University of Southern California Dissertations and Theses

Immune escape in head and neck squamous cell carcinoma

(USC Thesis Other)

Immune escape in head and neck squamous cell carcinoma

PDF

Download a page range

Download transcript

Copy asset link

Request this asset

Transcript (if available)

Content

IMMUNE ESCAPE IN HEAD AND NECK SQUAMOUS CELL CARCINOMA

by

Sarah Marie Russell

________________________________________________________________________

A Thesis Presented to the
FACULTY OF THE USC GRADUATE SCHOOL
UNIVERSITY OF SOUTHERN CALIFORNIA
In Partial Fulfillment of the
Requirements for the Degree
MASTER OF SCIENCE
(CLINICAL AND BIOMEDICAL INVESTIGATIONS)

May 2012

Copyright 2012 Sarah Marie Russell

ii

TABLE OF CONTENTS

List of Tables iii

List of Figures iv

Abstract v

Chapter 1. Introduction 1

Chapter 2. USC-HN2, a new model cell line for recurrent oral cavity 6
squamous cell carcinoma with immunosuppressive characteristics

Chapter 3. Differences in Immune Escape in HPV
+
versus HPV
-
head and 32
neck squamous cell carcinoma

Chapter 4. Future Directions 54

Bibliography 57

iii

LIST OF TABLES

Table 2.1. Analysis of USC-HN2 surface markers by FACS. 22

Table 2.2. Selected up-regulated genes identified in USC-HN2 and SCCL-MT1 26
cell lines also present in HNSCC tumor biopsies.

Table 3.1. Primer Sequences. 39

Table 3.2. Patient Characteristics. 41
iv

LIST OF FIGURES

Figure 1.1. Schematic of the upper aerodigestive tract. 3
Figure 2.1. Histology and morphologic analysis of USC-HN2. 14
Figure 2.2. Cytogenetic analysis of USC-HN2 and SCCL-MT1. 17
Figure 2.3. Multi-color FISH analysis of USC-HN2 18
Figure 2.4. Characterization of the original tumor biopsy, USC-HN2 cell line, and 20
heterotransplanted tumor.
Figure 2.5. USC-HN2 is highly immunomodulatory and induces suppressor cells. 24
Figure 2.6. HPV Viral Screen of USC-HN2 and SCCL-MT1. 28
Figure 3.1. Immune Cell Stains. 37
Figure 3.2. Human Leukocyte Antigen Stains. 37
Figure 3.3. HPV Screening. 42
Figure 3.4. Gene expression by qRT-PCR. 44
Figure 3.5. Analysis of Intratumoral Immune Cell Infiltration by 47
Immunohistochemistry.

Figure 3.6. Invasive Margin and HLA staining. 48
v

ABSTRACT

Head and neck squamous cell carcinomas (HNSCC) are common and aggressive tumors
that have not seen an improvement in survival rates in decades. Despite current standard-
of-care treatment, which includes surgical resection with adjuvant chemotherapy and
radiation therapy, recurrent and metastatic disease accounts for significant morbidity and
mortality. These highly immune-modulatory tumors are believed to evade the immune
system through a variety of mechanisms, including the induction of suppressor cell
populations, the release of suppressive cytokines, and down-regulation of genes related to
antigen presentation. In order to develop new therapies targeting the immune escape of
these tumors, there is a need to elucidate further the complex interaction between
HNSCC and the host immune system. Pre-clinical models allow investigators to explore
this interaction in a controlled environment and to test novel immunotherapeutic drugs.
To this end, we have established a novel human cell line, USC-HN2, which was derived
from an
invasive, recurrent buccal HNSCC and found to have unique immune-
modulatory features. In particular, this cell line provides an excellent model for the
development of new suppressor cell-targeted immunotherapies for HNSCC.
Additionally, we have investigated the immune escape mechanisms in human
papillomavirus (HPV)
+
versus HPV
-
HNSCC, with the goal of identifying new targets for
immunotherapy. These studies demonstrated a general pattern of increased
immunogenicity and concurrent immunosuppression in patients with HPV
+
versus HPV
-

vi

HNSCC that could potentially be used to inform immunotherapy treatment of HNSCC
patients.

1
CHAPTER 1.
INTRODUCTION

Head and Neck Squamous Cell Carcinoma
Head and neck squamous cell carcinoma (HNSCC) is a common and aggressive disease
worldwide and despite advances in healthcare over the past several decades, the 5-year
mortality rate patients receiving appropriate and timely care remains under 50% [1,2].
Current standard of care treatment includes surgical resection, chemotherapy, and
radiation therapy. Approximately 52,000 new cases are diagnosed each year in the
United States, and of these 60-70% present with locoregionally advanced disease (stages
III, IVa, and IVb) [2,3]. In addition to the late stage at diagnosis, high rates of second
primary tumors and local and distant recurrence contribute to the significant morbidity
and mortality associated with this disease.

HNSCC can arise from a variety of locations along the upper aerodigestive tract
including the nasal cavity, sinuses, oral cavity, pharynx, and larynx (Figure 1.1). The
specific sequence of mutations involved in the tumorigenesis of HNSCC has not been
defined, however it is believed to be a multistep process (initiation, promotion and
progression) involving repeated exposure to carcinogenic agents [1]. This process leads
to what has been termed "field cancerization", indicating that large areas of the
aerodigestive tract epithelium demonstrate significant genetic abnormalities despite not
meeting the criteria for malignancy. This field cancerization helps to explain the high

2
rates of secondary tumor development and is important to the interpretation of data from
adjacent, histologically normal tissue [4]. The primary risk factors associated with
HNSCC are alcohol and tobacco use, and more recently human papillomavirus (HPV)
infection. There is also evidence that genetics and ethnicity may predispose some people
to the carcinogenic effects of these etiologic agents [4]. HNSCC is most common among
elderly males, however the increasing incidence among females and younger patients can
be attributed in part to rising levels of HPV-associated disease [1,5]. HPV
+
head and
neck cancer occurs primarily in the oropharynx (Figure 1.1) and despite late stage
presentation, has a more favorable prognosis than HPV
-
tumors. Due to the lack of
knowledge about the influence of HPV infection status on HNSCC patient response to
treatment, HPV testing is not part of routine clinical care at this time. One issue this work
seeks to address is whether HPV status could be used to guide treatment selection and
therefore should be evaluated in HNSCC patients.

3

Figure 1.1. Schematic of the upper aerodigestive tract demonstrating the locations in which head
and neck squamous cell carcinoma can arise.

Tumor Immune Escape
It is well established that the immune system is capable of recognizing and destroying
tumor cells, a phenomenon known as immune surveillance, however this complex
interaction between the immune system and cancerous cells also leads to cancer
immunoediting, whereby tumors evolve ways to escape immune destruction [6,7]. It has
been proposed that the process of cancer immunoediting proceeds through three distinct
phases termed: elimination, equilibrium, and escape. During the elimination phase, the
immune system eradicates tumor cells before they become clinically apparent. Tumor
cells that survive the elimination phase will enter the equilibrium phase, during which the

4
immune system controls tumor expansion and metastasis. During the escape phase, tumor
cells that have developed mechanisms to evade destruction and inhibition by the immune
system begin to grow rapidly. This ability of the immune system to influence the course
of tumor progression has lead researchers to investigate the prognostic and predictive
value of immune infiltration in cancer, as well as to look to immunotherapy for cancer
treatment.

Head and neck squamous cell carcinomas are particularly amenable to immunotherapy
treatment for several reasons: (1) HNSCCs are highly immune-modulatory tumors
indicating that the immune system plays an important role in their development and
progression. (2) High rates of recurrence and second primary tumors suggest that a
therapy that produces memory would significantly improve patient outcomes. (3) The
importance of head and neck tissues for quality of life combined with the invasive nature
of the disease means that traditional therapies, which lack specificity for malignant tissue,
often produce significant disability in speech and sight, as well as facial deformities. The
specificity of immunotherapy could significantly decrease the morbidity associated with
treatment in these individuals.

The main mechanisms through which HNSCC tumors escape destruction by the immune
system include evasion, direct suppression, and indirect suppression via recruitment of
suppressor cell populations. Up to 60% of HNSCC tumors evade immune recognition
through the down-regulation or loss of human leukocyte antigen (HLA) class I

5
molecules, and/or disruption of the antigen-processing machinery (APM), both of which
are necessary for proper recognition of tumor associated-antigens by cytotoxic T
lymphocytes (CTL) [8-10]. HNSCC tumors have also been shown to down-regulate
costimulatory B7 molecules (CD80, CD86) and to express the nonclassical human
leukocyte antigen HLA-G, known to inhibit NK cells, T cells and antigen presenting cells
(APC) [11]. Direct inhibition of effector responses is mediated by tumor cell expression
of cytotoxic ligands (e.g. FasL, PD-L1, PD-L2), which lead to apoptosis of activated
CTL, and release of immunosuppressive factors into the tumor microenvironment [e.g.
interleukin (IL)-10, IL-6, transforming growth factor (TGF)-β, prostaglandin E2 (PGE2),
and vascular endothelial growth factor (VEGF)] [12]. Lastly, tumor cells recruit and
expand suppressor cell populations, namely regulatory T cells (Treg), myeloid derived
suppressor cells (MDSC), and tumor associated macrophages (TAM) [9,12].

6
CHAPTER 2.
USC-HN2, A NEW MODEL CELL LINE FOR RECURRENT ORAL CAVITY
SQUAMOUS CELL CARCINOMA WITH IMMUNOSUPPRESSIVE
CHARACTERISTICS

INTRODUCTION
Cancer cell lines play an important role in studying the molecular biology of tumors and
in translating these findings to clinical applications. Cell lines provide a constant source
of tumor cells to be used for in vitro and in vivo mouse studies, without which our current
understanding of cancer would be severely hampered or delayed. While cancer cell lines
are not exactly representative of heterogeneous in vivo cancer cell populations, they have
been shown to reproduce many of the general properties of cancer cells, as well as the
genotypic and phenotypic characteristics of the cells from which they were derived [13].
These cell lines also offer a means by which to study cancer cells in a highly controlled
and reproducible environment. Cancer cell lines are particularly important in studying
the pathophysiology of tumors cells, including genetic and signal transduction pathways,
for screening and testing potential drugs, and also for identifying diagnostic signatures of
cancer
27
. More recently cancer cell lines have also been used to study the interaction
between the immune system and tumor cells [14,15]. Currently, few HNSCC cell lines
are publicly available for such studies [12 HNSCC cell lines are currently available
through the American Tissue-type Cell Collection (ATCC)], and many lack complete
characterization, particularly with respect to immune-modulatory characteristics.

7

This project describes the establishment and characterization of a unique HNSCC cell
line, USC-HN2, derived from an invasive, recurrent buccal squamous cell carcinoma
tumor. Additionally, USC-HN2 was compared to a previously established HNSCC cell
line, SCCL-MT1, which has not been characterized in the literature and was also found to
have strong immune-modulatory activity, a pre-requisite for tumor models that can
facilitate the development of new immunotherapies for these cancers.

MATERIALS AND METHODS

Cell lines and tissues
Tumor cell lines were obtained from ATCC or gifted to the Epstein laboratory and
authenticity was verified by cytogenetics and surface marker analysis as described
previously [16]. Cell lines were maintained in complete medium (RPMI-1640 with 10%
FCS, 2mM L-Glutamine, 100 U/ml Penicillin, and 100ug/ml Streptomycin) in a
humidified 5% CO2, 37°C incubator. Informed consent and HNSCC tumor biopsies were
obtained as described previously [16]. IRB approval from the USC Keck School of
Medicine (HS-09-00048) was obtained for the collection and use of HNSCC tumor
biopsies.

8
Establishment of cell line USC-HN2
Tumor explants were used to develop the USC-HN2 cell line, as described previously
[16]. After establishment of the cell line, interval screening was performed using
MycoAlert Mycoplasma Detection Kit (Lonza, Rockland, ME). Cell doubling time was
determined for USC-HN2 by cell count measurements at 24 hour intervals for one week.

Heterotransplantation in Nude mice
Eight-week-old female Nude mice (n=3, Simonsen Laboratory, Gilroy, CA) were
injected with cultured USC-HN2 cells for heterotopic (s.c. flank, 7.5x10
6
cells) or
orthotopic (base of the tongue, 3x10
6
cells) heterotransplantation studies. Tumor
measurements were made twice weekly and animals were sacrificed two (oral cavity) or
four (flank) weeks after implantation. Institutional Animal Care and Use Committee-
approved protocols were followed.

Immunohistochemistry (IHC)
Cytospin preparations of USC-HN2 cells from culture and tissue sections of the patient
biopsy and heterotransplanted tumors were used for IHC studies, as described previously
[16,17]. Wright-Giemsa staining (Protocol Hema 3, Fisher, Kalamazoo, MI) of USC-
HN2 and SCCL-MT1 cytospin preparations was performed to assess and compare
morphology, as described previously [16,17]. Both USC-HN2 cytospin and paraffin
tissue slides were stained for specific antigens with monoclonal antibodies including
CD44 (DF1485; Dako Corp., Carpinteria, CA), E-cadherin (4A2C7; Invitrogen,

9
Carlsbad, CA), EGFR (E30; Biogenex, San Ramon, CA), keratin (AE1/AE-3; Covance,
Berkeley, CA), p53 (1801; CalBiochem, San Diego, CA), Rb (RbG3-245; BD
Biosciences, San Diego, CA), p16 (INK4), and FABP5 (311215) (R&D Systems,
Minneapolis, MN). Observation, evaluation, and image acquisition were made as
described previously [16,17].

Analysis of surface markers by flow cytometry
Single cell suspensions (10
6
cells in 100µl) in 2% FCS in PBS were stained with
fluorescence-conjugated antibodies as described previously [16,17]. For intracellular
stains, buffer fixation/permeabilization (eBioscience, San Diego, CA) was performed
prior to staining. Antibodies were purchased from BD Biosciences: CD24 (ML5), CD74
(M-B741), E-cadherin (36/Ecadherin), EGFR (EGFR1), Nanog (N31-355), Oct 3/4
(40/Oct-3), SOX2 (245610), and isotype controls; Santa Cruz Biotechnology (Santa
Cruz, CA): IL-13Rα2 (B-D13), and c-kit (104D2); Abcam (Cambridge, MA): CD44v6
(VFF-7); and eBioscience: CD133 (TMP4) and isotype controls.

Cytogenetics and in situ hybridization
Karyotype analysis using Giemsa staining and in situ hybridization for HPV DNA
sequences were performed by the Division of Anatomic Pathology, City of Hope Medical
Center (Duarte, CA) using early passages of USC-HN2 and SCCL-MT1. Single color
FISH for HPV was performed using Enzo Life Sciences HPV16/18 probe (ENZO-32886,
Plymouth Meeting, PA) followed by tyramide signal amplification (TSA kit#21,

10
Invitrogen). Multi-color FISH using probes for unique chromosomal abnormalities found
in USC-HN2 (Abbott MYC breakapart probe 8q24 and Abbott probe 5-9-15) confirmed
the origin of the cell line from the patient tumor biopsy.

Microarray gene expression profiling
Total RNA was isolated from USC-HN2 and SCCL-MT1 using RNeasy Mini Kit
(Qiagen, Valencia, CA) and analyzed by microarray, as previously described [16].
Human universal RNA (huRNA; Stratagene, Santa Clara, CA) was used as a common
reference for all experiments. For data analysis, data files were uploaded into mAdb
database and analyzed by the software tools provided by the Center for Information
Technology (CIT), NIH. SAM (Significance Analysis of Microarray) and t-test analyses
were performed to identify differentially expressed genes. In addition, GSEA (Gene Set
Enrichment Analysis) [18] provided in mAdb was also performed to distinguish groups
of differentially expressed genes in these cell lines.

TP53 mutation analysis
Genomic DNA isolated as above was amplified using primers for exons 5-9 of TP53, as
described by Dai et al [19]. Purified PCR products were sequenced by the USC DNA
core facility using ABI 3730 DNA Analyzer (Applied Biosystems) and screened for
mutations using BLAST (http://blast.ncbi.nlm.nih.gov/Blast.cgi).

11

Cytokine and oncogene analysis by quantitative(q)RT-PCR
RNA was isolated from cultured USC-HN2 and SCCL-MT1 cells by RNeasy Mini Kit
(Qiagen, Valencia, CA) and DNase treated using Turbo DNase (Applied Biosystems,
Foster City, CA) per manufacturer instructions. For qRT-PCR, 100ng of DNase-treated
RNA was amplified with Power SYBR Green RNA-to-CT 1-Step Kit (AB) using primer
sequences from the NIH database [http://primerdepot. nci.nih.gov] synthesized by the
USC Core Facility. Amplification was performed on a Stratagene Mx3000P cycler with
MxPro software (Strategene, La Jolla, CA). Gene-specific amplification was normalized
to GAPDH and fold change in gene expression calculated relative to human reference
RNA (Stratagene).

Measurement of tumor-derived factors by ELISA
Three-day supernatants were collected from cell line cultures at 90% confluence, 0.2µm-
filtered to remove cell debris, and analyzed for protein levels of IL-1β, IL-6, IL-8, TNFα,
VEGF, and GM-CSF using ELISA DuoSet kits (R&D). Plate absorbance was read on an
ELX-800 plate reader (Bio-Tek, Winooski, VT) and analyzed using KC Junior software
(Bio-Tek).

Induction of regulatory T cells and myeloid-derived suppressor cells
USC-HN2 and SCCL-MT1 cell lines were tested for induction of regulatory T cells
(Treg) and myeloid-derived suppressor cells (MDSC) as described previously [15,20].

12
Briefly, PBMCs obtained from healthy volunteers were co-cultured in complete medium
with tumor cell (6x10
5
cells/mL) for one week. Tumor cells were seeded to achieve
confluence by day seven. After co-culture, CD33
+
or CD4
+
CD25
high
cells were isolated
by magnetic bead separation and tested for suppressive function by their ability to inhibit
the proliferation of fresh, autologous CD3/CD28-stimulated CFSE-labeled (3µM) T cells
in vitro. T cell proliferation was measured by flow cytometry after three days.

Statistical analysis
To identify statistically significant differences in gene and protein expression by HNSCC
cell lines and T cell proliferation, one-way ANOVA followed by Dunnett post-test was
applied. Statistical analyses for microarray experiments are described above. Statistical
tests were performed using GraphPad Prism software (La Jolla, CA) at a significance
level of α=0.05. Graphs and figures were produced using GraphPad Prism, Microsoft
Excel, and Adobe Illustrator and Photoshop software.

RESULTS
Case report of patient with recurrent invasive left buccal squamous cell carcinoma
The patient is an 81-year-old female with a 50-pack-year history of tobacco smoking and
occasional alcohol consumption and a past medical history of recurrent left sided oral
cancer. The patient was initially diagnosed in April, 2002 following surgical resection of
a moderate-to-poorly differentiated SCC of the oral cavity with a second surgical
resection for recurrence in August, 2002. The patient underwent a third surgical resection

13
for suspected recurrence in August, 2009 which revealed a 4cm moderately differentiated
SCC of the buccal mucosa with bone and perineural invasion, but no evidence of vascular
invasion or tumor metastasis to submental, submandibular, maxillary, oral cavity, or floor
of mouth lymph nodes (Stage IV, T4N0M0; Figure 2.1A). The patient did not receive any
radiation or chemotherapy treatment and is currently tumor-free and continues to have
routine follow-up at the USC University Hospital.

Establishment of USC-HN2 cell line
The USC-HN2 cell line was derived from the patient’s recurrent buccal mucosal SCC
resected in August, 2009 using culture flask-adherent explant fragments. After 2-3
weeks, tumor cells were removed by trypsinization and placed in petri dishes for cloning
procedures required to isolate a cell line from normal stromal cells. USC-HN2 cells have
rapid doubling time of 22 hours, which is comparable to the previously reported growth
rates of other HNSCC cell lines (26.5 hours) [21]. Once a morphologically uniform
population of cells was established, several freezings were performed to obtain early
passages of USC-HN2 and several vials were sent to ATCC for distribution to other
investigators.

14
Figure 2.1. Histology and morphologic analysis of USC-HN2. (A) (Left panels) H&E stained
sections of the original tumor show groups of cells infiltrating the stroma with a desmoplastic and
dense lymphoplasmacytic reaction, and occasional keratin pearl formation (arrow). Cells show
increased nuclear to cytoplasmic ratio with prominent nucleoli and scattered mitotic figures
(H&E x200 and x400 original magnification). (Right panels) Subcutaneous heterotransplantation
of USC-HN2 cell line demonstrates a keratinizing tumor (arrow) that recapitulates the original
tumor histology (H&E x200 and x400 original magnification). (B) Phase-contrast
photomicrographs (top, x100 original magification) and Wright-Giemsa-stained cytospins
(bottom, x200 original magnification) of USC-HN2 and SCCL-MT1 cells. Both cell lines
demonstrate squamous cell morphology with varied numbers of mitotic cells (rounded,
luminescent cells).

15
Heterotransplantation in Nude mice
USC-HN2 cells from cell culture were injected in the oral cavity or subcutaneously in
athymic Nude mice (n=3) and tumors were excised after two (tongue) or four
(subcutaneous) weeks (Figure 2.1A). Subcutaneous tumors grew to between 110mm
3
and
150mm
3
and oral cavity tumors were excised once visible tumors had grown (3mm
3
; data
not shown). H&E stained sections of the heterotransplants showed a moderately to
poorly differentiated, keratinizing SCC. Surrounding the invasive tumor, a mild to
moderate chronic and acute inflammatory infiltrate was present. These findings
demonstrate that USC-HN2 is transplantable in xenograft models and that
heterotransplanted tumors closely resembled the original tumor.

Morphology of USC-HN2 cell line is typical of oral cavity squamous cell carcinoma
Phase-contrast photomicrographs of cultured cells and Wright-Giemsa stained cytospins
were used to assess the morphology of USC-HN2 cell line as compared to the established
HNSCC cell line SCCL-MT1 (Figure 2.1B). Both cell lines demonstrated characteristic
features of oral cavity squamous cell carcinoma. USC-HN2 cells showed nuclear
pleomorphisms with prominent nucleoli, frequent mitotic figures, and an abundant,
vacuolated cytoplasm.

16
Cytogenetics
Cytogenetic analysis of USC-HN2 was performed in order to confirm the unique identify
of this cell line and origin from the original tumor sample. All mitotic cells collected for
GTG-band analysis from USC-HN2 cell cultures were clonally abnormal. The karyotype
of USC-HN2 contains characteristic features of HNSCC, including isochromosome
formation with resultant loss/deletion of the short arm of chromosome 8, and breakpoints
at or near the centromeres (Figure 2.2A) [1]. Multi-color FISH shows similar
chromosomal abnormalities in the original tumor biopsy specimen including
isochromosome 8 formation and trisomy 5 and 9 (Figure 2.3). Additionally, cytogenetic
analysis of the SCCL-MT1 cell line demonstrates typical features of HNSCC and
confirms the unique identity of this cell line (Figure 2.2B).

17
Figure 2.2. Cytogenetic analysis of USC-HN2 and SCCL-MT1. (A) The karyotype of USC-
HN2 shows a hyperdiploid cell line characterized by unbalanced translocation suspected to occur
between the short arm of chromosome 2 and the distal long arm of chromosome 18, trisomy 5 and
9, partially trisomy for distal 2p, and tetrasomy for 8q with a modal number of 50 chromosomes.
(B) The karyotype of SCCL-MT1 also contains characteristic features of HNSCC.

18

Figure 2.3. Multi-color FISH analysis of USC-HN2. Multi-color FISH to verify that the USC-
HN2 cell line was derived from malignant cells present in the primary tumor. Cell line signal
patterns correlated very well with the original tumor.

Phenotype of USC-HN2 cell line and heterotransplants closely resemble the original
tumor biopsy
Immunophenotypic characterization of USC-HN2 cells in culture and tumors grown in
Nude mice demonstrated similarity to the original tumor and confirmed a keratinizing
squamous cell carcinoma (Figure 2.4). Neither the original tumor nor USC-HN2 cell line
expressed CD45, S100, or vimentin, consistent with its epithelial origin. USC-HN2 cells
demonstrate positive expression of keratin, FABP5, E-cadherin, and CD44, as well as

19
strong nuclear Rb and p53 expression in situ, consistent with HNSCC and the original
tumor biopsy [1,21-24]. EGFR and CD44 staining was increased in the cytospin and
heterotransplant samples in comparison with the original tumor biopsy.

20
Figure 2.4. Characterization of the original tumor biopsy, USC-HN2 cell line, and
heterotransplanted tumor. Photomicrograph of immunoperoxidase staining of original tumor
biopsy (left panels), USC-HN2 cells from culture in cytospin preparations (middle panels), and
formalin-fixed paraffin-embedded tissue sections of USC-HN2 Nude mouse subcutaneous
heterotransplant (right panels) for CD45, S100, Vimentin, p53, Rb, EGFR, FABP5, E-cadherin,
CD44, and Keratin (x400 original magnification).

21

Flow cytometry studies were completed to characterize the phenotype of USC-HN2
compared with SCCL-MT1 (Table 1). Compared to isotype controls, both cell lines
displayed positive staining for HNSCC biomarkers EGFR, CD24, E-cadherin, and
CD44v6, whereas staining for CD74, CD133, and IL-13Rα2 was negative [21,25-27].
Expression of stem cell-associated transcription factors c-KIT, NANOG, OCT3/4, and
SOX2 was measured, and with the exception of positive staining for c-KIT in SCCL-
MT1, these factors were not detected (data not shown)[28,29].

22
% Positive MFI
Target
Isotype
Control Antibody
Isotype
Control Antibody

USC-HN2
CD24 0.90 76.11 56.76 609.77**
E-cadherin 0.90 35.81 56.76 303.60**
EGFR 0.72 92.84 21.38 479.34**
CD44v6 0.90 7.75 56.76 152.86*
CD74 0.90 0.49 56.76 41.59
CD133 0.79 0.61 32.68 26.84
IL-13Rα2 0.38 0.24 19.23 12.15

SCCL-MT1
CD24 1.37 24.7 65.13 203.06**
E-cadherin 1.37 8.87 65.13 215.69**
EGFR 0.34 98.34 16.20 1392.73**
CD44v6 1.37 6.03 65.13 133.36*
CD74 1.37 0.61 65.13 49.12
CD133 1.32 0.98 31.02 27.16
IL-13Rα2 1.04 0.27 24.13 13.44

* MFI 50-100 above isotype control
** MFI >100 above isotype control

Table 2.1. Analysis of USC-HN2 surface markers by FACS. Flow cytometry studies of USC-
HN2 and SCCL-MT1 demonstrate surface markers characteristic of HNSCC cell lines. Percent
of positive staining cells (middle columns) and mean fluorescence intensity (MFI, right columns)
are shown for each antibody target and isotype control. Positive findings are shown in bold.

USC-HN2 has increased expression of immune modulatory cytokines
The expression of pertinent oncogenes and cytokines was examined for USC-HN2 and
SCCL-MT1 using qRT-PCR techniques. USC-HN2 showed a statistically significant
increase in mean expression of immune modulatory cytokines IL-1β, IL-6, and IL-8 as
compared to human reference RNA (Figure 2.5A, p<0.0005), which was confirmed at the
protein level by ELISA techniques (Figure 2.5B, p<0.05). Both cell lines demonstrated
significant protein secretion of GM-CSF and VEGF, though mRNA expression was not

23
significantly increased for these genes. USC-HN2 also had increased TNFα protein
levels compared with SCCL-MT1. The overall expression profile of USC-HN2 is highly
immune modulatory and closely resembles that of SCCL-MT1.

24
Figure 2.5. USC-HN2 is highly immunomodulatory and induces suppressor cells. (A) qRT-
PCR analysis of cytokine mRNA levels in USC-HN2 and SCCL-MT1 compared with human
reference RNA. Both cell lines both showed increased expression of IL-1β, IL-6, IL-8, and
COX2. (B) Secreted protein levels measured by ELISA confirmed similar, highly
immunomodulatory cytokine profiles for USC-HN2 and SCCL-MT1. (C) USC-HN2 and SCCL-
MT1 induced strongly suppressive MDSC after one-week co-culture with healthy donor PBMC.
For all samples mean (n≥2) data shown +SD; *indicates p<0.05.

25

To elucidate further the functional implications of the cytokine studies, both cell lines
were assessed for their ability to induce Treg and MDSC suppressor cell populations
from healthy volunteer peripheral blood mononuclear cells after one-week co-culture
using methods established in our laboratory [15,20]. Suppressive function of tumor-
educated CD33
+
MDSC or CD4
+
CD25
high
Treg cells was assessed by their ability to
inhibit the proliferation of fresh, autologous T cells stimulated with CD3/CD28 beads in
vitro. USC-HN2 and SCCL-MT1 both induced strongly suppressive MDSC (Figure 5C)
and weakly suppressive Treg cells (data not shown), consistent with previous reports that
demonstrate HNSCC to be highly immune modulatory in patients [14,15,20,24].

Microarray gene expression analysis
Results of microarray gene expression analyses from USC-HN2 and SCCL-MT1 cell
lines were compared with the data obtained from previously reported HNSCC tumor
biopsy samples [22]. A total of 243 genes were significantly differentially expressed in
both USC-HN2 and SCCL-MT1 cell lines. Many of the up-regulated genes identified
were also present in HNSCC tumor biopsies, suggesting that USC-HN2 has an
expression profile typical of HNSCC (Table 2).

26
GeneBank
Access ID
Gene Symbol (Annotation) Log
2
Ratio

Immune Response

NM_002117 HLA-C (major histocompatibility complex, class I C) 2.6
NM_004048 B2M (beta-2 microglobulin) 2.1
NM_005514 HLA-B (major histocompatibility complex, class I B) 1.8
NM_002116 HLA-A (major histocompatibility complex, class I A ) 1.7
NM_013230 CD24 (CD24 antigen) 1.3

Cell Growth, Maintenance/Cell cycle Regulation

NM_000424 KRT5 (keratin 5) 2.9
NM_000526 KRT14 (keratin 14) 2.0
NM_033666 ITGB1 (integrin, beta 1) 2.0
NM_002273 KRT8 (keratin 8) 1.5
NM_006088 TUBB2C (tubulin beta 2C) 1.5
NM_006082 TUBA1B (tubulin alpha 1b) 1.4
NM_005507 CFL1 (cofilin 1) 1.3
NM_002628 PFN2 (profilin 2) 1.3
NM_005022 PFN1 (profilin 1) 1.0
NM_004360 CDH1 (E-cadherin) 1.0

Translation and Protein Synthesis

NM_000971 RPL7 (ribosomal protein L7) 1.7
NM_006013 RPL10 (ribosomal protein L10) 1.4
NM_000979 RPL18 (ribosomal protein L18) 1.2
NM_001042559 EIF4G2 (translation initiation factor 4 gamma 2) 1.2
NM_001006 RPS 3A (ribosomal protein S3A) 1.2

Metabolism

NM_001135700 YWHAZ (tyrosine-3-monooxygenase/tryptophan 5-
monooxygenase activation protein, zeta)
2.5
NM_002808 PSMD2 (proteasome 26S subunit) 1.8
NM_002794 PSMB2 (proteasome subunit beta 2) 1.6
NM_021130 PPIA (peptidylprolyl isomerase A (cyclophilin A)) 1.5
NM_005561 LAMP1 (lysosomeal-associated membrane protein 1) 1.4
NM_001165415 LDHA (lactate dehydrogenase A) 1.4
NM_005348 HSP90AA1 (heat shock 90kDa alpha class A member 1) 1.4
NM_001689 ATP5G3 (ATP synthase H+ transporting subunit) 1.0
NM_002715 PPP2CA (protein phosphatase 2 catalytic subunit) 1.0

Table 2.2. Selected up-regulated genes identified in USC-HN2 and SCCL-MT1 cell lines
also present in HNSCC tumor biopsies. Log
2
ratio of 1 signifies a 2-fold difference in the
mean gene expression of the cell line versus human reference RNA (p<0.05).

27
GeneBank Access
ID
Gene Symbol (Annotation) Log
2
Ratio
Others
NM_005978 S100A2 (S100 calcium binding protein A2) 2.8
NM_005953 MT2A (metallothionein 2A) 2.6
NM_003329 TXN (thioredoxin) 2.3
NM_006096 NDRG1 (N-myc downstream regulated 1) 2.2
NM_021103 TMSB10 (thymosin, beta 10) 1.9
NM_021009 UBC (ubiquitin C) 1.7
NM_199185 NPM1 (nucleophosmin) 1.6
NM_001428 ENO1 (enolase 1) 1.2

Table 2.2, Continued.

Viral Screen and TP53 mutation analysis
Both cell lines, as well as the original tumor tissue used to derive USC-HN2 (SCCL-MT1
original tumor not available) were screened for HPV by in situ hybridization (Figure 2.6).
Consistent with the oral cavity origin of these cell lines, no evidence of HPV 16 or 18
was found [5,19]. DNA from the each of the cell lines was also screened for TP53
mutations, which are found in approximately half of all HNSCC tumors and are typically
absent in HPV
+
samples [1,19]. TP53 mutations were identified in SCCL-MT1, but not in
USC-HN2 (data not shown).

28

Figure 2.6. HPV Viral Screen of USC-HN2 and SCCL-MT1. Single color FISH using an
HPV16/18 probe demonstrates the HPV- status of USC-HN2 and SCCL-MT1 cell lines as
compared with the HPV+ control cell line HeLa.

DISCUSSION
In this report, we describe the establishment and characterization of USC-HN2, a novel
cell line derived from a patient with recurrent, invasive HPV
-
buccal SCC with a past
medical history significant for a 50-pack-year history of tobacco smoking and no pre-
operative chemotherapy or radiation therapy. USC-HN2 cultured cells and
heterotransplanted tumors closely resembled the original tumor biopsy specimen with
respect to morphology, HNSCC-associated markers (keratin, E-cadherin, FABP5), HPV
infection, and cytogenetic abnormalities. One difference noted was the outgrowth of a
highly proliferative, EGFR
+
subclone from a largely EGFR
-
original tumor during
establishment of the cell line. Overall, USC-HN2 showed similar morphology, growth

29
rate, phenotype, and tumor suppressor and oncogene expression to the previously
established HNSCC cell line SCCL-MT1.

Immune evasion and suppression are two mechanisms by which tumors escape immune
destruction and evidence exists for the employment of both by HNSCC tumors [8,30].
The results of this study revealed USC-HN2 and SCCL-MT1 to be highly immunogenic
tumor models with strong immune suppression capacity. Additionally, the USC-HN2
cultured cells and heterotransplants, as well as the SCCL-MT1 cells, showed strong
positivity for the cancer stem cell marker CD44v6. Cancer stem cell populations within
tumors are reported to have greater expression of immunogenic tumor-associated
antigens [13,31], a hypothesis that was supported here by microarray data demonstrating
significant up-regulation of antigen-presentation-related genes in USC-HN2 and SCCL-
MT1. In order for immunogenic tumor cells to persist in the face of infiltrating host
immune cells, they must adapt to acquire immunosuppressive capabilities, such as the
release of immune-inhibitory factors or the recruitment of immune suppressor cells [8].
In this study we demonstrate that both USC-HN2 and SCCL-MT1 have strong
immunosuppressive capabilities, including elevated expression of inflammatory and Th2
cytokines IL-1β, IL-6, IL-8, GM-CSF, and VEGF. Previously, we have identified IL-1β,
IL-6, and GM-CSF as key factors for the induction of myeloid-derived suppressor cells, a
population of innate immune suppressor cells that mediate direct suppression of effector
T cells and expand regulatory T cell populations [20]. Indeed, co-culture of USC-HN2

30
and SCCL-MT1 with normal healthy donor PBMC generated functionally suppressive
MDSC and Treg in vitro. Of note, when compared to six other established HNSCC cell
lines (SCC-4, FaDu, Cal27, SW2224, Sw451, RPMI 2650) USC-HN2 and SCCL-MT1
were found to be the most potent inducers of suppressive MDSC, a finding which
correlated with their high expression of immune modulatory cytokines [15].

Immunotherapy seeks to overcome tumor-mediated immune dysfunction and activate a
cell-mediated immune response against cancer cells. Such an approach holds great
promise for reducing damage to collateral tissue by taking advantage of the inherent
specificity of the human immune system. Systemic trafficking and monitoring by
immune cells also provides for superior treatment of metastatic and inoperable lesions
compared with external beam irradiation and surgical therapies. Perhaps most
importantly, the generation of immunologic memory following a robust anti-tumor
immune response prevents the recurrence of tumors. While immune stimulatory
treatment strategies have shown success in a variety of solid tumors, immunotherapeutic
approaches in HNSCC have proven difficult perhaps in part due to the profound immune
suppression generated by these tumors [8]. New pre-clinical models are needed with
which to study the mechanisms of immune suppression in HNSCC and develop new
targeted immunotherapies. USC-HN2 and SCCL-MT1 appear to model highly
immunogenic cancers with robust cytokine production and strong induction of suppressor
cell populations as compared with other available HNSCC cell lines. Based upon these

31
results, USC-HN2 and SCCL-MT1 provide excellent models for the development of new
suppressor cell-targeted therapies for these difficult to treat tumors.

ACKNOWLEDGEMENTS
The authors thank Lillian Young for performing the IHC studies, James Pang for his
assistance with the animal studies, and Victoria Bedell and the City of Hope Cytogenetic
Core Facility for performing expert cytogenetic and HPV FISH studies.

32
CHAPTER 3.
DIFFERENCES IN IMMUNE ESCAPE IN HPV
+
VERSUS HPV
-
HEAD AND
NECK SQUAMOUS CELL CARCINOMA

INTRODUCTION
Head and neck squamous cell carcinoma is a devastating and deadly disease leading to
352,000 cancer deaths worldwide each year and significant morbidity associated with
tumor therapies [2]. Current standard-of-care treatments including surgical resection,
chemotherapy and radiation still lead to high rates of recurrence and loco-regional
metastasis contributing to the poor prognosis in these patients. This aggressive
malignancy is associated with a variety of etiologic agents including alcohol
consumption, tobacco use, and more recently human papillomavirus (HPV) infection
[1,5]. HPV has been implicated in the etiology of a subset of HNSCC, often arising in
younger patients without a history of alcohol or tobacco use [1,5]. Approximately 30%
of HNSCC tumors are HPV
+
and despite late stage presentation, often have a better
prognosis and response to therapy [32]. HPV
+
tumors are now considered to be a distinct
biomodel from HPV
-
HNSCC, whereby cellular transformation occurs secondary to
virally-mediated degradation of tumor suppressor proteins p53 and Rb rather than
mutation inactivation of genes p53 and p16INK4 (Rb pathway downstream component),
as is seen in tumors from patients with significant smoking or alcohol use and no HPV
infection [1,2,5]. At this time, however, the use of HPV infection status to direct care or
prognosis is still investigational.

33

While it is well established that HNSCC are highly immune-modulatory tumors,
conflicting results on the significance of different immune cell subsets, patterns of
immune cell activity, and correlation of immune infiltration with prognosis and treatment
outcomes, has made it difficult to use this information to improve care of HNSCC
patients [33]. Distel el al. demonstrated that intratumoral CD8
+
and CD20
+
immune cell
infiltration correlated with improved prognosis in only early stage disease [34], whereas
Pretcher et al. found no association between tumor infiltrating immune cells at the
primary site and outcome [35]. These same immune cell populations in metastatic lymph
nodes were, however found to be associated with improved prognosis [35]. While
neither of these investigators found an association between Treg and prognosis, Baduoul
et al. demonstrated that infiltration with regulatory FoxP3
+
CD4
+
T cells was positively
associated with locoregional control [36]. Additionally, while it has been demonstrated
that HPV specific T cells are increased in the peripheral blood and tumors of patients
with HPV
+
HNSCC [37], further studies are needed to fully characterize the immune
response in HPV
+
versus HPV
-
HNSCC. This exploratory study examines how host
immune recognition and response varies between HPV
+
and HPV
-
HNSCC, with the goal
of elucidating new markers of prognosis and identifying new targets and approaches for
immunotherapy.

34
MATERIAL AND METHODS

Tissue Samples
Fresh tumor samples (n=32) and formalin-fixed paraffin embedded tissue sections (n=28)
were collected from patients who underwent surgical resection of HNSCC at USC
University Hospital or Los Angeles County Hospital between 2009 and 2011. Normal
tissue resected as a result of standard surgical procedures was also collected for a subset
of patients (n = 7). All patient specimens and clinical data were obtained with written
informed consent under the USC Keck School of Medicine IRB-approved protocol HS-
09-00048.

HPV Infection Status
Genomic DNA was isolated from fresh tumor specimens using TRIreagent (Sigma) per
manufacturer's instructions. For PCR, 50-100 ng of DNA was amplified using previously
reported consensus primers MY09/MY11 (expected product ~450 bp) and GP5+/GP6+
(expected product ~150 bp) [38,39]. All samples were run with a negative (H
2
0) and
positive control (HeLa cell line DNA). All samples that were found to be positive for
HPV by PCR were confirmed using p16 (INK4; BD Pharmingen) staining of formalin-
fixed paraffin embedded sections by immunohistochemistry, as described below.

35
Immunohistochemistry (IHC)
Sections cut from formalin-fixed paraffin embedded (FFPE) tissue were deparaffinized,
rehydrated, and subjected to heat induced antigen retrieval (0.01 M citrate, pH 6.0)
followed by 3% H
2
O
2
for 10 min to block endogenous peroxidase activity. Sections were
incubated with primary antibodies against CD3 (ab5690; Abcam), CD8 (C8/144B;
Dako), CD16 (0.N.82; Santa Cruz), CD20 (L26; Dako), CD68 (PGM1; Dako), FoxP3
(NBPI-43316; Novus), HLA-DR (LN-3), HLA-A (A18; Santa Cruz), HLA-G (4H84;
Santa Cruz) and TAP (H-300; Santa Cruz) overnight at 4°C. Vectastain ABC kit (Vector
Laboratories, Burlingame, CA) was applied, per manufacturer's instructions, followed by
detection with 3,3'-diaminobenzidine (DAB). Sections were counterstained with
hematoxylin, dehydrated, and mounted. Appropriate positive and negative controls were
used for all stains. H&E stained sections of tumor samples from each case were
obtained from USC University Hospital following surgical resection.

IHC Scoring
To develop an immune scoring system for these studies we completed a review of the
published English literature on PubMed using the following search term "systematic
immune scoring" from 1991-2011 and read reviews examining immune infiltrate and
tumor prognosis. A draft of the scoring system was then adapted for HNSCC with
guidance from Adrian Correa, an academic head and neck pathologist at the USC
University Hospital. Immunostained sections were scored for immune cell infiltration in
two regions of the tumor: at the invasive margin and in tumor cell nests. For each

36
immune cell stain (CD3, CD8, CD20, CD16, CD68, FoxP3, and HLA-DR), five high-
powered fields (x400 magnification) were assessed in each tumor region. At the invasive
margin of the tumor, the percentage of positively stained immune cells was estimated
(Figure 3.1). The number of positively stained cells infiltrating the tumor cell nests was
counted for each high-powered field. A categorical scale was used for CD20 (0 cells, 1-5
cells, >5 cells) and CD16 (<15 cells, 15-40 cells, >40 cells) intratumoral immune cell
infiltration. Two independent observers scored each section and a third observer was
consulted if consensus was not reached. The tumor cells were also assessed for
expression of HLA-A, HLA-G, and HLA-DR and scored as either negative (<10% of
nucleated tumor cells stained positively) or positive (>10% of nucleated tumor cells
stained positively) (Figure 3.2).

37
Figure 3.1. Immune Cell Stains. Sample images of immunohistochemical stains for CD3
+
T
cells, CD8
+
T cells, FoxP3
+
Treg, CD20
+
B cells, CD16
+
NK cells, CD68
+
macrophages and
HLA-DR
+
antigen presenting cells on patient tumor specimens (200x original magnification).
Figure 3.2. Human Leukocyte Antigen Stains. Sample images of immunohistochemical stains
for HLA-A, HLA-G, and HLA-DR on patient tumor specimens. The top row of images
demonstrates positively stained tumors and the bottom row shows negatively stained specimens
(200x original magnification).

38
Quantitative RT-PCR (qRT-PCR)
Total RNA was extracted by tissue homogenization with RNeasy mini isolation kit
(Qiagen) and DNase treated using Turbo DNase (Applied Biosystems, Foster City, CA)
per manufacturer instructions. For qRT-PCR, 100ng of DNase-treated RNA was
amplified with Power SYBR Green RNA-to-CT 1-Step Kit (AB) using the primer
sequences displayed in Table 1. The USC Core Facility synthesized all primers.
Amplification was performed on a Stratagene Mx3000P cycler with MxPro software
(Strategene, La Jolla, CA). Gene-specific amplification was normalized to GAPDH.
Human reference RNA (Stratagene) was used as a control. Differences in mean gene
expression were compared across HPV
+
tumors, HPV
-
tumors, normal tissue, and human
reference RNA using a one-way ANOVA followed by Dunnetts test for pairwise
comparisons.

39
Target Forward Primer Reverse Primer
4-1BBL 5' - CTTCACCGAGGRCGGAATAA - 3' 5' - GTCCAACTTGGGGAAGGAGT - 3'
ARG-1 5' - GTTTCTCAAGCAGACCAGCC - 3' 5' - GCTCAAGTGCAGCAAAGAGA - 3'
B7H4 5' - CCCTGAAATACCAAAGCCAA - 3' 5' - AGCTCCACTCAGCCAGTACC - 3'
CBLB 5' - GACCATTGGGAAAGATTGCT - 3' 5' - GAAAAAGTCAAAACGGGCAA - 3'
CD1c 5' - ACTGTCCCAGCCATGAGTCT - 3' 5' - TTCTTCTCCCAGGTGGTGAC - 3'
CD4 5' - CTTGGTCCCAAAGGCTTCTT - 3' 5' - AGCTTCCCAGAAGAAGAGCA - 3'
CD11b 5' - AGAGAGCTTGGAGCCTGCTA - 3' 5' - ACGTAAATGGGGACAAGCTG - 3'
CD25 5' - TAGGCCATGGCTTTGAATGT - 3' 5' - GTCCCAAGGGTCAGGAAGAT - 3'
CD33 5' - TTCCTCCTGTGGGTCTTCAC - 3' 5' - CTTTCCAGGAGATGGCTCAG - 3'
CD62L 5' - CTTTCACCAAGGGCGATTTA - 3' 5' - AACCCCCTCTTCATTCCAGT - 3'
CD80 5' - CATTGTGACCACAGGACAGC - 3' 5' - GGGAACATCACCATCCAAGT - 3'
CD83 5' - TCCTGAGCTGCGCCTACAG - 3' 5' - GCAGGGCAAGTCCACATCTT - 3'
CD86 5' - TGGAACCAACACAATGGAGA - 3' 5' - AAAAAGGTTGCCCAGGAACT - 3'
COX2 5' - TTCAAATGAGATTGTGGGAAAATTGCT - 3' 5' - AGATCATCTCTGCCTGAGTATCTT - 3'
CTLA4 5' - CACACACAAAGCTGGCGAT - 3' 5' - CTCAGCTGAACCTGGCTACC - 3'
CXCR3 5' - CCAACCACAAGCACCAAAG - 3' 5' - GCTGAAGTTCTCCAGGAGGG - 3'
FasL 5' - GTCTACCAGCCAGATGCACA - 3' 5' - CAGAGGCATGGACCTTGAGT - 3'
FoxP3 5' - AGGTCTGAGGCTTTGGGTG - 3' 5' - TTCTGTCAGTCCACTTCACCA - 3'
GAPDH 5' - CTCTGCTCCTCCTGTTCGAC - 3' 5' - TTAAAAGCAGCCCTGGTGAC - 3'
GITRL 5' - TGCCATTTTGAGGGTAATGG - 3' 5' - AAGCTGTGGCTCTTTTGCTC - 3'
GNLY 5' - ACCTCCCCGTCCTACACAC - 3' 5' - AGGGTGACCTGTTGACCAAA - 3'
GZMB 5' - CCGCACCTCTTCAGAGACTT - 3' 5' - CAACCAATCCTGCTTCTGCT - 3'
IDO 5' - GGCAAAGGTCATGGAGATGT - 3' 5' - CTGCAGTCTCCATCACGAAA - 3'
IFNγ 5' - TGTATTGCTTTGCGTTGGAC - 3' 5' - TGACCAGAGCATCCAAAAGA - 3'
IFNa 5' - TTATCCAFFCTGTGGGTCTC - 3' 5' - GCAAGCCCAGAAGTATCTGC - 3'
IL-2 5' - TCCCTGGGTCTTAAGTGAAA - 3' 5' - CAAACTCACCAGGATGCTCA - 3'
IL-4 5' - AGCGAGTGTCCTTCTCATGG - 3' 5' - CAGCCTCACAGAGCAGAAGA - 5'
IL-6 5' - CATTTGTGGTTGGGTCAGG - 3' 5' - AGTGAGGAACAAGCCAGAGC - 3'
IL-10 5' - GCCACCCTGATGTCTCAGTT - 3' 5' - GTGGAGCAGGTGAAGAATGC - 3'
IL-12 5' - GGTAAACAGGCCTCCACTGT - 3' 5' - CACTCCCAAAACCTGCTGAG - 3'
iNOS 5' - ATTCTGCTGCTTGCTGAGGT - 3' 5' - TTCAAGACCAAATTCCACCAG - 3'
IRF-1 5' - AGGCATCCTTGTTGATGTCC - 3' 5' - GACCCTGGCTAGAGATGCAG - 3'
MPO 5' - GGTTGTGCTCCCGAAGTAAG - 3' 5' - GATGACCCCTGTCTCCTCAC - 3'
NKG2D 5' - ACAGCTGGGAGATGAGTGAATTTC - 5' 5' - TGACTTCACCAGTTTAAGTAAATCCTG - 3'
OX40L 5' - TTTCATCCTCCTTTTGGGAA - 3' 5' - TCACCTACATCTGCCTGCAC - 3'
PDL1 5' - TATGGTGGTGCCGACTACCAA - 3' 5' - TGCTTGTCCAGATGACTTGG - 3'
PDL2 5' - TGACTTCAAATATGCCTTGTTAGTG - 3' 5' - GAAGAGTCCTTAGTGTGGTTATATG - 3'
SOCS-1 5' - TTTTTCGCCCTTAGCGGGAA - 3' 5' - CTGCCATCCAGGTGAAAGC - 3'
STAT3 5' - CATCCTGCTAAAATCAGGGG - 3' 5' - GTCTCTCCCCCTCGGCT - 3'
TGF-β 5' - GCAGAAGTTGGCATGGTAGC - 3' 5' - CCCTGGACACCAACTATTGC - 3'
VCAM-1 5' - GTCTCCAATCTGAGCAGCAA - 3' 5' - TGAGGATGGAAGATTCTGGA - 3'
VEGFa 5' - CACACAGGATGGCTTGAAGA - 3' 5' - AGGGCAGAATCATCACGAAG - 3'

Table 3.1. Primer Sequences. Primer sequences used for qRT-PCR analysis of gene expression.

40
Statistical Methods
Mann-Whitney U tests (for unpaired comparisons without the assumption of a normal
distribution) were used to compare mean immunohistochemistry immune cell scores
(CD3, CD8, CD20, CD16, CD68, FoxP3, HLA-DR) for HPV
+
versus HPV
-
tumors.
Fisher’s Exact tests (number per cell less than 5) were used to compare the proportion of
positive samples in HPV+ versus HPV- tumors for the following stains: HLA-A, HLA-G,
and HLA-DR. All p-values are reported. For planned analyses of the following markers
by immunohistochemistry (CD3, CD8, CD16, FoxP3) both intratumorally and at the
invasive margin, significance is reported with a Bonferroni adjustment for α to 0.006. To
identify statistically significant differences in the gene expression measured by qRT-PCR
across the following groups: HPV
+
tumors, HPV
-
tumors, normal patient samples, and
human reference RNA, one-way ANOVA followed by Dunnet post-test was applied and
Anova p-values are reported. For these exploratory studies, α was not adjusted for
multiple comparisons. Statistical tests were performed using GraphPad Prism software
(La Jolla, CA) and SAS at a significance level of α = 0.05 unless otherwise specified.
Two-sided tests were used for all statistical analyses. Graphs and figures were produced
using GraphPad Prism, Microsoft Excel, and Adobe Illustrator and Photoshop software.

41
RESULTS

Clinical Data
Fresh tumor samples (n=32) and formalin-fixed paraffin embedded tissue sections (n=28)
were collected from patients who underwent surgical resection of HNSCC at USC
University Hospital or Los Angeles County Hospital between 2009 and 2011. As shown
in Table 2, primary tumor sites included 12 oral cavity, 15 oropharynx, 1 hypopharynx, 2
larynx, and 3 sinonasal. The study population included twenty stage IV (59%) patients,
twelve stage III (35%) patients, and two stage II (6%) patients. The median age of the
patients was 63 years (range, 27-83) and the female to male ratio was 9 to 26.

All patients
no. (%)
HPV
+
no. (%)
HPV
-
no. (%)
Number

35 (100) 9 (26) 26 (74)
Gender

Male

26 (74) 7 (78) 19 (73)

Female

9 (26) 2 (22) 7 (27)
Age (median, range)

63 (27-83) 59 (45-80) 67 (27-83)
Tumor site* Oral Cavity 12 (36) 2 (22) 10 (42)

Oropharynx 15 (45) 6 (67) 9 (38)

Hyopharynx 1 (3) 0 (0) 1 (4)

Larynx

2 (6) 0 (0) 2 (8)

Sinonasal

3 (9) 1 (11) 2 (8)
AJCC Stage** I

0 (0) 0 (0) 0 (0)

II

2 (6) 0 (0) 2 (8)

III

12 (35) 4 (44) 8 (32)

IV

20 (59) 5 (56) 15 (60)
* Primary tumor site unknown for 2 subject

** Data missing for 1 subject

Table 3.2. Patient Characteristics. Characteristics of the 35 head and neck squamous cell
carcinoma patients included in this study.

42
HPV Infection Status
The overall frequency of HPV infection was 26% (9 patients), which is consistent with
rates reported by other investigators [40]. PCR results using MY09/MY11 or
GP5+/GP6+ primers (Figure 3.3A), were confirmed by p16 staining on a subset of patient
samples [40,41]. Six of the nine HPV
+
samples demonstrated positive staining with p16
(Figure 3.3B). The remaining three samples did not have FFPE sections available for
staining.

Figure 3.3. HPV Screening. Samples were screened for infection with human papillomavirus
using PCR with confirmation by p16 staining. (A) Sample PCR results demonstrating
amplification of a 150 bp product (MY09/MY11) in lane 2 and a 450 bp product (GP5+/GP6+) in
lane 3 using the positive control cell line, HeLa. The negative control (H
2
O) for each primer set
can be seen in lanes 4 and 5. An HPV
+
patient sample run in lanes 6 and 7 demonstrates
amplification using the MY09/MY11 primer set (Lane 6), but does not show amplification using
the GP5+/GP6+ primer set (Lane 7). (B) p16 staining on an HPV
+
and (C) HPV
-
patient sample
(200x original magnification).

qRT-PCR
The expression of 41 genes related to immune activation and suppression was measured
in tumor biopsy samples by quantitative RT-PCR and compared to adjacent normal tissue
and a human reference RNA sample. The human reference RNA sample was used as an
additional control as it has been demonstrated that tumor-adjacent normal tissue in
HNSCC may in fact be abnormal, likely due to field cancerization [4]. Tumor samples

43
were stratified for analysis by HPV infection status (Figure 3.4). HPV
+
tumors
demonstrated statistically significant increased expression (relative to either normal tissue
or HPV
-
tumors) of genes related to immunosuppression including regulatory T (CD4,
CD25, FoxP3, CTLA-4) and myeloid suppressor cell markers (CD11b, Arg-1, and IL-6,
an inducer of these suppressor cells), as well as the dendritic cell negative regulator,
SOCS1 (p<0.05). These tumors also demonstrated an increase in markers of immune
activation and infiltration, including evidence of T cells (CD4, IRF-1), antigen presenting
cells (CD80, CD83, CD1c), and inflammatory cytokines (IL-2, IL-12) (p<0.05). There
was also a trend towards increased expression of the Fas ligand, which can be expressed
on cytotoxic T cells, regulatory T cells and tumors as an immunosuppressive mechanism,
and the co-stimulatory molecule OX40L in HPV
+
tumors. Both HPV
+
and HPV
-
tumors
showed a trend towards increased expression of the T cell negative regulator, CBLB. A
marker for natural killer cells (NKG2D) was found to be significantly decreased in both
HPV
+
and HPV
-
tumors relative to normal tissue (p<0.05). Additionally, there was a
trend towards increased expression of the suppressive ligands PDL1 and PDL2 in HPV
-

tumors relative to normal and HPV
+
specimens. There were no other statistically
significant differences in gene expression found between the adjacent normal tissue and
HPV
-
HNSCC tumors. These data demonstrate a general pattern of increased
antigenicity and concurrent immunosuppression in patients with HPV
+
versus HPV
-

HNSCC.

44
Figure 3.4. Gene expression by qRT-PCR. A heatmap displaying gene expression data for
human reference RNA (HuRNA), adjacent normal tissue specimens, HPV
-
patient tumor samples,
and HPV
+
patient tumor samples. Gene specific amplification values were normalized to
GAPDH within each sample and the mean %GAPDH value for each group is shown in the figure.
Bright green highlights the lowest tenth percentile and bright red highlights the highest tenth
percentile for each gene. P-values from one-way ANOVAs are displayed, as well as the
significant differences identified with post-test analysis (p<0.05).

45
Immunohistochemistry
Immune cell infiltration was assessed intratumorally and at the invasive margin by
immunohistochemistry. Markers for cells of the adaptive immune system included: CD3
which identifies all T cells, CD8 as a lineage specific marker expressed primarily on
cytotoxic T cell subsets, FoxP3 as a marker of immunosuppressive regulatory T cells, and
CD20 as a marker of B cells. Markers for the innate compartment included: CD68 as a
macrophage marker and CD16 which identifies natural killer (NK) cells. HLA-DR is
typically found on antigen presenting cells (APC) including dendritic cells, macrophages
and B cells. Expression of HLA-A, HLA-G, and HLA-DR on tumor cells was also
examined.

These studies demonstrated a statistically significant difference in CD3
+
cells, as well as
CD8
+
cells, in the intratumoral region of HPV
+
versus HPV
-
HNSCC tumors (Figure 3.5)
(p<0.006). There was also a trend towards increased CD68
+
, HLA-DR
+
, and CD20
+
cells
in HPV
+
tumors. Analysis of immune cells at the invasive margin also demonstrated a
trend towards increased CD3
+
, CD8
+
, CD20
+
cells, and FoxP3
+
cells in HPV
+
tumors;
however, CD16
+
cells were decreased in HPV
+
compared with HPV
-
tumors (Figure
3.6A). In addition to examining the infiltration of single cell populations, we analyzed
the ratio of CD8
+
CTL to FoxP3
+
Treg and found that HPV
+
tumors have an increased
intratumoral ratio compared with HPV
-
tumors (Figure 3.6B). The ratio of CD8/FoxP3
was also assessed by stage of disease at presentation and no significant differences or
trends were observed across stage II (2.06 ± 0.78), stage III (4.19 ± 0.74), and stage IV

46
(3.78 ± 2.37) [mean ratio, SEM]. Analysis of HLA molecules on the tumor cells
themselves showed that a similar proportion of HPV
+
and HPV
-
tumor samples were
positive for HLA-A, HLA-G and HLA-DR (Figure 3.6C). Consistent with the qRT-PCR
data, these data demonstrate a pattern of increased immune cell infiltration in HPV
+

HNSCC tumors.

47

Figure 3.5. Analysis of Intratumoral Immune Cell Infiltration by Immunohistochemistry.
Intratumoral immune cell infiltration in HPV
+
and HPV
-
patient tumor samples. (A) The mean
number of positive cells per high powered field (HPF) is displayed, as well as SEM and p-values
for comparisons between groups. (* p<0.006). (B) The percentage of patient samples with 0, 1-5,
and >5 CD20
+
B cells per HPF. (C) The percentage of patient samples with <15, 15-40, and >40
CD16
+
NK cells per HPF.

48

Figure 3.6. Invasive Margin and HLA staining. (A) Invasive margin immune cell infiltration in
HPV
+
and HPV
-
patient tumor samples. The mean percentage of positive immune cells is
displayed, as well as SEM and p-values for comparisons between groups. (B) The ratio of CD8
+

T cells to FoxP3
+
Treg intratumorally and at the invasive margin. (C) The proportion of patient
samples positive (>10% of nucleated cells) for HLA-A, HLA-G, and HLA-DR.

49
DISCUSSION
Immunotherapy is capable of attacking cancer cells selectively and forming lasting
memory to prevent recurrence, and potentially secondary tumors, both of which
contribute significantly to the high mortality rates in HNSCC patients. Systemic
immunotherapy treatments could also potentially reduce the morbidity associated with
surgical resection of HNSCC tumors. These studies demonstrate a general pattern of
increased immunogenicity and concurrent immunosuppression in patients with HPV
+

versus HPV
-
HNSCC that could potentially be used to inform immunotherapy treatment
of HNSCC patients.

In our studies, HPV
+
HNSCC tumor samples demonstrated increased expression of genes
related to effector T cell populations (CD4, IRF-1, Fas-L) and antigen presenting cells
(CD80, CD83, CD1c, OX40L), as well as increased inflammatory cytokines (IL-2, IL-
12). This correlates with the increased level of immune cell infiltration (CD3
+
, CD8
+
,
CD20
+
, CD68
+
, HLA-DR
+
) that was seen in HPV
+
tumors by immunohistochemistry,
both intratumorally and at the invasive margin. Conversely, HPV
-
HNSCC specimens
demonstrated significantly lower levels of immune cell infiltration and markers of
immune cell activation, by both immunohistochemical and gene expression analyses. The
high levels of CD8
+
T cells in HPV
+
tumor specimens is consistent with studies that
demonstrate an increased frequency of circulating CD8
+
T cells targeted against E6 or
E7, proteins that are overexpressed by HPV
+
cells, and also demonstrates that these
circulating cells are effectively infiltrating the tumors [37]. This increased immune

50
response in HPV
+
tumors as compared with HPV
-
tumors likely contributes significantly
to the improved prognosis of HPV
+
tumors and supports the use of immunotherapy
techniques to further improve survival rates, particularly immune stimulatory regimens in
HPV
-
patients. This is further supported by the increased ratio of CD8 to FoxP3 T cells
in the intratumoral region of HPV+ HNSCC. This ratio was shown to be one of the few
immune cell markers significantly associated with improved prognosis in wide range of
human solid tumors [42].

HPV
+
tumors also showed significant up-regulation of regulatory T-cell (CD4, CD25,
CTLA-4, FoxP3) and myeloid-derived suppressor cell (CD1lb, Arg-1, IL-6) genes,
demonstrating the recruitment of these cells to the tumor microenvironment. These data
indicate that reversal of immune suppression through targeting of both subsets of
suppressor cells, Treg and MDSC, would likely benefit HPV
+
HNSCC patients.
Additionally, HPV
+
tumors demonstrated significantly elevated levels of IL-6 relative to
HPV
-
tumors, normal tissue, and human reference RNA. Other investigators have shown
that serum levels of IL-6 in HNSCC patients are significantly increased over those of
healthy volunteers, and that increased levels of IL-6 correlate with more advanced
disease and worse prognosis. It should be noted, however, that controls for HPV infection
status were not used in these studies [43,44]. IL-6 has been shown to induce pro-growth
and pro-survival mechanisms in HNSCC cells [45], as well as induce MDSCs [15,46].
The results from this study indicate that HPV
+
tumors may benefit more significantly
from therapies targeting IL-6 in the tumor microenvironment. By comparison, the lower

51
levels of effector immune cell infiltration in HPV
-
tumors necessitate fewer immune
suppressive mechanisms. HPV
-
tumors did, however, show a trend toward increased
expression of the T cell inhibitory ligands PDL1 and PDL2 which represent possible
targets for immunotherapy in these patients.

In addition to the adaptive immune system, the innate compartment of the immune
system has also been shown to be important in anti-tumor immunity [47, 48]. This study
demonstrates that both HPV
+
and HPV
-
HNSCC tumors have significantly decreased
expression of the activating NK cell receptor NKG2D relative to normal and human
reference RNA. Immunohistochemical data also demonstrate relatively low levels of
infiltration by CD16
+
NK cells in both HPV
+
and HPV
-
tumors. The significant deficit of
NKG2D may also reflect a lack of activation of the NK cells that are present, rather than
a decrease in the absolute number of NK cells. These data support the use of NK cell
targeted therapies in both HPV
+
and HPV
-
HNSCC. Related to NK cell activation and
proliferation, IL-2 therapy has been used as an investigational treatment of HNSCC
patients to improve NK cell function, although these studies have shown minimal
effectiveness, our data demonstrate that HPV
+
tumors, which have significantly increased
IL-2 expression relative to HPV
-
, may benefit from other methods of NK cell stimulation
[48].

In recent years there has been an increased focus on the distribution of immune cells in
tumors, including the location and composition of immune cell infiltrates, which may

52
impact the prognostic and predictive value of these markers [49]. Work by Galon et al.
and others, demonstrate that examining immune cell infiltrates within the tumor and at
the invading margin, can predict survival in colorectal cancer, whereas alone they are less
significantly associated with prognosis [7,50]. In our study, we see that HPV
-
tumors
have a significant deficit in intratumoral immune cell infiltration, as evidenced by the low
levels of CD3
+
, CD8
+
, and CD20
+
cells by immunohistochemistry. The difference at the
invasive margin is less prominent, but HPV
-
tumors did demonstrate significantly lower
levels of CD3
+
cells compared with HPV
+
tumors. The importance of both of these
locations as predictors of survival indicates that HPV
-
HNSCC patients may benefit from
therapies targeted both at boosting immune effector cell activation, as well as enhancing
the migration of these cells to the tumor site. HPV
+
tumors, which demonstrated an
increased CD8/FoxP3 T cell ratio intratumorally but not at the invasive margin, may also
benefit from immune stimulation therapies to improve the ratio of CD8/FoxP3 cells.

In summary, our data demonstrate the significant differences in the immune response to
HPV
+
versus HPV
-
HNSCC tumors and strongly argues for the use of HPV infection
status to stratify patients receiving experimental immunotherapy treatments. These data
also specifically identify several possible targets for immunotherapy in each of these
groups.

53
ACKNOWLEDGEMENTS
The authors would like to thank Dr. Clive Taylor and Lillian Young for assistance with
immunohistochemistry methods. This work was supported by the American Tissue
Culture Collection, National Institutes of Health training grant 3T32GM067587-07S1
(M.G.L.), and the USC Keck School of Medicine Dean’s Research Fellowship (S.M.R.).
All authors declare that they have no conflicts of interest.

54
CHAPTER 4.
FUTURE DIRECTIONS

In addition to the work done in Chapter 3 on the differences in immune escape in HPV
+

versus HPV
-
HNSCC, we are in the process of obtaining follow-up data on these patients
in order to examine the prognostic implications of these differences. We are hoping to
obtain at least one-year follow-up for all patients and will be analyzing overall and
disease-free survival. These data could provide important information on the prognostic
value of various immune cell subsets in HNSCC, a topic that other investigators have
presented conflicting results on. This prognostic information could help identify patients
that are likely to recur early and thus would benefit from more aggressive initial therapy
or closer post-operative surveillance. Additionally, identification of immune markers that
predict improved survival could be used to direct future experimental immunotherapy
protocols aimed at increasing these markers (immune cells, cytokines, etc) in patients that
are deficient.

In future analyses we also hope to examine the effects of smoking and alcohol
consumption on the observed tumor-host immune interaction. Smoking is believed to
have a suppressive effect on the immune system and while the majority of HNSCC
patients have an extensive smoking history, this disease does arise in non-smokers (both
HPV
+
and HPV
-
) and these patients may exhibit a very different immune response that
will require different treatment and follow-up. Additionally, while differences in HLA-

55
A, HLA-G and HLA-DR were not identified between HPV
+
versus HPV
-
HNSCC
patients, we plan to explore the difference in immune response to tumors that are positive
or negative for these markers, regardless of HPV infection status. Based on the studies
reported in Chapter 2, on the HNSCC cell lines USC-HN2 and SCCL-MT1, we believe
that overexpression of these human leukocyte antigens may correlate with highly
immunogenic and immunosuppressive tumors. In addition to HPV infection status, HLA
expression could provide a second marker that is relatively easy to assess, and may
significantly predict tumor immune responses.

Additional future experiments may include in vitro studies using the HNSCC cell lines
USC-HN2 and SCCL-MT1. These cell lines can be used to explore further the
mechanisms through which HNSCC tumors induce suppressor cells, including regulatory
T cells, myeloid derived suppressor cells and tumor associated macrophages. New
immunotherapy drugs targeting these suppressor cell populations can also be studied
using these highly immune modulatory cell lines. Additionally, as the theory of cancer
stem cells has become more accepted, evidence is building that these progenitor cells
play a significant role in HNSCC tumor initiation and propagation. The immunological
impact of these cells is still largely unknown and because USC-HN2 and SCCL-MT1
were both found to express the cancer stem cell marker CD44v6, these cell lines can be
used for in vitro studies of these cell populations.

56
The complexity of the interaction between the immune system and cancerous cells is
exemplified by the multitude of conflicting results presented by various investigators. As
our understanding of this interaction improves, the importance of the immune system in
shaping the progression of tumors and in potentially treating cancer has become evident.
There is now a need to analyze this relationship in a more rigorous manner and to study it
systematically with the goal to develop prognostic indicators that may predict response to
treatments, both immunotherapeutic and conventional. Data from this and other
descriptive, exploratory studies, offer a jumping off point from which to begin larger
scale studies designed to identify a set of standardized immune criteria to aid in the
treatment and monitoring of HNSCC.

57
BIBLIOGRAPHY

Allen CT, Judd NP, Bui JD, Uppaluri R. The clinical implications of antitumor immunity
in head and neck cancer. Laryngoscope. 2012;122:144-57. [12]
Badoual C, Hans S, Rodriguez J, Peyrard S, Klein C, Agueznay Nel H, Mosseri V,
Laccourreye O, Bruneval P, Fridman WH, Brasnu DF, Tartour E. Prognostic value of
tumor-infiltrating CD4+ T-cell subpopulations in head and neck cancers. Clin Cancer
Res. 2006;12:465-72. [36]
Burk RD, Terai M, Gravitt PE, Brinton LA, Kurman RJ, Barnes WA, Greenberg MD,
Hadjimichael OC, Fu L, McGowan L, Mortel R, Schwartz PE, Hildesheim A:
Distribution of human papillomaviurs types 16 and 18 variants in squamous cell
carcinomas and adenocarcinomas of the cervix. Cancer Res. 2003; 63:7215-20. [39]
Cerwenka A, Lanier LL. Natural killer cells, viruses and cancer. Nat Rev Immunol.
2001;1:41-9. [47]
Chikamatsu K, Takahashi G, Sakakura K, Ferrone S, Masuyama K. Immunoregulatory
properties of CD44+ cancer stem-like cells in squamous cell carcinoma of the head and
neck. Head Neck. 2011;33:208-15. [31]
Chiou SH, Yu CC, Huang CY, Lin SC, Liu CJ, Tsai TH, et al. Positive correlations of
Oct-4 and Nanog in oral cancer stem-like cells and high-grade oral squamous cell
carcinoma. Clin Cancer Res. 2008;14:4085-4095. [29]
Dai M, Clifford GM, le Calvez F, Castellsagué X, Snijders PJ, Pawlita M, et al. IARC
Multicenter Oral Cancer Study Group. Human papillomavirus type 16 and TP53 mutation
in oral cancer: matched analysis of the IARC multicenter study. Cancer Res.
2004;64:468-71. [19]
Dayyani F, Etzel CJ, Liu M, Ho CH, Lippman SM, Tsao AS. Meta-analysis of the impact
of human papillomavirus (HPV) on cancer risk and overall survival in head and neck
squamous cell carcinomas (HNSCC). Head Neck Oncol. 2010;2:15. [32]
Distel LV, Fickenscher R, Dietel K, Hung A, Iro H, Zenk J, Nkenke E, Büttner M,
Niedobitek G, Grabenbauer GG. Tumour infiltrating lymphocytes in squamous cell
carcinoma of the oro- and hypopharynx: prognostic impact may depend on type of
treatment and stage of disease. Oral Oncol. 2009;45:e167-74. [34]
Duffy SA, Taylor JM, Terrell JE, Islam M, Li Y, Fowler KE, Wolf GT, Teknos TN.
Interleukin-6 predicts recurrence and survival among head and neck cancer patients.
Cancer. 2008;113:750-7. [43]

58
Duray A, Demoulin S, Hubert P, Delvenne P, Saussez S. Immune suppression in head
and neck cancers: a review. Clin Dev Immunol. 2010;2010:701657. [9]
Erdem NF, Carlson ER, Gerard DA. Characterization of gene expression profiles of 3
different human oral squamous cell carcinoma cell lines with different invasion and
metastatic capacities. J Oral Maxillofac Surg. 2008;66:918-927. [26]
Fridman WH, Galon J, Pagès F, Tartour E, Sautès-Fridman C, Kroemer G. Prognostic
and predictive impact of intra- and peritumoral immune infiltrates. Cancer Res.
2011;71:5601-5. [49]
Galon J, Pagès F, Marincola FM, Thurin M, Trinchieri G, Fox BA, Gajewski TF,
Ascierto PA. The immune score as a new possible approach for the classification of
cancer. J Transl Med. 2012;10:1. [50]
Gooden MJ, de Bock GH, Leffers N, Daemen T, Nijman HW. The prognostic influence
of tumour-infiltrating lymphocytes in cancer: a systematic review with meta-analysis. Br
J Cancer. 2011;105:93-103. [42]
Goon PK, Stanley MA, Ebmeyer J, Steinsträsser L, Upile T, Jerjes W,et al. HPV & head
and neck cancer: a descriptive update. Head Neck Oncol. 2009;1:36-43. [5]
Han J, Kioi M, Chu WS, Kasperbauer JL, Strome SE, Puri RK. Identification of potential
therapeutic targets in human head & neck squamous cell carcinoma. Head Neck Oncol.
2009;1:27. [22]
Heo DS, Snyderman C, Gollin SM, Pan S, Walker E, Deka R, et al. Biology,
cytogenetics, and sensitivity to immunological effector cells of new head and neck
squamous cell carcinoma lines. Cancer Res. 1989;49:5167-5178. [14]
Heusinkveld M, Goedemans R, Briet RJ, Gelderblom H, Nortier JW, Gorter A, Smit VT,
Langeveld AP, Jansen JC, van der Burg SH. Systemic and local human papillomavirus
16-specific T-cell immunity in patients with head and neck cancer. Int J Cancer. 2011
doi: 10.1002/ijc.26497. [37]
Jemal A, Siegel R, Xu J, Ward E. Cancer Statistics, 2010. CA Cancer J Clin
2010;60;277-300. [2]
Jochems C, Schlom J. Tumor-infiltrating immune cells and prognosis: the potential link
between conventional cancer therapy and immunity. Exp Biol Med (Maywood).
2011;236:567-79. [33]
Kanazawa T, Nishino H, Hasegawa M, Ohta Y, Iino Y, Ichimura K, Noda Y. Interleukin-
6 directly influences proliferation and invasion potential of head and neck cancer cells.
Eur Arch Otorhinolaryngol. 2007;264:815-21. [45]

59
Kaur J, Ralhan R. Establishment and characterization of a cell line from smokeless
tobacco associated oral squamous cell carcinoma. Oral Oncol. 2003;39:806-820. [25]
Lechner MG, Lade S, Liebertz DJ, Prince HM, Brody GS, Webster HR, et al. Breast
implant-associated, ALK-negative, T-cell, anaplastic, large-cell lymphoma:
Establishment and characterization of a model cell line (TLBR-1) for this newly
emerging clinical entity. Cancer. 2011;117:1478-1489. [17]
Lechner MG, Liebertz DJ, Epstein AL. Characterization of cytokine-induced myeloid-
derived suppressor cells from normal human peripheral blood mononuclear cells. J
Immunol. 2010;185:2273-2284. [20]
Lechner MG, Megiel C, Russell SM, Bingham B, Arger N, Woo T, Epstein AL.
Functional characterization of human Cd33+ and Cd11b+ myeloid-derived suppressor
cell subsets induced from peripheral blood mononuclear cells co-cultured with a diverse
set of human tumor cell lines. J Transl Med. 2011;9:90. [15]
Leemans CR, Braakhuis BJ, Brakenhoff RH. The molecular biology of head and neck
cancer. Nat Rev Cancer. 2011;11:9-22. [4]
Liebertz DJ, Lechner MG, Masood R, Sinha UK, Han J, Puri RK, et al. Establishment
and characterization of a novel head and neck squamous cell carcinoma cell line USC-
HN1. Head Neck Oncol. 2010;2:5. [16]
Lin CJ, Grandis JR, Carey TE, Gollin SM, Whiteside TL, Koch WM, et al. Head and
neck squamous cell carcinoma cell lines: established models and rationale for selection.
Head Neck. 2007;29:163-188. [21]
Meissner M, Reichert TE, Kunkel M, Gooding W, Whiteside TL, Ferrone S, Seliger B.
Defects in the human leukocyte antigen class I antigen processing machinery in head and
neck squamous cell carcinoma: association with clinical outcome. Clin Cancer Res.
2005;11:2552-60. [10]
Okamoto A, Chikamatsu K, Sakakura K, Hatsushika K, Takahashi G, Masuyama K.
Expansion and characterization of cancer stem-like cells in squamous cell carcinoma of
the head and neck. Oral Oncol. 2009;45:633-639. [28]
Pagès F, Galon J, Dieu-Nosjean MC, Tartour E, Sautès-Fridman C, Fridman WH.
Immune infiltration in human tumors: a prognostic factor that should not be ignored.
Oncogene. 2010;29:1093-102. [7]
Pai SI, Westra WH. Molecular pathology of head and neck cancer: implications for
diagnosis, prognosis, and treatment. Annu Rev Pathol. 2009;4:49-70. [1]

60
Pretscher D, Distel LV, Grabenbauer GG, Wittlinger M, Buettner M, Niedobitek G.
Distribution of immune cells in head and neck cancer: CD8+ T-cells and CD20+ B-cells
in metastatic lymph nodes are associated with favourable outcome in patients with oro-
and hypopharyngeal carcinoma. BMC Cancer. 2009;9:292. [35]
Prince ME, Ailles LE. Cancer stem cells in head and neck squamous cell carcinoma. J
Clin Oncol. 2008;26:2871-2875. [24]
Qu W, Jiang G, Cruz Y, Chang CJ, Ho GY, Klein RS, Burk RD: PCR detection of
Human Papillomavirus: comparison between MY09/MY11 and GP5+/GP6+ primer
systems. J Clin Microbio. 1997;35:1304-10. [38]
Riedel F, Zaiss I, Herzog D, Götte K, Naim R, Hörmann K. Serum levels of interleukin-6
in patients with primary head and neck squamous cell carcinoma. Anticancer Res.
2005;25:2761-5. [44]
Russell SM, Lechner MG, Gong L, Megiel C, Liebertz DJ, Masood R, Correa AJ, Han J,
Puri RK, Sinha UK, Epstein AL. USC-HN2, a new model cell line for recurrent oral
cavity squamous cell carcinoma with immunosuppressive characteristics. Oral Oncol.
2011;47:810-7. [46]
Schilling B, Halstead ES, Schuler P, Harasymczuk M, Egan JE, Whiteside TL. IRX-2, a
novel immunotherapeutic, enhances and protects NK-cell functions in cancer patients.
Cancer Immunol Immunother. 2012 Jan 20. [Epub ahead of print] [48]
Schlecht NF, Brandwein-Gensler M, Nuovo GJ, Li M, Dunne A, Kawachi N, Smith RV,
Burk RD, Prystowsky MB. A comparison of clinically utilized human papillomavirus
detection methods in head and neck cancer. Mod Pathol. 2011;24:1295-305. [41]
Schreiber RD, Old LJ, Smyth MJ. Cancer immunoediting: integrating immunity's roles in
cancer suppression and promotion. Science. 2011;331(6024):1565-70. [6]
Siegel R, Naishadham D, Jemal A. Cancer statistics, 2012. CA Cancer J Clin.
2012;62:10-29. [3]
Silva TG, Crispim JC, Miranda FA, Hassumi MK, de Mello JM, Simões RT, Souto F,
Soares EG, Donadi EA, Soares CP. Expression of the nonclassical HLA-G and HLA-E
molecules in laryngeal lesions as biomarkers of tumor invasiveness. Histol Histopathol.
2011;26:1487-97. [11]
Snow, AN, Laudadio, J. Human Papillomavirus Detection in Head and Neck Squamous
Cell Carcinomas. Adv Anat Pathol. 2010;17:394-403. [40]
Stadler ME, Patel MR, Couch ME, Hayes DN. Molecular biology of head and neck
cancer: risks and pathways. Hematol Oncol Clin N Am. 2008;22:1099-1124. [23]

61
Stewart TJ, Abrams SI. How tumours escape mass destruction. Oncogene.
2008;27:5894–5903. [30]
Subramanian A, Tamayo P, Mootha VK, Mukherjee S, Ebert BL, Gillette MA, et al.
Gene set enrichment analysis: a knowledge-based approach for interpreting genome-wide
expression profiles. Proc Natl Acad Sci. 2005;102:15545-15550. [18]
van Staveren WC, Solís DY, Hébrant A, Detours V, Dumont JE, Maenhaut C. Human
cancer cell lines: Experimental models for cancer cells in situ? For cancer stem cells?
Biochim Biophys Acta. 2009;2:92-103. [13]
Walsh JE, Lathers DM, Chi AC, Gillespie MB, Day TA, Young MR. Mechanisms of
tumor growth and metastasis in head and neck squamous cell carcinoma. Curr Treat
Options Oncol. 2007;8:227-28. [27]
Young MR. Protective mechanisms of head and neck squamous cell carcinomas from
immune assault. Head Neck. 2006;28:462-470. [8]

Abstract (if available)

Linked assets

University of Southern California Dissertations and Theses

Conceptually similar

PDF

Targeting Langerhans cells: a human papillomavirus type 16 immune evasion mechanism

PDF

Immune infiltrates in papillary thyroid carcinomas

PDF

Rationalized immunotherapy by immune signature characterization

PDF

Human myeloid-derived suppressor cells in cancer: Induction, functional characterization, and therapy

PDF

Identification and characterization of immune-escape mechanisms in solid tumors

PDF

The silenced sentinel: a human papillomavirus type 16 immune evasion mechanism targeting Langerhans cells

PDF

Suppressor cell therapy: targeting T regulatory cells in cancer

PDF

Conjugation of CpG oligodeoxynucleotides to tumor‐targeting antibodies for immunotherapy of solid tumors

PDF

Investigating immune escape mechanisms between high & low risk mucosal human papillomavirus genotypes and cutaneous human papillomavirus genotypes

PDF

Tri-specific T cell engager immunotherapy targeting tumor initiating cells

PDF

Human papillomavirus type 16 entry via the annexin A2 heterotetramer leads to infection and immune evasion

PDF

Tri-specific T cell engager immunotherapy targeting tumor initiating cells

PDF

Establishing a human EGFR expressing murine mammary carcinoma cell line-D2F2, as a syngeneic immunocompetent model

PDF

Investigation of immune escape paths in the tumor microenvironment

PDF

Comparison of secondary and primary thyroid cancer in adolescents and young adults (AYA)

PDF

The effect of tumor-mediated immune suppression on prostate cancer immunotherapy

PDF

Stable expression of human B7-H4 in a mouse mammary tumor model as a target for cancer immunotherapy

PDF

Developing a bioluminescence tracking system targeting on tumor cells and T cells for cancer immunotherapy

PDF

The role of LGR5 in the pathogenesis of Ewing sarcoma: a marker of aggressive disease and a contributor to the malignant phenotype

PDF

Self-secretion of checkpoint blockade enhances antitumor immunity by murine chimeric antigen receptor-engineered T cells

Asset Metadata

Creator Russell, Sarah Marie (author)

Core Title Immune escape in head and neck squamous cell carcinoma

School Keck School of Medicine

Degree Master of Science

Degree Program Clinical and Biomedical Investigations

Publication Date 05/02/2014

Defense Date 05/02/2012

Publisher University of Southern California (original), University of Southern California. Libraries (digital)

Tag cell line,head and neck squamous cell carcinoma,human papillomavirus,OAI-PMH Harvest,tumor immunology

Language English

Contributor Electronically uploaded by the author (provenance)

Advisor Epstein, Alan L. (committee chair), Azen, Stanley P. (committee member), Taylor, Clive R. (committee member)

Creator Email russell.sarah1@gmail.com,smrussel@usc.edu

Permanent Link (DOI) https://doi.org/10.25549/usctheses-c3-23281

Unique identifier UC11289366

Identifier usctheses-c3-23281 (legacy record id)

Legacy Identifier etd-RussellSar-723.pdf

Dmrecord 23281

Document Type Thesis

Rights Russell, Sarah Marie

Type texts

Source University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Access Conditions The author retains rights to his/her dissertation, thesis or other graduate work according to U.S. copyright law. Electronic access is being provided by the USC Libraries in agreement with the a...

Repository Name University of Southern California Digital Library

Repository Location USC Digital Library, University of Southern California, University Park Campus MC 2810, 3434 South Grand Avenue, 2nd Floor, Los Angeles, California 90089-2810, USA