University of Southern California Dissertations and Theses

A functional genomic approach based on shRNA-mediated gene silencing to delineate the role of NF-κB and cell death proteins in the survival and proliferation of KSHV associated primary effusion l...

(USC Thesis Other)

A functional genomic approach based on shRNA-mediated gene silencing to delineate the role of NF-κB and cell death proteins in the survival and proliferation of KSHV associated primary effusion l...

PDF

Download a page range

Download transcript

Copy asset link

Request this asset

Transcript (if available)

Content

A functional genomic approach based on shRNA-mediated gene silencing to

delineate the role of NF- κB and cell death proteins in the survival and proliferation
of KSHV associated primary effusion lymphoma cells

By

Akshata Ijantkar

A Thesis Presented to the Faculty of the Graduate School

UNIVERSITY OF SOUTHERN CALIFORNIA

In Partial Fulfillment of the Degree

MASTER OF SCIENCE

August 2014

Table of Contents
I. Acknowledgements
II. Abstract
III. List of Abbreviation
IV. Introduction 1
V. Material and Methods 9
VI . Results 14
VII. Discussions 23
VIII. References 25

I. Acknowledgements.

It was my immense pleasure to work on this project .This lab has been the most
important chapter in my life as young researcher who started her research by learning to
hold pipette in her hand to handling many cell lines at a time. I would like to thank Dr
Preet Chaudhary my mentor,a great scientist and most importantly a great advisor and
teacher. His teachings will always help me in my career in research further. I would like
to thank Dr Hittu Matta, Dr Ramakrishnan Gopalkrishnan ,Dr Sunju Choi for always
helping me out in the lab. Dr Hittu for teaching protein work, Dr Ramakrishnan for
teaching cell culture and mice work and Dr Sunju for helping me with cloning DNA into
various cloning vectors. I would like to thank my committee members Dr Zoltan Tokes
and Dr Pragna Patel for taking time out from labs and becoming a part of this defense.
Lastly, I would like to thank my parents, family and friends without whom this journey
would not be possible.
II. Abstract:

Lentiviral mediated gene transfer has been used recently for gene transfer in lot of
mammalian cell line. The most important advantage of using lentiviral vector is their
high virus titre and their ability to infect non –dividing cell line. We used this approach
to make sh-RNA knockouts of a few signaling proteins from the NF κB family. shRNA is
used an important genetic tool to silence gene expression in cells to study the phenotype
of a particular gene in disease progression and to study potential therapeutic targets for
the disease. We made eight copies of the shRNA from the oligonucleotide primers and
inserted them into cloning vector which had H1/TO promoter for doxycycline. The
expression of sh-RNA was inducible since the promoter was switched on only in the
presence of doxycycline. We then cloned this entire shRNA cassette into lentiviral
expression (PSLIKneo).This expression vector had antibiotic resistance gene neomycin
.Hence cells which had sh-RNA cassette which got successfully cloned into expression
vector got selected with neomycin (G418) in this case. We targeted sh-RNA against
many NF κB signaling proteins like TRAF2, cRel, cIAP1 and cIAP2,IKK1,IKK2,Nemo
and caspase 8.We successfully got knockout of cRel and TRAF2 both at the cell survival
and protein expression level. We tested whether these genes are involved in the survival
of PEL cells. Knocking out these genes showed cell death in the PEL cells. Hence ,
demonstrating that the expression of these genes are required for the survival of PEL
cells.

III. List of Abbreviations

NF κB- Nuclear factor kappa B.

IL-Interleukin

I κB- Inhibitor of kappa B.

IKK- Inhibitor kappa kinase.

cIAP- cellular inhibitor of apoptosis. RPMI-
Roswell Park Memorial Institute

DMEM- Dubelcco’s Modified Eagle Medium. TRAF-
TNF receptor associated factor.
TNF- Tumor receptor factor.

ICAM-1 (Intercellular Adhesion Molecule 1) also known as CD54 (Cluster of
Differentiation 54)

X-linked inhibitor of apoptosis protein (XIAP)

VCAM-Vascular cell adhesion protein 1 also known as 1 (VCAM-1) or cluster of
differentiation 106 (CD106).

IRF3, IRF4- Interferon response factor.

JAK-STAT: Janus kinase and STAT Signal Transducer and Activator of
Transcription (STAT).

FLICE- [FADD-like interleukin-1 beta-converting enzyme]
ATCC-American Type Culture Collection

CaCl
2
– Calcium Chloride

1

IV. INTRODUCTION

Nuclear Factor kappa B (NF- κB) pathway

NF- κB transcription factors are important regulators of cellular survival, proliferation,
differentiation, and acquired and innate immune responses(Bonizzi and Karin, 2004;
Pomerantz and Baltimore, 2002).A host of stimuli activate the NF- κB pathway, including
inflammatory cytokines, viral and bacterial infections, oxidative and DNA-damaging
agents, UV light, and osmotic shock(Bonizzi and Karin, 2004; Pomerantz and Baltimore,
2002). Five subunits of NF- κB(RelA/p65, c-Rel, RelB, p50, and p52) have been
described that bind to DNA as homodimer or heterodimer with each binding to half of a
conserved 10-base pair consensus sequence (GGGRNWTYCC)(Bonizzi and Karin, 2004;
Pomerantz and Baltimore, 2002).The subunits p50,cRel,RelA are found in most cells,
while p52 and p50 are found in few differentiated cells(Bonizzi and Karin, 2004;
Pomerantz and Baltimore, 2002). The classical NF- κB complex is a heterodimer of the
RelA/p65 and p50 subunits NF- κB. This complex is found in an inactive state in the
cytoplasm of most cells due to its association with a family of inhibitory proteins, called I
κBs, of which the most common is I κB α(Bonizzi and Karin, 2004; Pomerantz and
Baltimore, 2002). In the canonical (classical) NF- κB pathway, stimulation by a number
of cytokines, such as TNF α and IL-1, results in phosphorylation of I κB α on serine 32 and
36 residues, leading to its ubiquitination
and proteosomal-mediated degradation, releasing the NF- κB subunits.

2

The released NF- κB subunits then translocate to the nucleus and activate their

downstream target genes. The phosphorylation of I κB α is carried out by a multiprotein
kinase complex, called I kappaB kinase (IKK) complex, which has

two catalytic subunits, IKK1/IKK α and IKK2/IKK β, and a regulatory subunit

called NEMO/IKK γ(Bonizzi and Karin, 2004; Pomerantz and Baltimore, 2002). The
alternate (or non-canonical) pathway of NF- κB activation was described and

involves proteasome-mediated processing of p100/NF- κB2 into p52 subunit that

culminates in kinetically slower nuclear translocation of the p52-RelB NF- κB

Figure 1: Crosstalk of NF- κB signaling

3

complex (Sun, 2010).The alternate NF- κB activation is critically dependent on

IKK α/IKK1 (Fig 1) (Bonizzi and Karin, 2004; Pomerantz and Baltimore, 2002).

NF- κB and cancer

NF- κB activation has been shown to play a role in development of cancer (Bonizzi and
Karin, 2004; Pomerantz and Baltimore, 2002). In particular, cRel amplification is seen in
Hodgkin's lymphomas and certain forms of B-cell lymphomas. Moreover, v-rel, a viral
homolog of c-Rel causes aggressive tumors in chickens. Ras which is found to be active
in most tumors activates the NF- κB pathway(Clement et al., 2008). NF- κB activates the
anti-apoptotic machinery by producing caspase inhibitors like (TRAF1 and TRAF2,
cIAP1, XIAP) and mitochondria membrane stabilizing proteins, such as Mcl-1 and Bcl-
XL.(Bonizzi and Karin, 2004; Pomerantz and Baltimore, 2002)

NF- κB tumor progression

Among the six hallmarks of cancer NF- κB is directly involved in three hallmarks,

namely metastasis, angiogenesis and invasiveness(Clement et al., 2008). NF- κB was
shown to regulate the expression of the adhesion molecules ICAM-I, VCAM-

l and E-Selectin. NF- κB is essential for epithelial-mesenchymal transition and

metastasis of tumor cells. NF- κB causes increased expression of chemokine

receptor CXCR4, causing metastasis(Clement et al., 2008). NF- κB also increases the
expression of metalloproteases MMP2 and 9.These metalloproteases cause the
degradation of extracellular matrix and hence the tumor cells can enter circulation

4

thus causing metastasis. NF- κB increases tumor angiogenesis by at lea mechanisms.
Firstly, it induces the expression of the chemokine Growth Regulated Oncogene-
alpha (Gro- ɑ) and, secondly, of cyclooxygenase 2.The continuous expression of Gro-
alpha by NF- κB causes growth of microvessels into the tumor(Clement et al., 2008).

Fig. 2 Schematic model of RNA virus-triggering of the RIG-
I/MAVS signaling pathway (Hiscott, 2007)

5

IKK related kinases The structure of IKK1/IKK α and IKK2/IKK β have been
determined and they are shown to contain an N-terminal catalytic kinase domain (KD), a
more central leucine zipper (LZ) and helix loop helix (HLH) domain, and a C-terminal
NEMO-binding domain (NBD)(Fitzgerald et al., 2003).Based on sequence similarities
with IKK α and IKK β, two IKK-related kinases, IKK ε (also known as IKK-inducible or
IKK-i) and TANK binding kinase 1 (TBK1), were discovered (Bonnard et al., 2000;
Tojima et al., 2000). IKK ε is predominantly expressed in spleen, thymus, pancreas and
peripheral blood leucocytes(Clement et al., 2008). It is virus activated kinase and helps to
form anti-viral environment. IKK ε is expressed in response to various NF- κB induced
cytokines and viral infection or exposure to LPS (Verhelst et al., 2013). IKK ε
phosphorylates on serine 36 of I κB inhibitor and activates the NF- κB

pathway(Peters et al., 2000). IKK ε and TBK1 both phosphorylate serine 536 of

p65/RelA subunit, activating the NF- κB pathway (Buss et al., 2004). IKK ε can also
activate the transcription of various interferon genes by phosphorylating IRF3 and IRF7,
causing their heterodimerization and translocation to the nucleus(Fitzgerald et al., 2003).
IKK ε is also involved in activation of JAK – STAT pathway(Ng et al., 2011). IKK ε also
acts as a link between AKT/PI3K pathway and MEK pathway, causing cellular
transformation(Clement et al., 2008).
6

TRAF2/cIAP1/cIAP2

TRAF2 is the most widely expressed member of TRAF (TNF Receptor

Associated Factor) family and is involved in NF- κB and MAPK pathways(Sun,
2010).Oligomerization of TRAF2 and RIP (Receptor Interacting Protein) causes

activation of classical NF- κB pathway by directly acting on IKK’s. TRAF2 works with
cIAPs to prevent TNF mediated apoptosis by inhibiting caspases(Cabal-Hierro and Lazo,
2012). TRAF2 along with cIAP1/2 is also known to inhibit the alternative NF- κB
pathway by degrading protein kinase NIK (NF- κB inducing kinase)(Sun, 2010).

Caspases

Caspases are cysteine proteases that are key mediators of cell death or apoptosis. They
are synthesized as zymogens containing N terminal prodomains. The prodomains of
caspases can be small (e.g.caspase 6 and 7) or large (caspase 8 and 10).Caspases with
large prodomains, such as caspase 8 and 10, initiate apoptosis and are called initiator
caspases and the ones with small prodomains(e.g. caspase 3, 6 and 7) are executionary
caspases since they execute the apoptotic process. Two homologous Death Effector
Domains (DED) are found in the prodomains of caspase 8 and 10 and are used to interact
with other molecules having DED domains, such as adaptor molecule FADD (Fas
Associated Death Domain)(Earnshaw et al., 1999; Li et al., 1998).

7

Kaposi’s sarcoma associated herpesvirus

KSHV, also known as human herpesvirus 8 (HHV8), was originally isolated from a
patient with AIDS-associated Kaposi’s sarcoma and is now known to be associated with
all clinicoepidemiologic forms of KS (AIDS-associated, classical, endemic and
iatrogenic)(Chang et al., 1994).KSHV genomes are also consistently associated with two
distinct lymphoproliferative disorders: primary effusion lymphoma (PEL) and
Multicentric Castleman’s disease (MCD). The prognosis of KSHV associated
lymphoproliferative disorders is generally extremely poor, and median survival of
patients with PEL does not exceed 3 months in most reported studies(Boulanger et al.,
2003; Boulanger et al., 2004; Nador et al., 1996). In addition, most patients with KSHV-
associated lymphoproliferative disorders are not candidates for aggressive chemotherapy
or chemo-immunotherapy because of HIV-induced immunosuppression and poor
performance status (Spina et al., 2005; Straus, 2005;Thirlwell et al., 2003). Thus, there is
an urgent need for novel molecularly targeted therapies in KSHV-associated
lymphoproliferative disorders. The KSHV genome contains a vFLIP (viral FLICE
inhibitory Protein), encoded by the open reading frame K13, which is one of the few viral
proteins to be expressed in latently-infected KS spindle cells and PEL cell lines and
therefore, is a prime candidate for causing cellular transformation associated with KSHV
infection. Based on its structural homology to the prodomain of caspase 8/FLICE, K13
was originally believed to be an inhibitor of caspase 8/FLICE (hence the name vFLIP).
8

However, subsequent work from our laboratory and others demonstrated that K13
possesses the unique ability to activate the NF- κB pathway by interacting with
NEMO/IKK γ, the regulatory subunit of a ~700-kDa I κB kinase (IKK) complex.
Moreover, K13 leads to increased cellular proliferation, transformation, cytokine
secretion and protection against growth factor withdrawal-induced apoptosis through
NF- κB activation, and independent of caspase 8/FLICE inhibition. These results have
helped to identify the NF- κB pathway as an attractive therapeutic target for KSHV-
associated malignancies.

However, NF- κB pathway plays a key role in lymphocyte development and immune and
inflammatory responses, and its global inhibition results in lymphocyte depletion and
immunodeficiency(Doffinger et al., 2001; Nagashima et al., 2006; Pasparakis et al., 2002;
Schmidt-Supprian et al., 2003). Therefore, the overall goal of this project is to use a
functional genomic approach, involving shRNA-mediated gene silencing, to identify key
genes of NF- κB and cell death pathways that are required for the survival and
proliferation of PEL cells.

9

V.MATERIALS AND METHODS

Cell lines and reagents

PEL cells (BC-3) were obtained from ATCC (Manassas,VA) and were cultured in a
humidified 5% CO
2
environment at 37°C in RPMI 1640 medium supplemented

with 20% FBS (Foundation, Gemini), 1% penicillin/streptomycin (Mediatech), and 1%
L-Glutamine (Mediatech). PEL cells expressing sh-RNAs were cultured under identical
conditions as parental cells. 293FT cells were grown in DMEM supplemented with 10%
FBS (Gibco), 1% penicillin/streptomycin, 1% L-Glutamine, and 25 mM HEPES buffer
(Mediatech) in a humidified 5% CO
2
environment at 37°C. Trypsin (Mediatech) was
used to passage adherent 293FT cells.

Lentiviral constructs

For generation of sh-RNA encoding lentiviral vectors, sh-RNA oligonucleotides (Table
1) directed against target genes were designed using the sh-RNA design tool available at
the Broad Institute (http://www.broadinstitute.org/rnai/public/seq/search)website. The
annealed oligonucleotides were cloned into the AgeI and EcoRI sites of a modified pENT
entry vector downstream of a tetracycline-inducible H1 promoter (H1/TO). The cassette
containing the H1/TO promoter along with the sh-RNA hairpin was concatenated as
illustrated in Figure 3 so as to result in eight copies of the H1/TO-
10

shRNA cassettes in each vector. Recombination based sub-cloning (Figure 3) was

attL H1/T shRN

att

1 O A-1 L2

Cloning: concatamerization

attL

H1/T

shRN

H1/T shRN

att

1 O A-1 O A-8 L2

LR recombination

5’L FLA att att Ubi rtT IR
Neo
WR 3’SIN

TR

P R1

R2 -c A3

ES

E

LTR

+DOX

5’L FLA att H1/T shRN H1/T shRN att Ubi rtT IR
Neo
WR 3’SIN

TR P B1 O A-1

O A-8 B2 -c A3 ES E

LTR

Fig 3. Design and construction of shRNA targeted against NF- κB

used to transfer the concatenated H1/TO-shRNA cassettes into pSLIK destination vector
(Shin et al., 2006). 293FT cells were used for virus production by CaCl
2

transfection of viral packaging plasmids pLP1, pLP2 and pLP/VSVG together with the
respective lentiviral expression vectors. Supernatants were harvested 48 hours post
transfection and filtered through a 0.45 ∝m filter (Millipore). Packaged virus along with
polybrene (8 ∝g/mL) was then used to infect PEL cells and positive clones were selected
with G418. Doxycycline(Sigma) was used to induce the expression of
shRNAs(Oeckinghaus et al., 2011).

11

Table 1. Sequence of oligonucleotides
1
used for shRNA cassette construction

Target Forward Oligo Reverse Oligo
Gene
IKK1-2753 CCGGGCTGCTCACAAGTTCTATTTC AATTCAAAAAGCTGCTCACAAGTTCT
CTCGAGGAAATAGAACTTGTGAGC ATTTCCTCGAGGAAATAGAACTTGTG
AGCTTTTTG AGCAGC
IKK2-1107 CCGGGCTGGTTCATATCTTGAACAT AATTCAAAAAGCTGGTTCATATCTTG
CTCGAGATGTTCAAGATATGAACCA AACATCTCGAGATGTTCAAGATATGA
GCTTTTTG ACCAGC
NEMO-592 CCGGGCTCGATCTGAAGAGGCAGA AATTCAAAAAGCTCGATCTGAAGAGG
ACTCGAGTTCTGCCTCTTCAGATCG CAGAACTCGAGTTCTGCCTCTTCAGAT
AGCTTTTTG CGAGC
IKK ε-941 CCGGGAGCATTGGAGTGACCTTGTA AATTCAAAAAGAGCATTGGAGTGACC
CTCGAGTACAAGGTCACTCCAATGC TTGTACTCGAGTACAAGGTCACTCC
TCTTTTTG ATGCTC
IKK ε-1628 CCGGTGGGCAGGAGCTAATGTTTCG AATTCAAAAATGGGCAGGAGCTAATG
CTCGAGCGAAACATTAGCTCCTGCC TTTCGCTCGAGCGAAACATTAGCTCCT
CATTTTTG GCCCA
TRAF2-1362 CCGGCGACCAGAATAACCGGGAGC AATTCAAAAACGACCAGAATAACCGG
ACTCGAGTGCTCCCGGTTATTCTGG GAGCACTCGAGTGCTCCCGGTTATTCT
TCGTTTTTG GGTCG
cIAP1 – 3398 CCGGGCCGAATTGTCTTTGGTGCTT AATTCAAAAAGCCGAATTGTCTTTGG
CTCGAGAAGCACCAAAGACAATTC TGCTTCTCGAGAAGCACCAAAGACAA
GGCTTTTTG TTCGGC
cIAP1 -2714 CCGGGCTGCGGCCAACATCTTCAA AATTCAAAAAGCTGCGGCCAACATCT
ACTCGAGTTTGAAGATGTTGGCCG TCAAACTCGAGTTTGAAGATGTTGGC
CAGCTTTTTG CGCAGC
cIAP2 -4821 CCGGGCACTACAAACACAATATTC AATTCAAAAAGCACTACAAACACAAT
ACTCGAGTGAATATTGTGTTTGTA ATTCACTCGAGTGAATATTGTGTTTGT
GTGCTTTTTG AGTGC
cIAP2- 4575 CCGGCAGTTCGTACATTTCTTTCAT AATTCAAAAACAGTTCGTACATTTCTT
CTCGAGATGAAAGAAATGTACGAA TCATCTCGAGATGAAAGAAATGTACG
CTGTTTTTG AACTG
Casp8-552 CCGGAGGAGTTGTGTGGGGTAATTTCAAGAGAA AATTCAAAAAGGAGGAGTTGTGTGGG
TTACCCCACACAACTCCTCCTTTTTG GTAATTCTCTTGAAATTACCCCACACA
CCGGAGCATCTGCTAACACTCTAATTCAAGAGA ACTCCT
Casp10-1192 TTAGAGTGTTAGCAGATGCTCTTTTTG AATTCAAAAAGAGCATCTGCTAACAC
CCGGCTTCAGTTGTGCAGATAACAGCTCGAGCT TCTAATCTCTTGAATTAGAGTGTTAGC
GTTATCTGCACAACTGAAGTTTTTG AGATGCT
cRel-1875 CCGGGCAGAACGTAGATTAGCTTATCTCGAGAT AATTCAAAAACTTCAGTTGTGCAGAT
AAGCTAATCTACGTTCTGCTTTTTG AACAGCTCGAGCTGTTATCTGCACAAC
TGAAG
TBK1-1773 AATTCAAAAAGCAGAACGTAGATTAG
CTTATCTCGAGATAAGCTAATCTACGT
TCTGC

1
shRNA sequences were designed by using the online software available on the
RNAi consortium website hosted by the Broad Institute/MIT at
http://www.broadinstitute.org/

12

Cell viability Assays

Logarithmically growing PEL cells expressing lentiviral sh-RNA constructs were
counted using trypan blue exclusion (Gibco) and plated at a density of 5,000 cells/well in
a 96-well plate. Subsequently these PEL cells were treated with increasing doses of
Doxycycline for indicated periods of time. The cell viability was assessed using the MTS
reagent (3-4,5-dimethylthiazol-2yl)-5-(3-carboxy-methoxyphenyl)-2-(4-sulfophenyl)-2H-
tetrazolium, inner salt) following the manufacturer's instructions (Promega). A Bio-Tek
plate reader was used to record the absorbance values of experimental wells at 490 nm.
Percent cell survival was calculated based on the reading of untreated cells set as 100%.
Each graph/figure represents one of two/three independent experiments.

Western blots

PEL cells expressing lentiviral shRNA constructs were treated with increasing doses of
Doxycycline for indicated periods, cell pellets were harvested, washed with PBS and re-
suspended in mRIPA buffer (50 mM Tris-Cl, 150 nMNaCl, 1% NP-40, 10% glycerol,
PMSF and protease inhibitor cocktail tablets). 40 ∝g of whole cell extracts were boiled in
the presence of SDS sample buffer and loaded onto an 8% SDS-PAGE gel followed by
nitrocellulose membrane (Whatman) transfer. Membranes were blocked in 5% milk and
incubated with primary and secondary antibodies. Primary antibodies used in these
experiments are listed in Table 2. Membrane blots were either developed with
SuperSignal chemiluminescent reagents (ThermoScientific) followed by x-ray film
exposure and development or by Odyssey Infrared Imaging System CLx (Li-
13

Cor Biosciences). For Odyssey system, the secondary antibodies, IRDye
800CW/680CW conjugates of goat anti-rabbit IgG (Li-Cor), goat anti-mouse IgG (Li-
Cor), or rabbit-anti-goat IgG (Li-Cor) were used at a 1:10,000 dilution for detection
of antibody targets in the 800-nm and 700-nm channels. The blots were scanned and
analyzed using an Odyssey Infrared scanner using Odyssey imaging software, version
3.1.

Table 2. Primary antibodies used in this study

Antibody Description Dilution Source Reference

IKK1 Rabbit polyclonal 1: 1000 Santa Cruz Biotech
IKK2 Goat polyclonal 1: 1000 Santa Cruz Biotech
NEMO Rabbit polyclonal 1:10000 Santa Cruz Biotech
GAPDH Mouse monoclonal 1:10000 Ambion
TBK1 Rabbit polyclonal 1:10000 Santa Cruz Biotech
cIAP1 Goat polyclonal 1:1000 R&D Systems
cIAP1 Goat polyclonal 1:1000 R&D Systems
TRAF2 Rabbit polyclonal 1: 10000 Santa Cruz Biotech
cREL Rabbit polyclonal 1: 1000 Santa Cruz Biotech
Caspase 8 Mouse monoclonal 1: 10000 Cell Signaling
IKK ε Rabbit 1: 1000 Cell Signaling

14

VI .RESULTS

Generation of doxycycline-inducible shRNA expressing lentiviral vectors

RNA interference (RNAi) is an evolutionarily conserved mechanism of sequence-specific
silencing of specific genes that is mediated by double stranded RNA molecules which
match the sequence of the target gene(Sharp, 1999, 2001). Subsequently, it was
demonstrated that transfection of synthetic 21-nt siRNA duplexes can effectively inhibits
endogenous genes in mammalian cells a sequence-specific manner(Elbashir et al.,
2001).Several groups described viral vectors for stable expression of siRNA within
mammalian cells that rely on DNA vectors(Brummelkamp et al., 2002; Lee et al., 2002;
Miyagishi and Taira, 2002; Paddison et al., 2002; Paul et al., 2002; Sui et al., 2002). In
general, these vectors use a RNA polymerase III (Pol III) promoter to constitutively
express a small hairpin RNA which is efficiently processed into siRNAs inside the cells.
RNA interference mediated gene silencing has emerged as a powerful approach to study
the roles of genes in various biological processes. A potential problem with the use of
RNAi to identify genes that are essential for the survival and proliferation of mammalian
cells is that silencing of these genes would be toxic to the cells. To overcome this
limitation, we used a doxycycline-inducible lentiviral system to

conditionally express shRNAs targeting different genes involved in NF- κB and cell death
pathways in PEL cells.

We began by using the shRNA design tool available at the Broad Institute
Website (http://www.broadinstitute.org/rnai/public/seq/search)

to design shRNA
oligonucleotides against 11 genes involved in NF- κB and cell death pathways.

15

The targeted genes and sequence of the forward and reverse oligonucleotides are shown
in Table 1. The oligonucleotides were designed so as to lead to generation of 5’ and 3’
overhangs compatible with AgeI and Eco RI sites, respectively, upon annealing. The
oligonucleotides were synthesized using a commercial vendor (Invitrogen) and, following
annealing, cloned into the AgeI and EcoRI sites of a modified pENT entry vector
downstream of a tetracycline-inducible H1 promoter (H1/TO). Several clones were
picked and the sequence confirmed by automated sequencing. Once a construct with the
correct shRNA was identified, the cassette containing the H1/TO promoter along with the
shRNA hairpin was concatenated as illustrated in Figure 3 so as to result in eight copies
of the H1/TO-shRNA cassettes in each vector. Recombination based sub-cloning (Fig3)
was used to transfer the concatenated H1/TO-shRNA cassettes into pSLIKlentiviral
destination vector. A pSLIKlentiviral vector containing scrambled shRNA sequence was
constructed similarly to serve as a control. After confirming the sequences of the
resulting vectors by automated sequencing, lentiviruses were generated using the 293FT
cells and used to infect the PEL derived BC3 cell line. Selection with G418 was used to
select polyclonal population of lentiviral transduced cells. Using the above strategy, we
were able to successfully generate stable polyclonal population of BC3 cells expressing
all 11shRNAs.

Effect of induction of shRNA expression on survival of BC3 cells

To study the effect of expression of shRNA targeting the different genes on the survival
and proliferation of BC3 cells, logarithmically growing five thousand

16

cells expressing the scrambled control vector or shRNA targeting the different

genes were plated in a 96 well plate. The cells were treated in triplicate with

increasing concentrations of doxycycline for 3 days or left untreated. Cell

viability was measured using an MTS based assay. As shown in Figure 4, we

observed a robust reduction in cell viability upon treatment with doxycycline in

BC3 cells expressing IKK ε-1628 shRNA. This effect was visible at the lowest

doxycycline concentration (62.5 ng/ml) tested, which had no significant effect on

the scrambled shRNA expressing cells. Treatment of BC3-IKK ε-1628 shRNA

expressing cells with increasing concentrations of

Fig 4.shRNA mediated knock-down of NF- κB pathway associated proteins is toxic to
BC-3 cells. BC-3 cells were transduced with tetracycline-inducible H1 promoter
(H1/TO)-driven shRNAs for the respective genes. The cells were treated with increasing
doses of doxycycline for 3 days and the cell viability was measured by MTS assay. The
values shown are mean±SD of an experiment carried out in triplicate.

17

doxycycline resulted in a dose-dependent decline in cell viability. Although higher
concentration of doxycycline resulted in modest reduction in cell viability even in the
scrambled shRNA expressing cells, presumably reflecting an off-

target effect or non-specific toxicity, BC3-IKK ε-1628 cells showed greater

reduction in cell viability at all concentrations tested (Fig. 4). Similar to IKK ε-

1628, BC3 cells expressing IKK ε-941 shRNA showed a major reduction in cell viability
as compared to the scrambled shRNA expressing cells at all concentrations of
doxycycline.
We also tested the effect of shRNAs targeting IKK1/IKK α, IKK2/IKK β,

NEMO/IKK γ and TBK1 on the survival of BC3 cells. As shown in Figure 4, treatment of
BC3 cells expressing IKK1-2753, IKK2-1107, NEMO-592 and TBK1-1173shRNAs
resulted in significant reduction in cell viability upon treatment with doxycycline.

IKK ε is known to induce the nuclear translocation of NF- κB subunit c-

Rel. Based on the strong reduction in cell viability upon silencing of IKK ε, we next asked
if down-regulation of c-Rel would also adversely affect the viability of BC3 cells. As
shown in Figure 4, BC3 cells expressing c-Rel-1875 shRNA showed significant reduction
in cell viability upon treatment with doxycycline at all tested doses.

TRAF2 is the most widely expressed TRAF family member and is known to
affect multiple signaling pathways, including cell death, classical and

alternative NF- κB and MAPK pathways. As shown in Figure 4, BC3 cells

18

expressing both TRAF2 1362shRNAshowed significant reduction in cell viability in a
dose-dependent manner upon treatment with doxycycline as compared to scrambled
shRNA expressing cells.

cIAP1 and cIAP2 are important players in the regulation of cell death and

classical and alternative NF- κB pathways. We generated two shRNA constructs targeting
cIAP1 and cIAP2 each. BC3 cells expressing cIAP1 shRNA 2714 and 3398 showed a
modest decline in cell viability upon treatment with doxycycline. In the case of cIAP2,
BC3 cells expressing cIAP2 shRNA 4575 and 4821 showed significant effect on cell
viability.

Caspase 8 and 10 are initiator caspases in the death receptor induced

apoptotic cascade but have been also implicated in the activation of NF- κB pathway. As
shown in Figure 4, BC3 cells expressing shRNAs targeting Caspase 8 and 10 showed
significant reduction in cell viability upon treatment with doxycycline as compared to the
scrambled shRNA expressing cells.

Effect of shRNAs on protein expression

To examine if the reduction in cell viability upon treatment with doxycycline was
associated with down-regulation of the targeted gene, we carried out Western analyses.
BC3 cells expressing the different shRNA were treated with doxycycline (500 ng/ml) for
3 days after which cell lysates were prepared for Western blot. As shown in Figure 5, we
observed significant reduction in the expression of cRel upon treatment with doxycycline
in BC3-shRNA cRel 1875 expressing cells. In contrast doxycycline had no significant
effect on the expression of cRel in scrambled shRNA expressing BC3 cells. Similarly,

19

doxycycline treatment led to significant reduction in TRAF2 expression in shRNA
TRAF2 expressing cells. However, we did not observe a significant

difference in the expression of IKK1/IKK α, IKK2/IKK β, NEMO/IKK γ, TBK1, cIAP1/2,
caspase 8 and caspase 10 upon expression of their corresponding shRNA constructs
following treatment with doxycycline.

20

Fig 5. Western blot analysis respective shRNA transduced BC-3 cells. A, The cells were
treated with doxycycline (500ng/ml) for indicated time periods. B-J, The cells were
treated with doxycycline (500ng/ml) for 3 days after that the cells were lysed using RIPA
buffer on ice and the cleared whole cell lysates were blotted for the respective proteins.
A- IKK ε, B– TBK1, C-IKK1, D- IKK2, E- NEMO, F- cRel, G- TRAF2, H-cIAP1, I-
cIAP2 and J- Caspase8.

21

BC3 cells expressing Tet-inducible shRNAs develop resistance to shRNAs-

induced loss of cell viability upon continuous culture

Even though BC3 cells expressing the different shRNAs initially showed

robust reduction in cell viability upon treatment with doxycycline, they failed to

show effective silencing of the targeted protein by Western blot (Fig 5). A

possible explanation for the discrepancy between the two studies was that

shRNA-expressing BC3 cells were initially sensitive to the knock down of the

targeted proteins but grew resistant to this effect upon continuous long term in

vitro culture due to the over-growth of subclones that were resistant to the effect

Fig 6. Prolonged culturing of lentiviralshRNA transduced cells resulted in the loss of the
associated phenotype upon doxycycline induction with the exception of shTRAF2. BC-3
cells transduced with tetracycline-inducible H1 promoter (H1/TO)-driven shRNAs for the
respective genes. The cells were treated with increasing doses of doxycycline for 3 days
and the cell viability was measured by MTS assay. The values shown are mean±SD.

22

of shRNAs. To test this hypothesis, we repeated the cell viability studies. In contrast to
the original results, we observed that BC3 cells expressing shRNA against TBK1, IKK1,
IKK2,cRel, cIAP1, cIAP2, caspase 8 and caspase 10 failed to show significant effect on
cell viability upon treatment with doxycycline as compared to the scrambled shRNA
expressing cells (Fig 6). There was modest reduction in cell viability upon treatment with
doxycycline in BC3 cells expressing shRNA against TRAF2.Taken collectively, these
results support the hypothesis that long term culture of shRNA expressing cells can result
in loss of phenotype even in cases where shRNAs are expressed from a tetracycline-
inducible promoter.

23

VII. DISCUSSION

RNA interference is a powerful approach to identify genes that are essential for
the survival and proliferation of cells. In this study, we used this approach to identify
genes belonging to the NF- κB and cell death pathways that are essential for the viability
of PEL cells. We targeted 11 genes with 14shRNA constructs. There are two main
problems with the use of shRNA vectors for knock down of genes for functional
genomics studies. First, shRNA vectors are notorious for incomplete gene knock down,
which may result ina lack of clear phenotypedue to significant residual expression of the
targeted protein. Second, in the case the targeted gene/protein is essential for cell survival
or proliferation; its constitutive knock-down would result in the death of the cells that
show effective knock-down or their overgrowth by cells with incomplete knockdown. To
circumvent these problems, we used a unique lentiviral system that allowed us to achieve
effective gene silencing in an inducible manner. We used a lentiviral vector system which
included multiple cassettes of Tet-inducible H1 promoter (H1/TO)-driven shRNAs in a
single vector (Fig 3). The main advantages of this vector system include 1) use of a single
vector for delivery of Tet transactivating components (e.g. rtTA3) and Tet-inducible
shRNAs cassette that obviates cumbersome multiple rounds of viral infection or
generation of rtTA3-expressing cell lines; 2) flexibility to include multiple shRNAs
cassette targeting a single region of a gene, different regions of a single gene or different
genes; and 3) Gateway compatibility allowing easy transfer of shRNA cassettes into
lentiviral vectors with different selection markers.
24

Using the above approach, we successfully generated stable polyclonal
populations of BC3 cells expressing Tet-inducible H1 promoter (H1/TO)-driven shRNAs
constructs against multiple genes. In our initial functional assay, treatment with
doxycycline reduced the viability of BC3 cells expressing all shRNA constructs as
compared to scrambled shRNA expressing cells (Fig 4). However, we could observe
effective knock down at the protein level in the case of only a two shRNA constructs (Fig
5). A possible explanation for our inability to observe effective knock-down at the protein
level by most shRNA constructs is low-level leaky expression of the shRNAs in the
absence of the drug (i.e. doxycycline or tetracycline) that led to the eventual overgrowth
of cultures by clones that were resistant to the effect of shRNA. A support for this
hypothesis is provided by our repeat viability assay conducted on late passage cells. In
contrast to the first assay, this repeat assay showed that BC3 cells expressing most
shRNA constructs had become resistant to the effect of doxycycline (Fig 6). Thus, even
though we used an inducible system to express the shRNAs, it could not prevent the
overgrowth of culture by clones that were resistant to the effect of shRNAs. To
circumvent this problem, future studies should include use of early passage cells and use
of Tetracycline-free serum and culture conditions for the growth of cells.

In this study, we have identified several genes belonging to the NF- κB and cell
death pathways that are required for the survival of PEL cells. Pharmacological
compounds targeting a number of these genes have been described and should be
explored for the treatment of PEL.

25

VIII. References

1. Bonizzi, G., and Karin, M. (2004). The two NF-kappaB activation pathways and their
role in innate and adaptive immunity. Trends Immunol 25, 280-288.

2. Bonnard, M., Mirtsos, C., Suzuki, S., Graham, K., Huang, J., Ng, M., Itie, A., Wakeham,
A., Shahinian, A., Henzel, W.J., et al. (2000). Deficiency of T2K leads to apoptotic liver
degeneration and impaired NF-kappaB-dependent gene transcription. Embo J 19, 4976-
4985.

3. Boulanger, E., Daniel, M.T., Agbalika, F., and Oksenhendler, E. (2003). Combined
chemotherapy including high-dose methotrexate in KSHV/HHV8-associated primary
effusion lymphoma. Am J Hematol 73, 143-148.

4. Boulanger, E., Hermine, O., Fermand, J.P., Radford-Weiss, I., Brousse, N., Meignin, V.,
and Gessain, A. (2004). Human herpesvirus 8 (HHV-8)-associated peritoneal primary
effusion lymphoma (PEL) in two HIV-negative elderly patients. Am J Hematol 76, 88-
91.

5. Brummelkamp, T.R., Bernards, R., and Agami, R. (2002). A System for Stable
Expression of Short Interfering RNAs in Mammalian Cells. Science 296, 550-553.

6. Buss, H., Dorrie, A., Schmitz, M.L., Hoffmann, E., Resch, K., and Kracht, M. (2004).
Constitutive and interleukin-1-inducible phosphorylation of p65 NF-{kappa}B at serine
536 is mediated by multiple protein kinases including I{kappa}B kinase (IKK)-{alpha},
IKK{beta}, IKK{epsilon}, TRAF family member-associated (TANK)-binding kinase 1
(TBK1), and an unknown kinase

26

and couples p65 to TATA-binding protein-associated factor II31-mediated

interleukin-8 transcription. J Biol Chem 279, 55633-55643.

7. Cabal-Hierro, L., and Lazo, P.S. (2012). Signal transduction by tumor necrosis factor
receptors. Cellular signalling 24, 1297-1305.

8. Chang, Y., Cesarman, E., Pessin, M.S., Lee, F., Culpepper, J., Knowles, D.M., and
Moore, P.S. (1994). Identification of herpesvirus-like DNA sequences in AIDS-
associated Kaposi's sarcoma. Science 266, 1865-1869.

9. Clement, J.F., Meloche, S., and Servant, M.J. (2008). The IKK-related kinases: from
innate immunity to oncogenesis. Cell Res 18, 889-899.

10. Doffinger, R., Smahi, A., Bessia, C., Geissmann, F., Feinberg, J., Durandy, A., Bodemer,
C., Kenwrick, S., Dupuis-Girod, S., Blanche, S., et al. (2001). X-linked anhidrotic
ectodermal dysplasia with immunodeficiency is caused by impaired NF-kappaB
signaling. Nat Genet 27, 277-285.

11. Earnshaw, W.C., Martins, L.M., and Kaufmann, S.H. (1999). Mammalian caspases:
structure, activation, substrates, and functions during apoptosis. Annu Rev Biochem 68,
383-424.

12. Elbashir, S.M., Harborth, J., Lendeckel, W., Yalcin, A., Weber, K., and Tuschl, T.
(2001). Duplexes of 21-nucleotide RNAs mediate RNA interference in cultured
mammalian cells. Nature 411, 494-498.

13. Fitzgerald, K.A., McWhirter, S.M., Faia, K.L., Rowe, D.C., Latz, E., Golenbock, D.T.,
Coyle, A.J., Liao, S.M., and Maniatis, T. (2003). IKKepsilon and TBK1 are essential
components of the IRF3 signaling pathway. Nat Immunol 4, 491-496.

27

14. Hiscott, J. (2007). Convergence of the NF-kappaB and IRF pathways in the regulation of
the innate antiviral response. Cytokine Growth Factor Rev 18, 483-490.

15. Lee, N.S., Dohjima, T., Bauer, G., Li, H., Li, M.J., Ehsani, A., Salvaterra, P., and Rossi,
J. (2002). Expression of small interfering RNAs targeted against HIV-1 rev transcripts in
human cells. Nature Biotechnology 20, 500-505.

16. Li, H., Zhu, H., Xu, C.J., and Yuan, J. (1998). Cleavage of BID by caspase 8 mediates
the mitochondrial damage in the Fas pathway of apoptosis. Cell 94, 491-501.

17. Miyagishi, M., and Taira, K. (2002). U6 promoter-driven siRNAs with four uridine 3'
overhangs efficiently suppress targeted gene expression in mammalian cells.[comment].
Nature Biotechnology 20, 497-500.

18. Nador, R.G., Cesarman, E., Chadburn, A., Dawson, D.B., Ansari, M.Q., Sald, J., and
Knowles, D.M. (1996). Primary effusion lymphoma: a distinct clinicopathologic entity
associated with the Kaposi's sarcoma-associated herpes virus. Blood 88, 645-656.

19. Nagashima, K., Sasseville, V.G., Wen, D., Bielecki, A., Yang, H., Simpson, C., Grant,
E., Hepperle, M., Harriman, G., Jaffee, B., et al. (2006). Rapid TNFR1-dependent
lymphocyte depletion in vivo with a selective chemical inhibitor of IKKbeta. Blood 107,
4266-4273.

20. Ng, S.L., Friedman, B.A., Schmid, S., Gertz, J., Myers, R.M., Tenoever, B.R., and
Maniatis, T. (2011). IkappaB kinase epsilon (IKK(epsilon)) regulates the balance

28

between type I and type II interferon responses. Proc Natl Acad Sci U S A 108,

21170-21175.

21. Oeckinghaus, A., Hayden, M.S., and Ghosh, S. (2011). Crosstalk in NF-kappaB signaling
pathways. Nat Immunol 12, 695-708.

22. Paddison, P.J., Caudy, A.A., and Hannon, G.J. (2002). Stable suppression of gene
expression by RNAi in mammalian cells. Proc Natl Acad Sci U S A 99, 1443-1448.

23. Pasparakis, M., Schmidt-Supprian, M., and Rajewsky, K. (2002). IkappaB kinase
signaling is essential for maintenance of mature B cells. J Exp Med 196, 743-752.

24. Paul, C.P., Good, P.D., Winer, I., and Engelke, D.R. (2002). Effective expression of
small interfering RNA in human cells.[comment]. Nature Biotechnology 20, 505-508.

25. Peters, R.T., Liao, S.M., and Maniatis, T. (2000). IKKepsilon is part of a novel PMA-
inducible IkappaB kinase complex. Mol Cell 5, 513-522.

26. Pomerantz, J.L., and Baltimore, D. (2002). Two pathways to NF-kappaB. Molecular Cell
10, 693-695.

27. Schmidt-Supprian, M., Courtois, G., Tian, J., Coyle, A.J., Israel, A., Rajewsky, K., and
Pasparakis, M. (2003). Mature T cells depend on signaling through the IKK complex.
Immunity 19, 377-389.

28. Sharp, P.A. (1999). RNAi and double-strand RNA. Genes & Development 13, 139-141.

29. Sharp, P.A. (2001). RNA interference--2001. Genes & Development 15, 485-490.

29

30. Shin, K.J., Wall, E.A., Zavzavadjian, J.R., Santat, L.A., Liu, J., Hwang, J.I., Rebres, R.,
Roach, T., Seaman, W., Simon, M.I., et al. (2006). A single lentiviral vector platform for
microRNA-based conditional RNA interference and coordinated transgene expression.
Proc Natl Acad Sci U S A 103, 13759-13764.

31. Spina, M., Jaeger, U., Sparano, J.A., Talamini, R., Simonelli, C., Michieli, M., Rossi, G.,
Nigra, E., Berretta, M., Cattaneo, C., et al. (2005). Rituximab plus infusional
cyclophosphamide, doxorubicin, and etoposide in HIV-associated non-Hodgkin
lymphoma: pooled results from 3 phase 2 trials. Blood 105, 1891-1897.

32. Straus, D.J. (2005). HIV-associated lymphoma: promising new results, but with toxicity.
Blood 105, 1842.

33. Sui, G., Soohoo, C., Affar el, B., Gay, F., Shi, Y., and Forrester, W.C. (2002). A DNA
vector-based RNAi technology to suppress gene expression in mammalian cells.
Proceedings of the National Academy of Sciences of the United States of America 99,
5515-5520.

34. Sun, S.C. (2010). Controlling the fate of NIK: a central stage in noncanonical NF-kappaB
signaling. Sci Signal 3, pe18.

35. Thirlwell, C., Sarker, D., Stebbing, J., and Bower, M. (2003). Acquired
immunodeficiency syndrome-related lymphoma in the era of highly active antiretroviral
therapy. Clin Lymphoma 4, 86-92.

36. .Tojima, Y., Fujimoto, A., Delhase, M., Chen, Y., Hatakeyama, S., Nakayama, K.,
Kaneko, Y., Nimura, Y., Motoyama, N., Ikeda, K., et al. (2000). NAK is an IkappaB
kinase- activating kinase. Nature 404, 778-782.

30

37. Verhelst, K., Verstrepen, L., Carpentier, I., and Beyaert, R. (2013). IkappaB kinase
epsilon (IKKepsilon): a therapeutic target in inflammation and cancer. Biochem
Pharmacol 85, 873-880.

Abstract (if available)

Abstract Lentiviral mediated gene transfer has been used recently for gene transfer in a lot of mammalian cell line. The most important advantage of using lentiviral vector is their high virus titre and their ability to infect non‐dividing cell line. We used this approach to make sh-RNA knockouts of a few signaling proteins from the NFκB family. shRNA is used as an important genetic tool to silence gene expression in cells to study the phenotype of a particular gene in disease progression and to study potential therapeutic targets for the disease. We made eight copies of the shRNA from the oligonucleotide primers and inserted them into cloning vector which had H1/TO promoter for doxycycline. The expression of sh-RNA was inducible since the promoter was switched on only in the presence of doxycycline. We then cloned this entire shRNA cassette into lentiviral expression (PSLIKneo). This expression vector had antibiotic resistance gene neomycin. Hence cells which had sh-RNA cassette which got successfully cloned into expression vector got selected with neomycin (G418) in this case. We targeted sh-RNA against many NFκB signaling proteins like TRAF2, cREL, cIAP1 and cIAP2,IKK1,IKK2,Nemo and caspase 8. We successfully got knockout of cRel and TRAF2 both at the cell survival and protein expression level. We tested whether these genes are involved in the survival of PEL cells. Knocking out these genes showed cell death in the PEL cells. Hence , demonstrating that the expression of these genes are required for the survival of PEL cells.

Linked assets

University of Southern California Dissertations and Theses

Conceptually similar

PDF

Studies on the role of a novel protein, TMEM 56 in tumorigenic growth for MCF-7 cells

PDF

Placenta growth factor-miRNAs-lncRNAs axis in the regulation of ET-1 gene involved in pulmonary hypertension in sickle cell disease

PDF

Elucidating the functional role of CHD7 associated nuclear PDH complex and other associated proteins on neural crest development

PDF

Investigating the function and epigenetic regulation of ABCA3, a novel LUAD tumor suppressor gene

PDF

The role of endoplasmic reticulum chaperones in regulating hematopoietic stem cells and hematological malignancies

Asset Metadata

Creator Ijantkar, Akshata (author)

Core Title A functional genomic approach based on shRNA-mediated gene silencing to delineate the role of NF-κB and cell death proteins in the survival and proliferation of KSHV associated primary effusion l...

School Keck School of Medicine

Degree Master of Science

Degree Program Biochemistry and Molecular Biology

Publication Date 08/11/2014

Defense Date 06/18/2014

Publisher University of Southern California (original), University of Southern California. Libraries (digital)

Tag apoptosis,IFN pathway,KSHV associated Kaposi Sarcoma,NF-kB,OAI-PMH Harvest,primary effusion lymphoma,sh-RNA

Format application/pdf (imt)

Language English

Contributor Electronically uploaded by the author (provenance)

Advisor Chaudhary, Preet M. (committee chair), Patel, Pragna (committee member), Tokes, Zoltan A. (committee member)

Creator Email akshataijantkar@gmail.com,ijantkar@usc.edu

Permanent Link (DOI) https://doi.org/10.25549/usctheses-c3-458758

Unique identifier UC11286867

Identifier etd-IjantkarAk-2805.pdf (filename),usctheses-c3-458758 (legacy record id)

Legacy Identifier etd-IjantkarAk-2805.pdf

Dmrecord 458758

Document Type Thesis

Format application/pdf (imt)

Rights Ijantkar, Akshata

Type texts

Source University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Access Conditions The author retains rights to his/her dissertation, thesis or other graduate work according to U.S. copyright law. Electronic access is being provided by the USC Libraries in agreement with the a...

Repository Name University of Southern California Digital Library

Repository Location USC Digital Library, University of Southern California, University Park Campus MC 2810, 3434 South Grand Avenue, 2nd Floor, Los Angeles, California 90089-2810, USA