University of Southern California Dissertations and Theses

Hepatic c-Jun overexpression metabolically reprograms cancer cells through mTORC2/AKT pathway

(USC Thesis Other)

Hepatic c-Jun overexpression metabolically reprograms cancer cells through mTORC2/AKT pathway

PDF

Download a page range

Download transcript

Copy asset link

Request this asset

Transcript (if available)

Content i

Hepatic c-Jun overexpression
metabolically reprograms cancer cells
through mTORC2/AKT pathway

A Thesis Presented to the
FACULTY OF THE USC GRADUATE SCHOOL
UNIVERSITY OF SOUTHERN CALIFORNIA
In Partial Fulfillment of the
Requirements for the Degree
MASTER OF SCIENCE
(MOLECULAR MICROBIOLOGY AND IMMUNOLOGY)

August 2014

Copyright 2014 Ambika Ramrakhiani
ii

ACKNOWLEDGEMENTS

I would like to thank my parents and my little brother for their love and encouragement, without
which I couldn’t have reached where I am today. I would like to thank my friends without whose
help and support I couldn’t have made it so far.
I would like to thank Dr. Keigo Machida for giving me an opportunity to work in his lab. I am
grateful for his guidance and patience in mentoring me from a graduate student to a ‘graduate
student researcher’. It was his encouragement and his perfectly timed guidance that has been the
driving force behind the successful completion of my thesis as well as the ongoing research in
this project.
It is indeed difficult to be perfect in everything you do, but I have spent my time in lab with
someone who makes this look easy. The next bit of my gratitude is reserved for one of my lab
member and teacher of sorts, Chia-lin Chen (PHD Candidate). She taught me everything that I
needed to learn for lab and at the same time has been a constant source of motivation, I thank her
from the bottom of my heart.
I would also like to thank all my former and current lab members for the support and cooperation:
Mr. Jian-Chang Liu (Felix), Dr. Douglas Feldman, Mr. Rajeshwar Nityanandam, Mr Dinesh
Babu, Ms. Judy Lee, Mr. Jordan Pedersen, Mr. Chad Nakagawa, Ms. Padmini Narayanan, Dr.
Hifzur R Siddique, and Ms. Ariana Gonzalez.
Last but not the least, my sincere gratitude and thanks goes to Ms Silvina Campos for her help in
all possible means.

iii

TABLE OF CONTENTS

List of Figures
Abstract
Chapter 1: Introduction ....................................................................................................1
1.1 Activator Protein (AP-1) ........................................................................................................ 2
1.2 Insulin Signaling .................................................................................................................... 4
1.2.1 Glucokinase ................................................................................................................ 6
1.2.2 Glucose-6-Phosphatase............................................................................................... 7
1.2.3 Glycogen Synthase ..................................................................................................... 7
1.3 Insulin Resistance .................................................................................................................. 9

Chapter 2: Materials and Methods ................................................................................11
2.1 Cell Culture .......................................................................................................................... 11
2.2 Transfection .......................................................................................................................... 11
2.3 Western Blot and Immunoprecipitation ............................................................................... 12
2.4 qRT-PCR .............................................................................................................................. 13
2.5 Flow Cytometry-Glucose Uptake Assay .............................................................................. 13
2.6 Glucose Production Assay .................................................................................................... 13
2.7 ChIP-qPCR ........................................................................................................................... 14
2.8 Luciferase Reporter Assay.................................................................................................... 15
2.9 Statistics ................................................................................................................................ 15

Chapter 3: Results............................................................................................................16
3.1 c-Jun Overexpression causes Insulin Resistance......................................................16
3.2 AKT Pathway Dysregulation ...................................................................................18
3.3 Dysregulation of AKT pathway disrupts the downstream pathway ........................19
3.4 c-Jun down-regulates the Rictor levels in mTORC2 complex .................................21
3.5 c-Jun knockdown restores Rictor Expression ..........................................................23

Chapter 4: Discussion ......................................................................................................25
Chapter 5: Summary and Future Directions ................................................................29
References .........................................................................................................................31
iv

LIST OF FIGURES

Figure 1: Insulin Signaling
Figure 2: c-Jun overexpression induces insulin resistance in the HepG2 Cells
Figure 3: c-Jun dysregulates AKT pathway
Figure 4: Dysregulation of AKT pathway disrupts the downstream pathway
Figure 5:c-Jun down regulates the Rictor levels in mTOR2 complex:
Figure 6: Knocking down of c-Jun restores Rictor Expression
Figure 7: Hypothetical Model

v

ABSTRACT

The term metabolic syndrome describes the association between obesity, insulin resistance, and
the risk of several prominent chronic diseases, including cancer. The link between many of these
components remains unexplained. There are many oncogenes that cause cancer, one out of which
is c-Jun which is the first discovered oncogenic transcription factor. There have been rarely few
studies that discovered some alternative activities of c-Jun, suggesting that c-Jun may actually
play key role other metabolic pathways other than oncogenesis. A short animal study in our lab
showed that abundance of hepatic c-Jun causes the mice to be obese and also developed insulin
resistance. When c-Jun was knocked out in liver specific manner the body weight of the mice
reduced and improved insulin resistance. In this study we wanted to know the mechanism that
causes insulin resistance when c-Jun is abundant in the liver by studying the AKT/mTORC2
pathway. We identified that c-Jun down regulates rictor by binding to its promoter, which further
dysregulates the entire downstream pathway. Here, we concluded that abundance of c-Jun in the
liver causes reduced phosphorylation of AKT at Sr473 site which further causes insulin resistance
in the cancer cells. c-Jun being the proto-oncogene can be used a target to treat cancer as well as
insulin resistance.

1

Chapter 1: INTRODUCTION

Over the past few decades, the proportion of populations that is overweight or obese has greatly
increased
1
. It may be due to the changes in lifestyle that affects the diet and physical activity. Today,
about half of the adult population in the developed countries is overweight or obese and are facing some
metabolic disorders. Yet, obesity is one preventable cause of illnesses which if uncontrolled contributes
to premature mortality and many other complications. In addition to the increased risk of heart diseases,
high blood pressure, stoke, Osteoarthritis and type 2 diabetes mellitus, morbid obesity seems to be a
significant risk factor for several malignancies, including hepatocellular carcinoma (HCC)
2
. Recent
studies have pointed out the link between insulin resistance and cancer. The mechanisms for this
association are unknown, but hyperinsulinaemia (a hallmark of insulin resistance) and the increase in
bioavailable insulin-like growth factor I (IGF-I) has a role in tumor initiation and progression in insulin-
resistant patient
3
. Type 2 diabetes mellitus (T2DM) is an independent risk factor for developing
chronic liver disease and HCC. The increased incidence of HCC among those with diabetes ranged
from 2 to 4 fold in many different cohort studies. A strong synergism between obesity and diabetes
conveyed a 100-fold excess HCC risk in the context of either hepatitis B virus (HBV) or hepatitis C
virus (HCV) infection. In addition, coexistent diabetes appears to increase the recurrence of HCC after
curative therapy. Non-alcoholic fatty liver disease (NAFLD) is the liver manifestation of metabolic
syndrome which occurs when fat is deposited in the liver not due to excessive alcohol use; it is also
defined by the collective features of obesity, diabetes, insulin resistance and dyslipidemia. NAFLD is
now considered the most common cause of chronic liver disease in Western countries and Asia. It is
estimated that NAFLD is prevalent in 30–40% of the adult population in the United States
4
. Insulin
resistance that is associated with NAFLD is another important mechanism that may induce hepatic
malignancy. NAFLD and HCC may be regulated by similar signaling molecules and pathways related
with inflammation. Lipid accumulation in obesity triggers cancer-related pathways including c-Jun N-
2

terminal kinase (JNK), NF- κB and toll-like receptors (TLR) signaling pathway, and overexpression of
oncogenic genes. TLR4 receptor rapidly activates not only the NF-κB pathway but also MAPK
pathways, including JNK, ERK, and p38. Many of the downstream targets of MAPK pathways are
transcription factors that include c-Jun, ATF2, and Elk-1
5
. c-Jun (component of AP-1) is considered
one of the most important transcription factors, which is not only considered as a proto-oncogene but
can play a role in metabolic disorders too.

1.1 Activator Protein (AP-1)
The composite transcription factor activating protein-1 (AP-1) participate in fundamental cellular
processes and control cellular responses to stimuli that regulate proliferation, differentiation, oncogenic
transformation and apoptosis. AP-1 is not a single protein, but a menagerie dimeric basic region- leucin
zipper (bZIP) proteins that belong to the Jun (c-Jun , JunB, JunD), Fos (c-Fos, FosB, Fra-1 and Fra2),
Maf (c-Maf, MafB, MafA, MafG/F/K and Nrl) and ATF (ATF2, LRF1/ ATF3, B- ATF, JDP1, JDP2)
sub-families, which recognize either 12-O-tetradecanoylphorbol-13-acetat (TPA) response elements (5’-
TGAG/ CTCA- 3’) or cAMP response elements (CRE, 5’-TGACGTCA- 3’)
6
. These homodimers or
heterodimers bind to specific DNA sequences, known as 12-Otetradecanoylphorbol-13-acetate response
elements (TRE), in the promoter regions of target genes and activate transcription. Among them, c-Jun is
the major component of the AP-1 complex and c-Fos is its best-known binding partner
7
. Both Jun and
its dimerization partners in AP-1 formation are regulated by diverse extracellular stimuli, which include
peptide growth factors, pro-inflammatory cytokines, oxidative and other forms of cellular stress, and UV
irradiation
8
. The c-Jun transcription is auto-regulated by its own product; Jun which stimulates its own
transcription may be a mechanism for prolonging the signals from extracellular stimuli. This mechanism
can have biological significance for the activity of c-Jun in cancer
9
.
Phosphorylation of Jun at serines 63 and 73 and threonine 91 and 93 increases transcription of the c-Jun
target genes. Therefore, regulation of c-Jun activity can be achieved through N-terminal phosphorylation
by the Jun N-terminal kinases (JNKs). c-Jun-N-terminal Kinase (JNK) is a mitogen-activated protein
3

kinase (MAPK) family member that is activated by diverse stimuli, including cytokines (such as tumor
necrosis factor and interleukin-1), reactive oxygen species (ROS), pathogens, toxins, drugs, endoplasmic
reticulum stress, free fatty acids, and metabolic changes. Strong activation of JNK has already been
observed in the liver, fat, and muscle tissues in mice placed on a high fat diet (HFD) and obese mice
10
.
Upon activation, JNK induces multiple biologic events through the transcription factor AP-1 and
transcription-independent control of effector molecules
11, 12
. It is shown that Jun’s activity (AP-1
activity) in stress-induced apoptosis and cellular proliferation is regulated by its N-terminal
phosphorylation
13
. c-JUN is also downstream of TLR-4 pathway which is also activated in high fat diet
HCV model
11, 12
. The regulation of cell proliferation by AP- 1 might be of crucial importance for the
multi-stage development of tumors
14, 15
. However, AP-1 does not always promote cell proliferation it
also has anti-proliferative activities. c-Jun is primarily a positive regulator of cell proliferation, as c-Jun
deficient fibroblasts have a marked proliferation defect in vitro
8, 16
and the proliferation of c-Jun
deficient hepatocytes is severely impaired during liver regeneration in vivo
13
. Components of the AP-1
transcription factor including c-Jun and c-FOS are important regulators of tumor development
17, 18
.

1.2 Insulin Signaling
Insulin is a hormone released by pancreatic beta cells in response to elevated levels of nutrients in the
blood. Insulin triggers the uptake of glucose, fatty acids and amino acids into liver, adipose tissue and
muscle and promotes the storage of these nutrients in the form of glycogen, lipids and protein
respectively. Failure to uptake and store nutrients results insulin resistance and higher levels of glucose
in the bloodstream. This is presumably because of defects in the insulin signaling pathway.

The insulin receptor is composed of two extracellular a subunits and two transmembrane β subunits
linked together by disulphide bonds. Binding of insulin to α subunit induces a conformational change
resulting in the autophosphorylation of a number of tyrosine residues present in the β subunit (Van
4

Obberghen et al., 2001). These residues are recognized by phosphor-tyrosine-binding (PTB) domains of
adaptor proteins such as members of the insulin receptor substrate family (IRS)
19, 20
. Receptor activation
leads to the phosphorylation of key tyrosine residues on IRS proteins, some of which are recognized by
the Src homology 2 (SH2) domain of the p85 regulatory subunit of PI 3-kinase (a lipid kinase). The
catalytic subunit of PI3-kinase, p110, then phosphorylates phosphatidylinositol(4,5)bi-
sphosphate(PtdIns(4,5)P
2
) leading to the formation of Ptd(3,4,5)P
3
. A key downstream effector of
Ptd(3,4,5)P
3
is AKT (otherwise known as PKB), which is recruited to the plasma membrane. Activation
of AKT also requires the protein kinase 3-phosphoinositide-dependent protein kinase-1 (PDK1) and
mTOR2 complex, which leads to the phosphorylation of AKT at Thr308 and Sr473 sites respectively.
Once activated, AKT enters the cytoplasm where it leads to the phosphorylation and inactivation of
FOXO-1 and glycogen synthase kinase 3 (GSK3). Inactive form of FOXO-1 inactivates gluconeogenic
gene expression, while GSK3 controls the levels of glycogen synthase, an enzyme that catalysis the final
step in glycogen synthesis. Phosphorylation of glycogen synthase by GSK3 inhibits glycogen synthesis;
therefore the inactivation of GSK3 and FOXO-1 by AKT promotes glucose storage as glycogen and
down regulates gluconeogenesis. In addition to promoting glucose storage and inhibiting the production
and release of glucose by the liver by blocking gluconeogenesis, insulin also blocks glycogenolysis and
Glucokinase activity and also controls lipogenesis
19
. The pathway directly controls the activities of a set
of metabolic enzymes by phosphorylation and dephosphorylation events and also regulates the
expression of genes encoding hepatic enzymes involved in gluconeogenesis.

One of the most important actions of this pathway is to stimulate glucose uptake into cells by inducing
translocation of the glucose transporter, GLUT4, from intracellular storage to the plasma membrane.
PI3-kinase and AKT are known to play a role in GLUT4 translocation
20
. In addition, a PI3-kinase
independent pathway provides a second cue for GLUT4 recruitment to the plasma membrane
19
. In this
pathway, insulin receptor activation leads to the phosphorylation of Cbl, which is associated with the
adaptor protein CAP. Following phosphorylation the Cbl-CAP complex translocates to lipid rafts in the
5

plasma membrane. Cbl then interacts with the adaptor protein Crk, which is constitutively associated
with the Rho-family guanine nucleotide exchange factor, C3G. C3G in turn activates members of the
GTP-binding protein family, TC10, which promote GLUT4 translocation to the plasma membrane
through the activation of as yet unknown adaptor molecules.

The glucose transporter present in the liver is GLUT-2 which is a bidirectional transporter, allowing
glucose to flow in 2 directions. It is expressed by renal tubular cells, small intestinal epithelial cells,
liver cells and pancreatic beta cells. It is also present in the basolateral membrane of the small intestine
epithelium. Bi-directionality is required in liver cells to uptake glucose for glycolysis, and release of
glucose during gluconeogenesis. The net flux through G6Pase and GK (the glucose cycle) also
determines the net production or uptake of glucose through this transporter and is thus a key in
determining both fasting glucose levels and the tolerance to exogenous glucose, or more generally, meal
carbohydrate. Glycogen is the principal repository for glucose taken up from the circulation and thus a
major determinant of this uptake. Hepatic glucose uptake is based on four highly integrated enzyme
complexes: glucokinase, glucose-6-phophatase, and glycogen synthase and glycogen phosphorylase.
These four enzymes are known to control glucose uptake and release of the glucose molecule in the
hepatocyte, and its incorporation into or release from glycogen. All the four reactions (together with
gluconeogenesis and glycolysis) either replenish or deplete the G6P pool within each hepatocyte
20
.

1.2.1 Glucokinases
Glucokinase (GK) is a distinct form of hexokinase expressed in the liver and in the pancreatic islet β-cell
21
. Because these two organs are involved in sensing circulating glucose concentrations, GK, because of
its particular affinity for glucose, is strongly implicated in this process. This is enabled by the high-
capacity facilitated diffusion of glucose into the hepatocyte via the glucose transporter, GLUT-2. In the
liver its activity can be modulated by a regulatory protein (GKRP). In the presence of fructose-6-P
GKRP binds GK to form an inhibitory complex. It has been suggested that GKRP is a constitutive
6

protein of the hepatocyte nucleus where GK is translocated when glucose is low. Translocation to the
cytoplasm takes place when glucose (and fructose) is high, for example postprandially
22
.

1.2.2 Glucose-6-phosphatase
Glucose-6-phosphatase (G6Pase) is an enzymic system that is located in the endoplasmic reticulum
(ER).The structure–function relationships of this enzyme are not yet well defined. One model proposes a
combination of a hydrolase, the catalytic site of which is oriented toward the luminal site of the ER, and
translocases which allow the movement of the G6P, glucose and inorganic phosphate across the
microsomal membrane
23
. The existence of the microsomal glucose and inorganic phosphate transporters
remain unclear. This is a critical enzyme at the last step in the production of glucose by both the
glycogenolytic and gluconeogenetic pathways and would thus be expected to be an important control
point in this process
24, 25
.

1.2.3 Glycogen metabolism: Glycogen Synthase
The first step in glycogen synthesis is the autocatalytic attachment of the first carbon of the glucosyl
moiety of UDP-glucose to a tyrosine residue of the enzyme glycogenin. Glycogenin then
autocatalytically extends this chain by several more residues to produce a primed glycogen molecule.
Glycogen synthase then dissociates from the glycogenin to continue the elongation process that is
interrupted by a branching enzyme which transfers short (about six glucosyl units) chains from an
elongated external chain to a neighboring chain with an α-1,6 linkage
26, 27
.

7

Figure 1: Insulin Signaling

8

1.3 Insulin Resistance
Insulin resistance (IR) is a physiological condition in which cells fail to respond to the normal actions of
the hormone insulin. The body produces insulin, but the cells in the body become resistant to insulin and
are unable to use it as effectively. When people are insulin resistant, their muscle, fat, and liver cells do
not respond properly to insulin. As a result, their bodies need more insulin to help glucose enter cells.
The pancreas tries to keep up with this increased demand for insulin by producing more, but eventually it
fails to keep up with the body’s need for insulin. This further leads to excess glucose in the bloodstream.
Many times people with insulin resistance have high levels of both glucose as well as insulin circulating
in their blood at the same time.

Insulin resistance plays a fundamental role in the pathogenesis of a host of metabolic diseases, ranging
from Type 2 Diabetes to hypertension, lipid disorders, atherosclerosis, and reproductive abnormalities.
In liver, insulin resistance increases glucose production because of an impaired ability of insulin to
suppress the expression/activity of gluconeogenic enzymes. This abnormality coexists with increased
triglyceride (TG) synthesis and reduced FFA oxidation, which are consistent with a heightened state of
insulin sensitivity
28
. Insulin resistance consistently demonstrates defects in IRS-1 tyrosine
phosphorylation or/and PI-3 kinase or/and AKT activation. Any defect in these genes leads to altered
glucose metabolism and thereby hyperglycemia by affecting the downstream pathway. Inactivated IRS
or PI-3 ultimately leads to inactivation of AKT which furthers activates the gluconeogenic genes by
activating FOXO-1 and inhibits glycolytic and lipogenic genes, by inhibiting sterol regulatory element-
binding protein 1c (SREBP1c) and glucokinase (GK). SREBP1c is a transcription factor that promotes
expression of number of lipogenic genes. GK, the rate- limiting enzyme of glycolysis in the liver,
stimulates glycolysis and lipogensis by enhancing glucose flux, including production of acetyl-CoA for
lipid synthesis
29
. Full activation of AKT occurs when it’s phosphorylated at both its sites, Sr473 and
Th308 by mTORC2 complex and PDK-1 respectively.

9

Target of rapamycin (TOR) is a highly conserved protein kinase that controls cell growth and
metabolism in response to nutrients, growth factors, and energy status. TOR exists in two structurally
and functionally distinct complexes termed TOR complex 1 (TORC1) and TORC2
30
. Mammalian
TORC1 (mTORC1) contains mTOR, raptor, and mLST8 and phosphorylates a variety of substrates to
control protein synthesis, ribosome biogenesis, autophagy, and other growth related processes. The two
best-characterized mTORC1 substrates are ribosomal protein S6 kinase (S6K) and eukaryotic initiation
factor 4Ebinding protein (4E-BP), both of which control protein synthesis.mTORC2 comprises mTOR,
Rictor, mSin1, mLST8, and PRR5 (also known as protor) and phosphorylates members of the AGC
kinase family, including AKT (also known as PKB), SGK1, and PKC, via which mTORC2 controls cell
survival, actin cytoskeleton organization, and other processes. By regulating a wide range of anabolic
and catabolic processes, the mTOR complexes play a key role in growth, development, metabolism, and
aging and are implicated in a variety of pathological states including cancer, obesity, and diabetes
29
.

10

Chapter 2: MATERIALS AND METHODS

2.1 Cell culture
HepG2, HEK293T and Mouse TIC cells were used in the study. HepG2 is a perpetual cell line which
was derived from the liver tissue of a 15-year-old Caucasian American male with a well-differentiated
hepatocellular carcinoma. Because of their high degree of morphological and functional
differentiation in vitro, HepG2 cells are a suitable model to study the intracellular trafficking (insulin
signaling), sinusoidal membrane proteins and lipids in human hepatocytes in vitro. HEK 293T is a
variant type of the Human embryonic kidney 293 cells containing the large T-antigen of the SV40 virus.
This variant helps achieve episomal replication of transfected plasmids and generally used in retroviral
vectors. These cells form the basis for a lot of retroviral packaging cell lines. Human hepatocellular liver
carcinoma (HepG2) cells and HEK293T cells were cultured in DMEM supplemented with 20% heat-
inactivated fetal bovine serum, antibiotics and non-essential amino acids. Cell Line was cultured at 37°C
in a 5% CO
2
humidified atmosphere. Mouse TICs were cultured in DMEM HamF12 supplemented with
20% heat-inactivated fetal bovine serum, antibiotics, non-essential amino acids, Nucleosides, mEGF.
HepG2 cells were incubated in serum-free medium with the labeled glucose for glucose uptake assay and
glucose free media for glucose production assay.

2.2 Transfection
HepG2 cells were transiently transfected by c-Jun Overexpression vector. This type of transfections
was carried out with BioT method. Cells were grown to 60–75% confluence; a mixture of transfection
complexes was prepared using a BioT (µl) to DNA (µg) ratio of 1.5:1. Entire mixture was directly added
to the cells and the plate was returned to the CO
2
incubator. 16 to 24 hours after transfection, the medium
was replaced in the dish with fresh growth medium. Cells were harvested after 48hrs for western blot
analysis or qRT-PCR.
11

c-Jun was also knockdown in mouse TICs using lentiviral stable transfection method. Lentivirus
carrying the gene of interest was produced using 293T cells. Cells were plated in T75 flasks and were
grown upto 70% confluency. Transfection mixture was prepared using packaging plasmid (psPAX2),
envelop plasmid (VSV-G), vector plasmid (gene of interest), transfection reagent (BioT) and serum free
DMEM. The mixture was mixed and kept at room temperature for 5 mins, and was added to the cells.
After 14 to 16 hrs post transfection, media was replaced and was harvested after 48hrs. The media was
centrifuged and supernatant was filtered in 0.22µm/0.45µm filters. Supernatant was concentrated by
ultra-centrifuge at 20,000 rpm for 2 hrs. After centrifuge re-suspend the pellet in media or PBS and was
stored at -80 ºC. TICs were infected and selection was done using Puromycine after 48 to 72 hrs. Cells
were harvested after the dish was 90% confluent and used for further experiments.

2.3 Western blot and immunoprecipitation
To prepare the samples for western blot analysis, cells were harvested and lysed using RIPA lysis buffer
(sodium chloride, NP-40 or Triton X-100, sodium deoxycholate, SDS, protease and phosphatase
inhibitors). Liver tissues were collected from high fat diet fed mice and high fat diet fed mice in which c-
Jun was knocked out in liver specific manner. The tissues were also lysed using RIPA buffer. Western
Blot was carried, using antibodies against c-Jun and RICTOR (Santa Cruz Biotechnology Inc); FOXO1,
FOXO1S256, AKT, AKTS473, AKTT308, mTOR, GSK and P-GSK (Cell Signaling Technology); and
SIN1 (Bethyl Laboratories). Complex formation of mTORC2 complex was analyzed by
Immunoprecipitation. The buffer used to lyse the cells for immunoprecipitation was NP-40 as RIPA
might disrupt protein-protein interactions and may therefore be problematic for
immunoprecipitations/pull down assays

12

2.4 qRT-PCR
Total RNA was isolated from the cells using Qiagen RNeasy mini kit (Qiagen, Inc., Venlo, Netherlands)
according the manufacturer's protocol and the RNA concentration was measured using Thermo
Scientific NanoDrop
TM
Spectrophotometer. cDNA was synthesized from the RNA templates using
Random primers and 10 mM dNTPs under the following conditions- 16
o
C for 30 min, 42
o
C for 30 min
and 85
o
C for 5 min.
Real time PCR analysis was performed on ABI 7900 HT QPCR system(Life Technologies, Carlsbad,
CA) using SYBR Green QPCR Master Mix (Stratagene) according to the manufacturers' instructions. β-
actin and GAPDH was used as endogenous reference control.

2.5 Flow Cytometry Glucose Uptake Assay
A glucose uptake assay using 2-NBDG was performed as previously described with minor
modifications. Briefly, HepG2 cells and c-Jun overexpressed HepG2 cells were cultured for 24 hr,
maintained in serum-free DMEM with or without 1 µmol/l insulin with the absence or presence of 10
µmol/l 2-NBDG for 2 hr. The fluorescence intensity of 2-NBDG was recorded on the FL1 channel using
a FACS Calibur flow cytometer. Data from 10,000 single-cell events were collected. To exclude false-
positives, cells in the absence of 2-NBDG were measured and taken as the background. The relative
fluorescence intensities minus the background were used for subsequent data analysis.

2.6 Glucose Production Assay
HepG2 cells were washed three times with PBS to remove glucose and then were incubated in a 6 well
plate for 16 h in 2 ml of glucose production medium (glucose- and phenol red-free DMEM containing
gluconeogenic substrates, 20 mM sodium lactate, and 2 mM sodium pyruvate) and in the presence of 1
nM insulin (Usbio) during the last 3 h. A quantity of 300 μl of medium was sampled for measurement of
glucose concentration using a glucose assay kit (Sigma).
13

2.6 ChIP qPCR
To determine how signaling pathways differentially regulate gene expression, it is necessary to identify
the interactions between transcription factors (TFs) and their cognate regulatory DNA elements. ChIP
involves crosslinking of the protein–DNA complex within an intact cell using crosslinking agents, such
as formaldehyde. The DNA is then sheared to smaller pieces ( ∼500 bp) by sonication or nuclease
digestion. The sheared protein-bound DNA is then immunoprecipitated using a highly specific Ab
against the protein. An aliquot of the sheared DNA before immunoprecipitation is used as a reference
sample. The protein–DNA complexes from reference and ChIP samples are then reverse crosslinked.
The DNA is purified and enrichment of ChIP-ed DNA over the reference sample can be analyzed using
quantitative PCR
31
. Chip assay was performed using mouse TICs on Rictor promoter with AP-1/c-Jun
antibody which was bought from Abcam.
Rictor Primers Forward primer (5’-3’) Reverse primer (5’-3’)
ChIP Primer 1
GCTGAAGGTTTACACTAACAGATACT AAGTCCAAAGTGGAGATCTTGC
ChIP Primer 2
TGGAAGAGAGAGGTGAGGAATA GCCCTTAACCCAGCAACT
ChIP Primer 3
TCTAGCTTAAGAGAGTTGCTG AGGATTAGTTTACGGGTTTCT
ChIP Primer 4
CCGCTTCTAGAAACCCGTAAA GCTGATGCCGATGTCGAG
ChIP Primer 5
AGCCAGTGATGTAGGAGTAACA CGGGACAGGGTTTCCTCT
Table 1: List of Rictor ChIP primers

14

2.7 Luciferase Reporter Assay
Luciferase-based genetic reporter assays provide sensitive methods for assaying gene expression,
enabling the accurate quantification of small changes in transcription resulting from subtle changes in
biology. Cells are inherently complex, and the data available from a single reporter may be insufficient
for achieving reliable results. Dual-reporter assays enable researchers to obtain additional information
from complex systems with minimal effort. The Dual-Luciferase® Reporter (DLR™) Assay and Dual-
Glo™ Assay enable the sequential measurement of both firefly and Renilla luciferases from one sample.
The DLR™ and Dual-Glo™ Assays provide rapid and convenient means for achieving greater control
over the biological significance of reporter data by differentiating genetic responses of interest from
nonrelevant influences in the experimental system.
pGL3B vectors containing different Rictor promoter sequences were transfected into mouse TICs and
sh-cJun TICs. After 24 hours incubation, the luciferase activity was assessed with the Dual-Luciferase
Reporter Assay Kit (Promega).

2.8 Statistics
Student’s t test was used to compare differences between samples analyzed. P values of less than 0.05
are considered as statistically significant. Data represent average ± S.D.

15

Chapter 3: RESULTS

3.1 c-JUN Overexpression causes Insulin Resistance
To examine if c-Jun overexpression causes Insulin Resistance, we overexpressed c-Jun in human HepG2
hepatocytes using Transient BioT transfection method. The cells were harvested after 48 hrs, lysed for
western blot Analysis and RNA was isolated for qPCR analysis. In hepatic insulin resistance, the level of
glucose production increases which could correlate with gluconeogenesis. The overexpression of c-Jun
enhances gluconeogenesis which was shown by glucose production assay as the production of glucose
increased in these cells compared to normal HepG2 (Fig.2 a). Hepatic insulin resistance also affects the
glucose uptake which was also reduced in c-Jun overexpressed samples compared to the parental HepG2
(Fig.2 b).
a.

16

b.

Figure 2: c-Jun overexpression induces insulin resistance in the HepG2 Cells: (a) There was also increase in
the gluconeogenesis shown by glucose production which was performed using glucose assay kit. (b) FACs analysis
using labeled glucose (2-NBDG) shows that c-Jun overexpression in HepG2 cells decreases glucose uptake.

17

3.2 AKT pathway Dysregulation
The above data suggests that c-Jun overexpression causes insulin resistance by activating gluconeogesis
and decreases the glucose uptake. To investigate further, we examined insulin signaling, in particular
insulin-activated AKT signaling, in the c-Jun knockout liver samples as well as in C-JUN overexpressed
hepatic cell line (HepG2). We first analyzed the phosphorylation status of AKT and its downstream
effectors in each of the samples. In c-Jun wild type liver samples insulin failed to stimulate the
phosphorylation of AKT at Sr473 whereas Thr308 phosphorylation was induced (Fig.3 a). Disruption of
c-Jun in a liver specific manner promotes phosphorylation of AKT at Sr 473 site (Fig.3 a). Similar data
was obtained when c-Jun was overexpressed in HepG2. Phophorylation of AKT at Sr473 site was altered
in the overexpressed sample compared to parental HepG2 or empty vector transfected cells (Fig.3 b).
One of AKT substrates FOXO-1, which is responsible for activation of the gluconeogenic genes, was
significantly hyperphosphorylated in c-Jun knockout liver samples (Fig.3 a) while it was hypo-
phosphorylated in c-Jun overexpressed HepG2 cells (Fig.3 b).

18

a. b.

Figure 3: c-Jun dysregulates AKT pathway: (a) Western Blots of signaling molecules showing dysregulation in
the AKT by decreased p-AKT-S473 and p-FOXO-1 in c-Jun wild type high fat diet fed mice. (b) Western Blots of
signaling molecules showing dysregulation in the AKT by decreased p-AKT-S473 and p-FOXO-1 in c-Jun
overexpressed HepG2 samples.

3.3 Dysregulation of AKT pathway disrupts the downstream pathway
Activation of FOXO-1 activated the gluconeogenic genes, which is directly correlated with the
production of glucose (Fig. 2). The expression of gluconeogenic genes was measured by checking the
mRNA levels of two major ones G6Pase (Glucose 6-phosphatase) and PEPCK (Phosphoenolpyruvate
carboxykinase). The expression of both the genes was higher in c-Jun overexpressed HepG2 samples
(Fig.4 a). Hepatic insulin resistance also affects the synthesis of glycogen which is synthesized from
monomers of UDP-glucose by the enzyme glycogen synthase. To test if c-Jun overexpression also
affects the glycogen synthesis, this could be analyzed by the expression of glycogen synthase enzyme.
Phospho-Glycogen Synthase which is the inactive form of the enzyme was hyperphosphorylated in the
c-Jun overexpressed samples (Fig.4 b). The control of glycogen synthase is a key step in regulating
19

glycogen metabolism and glucose storage. Glycogen synthase is directly regulated by glycogen synthase
kinase 3, which is downstream effecter molecule of AKT. Phosphorylation of a protein by GSK-3β
usually inhibits the activity of its downstream target which is Glycogen Synthase. GSK-3β was
hypophosphorylated in c-Jun overexpressed samples (Fig. 4c). Phosphorylation of AKT also affects the
Glucokinase activity, which was reduced in the c-Jun overexpressed samples compared to normal
HepG2. (Fig. 4d)
a.

b. c.

20

d.

Figure 4: Dysregulation of AKT pathway disrupts the downstream pathway: (a) Activation of FOXO-1
activates the gluconeogenic genes, Real time RT-PCR analysis reveals that PEPCK and G6PASE is increased in c-
Jun overexpressed HepG2 cells. (b) Western Blot analysis shows that GSK3β is activated as it is
hypophosphorylated in c-Jun overexpressed samples. (c) Western Blot analysis shows that activation of GSK3β
inactivates glycogen synthase as it was hyperphosphorylated in c-Jun overexpressed HepG2 cells. (d) Real Time
RT-PCR analysis also shows that the expression of glucokinases decreases in c-Jun overexpressed HepG2 cells.

3.4 c-Jun down regulates the Rictor levels in mTOR2 complex:
Our data suggests that c-Jun inhibits phosphorylation of AKT at Sr473 site. The mTORC2 complex is
responsible for AKT phosphorylation at Sr473 site. It is composed of mTOR, rapamycin-insensitive
companion of mTOR (RICTOR), GβL, and mammalian stress-activated protein kinase interacting
protein 1 (mSIN1). mTORC2 regulates the cytoskeleton through its stimulation of F-actin stress fibers,
paxillin, RhoA, Rac1, Cdc42, and protein kinase C α (PKCα). mTORC2 also appears to possess the
activity of a previously elusive protein known as "PDK2". mTORC2 phosphorylates the serine/threonine
protein kinase AKT/PKB at a serine residue S473. Phosphorylation of the serine stimulates AKT
phosphorylation and threonine T308 residue by PDK1 and leads to full AKT activation. The decreased
expression of Rictor was detected at protein as well as at mRNA level in c-Jun overexpressed HepG2
cells compared to normal HepG2 cells and empty vector transfected HepG2 cells (Fig. 5a and Fig. 5c).
Immunoprecipitation data shows that the absence of protein alters the complex formation between Rictor
21

and SIN-1 (Fig. 5b). These results indicated that one of the mTORC2 components, Rictor was down
regulated in c-Jun overexpressed HepG2 cells while other components, Sin1 and mTOR2 were
unaltered.

a. b.

22

c.

Figure 5: c-Jun down regulates the Rictor levels in mTOR2 complex: (a) Western Blot Analysis shows that
Rictor levels were decreased in c-Jun overexpressed HepG2 cells, while the other components of Mtorc2 complex
were same. (b) Immunoprecipitation analysis revealed that there was no complex formation between SIN-1 and
RICTOR. (c) Real time RT-PCR analysis also shows that Rictor mRNA expression was significantly reduced in c-
Jun overexpressed HepG2 cells.

23

3.5 Knocking down of c-Jun restores Rictor Expression:
These observations prompted us to hypothesize that c-Jun plays a negative role in regulating Rictor
expression. To investigate this further c-Jun was knocked down in mouse TICs as the level of c-Jun in
TICs is high compared to HepG2 cells. Knocking down of c-Jun restored the expression of P-AKT and
RICTOR, showing gain of function analysis (Fig. 6a). Next we investigated the potential mechanism
underlying the regulation of Rictor expression by c-Jun. c-Jun being a transcription factor; we assumed
that there might be c-Jun binding sites on Rictor Promoter which may negatively regulate the Rictor
expression. ChIP analysis with c-Jun antibody detected the existence of c-Jun binding sites on 2
fragments of Rictor promoter between 751-529 bp (Fig. 6b). We showed that ectopic expression of c-Jun
in mouse TICs activated luciferase constructs 852-512, this region covers both the fragments where c-
Jun strongly binds (Fig. 6c). Using reporter construct containing serial deletions, we identified that both
the binding sites are important for Rictor down-regulation.
a.

24

b.

c.

Figure 6: Knocking down of c-Jun restores Rictor Expression: (a) Western Blot showing restoration of Rictor
and P-AKT expression when c-Jun was knocked out in mouse TICs. (b) ChIP-qPCR analysis shows c-Jun binding
sites on 2 fragments of Rictor promoter between 751-529 bp (c) Luciferase Analysis of Rictor promoter-Pgl3B
demonstrates that knockdown of c-Jun strongly activates Rictor expression in particular regions.

25

Chapter 4: DISCUSSION
Components of the AP-1 transcription factor including c-Jun and c-Fos are important regulators of tumor
development. A genome-wide expression analysis of human HCCs revealed that c-Jun is at the center of
an oncogenic signaling network in HCCs with poor prognosis
32
. Using a diethylnitrosamine (DEN)-
induced mouse liver cancer model, c-Jun was found to promote tumorigenesis by suppressing the
important cell death regulator p53
33
. In addition, c-Jun was required for mouse liver tumorigenesis
during early stages, but dispensable in advanced liver tumors. It is also shown that, c-Jun up regulation
correlates with human hepatocyte survival during hepatitis C virus infection and with early events during
cirrhosis-associated human HCC development. Taking advantage of the c-Jun -dependent mouse model,
a study showed that c-Jun promotes cell survival during cancer initiation by regulating c-Fos- and
SIRT6-dependent expression of survivin, rather than antagonizing p53
18
.
In this study we not only show the role of c-Jun in oncogenesis but also in metabolic reprogramming in
cancer cells through dysregulation of mTORC2/AKT pathway. Saturated FFAs and lipid accumulation
activate this proinflammatory transcription factor in hepatocytes, and enhanced AP-1 activation has been
demonstrated in obese patients
34
. AP-1 is a homo or heterodimer consisting of proteins belonging to the
c-Jun, c-FOS, ATF and JDP families, with c-Jun being the best-characterized AP-1 component. The
nuclear import of c-Jun is mediated by multiple mechanisms and nuclear c-Jun levels correlate with AP-
1 target gene activity. This further increases c-Jun protein abundance, as the Jun proto-oncogene itself is
activated by AP-1 in the manner of a positive auto-regulatory loop. The activity of c-Jun /AP-1 is
markedly enhanced by phosphorylation of the transcriptional activation domain by JNKs. Sustained
activation of the JNK pathway mediates the development and progression of experimental diet-induced
NAFLD.

26

Apart from boosting c-Jun /AP-1 activity, it has also been shown that JNK activation can also
phosphorylate insulin receptor substrates (IRS)-1 and -2, which may lead to insulin resistance by
blocking insulin receptor signal transduction
35
. Further inducers of JNK activity are ROS (Reactive
Oxygen Species), which are also known to have a role in NAFLD progression. It has also been
demonstrated that the c-Jun itself promotes nuclear accumulation of JNK, further propelling AP-1
transcriptional activity.

The importance of insulin and its downstream effecter AKT to glucose homeostasis has been studied
extensively. PDK1 and mTORC2 are both required to fully activate AKT, which provides another layer
of regulation downstream of the insulin-insulin receptor pathway. mTORC2 is composed of 2 unique
components, Rictor and Sin1, and 2 common components, mTOR and mLST8, that are shared with
mTORC1. Deletion of Rictor or Sin1 could only impair the phosphorylation of AKT at S473. Activation
of AKT in hepatocytes results in the phosphorylation of the FOXO1 transcription factor, leading to its
transportation to the cytoplasm and degradation. This results in the reduced expression of G6Pase and
Pepck and diminished glucose production and elevated synthesis of glycogen in the liver. On the other
hand, the absence of AKT-S473 phosphorylation reduces the phosphorylation of FOXO1, which is
important for the maintenance of the transcriptional activity of FOXOs. However, how mTORC2
expression and/or activity are regulated remains elusive.

In most of the cases, c-Jun serves as a positive regulator of gene expression and increases the
phosphorylation of AKT. However there have been recent studies that indicate that c-Jun also negatively
regulates gene expression and also inhibits phosphorylation of AKT in case of Non-alcoholic Fatty Liver
Disease. Recent study showed increased hepatic c-Jun expression in their newly developed dietary
murine NASH model (high fat diet) and confirmed this observation in NAFLD patients where they
detected c-Jun abundance even in simple steatosis It appeared likely that higher c-Jun levels facilitate
NASH development and progression. Nonalcoholic steatohepatitis (NASH) is common cause of chronic
27

liver disease strongly associated with insulin resistance & obesity which could lead to diabetes and other
metabolic disorders. In line with this they also showed, decreased hepatic AKT phosphorylation in high
fat diet-fed mice compared with control mice indicated an impaired insulin response, a key pathological
factor for NAFLD development and progression also in patients
34
.

In this study, we also showed that hepatic c-Jun abundance has an impaired insulin response, primarily
due to reduced phosphorylation of AKT-S473 and further activates FOXO-1 and GSK-3β which leads to
insulin resistance. Our data demonstrated for the first time that c-Jun controls the expression of Rictor, a
component of the mTORC2, through interacting with it on the c-Jun binding sites of Rictor promoter.
This relationship further illustrates the importance of a fine-tuning in the metabolic pathway and in
maintaining insulin sensitivity.

Abnormal regulation of hepatic glucose production is one of the causes for several human health
problems, such as insulin resistance, type 2 diabetes, nonalcoholic fatty liver disease, and liver cirrhosis.
In our study, we showed that c-Jun overexpression caused increase level of glucose production. Our lab
has also observed the same in in-vivo studies using different mice models; wild type mice and NS5A Tg
mice in which c-JUN was knocked-out in a liver specific manner and then the mice were fed with high
cholesterol fat diet (data not shown). They saw that c-Jun wild type mice developed insulin resistance
while c-Jun knockout mice had improved conditions. It is already been shown that hepatic insulin
resistance causes whole body insulin, which is accompanied by increased levels of ROS in their insulin-
response organs. Increased level of ROS is one of the major causes for insulin resistance
36
.

28

Figure 7: Hypothetical Model

29

Chapter 5: SUMMARY AND FUTURE DIRECTIONS

We demonstrated that c-Jun binds on the promoter of Rictor and negatively regulates its expression.
Overexpression of c-Jun reduces the Rictor expression at both Mrna as well as protein level and when c-
Jun is knocked out from the hepatic cell its expression is restored. Decrease expression of Rictor leads to
reduced phosphorylation of AKT-S473. This event maintains the nuclear localization of FOXO1 and
increases the expression of gluconeogenetic genes, G6pase and Pepck, leading to hepatic glucose
overproduction and hyperglycemia, which was also measured by in-vitro glucose production assay.
Reduced phosphorylation of AKT also activates GSK3β which further inhibits glycogen Synthase and
affects glycogen synthesis of the excess glucose. C-Jun overexpression also affects glycolysis because of
impaired glucokinase activity.
Now that we know that c-Jun binds on the Rictor promoter at two fragments between 803-622 bp and
negatively regulates the expression and both binding sites are critical for Rictor expression. The next
step would be to mutate the site and see if there is any change in the expression. This experiment would
be carried out by in-vitro mutagenesis using Dpn-1 treatment by Aglient Technology, Quick Change Site
Directed Mutagenesis Kit. For further confirmatory analysis it would be good to carry out some
histological evaluation using mouse tissue sections as well as human tissue sections. We have high fat
fed tissue sections and control diet fed tissue sections which will be stained with c-JUN, Rictor, PEPCK,
and G-6-Pase. Another key experiment would be to check if this metabolic reprograming is cancer cell
specific or can also be observed in normal hepatocytes. As we carried out our experiments in HepG2 and
TICs which are liver cancer cell lines, now we would over-express c-JUN in primary hepatocytes and
check for the expression of Rictor and its downstream effectors.
We would also want to evaluate if this c-Jun mediated metabolic shift is the primary driver or
messenger of oncogenesis and self-renewable ability of TICs, using the rescue experiments by silencing
c-Jun and performing colony and spheroid formation assays. Nanog, the stem/progenitor cell marker, is
30

also downstream gene up-regulated by TLR4 activation. Nanog-positive cells exhibited enhanced ability
of self-renewal, clonogenicity, and initiation of tumors, which are consistent with crucial hallmarks in
the TICs. To investigate the self-renewable ability, we will check the expression of Nanog and also if c-
Jun is associated with it.

31

REFERENCES

[1] Qatanani M, Lazar MA: Mechanisms of obesity-associated insulin resistance: many choices on the
menu. Genes & development 2007, 21:1443-55.

[2] Kopelman P: Health risks associated with overweight and obesity. Obesity reviews : an official
journal of the International Association for the Study of Obesity 2007, 8 Suppl 1:13-7.

[3] Arcidiacono B, Iiritano S, Nocera A, Possidente K, Nevolo MT, Ventura V, Foti D, Chiefari E,
Brunetti A: Insulin Resistance and Cancer Risk: An Overview of the Pathogenetic Mechanisms.
Experimental Diabetes Research 2012, 2012:1-12.

[4] Yu J, Shen J, Sun TT, Zhang X, Wong N: Obesity, insulin resistance, NASH and hepatocellular
carcinoma. Seminars in cancer biology 2013, 23:483-91.

[5] Liu WC, Ouyang XS, Yang JJ, Liu JG, Li QS, Gu YP, Fukata M, Lin T, He JC, Abreu M, Unkeless
JC, Mayer L, Xiong HB: AP-1 Activated by Toll-like Receptors Regulates Expression of IL-23 p19. J
Biol Chem 2009, 284:24006-16.

[6] Chinenov Y, Kerppola TK: Close encounters of many kinds: Fos-Jun interactions that mediate
transcription regulatory specificity. Oncogene 2001, 20:2438-52.

[7] Zhang Y, Pu X, Shi M, Chen L, Song Y, Qian L, Yuan G, Zhang H, Yu M, Hu M, Shen B, Guo N:
Critical role of c-Jun overexpression in liver metastasis of human breast cancer xenograft model. BMC
cancer 2007, 7:145.

[8] Wisdom R, Johnson RS, Moore C: c-Jun regulates cell cycle progression and apoptosis by distinct
mechanisms. The EMBO journal 1999, 18:188-97.

[9] Angel P, Hattori K, Smeal T, Karin M: The jun proto-oncogene is positively autoregulated by its
product, Jun/AP-1. Cell 1988, 55:875-85.

[10] Seki E, Brenner DA, Karin M: A liver full of JNK: signaling in regulation of cell function and
disease pathogenesis, and clinical approaches. Gastroenterology 2012, 143:307-20.

[11] Machida K: TLRs, Alcohol, HCV, and Tumorigenesis. Gastroenterology research and practice
2010, 2010:518674.

[12] Machida K, Tsukamoto H, Mkrtchyan H, Duan L, Dynnyk A, Liu HM, Asahina K, Govindarajan S,
Ray R, Ou JH, Seki E, Deshaies R, Miyake K, Lai MM: Toll-like receptor 4 mediates synergism
between alcohol and HCV in hepatic oncogenesis involving stem cell marker Nanog. Proceedings of the
National Academy of Sciences of the United States of America 2009, 106:1548-53.

[13] Behrens A, Sibilia M, Wagner EF: Amino-terminal phosphorylation of c-Jun regulates stress-
induced apoptosis and cellular proliferation. Nature genetics 1999, 21:326-9.

[14] Liu Y, Ludes-Meyers J, Zhang Y, Munoz-Medellin D, Kim HT, Lu C, Ge G, Schiff R, Hilsenbeck
SG, Osborne CK, Brown PH: Inhibition of AP-1 transcription factor causes blockade of multiple signal
transduction pathways and inhibits breast cancer growth. Oncogene 2002, 21:7680-9.
32

[15] Park JM, Adam RM, Peters CA, Guthrie PD, Sun Z, Klagsbrun M, Freeman MR: AP-1 mediates
stretch-induced expression of HB-EGF in bladder smooth muscle cells. The American journal of
physiology 1999, 277:C294-301.

[16] Schreiber M, Kolbus A, Piu F, Szabowski A, Mohle-Steinlein U, Tian J, Karin M, Angel P, Wagner
EF: Control of cell cycle progression by c-Jun is p53 dependent. Genes & development 1999, 13:607-19.

[17] Maeda S, Karin M: Oncogene at last--c-Jun promotes liver cancer in mice. Cancer cell 2003, 3:102-
4.

[18] Min L, Ji Y, Bakiri L, Qiu Z, Cen J, Chen X, Chen L, Scheuch H, Zheng H, Qin L, Zatloukal K,
Hui L, Wagner EF: Liver cancer initiation is controlled by AP-1 through SIRT6-dependent inhibition of
survivin. Nature cell biology 2012, 14:1203-11.

[19] Lazar DF, Saltiel AR: Lipid phosphatases as drug discovery targets for type 2 diabetes. Nature
reviews Drug discovery 2006, 5:333-42.

[20] Lizcano JM, Alessi DR: The insulin signalling pathway. Current biology : CB 2002, 12:R236-8.

[21] Kawai S, Mukai T, Mori S, Mikami B, Murata K: Hypothesis: structures, evolution, and ancestor of
glucose kinases in the hexokinase family. Journal of bioscience and bioengineering 2005, 99:320-30.

[22] Iynedjian PB: Molecular physiology of mammalian glucokinase. Cellular and molecular life
sciences : CMLS 2009, 66:27-42.

[23] Ghosh A, Shieh JJ, Pan CJ, Sun MS, Chou JY: The catalytic center of glucose-6-phosphatase.
HIS176 is the nucleophile forming the phosphohistidine-enzyme intermediate during catalysis. J Biol
Chem 2002, 277:32837-42.

[24] Ghosh A, Shieh JJ, Pan CJ, Chou JY: Histidine 167 is the phosphate acceptor in glucose-6-
phosphatase-beta forming a phosphohistidine enzyme intermediate during catalysis. J Biol Chem 2004,
279:12479-83.

[25] van Schaftingen E, Gerin I: The glucose-6-phosphatase system. The Biochemical journal 2002,
362:513-32.

[26] Jentjens R, Jeukendrup A: Determinants of post-exercise glycogen synthesis during short-term
recovery. Sports medicine (Auckland, NZ) 2003, 33:117-44.

[27] Buschiazzo A, Ugalde JE, Guerin ME, Shepard W, Ugalde RA, Alzari PM: Crystal structure of
glycogen synthase: homologous enzymes catalyze glycogen synthesis and degradation. The EMBO
journal 2004, 23:3196-205.
[28] Matsumoto M, Han S, Kitamura T, Accili D: Dual role of transcription factor FoxO1 in controlling
hepatic insulin sensitivity and lipid metabolism. The Journal of clinical investigation 2006, 116:2464-72.

[29] Hagiwara A, Cornu M, Cybulski N, Polak P, Betz C, Trapani F, Terracciano L, Heim MH, Ruegg
MA, Hall MN: Hepatic mTORC2 activates glycolysis and lipogenesis through Akt, glucokinase, and
SREBP1c. Cell metabolism 2012, 15:725-38.

33

[30] Loewith R, Jacinto E, Wullschleger S, Lorberg A, Crespo JL, Bonenfant D, Oppliger W, Jenoe P,
Hall MN: Two TOR complexes, only one of which is rapamycin sensitive, have distinct roles in cell
growth control. Molecular cell 2002, 10:457-68.

[31] Mukhopadhyay A, Deplancke B, Walhout AJ, Tissenbaum HA: Chromatin immunoprecipitation
(ChIP) coupled to detection by quantitative real-time PCR to study transcription factor binding to DNA
in Caenorhabditis elegans. Nature protocols 2008, 3:698-709.

[32] Lopez-Bergami P, Lau E, Ronai Z: Emerging roles of ATF2 and the dynamic AP1 network in
cancer. Nature reviews Cancer 2010, 10:65-76.

[33] Eferl R, Ricci R, Kenner L, Zenz R, David JP, Rath M, Wagner EF: Liver tumor development. c-
Jun antagonizes the proapoptotic activity of p53. Cell 2003, 112:181-92.

[34] Dorn C, Engelmann JC, Saugspier M, Koch A, Hartmann A, Muller M, Spang R, Bosserhoff A,
Hellerbrand C: Increased expression of c-Jun in nonalcoholic fatty liver disease. Laboratory
investigation; a journal of technical methods and pathology 2014, 94:394-408.

[35] Hirosumi J, Tuncman G, Chang L, Gorgun CZ, Uysal KT, Maeda K, Karin M, Hotamisligil GS: A
central role for JNK in obesity and insulin resistance. Nature 2002, 420:333-6.

[36] Wang RH, Kim HS, Xiao C, Xu X, Gavrilova O, Deng CX: Hepatic Sirt1 deficiency in mice
impairs mTorc2/Akt signaling and results in hyperglycemia, oxidative damage, and insulin resistance.
The Journal of clinical investigation 2011, 121:4477-90.

Abstract (if available)

Abstract The term metabolic syndrome describes the association between obesity, insulin resistance, and the risk of several prominent chronic diseases, including cancer. The link between many of these components remains unexplained. There are many oncogenes that cause cancer, one out of which is c‐Jun which is the first discovered oncogenic transcription factor. There have been rarely few studies that discovered some alternative activities of c‐Jun, suggesting that c‐Jun may actually play key role other metabolic pathways other than oncogenesis. A short animal study in our lab showed that abundance of hepatic c‐Jun causes the mice to be obese and also developed insulin resistance. When c‐Jun was knocked out in liver specific manner the body weight of the mice reduced and improved insulin resistance. In this study we wanted to know the mechanism that causes insulin resistance when c‐Jun is abundant in the liver by studying the AKT/mTORC2 pathway. We identified that c‐Jun down regulates rictor by binding to its promoter, which further dysregulates the entire downstream pathway. Here, we concluded that abundance of c‐Jun in the liver causes reduced phosphorylation of AKT at Sr473 site which further causes insulin resistance in the cancer cells. c‐Jun being the proto‐oncogene can be used a target to treat cancer as well as insulin resistance.

Linked assets

University of Southern California Dissertations and Theses

Conceptually similar

PDF

Roles of epithelial-mesenchymal transition and niche in tumorigenesis of tumor-initiating cells

PDF

c-JUN mediated alteration of SLC2A2 expression in hepatoma cell line HepG2

PDF

Effect of hepatitis C virus infection on signal transduction adaptor protein: TRAF6

PDF

Role of TLR4 and AID in lymphomagenesis induced by obesity and hepatitis C virus

PDF

Synergism between TLR4-c-JUN axis and surface receptor stimulation translocate c-MYC into Ig loci, through AID leading to lymphomagenesis

PDF

The role of amphisomes and Rab11 protein in release of mature hepatitis B viral particles and analysis of the arginine-rich C-terminal domain of HBV precore protein

PDF

Placental growth factor mediated transcriptional and post-transcriptional regulation of hemeoxygenase-1

PDF

Hepatitis B virus X protein regulation of β-catenin and NANOG and co-regulatory role with YAP1 in HCC malignancy

PDF

Lnc-RNA and WNT signal synergistically promotes self-renewal of tumor initiating stem-like cells via epigenetic regulation

PDF

The analysis and modeling of signaling pathways induced by the interactions of the SARS-CoV-2 spike protein with cellular receptors

PDF

Transcriptional regulation of IFN-γ and PlGF in response to Epo and VEGF in erythroid cells

PDF

Expression of recombinant hepatitis B virus e antigen and analysis of its effect on macrophages

PDF

Steatosis induces Wnt/β-catenin pathway to stimulate proliferation of hepatic tumor initiating cells and promote liver cancer development

PDF

Identification of molecular mechanism for cell-fate decision in liver; &, SARS-CoV replicon inhibitor high throughput drug screening

PDF

CAD-mediated metabolic reprogramming is regulated by innate immune kinases TBK1 and IKKβ

PDF

UVRAG maintains genomic integrity

PDF

Pten deletion in adult pancreatic beta-cells induces cell proliferation and G1/S cell cycle progression

PDF

Targeting tumor-initiating stem-like cells through metabolic and epigenetic regulations

PDF

Protein kinase C (PKC) participates in acetaminophen hepatotoxicity through JNK dependent and independent pathways

PDF

Cell fate reprogramming of liver tumor-initiating stem-like cells via phosphorylated NUMB and TBC1D15

Asset Metadata

Creator Ramrakhiani, Ambika (author)

Core Title Hepatic c-Jun overexpression metabolically reprograms cancer cells through mTORC2/AKT pathway

School Keck School of Medicine

Degree Master of Science

Degree Program Molecular Microbiology and Immunology

Publication Date 07/23/2014

Defense Date 06/10/2014

Publisher University of Southern California (original), University of Southern California. Libraries (digital)

Tag c-Jun,Diabetes,insulin pathway,OAI-PMH Harvest

Format application/pdf (imt)

Language English

Contributor Electronically uploaded by the author (provenance)

Advisor Machida, Keigo (committee chair), Kalra, Vijay K. (committee member), Ou, J.-H. James (committee member)

Creator Email ambika.ramrakhiani@gmail.com,ramrakhi@usc.edu

Permanent Link (DOI) https://doi.org/10.25549/usctheses-c3-445587

Unique identifier UC11287108

Identifier etd-Ramrakhian-2729.pdf (filename),usctheses-c3-445587 (legacy record id)

Legacy Identifier etd-Ramrakhian-2729.pdf

Dmrecord 445587

Document Type Thesis

Format application/pdf (imt)

Rights Ramrakhiani, Ambika

Type texts

Source University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Access Conditions The author retains rights to his/her dissertation, thesis or other graduate work according to U.S. copyright law. Electronic access is being provided by the USC Libraries in agreement with the a...

Repository Name University of Southern California Digital Library

Repository Location USC Digital Library, University of Southern California, University Park Campus MC 2810, 3434 South Grand Avenue, 2nd Floor, Los Angeles, California 90089-2810, USA