University of Southern California Dissertations and Theses

Targeting BCL-2 family proteins and plasminogen activator inhibitor-1 in turmor cell apoptosis

(USC Thesis Other)

Targeting BCL-2 family proteins and plasminogen activator inhibitor-1 in turmor cell apoptosis

PDF

Download a page range

Download transcript

Copy asset link

Request this asset

Transcript (if available)

Content

TARGETING BCL-2 FAMILY PROTEINS AND PLASMINOGEN ACTIVATOR
INHIBITOR-1 IN TUMOR CELL APOPTOSIS

by

Hua Fang

A Dissertation Presented to the
FACULTY OF THE USC GRADUATE SCHOOL
UNIVERSITY OF SOUTHERN CALIFORNIA
In Partial Fulfillment of the
Requirements for the Degree
DOCTOR OF PHILOSOPHY
(PATHOBIOLOGY)

May 2012

Copyright 2012 Hua Fang

ii

DEDICATION

This work is dedicated to my parents and my husband for their love,
understanding, and support.

iii

ACKNOWLEDGEMENTS

This dissertation cannot have been possible without the support of my mentors,
my coworkers, and my family. First of all, I would like to express my deep and
sincere gratitude to my mentor Dr. Yves A. DeClerck whose guidance, support,
trust, and encouragement have enabled me to accomplish this dissertation and
to successfully finish my Ph.D. study. I have learnt so much from him, not only
the passion about science, but also the positive attitudes and consistent efforts to
reach the goals. I would also like to thank my previous mentor Dr. Patrick
Reynolds for his supports during my first two years in the Ph.D. study. I am
grateful to all the members in my Ph.D. Guidance Committee, Dr. Cheng-Ming
Chuong, Dr. Louis Dubeau, Dr. Anat Epstein, and Dr. Vijay Kalra, who gave me
excellent input and guidance to improve my scientific achievements.
I would also like to give my special thanks to all the previous and current
members in Dr. DeClerck’s laboratory, Dr. Ayaka Silverman, Dr. Bhakti Mehta, Dr.
Josephine HaDuong, Dr. Lawrence Sarte, Ms. Rie Nakata, Mr. Scott Bergfeld, Dr.
Tasnim Ara, Dr. Veronica Placencio, and Dr. Valeria Solari who have created a
very stimulating research environment; especially Dr. Veronica Placencio, who
has contributed to some experiments shown in Chapter 3. In addition, I thank all
my coworkers and friends at Children’s Hospital Los Angeles, especially Dr.
Zesheng Wan, Dr. Xiuhai Ren, and Ms. Jackie Tsen-Yin Lin who always shared
their knowledge, offered me valuable advice and support. I would also like to

iv

thank two individuals for their generous help in administrative affairs during my
Ph.D study- Ms. Jackie Rosenberg from Dr. DeClerck’s Laboratory and Ms. Lisa
Doumak from home department.
Finally, I would like to thank my parents Kangbao Fang and Yihong Hu, my
parents in laws, and my husband and best friend Meng Jing for their
encouragement, patience, and support throughout my study.

v

TABLE OF CONTENTS

Dedication ii
Acknowledgements iii
List of Tables vii
List of Figures viii
Abstract x
Chapter 1: Introduction 1
1.1 Cancer biology and targeted cancer therapy 1
1.1.1 Overview 1
1.1.2 Hallmarks and characteristics of cancer 2
1.1.3 The tumor microenvironment 11
1.1.4 Targeted cancer therapy 14
1.2 Apoptosis and Bcl-2 family proteins in cancer 18
1.2.1 Overview of Apoptosis 18
1.2.2 Regulation of extrinsic apoptotic pathway 20
1.2.3 Regulation of intrinsic apoptotic pathway 21
1.2.4 Targeting Bcl-2 family members in cancer 24
1.3 Plasminogen activator inhibitor-1 (PAI-1) in cancer 27
1.3.1 Overview of urokinase plasminogen activator system 27
1.3.2 The PAI-1 paradox in cancer 29
1.3.3 Targeting PAI-1 in cancer 33
Chapter 2: Inhibition of Bcl-2 family members in cancer cell apoptosis-
Synergistic apoptotic activity of Fenretinide and the Bcl-2 family
protein inhibitor ABT-737 against human neuroblastoma 36
2.1 Abstract 36
2.2 Introduction 37
2.3 Materials and Methods 39
2.4 Results 49
2.5 Discussion 71
Chapter 3: Inhibtion of PAI-1 in cancer cell apoptosis-
Pro-Tumorigenic Activity of PAI-1 through an Anti-Apoptotic
Function on Tumor Cells 75
3.1 Abstract 75
3.2 Introduction 77

vi

3.3 Materials and Methods 78
3.4 Results 86
3.5 Discussion 116
Chapter 4: Conclusions and future directions 120
4.1 ABT-737 and 4-HPR in human clinical trials 120
4.2 PAI-1 in cancer biology and therapy 121
4.3 Targeting both Bcl-2 family proteins and PAI-1 in cancer 123
4.4 Future directions and research proposals 123
4.4.1 Future investigations – inhibition of Bcl-2 family proteins
in cancer 123
4.4.2 Future investigations – inhibition of PAI-1 in cancer 124
4.4.3 Future investigations – convergence of both inhibitions of
Bcl-2 family proteins and PAI-1 in cancer 125
4.5 Final remarks 126
Bibliography 127

vii

LIST OF TABLES

Table 1-1: Drugs developed on the basis of cancer biology. 17
Table 2-1: LC
90
of 4-HPR, ABT-737 and combination index values of
ABT-737 at concentrations in combination with 4-HPR. 53
Table 2-2: In vivo efficacy of ABT-737 in combination with 4-HPR in
CHLA-119 neuroblastoma xenografts. 69

viii

LIST OF FIGURES

Figure 1-1: Eight Hallmarks and two characteristics of cancer. 2
Figure 1-2: An assemblage of distinct cell types in solid tumors. 12
Figure 1-3: Signaling interactions in the tumor microenvironment. 13
Figure 1-4: Therapeutic targeting of the hallmarks of cancer. 16
Figure 1-5: The apoptotic pathways. 20
Figure 1-6: The apoptotic pathway from the perspective of Bcl-2 family
members. 23
Figure 1-7: Different binding profiles of BH3-only proteins towards
pro-survival Bcl-2 proteins. 24
Figure 1-8: BH3 mimic anticancer drug ABT-737. 26
Figure 1-9: Schematic representation of urokinase plasminogen
activator system. 28
Figure 2-1: The combination of ABT-737 plus 4-HPR is synergistically
cytotoxic against neuroblastoma cell lines but not against
a normal fibroblast cell line in vitro. 51
Figure 2-2: The basal expression of Bcl-2 family members in
neuroblastoma cell lines. 54
Figure 2-3: The combination of ABT-737 and 4-HPR induces
apoptosis through mitochondrial membrane
depolarization and cytochrome c release. 57
Figure 2-4: The combination of ABT-737 and 4-HPR induces
caspase-dependent apoptosis. 60
Figure 2-5: The combination ABT-737 plus 4-HPR does not induce
apoptosis in normal fibroblast cells in vitro. 62
Figure 2-6: Effects of ABT-737 plus 4-HPR on the activation of
pro-apoptotic Bcl-2 proteins. 65

ix

Figure 2-7: In vivo antitumor activity of ABT-737 combined with 4-HPR
against human neuroblastoma cells. 68
Figure 2-8: Effects of ABT-737 plus 4-HPR on Mcl-1 expression. 70

Figure 3-1: Induction of spontaneous apoptosis upon PAI-1
downregulation by small interfering RNAs (siRNAs) in
human cancer cell lines. 89
Figure 3-2: Induction of spontaneous apoptosis upon PAI-1 inhibition by
PAI-039 in human cancer cell lines. 92
Figure 3-3: Induction of extrinsic apoptosis by PAI-1 downregulation
in tumor cells. 95
Figure 3-4: Involvement of plasmin in apoptosis upon PAI-1
downregulation. 99
Figure 3-5: Decreased viability of tumor cells expressing PAI-1 short
hairpin RNAs (shRNAs). 102
Figure 3-6: Four experimental groups of mice xenotransplanted with
HT-1080 cells. 104
Figure 3-7: Inhibition of tumorigenesis of xenotransplanted HT-1080
cells by downregulation of tumor- and host-derived PAI-1. 107
Figure 3-8: Increase in apoptosis, decrease in proliferation and
inhibition of angiogenesis in the absence of host- and
tumor-derived PAI-1 in HT-1080 tumors. 110
Figure 3-9: Inhibition of A549, HCT-116, and MDA-MB-231
tumorigenesis in the absence of host- and
tumor-derived PAI-1. 114
Figure 3-10: Plasma levels of human PAI-1 in group 4 of HT-1080 and
MDA-MB-231 xenotransplanted mice. 115

x

ABSTRACT
Resistance to cell death, especially to apoptosis, is an important feature of tumor
cells, which is also described as one of the hallmarks in cancer. The apoptosis
machinery can be divided into two major pathways based on the source of death
signaling, the Bcl-2-regulated (known as intrinsic or mitochondrial) apoptotic
pathway and death receptor-regulated (known as extrinsic) apoptotic pathway.
In Chapter 2 of this dissertation, I studied how tumor cell apoptosis could
be a target for therapeutic intervention by examining the synergistic activity of a
novel drug combination- ABT-737, a small molecule inhibitor of Bcl-2 family
proteins, and Fenretinide (4-HPR), a cytotoxic retinoid - in preclinical models of
childhood cancer neuroblastoma. Multilog synergistic cytotoxicity was observed
for the drug combination in all of the eleven neuroblastoma cell lines tested. ABT-
737 + 4-HPR induced greater mitochondrial membrane depolarization and
mitochondrial cytochrome c release, greater activation of caspases, Bax-α, t-Bid,
and Bak, and a higher level of apoptosis than either drug alone. In vivo, ABT-737
+ 4-HPR increased the event-free survival (EFS) of the multidrug-resistant
human neuroblastoma line CHLA-119 implanted subcutaneously in nu/nu mice.
Thus, the combination of ABT-737 and 4-HPR warrants clinical trials in recurrent
neuroblastoma.
In Chapter 3 of this dissertation, I have studied how tumor apoptosis could
be regulated by plasminogen activator inhibitor-1, which is an inhibitor of

xi

urokinase plasminogen activator, an extracellular protease in tumor
microenvironment.
PAI-1 is a predictor of poor outcome in cancer. An explanation for this
paradoxical role has been its pro-angiogenic activity. The effect of PAI-1 on
tumor cells has not been explored. Here we have examined the effect of PAI-1
knockdown (KD) on the survival of human cancer cell lines in vitro and in vivo.
We demonstrated a decrease in survival and an increase in apoptosis in the four
cell lines when PAI-1 was genetically (siRNA) or pharmacologically (PAI-1
inhibitor, PAI-039) suppressed. Apoptosis was blocked by a caspase-8 inhibitor,
Fas/FasL neutralizing antibodies, and plasmin inhibitors. Stable PAI-1 KD tumor
cells were generated by the transduction of short hairpin RNA lentivirus and
examined for tumorigenicity in immunodeficient PAI-1 wildtype and knockout (KO)
mice. In vivo, we observed a decrease in tumor growth, tumor take, cell
proliferation and angiogenesis and an increase in apoptosis in PAI-1 KD HT-
1080 in PAI-1 KO mice. A similar inhibition in tumor growth was observed when
PAI-1 KD HCT-116 or A549 cells were implanted in PAI-1 KO mice. In conclusion,
PAI-1 exerts a protective effect against extrinsic apoptosis in tumor cells.
Downregulation of PAI-1 in both tumor and host cells is necessary for a
significant inhibitory activity on tumorigenesis through a dual effect on tumor cell
and endothelial cell apoptosis. The data suggest that PAI-1 may be necessary for
tumor growth and support further investigation of the use of PAI-1 inhibitors in
pre-clinical models of cancer.

xii

In conclusion, the research presented in this dissertation supports the
concept that apoptosis induction in tumor cells (either through manipulating
tumor cells alone or manipulating the tumor microenvironment) is a vital player in
anticancer therapies.

1

CHAPTER 1
INTRODUCTION

1.1 Cancer biology and targeted cancer therapy
1.1.1 Overview
As one of the worldwide health problems nowadays, cancer is the leading cause
of morbidity and mortality in industrialized countries. In the United States alone,
more than half million people die from cancer and 1.6 million Americans are
diagnosed with cancer each year. Approximately 1 out of every 2 men and 1 out
of every 3 women will develop cancer in their lifetimes (data from NIH website).
Since the signing of the National Cancer Act in 1971, cancer research has
been paid greater attention, which has brought enormous advances in cancer
biology, diagnoses, therapeutics, and prevention. We now have a deeper
understanding about cancer, and at the same time, we also realize that cancer is
much more complex than what could have been imagined decades ago. Cancer
is in fact one large group of hundreds of different diseases and all of them involve
deregulated cell growth with different causes and require different treatments.
Tremendous efforts in cancer research are still urgently needed to better
understand the fundamental nature of cancer and eventually to translate these
cancer biology discoveries into new cancer therapies, diagnostics, and
preventions.

2

1.1.2 Hallmarks and characteristics of cancer
In a recent review article, Drs. Robert Weinberg and Douglas Hanahan have
summarized our current understanding of cancer biology and pathology in eight
biological hallmarks and two characteristics. The eight hallmarks of cancer
acquired during the multistep development of human tumors are the features of
almost all malignancies, especially solid tumors (Hanahan and Weinberg, 2011).

Figure 1-1. Eight hallmarks and two characteristics of cancer.
(Hanahan and Weinberg, 2011)

Hallmark #1
Sustaining proliferative
signaling
Hallmark #2
Evading growth
suppressors
Hallmark #3
Resisting
cell death
Hallmark #4
Enabling replicative
immortality
Hallmark #7
Inducing
angiogenesis
Hallmark #8
Activating Invasion and
metastasis
Hallmark #5
Deregulating
cellular energies
Hallmark #6
Avoiding immune
destruction
Characteristic #1
Genome instability
and mutation
Characteristic #2
Tumor promoting
inflammation

3

Hallmark #1: Sustaining proliferative signaling
Different from normal tissues which carefully control the progression through the
cell growth-and-division cycle to keep the homeostasis of cell number and thus
maintain the normal architecture and function, tumor cells, in contrast, divide and
grow uncontrollably. As the most fundamental hallmark of cancer, the ability of
tumor cells to sustain chronic proliferation can be acquired through a number of
alternative ways, including both growth factor-dependent and growth factor-
independent means.
In the growth factor-dependent way, tumor cells either produce a large
number of growth factor ligands themselves (Grotsch et al., 2010; Lemmon and
Schlessinger, 2010; Perona, 2006) or send signals to the surrounding stromal
tissues to get supply of growth factors (Bhowmick et al., 2004; Cheng et al.,
2008). They can also overexpress growth receptors on cell surface to be
hypersensitive toward the proliferative growth factor ligands.
In the growth factor-independent way, various somatic mutations were
observed to either activate additional downstream pathways or disrupt the
negative-feedback mechanisms. For example, activating B-Raf (V600E) kinase
mutations occur in ~60% of human melanomas (Davies et al., 2002), which result
in constitutive signaling through Raf to mitogen-activated protein-kinase (MAPK)
pathway (Davies and Samuels, 2010). Loss-of-function mutations in phosphatase
and tensin homolog (PTEN) amplify PI3K signaling and promote tumorigenesis in

4

a variety of experimental models of cancer; in human tumors, PTEN expression
is often lost by promoter methylation (Jiang and Liu, 2009).

Hallmark #2: Evading growth suppressors
Cancer cells can also circumvent powerful programs that negatively regulate cell
proliferation, most of which depend on the actions of tumor suppressor genes.
The retinoblastoma-associated (RB) and p53 proteins are two canonical
suppressors of tumor proliferation. Both of them are critical in normal cell cycle
regulation; hypophosphorylated RB is active and carries its role as tumor
suppressor, and wild type p53 is responsible for DNA repair, cell cycle arrest,
and apoptosis initiation (Sherr and McCormick, 2002). Cancer cells with defects
in those tumor suppressors are thus missing the critical gatekeeper function of
cell-cycle progression. Loss of RB through mutation, deletion, or epigenetic
silencing, occurs in many types of cancer. Similarly, more than 50% of human
tumors contain a mutation or deletion of p53 gene (Hollstein et al., 1991).

Hallmark #3: Resisting cell death
In response to various physiologic stresses during tumor progression and/or as a
result of anticancer therapy, cancer cells can trigger at least three different types
of cell death, which are apoptosis, autophagy, and necrosis.
Programmed cell death, also known as apoptosis, is the most investigated
cell death type and serves as a nature barrier to cancer development (Adams,

5

2003; Adams and Cory, 2007; Evan and Littlewood, 1998). Tumor cells have
developed a variety of strategies to limit or evade apoptosis, including the loss of
p53 tumor suppressor function (Wang and Wang, 1996), increasing expression
of antiapoptotic regulators (e.g. Bcl-2, Bcl-X
L
), downregulating pro-apoptotic
factors (e.g. Bax, Puma), and short-circuiting the extrinsic ligand-induced death
pathway.
In the highly stressed, nutrient-limited tumor environment, another form of
cell death called autophagy can be triggered (Levine and Kroemer, 2008). The
function of autophagy in tumor progression is paradoxical (Apel et al., 2009;
White and DiPaola, 2009); it has been shown to be either cytoprotective for
cancer cells by promoting severely stressed tumor cells to a state of reversible
dormancy, or anti-tumorigenic by inducing tumor cell death.
In contrast to apoptosis and autophagy, necrotic cell death is a form of
system-wide exhaustion and breakdown that releases pro-inflammatory signals
into the surrounding tissue microenvironment, recruits immune inflammatory cells
or release bioactive regulatory factors (e.g. IL-1α) that directly stimulate
proliferation of neighboring viable cells, and ultimately promotes tumor
progression (Galluzzi and Kroemer, 2008; Grivennikov et al., 2010).

Hallmark #4: Enabling replicative immortality
The unlimited replicative potential of tumor cells in culture without evidence of
either senescence or crisis/apoptosis is termed immortality. Telomeres, which

6

protect the ends of chromosomal DNAs from cell viability threatening end-to-end
fusion, are progressively getting shorter in non-immortalized normal cells and
eventually lose their protection ability (Blackburn, 1991). To overcome the
shortening of telomeres that limit their replication potential, tumor cells express
telomerases, the specialized DNA polymerases that add telomere repeat
segments to the ends of telomeric DNA. In the presence of telomerase activity,
tumor cells become resistant to both senescence and crisis/apoptosis, generate
tumor-promoting mutations, and acquire unlimited replicative capacity (Blasco,
2005; Shay and Wright, 2000).

Hallmark #5: Reprogramming energy metabolism
In contrast to normal cells, cancer cells can reprogram their energy
mechanism by limiting their metabolism largely to glycolysis, leading to a state of
“aerobic glycolysis”, a phenomenon termed “the Warburg effect” (Warburg, 1930,
1956). Tumor cells do so in part by upregulating glucose transporters, notably
GLUT1, which substantially increases glucose import into the cytoplasm.
Glycolytic fueling has been shown to be associated with activated oncogenes
and mutant tumor suppressors, conferring tumor cells the capability to proliferate
under stressed conditions, avoiding cytostatic controls, and evading apoptosis
(DeBerardinis et al., 2008; Hsu and Sabatini, 2008).
Given the relatively poor efficiency of ATP-generation by glycolysis
relative to mitochondrial oxidative phosphorylation, the rationale for the glycolytic

7

switch in cancer cells has been questioned. One possible explanation is the fact
that increased glycolysis would allow the diversion of glycolytic intermediates into
various biosynthetic pathways, which actually facilitates the biosynthesis of
macromolecules needed for cell division and organelles of new cells (Vander
Heiden et al., 2009).

Hallmark #6: Avoiding immune destruction
The immune surveillance is responsible for recognizing and eliminating cancer
cells, which functions as a significant barrier to tumor formation and progression.
However, cancer cells are able to evade immunological destruction by either
secreting immunosuppressive factors (e.g. TGF-β, CCL21) (Shields et al., 2010;
Yang et al., 2010) or directly recruiting immunosuppressive inflammatory cells,
like regulatory T cells (Tregs) and myeloid-derived suppressor cells
(Mougiakakos et al., 2010; Ostrand-Rosenberg and Sinha, 2009).

Hallmark #7: Inducing angiogenesis
To access nutrients and oxygen and to evacuate metabolic wastes and
carbon dioxide like normal tissues, tumors need to develop the tumor-associated
vasculature. The tumor vasculature can arise from sprouting and proliferation of
endothelial cells from local vessels (angiogenesis), co-option of preexisting
vessels, or by colonization of circulating endothelial or progenitor other cells
primarily from the bone marrow (vasculogenesis). Different from the transient

8

angiogenesis in normal adult tissues, tumor angiogenic switch is almost always
activated and remains on (Hanahan and Folkman, 1996). Further, angiogenesis
is induced surprisingly early during the development of invasive cancers,
contributing to the microscopic pre-malignant phase of neoplastic progression.
The angiogenic switch is controlled by proangiogenic and antiangiogenic factors,
and most of those regulators are proteins that bind to surface receptors displayed
by vascular endothelial cells (Baeriswyl and Christofori, 2009; Bergers and
Benjamin, 2003). Vascular endothelial growth factor-A (VEGF-A) is the
predominant angiogenic inducer, and its gene expression is upregulated both by
hypoxia and by oncogene signaling (Carmeliet, 2005; Ferrara, 2009; Mac
Gabhann and Popel, 2008).
A number of endogenous inhibitors of angiogenesis can be detected in the
circulation of normal bodies and act as intrinsic barriers to induction and/or
persistence of angiogenesis by incipient neoplasias (Folkman, 2006; Nyberg et
al., 2005; Ribatti, 2009). Tumor growth is impaired by the increasing levels of
circulating endogenous inhibitors.
Circulating endothelial progenitor cells (EPCs), which are thought to
incorporate into the vascular endothelium, contribute to vasculogenesis (Orlic et
al., 2001; Takahashi et al., 1999). A variety of other bone marrow-derived cells
also contribute to the tumor vasculature including cells of innate immune system
(e.g. macrophages, neutrophils, myeloid cells) that infiltrate premalignant lesions
and tumors (Murdoch et al., 2008; Qian and Pollard, 2010; Zumsteg and

9

Christofori, 2009), and are intercalated into the neovasculature as pericytes or
endothelial cells (Kovacic and Boehm, 2009; Lamagna and Bergers, 2006;
Patenaude et al., 2010).

Hallmark #8: Activating invasion and metastasis
Epithelial carcinomas progress to higher grades of malignancy via local invasion
and distant metastasis. The multiple steps process of invasion and metastasis,
has been characterized by a sequence of events beginning with local invasion
through the basement membrane, then intravasation by cancer cells into nearby
blood and lymphatic vessels, transit of cancer cells through the lymphatic and
hematogenous systems, followed by extravasation by escape of cancer cells
from the lumina of such vessels into the parenchyma of distant tissues.
Micrometastatic cancer cells will then either stay dormant or proliferate into
macroscopic tumors, depending on their ability to turn on the angiogenic switch
(Fidler, 2003; Talmadge and Fidler, 2010).
Epithelial to mesenchymal transition (EMT) has become prominently
recognized as a means by which transformed epithelial cells acquire the ability to
invade, to resist apoptosis, and to disseminate (Polyak and Weinberg, 2009;
Thiery et al., 2009; Yilmaz and Christofori, 2009). Moreover, the crosstalk
between cancer cells and stromal cells within the tumor microenvironment has
also been increasingly recognized as playing a critical role in the ability of cancer
cells to invade and metastasize (Egeblad et al., 2010; Kalluri and Zeisberg, 2006;

10

Qian and Pollard, 2010). Another emerging concept is the facilitation of cancer
cell invasion by inflammatory cells that assemble at the boundaries of tumors,
producing extracellular matrix-degrading enzymes and other factors that enable
invasive growth (Joyce and Pollard, 2009; Qian and Pollard, 2010).

In addition to these eight hallmarks mentioned above, two other characteristics of
cancer cells have been recently recognized and are the subject of increased
attention.

Characteristics #1- Genome instability and mutation
Genomic instability and thus mutability endows cancer cells with genetic
alterations that drive tumor progression. Genomic instability and somatic
mutations are the “Darwinian forces” responsible for the activation of oncogenes,
the inactivation of tumor suppressor genes, and other selective processes that
drive malignancy. In addition, specific inherited mutations have been linked to
tumorigenesis. For example, inherited mutations in breast cancer susceptibility
gene 1 and 2 (BRCA1/2) account for 5 to 10 percent of breast cancers and 10 to
15 percent of ovarian cancers among white women in the United States
(Campeau et al., 2008).

11

Characteristics #2- Tumor-promoting inflammation
Inflammation by innate and adaptive immune cells designed to fight infections
and heal wounds can instead result in the support of multiple hallmark
capabilities, thereby manifesting the now widely appreciated tumor-promoting
consequences of inflammatory responses. Inflammation acts at all stages of
tumorigenesis by the production of cytokines, chemokines, growth factors,
reactive oxygen and nitrogen species from immune cells. It may contribute to
tumor initiation through mutations, genomic instability, and epigenetic
modifications. Next, inflammation activates tissue repair responses, induces
proliferation of premalignant cells, and enhances their survival. Inflammation also
stimulates angiogenesis, causes localized immunosuppression, and promotes
the formation of a hospitable microenvironment in which premalignant cells can
survive, expand, and accumulate additional mutations and epigenetic changes.
Eventually, inflammation also promotes metastatic spread (Grivennikov et al.,
2010).

1.1.3 The tumor microenvironment
Tumors have increasingly been recognized as organs whose complexity
approaches and may even exceed that of normal tissues. Several hallmarks and
characteristics of cancer- induction of angiogenesis, activating invasion and
metastasis, avoiding immune destruction, and tumor-promoting inflammation -

involve close interaction between malignant cells and non
the extra cellular matrix (ECM). From this perspective, cancer biology can only
be understood through a non
tumor microenvironment (Figure 1

Figure 1-2. An assemblage of distinct cell types in solid tumors.
(From Hanahan and Weinberg, 2011)
Cancer cells initiate tumors and drive tumor progression forward, carrying
the oncogenic and tumor suppressor mutations that define cancer as a genetic
disease. Cancer stem cells contribute to this process by their ability to efficiently
self-renew and to maintain the genotype of the cancer. Cancer
fibroblasts (CAF) enhance tumor phenotypes, notably cancer cell proliferation,
angiogenesis, and invasion and metastasis
Zeisberg, 2006). Endothelial cells and pericytes are essential for the formation of
the tumor-associated vasculature. Adaptive and innate Immune cells are
recruited to the tumor and can act as friend or foe of cancer cells.
involve close interaction between malignant cells and non-transformed cells and
the extra cellular matrix (ECM). From this perspective, cancer biology can only
be understood through a non-reductionist approach that includes the study of t
tumor microenvironment (Figure 1-2).
2. An assemblage of distinct cell types in solid tumors.
(From Hanahan and Weinberg, 2011)

Cancer cells initiate tumors and drive tumor progression forward, carrying
the oncogenic and tumor suppressor mutations that define cancer as a genetic
disease. Cancer stem cells contribute to this process by their ability to efficiently
maintain the genotype of the cancer. Cancer-associated
fibroblasts (CAF) enhance tumor phenotypes, notably cancer cell proliferation,
angiogenesis, and invasion and metastasis (Bhowmick et al., 2004
. Endothelial cells and pericytes are essential for the formation of
associated vasculature. Adaptive and innate Immune cells are
recruited to the tumor and can act as friend or foe of cancer cells.
12
transformed cells and
the extra cellular matrix (ECM). From this perspective, cancer biology can only
reductionist approach that includes the study of the
2. An assemblage of distinct cell types in solid tumors.

Cancer cells initiate tumors and drive tumor progression forward, carrying
the oncogenic and tumor suppressor mutations that define cancer as a genetic
disease. Cancer stem cells contribute to this process by their ability to efficiently
associated
fibroblasts (CAF) enhance tumor phenotypes, notably cancer cell proliferation,
Bhowmick et al., 2004; Kalluri and
. Endothelial cells and pericytes are essential for the formation of
associated vasculature. Adaptive and innate Immune cells are
recruited to the tumor and can act as friend or foe of cancer cells.

13

Figure 1-3. Signaling interactions in the tumor microenvironment.
(From Hanahan and Weinberg, 2011)

Studying the individual specialized cell types within a tumor also needs to
be complemented by understanding the complex interactions between the
neoplastic and stromal cells within a tumor and the dynamic extracellular matrix
that they collectively erect and remodel. A simplified network of
microenvironmental signaling interactions is illustrated in Figure 1-3. A dynamic
crosstalk between tumor cells and stromal cells exists during the course of
multistage tumor development and promotes cancer aggressiveness.

14

1.1.4 Targeted cancer therapy / personalized cancer medicine
The era of chemotherapy against cancer began in the late 1940’s with the first
use of single agents like nitrogen mustards and antifolate drugs. Between 1950’s
and 1990’s, we witnessed the development of modern chemotherapy, including
the use of combination chemotherapy and adjuvant chemotherapy.
As we enter a new century, we are moving away from the era of “one-size-
fits-all” cancer care toward the era of “targeted therapy”, with the development of
a new generation of cancer drugs designed to interfere with the specific
molecular targets (e.g. tyrosine kinase enzymes) that are believed to have a
critical role in tumor growth or progression. Targeted therapy, also called
molecularly based medicine, precision medicine, or personalized medicine, holds
significant promise to deliver the best therapeutic effects and avoid the
unnecessary toxicities in cancer treatment.
One of the landmark agents is Imatinib (Gleevec) that targets BCR/ABL, a
hyperactive chimeric kinase that is the product of the t9q:22q chromosomal
translocation in chronic myeloid leukemia (CML) and is also active against the
gain-of-function mutation of c-kit in gastrointestinal stromal tumors. The
introduction of Gleevec in the treatment of patients with CML, has improved their
5 year survival from 45 % to 95%. There are also anticancer medications that are
targeted against aberrant expression of cell-surface antigens, like transtuzumab
(Herceptin), a monoclonal antibody against breast cancer cells that express
human epidermal growth factor receptor 2 (HER2+).

15

Currently, over 30 molecularly targeted drugs have been approved by the
Food and Drug Administration (FDA), which have again proved that our deeper
understanding of cancer, particularly at the molecular level, can revolutionarily
improve patient care. Table 1-1 (Hait, 2011), summarizes some of the drugs
developed on the basis of our understanding of tumor biology.
The rapidly growing number of targeted cancer medicines can be
categorized according to their effects on one or more cancer hallmarks (Figure 1-
4). At the same time, we have also realized that each of the hallmark capabilities
is regulated by partially redundant signaling pathways, so blocking one pathway
may not be enough. Alternatively, in response to therapy, tumor cells may also
reduce their dependence on a particular hallmark capability, becoming more
dependent on another. Thus, targeting multiple hallmarks and enabling
characteristics by mechanism-guided combinations will likely result in more
effective therapies for cancer.
Looking ahead, we envision the future where all cancer treatment and
prevention strategies will be based on the analysis of genetic makeup of both a
person’s germ line and his/her specific cancer, and also on the characteristics of
the tumor microenvironment.

16

Figure 1-4. Therapeutic targeting of the hallmarks of cancer.
(Adapted from Hanahan and Weinberg, 2011)

Immune
activating
anti-CTLA4
mAb
Telomerase
inhibitors
Proapoptotic
BH3 mimics
(e.g. ABT-737)
PARP inhibitors
for BRCA1/2
mutant breast
cancer
VEGF signaling
inhibitor
(e.g. Avastin)
B-Raf (V600E)
inhibitor PLX 4032
Hallmark #1
Sustaining proliferative
signaling
Hallmark #2
Evading growth
suppressors
Hallmark #3
Resisting
cell death
Hallmark #4
Enabling replicative
immortality
Hallmark #7
Inducing
angiogenesis
Hallmark #8
Activating Invasion and
metastasis
Hallmark #5
Deregulating
cellular energies
Hallmark #6
Avoiding immune
destruction
Characteristic #1
Genome instability
and mutation
Characteristic #2
Tumor promoting
inflammation
Aerobic
glycolysis
inhibitors
HGF/c-Met
inhibitors
Selective anti-
inflammatory
drugs (e.g. Cox-
2 inhibitors)
Small molecules
to reactivate p53

17

Table 1-1. Drugs developed on the basis of tumor biology.
(From Hait, 2011)

18

1.2 Apoptosis and Bcl-2 family proteins in cancer
1.2.1 Overview of Apoptosis
First discovered by Carl Vogt in 1842, apoptosis is a highly conserved
mechanism by which eukaryotic cells die following a series of molecular and
cellular events. It is one of the major mechanisms of cell death in response to
cancer therapies, and has attracted great attention in the study of cancer biology
and therapy. Cells that are undergoing apoptosis can be characterized by a
series of morphological changes: cell shrinkage, blebbing of plasma membrane,
condensation and fragmentation of DNA, followed by ordered removal by
phagocytes (Kerr et al., 1972).
The apoptosis machinery can be divided into two major pathways based
on the source of death signaling, the Bcl-2-regulated (known as intrinsic or
mitochondrial) apoptotic pathway and death receptor-regulated (known as
extrinsic) apoptotic pathway (Fig.1-5). The intrinsic apoptotic pathway is activated
by a wide range of stimuli, including radiation, cytotoxic drugs, cellular stress,
and growth factor withdrawal, and involves the release of proteins from the
mitochondrial membrane space. By contrast, the extrinsic apoptotic pathway can
function independently of mitochondria and is activated by cell-surface death
receptors, such as CD95 (Fas) and tumor necrosis factor-related apoptosis-
inducing ligand (TRAIL) receptors. In both pathways, cysteine aspartyl-specific
proteases (caspases) are activated and act as executors to cleave cellular

19

substrates, leading to the biochemical and morphological changes of apoptosis
(Adams, 2003).
There is crosstalk between these two pathways: cleavage of the Bcl-2-
family member Bid by an initiator caspase (caspase-8) can activate the intrinsic
pathway after apoptosis induction through death receptors, which can also be
used to amplify the apoptotic signal. In addition, these two apoptotic pathways
converge on the executioner caspases (caspase-3 and caspase-7) (Igney and
Krammer, 2002).

20

Figure 1-5. The apoptotic pathways.
(From Igney and Krammer, 2002)

21

1.2.2 Regulation of extrinsic apoptotic pathway
The extrinsic apoptotic pathway requires effective engagement between the
death receptors on the cell surface and their respective death ligands. The death
receptors belong to the tumor necrosis factor (TNF) superfamily of receptors and
the best-characterized ones are CD95 (Fas) and TRAIL receptors. These
receptors have an extracellular domain to engage the ligands and an intracellular
cytoplasmic death domain to transmit the death signal from the surface to the
intracellular signaling pathways (Ashkenazi and Dixit, 1998).
Activation of death receptors often leads to receptor clustering and
intracellular recruitment of adaptive proteins, like Fas-associated death domain
protein (FADD), into a death-inducing signaling complex (DISC). DISC then
activates an initiator caspase - procaspase-8 that upon activation triggers the
execution phase of apoptosis via the activation of the downstream effector or
executioner caspase-3 (Hengartner, 2000). Activated caspase-8 can also induce
intrinsic apoptosis by cleaving the Bcl-2 family protein Bid into its active form t-
Bid that translocates to the mitochondria (Elmore, 2007; Fesus et al., 1991).

1.2.3 Regulation of intrinsic apoptotic pathway
The intrinsic apoptotic pathway is regulated by three subgroups of the Bcl-2
family proteins (Cory and Adams, 2002): (1) the pro-apoptotic Bcl-2 homology
domain (BH3)-only proteins, including Bim, Puma, Bad, Nova, and Bid; (2) the

22

pro-survival Bcl-2 members, including Bcl-2, Bcl-xL, Bcl-w, Mcl-1, and A1; (3)
the pro-apoptotic Bax and Bcl-2 homologous killer (Bak) subgroup.
The damage signals are transduced by diverse BH-3-only proteins that
use their distinguished BH3 domain to engage their pro-survival relatives (e.g.
Bcl-2, Bcl-xL, Bcl-w, Mcl-1). This interaction ablates the pro-survival function of
the pro-survival Bcl-2 members, allowing the oligomerization and thus the
activation of Bax and Bak, which commit cells to apoptosis by permeabilizing the
outer membrane of the mitochondria. Permeabilized mitochondrial outer
membrane causes dissipation of the proton gradient and the membrane
becomes non-polarized, which results in swelling of the intermembrane space
and release of pro-apoptotic proteins, including proteins such as cytochrome c
and Smac/DIABLO. Cytochrome c induces Apaf-1 oligomerization, leading to the
activation of caspase-9. This active cytochrome c/Apaf-1/caspase-9 complex
forms the apoptosome and activates the executioner caspases-3 and -7,
(Hengartner, 2000; Slee et al., 1999). Smac/DIABLO binds to inhibitor of
apoptosis proteins (IAPs) and deactivates them, thus preventing IAPs from
arresting the apoptotic process.
In the last decade, there has been increasing evidence that pro-apoptotic
mitochondrial membrane permeabilization can exclusively affect the outer
membrane via the formation of lipidic pores or pores formed by Bcl-2 family
members and then, independent of permeability transition, affect the inner
membrane (Kuwana et al., 2002). The p53 tumor suppressor protein can induce

23

the expression of numerous pro-apoptotic gene products that can initiate the
intrinsic apoptotic pathway, such as Nova, Puma, and Bax (Chipuk et al., 2004;
Michalak et al., 2008). Figure 1-6 illustrates the regulations of the intrinsic
apoptotic pathway above discussed.
Certain BH3-only proteins (e.g. Bim,Puma) can engage all the pro-survival
proteins, but others (e.g. Bad, Noxa) engage only subsets (Figure 1-7).

Figure 1-6. The apoptotic pathway from the perspective of Bcl-2 family members
(From Kang and Reynolds, 2009).

24

Figure 1-7. Different binding profiles of BH3-only proteins (Bim, Puma, tBid, Bad,
Nova) towards pro-survival Bcl-2 proteins (Bcl-2, Bcl-XL, Bcl-w, Mcl-1, A1).
(From Adams and Cory, 2007).

1.2.4 Targeting Blc-2 family proteins in cancer
The balance between the pro-survival proteins (e.g. Bcl-2, Bcl-xL, Bcl-w, Mcl-1)
and their BH3 ligands (e.g. Bim, Puma, Bad, Nova, Bid) regulates tissue
homeostasis, and either overexpression of a pro-survival family member or loss
of a proapoptotic relative can be oncogenic. The role of the Bcl-2 family in
association with a more aggressive malignant phenotype or resistance to
anticancer treatments has been widely demonstrated in hematologic
malignancies and solid tumors (Kang and Reynolds, 2009; Minn et al., 1995;
Perego et al., 1997; Reed, 2008). Their role in resistance to targeted therapeutics,
particularly some oncogenic kinase inhibitors (e.g. imatinib, erlotinib), is also now
becoming apparent (Deng et al., 2007; Kuroda et al., 2006). Thus, there is a

25

great interest in developing drugs that function through re-balancing the death
machinery of the cancer cell towards apoptosis.
The first agent reported to target Bcl-2 family machinery was oblimersen
sodium (G3139, Genasense), a phosphothioate Bcl-2 antisense
oligodeoxynucleotite that specifically targets Bcl-2 mRNA. The apoptotic effect of
G3139 antisense in breast cancer cells occurs via an increase in Bax and poly
adenosine diphosphate-ribose polymerase (PARP), ultimately resulting in
intrinsic apoptosis (Emi et al., 2005). G3139 has entered multiple phase II and
phase III clinical trials and shown chemosensitizing effects when combined with
conventional chemotherapy drugs in chronic lymphocytic leukemia (CLL) patients,
leading to improved survival (O'Brien et al., 2007; O'Brien et al., 2009)
More recent advances involve the discovery of small molecule inhibitors of
the Bcl-2 family proteins, which are designed to mimic BH3-only proteins by
binding to the hydrophobic groove of pro-survival Bcl-2 proteins and inhibiting
their activities. This new class of therapeutics is known as BH3 mimetics; the
best characterized BH3 mimetic is ABT-737, discovered and developed by
Abbott Laboratories through a combination of nuclear magnetic resonance
(NMR)-based screening and structure-based design. It predominantly targets
Bcl-2, Bcl-X
L
, and Bcl-w, thereby liberating and activating Bax and Bak, and
ultimately inducing apoptosis of malignant cells (Oltersdorf et al., 2005). The
simplified mechanism of action of ABT-737 is illustrated in Figure 1-8.

26

ABT-263, an oral version of ABT-737 with improved pharmacokinetics,
shares similar biological properties with ABT-737. In xenograft models, ABT-263
shows significant single-agent activity in xenograft models of acute lymphoblastic
leukaemia (Lock et al., 2008) and small cell lung cancer (Shoemaker et al., 2008;
Tse et al., 2008) as well as potent responses in combination with chemotherapy
or targeted inhibitors, such as rituximab, bortezomib and rapamycin (Ackler et al.,
2008). ABT-263 has also entered Phase I and II clinical trials as a single agent in
hematological malignancies that are dependent on Bcl-2 and in small cell lung
cancer (Roberts, 2008), whereas the primary utility of ABT-263 is likely to be in
combination therapies.
Figure 1-8. BH3 mimic anticancer drug ABT-737.
(From Adams and Cory, 2007)

27

1.3 Plasminogen activator inhibitor-1 (PAI-1) in cancer
1.3.1 Overview of urokinase plasminongen activator system
Extracellular proteases play an important regulatory role in many biological and
pathological processes, such as organ development, tissue injury and repair,
inflammation, and cancer (Page-McCaw et al., 2007; Werb, 1997). They process
not only extracellular matrix (ECM) proteins but also growth factors, membrane-
associated receptors, a large variety of ligands, and proenzymes (Overall and
Blobel, 2007). Due to the large variety of substrates they target, extracellular
proteases have an extremely complex role in cancer and have been shown to
have an anti-tumorigenic as well as a pro-tumorigenic function. Adding to the
complexity of their function is the fact that their activity is tightly regulated by
natural inhibitors, which often have other functions besides the control of
extracellular proteolysis.
Such a complex role is well illustrated in the case of the urokinase
plasminogen activator (uPA) system, which is one of the most investigated
protease systems in cancer (Blasi and Sidenius, 2010; Dass et al., 2008;
McMahon and Kwaan, 2008). The uPA system is a serine protease family
consisting of the uPA, its cell membrane receptor uPAR, and two main inhibitors
belonging to the serine proteinase inhibitors (serpin superfamily, the plasminogen
activator inhibitor-1 (PAI-1) and -2 (PAI-2) (Ulisse et al., 2009). The serine
protease uPA concentrates at the cell surface where it becomes activated upon
binding to uPAR (Blasi and Verde, 1990); activated uPA then cleaves

28

plasminogen into plasmin, which is a broad-spectrum serine protease that in
addition to degrading proteins like fibrin and multiple ECM glycoproteins,
activates pro-metalloproteases and converts pro-growth factors into their active
forms (Dano et al., 2005; McMahon and Kwaan, 2008). Plasmin action is mainly
counteracted by the α2-antiplasmin, which also belongs to the serpin superfamily.
The simplified uPA system is illustrated in Figure 1-9.
Figure 1-9. Schematic representation of uPA system. sc-uPA, single chain-uPA,
which is the inactive form; tc-uPA, two chain-uPA, which is the active form; Plg,
plasminogen; PlgR, plasminogen receptor; α2MR/LRP, α2-macroglobulin
receptor/low density lipoprotein receptor related protein. (From Ulisse et al. 2009)

29

Typically these effects result in an increase in tumor cell proliferation,
migration, invasion and metastasis. Accordingly, elevated levels of uPA and
uPAR expression in blood and tumor tissues have been reported to be
associated with poor clinical outcome and a decreased response to
chemotherapy in many different types of cancer (de Witte et al., 2001; Duffy et al.,
1998; Ljuca et al., 2007; Seddighzadeh et al., 2002; Skelly et al., 1997).

1.3.2 The PAI-1 paradox in cancer
Overview of PAI-1
As the primary physiological inhibitor for uPA, PAI-1 is a single-chain
glycoprotein belonging to the serpin family. It is widely expressed in many cell
types, such as fibroblasts, smooth muscle cells, endothelial cells, hepatocytes,
platelets, and many different types of cancer cells (Saksela and Rifkin, 1988).
PAI-1 cDNA encodes a protein containing 402 amino acids with a predicted
nonglycosylated molecular mass of 45 kDa, but the mature secreted form of PAI-
1 consists of 379 amino acids with ~13% carbohydrate, which increases the
molecular weight to ~50 kDa (Ginsburg et al., 1986).
PAI-1 has a dual, anti-proteolytic and anti-adhesion function (Czekay et al.,
2003; Lijnen, 2005): (1) it inhibits uPA-mediated plasminogen activation by
promoting the rapid endocytosis of the trimolecular uPA/PAI-1/uPAR complex
(Bauman et al.; Cale and Lawrence, 2007; Dupont et al., 2009); (2) it also
competes with uPAR and integrins for binding to vitronectin in tumor

30

microenvironment (Deng et al., 1996; Loskutoff et al., 1999). According to these
two major functions of PAI-1, an increased level of PAI-1 would be expected to
inhibit uPA generation of plasmin, protect ECM from proteolysis/degradation, and
also inhibit cell migration therefore inhibiting cancer progression. Surprisingly and
paradoxically, elevated levels of PAI-1 in tumor samples and blood of cancer
patients were discovered to predict a poorer rather than a favorable clinical
outcome in a large variety of cancers including gastric (Allgayer et al., 1997),
colorectal (Berger, 2002), breast (Foekens et al., 1995; Harbeck et al., 1999),
ovarian (Chambers et al., 1998; Kuhn et al., 1999), and lung cancer
(Zekanowska et al., 2004), suggesting that PAI-1 positively contributes to cancer
progression, which is also known as “PAI-1 paradox” in cancer.

PAI-1 in regulation of cell adhesion, migration, and invasion in vitro
The observed effects of PAI-1 on cell adhesion, migration, and invasion are
highly controversial. Due to the capability of uPA of mediating proteolytic
degradation of ECM proteins, uPA would be expected to act anti-adhesively,
while PAI-1 would be expected to promote adhesion. In particular, PAI-1 has
been observed to selectively protect vitronectin against proteolysis by inhibiting
local plasminogen activation and thus stabilizing vitronectin-dependent adhesion
in cell cultures (Ciambrone and McKeown-Longo, 1990). On the other hand, an
anti-adhesive effect of PAI-1 was reported in association with its ability to

31

compete with uPAR and integrins for binding to vitronectin (Deng et al., 1996;
Loskutoff et al., 1999).
There are many reports on the positive effect of uPA in stimulating cell
migration through its ability to activate plasminogen, which is consistent with the
concept that proteolysis would facilitate the penetration of the ECM by tumor
cells. Accordingly, PAI-1 would be expected to inhibit plasminogen activation-
dependent cell migration. However, PAI-1 was found to be either pro-migratory or
anti-migratory, depending on whether it is presented to the migrating cell at its
leading or trailing edge and on its concentration (Kjoller et al., 1997).
Reports on the activity of PAI-1 on tumor cell invasion have also been the
subject of controversy. Some reports suggest that PAI-1 inhibits cell invasion
through its anti-proteolytic activity, (Bruckner et al., 1992), wherehas
coexpression of uPA, uPAR and PAI-1 is required for optimal invasiveness of
human lung cancer cells (Liu et al., 1995). In addition, transfection of PAI-1 cDNA
into PC-3 prostate carcinoma cells has been reported not to alter cell
invasiveness (Soff et al., 1995).

PAI-1 in regulation of angiogenesis and tumor progression
This paradoxical role of PAI-1 in cancer has been primarily attributed to its pro-
angiogenic function. In PAI-1-deficient host, tumor angiogenesis and progression
are greatly impaired. For example, deficiency in PAI-1 expression in host mice
prevented murine T241 fibrosarcoma growth compared with control wild-type

32

mice (Gutierrez et al., 2000). Also, PAI-1 deficiency in the host mice prevented
local invasion and tumor vascularization of transplanted malignant keratinocytes
(Bajou et al., 2008). In addition, our laboratory has previously reported that PAI-1
stimulates angiogenesis by promoting endothelial cells (ECs) migration from
vitronectin-rich perivascular space toward fibronectin-containing tumor tissue
(Isogai et al., 2001). We later demonstrated that PAI-1 protects ECs from
Fas/FasL-mediated apoptosis. This latter effect was found to be the result of
inhibition of plasmin-mediated cleavage of membrane-associated FasL into a
pro-apoptotic soluble FasL fragment (Bajou et al., 2008).
However, PAI-1 appears to promote angiogenesis in a dose-dependent
manner. Low level (physiological level) of PAI-1 in the host may facilitate
angiogenesis and tumor growth. Conversely, administration of high level
(pharmacological level) of PAI-1 seems to prevent the angiogenesis, tumor
growth, and metastasis (Devy et al., 2002; Stefansson et al., 2001). For example,
high levels of PAI-1 expression in human or murine cancer cells were associated
with the retardation of tumor growth, invasion, and metastasis in immunodeficient
mice (Ma et al., 1997; Praus et al., 2002; Soff et al., 1995). Application of high
level of PAI-1 protein to immunodeficient mice bearing transplanted human
tumors caused tumor growth inhibition (Jankun et al., 1997), but low level of PAI-
1 enhanced tumor growth (McMahon et al., 2001).

33

PAI-1 in regulation of cell apoptosis
More recent reports have suggested that PAI-1 may also play a critical role in
regulation of cell apoptosis, particularly in tumor cells. It was first reported that
the addition of rPAI-1 to HL-60 and PC-3 tumor cells inhibits campothecin or
etoposide-induced apoptosis (Kwaan et al., 2000). Overexpression of active PAI-
1 in low PAI-1-expressing MDA-MB-435 breast cancer cells has also been shown
to increase tumor cell survival upon paclitaxel treatment compared with cells
expressing inactive PAI-1 (Beaulieu et al., 2007), and mouse fibrosarcoma cells
derived from PAI-1
-/-
mice were reported to be significantly more sensitive to
etoposide-induced apoptosis than their counterparts derived from PAI-1
+/+
mice
(Romer et al., 2005). The mechanism by which PAI-1 protects tumor cells from
apoptosis is however not well understood. Fibrosarcoma cell lines derived from
PAI-1
-/-
mice have an increased level of spontaneous apoptosis that is associated
with a decreased activation of the PI3K/AKT cell survival pathway (Romer et al.,
2008).

1.3.3 Targeting PAI-1 in cancer
Small inhibitors of PAI-1 have been initially developed with the concept that PAI-
1 inhibition could be valuable to promote plasmin-mediated fibrinolysis post acute
thrombotic events. Based on the observations that PAI-1 paradoxically promotes
tumor progression in several cancer types, interests in using inhibitors of PAI-1 in

34

anti-cancer therapy have been generated. However, only a few studies have
evaluated these PAI-1 inhibitory compounds in the malignant tumor context.
One of the well-characterized small molecule selective inhibitor of PAI-1
(PAI-039/tiplaxtinin) was identified by high-throughput screening of compound
libraries (Elokdah et al., 2004). PAI-039 (Tiplaxtinin), that is orally active, has
been tested in several preclinical models of vascular thrombosis in rats and dogs
and shown to be effective in inhibiting plasma PAI-1 and promoting thrombus
repermeabilization (Elokdah et al., 2004; Hennan et al., 2005; Hennan et al.,
2008). PAI-039 has also been shown to prevent the development of diet-induced
obesity in a preclinical mouse model by inhibiting PAI-1 (Crandall et al., 2006).
PAI-039 has been shown to inhibit endothelial cell motility and angiogenesis in
Matrigel implants in mice (Leik et al., 2006).
In addition, other evidences that inhibition of PAI-1 activity may be of
therapeutic benefit in cancer management were provided by a study which
demonstrated the inhibition of invasiveness of human HT1080 fibrosarcoma cells
and melanoma BLM cells by anti-PAI-1 antibodies (Brooks et al., 2000).
Subsequently, several small molecule inhibitor of PAI-1 were tested for their anti-
cancer activity. XR5967, a diketopiperazine that inhibits the activity of human and
murine PAI-1 , has been shown to dose-dependently inhibit the
invasion/migration of human endothelial cells in an in vitro angiogenesis model
as well as inhibit the invasion of human HT1080 fibrosarcoma cells through
Matrigel (Brooks et al., 2004).

35

Two other PAI-1 inhibitors, SK-216 and SK116, have been tested in Min
mice. Min mice possess a defect in the adenomatous polyposis coli gene that
provokes the formation of intestinal polyps along with serum triglyceride levels up
to 10-fold higher than normal mice. They also exhibit increased serum PAI-1
levels, hepatic PAI-1 mRNA levels and stronger PAI-1 immunostaining in small
intestinal epithelial cells. The administration of SK-216 and SK116 to Min mice
reduced both PAI-1 activity and expression levels, and concomitantly suppressed
intestinal polyp formation, indicating that PAI-1 inhibition could play a role in the
prevention of colorectal tumors (Mutoh et al., 2008).

36

CHAPTER 2
Inhibition of Bcl-2 family members in cancer cell apoptosis-
Synergistic apoptotic activity of Fenretinide and the Bcl-2 family protein inhibitor
ABT-737 against human neuroblastoma

2.1 Abstract
Background: Fenretinide (4-HPR) is a cytotoxic retinoid with minimal systemic
toxicity that has shown clinical activity against recurrent high-risk neuroblastoma.
To identify possible synergistic drug combinations for future clinical trials, we
determined if ABT-737, a small-molecule BH3-mimetic that inhibits most proteins
of the anti-apoptotic Bcl-2 family, could enhance 4-HPR activity in neuroblastoma.

Methods: Eleven neuroblastoma cell lines were tested for the cytotoxic activity of
4-HPR and ABT-737 as single agents and in combination using the DIMSCAN
fluorescence digital imaging cytotoxicity assay. The effect of these agents alone
and in combination on mitochondrial membrane depolarization and apoptosis (by
flow cytometry), cytochrome c release, caspases, Bax-α, t-Bid, and Bak
activation, and subcutaneous xenografts in nu/nu mice was also determined.

Results: Multilog synergistic cytotoxicity was observed for the drug combination
in all of the eleven neuroblastoma cell lines tested, including multi-drug resistant
lines and those insensitive to either drug as single agents. 4-HPR + ABT-737

37

induced greater mitochondrial membrane depolarization and mitochondrial
cytochrome c release, greater activation of caspases, Bax-α, t-Bid, and Bak, and
a higher level of apoptosis than either drug alone. In vivo, 4-HPR + ABT-737
increased the event-free survival (EFS) of the multidrug-resistant human
neuroblastoma line CHLA-119 implanted subcutaneously in nu/nu mice (194.5
days for the combination vs. 68 days for ABT-737 and 99 days for 4-HPR).

Conclusion: Thus, the combination of ABT-737 and 4-HPR warrants clinical trials
in recurrent neuroblastoma.

2.2 Introduction
Neuroblastoma (NB) is an aggressive childhood tumor of the sympathetic
nervous system accounting for 8-10% of all childhood cancers and approximately
15% of cancer deaths in children (Maris and Matthay, 1999). Treatment of high-
risk NB (stage 4 patients > 1-year-old at diagnosis and stage 3 disease with
MYCN amplification or unfavorable histopathology) with multiagent
chemotherapy, radiotherapy, and myeloablative chemotherapy supported stem
cell transplant followed by treatment of minimal residual disease by 13-cis-
retinoic acid (13-cis-RA) (Matthay et al., 2009; Matthay et al., 1999), and more
recently anti-GD2 antibody, cytokines, and 13-cis-RA has significantly improved
the outcome for these patients (Landis et al., 1999; Yu et al., 2010). However, as

38

many high-risk patients still ultimately die from tumor that is refractory to initial
therapy or recurrent, resistant disease, novel therapies effective against
multidrug-resistant NB are needed.
4-HPR is a synthetic derivative of retinoic acid that has a broad-spectrum of
cytotoxic activity against primary tumor cells, cell lines, and xenografts of various
cancers including neuroblastoma (Di Vinci et al., 1994; Maurer et al., 1999;
Ponzoni et al., 1995; Reynolds et al., 2000), and it has been tested in early
phase clinical trials in recurrent NB (Garaventa et al., 2003; Villablanca et al.,
2006; Villablanca et al., 2011). In contrast to retinoids such as all-trans-retinoic
acid (ATRA) and 13-cis-retinoic acid (13-cis-RA) that cause arrest of cell growth
and morphological differentiation of human NB cell lines, 4-HPR induces cell
death in NB cells via both apoptotic and non-apoptotic mechanisms (Di Vinci et
al., 1994; Maurer et al., 1999; Ponzoni et al., 1995). The observation that 4-HPR
remains cytotoxic in NB cell lines that are resistant to all-trans-retinoic acid, 13-
cis-RA, alkylating agents, and etoposide suggests that it may be active in high-
risk NB patients resistant to standard therapy (Maurer et al., 1999; Reynolds et
al., 2003; Reynolds et al., 2000). Indeed, a recent phase I trial in
refractory/recurrent NB patients of a novel oral powder 4-HPR formulation (4-
HPR LXS oral powder) that improves 4-HPR exposures documented four
complete responses (Marachelian et al., 2009).
Overexpression of anti-apoptotic Bcl-2 family proteins is a common
mechanism by which cells become resistant to conventional chemotherapy,

39

providing attractive therapeutic targets (Kang and Reynolds, 2009; Lessene et al.,
2008). NB cell lines obtained from patients with recurrent disease after treatment
exhibit increased levels of Bcl-2 expression, which may be responsible for their
drug resistance (Lasorella et al., 1995). Strong Bcl-2 immunoreactivity was also
detected in islets of residual NB cells in MYCN non-amplified primary tumors of
treated patients (Krajewski et al., 1995). These observations suggest that an
increased expression of anti-apoptotic Bcl-2 family of proteins may be one
mechanism for the resistance of NB cells to cytotoxic agents, including 4-HPR.
We therefore hypothesized that the combination of an inhibitor of proteins of
the Bcl-2 family (such as ABT-737) with 4-HPR would be synergistic against NB
with minimal systemic toxicities. To test this hypothesis, we evaluated the activity
of ABT-737 and 4-HPR (alone and in combination) on a panel of human NB cell
lines and in a xenograft model of recurrent multidrug-resistant human NB.

2.3 Materials and Methods
Cell Culture
We used a panel of eleven human NB cell lines obtained from patients at various
stages of disease: two cell lines established at diagnosis prior to any therapy
(CHLA-15, SMS-KAN); seven cell lines obtained at the time of progressive
disease during induction therapy (SK-N-BE (2), SK-N-RA, CHLA-119, LA-N-6,
CHLA-20, SMS-KCNR, CHLA-140); and two cell lines established at relapse

40

after myeloablative therapy and bone marrow transplantation (CHLA-79, CHLA-
136). All cell lines were established in the senior author’s lab, except SK-N-RA
and SK-N-BE(2) which were a gift of Dr. L Helson; characterization of these NB
cell lines has been previously reported (Keshelava et al., 1998; Keshelava et al.,
2001; Reynolds et al., 1986). Cell line identity was confirmed at time of the
experiments using a 15 loci short tandem repeat (STR) assay + amelin for sex
determination(Masters et al., 2001), with the genetic signature compared to the
Children’s Oncology Group STR database (www.COGcell.org). We also tested
the human normal fibroblast cell line CRL-2076 obtained from the American Type
Culture Collection (ATCC, Manassas, VA).
SMS-KAN, SK-N-BE (2), SK-N-RA, LA-N-6, SMS-KCNR and CRL-2076
cells were cultured in RPMI-1640 medium (Irvine Scientific, Santa Ana, CA)
supplemented with 10% heat-inactivated fetal

bovine serum (FBS) (Gemini Bio-
Products, Inc., Calabasas, CA). CHLA-15, CHLA-119, CHLA-20, CHLA-140,
CHLA-79 and CHLA-136 were cultured in Iscove’s modified Dulbecco’s

medium
(IMDM; Bio Whittaker, Walkersville, MD) containing 20% heat-inactivated FBS
and supplemented with 3

mM L-glutamine (Gemini Bio-Products, Inc., Calabasas,
CA), insulin, and transferrin (5 μg/ml each) and selenium (5 ng/ml) (ITS Culture
Supplement, Collaborative

Biomedical Products, Bedford, MA). All cell lines were
continuously cultured

at 37° C in a humidified incubator containing 95% air + 5%
CO
2
without antibiotics. Experiments were carried out using NB cell lines at
passage

15–35. Cells were detached from culture plates or flasks

with the use of

41

a modified Puck’s Solution A plus EDTA

(Puck’s EDTA), containing 140 mM NaCl,
5 mM KCl, 5.5

mM glucose, 4 mM NaHCO
3
, 0.8 mM EDTA, 13 μM phenol red,

and 9 mM HEPES buffer (pH 7.3).

Drugs and Reagents
ABT-737 was kindly provided by Abbott Laboratories (Abbott Park, IL). 4-HPR
was obtained from the Developmental Therapeutics Program

of the National
Cancer Institute (Bethesda, MD). Fenretinide was formulated as LYM-X-SORB
TM
oral powder (3% 4-HPR by weight, 4-HPR LXS) by Avanti Polar Lipids, Inc,
Alabaster, AL (Maurer et al., 2007), and was kindly provided to the investigators
by Barry J. Maurer, MD PhD. Eosin Y was purchased from Sigma Chemical Co.

(St. Louis, MO) and fluorescein diacetate (FDA) was obtained from Eastman
Kodak Co. (Rochester, NY). Mitochondrial membrane potential probe JC-1 (5,5',
6,6’-tetrachloro-1, 1’, 3,3’-tetraethylbenzimidazolyl-carbocyanine iodide) was
obtained from Molecular

Probes (Eugene, OR); the terminal deoxynucleotidyl
transferase-mediated dUTP nick end labeling (TUNEL) kit and the caspase-8
enzyme inhibitor, Z-IETD-FMK were obtained from BD Biosciences

(APO-
DIRECT
TM
, San Diego, CA). The pan-caspase enzyme inhibitor, Boc-d-fmk, was
purchased

from MP Biomedicals, LLC, (Solon, OH). Stock solutions of ABT-737
(5 mM), 4-HPR (10 mM), FDA (1 mg/ml), JC-1 (2 mg/ml), Z-IETD-FMK (10mM),
and Boc-d-fmk (20 mM) were dissolved in dimethyl sulfoxide (DMSO) except 4-
HPR which was dissolved in 95% ethanol. All reagents were stored at -20° C.

42

Cytotoxicity Assay
The cytotoxicity of ABT-737, 4-HPR, and their combination (at a 1:1 molar

ratio)
was determined in 96-well plates using the semiautomatic fluorescence-based
Digital Imaging Microscopy System (DIMSCAN) (Frgala et al., 2007; Keshelava
et al., 2005). DIMSCAN uses digital imaging microscopy to quantify viable cells,
which selectively accumulate FDA. DIMSCAN is capable of measuring
cytotoxicity over a four log dynamic range by quantifying total fluorescence per
well (which is proportional to the number of viable cells) after elimination of the
background fluorescence by digital thresholding and eosin Y quenching. Cells
were seeded into 96-well plates in 100 μl of complete

medium at 5,000 to 10,000
cells per well. After overnight incubation, ABT-737, 4-HPR, or their combination
was added to each well at various concentrations in 50

μL of culture medium. We
used the following drug concentrations: 0, 1.25, 2.5, 5, 10 μM or 0, 2.5, 5, 7.5, 10
μM in replicates of 12 wells for each experimental condition. After incubation with
the drugs for 96 hours at 37° C, FDA (final concentrati on 10 μg/ml) and eosin Y
(final concentration 0.1% [w/v]) were added to each well and the cells were
incubated for an additional 20 minutes at 37° C. Total fluorescence per well was
then measured using DIMSCAN, and the results were expressed as the ratio of
the fluorescence in treated wells to the fluorescence in untreated wells (survival
fraction).

43

Assessment of Apoptosis by Flow Cytometry
Apoptosis in cells was examined by flow cytometry using a commercial TUNEL
kit (APO-DIRECT
TM
) according to the manufacturer’s instructions. Cells treated
with ABT-737, 4-HPR or their combination in the presence or absence of the
pancaspase inhibitor Boc-d-fmk (40 μM for 1 hour) were collected, washed,
centrifuged and resuspended in 1% (w/v) paraformaldehyde in phosphate
buffered saline (PBS) (pH 7.4). They were then kept on ice for 60 minutes,
washed in PBS, centrifuged,

and fixed in 70% (v/v) ice-cold ethanol at -20° C for
12-18 hours, before been stained with terminal deoxynucleotidyltransferase (TdT)
and FITC-labeled deoxyuridine triphosphates (FITC-dUTP) for 2 hours at 37° C.
After washing with PBS, cells were resuspended in 0.5 ml of propidium iodide (PI)
and RNase containing buffer (5 μg/ml PI, 200 μg/ml RNase). Cells were then
incubated in the dark for 30 minutes at room temperature prior to analysis by flow
cytometry. The percentage of TdT-mediated fluorescent cells was measured by
flow cytometry using band pass filters of 525 ± 25 nm for FITC and 610 ± 25 nm
for PI (Sakahira et al., 1998) in a BD LSR II system (BD Biosciences, San Jose,
CA) equipped with the DiVA software (version 4.1.2; BD Biosciences).

Determination of Mitochondrial Membrane Potential (Δ ψ
m
) Transition
Cells were treated with ABT-737, 4-HPR, or the combination, collected in 5 mL
polystyrene tubes,

centrifuged at 300 g for 5 minutes, and resuspended in 1 ml of
medium

containing 10 μg/ml of JC-1, incubated at 37° C for 10 minutes and

44

analyzed by flow cytometry. The detection of a fluorescence emission shift from

red (610 ±

10 nm) to green (525 ± 10 nm) was an indication of mitochondrial
membrane depolarization (Mancini et al., 1997).

Western Blot Analysis
Cells were lysed in radioimmunoprecipitation (RIPA) lysis buffer

(Upstate,

Lake
Placid, NY), containing 15 μl/ml of phenylmethanesulphonylfluoride (PMSF),

and
40μl/ml of Protease Inhibitor Cocktail (Sigma, St Louis, MD).

The lysates were
left on ice for 15 minutes, briefly sonicated, and centrifuged at 12,000 g for 15
minutes. Protein concentration in the supernatants was determined using the
BCA

protein assay kit (Pierce Biotechnology, Rockford, IL), and

20 μg of protein
in each sample was resolved by electrophoresis in

a 10-20% gradient acrylamide
gel containing 0.1% SDS (Invitrogen, Carlsbad, CA). After electrophoresis, the
gels were transferred to a Protein Nitrocellulose transfer membrane (Whatman
GmbH, Germany). The membrane was hybridized with primary antibodies
followed by horseradish peroxidase (HRP)-conjugated secondary antibodies, and
immunocomplexes detected by chemiluminescence

(Pierce Biotechnology,
Rockford, IL) and visualized on autoradiography

film (Denville Scientific, Inc,
Metuchen, NJ). Quantification was obtained by scanning the immunoblots using
an Epson

Expression 1680 system (Epson, Long Beach, CA). Following
antibodies were used in the western blot analysis: anti-Bax rabbit polyclonal
antibody (#554104) was from BD Biosciences, San Diego, CA; anti-β-actin goat

45

polycolonal antibody, anti-GAPDH mouse monoclonal antibody, and HRP-
conjugated secondary anti-mouse, anti-goat, and anti-rabbit antibodies were from
Santa Cruz Biotechnology, Santa Cruz, CA; anti-caspase-9 rabbit polyclonal
antibody (#9502), anti-caspase-3 rabbit polyclonal antibody (#9662), anti-Bid
rabbit polyclonal antibody (#2002), anti-Bcl-2 rabbit polyclonal antibody (#2870),
anti-Bcl-XL rabbit polyclonal antibody (#2764), anti-Bcl-w rabbit polyclonal
antibody (#2724), anti-Mcl-1 rabbit polyclonal antibody (#5453), and anti-Bak
rabbit polyclonal antibody (#3814) were from Cell Signaling Technology, Danvers,

MA; anti-Bak mouse monoclonal antibody (Ab-1) which recognizes only
conformationally active Bak was from Calbiochem, La Jolla, CA; anti-cytochrome
c rabbit polyclonal antibody and anti-OxPhos Complex IV (COX IV) mouse
monoclonal antibody were from Clontech, Mountain View, CA. Densitometric
analysis was performed using Image J digital imaging software (National Institute
of Health, USA).

Detection of Cytochrome c Release from Mitochondria
After treatment with ABT-737, 4-HPR, or the combination for 6 or 24 hours, cells
were subjected to a

digitonin-based subcellular fractionation (Diaz et al., 2003) to
separate the cytosol (supernatant) from intact mitochondria (pellet). The pellets
were then lysed in RIPA lysis buffer and the resulting proteins were preceded for
western blot analysis as above described.

46

Caspase-8 Activation
Specific Caspase-8/FLICE colorimetic assay (Invitrogen, Carlsbad, CA) was
used according to the manufacturer's instructions to detect the activation of
caspase-8.

RNA interference
Validated small interfering RNAs (siRNAs) specific for Bax (5’-
GCUCUGAGCAGAUCAUGAATT-3’) and Bak (5’-
GCGAAGUCUUUGCCUUCUCTT-3’) were purchased from Qiagen (Valencia,
CA). A nonspecific nonsilencing siRNA (AllStars Negative Control siRNA;
QIAGEN) was used as negative control. Neuroblastoma cells were transfected
with 100 nM of Bax or Bak siRNA or control siRNA using Lipofectamine iMax
transfection reagent (Invitrogen, Carlsbad, CA) according to the manufacturer’s
instructions.

Human Neuroblastoma Xenograft Model
The CHLA-119 NB cell line was injected at 17 x 10
6
cells subcutaneously (s.c.)
between the shoulder blades of 4 to 6-week-old female athymic (nu/nu) mice.
Once palpable and progressing tumors of 100 to 200 mm
3
had developed, mice
were treated with a maximal-tolerated dose of 4-HPR LXS oral powder (240
mg/kg/day) and ABT-737 (50 mg/kg/day) for 5 days per week, alone or in
combination or with the vehicle as control. When given alone, the dose of ABT-

47

737 was increased to 100 mg/kg/day. 4-HPR LXS was prepared as a slurry in
sterile water and given orally by gavage while ABT-737 was administered by
intraperitoneal (i.p.) injection. Tumor volume was determined from
measurements taken twice weekly using the formula 0.5 × height × width ×
length (Tomayko and Reynolds, 1989). When tumor volumes reached 1,500
mm
3
, the mice were sacrificed.

Statistical Analysis
For in vitro experiments, synergistic drug interactions were determined by fixed
ratio dose-response assays of the drugs alone and in combination (4-HPR: ABT-
737 = 1:1). The IC
90
value (the drug concentration that is cytotoxic or growth
inhibitory for 90% of a cell population) and the combination index (CIN) value
were obtained by DIMSCAN analysis and calculated using Calcusyn software
(Biosoft, Cambridge, United Kingdom). Calculation of a CIN is a method to
numerically quantify drug synergism based on the multiple drug–effect equation
of Chou-Talalay derived from enzyme kinetic models (Chou and Talalay, 1981,
1984). With this method, a CIN lower than 0.9 indicates synergism; a CIN of 0.9
to 1.10 indicates additive activity; and a CIN greater than 1.10 indicates
antagonism.
In vivo data were analyzed using the software of Graphpad Prism
(GraphPad Software, Inc., version 4.03, La Jolla, CA). Event-free-survival (EFS)
curves were compared by Kaplan-Meier log-rank test and quantified as the time

48

taken from the initiation of treatment until an event, with events defined as tumor
volume reaching 1,500 mm
3
or when mice died or were sacrificed because of
treatment-related toxicity. An EFS T/C value was defined as the ratio of the
median time to event of the treatment group and the median time to event of the
respective control group (Houghton et al., 2007). For the EFS T/C measure,
agents are considered highly active if they met three criteria: (a) an EFS T/C > 2;
(b) a significant difference (P ≤ 0.05) in EFS distribution between treated and
control (or single agent) and (c) a net reduction in median tumor volume for
animals in the treated group at the end of treatment as compared to treatment
initiation. Agents meeting the first two criteria, but not having a net reduction in
median tumor volume for treated animals at the end of the study, are considered
to have intermediate activity. Agents with an EFS T/C < 2 are considered to have
low levels of activity.
Relative tumor volumes (RTV) for control (C) and treatment (T) mice (Tumor
volume T/C values) were calculated on Day 21 (Houghton et al., 2007). The
mean RTVs for control and treatment mice for each study were then calculated
and the T/C value was the mean RTV for the treatment group divided by the
mean RTV for the control group. For the tumor volume T/C response measure,
agents producing a T/C of ≤ 15% are considered highly active, those with a mean
tumor volume T/C of ≤ 45% but > 15% are considered to have intermediate
activity, and those with mean T/C values > 45% are considered to have low
levels of activity.

49

Results with a P value less than 0.05 were regarded as significant (log-rank
for EFS by Graphpad Prism or unpaired two-sided Student’s t test by Microsoft
Excel 2000 for other data).

2.4 Results
2.4.1 The combination ABT-737 plus 4-HPR was synergistically cytotoxic against
NB cell lines in vitro.
We first determined the cytotoxicity of ABT-737, 4-HPR, and ABT-737 plus 4-
HPR (0 to 10 μM for each drug) at 1:1 molar ratio in eleven NB cell lines using
the DIMSCAN cytotoxicity assay. Representative drug cytotoxicity dose-response
curves are shown in Figure 2-1 and CIN values calculated at the fixed-ratio drug
concentrations tested for cytotoxicity assay as well as IC
90
values of both agents
were indicated in Table 2-1. 4-HPR + ABT-737 showed synergistic activity in all
eleven cell lines (CIN < 0.9). In eight of the eleven cell lines, including those
resistant to 4-HPR alone (CHLA-136), ABT-737 alone (SK-N-BE (2), CHLA-119)
or both (SK-N-RA, CHLA-20), 4-HPR + ABT-737 showed very strong to good
synergistic activity. Only in three cell lines (LA-N-6, CHLA-79, and CHLA-140) did
4-HPR + ABT-737 show moderate or slight synergistic activity. There was no
apparent association between sensitivity to single agents and synergy of the
drugs in combination. To test whether the cytotoxicity of ABT-737 and 4-HPR
was tumor cell specific, we tested their cytotoxic activity on normal human

50

fibroblasts CRL-2076 cells and found that neither ABT-737 nor 4-HPR alone was
cytotoxic as a single agent against CRL-2076 cells at concentrations up to 10 μM,
and that their combination was only minimally toxic (one log decrease in survival)
at the highest concentration (10 μM) (Figure 2-1 D). The basal levels of pro-
apoptotic and anti-apoptotic proteins in 10 of these cell lines was also examined
by Western blot analysis to determine whether there was any correlation
between the basal level of any Bcl-2 family member and the synergism of drug
combination. This analysis (Figure 2-2) indicated that there was no correlation
between the basal levels of Bcl-2, Bcl-X
L
, Bcl-w, Mcl-1, and Bax and the CIN
index.

51

Figure 2-1.The combination ABT-737 plus 4-HPR is synergistically cytotoxic
against NB cell lines but not normal fibroblasts cell line in vitro. Dose response
curves of NB cell lines treated with ABT-737 (●), 4-HPR (○), and the combination
(▼) as measured by DIMSCAN. The concentrations applied for the cell lines
were 1.25 to 10 μM for ABT-737 and/or 4-HPR (except for LA-N-6 and CHLA-79,
from 2.5 to 10 μM). Each condition had 12 replicates, and error bars represent
standard deviations. (A - C)Eleven tested NB cell lines were divided into three
different groups according to therapy received by the patients prior to the line
being established: (A) cell lines established prior any therapy (CHLA-15, SMS-
KAN), (B) cell lines obtained at the time of progression disease during induction
therapy (SMS-KCNR, SK-N-RA, CHLA-20, LA-N-6, SK-N-BE (2), CHLA-119,
CHLA-140), (C) cell lines established at relapse after myeloablative therapy
(CHLA-79 and CHLA-136). (D) Human normal fibroblasts cell line (CRL-2076).

Figure 2-1: Continued

52

Table 2-1.LC
90
of 4-HPR, ABT
in combination with 4-HPR.
diagnosis before therapy (DX), at time of progressive disease during or after
nonmyeloablative therapy (PD), after therapy with 13
myeloablative therapy and bone marrow transplantation (
than 0.9 indicates synergism; 0.1, very strong synergism; 0.1 to 0.3, strong
synergism; 0.3 to 0.7, good synergism; 0.7 to 0.85, moderate synergism; 0.85 to
0.9, slight synergism; 0.9 to 1.1, addictive; and more than 1.1, antagonism.
Indicates not applicable.

HPR, ABT-737 and CIN values of ABT-737 at concentrations
HPR. Lines in the panel included those established at
diagnosis before therapy (DX), at time of progressive disease during or after
nonmyeloablative therapy (PD), after therapy with 13-cis-RA (PD*), after
myeloablative therapy and bone marrow transplantation (PD-BMT).A CIN less
than 0.9 indicates synergism; 0.1, very strong synergism; 0.1 to 0.3, strong
synergism; 0.3 to 0.7, good synergism; 0.7 to 0.85, moderate synergism; 0.85 to
0.9, slight synergism; 0.9 to 1.1, addictive; and more than 1.1, antagonism.
ndicates not applicable.

53
737 at concentrations
Lines in the panel included those established at
diagnosis before therapy (DX), at time of progressive disease during or after
RA (PD*), after
BMT).A CIN less
than 0.9 indicates synergism; 0.1, very strong synergism; 0.1 to 0.3, strong
synergism; 0.3 to 0.7, good synergism; 0.7 to 0.85, moderate synergism; 0.85 to
0.9, slight synergism; 0.9 to 1.1, addictive; and more than 1.1, antagonism. -

Figure 2-2. The basal expression of Bcl
Western blot analysis of basal expression of Bcl

The basal expression of Bcl-2 family members in NB cell lines.
Western blot analysis of basal expression of Bcl-2 family proteins in NB cell lines.

54
2 family members in NB cell lines.
2 family proteins in NB cell lines.

55

2.4.2 The combination of ABT-737 and 4-HPR induced caspase-dependent
apoptosis through mitochondrial membrane depolarization and cytochrome c
release.
Because apoptosis is a major mechanism of action for both 4-HPR and ABT-737,
we examined the effect of single reagents and their combination on apoptosis. In
all four cell lines tested (CHLA-119, CHLA-15, SMS-KAN and CHLA-136), we
observed a higher level of apoptosis when the two drugs were combined in
comparison with each drug alone (Figure 2-3, A). For example, in CHLA-119
cells, the percentage of apoptotic cells at 24 hours was 0.6 ± 0.4% (control), 19.2
± 2.9% in the presence of 2.5 μM ABT-737, 26.9 ± 0.9% in the presence of 2.5
μM 4-HPR, and 82.1 ± 6.0% in the presence of both drugs (P < 0.005 and P <
0.001 relative to ABT-737 and 4-HPR as single agents, respectively). By contrast,
4-HPR did not cause a significant increase of apoptosis in the other cell lines
(CHLA-15, SMS-KAN, and CHLA-136), but the combination of 4-HPR and ABT-
737 significantly increased apoptosis compared with ABT-737 alone. Again, ABT-
737 and 4-HPR (either alone or in combination) did not induce apoptosis in
normal fibroblasts CRL-2076 cells (P > 0.05) (Figure 2-5). Based on the data
above, we concluded that ABT-737 + 4-HPR can induce apoptosis in NB cells in
a synergistic manner, but that ABT-737 and 4-HPR (either alone or in
combination) do not induce apoptosis in non-malignant fibroblast cells.
We next investigated the effect of 4-HPR and ABT-737 on the loss of
mitochondrial membrane potential (Δψ
m
) in CHLA-119, CHLA-15 and SMS-KAN

56

cells. Treatment with ABT-737 and 4-HPR resulted in a greater than additive loss
of Δψ
m
when compared with the sum of the losses observed with each single
agent (Figure 2-3, B). ABT-737 or 4-HPR alone and especially the combination
caused release of cytochrome c from the mitochondria into the cytosol, and a
decrease of cytochrome c in the mitochondrial fraction in CHLA-119 cells (Figure
2-3, C).

57

Figure 2-3. The combination of ABT-737 and 4-HPR induces apoptosis through
mitochondrial membrane depolarization and cytochrome c release. (A and B)
CHLA-119, CHLA-15, SMS-KAN or CHLA-136 NB cells were treated with ABT-
737, 4-HPR, or the combination for 24 hours (for CHLA-15, 3 hours). Drug
concentrations used were 2.5 M for CHLA-119 and CHLA 15, and 5 M for SMS-
KAN and CHLA-136. (A) Cells were then analyzed for apoptosis (TUNEL assay)
by flow cytometry. Bars show the percentages of TUNEL-positive cells, defined
as apoptotic. (B) CHLA-119, CHLA-15 and SMS-KAN cells were incubated with
JC-1 mitochondrial probe and analyzed by flow cytometry. Bars show the
percentages of mitochondrial membrane-depolarized cells. (C) Cytostolic and
mitochondrial extracts from CHLA-119 cells incubated for 6 or 24 hours with
ABT-737, 4-HPR or the combination were prepared and immunoblotted with an
anti-cytochrome c (cyt.-c) antibody. β-Actin and COX IV were used as the loading
control for cytosolic and mitochondrial fractions, respectively.

58

Figure 2-3: Continued

0
20
40
60
80
100
Apoptosis (%)
CHLA-119 CHLA-15 SMS-KAN CHLA-136
**
***
**
***
*
***
*
***
0
20
40
60
80
100
Loss of Δ ψ
m
(%)
CHLA-119 CHLA-15 SMS-KAN
***
***
***
***
**
***
B
A

59

Figure 2-3: Continued

mitochondria
6h 24h
cytosol
Cyt.-c
β-Actin
Cyt.-c
COX IV
0
1
2
cytosolic
cyt.-c/β β β β-Actin
control
ABT-737
4-HPR
ABT-737+4-HPR
ABT-737
4-HPR
ABT-737+4-HPR
0.0
0.5
1.0
mitochondrial
cyt.-c/ COX IV
CHLA-119 C

60

Figure 2-4. The combination of ABT-737 and 4-HPR induces caspase-dependent
apoptosis. CHLA-119 and CHLA-15 cells were incubated with ABT-737, 4-HPR,
or the combination for 1.5, 3 hours (CHLA-15) or 6, 24 hours (CHLA-119). (A)
Cell lysates were then examined by Western blot analysis for caspase-9 and
caspase-3. (B) Cell lysates from CHLA-119 (24h) and CHLA-15 (1.5h) were
incubated with caspase-8 substrate using a colorimetric assay. Bars show the
mean fold increase of casapse-8 activity. (C) CHLA-119 and CHLA-15 cells were
pre-treated with Boc-d-fmk (40 μM) for 1 hour before being exposed to ABT-737,
4-HPR, or the combination for 24 (2.5 μM) or 3 hours (2.5 μM). After treatment,
apoptotic cells were measured by flow cytometric TUNEL assay. Bars show the
percentage of TUNEL-positive cells, defined as apoptotic. All the data shown are
representative of two independent experiments. In A, B, E, and F, data represent
mean + standard deviations (SD) of triplicate samples. * P < 0.05, ** p < 0.005,
*** p <0.001.

CHLA-15
control
ABT-737
4-HPR
ABT-737+4-HPR
0
20
40
60
80
100
- Boc
+ Boc
CHLA-119
control
ABT-737
4-HPR
ABT-737+4-HPR
% Apoptosis
0
20
40
60
80
100
- Boc
+ Boc
**
**
***
**
**
B C
A

61

Caspase-9 is a key intermediate in the mitochondrial or intrinsic apoptotic
pathway, and caspase-3 is the main final "effector caspase" inducing cell death.
We therefore examined the effects of ABT-737, 4-HPR and their combination on
the expression and activation of these two caspases (Figure 2-4, A). The data
indicated that both caspase-9 and caspase-3 were cleaved and activated upon
treatment with ABT-737 alone or in combination with 4-HPR. To determine
whether the effect of 4-HPR and ABT-737 solely involved activation of intrinsic
pathway, we also examine their effect on the activation of caspase-8, the major
caspase involved in the extrinsic apoptosis. The data (Figure 2-4, B) revealed
that caspase-8 activity was significantly higher in CHLA-119 and CHLA-15 cells
treated with the combination than in untreated cells or in cells treated with any
agent alone. This data suggested that ABT-737 plus 4-HPR induced both
extrinsic and intrinsic apoptotic pathways. To confirm that apoptosis induced by
these reagents was caspase-dependent, we pretreated the cells with a pan-
caspase inhibitor Boc-d-fmk (40 μM) 1 hour before drug exposure and examined
cells for apoptosis by TUNEL assay (Figure 2-4, C). In all cases (single drug and
combination), blocking caspase activity in the presence of Boc-d-fmk returned
the levels of apoptosis to the levels observed in the absence of any drug (control).
These data indicated that the apoptotic effects of ABT-737, 4-HPR and the
combination were caspase-dependent.

Figure2-5. The combination ABT
normal fibroblast cells in vitro
737 (5 μM), 4-HPR (5 μ
measured by TUNEL and flow cytometry. The bar graph shows the percentage of
apoptotic cells and the values represent means (± SD) of triplicate samples.

. The combination ABT-737 plus 4-HPR does not induce apoptosis in
in vitro. CRL-2076 fibroblasts were incubated with ABT
HPR (5 μM) or the combination for 24 hours. Apoptosis was
measured by TUNEL and flow cytometry. The bar graph shows the percentage of
apoptotic cells and the values represent means (± SD) of triplicate samples.

62
HPR does not induce apoptosis in
incubated with ABT-
M) or the combination for 24 hours. Apoptosis was
measured by TUNEL and flow cytometry. The bar graph shows the percentage of
apoptotic cells and the values represent means (± SD) of triplicate samples.

63

2.4.3 The combination of ABT-737 and 4-HPR increased expression of members
of the pro-apoptotic Bcl-2 family of proteins.
To further explore the mechanisms of the apoptosis induced by ABT-737 and 4-
HPR, we determined the effects of ABT-737, 4-HPR, and the combination on the
expression of pro-apoptotic proteins Bid and Bax by Western blot analysis
(Figure 2-6, A). The activation of Bid was shown by the presence of the 15 kDa
truncated form of Bid (t-Bid), and the activation of Bax by the presence of Bax-α
(21 kDa), the most active form of Bax that plays a key role in cytochrome c
release. In CHLA-136 cells (sensitive to ABT-737 and resistant to 4-HPR), ABT-
737 activated Bid as indicated by the presence of t-Bid and Bax-α, and a greater
effect was seen with the combination whereas 4-HPR alone had little effect. In
CHLA-119 cells, which are relatively sensitive to 4-HPR but resistant to ABT-737,
treatment with 4-HPR induced the truncation of Bid in a

time-dependent manner,
and a maximum activation was observed in the presence of 4-HPR + ABT-737.
Bax activation occurred earlier

in CHLA-136 than CHLA-119, perhaps due to
differences in

the relative sensitivity of them to ABT-737 as a

single agent.
The cleavage of Bid into tBid further supported the contribution of the
extrinsic apoptotic pathway to the apoptosis induced by 4-HPR and ABT-737
since Bid is a substrate for caspase-8 (Kantari and Walczak, 2011). To confirm
this possibility, we tested whether the activation of Bid into tBid in cells treated
with ABT-737 and 4-HPR could be prevented by the caspase-8 inhibitor Z-VAD-
FMK (20 μM). The data (Figure 2-6, B) indicated a significant decrease of Bid

64

cleavage into tBid when CHLA-119 cells were pre-treated with Z-VAD-FMK 1
hour before being exposed to 4-HPR and ABT-737.
Besides Bax and Bid activation upon drug treatment, the activation of
another proapoptotic Bcl-2 family protein, Bak, was detected by western blot
using an antibody which specifically recognizes activate Bak (Figure 2-6, C). To
determine whether the activation of Bax and Bak in cells treated with ABT-737
and/or 4-HPR was a necessary mechanism for the response to the drugs, we
knocked down Bax or Bak by siRNA and examined the apoptosis induced by the
drug combination. The data (Figure 2-6, D and E) revealed a statistically
significant decrease in 4-HPR and ABT-737-induced apoptosis in CHLA-119
cells in which Bax or Bak were knocked-down compared to control cells, and this
data was consistent with Bax and Bak playing a necessary role in the synergistic
effect of these two drugs on apoptosis.
These results suggested that ABT-737 alone or in combination with 4-HPR
caused the sequestration of Bid

from Bcl-2 and Bcl-X
L
, allowing activation to tBid,
followed

by induction of Bax oligomerization and the conformation change in Bak,
both of which finally induced apoptosis.

65

Figure 2-6. Effects of ABT-737 plus 4-HPR on the activation of pro-apoptotic Bcl-
2 proteins. CHLA-119 or CHLA-136 cells were incubated with ABT-737 or 4-HPR
(2.5, 5 μM, respectively) or the combination for 6 or 24 hours. (A) Cell lysates
were then examined for the presence of pro-apoptotic Bid and Bax. (B) CHLA-
119 cells were pretreated with Z-IETD-FMK (20 μM) for 1 hour before being
exposed to ABT-737+4-HPR (2.5 μM each) for 24 hours. Cell lysates were then
examined for Bid cleavage into t-Bid by Western blot analysis. (C) CHLA-119
cells were incubated with ABT-737 or 4-HPR (2.5 μM each) or the combination
for 24 hours, and the presence of conformationally active Bak and total Bak were
detected by Western blot. (D and E) CHLA-119 cells were transfected with siRNA
against Bax or Bak or control siRNA as indicated in materials and methods.
Knockdown of Bax (D) and Bak (E) protein expression was assessed by Western
blot (upper panels). 48 hours after transfection, cells were treated with ABT-
737+4-HPR (2.5 μM each) for another 16 hours and apoptosis was determined
by flow cytometric TUNEL assay (lower panels). The bar graph shows the mean
percentage of apoptotic cells (± SD) of triplicate samples. All the data shown are
representative of two independent experiments showing similar results. * P <
0.05.

CHLA-119 CHLA-136
Bid
t-Bid
Bax
GAPDH
Bax-α
6h 24h 6h 24h
Non-specific
Active Bak
GAPDH
24h
Total Bak
CHLA-119
A B
C
0
20
40
60
80
100
Bax siRNA
ABT-737+4-HPR
(16h)
*
-
-
-
- + +
+ +
Apoptosis (%)
D E
0
20
40
60
80
100
Bak siRNA
ABT-737+4-HPR
(16h)
*
-
-
-
- + +
+ +
Apoptosis (%)
GAPDH
Bak
Bak siRNA - +
GAPDH
Bax
Bax siRNA
- +

66

2.4.4 Increased in vivo activity of ABT-737 and 4-HPR combination to recurrent
NB xenografts of CHLA-119.
To determine whether ABT-737 and 4-HPR would have a synergistic activity in
vivo, we selected CHLA-119, a cell line derived from a patient whose disease
progressed during intensive multiagent chemotherapy (24) and that is sensitive
to 4-HPR but resistant to ABT-737 and for which strong synergism was observed
in vitro (Table 2-1).
The tumor growth rate over time was recorded (Figure 2-7, A) and tumor
volume T/C on day 21 was calculated to evaluate the capability of inhibiting
tumor growth (Table 2-2). We observed that ABT-737 only showed a low activity
(tumor volume T/C = 66.8%), but both 4-HPR as single agent and 4-HPR + ABT-
737 showed intermediate activity with tumor volume T/C = 45.9 % and 30.9 %
respectively, which was consistent with CHLA-119 cells being resistant to ABT-
737 but sensitive to 4-HPR alone and the combination in vitro. Median EFS and
EFS T/C values were also calculated to evaluate prolonged survival by the log-
rank analysis (Figure 2-7, B and Table 2-2) and the results were consistent with
tumor growth rate analysis. Only 4-HPR (EFS T/C=1.7) and 4-HPR + ABT-737
(EFS T/C = 3.3) statistically increased EFS (P = 0.0002) relative to controls,
whereas ABT-737 had no significant effect (EFS T/C = 1.1, P > 0.05). ABT-737 +
4-HPR also increased EFS relative to either single drug alone (P < 0.001).

67

Thus, in the case of CHLA-119 xenografts, although ABT-737 alone did very
little by itself, the addition of 4-HPR to ABT-737 to which cells were resistant
resulted in a significant response in vivo.

68

Figure 2-7. In vivo antitumor activity of ABT-737 combined with 4-HPR against
human neuroblastoma cells. Athymic (nu/nu) mice were inoculated with CHLA-
119 NB cells and treated with vehicle control (thin lines), ABT-737 (bold lines), 4-
HPR (thin dotted lines) or 4-HPR plus ABT-737 (bold dotted lines). 4-HPR/LYM-
X-SORB (LXS power) 4-HPR in water (240 mg/kg) was given by oral gavage five
days/week. ABT-737 (100 mg/kg) was administered by i.p. injection 5 days/week.
When used in combination, ABT-737 was administered at a dose of 50
mg/kg/day of ABT-737 (half of the dose used in single agent treatment). (A)
Tumor volumes were measured twice per week and the mouse was sacrificed
once the bearing tumor reached 1,500 mm
3
. (B) The EFS of mice was calculated
from the time of tumor injection to the time the tumor volume reached 1,500 m
3
or
the mice had to be sacrificed due to treatment-related toxicity. Each line
represents the proportion of mice remaining event-free over time.

0 50 100 150 200 250 300 350 400 450
0
20
40
60
80
100
control
4-HPR
ABT-737
4-HPR + ABT-737
Days after randomization
% EFS
A
B

69

Table 2-2 In vivo efficacy of ABT-737 in combination with 4-HPR in CHLA-119
NB xenografts. - Indicates not applicable; ∗Relative to controls, P ≤ 0.05; §
Relative to 4-HPR/ABT-737, P ≤ 0.05.
For the EFS T/C measure, agents are considered highly active if they meet three
criteria: (a) an EFS T/C >2; (b) a significant difference in EFS distributions (P ≤
0.05), and (c) a net reduction in median tumor volume for animals in the treated
group at the end of treatment as compared to at treatment initiation. Agents
meeting only the first two criteria are considered to have intermediate activity.
Agents with an EFS T/C <2 are considered to have low levels of activity.
For the tumor volume T/C response measure, agents producing a T/C ≤ 15% are
considered highly active; those with a T/C ≤ 45% but T/C ≥ 15% are considered
intermediately active; and those with mean T/C values ≥ 45% are considered to
have low levels of activity.

Figure 2-8. Effects of ABT
were incubated with ABT
hours. Cell lysates were then examined for the presence of Mcl

Effects of ABT-737 plus 4-HPR on Mcl-1 expression. CHLA
were incubated with ABT-737 or 4-HPR (2.5 μM) or the combination for 6 or 24
hours. Cell lysates were then examined for the presence of Mcl-1.

70
CHLA-119 cells
M) or the combination for 6 or 24

71

2.5 Discussion
The antiapoptotic Bcl-2 family of proteins provides one mechanism by which
malignant cells can survive from various cytotoxic drugs and inhibition of Bcl-2
family anti-apoptotic proteins by drugs like ABT-737 is a promising approach for
the treatment of cancer. Here we have showed that ABT-737 is active against
most NB cell lines in vitro and has a synergistic anti-tumor effect when combined
with 4-HPR at a concentration range that is active and tolerable in mouse
xenograft models (Oltersdorf et al., 2005). Concentrations of 4-HPR used in this
study were within the range achieved in children in clinical trials (Villablanca et al.,
2006) with little hematopoietic toxicity observed.
In most of the NB cell lines and drug concentrations tested in this study, we
found that 4-HPR alone had modest effect on apoptosis, whereas ABT-737 alone
readily induced apoptosis in sensitive cell lines. In some cell lines, like CHLA-119,
the cells were found relatively resistant to ABT-737. However, despite of this
resistance, in all cell lines the combination of the two drugs was found active
synergistically in vitro. We also found that ABT-737 enhanced the activity of 4-
HPR for CHLA-119 in vivo. Interestingly, we observed that the combination of
these two agents had minimal toxic effect on normal human fibroblasts, which is
consistent with similar observations made in normal resting lymphocytes (Kang
et al., 2008), and suggests that the combination should have minimal toxicity for
non-neoplastic cells in vivo.

72

The combination of 4-HPR and ABT-737 induced the loss of ΔΨm and the
release of cytochrome c to the cytoplasm (Figure 2-3, B and C), indicating that
this effect involves the mitochondrial pathway. Activation of caspase-9 and
caspase-3 by ABT-737 in the presence or absence of 4-HPR further confirmed
that ABT-737 acts via the mitochondria-dependent apoptotic pathway (Figure 2-4,
A). In addition, the observation that caspase-8 was activated by these two agents
(Figure 2-4, B) and the fact that ABT-737 and 4-HPR-induced cleavage of Bid
into tBid was inhibited in the presence of a caspase-8 inhibitor, indicate the
involvement of the extrinsic apoptotic pathway as well (Figure 2-6, B).
Furthermore, the majority of apoptosis induced by ABT-737 alone and by the
combination of ABT-737 + 4-HPR occurred largely via caspase-dependent
pathways as indicated by the fact that the pancaspase inhibitor Bok-d-fmk
reversed the effect of ABT-737 and 4-HPR on apoptosis (Figure 2-4, C).
The mitochondrial apoptotic pathway is controlled by a balance between the
pro-apoptotic protein members (i.e. the multi-domain pro-apoptotic Bax, Bak, and
BH-3 only pro-apoptotic Bid, Bim, Bad, Bik, Noxa, Puma, Bmf, Hrk) and anti-
apoptotic protein members (i.e. the multi-domain anti-apoptotic Bcl-2, Bcl-X
L
, Bcl-
w, Mcl-1, Bfl/A1) of the Bcl-2 family. Those multi-domain Bcl-2 proteins are
functionally regulated by the BH-3 only proteins (Letai, 2005; Letai et al., 2002).
Bid is localized in the cytosolic fraction of cells as an inactive precursor (Luo et
al., 1998) and truncated Bid (tBid), the active form of Bid, is generated upon
proteolytic cleavage by caspase-8 (Gross et al., 1999; Yin et al., 1999).

73

We showed that ABT-737 together with 4-HPR increased the release of
sequestrated tBid from Bcl-2 and Bcl-X
L
, and the induction of Bax and Bak
oligomerization (Figure 2-6). The observation that Bid was cleaved into tBid in
cells treated with ABT-737 alone or in combination with 4-HPR is similar to the
previously reported activity of ABT-737 on leukemic and human pancreatic
cancer cells (Huang and Sinicrope, 2008; Kang et al., 2007). The fact that Bax or
Bak knockdown significantly impaired the apoptosis induced by ABT-737 plus 4-
HPR further confirms the importance of Bax and /or Bak activation in this process
and suggest that these changes in the expression of these pro-apoptotic Bcl-2
family proteins are likely responsible for the synergistic effect observed with ABT-
737 and 4-HPR. Another anti-apoptotic Bcl-1 family protein Mcl-1 has been
shown to be overexpressed in cells resistant to ABT-737 (Chen et al., 2007; Del
Gaizo Moore et al., 2007; Lin et al., 2007; Tahir et al., 2007; Wesarg et al., 2007)
and a recent study in ALL demonstrated that the combination of ABT-737 and 4-
HPR was associated with Mcl-1 inactivation by 4-HPR (Kang et al., 2008).
Different from their mechanism in ALL, ABT-737 and 4-HPR did not change the
Mcl-1 levels in NB cells (Figure 2-8).
We extended our in vitro cytotoxicity studies by showing that 4-HPR and
ABT-737 enhanced EFS in CHLA-119 tumor-bearing mice when compared to
either drug alone (Figure 2-7). These observations were consistent with our in
vitro data demonstrating synergistic cytotoxicity for ABT-737 + 4-HPR against
CHLA-119. Thus, we have demonstrated a positive synergistic interaction

74

between 4-HPR and the BH3 mimetic agent ABT-737 in NB cell lines and
consistent with the in vitro activity we showed anti-NB activity of this novel
combination in a mouse xenograft model of recurrent, TP53-mutated, p53-non-
functional, multidrug-resistant NB. These data support clinical trials combining 4-
HPR with BH3 mimetic drugs in children with recurrent NB.

75

CHAPTER 3
Inhibition of PAI-1 in cancer cell apoptosis-
Pro-Tumorigenic Activity of PAI-1 through an Anti-Apoptotic Function on Tumor
Cells

3.1 Abstract
Background: PAI-1 is a predictor of poor outcome in cancer. An explanation for
this paradoxical role has been its pro-angiogenic activity. The effect of PAI-1 on
tumor cells has not been explored. Here we have examined the effect of PAI-1
knockdown (KD) on the survival of human cancer cell lines in vitro and in vivo.

Methods: Endogenous PAI-1 in four human tumor cell lines was knocked down
by small interfering RNA (siRNA) and the effect on Fas/FasL-mediated apoptosis,
caspase activation, and plasmin activity was examined. Stable PAI-1 KD tumor
cells were generated by the transduction of short hairpin RNA lentivirus and
examined for tumorigenicity in immunodeficient wildtype and PAI-1 knockout
mice. The effect of PAI-1 suppression was evaluated by bromodeoxyuridine
incorporation, terminal nucleotidyl transferase-mediated nick end labeling, and
CD31 staining. All statistical tests were two-sided.

Results: We demonstrated a decrease in survival and an increase in apoptosis in
the four cell lines when PAI-1 was genetically (siRNA) or pharmacologically (PAI-

76

1 inhibitor, PAI-039) suppressed. Apoptosis was blocked by a caspase-8 inhibitor,
Fas/FasL neutralizing antibodies, and plasmin inhibitors. In vivo, we observed a
decrease in tumor growth, tumor take, cell proliferation and angiogenesis and an
increase in apoptosis in PAI-1 KD HT-1080 tumors in PAI-1 KO mice. A similar
inhibition in tumor growth was observed when PAI-1 KD HCT-116 or A549 cells
were implanted in PAI-1 KO mice. In all PAI-1 KO mice implanted with PAI-1 KD
cells that developed tumors, human PAI-1 was detected in the plasma indicating
an incomplete inhibition of tumor-derived PAI-1. Five out of 15 PAI-1 KO mice
implanted with PAI-1 KD HT-1080 cells and 2 out of 8 implanted with PAI-1 KD
MDA-MB-231 cells never developed tumors.

Conclusions: PAI-1 exerts a protective effect against extrinsic apoptosis in tumor
cells. Downregulation of PAI-1 in both tumor and host cells is necessary for a
significant inhibitory activity on tumorigenesis through a dual effect on tumor cell
and endothelial cell apoptosis. The data suggest that PAI-1 may be necessary for
tumor growth and support further investigation of the use of PAI-1 inhibitors in
pre-clinical models of cancer.

77

3.2 Introduction
This paradoxical role of PAI-1 in cancer has been primarily attributed to its pro-
angiogenic function in the extracellular milieu. It has been shown that in tumor-
bearing PAI-1 deficient mice, there is a defect in angiogenesis (Bajou et al., 2004;
Bajou et al., 1998), and our laboratory has previously reported that PAI-1
stimulates angiogenesis by promoting endothelial cells (ECs) migration from
vitronectin-rich perivascular space toward fibronectin-containing tumor tissue
(Isogai et al., 2001). We later demonstrated that PAI-1 protects ECs from
Fas/FasL-mediated apoptosis. This latter effect was found to be the result of
inhibition of plasmin-mediated cleavage of membrane-associated FasL into a
pro-apoptotic soluble FasL fragment (Bajou et al., 2008).
uPA, uPAR, and PAI-1 are also expressed by tumor cells (Madsen et al.,
2006) and PAI-1 has been shown to regulate apoptosis in both normal and
cancer cells (Lademann and Romer, 2008; Romer et al., 2008), but the
mechanisms have not been fully explored. Furthermore studies have suggested
that PAI-1 primarily acts extracellularly. This leaves the question whether stroma-
derived PAI-1 could compensate for a lack of PAI-1 in the tumor cells and vice-
versa. Here, we have examined the effect of PAI-1 suppression in tumor cells on
their survival in vitro and the effect of PAI-1 suppression in both tumor cells and
host cells on tumorigenesis in vivo.

78

3.3 Materials and Methods
Cell Lines and Cell Culture
HT-1080 human fibrosarcoma, A549 human lung carcinoma, HCT-116 human
colon carcinoma, and MDA-MB-231 human breast adenocarcinoma cell lines
were obtained from American Type Culture Collection (ATCC; Manassas, VA).
All cells were grown in monolayer cultures in RPMI-1640 medium (Mediatech Inc.,
Manassas, VA) supplemented with 10% fetal bovine serum (FBS; Hyclone,
Logan, UT), 2 mM L-glutamine (Invitrogen, Carlsbad, CA), 100 μg/mL
streptomycin (Mediatech Inc.), and 100 units/mL penicillin (Mediatech Inc.) in a
humidified incubator (5% carbon dioxide, 95% air) at 37
°
C. Cell lines were
authenticated by short tandem repeat profile analysis (Masters et al., 2001).

Reagents
Purified mouse anti-human Fas Ligand (FasL) neutralizing antibody (NOK-2
clone, 1:100 dilution) and a caspase-8 inhibitor (Z-IETD-FMK, 1:200 dilution)
were purchased from BD Biosciences (San Diego, CA). Mouse anti-human Fas
neutralizing antibody (ZB4 clone, 1:200 dilution) and urokinase plasminogen
activator (uPA) activity assay kit were from Millipore (Billerica, MA). Mouse IgG1
isotype control was from R&D Systems (Minneapolis, MN). Human α2-anti-
plasmin (1:200 dilution) and human recombinant Plasminogen Activator Inhibitor-
1 (rPAI-1, 1:1000 dilution) were both from Calbiochem (San Diego, CA). PAI-1
small molecule inhibitor PAI-039 (Tiplaxtinin) was from Axon MedChem

79

(Groningen, The Netherlands). PAI-039 was dissolved in dimethyl sulfoxide
(DMSO) at a stock concentration of 10 mM and stored at -20
º
C.

RNA Interference
Small Interference RNA (siRNA)
Two duplex oligonucleotides encoding siRNA designed against human PAI-1
mRNA sequences (GenBank Accession number X12701) and a scrambled
control siRNA were used in this study (QIAGEN, Inc., Valencia, CA). The siRNA
target sequences were as follows: PAI-1 siRNA 1: 5′-
AAGGATGAGATCAGCACCACA -3′; PAI-1 siRNA 2: 5′-
AAGCAGCTATGGGATTCAAGA -3′; Scramble control siRNA: 5′-
AATTCTCCGAACGTGTCACGT -3′. Tumor cells were transfected with 100 nM of
PAI-1 siRNA or scramble control siRNA using Lipofectamine 2000 (Invitrogen)
(for MDA-MB-231 cells) or Lipofectamine iMax transfection reagent (Invitrogen)
(for all the other cells) according to the manufacturer’s instructions.

Short Hairpin RNA (shRNA)
For stable knockdown of PAI-1, oligonucleotide duplexes used in siRNA
experiments were expressed as shRNA in a pLKO.1-TRC lentiviral vector
(Addgene, Cambridge, MA) and packaged into lentiviral particles by the
HEK293T producer cell line. Supernatants from HEK293T cells containing
pLKO.1 PAI-1 shRNA or scramble control lentiviral particles were collected after

80

48-72 hours of incubation. Thirty percent confluent tumor cell cultures were
transduced by being incubated overnight with viral supernatant in the presence of
8 μg/mL polybrene (Sigma Aldrich, St. Louis, MO). The virus-containing medium
was then removed and fresh medium containing 1 μg/mL puromycin (Sigma
Aldrich) was added. Pooled populations of puromycin-resistant tumor cells were
obtained after 4-5 days selection without subcloning.

Cell Proliferation and Cytotoxicity Assay
Proliferation and cytotoxicity assays were performed in 96-well plates (1×10
5
-
2×10
5
cells/well), using the fluorescence-based CyQUANT direct cell proliferation
assay kit (Invitrogen) according to the manufacturer’s instructions. When
indicated, PAI-039 was added to each well in 50 μL of medium.

Caspase Activation Assay
Same as the methods described in Chapter 2, caspase activity in cell lysates was
determined using specific colorimetric assay kits of Caspase-3/CPP32
(Invitrogen), Caspase-8/FLICE (Invitrogen), and Caspase-9 (R&D Systems)
according to the manufacturer's instructions.

81

Fluorescence-Activated Cell Sorting (FACS) Analysis
Annexin V Staining Assay
Apoptosis was evaluated by assessing the subdiploid DNA content and Annexin
V binding, using the fluorescein isothiocyanate (FITC) Annexin V Apoptosis
Detection Kit I (BD Biosciences) according to the manufacturer’s instructions.
Briefly, tumor cells were collected and suspended in 100 μL of binding buffer at a
final concentration of 0.5 × 10
6
cells per 50 μL. 5 μL of Annexin V–FITC and 5 μL
of propidium iodide (PI, 20 μg/mL) were added to the cell suspension, and the
mixture was incubated for 15 minutes at room temperature in the dark. The cells
were then resuspended in 400 μL of binding buffer and analyzed by flow
cytometry with band-pass filters of 525 ± 25 nm for FITC and 610 ± 20 nm for PI
in a BD LSR II system (BD Biosciences) equipped with the DiVA software
(Version 6.0; BD Biosciences).

Expression of Fas and FasL on Cell Surface
Cells were collected, resuspended in 1 mL of the buffer containing 5% fetal calf
serum (FCS), 0.1% sodium azide in phosphate-buffered saline (PBS) at a density
of 1 × 10
6
cells/mL. Expression of Fas and FasL on the cell surface was detected
by flow cytometry using a mouse monoclonal anti-Fas (1:100 dilution, Enzo Life
Sciences, Inc., Farmingdale, NY) or anti- FasL (1:100 dilution, Enzo Life
Sciences, Inc.) as primary antibody and a FITC-conjugated horse anti-mouse IgG

82

(Vector laboratories, Inc., Burlingame, CA) as a secondary antibody. A mouse
IgG primary antibody was used as a negative control.

Western Blot Analysis
Same as the method described in Chapter 2, and the following primary
antibodies were used: a mouse monoclonal anti-human PAI-1 antibody (1:500
dilution; R&D Systems), a rabbit polyclonal anti-poly adenosine diphosphate-
ribose polymerase (PARP) antibody (1:500 dilution; Cell Signaling Technology,
Danvers, MA), and a mouse monoclonal anti-glyceraldehyde 3-phosphate
dehydrogenase (GAPDH) antibody (1:1000 dilution; Santa Cruz Biotechnology,
Santa Cruz, CA).

PAI-1 Levels
Human PAI-1 levels in the lysates of cultured cells and mice plasma were
determined using a commercially available enzyme-linked immunosorbent assay
(ELISA) kit (American Diagnostica Inc., Stamford, CT) according to
manufacturer’s instructions.

uPA and Plasmin Activities
Human uPA and plasmin activities in the conditioned medium and total cell
lysates of cultured cells were determined using commercially available

83

SensoLyte AFC uPA and plasmin activity assay kits (Anaspec, Inc., Fremont, CT)
according to manufacturer’s instructions.

Mouse Models and Xenograft Experiments

All animal experiments were performed in accordance with protocols approved
by the Institutional Animal Care and Usage Committee of Children’s Hospital Los
Angeles. Rag-1
-/-
PAI-1
+/+
wildtype (WT) and Rag-1
-/-
PAI-1
-/-
knockout (KO)
immunodeficient mice were generated as previously described (Bajou et al.,
2008; Carmeliet et al., 1993). Four to 6-week-old female mice were used in this
study and mice were genotyped by polymerase chain reaction (PCR) done on tail
DNA using three primers specific for PAI-1 alleles: (1) 5’- GAG TGG CCT GCT
AGG AAA TTC ATT C-3’; (2) 5’- GAC CTT GCC AAG GTG ATG CTT GGC AAC-
3’; (3) 5’- AAT GTG TCA GTT TCA TAG CC-3’. One 400bp band and one 190bp
band were detected in PCR products for PAI-1
+/+
mice and PAI-1
-/-
mice
respectively. MDA-MB-231 cells (2 × 10
6
) were injected into the fourth mammary
fat pad and HT-1080 cells, A549 cells, or HCT-116 cells (5 × 10
6
) were injected
subcutaneously into the right flanks of mice. After tumors became palpable,
tumor size (length and width) was measured every 2 to 3 days using a vernier
caliper and the tumor volume was calculated using the modified ellipsoid formula:
Tumor volume (mm
3
) = (width in mm)
2
× (length in mm) × π / 6. When tumors
reached the size of 1,500 mm
3
or showed signs of ulceration, or when animals
were found in distress, mice were sacrificed by CO
2
euthanasia. Two hours

84

before sacrifice, mice were injected intraperitoneally (i.p.) with 4 mg/mouse
bromodeoxyuridine (BrdU; Sigma Aldrich). After surgical resection, tumor tissue
samples were cut in two halves; one half was fixed in 4% paraformaldehyde in
PBS overnight at 4
°
C before paraffin-embedding and the other half was frozen in
optimum cutting temperature (O.C.T.) formulation (VWR, Radnor, PA).

Mice Blood Collection
Blood samples were collected from anesthetized mice by the retro-orbital method
(Hoff, 2000) using a 75mm hematocrit tube (Drummond Scientific Company,
Broomall, PA). Whole blood was centrifuged in a 200Z gel-coated microcuvette
tube (SARSTED Inc., Newton, NC) and the plasma collected and stored at -20
º
C
before being assayed for human PAI-1 detection by ELISA.

Immunohistochemistry
Terminal Nucleotidyl Transferase-mediated Nick End Labeling (TUNEL) Staining
and BrdU Staining
Paraformaldehyde-fixed, paraffin-embedded tumor tissue sections (5 μm) were
immunostained for TUNEL using an in situ cell death detection kit, AP (Roche
Diagnostics, Indianapolis, IN) followed by a substrate solution (Fuchsin +
substrate-chromogen system, DAKO Corporation, Carpinteria, CA), and for BrdU
using a BrdU immunohistochemistry Kit (Millipore) according to the
manufacturer’s instructions. Images were acquired on a Zeiss wide field Axioplan

85

microscope (Oberkochen, Germany). The number of TUNEL-positive cells was
counted manually in 5 fields per tumor section at 20x magnification to get the
number of apoptotic cells per field. To determine the percentage of proliferative
cells, the number of total nuclei and BrdU-positive nuclei was counted in 5 fields
per tumor at 20x magnification with MetaMorph 6.3 software (Molecular Devices,
Inc., Sunnyvale, CA).

Blood Vessel Staining
O.C.T.-embedded frozen tumor tissue sections (5 μm) were immunostained for
blood vessels using a rat anti-mouse CD31 primary antibody (1:75 dilution, BD
Biosciences) followed by a biotinylated goat anti-rat secondary antibody (1:200
dilution, Vector Laboratories, Inc.). Endogenous peroxidase activity was blocked
by 0.3% H
2
O
2
and Elite-ABC kit (Vector Laboratories, Inc.) was applied
afterwards. Visualization of antibody binding was carried out by diaminobenzidine
(DAB, Sigma-Aldrich) staining and sections were counterstained with Gill 3
Hematoxylin (Sigma-Aldrich). The pixels of CD31-positive cells and the pixels of
the whole tumor area were counted with MetaMorph 6.3 software in 5 fields per
tumor at 20x magnification to obtain the microvessel density per field (Chantrain
et al., 2003).

86

Statistical Analysis
Results were subjected to statistical analysis using GraphPad Prism v5.0
software (GraphPad Software Inc., San Diego, CA). Nonlinear regression of
inhibitory dose-response analysis was used to calculate the IC
50
of PAI-039, the
concentration causing 50% inhibition in cell viability. Kaplan-Meier method was
used to analyze survival curves and student’s t-test (two-sided) was used to
evaluate statistically significant differences in other experiments. Results were
expressed as mean ± 95% confidence intervals (error bars) with at least three
biological replicates. A P value of < .05 was considered statistically significant.
For best fit exponential growth curves shown in Supplementary Figure 5, a non-
linear exponential procedure was performed using STAT software (Version 10,
StataCorp LP, College Station, TX).

3.4 Results
3.4.1 Induction of spontaneous apoptosis upon PAI-1 downregulation or inhibition
in human cancer cell lines
To test the hypothesis that tumor-derived PAI-1 has a similar anti-apoptotic effect
on tumor cells as the one reported by us in EC (Bajou et al., 2008), we first
downregulated PAI-1 expression by siRNA in human cancer cell lines and
examined the effect on spontaneous apoptosis using three different assays
(PARP cleavage, caspase-3 activation, and Annexin V staining). As shown in

87

Figure 3-1, A, transfection of both siRNA sequences resulted in a significant
downregulation of cell-associated PAI-1 protein when compared with cells
transfected with a scramble sequence. The knockdown of PAI-1 expression was
associated with an increase in PARP cleavage (Figure 3-1, A), a statistically
significant increase in caspase-3 activation (Figure 3-1, B) and a statistically
significant increase in the percentage of Annexin V positive cells (Figure 3-1, C)
in all four cell lines tested. For example, in HT-1080 cells, the mean fold
increases in caspase-3 activity upon PAI-1 downregulation by siRNA #1 and #2
when compared with the scramble sequence were 2.75-fold (95% CI = 1.19- to
4.32-fold) and 2.34-fold (95% CI = 0.99- to 3.69-fold), respectively, and the mean
percentages of Annexin V positive cells by PAI-1 siRNA #1 and #2 were 19.80%
(95% CI = 16.99 % to 22.61%) and 12.83% (95% CI = 9.83% to 15.84%),
respectively, when compared with the scramble sequence (3.63% , 95% CI =
2.51% to 4.75%). To prove the specificity of this effect, we demonstrated that the
addition of human rPAI-1 to the culture medium of HT-1080 and MDA-MB-231
cells in which PAI-1 was knocked down by siRNA, restored apoptosis to the
similar low levels observed in the cells transfected with a scramble siRNA (Figure
3-1, D). This observation also pointed to an extracellular effect of PAI-1. We then
combined a pharmacological approach to this genetic approach to further test our
hypothesis by examining the effect of PAI-039 (Tiplaxtinin), a small molecular
PAI-1 inhibitor (Elokdah et al., 2004), on tumor cell apoptosis. These experiments
(Figure 3-2, A) demonstrated that inhibition of PAI-1 activity by PAI-039 induced

88

apoptosis in a dose-dependent manner in HT-1080 and A549 cells. PAI-039 also
inhibited cell survival in HT-1080, A549, HCT-116, and MDA-MB-231 cells, with
IC
50
values of 28.44 μM, 35.70 μM, 32.44 μM, and 61.52 μM, respectively (Figure
3-2, B). Taken together, the data indicate that PAI-1, through an extracellular
effect, has a protective action on spontaneous apoptosis in cancer cells, as
previously shown in EC.

89

Figure 3-1. Induction of spontaneous apoptosis upon PAI-1 downregulation by
siRNA in human cancer cell lines. (A) HT-1080, A549, HCT-116, and MDA-MB-
231 cells transfected with PAI-1 specific small interference RNA (siRNA) #1 (si1),
siRNA #2 (si2), or the scramble control siRNA (sc) were examined after 72 hours
for PAI-1 expression and poly adenosine diphosphate-ribose polymerase (PARP)
cleavage by Western blot analysis. Data are representative of two independent
experiments. The numbers indicated above the gel represent the percent
decrease in PAI-1 expression upon scanning of the Western blot data.(B) Cells
treated as described in (A) were examined for caspase-3 activity using a
colorimetric assay kit. Data represent the mean fold increase in caspase-3
activity ± 95% confidence intervals (error bars) for duplicate samples assayed in
three separate experiments. Two-sided Student t test was applied for two siRNA
samples compared with respective scramble control. (C) Cells treated as
described in (A) were examined for apoptosis by propidium iodide (PI) and
Annexin V staining. (D) HT-1080 and MDA-MB-231 cells were pretreated with or
without human recombinant PAI-1 (rPAI-1, 2.5 μg/mL) for one hour, then
transfected with PAI-1 siRNA or the scramble control siRNA. Apoptosis was
assessed after 72 hours by staining tumor cells with PI and Annexin V using flow
cytometry. For (C and D), data represent the mean percentage of Annexin V
positive cells ± 95% confidence intervals (error bars) for duplicate samples
assayed in three separate experiments. P values were calculated using the two-
sided Student t test * = P < .05, ** = P < .005, and *** = P < .001.

90

Figure 3-1: Continued

A
MDA-MB-231
PARP
PAI-1
GAPDH
HT-1080 A549 HCT-116
sc si1 si2 sc si1 si2 sc si1 si2 sc si1 si2
Inhibition of PAI-1
expression
0% 83% 84% 0% 62% 56% 0% 85% 68% 0% 84% 84%
HT-1080 A549 HCT-116 MDA-MB-231
0
2
4
6
sc
si1
si2
Caspase 3 activity
(fold increase)
***
***
***
**
**
*
***
**
HT-1080 A549 HCT-116 MDA-MB-231
0
10
20
30
40
50
sc
si1
si2
**
***
***
* ***
* ***
**
Apoptosis (%)
A
B
C

91

Figure 3-1: Continued

HT-1080 MDA-MB-231
0
10
20
30
40
50
sc
si1
si1 + rPAI-1
**
*
Apoptosis (%)
D

92

Figure 3-2. Induction of spontaneous apoptosis upon PAI-1 inhibition by PAI-039
in human cancer cell lines. (A) HT-1080 and A549 cells were treated with PAI-
039 at indicated concentrations for 72 hours before being examined for apoptosis
with PI and Annexin V staining. Data represent the mean percentage of Annexin
V positive cells ± 95% confidence intervals (error bars) for duplicate samples
assayed in three separate experiments. P values were calculated using the two-
sided Student t test * = P < .05, ** = P < .005, and *** = P < .001. (B) Dose
response viability curves of HT-1080, A549, HCT-116, and MDA-MB-231 cells
treated with PAI-039 at indicated concentrations for 72 hours. The data represent
the mean percentage of viable cells using dimethyl sulfoxide (DMSO) control as
100% survival determined by the CyQUANT kit; each condition had six replicates
and error bars represent 95% confidence intervals. Data are representative of
two independent experiments.

0.00 6.25 12.50 25.00 50.00
0
10
20
30
A549
HT-1080
PAI-039 (μ μ μ μM)
Apoptosis (%)
**
*
*
PAI-039 (μM)
Fractional Survival (%)
0 10 20 30 40 50
0
20
40
60
80
100
HT-1080
0 10 20 30 40 50
0
20
40
60
80
100
A549
0 10 20 30 40 50
0
20
40
60
80
100
HCT-116
0 20 40 60 80 100
0
20
40
60
80
100
MDA-MB-231
A
B

93

3.4.2 Induction of extrinsic apoptosis upon PAI-1 downregulation in tumor cells
To test whether PAI-1 downregulation in tumor cells involves the activation of the
extrinsic apoptotic pathway, we examined the effect of PAI-1 knockdown on
caspase-8 activation, a marker of extrinsic apoptosis, and the involvement of Fas
and FasL, the key mediators in extrinsic apoptosis reported by us to be regulated
by PAI-1 in EC (Bajou et al., 2008). In support of an involvement of the extrinsic
apoptotic pathway, we first demonstrated a statistically significant 2- to 5-fold
increase in caspase-8 activity in all four tumor cell lines tested (Figure 3-3, A)
upon PAI-1 knockdown by siRNA when compared with respective scramble
controls. Consistent with caspase-8 activation being critical, we showed that the
addition of a caspase-8 specific inhibitor (Z-IETD-FMK) to tumor cells in which
PAI-1 was downregulated by siRNA, prevented the induction of apoptosis as
shown by inhibition of PARP cleavage (Figure 3-3, B).
We next asked the question whether the activation of extrinsic apoptosis
observed upon PAI-1 downregulation involved Fas and FasL. We first
demonstrated the expression of both Fas and FasL on the cell surface of all four
cell lines (Figure 3-3, C). Supporting a necessary role of Fas and FasL, we then
demonstrated an inhibition of PARP cleavage (Figure 3-4, D) in PAI-1 knocked-
down HT-1080 and MDA-MB-231 cells in the presence of a blocking antibody
against Fas (ZB-4) or FasL (NOK-2) or in the presence of both. An analysis of
Annexin V staining was also used to confirm the dependence of this effect on
Fas/FasL-mediated extrinsic apoptosis. These data demonstrated a statistically

94

significant decrease in the levels of apoptosis in all four cell lines tested in the
presence of either Z-IETD-FMK or a combination of both ZB-4 and NOK-2
(Figure 3-3, E). Altogether, the data indicate that PAI-1 protects tumor cells from
Fas/FasL-mediated extrinsic apoptosis.

95

Figure 3-3. Induction of extrinsic apoptosis by plasminogen activator inhibitor-1
(PAI-1) downregulation in tumor cells. (A) Tumor cells transfected with PAI-1
siRNA (closed bars) or the scramble control (open bars) were examined after 72
hours for caspase-8 activity. (B) HT-1080 and MDA-MB-231 cells were
pretreated with or without a caspase-8 inhibitor Z-IETD-FMK before and after
transfected with PAI-1 siRNA or the scramble control. Cells were examined after
72 hours for PAI-1 expression and PARP cleavage by Western blot. (C) HT-1080,
A549, HCT-116, and MDA-MB-231 cells were examined for Fas and FasL
expression by flow cytometry. A mouse IgG (grey area) was used as a negative
control. (D) HT-1080 and MDA-MB-231 cells were pretreated with or without a
Fas neutralizing antibody ZB4, a FasL neutralizing antibody NOK-2, or the
combination before and after being transfected with PAI-1 siRNA or the scramble
control siRNA; ZB4 (5 μg/ml), NOK-2 (5 μg/ml), or the combination were re-
added after transfection. Cells were examined for PAI-1 expression and PARP
cleavage by Western blot analysis after 72 hours. (E) HT-1080, A549, HCT-116,
and MDA-MB-231 cells were pretreated with or without Z-IETD-FMK, or the
combination for one hour, and then transfected with PAI-1siRNA or the scramble
control siRNA; Z-IETD-FMK, ZB4, NOK-2 were re-added after transfection. After
72 hours, apoptosis was determined by staining tumor cells with propidium iodide
(PI) and Annexin V using flow cytometry. Data represent the mean ± 95%
confidence intervals (error bars).

96

Figure 3-3: Continued

Figure 3-3.

A
0
2
4
6
8
MDA-MB-231 HT-1080
PAI-1 siRNA
- +
P < 0.005
P = 0.001
P = 0.007 P = 0.008
A549 HCT-116
- + - + - +
Caspase 8 activity
(fold increase)

MDA-MB-231
PAI-1 siRNA
Z-IETD-FMK
HT-1080
PARP
PAI-1
GAPDH
-
-
-
+
+
-
+
+
PARP
PAI-1
GAPDH

A
B

HT-1080
---- IgG control ---- Fas ---- FasL
A549 HCT-116 MDA-MB-231

ZB4
NOK-2
MDA-MB-231
GAPDH
HT-1080
PARP
PAI-1
GAPDH
PAI-1 siRNA
IgG control
-
-
-
-
-
+
-
-
+
-
-
-
+
+
-
-
+
-
+
-
+
-
-
+
+
-
+
+
PARP
PAI-1
D
C

97

0
10
20
30
P < 0.005
P < 0.005
0
5
10
15
20
25
P < 0.05
P < 0.05
0
10
20
30
P < 0.005
P < 0.05
0
5
10
15
20
P < 0.005
P < 0.005
Apoptosis (%)
+
+
-
-
-
-
-
-
-
-
-
-
+
-
-
-
+
-
-
-
+
-
-
-
-
+
-
+
-
-
+
-
-
+
+
MDA-MB-231 HT-1080 A549 HCT-116
PAI-1 siRNA
Z-IETD-FMK
IgG control
ZB4
NOK-2
E
Figure 3-3. Continued

98

3.4.3 Involvement of plasmin in apoptosis
To test whether this anti-apoptotic role of PAI-1 involves its anti-proteolytic
activity, we first examined the effects of PAI-1 knockdown on uPA and plasmin
activities in HT-1080 cells. As anticipated upon the downregulation of PAI-1, we
observed a statistically significant increase in cell-associated uPA and also to a
lesser degree in active uPA in the conditioned medium (Figure 3-4, A). This
increase in uPA activity was associated with a corresponding increase in active
plasmin in the conditioned medium and in the cell lysates as shown by the
activity assay (Figure 3-4, B). To demonstrate a causal link between plasmin
activity and tumor cell apoptosis, we tested the effect of the addition of plasmin
inhibitors on apoptosis in tumor cells in which PAI-1 was downregulated by
siRNA. The data showed a statistically significant decrease in cell-associated
plasmin activity by the addition of α2-anti-plasmin or aprotinin (Figure 3-4, C,
upper panel) and a statistically significant decrease in the percentage of
apoptotic cells upon PAI-1 downreguflation (Figure 3-4, C, lower panel). These
data indicate that plasmin is involved in inducing apoptosis in tumor cells upon
PAI-1 downregulation.

99

Figure 3-4. Involvement of plasmin in apoptosis upon PAI-1 downregulation. (A)
HT-1080 cells transfected with plasminogen activator inhibitor-1 (PAI-1) small
interfering RNA (PAI-1 siRNA, closed bars) or the scramble control siRNA (open
bars) were examined after 72 hours for urokinase plasminogen activator (uPA)
activity in conditioned medium (CM) and cell lysates (CL) using the SensoLyte
AFC uPA activity assay kit. (B) Cells treated as described in (A) were examined
for plasmin activity in the conditioned medium (CM) and in the cell lysates (CL)
(SensoLyte AFC plasmin activity assay kit). (C) Cells were transfected with PAI-1
siRNA or scramble control siRNA in the presence or absence of α2-anti-plasmin
(20 μg/mL) or aprotinin (50 μg/mL). After 72 hours, cell-associated plasmin
activity in the cell lysates was determined by the SensoLyte AFC plasmin activity
assay kit (upper panel) and apoptosis was assessed by propidium iodide (PI) and
Annexin V staining (lower panel) using flow cytometry. Bar graphs represent the
mean fold increase in uPA or plasmin activity or the mean percentage of Annexin
V positive cells ± 95% confidence intervals (error bars) for duplicate samples
assayed in three separate experiments. P values were calculated using the two-
sided Student t test.

100

Figure 3-4. Continued

0.0
0.5
1.0
1.5
2.0
2.5
CM
PAI-1 siRNA
- +
P = 0.002
P = 0.002
CL
- +
uPA activity
(fold increase)
C
A

0
1
2
3
4
CM
PAI-1 siRNA
- +
P = 0.0037
CL
- +
P = 0.002
plasmin activity
(fold increase)
B
0
1
2
3
4
5
P < 0.005
P < 0.005
plasmin activity in CL
(fold increase)
0
10
20
30
PAI-1 siRNA
- + - + - +
α α α α2-anti-plasmin
- - + + - -
P = 0.05
aprotinin
- - - - + +
P = 0.001
Apoptosis (%)

101

3.4.4 Decreased viability of stable PAI-1 shRNA expressing tumor cells
To stably knock down endogenous PAI-1 expression, tumor cells were
transduced with lentiviral particles containing the pLKO.1-TRC lentiviral vector
coding for PAI-1 shRNAs (sc, sh1 and sh2). In these stable PAI-1 knockdown
cells, the inhibition of PAI-1 expression ranged from 10% to 84% as a function of
the cell line and the shRNA construct as shown by western blot analysis (Figure
3-5, A). Consistent with our previous data using siRNA, we observed a
statistically significant decrease in cell viability in PAI-1 shRNA#1-engineered
HT-1080, A549, HCT-116, and MDA-MB-231 cells on both day 3 and day 5 or 6
when compared with their scramble shRNA-engineered counterparts (Figure 3-5,
B).

Figure 3-5. Decreased viability of tumor cells expressing PAI
RNAs (shRNAs). HT-1080, A549, HCT
transduced with lentiviral particles containing PAI
(sh2), or the scramble control shRNA (sc) expressing vectors. (
examined for PAI-1 expression by Western blot analysis. The numbers indicated
above the gel represent the percent decrease in PAI
of the Western blot dat
experiments. (B) Stable PAI
seeded into 96-well plates and examined at indicated times for DNA content by
the CyQUANT kit. The data represent the mean fold incre
using day 0 (the day of cell seeding) as 1.0 fold; each condition had six replicates
and error bars represent 95% confidence intervals.
using the two-sided Student

A
PAI-1
GAPDH
HT
sc
0 % 62% 51%
Inhibition of PAI-1
expression
Decreased viability of tumor cells expressing PAI-1 short hairpin
1080, A549, HCT-116, and MDA-MB-231 cells were stably
transduced with lentiviral particles containing PAI-1 shRNA #1 (sh1), shRNA #2
sh2), or the scramble control shRNA (sc) expressing vectors. (A) Cells were
1 expression by Western blot analysis. The numbers indicated
above the gel represent the percent decrease in PAI-1 expression upon scanning
of the Western blot data. Data are representative of two independent
) Stable PAI-1 knockdown or scramble control tumor cells were
well plates and examined at indicated times for DNA content by
the CyQUANT kit. The data represent the mean fold increase of DNA content
using day 0 (the day of cell seeding) as 1.0 fold; each condition had six replicates
represent 95% confidence intervals. P values were calculated
sided Student t test. * = P < .05, ** = P < .005, and *** =
MDA-MB HT-1080 A549 HCT-116
sc sh1 sh1 sh2 sc sh1 sh2
0 % 62% 51%
sc sh1 sh2
0 % 63% 60% 0 % 55% 10% 0 % 84% 67%
102
1 short hairpin
231 cells were stably
1 shRNA #1 (sh1), shRNA #2
) Cells were
1 expression by Western blot analysis. The numbers indicated
1 expression upon scanning
a. Data are representative of two independent
1 knockdown or scramble control tumor cells were
well plates and examined at indicated times for DNA content by
ase of DNA content
using day 0 (the day of cell seeding) as 1.0 fold; each condition had six replicates
values were calculated
< .005, and *** = P < .001.

MB-231
sh1 sh2
0 % 84% 67%

103

3.4.5 Inhibition of tumorigenesis of xenotransplanted HT-1080 cells by
downregulation of host- and tumor-derived PAI-1
Because our aforementioned data pointed to an extracellular function of PAI-1 in
protecting tumor cells from extrinsic apoptosis, we postulated that host-derived
PAI-1 may compensate for the lack of tumor-derived PAI-1 and that only in an
absence or sufficient decrease in both host- and tumor-derived PAI-1, would
there be a significant inhibition on tumorigenesis in vivo. We initially tested this
hypothesis in HT-1080 cells (transduced with either PAI-1shRNA #1 or the
scramble shRNA lentiviral vector) that were subcutaneously xenotransplanted
into immunodeficient Rag-1
-/-
PAI-1
-/-
mice or into their WT counterparts (Rag-1
-/-
PAI-1
+/+
mice). Four different experimental groups were generated for these
experiments (Figure 3-6).

104

Figure 3-6. Four experimental groups of mice xenotransplanted with HT-1080
cells. Diagram representing the four experimental groups of mice injected with
HT-1080 cells as described as follows: scramble tumor cells in wildtype mice
(Group 1), PAI-1 knockdown tumor cells in PAI-1 wildtype mice (Group 2),
scramble tumor cells in PAI-1 knockout mice (Group 3), and PAI-1 knockdown
tumor cells in PAI-1 knockout mice (Group 4).

Injection of tumor cells
Rag-1
-/-
PAI-1
+/+
mice
1
2
3
4
host
tumor
host
tumor
host
tumor
host
tumor
+
-
+
+
-
-
-
+
Group
Rag-1
-/-
PAI-1
-/-
mice

105

Mice were monitored for primary tumor formation, tumor volume and
survival during a period of 150 days. The tumor take, which is the percentage of
mice developing tumor, and mean time for a tumor to reach the threshold volume
of 1,500 mm
3
were calculated. Human PAI-1 levels in the mice plasma were also
measured. We observed a statistically significant difference in tumor growth
between tumors of group 1, 2, and 3 mice which reached a volume threshold of
1,500 mm
3
in an average of 18.78 days (95% CI = 13.57 to 23.99 days), 20.67
days (95% CI = 17.62 to 23.72 days), and 20.64 days (95% CI = 17.59 to 23.69
days), respectively and tumors of group 4 mice which reached the threshold
volume in an average of 25.75 days (95% CI = 20.90 to 30.60 days) (Figure 3-7,
A and B). Furthermore, no tumors were detected in 5 out of 15 mice of group 4
resulting in a tumor take of 66.7%, compared with a 100% tumor take in all the
other groups (Figure 3-7, C).
Consistent with the need to inhibit PAI-1 in tumor cells and in host cells to
affect tumorigenesis, we observed a significant increase in survival only in group
4 mice (P = 0.0018) with a prolonged median survival time of 31 days when
compared to 19-21 days in the other three groups (Figure 3-7, D). The levels of
human PAI-1 in the blood at the time of sacrifice in these four groups of mice
were also determined (Figure 3-7, E). This analysis was informative and
indicated a mean plasma PAI-1 concentration of 57.57 ng/mL (95% CI= 13.63 to
101.5 ng/mL) in group 1 mice and 54.69 ng/mL (95% CI = 31.32 to 78.06 ng/mL)
in group 3 as expected considering the high level of PAI-1 expression in HT-1080

106

cells. However low levels of human PAI-1 (10 to 15 ng/ml) were also detected in
the plasma of tumor bearing mice in group 2 and 4 (which were transplanted with
PAI-1 KD tumor cells), indicating a failure of the PAI-1 shRNA to completely
suppress PAI-1 expression in HT-1080 cells. Human PAI-1 was not detected in
the five mice that failed to develop tumors. Together the data suggest that PAI-1
may be necessary for tumor development.
HT-1080 tumors in these 4 groups of mice were examined for apoptosis
(TUNEL staining), proliferation (BrdU incorporation), and angiogenesis (CD31
expression) (Figure 3-8). This analysis revealed a statistically significant increase
in cell apoptosis and a statistically significant decrease in cell proliferation in
tumors derived from group 4 mice, when compared with tumors from group 1
mice (mean number of TUNEL positive bodies per field = 57.13 in group 4 vs
18.84 in group 1, difference = 38.29, 95% CI = 26.67 to 49.89, P = 0.0006; mean
percentage of BrdU positive nuclei per field = 12.93% in group 4 vs 31.78 % in
group 1, difference = -18.85%, 95% CI = -18.01% to -19.70 %, P = 0.0036)
Tumors from group 2 and 3 mice also showed a decrease in BrdU positive cells
but these differences were not statistically significant when compared with
tumors of group 1. There was also a statistically significant decrease in
microvessel density in tumors from group 3 and 4 mice when compared with
tumors from group 1 mice. Altogether the data indicate that a suppression of PAI-
1 in both tumor cells and host cells inhibits tumorigenesis by affecting apoptosis,
cell proliferation and angiogenesis.

107

Figure 3-7. Inhibition of tumorigenesis of xenotransplanted HT-1080 cells by
downregulation of tumor- and host-derived PAI-1. HT-1080 cells stably
transduced with PAI-1short hairpin RNA (shRNA) or scramble control shRNA
lentiviral particles were injected subcutaneously into the right flank of 6- to 8-
week-old female Rag-1
-/-
PAI-1
+/+
mice or Rag-1
-/-
PAI-1
-/-
mice. Four different
experimental groups were generated as shown in Figure 3-6. (A) The volume of
each individual tumor over time. Mice were sacrificed once the tumor volume was
≥ 1,500 mm
3
(horizontal dotted line).

(B) Mean time for tumors in each group to
reach a tumor volume ≥ 1,500 mm
3
. Data are shown as mean ± 95% confidence
intervals (error bars) (two-sided Student t test compared with group 4). (C) The
percentage of mice developing a tumor (tumor take) in each experimental group.
(D) Event free survival (EFS, Kaplan-Meier survival) curve and median survival
time of mice in each group over time. An event was defined as tumor volume ≥
1,500 mm
3
or tumor ulceration that necessitated the sacrifice of the animal.
Overall P value = .0018; P = .006, group 1 vs group 4; P = .0003, Group 2 vs
Group 4; P = .0001, group 3 vs group 4. All P values were calculated using the
log rank test. (E) Mean plasma levels of human PAI-1 in each group at the time
of sacrifice. Data are shown as mean ± 95% confidence intervals (error bars)
(group 1, n = 6; group 2, n = 6; group 3, n = 10; group 4, n = 7).

108

Group 1
n=9
Group 2
n=9
Group 3
n=14
Group 4
n=15
A
0 10 20 30
0
1000
2000
3000
60 80
Days post injection (days)
0 10 20 30
0
1000
2000
3000
60 80
0 10 20 30
0
1000
2000
3000
60 80
0 10 20 30
0
1000
2000
3000
100150
Days post injection
Tumor size (mm
3
)
A

B
C

1 2 3 4
0
10
20
30
40
Group
P < 0.05
Mean time to reach
the threshold (days)

1 2 3 4
0
20
40
60
80
100
100% 100% 100% 66.7%
Group
Tumor take (%)
Figure 3-7: Continued

109

Figure 3-7. continued

0 30 60 90 120 150
0
20
40
60
80
100
group 1 (n=9) 19.0
group 2 (n=9) 21.0
group 3 (n=14) 20.5
group 4 (n=15) 31.0
Log-rank
P = 0.0018
Median Survival
(Days)
Days post injection
EFS (%)
1 2 3 4
0
50
100
150
Group
Human PAI-1 plasma level
(ng/ml)
D
E

110

Figure 3-8. Increase in apoptosis, decrease in proliferation and inhibition of
angiogenesis in the absence of host- and tumor-derived PAI-1 in HT-1080
tumors. (A) Representative immunohistochemical staining of HT-1080 tumor
samples in the four experimental groups for Top) Terminal Nucleotidyl
Transferase-mediated Nick End Labeling (TUNEL), Middle) bromodeoxyuridine
(BrdU), and Bottom) CD31 immunohistochemical staining. The data show cell
nuclei in blue, apoptotic nuclei in red and proliferative cell nuclei and blood
vessels in brown (40x magnification, scale bar = 50 μm). (B) The data show
Upper left) mean TUNEL-positive cells per field (Group 1, n = 45; Group 2, n = 45;
Group 3, n = 40; Group 4, n = 40), Upper right) mean percentage of BrdU-
positive cells per field (Group 1, n = 30; Group 2, n = 35; Group 3, n = 30; Group
4, n = 25), and Lower) mean blood vessel densities per field (Group 1, n = 23;
Group 2, n = 15; Group 3, n = 16; Group 4, n = 24) at 20x magnification. Error
bars represent corresponding 95% confidence intervals. P values were
calculated using the two-sided Student t test and < .05 is considered statistically
significant; ns = not significant.

111

Figure 3-8: Continued

TUNEL BrdU CD31
Group 1 Group 2 Group 3 Group 4
1 2 3 4
0
20
40
60
80
100
P = 0.0006
Group
ns ns
ns
TUNEL positive cells
/ field at 20x (numbers)
1 2 3 4
0
20
40
60
P = 0.0036
Group
ns
ns
BrdU positive nuclei
/ field at 20x (%)
B
1 2 3 4
0
5
10
15
20
25
Group
ns
P = 0.008
P < 0.001
Microvessel
density (%)
B
A

112

3.4.6 Inhibition of A549, HCT-116, and MDA-MB-231tumorigenesis in the
absence of host- and tumor-derived PAI-1
To confirm the inhibitory effect of PAI-1 suppression on tumorigenesis in other
tumor cell lines, we xenotransplanted A549, HCT-116, and MDA-MB-231 cells
transduced with the scramble shRNA lentiviral vector in Rag-1
-/-
PAI-1
+/+
mice
(group 1) and cells transduced with PAI-1 shRNA#1 in Rag-1
-/-
PAI-1
-/-
mice
(group 4) and tested these two experimental groups of mice for primary tumor
formation (Figure 3-9, A) and survival (Figure 3-9, B).
As shown with HT-1080 cells, we observed a statistically significant inhibition
of tumor growth in PAI-1 KO mice xenotransplanted with PAI-1 knockdown A549
and HCT-116 tumor cells (group 4) when compared with PAI-1 WT mice
transplanted with A549 and HCT-116 tumor cells transduced with the control
shRNA (group 1). The mean time to reach the volume threshold of 1,500 mm
3
was 55.2 days in group 4 vs. 44.6 days in group 1 mice transplanted with A549
tumor cells (difference = 10.6 days, 95% CI = 7.9 to 13.3 days, P = 0.05) and
36.0 days in group 4 vs. 21.4 days in group 1 mice transplanted with HCT-116
tumors cells (difference = 14.6 days, 95% CI = 13.9 to 15.0 days, P = 0.002).
Accordingly, there were also significant differences in survival between group 4
mice and group 1 mice injected with these 2 tumor cell lines. In all group 4 mice
that developed tumors, PAI-1 was detected in the serum indicating a failure of
the shRNA to completely suppress PAI-1 expression, as seen in HT-1080 tumors.
In MDA-MB-231 tumor-bearing mice, we observed - as with HT-1080 tumors - a

113

decrease in tumor take with 2 out of 8 mice in group 4 which never developed
tumors even 180 days after tumor cell injection. As was the case in HT-1080
tumors, human PAI-1 in the plasma of these 2 mice was not detected (Figure 3-
10).
In conclusion, our data demonstrate that in the absence of host-derived PAI-
1 and upon a decrease of tumor-derived PAI-1, there is a significant inhibition of
tumorigenesis which is associated with a decrease in angiogenesis, an inhibition
of cell proliferation and an increase in host and tumor cell apoptosis. This
indicates that host-derived PAI-1 can compensate for a decrease in tumor-
derived PAI-1 and vice-versa, and that the pro-tumorigenic role of PAI-1
combines a prosurvival effect on both tumor cells and EC.

114

Figure 3-9. Inhibition of A549, HCT-116, and MDA-MB-231tumorigenesis in the
absence of host- and tumor-derived PAI-1. A549, HCT-116, and MDA-MB-231
cells stably transduced with PAI-1 short hairpin RNA (shRNA) or scramble
control shRNA lentiviral particles were injected into 6- to 8- week-old female PAI-
1
+/+
Rag-1
-/-
mice and PAI-1
-/-
Rag-1
-/-
mice, respectively, to generate two different
experimental groups: PAI-1 scramble cells in PAI-1 wildtype host (group 1), and
PAI-1 knockdown cells in PAI-1 knockout host (group 4). (A) The data represent
the volume of individual tumors over time in each group for the three tumor cell
lines tested. (B) The data represent the event free survival (EFS, Kaplan-Meier
survival) curve (lower panel) in each experimental group for the three cell lines. P
values were calculated using the log rank test.
A

A549 HCT-116 MDA-MB-231
0 20 40 60 80
0
500
1000
1500
2000
2500
Group 1
n=5
0 20 40 60 80
0
500
1000
1500
2000
2500
Group 4
n=5
0 10 20 30 40 50
0
500
1000
1500
2000
2500
Group 1
n=5
0 10 20 30 40 50
0
500
1000
1500
2000
2500
Group 4
n=5
0 50 100 150
0
500
1000
1500
2000
2500
Group 1
n=5
0 50 100 150
0
500
1000
1500
2000
2500
Group 4
n=8
Tumor size (mm
3
)
Days
EFS (%)
0 20 40 60 80
0
20
40
60
80
100
Group 1
Group 4
log-rank
P = 0.048
A549 HCT-116
0 10 20 30 40 50
0
20
40
60
80
100
Group 1
Group 4
log-rank
P = 0.0025
MDA-MB-231
0 50 100 150 200
0
20
40
60
80
100
Group 1
Group 4
log-rank
P = 0.21
Days
B

115

Figure 3-10. Plasma levels of human plasminogen activator inhibitor-1 (PAI-1) in
group 4 of HT-1080 and MDA-MB-231 xenotransplanted mice. Individual human
PAI-1 levels are shown with corresponding tumor volumes.

0 1000 2000 3000 4000
0
10
20
30
40
HT-1080
0 1000 2000 3000 4000
0
10
20
30
40
MDA-MB-231
Human PAI-1 plasma level
(ng/mL)
Tumor Size (mm
3
)

116

3.5 Discussion
The mechanisms to explain the paradoxical activity of PAI-1 in cancer
progression have primarily pointed to an effect on host-derived cells and in
particular on ECs where PAI-1 has been shown to have a pro-angiogenic activity
by promoting ECs migration and inhibiting Fas/FasL-mediated apoptosis (Bajou
et al., 1998; Bajou et al., 2008; Devy et al., 2002; Gutierrez et al., 2000; Isogai et
al., 2001). The role of PAI-1 in tumor cells has initially focused on its inhibitory
activity on tumor invasion and metastasis (Cajot et al., 1990). More recent
reports however suggested that PAI-1 may regulate tumor cell apoptosis. Here
we provide evidence that PAI-1 protects tumor cells from apoptosis by a
mechanism that is dependent on Fas/FasL-mediated apoptosis and partially due
to the activation of plasmin by uPA.
As the primary inhibitor of uPA, PAI-1inhibits uPA-mediated plasminogen
activation by promoting the rapid endocytosis of the trimolecular uPA/PAI-
1/uPAR complex. Accordingly, we observed a significant increase of uPA and
subsequent increase in cell associated-plasmin upon PAI-1 downregulation in
tumor cells in association with an increase in extrinsic apoptosis that could be
prevented upon Fas and FasL blockade. As we found in EC, plasmin is involved
in this apoptosis in tumor cells, because the data indicate that plasmin inhibitors
(α2-anti-plasmin and aprotinin) statistically significantly reverse the apoptosis.
The fact that the addition of rPAI-1 could reverse the apoptosis induced by
PAI-1 downregulation in tumor cells pointed primarily to an extracellular effect of

117

PAI-1 and also suggested that paracrine PAI-1 produced within the tumor
microenvironment may protect tumor cells lacking PAI-1 and vice-versa. This
aspect was demonstrated in our xenotransplantation experiments that compared
WT and PAI-1 KO mice. Among the four experimental groups of mice
xenotransplanted with HT-1080, we only observed a significant inhibition of
tumorigenesis, a decrease in tumor take, and an increase in survival in group 4
mice in which PAI-1 deficient tumor cells were implanted in PAI-1 KO hosts. This
suggests that both host- and tumor-derived PAI-1 need to be inhibited to affect
tumorigenesis. The effect of genetic ablation of PAI-1 on tumor promotion and
progression has however been the subject of conflicting reports. Our data is
consistent with previous reports showing that PAI-1 deficiency in mice markedly
reduced tumor progression and angiogenesis in models of xenotransplantation
(Bajou et al., 1998; Gutierrez et al., 2000). However, the effect of PAI-1
suppression in transgenic tumor models seems to be different. No effect on
tumor development, primary tumor growth, angiogenesis, or lung metastasis was
reported in PAI-1 deficient MMTV-PymT mice that develop spontaneous and
metastatic mammary tumors (Almholt et al., 2003). Similarly, no changes in
tumor progression or angiogenesis were observed in PAI-1 deficient TRP-1/SV40
Tag mice that develop spontaneous metastatic ocular tumors derived from retinal
pigmented epithelium (Maillard et al., 2008) or PAI-1 deficient K14-HPV16
transgenic mice that develop spontaneous skin carcinoma (Masset et al., 2011).
The reason for this discrepancy is not completely understood, but the data may

118

point to some important differences between transgenic and xenotransplanted
models. In transgenic models of carcinogenesis, compensatory mechanisms for
a lack of endogenous PAI-1 that could support tumor progression might be
triggered during development. For instance, an increased level of the angiogenic
factor fibroblast growth factor-1 (FGF-1) was found in primary tumors of PAI-1
deficient TRP-1/SV40 Tag mice and may play a role in stimulating angiogenesis
(Maillard et al., 2008). Subtle differences between human and mouse PAI-1 may
also play a role (Declerck et al., 2011; Matsuo et al., 2007). In mice, PAI-1
activity in plasma is about 5-fold lower than in humans, which points to the
possibility that tumors from transgenic mice may be less dependent on PAI-1 for
survival, whereas human tumors may require PAI-1 for survival and proliferation.
PAI-1 has been proposed as a target for therapeutic intervention in
thrombotic diseases where elevated levels of PAI-1 represent a well-known risk
factor and play a critical role in preventing the repermeabilization of a thrombus
and in promoting restenosis (Brown, 2010; Lijnen, 2009; Meltzer et al., 2009).
PAI-039 (Tiplaxtinin), a small molecule inhibitor of PAI-1 that is orally active, has
been shown to inhibit EC motility and angiogenesis in Matrigel implants in mice
(Leik et al., 2006). In our study, we provide data supporting an anticancer activity
of PAI-039 by showing that it induces apoptosis in tumor cells at concentrations
that inhibit PAI-1 activity in vitro (Gorlatova et al., 2007).
In conclusion, our data have indicated that similar to EC, PAI-1 exerts a
protective effect against Fas/FasL-mediated extrinsic apoptosis in tumor cells,

119

and that both tumor- and host-derived PAI-1 are important in tumor progression.
Our data also confirm PAI-1 as a therapeutic target in cancer and support further
investigation of PAI-1 inhibitors in cancer therapy.

120

CHAPTER 4
Conclusions and Future Directions

4.1 ABT-737 and 4-HPR in human clinical trials
Previously in Chapter 2, we have shown a significant synergistic interaction
between 4-HPR (a synthetic retinoid that has clinical activity against recurrent
high-risk NB) and ABT-737 (a BH3-mimetic small-molecule inhibitor of Bcl-2, Bcl-
XL, and Bcl-w) in NB cell lines through their inhibitory activity against caspase-
dependent apoptosis involving both intrinsic and extrinsic pathways. Consistent
with their synergistic in vitro activity, we also show a similar anti-NB activity in a
mouse xenograft model of recurrent, multi-drug resistant NB. These data support
clinical trials combining 4-HPR with BH3-mimetic drugs (e.g. ABT-737 in
recurrent NB patients.
ABT-263 (or Navitoclax), the oral version of ABT-737, has been tested in
multiple Phase I clinical trials in lymphoid malignancies (Wilson et al., 2010),
small-cell lung cancer and other solid tumors (Gandhi et al., 2011), showing
promising antitumor activity with good safety and tolerance. Multiple combination
clinical trials combining ABT-263 and other targeted therapies or chemotherapies
are currently under investigation (data from clinicaltrials.gov.). A recently Phase II
clinical trial of 4-HPR (oral capsular version) has shown promising responses in
14/59 (24%) of recurrent NB patients (Villablanca et al., 2011). Low bioavailability
may have limited 4-HPR activity and novel formulations with improved

121

bioavailability are required. A phase I clinical trial has demonstrated that an
intravenous intralipid emulsion formulation of 4-HPR (ILE 4-HPR) could be safely
administered and can achieve plasma levels 6 to 7 times higher than previously
obtained by oral capsule 4-HPR, with clinical activity in hematologic malignancies
(Mohrbacher et al., 2007).
Keeping in mind of our ultimate goal to push this novel drug combination
(4-HPR + ABT-737) to the clinical testing in NB patients, there are a few
limitations or concerns from these current studies. For example, despite the
striking cytotoxic activity of ABT-737 on all the NB cell lines tested, even on those
multi-drug resistant cell lines, we couldn’t demonstrate a correlation between
sensitivity of ABT-737 and the relative levels of Bcl-2 family proteins, which might
raise a problem in the clinical setting to find the “right” patients for the ABT-737
treatment. Moreover, both intrinsic resistance and acquired resistance are the
common failures of chemotherapies, so it would be quite beneficial if we can
predict the potential resistant mechanisms before we start treating patients with
ABT-737 or the combination.

4.2 PAI-1 in cancer biology and therapy
Previously in Chapter 3, we have demonstrated that intrinsic tumor-derived PAI-1
exerts a protective effect on tumor cells from Fas/FasL-mediated extrinsic
apoptosis, which partially involves plamin activation. In vivo data suggest both

122

tumor- and host-derive PAI-1 are important in tumor progression. We have
proved a causal relationship between upregulated plasmin activity and apoptosis
in tumor cells, but other mechanisms besides plamin may also be involved as
shown by the observation that that the almost complete inhibition of plasmin
activity cannot fully block apoptosis. An important and remaining question that
our data raised is the presence of a plasmin-independent mechanism by which
PIA-1 protects tumor cell from apoptosis.
Our data also provide the foundation for the pre-clinical testing of PAI-1
inhibitors in cancer models. PAI-039 is unlikely to be the leading compound
because of its limited bioavailability and absence of effect against vitronectin-
bound PAI-1. New compounds however are emerging such as TM5001, TM5007,
and TM5275, developed by a Japanese translational research group (Izuhara et
al., 2008; Izuhara et al., 2010). The orally active PAI-1 inhibitor TM5275 was
newly identified by an extensive study of structure-activity relationship based on
the lead compound TM5007. With an improved pharmacokinetic properties
compared with TM5007, TM5275 has shown better antithrombotic benefits
devoid of bleeding effect in nonhuman primates (Izuhara et al., 2010) and it also
been proved to be effective in another PAI-1-related disease model- lung fibrosis
(Huang et al., 2012). All these data have suggested that TM5275 could be tested
in pre-clinical models of cancer growth and metastasis.

123

4.3 Targeting both Bcl-2 family proteins and PAI-1 in cancer
Our data also raise the intriguing question whether combining an approach
targeting Bcl-2 in tumor cells with an approach of targeting PAI-1 in the
extracellular space and microenvironment could have a therapeutic value and
could increase the response of tumor cells to chemotherapy. Although exploring
this question is beyond the scope of my dissertation, it would be interesting to
test this novel strategy that might be potentially useful in cancer therapy.

4.4 Future directions and research proposals
4.4.1 Future investigations- Inhibition of Bcl-2 family proteins in cancer
To address the above-mentioned concerns in Chapter 2, the following specific
aims and subaims are proposed:
Aim I: To examine and validate a correlation between over-expression of Bcl-2
family proteins in tumor samples and prognosis and/or recurrent status of NB
patients.
Subaim I: To determine the RNA expression levels of anti-apoptotic Bcl-2 family
proteins (e.g. Bcl-2, Bcl-XL, Bcl-w, Mcl-1) and pro-apoptotic Bcl-2 family proteins
(e.g. Bax, Bak) on samples from the established NB tumor bank (with available
clinical outcome data) by q-PCR.
Subaim II: To determine the protein expression levels of anti-apoptotic Bcl-2
family proteins (e.g. Bcl-2, Bcl-XL, Bcl-w, Mcl-1) and pro-apoptotic Bcl-2 family

124

proteins (e.g. Bax, Bak) on human NB specimens (with available clinical outcome
data) by tissue microarray.
Subaim III: To determine whether there is any correlation between expression
levels of Bcl-2 family proteins (both in mRNA and protein levels) and prognosis
and/or recurrent status of NB patients by multiple statistical analyses.

Aim II: To explore the molecular mechanisms of acquired resistance of ABT-737
on NB cell lines.
Subaim I: To establish several ABT-737-resistant NB cell lines by long-term
exposure of ABT-737 (increasing concentrations) to parent sensitive cell lines.
Subaim II: To identify the potential molecular targets of acquired resistance of
ABT-737 by comparing ABT-737-resistant NB cell lines and their parent
counterparts using RNA microarray analysis.
Subaim III: To validate the importance of those potential molecular targets of
acquired resistance of ABT-737 by applying genetic manipulation (siRNA or
shRNA) or pharmacological manipulation (small molecule inhibitors, if available).

4.4.2 Future investigations- Inhibition of PAI-1 in cancer
To address the above-mentioned concerns in Chapter 3, the following specific
aims and subaims are proposed:
Aim I: To explore the plasmin-independent mechanisms of PAI-1’s anti-apoptotic
protective effect on tumor cells.

125

Subaim I: To identify the potential molecular targets of anti-apoptotic protective
effect of PAI-1 on tumor cells by comparing scramble control-transfected tumor
cells and their PAI-1 siRNA-transfected counterparts using RNA microarray
analysis.
Subaim II: To validate the importance of those potential molecular targets by
applying genetic manipulation (siRNA or shRNA) or pharmacological
manipulation (small molecule inhibitors, if available).

Aim II: To identify potent PAI-1 inhibitors for cancer therapy.
Subaim I: To identify the potent PAI-1 small molecule inhibitor candidates by
screening a pool of PAI-1 inhibitors from University of Michigan (Cale et al., 2010)
using cytotoxicity assay on a panel of PAI-1-expressing tumor cells and ECs in
vitro.
Subaim II: To test anticancer activity of the PAI-1 inhibitors (PAI-039 or
candidates selected from Subaim I) by using multiple cancer xenograft models.

4.4.3 Future investigations- convergence of both inhibitions of Bcl-2 family
proteins and PAI-1 in cancer
Based on the fact that inhibition of Bcl-2 family proteins by ABT-737 mainly
targets intrinsic apoptotic pathway and inhibition of PAI-1 by siRNA mainly
targets extrinsic apoptosis, we hypothesize that the combination therapy of ABT-

126

737 + PAI-1 siRNA or PAI-1 inhibitors might generate a synergistic cytotoxic or
apoptotic effect.
Subaim I: To test the cytotoxicity and apoptosis of ABT-737, PAI-1 siRNA or the
second generation PAI-1 inhibitors, or the combination on a panel of tumor cell
lines and examine whether there is any synergistic effect.

4.5 Final remarks
We are now at an exciting era when our increased understanding of cancer
biology jointly with the rapid advances in biotechnologies (e.g. genetic
manipulations, pharmacological inhibitors) are allowing us to test fundamental
concepts in cancer and ultimately translate them into the evolution of targeted
cancer therapy. The research presented in this dissertation supports the concept
that apoptosis induction in tumor cells is a vital player in anticancer therapies.
Although we already have a good knowledge of apoptosis machinery in cancer,
various seemingly unrelated pathways (for example PAI-1 - uPA system) may
also have linked to this important hallmark of cancer. Overall, my research
projects clearly illustrate the important principle that a thorough understanding
about cancer biology including taking tumor microenvironment into consideration
is the foundation for the development of “targeted cancer therapy”.

127

BIBLIOGRAPHY

Ackler, S., Xiao, Y., Mitten, M.J., Foster, K., Oleksijew, A., Refici, M.,
Schlessinger, S., Wang, B., Chemburkar, S.R., Bauch, J., et al. (2008). ABT-263
and rapamycin act cooperatively to kill lymphoma cells in vitro and in vivo. Mol
Cancer Ther 7, 3265-3274.
Adams, J.M. (2003). Ways of dying: multiple pathways to apoptosis. Genes Dev
17, 2481-2495.
Adams, J.M., and Cory, S. (2007). The Bcl-2 apoptotic switch in cancer
development and therapy. Oncogene 26, 1324-1337.
Allgayer, H., Heiss, M.M., and Schildberg, F.W. (1997). Prognostic factors in
gastric cancer. Br J Surg 84, 1651-1664.
Almholt, K., Nielsen, B.S., Frandsen, T.L., Brunner, N., Dano, K., and Johnsen,
M. (2003). Metastasis of transgenic breast cancer in plasminogen activator
inhibitor-1 gene-deficient mice. Oncogene 22, 4389-4397.
Apel, A., Zentgraf, H., Buchler, M.W., and Herr, I. (2009).
Autophagy- A doubleedged sword in oncology. Int J Cancer 125, 991-995.
Ashkenazi, A., and Dixit, V.M. (1998). Death receptors: signaling and modulation.
Science 281, 1305-1308.
Baeriswyl, V., and Christofori, G. (2009). The angiogenic switch in
carcinogenesis. Semin Cancer Biol 19, 329-337.
Bajou, K., Maillard, C., Jost, M., Lijnen, R.H., Gils, A., Declerck, P., Carmeliet, P.,
Foidart, J.M., and Noel, A. (2004). Host-derived plasminogen activator inhibitor-1
(PAI-1) concentration is critical for in vivo tumoral angiogenesis and growth.
Oncogene 23, 6986-6990.
Bajou, K., Noel, A., Gerard, R.D., Masson, V., Brunner, N., Holst-Hansen, C.,
Skobe, M., Fusenig, N.E., Carmeliet, P., Collen, D., et al. (1998). Absence of
host plasminogen activator inhibitor 1 prevents cancer invasion and
vascularization. Nat Med 4, 923-928.
Bajou, K., Peng, H., Laug, W.E., Maillard, C., Noel, A., Foidart, J.M., Martial, J.A.,
and DeClerck, Y.A. (2008). Plasminogen activator inhibitor-1 protects endothelial
cells from FasL-mediated apoptosis. Cancer Cell 14, 324-334.

128

Bauman, S.J., Whinna, H.C., and Church, F.C. Serpins (serine protease
inhibitors). Curr Protoc Protein Sci 2002 Feb;, Unit 21.27.
Beaulieu, L.M., Whitley, B.R., Wiesner, T.F., Rehault, S.M., Palmieri, D.,
Elkahloun, A.G., and Church, F.C. (2007). Breast cancer and metabolic
syndrome linked through the plasminogen activator inhibitor-1 cycle. Bioessays
29, 1029-1038.
Berger, D.H. (2002). Plasmin/plasminogen system in colorectal cancer. World J
Surg 26, 767-771.
Bergers, G., and Benjamin, L.E. (2003). Tumorigenesis and the angiogenic
switch. Nat Rev Cancer 3, 401-410.
Bhowmick, N.A., Neilson, E.G., and Moses, H.L. (2004). Stromal fibroblasts in
cancer initiation and progression. Nature 432, 332-337.
Blackburn, E.H. (1991). Structure and function of telomeres. Nature 350, 569-573.
Blasco, M.A. (2005). Telomeres and human disease: ageing, cancer and beyond.
Nat Rev Genet 6, 611-622.
Blasi, F., and Sidenius, N. (2010). The urokinase receptor: focused cell surface
proteolysis, cell adhesion and signaling. FEBS Lett 584, 1923-1930.
Blasi, F., and Verde, P. (1990). Urokinase-dependent cell surface proteolysis and
cancer. Semin Cancer Biol 1, 117-126.
Brooks, T.D., Slomp, J., Quax, P.H., De Bart, A.C., Spencer, M.T., Verheijen,
J.H., and Charlton, P.A. (2000). Antibodies to PAI-1 alter the invasive and
migratory properties of human tumour cells in vitro. Clin Exp Metastasis 18, 445-
453.
Brooks, T.D., Wang, S.W., Brunner, N., and Charlton, P.A. (2004). XR5967, a
novel modulator of plasminogen activator inhibitor-1 activity, suppresses tumor
cell invasion and angiogenesis in vitro. Anticancer Drugs 15, 37-44.
Brown, N.J. (2010). Therapeutic potential of plasminogen activator inhibitor-1
inhibitors. Ther Adv Cardiovasc Dis 4, 315-324.
Bruckner, A., Filderman, A.E., Kirchheimer, J.C., Binder, B.R., and Remold, H.G.
(1992). Endogenous receptor-bound urokinase mediates tissue invasion of the
human lung carcinoma cell lines A549 and Calu-1. Cancer Res 52, 3043-3047.

129

Cajot, J.F., Bamat, J., Bergonzelli, G.E., Kruithof, E.K., Medcalf, R.L., Testuz, J.,
and Sordat, B. (1990). Plasminogen-activator inhibitor type 1 is a potent natural
inhibitor of extracellular matrix degradation by fibrosarcoma and colon carcinoma
cells. Proc Natl Acad Sci U S A 87, 6939-6943.
Cale, J.M., and Lawrence, D.A. (2007). Structure-function relationships of
plasminogen activator inhibitor-1 and its potential as a therapeutic agent. Curr
Drug Targets 8, 971-981.
Cale, J.M., Li, S.H., Warnock, M., Su, E.J., North, P.R., Sanders, K.L., Puscau,
M.M., Emal, C.D., and Lawrence, D.A. (2010). Characterization of a novel class
of polyphenolic inhibitors of plasminogen activator inhibitor-1. J Biol Chem 285,
7892-7902.
Campeau, P.M., Foulkes, W.D., and Tischkowitz, M.D. (2008). Hereditary breast
cancer: new genetic developments, new therapeutic avenues. Hum Genet 124,
31-42.
Carmeliet, P. (2005). VEGF as a key mediator of angiogenesis in cancer.
Oncology 69 Suppl 3, 4-10.
Carmeliet, P., Kieckens, L., Schoonjans, L., Ream, B., van Nuffelen, A.,
Prendergast, G., Cole, M., Bronson, R., Collen, D., and Mulligan, R.C. (1993).
Plasminogen activator inhibitor-1 gene-deficient mice. I. Generation by
homologous recombination and characterization. J Clin Invest 92, 2746-2755.
Chambers, S.K., Ivins, C.M., and Carcangiu, M.L. (1998). Plasminogen activator
inhibitor-1 is an independent poor prognostic factor for survival in advanced
stage epithelial ovarian cancer patients. Int J Cancer 79, 449-454.
Chantrain, C.F., DeClerck, Y.A., Groshen, S., and McNamara, G. (2003).
Computerized quantification of tissue vascularization using high-resolution slide
scanning of whole tumor sections. J Histochem Cytochem 51, 151-158.
Chen, S., Dai, Y., Harada, H., Dent, P., and Grant, S. (2007). Mcl-1
downregulation potentiates ABT-737 lethality by cooperatively inducing
Bak activation and Bax translocation. Cancer Res 67, 782-791.
Cheng, N., Chytil, A., Shyr, Y., Joly, A., and Moses, H.L. (2008). Transforming
growth factor-beta signaling-deficient fibroblasts enhance hepatocyte growth
factor signaling in mammary carcinoma cells to promote scattering and invasion.
Mol Cancer Res 6, 1521-1533.

130

Chipuk, J.E., Kuwana, T., Bouchier-Hayes, L., Droin, N.M., Newmeyer, D.D.,
Schuler, M., and Green, D.R. (2004). Direct activation of Bax by p53 mediates
mitochondrial membrane permeabilization and apoptosis. Science 303, 1010-
1014.
Chou, T.C., and Talalay, P. (1981). Generalized equations for the analysis of
inhibitions of Michaelis-Menten and higher-order kinetic systems with two or
more mutually exclusive and nonexclusive inhibitors. Eur J Biochem 115, 207-
216.
Chou, T.C., and Talalay, P. (1984). Quantitative analysis of dose-effect
relationships: the combined effects of multiple drugs or enzyme inhibitors. Adv
Enzyme Regul 22, 27-55.
Ciambrone, G.J., and McKeown-Longo, P.J. (1990). Plasminogen activator
inhibitor type I stabilizes vitronectin-dependent adhesions in HT-1080 cells. J Cell
Biol 111, 2183-2195.
Cory, S., and Adams, J.M. (2002). The Bcl2 family: regulators of the cellular
lifeor-death switch. Nat Rev Cancer 2, 647-656.
Crandall, D.L., Quinet, E.M., El Ayachi, S., Hreha, A.L., Leik, C.E., Savio, D.A.,
Juhan-Vague, I., and Alessi, M.C. (2006). Modulation of adipose tissue
development by pharmacological inhibition of PAI-1. Arterioscler Thromb Vasc
Biol 26, 2209-2215.
Czekay, R.P., Aertgeerts, K., Curriden, S.A., and Loskutoff, D.J. (2003).
Plasminogen activator inhibitor-1 detaches cells from extracellular matrices by
inactivating integrins. J Cell Biol 160, 781-791.
Dano, K., Behrendt, N., Hoyer-Hansen, G., Johnsen, M., Lund, L.R., Ploug, M.,
and Romer, J. (2005). Plasminogen activation and cancer. Thromb Haemost 93,
676-681.
Dass, K., Ahmad, A., Azmi, A.S., Sarkar, S.H., and Sarkar, F.H. (2008). Evolving
role of uPA/uPAR system in human cancers. Cancer Treat Rev 34, 122-136.
Davies, H., Bignell, G.R., Cox, C., Stephens, P., Edkins, S., Clegg, S., Teague, J.,
Woffendin, H., Garnett, M.J., Bottomley, W., et al. (2002). Mutations of the BRAF
gene in human cancer. Nature 417, 949-954.
Davies, M.A., and Samuels, Y. (2010). Analysis of the genome to personalize
therapy for melanoma. Oncogene 29, 5545-5555.

131

de Witte, J.H., Foekens, J.A., Brunner, N., Heuvel, J.J., van Tienoven, T., Look,
M.P., Klijn, J.G., Geurts-Moespot, A., Grebenchtchikov, N., Benraad, T., et al.
(2001). Prognostic impact of urokinase-type plasminogen activator receptor
(uPAR) in cytosols and pellet extracts derived from primary breast tumours. Br J
Cancer 85, 85-92.
DeBerardinis, R.J., Lum, J.J., Hatzivassiliou, G., and Thompson, C.B. (2008).
The biology of cancer: metabolic reprogramming fuels cell growth and
proliferation. Cell Metab 7, 11-20.
Declerck, P.J., Gils, A., and De Taeye, B. (2011). Use of mouse models to study
plasminogen activator inhibitor-1. Methods Enzymol 499, 77-104.
Del Gaizo Moore, V., Brown, J.R., Certo, M., Love, T.M., Novina, C.D., and Letai,
A. (2007). Chronic lymphocytic leukemia requires BCL2 to sequester prodeath
BIM, explaining sensitivity to BCL2 antagonist ABT-737. J Clin Invest 117, 112-
121.
Deng, G., Curriden, S.A., Wang, S., Rosenberg, S., and Loskutoff, D.J. (1996). Is
plasminogen activator inhibitor-1 the molecular switch that governs urokinase
receptor-mediated cell adhesion and release? J Cell Biol 134, 1563-1571.
Deng, J., Shimamura, T., Perera, S., Carlson, N.E., Cai, D., Shapiro, G.I., Wong,
K.K., and Letai, A. (2007). Proapoptotic BH3-only BCL-2 family protein BIM
connects death signaling from epidermal growth factor receptor inhibition to the
mitochondrion. Cancer Res 67, 11867-11875.
Devy, L., Blacher, S., Grignet-Debrus, C., Bajou, K., Masson, V., Gerard, R.D.,
Gils, A., Carmeliet, G., Carmeliet, P., Declerck, P.J., et al. (2002). The pro- or
antiangiogenic effect of plasminogen activator inhibitor 1 is dose dependent.
FASEB J 16, 147-154.
Di Vinci, A., Geido, E., Infusini, E., and Giaretti, W. (1994). Neuroblastoma cell
apoptosis induced by the synthetic retinoid N-(4-hydroxyphenyl)retinamide. Int J
Cancer 59, 422-426.
Diaz, G.D., Li, Q., and Dashwood, R.H. (2003). Caspase-8 and apoptosis
inducing factor mediate a cytochrome c-independent pathway of
apoptosis in human colon cancer cells induced by the dietary phytochemical
chlorophyllin. Cancer Res 63, 1254-1261.
Duffy, M.J., Duggan, C., Mulcahy, H.E., McDermott, E.W., and O'Higgins, N.J.
(1998). Urokinase plasminogen activator: a prognostic marker in breast cancer
including patients with axillary node-negative disease. Clin Chem 44, 1177-1183.

132

Dupont, D.M., Madsen, J.B., Kristensen, T., Bodker, J.S., Blouse, G.E., Wind, T.,
and Andreasen, P.A. (2009). Biochemical properties of plasminogen activator
inhibitor-1. Front Biosci 14, 1337-1361.
Egeblad, M., Nakasone, E.S., and Werb, Z. (2010). Tumors as organs: complex
tissues that interface with the entire organism. Dev Cell 18, 884-901.
Elmore, S. (2007). Apoptosis: a review of programmed cell death. Toxicol Pathol
35, 495-516.
Elokdah, H., Abou-Gharbia, M., Hennan, J.K., McFarlane, G., Mugford, C.P.,
Krishnamurthy, G., and Crandall, D.L. (2004). Tiplaxtinin, a novel, orally
efficacious inhibitor of plasminogen activator inhibitor-1: design, synthesis, and
preclinical characterization. J Med Chem 47, 3491-3494.
Emi, M., Kim, R., Tanabe, K., Uchida, Y., and Toge, T. (2005). Targeted therapy
against Bcl-2-related proteins in breast cancer cells. Breast Cancer Res 7, R940-
952.
Evan, G., and Littlewood, T. (1998). A matter of life and cell death. Science 281,
1317-1322.
Ferrara, N. (2009). Vascular endothelial growth factor. Arterioscler Thromb Vasc
Biol 29, 789-791.
Fesus, L., Davies, P.J., and Piacentini, M. (1991). Apoptosis: molecular
mechanisms in programmed cell death. Eur J Cell Biol 56, 170-177.
Fidler, I.J. (2003). The pathogenesis of cancer metastasis: the 'seed and soil'
hypothesis revisited. Nat Rev Cancer 3, 453-458.
Foekens, J.A., Look, M.P., Peters, H.A., van Putten, W.L., Portengen, H., and
Klijn, J.G. (1995). Urokinase-type plasminogen activator and its inhibitor PAI-1:
predictors of poor response to tamoxifen therapy in recurrent breast cancer. J
Natl Cancer Inst 87, 751-756.
Folkman, J. (2006). Angiogenesis. Annu Rev Med 57, 1-18.
Frgala, T., Kalous, O., Proffitt, R.T., and Reynolds, C.P. (2007). A fluorescence
microplate cytotoxicity assay with a 4-log dynamic range that identifies
synergistic drug combinations. Mol Cancer Ther 6, 886-897.
Galluzzi, L., and Kroemer, G. (2008). Necroptosis: a specialized pathway of
programmed necrosis. Cell 135, 1161-1163.

133

Gandhi, L., Camidge, D.R., Ribeiro de Oliveira, M., Bonomi, P., Gandara, D.,
Khaira, D., Hann, C.L., McKeegan, E.M., Litvinovich, E., Hemken, P.M., et al.
(2011). Phase I study of Navitoclax (ABT-263), a novel Bcl-2 family inhibitor, in
patients with small-cell lung cancer and other solid tumors. J Clin Oncol 29, 909-
916.
Garaventa, A., Luksch, R., Lo Piccolo, M.S., Cavadini, E., Montaldo, P.G.,
Pizzitola, M.R., Boni, L., Ponzoni, M., Decensi, A., De Bernardi, B., et al. (2003).
Phase I trial and pharmacokinetics of fenretinide in children with neuroblastoma.
Clin Cancer Res 9, 2032-2039.
Ginsburg, D., Zeheb, R., Yang, A.Y., Rafferty, U.M., Andreasen, P.A., Nielsen, L.,
Dano, K., Lebo, R.V., and Gelehrter, T.D. (1986). cDNA cloning of human
plasminogen activator-inhibitor from endothelial cells. J Clin Invest 78, 1673-1680.
Gorlatova, N.V., Cale, J.M., Elokdah, H., Li, D., Fan, K., Warnock, M., Crandall,
D.L., and Lawrence, D.A. (2007). Mechanism of inactivation of plasminogen
activator inhibitor-1 by a small molecule inhibitor. J Biol Chem 282, 9288-9296.
Grivennikov, S.I., Greten, F.R., and Karin, M. (2010). Immunity, inflammation,
and cancer. Cell 140, 883-899.
Gross, A., Yin, X.M., Wang, K., Wei, M.C., Jockel, J., Milliman, C., Erdjument-
Bromage, H., Tempst, P., and Korsmeyer, S.J. (1999). Caspase cleaved BID
targets mitochondria and is required for cytochrome c release, while BCL-XL
prevents this release but not tumor necrosis factor-R1/Fas death. J Biol Chem
274, 1156-1163.
Grotsch, H., Giblin, J.P., Idrissi, F.Z., Fernandez-Golbano, I.M., Collette, J.R.,
Newpher, T.M., Robles, V., Lemmon, S.K., and Geli, M.I. (2010). Calmodulin
dissociation regulates Myo5 recruitment and function at endocytic sites. EMBO J
29, 2899-2914.
Gutierrez, L.S., Schulman, A., Brito-Robinson, T., Noria, F., Ploplis, V.A., and
Castellino, F.J. (2000). Tumor development is retarded in mice lacking the gene
for urokinase-type plasminogen activator or its inhibitor, plasminogen activator
inhibitor-1. Cancer Res 60, 5839-5847.
Hait, W. (2011). Forty years of Translational Cancer Research. Cancer Dicovery
1, 383-390.
Hanahan, D., and Folkman, J. (1996). Patterns and emerging mechanisms of the
angiogenic switch during tumorigenesis. Cell 86, 353-364.

134

Hanahan, D., and Weinberg, R.A. (2011). Hallmarks of cancer: the next
generation. Cell 144, 646-674.
Harbeck, N., Thomssen, C., Berger, U., Ulm, K., Kates, R.E., Hofler, H., Janicke,
F., Graeff, H., and Schmitt, M. (1999). Invasion marker PAI-1 remains a strong
prognostic factor after long-term follow-up both for primary breast cancer and
following first relapse. Breast Cancer Res Treat 54, 147-157.
Hengartner, M.O. (2000). The biochemistry of apoptosis. Nature 407, 770-776.
Hennan, J.K., Elokdah, H., Leal, M., Ji, A., Friedrichs, G.S., Morgan, G.A., Swillo,
R.E., Antrilli, T.M., Hreha, A., and Crandall, D.L. (2005). Evaluation of PAI-039
[{1-benzyl-5-[4-(trifluoromethoxy)phenyl]-1H-indol-3-yl}(oxo)acetic acid], a novel
plasminogen activator inhibitor-1 inhibitor, in a canine model of coronary artery
thrombosis. J Pharmacol Exp Ther 314, 710-716.
Hennan, J.K., Morgan, G.A., Swillo, R.E., Antrilli, T.M., Mugford, C., Vlasuk, G.P.,
Gardell, S.J., and Crandall, D.L. (2008). Effect of tiplaxtinin (PAI-039), an orally
bioavailable PAI-1 antagonist, in a rat model of thrombosis. J Thromb Haemost 6,
1558-1564.
Hoff, J. (2000). Methods of blood collection in the mouse. Lab Animal 29, 47-53.
Hollstein, M., Sidransky, D., Vogelstein, B., and Harris, C.C. (1991). p53
mutations in human cancers. Science 253, 49-53.
Houghton, P.J., Morton, C.L., Tucker, C., Payne, D., Favours, E., Cole, C.,
Gorlick, R., Kolb, E.A., Zhang, W., Lock, R., et al. (2007). The pediatric
preclinical testing program: description of models and early testing results.
Pediatr Blood Cancer 49, 928-940.
Hsu, P.P., and Sabatini, D.M. (2008). Cancer cell metabolism: Warburg and
beyond. Cell 134, 703-707.
Huang, S., and Sinicrope, F.A. (2008). BH3 mimetic ABT-737 potentiates
TRAILmediated apoptotic signaling by unsequestering Bim and Bak in human
pancreatic cancer cells. Cancer Res 68, 2944-2951.
Huang, W.T., Vayalil, P.K., Miyata, T., Hagood, J., and Liu, R.M. (2012).
Therapeutic value of small molecule inhibitor to plasminogen activator inhibitor-1
for lung fibrosis. Am J Respir Cell Mol Biol 46, 87-95.
Igney, F.H., and Krammer, P.H. (2002). Death and anti-death: tumour resistance
to apoptosis. Nat Rev Cancer 2, 277-288.

135

Isogai, C., Laug, W.E., Shimada, H., Declerck, P.J., Stins, M.F., Durden, D.L.,
Erdreich-Epstein, A., and DeClerck, Y.A. (2001). Plasminogen activator inhibitor-
1 promotes angiogenesis by stimulating endothelial cell migration toward
fibronectin. Cancer Res 61, 5587-5594.
Izuhara, Y., Takahashi, S., Nangaku, M., Takizawa, S., Ishida, H., Kurokawa, K.,
van Ypersele de Strihou, C., Hirayama, N., and Miyata, T. (2008). Inhibition of
plasminogen activator inhibitor-1: its mechanism and effectiveness on
coagulation and fibrosis. Arterioscler Thromb Vasc Biol 28, 672-677.
Izuhara, Y., Yamaoka, N., Kodama, H., Dan, T., Takizawa, S., Hirayama, N.,
Meguro, K., van Ypersele de Strihou, C., and Miyata, T. (2010). A novel inhibitor
of plasminogen activator inhibitor-1 provides antithrombotic benefits devoid of
bleeding effect in nonhuman primates. J Cereb Blood Flow Metab 30, 904-912.
Jankun, J., Keck, R.W., Skrzypczak-Jankun, E., and Swiercz, R. (1997).
Inhibitors of urokinase reduce size of prostate cancer xenografts in severe
combined immunodeficient mice. Cancer Res 57, 559-563.
Jiang, B.H., and Liu, L.Z. (2009). PI3K/PTEN signaling in angiogenesis and
tumorigenesis. Adv Cancer Res 102, 19-65.
Joyce, J.A., and Pollard, J.W. (2009). Microenvironmental regulation of
metastasis. Nat Rev Cancer 9, 239-252.
Kalluri, R., and Zeisberg, M. (2006). Fibroblasts in cancer. Nat Rev Cancer 6,
392-401.
Kang, M.H., Kang, Y.H., Szymanska, B., Wilczynska-Kalak, U., Sheard, M.A.,
Harned, T.M., Lock, R.B., and Reynolds, C.P. (2007). Activity of vincristine,LASP,
and dexamethasone against acute lymphoblastic leukemia is enhanced by the
BH3-mimetic ABT-737 in vitro and in vivo. Blood 110, 2057-2066.
Kang, M.H., and Reynolds, C.P. (2009). Bcl-2 inhibitors: targeting mitochondrial
apoptotic pathways in cancer therapy. Clin Cancer Res 15, 1126-1132.
Kang, M.H., Wan, Z., Kang, Y.H., Sposto, R., and Reynolds, C.P. (2008).
Mechanism of synergy of N-(4-hydroxyphenyl)retinamide and ABT-737 in acute
lymphoblastic leukemia cell lines: Mcl-1 inactivation. J Natl Cancer Inst 100, 580-
595.

136

Kantari, C., and Walczak, H. (2011). Caspase-8 and bid: caught in the act
between death receptors and mitochondria. Biochim Biophys Acta 1813, 558-563.
Kerr, J.F., Wyllie, A.H., and Currie, A.R. (1972). Apoptosis: a basic biological
phenomenon with wide-ranging implications in tissue kinetics. Br J Cancer 26,
239-257.
Keshelava, N., Frgala, T., Krejsa, J., Kalous, O., and Reynolds, C.P.
(2005).DIMSCAN: a microcomputer fluorescence-based cytotoxicity assay for
preclinical testing of combination chemotherapy. Methods Mol Med 110, 139-153.
Keshelava, N., Seeger, R.C., Groshen, S., and Reynolds, C.P. (1998). Drug
resistance patterns of human neuroblastoma cell lines derived from patients at
different phases of therapy. Cancer Res 58, 5396-5405.
Keshelava, N., Zuo, J.J., Chen, P., Waidyaratne, S.N., Luna, M.C., Gomer, C.J.,
Triche, T.J., and Reynolds, C.P. (2001). Loss of p53 function confers high-level
multidrug resistance in neuroblastoma cell lines. Cancer Res 61, 6185-6193.
Kjoller, L., Kanse, S.M., Kirkegaard, T., Rodenburg, K.W., Ronne, E., Goodman,
S.L., Preissner, K.T., Ossowski, L., and Andreasen, P.A. (1997). Plasminogen
activator inhibitor-1 represses integrin- and vitronectin-mediated cell migration
independently of its function as an inhibitor of plasminogen activation. Exp Cell
Res 232, 420-429.
Kovacic, J.C., and Boehm, M. (2009). Resident vascular progenitor cells: an
emerging role for non-terminally differentiated vessel-resident cells in vascular
biology. Stem Cell Res 2, 2-15.
Krajewski, S., Chatten, J., Hanada, M., and Reed, J.C. (1995).
Immunohistochemical analysis of the Bcl-2 oncoprotein in human
neuroblastomas. Comparisons with tumor cell differentiation and N-Myc protein.
Lab Invest 72, 42-54.
Kuhn, W., Schmalfeldt, B., Reuning, U., Pache, L., Berger, U., Ulm, K., Harbeck,
N., Spathe, K., Dettmar, P., Hofler, H., et al. (1999). Prognostic significance of
urokinase (uPA) and its inhibitor PAI-1 for survival in advanced ovarian
carcinoma stage FIGO IIIc. Br J Cancer 79, 1746-1751.
Kuroda, J., Puthalakath, H., Cragg, M.S., Kelly, P.N., Bouillet, P., Huang, D.C.,
Kimura, S., Ottmann, O.G., Druker, B.J., Villunger, A., et al. (2006). Bim and Bad
mediate imatinib-induced killing of Bcr/Abl+ leukemic cells, and resistance due to
their loss is overcome by a BH3 mimetic. Proc Natl Acad Sci U S A 103, 14907-
14912.

137

Kuwana, T., Mackey, M.R., Perkins, G., Ellisman, M.H., Latterich, M.,
Schneiter, R., Green, D.R., and Newmeyer, D.D. (2002). Bid, Bax, and lipids
cooperate to form supramolecular openings in the outer mitochondrial membrane.
Cell 111, 331-342.
Kwaan, H.C., Wang, J., Svoboda, K., and Declerck, P.J. (2000). Plasminogen
activator inhibitor 1 may promote tumour growth through inhibition of apoptosis.
Br J Cancer 82, 1702-1708.
Lademann, U.A., and Romer, M.U. (2008). Regulation of programmed cell death
by plasminogen activator inhibitor type 1 (PAI-1). Thromb Haemost 100, 1041-
1046.
Lamagna, C., and Bergers, G. (2006). The bone marrow constitutes a reservoir
of pericyte progenitors. J Leukoc Biol 80, 677-681.
Landis, S.H., Murray, T., Bolden, S., and Wingo, P.A. (1999). Cancer statistics,
1999. CA Cancer J Clin 49, 8-31, 31.
Lasorella, A., Iavarone, A., and Israel, M.A. (1995). Differentiation of
neuroblastoma enhances Bcl-2 expression and induces alterations of apoptosis
and drug resistance. Cancer Res 55, 4711-4716.
Leik, C.E., Su, E.J., Nambi, P., Crandall, D.L., and Lawrence, D.A. (2006). Effect
of pharmacologic plasminogen activator inhibitor-1 inhibition on cell motility and
tumor angiogenesis. J Thromb Haemost 4, 2710-2715.
Lemmon, M.A., and Schlessinger, J. (2010). Cell signaling by receptor tyrosine
kinases. Cell 141, 1117-1134.
Lessene, G., Czabotar, P.E., and Colman, P.M. (2008). BCL-2 family antagonists
for cancer therapy. Nat Rev Drug Discov 7, 989-1000.
Letai, A. (2005). BCL-2: found bound and drugged! Trends Mol Med 11, 442-444.
Letai, A., Bassik, M.C., Walensky, L.D., Sorcinelli, M.D., Weiler, S., and
Korsmeyer, S.J. (2002). Distinct BH3 domains either sensitize or activate
mitochondrial apoptosis, serving as prototype cancer therapeutics. Cancer Cell 2,
183-192.
Levine, B., and Kroemer, G. (2008). Autophagy in the pathogenesis of disease.
Cell 132, 27-42.

138

Lijnen, H.R. (2005). Pleiotropic functions of plasminogen activator inhibitor-1. J
Thromb Haemost 3, 35-45.
Lijnen, H.R. (2009). Role of fibrinolysis in obesity and thrombosis. Thromb Res
123 Suppl 4, S46-49.
Lin, X., Morgan-Lappe, S., Huang, X., Li, L., Zakula, D.M., Vernetti, L.A., Fesik,
S.W., and Shen, Y. (2007). 'Seed' analysis of off-target siRNAs reveals an
essential role of Mcl-1 in resistance to the small-molecule Bcl-2/Bcl-XL inhibitor
ABT-737. Oncogene 26, 3972-3979.
Liu, G., Shuman, M.A., and Cohen, R.L. (1995). Co-expression of urokinase,
urokinase receptor and PAI-1 is necessary for optimum invasiveness of cultured
lung cancer cells. Int J Cancer 60, 501-506.
Ljuca, D., Fatusic, Z., Iljazovic, E., and Ahmetovic, B. (2007). Monitoring of
chemotherapy successfulness of platina/taxol chemotherapy protocol by using
determination of serum urokinase plasminogen activator (uPA) and soluble
urokinase plasminogen activator receptor (suPAR) in patients with ovarian
carcinoma FIGO II and III stage. Bosn J Basic Med Sci 7, 111-116.
Lock, R., Carol, H., Houghton, P.J., Morton, C.L., Kolb, E.A., Gorlick, R.,
Reynolds, C.P., Maris, J.M., Keir, S.T., Wu, J., et al. (2008). Initial testing (stage
1) of the BH3 mimetic ABT-263 by the pediatric preclinical testing program.
Pediatr Blood Cancer 50, 1181-1189.
Loskutoff, D.J., Curriden, S.A., Hu, G., and Deng, G. (1999). Regulation of cell
adhesion by PAI-1. APMIS 107, 54-61.Luo, X., Budihardjo, I., Zou, H., Slaughter,
C., and Wang, X. (1998). Bid, a Bcl2 interacting protein, mediates cytochrome c
release from mitochondria in response to activation of cell surface death
receptors. Cell 94, 481-490.
Ma, D., Gerard, R.D., Li, X.Y., Alizadeh, H., and Niederkorn, J.Y. (1997).
Inhibition of metastasis of intraocular melanomas by adenovirus-mediated gene
transfer of plasminogen activator inhibitor type 1 (PAI-1) in an athymic mouse
model. Blood 90, 2738-2746.
Mac Gabhann, F., and Popel, A.S. (2008). Systems biology of vascular
endothelial growth factors. Microcirculation 15, 715-738.
Madsen, M.A., Deryugina, E.I., Niessen, S., Cravatt, B.F., and Quigley, J.P.
(2006). Activity-based protein profiling implicates urokinase activation as a key
step in human fibrosarcoma intravasation. J Biol Chem 281, 15997-16005.

139

Maillard, C.M., Bouquet, C., Petitjean, M.M., Mestdagt, M., Frau, E., Jost, M.,
Masset, A.M., Opolon, P.H., Beermann, F., Abitbol, M.M., et al. (2008).Reduction
of brain metastases in plasminogen activator inhibitor-1-deficient mice
with transgenic ocular tumors. Carcinogenesis 29, 2236-2242.
Mancini, M., Anderson, B.O., Caldwell, E., Sedghinasab, M., Paty, P.B., and
Hockenbery, D.M. (1997). Mitochondrial proliferation and paradoxical membrane
depolarization during terminal differentiation and apoptosis in a human colon
carcinoma cell line. J Cell Biol 138, 449-469.
Marachelian, A., Kang, M.H., Hwang, K., Villablanca, J.G., Groshen, S., and
Matthay, K.K., et al. (2009). Phase I study of fenretinide (4-HPR) oral powder in
patients with recurrent or resistant neuroblastoma: New Approaches to
Neuroblastoma Therapy (NANT) Consortium trial [abstract]. Journal of Clinical
Oncology 27.
Maris, J.M., and Matthay, K.K. (1999). Molecular biology of neuroblastoma. J Clin
Oncol 17, 2264-2279.
Masset, A., Maillard, C., Sounni, N.E., Jacobs, N., Bruyere, F., Delvenne, P.,
Tacke, M., Reinheckel, T., Foidart, J.M., Coussens, L.M., et al. (2011).
Unimpeded skin carcinogenesis in K14-HPV16 transgenic mice deficient for
plasminogen activator inhibitor. Int J Cancer 128, 283-293.
Masters, J.R., Thomson, J.A., Daly-Burns, B., Reid, Y.A., Dirks, W.G., Packer, P.,
Toji, L.H., Ohno, T., Tanabe, H., Arlett, C.F., et al. (2001). Short tandem repeat
profiling provides an international reference standard for human cell lines. Proc
Natl Acad Sci U S A 98, 8012-8017.
Matsuo, O., Lijnen, H.R., Ueshima, S., Kojima, S., and Smyth, S.S. (2007). A
guide to murine fibrinolytic factor structure, function, assays, and genetic
alterations. J Thromb Haemost 5, 680-689.
Matthay, K.K., Reynolds, C.P., Seeger, R.C., Shimada, H., Adkins, E.S., Haas-
Kogan, D., Gerbing, R.B., London, W.B., and Villablanca, J.G. (2009). Long-term
results for children with high-risk neuroblastoma treated on a randomized trial of
myeloablative therapy followed by 13-cis-retinoic acid: a children's oncology
group study. J Clin Oncol 27, 1007-1013.
Matthay, K.K., Villablanca, J.G., Seeger, R.C., Stram, D.O., Harris, R.E., Ramsay,
N.K., Swift, P., Shimada, H., Black, C.T., Brodeur, G.M., et al. (1999). Treatment
of high-risk neuroblastoma with intensive chemotherapy, radiotherapy,
autologous bone marrow transplantation, and 13-cis-retinoic acid. Children's
Cancer Group. N Engl J Med 341, 1165-1173.

140

Maurer, B.J., Kalous, O., Yesair, D.W., Wu, X., Janeba, J., Maldonado, V.,
Khankaldyyan, V., Frgala, T., Sun, B.C., McKee, R.T., et al. (2007). Improved
oral delivery of N-(4-hydroxyphenyl)retinamide with a novel LYM-X-SORB
organized lipid complex. Clin Cancer Res 13, 3079-3086.
Maurer, B.J., Metelitsa, L.S., Seeger, R.C., Cabot, M.C., and Reynolds, C.P.
(1999). Increase of ceramide and induction of mixed apoptosis/necrosis by N-(4-
hydroxyphenyl)- retinamide in neuroblastoma cell lines. J Natl Cancer Inst 91,
1138-1146.
McMahon, B., and Kwaan, H.C. (2008). The plasminogen activator system and
cancer. Pathophysiol Haemost Thromb 36, 184-194.
McMahon, G.A., Petitclerc, E., Stefansson, S., Smith, E., Wong, M.K., Westrick,
R.J., Ginsburg, D., Brooks, P.C., and Lawrence, D.A. (2001). Plasminogen
activator inhibitor-1 regulates tumor growth and angiogenesis. J Biol Chem 276,
33964-33968.
Meltzer, M.E., Doggen, C.J., de Groot, P.G., Rosendaal, F.R., and Lisman, T.
(2009). The impact of the fibrinolytic system on the risk of venous and arterial
thrombosis. Semin Thromb Hemost 35, 468-477.
Michalak, E.M., Villunger, A., Adams, J.M., and Strasser, A. (2008). In several
cell types tumour suppressor p53 induces apoptosis largely via Puma but Noxa
can contribute. Cell Death Differ 15, 1019-1029.
Minn, A.J., Rudin, C.M., Boise, L.H., and Thompson, C.B. (1995). Expression of
bcl-xL can confer a multidrug resistance phenotype. Blood 86, 1903-1910.
Mohrbacher, A., Gutierrez, M., Murgo, A.J., Kummar, S., Reynolds, C.P., Maurer,
B.J., Groshen, S., Vergara, L., and Yang, A.S. (2007). Phase I trial of fenretinide
(4-HPR) intravenous emulsion for hematologic malignancies. . Journal of Clinical
Oncology, 2007 ASCO Annual Meeting Proceedings Part I 25 13007
Mougiakakos, D., Choudhury, A., Lladser, A., Kiessling, R., and Johansson, C.C.
(2010). Regulatory T cells in cancer. Adv Cancer Res 107, 57-117.
Murdoch, C., Muthana, M., Coffelt, S.B., and Lewis, C.E. (2008). The role of
myeloid cells in the promotion of tumour angiogenesis. Nat Rev Cancer 8, 618-
631.

141

Mutoh, M., Niho, N., Komiya, M., Takahashi, M., Ohtsubo, R., Nakatogawa, K.,
Ueda, K., Sugimura, T., and Wakabayashi, K. (2008). Plasminogen activator
inhibitor-1 (Pai-1) blockers suppress intestinal polyp formation in Min mice.
Carcinogenesis 29, 824-829.
Nyberg, P., Xie, L., and Kalluri, R. (2005). Endogenous inhibitors of angiogenesis.
Cancer Res 65, 3967-3979.
O'Brien, S., Moore, J.O., Boyd, T.E., Larratt, L.M., Skotnicki, A., Koziner,
B.,Chanan-Khan, A.A., Seymour, J.F., Bociek, R.G.,
Pavletic, S., et al. (2007). Randomized phase III trial of fludarabine plus
cyclophosphamide with or without oblimersen sodium (Bcl-2 antisense) in
patients with relapsed or refractory chronic lymphocytic leukemia. J Clin Oncol 25,
1114-1120.
O'Brien, S., Moore, J.O., Boyd, T.E., Larratt, L.M., Skotnicki, A.B., Koziner, B.,
Chanan-Khan, A.A., Seymour, J.F., Gribben, J., Itri, L.M., et al. (2009). 5-year
survival in patients with relapsed or refractory chronic lymphocytic leukemia in a
randomized, phase III trial of fludarabine plus cyclophosphamide with or without
oblimersen. J Clin Oncol 27, 5208-5212.
Oltersdorf, T., Elmore, S.W., Shoemaker, A.R., Armstrong, R.C., Augeri, D.J.,
Belli, B.A., Bruncko, M., Deckwerth, T.L., Dinges, J., Hajduk, P.J., et al. (2005).
An inhibitor of Bcl-2 family proteins induces regression of solid tumours. Nature
435, 677-681.
Orlic, D., Kajstura, J., Chimenti, S., Jakoniuk, I., Anderson, S.M., Li, B., Pickel, J.,
McKay, R., Nadal-Ginard, B., Bodine, D.M., et al. (2001). Bone marrow cells
regenerate infarcted myocardium. Nature 410, 701-705.
Ostrand-Rosenberg, S., and Sinha, P. (2009). Myeloid-derived suppressor cells:
linking inflammation and cancer. J Immunol 182, 4499-4506.
Overall, C.M., and Blobel, C.P. (2007). In search of partners: linking extracellular
proteases to substrates. Nat Rev Mol Cell Biol 8, 245-257.
Page-McCaw, A., Ewald, A.J., and Werb, Z. (2007). Matrix metalloproteinases
and the regulation of tissue remodelling. Nat Rev Mol Cell Biol 8, 221-233.
Patenaude, A., Parker, J., and Karsan, A. (2010). Involvement of endothelial
progenitor cells in tumor vascularization. Microvasc Res 79, 217-223.

142

Perego, P., Righetti, S.C., Supino, R., Delia, D., Caserini, C., Carenini, N.,
Bedogne, B., Broome, E., Krajewski, S., Reed, J.C., et al. (1997). Role of
apoptosis and apoptosis-related proteins in the cisplatin-resistant phenotype of
human tumor cell lines. Apoptosis 2, 540-548.
Perona, R. (2006). Cell signalling: growth factors and tyrosine kinase
receptors.Clin Transl Oncol 8, 77-82.
Polyak, K., and Weinberg, R.A. (2009). Transitions between epithelial and
mesenchymal states: acquisition of malignant and stem cell traits. Nat Rev
Cancer 9, 265-273.
Ponzoni, M., Bocca, P., Chiesa, V., Decensi, A., Pistoia, V., Raffaghello, L.,
Rozzo, C., and Montaldo, P.G. (1995). Differential effects of N-(4-
hydroxyphenyl)retinamide and retinoic acid on neuroblastoma cells: apoptosis
versus differentiation. Cancer Res 55, 853-861.
Praus, M., Collen, D., and Gerard, R.D. (2002). Both u-PA inhibition and
vitronectin binding by plasminogen activator inhibitor 1 regulate HT1080
fibrosarcoma cell metastasis. Int J Cancer 102, 584-591.
Qian, B.Z., and Pollard, J.W. (2010). Macrophage diversity enhances tumor
progression and metastasis. Cell 141, 39-51.
Reed, J.C. (2008). Bcl-2-family proteins and hematologic malignancies: history
and future prospects. Blood 111, 3322-3330.
Reynolds, C.P., Biedler, J.L., Spengler, B.A., Reynolds, D.A., Ross, R.A., Frenkel,
E.P., and Smith, R.G. (1986). Characterization of human neuroblastoma cell
lines established before and after therapy. J Natl Cancer Inst 76, 375-387.
Reynolds, C.P., Matthay, K.K., Villablanca, J.G., and Maurer, B.J. (2003).
Retinoid therapy of high-risk neuroblastoma. Cancer Lett 197, 185-192.
Reynolds, C.P., Wang, Y., Melton, L.J., Einhorn, P.A., Slamon, D.J., and Maurer,
B.J. (2000). Retinoic-acid-resistant neuroblastoma cell lines show altered MYC
regulation and high sensitivity to fenretinide. Med Pediatr Oncol 35, 597-602.
Ribatti, D. (2009). Endogenous inhibitors of angiogenesis: a historical review.
Leuk Res 33, 638-644.

143

Romer, M.U., Kirkebjerg Due, A., Knud Larsen, J., Hofland, K.F., Christensen,
I.J., Buhl-Jensen, P., Almholt, K., Lerberg Nielsen, O., Brunner, N., and
Lademann, U. (2005). Indication of a role of plasminogen activator inhibitor type I
in protecting murine fibrosarcoma cells against apoptosis. Thromb Haemost 94,
859-866.
Romer, M.U., Larsen, L., Offenberg, H., Brunner, N., and Lademann, U.A. (2008).
Plasminogen activator inhibitor 1 protects fibrosarcoma cells from etoposide
induced apoptosis through activation of the PI3K/Akt cell survival pathway.
Neoplasia 10, 1083-1091.
Sakahira, H., Enari, M., and Nagata, S. (1998). Cleavage of CAD inhibitor in CAD
activation and DNA degradation during apoptosis. Nature 391, 96-99.
Saksela, O., and Rifkin, D.B. (1988). Cell-associated plasminogen activation:
regulation and physiological functions. Annu Rev Cell Biol 4, 93-126.
Seddighzadeh, M., Steineck, G., Larsson, P., Wijkstrom, H., Norming, U., Onelov,
E., and Linder, S. (2002). Expression of UPA and UPAR is associated with the
clinical course of urinary bladder neoplasms. Int J Cancer 99, 721-726.
Shay, J.W., and Wright, W.E. (2000). Hayflick, his limit, and cellular ageing. Nat
Rev Mol Cell Biol 1, 72-76.
Sherr, C.J., and McCormick, F. (2002). The RB and p53 pathways in cancer.
Cancer Cell 2, 103-112.
Shields, J.D., Kourtis, I.C., Tomei, A.A., Roberts, J.M., and Swartz, M.A. (2010).
Induction of lymphoidlike stroma and immune escape by tumors that express the
chemokine CCL21. Science 328, 749-752.
Shoemaker, A.R., Mitten, M.J., Adickes, J., Ackler, S., Refici, M., Ferguson, D.,
Oleksijew, A., O'Connor, J.M., Wang, B., Frost, D.J., et al. (2008). Activity of the
Bcl-2 family inhibitor ABT-263 in a panel of small cell lung cancer xenograft
models. Clin Cancer Res 14, 3268-3277.
Skelly, M.M., Troy, A., Duffy, M.J., Mulcahy, H.E., Duggan, C., Connell, T.G.,
O'Donoghue, D.P., and Sheahan, K. (1997). Urokinase-type plasminogen
activator in colorectal cancer: relationship with clinicopathological features and
patient outcome. Clin Cancer Res 3, 1837-1840.
Slee, E.A., Adrain, C., and Martin, S.J. (1999). Serial killers: ordering caspase
activation events in apoptosis. Cell Death Differ 6, 1067-1074.

144

Soff, G.A., Sanderowitz, J., Gately, S., Verrusio, E., Weiss, I., Brem, S., and
Kwaan, H.C. (1995). Expression of plasminogen activator inhibitor type 1 by
human prostate carcinoma cells inhibits primary tumor growth, tumor-associated
angiogenesis, and metastasis to lung and liver in an athymic mouse model. J
Clin Invest 96, 2593-2600.
Stefansson, S., Petitclerc, E., Wong, M.K., McMahon, G.A., Brooks, P.C., and
Lawrence, D.A. (2001). Inhibition of angiogenesis in vivo by plasminogen
activator inhibitor-1. J Biol Chem 276, 8135-8141.
Tahir, S.K., Yang, X., Anderson, M.G., Morgan-Lappe, S.E., Sarthy, A.V., Chen,
J., Warner, R.B., Ng, S.C., Fesik, S.W., Elmore, S.W., et al. (2007). Influence of
Bcl-2 family members on the cellular response of small-cell lung cancer cell lines
to ABT-737. Cancer Res 67, 1176-1183.
Takahashi, T., Kalka, C., Masuda, H., Chen, D., Silver, M., Kearney, M., Magner,
M., Isner, J.M., and Asahara, T. (1999). Ischemia- and cytokine-induced
mobilization of bone marrow-derived endothelial progenitor cells for
neovascularization. Nat Med 5, 434-438.
Talmadge, J.E., and Fidler, I.J. (2010). AACR centennial series: the biology of
cancer metastasis: historical perspective. Cancer Res 70, 5649-5669.
Thiery, J.P., Acloque, H., Huang, R.Y., and Nieto, M.A. (2009). Epithelial
mesenchymal transitions in development and disease. Cell 139, 871-890.
Tomayko, M.M., and Reynolds, C.P. (1989). Determination of subcutaneous
tumor size in athymic (nude) mice. Cancer Chemother Pharmacol 24, 148-154.
Tse, C., Shoemaker, A.R., Adickes, J., Anderson, M.G., Chen, J., Jin, S.,
Johnson, E.F., Marsh, K.C., Mitten, M.J., Nimmer, P., et al. (2008). ABT-263: a
potent and orally bioavailable Bcl-2 family inhibitor. Cancer Res 68, 3421-3428.
Ulisse, S., Baldini, E., Sorrenti, S., and D'Armiento, M. (2009). The urokinase
plasminogen activator system: a target for anti-cancer therapy. Curr Cancer Drug
Targets 9, 32-71.
Vander Heiden, M.G., Cantley, L.C., and Thompson, C.B. (2009). Understanding
the Warburg effect: the metabolic requirements of cell proliferation. Science 324,
1029-1033.

145

Villablanca, J.G., Krailo, M.D., Ames, M.M., Reid, J.M., Reaman, G.H., and
Reynolds, C.P. (2006). Phase I trial of oral fenretinide in children with high-risk
solid tumors: a report from the Children's Oncology Group (CCG 09709). J Clin
Oncol 24, 3423-3430.
Villablanca, J.G., London, W.B., Naranjo, A., McGrady, P., Ames, M.M., Reid,
J.M., McGovern, R.M., Buhrow, S.A., Jackson, H., Stranzinger, E., et al. (2011).
Phase II study of oral capsular 4-hydroxyphenylretinamide (4-HPR/fenretinide) in
pediatric patients with refractory or recurrent neuroblastoma: a report from the
Children's Oncology Group. Clin Cancer Res 17, 6858-6866.
Wang, T.H., and Wang, H.S. (1996). p53, apoptosis and human cancers. J
Formos Med Assoc 95, 509-522.
Warburg, O. (1930). The metobolism of tumours: Investigations from the Kaiser
Wilhelm Institute for Biology, Berlin-Dahlem.
Warburg, O. (1956). On respiratory impairment in cancer cells. Science 124, 269-
270.
Werb, Z. (1997). ECM and cell surface proteolysis: regulating cellular ecology.
Cell 91, 439-442.
Wesarg, E., Hoffarth, S., Wiewrodt, R., Kroll, M., Biesterfeld, S., Huber, C., and
Schuler, M. (2007). Targeting BCL-2 family proteins to overcome drug resistance
in non-small cell lung cancer. Int J Cancer 121, 2387-2394.
White, E., and DiPaola, R.S. (2009). The double-edged sword of autophagy
modulation in cancer. Clin Cancer Res 15, 5308-5316.
Wilson, W.H., O'Connor, O.A., Czuczman, M.S., LaCasce, A.S., Gerecitano, J.F.,
Leonard, J.P., Tulpule, A., Dunleavy, K., Xiong, H., Chiu, Y.L., et al. (2010).
Navitoclax, a targeted high-affinity inhibitor of BCL-2, in lymphoid malignancies: a
phase 1 dose-escalation study of safety, pharmacokinetics, pharmacodynamics,
and antitumour activity. Lancet Oncol 11, 1149-1159.
Yang, L., Pang, Y., and Moses, H.L. (2010). TGF-beta and immune cells: an
important regulatory axis in the tumor microenvironment and progression. Trends
Immunol 31, 220-227.
Yilmaz, M., and Christofori, G. (2009). EMT, the cytoskeleton, and cancer cell
invasion. Cancer Metastasis Rev 28, 15-33.

146

Yin, X.M., Wang, K., Gross, A., Zhao, Y., Zinkel, S., Klocke, B., Roth, K.A., and
Korsmeyer, S.J. (1999). Bid-deficient mice are resistant to Fas-induced
hepatocellular apoptosis. Nature 400, 886-891.
Yu, A.L., Gilman, A.L., Ozkaynak, M.F., London, W.B., Kreissman, S.G., Chen,
H.X., Smith, M., Anderson, B., Villablanca, J.G., Matthay, K.K., et al. (2010). Anti-
GD2 antibody with GM-CSF, interleukin-2, and isotretinoin for neuroblastoma. N
Engl J Med 363, 1324-1334.
Zekanowska, E., Cieslinski, K., and Rosc, D. (2004). [Plasminogen activator
inhibitor type 1 (PAI-1) in blood and tissue extracts of patients with non-small cell
lung cancer]. Pneumonol Alergol Pol 72, 409-414.
Zumsteg, A., and Christofori, G. (2009). Corrupt policemen: inflammatory cells
promote tumor angiogenesis. Curr Opin Oncol 21, 60-70.

Abstract (if available)

Abstract Resistance to cell death, especially to apoptosis, is an important feature of tumor cells, which is also described as one of the hallmarks in cancer. The apoptosis machinery can be divided into two major pathways based on the source of death signaling, the Bcl-2-regulated (known as intrinsic or mitochondrial) apoptotic pathway and death receptor-regulated (known as extrinsic) apoptotic pathway. ❧ In Chapter 2 of this dissertation, I studied how tumor cell apoptosis could be a target for therapeutic intervention by examining the synergistic activity of a novel drug combination- ABT-737, a small molecule inhibitor of Bcl-2 family proteins, and Fenretinide (4-HPR), a cytotoxic retinoid - in preclinical models of childhood cancer neuroblastoma. Multilog synergistic cytotoxicity was observed for the drug combination in all of the eleven neuroblastoma cell lines tested. ABT-737 + 4-HPR induced greater mitochondrial membrane depolarization and mitochondrial cytochrome c release, greater activation of caspases, Bax-α, t-Bid, and Bak, and a higher level of apoptosis than either drug alone. In vivo, ABT-737 + 4-HPR increased the event-free survival (EFS) of the multidrug-resistant human neuroblastoma line CHLA-119 implanted subcutaneously in nu/nu mice. Thus, the combination of ABT-737 and 4-HPR warrants clinical trials in recurrent neuroblastoma. ❧ In Chapter 3 of this dissertation, I have studied how tumor apoptosis could be regulated by plasminogen activator inhibitor-1, which is an inhibitor of urokinase plasminogen activator, an extracellular protease in tumor microenvironment. ❧ PAI-1 is a predictor of poor outcome in cancer. An explanation for this paradoxical role has been its pro-angiogenic activity. The effect of PAI-1 on tumor cells has not been explored. Here we have examined the effect of PAI-1 knockdown (KD) on the survival of human cancer cell lines in vitro and in vivo. We demonstrated a decrease in survival and an increase in apoptosis in the four cell lines when PAI-1 was genetically (siRNA) or pharmacologically (PAI-1 inhibitor, PAI-039) suppressed. Apoptosis was blocked by a caspase-8 inhibitor, Fas/FasL neutralizing antibodies, and plasmin inhibitors. Stable PAI-1 KD tumor cells were generated by the transduction of short hairpin RNA lentivirus and examined for tumorigenicity in immunodeficient PAI-1 wildtype and knockout (KO) mice. In vivo, we observed a decrease in tumor growth, tumor take, cell proliferation and angiogenesis and an increase in apoptosis in PAI-1 KD HT-1080 in PAI-1 KO mice. A similar inhibition in tumor growth was observed when PAI-1 KD HCT-116 or A549 cells were implanted in PAI-1 KO mice. In conclusion, PAI-1 exerts a protective effect against extrinsic apoptosis in tumor cells. Downregulation of PAI-1 in both tumor and host cells is necessary for a significant inhibitory activity on tumorigenesis through a dual effect on tumor cell and endothelial cell apoptosis. The data suggest that PAI-1 may be necessary for tumor growth and support further investigation of the use of PAI-1 inhibitors in pre-clinical models of cancer. ❧ In conclusion, the research presented in this dissertation supports the concept that apoptosis induction in tumor cells (either through manipulating tumor cells alone or manipulating the tumor microenvironment) is a vital player in anticancer therapies.

Linked assets

University of Southern California Dissertations and Theses

Conceptually similar

PDF

Bone marrow derived mesenchymal stem cells promote survival and drug resistance in tumor cells

PDF

Bone marrow-derived mesenchymal stromal cells in the tumor microenvironment of neuroblastoma

PDF

Targeting tumor cells and microvessels in pediatric brain tumors

PDF

Neuronal master regulator SRRM4 in breast cancer cells facilitates CNS-acclimation and colonization leading to brain metastasis

PDF

Study of the role of bone morphogenetic proteins in prostate cancer progression

PDF

The role of GRP78 in the regulation of apoptosis and prostate cancer progression

PDF

Bimodal effects of bone morphogenetic proteins in prostate cancer

PDF

Anti-cancer effects of novel glidobactin type proteasome inhibitors

PDF

Insights from mouse models on the origin of ovarian cancer and its predisposing mechanisms

PDF

The mechanism by which extracellular Hsp90α promotes cell migration: implications in wound healing and cancer

PDF

Study of bone morphogenetic protein-2 and stromal cell derived factor-1 in prostate cancer

PDF

Homologous cell systems for the study of progression of androgen-dependent prostate cancer to castration-resistant prostate cancer

PDF

Treatment of HPV driven tumors with SH5-07, a small molecule inhibitor targeting STAT3

PDF

Protein kinase C (PKC) participates in acetaminophen hepatotoxicity through JNK dependent and independent pathways

PDF

Investigating PID1 as a modulator of brain tumor cell growth

PDF

Design of novel anticancer agents targeting cellular stress response pathways

PDF

Mechanism of secretion and function of heat shock protein-90 (Hsp90) family genes

PDF

Mass spectrometry-based proteomic analysis of inhibitor of kappa b kinase beta and its role in cytokine-induced drug resistance in cancer

PDF

Kaposi's sarcoma associated herpes-virus induces cellular proxi expression to modulate host gene expression that benefits viral infection and oncogenesis

PDF

Developing a bioluminescence tracking system targeting on tumor cells and T cells for cancer immunotherapy

Asset Metadata

Creator Fang, Hua (author)

Core Title Targeting BCL-2 family proteins and plasminogen activator inhibitor-1 in turmor cell apoptosis

School Keck School of Medicine

Degree Doctor of Medicine

Degree Program Pathobiology

Publication Date 05/06/2012

Defense Date 03/08/2012

Publisher University of Southern California (original), University of Southern California. Libraries (digital)

Tag ABT-737,apoptosis,Bcl-2,cancer,OAI-PMH Harvest,plasminogen activator inhibitor-1

Language English

Contributor Electronically uploaded by the author (provenance)

Advisor Dubeau, Louis (committee chair), Chuong, Cheng-ming (committee member), DeClerck, Yves A. (committee member), Erdreich-Epstein, Anat (committee member), Kalra, Vijay K. (committee member)

Creator Email christina_fanghua@hotmail.com,huafang@usc.edu

Permanent Link (DOI) https://doi.org/10.25549/usctheses-c3-33557

Unique identifier UC11289844

Identifier usctheses-c3-33557 (legacy record id)

Legacy Identifier etd-FangHua-792.pdf

Dmrecord 33557

Document Type Dissertation

Rights Fang, Hua

Type texts

Source University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Access Conditions The author retains rights to his/her dissertation, thesis or other graduate work according to U.S. copyright law. Electronic access is being provided by the USC Libraries in agreement with the a...

Repository Name University of Southern California Digital Library

Repository Location USC Digital Library, University of Southern California, University Park Campus MC 2810, 3434 South Grand Avenue, 2nd Floor, Los Angeles, California 90089-2810, USA