University of Southern California Dissertations and Theses

Alcohol mediated expression of cyto-protective enzyme - NQO-1 and its post translational regulation

(USC Thesis Other)

Alcohol mediated expression of cyto-protective enzyme - NQO-1 and its post translational regulation

PDF

Download a page range

Download transcript

Copy asset link

Request this asset

Transcript (if available)

Content
ALCOHOL MEDIATED EXPRESSION OF
CYTOPROTECTIVE ENZYME - NQO-1
AND ITS POST TRANSLATIONAL REGULATION

by

Monisha Ravichandran

A Thesis Presented to the
FACULTY OF THE USC GRADUATE SCHOOL
UNIVERSITY OF SOUTHERN CALIFORNIA
In Partial Fulfillment of the
Requirements for the Degree
MASTER OF SCIENCE
(BIOCHEMISTRY AND MOLECULAR BIOLOGY)

August 2012

Copyright 2012 Monisha Ravichandran

ii

ACKNOWLEDGEMENTS
First of all, I would like to show my sincere gratitude to Dr. Vijay Kalra, my mentor and thesis
committee chair whose guidance and support helped me throughout my thesis. His immense
support and constant encouragement made me move forward. I would like to thank Dr.Stanley
Tahara for his valuable suggestions and help during my tough times. I would like to extend my
deepest gratitude for Dr. Zoltan Tokes for his immense support throughout my Masters program.
I would like to thank all my labmates - Vicky Yamamoto, Jo Lee, Chen Li, and Evelyn Tran for
their help and support throughout my stay in the lab. I am very much thankful to postdocs Murali
and, Jagadeesh for their valuable suggestions. I would like to thank my friends- Deepthi, Mohit,
Namrata, Deepa, Aparna, and Pradeep for their help and support.
Finally I am extremely thankful to my parents, Ravichandran and Santhakumari Ravichandran,
for their extreme love and support throughout my life. Last but not the least, I would like to
thank my brother Sudharsan Ravichandran for his love and support throughout my good and bad
times.

iii

TABLE OF CONTENTS
Acknowledgements ii
List of Tables v
List of Figures vi
Abstracts vii
Chapter 1: Introduction
1.1 Ethanol mediated liver damage 1
1.2 Metabolism of alcohol in liver 2
1.3 Cell-types in liver, which mediate metabolism of alcohol 4
1.4 Cytoprotective enzymes in prevention of oxidant-stress induced by
consumption of alcohol. 5
1.4.1 NADH-Quinone Oxidoreductase-1 5
1.4.2 Role of Nrf-2, a transcription factor, in mediating anti-oxidant response 5
1.5. MicroRNA 8
1.5.1. Role of miRNAs in post-transcriptional regulation in the
expression of mRNA and protein translation. 8
1.5.2. Biogenesis of microRNA 8
1.5.3. Transcription of miRNAs 9
1.5.4. Nuclear Processing 9
1.5.5. Nuclear export of pre-miRNA 10
1.5.6. Processing of Pre-miRNA in the cytoplasm 11
1.5.7. RISC complex 11
1.5.8. miRNA role in disease and as biomarkers 11
Chapter 2: Hypothesis and Aims
2.1. Hypothesis 13
2.2. Approach 13
Chapter 3: Materials and Methods
3. 1. Endothelial Cell culture 15
3.2. Reagents 16

iv

3.3. RNA isolation and qRT-PCR 16
3.4. Isolation and quantification of microRNAs (miRNAs) 18
3.5. Identification of miRNAs 22
3.6. Transient Transfection of HMEC-1 cells with miRs and anti-miRs 22
3.7 Transient Transfection of HMEC-1 with 3’UTR Luciferase reporter
construct of NQO-1 24
3.8. Luciferase Assay 25
3.9. Preparation of whole cell lysate for western blot 25
3.10. Statistical analysis 26
Chapter 4: Results
4.1. Ethanol increases NQO-1 mRNA expression in human endothelial
cells (HMEC-1) 27
4.2. Does ethanol affect the stability of mRNA 30
4.3. Identification of miRNAs involved in alcohol-mediated
NQO-1 and Nrf-2 mRNA stabilization 33
4.4. Role of miR-518, miR-566 and miR-642 in regulation
of NQO-1 mRNA expression 38
Chapter 5: Discussion
5.1. Discussion 43
5.2. Conclusion 44
5.3. Future Work 46
Bibliography 48

v

LIST OF TABLES
TABLE 1: Composition of Complete Media 15
TABLE 2: qRT-PCR amplification conditions 17
TABLE 3: Components of Master Mix for 10µl of RT-PCR reaction mixture 17
TABLE 4: Oligonucleotide sequence for Primers used in RT-PCR 18
TABLE 5: Components for Reverse transcription of the miRNA 20
TABLE 6: Conditions for Reverse transcription of miRNA 20
TABLE 7: Components for quantitative PCR amplification 21
TABLE 8: Conditions for quantitative PCR amplification ofcDNA 21
TABLE 9: Oligonucleotide sequence for the miRNAs specific for NQO-1,
used for transfection 23
TABLE 10: Oligonucleotide sequence for miRNA specific for Nrf-2,
Keap-1 and Bach-1 used for transfection 24

vi

LIST OF FIGURES
FIGURE 1: Stages of alcohol mediated liver disease 1
FIGURE 2: Metabolism of ethanol 3
FIGURE 3: Nrf2 and Keap-1 mediated NQO-1 regulation 7
FIGURE 4: Biogenesis of miRNA 10
FIGURE 5: Relative level of NQO-1, Nrf-2, Keap-1 and Bach-1
mRNA in response to Ethanol 29
FIGURE 6: Stability analysis for relative levels of NQO-1 mRNA 31
FIGURE 7: Stability analysis for relative levels of Nrf-2, Keap-1 and Bach-1 32
FIGURE 8: Candidate miRNAs at 3’UTR of NQO-1, Nrf-2, Keap-1 and Bach-1 34
FIGURE 9: Relative levels of NQO-1 specific candidate miRNAs (518,566 and 642) 35
FIGURE 10: Relative levels of Nrf- 2 candidate miRNAs 36
FIGURE 11: Relative levels of Keap-1 candidate miRNAs 37
FIGURE 12: Relative levels of Bach-1 candidate miRNAs 38
FIGURE 13: Effect of miRs and anti-miRs transfection on NQO-1 mRNA levels
under basal conditions (A and B) and ethanol- treated conditions (C and D) 39

FIGURE 14: Effect of miRs and anti-miRs transfection on Keap-1 mRNA
levels under basal conditions (A) and ethanol- treated conditions (B) 41

vii

ABSTRACT
Chronic alcohol consumption leads to liver injury and death. Studies have shown ethanol causes
increased inflammation, which leads to liver damage and cirrhosis. To counteract this
inflammatory response, cells up-regulate antioxidant response genes, e.g. hemeoxygenase-1(HO-
1) and NADH-quinone oxidoreductase-1(NQO-1). These cytoprotective genes are regulated by a
central transcription factor, Nrf-2. Previous studies show ethanol induced mRNA levels of both
HO-1 and NQO-1 in Kupffer cells involve activation of Nrf-2. In the present study, we examined
whether ethanol affected the stability of NQO-1 mRNA, and transcription factors, i.e. Nrf-2
mRNA and Keap-1 mRNA, in endothelial cells. Our studies showed that ethanol increased the
net expression of NQO-1, Nrf-2 and Keap-1 mRNAs in human endothelial cells (HMEC-1) in a
time-dependent manner. Moreover, ethanol increased the stability of NQO-1 mRNA and Nrf-2
mRNA, while the Keap-1 mRNA was destabilized. Thus, we examined the role of microRNAs
in the post-transcriptional regulation of NQO-1mRNA and Keap-1 mRNA.
Our studies showed that both miR-566 and miR-518 attenuate the NQO-1 mRNA levels under
basal and ethanol-treated conditions, as determined by transfection of HMEC-1 cells with miRs
(synthetic mimics) and anti-miRs. We identified miR-200a as a potential candidate miRNA,
which affects the Keap-1 mRNA expression. These studies for the first time, to the best of my
knowledge, identify specific miRNAs, which may be involved in binding to the 3’UTR of NQO-
1 mRNA and the 3’UTR of Keap-1 mRNA. These miRNAs may play an important role in
affecting expression of cyto-protective genes and inflammation as observed in chronic alcoholic
individuals.

1

CHAPTER 1
INTRODUCTION
1.1. Ethanol mediated liver damage
Long term consumption of alcohol leads to liver disease, specifically liver failure and death.
About 100,000 persons die each year from chronic alcohol consumption, making it the third
leading cause of death behind cigarette smoking and diabetes in the United States; thus
alcoholism is a serious health problem. The stages of alcohol-mediated liver disease are steatosis
(fatty liver), steatohepatitis (inflammation), cirrohosis, hepatitis and hepatocellular carcinoma
(Figure 1) (8, 30). In humans, more than 90% of consumed alcohol is metabolized through liver.

Figure 1: Stages of alcohol mediated liver disease

2

1.2. Metabolism of alcohol in liver
Ethanol undergoes metabolism by alcohol dehydrogenase (ADH) in the cytosol of the cell andby
cytochrome P450 (CYP2E1) in the smooth endoplasmic reticulum and peroxisomes. The
metabolism of alcohol by the ADH pathway in the cytosol of liver cells is the predominant
pathway for alcohol catabolism. There are three main ADH iso-enzymes in humans. Alcohol
dehydrogenase-1 (ADH-1), expressed in the liver has a low Km for ethanol (Km<5mM) (6), thus
playing a major role in the metabolism of ethanol in liver. ADH-2 is found in the liver, but has a
higher Km for ethanol (5-10 mM). Studies have shown that in the livers of alcoholics, ADH-3
activity increases as the total intake of ethanol increases, while ADH-1 activity decreases,
suggesting a possible role of ADH-3 in alcohol metabolism in vivo (49). Alcohol is metabolized
by alcohol dehydrogenase (ADH) to acetaldehyde by NAD
+
-dependent enzyme, yielding NADH
as illustrated in Figure 2. The acetaldehyde produced in the cytosol of hepatocytes is transported
across the inner mitochondrial membrane into the mitochondrial matrix for oxidation by
acetaldehyde dehydrogenase (ALDH) (7). Such a reaction yields, acetate and NADH as
illustrated in Figure 2. The NADH generated in the mitochondrion is utilized by the electron
transport chain to generate energy (ATP).As a result of excessive alcohol consumption, NADH
generated in the cytosol converts pyruvate to lactate, which contributes to lactic acidosis
(14).Moreover, due to lack of NAD
+
in the cytosol, lactate cannot be converted to glucose via
gluconeogenesis. Thus an alcoholic, without consuming food, will become hypoglycemic, due to
lack of gluconeogenesis, and develops lactic acidosis leading to coma and death.

3

ADH
CH
3
CH
2
OH+ NAD
+
CH
3
CHO + NADH + H
+
(I)
ALDH
CH
3
CHO + NAD
+
+ H
2
O CH
3
COO
-
+ NADH +2H
+
(II)
LDH (Lactate Dehydrogenase)
Pyruvate + NADH Lactate + NAD
+
(III)
Figure 2: Metabolism of ethanol
Acetaldehyde is converted to acetate by aldehyde dehydrogenase (ALDH). Acetate, released
from the liver into the blood stream is taken up by muscle and heart for energy production via the
TCA cycle. The rate at which ethanol is metabolized by ADH and ALDH is critical in
determining whether toxicity develops, as the intermediates in these pathways (8, 45), e.g.
acetaldehyde, are cytotoxic.
Only 2-10% of ethanol can be eliminated by kidney, lungs or other organs. The remainder up to
90% of ethanol is oxidized in the liver (41). The preferential uptake of ethanol by the liver along
with the high energy content and lack of feedback control for its catabolism leads to a decrease
in overall detoxification and metabolism of other toxic substances normally taken up by the liver,
thus resulting in tissue damage and cirrhosis (30, 44).

4

1.3. Cell-types in liver, which mediate metabolism of alcohol
The major cell types of the liver are:
a) Parenchymal cells – i.e. hepatocytes, the major constituent cell types of liver (80% by
volume and 60% by number)
b) Non-Parenchymal cells (6.5% by volume and 40% by number):
(i) Sinusoidal endothelial cells – Lines the hepatic sinusoid
(ii) Kupffer cells – Lines the hepatic sinusoid
(iii) Hepatic Stellate cells – Lines the hepatic sinusoid
The blood vessels to the liver include the hepatic arteries and hepatic portal veins the former of
which supplies almost the entire oxygen requirement of the liver.
All of these cells are affected by ethanol or its metabolite, acetaldehyde, leading to liver
dysfunction (12, 27). Studies have shown that feeding alcohol to rats results in increased
accumulation of PMNs (polymorphonuclear leukocytes) in the liver as a result of transmigration
of these cells from blood through liver sinusoidal endothelial cell junctions. Accumulation of
neutrophils in the liver is the hallmark feature of alcoholic hepatitis. Other studies have also
shown that ethanol increases permeability of gut to endotoxins derived from Gram-negative
bacteria (13). Endotoxins (LPS) activate Kupffer cells in the liver (13, 50) to generate reactive
oxygen species (ROS) and the inflammatory mediator TNF-α, by the action of NADPH-oxidase.
The role of NADPH-oxidase in TNF-α production has been validated in ethanol fed mice using
NADPH-oxidase (p
47phox
, a subunit of NADPH-oxidase enzyme) knockout mice (26).

5

1.4. Role of cytoprotective enzymes in prevention of oxidant-stress induced by alcohol
consumption
To overcome oxidative stress, mammalian cells have evolved anti-oxidant defense mechanisms.
Specifically, the expression of enzymes, such as hemeoxygenase-1, NADH-quinone
oxidoreductase-1 (NQO-1) and gamma glutamyl cysteine lyase (GCLc) has been shown to
increase in response to oxidative-stress (35). The role of HO-1 in an antioxidant response and its
anti-inflammatory effect has been shown both in vitro and in HO-1 knockout mice (23).
1.4.1. NADH-Quinone Oxidoreductase-1
NQO-1, a 273 amino acid, cytosolic flavoenzyme, is one of the major cytoprotective enzymes in
the phase II detoxification pathway. NQO-1 is widely expressed in almost all endothelial (39)
and epithelial tissues as well as in a variety of tumor tissues (40). The most important function of
NQO-1 is to prevent one electron reduction of quinones and detoxify the latter to form stable
hydroquinones (can be excreted upon conjugation with glutathione and UDP glucuronic acid) by
two-electron reduction (37). One-electron reduction of quinones leads to generation of reactive
oxygen species and free radicals that are toxic to the body (16).
1.4.2 Role of Nrf2, a transcription factor, in mediating the anti-oxidant response
The expression of these enzymes (HO-1 and NQO-1) and other cytoprotective enzymes has been
shown to be regulated by nuclear erythroid 2-related factor (Nrf-2),which binds the anti-oxidant
response element (ARE) in the promoters of anti-oxidant response genes (e.g. HO-1 and NQO-
1), thus resulting in the induction of these genes (22, 33, 36). Nrf-2 is bound to the repressor
Keap1 in the cytosol of the cell. Under steady state or basal conditions, Nrf-2 is constantly
degraded by ubiquitination of Nrf-2, mediated by E3 ligase and proteasomal degradation (2, 10)

6

as illustrated in Figure3. In response to oxidative stress, i.e. ROS, cysteine residues in Keap-1
undergo oxidation to form disulfide linkage (-S-S), consequently Keap-1 becomes inactive and is
no longer able to associate with Nrf-2 (36).This results in translocation of Nrf-2 into the nucleus,
where it heterodimerizes with Maf(s) protein to bind AREs in the promoters of ARE–responsive
genes (Phase II genes, i.e., HO-1 and NQO-1) (21). Once inside the nucleus, Nrf-2 and Bach-1
competes to bind to ARE genes (HO-1 and NQO-1). However it was shown that the recruitment
of Bach-1 into the nucleus is delayed (11) under oxidative stress induced conditions over that of
Nrf-2 leading to a balance in Nrf-2 mediated induction of NQO-1 and HO-1.
The role of Nrf-2 in the regulation of ARE genes like NQO-1, HO-1, etc., has been validated in
vivo using Nrf-2 knockout mice (28). Recent studies from our laboratory show that ethanol-
mediated induction of HO-1 and NQO-1 in Kupffer cells and monocytes is transcriptionally
regulated by Nrf-2 (47, 48). However, HO-1 mRNA expression, but not NQO-1 mRNA
expression, involves activation by both HIF-1α and Nrf-2 (46, 48).However, relatively little is
understood how these co-regulators (Keap-1 andBach-1) of Nrf-2, and cytoprotective genes e.g.
NQO-1 are post-transcriptionally regulated. Studies have shown that microRNAs play an
important role in post-transcriptional regulation of mRNA of genes (5).

7

Figure 3: Nrf-2 and Keap-1 mediated NQO-1 regulation

8

1.5. MicroRNA
MicroRNAs are short, single stranded RNA molecules found in eukaryotic organisms,
accounting for about 1% of the genome (25). The human genome expresses approximately 1000
microRNA transcripts, which regulates over one-third of gene transcripts. These 19-22
nucleotide sequences are generated by the cleavage of endogenous hairpin shaped transcripts
(25) (Figure 4).
1.5.1. Role of miRNAs in post-transcriptional regulation in the expression of mRNA and
protein translation
The biological role of microRNAs is to regulate messenger RNA transcripts by binding to
complementary sequences. Most microRNAs repress transcription and translation, but there are
certain microRNAs which also mediate activation of transcription and translation (31). Some of
their regulatory functions include control of developmental timing, hematopoietic cell
differentiation, apoptosis, cell proliferation and organ development. Different types of
microRNAs are expressed in different tissues, and altered expression of microRNAs is
characteristic for many diseases (31).
1.5.2. Biogenesis of microRNA
The formation or biogenesis of microRNAs involves nuclear and cytoplasmic processing
catalyzed by RNase III-like endonucleases. Most characterized microRNAs are found in between
genes and transcribed as independent units or with host genome and undergoes coupled
regulation with the protein coding genes (25).The mature miRNA may not be a direct copy of the
template DNA, they may undergo site specific modification called RNA editing to create a
different miRNA sequence. The biogenesis of microRNA involves four different steps (25):

9

1. Transcription
2. Nuclear Processing
3. Nuclear export
4. Cytoplasmic export
1.5.3. Transcription of miRNAs
Transcription of microRNA is mediated by RNA polymerase II. The polymerase binds to the
DNA sequence encoding that of the hairpin loop of the pre-miRNA (Figure 4). The resulting pri-
miRNA is capped and poly adenylated. The pri-miRNA may or may not be spliced. Generally
the microRNAs are transcribed as a 70-80 nucleotide pre-miRNA which is a part of pri-miRNA
(~ 100s of nucleotides long) (25).Some miRNAs are transcribed by RNA polymerase III (4).
1.5.4. Nuclear Processing
Nuclear processing of miRNAs involves formation of pre-miRNA (60-70 nucleotides). The
enzymes involved in nuclear processing include Drosha and Pasha. Pasha and Drosha bind to
each other to form a Microprocessor complex. The pri-miRNA is recognized by Pasha and this
orients Drosha to cleave the pri-miRNA transcript to many small stem-loop structures with two
nucleotide overhangs (the pre-miRNAs) (Figure 4). Some pri-miRNAs undergo a process called
RNA editing catalyzed by enzymes like adenosine deaminases. This process alters the
cytoplasmic processing of miRNAs and its target specificity by modifying the seed region of the
miRNA (17).

10

Figure 4: Biogenesis of miRNA (1)
1.5.5. Nuclear export of pre-miRNA
Pre-miRNAs are highly unstable molecules which upon formation have to be transported to the
cytoplasm for further processing (Figure 4). This step is mediated by nuclear pore complexes
embedded in the nuclear membrane. The nuclear receptors bind to a cargo protein and GTP-
bound form of Ran (a cofactor) in the nucleus (32).This complex along with the microRNA is
exported by the cargo carrier protein. The cargo is then released into the cytoplasm following

11

hydrolysis of GTP to GDP. Exportin-5 is one of the major nuclear receptor proteins involved in
export of pre-miRNA (32). Exportin-5 recognizes the two nucleotide overhang as well as the 3’-
end of pre-miRNA and helps in exporting the pre-miRNA to the cytosol along with Ran-GTP
complex.
1.5.6. Processing of Pre-miRNA in the cytoplasm
An RNase III protein named Dicer mediates the cytoplasmic processing of pre-miRNA (Figure
4). Dicer binds to the 3’ end of the hairpin loop structure and cleaves the loop joining the 3’ and
5’ ends of the pre-miRNA resulting in the formation of a 22 nucleotide imperfect
miRNA:miRNA
*
duplex (19). Both the strands of the duplex are functional and either one of
these two strands of this duplex can be incorporated into the RISC complex but not both. Ago2
protein mediates selection of which strand to be incorporated into the RISC complex (40). The
guide strand is incorporated into the RISC complex and the passenger strand is degraded.
1.5.7. RISC complex
RISC, also called the RNA-induced silencing complex, contains one strand of the miRNA
duplex as well as the Argonaute protein which functions as a slicer enzyme to degrade the
mRNA transcripts (19). miRNA duplexes are not stable for long in the cells, so they are
incorporated into the RISC complex as soon as they are processed by Dicer (19).
1.5.8. miRNA role in disease and as biomarkers
Mutations or over expression or altered expression of microRNAs is associated with several
diseases like cancer (15), heart diseases and various diseases related to the nervous system (18,
20). This is because of the roles played by various miRNAs during development and maturation

12

of certain important cell types in nerve and heart tissues. The expression levels of certain
miRNAs like miR-324a, miR-185, miR-133b, miR-194, and miR-192 are used as prognostic
markers for identification of certain types of cancers (31). There are different sets of miRNAs in
different tissue types that indicates the formation of different types of tumors (15).

13

CHAPTER 2
HYPOTHESIS AND AIMS
2.1. Hypothesis
Since ethanol increases levels of NQO-1 mRNA in human microvascular endothelial cells, we
hypothesized that ethanol increases the stability of NQO-1 mRNA by altering the levels of
miRNAs that bind to the 3’UTR of NQO-1. To address this, I developed the following specific
aims:
Aim 1: To determine the stability of mRNAs for NQO-1 as well as of Nrf-2, since the latter
regulates the induction of NQO-1 mRNA.
Aim 2: To identify and functionally characterize miRNAs that bind to the 3’UTR of NQO-1 in
HMEC-1 under basal and ethanol-treatment conditions. To address this we will
(a) identify and analyze putative miRNA candidates, based on potential miRNA target sites
present in the 3’UTR of NQO-1mRNA, as predicted by bioinformatics and confirm the results
by qRT-PCR in response to ethanol treatment.
(b) transfect HMEC-1 cells with functionally identified miRs and corresponding anti-miRs, for
their effect on NQO-1 mRNA levels , with and without ethanol treatment.
2.2. Approach
In the present study the role of microRNAs in post-transcriptional regulation of mRNA of NQO-
1 was determined. First, I determined whether alcohol affected the stability of mRNA of NQO-1
mRNA in human endothelial cells. I utilized SV-40 transformed human dermal vascular

14

endothelial cell line (HMEC-1) for ease of culture and previous studies have shown that these
cell lines reproduce most of the findings observed in primary human endothelial cells. The latter
cells can only be cultured for 6-7 passages and are exorbitantly costly, so they are not suited for
routine use. Thus, I have used HMEC-1 cells as a model system for primary endothelial cells,
although data generated in this cell line must be validated in primary cultures and in vivo. I have
used bioinformatics approach to identify candidate miRNAs that bind the 3’UTR of NQO-1, Nrf-
2 and Keap-1 mRNAs. In response to alcohol treatment of HMEC-1, the levels of miR-27, miR-
33a, miR-200a, miR-323-3p, miR-518, miR-522, miR-566 and, miR-642 was reduced, while
levels of miR-193 and miR-659 were not affected. Among these miRNAs, miR-566 and miR-
642 have binding sites in the 3’-UTR of NQO-1 mRNA, while miR-522, miR-323-5p, miR-27
and miR-659 have binding sites in the 3’UTRof Nrf-2 mRNA. The roles of miR-518, miR-566
and miR-642 in regulation of the 3’UTR of mRNA of NQO-1 was investigated in detail.

15

CHAPTER 3
MATERIALS AND METHODS
3.1. Endothelial Cell Culture
An immortalized HMEC-1 (Human Dermal Micro-Vascular Endothelial Cells) cell line was
obtained from Centers for Disease control and Prevention (CDC, Atlanta) and cultured for 2 days
in the Complete Media with the following composition:

Table 1: Composition of Complete Media

S. NO Media Components
1 RPMI-1640 media

2 10% FBS

3 5mM HEPES

4 1mM Sodium Pyruvate

5 1mM Glutamine

6 MEM Vitamins

7 Growth Factors

8 Non-Essential Amino Acids(1X)

9 Heparin (20 units/ml)

10 50 µg/mL Endothelial cell mitogen

16

Prior to the start of experiments, cells were cultured in serum-free media for 2 hours. Cells
exhibited a cobble-stone morphology, characteristics of endothelial cells.
3.2. Reagents
The oligonucleotide primers for NQO-1, Nrf-2, Keap-1 and Bach-1 were purchased from
Valugene (San Diego, CA) and their sequence is shown in Table 4.The miRNA isolation kits
(MirVana) were purchased from Life Technologies (Grand Island, NY). The miRNA detection
kits were purchased from Applied Biosystems (Carlsbad, CA). Primary antibodies for β-Actin
and HRP conjugated secondary antibodies were purchased from Santa Cruz Biotechnology
(Santa Cruz, CA). The miRs and anti-miRs for NQO-1, and Nrf-2 were purchased from
Shanghai Genepharma (Shanghai, China). The Luciferase assay kit was purchased from Promega
(Sunnyvale, CA). All other Reagents were purchased from Sigma Aldrich (St. Louis, MO),
unless otherwise specified.
3.3. RNA Isolation and qRT-PCR
o The HMEC-1 cells were incubated in serum free media for 2 hours before
addition of 50mMEtOH for the specified time intervals. This was followed by
total RNA extraction using Trizol reagent (1 ml/6mm dish of cultured cells;
Invitrogen, (Carlsbad, CA).
o This was followed by addition of 200 µL of chloroform per 1 mL of Trizol. The
solution was mixed well by vortexing and centrifuged at 16000 xg for 30 minutes.
o The top aqueous layer was removed and mixed well with equal volume of
isopropanol and left at -80°C for an hour to precipitate total RNA.

17

o The contents were then centrifuged at 16000 xg for 30 minutes at 4°C. The pellet
was washed with 70% ethanol and the final pellet was dissolved in 50 µL of
DEPC treated water.
o The concentration and purity of the mRNA obtained was quantified using the
Nanodrop 8000 spectrometer (Thermo Scientific).
o Real-time PCR was performed for the quantification of specific mRNA levels
using iScript One Step RT-PCR kit with SYBR Green(Bio-Rad) utilizing the
quantitative PCR machine ABI PRISM 7900 HT sequence detection system
(Applied Biosystems, Foster City, CA).
o The qRT-PCR conditions for amplification of 100ng mRNA are as follows in
Table 2:
Steps Conditions
cDNA Synthesis 50°C for 11 minutes
iScript Reverse Transcriptase inactivation 95°C for 10 minutes
PCR amplification 95°C for 15 seconds,
60°C for 40 seconds

Table2: qRT-PCR amplification conditions
The number of cycles for PCR was set at 40 for 10 µL of RT-PCR reaction mixture (Master mix
and RNA).

Table 3: Components of Master Mix for 10µl of RT-PCR reaction mixture
Components Quantity
2X Buffer 5 µl
DEPC Water 1.8 µl
Forward Primer 1 µl
Reverse Primer 1 µl
Reverse Transcriptase 0.2 µl
RNA 1 µl

18

Relative quantification of mRNA was normalized to housekeeping GAPDH mRNA
expression in the HMEC-1 cells.

Table 4: Oligonucleotide sequence for Primers used in RT-PCR
3.4. Isolation and quantification of microRNAs(miRNAs)
mirVana miRNA isolation kits (Applied Biosystems, Foster City, CA) was used for isolation of
miRNAs from the HMEC-1 (Transformed human dermal microvascular endothelial cells).
1. Cells were treated with 50mMEtOH for specific time periods (4hrs for NQO-1; 1hr
for Nrf-2, Keap-1 and Bach-1) prior to miRNA isolation.
2. Cells were washed with PBS and lysed using 300-600 µL of Lysis/ Binding solution
and vortexed well for obtaining a homogeneous lysate.
3. 1/10
th
volume of Homogenate Additive was added to the cell lysate and mixed well
by inverting the tube several times. The mixture was incubated on ice for 10 minutes.
4. Acid chloroform- phenol was added to the cell lysate in a volume equal to that of
added lysis buffer.
5. The lysate was mixed well by vortexing and centrifuged at 12000 rpm for 5 minutes.
Organism/Gene Method Primer Sequence
Human/GAPDH RT-PCR Forward – AACCTGCCAAGTACGATGACATC
Reverse – GTAGCCCAGGATGCCCTTGA
Human/NQO-1 RT-PCR Forward – CGCAGACCTTGTGATATTCCAG
Reverse - CGTTTCTTCCATCCTTCCAGG
Human/Nrf-2 RT-PCR Forward – CAATTCAGCCAGCCCAGCAC
Reverse – CTACAAACGGGAATGTCTGCG
Human/Keap-1 RT-PCR Forward - CAACTTCGCTGAGCAGCAGATTGG
Reverse – GCAGCGCACGTTCAGGTC
Human/Bach-1 RT-PCR Forward – GTAGGCCAGGCTGATGGAG
Reverse – CACATTTGCACACTTCATCCAC

19

6. The aqueous phase was removed and transferred into a fresh tube.
7. 1/3
rd
volume of 100% Ethanol (Room temperature) was added to the aqueous phase
and mixed by vortexing.
8. The solution was then transferred onto a filter cartridge placed onto a collection tube
(up to 700 µL each time).
9. The mixture was then centrifuged at 10000 rpm for 15 seconds. The flow-through
was discarded and the cartridge was retained.
10. 700 µL of Wash buffer I was added and was centrifuged at 10000 rpm for 10 seconds.
11. 500 µL of Wash solution 2/3 was added to the filter cartridge and centrifuged for 10
seconds and the flow through was discarded. This step was repeated again.
12. After the last wash, the filter cartridge was placed in the same collection tube and
centrifuged at 10000 rpm for 1 minute.
13. The filter cartridge was then transferred onto a new collection tube and 100 µL of
pre-heated (95°C) elution buffer was added and centrifuged at 12000 rpm for 30
seconds to recover the miRNA from the cartridge.
14. The concentration and purity of miRNA isolated was quantified using Nanodrop
8000 (Thermo Scientific).
Detection and expression of miRNAs (200ng) specific for NQO-1, Nrf-2, Keap-1 and
Bach-1 was performed using the Reverse Transcription System (Promega) with the
specific miRNA primers (Applied Biosystems, Foster City, CA). Quantitative
miRNA amplification was performed using ABS7900 reverse transcription system.

20

Table 5: Components for Reverse transcription of the miRNA

Step Time Temperature
Hold 30 minutes 16°C
Hold 30 minutes 42°C
Hold 5 minutes 85°C
Hold ∞ 4°C

Table 6: Conditions for Reverse transcription of miRNA

Components Master Mix volume/15 µL reaction
100mM dNTPs (with dTTP) 0.15µL
MultiScribe Reverse Transcriptase, 50U/µL 1.00µL
10X Reverse Transcription Buffer 1.50 µL
RNase inhibitor, 20U/ µL 0.19 µL
Nuclease free- water 4.16 µL
5X RT-Primer 3.00 µL
miRNA sample 5.00 µL

21

The cDNA obtained from the Reverse transcription reaction was used to perform a
quantitative PCR amplification for detection of miRNA.

Table 7: Components for quantitative PCR amplification

Step Amp Erase UNG Activity Enzyme Activation PCR
Hold Hold Cycles (40 cycles)
Denature Anneal/Extend
Temperature 50°C 95°C 95°C 60°C
Time 2 minutes 10 minutes 15 seconds 60 seconds

Table 8: Conditions for quantitative PCR amplification of cDNA
Components Volume/20µl reaction
Taqman Small RNA assay (20X) 1.00 µL
Product from RT reaction(cDNA from the reverse transcription step) 1.33 µL
Taqman universal PCR Master Mix II (2X), no UNG 10.00 µL
Nuclease-free water 7.67 µL

22

The miRNA amplification was normalized to that of U6 snRNAamplification.
3.5. Identification of microRNAs:
To identify the miRNAs that are involved in regulating/altering the gene expression of NQO-1,
Keap-1, Nrf-2 and Bach-1, Bioinformatics approaches were used. MicroCosm, a web based
miRNA target prediction program that takes into account the complementarity, target site
accessibility and the extent of evolutionary conservation, was used to identify the potential
candidate miRNAs for the above mentioned genes. The program predicted six potential miRNA
target sites on the 3’UTR of NQO-1, seven potential miRNA target sites on the 3’UTR of Nrf-2 ,
two potential miRNA target sites on the 3’UTR of Keap-1 and nine potential miRNA target sites
on the 3’UTR of Bach-1. Based on complementarity and degree of conservation amongst
different species, we chose two miRNAs (miR-566, miR-642) for NQO-1, six miRNAs (miR-
27a, miR-193a, miR-659, miR-144, miR-323-3p, miR-522) for Nrf-2, two miRNAs (miR-144,
miR-200a) for Keap-1 and three miRNAs (miR-33a, miR144, miR-27a) for Bach-1. There were
only single predicted target sites for the miRNA on these genes as illustrated in Figure 7.
3.6. Transient Transfection of HMEC-1 cells with miRs and anti-miRs
HMEC-1s were cultured in complete media until cells were approximately 80-90% confluent.
100 µL of 10
6
cells (resuspended in serum-free media) were used for each transfection. NQO-1,
Nrf-2, Keap-1 and Bach-1 specific miRs were identified by quantitative miRNA amplification
and the corresponding anti-miRs were also used for the transfection experiments. For
transfection, the reaction mixture contained 100 µL of cells and 90 pmol of either miR or
antimiR per reaction. Nucleotransfection was performed according to manufacturer’s protocol
using program S-005 with tranfection cuvettes from Lonza (Allendale, NJ). The transfected cells

23

were plated onto 6mm dishes and left overnight. The cells were then pre-cultured in serum-free
media for 2 hours and then treated with 50mMEtOH.mRNA isolation was performed using
Trizol and gene expression was determined by qRT-
PCR. mRNA expression for the genes under study was normalized to that of the expression of
housekeeping GAPDH genes.

Table 9: Oligonucleotide sequences of the miRNAs specific for NQO-1, used for transfection

S.NO miRNA miRNA Sequence
1 miR-566 GGGCGCCUGUGAUCCCAAC

2 miR-642 GUCCCUCUCCAAAUGUGUCUUG

3 miR-518 GAAAGCGCUUCCCUUUGCUGGA

24

Table 10: Oligonucleotide sequences of the miRNAs specific for Nrf-2, Keap-1 and Bach-1
used for transfection

3.7. Transient Transfection of HMEC-1 with 3’UTR Luciferase reporter construct of
NQO-1
Co-transfection of 3’UTR-Luc constructs of NQO-1(Origene Technologies, MD) and Keap-1
with either the identified miRs or anti-miRs (90pmol) along with the transfection of control
Renilla luciferase reporter was performed according to manufacturer’s protocol using program S-
005 in the nucleo-transfector. The transfected cells were then plated onto 6mm dishes and
S.NO miRNA miRNA Sequence Target Gene
1 miR-27a AGGGCUUAGCUGCUUGUGAGCA

Nrf-2, Bach-
1
2 miR-193a AACUGGCCUACAAAGUCCCAGU

Nrf-2
3 miR-659 CUUGGUUCAGGGAGGGUCCCCA

Nrf-2
4 miR-522 CUCUAGAGGGAAGCGCUUUCUG

Nrf-2
5 miR-323-
3p
CACAUUACACGGUCGACCUCU

Nrf-2
6 miR-200a CAUCUUACCGGACAGUGCUGGA

Keap-1
7 miR-144 GGAUAUCAUCAUAUACUGUAAG

Keap-1
8 miR-33a GUGCAUUGUAGUUGCAUUGCA

Bach-1

25

cultured overnight. The cells were then pre-cultured in serum-free media for two hours prior to
start of the experiment and then treated with 50mM ethanol for 24 hours.
3.8. Luciferase Assay
After ethanol treatment, the cells were rinsed with PBS, and lysis was done using Passive lysis
buffer (Promega, Madison, WI). The dishes were then placed on a rocker for 15 minutes at room
temperature. This was followed by centrifugation for 5 minutes at 12000rpm. Supernatants
collected from the lysed cells were used for assaying luciferase as well as renilla luciferase
activity using a luminometer, Lumat LB 9501 (Berthold, Bad Wildbad, Germany). The
transfection efficiency was calculated by normalizing values of luciferase to that of the values for
renilla luciferase. Relative gene expression was calculated by using the vector (pMir Target
vector for NQO-1 and CMV promoter-Luc construct for Keap-1) as a control.
3.9. Preparation of whole cell lysate for Western Blot
HMEC-1s (5x10
6
cells) were pre-cultured in serum-free media for 2 hours and then treated with
50mMEtOH for 4hours for NQO-1 and 1 hour for Nrf-2, Keap-1 and Bach-1. Whole Cell
Lysates were prepared using RIPA (Radio Immuno-precipitation buffer) buffer.

Composition of RIPA Buffer:
150mM Sodium chloride
1% NP40 or Triton X-100
0.5% Sodium deoxycholate
0.1% SDS (Sodium dodecyl sulphate)
50mMTris (pH-8.0)

26

The whole cell lysates were subjected to SDS PAGE and then transferred onto nitrocellulose
membranes (BioRad, CA). Loading control was a two- color marker obtained from LI-COR
Biosciences (Lincoln, NA). The membranes were then probed with NQO-1 antibody (Santa Cruz
Biotechnology, Santa Cruz, CA) at a 1: 200 dilution and Keap-1 antibody (Santa Cruz
Biotechnology, Santa Cruz, CA) at a 1:200 dilution. The blots were stripped and re-probed with
anti-β-actin to monitor protein loading. Protein bands were detected using OdesseyCLx IR
Imager (LI-COR Biosciences).
3.10. Statistical Analysis
Mean ±S.D were calculated utilizing Microsoft Excel Program.

27

CHAPTER 4
RESULTS
4.1. Ethanol increases NQO-1 mRNA levels in human endothelial cells (HMEC-1)
Previous studies of Yeligar et al. showed that treatment of rat Kupffer cells or human monocytic
cells (THP-1) with ethanol (50-100 mM) resulted in a 5-fold and 4-fold increase in the mRNA
expression of hemeoxygenase -1 (HO-1) and NAD(P)H-Quinone oxidoreductase (NQO-1),
respectively (46, 48). The concentration of alcohol, which resulted in optimal expression of these
cytoprotective genes in Kupffer cells and THP-1 cells was 100 mM corresponding to 0.46%
(w/v) of alcohol. Our previous studies also showed that 100 mM ethanol was optimal in
upregulating the mRNA expression of endothelin-1 and RANTES, a chemokine, in rat liver
sinusoidal endothelial cells and human vascular endothelial cells (47).
In normal humans, alcohol concentration 0.08% in blood is considered to be unsafe for
driving. Thus the concentration of alcohol (0.46%) utilized in vitro experiments may be
physiologically high. However, other studies have shown that metabolism of ethanol increases in
chronic alcoholics to accommodate increased ethanol consumption. In the present study, we
utilized ethanol at 50 mM, corresponding to alcohol concentration of 0.23% (w/v), as there was
modest effect of alcohol at 25 mM on expression of cytoprotective gene expression. Since
moderate consumption of wine has been shown to have beneficial effects in preventing or
development of atherosclerosis, which develops in the vessel wall of arteries, we utilized
vascular endothelial cells for our study. We used SV-40 transformed human dermal
microvascular endothelial cells (HMEC-1) for ease of culture and because they can be used for
more than 20 passages. Previous studies from our laboratory have shown that studies performed

28

on HMEC-1 mimics most of the in vitro effects observed in primary human endothelial cells.
The primary human endothelial cells are ideal for studies but these cells cannot be cultivated past
passage 7-8, as they lose their characteristics after the 8
th
passage, and these cells are costly.
Thus, I used HMEC-1 cells for mechanistic studies, and the data obtained will be later validated
in primary endothelial cells and in vivo.
Treatment of HMEC-1 with ethanol (50 mM) for time period (1-6 hr), showed optimal increase
in NQO-1 mRNA levels at 4 hr (Figure 5A). Next, we examined the levels of Nrf-2 mRNA, a
central transcription factor, involved in the expression of anti-oxidant response genes, viz., HO-1
and NQO-1. As shown in Figure 5B, optimal increase in levels of Nrf-2 mRNA occurred at 1 hr.
Studies have shown Keap-1 repressor is bound to Nrf2 in the cytosol of the cell and keeps Nrf-2
at a lower level by ubiquitination of Nrf-2 on binding to a C3-ubiquitinase (29). However, in
response to oxidative stress, Keap-1 sulfhydryl groups are oxidized causing Keap-1 to lose Nrf-2
binding activity. This results in the translocation of Nrf-2 into the nucleus where it binds to Maf
(a DNA binding protein). This complex then binds to anti-oxidant response elements to
upregulate the expression of ARE regulated genes (anti-oxidant response) like NQO-1 and HO-1
(Figure 3) (3, 36). Thus, I examined the expression of Keap-1 as a function of time dependent
treatment with ethanol. As shown in Fig. 5C, the Keap-1 mRNA level was maximal at 1 hr, and
decreased by 4-6 hr, the time period when there was maximal increase in NQO-1 expression.
Taken together, these results showed that ethanol maximally increases the mRNA level of NQO-
1 at 4 hr, further providing an insight that Keap-1 may not be regulated at mRNA level, rather
regulated at protein levels, which may possibly occur due to post-transcriptional regulation by
miRNAs. Increase of the latter mRNA (NQO-1) is preceded by increase in Nrf-2 mRNA as well
as Keap-1 and Bach-1 as early as 1 hr of ethanol treatment.

29

Ethanol - + + + Ethanol - + + + +

Ethanol - + + + + Ethanol - + + + +
Figure 5: analysis for relative levels of NQO-1 mRNA
Ethanol increases NQO-1, Nrf-2, Keap-1 and Bach-1 mRNA levels: Figure shows an
increase in levels of NQO-1(A) after 4 hours of ethanol treatment, Nrf-2 (B), Keap-1(C) and
Bach-1 (D) mRNA after 1 hour of ethanol treatment in HMEC cells, as determined by qRT-
B A
C D

30

PCR. The cells were serum starved for 2 hours and then treated with 50 mM ethanol for 0, 1,
2, 4 and 6 hours. All mRNA levels were normalized to GAPDH mRNA levels and data
shown represents three independent experiments (mean ± SD).
4.2. Does ethanol affect the stability of mRNA
Next, we determined whether the increased NQO-1 mRNA levels in ethanol treated HMEC-1
were a result of increased mRNA stability. To determine the mRNA stability, actinomycin D
was used to inhibit ongoing transcription and cytoplasmic mRNA amount was determined as a
function of time. HMEC-1 cells were treated with ethanol (50 mM) for 4 hrs followed by
addition of actinomycin D (10 µg/ ml). Total RNA was isolated after 0, 0.30, 1, 2 and 4 hr of
drug treatment for quantitation of candidate mRNA. The expression of NQO-1 mRNA in
untreated and ethanol treated HMEC-1 was determined by qRT-PCR. This experiment with
ethanol has been run in triplicate in three independent experiments. The half -life of NQO-1
mRNA was inconclusive, based on our experimental results. Further validation will require
additional experiments to be performed with transcription inhibitor, actinomycin D. It is
pertinent to mention that NQO-1 mRNA half life in human colon carcinoma cell lines was
approximately 31 hrs (38).
Bach is a repressor of Nrf-2 -- Maf complex in the nucleus, and thus its steady state level, if
proportional to its mRNA level could affect Nrf-2 mediated gene expression. Our studies on the
stability of Nrf-2 and Bach-1 mRNA levels were also inconclusive because treatment with
actinomycin D caused an increase in mRNA levels in the first 2 hrs of treatment and it is still
unclear why this increase in mRNA levels occurred.
Since Keap-1 is a repressor of Nrf-2, we determined the half-life of Keap-1 mRNA. The half-life
of Keap-1 decreased in response to ethanol treatment (control, t
1/2
= 1.30 ± 0.15hrs vs. ethanol-

31

treated t
1/2
= 1.0 ± 0.10hrs). Taken together these results showed that stability of mRNA for
Keap1 decreased while the stability analysis for NQO-1, Nrf-2 and Bach-1 were inconclusive.
We propose to do further experimental verification, by treating the cells with ethanol for the
indicated time periods for analysis of NQO-1, Nrf-2 and Bach-1 mRNAs as described above
except that pre-treatment with actinomycin D for 1 to 2 hrs will be done prior to isolation and
analysis of mRNA levels.

Figure 6: Stability analysis for relative levels of NQO-1 mRNA
Stability analysis for NQO-1 mRNA : Figure shows stability analysis for NQO-1 mRNA after
4 hours of ethanol treatment followed by treatment with 10 µg/ mL of actinomycin D, in HMEC
cells for 0, 0.30, 1, 2 and 4 hours, as determined by qRT-PCR. All mRNA levels were
normalized to GAPDH mRNA levels and these experiments were performed in triplicates.

32

Figure 7: Stability analysis for relative levels of Nrf2, Keap-1 and Bach-1mRNA
Stability analysis for Nrf-2, Keap-1 and Bach-1 mRNA : Figure shows stability analysis
for Nrf-2 (A), Keap-1 (B) and Bach-1(C) mRNA after 1 hour of ethanol treatment followed
by treatment with 10 µg/ mL of actinomycin D, in HMEC cells for 0, 1, 2 and 4 hours, as
determined by qRT-PCR. All mRNA levels were normalized to GAPDH mRNA levels and
these experiments were performed in triplicates.
A B
C

33

4.3. Identification of miRNAs involved in alcohol-mediated NQO-1 and Nrf-2 mRNA
stabilization
Bioinformatics approaches were utilized to identify potential miRNA target sites present in
3’UTRs of NQO-1 and Nrf-2 mRNAs. We used miRNA target prediction program, namely
Microcosm, a web-based program. This approach considers mRNA complementarity to specific
miRNAs and the extent of evolutionary miRNA sequence conservation. This program revealed
the presence of several miRNAs, those with strongest correlation with seed sequence stability
(negative G°) and species conservation to 3’UTRs of NQO-1, Nrf-2, Keap-1 and Bach-1
mRNAs (Figure 8).

34

Figure 8: Candidate miRNAs at 3’UTR of NQO-1, Nrf-2, Keap-1 and Bach-1
In Figure 8, Blue color indicates – ORF (Open reading frame). White color indicates the 3’-UTR
of genes. To indicate that the length of Bach-1 3’UTR is longer than 3kb, a break was introduced
in the middle.

35

This program predicted ~6 putative miRNA target sites in the 3’UTR of NQO-1 mRNA, 7
putative miRNA target sites in the 3’UTR of Nrf-2, and two putative miRNA target sites in the
3’UTR of Keap-1 mRNA. We selected four candidates miRs (miR-642, miR-566, miR-518 and
miR-200a) based on complementarity ( G° ~ -15 to -21 kcal/ mol) and high degree of site
conservation among different mammalian species (e.g. 4-6 species).
HMEC-1 cells were treated with ethanol (50 mM) for 4 hrs followed by isolation of miRNA. The
amount of each miRNA from untreated and ethanol-treated HMEC-1 was determined by qRT-
PCR. As shown in Figure 9 (A-C), the levels of miR-518, miR-566 and miR-642 was reduced
by 60%, 90% and 65%, respectively, in response to ethanol-treatment. Both miR-566 and miR-
642 have complementary binding sites in the 3’UTR of NQO-1 mRNA, but miR-518 has no such
site in NQO-1. However, HO-1 3’UTR mRNA shows a binding site for miR-518. Thus, we
examined the role of miR-566 and miR-642 in destabilizing NQO-1 mRNA through its 3’UTR.

A B

36

Figure 9: Relative levels of NQO-1 specific candidate miRNAs (518, 566 and 642)
Relative levels of NQO-1 specific candidate miRNAs (A, B & C): Figure shows miRNA after
4 hours of ethanol treatment in HMEC cells, as determined by qRT-PCR. All miRNA levels
were normalized to U6-snRNA levels and these experiments were performed in triplicates.

C
A
B

37

Figure 10: Relative levels of Nrf-2 specific candidate miRNAs
Relative levels of Nrf-2 specific candidate miRNAs (A, B, C & D): Figure shows levels of
miRNAs after 1 hour of ethanol treatment in HMEC cells, as determined by qRT-PCR. All
miRNA levels were normalized to U6-snRNA levels and these experiments were performed
in triplicates.

Figure 11: Relative levels of Keap-1 candidate miRNAs
C

D
A

B

38

Relative levels of Keap-1 specific candidate miRNAs (A & B): Figure shows levels of
miRNAs after 1 hour of ethanol treatment in HMEC cells, as determined by qRT-PCR. All
miRNA levels were normalized to U6-snRNA levels and these experiments were performed in
triplicates.

Figure 12: Relative levels of Bach-1 candidate miRNA
Relative levels of Bach-1 specific candidate miRNAs: Figure shows levels of miRNAs after 1
hour of ethanol treatment in HMEC cells, as determined by qRT-PCR. All miRNA levels were
normalized to U6-snRNA levels and these experiments were performed in triplicates.
4.4. Role of miR-518, miR-566 and miR-642 in regulation of NQO-1 mRNA expression
In order to determine whether miRs (518, 566 and 642) were physiologically important for
regulation of endogenous NQO-1 mRNA, HMEC cells were transfected with specific miR
mimics and corresponding anti-miRs followed by isolation of total RNA. As shown in Figure
13A, transfection of these miR-mimics (90 pM) reduced endogenous NQO-1mRNA levels in the
range of 40-60% relative to control. Next, we examined the effect of transfection of anti-miRs to
miR-642, miR-566 and miR-518 on the endogenous NQO-1 mRNA levels. As shown in Figure

39

13B, anti-miR-518 and anti-miR-566 increased endogenous NQO-1 mRNA levels by
approximately 3-fold and 2-fold, respectively. Transfection with anti-miR-642 showed a modest
effect. It showed approximately a 1.4-fold increase in NQO-1 mRNA levels. These results
suggest that miR-518 and miR-566 are strong candidates for modulating endogenous NQO-1
mRNA levels. Transfection of HMEC-1 with these miRs followed by ethanol treatment resulted
in decreased NQO-1 mRNA levels below that seen with ethanol treatment alone (Figure 13C).
Conversely, anti-miRs showed increase in NQO-1 mRNA levels (Figure 13D).

A B

40

Figure 13: Effect of miRs and anti-miRs transfection on NQO-1mRNA levels under
basal conditions (A and B) and ethanol- treated conditions (C and D).
miR-642, miR-566 and miR-518 attenuates NQO-1 mRNA levels, anti-miR-642, anti-miR-
566 and anti-miR-518 increase NQO-1 mRNA levels: Figure (A) shows a decrease in levels of
NQO-1 mRNA after transfection with miR-642, miR-566, miR-518 and figure (B) shows an
increase in levels of NQO-1 mRNA after transfection with anti-miR-642, anti-miR-566, anti-
miR-518. Figure (C) shows a decrease in levels of NQO-1 mRNA after transfection with miR-
642, miR-566, miR-518 ethanol treated HMEC cells, as determined by qRT-PCRand figure (D)
shows an increase in levels of NQO-1 mRNA after transfection with anti-miR-642, anti-miR-
566, anti-miR-518 in ethanol treated HMEC cells, as determined by qRT-PCR. All mRNA levels
were normalized to GAPDH mRNA levels and data shown represents two independent
experiments (mean ± SD).
C D

41

Transfection with miR-200a, and anti-miR 200a showed up-regulation, and down-regulation of
Keap-1 mRNA levels respectively, under basal conditions (Figure 14A). On the other hand
transfection with miR-200a, and anti-miR-200a followed by ethanol treatment showed up-
regulation and down-regulation of the Keap-1 mRNA levels respectively, under ethanol
treatment (Figure 14B).

Figure 14: Effect of miRs and anti-miRs transfection on Keap-1 mRNA levels under basal
conditions (A) and ethanol- treated conditions (B)
miR-200a increases Keap-1mRNA levels, anti-miR-200a attenuates Keap-1 mRNA levels:
Figure (A) shows a increase in levels of Keap-1 mRNA after transfection with miR-200a, and a
decrease in levels of Keap-1 mRNA after transfection with anti-miR-200a, in HMEC cells, as
determined by qRT-PCR. Figure (B) shows an increase in levels of Keap-1 mRNA after
transfection with miR-200a followed in ethanol treated HMEC, and a decrease in levels of Keap-
1 mRNA after transfection with anti-miR-200a in ethanol treated for 1 hr in HMEC cells, as
A B

42

determined by qRT-PCR. All mRNA levels were normalized to GAPDH mRNA levels and data
shown represents two independent experiments (mean ± SD).

43

CHAPTER 5
DISCUSSION
5.1. Discussion
Alcoholism is one of the leading causes of liver disease. Both catabolism to form acetaldehyde
(which upon accumulation causes toxicity) or the induction of reactive oxygen species, which
thereby induces inflammatory cytokines that are harmful to the liver, lead to chronic disorders.
This stress response is overcome by the body by induction of phase II detoxifying enzymes e.g.
Hemoxygenase-I (HO-1), and NADH-Quinone Oxidoreductase (NQO-1) (9, 38).These genes are
up-regulated in response to reactive oxygen species, and protects the cells against any stress
induced by alcohol. Knockdown of Nrf-2 in mice, which results in loss of NQO-1 and HO-1
expression, results in up-regulation of inflammatory cytokines and inflammation response to
ethanol consumption (21).
In the current study, we propose a mechanism of expression and post-transcriptional regulation
of the NADH-Quinone Oxidoreductase (NQO-1) in HMEC-1 cells treated with 0.23% (w/v) of
alcohol, which is physiological in individuals who are chronic alcoholics. We found that upon
treatment with ethanol, the cells showed an increase in mRNA levels of NQO-1 after 4 hours of
treatment. Others have shown that Nrf-2 is bound to Keap-1, under basal conditions and Nrf-2 in
the cytosol is inactive. Our studies reveal that both Nrf-2 and Keap-1 mRNAs are up-regulated
after 1 hour of ethanol treatment. We also identified the potential miRNA candidates for NQO-1,
Nrf-2 and Keap-1 as putative post transcriptional regulators of these genes. We identified three
miRNAs (miR-566, miR-518 and miR-642) which reduced NQO-1 mRNA levels under basal

44

conditions and in response to ethanol treatment, as demonstrated by transfection with candidate
miRs and corresponding anti-miRs.
However, unexpectedly we observed that transfection with miR-200a, which was predicted to
have a binding site in the 3’UTR of Keap-1 mRNA resulted in an increase in Keap-1 mRNA
levels. Conversely, transfection with anti-miR-200a resulted in a decrease in Keap-1 mRNA
levels. These results show that either miR-200a regulates Keap-1 mRNA levels directly by
binding to the 3’UTR of Keap-1 or indirectly by triggering a protein that might enhance the
levels of Keap-1 mRNA or conversely, miR-200a may not regulate the Keap-1 mRNA levels. It
is pertinent to mention that previous studies on miRNAs have shown that some miRNAs may
increase the levels of mRNA expression (43).
Overall, these studies showed that ethanol affects the stability of Keap-1, and the stability
analysis for NQO-1, Nrf-2 and Bach-1 mRNA levels has to be further validated with more
experimental results. Moreover, we identified miR-566, miR-518 and miR-642 as potential
candidate miRNAs, which likely bind to the 3’UTR of NQO-1 mRNA. Furthermore, miR-200a
is a likely candidate miRNA that may or may not bind to the 3’UTR of Keap-1 mRNA.
5.2. Conclusion
Overconsumption of ethanol causes a severe inflammatory response by induction of reactive
oxygen species leading to chronic liver injury and cirrhosis (26). Previous studies have shown
that ethanol induces the expression of HO-1 and NQO-1, which are regulated by Nrf-2, a
transcription factor (42, 46). We hypothesized that ethanol may regulate the stability of NQO-1
mRNA and Keap1 mRNA by putative miRNAs acting on the 3’UTRs of these mRNAs. The
three putative miRNAs that we identified, caused a decrease in levels of NQO-1 mRNA under

45

basal and ethanol treated conditions. Since, I have not analyzed binding of these miRNAs to
NQO-1 3’UTR reporter constructs, these findings are provisional that these miRNAs will affect
the level of NQO-1 mRNA under basal and ethanol treated conditions.
We further observed that ethanol coordinately increased the mRNA levels for Nrf-2 and Keap-1
after 1 hour of treatment. This suggests the quick response of the transcriptional activator (Nrf-2)
and followed by up-regulation of NQO-1 gene expression at a later time period, i.e. 4 hrs. As per
previous studies, Keap-1 is an inhibitor of Nrf-2, which upon binding to Nrf-2 facilitates its
degradation through a C3-ubiquitinase dependent pathway (21). But our studies showed up-
regulation of both Keap-1 and Nrf-2 mRNAs occurred after 1 hour of ethanol treatment, prior to
NQO-1 mRNA expression. These results were contrary to our hypothesis, where-in the levels of
Keap-1 mRNA should have decreased. However, we believe that regulation may occur at the
protein levels via post-transcriptional regulation by miRNAs. Another possible reason might be
Keap-1, an oxidative stress response sensor, may regulate the levels of Nrf-2 faster, to avoid over
induction of cyto-protective enzymes.
We identified miR-200a as a potential miRNA that binds the 3’UTR of Keap-1 mRNA.
However, our results showed that transfection of HMEC-1 cells with miR-200a actually
increased Keap-1 mRNA levels, while transfection with anti-miR-200a decreased net Keap-1
mRNA levels. These results suggest that endogenous levels of miR-200a under basal conditions
and after ethanol treatment may affect Keap-1 activity, which in turn may affect Nrf-2 activity.
Since we observed higher levels of miR-200a in untreated HMEC vs. ethanol treated HMEC, we
anticipated lower levels of Keap-1 mRNA. However, we observed higher levels of Keap-1
mRNA under basal vs. ethanol treated conditions. These results indicated that miR-200a, may be
an activator rather than a repressor of Keap-1 mRNA expression. This might be because Keap-1

46

might be regulated indirectly by miR-200a, by targeting mRNA binding proteins, which in turn
might act on Keap-1 mRNA and up-regulate its levels. Another possibility is that miR-200a
might not even regulate Keap-1 mRNA expression (may not have a binding site in the 3’UTR of
Keap-1). Further experiments has to performed to validate whether miR-200a regulates Keap-1
mRNA levels directly by binding to its 3’UTR or by indirect regulation or whether it does not
even regulate Keap-1 mRNA levels.
We further studied the stability of these genes under basal and ethanol treated conditions, using
actinomycin D. These experiments revealed that Keap-1 mRNA was destabilized under ethanol
treatment, whereas the stabilities of NQO-1, Nrf-2 and Bach-1 were inconclusive. This suggests
that Keap-1 mRNA is unstable under oxidative stress resulting from exposure to ethanol, which
may lead to increased Nrf-2 activation and induction of NQO-1. Overall, our studies showed that
ethanol induced NQO-1 mRNA expression and is post-transcriptionally regulated by three
specific miRNAs.
5.3. Future Plans
Since our studies showed that miR-518, miR-566 and miR-642 affect the NQO-1 mRNA levels,
these miRNAs are thus potential candidate miRNAs, which destabilize NQO-1 mRNA through
its 3’UTR. To support these results, we need to determine the effect of miRs and anti-miRs on (i)
NQO-1 protein expression by Western Blot analysis, and (ii) luciferase activity of 3’UTR of
NQO-1 fused to a luciferase gene reporter construct. Furthermore, site-directed mutagenesis of
binding sites for specific miRNAs in the 3’UTR of NQO-1 mRNA reporter construct will
confirm the specific complementarity of the miRNAs. Similar studies will be required for miR-

47

200a which binds the 3’UTR of Keap-1 mRNA. Prior to these experiments, we also will need to
determine the stability of NQO-1, Nrf-2 and Keap-1 mRNA in response to ethanol treatment.

48

BIBLIOGRAPHY
1. Asgari, S. Role of MicroRNAs in Insect Host–Microorganism Interactions Front. Physio.2:48.
2. Baird, L. and A. T. Dinkova-Kostova. 2011. The cytoprotective role of the Keap1-Nrf2
pathway Arch. Toxicol.
3. Bloom, D.A. and A.K. Jaiswal. 2003. Phosphorylation of Nrf2 at Ser40 by Protein Kinase C in
Response to Antioxidants Leads to the Release of Nrf2 from INrf2, but Is Not Required for Nrf2
Stabilization/Accumulation in the Nucleus and Transcriptional Activation of Antioxidant
Response Element-mediated NAD(P)H:Quinone Oxidoreductase-1 Gene Expression J Biol
Chem. 278(45): 44675-82.
4. Borchert, G. M., W. Lanier, and B. L. Davidson. 2006. RNA polymerase III transcribes human
microRNAs Nature Structural & Molecular Biology 13: 1097 - 1101.
5. Checkulaeva, M. and Filipowic, W. 2009. Mechanisms of miRNA-mediated post-
transcriptional regulation in animal cells Current Opinion in Cell Biology. 21(3):452- 460.
6. Chen,C. C., R.B. Lu, Y.C. Chen, T.K. Li and S.J. Yin. 1999. Interaction between the
Functional Polymorphisms of the Alcohol- Metabolism Genes in Protection against Alcoholism
Am J Hum Genet. 65(3): 795-807.
7. Crabb, D. W., H. J. Edenberg, W. F. Bosron, and T. K. Li. 1989. Genotypes for aldehyde
dehydrogenase deficiency and alcohol sensitivity. The inactive ALDH2(2) allele is dominant J.
Clin. Invest. 83: 314-316.
8. Das, S. K., S. Mukherjee, and D. M. Vasudevan. 2010; 2011. Effects of Long Term Ethanol
Consumption on Cell Death in Liver Indian Journal of Clinical Biochemistry. 26: 84 - 87.
9. Dhakshinamoorthy, S., A. K. Jain, D. A. Bloom, and A. K. Jaiswal. 2005. Bach1 competes
with Nrf2 leading to negative regulation of the antioxidant response element (ARE)-mediated
NAD(P)H:quinoneoxidoreductase 1 gene expression and induction in response to antioxidants J.
Biol. Chem. 280: 16891-16900.
10. Dhakshinamoorthy, S. and A. K. Jaiswal. 2001. Functional characterization and role of INrf2
in antioxidant response element-mediated expression and antioxidant induction of
NAD(P)H:quinone oxidoreductase1 gene Oncogene 20: 3906-3917.
11. Dhakshinamoorthy, S and A.G. Porter. 2004. Nitric Oxide-induced Transcriptional Up-
regulation of Protective Genes by Nrf2 via the Antioxidant Response Element Counteracts
Apoptosis of NeuroblastomaCells Journal of Biological Chemistry. 279: 20096-20107.
12. Duguay, L., D. Coutu, C. Hetu, and J. G. Joly. 1982. Inhibition of liver regeneration by
chronic alcohol administration Gut. 23: 8-13.

49

13. Enomoto, N., K. Ikejima, B. Bradford, C. Rivera, H. Kono, D.A. Brenner and R.G. Thurman.
1998. Alcohol causes both tolerance and sensitization of rat Kupffer cells via mechanisms
dependent on endotoxin Gastroenterology. 115(2): 443-451.
14. Garrison, H. G., A. R. Hansen, R. E. Cross, and H. J. Proctor. 1984. Effect of ethanol on
lactic acidosis in experimental hemorrhagic shock Ann. Emerg. Med. 13: 26 - 29.
15. Garzon, R., G. A. Calin, and C. M. Croce. 2009. MicroRNAs in Cancer Annu. Rev. Med. 60:
167-179.
16. Gerjevic, L. N., S. Lu, J. P. Chaky, and D. D. Harrison-Findik. 2011. Regulation of heme
oxygenase expression by alcohol, hypoxia and oxidative stress World J. Biol. Chem. 2: 252-260.
17. Grimson, A., K. K. Farh, W. K. Johnston, P. Garrett-Engele, L. P. Lim, and D. P. Bartel.
2007. MicroRNA Targeting Specificity in Mammals: Determinants beyond Seed Pairing Mol.
Cell 27: 91 - 105.
18. Haramati, S., E. Chapnik, Y. Sztainberg, R. Eilam, R. Zwang, N. Gershoni, E. McGlinn, P.
W. Heiser, A. M. Wills, I. Wirguin, L. L. Rubin, H. Misawa, C. J. Tabin, R. Brown Jr, A. Chen,
and E. Hornstein. 2010. miRNA malfunction causes spinal motor neuron disease Proc. Natl.
Acad. Sci. U. S. A. 107: 13111-13116.
19. Hutvagner, G. 2002; 2002. A microRNA in a Multiple-Turnover RNAi Enzyme Complex
Science 297: 2056 -2060.
20. Ikeda, S., S. W. Kong, J. Lu, E. Bisping, H. Zhang, P. D. Allen, T. R. Golub, B. Pieske, and
W. T. Pu. 2007. Altered microRNA expression in human heart disease Physiol. Genomics 31:
367-373.
21. Jung, K. A. and M. K. Kwak. 2010. The nrf2 system as a potential target for the development
of indirect antioxidants Molecules 15: 7266-7291.
22. Kensler, T.W., N. Wakabayashi and S. Biswal. 2007. Cell Survival Responses to
Environmental Stresses Via the Keap1-Nrf2-ARE Pathway Annu Rev of PharmacolToxicol.
47(1):89-116.
23. Kie, J., M. H. Kapturczak, A. Traylor, A. Agarwal, and N. Hill-Kapturczak. 2008. Heme
Oxygenase-1 Deficiency Promotes Epithelial-Mesenchymal Transition and Renal Fibrosis
Journal of the American Society of Nephrology 19: 1681-1691.
24. Kim, H. J., M. Zheng, S. K. Kim, J. J. Cho, C. H. Shin, Y. Joe, and H. T. Chung. 2011.
CO/HO-1 Induces NQO-1 Expression via Nrf2 Activation Immune Netw. 11: 376-382.
25. Kim, V. N. 2005. MicroRNA biogenesis: coordinated cropping and dicing Nat. Rev. Mol.
Cell Biol. 6: 376-385.

50

26. Kono, H., I. Rusyn, T. Uesugi, S. Yamashina, H. D. Connor, A. Dikalova, R. P. Mason, and
R. G. Thurman. 2001. Diphenyleneiodonium sulfate, an NADPH oxidase inhibitor, prevents
early alcohol-induced liver injury in the rat Am. J. Physiol. Gastrointest. Liver Physiol. 280:
G1005-12.
27. Koteish, A., S. Yang, H. Lin, X. Huang and A.M. Diehl. 2002. Chronic Ethanol Exposure
Potentiates Lipopolysaccharide Liver Injury Despite Inhibiting Jun N-terminal Kinase and
Caspase 3 Activation Journal of Biological Chemistry. 277: 13037-13044.
28. Kundu, J. K. and Y. Surh. 2010. Nrf2-Keap1 Signaling as a Potential Target for
Chemoprevention of Inflammation-Associated Carcinogenesis Pharm. Res.
29. Kwak, M.K., N. Wakabayashi, K. Itoh, H. Motohashi, M. Yamamoto and T.W. Kensler.
2002. Modulation of Gene Expression by Cancer Chemopreventive Dithiolethiones through the
Keap1-Nrf2 Pathway JBiol Chem. 278: 8135-8145.
30. Lieber, C. S. 1997. Ethanol metabolism, cirrhosis and alcoholism ClinicaChimicaActa. 257:
59 - 84.
31. Lu, J., G. Getz, E. A. Miska, E. Alvarez-Saavedra, J. Lamb, D. Peck, A. Sweet-Cordero, B.
L. Ebert, R. H. Mak, A. A. Ferrando, J. R. Downing, T. Jacks, H. R. Horvitz, and T. R. Golub.
2005. MicroRNA expression profiles classify human cancers Nature 435: 834-838.
32. Lund, E. 2004. Nuclear Export of MicroRNA Precursors Science 303: 95 - 98.
33. Nguyen, T., P. Nioi, and C. B. Pickett. 2009; 2009. The Nrf2-Antioxidant Response Element
Signaling Pathway and Its Activation by Oxidative Stress J. Biol. Chem. 284: 13291 - 13295.
34. Okamura, K., N. Liu, and E. C. Lai. 2009. Distinct Mechanisms for MicroRNA Strand
Selection by Drosophila ArgonautesMol. Cell 36: 431 - 444.
35. Poss, K. and S. Tonegawa. 1997. Reduced stress defense in heme oxygenase 1-deficient
cells. Proc. Natl. Acad. Sci. USA Vol. 94: 10925.
36. Reisman, S.A., R.L. Yeager, M. Yamamoto and C.D. Klaassen. 2009. Increased Nrf2
Activation in Livers from Keap1-Knockdown Mice Increases Expression of Cytoprotective
Genes that Detoxify Electrophiles more than those that Detoxify Reactive Oxygen Species
Toxicol. Sci. 108(1): 35-47.
37. Ross, D. and D. Siegel. 2004. NAD(P)H:QuinoneOxidoreductase 1 ( NQO1, DT-
Diaphorase), Functions and PharmacogeneticsMethods in Enzymology. 382: 115-144.
38. Siegel, D., A. Anwar, S.L. Winski, J.K. Kepa, K.L. Zolman and D. Ross. 2001. Rapid
Polyubiquitination and Proteasomal Degradation of a Mutant Form of
NAD(P)H:QuinoneOxidoreductase 1 MolPharmacol. 59(2): 263-268.

51

39. Siegel, D., W. A. Franklin, and D. Ross. 1998. Immunohistochemical detection of
NAD(P)H:quinoneoxidoreductase in human lung and lung tumors Clin. Cancer Res. 4: 2065-
2070.
40. Siegel, D. and D. Ross.2000. Immunodetection of NAD(P)H:quinoneoxidoreductase 1
(NQO1) in human tissues Free Radical Biology and Medicine. 29(3-4): 246-253.
41. Suzanne, M.D.L.M., L. Longato, M. Tong, S. DeNucci and J.R. Wands. 2009. The Liver-
Brain Axis of Alcohol-Mediated Neurodegeneration: Role of Toxic Lipids Int J Environ Res
Public Health. 6(7):2055-2075.
42. Ungvari, Z., L. Bailey-Downs, T. Gautam, R. Jimenez, G. Losonczy, C. Zhang, P. Ballabh,
F. A. Recchia, D. C. Wilkerson, W. E. Sonntag, K. Pearson, R. de Cabo, and A. Csiszar. 2011.
Adaptive induction of NF-E2-related factor-2-driven antioxidant genes in endothelial cells in
response to hyperglycemia Am. J. Physiol. Heart Circ. Physiol. 300: H1133-40.
43. Vasudevan, S., Y. Tong and J.A. Steitz. 2007. Switching from Repression to Activation:
MicroRNAs Can Up-Regulate Translation Science. 318(5858): 1931-1934.
44. Werner, J., M. Saghir, A. L. Warshaw, K. B. Lewandrowski, M. Laposata, R. V. Iozzo, E. A.
Carter, R. J. Schatz, and C. Fernandez-Del Castillo. 2002. Alcoholic pancreatitis in rats: injury
from nonoxidative metabolites of ethanol Am. J. Physiol. Gastrointest. Liver Physiol. 283: G65-
73.
45. Xu, Y., M. A. Leo and C.S. Lieber. 2005. DLPC attenuates alcohol-induced cytotoxicity in
HEPG2 cells expressing CYP2E1 Alcohol & Alcoholism. 40(3):172-175.
46. Yeligar, S. M., F. L. Harris, C. M. Hart, and L. A. Brown. 2012. Ethanol Induces Oxidative
Stress in Alveolar Macrophages via Upregulation of NADPH Oxidases J. Immunol. 188: 3648-
3657.
47. Yeligar, S. M., K. Machida, and V. K. Kalra. 2010. Ethanol-induced HO-1 and NQO1 are
differentially regulated by HIF-1alpha and Nrf2 to attenuate inflammatory cytokine expression J.
Biol. Chem. 285: 35359-35373.
48. Yeligar, S. M., K. Machida, H. Tsukamoto, and V. K. Kalra. 2009. Ethanol augments
RANTES/CCL5 expression in rat liver sinusoidal endothelial cells and human endothelial cells
via activation of NF-kappa B, HIF-1 alpha, and AP-1 J. Immunol. 183: 5964-5976.
49. Yoshiaki, H., T. Nakayama, A. Futamura, M. Omura, H. Nakarai and K. Nakahara. 2002.
Relationship between Genetic Polymorphisms of Alcohol-metabolizing Enzymes and Changes in
Risk Factors for Coronary Heart Disease Associated with Alcohol Consumption Clinical
Chemistry. 48(7): 1043-1048.

52

50. Zhang, F., U. Warskulat, and D. Häussinger. 1996. Modulation of tumor necrosis factor-a
release by anisoosmolarity and betaine in rat liver macrophages (Kupffer cells) FEBS Lett. 391:
293 - 296.

Abstract (if available)

Abstract Chronic alcohol consumption leads to liver injury and death. Studies have shown ethanol causes increased inflammation, which leads to liver damage and cirrhosis. To counteract this inflammatory response, cells up-regulate antioxidant response genes, e.g. hemeoxygenase-1(HO-1) and NADH-quinone oxidoreductase-1(NQO-1). These cytoprotective genes are regulated by a central transcription factor, Nrf-2. Previous studies show ethanol induced mRNA levels of both HO-1 and NQO-1 in Kupffer cells involve activation of Nrf-2. In the present study, we examined whether ethanol affected the stability of NQO-1 mRNA, and transcription factors, i.e. Nrf-2 mRNA and Keap-1 mRNA, in endothelial cells. Our studies showed that ethanol increased the net expression of NQO-1, Nrf-2 and Keap-1 mRNAs in human endothelial cells (HMEC-1) in a time-dependent manner. Moreover, ethanol increased the stability of NQO-1 mRNA and Nrf-2 mRNA, while the Keap-1 mRNA was destabilized. Thus, we examined the role of microRNAs in the post-transcriptional regulation of NQO-1mRNA and Keap-1 mRNA. ❧ Our studies showed that both miR-566 and miR-518 attenuate the NQO-1 mRNA levels under basal and ethanol-treated conditions, as determined by transfection of HMEC-1 cells with miRs (synthetic mimics) and anti-miRs. We identified miR-200a as a potential candidate miRNA, which affects the Keap-1 mRNA expression. These studies for the first time, to the best of my knowledge, identify specific miRNAs, which may be involved in binding to the 3’UTR of NQO-1 mRNA and the 3’UTR of Keap-1 mRNA. These miRNAs may play an important role in affecting expression of cyto-protective genes and inflammation as observed in chronic alcoholic individuals.

Linked assets

University of Southern California Dissertations and Theses

Conceptually similar

PDF

Placental growth factor mediated transcriptional and post-transcriptional regulation of hemeoxygenase-1

PDF

Differential effect of ethanol and r-sulforaphane on regulation of heme oxygenase-1 in endothelial cells

PDF

MicroRNAs involved in the regulation of Endothelin-1 gene expression in endothelial cells

PDF

Placenta growth factor-miRNAs-lncRNAs axis in the regulation of ET-1 gene involved in pulmonary hypertension in sickle cell disease

PDF

Creating a multiple micrornia expression vector to target GRP78, an ER chaperone and signaling regulator in cancer

PDF

Ethanol induced modulation of microglial P2X7 receptor expression and its role in neuroinflammation

PDF

The role of miRNA and its regulation in pulmonary hypertension in sickle cell disease

PDF

A novel role for hypoxia-inducible factor-1alpha (HIF-1alpha) in the regulation of inflammatory chemokines and leukotriene expression in sickle cell disease

PDF

Transcriptional regulation of IFN-γ and PlGF in response to Epo and VEGF in erythroid cells

PDF

Ethanol-HIF-1 alpha axis in inflammatory gene expression in liver cells

PDF

RNA polymerase III-dependent transcription is repressed under prolonged hypoxic conditions

PDF

A functional genomic approach based on shRNA-mediated gene silencing to delineate the role of NF-κB and cell death proteins in the survival and proliferation of KSHV associated primary effusion l...

PDF

Discovery of mature microRNA sequences within the protein- coding regions of global HIV-1 genomes: Predictions of novel mechanisms for viral infection and pathogenicity

PDF

Protein kinase C (PKC) participates in acetaminophen hepatotoxicity through JNK dependent and independent pathways

PDF

Investigating the function and epigenetic regulation of ABCA3, a novel LUAD tumor suppressor gene

PDF

Nuclear respiratory factor-1 regulation by PTEN signaling

PDF

Pten deletion in adult pancreatic beta-cells induces cell proliferation and G1/S cell cycle progression

PDF

Studies on the expression and function of the human TMEM56 protein

PDF

Interaction of Hic-5 with different steroid receptors and its selective coregulator activity

PDF

TLR8-transferred miR-192 acts as a tumor suppressor in neuroblastoma by inhibiting CTCF

Asset Metadata

Creator Ravichandran, Monisha (author)

Core Title Alcohol mediated expression of cyto-protective enzyme - NQO-1 and its post translational regulation

School Keck School of Medicine

Degree Master of Science

Degree Program Biochemistry and Molecular Biology

Publication Date 08/02/2012

Defense Date 05/22/2012

Publisher University of Southern California (original), University of Southern California. Libraries (digital)

Tag Bach-1,ethanol,Keap-1,miR-518,miR-566,miR-642,NQO-1,Nrf-2,OAI-PMH Harvest

Language English

Contributor Electronically uploaded by the author (provenance)

Advisor Kalra, Vijay K. (committee chair), Tahara, Stanley M. (committee member), Tokes, Zoltan A. (committee member)

Creator Email mravicha@usc.edu,souravmoni42@gmail.com

Permanent Link (DOI) https://doi.org/10.25549/usctheses-c3-84016

Unique identifier UC11289287

Identifier usctheses-c3-84016 (legacy record id)

Legacy Identifier etd-Ravichandr-1112.pdf

Dmrecord 84016

Document Type Thesis

Rights Ravichandran, Monisha

Type texts

Source University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Access Conditions The author retains rights to his/her dissertation, thesis or other graduate work according to U.S. copyright law. Electronic access is being provided by the USC Libraries in agreement with the a...

Repository Name University of Southern California Digital Library

Repository Location USC Digital Library, University of Southern California, University Park Campus MC 2810, 3434 South Grand Avenue, 2nd Floor, Los Angeles, California 90089-2810, USA