University of Southern California Dissertations and Theses

Progesterone receptors in the rat brain and their role in steroidal regulation of neurite outgrowth

(USC Thesis Other)

Progesterone receptors in the rat brain and their role in steroidal regulation of neurite outgrowth

PDF

Download

Open document

Flip pages

Download a page range

Download transcript

Copy asset link

Request this asset

Transcript (if available)

Content

PROGESTERONE RECEPTORS IN THE RAT BRAIN AND THEIR ROLE IN
STEROIDAL REGULATION OF NEURITE OUTGROWTH

by

Namrata Bali

A Dissertation Presented to the
FACULTY OF THE USC GRADUATE SCHOOL
UNIVERSITY OF SOUTHERN CALIFORNIA
In Partial Fulfillment of the
Requirements for the Degree
DOCTOR OF PHILOSOPHY
(MOLECULAR BIOLOGY)

August 2012

Copyright 2012 Namrata Bali

ii
DEDICATION

To all those blessed with curiosity for sad is the incurious mind

iii
ACKNOWLEDGEMENTS

I would like to thank my graduate advisor Dr. Caleb E. Finch for his guidance and
support throughout my PhD pursuit. He has been a wonderful teacher to me and I am
grateful for the opportunity to learn from one of the best scientists in the world. I would
also like to sincerely thank Dr. Todd E. Morgan for his help and guidance in all my
experiments throughout my stay in Dr. Finch’s lab. My numerous discussions with Dr.
Finch and Dr. Morgan have made me a much better scientist than I could have been. In
addition, I would like to thank my thesis and guidance committee comprised of Dr. John
Tower, Dr. P. Elyse Schauwecker and Dr. Valter Longo for their support, comments and
critiques of my research and this dissertation. I would also like to thank the past and
present members of the Finch lab, especially Dr. Jason M. Arimoto, Dr. David A. Davis,
Nahoko Iwata, Dr. Sharon W. Lin, David Berg and Hank Cheng. I would like to thank
Dr. Chanpreet Singh for his unwavering support and helpful critiques of my experiments.
Finally, I would like to extend my thanks to the Molecular Biology program for making
graduate school an enjoyable and enriching experience.

iv
TABLE OF CONTENTS

DEDICATION ii
ACKNOWLEDGEMENTS iii
LIST OF TABLES vi
LIST OF FIGURES vii
ABSTRACT ix
CHAPTER ONE: Introduction 1
Rat Estrous Cycle 1
E2 and P4 in the CNS 2
Synthesis 2
Effects on CNS 3
Effects on neurite outgrowth 4
Progesterone receptors 6
Pgr 6
Pgrmc1 7
E2 and P4 in postmenopausal hormone therapy 9
E2 and P4 effects on neurite outgrowth: involvement of microglia 10
Conclusions 12

CHAPTER TWO: Differential Responses of Progesterone Receptor
Membrane Component-1 (Pgrmc1) and the Classical Progesterone Receptor
(Pgr) to 17β-Estradiol and Progesterone in Hippocampal Subregions that
Support Synaptic Remodeling and Neurogenesis 13
Abstract 13
Introduction 14
Methods 18
Results 28
Discussion 41

CHAPTER THREE: Microglia Modulate Neurite Outgrowth Responses to
Progesterone Through Pgrmc1, a Non-Classical Progesterone Mediator 50
Abstract 50
Introduction 51
Methods 54

v
Results 59
Discussion 84

CHAPTER FOUR: Conclusion 93
REFERENCES 99

vi
LIST OF TABLES

Table 1: Average grain densities 38
Table 2: Summary of Pgrmc1 & Pgr responses to E2 & P4 in CA1 44

vii
LIST OF FIGURES

Figure 1 Hormone replacement schedules for Pgrmc1 and Pgr
regulation by E2 and P4. 20

Figure 2 Brightfield images of in situ hybridization for Pgrmc1 and Pgr
in hippocampal CA1 pyramidal and dentate gyrus neuron layers. 23

Figure 3 Frequency distribution of average grain density with sense- and
anti-sense probes for Pgrmc1 in CA1 neurons and Pgr in DG neurons. 24

Figure 4 Antibody specificity of rabbit polyclonal Pgr antibody. 26

Figure 5 Pgrmc1 and Pgr mRNA prevalence in total RNA from adult rat
hippocampus by RT-PCR. 29

Figure 6 Expression of Pgrmc1 and Pgr in hippocampal neuronal layers. 30

Figure 7 Regulation of Pgrmc1 mRNA by 17β-estradiol (E2) and progesterone
(P4). 32

Figure 8 Frequency distributions of grain densities of Pgrmc1 mRNA after
4-day hormone replacement. 33

Figure 9 Frequency distributions of grain densities of Pgrmc1 mRNA after
30-day hormone replacement. 34

Figure 10 Regulation of Pgr mRNA by 17β-estradiol (E2) and progesterone. 35

Figure 11 Frequency distributions of grain densities of Pgr mRNA after 4-day
hormone replacement. 36

Figure 12 Frequency distributions of grain densities of Pgr mRNA after 30-day
hormone replacement. 37

Figure 13 Expression of Pgrmc1 and Pgr in neural progenitor cells (NPC). 40

Figure 14 The entorhinal cortex lesioning (ECL) model of perforant pathway
degeneration. 56

Figure 15 Microglial activation (Isolectin-B4) in the DG molecular layer. 61

viii
Figure 16 Astrocyte activation (GFAP) in the DG molecular layer. 62

Figure 17 Experimental outline: Add-back microglia to astrocyte-neuron
co-cultures. 63

Figure 18 Neurite outgrowth in mixed glia, enriched astrocytes and add-back
microglia co-cultures. 65

Figure 19 Requirement of microglial wounding for P4 antagonism of neurite
outgrowth. 68

Figure 20 Experimental outline: Effect of LPS-treated microglial conditioned
media on P4 antagonism. 69

Figure 21 Requirement of activated microglial secreted factors for P4
antagonism of neurite outgrowth. 70

Figure 22 CD11b protein expression in vehicle and LPS-treated microglia. 71

Figure 23 Glial expression of Pgrmc1 and Pgr. 72

Figure 24 Pgrmc1 protein in cultured primary astrocytes and microglia. 73

Figure 25 Pgrmc1 protein expression in rat DG molecular layer. 74

Figure 26 Requirement of Pgrmc1 in P4 antagonism of neurite outgrowth. 76

Figure 27 Pgrmc1 siRNA in astrocytes only: effect on P4 antagonism. 77

Figure 28 Pgrmc1 siRNA in microglia only: effect on P4 antagonism. 78

Figure 29 Requirement of Pgrmc1 in wounded microglial CM-mediated P4
antagonism. 80

Figure 30 Requirement of Pgrmc1 in LPS-activated microglial CM-mediated
P4 antagonism. 81

Figure 31 Pgrmc1 protein in vehicle, LPS, and LPS and Pgrmc1 siRNA treated
microglia. 82

Figure 32 CD11b protein in vehicle, LPS and LPS and Pgrmc1 siRNA treated
microglia. 83

ix
ABSTRACT

Estrogen (E2) and progesterone (P4) regulate synaptic plasticity in the adult rat
hippocampus during the normal rat estrous cycle and in response to deafferenting lesions.
E2 increases neurite sprouting, whereas P4 antagonizes the E2-induced neurite
outgrowth. Moreover, in the in vitro wounding-in-a-dish lesion model with glia-neuron
co-cultures, E2 increases neurite outgrowth and P4 antagonizes the E2-induced neurite
outgrowth. However, the P4-E2 antagonism of neurite outgrowth was only seen in the
presence of microglia. The receptors involved in the P4 responses to neurite outgrowth
are not well understood. Two progesterone mediators, Pgrmc1 and Pgr are studied in this
thesis.

Both Pgrmc1 and Pgr are expressed in the CA1, CA3 and DG hippocampal neurons,
although their expression patterns differ between the neuronal subtypes. Both Pgrmc1
and Pgr are also regulated by E2 and P4 in the hippocampal neurons. Pgrmc1 mRNA is
upregulated by both E2 and P4 in CA1, CA3 and DG neurons, while Pgr is hormonally
regulated in CA1 neurons only. The differential expression and regulation of Pgrmc1 and
Pgr in different hippocampal neurons could be due to possible different functions
mediated by each in the different neurons. Pgrmc1 and Pgr are also expressed in glia.
While both are expressed in astrocytes, only Pgrmc1 is expressed in microglia.

Using a new microglia add-back protocol, microglia are shown to be required for P4-E2
antagonism of neurite outgrowth. However, physical contact between microglia and

x
neurons is not required for the P4 antagonism, and soluble factors from activated
microglia suffice to restore P4-E2 antagonism. Moreover, Pgrmc1 expression in
microglia is required for the P4-E2 antagonism of neurite outgrowth.

These findings together provide evidence of a P4 mediator in microglia with novel roles
in P4 regulation of neurite outgrowth and in regulation of microglial activation.
Understanding the mechanisms involved in P4-E2 regulation of synaptic plasticity is
important in optimization of postmenopausal hormone therapy and in the therapeutic use
of P4 for traumatic brain injury.

1
CHAPTER 1
Introduction

Estrogen and progesterone are the two main female reproductive hormones. Three
different estrogens are normally found in mammals – (i) Estrone, which is comprised of a
single hydroxyl group and is the principal estrogen post-menopause, (ii) Estradiol
contains two hydroxyl groups and is the most potent estrogen during the female
reproductive years, (iii) Estriol consists of three hydroxyl groups and is the most
important estrogen during pregnancy. Natural progesterone comes in a single form,
however many synthetic progestins are utilized in hormonal contraception and hormone
replacement therapy.

Rat estrous cycle

The rat estrous cycle is a 4-5 day cycle during the rat’s reproductive months during which
estradiol (E2) and progesterone (P4) undergo cyclic elevations. Estradiol levels rise
steadily during diestrous and reach its peak at mid-day of proestrous. After the proestrous
peak, estradiol levels fall rapidly during the next 12 hours, until reaching its nadir at
estrous stage. Progesterone levels peak during the rapidly falling E2 levels and reach its
peak at late proestrous / early estrous. The cyclic changes of E2 and P4 are responsible
for the cyclic changes that occur in the rat reproductive tract. E2 is produced from the
ovaries and also from the adrenal glands. P4 is produced from the corpus luteum and the

2
adrenal glands. Apart from these sites of synthesis, both E2 and P4 are also synthesized
from the rat central nervous system (CNS) from both neurons and glia (Zwain and Yen
1999). Hence, E2 and P4 are also termed neurosteroids.

E2 and P4 in the CNS

Synthesis:
Both E2 and P4 are ultimately synthesized from cholesterol. Cholesterol is converted by
the enzyme Cholesterol side-chain cleavage enzyme, also known as P450scc into
pregnenolone, which in turn is converted into progesterone via the enzyme 3β-
hydroxysteroid dehydrogenase (3β-HSD). Progesterone can be converted into
testosterone through the sequential action of 17α-hydroxylase, 17,20-lyase and 17β-HSD.
Testosterone can be converted to estradiol via the enzyme aromatase. Of the neural cells,
astrocytes are the most active in neurosteroidogenesis, expressing all the above
mentioned enzymes and capable of synthesizing progesterone, testosterone and estradiol
(Zwain and Yen 1999). Neurons chiefly synthesize estradiol, whereas microglia do not
express enzymes necessary for de novo steroidogenesis of progesterone or
dehydroepiandrosterone (DHEA). However, microglia do express 17β-HSD and 5α-
reductase, two enzymes involved in the metabolism of androgens and estrogens
(Gottfried-Blackmore, Sierra et al. 2008). Thus, all neural cells are involved in the
metabolism of both E2 and P4.

3
Effects on CNS:
A series of studies performed in the early 1990s showed direct roles of E2 and P4 on
neurons in the rat CNS. During the adult rat estrous cycle, neurons in the hippocampus
undergo cyclic changes. Specifically, CA1 neurons of the hippocampus show cyclic
changes in their dendritic spine and synapse density across the rat estrous cycle. CA1
dendritic spine density is lowest at the estrous stage when E2 is at its lowest levels
(Woolley and McEwen 1992). Further, E2 treatment of ovariectomized (OVX) rats for 2
days results in an increase in dendritic spine density in CA1 neurons compared to OVX
rats treated with vehicle (Woolley and McEwen 1993). P4, on the other hand has
different effects on CA1 dendritic spine density. Treatment of OVX rats with combined
E2+P4 results in a loss of the increase in spines seen with E2 alone (Woolley and
McEwen 1993), indicating that P4 antagonizes E2 induction of CA1 dendritic spines.
Moreover, treatment of rats with RU486, a classical progesterone receptor antagonist, at
the estrous phase results in a loss of the decrease in dendritic spine density seen in normal
cycling rats at estrous (Woolley and McEwen 1993). Thus, the decrease of CA1 dendritic
spine density at estrous phase is due to decreased E2 levels and also due to the increased
P4 levels at that phase.

Both E2 and P4 have numerous other effects on the CNS. E2 has been shown to be
neuroprotective against neuronal damage by ischemia (Wise and Dubal 2000), oxidative
stress (Behl, Skutella et al. 1997) and glutamate excitotoxicity (Singer, Figueroa-Masot et
al. 1999). E2 also decreases glial activation, which can have detrimental effects on

4
neurons (Smith, Das et al. 2011). E2 reduces the levels of β-amyloid (Aβ) in a mouse
model of Alzheimer disease (AD), concurrent with improving learning and memory
(Carroll, Rosario et al. 2007). P4, on the other hand, antagonizes E2’s effect on reducing
Aβ load (Carroll, Rosario et al. 2007). However, P4 has also been shown to have
neuroprotective roles, especially in mouse models of traumatic brain injury (TBI) (Shear,
Galani et al. 2002; De Nicola, Labombarda et al. 2009) and spinal cord injury (SCI)
(Labombarda, Gonzalez Deniselle et al. 2010). It is currently hypothesized that P4
mediates neuroprotection in these models by reducing edema and glial activation (Shear,
Galani et al. 2002; Hua, Wang et al. 2011). P4 is also neuroprotective in models of
ischemia, where it promotes cell survival in CA1 neurons post-ischemia (Morali,
Letechipia-Vallejo et al. 2005). These neuroprotective roles of P4 are divergent from its
roles in antagonizing the beneficial effects of E2.

Effects on neurite outgrowth:
E2 has been shown to enhance neurite outgrowth in cultured neurons from the
hypothalamus (Ferreira and Caceres 1991), cortex (Nathan, Barsukova et al. 2004) and in
neuronal cell lines (Takahashi, Piao et al. 2011). E2 also increases neurite outgrowth after
in vivo and in vitro lesions. Specifically, the role of E2 in lesion induced neurite
sprouting has been studied in detail in the rat entorhinal cortex lesion model of neuronal
injury (Stone, Rozovsky et al. 1998; Wong, Rozovsky et al. 2009). The entorhinal cortex
is the origin of the perforant pathway, which connects the entorhinal cortex to the
hippocampus. It is the main cortical input to the hippocampus, which is a primary seat of

5
learning and memory. Lesions of the entorhinal cortex (ECL) result in degeneration of
efferent axons from the entorhinal cortex to the dentate gyrus, resulting in deafferentation
of the dentate gyrus (DG) outer molecular layer. As a result of this deafferentation,
compensatory neurite sprouting occurs into the outer molecular layer of DG by other
pathways, including the septo-hippocampal fibers, commissural-associational fibers and
sprouting from local interneurons (Geddes, Monaghan et al. 1985).

Using this model of lesion-induced neurite sprouting, our lab previously showed that E2
increases neurite outgrowth into the outer molecular layer of the DG (Wong, Rozovsky et
al. 2009). However, treatment of rats with combined E2+P4 results in antagonism of the
E2-induced neurite outgrowth. This is another example of P4’s antagonizing action on E2
mediated induction of neurite outgrowth. Moreover, similar E2 and P4 effects are also
seen in in vitro models of lesioning. Our lab showed that using primary rat glia-neuron
co-cultures, the in vivo effects of E2 and P4 could be replicated (Wong, Rozovsky et al.
2009). The technique involves scratch-wounding the glia-neuron co-cultures, resulting in
neurite outgrowth into the wound zone. E2 increases neurite outgrowth into the wound
zone, while P4 antagonizes the E2-induced neurite outgrowth. This thesis is primarily
concerned with studying the mechanism of P4 antagonism of E2-induction of neurite
outgrowth.

6
Progesterone receptors
P4 mediates its actions through progesterone receptors. Until recently, only the classical
progesterone receptor (Pgr) was recognized for mediating P4 actions. However, a novel
membrane-associated putative progesterone receptor was identified in 1996 (Falkenstein,
Meyer et al. 1996). This receptor was initially termed 25-Dx, since it was a ~25 kD
protein, inducible by dioxin in porcine liver microsomes (Selmin, Lucier et al. 1996). It
was originally purified from porcine liver microsomes. 25-Dx was termed progesterone
receptor membrane component-1 (Pgrmc1) later on, since the protein has a single trans-
membrane domain and was shown to mediate P4’s action on sperm capacitation
(Buddhikot, Falkenstein et al. 1999; Falkenstein, Heck et al. 1999). Moreover, three more
novel putative progesterone receptors were also identified in 2003 (Zhu, Bond et al.
2003; Zhu, Rice et al. 2003): they are termed mPRα, mPRβ and mPRγ. All three mPRs
are membrane receptors with seven trans-membrane domains and act as G-protein
coupled receptors.
Pgr:
The classical progesterone receptor, Pgr, is a classic steroid receptor and acts as a
transcription factor upon steroid-binding. Pgr has two isoforms: A and B, both being
transcribed from the same gene. The A and B isoforms of Pgr differ in their transcription
start sites, but have common ligand binding and DNA-binding domains. It is currently
unknown whether the two isoforms have different functions in the CNS. Pgr is expressed
in reproductive as well as non-reproductive tissues, including the CNS (Brinton,
Thompson et al. 2008). It has a high binding affinity for P4 (dissociation constant, K
d

7
~0.38 nM (Keightley 1979)) and very low affinity for other steroids (Keightley 1979). It
mediates the P4 actions by regulating P4-dependent gene transcription.

Within the CNS, Pgr has been shown to be expressed in the cortex, hippocampus,
hypothalamus and cerebellum. Neuronal expression has been well established (Bali,
Arimoto et al. 2012). However, glial expression of Pgr has only been implicated and
derived from studies using Pgr antagonists in astrocytes (Lacroix-Fralish, Tawfik et al.
2006). Hormonal regulation of this receptor has been studied in different sub-regions of
the brain. For example, E2 has been shown to increase Pgr mRNA and protein in the rat
uterus, ovary, cortex, hypothalamus and hippocampus (Camacho-Arroyo, Villamar-Cruz
et al. 2002; Guerra-Araiza, Coyoy-Salgado et al. 2002). P4 regulation of Pgr is less clear.
In most tissues, P4 either decreases or does not change Pgr mRNA or protein (Camacho-
Arroyo, Villamar-Cruz et al. 2002; Guerra-Araiza, Coyoy-Salgado et al. 2002). It has
been shown, however, to antagonize E2’s effect on increasing Pgr mRNA and protein.
But, in the chick pituitary P4 has been shown to increase Pgr mRNA (Guennoun and
Gasc 1990). Moreover, these studies have documented Pgr regulation in whole brain
regions, and not in sub-regions. There is a need for cellular level analysis of hormonal
regulation of this receptor within CNS neurons.
Pgrmc1:
Pgrmc1 is a membrane-associated receptor originally identified from porcine liver
microsomes and termed 25-Dx for a 25 Kd protein inducible by dioxin (Falkenstein,
Meyer et al. 1996; Selmin, Lucier et al. 1996). The purified liver microsomes had P4-

8
binding activity, with both low affinity (Kd ~ 200nM) and high affinity binding sites (Kd
~ 11nM) (Meyer, Schmid et al. 1996). Moreover, this receptor was required for P4-
dependent Ca
2+
flux in sperm acrosome reaction (Buddhikot, Falkenstein et al. 1999;
Falkenstein, Heck et al. 1999). Thus, it was termed progesterone receptor membrane
component – 1 (Pgrmc1) since it mediates rapid, non-genomic P4 effects and has a single
trans-membrane domain. Numerous other groups have identified this protein under
different names and functions. It has been termed VEM-1 / VEMA in c. elegans and rat
respectively for ventral midline antigen. VEM-1 is required for correct axon guidance in
the c. elegans ventral nerve cord (Runko and Kaprielian 2004). The yeast homolog of
Pgrmc1, Dap1 has been shown to be required for sterol biosynthesis (Hughes, Powell et
al. 2007). Moreover, Pgrmc1 has a heme-binding domain and it has been shown to
interact with numerous enzymes that mediate cholesterol and steroid metabolism,
including CYP51 (lanosterol demethylase), CYP21 (21-hydroxylase) and CYP7A1
(cholesterol 7α-hydroxylase) and CYP3A4 (Hughes, Powell et al. 2007). Pgrmc1 is now
also recognized as the sigma-2-receptor (S2R
Pgrmc1
) (Ahmed, Chamberlain et al. 2012). It
is upregulated in multiple cancers including lung, breast and ovarian cancer and is
thought to play a role in tumorigenesis (Peluso 2011).

Apart from the above-mentioned functions of Pgrmc1, it is also implicated in mediating
numerous P4 effects. Peluso JJ et al. have showed that Pgrmc1 mediates the anti-
apoptotic effects of P4 on immortalized rat granulosa cells (Peluso, Romak et al. 2008;
Peluso, Liu et al. 2009; Peluso, Liu et al. 2010). It also mediates P4’s proliferative effect

9
on rat neural progenitor cells (NPC) (Liu, Wang et al. 2009). A recent study has
documented the broad expression pattern of Pgrmc1 in adult rat brain, but its cellular
level regulation by E2 and P4 within the hippocampus is not known (Intlekofer and
Petersen 2011; Intlekofer and Petersen 2011). Intlekofer KA et al. showed Pgrmc1
mRNA induction by E2+P4 and P4 in the hypothalamus by semi-quantitative in situ
hybridization. Another study by Krebs CJ et al. however, showed that P4 decreased
Pgrmc1 mRNA in the rat hypothalamus (Krebs, Jarvis et al. 2000). Thus, Pgrmc1
regulation by E2 and P4 might be complex and vary within brain regions and with
hormone treatment.

E2 and P4 in postmenopausal hormone therapy
Women are more prone to developing dementia and Alzheimer Disease (AD) than men
(Paganini-Hill and Henderson 1994). The decline of ovarian hormones (E2 and P4) after
menopause is implicated as a risk factor for developing osteoporosis, heart disease and
dementias. Considering the co-relation between the loss of E2 and P4 and subsequent
decline in cognition, postmenopausal hormone therapy (HT) was developed for the
treatment of side-effects of menopause (hot flashes) as well as the prevention of heart
disease and decline in cognition. Basic research using rodent models showed beneficial
effects of E2 on neuroprotection from amyloid-β (Aβ) mediated toxicity, as well as
improvement in learning and memory (Carroll, Rosario et al. 2007). Thus, it was
surprising when clinical trials on postmenopausal women did not show any beneficial
effects of E2 or E2+P4. P4 needs to be administered along with E2 in women with intact

10
uterus to counteract unopposed E2’s proliferative action that increases the risk for uterine
cancer. One of the largest clinical trials for HT, the Women’s Health Initiative trials that
were started in 1991 were stopped early because of an increased risk of stroke in women
taking E2 alone (Anderson, Limacher et al. 2004; Curb, Prentice et al. 2006) and an
increase in the incidence of breast cancer in women taking E2+P4 (Rossouw, Anderson et
al. 2002) and also because the associated increase in risks outweighed any reported
benefits. Moreover, there was no benefit of either E2 alone or E2+P4 on cognition and
there was even an increase in the risk for dementia in the E2+P4 group (Shumaker,
Legault et al. 2003; Shumaker, Legault et al. 2004). This discrepancy in the effects of E2
in basic research studies vs. clinical trials could be attributed to various reasons,
including the age of HT initiation (critical window hypothesis), the formulation of E2 and
P4 used, the route of intake (oral vs. patch) and continuous vs. cyclic delivery of P4.
Current clinical trials have been designed to test all these issues.

E2 and P4 effects on neurite outgrowth: involvement of microglia
Entorhinal cortex is one of the earliest brain regions to develop neuronal damage in AD
with extensive neuronal loss (Ueki, Miwa et al. 1997). Entorhinal cortex is also the
primary cortical input to the hippocampus through a pathway called the perforant
pathway. Perforant path originates in the entorhinal cortex layers II/III which send axons
to the dentate gyrus (DG) molecular layer where they form synapses with DG granule
neurons. The DG granule neurons in turn send their axons (mossy fibers) to CA3
pyramidal neurons. The CA3 pyramidal neurons send their axons (schaffer-collateral) to

11
CA1 pyramidal neurons and the CA1 neurons send output to the entorhinal cortex via the
subiculum. This pathway of information flow from the entorhinal cortex to the
hippocampus is damaged in AD due to neuronal damage to the entorhinal cortex neurons.
However, the pathway can be at least partially restored through neuronal plasticity when
fibers from other sources re-innervate the DG molecular layer, compensating for the loss
of projections from the entorhinal cortex (Geddes, Monaghan et al. 1985).

The entorhinal cortex lesion (ECL) is a model of this perforant path degeneration. In a
prior study from our lab, we showed that E2 increased neurite sprouting into the DG
molecular layer, and P4 antagonized the E2-induced neurite outgrowth (Wong, Rozovsky
et al. 2009). To understand the mechanisms involved in the P4-E2 antagonism of neurite
outgrowth, we used the wounding-in-a-dish model of neuronal injury (Lefrancois, Fages
et al. 1997). Primary rat glia-neuron co-cultures were wounded with a plastic pipette tip
followed by addition of steroids (E2: 0.1nM; P4: 100nM). When mixed glia-neuron co-
cultures were used (Mixed glia – 3:1, astrocytes:microglia), E2 increased neurite
outgrowth and P4 antagonized the E2-induced neurite outgrowth. In astrocyte-neuron co-
cultures (<5% microglia), while E2 still increased neurite outgrowth, P4 did not
antagonize the E2-induced neurite outgrowth (Wong, Rozovsky et al. 2009). This
indicated that microglia might be required for the P4-E2 antagonism of neurite
outgrowth. However, the microglial role in P4 antagonism was puzzling since microglia
have not been shown to express the classical P4 receptor, Pgr. We sought to identify the

12
role of microglia in the P4-E2 antagonism as well as the involvement of Pgrmc1 and Pgr
in mediating P4 actions on neurite outgrowth.

Conclusions

E2 and P4 have antagonistic effects on neurite outgrowth. While E2 increases neurite
outgrowth, P4 antagonizes the E2-induced neurite outgrowth. According to a prior study
from our lab, microglia could be required for the P4 antagonism of neurite outgrowth.
Here, we sought to identify the role of microglia and progesterone receptors in mediating
P4 actions on neurite outgrowth. Furthermore, we also studied the expression and
regulation of Pgrmc1 and Pgr, two P4 mediators, by E2 and P4. These studies will
provide insight into the complex actions of steroids on neuronal functions and will help in
the optimization of postmenopausal hormone therapy for Alzheimer disease and
dementia.

13
CHAPTER 2
Differential Responses of Progesterone Receptor Membrane
Component-1 (Pgrmc1) and the Classical Progesterone Receptor (Pgr)
to 17β-Estradiol and Progesterone in Hippocampal Subregions that
Support Synaptic Remodeling and Neurogenesis
(Published in Endocrinology 2012 153(2): 759-769)

Abstract

Progesterone (P4) and estradiol (E2) modulate neurogenesis and synaptic remodeling in
the hippocampus during the rat estrous cycle and in response to deafferenting lesions, but
little is known about the steroidal regulation of hippocampal progesterone receptors
associated with these processes. We examined the neuronal expression of Progesterone
receptor membrane component-1 (Pgrmc1) and the classical progesterone receptor (Pgr),
by in situ hybridization and immunohistochemistry. Pgr, a transcription factor, has been
associated with synaptic remodeling and other major actions of P4, while Pgrmc1 is
implicated in P4-dependent proliferation of adult neuroprogenitor cells (NPC) and with
rapid P4 effects on membranes. Ovariectomized (OVX) adult rats were given E2, P4, or
E2+P4 on two schedules: a 4-day model of the rodent estrous cycle and a 30-day model
of postmenopausal hormone therapy. Pgr was hormonally responsive only in CA1
pyramidal neurons and the induction of Pgr by E2 was partly antagonized by P4 only on

14
the 30-day schedule. In CA3 pyramidal and dentate gyrus (DG) neurons, Pgr was largely
unresponsive to all hormone treatments. In contrast to Pgr, Pgrmc1 was generally
induced by E2 and/or P4 throughout the hippocampus in CA1, CA3 and DG neurons. In
NPCs of the DG (immunopositive for BrdU and doublecortin), both Pgrmc1 and Pgr
were detected. The differential regulation of hippocampal Pgrmc1 and Pgr by E2 and P4
may guide drug development in hormonal therapy for support of neurogenesis and
synaptic regeneration.

Introduction

Interactions of E2 and P4 drive reproductive organ remodeling during ovulatory cycles
(Graham and Clarke 1997; Rosario, Sachdeva et al. 2003). In anticipation of
implantation, uterine cell growth is stimulated by blood elevations of E2 during the
follicular phase. During the luteal phase in the absence of implantation, endometrial cell
death (apoptosis) is promoted by the cyclic elevation and decrease of P4 (Graham and
Clarke 1997; Rosario, Sachdeva et al. 2003). Moreover, during rodent ovulatory cycles,
there is cyclic synaptic remodeling in the hippocampus (Woolley and McEwen 1992;
Woolley and McEwen 1993), a brain region critical for memory. In the follicular phase,
hippocampal CA1 pyramidal neurons grow additional dendritic spines and synapses,
which then regress rapidly after ovulation when E2 falls and P4 rises (Woolley and
McEwen 1992; Woolley and McEwen 1993; Cooke and Woolley 2005). These ovarian-
driven processes have been further resolved in ovariectomized (OVX) rats as independent

15
actions of E2 and P4: after induction by E2 treatment, the decline of CA1 spines is
dependent on the presence of elevated plasma P4 (Woolley and McEwen 1993).

In these examples, E2 and P4 appear to act independently at different phases of cyclical
remodeling processes. However, in several animal models, co-treatment with P4
attenuated E2-induced synaptic growth. In the OVX macaque, the induction by E2 of the
synaptic proteins syntaxin, synaptophysin, and spinophilin in CA1 neurons was
attenuated by co-administration of P4 (Choi, Romeo et al. 2003). Similarly, in the rat
entorhinal cortex lesion model of Alzheimer disease, we showed that co-treatment with
P4 attenuated E2-induced neurite outgrowth in the dentate gyrus (DG) (Wong, Rozovsky
et al. 2009). In contrast to many examples of P4-E2 cross-talk throughout the
reproductive system, the proliferation of neural progenitor cells (NPC) derived from adult
rat DG was induced by both E2 and P4, in vitro (Liu, Wang et al. 2009) and in vivo (Liu,
Zhao et al. 2010). Because combined concurrent E2 + P4, is commonly used for
menopausal hormone therapy (Rapp, Espeland et al. 2003; Shumaker, Legault et al. 2003;
Harman, Brinton et al. 2005), we sought to clarify E2-P4 interactions in neuronal
expression of Pgr, a transcription factor, and in progesterone receptor membrane
component-1 (Pgrmc1), a putative progesterone receptor (Brinton, Thompson et al. 2008;
Thomas 2008). Both Pgr and Pgrmc1 have high affinity P4 binding: Pgr, Kd = 0.38nM
(Keightley 1979); Pgrmc1, Kd = 11 nM (Meyer, Schmid et al. 1996).

16
Neuronal responses to P4 have been associated with both Pgrmc1 and Pgr. The decline of
hippocampal CA1 spines by P4 in OVX rats described above was blocked by RU486, a
specific antagonist of Pgr (Woolley and McEwen 1993). We also observed antagonism of
neurite outgrowth by RU486 in an in vitro model (Wong, Rozovsky et al. 2009).
However, Pgrmc1 mediated in vitro proliferation of rat neural progenitor cells (NPC), in
which Pgr was not detected (Liu, Wang et al. 2009). Based on these findings, we
hypothesized that Pgrmc1 will be more responsive than Pgr to ovarian steroids in DG
neurons, while Pgr regulation will be more responsive in CA1 neurons than CA3 and DG
neurons.

Pgrmc1 has been associated with diverse functions across the reproductive system that
are less understood relative to Pgr. In rat ovarian granulosa cells, which lack Pgr, Pgrmc1
mediates the anti-apoptotic effects of P4 (Peluso, Romak et al. 2008). Rapid membrane
effects of P4 are also mediated by Pgrmc1, independently of Pgr, e.g. in the rapid P4-
induced Ca
2+
influx of the acrosome reaction (Buddhikot, Falkenstein et al. 1999;
Falkenstein, Heck et al. 1999). Pgrmc1 sequences are associated with a remarkable
variety of cell functions under yet other names (Cahill 2007; Brinton, Thompson et al.
2008; Rohe, Ahmed et al. 2009). During development, Pgrmc1 mediates neuronal
guidance under the names: Vema (mouse) and VEM-1 (nematode) (Runko and
Kaprielian 2004). We verified that Vema and Pgrmc1 in GeneBank share amino acid
sequences. In adult rodents, Pgrmc1 was detected in the hippocampus, hypothalamus and
cerebellum (Sakamoto, Ukena et al. 2004; Intlekofer and Petersen 2011). Both E2 and P4

17
induced Pgrmc1 in the sexually dimorphic nucleus of the preoptic area (SDN-POA) and
the ventromedial nucleus (VMN) of the hypothalamus (Intlekofer and Petersen 2011).
However, these reports did not describe its cell level expression.

We extend to the cellular level prior findings of steroid regulation of Pgrmc1 and Pgr. In
whole hippocampal extracts and hypothalamic subregions, Pgr was induced by E2
(Guerra-Araiza, Villamar-Cruz et al. 2003; Intlekofer and Petersen 2011). Whereas some
studies have shown P4 antagonism of E2 induction of Pgr, the P4 antagonism may be
only transient (Turgeon, Van Patten et al. 1999). Moreover, in hypothalamus and
posterior pituitary from chick embryos, P4 can induce Pgr (Guennoun and Gasc 1990).
Thus, P4 regulation of Pgr is physiologically complex and may vary widely between cell
types. Less is known about Pgrmc1, which showed induction by both E2 and P4 in
hypothalamic subregions (SDN-POA and VMN) (Intlekofer and Petersen 2011). The
hippocampal regulation of Pgrmc1and Pgr by E2 and P4 is undefined.

Two hormone treatment schedules were used: a 4-day model of rodent ovulatory cycles
(Gould, Woolley et al. 1990; Woolley and McEwen 1993; Guerra-Araiza, Villamar-Cruz
et al. 2003) and a 30-day model of the KEEPS trial of postmenopausal hormone therapy
(Harman, Brinton et al. 2005; Carroll, Rosario et al. 2010). We show differential
regulation of Pgrmc1 and Pgr in hippocampal neurons by E2 and P4 and discuss the
potential relevance to optimization of postmenopausal hormone therapy for maintaining

18
cognitive functions (Practice Committee of American Society for Reproductive 2008;
Asthana, Brinton et al. 2009; Sherwin 2009).

Methods

Animals and steroid replacement: Experiments conformed with standards of humane
animal care in the National Institutes of Health Ethical Guidelines. Adult female
Sprague-Dawley rats (3 mo old, 250-300 g; nulliparous; 44 rats total - 6 rats per group for
the 4-day replacement schedule and 5 rats per group for 30-day schedule) were used
throughout. All animal procedures were performed under anesthesia with ketamine (80
mg/kg) plus xylazine (10mg/kg). Experiments for the two hormone replacement
schedules were run separately with different cohorts of animals. Nonetheless, the in situ
hybridization (ISH) grain densities for both receptors in control OVX tissues were very
similar in each experiment (Table 1).
4-day replacement (Fig. 1A): Rats were bilaterally ovariectomized (OVX) 2 weeks
before hormone replacement and treated in four groups (n = 6 per group): (i) Vehicle, (ii)
E2 alone, (iii) P4 alone, and (iv) E2+P4. The E2 alone and E2+P4 groups received two
injections of E2 benzoate (10µg, s.c. in 100µl sesame oil) 24 hours apart; other groups
received only vehicle (100µl sesame oil) injections. On day 3, P4 alone and E2+P4
groups received P4 to simulate the luteal phase P4 elevation (single injection, 4mg/kg,
s.c. in 100µl sesame oil), the remaining two groups (E2 and Vehicle) received vehicle
injections. For evaluation of NPC, all groups were given a single injection of BrdU (100

19
mg/kg, ip) one hour after last steroid injection, and sacrificed 30 hours after BrdU
injection (Fig. 1A).
30-day replacement (Fig. 1B): Fourteen days after OVX, rats were subcutaneously
implanted with E2 pellets (0.72 mg/30d release; Innovative Research of America,
Sarasota, FL) or sham pellets (Innovative Research of America, Sarasota, FL) for a total
of 30 days. P4 pellets were administered to P4 alone and E2+P4 groups (50 mg/15d
release; Innovative Research of America, Sarasota, FL) starting on day 21 for a total of
10 days. The E2 alone group received E2 pellet, then sham implant for the last 10 days.
The P4 only group received a sham pellet for the first 20 days, followed by the P4 pellet
for the last 10 days. OVX controls received sham implants (Fig. 1B). Uterine weights
showed expected doubling of wet weight in response to E2; the P4 only group was
equivalent to OVX (not shown). The 30-day hormone schedule with these implants
yielded physiological levels of plasma E2 and P4 in our prior study (Wong, Rozovsky et
al. 2009).
Tissue Collection: After lethal anesthesia, rats were cardiac perfused with 0.9% saline
and brains were removed from the skull. One brain hemisphere was frozen on dry ice for
ISH; the other was fixed in 4% paraformaldehyde, followed by sucrose cryoprotection
(30% sucrose in 0.1M phosphate buffer, pH 7.4) for immunohistochemistry (IHC).

20

Figure 1: Hormone replacement schedules for Pgrmc1 and Pgr regulation by E2 and P4.
(A) For 4-day hormone replacement, rats (n = 6 rats per group) were given two injections
of E2 (10µg, sc), 24 hours apart, followed by single P4 injection (4mg/kg, sc) 24 hours
after last E2 injection. A single injection of BrdU (100mg/kg, ip) was given one hour
after P4; sacrifice, 30 hours after BrdU. (B) For 30-day hormone replacement, rats (n = 5
rats per group) were implanted with E2 pellet (0.72 mg / 30d release) 2 weeks after OVX,
followed by P4 pellet (50 mg / 15d release) in the last 10 days; sacrifice on day 30.

Quantitative real-time PCR (RT-PCR): Hippocampal tissue was obtained from intact
female Sprague-Dawley rats at defined stages of the estrous cycle (estrus; proestrus) and
from OVX females. Total cellular RNA was extracted (Tri Reagent) and cDNA was
prepared (2 ug RNA; Superscript® III kit, Invitrogen). RT-PCR was performed with
SYBR Green I and used the following primers: rPgrmc1 (forward 5’-
GCCTCAAGCCGCGTGACTTC–3’; reverse 5’-CTGGGCAGGAGTGAGGTCAG -3’);

21
rPgr (forward 5’-GTCAGTGGACAGATGCTA-3’; reverse 5’-
AGCTGTTTCACAAGATCA-3’). Standard curves were constructed from serial
dilutions of Pgrmc1 and Pgr plasmid controls and used the same primers.

In situ hybridization (ISH): Frozen brain hemispheres were sectioned sagitally (18-µm)
on a cryostat and stored at -80°C until use. For ISH,
35
S-UTP labeled sense- and
antisense riboprobes were generated by in-vitro transcription using 1µg linearized
plasmid from the following sequences: for Pgrmc1, nucleotides 1012-1374 of rat Pgrmc1
mRNA (Krebs, Jarvis et al. 2000); for Pgr, nucleotides 1-548 of the steroid-binding
domain of both rat PR isoforms (PR-A and PR-B) (kindly provided by Dr. S.L. Petersen
(Park and Mayo 1991)). Both Pgrmc1 and Pgr cRNA probes had the same specific
activity (4.9 x 10
6
cpm/µl) and concentration in hybridization buffer (0.3 ng/µl/kb). 1ng
labeled probe was used per slide and hybridized at 55°C. Post-hybridization washes were
performed in 50% formamide/2x SSC, 0.5x SSC and 0.1x SSC at 60°C. Slides were then
dehydrated in graded 0.3M ammonium acetate-alcohol series and exposed to x-ray film
for 18 to 48 hours. Slides were emulsion dipped (NTB2, Kodak), developed and counter-
stained in Harris modified Hematoxylin according to standard procedures (Morgan, Xie
et al. 1999). Based on x-ray film density, the emulsion-dipped slides were exposed for
different times to reach equivalent grain densities needed for accurate comparison:
Pgrmc1, 4 days; Pgr, 21 days. Grain density in emulsion-dipped, developed slides was
analyzed from brightfield images (Fig. 2) and counted manually around individual
neurons (perikarya) that did not overlap. For CA1 and CA3 neurons, 100 cells were

22
analyzed across 6-8 images per brain; for DG neurons, 120 cells across 10 images per
brain. Cells for analyses were chosen randomly to ensure uniform sampling. The
frequency distributions of grain densities showed negligible overlap of sense and
antisense strand grain densities (Fig. 3). Cells with ≥ 2 grains per cell were classified as
positive for mRNA with antisense probes; for sense-strand ‘background’ probes, few
cells (<3%) had ≥ 2 grains per cell. The data shown here was calculated from cells with ≥
2 grains per cell. Pgr grain cluster development took five times longer than for Pgrmc1.
Based on frequency distributions of grain densities for antisense and sense cRNA probes
(Fig. 8-9, 11-12), the sense-strand ‘background’ controls for all probes and regions
showed no grains in most cells and few cells showed >2 grains, yielding an average
background, 0.3 +/- 0.03 grains/cell. We only analyzed perikarya showing >2 grains per
cell with anti-sense cRNA probes.

23

Figure 2: Brightfield images of in situ hybridization for Pgrmc1 (A, B) and Pgr (C, D) in
hippocampal CA1 pyramidal and dentate gyrus (DG) neuron layers. Note the absence of
silver grain clusters over cells hybridized with sense-strand labeled probe (Pgrmc1, A;
Pgr, C). (B) Representative image shows silver grain clusters over CA1 neurons for
Pgrmc1. (D) In the DG, note the absence of grain clusters for Pgr over most DG neurons.
Scale bars, 20µm.

24

Figure 3: Frequency distribution of average grain density with sense- and anti-sense
probes for Pgrmc1 in CA1 neurons and Pgr in DG neurons. Both frequency distributions
show non-overlapping grain densities of sense vs. anti-sense probe. The majority of cells
labeled with sense probe (~80%) had 0 grains per cell. A minor population of cells had
scattered 1 or 2 grains per cell.

25
Antibodies: Primary antibodies used were: polyclonal rabbit anti-Pgrmc1 (1:300,
HPA002877, Sigma- Aldrich, St. Louis, MO); polyclonal rabbit anti-Pgr (1:50, sc-538,
Santa Cruz Biotechnology, Santa Cruz, CA); polyclonal goat anti-doublecortin (1:100,
sc-8066, Santa Cruz Biotechnology, Santa Cruz, CA; (Hodge, Kowalczyk et al. 2008;
Snyder, Choe et al. 2009); monoclonal rat anti-BrdU (1:100, MCA2060, AbDSerotec,
Raleigh, NC; (Farioli-Vecchioli, Saraulli et al. 2008; Farioli-Vecchioli, Saraulli et al.
2009; Wang, Singh et al. 2010). Secondary antibodies used were goat anti-rabbit
biotinylated antibody (1:200, Vector Labs), goat anti-rat conjugated to Alexa Fluor 594
(1:400, Molecular probes, Invitrogen), donkey anti-goat conjugated to Alexa Fluor 594
(1:400, Molecular Probes, Invitrogen). The specificity of the Pgrmc1 antibody was
confirmed by western blotting of rat whole hippocampal and cortical lysates. Two bands
were detected, a strong band at 25kD and a weak band at 50kD corresponding to Pgrmc1
monomer and dimer respectively (Falkenstein, Eisen et al. 2001; Peluso, Liu et al. 2010).
The Santa Cruz Pgr antibody detected both PR-A and B isoforms. Western blot bands
corresponded to PR-A and B at ~95kD and ~110kD (Fig. 4). Specificity of the antibody
was confirmed by preadsorbing the antibody with ten-fold excess of immunizing peptide
(sc-538P, Santa Cruz Biotechnology, Santa Cruz, CA), which depleted the Pgr bands on
western blots (Fig. 4B) and parikaryal staining after IHC (Fig. 4C, D). We did not detect
cellular staining with the rabbit PR antibody (1:100, A0098, Dako, Carpinteria, CA) in
adult rat hippocampus, confirming Waters et al 2008 (Waters, Torres-Reveron et al.
2008).

26

Figure 4: Antibody specificity of rabbit polyclonal Pgr antibody. (A, B) Western blots of
whole hippocampal lysates using 25µg total protein showed two bands of ~ 110kD and
~95kD corresponding to PR-B and PR-A respectively (A). Preadsorbing the Pgr antibody
with 10-fold excess of blocking peptide depleted both Pgr bands on the western blot (B).
(C, D) Immunohistochemistry on rat brain tissue showed specific Pgr signal (C).
Preadsorbing the antibody with 10-fold excess of blocking peptide depleted all Pgr IHC
signal (D). Scale bars represent 100µm.

27
Immunohistochemistry (IHC): Perfused brain hemispheres were fixed in 4%
paraformaldehyde at 4°C for 24 hours followed by cryoprotection in 30% sucrose/PB
prior to sagittal sectioning as above. IHC was performed on whole hemisphere sagittal
sections according to Morgan et al 1999 (Morgan, Xie et al. 1999) and the dorsal
hippocampus was analyzed. Briefly, sections were fixed in 4% paraformaldehyde and
permeabilized in 1% Noniodet (NP-40), followed by blocking in 5% normal serum.
Sections were then incubated in primary antibodies overnight at room temperature for
Pgrmc1 and Pgr and at 4°C for others. Secondary antibody incubation was performed for
1 hour at room temperature. The Pgrmc1 epitope was visualized by fluorescence using
goat anti-rabbit secondary antibody conjugated to Alexa Fluor 488 (1:400, Molecular
Probes). For Pgr, sections were treated with biotinylated secondary antibody, followed by
incubation with ABC reagent (Avidin-Biotin-HRP complex, Vector Labs). Pgr signal was
visualized after signal amplification using tyramide-fluorescein as the HRP substrate
(TSA-Fluorescein, Perkin Elmer). For BrdU IHC, sections were treated with 2N HCl (to
denature DNA) at 37°C for 45 minutes followed by neutralization in 0.1M Boric acid for
10 minutes before blocking in normal serum. BrdU
+
cells were quantified in 7 sections
per animal.

Data analysis: Data are shown as means ± SEM. Grain densities in Fig. 3 were
calculated as the percentage of OVX controls. Statistical comparisons are based on
ANOVA followed by Fisher post hoc analysis, with significance at p <0.05.

28
Results

Distribution of progesterone receptors in hippocampal sub-regions
First, we determined the relative prevalence of Pgrmc1 and Pgr mRNA in whole
hippocampus. By RT-PCR, Pgrmc1 mRNA prevalence was 4-fold above Pgr mRNA in
OVX rats. At proestrus and estrus stages, Pgrmc1 was 2-fold above Pgr (Fig. 5). The
ISH exposure times to reach equivalent grain density differed correspondingly for cRNA
probes of the same concentration and specific activity (see Methods). Hippocampal
regions differed in neuronal expression of Pgrmc1 and Pgr. Pgrmc1 mRNA per cell was
two-fold higher in CA1 and CA3 pyramidal neurons than in dentate gyrus (DG) neurons
(Fig. 6A, B; Table 1). However, CA1 and CA3 neurons had similar levels of Pgrmc1
mRNA. Within hippocampal regions, neuronal Pgr mRNA prevalence was highest in
CA3, followed by CA1 and DG, in ratios of 4:2:1 (Fig. 6A, B; Table 1). These regional
differences in Pgrmc1 and Pgr expression extend semi-quantitative analyses of Intlekofer
KA et al (Intlekofer and Petersen 2011).

A minority of DG neurons expressed Pgr mRNA (27 ± 4.2% cells had >2 grains per cell
for Pgr), whereas, Pgrmc1 was detected in most DG neurons (82 ± 5.1% cells had >2
grains per cell, p<0.0001) (Fig. 6B). Thus, 3-fold more DG neurons had significant signal
for Pgrmc1 than for Pgr, in contrast to CA1 and CA3 pyramidal neurons, in which both
receptors were detected in >80% neurons (Fig. 6B).

29
Immunostaining for cell body protein levels of Pgrmc1 and Pgr (Fig. 6C) corresponded to
RNA levels by ISH grain densities (Fig. 6A). Again, Pgr protein was detected in a
minority of DG neurons. A caveat is that protein levels of Pgrmc1 and Pgr cannot be
directly compared due to the different techniques used to visualize the signals from both
receptors (Methods; Pgr detection required two rounds of signal amplification, whereas
Pgrmc1 did not require amplification). While Pgrmc1 immunostaining had similar
intensity throughout the hippocampal cell layers (Fig. 6C), Pgr immunostaining was
stronger in CA3 than in CA1 and DG neurons (Fig. 6C).

Figure 5: Pgrmc1 and Pgr mRNA prevalence in total RNA from adult rat hippocampus
by RT-PCR. Copy number was estimated with reference to respective plasmid standard
curves containing the same PCR amplicons. In OVX rats, hippocampal Pgrmc1 mRNA
prevalence was 4-fold above Pgr (n=3). In intact rats, Pgrmc1 was > 2-fold above Pgr at
proestrus and estrus stages; at estrus, Pgrmc1 mRNA was 50% above OVX rats. **,
p<0.0001, all estrous cycle stages between Pgrmc1 and Pgr. ^, p<0.01 compared to
Pgrmc1 OVX.

30
Figure 6: Expression of Pgrmc1 and Pgr in hippocampal neuronal layers. (A)
Autoradiographic film images showed differential distribution of mRNA for Pgrmc1
(left) and Pgr (right) in hippocampal neuronal layers. Pgrmc1 was prevalent across all 3
neuronal layers. By contrast, Pgr mRNA was prevalent in CA1 and CA3 pyramidal
neurons but it was barely detected in adjacent DG neurons. (B) Average grain density for
Pgrmc1 and Pgr in individual neurons of CA1 (100 cells per rat), CA3 (100 cells per rat)
and DG (120 cells per rat). Pgrmc1 grain density was similar in CA1 and CA3 neuronal
perikarya and far below in DG neurons. *, p<0.01 vs. CA1 and CA3. More than 80%
neurons in CA1, CA3 and DG were positive for Pgrmc1 mRNA. CA3 neurons had two-
fold more Pgr mRNA/perikaryon than CA1 and DG neurons. CA1 neurons had two-fold
Pgr over DG neurons. Over 80% CA1 and CA3 neurons, but only ~25% DG neurons
were positive for Pgr mRNA. **, p<0.0001 vs. other groups. (C) Immunohistochemistry
for Pgrmc1 and Pgr showed similar protein expression of both receptors as mRNA. Scale
bars represent 100µm.

31
E2 and P4 differentially regulate Pgrmc1 and Pgr mRNA in hippocampal sub-
regions
Two schedules of steroid replacements (E2, P4, and E2+P4) of OVX young rats were
compared: a 4-day model of the ovulatory cycle and a 30-day model of hormone therapy
(Fig. 1). By ISH, Pgrmc1 mRNA was broadly induced above OVX controls by 44-92%
with E2 and/or P4 on both schedules in all neuronal layers of the hippocampus (Fig. 7;
Table 1). In contrast, Pgr induction was regionally restricted on both hormone schedules.
Pgr was induced only in CA1 neurons, with minimal response in CA3 and DG neurons
(Fig. 10; Table 1). All steroid treatments in the 4-day schedule induced Pgr mRNA by at
least 50% in CA1 neurons. However, the 30-day schedule showed more modest effects,
with Pgr induction in CA1 only by E2 or P4 alone (~35%, p<0.05). The absence of
induction by E2 + P4 suggests antagonism. In CA3 neurons, only the 4-day schedule
induced Pgr mRNA, and very modestly (22% by P4, p<0.05; 24% by E2+P4, p<0.04; no
response to E2 alone), while the 30-day schedule had no effect. Moreover, Pgr in DG
neurons was unresponsive to all hormone schedules.

32

Figure 7: Regulation of Pgrmc1 mRNA by 17β-estradiol (E2) and progesterone (P4).
Pgrmc1 mRNA was increased by E2, P4 and E2+P4 in CA1, CA3 and DG neurons after
both 4-day (n=6 rats/group) and 30-day hormone replacement schedules (n=5 rats/group).
*, p<0.03 compared to respective OVX. *, p<0.05, vs. OVX in CA3 neurons.

33

Figure 8: Frequency distributions of grain densities of Pgrmc1 mRNA after 4-day
hormone replacement in CA1, CA3 and DG neurons.

34

Figure 9: Frequency distributions of average grain densities of Pgrmc1 mRNA after 30-
day hormone replacement in CA1, CA3 and DG neurons.

35

Figure 10: Regulation of Pgr mRNA by 17β-estradiol (E2) and progesterone. In CA1
neurons Pgr mRNA was increased by E2, P4 and E2+P4 on the 4-day schedule, and by
E2 or P4 alone on the 30-day schedule. Modest increase in Pgr mRNA was also seen in
CA3 neurons by P4 (P4 alone and E2+P4 group) only on the 4-day schedule. Pgr mRNA
did not respond to either the 4-day or 30-day schedule in DG neurons. **, p<0.01, vs.
OVX in CA1. ^, p<0.01 compared to 4-day schedule in CA1. *, p<0.05, vs. OVX in CA3
neurons.

36

Figure 11: Frequency distributions of average grain densities of Pgr mRNA after 4-day
hormone replacement in CA1, CA3 and DG neurons. In CA1 neurons, more cells had
higher grain densities vs. OVX. In CA3 neurons, only a subset of cells treated with P4
and E2+P4 had higher grain densities than OVX and E2. No effect of hormones was seen
in any grain density class in DG neurons.

37

Figure 12: Frequency distributions of average grain densities of Pgr mRNA after 30-day
hormone replacement in CA1, CA3 and DG neurons. In CA1 neurons, more cells treated
with E2 and P4 alone had higher grain densities vs. OVX. Treatment with E2+P4 did not
change grain density distribution compared to OVX, in contrast with acute hormone
treatment of E2+P4. The 30-day hormone treatment did not change grain density
distribution in CA3 and DG neurons.

38

Table 1: Pgrmc1 and Pgr in situ hybridization (ISH) grain densities in hippocampal
neurons on 4-day and 30-day hormone schedules. Emulsion-dipped slides for Pgrmc1
and Pgr were exposed for different times to achieve similar grain densities. Statistical
comparisons were made within treatment groups for each receptor. Grain densities are
means ± SEM of 6 rats per hormone group for 4-day and 5 rats per group for 30-day
schedules; 100 cells per brain in CA1 and CA3, and 120 cells per brain in DG. Pgrmc1:
*, p<0.03, vs. respective OVX group. Pgr: *, p<0.05, vs. respective OVX group.

39
Progesterone receptor expression in neural progenitor cells (NPC)
Because of conflicting reports on the expression of Pgr in NPC (see Intro.), we evaluated
Pgrmc1 and Pgr expression in the endogenous NPC of the DG subgranular zone. Double
IHC co-localized both Pgrmc1 and Pgr in >90% of the BrdU-labeled progenitor cells
(Fig. 13A, B). Furthermore, the Doublecortin marker for NPC destined to be neurons also
co-localized with both Pgrmc1 and Pgr (Fig. 13C, D). The 4-day steroid treatments
increased BrdU labeled cells in the DG subgranular zone by 50-100% (Fig. 13E),
consistent with Liu et al 2010 (Liu, Zhao et al. 2010). Separately, E2 or P4 treatment
doubled the number of proliferating NPC (p<0.03), while the combination of E2+ P4 was
not significant (Fig. 13E).

40

Figure 13: Expression of Pgrmc1 and Pgr in neural progenitor cells (NPC). (A, B) Co-
localization of Pgrmc1 and Pgr in replicating (BrdU) NPC by double
immunohistochemistry for Pgrmc1 with BrdU (A) and Pgr with BrdU (B); individual co-
labeled cell magnified in inset. (C, D) Double immunohistochemistry for Pgrmc1 (C)
with Doublecortin (DCX), a marker of newly generated neurons in SGZ of DG and Pgr
(D) with DCX showed co-localization of both in DCX positive newly generated neurons;
individual co-labeled cell magnified in inset. Scale bars, 20µm. (E) Hormonal regulation
of neurogenesis by E2 and P4 in the DG subgranular zone. Both E2 and P4 (4-day
schedule; n=6 rats/group) increased the number of BrdU
+
cells in SGZ; response to
E2+P4 was slightly lower (P=0.15; not significant). *, p<0.03, vs. OVX.

41
Discussion

We show that Pgrmc1 and Pgr differ markedly in expression and in regulation by E2 and
P4 in neurons of the adult rat hippocampus, and discuss implications for hormonal
regulation of synaptic plasticity and NPC proliferation. Overall, Pgrmc1 was widely
expressed throughout hippocampal neurons and was induced by both E2 and P4. In
contrast, Pgr showed limited expression and regulation by steroids that differed widely
among neuronal subpopulations. In those responding neurons, both acute and chronic E2
and P4 replacements gave equivalent induction of Pgrmc1 and Pgr, with little or no
mutual antagonism. We hypothesize that Pgrmc1 and Pgr mediate selective hippocampal
P4 effects in different neuron subtypes based on their different regional expression and
responses to E2 and P4. These findings are relevant to cognitive functions in
postmenopausal hormone therapy (HT).

Differential expression of Pgrmc1 and Pgr in hippocampal sub-regions
First we discuss the neuroanatomical differences in expression of these receptors in the
hippocampus, a key site of learning and memory. Pgrmc1 was equally prevalent in CA1
and CA3 neurons, with lower expression in DG neurons. Pgr, on the other hand, was
most prevalent in CA3 neurons and much less in DG neurons. CA1 neurons had
intermediate levels of Pgr mRNA. These findings at the cellular level confirm the
regional distributions of Pgrmc1 and Pgr reported by Intlekofer et al 2011 (Intlekofer and
Petersen 2011). With electron microscopy, Waters EM et al (Waters, Torres-Reveron et
al. 2008) localized extra-nuclear Pgr in axons of hippocampal neurons, with greater

42
detection in CA3 axons than in other hippocampal neurons. However, detection of Pgr
protein by immunohistochemistry required secondary signal amplification in the present
study. We confirmed the neuronal cell-type restricted expression of Pgr by RNA and
protein content (in situ hybridization and immunohistochemistry, respectively). In
contrast, Pgrmc1 was expressed throughout the hippocampal neuron layers. Expression in
the hippocampal hilus of Pgrmc1 and Pgr (Fig. 6C) could represent interneurons, as well
as glia. Although this study was focused on Pgrmc1 and Pgr expression in different
hippocampal neurons, we also observed glial expression of both receptors both in vivo,
and in cultured primary glia (Fig. 23-25).

Differential regulation of Pgrmc1 and Pgr mRNA
Besides the regional differences in levels of expression between hippocampal neuron
types, both Pgrmc1 and Pgr responded differently to E2 and P4. Two hormone
replacement schedules, 4-day and 30-day (Fig. 1) induced similar responses in
expression. The 4-day schedule models the normal rodent ovulatory cycle, and has been
widely used in studies of hippocampal sprouting (Gould, Woolley et al. 1990; Woolley
and McEwen 1993), as well as in a few studies of neurogenesis (Tanapat, Hastings et al.
2005). The 30-day schedule of continual E2 with P4 in the last 10 days is a model of the
ongoing KEEPS trial of postmenopausal HT (Harman, Brinton et al. 2005). We have
used this 30-day replacement schedule to show P4 antagonism of E2-dependent synaptic
sprouting in response to deafferenting lesions of the hippocampus (Wong, Rozovsky et
al. 2009). Clinical trials for postmenopausal HT for age-associated cognitive decline and

43
Alzheimer disease are controversial. The Women’s Health Initiative study, one of the
largest randomized controlled clinical trial of HT, found increased breast cancer
incidence in the group receiving equine estrogens plus a progestin, and no cognitive
benefits (Rapp, Espeland et al. 2003; Shumaker, Legault et al. 2003). Thus, it is
imperative to study the combined effects of E2 and P4 on cognition, cardiovascular
disease and other health outcomes. The KEEPS trial addresses the effects of delayed
initiation of HT (critical window hypothesis); KEEPS also evaluates cyclic vs.
continuous P4. In a triple transgenic mouse model of Alzheimer disease, 3 consecutive
30-day cycles of E2 and P4 (present model) were neuroprotective (Carroll, Rosario et al.
2010). Most animal models of long term HT have evaluated E2 alone (Rusa, Alkayed et
al. 1999; Markowska and Savonenko 2002; Marriott, Hauss-Wegrzyniak et al. 2002). The
present studies also used a 30-day hormone schedule, as well as a 4-day schedule to
model the normal estrous cycle.

On both the 4- and 30-day replacement schedules, Pgr was induced by both E2 and P4,
but only in CA1 neurons and not in CA3 or DG neurons. In contrast, Pgrmc1 was more
broadly responsive to E2 and P4, across all neurons examined. About 40-80% induction
was seen after both 4- and 30-day schedules, with similar responses in the CA1, CA3 and
DG neurons. The similar induction in CA1 neurons of both Pgrmc1 and Pgr by E2 and
P4 is relevant to synaptic remodeling. CA1 neurons are notable for synaptic remodeling
during the rodent estrous cycle, not observed in CA3 or DG neurons (Introduction).
Moreover, in OVX macaques, E2 replacement for 28 days alone induced synaptogenesis

44
in CA1 neurons (Choi, Romeo et al. 2003). Introduction of P4 to the last 14 days of E2
treatment antagonized the E2-mediated increase in pre- and post-synaptic proteins,
syntaxin, synaptophysin and spinophilin, whereas P4 alone treatment increased
synaptophysin in CA1 neurons. This report gives an unusual example in which P4 alone
can induce synaptic proteins and with mutual antagonism of E2 + P4. We found similar
responses of Pgr in CA1 neurons during the 30-day schedule. However, on a 4-day
schedule, there was no indication of mutual antagonism. The differences in P4 actions
when acting alone vs. E2 + P4 on a 30-day schedule are relevant to hormone therapy
strategies.

The equal induction of Pgrmc1 and Pgr by E2 and P4 raises interesting questions about
transcriptional regulation, particularly their auto-induction by P4. We did not find full

45
consensus progesterone response elements (PRE) in the Pgr gene. However, Pgr has
multiple half-PRE sites, which, in other genes, can bind the Pgr peptides in synergy with
other co-factors (Lieberman, Bona et al. 1993; De Amicis, Zupo et al. 2009). The auto-in
duction by P4 is consistent with the elevation of Pgr protein in the hypothalamus during
pregnancy, which peaks at day 19 of rat pregnancy when plasma P4 is maximal, with
much lower E2 (Steyn, Anderson et al. 2007). The transcriptional regulation of Pgrmc1
has not been studied. We did not find consensus PREs in the Pgrmc1 upstream promoter,
but did find multiple half-PRE sites. Thus, the P4 auto-induction of Pgrmc1 observed in
the hippocampus here and in the hypothalamus (Intlekofer and Petersen 2011) could be
mediated indirectly by Pgr through binding of Pgr peptides to half-PRE sites.

The observed E2 regulation of Pgrmc1 and Pgr could be mediated by estrogen receptors
(ERs). We can dismiss a mechanism of cross-talk at the ligand binding level, because E2
does not compete with P4 for binding to either Pgrmc1 or Pgr (Pichon and Milgrom
1977); nor does P4 compete with E2 at physiological levels for binding to ERs (Kuiper,
Carlsson et al. 1997). The Pgr promoter contains multiple ERE (estrogen response
element) sequences which could mediate induction by E2 (Petz and Nardulli 2000; Petz,
Ziegler et al. 2004; Boney-Montoya, Ziegler et al. 2010). Although we did not find
consensus ERE in the Pgrmc1 upstream promoter, there are multiple half-ERE sites. Both
ERα and ERβ are expressed in hippocampal neurons (Shughrue, Lane et al. 1997; Solum
and Handa 2001; Kalita, Szymczak et al. 2005), though ERβ was more prevalent in CA1
and CA3 pyramidal neurons than in DG neurons (Shughrue, Lane et al. 1997; Kalita,

46
Szymczak et al. 2005), resembling the expression of Pgrmc1 and Pgr (Fig. 2). The
importance of Erα to Pgr regulation is shown by the absence of induction by E2 in the
hippocampus of ERKOα mice (Alves, McEwen et al. 2000).

The pharmacological specificity of Pgrmc1 and Pgr also needs further study. The anti-
progestin RU486 blocked the decrease in CA1 dendritic spines during the estrus
(Woolley and McEwen 1993) and also blocked P4 antagonism of E2-induced neurite
outgrowth in an in vitro lesion model (Wong, Rozovsky et al. 2009). Although RU486
does act on recombinant Pgr (Skafar 1991; Raaijmakers, Versteegh et al. 2009), it is not
known whether it also acts on Pgrmc1. Besides Pgrmc1, three other membrane PRs are
recognized – the G-protein coupled receptors mPRα, mPRβ and mPRγ. Little is known of
their expression patterns in brain cell types, P4 binding characteristics and steroidal
regulation, or P4-specific functions (Ashley, Arreguin-Arevalo et al. 2009; Liu and
Arbogast 2009; Foster, Reynolds et al. 2010; Labombarda, Meffre et al. 2010; Intlekofer
and Petersen 2011; Intlekofer and Petersen 2011).

CA1 neurons were the only hippocampal subregion that showed similar hormonal
responses of both Pgrmc1 and Pgr (Fig. 7, 10; Table 2). This regional restriction is
interesting because CA1 neurons are more vulnerable to Alzheimer disease (West,
Coleman et al. 1994; Simonian and Hyman 1995), post ischemic damage ((Chang, Sasaki
et al. 1989) and hypoxia-induced seizure activity, relative to CA3 and DG neurons
(Kawasaki, Traynelis et al. 1990). The responsiveness of progesterone receptors to E2

47
and P4 is relevant to stroke because CA1 neurons are protected in rodent models of
ischemia by both E2 (Jover-Mengual, Miyawaki et al. 2010; Lebesgue, Traub et al. 2010)
and P4 (Morali, Letechipia-Vallejo et al. 2005). The P4 neuroprotection of CA1 could be
mediated by either Pgrmc1 or Pgr. The receptor involved in CA1 neuroprotection could
be identified using Pgr knockout mice (PRKO). However Pgrmc1 knockout mice have
not been reported so far.

Pgrmc1 and Pgr expression in neuronal progenitor cells (NPC) of the subgranular
zone of DG
The DG was examined for expression of Pgrmc1 and Pgr in its P4-sensitive NPC, which
have not been characterized in detail. In adult female rats (Liu, Zhao et al. 2010) and
male mice (Zhang, Yang et al. 2010), P4 promoted the generation of nascent neurons in
the DG subgranular zone. Both E2 and P4 stimulated NPC proliferation in cells obtained
by whole hippocampus cell sorting (Liu, Zhao et al. 2010) and in an established adult rat
NPC line derived from the DG subgranular zone (Gage, Coates et al. 1995; Liu, Wang et
al. 2009), as confirmed in vivo here. The in vitro proliferative effects of P4 involve
Pgrmc1 through P4-induced kinase signaling (Liu, Wang et al. 2009). The present study
detected both Pgrmc1 and Pgr in newly formed immature neurons (Doublecortin
immunopositive) in the subgranular zone. However, most DG mature neurons lack Pgr
(Fig. 2B), which may be consequent to DG neuronal maturation, e.g. Pgr expression in
the DG peaked by postnatal day 7 and was undetectable by day 28 (Quadros, Pfau et al.
2007). Lastly, we note the divergence in Pgr expression between NPC lines. While a rat

48
NPC line derived from the DG subgranular zone did not have Pgr by PCR (Liu, Wang et
al. 2009), Pgr protein was detected in NPC originated from the subventricular zone,
another site of adult neurogenesis. This difference could be outcomes of continued in
vitro propagation of the DG subgranular cell line, or to the different sites of NPC
origination.

The responses of Pgrmc1 and Pgr to P4 +/- E2 were very similar for both 4-day and 30-
day hormone replacement schedules. Pgrmc1 was increased in all hippocampal neuronal
layers on both schedules in which E2 alone, P4 alone, or combined gave similar
induction. While Pgr responses were restricted to CA1 neurons, responses to E2 and P4
alone or together were again equivalent on the 4-day schedule. However, the weaker
increase of Pgr in CA1 on the 30-day schedule of combined E2 +P4 suggests possible
antagonism. Others have reported selective induction. In the hypothalamus (Intlekofer
and Petersen 2011) only select nuclei showed Pgrmc1 elevations with P4 alone or E2+P4;
unlike hippocampal responses, there was no effect of E2 alone. In contrast, Pgrmc1 (cited
as 25-Dx) was increased in the hypothalamus of E2-primed OVX females, but this
increase was attenuated by P4 (Krebs, Jarvis et al. 2000). Reports on Pgr are also
divergent. As we observed in CA1 neurons with both hormone schedules, P4 alone
increased Pgr in chick embryo hypothalamus and posterior pituitary (Guennoun and Gasc
1990). However, Intlekofer and Petersen (Intlekofer and Petersen 2011) observed that P4
alone did not increase hypothalamic Pgr mRNA. A more detailed study of the time
course is warranted because Turgeon et al (Turgeon, Van Patten et al. 1999) showed the

49
transiency of P4 down-regulation of Pgr, with receptor levels returning to the level of E2-
treated controls by 12 hours post-treatment.

Conclusions
Pgrmc1 is widely expressed in neuronal layers of all hippocampal regions and is induced
by both E2 and P4. In contrast, Pgr shows restricted regional expression and regulation
by E2 and P4. The shared induction of both Pgrmc1 and Pgr by E2-P4 in CA1 neurons
may be relevant to their capacity for E2-dependent synaptic remodeling and to CA1
sensitivity to neurodegeneration from Alzheimer disease and ischemia. The differential
regulation of hippocampal Pgrmc1 and Pgr gives a rationale for development of drugs in
hormonal therapy to target multiple receptors in the support of neurogenesis,
neuroprotection, and synaptic regeneration.

50
CHAPTER 3
Microglia Modulate Neurite Outgrowth Responses to Progesterone
Through Pgrmc1, a Non-Classical Progesterone Mediator

Abstract

Progesterone (P4) antagonizes estradiol (E2)-dependent neurite outgrowth in the rat
hippocampus after lesions of the entorhinal cortex. In the ‘wounding-in-a-dish’ model,
the P4-antagonism of E2-induced neurite outgrowth (‘P4-E2 antagonism’) required the
presence of both astrocytes and microglia in mixed glial cultures, but was absent in
astrocyte-neuron co-cultures (Wong et al 2009). We developed a microglial ‘add-back’
protocol to study the role of microglia in the P4-E2 antagonism. Soluble factors from
activated microglia were shown to mediate P4-E2 antagonism on neurite outgrowth,
under the control of Pgrmc1, a non-classical progesterone mediator. Moreover, the
activation of microglia by mechanical wounding or lipopolysaccharide was inhibited by
siRNA knock-down of Pgrmc1. These findings identify a new role of Pgrmc1 in
microglial activation and in P4-E2 interactions during neuronal responses to injury which
are relevant to synaptic plasticity during Alzheimer disease and to the use of
progestagens for traumatic brain injury.

51
Introduction

Neuronal responses to injury in adult brains are influenced by local glial responses in
concert with systemic steroid hormones. Blood plasma estradiol (E2), for example,
enhances neurite outgrowth in the hippocampus following entorhinal cortex lesions
(ECL) that axotomize the perforant pathway to the hippocampus (Morse, DeKosky et al.
1992) (Fig. 14). The ECL is a model of the perforant path degeneration that occurs early
in AD, causing degeneration of cortical afferents to the dentate gyrus (DG) granule
neurons that are critical to declarative memory (Geddes, Monaghan et al. 1985). Glial
activation also varies inversely with neurite outgrowth during ovarian steroid modulation
of ECL responses. In particular, the activation of astrocytes and microglia by ECL was
suppressed by E2 during E2-dependent neurite outgrowth (Wong, Rozovsky et al. 2009).
Correspondingly, progesterone (P4) blocked the E2-dependent sprouting in association
with attenuation of glial activation (Wong, Rozovsky et al. 2009). The simultaneous
exposure to E2 and P4 in these studies is a model for postmenopausal hormone therapy
on the brain, as in the Women’s Health Initiative, where the combination of estrogen plus
progestin increased the risk of cognitive decline (Rapp, Espeland et al. 2003).

To further analyze glial-neuron interactions relevant to hormone therapy, we developed
an in vitro model of P4-E2 interactions during ‘wounding-in-a-dish” (Lefrancois, Fages
et al. 1997) in which P4 antagonized E2-induced neuron outgrowth (Wong, Rozovsky et
al. 2009). The P4-E2 antagonism of neurite outgrowth required the presence of microglia

52
with astrocytes in mixed glial cultures (3:1 astrocytes: microglia), and did not occur in
neurons co-cultured with astrocytes alone (<5% microglia). We therefore considered the
glial expression of various progesterone receptors.

The classical progesterone receptor Pgr, a DNA binding transcription factor, is
implicated in P4-E2 interactions during physiological cycles of synapse turnover and in
axotomy-induced neurite outgrowth (Woolley and McEwen 1993; Wong, Rozovsky et al.
2009). Although neuronal expression of Pgr and other progesterone receptors is well
documented (Brinton, Thompson et al. 2008; Bali, Arimoto et al. 2012), the glial
expression of Pgr is not defined. No Pgr mRNA was detected in isolated microglia
(Sierra, Gottfried-Blackmore et al. 2008), whereas Pgr was detected in the hippocampal
neuropil in unidentified cells, putatively glia (Waters, Torres-Reveron et al. 2008). In
astrocyte cultures, the presence of Pgr is implied by the efficacy of classic progestin
receptor antagonists (e.g. RU486) in blocking various P4 stimulated activities (Lacroix-
Fralish, Tawfik et al. 2006; Wong, Rozovsky et al. 2009). Another candidate P4 mediator
is Pgrmc1 (progesterone receptor membrane component-1), a 25 kDa protein which
mediates P4-induced proliferation of rat neural stem cells (Liu, Wang et al. 2009) and
which is regulated by E2 and P4 in hippocampal neurons (Intlekofer and Petersen 2011;
Bali, Arimoto et al. 2012). During development, this protein was identified under other
names as a regulator of neurite outgrowth and guidance: VemA, rat; VEM-1, nematode
(Runko, Wideman et al. 1999; Runko and Kaprielian 2004). Pgrmc1 is expressed in many
tissues with remarkably diverse roles which include association with malignancies (Cahill

53
2007) (see discussion). Although Pgrmc1 was initially termed a membrane P4 receptor
(Falkenstein, Meyer et al. 1996), it lacks homology with Pgr or with other P4-binding
membrane receptors (Cahill 2007; Rohe, Ahmed et al. 2009). Binding of P4 by Pgrmc1
remains undefined (Cahill 2007). Two studies with recombinant Pgrmc1 diverged: no
binding of P4 (Min, Strushkevich et al. 2005) vs. P4 binding (Mansouri, Schuster et al.
2008), but neither reported the P4 concentration range. We hypothesized a role for
microglial Pgrmc1 in P4 antagonism of E2-dependent lesion-induced neurite outgrowth,
because microglia lack expression of the classical progesterone receptor Pgr and because
of the role of VemA/VEM-1 in neurite outgrowth.

To analyze the microglial requirement for P4-E2 antagonism of neurite outgrowth and the
relevant receptors, we developed procedures to ‘add-back’ microglia to astrocyte
cultures. We show microglial expression of Pgrmc1 and its requirement for P4-E2
antagonism of neurite outgrowth. Moreover, Pgrmc1 mediates P4 antagonism by
modulating microglial activation. These novel interactions between microglia and
steroidal effects on neurite sprouting are relevant to the adverse effects of progesterone in
hormone therapy noted above, but also to the potential neuroprotective effects of acute P4
treatment after traumatic brain injury in rodent models (Discussion).

54
Methods

Animals: All animal procedures conformed to standards of humane animal care in the
National Institutes of Health Ethical Guidelines. Adult female Sprague-dawley rats (250-
300g) were ovariectomized and 2 weeks later implanted with slow-release E2 pellet
(0.72mg/pellet; 30d release, n=6 rats) or sham vehicle pellets (n=6 rats) (Innovative
Research of America, Sarasota, FL). After 2 weeks, all rats were given unilateral
entorhinal cortex lesion (Fig. 14b). P4 pellet (50mg/pellet; 15d release, n=6 rats) or sham
vehicle pellets (n=6 rats) were implanted immediately after ECL. Rats were sacrificed
and brains were collected 4 days after ECL.
Tissue processing and immunohistochemistry (IHC): Brains were fixed in 4%
paraformaldehyde for 24 hrs and cryoprotected in 30% sucrose until sectioning. 18µm
horizontal sections were taken with a cryostat. Frozen sections were stored at -80°C until
use. IHC was performed according to Bali et al.(Bali, Arimoto et al. 2012). Briefly,
sections were fixed in 4% paraformaldehyde, permeabilized in 1% Noniodet P-40,
followed by blocking in 5% normal serum. Sections were incubated in primary antibodies
overnight at 4°C. Primary antibodies used were: mouse monoclonal anti-GFAP (1:400,
G3893, Sigma-Aldrich, St. Louis, MO); polyclonal rabbit anti-Pgrmc1 (1:300,
HPA002877, Sigma-Aldrich, St. Louis, MO); polyclonal goat anti-IBA1 (1:200, ab5076,
Abcam, Cambridge, MA). Secondary antibody incubation was performed for 1 hr at
room temperature. Secondary antibodies used were: Goat anti-mouse Alexa Fluor 488;

55
goat anti-rabbit Alexa Fluor 594; donkey anti-goat Alexa Fluor 488; donkey anti-rabbit
Alexa Fluor 594 (1:400, Molecular probes, Invitrogen, Grand Island, NY).
Lectin histochemistry: Microglia were stained with griffonia simplicifolia isolectin-B4
(5µg/ml, B-1105, Vector Labs, Burlingame, CA). Briefly, sections were rinsed and
incubated in the lectin overnight at 4°C. Next day, sections were incubated in ABC
reagent (Vector labs, Burlingame, CA) for 30 mins, followed by signal development
using tyramide-Cy3 (Tyramide signal amplification-Cy 3 kit, PerkinElmer, Waltham,
MA).
Image analysis: Fluorescent images were captured using a Nikon Eclipse EC300. Images
were captured at 20x magnification from the dentate gyrus molecular layer. 3 section
series were stained and the entire DG molecular layer was captured per animal. GFAP
and isolectin-B4 staining was quantified using the software ImageJ (NIH software). Data
represents average of 3 section series per animal.

56

Figure 14: The entorhinal cortex lesioning (ECL) model of perforant pathway
degeneration. (a) Unilateral ECL results in degeneration of perforant path axons that
project to the dentate gyrus (DG) molecular layer, resulting in compensatory sprouting
within the DG molecular layer from axons of the septo-hippocampal pathway, local
interneurons and commissural/associational axons(Geddes, Monaghan et al. 1985).
(b) Experimental outline: 2 weeks after OVX, rats (n=6 rats/treatment group) were
implanted with either E2 pellets (0.72 mg/pellet; 30-d release) or vehicle pellets. 2 weeks
later, rats were given unilateral ECL; P4 (50 mg/pellet; 15-d release) or vehicle pellets
were inserted subcutaneously at ECL(Wong, Rozovsky et al. 2009). Tissues were
collected 4 days post ECL.

57
Cell culture and wounding-in-a-dish co-culture: Primary mixed glia cultures were
obtained from the cerebral cortices of 3-4 day old rat pups and maintained in DMEM/F12
media (Cellgro, Manassas, VA), supplemented with 10% fetal bovine serum (HyClone,
Logan, UT), 100U/ml penicillin, 50U/ml streptomycin and 2mM L-glutamine at 37°C,
5% CO
2
, 95% humidity. Primary neurons were obtained from embryonic day 18 (E18)
rat pup cortices and maintained in high glucose DMEM (Cellgro, Manassas, VA),
supplemented with 2.4mg/ml bovine serum albumin, 0.1mM sodium pyruvate, 15mM
HEPES, 200U/ml penicillin and 100U/ml streptomycin. Separate astrocyte and microglia
cultures were obtained from 2-3 week old mixed glia cultures by shaking mixed glia
flasks. Microglia were harvested from the media and astrocytes from the flasks after
shaking for 4 hours. Enriched astrocyte, enriched microglia or mixed glia cultures were
plated in poly-d-lysine coated 4-chamber glass slides (Lab-Tek II, Thermo Scientific
Nunc, Rochester, NY) at 2x10
5
cells/well for mixed glia. The ratio of
astrocytes:microglia in mixed glia is ~3:1. Enriched astrocytes and microglia were plated
using the same ratio – 1.4x10
5
cells/well for astrocytes and 6x10
4
cells/well for microglia.
Glia was allowed to grow for 2 days, followed by plating E18 neurons (7x10
4
cells/well).
The co-cultures were grown for 3 days before scratch-wounding with a plastic pipette tip
(Wong, Rozovsky et al. 2009), followed immediately by treatment with steroids, E2
(0.1nM, Sigma-Aldrich, St. Louis, MO) and/or P4 (100nM, Steraloids, Newport, RI) in
neuronal media (described above), supplemented with B27 supplement without
antioxidants and P4. Vehicle control was 0.08% ethanol. Slides were fixed in 4%
paraformaldehyde after 2 days and immunocytochemistry was performed.

58
Immunocytochemistry and data analysis: After fixing, slides were permeabilized in 1%
Noniodet P-40, followed by blocking in 5% normal serum. Slides were incubated in
primary antibodies overnight at 4°C. Primary antibodies used were: mouse monoclonal
anti-GFAP (1:400, G3893, Sigma-Aldrich, St. Louis, MO), rabbit polyclonal anti-βIII
Tubulin (1:1000, T8578, Sigma-Aldrich, St. Louis, MO), mouse monoclonal anti-CD11b
(1:200, MCA275G, AbDSerotec, Raleigh, NC) and rabbit polyclonal anti-Pgrmc1 (1:300,
HPA002877, Sigma-Aldrich, St. Louis, MO). Secondary antibody incubation was 1 hr at
room temperature and secondary antibodies used were: goat anti-mouse Alexa Fluor 488
and goat anti-rabbit Alexa Fluor 594 (1:500, Molecular Probes, Invitrogen, Grand Island,
NY). CD11b and Pgrmc1 protein were quantified from fluorescent images using ImageJ.
20-30 images per treatment were analyzed and the total integrated density per image was
normalized to the number of cells per image. Data represents average integrated density
per cell.
Neurite outgrowth analysis: Fluorescent images were captured using a Nikon Eclipse
EC300 microscope in a 1mm
2
area adjacent to the wound tract, 8 random images per
wound, 2 wounds per well, total 16 images per well (n=4 wells per treatment). Neurite
outgrowth was quantified by counting the number of neurites extending into the wound
zone. Each experiment was repeated 3 times. Data shown is average of 3 experiments.
Western blotting: Total protein lysates were prepared from mixed glia, enriched
astrocytes and enriched microglia using 1xRIPA buffer (20mM Tris-HCl, pH 7.5,
150mM NaCl, 1mM Na
2
EDTA, 1mM EGTA, 1% NP-40, 1% sodium deoxycholate,
2.5mM sodium pyrophosphate, 1mM β-glycerophosphate, 1mM Na
3
VO
4
, 1µg/ml

59
leupeptin), containing protease and phosphatase inhibitor. Protein lysates were stored at -
80°C until use. 10µg total protein (Pgrmc1) and 25µg total protein (Pgr) were run on 4-
12% Novex NuPage Bis-Tris gels (Invitrogen, Grand Island, NY), followed by transfer to
PVDF membranes. Membranes were blocked in 5% non-fat milk (Bio-Rad) for 1 hr at
room temperature, followed by incubation in primary antibodies overnight at 4°C.
Primary antibodies used were: rabbit polyclonal anti-Pgrmc1 (1:1000, HPA002877,
Sigma-Aldrich, St. Louis, MO) and rabbit polyclonal anti-Pgr (1:500, sc-538, Santa Cruz
Biotechnology, Santa Cruz, CA). Secondary antibody incubation was 1 hr at room
temperature and antibodies used were: Goat anti-rabbit-HRP (1:4000, Jackson
ImmunoResearch, West Grove, PA). Signal was developed using SuperSignal West Pico
ECL Chemiluminescent Substrate (Thermo Scientific, Rockford, IL).

Statistical analysis: Data are shown as ± SEM, average of 3 experiments. Statistical
comparisons are based on ANOVA followed by Fisher post hoc analysis, with
significance at p<0.05.

Results

Effects of E2 and P4 on glial activation 4 days post ECL
Prior studies showed that P4 blocked E2-dependent neurite outgrowth and suppressed the
astrocyte and microglial activation at 14d post ECL in ovariectomized (OVX) rats
(Wong, Rozovsky et al. 2009). To further resolve E2 and P4 interactions during ECL, we

60
examined an early time after ECL at 4 days, when glial activities are maximal during the
clearance of axonal debris (Jensen, Finsen et al. 1997), but before neurite outgrowth has
reached the granule layer of the dentate gyrus (Fig. 14). At 4d post ECL, both astrocyte
and microglial activation were modulated by E2 and P4. In OVX rats with only E2
replacement, microglial activation (Isolectin B4 staining) was decreased (58%, p<0.01;
Fig. 15). Astrocyte activation (GFAP marker) was similarly lower in E2-treated rats
(64%, p<0.01) in the molecular layer of the DG ipsilateral to lesioned side (Fig. 16).
Treatment with P4 antagonized these effects of E2 on Isolectin B4 and GFAP (Fig. 15,
16). No hormone effects were seen on the contralateral side for both Lectin and GFAP
(not shown). Thus, E2 and P4 modulated glial activation after axotomy in the same
direction and extent as observed at 14d postECL, which is consistent with general
observations that glial activation inhibits axonal outgrowth after lesioning.

61

Figure 15: Microglial activation (Isolectin-B4) in the DG molecular layer, measured by
histochemistry (HC). E2 pellets decreased microglial activation 58% (p<0.01) in the
ipsilateral DG, but not in the contralateral DG. P4 pellets antagonized E2-mediated
decrease in microglial activation. Scale bars, 50 μm.

62

Figure 16: Astrocyte activation (GFAP) in the DG molecular layer, measured by
immunohistochemistry (IHC). E2 decreased astrocyte activation (GFAP) in the ipsilateral
DG molecular layer (p<0.01). P4 antagonized the E2-mediated decrease in astrocyte
activation. Scale bars, 50 μm.

63
Microglial requirement for P4 antagonism of neurite outgrowth
To prove the requirement of microglia in P4-E2 antagonism of neurite outgrowth in
wounding-in-a-dish, microglia were added back to plated astrocytes, followed by
neuronal overlay and wounding of the reconstituted mixed glial co-cultures (Fig. 17). P4
antagonized the E2-induced neurite outgrowth when microglia were added back to
astrocyte-neuron co-cultures (Fig. 18), proving that the P4 antagonism of E2-dependent
neurite outgrowth is mediated through microglia.

Figure 17: Experimental outline: Mixed glia or astrocytes alone or astrocytes with
microglia added back were plated in 4-chamber slides, followed by adding neurons 2
days later. After co-cultures grew for 3 days, they were scratch-wounded with a plastic
pipette tip(Rozovsky, Wei et al. 2002; Wong, Rozovsky et al. 2009). Immediately after
wounding, co-cultures were treated with either vehicle, E2 (0.1nM) or E2+P4 (E2:
0.1nM; P4: 100nM) for 2 days. Slides were immunostained for βIII-tubulin and GFAP.

64

Figure 18: Neurite outgrowth in mixed glia, enriched astrocytes and add-back microglia
co-cultures. In mixed glia-neuron co-cultures, E2 increased neurite outgrowth 63%
(p<0.0001) and P4 antagonized the E2-induced neurite outgrowth. In astrocyte-neuron
co-cultures, E2 increased neurite outgrowth 53% (p<0.001). With absent microglia, P4
did not antagonize E2-induced neurite outgrowth (p<0.001). In astrocyte-neuron co-
cultures with add-back microglia, E2 increased neurite outgrowth 93% (p<0.0001). With
microglia added back to astrocyte-neuron co-cultures, P4 antagonized E2-induced neurite
outgrowth.
(c) Representative images from wounded mixed glia-neuron co-cultures treated with
either vehicle, E2 or E2+P4. The dotted line represents the wound zone. E2 increased
neurite outgrowth into the wound zone and P4 antagonized the E2-induced outgrowth.
Scale bars, 50 μm.
(d) Microglial composition in mixed glia, enriched astrocytes and add-back microglia
cultures. Astrocytes are labeled with GFAP (green) and microglia with IBA1 (red).
Microglial composition is similar in mixed glia and add-back microglia cultures.
Enriched astrocyte cultures have <5% microglia. Scale bars, 50 μm.

65

66
Requirement of microglial soluble factors for P4-E2 antagonism of neurite
outgrowth
Microglia could mediate the P4-E2 antagonism directly, by cell-to-cell contact, or
indirectly, through the release of soluble factors. Isolated microglia were plated
separately in steroid-free media and given scratch-wounds. The microglial conditioned
media was added to astrocyte-neuron co-cultures (plated separately) at the time of
wounding (day 6) in the presence of steroids (Fig. 19a). P4 antagonized E2-induced
neurite outgrowth in the presence of conditioned media from wounded microglia, but not
from control (unwounded) microglia (Fig. 19b). The microglial conditioned media did
not alter E2-dependent neurite outgrowth. Thus, soluble factors released by wounded
microglia suffice to restore P4-E2 antagonism to astrocyte-neuron co-cultures.

CD11b protein was analyzed in the vicinity of the wound zone by ICC. Microglial
activation was increased 77% in the zone adjacent to the wound track (Zone 1; Fig. 19c).
CD11b protein was also increased in Zone 2 44% (Fig. 19c). However, microglial
activation was not evident in the zone furthest away from the wound track.

67
Figure 19: Requirement of microglial wounding for P4 antagonism of neurite outgrowth.
(a) Experimental outline: Microglia were plated in 4-chamber slides and allowed to grow
for 3 days, followed by scratch-wounding. Conditioned media from non-wounded or
wounded microglia was added to wounded astrocyte-neuron co-cultures with vehicle, E2
(0.1nM) or E2+P4 (E2: 0.1nM; P4, 100nM).
(b) With conditioned media from non-wounded microglia, E2 increased neurite
outgrowth 48% (p<0.0001). P4 did not antagonize E2-induced neurite outgrowth
(p<0.0001). When wounded microglial CM was used, E2 increased neurite outgrowth
42% (p<0.0001). In the presence of wounded microglial CM, P4 antagonized E2-induced
neurite outgrowth.
(c) CD11b protein expression was analyzed in 3 zones from wounded microglia: zone 1,
1mm
2
area adjacent to wound zone; zone 2, 1mm
2
away from wound zone and adjacent
to zone 1; zone 3, 2mm
2
away from wound zone and adjacent to zone 2. CD11b protein
was increased 77% (p<0.0001) in zone 1 compared to non-wounded microglia. CD11b
induction was less in zone 2 compared to zone 1 (p<0.03), yet was increased 44%
compared to non-wounded microglia (p<0.01). CD11b was not increased in zone 3.

68

69
Requirement of microglial activation for P4-E2 antagonism of neurite outgrowth
Since wounding of microglia induced microglial activation (Fig. 19c), we studied the
effect of a classic activator of microglia, lipopolysaccharide (LPS, 100 ng/ml) on P4
antagonism of neurite outgrowth (Fig. 20). As expected, treatment with LPS induced
microglial CD11b expression 2-fold (Fig. 22). The addition of conditioned media from
LPS-activated microglia restored the P4-E2 antagonism to astrocyte-neuron co-cultures.
Controls included conditioned media from microglia without LPS treatment and addition
of LPS to astrocyte-neuron co-cultures without microglial conditioned media (Fig. 21).
Thus, microglial activation by several modes induces soluble factors that mediate P4-E2
antagonism of neurite outgrowth.

Figure 20: Experimental outline: Microglia were plated in 4-chamber slides and allowed
to grow for 3 days, followed by treatment with either vehicle or LPS (100ng/ml) for 2
days. Conditioned media (CM) was collected from un-activated and activated microglia
and was used for treating wounded astrocyte-neuron co-cultures with vehicle, E2 (0.1nM)
or E2+P4 (E2: 0.1nM; P4, 100nM).

70

Figure 21: Requirement of activated microglial secreted factors for P4 antagonism of
neurite outgrowth. (top) After treatment of astrocyte-neuron co-cultures with LPS alone,
E2 increased neurite outgrowth 53% (p<0.001). LPS had no effect on P4 antagonism
since P4 did not antagonize E2-induced neurite outgrowth (p<0.001). (bottom) When
basal microglial CM was used, E2 increased neurite outgrowth 53% (p<0.01). P4 did not
antagonize E2-induced neurite outgrowth (p<0.03). With LPS-activated microglial
conditioned media, E2 increased neurite outgrowth 79% (p<0.001). In the presence of
activated microglial CM, P4 antagonized E2-induced neurite outgrowth.

71

Figure 22: CD11b protein expression in vehicle and LPS-treated microglia by ICC was
induced by 122% after LPS treatment (p<0.0001). Mean average of 3 individual
experiments ± SEM.

Progesterone receptor expression in astrocytes and microglia
To further understand receptors that may mediate the microglia-mediated P4-E2
antagonism, we characterized the expression in vitro and in vivo of Pgr, the classical
progesterone receptor, and Pgrmc1, the membrane-associated receptor component that is
required for neuronal stem cell proliferation in the adult hippocampus and that regulates
axon guidance during development (Introduction). Pgr was only detected in astrocytes,
but not in microglia, even with 2.5-fold more protein (Fig. 23). However, Pgrmc1 protein

72
was abundant in mixed glia, enriched astrocytes, and enriched microglia by Western blots
(Fig. 23). The expression of Pgrmc1 in both astrocytes and microglia was confirmed by
double immunocytochemistry in vitro (Fig. 24) and in vivo in the dentate gyrus molecular
layer (Fig. 25). This is the first evidence for expression of a progesterone mediator in
microglia.

Figure 23: Glial expression of Pgrmc1 and Pgr. Western blots with 10µg total protein
from mixed glia, astrocytes or microglia alone showed Pgrmc1 expression in both
astrocytes and in microglia. Even with higher loading (25µg total protein), no Pgr was
detected in microglia.

73

Figure 24: Pgrmc1 protein in cultured primary astrocytes and microglia by ICC. Double
ICC for GFAP and Pgrmc1 detected Pgrmc1 in astrocytes (top). Double ICC using
CD11b and Pgrmc1 detected Pgrmc1 in microglia (bottom). Scale bars, 20 μm.

74

Figure 25: Pgrmc1 protein expression in rat DG molecular layer. Double IHC using
GFAP and Pgrmc1 detected Pgrmc1 in astrocytes (top). Double IHC using IBA1 and
Pgrmc1 detected Pgrmc1 in microglia in vivo (bottom). Scale bars, 20 μm.

75
Role of glial Pgrmc1 in P4 antagonism of E2-induced neurite outgrowth
To investigate the role of Pgrmc1 in P4-E2 antagonism, we did a siRNA knock-down of
Pgrmc1 in mixed glia (both astrocytes and microglia), or astrocytes, or microglia alone
before plating of neurons. In mixed glia-neuron co-cultures, Pgrmc1 knock-down
eliminated the P4-E2 antagonism (Fig. 26). The specificity of this effect to P4 is shown
by the normal E2 induced neurite outgrowth 65% (p<0.0001). Because Pgrmc1 is
expressed in both astrocytes and microglia, we next investigated the possible independent
contribution of astrocytic and microglial Pgrmc1 to P4-E2 antagonism. The Pgrmc1
knock-down in astrocytes or microglia persisted at 45% below controls for 5 days
(immunocytochemistry; not shown). After Pgrmc1 knock-down in astrocytes only, P4
still antagonized E2-induced neurite outgrowth (Fig. 27). Again, E2-induced neurite
outgrowth was not impaired. Thus, astrocytic Pgrmc1 is not required for P4 antagonism
of E2-induced neurite outgrowth. In contrast, microglial knock-down of Pgrmc1
abolished the P4-E2 antagonism of neurite outgrowth (p<0.0001) (Fig. 28).

76

Figure 26: Requirement of Pgrmc1 in P4 antagonism of neurite outgrowth.
Pgrmc1 siRNA in mixed glia. Mixed glia was treated with either scrambled siRNA
(control) or Pgrmc1. In co-cultures treated with scrambled siRNA, E2 increased neurite
outgrowth 73% (p<0.0001). P4 antagonized E2-induced neurite outgrowth. When
Pgrmc1 was knocked-down in mixed glia, E2 still induced neurite outgrowth 65%
(p<0.0001). However, P4 did not antagonize E2-induced neurite outgrowth (p<0.0001).

77

Figure 27: Pgrmc1 siRNA in astrocytes only. Astrocytes were treated with siRNA and
untreated microglia were added back. E2 increased neurite outgrowth 75% in scrambled
siRNA treated co-cultures (p<0.0001). P4 antagonized E2-induced neurite outgrowth. E2
increased neurite outgrowth 61% even with Pgrmc1 knocked-down in astrocytes
(p<0.0001). However, P4 antagonized E2-induced neurite outgrowth.

78

Figure 28: Pgrmc1 siRNA in microglia only. Microglia were treated with siRNA and
untreated astrocytes were added back. E2 increased neurite outgrowth 84% in scrambled
siRNA treated co-cultures (p<0.0001) and P4 antagonized E2-induced neurite outgrowth.
When Pgrmc1 was knocked-down in microglia, E2 increased neurite outgrowth 78%
(p<0.0001). P4 did not antagonize E2-induced neurite outgrowth when Pgrmc1 was
knocked-down in microglia (p<0.0001).

79
Microglial Pgrmc1 mediates P4-E2 antagonism via soluble factors in conditioned
media
The role of Pgrmc1 in the soluble factors that mediate P4-E2 antagonism was evaluated
by microglial Pgrmc1 knock-down by siRNA before scratch-wounding of microglia (Fig.
29a). Addition of these conditioned media to astrocyte-neuron co-cultures resulted in loss
of P4-E2 antagonism (Fig. 29b), whereas conditioned media from the scrambled siRNA
control allowed P4-E2 antagonism.

The requirement for Pgrmc1 in soluble factors from activated microglia was extended to
LPS-activated microglia. Microglia were treated with either Pgrmc1 siRNA to knock
down Pgrmc1 in microglia prior to LPS treatment or scrambled siRNA for control. Three
days after siRNA treatment, microglia were activated by LPS, followed by wounding of
co-cultures and treatment with E2 and P4 (Fig. 30a). As for scratch wounding of
microglia, Pgrmc1 knock-down abolished the P4-E2 activity in LPS activated microglia
(Fig. 30b). Importantly, treatment of microglia with LPS also induced Pgrmc1 protein by
50% (Fig. 31). Furthermore, Pgrmc1 knock-down attenuated induction of CD11b, a
classic marker of microglial activation (Fig. 32). Thus, Pgrmc1 may be a required
mediator of microglial activation, which in turn regulates P4 antagonism of neurite
outgrowth through soluble factors.

80

Figure 29: Requirement of Pgrmc1 in wounded microglial CM-mediated P4 antagonism.
(a) Experimental outline: Microglia were plated and treated with siRNA followed by
scratch wounding. CM was collected from scrambled siRNA and Pgrmc1 siRNA treated
wounded microglia and used for steroid treatment of wounded astrocyte-neuron co-
cultures.
(b) Add-back of conditioned media from wounded/scrambled siRNA treated microglia to
astrocyte-neuron co-cultures resulted in P4-E2 antagonism of neurite outgrowth. P4 did
not antagonize E2-induced neurite outgrowth (p<0.001), while E2 still increased neurite
outgrowth 40% (p<0.0001) in conditioned media from wounded/Pgrmc1 siRNA treated
microglia.

81

Figure 30: Requirement of Pgrmc1 in microglial CM-mediated P4 antagonism.
(a) Experimental outline: Microglia were plated and treated with siRNA followed by
treatment with LPS (100 ng/ml) to induce microglial activation. CM was collected from
activated microglia and used for steroid treatment of wounded astrocyte-neuron co-
cultures.
(b) When CM from scrambled siRNA/LPS treated microglia was added to astrocyte-
neuron co-cultures, E2 increased neurite outgrowth 69% (p<0.0001). P4 antagonized E2-
induced neurite outgrowth in this CM. When CM from Pgrmc1 siRNA/LPS treated
microglia was added to astrocyte-neuron co-cultures, E2 increased neurite outgrowth
52% (p<0.0001). However, P4 did not antagonize E2-induced neurite outgrowth
(p<0.0001).

82

Figure 31: Pgrmc1 protein in vehicle, LPS, and LPS and Pgrmc1 siRNA treated
microglia showed 53% induction after LPS treatment (p<0.01). Treatment of LPS-treated
microglia with Pgrmc1 siRNA caused 50% decrease in Pgrmc1 protein vs.
LPS/scrambled siRNA treated microglia (p<0.01).

83

Figure 32: CD11b protein was induced 120% by LPS treatment (p<0.0001). Treatment
of microglia with Pgrmc1 siRNA before LPS treatment decreased CD11b protein 56%
vs. scrambled siRNA/LPS treated microglia (<0.04).

84
Discussion

We report a new role of microglia in steroidal regulation of neurite outgrowth in response
to axonal injury and a new role of Pgrmc1, a multi-functional, non-classical P4 mediator.
First, we confirmed the requirement of microglia in P4 antagonism of E2-induced neurite
outgrowth (Wong, Rozovsky et al. 2009). Second, we showed that soluble factors from
microglia mediate the antagonism of E2-dependent neurite outgrowth by P4. Third, the
P4-E2 activity of microglia in modulating neurite outgrowth is dependent on Pgrmc1, a
non-classical progesterone mediator. These studies extend the known functions of
microglia beyond their most recognized function in the phagocytosis of cell debris during
development and after injury. These findings have relevance to the use of progestins in
ischemic damage, traumatic brain injury, and postmenopausal hormone therapy for
cognitive decline and Alzheimer’s disease. Moreover, the role of Pgrmc1 in neuritic
responses to P4 is the first evidence for a role of any progesterone mediator in microglia,
which do not express the classical DNA binding Pgr.

Role of microglia in P4 antagonism of E2-induced neurite outgrowth
Two models were used to study P4 antagonism of E2-induced neurite outgrowth:
axotomy of the perforant path from the entorhinal cortex to the hippocampus (entorhinal
cortex lesions, ECL) (Fig. 14) and in vitro scratch-wounding of embryonic neurons
growing on primary cultures of glial monolayers (wounding-in-a-dish). In both models of
neuronal wounding, the E2-induced neurite outgrowth was antagonized by P4 (Wong,
Rozovsky et al. 2009) (present data). Moreover, after lesioning in vivo and in vitro, E2

85
suppressed microglial activation. P4 antagonized these effects of E2, as observed here at
4 days postECL during axonal degeneration and as reported at 14 days postECL during
neurite outgrowth (Wong, Rozovsky et al. 2009). A specific role of microglia in neurite
outgrowth was defined in the wounding-in-a-dish model, where P4-E2 antagonism
required the presence of microglia. Thus, the P4-E2 antagonism of neurite outgrowth was
observed with neurons co-cultured with mixed glia (3:1 astrocytes: microglia) and after
add-back of microglia to astrocyte cultures (Fig. 18). In contrast, there was no P4-E2
antagonism in co-cultures of enriched astrocytes with <5% microglia. The P4-E2
antagonism was also restored by conditioned media from microglia activated by scratch-
wounding or LPS.

The role of P4 in microglia was puzzling because microglia lack detectable expression of
Pgr, the classical DNA-binding progesterone receptor, as initially observed in ex vivo
FACS-sorted microglia (Sierra, Gottfried-Blackmore et al. 2008). We further verified the
absence of Pgr expression in primary microglial cultures (Fig. 23). However, in vivo and
in vitro, microglia have abundant mRNA and protein for Pgrmc1, a non-classical
membrane progesterone mediator (Fig. 23-25). Pgrmc1 knockdown by siRNA in
microglia eliminated the P4 antagonism of E2-dependent neurite outgrowth. The P4-E2
antagonism of neurite outgrowth after axotomy in vivo (14 days post ECL (Wong,
Rozovsky et al. 2009)) could also be mediated by microglial Pgrmc1 which is also
expressed in the hippocampal zone of neurite outgrowth (Fig. 25). Pgrmc1 knock-out
mice are not yet available to test the requirement of Pgrmc1 in P4-E2 antagonism in vivo.

86
No direct contact with microglia is needed for the P4-E2 antagonism, because
conditioned media from activated microglia restored the P4-E2 effects. Moreover, while
Pgrmc1 is required for microglial activation and for the activity in conditioned media, the
presence of P4 itself was not required during scratch-wounding of microglia to produce
the neuromodulatory activity in conditioned media. Knock-down of astrocytic Pgrmc1 by
siRNA did not alter the E2-P4 antagonism. However, the classical Pgr in astrocytes
(Sierra, Gottfried-Blackmore et al. 2008) (Fig. 23) may directly mediate the P4-E2 effect
because two classical Pgr receptor antagonists (RU486 and ORG31710) blocked the P4-
E2 antagonism in the present model (Wong, Rozovsky et al. 2009). Thus, the soluble
activity released from microglia by scratch-wounding in the absence of P4 is dependent
on Pgrmc1, but is not proximally regulated by P4. Cancer cells can also make soluble
growth factors that depend on Pgrmc1 (Ahmed, Chamberlain et al. 2012). Although there
is no direct evidence on RU486 as an antagonist of Pgrmc1, in breast cancer cells Pgrmc1
mediated proliferation was not blocked by RU486 (Neubauer, Adam et al. 2009),
consistent with a brief report that recombinant Pgrmc1 did not bind P4 (Min,
Strushkevich et al. 2005).

The mechanisms of Pgrmc1 in P4-E2 antagonism involve two major unknowns which
extend beyond the present study: the nature of the Pgrmc1-dependent soluble factor and
the sites of its interaction with neurons. The E2-dependent outgrowth of neurites is
mediated by several mechanisms, including ApoE (Nathan, Barsukova et al. 2004) and
laminins secreted by astrocytes (Rozovsky, Wei et al. 2002). Brain cell de novo synthesis

87
of estrogens and progestagens could also have roles (Kuo, Hamid et al. 2010) because
Pgrmc1 affects steroid metabolism through its association with P450 enzymes (Min,
Strushkevich et al. 2005; Hughes, Powell et al. 2007).

There may be a broader role of Pgrmc1-dependent diffusible factors in neurite guidance
during development. Pgrmc1 orthologues have roles in neurite guidance during
development in nematode (VEM-1) and mouse (Vema) and are transiently expressed in
subsets of neurons during development (Runko and Kaprielian 2004). The lack of strong
expression of VEM-1 in other cell types in developing nematode and mouse nervous
systems does not rule out glial roles, where expression is lower than in neurons
(unpublished, based on material from Bali et al., 2012).

Most studies on microglial responses to ovarian steroids have focused on microglial
activation. The attenuation of microglial activation by either E2 or P4 (Smith, Das et al.
2011) is consistent with the reported neuroprotective roles of both steroids. For example,
E2 can reduce oxidative stress (Behl, Skutella et al. 1997), excitotoxicity (Singer,
Figueroa-Masot et al. 1999), β-amyloid induced toxicity (Carroll, Rosario et al. 2007)
and ischemia (Wise and Dubal 2000). However, P4 alone can also be neuroprotective in
traumatic brain injury (TBI), where acute treatment attenuated cerebral edema and
cytokine induction (Shear, Galani et al. 2002; Hua, Wang et al. 2011). Because TBI
causes blood-brain barrier breakdown with influx of peripheral monocytes (Grossman,
Goss et al. 2004), these studies did not resolve the responses of resident microglia to P4.

88
The inhibition of microglial activation by knock-down of Pgrmc1 (Fig. 32), suggests a
role for this receptor in the therapeutics of P4 to TBI. These observations expand the
roles of microglia in regulating neurite outgrowth, which differs from their classical
functions in phagocytosis of debris in response to injury and in synaptic pruning during
development (Paolicelli, Bolasco et al. 2011). Another non-phagocytic role is in
regulating adult neurogenesis in the adult subventricular zone (Walton, Sutter et al.
2006). Our observations of microglial involvement in ovarian steroid functions adds
another facet to the complex emerging roles of microglia. Because knock-down of
Pgrmc1 in microglia decreased LPS-induced microglial activation, Pgrmc1 may have
more general roles in microglial activation and innate immunity.

Glial expression of progesterone receptors
The glial expression of progesterone receptors is now better defined by direct evidence
that astrocytes have abundant Pgr, a classical transcription factor, which had been
implicated in P4-E2 antagonism by specific Pgr receptor blocking agents (Wong,
Rozovsky et al. 2009). Astrocytes and microglia also express Pgrmc1 in primary cultures
and in vivo, in the dentate gyrus molecular layer. As discussed above, microglia lack Pgr
expression. We also detected several membrane progesterone receptors (mPRα, mPRβ,
mPRγ) in cultured astrocytes and microglia (not shown). The PCR primers and siRNA
oligonucleotides used were unique for Pgrmc1 and did not detect these other receptors
which are not relevant to the present study.

89
P4 in treatment of brain injury and neurodegenerative condition
P4 has both beneficial and detrimental effects on neuronal outcomes in injury and
disease. In rodent models P4 can be neuroprotective for ischemia (Morali, Letechipia-
Vallejo et al. 2005), traumatic brain injury (TBI) (Shear, Galani et al. 2002), and spinal
cord injury (Labombarda, Gonzalez Deniselle et al. 2010). Pgrmc1, under another name,
25-Dx, was transiently decreased by spinal cord transection in neurons and ‘glia’ (not
specified further), with attenuation by P4 (Guennoun, Meffre et al. 2008). In agreement
with the direction of response to ECL, 25-Dx was induced at the site of TBI in astrocytes
and some neurons; however, this study did not include P4 treatment (Meffre, Delespierre
et al. 2005).

The neuroprotective mechanisms of P4 are unclear and differ between models. A role of
Pgrmc1 in neurogenesis was shown by the suppression of P4-dependent adult neural stem
cell proliferation after Pgrmc1 knock-down by siRNA (Liu, Wang et al. 2009). In a
different model with mixed cell types derived from the subventricular zone of postnatal
rats, the presence of microglia, or of conditioned medium from microglia was necessary
for continued neural stem cell proliferation (Walton, Sutter et al. 2006). In TBI and in
spinal cord injury, P4 can reduce edema (Shear, Galani et al. 2002). Other hypotheses
include decreasing glial activation (Pettus, Wright et al. 2005) and reducing oxidative
stress (Roof, Hoffman et al. 1997). The increased survival of CA1 neurons after ischemia
could involve anti-apoptotic actions of P4, which are well defined in rat granulosa cells to
involve Pgrmc1 (Peluso, Liu et al. 2009). These P4 actions differ from its actions on

90
neurite outgrowth, where P4 antagonizes lesion induced E2-mediated outgrowth (Wong,
Rozovsky et al. 2009) (reported here). P4 also antagonized E2-mediated protection from
NMDA toxicity via BDNF (Aguirre and Baudry 2009). We do not know how P4
mediates these opposing effects (neuroprotection vs. inhibition of neurite sprouting),
which could involve different mechanisms and different receptors.

Understanding P4-E2 interactions in neurite sprouting and synaptic plasticity is relevant
to hormone therapy for menopause, in which progestins are often given in combination
with estrogens. During normal estrous cycles in the unlesioned hippocampus, P4
mediates the regression of dendritic spines after ovulation (Woolley and McEwen 1993).
In the Women’s Health Initiative trial, combined E2 and P4 appeared to worsen cognitive
decline during 5 years follow-up (Rapp, Espeland et al. 2003). Analysis of The Cochrane
Dementia and Cognitive Improvement Group Specialized Register also showed overall
negative effects of estrogen replacement, with a single exception of short-term benefits of
unopposed E2 (Hogervorst, Yaffe et al. 2009). Subsequent smaller studies suggest that
hormone therapy can improve cognition in early to moderate Alzheimer disease, with
marginally greater benefits by E2 alone (Wharton, Baker et al. 2011).

Role of Pgrmc1 outside the brain
Pgrmc1 mediates numerous P4 actions throughout life. Before fertilization, Pgrmc1
mediates the Ca
2+
fluxes in the sperm acrosome reaction (Falkenstein, Heck et al. 1999).
Ovarian Pgrmc1 mediates the follicle loss of aging through P4-dependent granule cell

91
apoptosis noted above (Peluso, Liu et al. 2009). In the premature ovarian failure (POF)
syndrome, some familial cases had missense mutations in Pgrmc1, which impaired anti-
apoptotic actions of P4 (Mansouri, Schuster et al. 2008). The anti-apoptotic role of
Pgrmc1 may be relevant to ovarian cancer (Peluso, Liu et al. 2008). In breast cancer and
other malignancies, Pgrmc1 expression correlates with tumor stage and is associated with
resistance to chemotherapeutic drugs (Peluso, Liu et al. 2008). Recently, Pgrmc1 has
been identified as the sigma-2 receptor, which is implicated in several cancers where its
expression is increased compared to non-malignant tissues (Ahmed, Chamberlain et al.
2012). It is now also referred to as S2R
Pgrmc1
(Ahmed, Chamberlain et al. 2012). The
failure of RU486 to block Pgrmc1 mediated proliferation in breast cancer cells as noted
above (Neubauer, Adam et al. 2009), gives further support for its difference from Pgr in
steroidal specificity. An indirect link to steroids may be through its heme-binding and
influence on steroid-21 hydroxylation (Min, Strushkevich et al. 2005; Hughes, Powell et
al. 2007).

Pgrmc1 may have a broader role in microglial activation beyond P4-E2 antagonism.
Unexpectedly, knock-down of Pgrmc1 by siRNA also attenuated microglia markers of
activation by LPS. In view of emerging evidence for peripheral macrophages that P4 can
modulate inflammatory pathways (Menzies, Henriquez et al. 2011), it will be of interest
to evaluate Pgrmc1 in other monocytic lineage cells besides resident microglia.

92
Conclusions
These experiments show novel roles of microglia and the non-classical progesterone
receptor Pgrmc1 (progesterone receptor membrane component-1), in the steroidal
regulation of neurite outgrowth after wounding. The P4-E2 antagonism of neurite
outgrowth is mediated by microglial Pgrmc1 a multi-functional protein with roles in
neurogenesis, as well as in cancer cell growth. Moreover, microglial activation by
mechanical injury and lipopolysaccharide (LPS) was blocked by attenuating Pgrmc1
expression, suggesting roles of this receptor in the inflammatory response mediated by
microglia. These findings are relevant to the use of progestins in therapy for neuronal
damage from Alzheimer disease, ischemia, and traumatic brain injury. Ongoing studies
address the nature of the Pgrmc1 soluble factors from microglia that mediate P4-
antagonism of E2-dependent neurite growth.

93
CHAPTER 4
Conclusion

E2 and P4 play diverse roles in the central nervous system regulating neuronal health in
the intact as well as diseased brain. E2 has general neuroprotective roles in a range of
physiological concentrations. The actions of P4, however, are more complex ranging
from neuroprotection in ischemia and traumatic brain injury to blocking E2’s trophic
effects on neurite sprouting. We have identified the cellular mechanisms involved in the
P4 antagonism of E2-induced neurite outgrowth as well as the role of the non-classical P4
mediator, Pgrmc1. Moreover, we have also studied the expression and regulation of
Pgrmc1 and the classical progesterone receptor, Pgr in the adult rat hippocampus.

First and foremost, both Pgrmc1 and Pgr are expressed in the adult rat hippocampus
neurons as well as glia. Neuronal expression of both Pgrmc1 and Pgr is greater than glial
expression as evidenced by in situ hybridization silver grain clusters. Both Pgrmc1 and
Pgr are also regulated by E2 and P4 in the hippocampus. Second, only Pgrmc1 expression
is evident in microglia and they lack expression of Pgr, the classical P4 receptor. Third,
microglia are required for the P4 antagonism of E2-induced neurite outgrowth and
soluble factors from activated microglia suffice to restore the P4-E2 antagonism of
neurite outgrowth. Finally, Pgrmc1 is required for the souble factor activity of microglia
in the P4-E2 antagonism.

94
Pgrmc1 and Pgr: expression in the adult rat hippocampus
Pgrmc1 and Pgr expression in the adult rat hippocampus had not been extensively
characterized, especially within subsets of hippocampal neurons. We studied the neuronal
expression of Pgrmc1 and Pgr in CA1, CA3 and DG neurons and their regulation by E2
and P4 after 4-day and 30-day hormone replacement. Pgrmc1 was expressed at similar
levels in CA1, CA3 and DG neurons and was regulated similarly by E2 and P4 in all 3
neuronal subtypes. This could mean broad roles of this receptor in hippocampal neuronal
functions. Pgrmc1 is not a classical P4 receptor and mediates other functions including
heme-binding dependent sterol synthesis and metabolism and steroid metabolism as well
as anti-apoptotic functions in cancer cells (Cahill 2007; Rohe, Ahmed et al. 2009;
Ahmed, Chamberlain et al. 2012). The presence of Pgrmc1 at similar levels in
hippocampal neurons could suggest its non-P4 dependent roles in neuronal functions.
These functions could be presently unknown as novel roles of Pgrmc1 are still emerging.
Pgr, on the other hand, is expressed highly in CA3 neurons, modestly in CA1 neurons
and at very low levels in DG neurons. This could directly relate to different functions of
P4 on the 3 different neuronal subtypes. For example, CA1 neurons are more susceptible
to neuronal damage from ischemia and P4 protects these neurons from cell-death
(Kawasaki, Traynelis et al. 1990; Morali, Letechipia-Vallejo et al. 2005). This action of
P4 could be mediated by Pgrmc1, based on its known anti-apoptotic roles in ovarian
granulosa cells, pro-proliferative roles in adult neurogenesis and other cancers including
breast cancer and lung cancer (Peluso, Liu et al. 2008; Peluso, Romak et al. 2008;
Ahmed, Rohe et al. 2010; Peluso 2011). CA1 neurons also show steroid-dependent

95
plasticity during the normal rat estrous cycle, where E2 increases synaptic density and P4
eventually decreases the spine density (Woolley and McEwen 1992; Woolley and
McEwen 1993). This role of P4 in regulating spine and synapse density in CA1 neurons
could be mediated by the classical receptor, Pgr. However, it is not clear what roles Pgr
has in CA3 neurons. Since CA3 neurons express the maximal Pgr of all 3 hippocampal
neurons, it is possible that it mediates certain functions of P4 that are unclear at present.

Pgr expression in DG neurons is complex. In mature DG neurons, it is only expressed in
~25% neurons , while in immature developing neurons (DCX+), it is expressed in ~84%
neurons. In BrdU+ cells in the subgranular zone of DG, Pgr is expressed in ~92% cells.
During development, Pgr expression peaks at postnatal day 7-8, then gradually declines
in the rat cortex (Quadros, Pfau et al. 2007). This suggests a role of Pgr in neuronal
development. Thus, BrdU+ cells express abundant Pgr, which decreases with neuronal
differentiation in DCX+ immature neurons and decreases even further in mature DG
neurons. Thus, Pgr in DG neurons could play roles in the development of newly
generated neurons during adult neurogenesis in the SGZ of DG.

Pgrmc1 and Pgr are also expressed in astrocytes in the DG molecular layer. However,
only Pgrmc1 is expressed in microglia. Astrocytes play a major role in de novo
steroidogenesis and synthesize both E2 and P4 (Zwain and Yen 1999). Both P4
mediators, Pgrmc1 and Pgr, could be involved in the steroidogenesis, especially Pgrmc1
considering its known functions in steroid metabolism. The expression of a P4 mediator

96
in microglia is unprecedented. However, we show here that Pgrmc1 could be involved in
the immune functions mediated by microglia, since lowering Pgrmc1 expression in
microglia also lowers microglial activation. Thus, the role of Pgrmc1 in microglia could
be related to their most well-recognized functions of phagocytosis of cell debris and
foreign particles. We have shown a role of microglial Pgrmc1 in mediating P4 actions on
neurite outgrowth in vitro. It is possible that the P4-E2 antagonism of neurite outgrowth
seen after entorhinal cortex lesion in the DG molecular layer could be mediated by
microglial Pgrmc1. However, Pgrmc1 knock-out mice are not yet available to test this
hypothesis.

P4-E2 antagonism of neurite outgrowth: role of soluble factors
We have shown that soluble factors from activated microglia suffice to restore P4-E2
antagonism of neurite outgrowth. This shows that physical cell-cell contact between
microglia and neurons is not required for the P4 antagonism. However, soluble factors
from un-activated microglia do not restore P4 antagonism. This is expected since
wounding of microglia induces microglial activation. Thus, in mixed glia-neuron co-
cultures, wounding of the co-cultures would induce microglial activation which would
result in the secretion of the soluble factors that are responsible for the P4 antagonism of
neurite outgrowth. The nature of these soluble factors remains to be elucidated.

In a set of pilot experiments, we have shown that the soluble factor/s is not TNFα.
Measuring TNFα levels in microglial conditioned media by ELISA showed an increase in

97
TNFα protein in the conditioned media from microglia treated with LPS, but not in
conditioned media from wounded microglia. Since, conditioned media from wounded
microglia also sufficed to restore P4-E2 antagonism of neurite outgrowth, the soluble
factor cannot be TNFα as its levels do not change after microglial wounding.

Other candidates include keratan sulfate proteoglycans, chondroitin sulfate
proteoglycans, NCAM and N-Cadherin. Keratin sulfate proteoglycans have been shown
to inhibit astrocyte-mediated neurite outgrowth by the suppression of laminin secretion
from astrocytes (Smith-Thomas, Fok-Seang et al. 1994; Smith-Thomas, Stevens et al.
1995). Moreover, injury activated microglia have been shown to increase the expression
of keratin sulfate proteoglycans (Jones and Tuszynski 2002; Krautstrunk, Scholtes et al.
2002). How these glycoproteins mediate P4 antagonism and how Pgrmc1 could regulate
them is not known. NCAM and N-Cadherin are neurite outgrowth promoting cell-
adhesion proteins (Neugebauer, Tomaselli et al. 1988; Doherty, Fruns et al. 1990). E2 has
been shown to increase mRNA of N-Cadherin while P4 had not effect on its levels
(MacCalman, Farookhi et al. 1995). Thus, N-Cadherin is another possible candidate for
the soluble factor/s that mediate P4-E2 antagonism of neurite outgrowth.

Understanding the mechanisms involved in the P4-E2 responses to neurite outgrowth
have important implications in the development and optimization of postmenopausal
hormone therapy for Alzheimer disease and dementias. Since neuronal degeneration and
synaptic loss accompany Alzheimer disease, means of intervention that could prevent or

98
delay these changes would be highly beneficial. E2 has trophic effects on neurite
outgrowth which would prove useful in the face of synaptic loss. However, P4 needs to
be administered along with E2 in postmenopausal women with an intact uterus, and P4
has been shown to antagonize E2’s beneficial effects on neurite outgrowth. Thus,
understanding the receptor/s involved in the P4 responses to neurite outgrowth would
help in optimizing the hormone therapy. A known inhibitor of Pgrmc1 exists in the form
of a small compound commercially known as AG-205 (Ahmed, Rohe et al. 2010).
Receptor antagonists for Pgr are well-known and widely used (Ex. RU486, also known as
Mifepristone). Future studies will help in determining the nature of the soluble factor/s
that mediate P4-E2 antagonism of neurite outgrowth and will provide means to optimize
the therapeutics for hormone therapy and brain injury.

99
REFERENCES

Aguirre, C. C. and M. Baudry (2009). "Progesterone reverses 17beta-estradiol-mediated
neuroprotection and BDNF induction in cultured hippocampal slices." Eur J Neurosci
29(3): 447-454.

Ahmed, I. S., C. Chamberlain, et al. (2012). "S2R(Pgrmc1): the cytochrome-related
sigma-2 receptor that regulates lipid and drug metabolism and hormone signaling."
Expert Opin Drug Metab Toxicol 8(3): 361-370.

Ahmed, I. S., H. J. Rohe, et al. (2010). "Progesterone receptor membrane component 1
(Pgrmc1): a heme-1 domain protein that promotes tumorigenesis and is inhibited by a
small molecule." J Pharmacol Exp Ther 333(2): 564-573.

Alves, S. E., B. S. McEwen, et al. (2000). "Estrogen-regulated progestin receptors are
found in the midbrain raphe but not hippocampus of estrogen receptor alpha (ER alpha)
gene-disrupted mice." J Comp Neurol 427(2): 185-195.

Anderson, G. L., M. Limacher, et al. (2004). "Effects of conjugated equine estrogen in
postmenopausal women with hysterectomy: the Women's Health Initiative randomized
controlled trial." JAMA 291(14): 1701-1712.

Ashley, R. L., J. A. Arreguin-Arevalo, et al. (2009). "Binding characteristics of the ovine
membrane progesterone receptor alpha and expression of the receptor during the estrous
cycle." Reprod Biol Endocrinol 7: 42.

Asthana, S., R. D. Brinton, et al. (2009). "Frontiers proposal. National Institute on Aging
"bench to bedside: estrogen as a case study"." Age (Dordr) 31(3): 199-210.

Bali, N., J. M. Arimoto, et al. (2012). "Differential responses of progesterone receptor
membrane component-1 (Pgrmc1) and the classical progesterone receptor (Pgr) to
17beta-estradiol and progesterone in hippocampal subregions that support synaptic
remodeling and neurogenesis." Endocrinology 153(2): 759-769.

Behl, C., T. Skutella, et al. (1997). "Neuroprotection against oxidative stress by
estrogens: structure-activity relationship." Mol Pharmacol 51(4): 535-541.

Boney-Montoya, J., Y. S. Ziegler, et al. (2010). "Long-range transcriptional control of
progesterone receptor gene expression." Mol Endocrinol 24(2): 346-358.

Brinton, R. D., R. F. Thompson, et al. (2008). "Progesterone receptors: form and function
in brain." Front Neuroendocrinol 29(2): 313-339.

100
Buddhikot, M., E. Falkenstein, et al. (1999). "Recognition of a human sperm surface
protein involved in the progesterone-initiated acrosome reaction by antisera against an
endomembrane progesterone binding protein from porcine liver." Mol Cell Endocrinol
158(1-2): 187-193.

Cahill, M. A. (2007). "Progesterone receptor membrane component 1: an integrative
review." J Steroid Biochem Mol Biol 105(1-5): 16-36.

Camacho-Arroyo, I., O. Villamar-Cruz, et al. (2002). "Participation of the 26S
proteasome in the regulation of progesterone receptor concentrations in the rat brain."
Neuroendocrinology 76(5): 267-271.

Carroll, J. C., E. R. Rosario, et al. (2007). "Progesterone and estrogen regulate
Alzheimer-like neuropathology in female 3xTg-AD mice." J Neurosci 27(48): 13357-
13365.

Carroll, J. C., E. R. Rosario, et al. (2010). "Continuous and cyclic progesterone
differentially interact with estradiol in the regulation of Alzheimer-like pathology in
female 3xTransgenic-Alzheimer's disease mice." Endocrinology 151(6): 2713-2722.

Chang, H. S., T. Sasaki, et al. (1989). "Hippocampal unit activity after transient cerebral
ischemia in rats." Stroke 20(8): 1051-1058.

Choi, J. M., R. D. Romeo, et al. (2003). "Estradiol increases pre- and post-synaptic
proteins in the CA1 region of the hippocampus in female rhesus macaques (Macaca
mulatta)." Endocrinology 144(11): 4734-4738.

Cooke, B. M. and C. S. Woolley (2005). "Gonadal hormone modulation of dendrites in
the mammalian CNS." J Neurobiol 64(1): 34-46.

Curb, J. D., R. L. Prentice, et al. (2006). "Venous thrombosis and conjugated equine
estrogen in women without a uterus." Arch Intern Med 166(7): 772-780.

De Amicis, F., S. Zupo, et al. (2009). "Progesterone receptor B recruits a repressor
complex to a half-PRE site of the estrogen receptor alpha gene promoter." Mol
Endocrinol 23(4): 454-465.

De Nicola, A. F., F. Labombarda, et al. (2009). "Progesterone neuroprotection in
traumatic CNS injury and motoneuron degeneration." Front Neuroendocrinol 30(2): 173-
187.

Doherty, P., M. Fruns, et al. (1990). "A threshold effect of the major isoforms of NCAM
on neurite outgrowth." Nature 343(6257): 464-466.

101
Falkenstein, E., C. Eisen, et al. (2001). "Chemical modification and structural analysis of
the progesterone membrane binding protein from porcine liver membranes." Mol Cell
Biochem 218(1-2): 71-79.

Falkenstein, E., M. Heck, et al. (1999). "Specific progesterone binding to a membrane
protein and related nongenomic effects on Ca2+-fluxes in sperm." Endocrinology
140(12): 5999-6002.

Falkenstein, E., C. Meyer, et al. (1996). "Full-length cDNA sequence of a progesterone
membrane-binding protein from porcine vascular smooth muscle cells." Biochem
Biophys Res Commun 229(1): 86-89.

Farioli-Vecchioli, S., D. Saraulli, et al. (2009). "Impaired terminal differentiation of
hippocampal granule neurons and defective contextual memory in PC3/Tis21 knockout
mice." PLoS One 4(12): e8339.

Farioli-Vecchioli, S., D. Saraulli, et al. (2008). "The timing of differentiation of adult
hippocampal neurons is crucial for spatial memory." PLoS Biol 6(10): e246.

Ferreira, A. and A. Caceres (1991). "Estrogen-enhanced neurite growth: evidence for a
selective induction of Tau and stable microtubules." J Neurosci 11(2): 392-400.

Foster, H., A. Reynolds, et al. (2010). "Internalisation of membrane progesterone
receptor-alpha after treatment with progesterone: Potential involvement of a clathrin-
dependent pathway." Mol Med Report 3(1): 27-35.

Gage, F. H., P. W. Coates, et al. (1995). "Survival and differentiation of adult neuronal
progenitor cells transplanted to the adult brain." Proc Natl Acad Sci U S A 92(25):
11879-11883.

Geddes, J. W., D. T. Monaghan, et al. (1985). "Plasticity of hippocampal circuitry in
Alzheimer's disease." Science 230(4730): 1179-1181.

Gottfried-Blackmore, A., A. Sierra, et al. (2008). "Brain microglia express steroid-
converting enzymes in the mouse." J Steroid Biochem Mol Biol 109(1-2): 96-107.

Gould, E., C. S. Woolley, et al. (1990). "Gonadal steroids regulate dendritic spine density
in hippocampal pyramidal cells in adulthood." J Neurosci 10(4): 1286-1291.

Graham, J. D. and C. L. Clarke (1997). "Physiological action of progesterone in target
tissues." Endocr Rev 18(4): 502-519.

Grossman, K. J., C. W. Goss, et al. (2004). "Effects of progesterone on the inflammatory
response to brain injury in the rat." Brain Res 1008(1): 29-39.

102
Guennoun, R. and J. M. Gasc (1990). "Estrogen-independent and estrogen-induced
progesterone receptors, and their regulation by progestins in the hypothalamus and
pituitary of the chick embryo: an immunohistochemical study." Brain Res Dev Brain Res
55(2): 151-159.

Guennoun, R., D. Meffre, et al. (2008). "The membrane-associated progesterone-binding
protein 25-Dx: expression, cellular localization and up-regulation after brain and spinal
cord injuries." Brain Res Rev 57(2): 493-505.

Guerra-Araiza, C., A. Coyoy-Salgado, et al. (2002). "Sex differences in the regulation of
progesterone receptor isoforms expression in the rat brain." Brain Res Bull 59(2): 105-
109.

Guerra-Araiza, C., O. Villamar-Cruz, et al. (2003). "Changes in progesterone receptor
isoforms content in the rat brain during the oestrous cycle and after oestradiol and
progesterone treatments." J Neuroendocrinol 15(10): 984-990.

Harman, S. M., E. A. Brinton, et al. (2005). "KEEPS: The Kronos Early Estrogen
Prevention Study." Climacteric 8(1): 3-12.

Hodge, R. D., T. D. Kowalczyk, et al. (2008). "Intermediate progenitors in adult
hippocampal neurogenesis: Tbr2 expression and coordinate regulation of neuronal
output." J Neurosci 28(14): 3707-3717.

Hogervorst, E., K. Yaffe, et al. (2009). "Hormone replacement therapy to maintain
cognitive function in women with dementia." Cochrane Database Syst Rev(1):
CD003799.

Hua, F., J. Wang, et al. (2011). "Genomic profile of Toll-like receptor pathways in
traumatically brain-injured mice: effect of exogenous progesterone." J
Neuroinflammation 8: 42.

Hughes, A. L., D. W. Powell, et al. (2007). "Dap1/PGRMC1 binds and regulates
cytochrome P450 enzymes." Cell Metab 5(2): 143-149.

Intlekofer, K. A. and S. L. Petersen (2011). "17beta-estradiol and progesterone regulate
multiple progestin signaling molecules in the anteroventral periventricular nucleus,
ventromedial nucleus and sexually dimorphic nucleus of the preoptic area in female rats."
Neuroscience 176: 86-92.

Intlekofer, K. A. and S. L. Petersen (2011). "Distribution of mRNAs encoding classical
progestin receptor, progesterone membrane components 1 and 2, serpine mRNA binding
protein 1, and progestin and ADIPOQ receptor family members 7 and 8 in rat forebrain."
Neuroscience 172: 55-65.

103
Jensen, M. B., B. Finsen, et al. (1997). "Morphological and immunophenotypic
microglial changes in the denervated fascia dentata of adult rats: correlation with blood-
brain barrier damage and astroglial reactions." Exp Neurol 143(1): 103-116.

Jones, L. L. and M. H. Tuszynski (2002). "Spinal cord injury elicits expression of keratan
sulfate proteoglycans by macrophages, reactive microglia, and oligodendrocyte
progenitors." J Neurosci 22(11): 4611-4624.

Jover-Mengual, T., T. Miyawaki, et al. (2010). "Acute estradiol protects CA1 neurons
from ischemia-induced apoptotic cell death via the PI3K/Akt pathway." Brain Res 1321:
1-12.

Kalita, K., S. Szymczak, et al. (2005). "Non-nuclear estrogen receptor beta and alpha in
the hippocampus of male and female rats." Hippocampus 15(3): 404-412.

Kawasaki, K., S. F. Traynelis, et al. (1990). "Different responses of CA1 and CA3
regions to hypoxia in rat hippocampal slice." J Neurophysiol 63(3): 385-394.

Keightley, D. D. (1979). "The binding of progesterone, R-5020 and ORG-2058 to
progesterone receptor." Eur J Cancer 15(5): 785-790.

Krautstrunk, M., F. Scholtes, et al. (2002). "Increased expression of the putative axon
growth-repulsive extracellular matrix molecule, keratan sulphate proteoglycan, following
traumatic injury of the adult rat spinal cord." Acta Neuropathol 104(6): 592-600.

Krebs, C. J., E. D. Jarvis, et al. (2000). "A membrane-associated progesterone-binding
protein, 25-Dx, is regulated by progesterone in brain regions involved in female
reproductive behaviors." Proc Natl Acad Sci U S A 97(23): 12816-12821.

Kuiper, G. G., B. Carlsson, et al. (1997). "Comparison of the ligand binding specificity
and transcript tissue distribution of estrogen receptors alpha and beta." Endocrinology
138(3): 863-870.

Kuo, J., N. Hamid, et al. (2010). "Membrane estrogen receptors stimulate intracellular
calcium release and progesterone synthesis in hypothalamic astrocytes." J Neurosci
30(39): 12950-12957.

Labombarda, F., M. C. Gonzalez Deniselle, et al. (2010). "Progesterone and the spinal
cord: good friends in bad times." Neuroimmunomodulation 17(3): 146-149.

Labombarda, F., D. Meffre, et al. (2010). "Membrane progesterone receptors localization
in the mouse spinal cord." Neuroscience 166(1): 94-106.

104
Lacroix-Fralish, M. L., V. L. Tawfik, et al. (2006). "Differential regulation of neuregulin
1 expression by progesterone in astrocytes and neurons." Neuron Glia Biol 2(4): 227-234.

Lebesgue, D., M. Traub, et al. (2010). "Acute administration of non-classical estrogen
receptor agonists attenuates ischemia-induced hippocampal neuron loss in middle-aged
female rats." PLoS One 5(1): e8642.

Lefrancois, T., C. Fages, et al. (1997). "Neuritic outgrowth associated with astroglial
phenotypic changes induced by antisense glial fibrillary acidic protein (GFAP) mRNA in
injured neuron-astrocyte cocultures." J Neurosci 17(11): 4121-4128.

Lieberman, B. A., B. J. Bona, et al. (1993). "The constitution of a progesterone response
element." Mol Endocrinol 7(4): 515-527.

Liu, B. and L. A. Arbogast (2009). "Gene expression profiles of intracellular and
membrane progesterone receptor isoforms in the mediobasal hypothalamus during pro-
oestrus." J Neuroendocrinol 21(12): 993-1000.

Liu, L., J. Wang, et al. (2009). "Progesterone increases rat neural progenitor cell cycle
gene expression and proliferation via extracellularly regulated kinase and progesterone
receptor membrane components 1 and 2." Endocrinology 150(7): 3186-3196.

Liu, L., L. Zhao, et al. (2010). "Clinically relevant progestins regulate neurogenic and
neuroprotective responses in vitro and in vivo." Endocrinology 151(12): 5782-5794.

MacCalman, C. D., R. Farookhi, et al. (1995). "Estradiol regulates N-cadherin mRNA
levels in the mouse ovary." Dev Genet 16(1): 20-24.

Mansouri, M. R., J. Schuster, et al. (2008). "Alterations in the expression, structure and
function of progesterone receptor membrane component-1 (PGRMC1) in premature
ovarian failure." Hum Mol Genet 17(23): 3776-3783.

Markowska, A. L. and A. V. Savonenko (2002). "Effectiveness of estrogen replacement
in restoration of cognitive function after long-term estrogen withdrawal in aging rats." J
Neurosci 22(24): 10985-10995.

Marriott, L. K., B. Hauss-Wegrzyniak, et al. (2002). "Long-term estrogen therapy
worsens the behavioral and neuropathological consequences of chronic brain
inflammation." Behav Neurosci 116(5): 902-911.

Meffre, D., B. Delespierre, et al. (2005). "The membrane-associated progesterone-
binding protein 25-Dx is expressed in brain regions involved in water homeostasis and is
up-regulated after traumatic brain injury." J Neurochem 93(5): 1314-1326.

105
Menzies, F. M., F. L. Henriquez, et al. (2011). "Selective inhibition and augmentation of
alternative macrophage activation by progesterone." Immunology 134(3): 281-291.

Meyer, C., R. Schmid, et al. (1996). "Purification and partial sequencing of high-affinity
progesterone-binding site(s) from porcine liver membranes." Eur J Biochem 239(3): 726-
731.

Min, L., N. V. Strushkevich, et al. (2005). "Molecular identification of adrenal inner zone
antigen as a heme-binding protein." FEBS J 272(22): 5832-5843.

Morali, G., G. Letechipia-Vallejo, et al. (2005). "Post-ischemic administration of
progesterone in rats exerts neuroprotective effects on the hippocampus." Neurosci Lett
382(3): 286-290.

Morgan, T. E., Z. Xie, et al. (1999). "The mosaic of brain glial hyperactivity during
normal ageing and its attenuation by food restriction." Neuroscience 89(3): 687-699.

Morse, J. K., S. T. DeKosky, et al. (1992). "Neurotrophic effects of steroids on lesion-
induced growth in the hippocampus. II. Hormone replacement." Exp Neurol 118(1): 47-
52.

Nathan, B. P., A. G. Barsukova, et al. (2004). "Estrogen facilitates neurite extension via
apolipoprotein E in cultured adult mouse cortical neurons." Endocrinology 145(7): 3065-
3073.

Neubauer, H., G. Adam, et al. (2009). "Membrane-initiated effects of progesterone on
proliferation and activation of VEGF in breast cancer cells." Climacteric 12(3): 230-239.

Neugebauer, K. M., K. J. Tomaselli, et al. (1988). "N-cadherin, NCAM, and integrins
promote retinal neurite outgrowth on astrocytes in vitro." J Cell Biol 107(3): 1177-1187.

Paganini-Hill, A. and V. W. Henderson (1994). "Estrogen deficiency and risk of
Alzheimer's disease in women." Am J Epidemiol 140(3): 256-261.

Paolicelli, R. C., G. Bolasco, et al. (2011). "Synaptic pruning by microglia is necessary
for normal brain development." Science 333(6048): 1456-1458.

Park, O. K. and K. E. Mayo (1991). "Transient expression of progesterone receptor
messenger RNA in ovarian granulosa cells after the preovulatory luteinizing hormone
surge." Mol Endocrinol 5(7): 967-978.

Peluso, J. J. (2011). "Progesterone signaling mediated through progesterone receptor
membrane component-1 in ovarian cells with special emphasis on ovarian cancer."
Steroids 76(9): 903-909.

106
Peluso, J. J., X. Liu, et al. (2009). "Progesterone activates a progesterone receptor
membrane component 1-dependent mechanism that promotes human granulosa/luteal cell
survival but not progesterone secretion." J Clin Endocrinol Metab 94(7): 2644-2649.

Peluso, J. J., X. Liu, et al. (2010). "Progesterone inhibits apoptosis in part by PGRMC1-
regulated gene expression." Mol Cell Endocrinol 320(1-2): 153-161.

Peluso, J. J., X. Liu, et al. (2008). "Regulation of ovarian cancer cell viability and
sensitivity to cisplatin by progesterone receptor membrane component-1." J Clin
Endocrinol Metab 93(5): 1592-1599.

Peluso, J. J., J. Romak, et al. (2008). "Progesterone receptor membrane component-1
(PGRMC1) is the mediator of progesterone's antiapoptotic action in spontaneously
immortalized granulosa cells as revealed by PGRMC1 small interfering ribonucleic acid
treatment and functional analysis of PGRMC1 mutations." Endocrinology 149(2): 534-
543.

Pettus, E. H., D. W. Wright, et al. (2005). "Progesterone treatment inhibits the
inflammatory agents that accompany traumatic brain injury." Brain Res 1049(1): 112-
119.

Petz, L. N. and A. M. Nardulli (2000). "Sp1 binding sites and an estrogen response
element half-site are involved in regulation of the human progesterone receptor A
promoter." Mol Endocrinol 14(7): 972-985.

Petz, L. N., Y. S. Ziegler, et al. (2004). "Differential regulation of the human
progesterone receptor gene through an estrogen response element half site and Sp1 sites."
J Steroid Biochem Mol Biol 88(2): 113-122.

Pichon, M. F. and E. Milgrom (1977). "Characterization and assay of progesterone
receptor in human mammary carcinoma." Cancer Res 37(2): 464-471.

Practice Committee of American Society for Reproductive, M. (2008). "Estrogen and
progestogen therapy in postmenopausal women." Fertil Steril 90(5 Suppl): S88-102.

Quadros, P. S., J. L. Pfau, et al. (2007). "Distribution of progesterone receptor
immunoreactivity in the fetal and neonatal rat forebrain." J Comp Neurol 504(1): 42-56.

Raaijmakers, H. C., J. E. Versteegh, et al. (2009). "The X-ray structure of RU486 bound
to the progesterone receptor in a destabilized agonistic conformation." J Biol Chem
284(29): 19572-19579.

107
Rapp, S. R., M. A. Espeland, et al. (2003). "Effect of estrogen plus progestin on global
cognitive function in postmenopausal women: the Women's Health Initiative Memory
Study: a randomized controlled trial." JAMA 289(20): 2663-2672.

Rohe, H. J., I. S. Ahmed, et al. (2009). "PGRMC1 (progesterone receptor membrane
component 1): a targetable protein with multiple functions in steroid signaling, P450
activation and drug binding." Pharmacol Ther 121(1): 14-19.

Roof, R. L., S. W. Hoffman, et al. (1997). "Progesterone protects against lipid
peroxidation following traumatic brain injury in rats." Mol Chem Neuropathol 31(1): 1-
11.

Rosario, G., G. Sachdeva, et al. (2003). "Role of progesterone in structural and
biochemical remodeling of endometrium." Front Biosci 8: s924-935.

Rossouw, J. E., G. L. Anderson, et al. (2002). "Risks and benefits of estrogen plus
progestin in healthy postmenopausal women: principal results From the Women's Health
Initiative randomized controlled trial." JAMA 288(3): 321-333.

Rozovsky, I., M. Wei, et al. (2002). "Estradiol (E2) enhances neurite outgrowth by
repressing glial fibrillary acidic protein expression and reorganizing laminin."
Endocrinology 143(2): 636-646.

Runko, E. and Z. Kaprielian (2004). "Caenorhabditis elegans VEM-1, a novel membrane
protein, regulates the guidance of ventral nerve cord-associated axons." J Neurosci
24(41): 9015-9026.

Runko, E., C. Wideman, et al. (1999). "Cloning and expression of VEMA: a novel
ventral midline antigen in the rat CNS." Mol Cell Neurosci 14(6): 428-443.

Rusa, R., N. J. Alkayed, et al. (1999). "17beta-estradiol reduces stroke injury in estrogen-
deficient female animals." Stroke 30(8): 1665-1670.

Sakamoto, H., K. Ukena, et al. (2004). "Expression and localization of 25-Dx, a
membrane-associated putative progesterone-binding protein, in the developing Purkinje
cell." Neuroscience 126(2): 325-334.

Selmin, O., G. W. Lucier, et al. (1996). "Isolation and characterization of a novel gene
induced by 2,3,7,8-tetrachlorodibenzo-p-dioxin in rat liver." Carcinogenesis 17(12):
2609-2615.

Shear, D. A., R. Galani, et al. (2002). "Progesterone protects against necrotic damage and
behavioral abnormalities caused by traumatic brain injury." Exp Neurol 178(1): 59-67.

108
Sherwin, B. B. (2009). "Estrogen therapy: is time of initiation critical for
neuroprotection?" Nat Rev Endocrinol 5(11): 620-627.

Shughrue, P. J., M. V. Lane, et al. (1997). "Comparative distribution of estrogen
receptor-alpha and -beta mRNA in the rat central nervous system." J Comp Neurol
388(4): 507-525.

Shumaker, S. A., C. Legault, et al. (2004). "Conjugated equine estrogens and incidence of
probable dementia and mild cognitive impairment in postmenopausal women: Women's
Health Initiative Memory Study." JAMA 291(24): 2947-2958.

Shumaker, S. A., C. Legault, et al. (2003). "Estrogen plus progestin and the incidence of
dementia and mild cognitive impairment in postmenopausal women: the Women's Health
Initiative Memory Study: a randomized controlled trial." JAMA 289(20): 2651-2662.

Sierra, A., A. Gottfried-Blackmore, et al. (2008). "Steroid hormone receptor expression
and function in microglia." Glia 56(6): 659-674.

Simonian, N. A. and B. T. Hyman (1995). "Functional alterations in neural circuits in
Alzheimer's disease." Neurobiol Aging 16(3): 305-309.

Singer, C. A., X. A. Figueroa-Masot, et al. (1999). "The mitogen-activated protein kinase
pathway mediates estrogen neuroprotection after glutamate toxicity in primary cortical
neurons." J Neurosci 19(7): 2455-2463.

Skafar, D. F. (1991). "Differences in the binding mechanism of RU486 and progesterone
to the progesterone receptor." Biochemistry 30(45): 10829-10832.

Smith-Thomas, L. C., J. Fok-Seang, et al. (1994). "An inhibitor of neurite outgrowth
produced by astrocytes." J Cell Sci 107 ( Pt 6): 1687-1695.

Smith-Thomas, L. C., J. Stevens, et al. (1995). "Increased axon regeneration in astrocytes
grown in the presence of proteoglycan synthesis inhibitors." J Cell Sci 108 ( Pt 3): 1307-
1315.

Smith, J. A., A. Das, et al. (2011). "Estrogen or estrogen receptor agonist inhibits
lipopolysaccharide induced microglial activation and death." Neurochem Res 36(9):
1587-1593.

Snyder, J. S., J. S. Choe, et al. (2009). "Adult-born hippocampal neurons are more
numerous, faster maturing, and more involved in behavior in rats than in mice." J
Neurosci 29(46): 14484-14495.

109
Solum, D. T. and R. J. Handa (2001). "Localization of estrogen receptor alpha (ER alpha)
in pyramidal neurons of the developing rat hippocampus." Brain Res Dev Brain Res
128(2): 165-175.

Steyn, F. J., G. M. Anderson, et al. (2007). "Expression of ovarian steroid hormone
receptors in tuberoinfundibular dopaminergic neurones during pregnancy and lactation."
J Neuroendocrinol 19(10): 788-793.

Stone, D. J., I. Rozovsky, et al. (1998). "Increased synaptic sprouting in response to
estrogen via an apolipoprotein E-dependent mechanism: implications for Alzheimer's
disease." J Neurosci 18(9): 3180-3185.

Takahashi, K., S. Piao, et al. (2011). "Estrogen induces neurite outgrowth via Rho family
GTPases in neuroblastoma cells." Mol Cell Neurosci 48(3): 217-224.

Tanapat, P., N. B. Hastings, et al. (2005). "Ovarian steroids influence cell proliferation in
the dentate gyrus of the adult female rat in a dose- and time-dependent manner." J Comp
Neurol 481(3): 252-265.

Thomas, P. (2008). "Characteristics of membrane progestin receptor alpha (mPRalpha)
and progesterone membrane receptor component 1 (PGMRC1) and their roles in
mediating rapid progestin actions." Front Neuroendocrinol 29(2): 292-312.

Turgeon, J. L., S. M. Van Patten, et al. (1999). "Steroid regulation of progesterone
receptor expression in cultured rat gonadotropes." Endocrinology 140(5): 2318-2325.

Ueki, A., C. Miwa, et al. (1997). "Synapse alteration in hippocampal CA3 field following
entorhinal cortex lesion." J Neurol Sci 151(1): 1-5.

Walton, N. M., B. M. Sutter, et al. (2006). "Microglia instruct subventricular zone
neurogenesis." Glia 54(8): 815-825.

Wang, J. M., C. Singh, et al. (2010). "Allopregnanolone reverses neurogenic and
cognitive deficits in mouse model of Alzheimer's disease." Proc Natl Acad Sci U S A
107(14): 6498-6503.

Waters, E. M., A. Torres-Reveron, et al. (2008). "Ultrastructural localization of
extranuclear progestin receptors in the rat hippocampal formation." J Comp Neurol
511(1): 34-46.

West, M. J., P. D. Coleman, et al. (1994). "Differences in the pattern of hippocampal
neuronal loss in normal ageing and Alzheimer's disease." Lancet 344(8925): 769-772.

110
Wharton, W., L. D. Baker, et al. (2011). "Short-term hormone therapy with transdermal
estradiol improves cognition for postmenopausal women with Alzheimer's disease:
results of a randomized controlled trial." J Alzheimers Dis 26(3): 495-505.

Wise, P. M. and D. B. Dubal (2000). "Estradiol protects against ischemic brain injury in
middle-aged rats." Biol Reprod 63(4): 982-985.

Wong, A. M., I. Rozovsky, et al. (2009). "Progesterone influence on neurite outgrowth
involves microglia." Endocrinology 150(1): 324-332.

Woolley, C. S. and B. S. McEwen (1992). "Estradiol mediates fluctuation in hippocampal
synapse density during the estrous cycle in the adult rat." J Neurosci 12(7): 2549-2554.

Woolley, C. S. and B. S. McEwen (1993). "Roles of estradiol and progesterone in
regulation of hippocampal dendritic spine density during the estrous cycle in the rat." J
Comp Neurol 336(2): 293-306.

Zhang, Z., R. Yang, et al. (2010). "Progesterone promotes the survival of newborn
neurons in the dentate gyrus of adult male mice." Hippocampus 20(3): 402-412.

Zhu, Y., J. Bond, et al. (2003). "Identification, classification, and partial characterization
of genes in humans and other vertebrates homologous to a fish membrane progestin
receptor." Proc Natl Acad Sci U S A 100(5): 2237-2242.

Zhu, Y., C. D. Rice, et al. (2003). "Cloning, expression, and characterization of a
membrane progestin receptor and evidence it is an intermediary in meiotic maturation of
fish oocytes." Proc Natl Acad Sci U S A 100(5): 2231-2236.

Zwain, I. H. and S. S. Yen (1999). "Neurosteroidogenesis in astrocytes, oligodendrocytes,
and neurons of cerebral cortex of rat brain." Endocrinology 140(8): 3843-3852.

Abstract (if available)

Abstract Estrogen (E2) and progesterone (P4) regulate synaptic plasticity in the adult rat hippocampus during the normal rat estrous cycle and in response to deafferenting lesions. E2 increases neurite sprouting, whereas P4 antagonizes the E2-induced neurite outgrowth. Moreover, in the in vitro wounding-in-a-dish lesion model with glia-neuron co-cultures, E2 increases neurite outgrowth and P4 antagonizes the E2-induced neurite outgrowth. However, the P4-E2 antagonism of neurite outgrowth was only seen in the presence of microglia. The receptors involved in the P4 responses to neurite outgrowth are not well understood. Two progesterone mediators, Pgrmc1 and Pgr are studied in this thesis. ❧ Both Pgrmc1 and Pgr are expressed in the CA1, CA3 and DG hippocampal neurons, although their expression patterns differ between the neuronal subtypes. Both Pgrmc1 and Pgr are also regulated by E2 and P4 in the hippocampal neurons. Pgrmc1 mRNA is upregulated by both E2 and P4 in CA1, CA3 and DG neurons, while Pgr is hormonally regulated in CA1 neurons only. The differential expression and regulation of Pgrmc1 and Pgr in different hippocampal neurons could be due to possible different functions mediated by each in the different neurons. Pgrmc1 and Pgr are also expressed in glia. While both are expressed in astrocytes, only Pgrmc1 is expressed in microglia. ❧ Using a new microglia add-back protocol, microglia are shown to be required for P4-E2 antagonism of neurite outgrowth. However, physical contact between microglia and neurons is not required for the P4 antagonism, and soluble factors from activated microglia suffice to restore P4-E2 antagonism. Moreover, Pgrmc1 expression in microglia is required for the P4-E2 antagonism of neurite outgrowth. ❧ These findings together provide evidence of a P4 mediator in microglia with novel roles in P4 regulation of neurite outgrowth and in regulation of microglial activation. Understanding the mechanisms involved in P4-E2 regulation of synaptic plasticity is important in optimization of postmenopausal hormone therapy and in the therapeutic use of P4 for traumatic brain injury.

Linked assets

University of Southern California Dissertations and Theses

Conceptually similar

PDF

Glial support of neurite outgrowth: effects of aging and estrogen

PDF

Effects of age-related glial activation on neurite outgrowth

PDF

Estrogen, progesterone and BDNF interactions: roles in neuroprotection

PDF

Estrogen and progesterone interaction on synaptic transmission and LTP in rodent hippocampus

PDF

Non-apoptotic involvement of caspases in astrogliosis

PDF

Neuroinflammatory effects of urban traffic-derived nanoparticulate matter on neural systems

PDF

Estrogen and progesterone interactions in neurons: implications for Alzheimer's disease-related pathways

PDF

Estrogen and progesterone-based hormone therapy and the development of Alzheimer's disease

PDF

The role of RhoGEFs in glutamatergic synapse development and human cognitive disorders

PDF

Brain-derived neurotrophic factor (BDNF)-dependent activation of calpain: involvement of ERK pathway and regulation of AMPA receptor function and stability

PDF

Chorion gene amplification in Drosophila melanogaster

PDF

An orchestra of glutamate receptors and transporters in synaptic transmission, plasticity and excitotoxicity

PDF

Ethanol induced modulation of microglial P2X7 receptor expression and its role in neuroinflammation

PDF

The role of glial cells in spinal muscular atrophy

PDF

Uncovering cell type-specific roles of proteins involved in glutamatergic synapse regulation

PDF

Role of purinergic P2X4 receptors in regulation of dopamine homeostasis in the basal ganglia and associated behaviors

PDF

Characterizing the physiological roles and regulatory mechanisms of Maf1

PDF

The role of estrogen receptors and nociceptive signaling pathway of primary sensory neurons

PDF

Genetic manipulation of receptor interacting protein (RIP140) uncovers its critical role in the regulation of metabolism, gene expression and insulin signaling in skeletal muscle cells

PDF

Studies of Sir2 and caloric restriction mimetic pathways in aging

Asset Metadata

Creator Bali, Namrata (author)

Core Title Progesterone receptors in the rat brain and their role in steroidal regulation of neurite outgrowth

School College of Letters, Arts and Sciences

Degree Doctor of Philosophy

Degree Program Molecular Biology

Publication Date 06/20/2012

Defense Date 06/04/2012

Publisher University of Southern California (original), University of Southern California. Libraries (digital)

Tag microglia,neurite outgrowth,OAI-PMH Harvest,Pgrmc1,progesterone,progesterone receptor

Language English

Contributor Electronically uploaded by the author (provenance)

Advisor Finch, Caleb E. (committee chair), Schauwecker, P. Elyse (committee member), Tower, John G. (committee member)

Creator Email nbali.usc.ca@gmail.com,nbali@usc.edu

Permanent Link (DOI) https://doi.org/10.25549/usctheses-c3-46403

Unique identifier UC11289293

Identifier usctheses-c3-46403 (legacy record id)

Legacy Identifier etd-BaliNamrat-895.pdf

Dmrecord 46403

Document Type Dissertation

Rights Bali, Namrata

Type texts

Source University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Access Conditions The author retains rights to his/her dissertation, thesis or other graduate work according to U.S. copyright law. Electronic access is being provided by the USC Libraries in agreement with the a...

Repository Name University of Southern California Digital Library

Repository Location USC Digital Library, University of Southern California, University Park Campus MC 2810, 3434 South Grand Avenue, 2nd Floor, Los Angeles, California 90089-2810, USA