University of Southern California Dissertations and Theses

Creating a multiple micrornia expression vector to target GRP78, an ER chaperone and signaling regulator in cancer

(USC Thesis Other)

Creating a multiple micrornia expression vector to target GRP78, an ER chaperone and signaling regulator in cancer

PDF

Download a page range

Download transcript

Copy asset link

Request this asset

Transcript (if available)

Content

CREATING A MULTIPLE MICRORNA EXPRESSION VECTOR TO TARGET
GRP78, AN ER CHAPERONE AND SIGNALING REGULATOR IN CANCER

by
Yin-Wei Chang

_____________________________________________________________________

A Thesis Presented to the
FACULTY OF THE USC GRADUATE SCHOOL
UNIVERSITY OF SOUTHERN CALIFORNIA
In Partial Fulfillment of the
Requirements for the Degree
MASTER OF SCIENCE
(BIOCHEMISTRY AND MOLECULAR BIOLOGY)

August 2012

Copyright 2012 Yin-Wei Chang

ii

Dedication
To my dearest parents, Shih-Yu Chang and Ju-Lan Teng, who have continuously given
me pure love and full support; and my girlfriend, Yi-Tzu Kuo, who has brought me
happiness and endless love.

iii

Acknowledgments
I would like to thank my sincere appreciation of my mentor, Dr. Peter Jones for showing
me the right direction and guiding my graduate at USC. I would also like to thank my
guidance committee members, Drs. Michael Stallcup and Zoltan A. Tokes. Their
guidance and advice are an important part of this thesis.

I would like to appreciate Dr. Gangning Liang and Sheng-Fang Su in my lab for showing
me the right direction and giving me advice on the thesis and providing valuable critique
and feedbacks on all the experiments. I would want to thank Kurinji Pandiyan for
revising my thesis.

I would also like to thank Jones lab Postdoctoral fellows, Drs. Claudia Andreu-Vieyra,
Daniel Carvalho, Terry Kelly, Xiaojing Yang, and Jueng Soo You and lab member, Chris
Duymich, Flora Han, Fides Lay, Kurinji Pandiyan, Yvonne Tsai, for their scientific
contributions to my projects and personal assistance.

iv

Table of Contents
Dedication ........................................................................................................................... ii
Acknowledgments ............................................................................................................. iii
Table of Contents .............................................................................................................. iv
List of Figures .................................................................................................................... vi
Abstract ............................................................................................................................. vii
1. Introduction ............................................................................................................... 1
1.1 GRP78 .............................................................................................................. 1
1.2 MicroRNAs ...................................................................................................... 2
1.3 GRP78 and microRNAs ................................................................................... 4
2. Materials and Methods ............................................................................................. 6
2.1 Cell culture ....................................................................................................... 6
2.2 Expression vector construction ........................................................................ 6
2.3 Transient transfections ..................................................................................... 7
2.4 Lentivirus production ....................................................................................... 8
2.5 Lentivirus infection .......................................................................................... 9
2.6 Reverse transcription and quantitative Real-Time PCR analysis .................... 9
2.7 Harvesting of cells and Western blot assay .................................................... 10
2.8 Cell proliferation assay .................................................................................. 11
2.9 Colony formation assay ................................................................................. 11
3. Results ...................................................................................................................... 12
4. Discussion ................................................................................................................. 18

v

Numerical Bibliography ................................................................................................. 33
Bibliography .................................................................................................................... 39

vi

List of Figures
Figure 1. The three selected microRNAs targeting human GRP78. ................................ 21

Figure 2. Strategy to create multiple miRNA expression vector. ..................................... 22

Figure 3. Multiple microRNA vector down-regulated GRP78 protein level. .................. 23

Figure 4. microRNA expression in transduced C42B cells.............................................. 24

Figure 5. miR-30d, miR-181a, miR-199a decrease GRP78 protein levels in C42B
cells.…………………………………………………………………………………………………………………………….25

Figure 6. miR-30d, miR-181a, miR-199a inhibit cell proliferation in C42B cells. ......... 26

Figure 7. miR-30d, miR-181a, miR-199a inhibit colony formation in C42B cells. ........ 27

Figure 8. microRNA expression in transduced cells. ....................................................... 28

Figure 9. Lentiviral delivery of multiple co-transcribed microRNAs down-regulates
GRP78 protein levels in different cancer cell lines........................................................... 29

Figure 10. Lentiviral delivery of multiple co-transcribed microRNAs induces GRP78
apoptosis in different cancer cell lines. ............................................................................. 30

Figure 11. Lentiviral delivery of multiple co-transcribed microRNAs reduces cell
viability in different cancer cell lines. ............................................................................... 31

Figure 12. Lentiviral delivery of multiple co-transcribed microRNAs reduces cell colony
formation in different cancer cell lines. ............................................................................ 32

vii

Abstract
GRP78, a major endoplasmic reticulum (ER) chaperone and signaling regulator, is
commonly over-expressed in human cancer and contributes to cancer cell proliferation,
survival and tumorigenesis. Moreover, induction of GRP78 by a variety of anti-cancer drugs,
including histone deacetylase inhibitors, confers chemoresistance to cancer. Thus, targeting
GRP78 to inhibit tumor survival and proliferation, sensitize tumor cells to chemotherapeutic
drugs and consequently induce apoptosis serves as a promising avenue in anti-cancer therapy.
MicroRNAs (miRNAs) are ~22 nt non-coding RNA molecules that usually function as
endogenous repressors of target genes. However, how GRP78 expression is regulated is
still unclear. We hypothesized that small non-coding RNAs regulate GRP78 expression.
The previous works already shown that miR-30d, miR-181a, and miR-199a are capable
of directly targeting GRP78. By constructing a vector from which multiple miRNAs can
be expressed, we showed that miR-30d, miR-181a, and miR-199a act synergistically to
cause GRP78 down-regulation, and the reduction in cell proliferation and in colony
formation of C4-2B prostate cancer cells. Furthermore, delivery of multiple miRNAs by
lentivirial vector increased the sensitivity of cancer cells to the histone deacetylase
inhibitor trichostatin A (TSA), in C42B, HCT116, and P39 cells. The results suggest that
combining multiple tumor suppressor miRNAs serve as a novel therapeutic approach for
cancer treatment.

1

1. Introduction
1.1 GRP78
GRP78, a glucose-regulated protein, also referred to as immunoglobulin heavy chain
binding protein (Bip) or HSPA5, maintains the function and homeostasis of the
endoplasmic reticulum (ER) and is responsible for ER stress through the regulation of ER
calcium binding and the unfolded protein response (UPR) (1-3). Recently, GRP78 was
also found to be on the surface of cancer cells, and controls oncogenic signals (4). When
cells are undergoing stress, up-regulation of GRP78 plays a critical role in cancer cell
survival (1). Nevertheless, under the continuous stress or accumulation of misfolded
proteins, apoptosis is triggered through the induction of BAX/BAK and CHOP (3, 5).
GRP78 is induced by intrinsic and extrinsic factors related to ER stress in a tumor
microenvironment, such as acidosis, glucose starvation and hypoxia (6). Up-regulation of
GRP78 has been reported in a variety of tumors and plays a key role in anti-apoptosis,
tumor progression, angiogenesis and metastasis (1, 7). Increased GRP78 in cancer cells
facilitates drug resistance by repressing apoptosis (1, 8). Knockdown of GRP78 by
siRNA has been demonstrated to synergize apoptosis induced by histone deacetylase
inhibitor trichostatin A (TSA) in human cancer cells, thus sensitizing malignant gliomas,
which represent the most malignant and resistant from of tumor, to temozolomide
treatment (9-11). Similarly, knockdown of GRP78 enhances the sensitivity of
chemotherapeutic drugs for tumor associated endothelial cells (12). In addition, the
heterozygous mutant of GRP78 resulted in the reduction of tumor growth and prolonged
the survival of the mice (3, 6). Together, these studies suggest that GRP78 is a potential

2

therapeutic target in cancer (1).

1.2 MicroRNAs
Small regulatory RNAs, such as microRNAs (miRNAs) that are ~ 22 nt non-coding RNA
molecules, function as endogenous repressors of target genes (13). The miRNA is usually
transcribed by RNA polymerase II (Pol II) into long primary miRNA transcripts
(pri-miRNA). The pri-miRNA is processed in the nucleus by the RNAse III enzyme
Drosha which uses the stem-loop secondary structure in the pri-miRNA for direct
cleavage, resulting in a hairpin precursor from called pre-miRNA that is exported to the
cytoplasm. There, the RNAse III enzyme Dicer cleaves the pre-miRNA to ultimately
yield the mature miRNA (14, 15). In animals, miRNAs can bind with imperfect
complementarity to the 3’ untranslated region (3’ UTR) of the target mRNA via the
RNA-induced silencing complex. The resulting reduction in gene repression of the target
gene occurs by multiple mechanism including enhanced mRNA degradation and
translational repression (13, 16).

Hundreds of human miRNAs have been identified to regulate several crucial biological
events, including cell proliferation and differentiation, development, apoptosis and
epigenetic changes (17) in diseases such as cancer (18). Aberrant expression of miRNAs,
which could be caused by genomic abnormalities, miRNA processing defects, and
epigenetic alterations are common events in various cancers (19-21). Furthermore,
recently miRNA expression studies of various cancers revealed that many tumor

3

suppressor miRNAs are down-regulated in cancer and can potentially become therapeutic
targets (22). Manipulating mRNA expression to repress cancer progression may be
clinically relevant as RNAi is being used in some gene therapy (23). Several studies have
shown the potential applicability of the miRNA-based approaches in cancer (24). These
include the induction of apoptosis by the 34 family in colon cancer (25) and by
miR-15a/16-1 in CLL (26), growth inhibition by let-7 in cancer cells (14, 27, 28),
reduction in metastatic potential via miR-126 in breast cancer, and regression of murine
lung tumor by let-7 (29).

Currently, there are no reported studies of using miRNAs for in vivo anti-cancer therapy.
However, the development of methods for in vivo delivery of siRNA and shRNA to
silence single target genes has established technical approaches that could translate into
miRNA therapy (30). Gene therapies based on systemic delivery of siRNA/shRNA in
preclinical models have made use of viral vectors, liposomes, and nano particles (30-34),
but the same challenges encountered with delivering antisense and siRNA into cells are
faced with miRNA-based therapies. The primary obstacle is that introducing a charged,
linear polymer across the membrane of a cell is exceedingly difficult. The advantage that
the miRNA-based gene therapy will have over siRNAs, shRNAs and antisense
oligonucleotides is that multiple miRNAs can be co-transcribed and the miRNAs could
have multiple, synergistic targets. For example, let-7 has been reported to repress RAS,
MYS, and HMGA2 oncogenes (26, 27).

4

The general miRNA hairpin structure has been used to develop shRNA vectors for gene
knockdown experiments or antagomir vectors to study miRNA knockdown (35, 36) and
show much promise for both functional studies and gene therapy (37). Although miRNA
profiling of disease states indicates that many miRNAs are either up- or down-regulated,
most studies have focused on the function of single miRNAs or miRNA clusters. In
addition, a recent report indicates that the miRNA-mediated repression of a target mRNA
is additive with respect to the number of miRNA binding sites in the 3’UTR (irrespective
of whether they are for the same miRNA or multiple miRNAs), while this effect is
synergistic when the sites are within 40 bp of each other (38). These reports suggest that
thorough functional investigation of miRNAs should be taken into consideration for the
combinatorial effects of multiple miRNAs on target genes and pathways. Indeed, several
groups have developed methods by which one can express multiple microRNAs or
shRNAs through a single transcript but the methods are either complicated or cannot
ensure expression of mature microRNAs (36, 39, 40).

1.3 GRP78 and microRNAs
Since up-regulated GRP78 has been shown to play a key role in tumor progression and in
drug-resistance, and that miRNAs are functional in stress response by controlling the
expression of genes involved in the process (41), we hypothesized that if there are some
miRNAs that can target GRP78, they may serve as tumor suppressors or therapeutic
targets that down-regulate GRP78 in cancer. As a result, in our lab, the previous work of
graduate student Sheng-Fang Su has already shown that miR-30d, miR-181a, and

5

miR-199a are capable of directly targeting GRP78 (Figure 1). Combinatorial effects on
the inhibition of GRP78, the reduction of cell viability, as well as on the induction of cell
apoptosis in the C42B prostate cancer cell lines was established. However, all the results
were obtained using transient transfection in the cancer cells.

Here, I have developed a simple and flexible platform that can express multiple miRNAs
from a single transcript using endogenous pre-miRNA sequences and improved the
efficiency of delivery. I show that the miRNA processing machinery can generate
multiple mature miRNAs from a transcript made of inserts that include ~60 bp of
sequence flanking the pre-miRNAs. The results from the stable expression experiments
also confirm that these miRNAs have combinatorial effects on GRP78 repression,
apoptosis induction, and reduction of cell survival and colony. Furthermore, the
cooperative effects of these three miRNAs increased the sensitivity of cancer cells to drug
therapy. Together, these results provide evidence that delivery of multiple miRNAs may
have strong potential for development in to novel cancer therapies.

6

2. Materials and Methods
2.1 Cell culture
The human prostate cell lines C42B and human embryonic kidney cell line were
purchased from the American Type Culture Collection. C42B cells were cultured in
RPMI1640 mediums supplemented with 10% fetal bovine serum, 0.1 mg/ml
streptomycin and 100 U/ml penicillin in a humidified incubator at 37°C and 5% CO
2

atmosphere. 293T cells were maintained in DMEM containing 10% fetal bovine serum,
0.1 mg/ml streptomycin and 100 U/ml penicillin in a humidified incubator at 37°C and
5% CO
2
atmosphere.

2.2 Expression vector construction
Single miRNA expression vectors for miR-30d, miR-181a and miR-199a were made by
In-Fusion cloning 200 ~ 300 bp 5’ and 3’ of the pre-miRNA into the PLJM1 lentivirus
expression vector. The In-Fusion primer sequences were:

5’-30d-PLJM1-AgeI CGCTAGCGCTACCGGT ATTAGCTGAA GATGATGACT G
3’-30d-PLJM1-EcoRI TCGAGGTCGA GAATTCCACA TTTTATAGCC TCCTCAAC
5’-181a-PLJM1-AgeI CGCTAGCGCTACCGGT TCGACTTGA AACCCAGAG
3’-181a-PLJM1-EcoRI TCGAGGTCGA GAATTCAAAA TTCACTGGAC CACATTTGG
5’-199a-PLJM1-AgeI CGCTAGCGCTACCGGT GTTTCCTTGG CTGCTCAG
3’-199a-PLJM1-EcoRI TCGAGGTCGA GAATTCCTCG AATCTTCTAT

7

The multiple miRNA expression vector was first constructed by sequentially cloning the
miR-30d, miR-181a, and miR-199a inserts into the multiple cloning site for pcDNA3.1
(+) (Invitrogen). The primer sequences and restriction sites were:

5’-30d-kpnI TATAGGTACC ATTAGCTGAA GATGATGACT G
3’-30d-EcoRI TATAGAATTC CACATTTTAT AGCCTCCTCA AC
5’-181a-EcoRI TATAGAATTCTCGACTTGA AACCCAGAG
3’-181a-EcoRV TATAGATATC AAAATTCACT GGACCACATT TGG
5’-199a-EcoRV TATAGATATCGTTTCCTTGG CTGCTCAG
3’-199a-XhoI TATACTCGAG CTCGAATCTT CTATGCGAG

2.3 Transient transfections
The day before transfection, 5 x 10
4
C42B cells were seeded per 60 mm dish in 3 ml of
RPMI1640 containing 10% fetal bovine serum and incubated at 37°C and 5% CO
2
in an
incubator. C42B were grown to 60% to 80% confluence. Two ug of PLJM1 plasmid with
2 ug of miR-30d+181a+199a or a control with a scrambled miRNA sequence were
diluted with Opti-MEM to a total volume of 500 ul. The solution was mixed and vortexed
gently to collect all the drops from the top of the tube. Lipofectamine transfection reagent
(20 ul) was added to the DNA solution, which was mixed by vortexing for 10 – 20
seconds. The samples were incubated for 30 minutes at room temperature to allow for
DNA-lipid complex formation. While complex formation took place, the growth medium
was gently aspirated from the dish and 3 ml of fresh cell growth medium with serum and

8

antibiotics was added. One ml of complete growth medium was added to the reaction
tube containing the transfection complexes. The solution was gently mixed by pipetting
up and down twice, and the total volume was immediately transferred to the cells in a60
mm dish. The dish was gently swirled to ensure uniform distribution of the complexes.
The cells were incubated with the transfection complexes for 4 hours at 37°C and 5%
CO
2
, following which the medium containing the transfection complexes from the cells
was removed by gentle aspiration. Fresh growth medium (3ml) with serum and
antibiotics were added to the cells. Forty-eight hours later, the transfected cells were
harvested and the extracted protein analyzed using Western blot.

2.4 Lentivirus production
The pre-miRNAs sequences of GRP78 were subcloned into the PLJM1 lentivirus miRNA
expression vector. The day before lentivirus production, 3.5 x 10
5
293T cells were seeded
per 10 cm dish in 10 ml of DMEM containing 10% fetal bovine serum and the cells were
incubated at 37°C and 5% CO2 in an incubator. The cells were grown to 60% to 80%
confluence. First, a mixture of the three plasmids was prepared including 7.5 ug PCML1,
2.52 ug PMDG1, and 10 ug of each PLJM1 with the pre-miRNAs and then the total
volume was adjusted to 1.5 ml usingOPTI-MEM. Next,40 ul of the Lipofectamine 2000
was added into 1.5 ml OPTI-MEM, followed by gentle mixing by flicking the tube, and
incubating at room temperature for 5 minutes. The 3 plasmids were added drop-wise into
the diluted transfection reagent and mixed by swirling or gently flicking the tube. The
transfection mixture was incubated for 20 – 30 minutes at room temperature. The

9

transfection mixture was carefully transferred onto the 293T cells. The medium was
removed after 24 hours and the cells were incubated at 37°C and 5% CO2 in an incubator
after the addition of fresh culture media. The supernatant containing virus was collected
after incubating for 48 hours. The virus were filtered through cellulose acetate filters
(0.45 um). The virus stocks were stored in cryotubes at -80 °C.

2.5 Lentivirus infection
The day before infection, 5 x 10
5
C42B cells were seeded per 60 mm dish in 3 ml of
RPMI1640 containing 10% fetal bovine serum and cells were incubated at 37°C and 5%
CO
2
in an incubator. C42B were grown to 60% to 80% confluence. The growth media
was removed and fresh media containing 8 ug/ml polybrene was added. The virus
containing media (600 ul) was added into each well and cells were incubated at 37°C and
5% CO
2
for 24 hours. The media was removed and replaced with 3 ml fresh media
containing 1.25 ug/ml puromycin. Cells were incubated at 37°C and 5% CO
2
, with
replacements of growth media with puromycin as needed every few days. Puromycin
selection was performed for at least one week. Following this, the efficacy of the stably
transduced C42B cells was examined with the following experiments.

2.6 Reverse transcription and quantitative Real-Time PCR analysis
MiRNA Taqman assays (Applied Biosystems) were performed following the manufacturer’s
instructions. Total RNA (15ng) was reverse transcribed into miR- and miRNA expression
was normalized to U6 snRNA levels, used as an endogenous loading control.

10

2.7 Harvesting of cells and Western blot assay
Media was aspirated from the culture vessel and the cells were washed once with PBS.
Trypsin-EDTA was added to detach the cells from each well and cells were incubated at
37°C for 2 – 5 minutes with careful monitoring until the cells began to round up. PBS
was added and cells were dispersed into suspension by pipetting in and out repeatedly.
Cells were centrifuged at 3500 rpm for 10 min at 4°C. The remaining supernatant was
removed with pipette. Cell pellets were lysed in cold RIPA buffer with 1 M protein
inhibitor (Roche) and 1 mMNaV (sodium orthovanadate) at 4°C for 30 minutes. The
lysate was sonicated for 6 seconds,4 times for each sample. Cells were centrifuged at
10,000 rpm for 35 minutes in the cold room. The supernatant was transferred into clean
tubes and stored at -80 °C.

The proteins were diluted with the 2X Laemmli sample buffer (Bio-Rad) and incubated
for 5 minutes at 95 °C. The proteins were separated by SDS-polyacrylamide gel
electrophoresis (SDS-PAGE) and were transferred to nitrocellulose membranes according
to standard protocol. After proteins were transferred to the membrane, the nitrocellulose
membrane was rinsed briefly with distilled water. Non-specific binding sites were
blocked by immersing the membrane in 5% fat-free milk in Tris-buffered saline tween-20
(TBST) for 1 hour at room temperature on an orbital shaker. The membrane was
incubated in diluted primary antibody for 1 hour at room temperature or overnight at 4°C.
The membrane was briefly rinsed with TBST and then was washed three times for 10

11

minutes with fresh TBST at room temperature. The membrane was incubated in the
diluted secondary antibody for 1 hour at room temperature. The membrane was washed
as described before. An equal volume of ECL detection reagents solution 1 and solution 2
were mixed to cover the membrane and the membrane was incubated for 1 minute at
room temperature. The excess ECL was drained. The blot was placed with the protein
side facing up on a sheet of plastic wrap. The blots were wrapped, exposed to x-ray film
and then the film was developed.

The primary antibodies were mouse anti-GRP78 (BD Pharmingen), mouse anti–poly
(ADP-ribose) polymerase (PARP; F-2, Santa Cruz Biotechnology), and mouse
anti–ß-actin (Sigma-Aldrich). Anti-GRP78 was diluted at 1:1,500; anti PARP-1 at 1:500;
anti–ß-actin was diluted at 1:2,000. Respective horseradish peroxidase–conjugated
secondary antibodies (Santa Cruz Biotechnology) at 1:1,000 dilution were used.

2.8 Cell proliferation assay
C42B cells were infected as described above: 2 x 10
5
cells were seeded per 60 mm in 3
ml of RPMI1640 containing 10% fetal bovine serum and incubated at 37°C and 5% CO2
in an incubator. Cells were grown to 80% confluence, trypsinized and the cell number
determined by counting.

2.9 Colony formation assay
C42B cells were infected with GRP78 miRNAs vector, an empty vector or scrambled

12

miRNAs vector. The infected cells were seeded at 1000 cells per 60 mm dish in 3 ml of
RPMI1640 containing 10% fetal bovine serum and the cells were incubated at 37°C and
5% CO2 in an incubator. Cells were grown for 10 to 14 days with fresh media. Once
colonies were visible, they were fixed by 100 % methanol and were stained with the 10%
Giemsa (Harleco). All assays were repeated at least three times, and data are presented as
the mean with standard deviation error bars.

3. Results
The most important step in the production of mature miRNAs by the miRNA processing
machinery is the recognition of both the hairpin structure and the junction between the
single- and double-stranded regions of the pri-miRNA. This implies that the sequence
requirement for mature miRNA expression from an expression vector could be as little as
a few base pairs in either direction of the pre-miRNA sequence. (42, 43) Recent studies
suggest that the minimal length for efficient pri-miRNA processed should be 110 nt. (42)
Due to the small size of the pre-miRNA genes, it is technically feasible to clone many
different genes into the same expression vector. Therefore, it is possible to clone multiple
tumor suppressor miRNAs, which affect many different genes and/or pathways involved
in tumorigenesis, into one vector, creating a powerful miRNA-base cancer therapy.

In our lab, we have already proven this concept by cloning miR-34 tumor suppressor
family (miR-34a, miR-34b and miR-34c) into a single expression vector and shown that
it has combinatorial inhibitory action on cancer cell proliferation (44). Also, in a previous

13

study, we found that there are three miRNAs (miR-30d, miR-181a and miR-199a) that
can directly target the 3’-UTR of GRP78 (Figure 1) and down-regulate the expression of
GRP78. However, the previous studies were done by the transient transfection method.
Hence, I took advantage of this multiple miRNA expression vector system to further
consolidate the study. I used the pre-miRNAs which included the SD junction for
miR-30d, miR181a, and miR-199a to clone either individually or all three miRNAs
together into the pcDNA3.1 (+) expression vector. I then utilized the in-fusion method to
sub-clone into the PLJM1 lentivirus expression vector (Figure 2). Before the lentiviral
infection, we wanted to determine quickly whether the multiple miRNA containing
expression vector could inhibit the expression of GRP78. C42B cancer cells were
transfected with this PLJM1 multiple miRNA expression vector, twenty-four hours after
transfection, cells were stimulated with Thapsigargin (Tg) to induce GRP78. Protein was
collected 20 hours later and a western blot was performed to check the GRP78 protein
level. As expected, the GRP78 protein level was inhibited around 40% by the multiple
miRNA expression vector (Figure 3).

In order to improve the delivery efficiency of multiple miRNAs and to examine the
long-term effects of their expression following the transient transfected experiment we
executed the stable expression strategy. C42B cells which have low levels of miR-30d,
miR-181a, and miR-199a, were infected with each individual miRNA vector and the
multiple miRNA vector by applying the specific virus. RT-qPCR was used to detect the
mature miRNA levels in each stable cell line that was kept under puromycin selection

14

(Figure 4). Results showed that only the cells that were infected with the miRNAs
individually or in combination (miR-30d, miR181a and miR-199a) had the expression of
the respective miRNAs when compared to the negative control (L.V .). Therefore, the
results showed that individual endogenous pre-miRNAs can be ligated into one
expression vector that produces mature miRNAs from a single transcript at similar levels
to vectors containing individual miRNAs and this can be easily applied to the lentiviral
system.

After confirming that the multiple miRNA lentiviral expression vector can express the
mature miRNAsin the stable C42B cells, we investigated whether there were any changes
in the levels of endogenous GRP78 as a result. Tg was added to the stable cells to induce
GRP78 expression, along with either the individual or all three miRNAs and cells were
collected 20 hours after Tg treatment. On western blot analysis, results showed that
GRP78 was significantly increased after Tg treatment at the protein level. Cells
transduced with the individual miRNA vectors showed decreased up-regulation of
GRP78 protein levels when compared to negative control (L.V .) on exposure toTg.
Interestingly, a profound effect on the repression of GRP78 was evidenced by the
combination of these three miRNAs (Figure 5). In addition, as mentioned before,
over-expression of GRP78 in cancer could inhibit the apoptotic pathway (1). In support,
the apoptotic marker, PARP-1 was found increased while GRP78 was repressed by the
combination of miR-30d, miR-181a, and miR-199a. The results clearly demonstrate that
the combination of these three miRNAs has more substantial of an effect on GRP78

15

repression when compared to any individual miRNA, and this could also result in
decreasing apoptotic inhibition in C42B cells.

Since we confirmed that the multiple miRNA containing lentiviral vector can induce the
stable expression of multiple mature miRNAs that target GRP78, we further investigated
whether this resulted in altering the phenotype of the cells. Previous transient transfection
studies showed that miR-30d, miR-181a, and miR-199a cooperatively target GRP78 and
induce morphological changes in cancer cells, restoring GRP78-inhibited apoptosis, and
resulting in increased cell death on induction of stress. Here, we performed the cell
proliferation assay and the colony formation assay for C42B cells either expressing one
or all three miRNAs stably. A similar trend of increased effect on combinatorial treatment,
as seen for GRP78 protein levels, was observed in this experiment. The expression of
individual miRNAs showed some effect on the down-regulation of cell growth and
colony formation number when compared to the negative control (L.V .). Also,
interestingly, a dramatic repression of cell proliferation and colony formation was
observed in the cells that received the combination of the three miRNAs (Figure 6, 7).
The results indicated that although each miR-30d, miR-181a, or miR-199a might not
have a strong effect individually, when expressed together they can have a synergistic or
additive effect. These finding clearly showed that decreased levels of GRP78 by multiple
miRNAs in C42B cells suppresses cancer cell growth and colony formation.

Since we known that these three miRNAs have a combinatorial or additive effect on

16

repression of GRP78 in C42B cells by both transient tranfection and stable transduction,
we next introduced this multiple miRNA lentiviral expression system in different cell
lines that also have low levels of these three miRNAs. C42B, HCT116 and P39 were
transduced, and the expression of each miRNA was confirmed in the cells. The results
confirmed that each miRNA can be stably expressed on transduction with the multiple
lentiviral miRNA expression vector (Figure 8).

In addition, it has been demonstrated that the up-regulation of GRP78 expression can
negate the effects of TSA in cancer cells (9). To address this issue, which is critical for
increasing therapeutic efficacy of this drug, we hypothesized that the down-regulationof
GRP78 by a combination of miRNAs could help in anti-cancer treatment. In previous
transient transfection data, we have already shown that these three miRNAs repressed the
TSA induced GRP78 and further resulted in increased expression of the apoptotic marker,
PARP-1. Here, transduction of this lentiviral multiple miRNA vector caused a significant
decrease in GRP78 and in cell viability, and an increase in PARP-1 protein level in C42B
cells when treated with Tg and TSA (p<0.05, n=3) (Figure 9). Tg treated HCT116 and
P39 cells transduced with the vector also showed a decrease in GRP78 and an increase in
PARP-1 at the protein level, but not significantly, whereas a significant down-regulation
of GRP78 protein levels was observed in TSA-treated HCT116 cells (p<0.05, n=3)
(Figure 10). Cell viability was significantly reduced in Tg-treated P39 cells and in both
HCT116 and P39 cells treated with TSA (p<0.05, n=3) (Figure 11). The Tg-treated P39
and HCT116 transduced cells showed non-significant change in PARP-1 protein levels,

17

whereas a non-significant increase in PARP-1 was observed in TSA-treated cells (Figure
10). Furthermore, decreased colony formation was observed in these cells transduced
with the three miRNAs (Figure 12). These results suggest that the cooperative effect of
multiple miRNAs that target GRP78 is maintained in a stable expression system and
indicate that the magnitude of the overall effect of decreasing GRP78 is
cell-type-specific.

18

4. Discussion
Our results show that the cellular miRNA machinery can recognize and process
individual endogenous pre-miRNA sequences sequentially ligated into a single transcript.
The multiple miRNA lentiviral expression vector containing miR-30d+181a+199a stably
generated all the three miRNAs targeting GRP78 at comparable levels to individual
miRNA vectors. It also resulted in the inhibition of cell viability and GRP78 levels more
than by the individual miRNA vectors in C42B cells. This platform has the potential to be
used in any Pol II driven vector system, thereby allowing for tissue specific or inducible
miRNA expression (37). Furthermore, this lentiviral multiple miRNA expression system
can be utilized for gene therapy and may also be relevant to Pol III driven expression
vectors, which are often used to generate shRNAs (37). There is most likely an
experimentally optimal primary transcript length where adding more or longer inserts
would decrease the processing efficiency and reduce the mature miRNA expression from
the multiple expression vector. However, given the fact that the pre-miRNAs are short,
this vector is still relatively flexible. As a result, the multiple pre-miRNAs inserts would
not decrease the functional and the therapeutic applications for the multiple lentiviral
expression vector due to transcription efficiency.

The advantages that the miRNA-based gene therapy has over siRNAs, shRNAs, and the
antisense oligonucleotides are that multiple miRNAs can be co-transcribed and each
miRNAs has multiple targets. Therefore, the flexibility of the multiple miRNA
expression vector makes it a critical tool for the functional analysis of any combination of

19

miRNAs. This is critical to determining synergistic or additive effects of physiologically
relevant miRNA dysregulation, which has been shown in a number of human diseases
(45).
From recent studies, we have already known that GRP78 is up-regulated in various tumor
types and GRP78 induction after drug treatment has been shown to be the critical
contributor to tumorigenesis and therapeutic resistance (1, 46). In addition, our previous
study reported that miR-30d, miR-181a, and miR-199acan directly target GRP78. The
fact that miR-30d, miR-181a, and miR199a are down-regulated in the samples of prostate
cancer, colon cancer, and bladder cancer, indicates that these miRNAs are clinically
relevant and all of them are required to suppress GRP78 (47). This multiple miRNA
expression would be an ideal platform to study the relationship between these three
miRNAs and GRP78 in cancer.

In our study, we show that the down-regulation of GRP78 by the transduction of the
multiple miRNA lentiviral expression vector can increase the sensitivity of cancer cells to
TSA treatment, resulting in the inhibition of cell growth and colony formation, and the
induction of apoptosis. Therefore, the application of multiple specific miRNAs to key
target genes involved in tumorigenesis could provide an exciting approach to novel
cancer gene therapy. The results also suggest that this single multiple miRNA lentiviral
vector platform is an efficient and flexible (44) method to deliver and test the
combinatorial actions of miRNAs on a single target gene.

20

In addition to targeting GRP78 by these three miRNAs (miR-30d, miR-181a, and
miR-199a), miR-30d also can play a role as a negative regulator for p53 and regulate cell
cycle and apoptosis (48), while miR-181a has a critical role in hair cell regeneration and
has been recently reported to affect the outcome of cerebral ischemia(49, 50). The
down-regulation of miR-199a in human hepatocellular carcinoma (HCC) is associated
with cell invasion (51).
More recent reports have shown that a single mRNA molecule can be targeted by
multiple miRNAs, and have brought the focus to the combinatorial effects of multiple
miRNAs (52-55). For instance, the expression of multiple miRNAs on PTEN has been
shown to be the tumor suppressor in T-cell lymphoblastic leukemia (54). Such studies
indicate that gene expression is tightly controlled by miRNA networks (56). Here, our
results indicate that the combinational efforts of multiple miRNAs might increase the
efficiency of the down-regulation of GRP78.

In conclusion, we have developed a simple and flexible platform that can express
multiple mature miRNAs of GRP78 from a single transcript by using endogenous
pre-miRNA sequences. We show here that miR-30d, miR-181a, and miR-199a are
capable of down-regulating GRP78 in a combinatorial fashion, which can promote
tumorigenesis and drug resistance in cancer cells. Notably, our results suggest that
combining the use of multiple miRNAs and TSA or other therapeutic agents may provide
a potential approach in the treatment of GRP78-overexpressing and chemo-resistant
tumors.

Figure 1. The three selected microRNAs targeting human GRP78

The three selected microRNAs targeting human GRP78.
21

22

Figure 2. Strategy to create multiple miRNA expression vector.
The pre-miR-30d, pre-miR-181a, and pre-miR-199a and ~200 bp flanking sequences
were PCR amplified and sequentially cloned downstream of the CMV promoter in the
pcDNA3.1(+) vector. The pre-miR30d+181a+199a were PCR amplified and In-Fusion
cloned downstream of the CMV promoter into the lentivirial PLJM1 expression vector.

PLJM1+miR-30+miR-181+miR-199
8083 bp
miR-30
Ampicillin
miR-181
miR-199

0.0
0.1
0.2
0.3
GRP78/Actin
Figure 3. Multiple microRNA vector down
C42B cells were transfected with PLJM1 lentiviral vector which has
pre-miR-30d+181a+199a precursors; a negative control (
positive (siRNA against GRP78, siGRP78) control
were assessed by Western blot analysis. Actin levels were used as loading
control.Quantitation was performed
to Actin levels.

L.V.
miR30+181+199
siGRP78

. Multiple microRNA vector down-regulated GRP78 protein level
C42B cells were transfected with PLJM1 lentiviral vector which has
30d+181a+199a precursors; a negative control (lentivirial vector,
positive (siRNA against GRP78, siGRP78) control were also used. GRP78 protein levels
were assessed by Western blot analysis. Actin levels were used as loading
ion was performedusing Quantity One (Bio-Rad), and plotted as a ratio
23
regulated GRP78 protein level.
C42B cells were transfected with PLJM1 lentiviral vector which has
lentivirial vector, L.V .) and
. GRP78 protein levels
were assessed by Western blot analysis. Actin levels were used as loading
Rad), and plotted as a ratio

Figure 4. microRNA expression in transduced C42B cells
C42B cells were transduced with PLJM1 lentiviral vector which has pre
pre-miR-181a, pre-miR-199a, and pre
control (lentiviral vector, L.V .)
miR-181a, and miR199a was determined by quantitative real time PCR analysis in each
transduced C42B cells and normalized to U6 snRNA.

. microRNA expression in transduced C42B cells.
C42B cells were transduced with PLJM1 lentiviral vector which has pre
199a, and pre-miR-30d+181a+199a precursors; a negative
control (lentiviral vector, L.V .) was also used. microRNAs expression of miR
181a, and miR199a was determined by quantitative real time PCR analysis in each
ormalized to U6 snRNA.
24
C42B cells were transduced with PLJM1 lentiviral vector which has pre-miR-30d,
; a negative
. microRNAs expression of miR-30d,
181a, and miR199a was determined by quantitative real time PCR analysis in each

25

GRP78 expression
L.V.
miR-30
miR-181
miR-199
miR-30+181+199
0.0
0.2
0.4
0.6
0.8
1.0
1.2
GRP78/Actin

Figure 5. miR-30d, miR-181a, miR-199a decrease GRP78 protein levels in C42B
cells.
C42B cells were transduced with PLJM1 lentiviral vector which has pre-miR-30d,
pre-miR-181a, pre-miR-199a, and pre-miR-30d+181a+199a precursors; a negative
control (lentivirial vector, L.V .). C42B cells were treated with Thapsigargin (Tg). GRP78
protein levels were assessed by Western blot analysis. Actin levels were used as a loading
control. Quantitation was done using Quantity One (Bio-Rad), and plotted as a ratio to
Actin levels. Data represents mean ± SD (n=3). *=p<0.05.

*
*
*
*

26

L.V.
miR30
miR181
miR199
miR30+181+199
0.0
0.2
0.4
0.6
0.8
1.0
1.2
Relative Cell Number (10*5)

Figure 6. miR-30d, miR-181a, miR-199a inhibit cell proliferation in C42B cells.
C42B cells were transduced with PLJM1 lentiviral vector which has pre-miR-30d,
pre-miR-181a, pre-miR-199a, and pre-miR-30d+181a+199a precursors; a negative
control (lentivirial vector, L.V .) was also included. Total cell numbers were counted 4
days after seeding the cells. Data represents mean ± SD (n=3). *=p<0.05.

*
* *

27

L.V.
miR30
miR181
miR199
miR30+181+199
0
20
40
60
80
100
120
Relative Colony Number (%)

Figure 7. miR-30d, miR-181a, miR-199a inhibit colony formation in C42B cells.
C42B cells were transduced with PLJM1 lentiviral vector which has pre-miR-30d,
pre-miR-181a, pre-miR-199a, and pre-miR-30d+181a+199a precursors; a negative
control (lentivirial vector, L.V .) was also included. Colony formation was assessed 14
days after seeding the transduced C42B cells. Mean values of the data are represented ±
SD (n=3). *= p<0.05.

*
*
*

28

Figure 8. microRNA expression in transduced cells.
C42B, HCT116, and P39 cells were transduced with PLJM1 lentiviral vector which has
pre-miR-30d+181a+199a precursors; a negative control (lentiviral vector, L.V .) was also
used. microRNAs expression of miR-30d, miR-181a, and miR199a was determined by
quantitative real time PCR analysis in each transduced cells and normalized to U6
snRNA.

0
5
10
15
20
L.V.
m iR 30+181+199
miR-30d/U6 x 100
0
10
20
30
L.V.
miR30+181+199
miR-181a/U6 x 100
C42B
HCT116
P39
0.0
0.5
1.0
1.5
L.V.
m iR 30+181+199
miR-199a/U6 x 100

29

(A) WB of GRP78 (Tg)
C42B
HCT116
P39
0.0
0.2
0.4
0.6
0.8
1.0
1.2
L.V.
miR30+181+199
Protein
Relative GRP78

(B) WB of GRP78 (TSA)
C42B
HCT116
P39
0.0
0.2
0.4
0.6
0.8
1.0
1.2
L.V.
miR30+181+199
Protein
Relative GRP78

Figure 9. Lentiviral delivery of multiple co-transcribed microRNAs down-regulates
GRP78 protein levels in different cancer cell lines.
C42B, HCT116 and P39 cells infected with L.V. or lentiviral miR30+181+199 were
treated with Tg or the histone deacetylase inhibitor (TSA). GRP78 protein levels were
assessed by Western blot analysis. Actin levels were used as a loading control. Data
represents mean ± SD (n=3). *=p<0.05.
*
* *

30

(A) WB of PARP-1 (Tg)
C42B
HCT116
P39
0.0
0.2
0.4
0.6
0.8
1.0
1.2
1.4
1.6
1.8
2.0
L.V.
miR30+181+199
Protein
Relative PARP-1

(B) WB of PARP-1 (TSA)
C42B
HCT116
P39
0.0
0.2
0.4
0.6
0.8
1.0
1.2
1.4
1.6
1.8
2.0
2.2
2.4
2.6
L.V.
miR30+181+199
Protein
Relative PARP-1

Figure 10. Lentiviral delivery of multiple co-transcribed microRNAs induces
GRP78 apoptosis in different cancer cell lines.
C42B, HCT116 and P39 cells infected with L.V. or lentiviral miR30+181+199 were
treated with Tg or the histone deacetylase inhibitor (TSA). PARP-1 protein levels were
assessed by Western blot analysis. Actin levels were used as loading control. Data
represents mean ± SD (n=3). *=p<0.05.
*
*

31

(A) Mock treatment
C42B
HCT116
P39
0.0
0.2
0.4
0.6
0.8
1.0
1.2
L.V.
miR30+181+199
Relative Cell Number (10*5)

(B) TSA treatment
C42B
HCT116
P39
0.0
0.2
0.4
0.6
0.8
1.0
1.2
L.V.
miR30+181+199
Relative Cell Number (10*5)

Figure 11. Lentiviral delivery of multiple co-transcribed microRNAs reduces cell
viability in different cancer cell lines.
C42B, HCT116 and P39 cells infected with L.V. or lentiviral miR30+181+199 were
treated with histone deacetylase inhibitor (TSA). Total cell numbers were counted 4 days
after seedingthe transducted cells. Mean values of the data are represented ± SD (n=3).
*= p<0.05.
* * *
* *

32

(A) Mock treatment
C42B
HCT116
0
20
40
60
80
100
120
L.V.
miR30+181+199
Relative Colony Number (%)

(B) TSA treatment
C42B
HCT116
0
20
40
60
80
100
120
L.V.
miR30+181+199
Relative Colony Number (%)

Figure 12. Lentiviral delivery of multiple co-transcribed microRNAs reduces cell
colony formation in different cancer cell lines.
C42B and HCT116 cells infected with L.V. or lentiviral miR30+181+199 were treated
with histone deacetylase inhibitor (TSA).Colony formation was assessed 14 days after
seeding the transducted cells. Dataare shown as the mean ± SD (n=3). *= p<0.05.

* *
* *

33

Numerical Bibliography
1. Lee AS (2007) GRP78 induction in cancer: therapeutic and prognostic implications.
Cancer Res 67(8):3496-3499.

2. Pfaffenbach KT & Lee AS (2011) The critical role of GRP78 in physiologic and
pathologic stress. Curr Opin Cell Biol 23(2):150-156.

3. Ron D & Walter P (2007) Signal integration in the endoplasmic reticulum unfolded
protein response. Nat Rev Mol Cell Biol 8(7):519-529.

4. Ni M, Zhang Y, & Lee AS (2011) Beyond the endoplasmic reticulum: atypical
GRP78 in cell viability, signalling and therapeutic targeting. Biochem J
434(2):181-188.

5. Hetz C, et al. (2006) Proapoptotic BAX and BAK modulate the unfolded protein
response by a direct interaction with IRE1alpha. Science 312(5773):572-576.

6. Dong D, et al. (2011) A critical role for GRP78/BiP in the tumor microenvironment
for neovascularization during tumor growth and metastasis. Cancer Res
71(8):2848-2857.

7. Biquan L & Lee AS (2012) The critical roles of endoplasmic reticulum chaperones
and unfolded protein response in tumorigenesis and anti-cancer therapies. Oncogene
1-14

8. Roue G, et al. (2011) The Hsp90 inhibitor IPI-504 overcomes bortezomib resistance
in mantle cell lymphoma in vitro and in vivo by down-regulation of the prosurvival
ER chaperone BiP/Grp78. Blood 117(4):1270-1279.

9. Baumeister P, Dong D, Fu Y, & Lee AS (2009) Transcriptional induction of
GRP78/BiP by histone deacetylase inhibitors and resistance to histone deacetylase
inhibitor-induced apoptosis. Mol Cancer Ther 8(5):1086-1094.

34

10. Pyrko P, Schönthal AH, Hofman FM, Chen TC, & Lee AS (2007) The unfolded
protein response regulator GRP78/BiP as a novel target for increasing
chemosensitivity in malignant gliomas. Cancer Res 67(20):9809-9816.

11. Virrey JJ, et al. (2008) Stress chaperone GRP78/BiP confers chemoresistance to
tumor-associated endothelial cells. Mol Cancer Res 6(8):1268-1275.

12. Li J, et al. (2006) Endoplasmic reticulum stress-induced apoptosis: multiple pathways
and activation of p53-up-regulated modulator of apoptosis (PUMA) and NOXA by
p53. J BiolChem 281:7260-70

13. Huntzinger E. & Izaurralde E. (2011) Gene silencing by microRNAs: contributions of
translational repression and mRNA decay. Nat Rev Genet 12:99–110.

14. Akao Y, Nakagawa Y, & Naoe T (2006) Naoe, Let-7 microRNA functions as a
potential growth suppressor in human colon cancer cells. Biol Pharm Bull
29:903–906.

15. Bartel DP (2004) MicroRNAs: genomics, biogenesis, mechanism, and function. Cell
116:281–297.

16. Valencia-Sanchez MA et al. (2006) Control of translation and mRNA degradation by
miRNAs and siRNAs. Genes Dev. 20:515–524.

17. Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A, & Enright AJ (2006)
miRBase: microRNA sequences, targets and gene nomenclature. Nucleic Acids Res
34(Database issue):D140-144.

18. Croce CM (2009) Causes and consequences of microRNA dysregulation in cancer.
Nat Rev Genet 10(10):704-714.

19. Garzon R, Marcucci G, & Croce CM (2010) Targeting microRNAs in cancer:
rationale, strategies and challenges. Nat Rev Drug Discov 9(10):775-789.

35

20. Saito Y, et al. (2006) Specific activation of microRNA-127 with downregulation of
the proto-oncogene BCL6 by chromatin-modifying drugs in human cancer cells.
Cancer Cell 9(6):435-443.

21. Friedman JM, et al. (2009) The putative tumor suppressor microRNA-101 modulates
the cancer epigenome by repressing the polycomb group protein EZH2. Cancer Res
69(6):2623-2629.

22. Garzon R, Marcucci G, & Croce CM (2010) Targeting microRNAs in cancer:
rationale, strategies and challenges. Nat Rev Drug Discov 9:775–789.

23. Bader AG, Brown D, & Winkler M (2010) The promise of microRNA replacement
therapy. Cancer Res 70:7027–7030.

24. Chang TC, et al. (2007) Transactivation of miR-34a by p53 broadly influences gene
expression and promotes apoptosis. Mo. Cell 26:745–752.

25. Cimmino A, et al. (2005) MiR-15 and miR-16 induce apoptosis by targeting BCL2.
Proc Natl Acad Sci USA 102:13944–13949.

26. Johnson SM, et al. (2005) RAS is regulated by the let-7 microRNA family. Cell
120:635–647.

27. Mayr C, Hemann MT, & Bartel DP (2007) Disrupting the pairing between let-7 and
Hmga2 enhances oncogenic transformation. Science 315:1576–1579.

28. Tavazoie SF, et al. (2008) Endogenous human microRNAs that suppress breast
cancer metastasis. Nature 451:147–152.

29. Trang P, et al. (2009) Regression of murine lungtumors by the let-7 microRNA.
Oncogene 29:1580–1587.

36

30. Devi GR (2006) SiRNA-based approaches in cancer therapy. Cancer Gene Ther
13:819–829.

31. Lu PY, Xie F, & Woodle MC (2005) In vivo application of RNA interference: from
functional genomics to therapeutics. Adv Genet 54:117–142.

32. Tong AW (2006) Small RNAs and non-small cell lung cancer. Curr Mol Med
6:339–349.

33. Matrai J, Chuah MK, & VandenDriessche T (2010) Recent advances in lentiviral
vector development and applications. Mol Ther 18:477–490.

34. Zhang HY, et al. (2011) Mice overexpressing the gene for heparin-binding epidermal
growth factorlike growth factor (HB-EGF) have increased resistance to hemorrhagic
shock and resuscitation. Surgery 149:276–283.

35. Scherr M, et al. (2007) Lentivirus-mediated antagomir expression for specific
inhibition of miRNA function. Nucleic Acids Res 35:e149.

36. Zhu X, et al. (2007) A versatile approach to multiple gene RNA interference using
microRNA-based short hairpin RNAs. BMC Mol Biol 8:98.

37. Marquez RT, & McCaffrey AP (2008) Advances in microRNAs: implications for
gene therapists. Hum. Gene Ther 19:27–38.

38. Selbach M, et al. (2008) Widespread changes in protein synthesis induced by
microRNAs. Nature 455(7209):58-63.

39. Ely A, Naidoo T, & Arbuthnot P (2009) Efficient silencing of gene expression with
modular trimeric Pol II expression cassettes comprising microRNA shuttles. Nucleic
Acids Res 37:e91.

37

40. Snyder LL, Ahmed I, & Steel LF (2009) RNA polymerase III can drive polycistronic
expression of functional interfering RNAs designed to resemble microRNAs. Nucleic
Acids Res 37:e127.

41. Leung AK & Sharp PA (2010) MicroRNA functions in stress responses. Mol Cell
40(2):205-215.

42. Han J, et al. (2006) Molecular basis for the recognition of primary microRNAs by the
Drosha-DGCR8 complex. Cell 125:887–901.

43. Morlando M, et al. (2008) Primary microRNA transcripts are processed
co-transcriptionally. Nat Struct Mol Biol 15:902–909.

44. Qiu X, Friedman JM, & Liang G (2011) Creating a flexible multiple microRNA
expression vector by linking precursor microRNAs. Biochem Biophys Res Commun
411(2):276-280

45. Soifer HS, Rossi JJ, & Saetrom P (2007) MicroRNAs in disease and potential
therapeutic applications. Mol Ther 15:2070–2079.

46. Guo H, Ingolia NT, Weissman JS, & Bartel DP (2010) Mammalian microRNAs
predominantly act to decrease target mRNA levels. Nature 466(7308):835-840.

47. Daneshmand S, et al. (2007) Glucose-regulated protein GRP78 is up-regulated in
prostate cancer and correlates with recurrence and survival. Hum Pathol
38(10):1547-1552.

48. Kumar M, et al. (2011) Negative regulation of the tumor suppressor p53 gene by
microRNAs. Oncogene 30(7):843-853.

49. Frucht CS, Santos-Sacchi J, & Navaratnam DS (2011) MicroRNA181a plays a key
role in hair cell regeneration in the avian auditory epithelium. Neurosci Lett
493(1-2):44-48.

38

50. Ouyang YB, et al. (2012) miR-181 regulates GRP78 and influences outcome from
cerebral ischemia in vitro and in vivo. Neurobiol Dis 45(1):555-563.

51. Shen Q, et al. (2010) Role of microRNA-199a-5p and discoidin domain receptor 1 in
human hepatocellular carcinoma invasion. Mol Cancer 9:227.

52. Lewis BP, Burge CB, & Bartel DP (2005) Conserved seed pairing, often flanked by
adenosines, indicates that thousands of human genes are microRNA targets. Cell
120(1):15-20.

53. Lim LP, et al. (2005) Microarray analysis shows that some microRNAs downregulate
large numbers of target mRNAs. Nature 433(7027):769-773.

54. Mavrakis KJ, et al. (2011) A cooperative microRNA-tumor suppressor gene network
in acute T-cell lymphoblastic leukemia (T-ALL). Nat Genet 43(7):673-678.

55. Marasa BS, et al. (2009) Increased MKK4 abundance with replicative senescence is
linked to the joint reduction of multiple microRNAs. Sci Signal 2(94):ra69.

39

Bibliography
Akao Y, Nakagawa Y, & Naoe T (2006) Naoe, Let-7 microRNA functions as a potential
growth suppressor in human colon cancer cells. Biol Pharm Bull 29:903–906.

Bader AG, Brown D, & Winkler M (2010) The promise of microRNA replacement
therapy. Cancer Res 70:7027–7030.

Bartel DP (2004) MicroRNAs: genomics, biogenesis, mechanism, and function. Cell
116:281–297.

Baumeister P, Dong D, Fu Y, & Lee AS (2009) Transcriptional induction of GRP78/BiP
by histone deacetylase inhibitors and resistance to histone deacetylase inhibitor-induced
apoptosis. Mol Cancer Ther 8(5):1086-1094.

Biquan L & Lee AS (2012) The critical roles of endoplasmic reticulum chaperones and
unfolded protein response in tumorigenesis and anti-cancer therapies. Oncogene 1-14

Chang TC, et al. (2007) Transactivation of miR-34a by p53 broadly influences gene
expression and promotes apoptosis. Mo. Cell 26:745–752.

Cimmino A, et al. (2005) MiR-15 and miR-16 induce apoptosis by targeting BCL2. Proc
Natl Acad Sci USA 102:13944–13949.

Croce CM (2009) Causes and consequences of microRNA dysregulation in cancer. Nat
Rev Genet 10(10):704-714.

Daneshmand S, et al. (2007) Glucose-regulated protein GRP78 is up-regulated in prostate
cancer and correlates with recurrence and survival. Hum Pathol 38(10):1547-1552.

Devi GR (2006) SiRNA-based approaches in cancer therapy. Cancer Gene Ther
13:819–829.

40

Dong D, et al. (2011) A critical role for GRP78/BiP in the tumor microenvironment for
neovascularization during tumor growth and metastasis. Cancer Res 71(8):2848-2857.

Ely A, Naidoo T, & Arbuthnot P (2009) Efficient silencing of gene expression with
modular trimeric Pol II expression cassettes comprising microRNA shuttles. Nucleic
Acids Res 37:e91.

Friedman JM, et al. (2009) The putative tumor suppressor microRNA-101 modulates the
cancer epigenome by repressing the polycomb group protein EZH2. Cancer Res
69(6):2623-2629.

Frucht CS, Santos-Sacchi J, & Navaratnam DS (2011) MicroRNA181a plays a key role
in hair cell regeneration in the avian auditory epithelium. Neurosci Lett 493(1-2):44-48.

Garzon R, Marcucci G, & Croce CM (2010) Targeting microRNAs in cancer: rationale,
strategies and challenges. Nat Rev Drug Discov 9(10):775-789.

Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A, & Enright AJ (2006) miRBase:
microRNA sequences, targets and gene nomenclature. Nucleic Acids Res 34(Database
issue):D140-144.

Guo H, Ingolia NT, Weissman JS, & Bartel DP (2010) Mammalian microRNAs
predominantly act to decrease target mRNA levels. Nature 466(7308):835-840.

Han J, et al. (2006) Molecular basis for the recognition of primary microRNAs by the
Drosha-DGCR8 complex. Cell 125:887–901.

Hetz C, et al. (2006) Proapoptotic BAX and BAK modulate the unfolded protein
response by a direct interaction with IRE1alpha. Science 312(5773):572-576.

Huntzinger E. & Izaurralde E. (2011) Gene silencing by microRNAs: contributions of
translational repression and mRNA decay. Nat Rev Genet 12:99–110.

41

Johnson SM, et al. (2005) RAS is regulated by the let-7 microRNA family. Cell
120:635–647.

Kumar M, et al. (2011) Negative regulation of the tumor suppressor p53 gene by
microRNAs. Oncogene 30(7):843-853.

Lee AS (2007) GRP78 induction in cancer: therapeutic and prognostic implications.
Cancer Res 67(8):3496-3499.

Leung AK & Sharp PA (2010) MicroRNA functions in stress responses. Mol Cell
40(2):205-215.

Lewis BP, Burge CB, & Bartel DP (2005) Conserved seed pairing, often flanked by
adenosines, indicates that thousands of human genes are microRNA targets. Cell
120(1):15-20.

Li J, et al. (2006) Endoplasmic reticulum stress-induced apoptosis: multiple pathways and
activation of p53-up-regulated modulator of apoptosis (PUMA) and NOXA by p53. J
BiolChem 281:7260-70

Lim LP, et al. (2005) Microarray analysis shows that some microRNAs downregulate
large numbers of target mRNAs. Nature 433(7027):769-773.

Lu PY, Xie F, & Woodle MC (2005) In vivo application of RNA interference: from
functional genomics to therapeutics. Adv Genet 54:117–142.

Marasa BS, et al. (2009) Increased MKK4 abundance with replicative senescence is
linked to the joint reduction of multiple microRNAs. Sci Signal 2(94):ra69.

Marquez RT, & McCaffrey AP (2008) Advances in microRNAs: implications for gene
therapists. Hum. Gene Ther 19:27–38.

42

Matrai J, Chuah MK, & VandenDriessche T (2010) Recent advances in lentiviral vector
development and applications. Mol Ther 18:477–490.

Mavrakis KJ, et al. (2011) A cooperative microRNA-tumor suppressor gene network in
acute T-cell lymphoblastic leukemia (T-ALL). Nat Genet 43(7):673-678.

Mayr C, Hemann MT, & Bartel DP (2007) Disrupting the pairing between let-7 and
Hmga2 enhances oncogenic transformation. Science 315:1576–1579.

Morlando M, et al. (2008) Primary microRNA transcripts are processed
co-transcriptionally. Nat Struct Mol Biol 15:902–909.

Ni M, Zhang Y, & Lee AS (2011) Beyond the endoplasmic reticulum: atypical GRP78 in
cell viability, signalling and therapeutic targeting. Biochem J 434(2):181-188.

Ouyang YB, et al. (2012) miR-181 regulates GRP78 and influences outcome from
cerebral ischemia in vitro and in vivo. Neurobiol Dis 45(1):555-563.

Pfaffenbach KT & Lee AS (2011) The critical role of GRP78 in physiologic and
pathologic stress. Curr Opin Cell Biol 23(2):150-156.

Pyrko P, Schönthal AH, Hofman FM, Chen TC, & Lee AS (2007) The unfolded protein
response regulator GRP78/BiP as a novel target for increasing chemosensitivity in
malignant gliomas. Cancer Res 67(20):9809-9816.

Qiu X, Friedman JM, & Liang G (2011) Creating a flexible multiple microRNA
expression vector by linking precursor microRNAs. Biochem Biophys Res Commun
411(2):276-280

Ron D & Walter P (2007) Signal integration in the endoplasmic reticulum unfolded
protein response. Nat Rev Mol Cell Biol 8(7):519-529.

43

Roue G, et al. (2011) The Hsp90 inhibitor IPI-504 overcomes bortezomib resistance in
mantle cell lymphoma in vitro and in vivo by down-regulation of the prosurvival ER
chaperone BiP/Grp78. Blood 117(4):1270-1279.

Saito Y, et al. (2006) Specific activation of microRNA-127 with downregulation of the
proto-oncogene BCL6 by chromatin-modifying drugs in human cancer cells. Cancer Cell
9(6):435-443.

Scherr M, et al. (2007) Lentivirus-mediated antagomir expression for specific inhibition
of miRNA function. Nucleic Acids Res 35:e149.

Selbach M, et al. (2008) Widespread changes in protein synthesis induced by microRNAs.
Nature 455(7209):58-63.

Shen Q, et al. (2010) Role of microRNA-199a-5p and discoidin domain receptor 1 in
human hepatocellular carcinoma invasion. Mol Cancer 9:227.

Soifer HS, Rossi JJ, & Saetrom P (2007) MicroRNAs in disease and potential therapeutic
applications. Mol Ther 15:2070–2079.

Snyder LL, Ahmed I, & Steel LF (2009) RNA polymerase III can drive polycistronic
expression of functional interfering RNAs designed to resemble microRNAs. Nucleic
Acids Res 37:e127.

Tavazoie SF, et al. (2008) Endogenous human microRNAs that suppress breast cancer
metastasis. Nature 451:147–152.

Tong AW (2006) Small RNAs and non-small cell lung cancer. Curr Mol Med 6:339–349.

Trang P, et al. (2009) Regression of murine lungtumors by the let-7 microRNA.
Oncogene 29:1580–1587.

44

Valencia-Sanchez MA et al. (2006) Control of translation and mRNA degradation by
miRNAs and siRNAs. Genes Dev. 20:515–524.

Zhang HY, et al. (2011) Mice overexpressing the gene for heparin-binding epidermal
growth factorlike growth factor (HB-EGF) have increased resistance to hemorrhagic
shock and resuscitation. Surgery 149:276–283.

Zhu X, et al. (2007) A versatile approach to multiple gene RNA interference using
microRNA-based short hairpin RNAs. BMC Mol Biol 8:98.

Virrey JJ, et al. (2008) Stress chaperone GRP78/BiP confers chemoresistance to
tumor-associated endothelial cells. Mol Cancer Res 6(8):1268-1275.

Abstract (if available)

Abstract GRP78, a major endoplasmic reticulum (ER) chaperone and signaling regulator, is commonly over-expressed in human cancer and contributes to cancer cell proliferation, survival and tumorigenesis. Moreover, induction of GRP78 by a variety of anti-cancer drugs, including histone deacetylase inhibitors, confers chemoresistance to cancer. Thus, targeting GRP78 to inhibit tumor survival and proliferation, sensitize tumor cells to chemotherapeutic drugs and consequently induce apoptosis serves as a promising avenue in anti-cancer therapy. MicroRNAs (miRNAs) are ~22 nt non-coding RNA molecules that usually function as endogenous repressors of target genes. However, how GRP78 expression is regulated is still unclear. We hypothesized that small non-coding RNAs regulate GRP78 expression. The previous works already shown that miR-30d, miR-181a, and miR-199a are capable of directly targeting GRP78. By constructing a vector from which multiple miRNAs can be expressed, we showed that miR-30d, miR-181a, and miR-199a act synergistically to cause GRP78 down-regulation, and the reduction in cell proliferation and in colony formation of C4-2B prostate cancer cells. Furthermore, delivery of multiple miRNAs by lentivirial vector increased the sensitivity of cancer cells to the histone deacetylase inhibitor trichostatin A (TSA), in C42B, HCT116, and P39 cells. The results suggest that combining multiple tumor suppressor miRNAs serve as a novel therapeutic approach for cancer treatment.

Linked assets

University of Southern California Dissertations and Theses

Conceptually similar

PDF

The role of GRP78 in the regulation of apoptosis and prostate cancer progression

PDF

The role of nuclear GRP78 in regulation of EGFR expression in lung cancer

PDF

Utilizing novel small molecules to modulate GRP78 expression and activity in cancer

PDF

The role of endoplasmic reticulum chaperone protein GRP78 in breast cancer

PDF

The role of endoplasmic reticulum protein GRP78 in normal hematopoeises and PTEN-null leukemogenesis

PDF

The role of endoplasmic reticulum chaperones in regulating hematopoietic stem cells and hematological malignancies

PDF

Identification of novel epigenetic biomarkers and microRNAs for cancer therapeutics

PDF

The roles of endoplasmic reticulum chaperones in regulating liver homeostasis and tumorigenesis

PDF

The role of microRNAs in cancer

PDF

Cell surface translocation and therapeutic targeting of GRP78

PDF

Molecular mechanisms of chemoresistance in breast cancer

PDF

The role of endoplasmic reticulum chaperone glucose-regulated 78-kilodalton (GRP78) in lung cancer

PDF

Cell surface translocation mechanism of stress-inducible GRP78 in human cancer

PDF

Role of endoplasmic reticulum chaperones GRP78 and GRP94 in regulating unfolded protein response and cell survival

PDF

Alcohol mediated expression of cyto-protective enzyme - NQO-1 and its post translational regulation

PDF

The role of endoplasmic reticulum proteins GRP78 and IP3R1 in regulation of glucose homeostasis and acute pancreatitis

PDF

The molecular mechanism of GRP78 translocation from the endoplasmic reticulum to the cell surface

PDF

Role of GRP78 and its novel cytosolic isoform GRP78va in regulating the unfolded protein response in cancer

PDF

The role of endoplasmic reticulum chaperones in adipogenesis, liver cancer and mammary gland development

PDF

TLR8-transferred miR-192 acts as a tumor suppressor in neuroblastoma by inhibiting CTCF

Asset Metadata

Creator Chang, Yin-Wei (author)

Core Title Creating a multiple micrornia expression vector to target GRP78, an ER chaperone and signaling regulator in cancer

School Keck School of Medicine

Degree Master of Science

Degree Program Biochemistry and Molecular Biology

Publication Date 08/02/2012

Defense Date 04/17/2012

Publisher University of Southern California (original), University of Southern California. Libraries (digital)

Tag GRP78,microRNA,OAI-PMH Harvest

Language English

Contributor Electronically uploaded by the author (provenance)

Advisor Jones, Peter Anthony (committee chair), Stallcup, Michael R. (committee member), Tokes, Zoltan A. (committee member)

Creator Email yinweich@gmail.com,yinweich@usc.edu

Permanent Link (DOI) https://doi.org/10.25549/usctheses-c3-83898

Unique identifier UC11289147

Identifier usctheses-c3-83898 (legacy record id)

Legacy Identifier etd-ChangYinWe-1113.pdf

Dmrecord 83898

Document Type Thesis

Rights Chang, Yin-Wei

Type texts

Source University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Access Conditions The author retains rights to his/her dissertation, thesis or other graduate work according to U.S. copyright law. Electronic access is being provided by the USC Libraries in agreement with the a...

Repository Name University of Southern California Digital Library

Repository Location USC Digital Library, University of Southern California, University Park Campus MC 2810, 3434 South Grand Avenue, 2nd Floor, Los Angeles, California 90089-2810, USA