions 3
1.3 GRP78 and its role in cancer 7

Chapter 2: Liver-specific Knockout of Grp94 in Mice Disrupts Cell
Adhesion, Activates Liver Progenitor Cells, and Accelerates Pten-null
Liver Tumorigenesis

10
2.1 Introduction 10
2.2 Materials and Methods 12
2.3 Results 18
2.3.1 Hyperproliferation of Liver Progenitor Cells in cGrp94
f/f
Mice 18
2.3.2 Disorganization of Cell Adhesion Molecules in cGrp94
f/f
Livers 24
2.3.3 Accelerated Liver Tumorigenesis by Biallelic Deletion of Pten and
Grp94 in the Liver
25
2.3.4 Development of Hepatocellular Carcinoma and Cholangiocarcinoma
in cPten
f/f
Grp94
f/f
Mice
27
2.3.5 Expansion of the Liver Progenitor Cell Pool in cPten
f/f
Grp94
f/f
Mice 30
2.3.6 Disturbance of Cell Junctions in cPten
f/f
Grp94
f/f
Livers 31
2.3.7 ERK Activation in Premalignant cPten
f/f
Grp94
f/f
Livers 34
2.4 Discussion 35

vi

Chapter 3: Targeted Deletion of GRP94 in the Liver Results in
Spontaneous Liver Tumor Formation in Aged Mice

41
3.1 Introduction 41
3.2 Materials and Methods 43
3.3 Results 46
3.3.1 Spontaneous live tumor formation in aged cGrp94
f/f
mice 46
3.3.2 Progressive repopulation of cGrp94
f/f
livers with GRP94-positive
hepatocytes
48
3.3.3 Increased proliferation along with stellate cell activation and liver
fibrosis in cGrp94
f/f
livers
49
3.3.4 Activation of TGF-β signaling in premalignant cGrp94
f/f
livers 53
3.3.5 Expansion of GRP94-negative liver progenitor cells in cGrp94
f/f
mice 55
3.4 Discussion 57

Chapter 4: GRP78 as a Regulator of Liver Steatosis and Cancer
Progression Mediated by Loss of the Tumor Suppressor PTEN

64
4.1 Introduction 64
4.2 Materials and Methods 67
4.3 Results 72
4.3.1 Creation of the mouse model with biallelic deletion of Grp78 and Pten
in the liver
72
4.3.2 GRP78 reduction in Pten-null livers promoted liver steatosis, liver
injury and bile duct proliferation
76
4.3.3 cPten
f/f
Grp78
f/f
livers showed increased proliferation, progenitor cell
expansion and GRP78 expression in bile duct cells
80
4.3.4 Perturbation of selective signaling pathways in cPten
f/f
Grp78
f/f
livers 82
4.3.5 Accelerated HCC and CC development and repopulation of GRP78-
positive cells in cPten
f/f
Grp78
f/f
livers
84
4.4 Discussion 86

Chapter 5: Conclusions and Perspectives 93
BIBLIOGRAPHY 106

vii

LIST OF TABLES

Table 2.1: Primer sequences for mouse genotyping 14
Table 4.1: Primer sequences for mouse genotyping 69

viii

LIST OF FIGURES

Figure 2.1. Hyperproliferation of cells adjacent to portal veins in cGrp94
f/f
livers

19
Figure 2.2: Percentage of proliferative cells co-stained with cell markers and
zonation pattern in the liver

20
Figure 2.3: Increased LPC pool in cGrp94
f/f
mice

22
Figure 2.4: Disruption of cell adhesion molecules in cGrp94
f/f
livers at 2
months

24
Figure 2.5: Biallelic deletion of Pten and Grp94 in the liver accelerates liver
tumorigenesis

26
Figure 2.6: HCC and CC formation in cPten
f/f
Grp94
f/f
mice

28
Figure 2.7: Repopulation of GRP94-positive cells in cPten
f/f
Grp94
f/f
livers

29
Figure 2.8: Expansion of LPCs in cPten
f/f
Grp94
f/f
mice

31
Figure 2.9: Disturbance of cell junctions in cPten
f/f
Grp94
f/f
livers at 2 months

33
Figure 2.10: ERK activation in premalignant cPten
f/f
Grp94
f/f
livers at 2
months

35
Figure 2.11: Increased proliferation of liver progenitor/bile duct cells in
cGrp94
f/f
livers after DDC treatment

39
Figure 2.12: GRP94 upregulation in cPten
f/f
liver tumors

39
Figure 2.13: Robust repopulation of GRP94-positive cells in cPten
f/f
Grp94
f/f

HCC at 12 months

40

Figure 3.1: Spontaneous live tumor formation in aged cGrp94
f/f
mice

47
Figure 3.2: Progressive repopulation with GRP94-positive hepatocytes in
cGrp94
f/f
livers

49
Figure 3.3: Increased proliferation, ductular reaction, and liver fibrosis in 51

ix

cGrp94
f/f
livers

Figure 3.4: Characteristics of cGrp94
f/f
liver tumors

53
Figure 3.5: Activation of TGF-β signaling in premalignant cGrp94
f/f
livers at
15 months

55
Figure 3.6: Expansion of GRP94-negative LPCs in cGrp94
f/f
mice

57
Figure 3.7: Schematic model of liver tumor development in cGrp94
f/f
mice

59

Figure 4.1: Breeding scheme for generation of the 5 groups of mouse cohorts

73
Figure 4.2: Liver-specific PTEN deletion and GRP78 reduction accelerated
hepatomegaly

74
Figure 4.3: Decreased gonadal fat in cPten
f/f
Grp78
f/f
mice

76
Figure 4.4: Enhanced fat accumulation, bile-duct proliferation, injury and
apoptosis in cPten
f/f
Grp78
f/f
livers

77
Figure 4.5: Analysis of unfolded protein response markers in mouse livers

79
Figure 4.6: cPten
f/f
Grp78
f/f
livers exhibited increased proliferation, progenitor
cell expansion and GRP78 expression in bile duct cells

81
Figure 4.7: Perturbation of selective signaling pathways in cPten
f/f
Grp78
f/f

livers

83
Figure 4.8: Accelerated HCC and CC formation and GRP78 re-expression in
cPten
f/f
Grp78
f/f
livers

85
Figure 4.9: GRP78 was upregulated in cPten
f/f
liver tumors

89
Figure 4.10: Apoptosis and p-AKT(T308) expression analysis in mouse livers

90
Figure 4.11: P62 expression analysis in mouse livers

92

Figure 5.1: Knockdown of GRP94 resulted in cell morphology change 98
Figure 5.2: HSCs were not activated in cGrp94
f/f
livers at 15 months 100

x

Abstract

Cancer progression is characterized by the overriding of growth arrest and rapid
cell proliferation, which require increased protein synthesis. Additionally, the poor
vascularization of cancer tissues leads to glucose deprivation and hypoxia. Therefore,
the tumor microenvironment represents physiological endoplasmic reticulum (ER)
stress and activates the unfolded protein response (UPR) for survival. ER stress has
been linked to a variety of human diseases, including liver steatosis and different
cancers, and the conventional function of ER chaperones in protein quality control is
updated to promote tumor progression, metastasis, and drug resistance.
Liver cancer is one of the most common solid tumors with poor prognosis and high
mortality. 40-50% of liver cancer patients have the tumor suppressor PTEN mutations
or deletion, whereas the two major ER chaperones, glucose-regulated protein 94
(GRP94) and glucose-regulated protein 78 (GRP78), have been shown to be
overexpressed in liver cancer. Thus, in this dissertation we established multiple mouse
models with liver-specific deletion of Grp94 (cGrp94
f/f
) or Grp78 alone (cGrp78
f/f
) or
in combination with Pten (cP
f/f
94
f/f
or cP
f/f
78
f/f
) to investigate the roles of GRP94 and
GRP78 in liver cancer development. First, we demonstrated that while deletion of
GRP94 in the liver led to hyperproliferation of liver progenitor cells (LPCs), deletion
of both GRP94 and PTEN accelerated development of liver tumors, including both
hepatocellular carcinoma (HCC) and cholangiocarcinoma (CC), suggestive of
progenitor cell origin. Moreover, at the premalignant stage, disturbance of cell
adhesion proteins and minor liver injury were observed. When GRP94 was deleted in

xi

Pten-null livers, ERK was selectively activated.
Next, we further explored the long-term effect of GRP94 deletion on liver
tumorigenesis. cGrp94
f/f
livers showed small nodules at 15 months and spontaneously
developed HCC and ductular reactions (DRs) by 21 months, associating with increased
liver injury and fibrosis. Interestingly, GRP94-positive hepatocytes progressively
repopulated cGrp94
f/f
livers. At 15 months, we observed expansion of LPCs and mild
DRs, as well as increase in cell proliferation. Analysis of signaling pathways revealed
TGF-β1 upregulaion, SMAD2/3, ERK, and JNK activation, and cyclin D1 upregulation
in cGrp94
f/f
livers. The HCC was found to be GRP94-positive, whereas the expanded
LPCs and DRs remained GRP94-negative.
Interestingly, hepatic deletion of Grp78 led to a different story. Ablation of GRP78
was progressive but incomplete. At 3 months, cP
f/f
78
f/f
livers showed lipogenic gene
activation, exacerbated steatosis, and liver injury. In response to liver injury, increased
proliferation of bile duct cells and LPCs was observed in cP
f/f
78
f/f
livers, and
GRP78 expression was intact in bile ducts and some LPCs. At 6 months, cP
f/f
78
f/f
livers
exhibited JNK activation, β-catenin downregulation, along with PDGFRα upregulation.
HCC and CC development was accelerated and evident in cP
f/f
78
f/f
livers at 8-9
months, coinciding with intense GRP78 expression, while adjacent normal areas
expressed WT level of GRP78. In summary, this dissertation revealed that ER
chaperones GRP94 and GRP78 are novel but distinct regulators for liver homeostasis
and cancer progression.

1

Chapter 1
Overview and Introduction

1.1 ER stress and ER chaperones
The endoplasmic reticulum (ER) is a cellular organelle where membrane and secretory
proteins are synthesized, folded, and modified. It is also the site for lipid synthesis and
Ca
2+
storage. When the amount of misfolded or unfolded proteins exceeds the folding
capacity of the ER, ER stress occurs and elicits a series of adaptive pathways, termed the
unfolded protein response (UPR) (Rutkowski & Kaufman, 2004). A number of
conditions activates UPR: the differentiation and development of secretory cells, such as
plasma or pancreatic β cells (physiological conditions); glucose deprivation, calcium
homeostasis disruption, viral infection, and secretory protein mutations (pathological
conditions); and the inhibition of N-linked glycosylation in the ER, depletion of ER
calcium stores, reductive stress, and the expression of mutant and some wild-type
secretory or transmembrane proteins (experimental conditions) (Rutkowski & Kaufman,
2004).
The UPR has both survival and proapoptotic arms for eukaryotic cells to respond to
the ER stress. Through upregulation of ER chaperones, transient arrest of general
translation, and degradation of misfolded ER proteins, the UPR alleviates the ER stress
and promotes cell survival (Luo and Lee 2013). However, if the stress is too severe,
apoptotic pathways are activated, including CHOP and caspase activation (Miao Wang,
Wey, Zhang, Ye, & Lee, 2009). ER stress can also induce autophagy, degrading cytosolic

2

proteins or defective organelles under starvation conditions, which is implicated in both
cell death and survival. The ER contains a number of molecular chaperones involved in
folding, assembly and quality control of newly synthesized proteins, disulfide bond
formation, post-translational modification, and ER-associated degradation (ERAD) to
preserve cellular homeostasis. Upon ER stress, upregulation of ER chaperones is critical
for survival by facilitating the correct protein folding and preventing protein aggregation
(Ni & Lee, 2007) . GRP78/BiP, the most abundant and best-characterized ER chaperone,
is the master regulator of the UPR. Under non-stressed conditions, GRP78 binds to and
maintains the three UPR transmembrane sensors, the activating transcription factor 6
(ATF6), inositolrequiring kinase 1 (IRE1), and PKR-like ER kinase (PERK) in an
inactive form. Under ER stress, GRP78 is titrated away by the accumulated malfolded
proteins, releasing the UPR sensors and triggering their activation (Lee 2005; Luo and
Lee 2013).
ATF6, a basic leucine zipper transcription factor, translocates from the ER to the
Golgi apparatus, where it is cleaved by S1P and S2P proteases. The cleaved form of
ATF6 enters the nucleus and acts as an active transcription factor for UPR target genes,
including Grp78. In the case of IRE1 and PERK, they homodimerize through their
luminal domains, autophosphorylate their respective cytoplasmic domains, and become
activated. Activated IRE1 with its RNase activity cleaves a 26 base intron from XBP1,
resulting in translation of the spliced form of XBP1 (XBP1-s), which is a potent
transcription factor of target genes, including DnaJ, p58, ERdj4, EDEM, and PDI, all
involved in protein folding and ER-associated degradation. PERK functions to attenuate
global protein synthesis through phosphorylation of eIF2α during UPR activation. The

3

eIF2α phosphorylation suppresses assembly of 80S ribosome and therefore inhibits
protein synthesis. However, select mRNAs that contain regulatory sequences in the open
reading frame in 5’-untranslated regions require eIF2α
phosphorylation
for translation.
The transcription factor ATF4 is such an example and translational upregulation of ATF4
can induce the expression of UPR target genes that promote ER folding capacity and
adaptation to stress (Wang et al. 2009; Luo and Lee 2013).
GRP78 can form a multiprotein complex with other ER chaperones, GRP94, PDI,
ERp72, GRP170/ORP150, UGGT (UDPglucose glycoprotein-glucosyltransferase),
CaBP1 (calcium binding protein 1), cyclophilin B, and SDF2-L1 to process unfolded
proteins. Another chaperoning system in the ER consists of calnexin, calreticulin, and
GRP58/ERp57, which recognize the nascent peptide with monoglucosylated N-linked
glycans (Ni & Lee, 2007).

1.2 GRP94 and its functions

Glucose-regulated protein 94 (GRP94), also known as endoplasmin, CaBP4, gp96,
and ERp99, encoded by the HSP90β1 gene, is the most abundant glycoprotein in the ER.
GRP94 is also the ER counterpart of heat shock protein 90 (HSP90). Like all members in
the HSP90 family, GRP94 is a homodimer, with each subunit comprising four domains:
the N-terminal ligand binding domain, the acidic linker domain, a middle domain and the
C-terminal dimerization domain (Eletto, Dersh, & Argon, 2010). GRP94 is an ATPase
and its ATP binding and hydrolysis activities are essential for its chaperone function
(Marzec, Eletto, & Argon, 2012).
GRP94 is highly conserved and essential, but only expressed in multicellular

4

organisms. For example, homozygous mutation of Grp94 in mice results in defected
mesoderm development and embryonic lethality at embryonic day 7 (Mao et al., 2010;
Marzec et al., 2012). In Drosophila, GRP94 ortholog Gp93 is required for gut epithelial
homeostasis and nutrient assimilation-coupled growth control, suggesting an essential
role in the functional expression of specific secretory/integral membrane proteins in
tissue specialization (Maynard et al., 2010).
The most important function of GRP94 is as a chaperone to fold and assembly
secreted and membrane proteins. However, unlike GRP78 and other ubiquitous ER
chaperones, GRP94 is rather selective, with a short client list, such as integrins, Toll-like
receptors (TLRs), and insulin-like growth factors (IGFs). It has been shown that GRP94
is important in innate immunity, through obligatory processing of multiple TLRs,
including TLR1, TLR2, TLR4, TLR5, TLR6, TLR7, and TLR9 (Randow & Seed, 2001;
Yang et al., 2007). GRP94 is also required for the expression of a majority of integrins,
including integrin α1, α2, α4, αD, αE, αL, αM, αX, αV, β2, β5, β6, β7, and β8 in the
hematopoietic system, to regulate adaptive immune response. GRP94 deficiency in
mouse hematopoietic system leads to impaired T and B lymphocyte differentiation (B.
Liu & Li, 2008; Staron et al., 2010), as well as hematopoietic stem cells (HSCs)
proliferation. The HSC expansion is attributed to the loss of attachment to the bone
marrow niche, which can be mediated by integrin α4 (Luo et al. 2011). Similarly, the
requirement of GRP94 for IGFs maturation and secretion has profound physiological
consequences, since deletion of GRP94 in the muscle impairs both muscle and body
growth by inhibiting local IGF production (Barton et al., 2012). Recently, it has been
reported that GRP94 interacts with both the Wnt co-receptor LRP6 and the ER resident

5

chaperone MesD. GRP94 deletion compromises gut homeostasis by loss of cell surface
expression of LRP6 and canonical Wnt signaling (B. Liu et al., 2013). These findings
reveal how GRP94 affects organ homeostasis could be context dependent.
As part of the ER quality control machinery, GRP94 is one of the major calcium-
binding proteins and also regulates ERAD, likely due to the interaction between GRP94
and an ERAD sensor protein, OS-9 (Eletto et al., 2010). GRP94 is constitutively
expressed in virtually all cell types and is coordinately regulated with GRP78 (Yang & Li,
2005). It is induced by various ER stress conditions, including hypoxia, nutrient
deprivation, calcium depletion, and the accumulation of malfolded proteins. Unlike
GRP78, GRP94 loss does not lead to ER stress or activate UPR. It has been demonstrated
that Grp94
−/−
mouse ESCs showed compensatory upregulation of major ER chaperones
and reduction of spliced XBP-1, without affecting the PERK-eIF2α signaling branch and
ERAD pathways (Mao et al., 2010). Moreover, GRP94 is not required for cell growth and
viability, but has been implicated as an anti-apoptotic protein to cells subjected to ER and
chemotoxic stress (Reddy, Lu, and Lee 1999; Ostrovsky, Ahmed, and Argon 2009).
It has been shown that GRP94 promoter is activated in a variety of spontaneous or
induced tumors (Reddy et al. 2002), and GRP94 overexpression is correlated with cancer
growth and metastasis (Ni and Lee 2007; Fu and Lee 2006; Eletto, Dersh, and Argon
2010). However, the function of GRP94 in cancer is just emerging. Recent reports using
transgenic mouse models demonstrated that GRP94 is essential for multiple myeloma cell
proliferation and survival, as well as drives the contributions of macrophages to
inflammatory colon tumorigenesis (Hua et al., 2013; Morales et al., 2014). Furthermore,
GRP94 can also bind to short peptides and has been implicated in antigen cross-

6

presentation (Yang & Li, 2005). Thus, along with its role in immune response, it is
hypothesized that GRP94 could present tumor peptides, eliciting anti-tumor immunity.
Interestingly, cell surface GRP94 has been found in tumor cells, which have enhanced
immunogenicity, which might due to increased cross-priming of CD8
+
T cells (Yang &
Li, 2005). Several studies demonstrated that a vaccination of lethally irradiated cancer
cells expressing various non-ER-retainable autologous GRP94 fusion proteins (without
the ER retention/retrieval signal KDEL) protects mice from primary tumor growth and
metastasis (Luo and Lee 2013). This effect could be attributed to that the maturation of
macrophages and DCs, stimulated by autologous tumor-derived GRP94, enhances
antigen cross-presentation and inflammatory signals. Nevertheless, clinical trials across
various types of tumors suggest that autologous tumor-derived GRP94 vaccination may
have limited efficacy (Luo and Lee 2013) .
Given that HSPs are overexpressed and aviated in transformed cells, and many
HSP90-depdent clients are oncoproteins, pan-HSP90 inhibitors, such as 17-AAG (Phase
I-II), IPI-504 (Phase I-III), and CNF2024 (Phase I-II), are currently being developed and
evaluated in clinical trials for different cancers (Garcia-Carbonero, Carnero, & Paz-Ares,
2013). Unfortunately, cardiovascular, ocular, and/or hepatotoxicities have been observed,
which might come from the pan-inhibition. GRP94-specific inhibitors have been
developed and demonstrated to regulate plasma membrane HER2 in breast cancer cells
overexpressing HER2, proposing GRP94 as a new target in such cancers (Duerfeldt et al.,
2012; Patel et al., 2013).

7

1.3 GRP78 and its role in cancer

The microenvironment of tumors is often acidic, hypoxic, and nutrient deprived,
which is due to poor vascularization, rapid growth, and altered glucose metabolism in
tumor cells. These conditions cause ER stress and thus the UPR is often activated in
tumor cells to cope with the stress for survival. Because of its pro-survival property,
GRP78 is overexpressed in a wide variety of tumors and cancer cells, and plays important
roles in cancer progression, drug resistance, and angiogenesis (A. S. Lee, 2007, 2014;
Miao Wang et al., 2009). High level of GRP78 is generally associated with greater cancer
recurrence and poorer prognosis.
The proliferative rate of glioma cells correlates with GRP78 expression levels, and
downregulation of GRP78 suppresses proliferation and increases chemosensitivity
(Pyrko, Schönthal, Hofman, Chen, & Lee, 2007). Targeting GRP78 inhibits the drug
resistance of B-CLL cells and induces apoptosis. Not only is GRP78 important for tumor
growth, but also supports the survival of tumor-associated cells. It has been demonstrated
that tumor-associated brain endothelial cells (TuBEC) constitutively overexpress GRP78,
and chemoresistance of TuBEC can be reversed by downregulation of GRP78.
Additionally, heterozygous deletion of Grp78 in endothelial cells showed a severe
reduction of tumor angiogenesis and metastatic growth (Virrey et al., 2008).
Mouse models with genetically altered GRP78 expression are powerful systems to
interrogate the requirement and function of GRP78 in cancer and other human diseases.
While homozygous knockout of GRP78 results in early embryonic lethality, Grp78
heterozygous mice are phenotypically normal (S. Luo, Mao, Lee, & Lee, 2006). In a
transgene-driven mammary tumor model, Grp78 heterozygosity lengthens the latency

8

period, inhibits tumor growth, and suppresses tumor angiogenesis while not affecting the
microvessel density of normal organs (Dong et al., 2008). Grp78 homozygous deletion in
the prostate epithelium blocks Pten-null mediated AKT activation and prostate
tumorigenesis (Fu et al., 2008). Similarly, Grp78 haploinsufficiency suppresses leukemia
and AKT signaling induced by the loss of Pten (Wey, Luo, Tseng, et al., 2012).
Collectively, GRP78 is critical for tumor development and drug resistance; recent studies
reducing the level of GRP78 in cancer cells showed promising therapeutic effects on
enhancing cancer cell death, sensitizing them to chemotherapy, and reducing xenografts.
Emerging evidence shows that a subfraction of GRP78 can be localized at the cell
surface of cancer cells as well as cells undergoing ER tress. Cell surface GRP78 acts as a
co-receptor for binding protein ligands on the plasma membrane, transducing signals for
proliferation, survival, as well as apoptosis. For example, cell surface GRP78 mediates
α2-macroglobulin-induced signal transduction for survival of prostate cancer (Misra,
Deedwania, & Pizzo, 2006). Oncoprotein Cripto has reported to bind cell surface GRP78
to inhibit TGF-β signaling for tumor growth (Shani et al., 2008). On the other hand, cell
surface GRP78 interacts with Kringle 5 and mediates its proapoptotic and antiangiogenic
activity (Davidson et al., 2005). Surface GRP78 is also required for cancer cell-specific
apoptosis by extracellular Par 4 (Burikhanov et al., 2009). Furthermore, hypoxic/stressed
endothelial cells express cell surface GRP78, which is induced by VEGF. Taken together,
the preferential expression of GRP78 on the cell surface of tumor cells and tumor
vasculature provides a new approach for selective targeting of tumor cells while sparing
normal tissues (Luo and Lee 2013; Lee 2014).

9

ER stress and ER chaperones have been implicated in various human cancers.
Currently, a paucity of effective treatments for advanced liver cancer highlights the need
to understand liver tumorigenic mechanisms. Therefore, we took advantage of Albumin-
Cre to disrupt GRP94 or GRP78, the two major ER chaperon proteins, alone or in
combination with PTEN deletion in the mouse livers. Overall, this dissertation uncovered
several unexpected results in liver progenitor cell regulation, liver homeostasis and
tumorigenesis, repopulation of non-recombined cells, and oncogenic signaling pathways.

10

Chapter 2
Liver-specific Knockout of Grp94 in Mice Disrupts Cell
Adhesion, Activates Liver Progenitor Cells, and Accelerates
Pten-null Liver Tumorigenesis

2.1 Introduction

The two most common types of liver cancer are hepatocellular carcinoma (HCC) and
cholangiocarcinoma (CC), arising from hepatocytes and cholangiocytes (bile duct cells),
respectively (T Roskams, 2006). Liver tumor with liver progenitor cell (LPC)
characteristics is particularly aggressive with poor prognosis (T Roskams, 2006).
Genetically defined liver cancer mouse models have provided important experimental
tools to study the role of LPCs in live tumorigenesis. For example, the conditional
knockout of the Pten tumor suppressor gene using albumin-Cre (Alb-Cre) caused liver
injury, LPC proliferation, and liver cancer development, including both HCC and CC
(Galicia et al., 2010). In another example, hepatic specific deletion of the Nf2/Merlin
tumor suppressor gene yielded a progressive expansion of progenitor cells and eventually
formation of both HCC and CC through aberrant EGFR signaling (Benhamouche et al.,
2010), indicating that these tumors can be derived from liver progenitor cells. LPCs are
bi-potential and quiescently reside in the stem cell niche, located in the most peripheral
branches of biliary tree (the Canals of Hering) (Tanaka, Itoh, Tanimizu, & Miyajima,
2011). During chronic or massive liver injury, LPCs are activated and differentiate into

11

hepatocytes and cholangiocytes. Deregulated LPCs can give rise to liver cancer (T
Roskams, 2006). Nevertheless, the regulation of LPC proliferation and its role in liver
tumorigenesis are not well understood.
Glucose-regulated protein 94 (GRP94) is a major endoplasmic reticulum (ER)
chaperone protein, assisting protein folding, processing and secretion, and is the ER
counterpart of HSP90 (Ni & Lee, 2007). Client proteins of GRP94 include cell adhesion
and signaling molecules such as integrins, Toll-like receptors, and insulin-like growth
factors (IGFs), suggesting that GRP94 has unique functions controlling specific pathways
critical for cell adhesion, immune modulation, and growth signaling (Eletto et al., 2010).
Cell adhesion molecules mediating cell-cell and cell-ECM (extracellular matrix)
interactions are multifunctional, and disturbance of adhesion complexes interferes normal
tissue function and may results in tumor development. Additionally, increasing evidence
indicates that physical interaction between stem cells and the surrounding niche regulates
stem cell proliferation and mobilization (Moore & Lemischka, 2006; Scadden, 2006).
Hepatocytes communicate directly with each other through gap junctional channels
composed of connexin proteins, of which Cx26 and Cx32 are most abundant (Vinken et
al., 2008). E-cadherin forms adheren junctions for cell-cell contact, and has been
implicated as a tumor suppressor in most epithelial cancers. E-cadherin downreguation is
found in many tumors and associated with epithelial-mesenchymal transition (EMT),
which promotes tumor metastasis (Jeanes, Gottardi, & Yap, 2008; Pećina-Slaus, 2003).
Integrins are major mediators of cell-ECM interaction and transduce signals required for
cell survival (Aoudjit & Vuori, 2012). Hepatocyte survival is dependent on integrin β1-
regulated attachment to hepatic ECM (Pinkse et al., 2004). Furthermore, disruption of

12

cell adhesion mediated by connexins, E-cadherin, and integrin β1 has been linked to
tumorigenesis (Jeanes et al., 2008; Moran-Jones, Ledger, & Naylor, 2012; Vinken et al.,
2008). However, the functional interaction between GRP94 and these adhesion molecules
is unknown.
Recently, we discovered that while homozygous mutation of Grp94 in mice results in
embryonic lethality (Mao et al., 2010; Marzec et al., 2012), inducible knockout of Grp94
in adult mice leads to the loss of attachment of the hematopoietic stem cells (HSCs) in the
bone marrow niche and increased HSC proliferation (Luo et al. 2011; Luo et al. 2013).
This suggests that GRP94 may also regulate other stem cell pools and tumorigenesis
arising from deregulated stem cell proliferation. Here we report the creation of two liver-
specific knockout mouse models with the deletion of Grp94 alone or in combination with
Pten. Our studies revealed that GRP94 deficiency led to hyperproliferation of LPCs,
correlating with impaired cell adhesion. Deletion of both GRP94 and PTEN accelerated
HCC and CC development with minor liver injury and that ERK was selectively
activated. These studies uncover a novel role of GRP94 in regulating liver physiology
and tumorigenesis.

2.2 Materials and Methods

Mice. Grp94
f/f
mice on a mixed C57BL/6; 129/Sv background (Mao et al., 2010) were
crossed with Pten
f/f
mice on a C57BL/6; 6xDBA2; 129 background (Fu et al., 2008) to
generate Pten
f/f
Grp94
f/f
mice, which were mated with the transgenic Alb-Cre; Pten
f/f
mice
on a C57BL/6; J129svj background (Galicia et al., 2010) to generate Alb-Cre;
Pten
f/f
Grp94
f/f
and Alb-Cre; Grp94
f/f
mice. Blood samples were collected through retro-

13

orbital bleeding. All protocols for animal use were reviewed and approved by the USC
Institutional Animal Care and Use Committee.

Genotyping. The primer set PAS1 and PAS3 was used to differentiate Grp94 WT and
floxed alleles, while niL and niR were used to detect the knockout allele (KO) (Mao et
al., 2010). For Genotyping of the Cre transgene, primers Cre109 and Cre457 were used.
Reactions for Grp94 floxed, WT (+), knockout alleles (KO), and Cre were under the
following conditions: 94°C for 5 min, followed by 46 cycles of 94°C for 20 sec, 62°C for
30 sec, and 72°C for 30 sec, ended with 72°C for 7 min. For genotyping of the Pten
floxed allele in mouse cohorts, the primer set Pten-1 and Pten-2 were used. Reactions
were under the following condition: 94°C for 3 min, followed by 46 cycles of 94°C for
30 sec, 62°C for 1 min, and 72°C for 1’10, ended with 72°C for 10 min. For PCR
detection of the Pten knockout allele (KO), another primer set Pten-F, Pten-R1, and Pten-
Rko was used. Reactions were under the following conditions: 94°C for 3 min, followed
by 40 cycles of 94°C for 45 sec, 60°C for 30 sec, and 72°C for 1 min, ended with 72°C
for 10 min. The primer sequences are listed in table 2.1.

14

Gene Primer name Sequence
Grp94
(floxed or +)
PAS1 5’- GCTGTGTCCTGCTGACCTTCG -3’
PAS3 5’-TGATCAGCGATCGCCAAAAGTCCTTAGGGAGG -3’
Grp94 (KO)
niL 5’- GCTGTGTCCTGCTGACCTTCG -3’
niR 5’- TACCTCACCGATTGAAAAGC -3’
Cre
Cre109 5’-AAGAACCTGATGGACATGTTCAGGGA-3’
Cre457 5’-ACGAACCTGGTCGAAATCAGTGCGTTC-3’

Pten
(floxed or + or
KO)

Pten-1
Pten-2
Pten-F
Pten-R1
Pten-Rko
5’-AAGCAAGCACTCTGCGAAACTGA -3’
5’-GATTGTCATCTTCACTTAGCCATTGGT -3’
5'-TCCCAGAGTTCATACCAGGA-3'
5'-AATCTGTGCATGAAGGGAAC-3'
5'-GCAATGGCCAGTACTAGTGAAC-3'
Table 2.1: Primer sequences for mouse genotyping

Plasma Biochemistry. Plasma alanine aminotransferase (ALT) was determined using
ALT Reagent (Raichem, San Diego, CA). Plasma total bilirubin and alkaline phosphatase
(ALP) were measured following manufacturers’ instruction (Thermo Scientific, Waltham,
MA).

TUNEL Assay. Apoptosis was determined using TUNEL staining (Roche Diagnostics,
Manheim, Germany).

Real-time Quantitative PCR. RNA was extracted from mouse livers, and reverse-
transcription and real-time PCR were performed as previously described (Luo et al.
2011). The following primers were used: AFP, 5’-ATCGACCTCACCGGGAAGAT-3’
and 5’- GAGTTCACAGGGCTTGCTTCA-3’; EpCAM, 5’-
AGGGGCGATCCAGAACAACG-3’ and 5’- ATGGTCGTAGGGGCTTTCTC-3’;
CK19, 5’- CCGGACCCTCCCGAGATTA-3’ and 5’- CTCCACGCTCAGACGCAAG-

15

3’; 18S RNA, 5’-ACG GCC GGT ACA GTG AAA C-3’ and 5’-GAG GGA GCT CAC
CGG G-3’.

Histology and Immunostaining in Paraffin Sections. Mouse tissues were fixed in 10%
zinc formalin, embedded in paraffin, sectioned at 4 µm, and subjected to H&E staining
and immunostaining as described (Fu et al., 2008). Cell proliferation was evaluated by
Ki67 staining (SP-6, 1:50, Thermo Scientific, Fremont, CA). Mesenchymal cells were
detected by monoclonal mouse anti-α-SMA (1:2000, Sigma, St. Louis, MO). Monoclonal
mouse anti-glutamine synthetase (GS) (1:400, BD Biosciences, San Jose, CA) was used
to examine liver zonation. Necrosis was determined by cytoplasmic release of HMGB1
(1:200, BioLegend, San Diego, CA). Monoclonal mouse anti-hepatocyte paraffin 1
(HepPar1) (1:25, DakoCytomation, Denmark A/S) and polyclonal rabbit anti-wide
spectrum cytokeratin (panCK) (1:75, Abcam, Cambridge, MA) antibodies were used to
identify hepatocytes and cholangiocytes, respectively. Mouse monoclonal anti-p-ERK1/2
(Thr202/Tyr204, E10, 1:100, Cell Signaling, Danvers, MA) was used to detect ERK
activation. Monoclonal rat anti-GRP94 (1:200) is from Enzo Life Sciences (Farmingdale,
NY).

Immunostaining in Frozen Sections. Mouse tissues were frozen in OCT compound
(Tissue-Tek Sakura, Torrance, CA), sectioned at 9 µm, and air-dried overnight. The
frozen slides were fixed in -20°C acetone at RT for 5 minutes, air-dried at RT for 1 hour,
and then blocked and incubated with primary and secondary antibodies as paraffin
sections. Monoclonal rabbit anti-Ki67 (SP-6, 1:50, Thermo Scientific, Fremont, CA) was

16

used to detect proliferation. Monoclonal rat anti-A6 (1:100, a generous gift of Valentina
Factor, National Cancer Institute, Bethesda, MD) and polyclonal rabbit anti-wide
spectrum cytokeratin (panCK) (1:75, Abcam, Cambridge, MA) were used to identify
LPCs. For gap junction protein detection, polyclonal goat anti-Cx26 (N-19, 1:100, Santa
Cruz Biotechnology, Dallas, TX) and monoclonal rat anti-Cx32 (R5.21C, undiluted,
DSHB, Iowa City, IA) antibodies were used. Monoclonal rabbit anti-integrin β1 (clone
EP1041Y , 1:100, Millipore, Billerica, MA) and monoclonal mouse anti-E-cadherin
(1:200, BD Biosciences, San Jose, CA) were used to examine cell-matrix and cell-cell
interactions.
For CD45 and Ki67 double staining, frozen liver tissues sectioned at 7 µm were fixed
with 0.5% PFA at RT for 5 minutes and then treated with 0.5% Triton X-100 at RT for 15
minutes, followed by PBS wash, respectively. The slides were blocked in 1% BSA in
PBS at RT for 1 hour and incubated with monoclonal rabbit anti-Ki67 (SP-6, 1:50,
Thermo Scientific, Fremont, CA) in PBS at 4°C overnight. Followed by the incubation
with 1% BSA in PBS at RT for 30 minutes, Alexa Fluor 594 goat anti-rabbit antibody
(1:200, Life Technologies, Grand Island, NY) in 1% BSA in PBS was applied at RT for 1
hour. The slides were re-blocked in 1% BSA in PBS at RT for 30 minutes and incubated
with monoclonal rat anti-CD45 (1:200, BioLegend, San Diego, CA) in 1% BSA in PBS
at 4°C overnight to identify hematopoietic cells. Alexa Fluor 488 goat anti-rat antibody
(1:200, Life Technologies, Grand Island, NY) in 1% BSA in PBS was applied at RT for 1
hour. After PBS and ddH
2
O wash, the slides were mounted with VECTASHIELD
Mounting Medium with DAPI (Vector Laboratories, Burlingame, CA).

17

Fluorescent Microscopy. Immunofluorescence was visualized by NIKON ECLIPSE
TE300 microscope using HAMAMATSU Orca camera and controlled by MetaMorph
program, or Zeiss LSM 510 confocal microscope equipped with LSM 510 Version 4.2
SP1 acquisition software (Carl Zeiss). Confocal images were obtained with 40X, 63X,
and 100X oil lens. Images were then processed with LSM Image Browser R4.2 and
Adobe
®
Photoshop
®
CS5.

Western Blot Analysis. Harvested tissues were frozen immediately, and homogenized in
RIPA buffer with added protease and phosphatase inhibitor cocktail (Thermo Scientific,
Waltham, MA). Cell lysates (25 µg) were subjected to SDS-PAGE and Western blot
analysis as described (Fu et al., 2008). The primary antibodies used are as follows.
Monoclonal rat anti-GRP94 (1:5000) is from Enzo Life Sciences (Farmingdale, NY).
Monoclonal mouse anti-GRP78 antibody (MAb159, 1:2000) is a gift of Parkash Gill
(Keck School of Medicine of USC). Mouse anti-PTEN (26H9, 1:1000), rabbit anti-AKT
(1:1000), rabbit anti-p-AKT (Ser473, 1:1000), rabbit anti-ERK1/2 (1:1000), mouse anti-
p-ERK1/2 (Thr202/Tyr204, E10, 1:1000), rabbit anti-SRC (36D10, 1:1000), rabbit anti-p-
SRC (Tyr416, 1:1000) are from Cell Signaling (Danvers, MA). Rabbit anti-p38α/β (H-
147, 1:1000), rabbit anti-p-p38-R (Tyr182, 1:1000), rabbit anti-β-catenin (H-102,
1:1000), and goat anti-Cx26 (N-19, 1:100) are from Santa Cruz Biotechnology (Dallas,
Texas). Rat anti-Cx32 (R5.21C, 1:50) is from DSHB (Iowa City, IA). Mouse anti-β-actin
(1:5000) is from Sigma (St. Louis, MO).

DDC-feeding Protocol. 3,5-diethoxycarbonyl-1,4-dihydrocolidine (DDC, 0.1% w/w diet)

18

treatment was performed in 3.5-month-old mice for 3 weeks.

Statistical Analysis. Statistical significance was assayed by 2-tailed Student’s t test, and
the error bars reflect standard error (s.e.).

2.3 Results

2.3.1 Hyperproliferation of Liver Progenitor Cells in cGrp94
f/f
Mice.
To study the requirement of GRP94 in liver homeostasis, we created a liver-specific
Grp94 knockout mouse model (Alb-Cre; Grp94
f/f
or cGrp94
f/f
). Littermates lacking Alb-
Cre served as wild-type (WT) controls. In livers isolated from 2 month-old cGrp94
f/f

mice, Grp94 allele deletion was confirmed by PCR (Figure 2.1A). Loss of GRP94 protein
expression was confirmed by Western blot, which also revealed a mild (1.3-fold)
compensatory increase of another ER chaperone GRP78 (Figure 2.1B). cGrp94
f/f
livers
appeared normal except that they were about 25% smaller than the WT, and in some mice
the surface acquired nodular appearance by 9 months (Figure 2.1C). At both 2 and 9
months, H&E staining revealed an increase of mononuclear cells that fit the
morphological description of mouse LPCs in cGrp94
f/f
livers, compared to the WT
(Figure 2.1D). Ki67 staining further demonstrated progressive increase of highly
proliferative cells adjacent to portal veins (PVs) in cGrp94
f/f
livers, while WT livers were
relatively quiescent (Figure 2.1D). Double staining of Ki67 and LPC marker A6
confirmed significantly increased Ki67-positive cells and more double-positive cells
around PVs, such that in cGrp94
f/f
livers at 9 months, about 48% of the Ki67-positive
cells were co-stained with A6 (Figsures 2.1E and 2.1F).

19

Figure 2.1. Hyperproliferation of cells adjacent to portal veins in cGrp94
f/f
livers. (A) Liver PCR
genotyping and (B) Western blot of liver lysates at 2 months. (C) Liver appearance and weight at indicated
ages. (D) Liver H&E staining and Ki67 staining of proliferative cells (black arrows) at 2 months and 9
months. Insets show 2X magnification. PV: portal vein. (E) Immunofluorescent staining with LPC marker
A6 (green) and Ki67 (red) in cGrp94
f/f
frozen liver sections. White arrows denote double-positive cells.
Nuclei were stained with DAPI (blue). (F) Quantitation of Ki67
+
cells (left) (student’s t test) and A6, Ki67
double-positive cells (right) (χ
2
test). Scale bar: 25 µm. All data are presented as mean ± s.e. (*P<0.05,
**P<0.01, and ***P<0.001).

20

Double staining of Ki67 with the mesenchymal cell marker α-SMA yielded few
double-positive cells, whereas about 38-50% of the Ki67-positive cells were co-stained
with the hematopoietic cell marker CD45 in both WT and cGrp94
f/f
livers (Figure 2.2A).
For cGrp94
f/f
livers at 9 months, the small nodules visible in some mice were not tumors
by histological analysis, and glutamine synthetase (GS) staining revealed similar liver
zonation pattern but some GS-marked hepatocytes were not around central veins (Figure
2.2B).

Figure 2.2. Percentage of proliferative cells co-stained with cell markers and zonation pattern in the liver.
(A) Quantitation of double staining with mesenchymal cell marker α-SMA and Ki67 (left panel), and
hematopoietic cell marker CD45 and Ki67 (right panel) (*P<0.05; χ
2
test). (B) Histological analysis of
livers at 9 months. Upper panels: liver H&E; lower panels: glutamine synthetase staining. Insets show 2X
magnification. CV: central vein. Scale bar: 200 µm.

21

Consistently, immunofluorescent staining showed LPC markers A6 and pan-
cytokeratin (panCK) labeling multiple layers of periportal cells in cGrp94
f/f
livers,
whereas in WT livers these same markers were restricted to bile duct epithelial cells
(Figure 2.3A). Quantitation of A6-positive cells showed progressive expansion from 2 to
9 months for both genotypes, with cGrp94
f/f
livers containing higher percentage of PVs
bearing large numbers (over 50) of A6-positive cells at both 2 and 9 months (Figure
2.3B). Additionally, more A6-positive cells extending from PVs into liver parenchyma,
indicative of migratory capability, were observed in cGrp94
f/f
livers (Figure 2.3C).
Liver injury is a common cause for LPC proliferation. We detected no increase in
plasma alanine aminotransferase (ALT) levels at both 2 and 9 months, but approximately
2-fold and 1.2-fold increase of cholestatic markers, plasma bilirubin, and alkaline
phosphatase (ALP), respectively, in cGrp94
f/f
mice at 2 months, which reverted back to
WT levels at 9 months (Figure 2.3D). Although the percentage of apoptotic cells
increased from 0.2% to 0.5% in cGrp94
f/f
livers, the overall apoptosis was minimal
(Figure 2.3E). Necrosis was not detected by histological examination and the lack of
cytosolic HMGB1 staining (Figure 2.3F). Taken together, these data suggested that liver-
specific deletion of Grp94 led to hyperproliferation of LPCs with limited liver injury and
death.

22

Figure 2.3. Increased LPC pool in cGrp94
f/f
mice. (A) Immunofluorescent staining with LPC markers A6
(green) and panCK (red) in frozen liver sections at 2 months. Nuclei were stained with DAPI (blue). (B)
Quantitation of PVs bearing over 50 A6
+
cells (**P<0.01 and ***P<0.001; χ
2
test). (C) Quantitation and
examples of free A6
+
cells (white arrows) in cGrp94
f/f
livers. (D) Plasma ALT, total bilirubin, and ALP
measurements (*P<0.05 and **P<0.01). (E) TUNEL staining (red) of liver sections for apoptotic cells
(white arrows) at 2 months. (F) Necrosis marker HMGB1 staining. PV: portal vein. Scale bar: 50 µm. All
data are presented as mean ± s.e.

23

2.3.2 Disorganization of Cell Adhesion Molecules in cGrp94
f/f
Livers.
To test whether the LPC proliferation was induced by a disruption in GRP94-
mediated cell adhesion, we examined the expression pattern of two prominent liver gap
junction proteins, Cx26 and Cx32. In WT livers, Cx26 and Cx32 exhibited well-
structured long patches at hepatocyte cell membranes; in contrast, both Cx26 and Cx32
staining in cGrp94
f/f
livers appeared disorganized and dispersed (Figures 2.4A and 2.4B).
Western blot analysis showed slight Cx26 and more prominent Cx32 reduction in
cGrp94
f/f
livers (Figure 2.4C).

24

Figure 2.4. Disruption of cell adhesion molecules in cGrp94
f/f
livers at 2 months. (A and B)
Immunofluorescent staining of Cx26 (A) and Cx32 (B) in frozen liver sections. Nuclei were stained with
DAPI (blue). Scale bar: 20 µm. (C) Western blot of liver lysates to detect Cx26 and Cx32 levels in WT and
cGrp94
f/f
mice. (D) Schematic drawing of E-cadherin zonal expression pattern (red) in WT and diffuse
expression (pink) in cGrp94
f/f
livers. Immunofluorescent co-staining of integrin β1 (green) and E-cadherin
(red) of the boxed areas (U1,2 and L1,2) is shown below. White arrows denote clusters of liver
progenitor/bile duct cells expressing high levels of E-cadherin near PVs. (E) Immunofluorescent staining of

25

E-cadherin (green) and panCK (red). Double-positive cells are indicated by white arrows. PV: portal vein;
CV: central vein. Scale bar (C, D): 50 µm.

Cx26 regulates integrin β1 expression in breast cancer cells (Kalra et al., 2006), and
E-cadherin co-localizes with Cx26 and Cx32 during gap junction reappearance in
regenerating mouse hepatocytes (Fujimoto et al., 1997). To examine whether Cx26 and
Cx32 disorganization affects expression patterns of integrin β1 and E-cadherin in
cGrp94
f/f
livers, double staining of integrin β1 and E-cadherin were performed. First, we
noted that while E-cadherin expression in WT livers showed zonal patterns where
expression was restricted to periportal areas as expected, it was homogeneously
expressed throughout cGrp94
f/f
livers (Figure 2.4D). In periportal areas of WT livers,
integrin β1 and E-cadherin majorly co-localized at hepatocyte cell membranes (Figure
2.4D, U1 panel). In contrast, in cGrp94
f/f
livers, integrin β1 was largely in the cytoplasm,
and the co-localization with E-cadherin was lost (Figure 2.4D, U2 panel). In areas right
adjacent to PVs, we detected more cells morphologically resembling progenitor/bile duct
cells expressing strong E-cadherin in cGrp94
f/f
livers (Figure 2.4D, L1 and L2 panels). In
agreement with E-cadherin being another LPC marker (Ueberham, Aigner, Ueberham, &
Gebhardt, 2007), double staining of E-cadherin and panCK confirmed that the cell
clusters near PVs were LPCs/bile duct cells (Figure 2.4E). Collectively, these results
suggest that the cell adhesion in cGrp94
f/f
livers was impaired, correlating with LPC
activation.

2.3.3 Accelerated Liver Tumorigenesis by Biallelic Deletion of Pten and Grp94 in the
Liver.

26

To test whether cell adhesion disturbance and LPC hyperproliferation in cGrp94
f/f

mice affect tumor development, we generated a novel hepatic Pten and Grp94 knockout
mouse model (Alb-Cre; Pten
f/f
Grp94
f/f
or cPten
f/f
Grp94
f/f
). Deletion of Pten and Grp94
alleles and loss of protein expression in cPten
f/f
Grp94
f/f
livers were validated by PCR
(data not shown) and Western blot (Figure 2.5A).

Figure 2.5. Biallelic deletion of Pten and Grp94 in the liver accelerates liver tumorigenesis. (A) Western
blot of liver lysates at 2 months. (B) Liver H&E and Ki67 staining at 2 months showing proliferative cells
(black arrows). Arrowheads denote bile ducts. Scale bar: 25 µm. (C) Liver appearance and weight at 8-9
months presented as mean ± s.e. (**P<0.01 and ***P<0.001). (D) Same as B but at 8-9 months.

At 2 months, cPten
f/f
livers devoid of PTEN were enlarged with fat accumulation and
1-2 bile ducts around each PV , and limited proliferation as revealed by Ki67 staining

27

(Figure 2.5B). In contrast, cPten
f/f
Grp94
f/f
livers were normal in size, with various
degrees of bile duct proliferation characterized by increased size, number, and altered
morphology of bile duct epithelial cells as early as 1 month of age. Additionally, multiple
layers of LPCs surrounding bile ducts were observed with high proliferative activity
(Figure 2.5B). At 8-9 months, cPten
f/f
Grp94
f/f
mice showed visible liver tumor formation
and significantly increased liver/body weight (Figure 2.5C). Histological analysis
indicated that cPten
f/f
mice developed fatty liver, whereas cPten
f/f
Grp94
f/f
mice had some
fat accumulation, and bile duct dysplasia with papillary growth pattern (Figure 2.5D),
correlating with markedly higher Ki67 staining in the liver (Figure 2.5D).

2.3.4 Development of Hepatocellular Carcinoma and Cholangiocarcinoma in
cPten
f/f
Grp94
f/f
Mice.
Whereas no tumor was detected in cPten
f/f
mice until 12 months, as previously
reported (Galicia et al., 2010), 80% of cPten
f/f
Grp94
f/f
mice developed visible liver tumors
by 6 months (not prior to 4.5 months), and 100% of cPten
f/f
Grp94
f/f
mice showed tumors
by 8-9 months (Figure 2.6A). Liver tumor H&E from cPten
f/f
Grp94
f/f
mice revealed the
presence of HCC and CC (Figure 2.6B). HCC was characterized by cords of tumor cells
separated by sinusoidal spaces that surrounded by endothelial cells. CC either was
composed of cells resembling bile ducts growing in tubules (well-differentiated), or cells
all altered without clear tubule structures and protruding to the duct lumen.
Immunofluorescent staining of HepPar1, a protein that is highly expressed in HCC
(Galicia et al., 2010), and cholangiocyte marker panCK validated that cPten
f/f
Grp94
f/f

mice developed both HCC and CC (Figure 2.6C), suggesting a common LPC origin of

28

the mixed lineage tumors.

Figure 2.6. HCC and CC formation in cPten
f/f
Grp94
f/f
mice. (A) Liver tumor spectrum. Each circle
represents one mouse. The solid and open circles represent mice with and without tumors, respectively. (B)
H&E staining of liver tumors in cP
f/f
94
f/f
mice (8 months) showed compact trabecular growth structures of
HCC and altered tubule structures protruding to the duct lumen characteristic of CC. Right panels represent
2X magnification of the boxed regions. (C) Immunofluorescent staining with HepPar1 (green) and panCK
(red) identified HCC and CC, respectively in cP
f/f
94
f/f
livers (9 months). Nuclei were stained with DAPI
(blue). PV: portal vein. Scale bar: 50 µm.

At 8-9 months, repopulation of GRP94-positive cells in cPten
f/f
Grp94
f/f
livers was
observed (Figure 2.7A). Triple staining of HepPar1, panCK, and GRP94 revealed
heterogeneous GRP94 expression from very low to WT level in HCC cells, whereas CC
cells were still devoid of GRP94 (Figure 2.7B).

29

Figure 2.7. Repopulation of GRP94-positive cells in cPten
f/f
Grp94
f/f
livers. (A) GRP94 staining in the liver
at 9 months. (B) Triple staining of GRP94 (red), panCK (green), and HepPar1 (light blue) in the liver at 8-
9 mos. Nuclei were stained with DAPI (blue). Scale bars: 100 µm.

30

2.3.5 Expansion of the Liver Progenitor Cell Pool in cPten
f/f
Grp94
f/f
Mice.
Quantitative PCR analysis of LPC markers showed significantly higher levels of
EpCAM and CK19, but not AFP, in cPten
f/f
Grp94
f/f
livers at both 2 and 9 months (Figure
2.8A). LPCs give rise to hepatocytes and cholangiocytes and express markers for both.
Such bi-potential LPCs expressing both lineage markers, HepPar1 and panCK, were
detected in cPten
f/f
Grp94
f/f
livers (Figure 2.8B). cPten
f/f
mice are known to exhibit
chronic liver injury, which leads to hepatocyte death prior to LPC proliferation (Galicia et
al., 2010). In agreement, gradual increase in plasma ALT levels was observed in cPten
f/f

mice starting at 3.5 months (Figure 2.8C). In contrast, although we observed LPC
expansion in cPten
f/f
Grp94
f/f
mice, ALT levels in cPten
f/f
Grp94
f/f
mice did not increase at
2 and 3.5 months (Figure 2.8C). Nonetheless, correlating with the onset of tumor
formation, high ALT was observed in cPten
f/f
Grp94
f/f
mice at 6 and 8-9 months (Figure
2.8C). Moreover, despite a mild but detectable increase in apoptosis in cPten
f/f
, which
was further elevated in cPten
f/f
Grp94
f/f
livers, overall apoptosis was low (0.4% or less) in
all three genotypes (Figure 2.8D).

31

Figure 2.8. Expansion of LPCs in cPten
f/f
Grp94
f/f
mice. (A) Quantitative PCR analysis of LPC markers
EpCAM, AFP, and CK19. (B) Immunofluorescent staining of cP
f/f
94
f/f
livers at 9 months with HepPar1
(green) and panCK (red) identifies bi-lineage LPCs (white arrows). Nuclei were stained with DAPI (blue).
PV: portal vein. Scale bar: 25 µm. (C) Plasma ALT measurements. (D) Quantitation of liver TUNEL
staining at 2 months. All data are presented as mean ± s.e. (*P<0.05 and **P<0.01).

2.3.6 Disturbance of Cell Junctions in cPten
f/f
Grp94
f/f
Livers.
As revealed by immunofluorescent staining, gap junction plaques assembled by Cx26
and Cx32 in cPten
f/f
Grp94
f/f
livers at 2 months were largely disorganized compared to the
WT, with an intermediate phenotype observed for cPten
f/f
livers (Figure 2.9A).
cPten
f/f
Grp94
f/f
livers also expressed reduced levels of both connexins (Figure 2.9B).

32

Altered patterns of integrin β1 and E-cadherin in cPten
f/f
Grp94
f/f
livers were similar to
that of cGrp94
f/f
livers in periportal areas, namely, cytoplasmic rather than membrane
distribution of integrin β1, disjointed E-cadherin expression and loss of zonal patterns,
and increased clusters of E-cadherin-positive cells around PVs (Figure 2.9C). In contrast,
cPten
f/f
livers showed similar expression level and pattern of E-cadherin as the WT,
however, integrin β1 was mostly localized in the cytoplasm (Figure 2.9C). Collectively,
PTEN and GRP94 deficiency caused inappropriate cell-cell and cell-matrix interaction at
the premalignant stage.

33

Figure 2.9. Disturbance of cell junctions in cPten
f/f
Grp94
f/f
livers at 2 months. Immunofluorescent staining
of Cx26 (A) and Cx32 (B) in frozen liver section. Nuclei were stained with DAPI (blue). Scale bar: 20 µm.
(B) Western blot of liver lysates to detect Cx26 and Cx32 levels in WT, cP
f/f
, and cP
f/f
94
f/f
mice. (C)
Schematic drawings of liver E-cadherin expression patterns. PV: portal vein; CV: central vein. Double

34

staining of integrin β1 (green) and E-cadherin (red) of the boxed areas (U1,2,3 and L1,2,3) is shown below.
White arrows indicate clusters of liver progenitor/bile duct cells with strong E-cadherin. Scale bar: 50 µm.

2.3.7 ERK Activation in Premalignant cPten
f/f
Grp94
f/f
Livers.
In examining proliferative pathways linked to liver cancer at the early age, we
observed strong AKT activation in cPten
f/f
livers (Figure 2.10A). Interestingly, both p-
AKT and total AKT levels were lower in cPten
f/f
Grp94
f/f
livers, thus the p-AKT/AKT
ratio was similar to cPten
f/f
. p-AKT was barely detectable in both WT and cGrp94
f/f
livers
(Figure 2.10A). Activation of SRC, p38 as measured by p-SRC and p-p38 levels, showed
no difference, and the levels of β-catenin, an effector of canonical Wnt signaling, were
similar in all genotypes (Figure 2.10A). Strikingly, p-ERK was markedly upregulated in
cPten
f/f
Grp94
f/f
, but not in WT, cPten
f/f
, or cGrp94
f/f
livers (Figure 2.10B). p-ERK
activation was observed in hepatocytes and in some cells around PVs morphologically
resembling LPCs in cPten
f/f
Grp94
f/f
livers at 2 months (Figure 2.10C).

35

Figure 2.10. ERK activation in premalignant cPten
f/f
Grp94
f/f
livers at 2 months. (A) Representative
Western blots of liver lysates for the indicated proteins. (B) Same as (A) except ERK was analyzed. (C)
Staining of p-ERK in the liver. The boxed area was enlarged with black arrows denoting positive cells
morphologically similar to LPCs. Scale bar: 50 µm. (D) Summary model on how hepatic GRP94 depletion
promotes PTEN-null induced tumorigenesis. PV: portal vein.

2.4 Discussion

GRP94, which is only expressed in multi-cellular organisms, plays an essential role in
cell-cell and cell-matrix interactions (Ostrovsky, Eletto, Makarewich, Barton, & Argon,

36

2010). Conditional knockout of GRP94 in the muscle and gut revealed how GRP94
affects organ homeostasis could be context dependent, involving pathways, such as IGF-1
and Wnt signaling (B. Liu et al., 2013; Marzec et al., 2012).

As summarized in Figure
2.10D, our studies identify GRP94 as a novel regulator of liver homeostasis and
tumorigenesis. We propose that in the normal liver, while hepatocytes are highly
polarized by cell adhesion proteins, LPCs are quiescent, localized in their niche. Upon
GRP94 deletion, cell-cell/cell-matrix interaction is disrupted, which activates LPCs to
proliferate and migrate. When GRP94 is depleted in the Pten-null liver, besides loss of
cell adhesion, ERK is activated in both hepatocytes and LPCs, further transforming LPCs
to become tumor initiating cells, giving rise to HCC and CC. Interestingly, this occurs
with limited early liver injury, minimal apoptosis, and no detectable necrosis.
Expansion of LPCs occurs when the replication of hepatocytes/cholangiocytes is
inhibited (T Roskams, 2006), and there could be multiple mechanisms. One explanation
is that cGrp94
f/f
livers are smaller, probably due to decreased capacity of hepatocytes to
grow, thus LPC proliferation is a SOS pathway to maintain liver size. Here, we provide
evidence that disruption of cell adhesion and ERK activation may also contribute to LPC
proliferation in cGrp94
f/f
livers.
The formation of functional gap junctions requires the appropriate cell-cell adhesion
(Fujimoto et al., 1997; Segretain & Falk, 2004), thus it is possible that the disorganized
E-cadherin led to the disruption of gap junctions. Although connexins form gap junctions
to mediate intercellular communication, we did not detect a major change in gap
junctional intercellular communication (GJIC) assay in our cGrp94
f/f
and cPten
f/f
Grp94
f/f
mouse models at early age (data not shown). Since emerging evidence showed that

37

connexins regulate cellular processes through GJIC-independent mechanisms (eg, various
connexin-binding proteins) (Dbouk, Mroue, El-Sabban, & Talhouk, 2009), our result
suggests GJIC-independent function(s) of connexins are involved in liver progenitor
hyperproliferation.
Connexins, integrin β1, and E-cadherin have been reported to regulate stem cell-niche
interactions in different tissues (Gonzalez-Nieto et al., 2012; Karpowicz et al., 2009;
Loulier et al., 2009). Moreover, Cx26, Cx32, and integrin β1 in the liver are exclusively
expressed in hepatocytes/cholangiocytes (Shiojiri & Sugiyama, 2004; Vinken et al., 2008)
which intimately associate with LPCs under normal conditions. Integrins regulate ECM
composition (J. Yue, Zhang, & Chen, 2012), such as laminin, which maintains LPCs at
undifferentiated state (Lorenzini et al., 2010). Moreover, in a CDE-induced liver injury
model, ECM deposition and activation of matrix-producing cells occurred as an initial
phase, prior to LPC expansion and migration into the parenchyma (Van Hul, Abarca-
Quinones, Sempoux, Horsmans, & Leclercq, 2009). Disrupted cell adhesion in
hepatocytes might also affect their contact with non-parenchymal cells (hepatic stellate
and kupffer cells), which closely surround activated LPCs during liver injury and are
important for LPC expansion/invasion (Kordes & Häussinger, 2013; Lorenzini et al.,
2010; Tania Roskams, 2008; Van Hul et al., 2009). Therefore, disorganization of these
cell adhesion proteins at early stage might disrupt the niche, allowing LPCs to overcome
contact inhibition, resulting in hyperproliferation and migration. While our results are
consistent with the tumor suppressor roles of E-cadherin in epithelial cancer (Jeanes et
al., 2008), connexins in liver tumors (Vinken et al., 2008), and the report that integrin β1
deletion correlates with prostate cancer progression (Moran-Jones et al., 2012), future

38

studies are required to establish the causative role of cell adhesion molecules in GRP94-
mediated liver tumorigenesis.
Upon examination of major proliferative pathways, we identified selective activation
of ERK pathway in cPten
f/f
Grp94
f/f
livers. ERK activation has been reported in HCC
associating with aggressive tumor behavior (Schmitz et al., 2008). LSP1, a scaffold
protein associated with RAF/MEK/ERK pathway, is the most commonly deleted gene in
HCC (Nalesnik et al., 2012). Additionally, RAF/MEK/ERK pathway promotes
proliferation of Sca-1 positive LPCs (Jin, Samuelson, Cui, Sun, & Gerber, 2011). We
showed that p-ERK was mainly upregulated in hepatocytes and in some LPCs at the
premalignant stage. Therefore, while ERK signaling may directly induce LPC
proliferation, ERK activation in hepatocytes might also stimulate the release of diffusible
factors that are mitogenic to LPCs. Indeed, ERK signaling mediates inflammatory
cytokine induction, such as tumor necrosis factor-α (TNF-α), which can regulate LPC
proliferation (D.-Q. Li et al., 2006). However, while our studies suggest LPCs to be the
origin of tumors in cPten
f/f
Grp94
f/f
mice, mature hepatocytes may also give rise to HCC
and CC (Fan et al., 2012; Sekiya & Suzuki, 2012).
No studies to date have examined the in vivo function of GRP94 in tumor
development. Here we investigated the consequence of loss of GRP94 function in the
liver and uncovered its novel role in maintaining cell adhesion, and in the context of
Pten-null livers selectively activating ERK pathway and accelerating tumorigenesis.
While the generality of these observations in other liver tumor models remains to be
determined, cGrp94
f/f
mice fed for 3 weeks with 3,5-diethoxycarbonyl-1,4-
dihydrocolidine (DDC) diet, known to induce liver injury and LPC proliferation (X.

39

Wang et al., 2003), showed higher proliferation of LPCs/bile duct cells, compared to the
WT (Figure 2.11).

Figure 2.11. Increased proliferation of liver progenitor/bile duct cells in cGrp94
f/f
livers after DDC
treatment. Left panel: Ki67 staining of liver progenitor/bile duct cells around PVs (dotted circle) in 3.5-
month-old WT and cGrp94
f/f
mice after 3 weeks of DDC diet. Brown Ki67 staining was detected in the cell
nuclei. It is noted that the big brown patches were nonspecific staining due to porphyrin crystallization.
Right panel: quantitation of Ki67
+
liver progenitor/bile duct cells in the indicated genotypes. PV: portal
vein. Scale bar: 100 µm. The data are presented as mean ± s.e. (***P<0.001).

40

Figure 2.12. GRP94 upregulation in cPten
f/f
liver tumors. Immunofluorescent staining of GRP94 (red)
in

liver sections from WT mice and liver tumor sections from cP
f/f
mice. Nuclei were stained with DAPI
(blue). Lower panels represent 2X magnification of the boxed regions. Scale bars: 100 µm.

GRP94 overexpression has been detected in various human cancers, including HCC (Fu
& Lee, 2006; Ni & Lee, 2007; Yao et al., 2006), as well as Pten-null mouse liver tumors
(Figure 2.12). While various levels of repopulation were observed in cPten
f/f
Grp94
f/f

HCC cells at 8-9 months, we found even stronger repopulation of GRP94-positive cells in
HCC by 12 months in cPten
f/f
Grp94
f/f
mice (Figure 2.13). GRP94, as an anti-apoptotic
protein (Reddy, Lu, and Lee 1999), may well protect tumor cells from host cell defense
and promote tumor progression. Thus, while loss of GRP94 function may accelerate
tumorigenesis, gain of GRP94 function could offer protection against stress in a growing
tumor, which awaits further investigation.

Figure 2.13. Robust repopulation of GRP94-positive cells in cPten
f/f
Grp94
f/f
HCC at 12 months.
Immunohistochemistry staining of GRP94 in liver sections from WT mice and liver tumor sections from
cP
f/f
94
f/f
mice. Scale bar: 100 µm.

41

Chapter 3
Targeted Deletion of GRP94 in the Liver Results in
Spontaneous Liver Tumor Formation in Aged mice

3.1 Introduction
Glucose-regulated protein (GRP94), encoded in humans by HSP90β1, shares 50%
amino acid homolog with the heat shock protein HSP90 (A. S. Lee, 2014; Ni & Lee,
2007). It is an essential endoplasmic reticulum (ER) chaperone, assisting in protein
folding, processing and secretion of selective clients. As such, GRP94 uniquely controls
specific pathways critical for cell adhesion, proliferation, and organ homeostasis (Eletto
et al., 2010; B. Liu et al., 2013; Maynard et al., 2010). GRP94 also maintains Ca
2+

homeostasis in the ER and protects cancer cells from apoptosis (R K Reddy et al., 1999).
GRP94 can translocate to the cell surface serving additional functions, including
modulating immune responses (A. S. Lee, 2014). Recently, GRP94 has been implicated
in tumorigenesis, with differential outcomes in a context dependent manner (Wan-Ting
Chen et al., 2014; Hua et al., 2013; A. S. Lee, 2014; Morales et al., 2014). Thus, it is
important to study the role of GRP94 in additional cancer models and how it affects
oncogenic signaling in vivo.
Liver cancer is the fifth most common cancer worldwide, among which
hepatocellular carcinoma (HCC) accounts for 70-85% of total cancer burden (Jemal et al.,
2011). Late diagnosis, recurrence, and metastasis result in a poor prognosis of HCC, and

42

the 5-year survival rate of patients undergoing surgical treatment is low (Bruix, Boix,
Sala, & Llovet, 2004). HCC often occurs in steatohepatitis or cirrhosis background
(Bruix et al., 2004; T Roskams, 2006) but the molecular pathogenesis of cancer
development remains elusive. Thus, it is important to understand liver tumorigenic
mechanisms, so that new treatments can be developed.
Liver regeneration is normally carried out by hepatocytes and cholangiocytes (bile
duct cells). However, during chronic liver injury and cirrhosis, the dividing ability of
these parenchymal cells is compromised and activation of liver progenitor cells (LPCs) is
observed (T Roskams, 2006). Due to its bi-potential, quiescent LPCs residing in the
niche, located in the most peripheral branches of the biliary tree, can differentiate into
hepatocytes and cholangiocytes to restore the liver function (T Roskams, 2006). Recently,
the concept that liver cancer originates from liver tumor-initiating cells (TICs), which can
be derived from normal LPCs, received much attention. Liver cancer with LPC
characteristics is particularly aggressive (J.-S. Lee et al., 2006), and deregulated LPCs
have been shown to obtain tumor-initiating ability in vivo (Chiba et al., 2007, 2010),
suggesting that LPCs might be the origin of at least part of liver cancer. Perturbation of
oncogenic signaling is central to tumorigenesis through their effects on proliferation,
apoptosis, and invasion. For example, human HCC overexpresses TGF-β (Giannelli,
Mazzocca, Fransvea, Lahn, & Antonaci, 2011), which has been shown to transform LPCs
to TICs (Wu et al., 2012). Other kinases reported to be upregulated in HCC include JNK,
AKT and ERK, with the latter associated with increased proliferation of LPCs (Hagiwara
et al., 2012; Jin et al., 2011; Nakagawa & Maeda, 2012; Schmitz et al., 2008).
We previously identified GRP94 as a novel regulator of cell adhesion, LPCs, and liver

43

tumorigenesis (Wan-Ting Chen et al., 2014). By using Albumin-Cre (Alb-Cre) system, we
generated the liver-specific Grp94 knockout mouse model (Grp94
f/f
; Alb-Cre or
cGrp94
f/f
), we found GRP94 deficiency leads to hyperproliferation of LPCs with minor
liver injury, correlating with impaired cell adhesion. Deletion of both Grp94 and Pten in
the liver (cPten
f/f
Grp94
f/f
) accelerates HCC and cholangiocarcinoma (CC) development,
and selectively activates ERK. Since expanded LPCs might become TICs, it is interesting
to determine whether GRP94 ablation alone is sufficient to induce liver tumors. Here we
investigated the effect of long-term GRP94 deficiency on liver tumorigenesis and
alteration of oncogenic signaling pathways implicated in human HCC. This study
revealed spontaneous liver tumor formation in aged cGrp94
f/f
mice with progressive
repopulation of GRP94-positive hepatocytes, upregulation of TGF-β1 concurrent with
LPC expansion, as well as activation of SMAD2/3, ERK, and JNK prior to the onset of
liver fibrosis and tumors. This study expands our knowledge of the biological functions
of GRP94 in liver homeostasis and cancer progression.

3.2 Materials and Methods
Mice. Alb-Cre; Grp94
f/f
mice on a mixed C57BL/6; 129/Sv; 6xDBA2; 129 background
were generated and genotyping was performed as previously described (Wan-Ting Chen
et al., 2014). Littermates lacking Alb-Cre served as wild-type (WT) controls. Blood
samples were collected through retro-orbital bleeding. All protocols for animal use were
reviewed and approved by the USC Institutional Animal Care and Use Committee.

Histology and immunostaining. Mouse liver tissues were fixed in 10% zinc formalin,

44

embedded in paraffin, sectioned at 4 µm, and subjected to H&E staining and
immunostaining as described (Fu et al., 2008). Monoclonal rat anti-GRP94 (1:200) is
from Enzo Life Sciences (Farmingdale, NY). Cell proliferation was evaluated by Ki67
staining (SP-6, 1:50, Thermo Scientific, Waltham, MA). Monoclonal mouse anti-
glutamine synthetase (GS) (1:400, BD Biosciences, San Jose, CA) was used to examine
liver zonation. Monoclonal mouse anti-hepatocyte paraffin 1 (HepPar1) (1:25,
DakoCytomation, Denmark A/S) and polyclonal rabbit anti-wide spectrum cytokeratin
(panCK) (1:75, Abcam, Cambridge, MA) antibodies were used to identify hepatocytes
and cholangiocytes/LPCs, respectively. Mesenchymal cells were detected by monoclonal
mouse anti-α-SMA (1:2000, Sigma, St. Louis, MO).

Plasma biochemistry. Plasma alanine aminotransferase (ALT) was determined using ALT
Reagent (Raichem, San Diego, CA). Plasma alkaline phosphatase (ALP) was measured
following manufacturers’ instruction (Thermo Scientific, Waltham, MA).

TUNEL assay. Apoptosis was determined using TUNEL staining (Roche Diagnostics,
Mannheim, Germany).

Western blot analysis. Harvested tissues were frozen immediately, and homogenized in
RIPA buffer with added protease and phosphatase inhibitor cocktail (Thermo Scientific,
Waltham, MA). Cell lysates (25-30 µg) were subjected to SDS-PAGE and Western blot
analysis as described.50 The primary antibodies used are as follows. Monoclonal rat anti-
GRP94 (1:5000) is from Enzo Life Sciences (Farmingdale, NY). Rabbit anti-ERK1/2

45

(1:1000), mouse anti-p-ERK1/2 (Thr202/Tyr204, E10, 1:1000), rabbit anti-AKT
(1:1000), and rabbit anti-p-AKT (Ser473, 1:1000) are from Cell Signaling (Danvers,
MA). Goat anti-SMAD2/3 (N-19, 1:1000), goat anti-p-SMAD2/3 (Ser423/425, 1:1000),
rabbit anti-JNK (FL, 1:1000), mouse anti-p-JNK (Thr183/Tyr185, G7, 1:1000), and
rabbit anti-β-catenin (H-102, 1:1000) are from Santa Cruz Biotechnology (Dallas, TX).
Monoclonal rabbit anti-Cyclin D1 (SP4, 1:1000) is from Thermo Scientific (Waltham,
MA). Monoclonal mouse anti-E-cadherin (1:1000) is from BD Biosciences (San Jose,
CA). Monoclonal rabbit anti-integrin β1 (clone EP1041Y , 1:1000) and monoclonal mouse
anti-active-β-catenin (anti-ABC) (clone 8E7, 1:1000) are from Millipore (Billerica, MA).
Monoclonal rabbit anti-vimentin (clone EPR3776, 1:1000) is from Epitomics
(Burlingame, CA). Mouse anti-β-actin (1:5000) is from Sigma (St. Louis, MO).

Fluorescent Microscopy. Immunofluorescence was visualized by Zeiss LSM 510
confocal microscope equipped with LSM 510 Version 4.2 SP1 acquisition software (Carl
Zeiss). Confocal images were obtained with 40X oil lens. Images were then processed
with LSM Image Browser R4.2 and Adobe Photoshop CS5.

Statistical analysis. Statistical significance was assayed by 2-tailed Student’s t test, and
the error bars reflect standard error (s.e.).

46

3.3 Results
3.3.1 Spontaneous live tumor development in aged cGrp94
f/f
mice.
In following the effect of long-term GRP94 deficiency on the mouse liver, we
observed that while wild-type (WT) livers were normal and tumor free at least up to 24
months, the livers of Grp94
f/f
; Alb-Cre mice (referred to as cGrp94
f/f
) started to develop
small nodules at 15 months and prominent liver tumors by 21 months (Figures 3.1A and
3.1B). As noted previously (Wan-Ting Chen et al., 2014), the cGrp94
f/f
liver weight
relative to the whole body of mice at 2 and 9 months were lower than the WT. However,
consistent with tumor development, this decrease was lower at 15 months and by 21
months, cGrp94
f/f
livers were 1.6-fold higher than the WT (Figure 3.1C). To follow liver
injury in cGrp94
f/f
mice, we measured levels of plasma alanine aminotransferase (ALT)
and alkaline phosphatase (ALP). While no increase in these injury markers was observed
at 9 months, a trend of mildly elevated ALT and ALP was detected in cGrp94
f/f
mice at 15
months and substantial increase in ALT and ALP was observed at 21 months, concurrent
with tumor formation (Figure 3.1D). cGrp94
f/f
livers exhibited an about 1.6-fold increase
in apoptosis at 9 and 15 months, and a 2.7-fold increase at 21 months, however the
percentage of apoptotic cells remained below 0.6% at 21 months (Figure 3.1E).

47

Figure 3.1. Spontaneous live tumor formation in aged cGrp94
f/f
mice. (A) Liver tumor spectrum. Each
circle represents one mouse. The solid and open circles represent mice with and without tumors,
respectively. (P<0.001, χ2 test). (B) Representative liver pictures at 15 and 21 months. Black arrowheads
indicate small nodules (SN). The inset shows the enlarged SN. White arrowheads denote tumors (T) on the
liver surface. (C) Liver weight to body weight percentage in WT and cGrp94f/f mice at indicated ages. (D)

48

Plasma ALT and ALP measurements. (E) Quantitation of TUNEL-positive cells in cGrp94f/f livers at
indicated ages. All data are presented as mean ± s.e. (*P<0.05 and ***P<0.001).

3.3.2 Progressive repopulation of cGrp94
f/f
livers with GRP94-positive hepatocytes.
Recent studies revealed that in conditional knockout models of ER chaperone in
specific tissues, repopulation with non-recombined cells could occur (W-T Chen et al.,
2014; Heijmans et al., 2013; Rosekrans et al., 2014). To test this, we first examined the
expression pattern of GRP94 in liver tissues from WT and cGrp94
f/f
mice by
immunohistochemistry (IHC) staining. Our results showed that while GRP94 expression
was largely ablated in cGrp94
f/f
livers at 2 months of age, by 9 months, patches of the
liver showed positive GRP94 staining, which intensified progressively from 15 to 21
months, with most of the GRP94-positive cells being hepatocytes (Figure 3.2A). Western
blot of liver lysates isolated from WT and cGrp94
f/f
mice confirmed gradual repopulation
of GRP94-positive cells in cGrp94
f/f
livers as the mice aged, reaching about 40% of the
WT level at 15 months (Figure 2B). At 21 months, the level of GRP94 in cGrp94
f/f
liver
tumor lysates was even higher, at about 60% of the WT level (Figure 3.2B).

49

Figure 3.2. Progressive repopulation with GRP94-positive hepatocytes in cGrp94
f/f
livers. (A) GRP94 IHC
in WT and cGrp94
f/f
livers at indicated ages. NT: non-tumor tissue. T: tumor tissue. Scale bar: 200 µm. (B)
Western blot of liver lysates to detect GRP94 at indicated ages. NT: liver lysates from non-tumor tissues. T:
liver lysates from tumor tissues. β-actin served as the loading control and corresponding quantifications are
shown on the bottom. Data are presented as mean ± s.e. (**P<0.01 and ***P<0.001).

3.3.3 Increased proliferation preceding hepatocellular carcinoma formation and
ductular reactions in livers of aged cGrp94f/f mice.
Histological analysis of cGrp94
f/f
livers at 15 months showed mild fat accumulation,
and the small nodules in these livers exhibited a combination of both fat and hydropic
change, as evidenced by extensive cellular swelling (Figure 3.3A). IHC staining revealed

50

patchy GRP94 expression in cGrp94
f/f
livers, with even higher level of repoluation in the
small nodules, correlating with marked increase in proliferation as revealed by Ki67
staining (Figure 3.3A).
At 21 months of age, HCC was evident and ductular reactions (DRs) were also
detected in the tumor region of cGrp94
f/f
livers (Figure 3.3B). DR is the expansion of
activated biliary epithelial cells in response to injury, and contains LPCs as well as a
complex of ECM, inflammatory cells, and mesenchymal cells (Gouw, Clouston, &
Theise, 2011; Williams, Clouston, & Forbes, 2014). Additionally, fibrosis was detected in
the liver tumors in 50% of cGrp94
f/f
mice (Figure 3.3B). IHC staining showed GRP94
expression and markedly higher Ki67 staining in cGrp94
f/f
livers (Figure 3B).
Furthermore, we performed staining of glutamine synthetase (GS), a liver zonation
marker expressed in about 50% of HCC (Di Tommaso et al., 2007). GS staining labeled
central vein (CV)-associated hepatocytes in the WT, but revealed decreased spacing
between GS-positive regions with an irregular distribution in cGrp94
f/f
livers at both 15
and 21 months. Increased GS expression was also observed in cGrp94
f/f
livers at 21
months, consistent with HCC formation (Figure 3.3C).

51

Figure 3.3. Increased proliferation and development of ductular reactions (DRs), fibrosis and HCC in
cGrp94
f/f
livers. Liver H&E staining, GRP94, and Ki67 IHC at 15 months (A) and 21 months (B). SN:
small nodule. Scale bars: 100 µm (C) GS IHC in livers. CV: central vein. Scale bar: 300 µm.

To further characterize cGrp94
f/f
liver tumors, HepPar1, panCK, and α-SMA staining
were performed on consecutive liver slides. While HepPar1 stained hepatocytes of WT

52

livers at a low basal level (Figure 3.4), strong HepPar1 staining was detected in HCC
(Figure 3.4). panCK staining marked bile ducts in the WT and highlighted DR areas in
cGrp94
f/f
livers (Figure 3.4). Interestingly, some HepPar1-labeled cells in HCC were also
co-stained by panCK, raising the possibilities that they might come from the common
progenitors, or hepatocytes might transdifferentiate into bile duct cells in the aged liver
undergoing tumorigenesis. In WT livers, α-SMA stained smooth muscle cells in vessel
walls (Figure 3.4). In contrast, many α-SMA-positive stellate cells were detected in
cGrp94
f/f
tumors (Figure 3.4), indicating activation of stellate cells, which represent the
major cell type for matrix production resulting in liver fibrosis (Bissell, 2001), as
observed in cGrp94
f/f
livers at 21 months (Figure 3.3B).

53

Figure 3.4. Characteristics of cGrp94
f/f
liver tumors. H&E staining, HepPar1, panCK, and α-SMA IHC in
WT livers and cGrp94
f/f
liver tumors at 21 months. Scale bars: 200 µm.

3.3.4 Activation of oncogenic signaling in premalignant cGrp94f/f livers.
To identify potential molecular mechanisms contributing to the tumorigenic
phenotypes of aged cGrp94
f/f
mice, we examined key oncogenic pathways implicated in
HCC in WT and cGrp94
f/f
livers at premalignant 15 months, prior to the tumor onset. Our
analysis showed prominent upregulation of TGF-β1, one of the most potent activators for

54

stellate cell activation and liver fibrosis (Bissell, 2001), correlating with elevated level of
its downstream target p-SMAD3 and a mild increase in p-SMAD2 (Figure 3.5A). This is
in agreement with SMAD3 playing a more important role than SMAD2 in the
development of liver fibrosis (Inagaki & Okazaki, 2007). Additionally, we observed
elevation of p-ERK and p-JNK, but not p-AKT in cGrp94
f/f
livers (Figure 3.5B). The
expression of the cell cycle regulator cyclin D1 was strikingly increased (Figure 3.5B),
consistent with higher proliferation of cGrp94
f/f
livers prior to tumor development.
Since TGF-β is an inducer of epithelial-mesenchymal transition (EMT), which may
contribute to tumorigenesis (Ikushima & Miyazono, 2010), EMT markers vimentin and
E-cadherin were examined. We detected strong upregulation of the epithelial marker E-
cadherin; however, there was no apparent difference in the levels of the mesenchymal
marker vimentin, which displayed similar variation (Figure 3.5C). TGF-β signaling can
also activate integrin β1 to induce EMT (Mamuya & Duncan, 2012). However, similar
integrin β1 expression levels were detected in WT and cGrp94
f/f
livers (Figure 3.5C).
Thus, despite increased TGF-β1 in premalignant cGrp94
f/f
livers, EMT was not evident.
Recently, it has been reported that GRP94 is an essential chaperone of the Wnt co-
receptor LRP6 required for Wnt/β-catenin signaling (B. Liu et al., 2013). Nevertheless,
the levels of both total and active β-catenin were similar in WT and cGrp94
f/f
livers
(Figure 3.5D).

55

Figure 3.5. Activation of oncogenic signaling in premalignant cGrp94
f/f
livers at 15 months. (A)
Representative Western blots of liver lysates for TGF-β1 and SMAD2/3. (B) Representative Western blots
for the indicated kinases and cyclin D1. (C) Representative Western blots for vimentin, E-cadherin, and
integrin β1. (D) Representative Western blots for total and active β-catenin.

3.3.5 Expansion of GRP94-negative liver progenitor cells and ductular reactions in
cGrp94
f/f
mice.
We previously demonstrated that liver-specific deletion of Grp94 leads to LPC
proliferation (Wan-Ting Chen et al., 2014), and bi-potential LPCs could give rise to liver
tumors (T Roskams, 2006). To address the origin of GRP94-positive HCC in cGrp94
f/f

mice, double staining of GRP94 and the LPC/bile duct marker panCK was performed on
liver sections at 21 months. panCK labeled LPC/bile duct cells as well as DRs, and while

56

WT bile duct cells co-expressed GRP94 and panCK, most LPC/bile ducts in cGrp94
f/f
livers were devoid of GRP94 expression (Figure 3.6A). Moreover, in agreement with
DRs in cGrp94
f/f
livers at 21 months, we observed increased panCK-positive cells and
many of which migrated away from portal veins, suggesting expansion of LPCs in
cGrp94
f/f
livers (Figure 3.6A). LPC expansion was also detected in cGrp94
f/f
livers from 2
to 15 months of age and DRs at 15 months, and most of them were GRP94-negative
(Figure 3.6B). Collectively, these results showed expansion of GRP94-negative LPCs in
cGrp94
f/f
livers, giving rise to the GRP94-negative DRs in aged cGrp94
f/f
mice. Since
HCC was mostly GRP94-positive and LPCs were mostly GRP94-negative, it is unlikely
that HCC primarily derived from LPCs.

57

Figure 3.6. Expansion of GRP94-negative LPCs in cGrp94
f/f
mice. (A) Immunofluorescent staining of WT
and cGrp94
f/f
livers at 21 months with panCK (green) and GRP94 (red). Nuclei were stained with DAPI
(blue). White arrows denote panCK-positive cells migrating away from PVs. (B) Immunofluorescent
staining of panCK (green) and GRP94 (red) in cGrp94
f/f
livers at 2, 9, and 15 months. PV: portal vein.
Scale bars: 25 µm.

3.4 Discussion
While the role of GRP94 as an ER chaperone is well studied, its in vivo function in
cancer progression is just emerging (Eletto et al., 2010; A. S. Lee, 2014; Ni & Lee, 2007).
Thus far, the role of GRP94 has been examined in three cancer mouse models (Wan-Ting

58

Chen et al., 2014; Hua et al., 2013; Morales et al., 2014). In the case of liver cancer, we
recently showed that liver-specific knockout of Grp94 disrupts cell adhesion, activates
LPCs, and promotes PTEN loss-induced HCC and CC (Wan-Ting Chen et al., 2014). In
contrast, genetic deletion of Grp94 in XBP1s-Tg mice attenuates multiple myeloma (Hua
et al., 2013), and macrophage-specific deletion of Grp94 reduces colitis and
inflammation-associated colon tumorigenesis (Morales et al., 2014). In view of the
multifunctional property of GRP94 in regulating protein folding and assembly, growth
factor secretion, cell adhesion, apoptosis and inflammation, the effects of GRP94 ablation
on different cancers are likely to be complex and dependent on cellular contexts.
Based on our recent discovery that Grp94 knockout in the liver and bone marrow
leads to progenitor/stem cell expansion (Wan-Ting Chen et al., 2014; Biquan Luo et al.,
2011, 2013), and such cells can fuel tumorigenesis, our present study interrogates
whether long-term GRP94 ablation alone is sufficient to induce liver tumor formation.
Our findings provide the first demonstration that as cGrp94
f/f
mice aged, abnormal small
nodules surfaced at 15 months and aggressive HCC was evident by 21 months. This
study also uncovered several novel observations on how the liver adapts to long-term
GRP94 deficiency and how they impact tumor development, which are summarized in
Figure 3.7.

59

Figure 3.7. Schematic model of GRP94 expression pattern and liver tumor development in cGrp94
f/f
mice.
The major phenotypes at each stage are listed below.

In following Grp94 knockout efficiency in aging cGrp94
f/f
mice, we discovered that
cGrp94
f/f
livers were progressively replaced by GRP94-positive hepatocytes. In cGrp94
f/f
livers at the early stage (2-9 months), GRP94 level was 10-30% of the WT, and most
hepatocytes and LPCs were GRP94-negative. At 15 months, GRP94 expression reverted
back to 40% of the WT level. HCC developed at 21 months were mostly GRP94-positive,
whereas most DRs remained GRP94-negative. This implies that the tumor development
in cGrp94
f/f
livers is not due to the lack of GRP94 in the tumor cells; rather it is caused by
some cell autonomous and/or non-autonomous events at the premalignant stage triggered
by GRP94 deficiency.
Since GRP94 possesses anti-apoptosis properties (Ostrovsky et al., 2009; R K Reddy
et al., 1999) and is required for the processing and secretion of IGF-1, which is protective
against liver injury (Hijikawa et al., 2008), we measured the effect of long-term GRP94

60

deficiency on liver injury and apoptosis. We detected a limited but detectable increase in
ALT and ALP at 15 months prior to the onset of tumorigenesis, and a general increase in
apoptotic cells spanning from 9 to 21 months. While these effects are modest, chronic
exposure to low level liver injury in mice undergoing the aging process, when other
mutations are likely to accumulate, may trigger the adaptive response of expanding LPCs,
which was observed in cGrp94
f/f
mice. Interestingly, LPCs in cGrp94
f/f
livers remained
GRP94-negative throughout, and as they migrated out from the niche, they contributed to
DRs, which were evident at the premalignant stage (15 months) and prominent in the
tumor regions at 21 months.
In examining the alteration of signaling pathways as a result of long-term GRP94
deficiency, we observed concurrent increase in LPCs and TGF-β1 level in premalignant
cGrp94
f/f
livers, associating with SMAD2/3 activation. While activation of SMAD2/3
stimulates stellate cell activation and fibrosis (Inagaki & Okazaki, 2007), establishing a
tumor reactive stroma (Cadamuro, Morton, Strazzabosco, & Fabris, 2013), TGF-β in the
microenvironment maintains TICs (Ikushima & Miyazono, 2010). Furthermore, TGF-β
exposure under chronic liver damage is capable of inducing transformation of LPCs,
giving rise to liver TICs (Wu et al., 2012). Thus, it is possible that TGF-β1 contributes to
the generation of DRs from transformed LPCs in cGrp94
f/f
livers. Paradoxically, TGF-β is
also anti-proliferative in most epithelial cells, including hepatocytes, but it is proposed
that cancer cells can escape the tumor suppressor function of TGF-β (Ikushima &
Miyazono, 2010). Therefore, GRP94-positive hepatocytes might develop mechanisms to
become resistant to TGF-β1-mediated growth inhibition. Concurrent gene alterations can
also influence whether TGF-β promotes or suppresses tumor growth. For example, in the

61

setting of p53 loss, TGF-β signaling enhances liver tumorigenesis (Morris et al., 2012). In
future studies, it will be interesting to dissect the factors in aging cGrp94
f/f
mice that
synergize with TGF-β signaling in liver tumor development.
Our analysis also revealed increased p-ERK and p-JNK levels at the premalignant
stage in cGrp94
f/f
livers. Both ERK and JNK activation have been reported in HCC
(Nakagawa & Maeda, 2012; Schmitz et al., 2008). JNK activity in HCC is significantly
correlated with stem cell marker CD133 expression (Hagiwara et al., 2012). Similarly,
ERK pathway is associated with aggressive tumor behaviors and promotes proliferation
of Sca-1-positive LPCs (Jin et al., 2011; Schmitz et al., 2008). Indeed, we also observed
increased p-ERK in cPten
f/f
Grp94
f/f
livers, which formed mixed lineage tumors at 8-9
months (Wan-Ting Chen et al., 2014). Further studies are required to address the
causative roles of these pathways in GRP94-mediated liver tumors.
E-cadherin has been suggested as a tumor suppressor in various cancers and E-
cadherin overexpression inhibits proliferation and invasiveness (Jeanes et al., 2008).
However, recent studies indicate that its role might be more complex, such that loss or
upregulation of E-cadherin levels identify two distinct categories of HCC in both humans
and transgenic mice (Calvisi, Ladu, Conner, Factor, & Thorgeirsson, 2004; Wei et al.,
2002). Overexpression of E-cadherin has been linked to invasive potential of tumor cells,
including HCC (Osada et al., 1996; Saha et al., 2007; Tomlinson, Alpaugh, & Barsky,
2001; Wei et al., 2002). Whether E-cadherin upregulation detected in cGrp94
f/f
livers at
15 months contributes to later HCC awaits further investigation.
The differential GRP94 expression in HCC and DRs in cGrp94
f/f
mice raises the
intriguing question on the cell origin of cGrp94
f/f
tumors. We speculate that since cells in

62

the small nodules at 15 months are GRP94-positive hepatocytes with high proliferative
activity, they could gain growth advantage, giving rise to the GRP94-positive HCC
(Figure 3.7). Although LPCs also can contribute to HCC, since the expanded LPCs in
cGrp94
f/f
mice are mostly devoid of GRP94, they are more likely to be the origin of
GRP94-negative DRs in the liver tumors, rather than the GRP94-positive HCC.
Nonetheless, given the recent report that hepatocytes can undergo cellular conversion to
biliary epithelial cells following injury (Yanger et al., 2013), it cannot be ruled out that
DRs might derive from a subfraction of hepatocytes that are GRP94-negative. Likewise,
it is also possible that a small fraction of GRP94-positive LPCs, which escape Cre at an
earlier stage, generate HCC cells. Future studies using specific cell lineage markers will
be required to resolve this, and our cGrp94
f/f
model may offer such an opportunity.
Lastly, similar to robust GRP94 expression in cGrp94
f/f
HCC cells, repopulation of
GRP94-positive cells was also observed in cPten
f/f
Grp94
f/f
HCC from 8-12 months
(Figures 2.7 and 2.13). GRP94 is upregulated in HBV-induced human HCC, correlating
with its progression (Lim et al., 2005; Yao et al., 2006), and in Pten-null mediated mouse
liver cancer (Figure 2.12). Nonetheless, in our cGrp94
f/f
mouse model, we observed that
long-term depletion of GRP94 resulted in HCC formation in aged mice. How can these
observations be reconciled? We hypothesize that in specific organs, such as the liver
where loss of GRP94 leads to LPC activation, tumorigenesis could occur in combination
with other carcinogenic events that are triggered during the process of aging.
Furthermore, there is generally a gain of GRP function in cancers in response to stress
associated with tumorigenesis (A. S. Lee, 2014). Under these conditions, the anti-
apoptotic function of GRP94 could confer survival advantage to the cancer cells.

63

Interestingly, GRP94-specific inhibitors have been identified (Duerfeldt et al., 2012; Patel
et al., 2013), and they reduce viability of HER2-overexpressing breast cancer cells and
multiple myeloma cells in vitro (Hua et al., 2013; Patel et al., 2013). Given that hepatic
GRP94 deficiency for 9 months in the mice leads to only minor liver injury and
apoptosis, short-term treatment of cancers with these inhibitors might trigger minimal
harmful effects on normal livers while useful in reducing GRP94 activity in HCC.

64

Chapter 4
GRP78 as a Regulator of Liver Steatosis and Cancer
Progression Mediated by Loss of the Tumor Suppressor PTEN

4.1 Introduction

Glucose-regulated protein 78 (GRP78), also known as BiP/HSPA5, belongs to the
HSP70 family. GRP78 is a major endoplasmic reticulum (ER) chaperone protein critical
for protein quality control of the ER, as well as a master regulator of the unfolded protein
response (UPR) (Ni & Lee, 2007; Pfaffenbach & Lee, 2011). Under ER stress, GRP78 is
titrated away by the accumulation of malfolded proteins, releasing and activating the
UPR sensors to restore ER homeostasis. In response to prolonged and severe ER stress,
the UPR triggers apoptotic pathways leading to cell death (Ron & Walter, 2007).
Accumulating evidence indicates that a subfraction of GRP78 localizes at the cell surface
under pathological conditions, such as in cancer cells (A. S. Lee, 2007; Pfaffenbach &
Lee, 2011). Cell surface GRP78 acts as a multifunctional receptor to regulate signaling
pathways, for instance, activating the PI3K/AKT signaling for cancer survival and
proliferation (Ni, Zhang, & Lee, 2011; Sansal & Sellers, 2004).
Hepatocellular carcinoma (HCC) and cholangiocarcinoma (CC) are the most common
primary liver cancers and are associated with poor prognosis. Currently, a paucity of
effective treatments for advanced liver cancers highlights the need to understand liver
tumorigenic mechanisms. The tumor suppressor, PTEN (phosphatase and tenson

65

homolog deleted on chromosome 10), which encodes for a non-redundant plasma
membrane lipid phosphatase that antagonizes the PI3K signaling pathway (Sansal &
Sellers, 2004), is mutated or deleted in 40-50% of human liver cancers (Whittaker,
Marais, & Zhu, 2010). Loss of PTEN activates PI3K/AKT pathway, leading to cancer
progression in a wide variety of human cancers. Liver-specific Pten knockout in mice
causes fatty liver and liver injury, which activates progenitor cells to become tumor-
initiating cells and over time (~12 months) leads to both HCC and CC development
(Galicia et al., 2010; Stiles et al., 2004). Liver progenitor cells (LPCs) are bi-potential
and quiescently reside in the stem cell niche. During chronic or massive liver injury,
LPCs are activated to proliferate and differentiate into hepatocytes and cholangiocytes
(bile duct cells). Nevertheless, deregulated liver progenitors can give rise to liver cancer
(T Roskams 2006).
GRP78 is commonly upregulated in various tumors due to intrinsic alterations of
cancer cell metabolism and hyperproliferation, as well as extrinsic factors in the tumor
microenvironment, such as glucose deprivation and hypoxia leading to ER stress (A. S.
Lee, 2007; B Luo & Lee, 2013). Increased GRP78 is generally associated with greater
risk for cancer recurrence and poorer patient outcome. In cancer cell lines and mouse
models, GRP78 has been shown to promote tumor survival, progression, and resistance to
therapy (A. S. Lee, 2007; B Luo & Lee, 2013). For instance, GRP78 deficiency in the
mouse prostate epithelium potently suppresses prostate tumorigenesis and AKT
activation mediated by the loss of PTEN (Fu et al., 2008). Similarly, GRP78
haploinsufficiency blocks Pten-null mediated-leukemia and AKT signaling (Wey, Luo,
Tseng, et al., 2012). In view of these studies, GRP78 might be required for PTEN-loss

66

driven tumorigenesis. However, several recent studies suggest that in metabolic organs,
the effect of GRP78 deletion is complex with both primary and compensatory
consequences resulting from partial loss of GRP78. For example, Grp78 heterozygosity
protects against high fat diet-induced obesity, type 2 diabetes, and pancreatitis in the
exocrine pancreas through compensatory mechanisms, whereby ER chaperones and other
protective ER stress pathways are upregulated (Ye, Jung, et al., 2010; Ye, Mareninova, et
al., 2010). In the case of adipose tissues, GRP78 is required for adipogenesis and glucose
homeostasis (Zhu et al., 2013). In the liver, breeding of Grp78 floxed/floxed mice (Fu et
al., 2008; S. Luo et al., 2006) with the Albumin-Cre transgenic mice generated offspring
(Alb-Cre; Grp78
f/f
) with incomplete deletion of GRP78 (Ji et al., 2011). Primary
hepatocytes isolated from these mice retained 30% wild-type (WT) level of GRP78.
These mice exhibited impaired insulin signaling and exacerbated liver injury resulting
from alcohol and high fat diet, and were sensitized to a variety of acute and chronic
hepatic disorders (Ji et al., 2011), consistent with a protective role of GRP78 in tissues in
general.
Taken together, the effects of GRP78 deletion could be tissue-specific and complex.
Moreover, the role of GRP78 on PTEN-loss driven liver cancer development has yet to
be determined. Thus, for the present study, we took advantage of the viability of mice
with partial hepatic GRP78 deficiency to create a liver-specific biallelic (Pten
f/f
Grp78
f/f
)
deletion mouse model mediated by Alb-Cre, referred to below as cP
f/f
78
f/f
. Previous
reports demonstrated that Alb-Cre is activated at embryonic day 9.5 in fetal hepatoblasts,
which are common progenitors of hepatocytes and bile duct cells. However, postnatally,
Alb-Cre activity is maintained in hepatocytes and LPCs but not in adult bile duct cells

67

(Tanaka et al., 2011). Here we characterized the phenotypes of cP
f/f
78
f/f
mice. Our studies
revealed that in the context of PTEN deletion, concomitant GRP78 reduction in
hepatocytes led to increased hepatomegaly, steatosis, liver injury, and progenitor cell
proliferation. GRP78 expression in bile duct cells was intact in these mice, and bile duct
proliferation was readily observed. At 6 months, we detected selective JNK activation, β-
catenin downregulation, along with PDGFRα upregulation in cP
f/f
78
f/f
livers. At 8-9
months, HCC and CC were clearly identified in cP
f/f
78
f/f
livers, associating with strong
GRP78 re-expression. In contrast and despite the development of fatty liver and
inflammation, there was no malignancy detected in livers of Alb-Cre; Grp78
f/f
(c78
f/f
)
mice even at 12-14 months. Overall, these results reveal a novel role of GRP78 in
regulating PTEN-loss mediated liver injury and cancer progression.

4.2 Materials and Methods

Mice. Grp78
f/f
mice on a mixed C57BL/6;129/Sv background (Fu et al., 2008; S. Luo et
al., 2006) and Pten
f/f
Grp78
f/f
mice on a C57BL/6;6xDBA2;129 background were
previously described (Fu et al., 2008). Pten
f/f
Grp78
f/f
mice were crossed with the
transgenic Alb-Cre; Pten
f/f
(cP
f/f
) mice on a C57BL/6;J129svj background (Galicia et al.,
2010) to generate Alb-Cre; Pten
f/f
Grp78
f/f
(cP
f/f
78
f/f
) and Alb-Cre; Pten
f/f
Grp78
f/+

(cP
f/f
78
f/+
) mice. Grp78
f/f
mice were mated with cP
f/f
78
f/f
mice to generate Alb-Cre;
Grp78
f/f
(c78
f/f
) mice (Figure 4.1). Littermates that were negative for the Cre transgene
were served as WT controls. Male mice were used in all experiments. Blood samples
were collected through retro-orbital bleeding prior to tissue collection. All protocols for
animal use were reviewed and approved by the USC Institutional Animal Care and Use

68

Committee.

Genotyping. For genotyping of the Grp78 floxed allele or knockout (KO) alleles, primer
sets PF3 and PR3 or PF3 and PTR were used, respectively (S. Luo et al., 2006). For
Genotyping of the Cre transgene, primers Cre109 and Cre457 were used. Reactions for
Grp78 floxed, WT (+), knockout alleles (KO), and Cre were under the following
conditions: 94°C for 5 min, followed by 46 cycles of 94°C for 20 sec, 62°C for 30 sec,
and 72°C for 30 sec, ended with 72°C for 7 min. For genotyping of the Pten floxed allele
(KO) in mouse cohorts, the primer set Pten-1 and Pten-2 were used. Reactions were
under the following condition: 94°C for 3 min, followed by 46 cycles of 94°C for 30 sec,
62°C for 1 min, and 72°C for 1’10, ended with 72°C for 10 min. For PCR detection of
the Pten knockout allele, another primer set Pten-F, Pten-R1, and Pten-Rko was used.
Reactions were under the following conditions: 94°C for 3 min, followed by 40 cycles of
94°C for 45 sec, 60°C for 30 sec, and 72°C for 1 min, ended with 72°C for 10 min. The
primer sequences are listed in table 4.1.

69

Gene Primer name Sequence

Grp78 (floxed or +
or KO)

PF3 5’-GATTTGAACTCAGGACCTTCGGAAGAGCAG-3’
PR3
PTR
5’-GCAATAGCAGCTGCTGTACTGTGAGGATGA-3’
5’-TTGTTAGGGGTCGTTCACCTAGA-3’
Cre
Cre109 5’-AAGAACCTGATGGACATGTTCAGGGA-3’
Cre457 5’-ACGAACCTGGTCGAAATCAGTGCGTTC-3’

Pten (floxed or +
or KO)

Pten-1
Pten-2
Pten-F
Pten-R1
Pten-Rko
5’-AAGCAAGCACTCTGCGAAACTGA -3’
5’-GATTGTCATCTTCACTTAGCCATTGGT -3’
5'-TCCCAGAGTTCATACCAGGA-3'
5'-AATCTGTGCATGAAGGGAAC-3'
5'-GCAATGGCCAGTACTAGTGAAC-3'
Table 4.1: Primer sequences for mouse genotyping

Histology. Mice were euthanized and their livers were removed and rinsed in PBS.
Samples collected from the livers were immediately frozen for RNA and protein
extraction, fixed in 10% zinc formalin, or frozen in OCT compound (Tissue-Tek Sakura,
Torrance, CA). Formalin-fixed tissue samples were embedded in paraffin, sectioned at 4
µm, and stained with H&E for morphology analysis. Frozen tissue samples were
sectioned at 10 µm for Oil Red O staining.

Immunostaining. The staining procedures of paraffin sections were performed as
described (Fu et al., 2008). Polyclonal rabbit anti-GRP78 (H-129, 1:100, Santa Cruz
Biotechnology, Dallas, TX) antibody was used to determine GRP78 levels in the liver.
Cell proliferation was evaluated by Ki67 staining (Ab-4, 1:200, Thermo Scientific,
Fremont, CA).

70

Oil Red O staining. Frozen liver sections were briefly fixed in cold 10% formalin. Slides
were stained in Oil Red O solution (3 mg/ml) and hematoxylin for counterstain.

Plasma alanine aminotransferase (ALT) quantitation. Plasma ALT was determined
using ALT Reagent (Raichem, San Diego, CA).

TUNEL assay. Apoptosis was determined using TUNEL staining (Roche Diagnostics,
Mannheim, Germany).

Western blot analyses. Western blot analyses were performed as described (Fu et al.,
2008). Liver samples were homogenized in RIPA buffer with added protease and
phosphatase inhibitor cocktail (Pierce, Rockford, IL) and 25 µg cell lysate was subjected
to SDS-PAGE. The immunoblot membranes were incubated with primary antibodies at
4°C overnight and the protein signals were detected with ECL reagent or SuperSignal
West Femto stable peroxide buffer (Pierce, Rockford, IL) after reacting with HRP-
conjugated secondary antibodies (Santa Cruz Biotechnology, Dallas, TX). The primary
antibodies used are as follows: Monoclonal mouse anti-GRP78 (1:2000) is a gift of
Parkash Gill (Keck School of Medicine of USC). Monoclonal rat anti-GRP94 (1:5000) is
from Enzo Life Sciences (Farmingdale, NY). Mouse anti-PTEN (26H9, 1:1000), rabbit
anti-AKT (1:1000), rabbit anti-p-AKT(Ser473) (1:1000), rabbit anti-p-AKT(Thr308)
(1:1000), rabbit anti-ERK1/2 (1:1000), mouse anti-p-ERK1/2(Thr202/Tyr204) (E10,
1:1000) are from Cell Signaling (Danvers, MA). Rabbit anti-JNK (FL, 1:1000), rabbit

71

anti-p-JNK (G-7, 1:1000), rabbit anti-β-catenin (H-102, 1:3000), rabbit anti-ATF4
(1:1000) and mouse anti-CHOP (GADD 153, B-3) (1:1000) are from Santa Cruz
Biotechnology. Rabbit anti-PDGFRα (N2C2, internal, 1:1000) is from GeneTex (Irvine,
CA). Rabbit anti-P62/SQSTM1 antibody (1:3000) is from MBL (Woburn, MA). Mouse
anti-β-actin (1:5000) is from Sigma (St. Louis, MO).

Real-time quantitative PCR. RNA was extracted from mouse livers, and reverse-
transcription and real-time PCR were performed as previously described (Ni, Zhou, Wey,
Baumeister, & Lee, 2009). The following primers were used for LPC activation: AFP, 5’-
ATCGACCTCACCGGGAAGAT-3’ and 5’- GAGTTCACAGGGCTTGCTTCA-3’;
EpCAM, 5’- AGGGGCGATCCAGAACAACG-3’ and 5’-
ATGGTCGTAGGGGCTTTCTC-3’; CK19, 5’- CCGGACCCTCCCGAGATTA-3’ and
5’- CTCCACGCTCAGACGCAAG-3’; 18S RNA, 5’-ACG GCC GGT ACA GTG AAA
C-3’ and 5’-GAG GGA GCT CAC CGG G-3’. The following primers were used for
lipogenic genes: SREBP-1c, 5’-GTTACTCGAGCCTGCCTTCAGG-3’ and 5’-
CAAGCTTTGGACCTGGGTGTG-3’; ACC1, 5’-
GGACAGACTGATCGCAGAGAAAG-3’ and 5’-TGGAGAGCCCCACACACA-3’;
FAS, 5’-GCTGCGGAAACTTCAGGAAAT-3’ and 5’-
AGAGACGTGTCACTCCTGGACTT-3’.

RT-PCR analysis of Xbp-1 mRNA splicing. RNA was extracted from mouse livers, and
reverse-transcription and RT-PCR were performed as previously described (Ni et al.,
2009). The following primers were used: Xbp-1, 5’-GAACCAGGAGTTAAGAACACG-

72

3’ and 5’- AGGCAACAGTGTCAGAGTCC-3’; β-actin, 5’-
GACGGCCAGGTCATCACTAT-3’ and 5’-GTACTTGCGCTCAGGAGGAG-3’.

Statistical analysis. Statistical significance was assayed by 2-tailed Student’s t test, and
the error bars reflect standard error (S.E.).

4.3 Results
4.3.1 Creation of the mouse model with biallelic deletion of Grp78 and Pten in the
liver.
The breeding scheme for the generation of the following five groups of mouse
cohorts is shown in Figure 4.1. They include: 1) single homozygous knockout of Pten
with Alb-Cre

(cP
f/f
); 2) homozygous knockout of Pten and heterozygous knockout of
Grp78 with Alb-Cre (cP
f/f
78
f/+
); 3) homozygous knockout of Pten and Grp78 with Alb-
Cre (cP
f/f
78
f/f
); 4) single homozygous knockout of Grp78 with Alb-Cre (c78
f/f
); and 5)
WT derived from littermates without the Alb-Cre transgene serving as normal controls. In
this set of breeding, a different strain of Alb-Cre mice was used from a previous study (Ji
et al., 2011). This allowed us to test if the residual GRP78 observed in c78
f/f
livers was
due to variability of the Cre activity among different transgenic mouse strains.

73

Figure 4.1. Breeding scheme for generation of the 5 groups of mouse cohorts. The genotypes indicated
with the gray shade were used in this study. All experiments were performed on male mice.

PCR performed with genomic DNA extracted from the mouse livers validated that
the various alleles were excised accordingly. We detected a Pten knockout band in cP
f/f

mice, a Grp78 knockout band in c78
f/f
mice, and both Pten and Grp78 knockout bands in
cP
f/f
78
f/+
and cP
f/f
78
f/f
mice, but not in WT mice (Figure 4.2A).

74

Figure 4.2. Liver-specific PTEN deletion and GRP78 reduction accelerated hepatomegaly. (A)
Representative PCR genotyping results from livers of the indicated genotypes. (B) Western blot analysis of
PTEN, GRP78, and GRP94 levels in livers from mice of the indicated genotypes, with β-actin serving as
the loading control. (C) Western blot analysis of GRP78 levels in livers from WT and cP
f/f
78
f/f
mice at 3 and

75

6 months. (D) Same as (C) except WT and c78
f/f
livers were analyzed. (E) Representative liver pictures
from the indicated genotypes aged from 3 to 14 months. Arrowheads point to nodules on the liver surface.
(F) Liver weight to body weight (percentage) in five types of mice (n=4 to 11) at the age indicated. Data are
presented as mean ± S.E. *p<0.05; **p<0.01; ***p<0.001.

Western blot analysis of liver lysates isolated from 6 month-old mice showed that PTEN
knockout was efficient in cP
f/f
, cP
f/f
78
f/+
and cP
f/f
78
f/f
mice (around 95% reduction
compared to the WT) (Figure 4.2B). As observed previously (Ji et al., 2011), GRP78
level only decreased gradually. At 3 months, we detected about 50% reduction of GRP78
in cP
f/f
78
f/f
and c78
f/f
livers and about 70% reduction by 6 months, compared to the WT
(Figures 4.2C and 4.2D). cP
f/f
78
f/+
livers showed intermediate GRP78 level (Figure 4.2B).
In all the mouse cohorts, no compensatory upregulation of the ER chaperone GRP94 was
observed. Morphologically, the size of livers with PTEN deficiency increased
significantly over WT and c78
f/f
livers (Figures 4.2E and 4.2F). This is likely due in part
to enhanced insulin signaling in Pten-null livers resulting in redistribution of body fat to
the liver as previously reported (Stiles et al., 2004). Indeed, fat redistribution was also
observed in our mouse cohorts, with cP
f/f
78
f/f
mice exhibiting even lower body (gonadal)
fat than cP
f/f
mice (Figures 4.3A and 4.3B).

76

Figure 4.3. Decreased gonadal fat in cPten
f/f
Grp78
f/f
mice. (A) Representative pictures from dissection of
mice of the indicated genotypes at 6-7 months and 8-9 months. The contour of the liver was outlined in
white and gonadal fat in blue. (B) The percentage of gonadal fat weight to body weight in the mice of the
indicated genotypes (n=4-11) at the age of 6-7 months. Data are presented as mean ± S.E. * p<0.05; **
p<0.01.

Livers of cP
f/f
78
f/f
mice exhibited multiple nodules on the surface as early as 6-7
months, while cP
f/f
and cP
f/f
78
f/+
mice started from 8-9 months and c78
f/f
mice from 12-14
months (Figure 4.2E). At 6-7 months, the weight of cP
f/f
78
f/f
livers normalized over body
weight increased 5-fold compared to WT livers, and 2.5-fold compared to cP
f/f
livers
(Figure 4.2F). We observed that cP
f/f
78
f/f
mice were not viable beyond 9 months. In
contrast, the normalized liver weight of c78
f/f
mice remained similar to the WT, and these
mice were fully viable. Therefore, hepatic GRP78 reduction accelerated Pten-null driven
hepatomegaly and abnormal nodule growth.

4.3.2 GRP78 reduction in Pten-null livers promoted liver steatosis, liver injury, and
bile duct proliferation.

77

Consistent with previous reports (Ji et al., 2011; Stiles et al., 2004), histological
analysis of livers showed mild lipid accumulation in both cP
f/f
and c78
f/f
mice at 3 months
(Figure 4.4A). In contrast, fat droplets were evident in cP
f/f
78
f/+
and cP
f/f
78
f/f
livers
(Figure 4.4A). Oil Red O staining further confirmed more severe steatosis in cP
f/f
78
f/f

livers (Figure 4.4B). Additionally, bile duct proliferation was detected in 2 out 5 cP
f/f
78
f/f

livers at 3 months (Figure 4.4A). In agreement with increased lipid accumulation, mRNA
levels of lipogenic genes SREBP-1c, ACC1, and FAS were upregulated in cP
f/f
78
f/f
livers,
compared to WT and cP
f/f
livers (Figure 4.4C).

Figure 4.4. Enhanced fat accumulation, bile-duct proliferation, injury and apoptosis in cPten
f/f
Grp78
f/f

livers. (A) H&E staining of livers from the indicated genotypes at 3 months. Scale bar shows 50 µm. PV:

78

portal vein. Black arrowheads denote examples of bile ducts. (B) Oil Red O staining of livers from the
indicated genotypes at 3 months. Scale bar shows 100 µm. (C) Real-time quantitative PCR analysis of
lipogenic genes SREBP-1c, ACC1, and FAS in livers of the indicated genotypes at 3 months (n=3 to 7 per
genotype per gene). Expression levels of each gene were normalized to the levels of 18S RNA. (D) Liver
injury of mice aged 3 months and 6 months was measured by plasma ALT test (n=3 to 5). (E)
Quantification of TUNEL-positive cells on liver sections of the indicated genotypes at 3 months. Data are
presented as mean ± S.E. *p<0.05, **p<0.01, ***p<0.001.

It has been reported that the transcription factor XBP-1 is a regulator of hepatic
lipogenesis (A.-H. Lee, Scapa, Cohen, & Glimcher, 2008). In the present study, we
observed mild Xbp-1 mRNA splicing in c78
f/f
livers, which was in agreement with
previous data (Ji et al., 2011). However, Xbp-1 splicing was minimal in cP
f/f
78
f/f
livers
(Figure 4.5A). ATF4 has also been implicated in lipogenic gene expression (Chunxia
Wang et al., 2010), but we did not detect increased ATF4 protein level in cP
f/f
78
f/f
livers
(Figure 4.5B).

79

Figure 4.5. Analysis of unfolded protein response markers in mouse livers. (A) The mRNA levels of Xbp-1
in livers of the indicated genotypes at 3 months. Xbp-1(u) and Xbp-1(s) indicate the unspliced and spliced
form of Xbp-1, respectively. The mRNA isolated from mouse embryonic stem cells untreated (-), or treated
with 300 nM thapsigargin (Tg) for 16 hours were used as the negative and positive controls, respectively.
(B) Western blot analysis of ATF4 in livers of the indicated genotypes at 6 months. (C) Western blot
analysis of CHOP in livers of the indicated genotypes at 6 months. The last two lanes are cell lysates from
HCT116 cells untreated (-), or treated with 300 nM thapsigargin (Tg) for 16 hours, serving as the negative
and positive control, respectively.

We next measured liver injury by examining plasma ALT. cP
f/f
78
f/f
mice displayed
1.7- and 2.3-fold increase in ALT level compared to cP
f/f
mice at 3 and 6 months,
respectively, whereas the ALT level remained at the WT level in c78
f/f
mice (Figure
4.4D). Consistent with high level of injury, cP
f/f
78
f/f
livers exhibited a 4-fold increase in
apoptosis compared to other genotypes (Figure 4.4E). Nonetheless, the percentage of
apoptosis only reached 2% in cP
f/f
78
f/f
livers, thus overall apoptosis in all genotypes was

80

mild at 3 months. Furthermore, none of the genotypes analyzed showed an increase in
hepatic expression of the transcription factor CHOP (Ron & Walter, 2007), which is often
used as an indicator of ER stress-induced apoptosis (Figure 4.5C). This result was in
agreement with the recent observation that PTEN deletion inhibits thapsigargin-induced
CHOP induction in hepatocytes isolated from these mice (Zeng et al., 2011).

4.3.3 cPten
f/f
Grp78
f/f
livers showed increased proliferation, progenitor cell expansion,
and GRP78 expression in bile duct cells.
Liver injury generally elicits regeneration through proliferation (T Roskams 2006). To
ascertain liver proliferation, we examined Ki67 expression in mouse livers. We observed
substantial increase in Ki67-positive cells in cP
f/f
78
f/f
livers, compared to cP
f/f
and c78
f/f

mice at both 3 and 6 months, whereas Ki67-positive cells were absent in WT livers
(Figure 4.6A). Additionally, some Ki67-positive cells with LPC morphology were
detected around bile ducts in cP
f/f
78
f/f
livers (Figure 4.6A). Liver progenitor markers
EpCAM, CK19, and AFP were also upregulated in cP
f/f
78
f/f
livers compared to WT, cP
f/f

and c78
f/f
livers, which further suggested proliferation (Figure 4.6B).

81

Figure 4.6. cPten
f/f
Grp78
f/f
livers exhibited increased proliferation, progenitor cell expansion and GRP78
expression in bile duct cells. (A) Immunohistochemistry staining of cell proliferation marker Ki67 (brown
nuclei) on livers of the indicated genotypes at 3 and 6 months. (B) Real-time quantitative PCR analysis of
liver progenitor markers EpCAM, AFP, and CK19 in livers of the indicated genotypes at 3 months.
Expression levels of each gene were normalized to 18S RNA levels. Data are presented as mean ± S.E.
*p<0.05. (C) Immunohistochemistry staining of GRP78 on livers from the indicated genotypes aged 3 and
6 months. Far right panels represent higher magnification of the boxed regions in cP
f/f
78
f/f
livers. Black
arrowheads in panels (A) and (C) denote examples of bile ducts. Scale bars show 100 µm and are
applicable to all panels.

As demonstrated by Western blot, there was residual GRP78 in cP
f/f
78
f/f
livers

82

(Figures 4.2B and 4.2C). Therefore, to gain insight into the distribution pattern of GRP78
in cP
f/f
78
f/f
mice, we performed immunohistochemistry (IHC) staining of the liver
sections. Consistently, GRP78 expression progressively decreased between 3 and 6
months of age. Strikingly, the cells of the expanded bile ducts in cP
f/f
78
f/f
livers showed
robust GRP78 staining at both 3 and 6 months (Figure 4.6C). This suggests that some
hepatoblasts with incomplete Cre-mediated recombination differentiated into bile ducts,
where Alb-Cre was inactive. Moreover, some GRP78-positive cells around bile ducts
resembled LPCs morphologically (Figure 4.6C).

4.3.4 Perturbation of selective signaling pathways in cPten
f/f
Grp78
f/f
livers.
GRP78 deficiency has been demonstrated to suppress PI3K/AKT signaling (Fu et al.,
2008; Wey, Luo, Tseng, et al., 2012). As expected, p-AKT(S473) was highly activated in
cP
f/f
mice, consistent with the established role of PTEN as a negative regulator of
PI3K/AKT (Figure 4.7A). At 6 months, both p-AKT(S473) and total AKT were
dramatically reduced in cP
f/f
78
f/f
livers, and cP
f/f
78
f/+
livers were also partially affected
(Figure 4.7A). Because of the reduction in total AKT, the functional reduction in p-AKT
was not statistically captured through the ratio p-AKT/AKT (Figure 4.7A). In the case of
ERK, similar levels of p-ERK1 and total ERK1 were observed in all the genotypes,
whereas the levels of p-ERK2 and total ERK2 decreased in cP
f/f
78
f/f
livers. The level of p-
JNK was moderately elevated in cP
f/f
78
f/f
livers, whereas total JNK level was slightly
decreased in cP
f/f
78
f/+
and cP
f/f
78
f/f
livers (Figure 4.7B). In contrast, β-catenin level was
significantly reduced in cP
f/f
78
f/f
livers (Figure 4.7C). It has been reported that in vitro
suppression of β-catenin in hepatoma cells leads to PDGFRα upregulation (Zhang et al.,

83

2010), which is associated with liver tumorigenesis (Stock et al., 2007). In agreement
with this finding, we detected elevated PDGFRα expression in cP
f/f
78
f/f
livers (Figure
4.7C).

Figure 4.7. Perturbation of selective signaling pathways in cPten
f/f
Grp78
f/f
livers. (A) Representative
Western blots of p-AKT(S473), total AKT, p-ERK1/2(T202/Y204), and total ERK1/2 levels from livers of
the indicated genotypes at 6 months. (B) Representative Western blots of p-JNK (p54, T183/Y185) and
total JNK (p54) levels. (C) Representative Western blots of β-catenin and PDGFRα expression. β-actin was
used as the loading control and corresponding quantifications were shown on the right. Data are presented
as mean ± S.E. *p<0.05, ***p<0.001.

84

4.3.5 Accelerated HCC and CC development and repopulation of GRP78-positive
cells in cPten
f/f
Grp78
f/f
livers.
In following liver morphology of the mouse cohorts, at the time of sacrifice all
cP
f/f
78
f/f
mice developed visible tumor-like nodules by 6 months. For cP
f/f
78
f/+
mice, 50%
exhibited nodules by 9 months and 100% by 13 months, and for cP
f/f
mice, liver nodules
were not apparent until 12 months (Figure 4.8A). c78
f/f
livers displayed very few and
small nodules at 12-14 months (Figure 4.2E), and H&E staining showed fatty liver
accompanied by inflammation with no sign of malignancy (data not shown). While
cP
f/f
78
f/f
livers showed extensive bile duct proliferation at 6 months (Figure 4.6C), liver
H&E revealed no malignancy, however, both HCC and CC were evident starting from 8-
9 months (Figure 4.8B). Intense GRP78 staining was detected in HCC and CC areas in
cP
f/f
78
f/f
livers, and GRP78 level in adjacent normal areas was comparable to the WT
level (Figure 4.8B). We further observed that both cP
f/f
and cP
f/f
78
f/+
mice developed
HCC and CC starting from 12 months (Figure 4.8C). Taken together, these results suggest
that HCC and CC development was accelerated in cP
f/f
78
f/f
mice. Furthermore, HCC and
CC areas in the liver were associated with the repopulation with GRP78-positive cells,
which may confer selective advantage for the cancer cells.

85

Figure 4.8. Accelerated HCC and CC formation and GRP78 re-expression in cPten
f/f
Grp78
f/f
livers. (A)
Kaplan-Meier plot of WT, cP
f/f
, cP
f/f
78
f/+
, and cP
f/f
78
f/f
mice showing tumor nodule-free percentage over
time. n=3 to 11 for each genotype at each time point. (B) Upper: H&E staining of liver sections from WT
and cP
f/f
78
f/f
mice at 8-9 months. cP
f/f
78
f/f
mice showed histological features of HCC and CC. Lower:
immunohistochemistry staining of GRP78 on liver sections of WT mice and tumor sections from cP
f/f
78
f/f

mice aged 8-9 months. (C) H&E staining of liver tumor sections from cP
f/f
and cP
f/f
78
f/+
mice at 12 months,
which showed the presence of both HCC and CC. Scale bars show 100 µm for (B) and (C). (D) Schematic
model of tumor development in cP
f/f
78
f/f
mice. Hepatic GRP78 expression level at each stage corresponds

86

to the color gradient bar on the upper left corner. The major phenotypes at each stage are indicated below.
BD: bile duct; PV: portal vein.

4.4 Discussion

Mutation or deletion of PTEN is commonly observed in liver cancer and GRP78 is
required for tumorigenesis in a variety of cancers (B Luo & Lee, 2013). In studying the
role of GRP78 in liver cancer development using the loss of PTEN as a model system, we
made several unexpected discoveries, which expand our understanding on how GRP78
regulates tumorigenesis in a metabolic organ. In the case of liver, injury leads to
hepatocyte death that in turn activates proliferation of residual hepatocytes and/or liver
progenitor cells, which may eventually promote liver cancer (Galicia et al. 2010; T
Roskams 2006). We noted that unlike other tissue-specific knockout models where
GRP78 can be nearly completely eliminated (Fu et al., 2008; M Wang et al., 2010; Wey,
Luo, & Lee, 2012), the c78
f/f
and cP
f/f
78
f/f
livers maintained about 30% of WT level of
GRP78. This is consistent with a previous study using a different Alb-Cre transgenic
mouse strain (Ji et al., 2011). Interestingly, both residual white and brown adipose tissues
maintain 40% GRP78 expression in adipose Grp78 knockout mice (Zhu et al., 2013).
This suggests that GRP78 may be indispensable for survival in liver and adipose tissues.
While male c78
f/f
mice maintained in these studies for 14 months showed no malignancy,
GRP78 reduction combined with loss of PTEN led to the onset of HCC and CC at 8-9
months. Based on our findings, we propose the following model which is summarized in
Figure 4.8D. In a normal liver, GRP78 is constitutively expressed and maintains liver
homeostasis. However, in cP
f/f
78
f/f
livers, there is loss of PTEN and gradual depletion of
GRP78 following Alb-Cre-mediated recombination at 3 months. The loss of GRP78

87

protection at this stage exacerbates fat accumulation caused by PTEN deficiency. Fatty
liver leads to liver injury, which activates bile duct and liver progenitor cell proliferation.
At 6 months, JNK activation, coupled with β-catenin loss and PDGFRα upregulation
could also contribute to liver injury (Nejak-Bowen & Monga, 2011; Nikolaou, Sarris, &
Talianidis, 2013). At the same time, GRP78 cannot be ablated completely in hepatocytes.
Bile duct and progenitor cells that escape Cre exhibit growth advantage and repopulate
the liver with GRP78-positive cells. At 8-9 months, HCC and CC growth is evident in
cP
f/f
78
f/f
livers, correlating with strong GRP78 expression, and GRP78 level in adjacent
normal areas is comparable to the WT level. While the molecular mechanisms leading to
these events await future investigations, our results raise several interesting questions.
First, why does GRP78 reduction combined with PTEN deletion in the liver
accelerate liver tumorigenesis, whereas GRP78 knockout in other tissues usually inhibits
tumor formation? Liver cancer is unique in that cancer arises as a result of injury and
regeneration. In the context of PTEN loss, we observed that GRP78 reduction fueled liver
steatosis, apparently via a mechanism independent of XBP-1, which led to injury that
induced progenitor cell proliferation. If GRP78 expression is eliminated in the tumor
cells, tumor development may be arrested, as seen in the other cancer models. However,
in the case of cP
f/f
78
f/f
livers, GRP78-positive bile duct and progenitor cells that escaped
Alb-Cre repopulated the liver, thus the developed liver tumors were not handicapped by
the lack of GRP78. Consistent with this explanation are the findings that β-catenin-
positive cells repopulate β-catenin-null livers due to a progressive loss of Alb-Cre
expression (Thompson et al., 2011), and GRP78-positive cells rapidly repopulate the
intestinal epithelium upon genetic knockout in AhCre1-Grp78
f/f
mice (Heijmans et al.,

88

2013).
With regard to the origin of the HCC and CC in cP
f/f
78
f/f
livers, HCC and CC could be
derived from LPCs (T Roskams 2006). Our immunohistochemistry data indicated strong
GRP78 expression in HCC and CC tissues, and that some cells around proliferating bile
ducts exhibited LPC morphology and also expressed GRP78. These observations suggest
the possibility that LPC is the origin of malignancies. Interestingly, transdifferentiation of
hepatocytes to bile duct epithelial cells has been demonstrated (Michalopoulos, Barua, &
Bowen, 2005). Conversely, some biliary epithelial cells appear capable of differentiating
to hepatocytes (Desmet, Roskams, & Van Eyken, 1995). Therefore, future studies will be
required to address whether the GRP78-positive bile duct cells give rise to GRP78-
positive liver cancers.
GRP78 overexpression has been reported in a wide range of tumors, including HCC
(Luk et al., 2006; Su et al., 2010). As the major chaperone with potent anti-apoptotic
properties and a signaling regulator, GRP78 protects tumor cells from ER stress and host
cell defense, thereby promoting tumor growth. This is consistent with our observation
that GRP78 was upregulated in cP
f/f
liver tumors (Figure 4.9). GRP78 has been showned
to protect liver cancer cells from ER stress-induced apoptosis and promote their invasion
in a metastasis model (Su et al., 2010; Cun Wang et al., 2013). Consequently, robust
GRP78 expression may indeed be required for liver cancer progression. Since several
therapeutics against GRP78 are in development (B Luo & Lee, 2013), it will be
interesting to treat liver cancer with these agents to see if they can block the re-expression
of GRP78 and suppress liver cancer progression, while maintaining essential liver
functions. In treatment of other cancers with anti-GRP78 agents, since the adult liver can

89

function normally with partial GRP78 level whereas cancer requires high level of
GRP78, the damage to normal liver may be limited. As reported recently, antibodies
against cell surface GRP78 were well tolerated in pharmacokinetic/toxicology studies in
mice, monkeys, and patients (Hensel, Eckstein, Rosenwald, & Brändlein, 2013; R. Liu et
al., 2013).

Figure 4.9. GRP78 was upregulated in cPten
f/f
liver tumors. Immunofluorescent staining of GRP78 (green)
of liver sections from WT mice and liver tumor sections from cP
f/f
mice. Lower panels show higher
magnification of the boxed regions in upper panels. Scale bars show 100 µm.

JNK signaling pathway has been implicated to the growth of carcinogen-induced
HCC and about 50-60% of human HCC shows strong activation of JNK1 (Nakagawa &
Maeda, 2012). The function of sustained JNK activation in hepatocyte death, as well as
subsequent inflammation and carcinogenesis is recapitulated in various genetic mouse
models developing HCC (Nikolaou et al., 2013). Our results revealed that p-JNK was
moderately elevated in cP
f/f
78
f/f
livers at 6 months, accompanied by increased

90

inflammation prior to HCC and CC formation, suggesting that JNK might partially
contribute to the accelerated liver tumorigenesis. While this requires validation, the extent
of apoptosis remained low (below 1%) in cP
f/f
78
f/f
livers at 6 months (Figure 4.10A), thus
moderate activation of JNK in these livers did not majorly affect apoptosis linked to
sustained activation of JNK.

Figure 4.10. Apoptosis and p-AKT(T308) expression analysis in mouse livers. (A) Quantification of
TUNEL-positive cells on liver sections at 6 months. (B) Representative Western blots of p-AKT(T308) and
total AKT levels from livers of the indicated genotypes at 6 months. All data are presented as mean ± S.E.
*p<0.05.

β-catenin signaling, the central effector of canonical Wnt signaling pathway and a
recognized oncogene, is also implicated in HCC. However, overexpressing β-catenin in
transgenic mouse models has not exhibited spontaneous HCC (Nejak-Bowen & Monga,
2011). Paradoxically, hepatic β-catenin loss impairs the ability of the liver to counteract

91

DEN-induced oxidative stress and enhances HCC through PDGFRα/PI3K/AKT(Thr308
phosphorylation) signaling (Zhang et al., 2010). It has been demonstrated that NF-κB
activation in the absence of β-catenin contributes to PDGFRα activation. Furthermore,
hepatic β-catenin deletion increases fatty liver and steatohepatitis under diet-induced
metabolic stress (Behari et al., 2010). These results suggest that β-catenin loss can
sensitize livers to injury and eventually tumorigenesis, which mimics the predominant
scenario of human HCC where tumors often occur in steatohepatitis or cirrhosis
background (Nejak-Bowen & Monga, 2011). cP
f/f
78
f/f
livers exhibited increased injury
compared to cP
f/f
livers, and we observed β-catenin downregulation along with PDGFRα
upregulation and significantly increased p-AKT(Thr308) (Figure 4.10B) in the liver at 6
months. Moreover, some NF-κB genes are upregulated in c78
f/f
livers (Ji et al., 2011), and
oxidative stress is present in Pten-null livers (Galicia et al., 2010), raising the possibility
that NF-κB might be activated in cP
f/f
78
f/f
livers. Overexpression of PDGF has also been
reported in cP
f/f
livers (Galicia et al., 2010). In combination, these factors might promote
PDGFRα activation. Therefore, it is tempting to speculate that increased PDGFRα may
be one of the mechanisms in our model to accelerate liver tumors, and hepatic β-catenin
loss might at the same time sensitize the liver to the injury induced by Pten and Grp78
double knockout, further promoting tumorigenesis. Liver fat accumulation, injury, and
tumorigenesis can be also enhanced by loss of autophagy, which can be monitored by
increase in P62 (Ding, 2010). Interestingly, we observed a trend of increased P62 level in
cP
f/f
78
f/f
livers, suggesting perturbation of autophagy (Figure 4.11). Future studies are
required to address whether these altered pathways are causative factors for the HCC and
CC formation in cP
f/f
78
f/f
livers. In summary, our studies reveal new mechanisms affected

92

by GRP78 reduction in Pten-null induced tumorigenesis. The role of GRP78 in different
forms of liver cancer and other metabolic cancers warrants further investigation.

Figure 4.11. P62 expression analysis in mouse livers. Representative Western blots of P62 in livers of the
indicated genotypes at 6 months, with β-actin as the loading control. The experiments were repeated three
times and the quantification was shown on the right. n=3 for each genotype. Data are presented as mean ±
S.E.

93

Chapter 5
Conclusions and Perspectives

The glucose-regulated proteins (GRPs) are stress-inducible molecular chaperones,
which belong to the heat shock protein (HSP) family. The GRPs serve multiple functions
in maintaining cellular homeostasis. The two major GRPs are GRP94 and GRP78, mainly
residing in the endoplasmic reticulum (ER) or cell surface, participate in protein folding,
translocation, ER-associated protein degradation, stress sensing and regulation, as well as
ER Ca
2+
binding. Recently, beyond their ER chaperone function, GRP94 and GRP78
have been linked to cancer growth and drug resistance, presenting novel markers and
potential targets for cancer therapy (A. S. Lee, 2014). However, the roles of GRP94 and
GRP78 in the adult liver homeostasis and tumorigenesis remain elusive. In this
dissertation, we therefore elucidate the specific function of GRP94 in (1) the regulation of
liver progenitor cell (LPC) proliferation and the progression of Pten-null induced liver
cancer, and (2) the development of spontaneous liver tumors. We also investigate (3) the
role of GRP78 in liver homeostasis and Pten-null mediated liver tumorigenesis. These
studies reveal diverse functions of ER chaperones, as well as complex regulatory
mechanisms for LPCs and liver cancer progression.
In the first part of this dissertation (Chapter 2), we investigated the role of GRP94 in
liver homeostasis. The model system we employed is Alb-Cre to specifically delete the
target gene in adult livers, and we created two liver-specific knockout mouse models with
the deletion of Grp94 alone (cGrp94
f/f
), or in combination with the tumor suppressor Pten
(cP
f/f
94
f/f
). Our results demonstrated that GRP94 deficiency led to hyperproliferation of

94

LPCs with minor liver injury, associating with disrupted cell adhesion, namely,
connexins, integrin β1, and E-cadherin. Besides similar cell adhesion loss, deletion of
both GRP94 and PTEN accelerated HCC and CC development, as well as selectively
activated ERK. The presence of bi-lineage liver tumors suggested a common progenitor
origin, and indeed progressive expansion of LPCs was detected in cP
f/f
94
f/f
mice.
Collectively, in Chapter 2 we have uncovered a novel role of GRP94 in regulating liver
physiology and tuomrigenesis in vivo for the first time.
It has been shown that liver cancer with LPC characteristics has more aggressive
phenotypes (T Roskams 2006), and LPCs can obtain tumor-initiating ability in vivo
(Chiba et al., 2007, 2010). Thus, with the hyperproliferative LPCs in cGrp94
f/f
mice, it is
interesting to explore whether GRP94 ablation alone is sufficient to induce liver tumor
formation. In Chapter 3, we investigated the long-term effect of GRP94 loss on liver
tumorigenesis. We discovered that hepatic deletion of Grp94 resulted in spontaneous
liver tumors in aged mice, containing both HCC and ductular reactions (DRs),
accompanied by increased liver injury and fibrosis. Surprisingly, the cGrp94
f/f
livers were
progressively repopulated by GRP94-positive hepatocytes. At the premalignant stage,
LPC expansion, hyperproliferation, upregulation of TGF-β1, and activation of SMAD2/3,
ERK, and JNK were observed. In agreement with marked proliferation in cGrp94
f/f
livers,
Cyclin D1 was concurrently upregualted. Overexpression of E-cadherin was detected,
while EMT was not evident. Furthermore, we demonstrated that HCC cells were GRP94-
positive but the expanded LPCs and DRs were GRP94-negative, implying these two
pathologies in the cGrp94
f/f
tumors have different cell origins. These findings suggest that
aging might accumulate some mutations and/or deletions to facilitate liver tumor

95

development in the setting of long-term GRP94 loss, and to the best of our knowledge
this is the first study to show deletion of an ER chaperone leads to spontaneous
malignancy.
In spite of being a major ER chaperone, the functional significance of GRP94 is
poorly characterized, and only its role in immune responses has been studied extensively.
Our group recently reported the unique function of GRP94 as an intrinsic regulator of
hematopoietic stem cell (HSC) homeostasis, including their proliferation, differentiation,
and interaction with the bone marrow niche (Biquan Luo et al. 2011; Biquan Luo et al.
2013). Upon GRP94 depletion in the hematopoietic system (Mx-1-Cre; Grp94
f/f
),
complete loss of cell surface integrin α4 expression on the HSCs contributes in part to the
impaired HSC-niche interaction, which leads to HSC proliferation. The increased HSC
proliferation can result from elevated AKT activation, associating with downregulation of
the cell cycle regulator Ms4a3 and cell surface conexin32. Likely, studies in Chapter 2
and Chapter 3 revealed that GRP94 can regulate another stem cell pool, specifically,
LPCs. The expansion of LPCs was also possible partly attributed to GRP94 loss-
mediated cell adhesion defect, but through different proteins: connexins, integrin β1, and
E-cadherin. This is in agreement with the essential role of GRP94 in controlling cell-
cell/cell-tissue interactions and cell/tissue morphogenesis. However, unlike integrin α4,
none of these cell adhesion molecules are client proteins of GRP94, since they were still
expressed but disorganized in cGrp94
f/f
livers. Yet it is possible that GRP94 is required
for the expression of integral membrane proteins that interact and affect functionality of
these cell adhesion molecules. Moreover, while AKT activation results in Mx-1-Cre;
Grp94
f/f
HSC expansion, ERK was selectively activated in proliferative LPCs in cGrp94
f/f

96

livers, suggesting that signaling modulation by GRP94 is context-dependent. It will be
interesting to explore whether GRP94 can regulate stem cell physiology generally.
Liver transplantation, the ultimate cell therapy, is currently the only proven treatment
for various liver diseases, such as cirrhosis, liver cancer, and inherited metabolic liver
disorders. However, due to a shortage of transplantable livers, approximately 40% of
patients do not receive a liver transplant, and many of them either die or become too sick
for transplantation (Yu et al., 2012). Therefore, new cell therapies are needed and being
actively developed. Transplant of LPCs presents a potential alternative to liver
transplantation, as LPCs can proliferate almost unlimitedly and migrate through injured
livers more efficiently than differentiated hepatocytes (Shupe & Petersen, 2011). LPCs
may be derived from the patient, expanded and corrected in vitro, and transplanted back
to the diseased liver. Nevertheless, LPCs are rare (0.3-0.7% of adult liver mass), which
makes LPC isolation and expansion for treatment difficult (Yu et al., 2012). Since GRP94
depletion in LPCs promoted their proliferation and migration, it is promising to develop
agents that target GRP94 expression or activity to increase LPC proliferation and
migration for liver cell therapy. Another aspect is to understand the microenvironment
cues that govern liver progenitor cell behaviors. Given the disrupted cell adhesion in the
liver upon GRP94 deletion, including the major extracellular matrix (ECM) receptor
integrin β1, ECM composition might be altered. Future studies examining ECM in
cGrp94
f/f
livers could provide insights to establish a favorable microenvironment for the
expansion of transplanted LPCs. Recently, GRP94-specific inhibitors are developed and
reported to inhibit cancer growth (Duerfeldt et al., 2012; Hua et al., 2013; Patel et al.,
2013); it will be exciting to test these agents on LPC regulation.

97

The epithelial-mesenchymal transition (EMT) is a process by which epithelial
cells lose their cell polarity as well as cell-cell contacts, and gain migratory and invasive
properties to become fibroblast-like cells. EMT is a crucial step for carcinoma cells to
metastasize (Ikushima & Miyazono, 2010). We observed disruption of cell adhesion,
which is a hallmark of EMT, in both cGrp94
f/f
and cP
f/f
94
f/f
livers at 2 months. However,
besides E-cadherin downregulation in periportal regions (Figures 2.4D and 2.9C), we did
not examine the expression levels of other EMT markers (N-cadherin, Twist1, Snail, or
Slug), which deserve future investigation to further understand the effect of GRP94
deletion on EMT. Intriguingly, we detected selective ERK activation in hepatocytes and
some LPCs in only cP
f/f
94
f/f
, but not in cGrp94
f/f
livers. Our follow-up studies of Grp94
knockdown near 100% in Pten-null LPCs also showed ERK activation (Figure 5.1A),
indicating that GRP94 can intrinsically regulate LPCs. More importantly, LPCs with both
PTEN and GRP94 deficiency became fibroblast-like (mesenchymal cells) (Figure 5.1B).
In addition, Grp94 knockdown in human HCC HepG2 cells, which express low PTEN,
resulted in a dramatic morphological change from organized/aggregated epithelial cells to
fibroblast-like cells (Figure 5.1C). These results suggested that GRP94 deletion or
reduction in the PTEN loss background triggers EMT, possibly through ERK activation.
Indeed, a recent study demonstrated that PTEN loss and ERK pathway activation
cooperate to promote EMT and metastasis initiated from prostate cancer stem/progenitor
cells (Mulholland et al., 2012).

98

Figure 5.1. Knockdown of GRP94 resulted in cell morphology change. (A) Representative Western blots of
lentivirus-infected Pten-/- liver progenitor cell lysates for detection of the indicated protein levels. (B)
Representative cell pictures of lentivirus-infected Pten-/- liver progenitor cells. (C) Left: Western blot
analysis of GRP94 in HepG2 cells transfected with siCtrl or siGrp94. Right: Representative HepG2 cell
pictures after siCtrl or siGrp94 transfection. Scale bars: 100 µm.

Thus, it will be interesting to determine whether LPCs with PTEN and GRP94 ablation

99

are more migratory, proliferative, and/or more tumorigenic/metastatic upon orthotopic
transplantation. Moreover, given that ERK activation only occurred in the livers with
both PTEN and GRP94 disruption, another question is how PTEN deletion coordinates
with GRP94 loss to activate ERK. It has been showed that PTEN can negatively regulate
ERK signaling through Shc adaptor protein, and AKT activation, the direct downstream
of PTEN deletion, can phosphorylate Raf through PKC, leading to ERK activation
(Chetram & Hinton, 2012; Hong, Jeong, Chan, & Park, 2013). It is likely that GRP94
deficiency sensitizes and/or promotes ERK phosphorylation induced by AKT. In addition,
the effect of AKT on ERK activation could be ligand and/or concentration dependent
(Chetram & Hinton, 2012). Since IGFs are AKT activators as well as known GRP94
clients and primarily produced by hepatocytes (Eletto et al., 2010), the depletion of IGFs
in cP
f/f
94
f/f
livers might be a possible mechanism, which awaits investigation.
TGF-β1 can trigger both SMAD-dependent and SMAD-independent pathways,
including ERK, JNK, and AKT signaling (Ikushima & Miyazono, 2010). The concurrent
upregulation of TGF-β1 and activation of SMAD2/3, ERK, and JNK in cGrp94
f/f
livers at
15 months suggests TGF-β1 could be the common inducer. Hepatocytes and activated
hepatic stellate cells (HSCs) can secrete TGF-β1 (J.-T. Li, Liao, Ping, Xu, & Wang,
2008). Nonetheless, HSCs were not activated until 21 months, rather than 15 months
(Figure 5.2), suggesting hepatocytes might be the source of TGF-β1 at 15 months, which
seemed to be the initiation stage of HSC activation.

100

Figure 5.2. HSCs were not activated in cGrp94
f/f
livers at 15 months. α-SMA staining of liver sections to
examine HSC activation. Black arrows indicate examples of activated HSCs in the positive control (Pos
Ctrl). Scale bar: 100 µm.

Furthermore, the secretion of TGF-β1 by hepatocytes could be regulated by different
mechanisms. For instance, injured hepatocytes secrete more TGF-β1 (Giannelli et al.,
2011). However, this is less likely, since only modest increase in liver injury and
apoptosis was observed in cGrp94
f/f
livers at 15 months. Alternatively, ECM remodeling
owing to GRP94 loss-mediated cell adhesion disruption might affect hepatocyte
behaviors, such as secretion. In addition, it has been shown that hepatocyte growth factor
(HGF) secreted by HSCs downregulates TGF-β1 in hepatocytes (Inagaki & Okazaki,
2007; Narmada, Chia, Tucker-Kellogg, & Yu, 2013), and insulin-like growth factor-1
(IGF-1) can stimulate HGF production by HSCs (Skrtic et al., 2001). Thus, we speculate
that IGF-1 depletion, caused by GRP94 deficiency in hepatocytes, could decrease HGF
levels, leading to upregulation of TGF-β1 and activation of various signaling pathways in
cGrp94
f/f
livers.
The finding that GRP94 is required for the functional expression of the Toll-like
receptor family and integrins provides intriguing suggestions that GRP94 functions in

101

tissue biology and is critical for multicellularity (Maynard et al. 2010; Eletto, Dersh, and
Argon 2010). It has been shown that muscle-specific deletion of GRP94 leads to 20%
smaller skeletal muscle due to the inhibited IGF secretion (Barton et al., 2012). Similarly,
we observed 25% smaller livers in cGrp94
f/f
mice, as well as 50% reduction in the uterus
size when GRP94 was deleted in the uterus (unpublished data). One explanation is
increased apoptosis in cGrp94
f/f
livers, which might also be the case for the uterus with
GRP94 ablation, demonstrated by more cleaved-caspase 3 staining (unpublished data).
Although apoptosis was not measured in the muscle carrying GRP94 deletion, these
results are consistent with its anti-apoptosis function and suggest a possible role of
GRP94 in organ size control. Organ size is dependent on the balance between cell growth
and cell death, and both of which can be regulated by cell adhesion (Tumaneng, Russell,
& Guan, 2012; T. Yue, Tian, & Jiang, 2012). For instance, anchorage-dependent cells
detaching from the surrounding ECM induces anoikis, a form of apoptosis
(Nagaprashantha, Vatsyayan, Lelsani, Awasthi, & Singhal, 2011). Interestingly, as
reported in Chapter 2, we observed disrupted cell adhesion and increased apoptosis
simultaneously in cGrp94
f/f
livers, supporting a hypothesis that cell adhesion defect
caused by GRP94 loss might lead to apoptosis, further resulting in smaller liver size.
While this hypothesis warrants further investigation, in combined with the essential roles
of GRP94 in muscle and gut homeostasis in mice and/or Drosophila (Barton et al., 2012;
B. Liu et al., 2013; Maynard et al., 2010), our studies in Chapter 2 and Chapter 3 indicate
that GRP94 is a critical regulator for tissue homeostasis.
The functions of GRP78 have been studied in a variety of tumors in vitro as well as in
vivo in diverse aspects of cancer progression, including proliferation, apoptosis,

102

inflammation, invasion, metastasis, angiogenesis, and drug resistance (A. S. Lee, 2014).
As a major ER chaperone to maintain high level of secretory functions in the liver, it has
been reported that liver-specific deletion of Grp78 perturbs the UPR and exacerbates a
spectrum of liver diseases in mice (Ji et al., 2011). Nevertheless, only benign spontaneous
liver tumors are observed in ~30% of female mice carrying hepatic Grp78 knockout
(Lau, Han, Hu, & Ji, 2013). Given the increasing incidence of deadly liver cancer
worldwide and ~50% of them carry PTEN mutations or deletions, we determined the role
of GRP78 in liver homeostasis and Pten-null mediated liver tumorigenesis in Chapter 4.
We established a biallelic liver-specific Grp78 and Pten knockout mouse model by Alb-
Cre (cP
f/f
78
f/f
). Consistent with the previous report (Ji et al., 2011), GRP78 deletion was
progressive but incomplete. In the context of PTEN ablation, concomitant GRP78
reduction in the liver resulted in increased lipogenic gene activation, steatosis, liver
injury, apoptosis, and LPC proliferation. Surprisingly, GRP78 was not deleted in both
bile duct cells and LPCs, and these cells, which escaped Cre, exhibited growth advantage
and repopulated the liver. Meanwhile, JNK activation, β-catenin downregulation, along
with PDGFRα upregulation were unique to cP
f/f
78
f/f
livers, followed by accelerated HCC
and CC development at 8-9 months, coinciding with strong GRP78 expression. GRP78
level in adjacent normal areas was comparable to the WT level. Contrarily, no
malignancy was detected in livers with Grp78 disruption alone (cGrp78
f/f
)

even at 12-14
months.
Despite the similarity of GRP94 and GRP78 as ER chaperones, the regulation of
GRP94 and GRP78 on liver homeostasis appears to be chaperone-specific, as GRP78
deficiency alone did not activate LPC proliferation and DRs. Likely, deletion of GRP78

103

in the Pten-null setting did not trigger ERK phosphorylation, but rather led to JNK
activation, β-catenin downregulation, as well as PDGFRα upregulation. The distinct
effects of GRP94 and GRP78 reflect their different characteristics. First, they bind to
unique client proteins to fulfill their chaperoning role and also exert different biological
functions. Additionally, the localization is another determinant for their regulation. It has
been shown that GRP78 can be located not only in ER, but in cytosol, cell surface,
mitochondria, and nucleus (A. S. Lee, 2014). Cell surface GRP78 itself and/or by
interacting with other surface proteins could serve as a receptor to modulate cell
signaling. A similar case can apply to GRP94, since GRP94 is detected at the cell surface
functioning in antigen presentation. More recently, GRP94 has been reported to
chaperone the oncogene HER2 at the cell membrane in HER2-overexpressing breast
cancer cells (Patel et al., 2013). Interestingly, concurrent disruption of both GRP78 and
PTEN in different tissues leads to distinct outcomes. In both prostate cancer and leukemia
mouse models induced by Pten deletion, tissue-specific homozygous or heterozygous
knockout of Grp78 inhibits cancer progression by AKT suppression (Fu et al., 2008; Wey,
Luo, Tseng, et al., 2012). Nevertheless, while liver cancer was rather accelerated in
cP
f/f
78
f/f
livers, AKT pathway was not significantly altered. Consequently, this
dissertation provides a great opportunity to compare the functions of different ER
chaperones in the same tissue, as well as of the same chaperone in different tissues, which
well present context-dependent effects.
As we explored the underlying mechanisms of the accelerated tumor formation, we
observed unexpectedly dramatic reduction of β-catenin in cP
f/f
78
f/f
livers at 6 months. It
has been shown that GRP78 is required for proper folding of Wnt3a, one of mammalian

104

Wnt proteins, and incompletely processed Wnt is targeted for proteasomal degradation
(Verras, Papandreou, Lim, & Denko, 2008). Therefore, we hypothesize that GRP78
deficiency (~70% reduction at 6 months) leads to Wnt3a degradation and loss of Wnt/β-
catenin signaling, resulting in β-catenin degradation by the disruption complex.
Moreover, Cripto/surface GRP78 can serve as the co-receptor of Wnt (Gray & Vale,
2012), raising a possibility that GRP78 reduction inhibits Wnt/β-catenin signaling and
leads to increased β-catenin degradation in cP
f/f
78
f/f
livers. JNK activation was also
observed in cP
f/f
78
f/f
livers, and can be induced in response to diverse stimuli, such as
cytokines (TNF, IL-1, TGF-β, and PDGF), pathogens, reactive oxygen species, ER stress,
and metabolic changes, including obesity and hyperlipidemia (Seki, Brenner, & Karin,
2012). While ER stress was not evident in cP
f/f
78
f/f
livers (minimal Xbp-1 spicing and no
increased ATF4), increased PDGF and oxidative stress have been detected in PTEN-null
livers (Galicia et al., 2010), and hyperlipidemia (elevated lipid levels in the blood) was
observed in cP
f/f
78
f/f
mice (data not shown). In combination, these factors could activate
JNK in cP
f/f
78
f/f
livers. Additionally, upregulation of TGF-β might be another explanation
for JNK induction, since Cripto/surface GRP78 reduces the level of TGF-β1 (Gray &
Vale, 2012), which requires further examination. A rescue experiment by treating
cP
f/f
78
f/f
mice with the JNK inhibitor would be essential to determine whether JNK
activation causes accelerated liver tumorignesis.
Liver cancer is the fifth most common cancer worldwide with poor prognosis and
high mortality rate. The lack of treatment against liver cancer results in an urgent need to
understand the liver tumorigenic mechanisms. GRP94 and GRP78 overexpressions have
been reported in human liver cancer, and we also observed upregulation of GRP94 and

105

GRP78 in mouse liver cancer induced by PTEN disruption, suggesting that liver cancer
may need these two chaperones for growth, progression, and resistance. Interestingly, we
found progressive re-population of GRP94 or GRP78-positive cells in cGrp94
f/f
, cP
f/f
94
f/f
,
as well as cP
f/f
78
f/f
livers. The liver tumors in cGrp94
f/f
mice exhibited substantial
expression of GRP94. However, while a robust GRP78 expression was readily observed
in cP
f/f
78
f/f
liver tumors, the re-population of GRP94-positive cells in cP
f/f
94
f/f
liver tumors
was gradual: heterogeneous (from low to WT levels) GRP94 levels at 8-9 months and
stronger expression in HCC by 12 months. The differential levels and timings of re-
population in cP
f/f
78
f/f
and cP
f/f
94
f/f
liver tumors suggest that GRP78 might be required for
liver cancer cell growth, whereas GRP94 is not required, but could facilitate the
transformation process. Apparently, long-term loss of GRP94 or GRP78 throughout the
normal development impairs liver homeostasis, specifically smaller livers, LPC
activation, injury, and cancer development in cGrp94
f/f
livers, and steatosis, injury, and
nodule/tumor formation in cGrp78
f/f
livers. Nonetheless, the liver cancer
microenvironment is different. It might still be beneficial for patients to treat liver cancer,
which usually has robust GRP94 and GRP78 expression, with the therapeutics against
GRP94 and GRP78.
Taken together, our studies in this dissertation revealed the complex roles of two
major ER chaperones, GRP94 and GRP78, in regulating liver homeostasis and
tumorigenesis. More importantly, these studies expand our understanding on biological
functions of ER chaperones as well as shed lights on potentials of GRP94 and GRP78 as
therapeutic targets for treating liver cancer and/or liver cell therapy.

106

BIBLIOGRAPHY
Aoudjit, F., & Vuori, K. (2012). Integrin signaling in cancer cell survival and
chemoresistance. Chemotherapy Research and Practice, 2012, 283181.
doi:10.1155/2012/283181
Barton, E. R., Park, S., James, J. K., Makarewich, C. a, Philippou, A., Eletto, D., …
Argon, Y. (2012). Deletion of muscle GRP94 impairs both muscle and body growth
by inhibiting local IGF production. FASEB Journal, 26(9), 3691–702.
doi:10.1096/fj.11-203026
Behari, J., Yeh, T.-H., Krauland, L., Otruba, W., Cieply, B., Hauth, B., … Monga, S. P.
S. (2010). Liver-specific beta-catenin knockout mice exhibit defective bile acid and
cholesterol homeostasis and increased susceptibility to diet-induced steatohepatitis.
The American Journal of Pathology, 176(2), 744–53.
doi:10.2353/ajpath.2010.090667
Benhamouche, S., Curto, M., Saotome, I., Gladden, A. B., Liu, C.-H., Giovannini, M., &
McClatchey, A. I. (2010). Nf2/Merlin controls progenitor homeostasis and
tumorigenesis in the liver. Genes & Development, 1718–1730.
doi:10.1101/gad.1938710
Bissell, D. M. (2001). Chronic liver injury, TGF-beta, and cancer. Experimental &
Molecular Medicine, 33(4), 179–90. doi:10.1038/emm.2001.31
Bruix, J., Boix, L., Sala, M., & Llovet, J. M. (2004). Focus on hepatocellular carcinoma.
Cancer Cell, 5(3), 215–9. Retrieved from
http://www.ncbi.nlm.nih.gov/pubmed/15050913
Burikhanov, R., Zhao, Y., Goswami, A., Qiu, S., Schwarze, S. R., & Rangnekar, V. M.
(2009). The tumor suppressor Par-4 activates an extrinsic pathway for apoptosis.
Cell, 138(2), 377–88. doi:10.1016/j.cell.2009.05.022
Cadamuro, M., Morton, S. D., Strazzabosco, M., & Fabris, L. (2013). Unveiling the role
of tumor reactive stroma in cholangiocarcinoma : an opportunity for new therapeutic
strategies. Translational Gastrointestinal Cancer, 45(3), 130–144.
doi:10.3978/j.issn.2224-4778.2013.04.02
Calvisi, D. F., Ladu, S., Conner, E. a, Factor, V. M., & Thorgeirsson, S. S. (2004).
Disregulation of E-cadherin in transgenic mouse models of liver cancer. Laboratory
Investigation, 84(9), 1137–47. doi:10.1038/labinvest.3700147
Chen, W.-T., Tseng, C.-C., Pfaffenbach, K., Kanel, G., Luo, B., Stiles, B. L., & Lee, A.
S. (2014). Liver-specific knockout of GRP94 in mice disrupts cell adhesion,

107

activates liver progenitor cells, and accelerates liver tumorigenesis. Hepatology,
59(3), 947–57. doi:10.1002/hep.26711
Chen, W.-T., Zhu, G., Pfaffenbach, K., Kanel, G., Stiles, B., & Lee, a S. (2014). GRP78
as a regulator of liver steatosis and cancer progression mediated by loss of the tumor
suppressor PTEN. Oncogene, (August), 1–9. doi:10.1038/onc.2013.437
Chetram, M. A., & Hinton, C. V. (2012). PTEN regulation of ERK1/2 signaling in
cancer. J Recept Signal Transduct Res, 32(4), 190–195.
doi:10.3109/10799893.2012.695798.
Chiba, T., Seki, A., Aoki, R., Ichikawa, H., Negishi, M., Miyagi, S., … Iwama, A.
(2010). Bmi1 promotes hepatic stem cell expansion and tumorigenicity in both
Ink4a/Arf-dependent and -independent manners in mice. Hepatology, 52(3), 1111–
23. doi:10.1002/hep.23793
Chiba, T., Zheng, Y.-W., Kita, K., Yokosuka, O., Saisho, H., Onodera, M., … Taniguchi,
H. (2007). Enhanced self-renewal capability in hepatic stem/progenitor cells drives
cancer initiation. Gastroenterology, 133(3), 937–50.
doi:10.1053/j.gastro.2007.06.016
Davidson, D. J., Haskell, C., Majest, S., Kherzai, A., Egan, D. a, Walter, K. a, … Henkin,
J. (2005). Kringle 5 of human plasminogen induces apoptosis of endothelial and
tumor cells through surface-expressed glucose-regulated protein 78. Cancer
Research, 65(11), 4663–72. doi:10.1158/0008-5472.CAN-04-3426
Dbouk, H. a, Mroue, R. M., El-Sabban, M. E., & Talhouk, R. S. (2009). Connexins: a
myriad of functions extending beyond assembly of gap junction channels. Cell
Communication and Signaling : CCS, 7, 4. doi:10.1186/1478-811X-7-4
Desmet, V., Roskams, T., & Van Eyken, P. (1995). Ductular Reaction in the Livers.
Pathology - Research and Practice, 191(6), 513–524. doi:10.1016/S0344-
0338(11)80870-8
Di Tommaso, L., Franchi, G., Park, Y. N., Fiamengo, B., Destro, A., Morenghi, E., …
Roncalli, M. (2007). Diagnostic value of HSP70, glypican 3, and glutamine
synthetase in hepatocellular nodules in cirrhosis. Hepatology, 45(3), 725–34.
doi:10.1002/hep.21531
Ding, W. (2010). Role of autophagy in liver physiology and pathophysiology. World
Journal of Biological Chemistry, 1(70), 3–12.
Dong, D., Ni, M., Li, J., Xiong, S., Ye, W., Virrey, J. J., … Lee, A. S. (2008). Critical
role of the stress chaperone GRP78/BiP in tumor proliferation, survival, and tumor
angiogenesis in transgene-induced mammary tumor development. Cancer Research,
68(2), 498–505. doi:10.1158/0008-5472.CAN-07-2950

108

Duerfeldt, A. S., Peterson, L. B., Maynard, J. C., Ng, C. L., Eletto, D., Ostrovsky, O., …
Blagg, B. S. J. (2012). Development of a Grp94 inhibitor. Journal of the American
Chemical Society, 134(23), 9796–804. doi:10.1021/ja303477g
Eletto, D., Dersh, D., & Argon, Y. (2010). GRP94 in ER quality control and stress
responses. Seminars in Cell & Developmental Biology, 21(5), 479–85.
doi:10.1016/j.semcdb.2010.03.004
Fan, B., Malato, Y., Calvisi, D. F., Naqvi, S., Razumilava, N., Ribback, S., …
Willenbring, H. (2012). Cholangiocarcinomas can originate from hepatocytes in
mice. The Journal of Clinical Investigation, 122(8), 2911–2915.
doi:10.1172/JCI63212.duct
Fu, Y., & Lee, A. S. (2006). Glucose-Regulated Proteins in Cancer Progression, Drug
Resistance and Immunotherapy. Cancer Biology & Therapy, (July), 741–744.
Fu, Y., Wey, S., Wang, M., Ye, R., Liao, C.-P., Roy-Burman, P., & Lee, A. S. (2008).
Pten null prostate tumorigenesis and AKT activation are blocked by targeted
knockout of ER chaperone GRP78/BiP in prostate epithelium. Proceedings of the
National Academy of Sciences of the United States of America, 105(49), 19444–9.
doi:10.1073/pnas.0807691105
Fujimoto, K., Nagafuchi, a, Tsukita, S., Kuraoka, a, Ohokuma, a, & Shibata, Y. (1997).
Dynamics of connexins, E-cadherin and alpha-catenin on cell membranes during
gap junction formation. Journal of Cell Science, 110 ( Pt 3, 311–22. Retrieved from
http://www.ncbi.nlm.nih.gov/pubmed/9057084
Galicia, V. a, He, L., Dang, H., Kanel, G., Vendryes, C., French, B. a, … Stiles, B. L.
(2010). Expansion of Hepatic Tumor Progenitor Cells in Pten-Null Mice Requires
Liver Injury and Is Reversed by Loss of AKT2. Gastroenterology, 139(6), 2170–
2182. doi:10.1053/j.gastro.2010.09.002
Garcia-Carbonero, R., Carnero, A., & Paz-Ares, L. (2013). Inhibition of HSP90
molecular chaperones: moving into the clinic. The Lancet Oncology, 14(9), e358–
69. doi:10.1016/S1470-2045(13)70169-4
Giannelli, G., Mazzocca, A., Fransvea, E., Lahn, M., & Antonaci, S. (2011). Inhibiting
TGF-β signaling in hepatocellular carcinoma. Biochimica et Biophysica Acta,
1815(2), 214–23. doi:10.1016/j.bbcan.2010.11.004
Gonzalez-Nieto, D., Li, L., Kohler, A., Ghiaur, G., Ishikawa, E., Sengupta, A., …
Cancelas, J. a. (2012). Connexin-43 in the osteogenic BM niche regulates its cellular
composition and the bidirectional traffic of hematopoietic stem cells and
progenitors. Blood, 119(22), 5144–54. doi:10.1182/blood-2011-07-368506

109

Gouw, A. S. H., Clouston, A. D., & Theise, N. D. (2011). Ductular reactions in human
liver: diversity at the interface. Hepatology, 54(5), 1853–63. doi:10.1002/hep.24613
Gray, P. C., & Vale, W. (2012). Cripto/GRP78 modulation of the TGF-β pathway in
development and oncogenesis. FEBS Letters, 586(14), 1836–45.
doi:10.1016/j.febslet.2012.01.051
Hagiwara, S., Kudo, M., Nagai, T., Inoue, T., Ueshima, K., Nishida, N., … Sakurai, T.
(2012). Activation of JNK and high expression level of CD133 predict a poor
response to sorafenib in hepatocellular carcinoma. British Journal of Cancer,
106(12), 1997–2003. doi:10.1038/bjc.2012.145
Heijmans, J., van Lidth de Jeude, J. F., Koo, B.-K., Rosekrans, S. L., Wielenga, M. C. B.,
van de Wetering, M., … van den Brink, G. R. (2013). ER stress causes rapid loss of
intestinal epithelial stemness through activation of the unfolded protein response.
Cell Reports, 3(4), 1128–39. doi:10.1016/j.celrep.2013.02.031
Hensel, F., Eckstein, M., Rosenwald, A., & Brändlein, S. (2013). Early development of
PAT-SM6 for the treatment of melanoma. Melanoma Research, 23(4), 264–75.
doi:10.1097/CMR.0b013e328362cbc8
Hijikawa, T., Kaibori, M., Uchida, Y., Yamada, M., Ozaki, T., Kamiyama, Y., …
Okumura, T. (2008). Insulin-like growth factor 1 prevents liver injury through the
inhibition of TNF-alpha and iNOS induction in D-galactosamine and LPS-treated
rats. Shock, 29(6), 740–747. doi:10.1097/SHK.0b013e31815d0780
Hong, S.-K., Jeong, J. H., Chan, A. M., & Park, J.-I. (2013). AKT upregulates B-Raf
Ser445 phosphorylation and ERK1/2 activation in prostate cancer cells in response
to androgen depletion. Experimental Cell Research, 319(12), 1732–43.
doi:10.1016/j.yexcr.2013.05.008
Hua, Y., White-Gilbertson, S., Kellner, J., Rachidi, S., Usmani, S. Z., Chiosis, G., … Liu,
B. (2013). Molecular chaperone gp96 is a novel therapeutic target of multiple
myeloma. Clinical Cancer Research, 19(22), 6242–51. doi:10.1158/1078-
0432.CCR-13-2083
Ikushima, H., & Miyazono, K. (2010). TGFbeta signalling: a complex web in cancer
progression. Nature Reviews. Cancer, 10(6), 415–24. doi:10.1038/nrc2853
Inagaki, Y., & Okazaki, I. (2007). Emerging insights into Transforming growth factor
beta Smad signal in hepatic fibrogenesis. Gut, 56(2), 284–92.
doi:10.1136/gut.2005.088690
Jeanes, a, Gottardi, C. J., & Yap, a S. (2008). Cadherins and cancer: how does cadherin
dysfunction promote tumor progression? Oncogene, 27(55), 6920–9.
doi:10.1038/onc.2008.343

110

Jemal, A., Bray, F., Center, M., Ferlay, J., Ward, E., & Forman, D. (2011). Global Cancer
Statistics. CA: A Cancer Journal for Clinicians, 61(2), 69–90.
doi:10.3322/caac.20107.Available
Ji, C., Kaplowitz, N., Lau, M. Y., Kao, E., Petrovic, L. M., & Lee, A. S. (2011). Liver-
specific loss of glucose-regulated protein 78 perturbs the unfolded protein response
and exacerbates a spectrum of liver diseases in mice. Hepatology, 54(1), 229–39.
doi:10.1002/hep.24368
Jin, C., Samuelson, L., Cui, C.-B., Sun, Y., & Gerber, D. a. (2011). MAPK/ERK and
Wnt/β-Catenin pathways are synergistically involved in proliferation of Sca-1
positive hepatic progenitor cells. Biochemical and Biophysical Research
Communications, 409(4), 803–7. doi:10.1016/j.bbrc.2011.05.094
Kalra, J., Shao, Q., Qin, H., Thomas, T., Alaoui-Jamali, M. a, & Laird, D. W. (2006).
Cx26 inhibits breast MDA-MB-435 cell tumorigenic properties by a gap junctional
intercellular communication-independent mechanism. Carcinogenesis, 27(12),
2528–37. doi:10.1093/carcin/bgl110
Karpowicz, P., Willaime-Morawek, S., Balenci, L., DeVeale, B., Inoue, T., & van der
Kooy, D. (2009). E-Cadherin regulates neural stem cell self-renewal. The Journal of
Neuroscience, 29(12), 3885–96. doi:10.1523/JNEUROSCI.0037-09.2009
Kordes, C., & Häussinger, D. (2013). Hepatic stem cell niches. The Journal of Clinical
Investigation, 123(5). doi:10.1172/JCI66027.1874
Lau, M. Y., Han, H., Hu, J., & Ji, C. (2013). Association of cyclin D and estrogen
receptor α36 with hepatocellular adenomas of female mice under chronic
endoplasmic reticulum stress. Journal of Gastroenterology and Hepatology, 28(3),
576–83. doi:10.1111/jgh.12084
Lee, A. S. (2005). The ER chaperone and signaling regulator GRP78/BiP as a monitor of
endoplasmic reticulum stress. Methods, 35(4), 373–81.
doi:10.1016/j.ymeth.2004.10.010
Lee, A. S. (2007). GRP78 induction in cancer: therapeutic and prognostic implications.
Cancer Research, 67(8), 3496–9. doi:10.1158/0008-5472.CAN-07-0325
Lee, A. S. (2014). Glucose-regulated proteins in cancer: molecular mechanisms and
therapeutic potential. Nature Reviews Cancer, 14(4), 263–276. doi:10.1038/nrc3701
Lee, A.-H., Scapa, E. F., Cohen, D. E., & Glimcher, L. H. (2008). Regulation of hepatic
lipogenesis by the transcription factor XBP1. Science, 320(5882), 1492–6.
doi:10.1126/science.1158042

111

Lee, J.-S., Heo, J., Libbrecht, L., Chu, I.-S., Kaposi-Novak, P., Calvisi, D. F., …
Thorgeirsson, S. S. (2006). A novel prognostic subtype of human hepatocellular
carcinoma derived from hepatic progenitor cells. Nature Medicine, 12(4), 410–6.
doi:10.1038/nm1377
Li, D.-Q., Luo, L., Chen, Z., Kim, H.-S., Song, X. J., & Pflugfelder, S. C. (2006). JNK
and ERK MAP kinases mediate induction of IL-1beta, TNF-alpha and IL-8
following hyperosmolar stress in human limbal epithelial cells. Experimental Eye
Research, 82(4), 588–96. doi:10.1016/j.exer.2005.08.019
Li, J.-T., Liao, Z.-X., Ping, J., Xu, D., & Wang, H. (2008). Molecular mechanism of
hepatic stellate cell activation and antifibrotic therapeutic strategies. Journal of
Gastroenterology, 43(6), 419–28. doi:10.1007/s00535-008-2180-y
Lim, S. O., Park, S. G., Yoo, J., Park, Y. M., Kim, H., Jang, K., … Park, C. K. (2005).
Expression of heat shock proteins (HSP27, HSP60, HSP70, GRP78 , GRP94) in
hepatitis B virus-related hepatocellular carcinomas and dysplastic nodules. World
Journal of Gastroenterology, 11(14), 2072–2079.
Liu, B., & Li, Z. (2008). Endoplasmic reticulum HSP90b1 (gp96, grp94) optimizes B-cell
function via chaperoning integrin and TLR but not immunoglobulin. Blood, 112(4),
1223–30. doi:10.1182/blood-2008-03-143107
Liu, B., Staron, M., Hong, F., Wu, B. X., Sun, S., Morales, C., … Li, Z. (2013). Essential
roles of grp94 in gut homeostasis via chaperoning canonical Wnt pathway.
Proceedings of the National Academy of Sciences of the United States of America,
110(17), 6877–82. doi:10.1073/pnas.1302933110
Liu, R., Li, X., Gao, W., Zhou, Y., Wey, S., Mitra, S. K., … Gill, P. S. (2013).
Monoclonal antibody against cell surface GRP78 as a novel agent in suppressing
PI3K/AKT signaling, tumor growth, and metastasis. Clinical Cancer Research,
19(24), 6802–11. doi:10.1158/1078-0432.CCR-13-1106
Lorenzini, S., Bird, T. G., Boulter, L., Bellamy, C., Samuel, K., Aucott, R., … Forbes, S.
J. (2010). Characterisation of a stereotypical cellular and extracellular adult liver
progenitor cell niche in rodents and diseased human liver. Gut, 59(5), 645–54.
doi:10.1136/gut.2009.182345
Loulier, K., Lathia, J. D., Marthiens, V., Relucio, J., Mughal, M. R., Tang, S.-C., …
Ffrench-Constant, C. (2009). Beta1 Integrin Maintains Integrity of the Embryonic
Neocortical Stem Cell Niche. PLoS Biology, 7(8), e1000176.
doi:10.1371/journal.pbio.1000176
Luk, J. M., Lam, C.-T., Siu, A. F. M., Lam, B. Y., Ng, I. O. L., Hu, M.-Y., … Fan, S.-T.
(2006). Proteomic profiling of hepatocellular carcinoma in Chinese cohort reveals

112

heat-shock proteins (Hsp27, Hsp70, GRP78) up-regulation and their associated
prognostic values. Proteomics, 6(3), 1049–57. doi:10.1002/pmic.200500306
Luo, B., Lam, B. S., Lee, S. H., Wey, S., Zhou, H., Wang, M., … Lee, A. S. (2011). The
endoplasmic reticulum chaperone protein GRP94 is required for maintaining
hematopoietic stem cell interactions with the adult bone marrow niche. PloS One,
6(5), e20364. doi:10.1371/journal.pone.0020364
Luo, B., & Lee, a S. (2013). The critical roles of endoplasmic reticulum chaperones and
unfolded protein response in tumorigenesis and anticancer therapies. Oncogene,
32(7), 805–18. doi:10.1038/onc.2012.130
Luo, B., Tseng, C.-C., Adams, G. B., & Lee, A. S. (2013). Deficiency of GRP94 in the
hematopoietic system alters proliferation regulators in hematopoietic stem cells.
Stem Cells and Development, 22(23), 3062–73. doi:10.1089/scd.2013.0181
Luo, S., Mao, C., Lee, B., & Lee, A. S. (2006). GRP78/BiP is required for cell
proliferation and protecting the inner cell mass from apoptosis during early mouse
embryonic development. Molecular and Cellular Biology, 26(15), 5688–97.
doi:10.1128/MCB.00779-06
Mamuya, F. a, & Duncan, M. K. (2012). aV integrins and TGF-β-induced EMT: a circle
of regulation. Journal of Cellular and Molecular Medicine, 16(3), 445–55.
doi:10.1111/j.1582-4934.2011.01419.x
Mao, C., Wang, M., Luo, B., Wey, S., Dong, D., Wesselschmidt, R., … Lee, A. S.
(2010). Targeted mutation of the mouse Grp94 gene disrupts development and
perturbs endoplasmic reticulum stress signaling. PloS One, 5(5), e10852.
doi:10.1371/journal.pone.0010852
Marzec, M., Eletto, D., & Argon, Y. (2012). GRP94: An HSP90-like protein specialized
for protein folding and quality control in the endoplasmic reticulum. Biochimica et
Biophysica Acta, 1823(3), 774–87. doi:10.1016/j.bbamcr.2011.10.013
Maynard, J. C., Pham, T., Zheng, T., Jockheck-Clark, A., Rankin, H. B., Newgard, C. B.,
… Nicchitta, C. V. (2010). Gp93, the Drosophila GRP94 ortholog, is required for
gut epithelial homeostasis and nutrient assimilation-coupled growth control.
Developmental Biology, 339(2), 295–306. doi:10.1016/j.ydbio.2009.12.023
Michalopoulos, G. K., Barua, L., & Bowen, W. C. (2005). Transdifferentiation of rat
hepatocytes into biliary cells after bile duct ligation and toxic biliary injury.
Hepatology, 41(3), 535–44. doi:10.1002/hep.20600
Misra, U. K., Deedwania, R., & Pizzo, S. V. (2006). Activation and cross-talk between
Akt, NF-kappaB, and unfolded protein response signaling in 1-LN prostate cancer

113

cells consequent to ligation of cell surface-associated GRP78. The Journal of
Biological Chemistry, 281(19), 13694–707. doi:10.1074/jbc.M511694200
Moore, K. a, & Lemischka, I. R. (2006). Stem cells and their niches. Science, 311(5769),
1880–5. doi:10.1126/science.1110542
Morales, C., Rachidi, S., Hong, F., Sun, S., Ouyang, X., Wallace, C., … Li, Z. (2014).
Immune Chaperone gp96 Drives the Contributions of Macrophages to Inflammatory
Colon Tumorigenesis. Cancer Research, 74(2), 446–59. doi:10.1158/0008-
5472.CAN-13-1677
Moran-Jones, K., Ledger, A., & Naylor, M. J. (2012). β1 integrin deletion enhances
progression of prostate cancer in the TRAMP mouse model. Scientific Reports, 2,
526. doi:10.1038/srep00526
Morris, S. M., Baek, J. Y., Koszarek, A., Kanngurn, S., Knoblaugh, S. E., & Grady, W.
M. (2012). Transforming growth factor-beta signaling promotes
hepatocarcinogenesis induced by p53 loss. Hepatology, 55(1), 121–31.
doi:10.1002/hep.24653
Mulholland, D. J., Kobayashi, N., Ruscetti, M., Zhi, A., Tran, L. M., Huang, J., … Wu,
H. (2012). Pten loss and RAS/MAPK activation cooperate to promote EMT and
metastasis initiated from prostate cancer stem/progenitor cells. Cancer Research,
72(7), 1878–89. doi:10.1158/0008-5472.CAN-11-3132
Nagaprashantha, L. D., Vatsyayan, R., Lelsani, P. C. R., Awasthi, S., & Singhal, S. S.
(2011). The sensors and regulators of cell-matrix surveillance in anoikis resistance
of tumors. International Journal of Cancer, 128(4), 743–52. doi:10.1002/ijc.25725
Nakagawa, H., & Maeda, S. (2012). Molecular mechanisms of liver injury and
hepatocarcinogenesis: focusing on the role of stress-activated MAPK. Pathology
Research International, 2012, 172894. doi:10.1155/2012/172894
Nalesnik, M. a, Tseng, G., Ding, Y., Xiang, G.-S., Zheng, Z., Yu, Y., … Luo, J.-H.
(2012). Gene deletions and amplifications in human hepatocellular carcinomas:
correlation with hepatocyte growth regulation. The American Journal of Pathology,
180(4), 1495–508. doi:10.1016/j.ajpath.2011.12.021
Narmada, B. C., Chia, S.-M., Tucker-Kellogg, L., & Yu, H. (2013). HGF regulates the
activation of TGF-β1 in rat hepatocytes and hepatic stellate cells. Journal of
Cellular Physiology, 228(2), 393–401. doi:10.1002/jcp.24143
Nejak-Bowen, K. N., & Monga, S. P. S. (2011). Beta-catenin signaling, liver regeneration
and hepatocellular cancer: sorting the good from the bad. Seminars in Cancer
Biology, 21(1), 44–58. doi:10.1016/j.semcancer.2010.12.010

114

Ni, M., & Lee, A. S. (2007). ER chaperones in mammalian development and human
diseases. FEBS Letters, 581(19), 3641–51. doi:10.1016/j.febslet.2007.04.045
Ni, M., Zhang, Y., & Lee, A. S. (2011). Beyond the endoplasmic reticulum: atypical
GRP78 in cell viability, signalling and therapeutic targeting. The Biochemical
Journal, 434(2), 181–8. doi:10.1042/BJ20101569
Ni, M., Zhou, H., Wey, S., Baumeister, P., & Lee, A. S. (2009). Regulation of PERK
signaling and leukemic cell survival by a novel cytosolic isoform of the UPR
regulator GRP78/BiP. PloS One, 4(8), e6868. doi:10.1371/journal.pone.0006868
Nikolaou, K., Sarris, M., & Talianidis, I. (2013). Molecular pathways: the complex roles
of inflammation pathways in the development and treatment of liver cancer. Clinical
Cancer Research, 19(11), 2810–6. doi:10.1158/1078-0432.CCR-12-1961
Osada, T., Sakamoto, M., Ino, Y., Iwamatsu, A., Matsuno, Y., Muto, T., & Hirohashi, S.
(1996). E-cadherin is involved in the intrahepatic metastasis of hepatocellular
carcinoma. Hepatology, 24(6), 1460–7. doi:10.1053/jhep.1996.v24.pm0008938181
Ostrovsky, O., Ahmed, N. T., & Argon, Y. (2009). The Chaperone Activity of GRP94
Toward Insulin-like Growth Factor II Is Necessary for the Stress Response to Serum
Deprivation. Molecular Biology of the Cell, 20(33258), 1855–1864.
doi:10.1091/mbc.E08
Ostrovsky, O., Eletto, D., Makarewich, C., Barton, E. R., & Argon, Y. (2010). Glucose
regulated protein 94 is required for muscle differentiation through its control of the
autocrine production of insulin-like growth factors. Biochimica et Biophysica Acta,
1803(2), 333–41. doi:10.1016/j.bbamcr.2009.11.005
Patel, P. D., Yan, P., Seidler, P. M., Patel, H. J., Sun, W., Yang, C., … Chiosis, G.
(2013). Paralog-selective Hsp90 inhibitors define tumor-specific regulation of
HER2. Nature Chemical Biology, 9(11), 677–684. doi:10.01038/nchembio.1335
Pećina-Slaus, N. (2003). Tumor suppressor gene E-cadherin and its role in normal and
malignant cells. Cancer Cell International, 3(1), 17. doi:10.1186/1475-2867-3-17
Pfaffenbach, K. T., & Lee, A. S. (2011). The critical role of GRP78 in physiological and
pathologic stress. Current Opinion in Cell Biology, 23(2), 150–156.
doi:10.1016/j.ceb.2010.09.007.The
Pinkse, G. G. M., Voorhoeve, M. P., Noteborn, M., Terpstra, O. T., Bruijn, J. A., & De
Heer, E. (2004). Hepatocyte survival depends on beta1-integrin-mediated
attachment of hepatocytes to hepatic extracellular matrix. Liver International, 24(3),
218–26. doi:10.1111/j.1478-3231.2004.0914.x

115

Pyrko, P., Schönthal, A. H., Hofman, F. M., Chen, T. C., & Lee, A. S. (2007). The
unfolded protein response regulator GRP78/BiP as a novel target for increasing
chemosensitivity in malignant gliomas. Cancer Research, 67(20), 9809–16.
doi:10.1158/0008-5472.CAN-07-0625
Randow, F., & Seed, B. (2001). Endoplasmic reticulum chaperone gp96 is required for
innate immunity but not cell viability. Nature Cell Biology, 3(10), 891–6.
doi:10.1038/ncb1001-891
Reddy, R. K., Dubeau, L., Kleiner, H., Macrophages, C., Parr, T., Nichols, P., … Lee, A.
S. (2002). Cancer-inducible Transgene Expression by the Grp94 Promoter :
Spontaneous Activation in Tumors of Various Origins and Cancer-associated
Macrophages. Cancer Research, 7207–7212.
Reddy, R. K., Lu, J., & Lee, a S. (1999). The endoplasmic reticulum chaperone
glycoprotein GRP94 with Ca(2+)-binding and antiapoptotic properties is a novel
proteolytic target of calpain during etoposide-induced apoptosis. The Journal of
Biological Chemistry, 274(40), 28476–83. Retrieved from
http://www.ncbi.nlm.nih.gov/pubmed/10497210
Ron, D., & Walter, P. (2007). Signal integration in the endoplasmic reticulum unfolded
protein response. Nature Reviews. Molecular Cell Biology, 8(7), 519–29.
doi:10.1038/nrm2199
Rosekrans, S. L., Heijmans, J., Büller, N. V. J. a, Westerlund, J., Lee, A. S., Muncan, V.,
& van den Brink, G. R. (2014). ER stress induces epithelial differentiation in the
mouse oesophagus. Gut, 1–8. doi:10.1136/gutjnl-2013-306347
Roskams, T. (2006). Liver stem cells and their implication in hepatocellular and
cholangiocarcinoma. Oncogene, 25(27), 3818–22. doi:10.1038/sj.onc.1209558
Roskams, T. (2008). Relationships among stellate cell activation, progenitor cells, and
hepatic regeneration. Clinics in Liver Disease, 12(4), 853–60, ix.
doi:10.1016/j.cld.2008.07.014
Rutkowski, D., & Kaufman, R. J. (2004). A trip to the ER: coping with stress. Trends in
Cell Biology, 14(1), 20–28. doi:10.1016/j.tcb.2003.11.001
Saha, B., Chaiwun, B., Imam, S. S., Tsao-Wei, D. D., Groshen, S., Naritoku, W. Y., &
Imam, S. A. (2007). Overexpression of E-cadherin protein in metastatic breast
cancer cells in bone. Anticancer Research, 27(6B), 3903–8. Retrieved from
http://www.ncbi.nlm.nih.gov/pubmed/18225549
Sansal, I., & Sellers, W. R. (2004). The biology and clinical relevance of the PTEN tumor
suppressor pathway. Journal of Clinical Oncology, 22(14), 2954–63.
doi:10.1200/JCO.2004.02.141

116

Scadden, D. T. (2006). The stem-cell niche as an entity of action. Nature, 441(June),
1075–1079. doi:10.1038/nature04957
Schmitz, K. J., Wohlschlaeger, J., Lang, H., Sotiropoulos, G. C., Malago, M., Steveling,
K., … Baba, H. A. (2008). Activation of the ERK and AKT signalling pathway
predicts poor prognosis in hepatocellular carcinoma and ERK activation in cancer
tissue is associated with hepatitis C virus infection. Journal of Hepatology, 48(1),
83–90. doi:10.1016/j.jhep.2007.08.018
Segretain, D., & Falk, M. M. (2004). Regulation of connexin biosynthesis, assembly, gap
junction formation, and removal. Biochimica et Biophysica Acta, 1662(1-2), 3–21.
doi:10.1016/j.bbamem.2004.01.007
Seki, E., Brenner, D. a, & Karin, M. (2012). A liver full of JNK: signaling in regulation
of cell function and disease pathogenesis, and clinical approaches.
Gastroenterology, 143(2), 307–20. doi:10.1053/j.gastro.2012.06.004
Sekiya, S., & Suzuki, A. (2012). Intrahepatic cholangiocarcinoma can arise from Notch-
mediated conversion of hepatocytes. The Journal of Clinical Investigation, 122(11).
doi:10.1172/JCI63065DS1
Shani, G., Fischer, W. H., Justice, N. J., Kelber, J. a, Vale, W., & Gray, P. C. (2008).
GRP78 and Cripto form a complex at the cell surface and collaborate to inhibit
transforming growth factor beta signaling and enhance cell growth. Molecular and
Cellular Biology, 28(2), 666–77. doi:10.1128/MCB.01716-07
Shiojiri, N., & Sugiyama, Y. (2004). Immunolocalization of extracellular matrix
components and integrins during mouse liver development. Hepatology, 40(2), 346–
55. doi:10.1002/hep.20303
Shupe, T., & Petersen, B. E. (2011). Potential applications for cell regulatory factors in
liver progenitor cell therapy. The International Journal of Biochemistry & Cell
Biology, 43(2), 214–21. doi:10.1016/j.biocel.2010.09.005
Skrtic, S., Wallenius, K., Sjögren, K., Isaksson, O. G., Ohlsson, C., & Jansson, J. O.
(2001). Possible roles of insulin-like growth factor in regulation of physiological and
pathophysiological liver growth. Hormone Research, 55 Suppl 1(suppl 1), 1–6.
doi:63454
Staron, M., Yang, Y., Liu, B., Li, J., Shen, Y., Zúñiga-Pflücker, J. C., … Li, Z. (2010).
gp96, an endoplasmic reticulum master chaperone for integrins and Toll-like
receptors, selectively regulates early T and B lymphopoiesis. Blood, 115(12), 2380–
90. doi:10.1182/blood-2009-07-233031
Stiles, B., Wang, Y., Stahl, A., Bassilian, S., Lee, W. P., Kim, Y.-J., … Wu, H. (2004).
Liver-specific deletion of negative regulator Pten results in fatty liver and insulin

117

hypersensitivity [corrected]. Proceedings of the National Academy of Sciences of the
United States of America, 101(7), 2082–7. doi:10.1073/pnas.0308617100
Stock, P., Monga, D., Tan, X., Micsenyi, A., Loizos, N., & Monga, S. P. S. (2007).
Platelet-derived growth factor receptor-alpha: a novel therapeutic target in human
hepatocellular cancer. Molecular Cancer Therapeutics, 6(7), 1932–41.
doi:10.1158/1535-7163.MCT-06-0720
Su, R., Li, Z., Li, H., Song, H., Bao, C., Wei, J., & Cheng, L. (2010). Grp78 promotes the
invasion of hepatocellular carcinoma. BMC Cancer, 10, 20. doi:10.1186/1471-2407-
10-20
Tanaka, M., Itoh, T., Tanimizu, N., & Miyajima, A. (2011). Liver stem/progenitor cells:
their characteristics and regulatory mechanisms. Journal of Biochemistry, 149(3),
231–9. doi:10.1093/jb/mvr001
Thompson, M. D., Wickline, E. D., Bowen, W. B., Lu, A., Singh, S., Misse, A., &
Monga, S. P. S. (2011). Spontaneous repopulation of β-catenin null livers with β-
catenin-positive hepatocytes after chronic murine liver injury. Hepatology, 54(4),
1333–43. doi:10.1002/hep.24506
Tomlinson, J. S., Alpaugh, M. L., & Barsky, S. H. (2001). An Intact Overexpressed E-
cadherin / α , β -Catenin Axis Characterizes the Lymphovascular Emboli of
Inflammatory Breast Carcinoma. Cancer Research, 5231–5241.
Tumaneng, K., Russell, R. C., & Guan, K.-L. (2012). Organ size control by Hippo and
TOR pathways. Current Biology, 22(9), R368–79. doi:10.1016/j.cub.2012.03.003
Ueberham, E., Aigner, T., Ueberham, U., & Gebhardt, R. (2007). E-cadherin as a reliable
cell surface marker for the identification of liver specific stem cells. Journal of
Molecular Histology, 38(4), 359–68. doi:10.1007/s10735-007-9098-1
Van Hul, N. K. M., Abarca-Quinones, J., Sempoux, C., Horsmans, Y., & Leclercq, I. a.
(2009). Relation between liver progenitor cell expansion and extracellular matrix
deposition in a CDE-induced murine model of chronic liver injury. Hepatology,
49(5), 1625–35. doi:10.1002/hep.22820
Verras, M., Papandreou, I., Lim, A. L., & Denko, N. C. (2008). Tumor hypoxia blocks
Wnt processing and secretion through the induction of endoplasmic reticulum stress.
Molecular and Cellular Biology, 28(23), 7212–24. doi:10.1128/MCB.00947-08
Vinken, M., Henkens, T., De Rop, E., Fraczek, J., Vanhaecke, T., & Rogiers, V. (2008).
Biology and pathobiology of gap junctional channels in hepatocytes. Hepatology,
47(3), 1077–88. doi:10.1002/hep.22049

118

Virrey, J. J., Dong, D., Stiles, C., Patterson, J. B., Pen, L., Ni, M., … Lee, A. S. (2008).
Stress chaperone GRP78/BiP confers chemoresistance to tumor-associated
endothelial cells. Molecular Cancer Research, 6(8), 1268–75. doi:10.1158/1541-
7786.MCR-08-0060
Wang, C., Huang, Z., Du, Y., Cheng, Y., Chen, S., & Guo, F. (2010). ATF4 regulates
lipid metabolism and thermogenesis. Cell Research, 20(2), 174–84.
doi:10.1038/cr.2010.4
Wang, C., Jiang, K., Gao, D., Kang, X., Sun, C., Zhang, Q., … Liu, Y. (2013). Clusterin
protects hepatocellular carcinoma cells from endoplasmic reticulum stress induced
apoptosis through GRP78. PloS One, 8(2), e55981.
doi:10.1371/journal.pone.0055981
Wang, M., Wey, S., Zhang, Y., Ye, R., & Lee, A. S. (2009). Role of the unfolded protein
response regulator GRP78/BiP in development, cancer, and neurological disorders.
Antioxidants & Redox Signaling, 11(9), 2307–16. doi:10.1089/ARS.2009.2485
Wang, M., Ye, R., Barron, E., Baumeister, P., Mao, C., Luo, S., … Lee, a S. (2010).
Essential role of the unfolded protein response regulator GRP78/BiP in protection
from neuronal apoptosis. Cell Death and Differentiation, 17(3), 488–98.
doi:10.1038/cdd.2009.144
Wang, X., Foster, M., Al-Dhalimy, M., Lagasse, E., Finegold, M., & Grompe, M. (2003).
The origin and liver repopulating capacity of murine oval cells. Proceedings of the
National Academy of Sciences of the United States of America, 100 Suppl , 11881–8.
doi:10.1073/pnas.1734199100
Wei, Y., Van Nhieu, J. T., Prigent, S., Srivatanakul, P., Tiollais, P., & Buendia, M.-A.
(2002). Altered expression of E-cadherin in hepatocellular carcinoma: correlations
with genetic alterations, beta-catenin expression, and clinical features. Hepatology,
36(3), 692–701. doi:10.1053/jhep.2002.35342
Wey, S., Luo, B., & Lee, A. S. (2012). Acute inducible ablation of GRP78 reveals its role
in hematopoietic stem cell survival, lymphogenesis and regulation of stress
signaling. PloS One, 7(6), e39047. doi:10.1371/journal.pone.0039047
Wey, S., Luo, B., Tseng, C.-C., Ni, M., Zhou, H., Fu, Y., … Lee, A. S. (2012). Inducible
knockout of GRP78/BiP in the hematopoietic system suppresses Pten-null
leukemogenesis and AKT oncogenic signaling. Blood, 119(3), 817–25.
doi:10.1182/blood-2011-06-357384
Whittaker, S., Marais, R., & Zhu, a X. (2010). The role of signaling pathways in the
development and treatment of hepatocellular carcinoma. Oncogene, 29(36), 4989–
5005. doi:10.1038/onc.2010.236

119

Williams, M. J., Clouston, A. D., & Forbes, S. J. (2014). Links between hepatic fibrosis,
ductular reaction, and progenitor cell expansion. Gastroenterology, 146(2), 349–56.
doi:10.1053/j.gastro.2013.11.034
Wu, K., Ding, J., Chen, C., Sun, W., Ning, B.-F., Wen, W., … Wang, H.-Y. (2012).
Hepatic transforming growth factor beta gives rise to tumor-initiating cells and
promotes liver cancer development. Hepatology, 56(6), 2255–67.
doi:10.1002/hep.26007
Yang, Y., & Li, Z. (2005). Roles of Heat Shock Protein gp96 in the ER Quality Control :
Redundant or Unique Function ? Molecules and Cells, 20(2), 173–182.
Yang, Y., Liu, B., Dai, J., Srivastava, P. K., Zammit, D. J., Lefrançois, L., & Li, Z.
(2007). Heat shock protein gp96 is a master chaperone for toll-like receptors and is
important in the innate function of macrophages. Immunity, 26(2), 215–26.
doi:10.1016/j.immuni.2006.12.005
Yanger, K., Zong, Y., Maggs, L. R., Shapira, S. N., Maddipati, R., Aiello, N. M., …
Stanger, B. Z. (2013). Robust cellular reprogramming occurs spontaneously during
liver regeneration. Genes & Development, 27(7), 719–24.
doi:10.1101/gad.207803.112
Yao, D., Wu, X., Su, X., Yao, M., Wu, W., Qiu, L., … Meng, X. (2006). Abnormal
expression of HSP gp96 associated with HBV replication in human hepatocellular
carcinoma. Hepatobiliary & Pancreatic Diseases International, 5(3), 381–386.
Ye, R., Jung, D. Y., Jun, J. Y., Li, J., Luo, S., Ko, H. J., … Lee, A. S. (2010). Grp78
Heterozygosity Promotes Adaptive Unfolded Protein Response and Attenuates Diet-
Induced Obesity and Insulin Resistance. Diabetes, 59(January). doi:10.2337/db09-
0755.
Ye, R., Mareninova, O. a, Barron, E., Wang, M., Hinton, D. R., Pandol, S. J., & Lee, A.
S. (2010). Grp78 heterozygosity regulates chaperone balance in exocrine pancreas
with differential response to cerulein-induced acute pancreatitis. The American
Journal of Pathology, 177(6), 2827–36. doi:10.2353/ajpath.2010.100368
Yu, Y., Fisher, J. E., Lillegard, J. B., Rodysill, B., Amiot, B., & Nyberg, S. L. (2012).
Cell Therapies for Liver Diseases. Liver Transplantation, 9–21. doi:10.1002/lt.
Yue, J., Zhang, K., & Chen, J. (2012). Role of integrins in regulating proteases to mediate
extracellular matrix remodeling. Cancer Microenvironment, 5(3), 275–83.
doi:10.1007/s12307-012-0101-3
Yue, T., Tian, A., & Jiang, J. (2012). The cell adhesion molecule Echinoid functions as a
tumor suppressor and upstream regulator of the Hippo signaling pathway.
Developmental Cell, 22(2), 255–267. doi:10.1016/j.devcel.2011.12.011.The

120

Zeng, N., Li, Y., He, L., Xu, X., Galicia, V., Deng, C., & Stiles, B. L. (2011). Adaptive
basal phosphorylation of eIF2α is responsible for resistance to cellular stress-
induced cell death in Pten-null hepatocytes. Molecular Cancer Research, 9(12),
1708–17. doi:10.1158/1541-7786.MCR-11-0299
Zhang, X.-F., Tan, X., Zeng, G., Misse, A., Singh, S., Kim, Y., … Monga, S. P. S.
(2010). Conditional beta-catenin loss in mice promotes chemical
hepatocarcinogenesis: role of oxidative stress and platelet-derived growth factor
receptor alpha/phosphoinositide 3-kinase signaling. Hepatology, 52(3), 954–65.
doi:10.1002/hep.23747
Zhu, G., Ye, R., Jung, D. Y., Barron, E., Friedline, R. H., Benoit, V. M., … Lee, A. S.
(2013). GRP78 plays an essential role in adipogenesis and postnatal growth in mice.
FASEB Journal, 27(3), 955–64. doi:10.1096/fj.12-213330

Abstract (if available)

Abstract Cancer progression is characterized by the overriding of growth arrest and rapid cell proliferation, which require increased protein synthesis. Additionally, the poor vascularization of cancer tissues leads to glucose deprivation and hypoxia. Therefore, the tumor microenvironment represents physiological endoplasmic reticulum (ER) stress and activates the unfolded protein response (UPR) for survival. ER stress has been linked to a variety of human diseases, including liver steatosis and different cancers, and the conventional function of ER chaperones in protein quality control is updated to promote tumor progression, metastasis, and drug resistance. ❧ Liver cancer is one of the most common solid tumors with poor prognosis and high mortality. 40-50% of liver cancer patients have the tumor suppressor PTEN mutations or deletion, whereas the two major ER chaperones, glucose‐regulated protein 94 (GRP94) and glucose‐regulated protein 78 (GRP78), have been shown to be overexpressed in liver cancer. Thus, in this dissertation we established multiple mouse models with liver‐specific deletion of Grp94 (cGrp94ᶠ/ᶠ) or Grp78 alone (cGrp78ᶠ/ᶠ) or in combination with Pten (cPᶠ/ᶠ94ᶠ/ᶠ or cPᶠ/ᶠ78ᶠ/ᶠ) to investigate the roles of GRP94 and GRP78 in liver cancer development. First, we demonstrated that while deletion of GRP94 in the liver led to hyperproliferation of liver progenitor cells (LPCs), deletion of both GRP94 and PTEN accelerated development of liver tumors, including both hepatocellular carcinoma (HCC) and cholangiocarcinoma (CC), suggestive of progenitor cell origin. Moreover, at the premalignant stage, disturbance of cell adhesion proteins and minor liver injury were observed. When GRP94 was deleted in Pten‐null livers, ERK was selectively activated. ❧ Next, we further explored the long‐term effect of GRP94 deletion on liver tumorigenesis. cGrp94ᶠ/ᶠ livers showed small nodules at 15 months and spontaneously developed HCC and ductular reactions (DRs) by 21 months, associating with increased liver injury and fibrosis. Interestingly, GRP94‐positive hepatocytes progressively repopulated cGrp94ᶠ/ᶠ livers. At 15 months, we observed expansion of LPCs and mild DRs, as well as increase in cell proliferation. Analysis of signaling pathways revealed TGF‐β1 upregulaion, SMAD2/3, ERK, and JNK activation, and cyclin D1 upregulation in cGrp94ᶠ/ᶠ livers. The HCC was found to be GRP94‐positive, whereas the expanded LPCs and DRs remained GRP94‐negative. ❧ Interestingly, hepatic deletion of Grp78 led to a different story. Ablation of GRP78 was progressive but incomplete. At 3 months, cPᶠ/ᶠ78ᶠ/ᶠ livers showed lipogenic gene activation, exacerbated steatosis, and liver injury. In response to liver injury, increased proliferation of bile duct cells and LPCs was observed in cPᶠ/ᶠ78ᶠ/ᶠ livers, and GRP78 expression was intact in bile ducts and some LPCs. At 6 months, cPᶠ/ᶠ78ᶠ/ᶠ livers exhibited JNK activation, β‐catenin downregulation, along with PDGFRα upregulation. HCC and CC development was accelerated and evident in cPᶠ/ᶠ78ᶠ/ᶠ livers at 8-9 months, coinciding with intense GRP78 expression, while adjacent normal areas expressed WT level of GRP78. In summary, this dissertation revealed that ER chaperones GRP94 and GRP78 are novel but distinct regulators for liver homeostasis and cancer progression.

Linked assets

University of Southern California Dissertations and Theses

Conceptually similar

PDF

The role of endoplasmic reticulum chaperones in adipogenesis, liver cancer and mammary gland development

PDF

The role of glucose-regulated proteins in endometrial and pancreatic cancers

PDF

The role of endoplasmic reticulum chaperones in regulating hematopoietic stem cells and hematological malignancies

PDF

Role of endoplasmic reticulum chaperones GRP78 and GRP94 in regulating unfolded protein response and cell survival

PDF

The role of GRP78 in the regulation of apoptosis and prostate cancer progression

PDF

The role of endoplasmic reticulum protein GRP78 in normal hematopoeises and PTEN-null leukemogenesis

PDF

The role of endoplasmic reticulum chaperone protein GRP78 in breast cancer

PDF

The role of endoplasmic reticulum chaperone glucose-regulated 78-kilodalton (GRP78) in lung cancer

PDF

Molecular mechanisms of chemoresistance in breast cancer

PDF

Cell surface translocation mechanism of stress-inducible GRP78 in human cancer

PDF

Utilizing novel small molecules to modulate GRP78 expression and activity in cancer

PDF

Steatosis induces Wnt/β-catenin pathway to stimulate proliferation of hepatic tumor initiating cells and promote liver cancer development

PDF

The molecular mechanism of GRP78 translocation from the endoplasmic reticulum to the cell surface

PDF

Design of novel anticancer agents targeting cellular stress response pathways

PDF

Role of GRP78 and its novel cytosolic isoform GRP78va in regulating the unfolded protein response in cancer

PDF

Creating a multiple micrornia expression vector to target GRP78, an ER chaperone and signaling regulator in cancer

PDF

Cell surface translocation and therapeutic targeting of GRP78

PDF

PTEN deletion induced tumor initiating cells: Strategies to accelerate the disease progression of liver cancer

PDF

The role of endoplasmic reticulum proteins GRP78 and IP3R1 in regulation of glucose homeostasis and acute pancreatitis

PDF

Mechanisms of nuclear translocation of pyruvate dehydrogenase and its effects on tumorigenesis of hepatocellular carcinoma…

Asset Metadata

Creator Chen, Wan-Ting (author)

Core Title The roles of endoplasmic reticulum chaperones in regulating liver homeostasis and tumorigenesis

School Keck School of Medicine

Degree Doctor of Philosophy

Degree Program Genetic, Molecular and Cellular Biology

Publication Date 08/12/2014

Defense Date 04/15/2014

Publisher University of Southern California (original), University of Southern California. Libraries (digital)

Tag ER chaperones,GRP78,GRP94,liver cancer,liver progenitor cells,OAI-PMH Harvest

Format application/pdf (imt)

Language English

Contributor Electronically uploaded by the author (provenance)

Advisor Lee, Amy S. (committee chair), Machida, Keigo (committee member), Stiles, Bangyan L. (committee member)

Creator Email chenwant@usc.edu,ostopping@gmail.com

Permanent Link (DOI) https://doi.org/10.25549/usctheses-c3-459118

Unique identifier UC11286757

Identifier etd-ChenWanTin-2810.pdf (filename),usctheses-c3-459118 (legacy record id)

Legacy Identifier etd-ChenWanTin-2810.pdf

Dmrecord 459118

Document Type Dissertation

Format application/pdf (imt)

Rights Chen, Wan-Ting

Type texts

Source University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Access Conditions The author retains rights to his/her dissertation, thesis or other graduate work according to U.S. copyright law. Electronic access is being provided by the USC Libraries in agreement with the a...

Repository Name University of Southern California Digital Library

Repository Location USC Digital Library, University of Southern California, University Park Campus MC 2810, 3434 South Grand Avenue, 2nd Floor, Los Angeles, California 90089-2810, USA