University of Southern California Dissertations and Theses

Akt1 deletion decrease proliferation in aged pancreatic beta-cells by arresting cell cycle in S phase

(USC Thesis Other)

Akt1 deletion decrease proliferation in aged pancreatic beta-cells by arresting cell cycle in S phase

PDF

Download a page range

Download transcript

Copy asset link

Request this asset

Transcript (if available)

Content
Akt1 deletion decrease proliferation in aged pancreatic beta-
cells by arresting cell cycle in S phase

By

Fan Fei

A Thesis Presented to the FACULTY OF THE USC GRADUATE SCHOOL UNIVERSITY
OF SOUTHERN CALIFORNIA In Partial Fulfillment of the Requirements for the Degree
MASTER OF SCIENCE (MOLECULAR PHARMACOLOGY & TOXICOLOGY)

May 2016

ii

Table of Contents

Acknowledgements v
List of Figures vi
Abstract viii

Chapter I:
Background and significance introduction 1
I-1 Beta cell mass and function 1
I-2 Signals regulating beta-cell mass and function 2
I-2-1 PI3K/AKT Pathway 3
I-3 Aging and beta cell impairment 6
I-4 Rationale of the study 7

iii

Chapter II:
Akt1 deletion leads to decrease in islet size and proliferation rate in aged mice 9
II-1 Introduction and rationale 9
II-2 Results 10
II-2-1 Beta cell function is normal in Akt1 deficient old mice 10
II-2-2 Beta cell mass decrease in Akt1 deficient old mice 15
II-2-3 Akt1 loss lead to decreased proliferation without increasing apoptosis 18
II-2-4 Immunoblotting analysis of pancreatic beta cells from wild type and Akt1 knockout old
mice

25

Chapter III:

Cell cycle arrest in G2/M phase of Akt1 knockout INS-1 cell 27
III-1 Introduction and rationale 27
III-2 Results 28
III-2-1 Akt1 deletion arrest INS-1 cell in G2/M phase 28
III-2-2 Immunoblotting analysis of INS-1 cells from wild type and Akt1 knockout groups 33

iv

Chapter IV:

Discussion 35

Chapter V:
Materials and methods 40

Bibliography 44

v

Acknowledgements

First of all, I want to earnestly thank my advisor, Dr. Bangyan Stiles, not only for her scientific
guidance, but also for life advice. I would like to thank her for providing opportunities for me to
conduct research and develop my technical skills. The patience and positive attitude set up an
outstanding role model for me to follow. The passion for science and dedication to work I learn
from her will benefit my whole life.
Then, I would like to thank my committee members, Dr. Curtis Okamoto and Dr. Jianming Xie.
Their support and guidance allowed me to finish my master thesis.
I would also like to thank all the members in Dr. Stiles’ lab, including Dr. Lina He, Dr. Ni Zeng,
Dr. Anketse Kassa, Dr. Chengyou Jia, Joshua Chen, Zhechu Peng, Richa Aggarwal, Jingyu Chen,
Mengcheng Li for their technical support and suggestions. Especially, I want to thank Zhechu
Peng. She taught me lots of professional techniques and encouraged me to do research.
Finally, I would like to thank my family and friends for their consistent support and company.

vi

List of Figures
Figure 1. AKT activation downstream of RTKs via the P13K pathway 4
Figure 2. Body Weight of wild type and Akt1 knockout old male mice 11
Figure 3. Fasting glucose of wild type and Akt1 knockout old male mice 12
Figure 4. Glucose tolerance test (GTT) result of wild type and Akt1 knockout old male 13
Figure 5. Insulin tolerance test (ITT) result of wild type and Akt1 knockout old male mice 14
Figure 6. Representative islet mass H&E pancreas staining of wild type and Akt1 knockout old
male mice

16
Figure 7. Quantification of islet mass size of wild type and Akt1 knockout groups 17
Figure 8. Representative immunofluorescence images of terminal deoxynucleotidyl transferase
dUTP nick end labeling (TUNEL) staining of wild type and Akt1 knockout old male mice

19
Figure 9. Quantification of TUNEL staining results of wild type and Akt1 knockout groups. 21
Figure 10. Representative immunofluorescence images BrdU staining of wild type and Akt1
knockout old male mice.

22
Figure 11. Quantification of BrdU staining results of wild type and Akt1 knockout groups. 24
Figure 12. Immunoblotting analysis of cell cycle regulators in wild type and Akt1 knockout old
male mice.

26

vii

Figure 13. Cell cycle progress analysis of wild type and Akt1 knockout INS-1 cell. 29
Figure 13.a. Representative figure of cell cycle progress of wild type and Akt1 knockout INS-1
cell without treatment.

30
Figure 13.b. Representative figure of cell cycle progress of wild type INS-1 cell. 31
Figure 13.c. Representative figure of cell cycle progress of Akt1 knockout INS-1 cell. 32
Figure 14. Immunoblotting analysis of cell cycle regulators in wild type and Akt1 knockout
INS-1 cell.

34

viii

Abstract

Pancreatic beta cells are key regulators of glucose homeostasis by producing insulin. AKT1 is an
important molecule of PI3K/AKT pathway which controls cell proliferation, metabolism and
survival. Previous reports have already shown that Pten deletion could increase beta cell
regeneration which would decrease in an age-dependent manner. The current study will investigate
if this effect is achieved through the downstream molecule AKT1 in aging condition.
Global Akt1 knockout mice model were kept in normal chow condition for more than 12 months.
The islet mass was significantly decreased compared with wild type mice. Using IHC, I determined
that the decrease of cell proliferation is the main contribution to islet mass decrease rather than
apoptosis increase. Using in vitro INS1 cell model, I further elucidate the function of AKT1 in
control of cell regeneration. Significantly higher percentage of Akt1 knockout cells arrested in S
phase compared with wild type cells. In addition, western blotting was performed to detected the
protein level change of cell cycle regulators. I found that cyclin E level was decreased in Akt1
knockout cells which is correspond to the S phase arrest. In conclusion, AKT1 is involved in
maintaining beta cell mass likely by controlling S phase entry. Lack of beta cell proliferation in
mice lacking Akt1 decreases the beta cell mass in old age with high risk of diabetes.

1

Chapter I.
Background and significance introduction

I-1 Beta cell mass and function

Blood glucose level is regulated in a narrow range in healthy individuals. Hypoglycemia could
result in fatal effects including brain dysfunction (Butler et al 2007), whereas hyperglycemia, often
caused by diabetes mellitus, could also lead to long-term health problems, such as heart disease,
eye and kidney damage. Pancreatic beta cells play a central role in maintaining glucose
homeostasis. (Meier et al 2005) In healthy individuals, beta cells secrete insulin in response to
changes in blood glucose concentrations. The secreted insulin inhibits glucose release from the
liver and stimulates glucose uptake by fat and skeletal muscle, thus restricts the blood glucose
concentration below upper limit. This insulin production and secretion property is the primary
function of beta cell. Beta cells are a type of cells located in the pancreatic islets and account for
about 60% of human islets. There are 2,000 to 3,000 beta cells per islet in adult human, (Stefan et
al 1982) with about 1 million islets distribute throughout the pancreas. (Butler et al 2007) Both the
mass and function of the beta cells are very important for glucose homeostasis.
The replication and differentiation of endocrine progenitor cells determine the beta cell mass at
birth (Stanger et al 2007; Georgia et al 2006), while beta cell proliferation drives islet size
expansion during early postnatal stage. (Kassem et al 2000; Dor et al 2004; Teta et al 2007) In

2

adult, differentiated beta cells only replicated at a very slow rate. (Cozar-Castellano et al 2006)
Although these beta cells are regarded as differentiated and cell-cycle arrested cells, they are still
able to replicate. (Cozar-Castellano et al 2006) The molecules that control the cell cycle
progression in beta cell are recently being elucidated. Pancreatic injury or metabolic stress
increases beta cell proliferation and islet mass in response to insulin demand. (Bouwens et al 2005)
Beta cell mass deficit is characterized for both type 1 and type 2 diabetes, suggesting a
therapeutical potential of beta cell regeneration.

I-2 Signals regulating beta-cell mass and function

The beta cell function and mass is regulated by glucose as well as signals including insulin-like
growth factors (IGFs), hepatocyte growth factor (HGF), platelet-derived growth factor (PDGF).
Glucose, in addition to the role as nutrient, has been reported to independently stimulate beta cell
proliferation and neogenesis of islets in rat pancreas. (Heit et al 2006, Paris et al 2003)
Administration of exogenous HGF has been shown to protect beta cells from apoptosis and
promote proliferation in diabetic mice induced by STZ. (Dai et al 2003) Conditional inactivation
of the PDGF receptor alpha gene in beta cells reduced beta-cell enhancer of zeste homologue 2
(Ezh2) levels and beta cell regeneration. (Chen et al 2011) IGF and insulin binding to its receptor,
regulates multiple cellular process including glucose transport, cell growth, proliferation.
(Assmann et al 2009; Kulkarni et al 2009; Taniguchi et al 2006) Collectively, these signals use
multiple cellular pathways to maintain the necessary amount of beta-cells needed for maintain
glucose homeostasis.

3

I-2-1 PI3K/AKT Pathway
PI3K/AKT signaling pathway is important for cell growth and survival. (Hennessy et al 2005)
Phosphatidylinositol-3-kinase (PI3K) is a lipid kinase, which contains an adaptor region at amino
terminal and a carboxyl-terminal catalytic domain. (Hennessy et al 2005) When growth factors
bind to receptor kinase tyrosine (RTK), the receptor will be stabilized and dimerization will happen.
Then trans-phosphorylation will occur at tyrosine residue and allow binding of Src homology 2
(SH2) domain. Proteins containing SH2 domain will be recruited to the receptor and get activated,
including PI3K. PI3K consists of a 110 kDa catalytic subunit and a 55 or 85 kDa regulatory subunit.
Upon activation, PI3K will add a phosphate to phosphatidylinositol-4,5-bisphosphate (PI(4,5)P2)
to become PI(3,4,5)P3, which will provide a membrane docking site for pleckstrin-homology (PH)
domain containing proteins. After activation, PI3K attract serine kinases to plasma membrane like
phosphoinositide-dependent kinase (PDK) and protein kinase B (PKB or AKT) isoforms. AKT is
a primary downstream molecule that binds to PI(3,4,5)P3, and the binding will also cause
conformational change which exposes residues for phosphorylation. Phosphoinositide-dependent
kinase 1 (PDK1) then adds a phosphate on threonine 308 (AKT1), while mammalian target of
rapamycin complex 2 (mTORC 2) phosphorylates serine at 473 in (AKT1). The activated AKT
translocates to cytoplasm and further phosphorylates many other substrates like BAD, GSK3beta,
FOXO1. (Osaki et al 2004)

4

Figure 1. AKT activation downstream of RTKs via the P13K pathway

PI3K/AKT pathway is a common intracellular signaling pathway share by three growth factor
receptor tyrosine kinases: insulin receptor (Insr), type 1 insulin-like growth factor receptor (Igf1r),
and Insr-related receptor (Irr). These surface receptor mediates insulin interaction to regulate beta
cell function. Insr is primarily important for metabolism and Igf1r for growth. The generation of
mouse model bearing mutations in genes required for insulin action and beta cell function 。 Using
these models, researchers have shed light onto on this complex metabolic condition. (Nandi et al
2004) The mice with null Insr mutations are born without apparent metabolic abnormalities.
However, the metabolic control deteriorates rapidly with fed glucose level increase and insulin
level rise up to 1000-fold above normal. Then beta cell failure occurs followed by death of animals.
(Kitamura et al 2003) The similar phenotype from mice lacking both insulin genes (Ins1 and Ins2)

5

suggests insulin signals through insulin receptor exclusively. (Duvillié et al 1997) Insulin receptor
substrate (IRS) is critical in mediating the action of insulin and growth factors after binding to
surface receptors. In islets isolated from Irs-1 knockout mice, insulin secreting function in response
to glucose and arginine is significantly defected and insulin expression is reduced by 2-fold
compare with wild type mice. This suggests that IRS1 is required for proper beta cell function.
Mice lacking Irs2 develop diabetes due to insulin deficiency and impaired insulin action. (Withers
et al 1999) While Irs3 and Irs4 mutation manifest milder abnormalities, which may due to
compensation effect of other IRS protein. (Kulkarni et al 1999) Mice lacking PI3K regulatory
subunits p85α p55α p50α show increased insulin sensitivity; while the mice lacking catalytic
subunits gene (p110a+/- p110b+/-) show mild glucose intolerance and hyperinsulinemia. The
regulatory subunit p85 has been indicated as a negative role in insulin signaling independent of
PI3K regulation. Loss of PTEN, the negative regulator of PI3K/AKT signaling is reported to be
responsible for growth factors like IGF-1 to control beta cell regeneration. (Zeng et al 2013, Wang
et al 2010)
AKT plays a key role in multiple cellular processes, including cell proliferation, metabolism,
apoptosis. AKT has been shown to regulate GSK3 by phosphorylating its N-terminal, (Cross et al
1995) which impedes degradation of beta-catenin, a protein can bind to different transcription
factors to increase protein expression like Cyclin D1. (Osaki et al 2004) P21/Waf1/Cip1 and
P27/Kip2 can also be phosphorylated by AKT and retained in cytoplasm, preventing the inhibitory
effect to cyclins and promoting cell proliferation. In addition, AKT also has anti-apoptotic property
by its phosphorylation and inactivation of Bad. (Datta et al1997; del Peso et al 1997) P53 could
also be indirectly regulated by AKT, impairing cellular stress response and promoting cell survival.
(Evan et al 2001; Mayo et al 2001; Zhou et al 2001)

6

There are three isoforms of AKT in mammalian genomes: AKT1 (PKB alpha), AKT2 (PKB beta),
AKT3 (PKB gamma) (Datta et al 1999). AKTs are widely expressed in various tissues. However,
AKT1 is ubiquitously expressed in most tissues whereas AKT2 is more abundant in skeletal
muscle and AKT3 expression is primarily restricted to the brain and testes. (Garofalo et al 2003)
Phenotypic analysis of mice deficient of each isoform revealed their function in cell growth,
neuronal development and glucose homeostasis. Akt1 deficient mice show growth retardation and
Akt3 deficient mice show brain development impairment, while no significant change in glucose
homeostasis in both models. (Chen et al 2001; Cho et al 2001; Easton et al 2005; Tschopp et al
2005; Yang et al 2003) In Akt2 knockout mice, insulin resistance and glucose intolerance is
observed. (Cho et al 2001; Garofalo et al 2003) AKT2 was thought to be the only isoform in
regulation of glucose metabolism. However, AKT1 was found to be specifically activated by IRS2
and required for proliferation in islets. (Buzzi et al 2010) In beta cells, all three isoforms are
expressed. (Muller et al 2006; Holst et al 1998)

I-3 Aging and beta cell impairment

Although proliferation of beta cell is a potential way to deal with diabetes, aging could
independently impair beta cell function and regeneration capacity. (Kushner et al 2013) In young
rat, beta cells take about 1-3 mouths to replicate, (Finegood et al 1995) but in aged mice, beta cell
turnover declines markedly by 12 months. In human, C14 content studies demonstrated that beta
cells were generated in the first 30 years of life. (Perl et al 2010) Ki67 experiment of human adult
subjects also showed a very slow rate of beta cell replication. (Meier et al 2008; Saisho et al 2013;

7

Gregg et al 2012) Regenerative response to pancreatectomy and low dose streptozotocin, a beta-
cell specific toxin was dramatically reduced in old age mice (14 months) (Rankin et al 2009) Taken
together, evidence illustrated that beta cell regeneration capacity may severely decrease with age.
Recent study showed that phosphatase and tensin homolog (PTEN) loss in mice model could
restore regeneration capacity in aged beta cells. (Zeng et al 2013) PTEN is a protein and lipid
phosphatase which negatively regulates PI3K/AKT signaling pathway by dephosphorylating
PI(3,4,5)P3 to PI(3,4)P2. In mice model which Pten is specifically deleted in insulin producing
cells, Pten loss could increase cyclin D1 and activate E2F transcription factor. Ezh2, a polycomb
protein, will be up-regulated, which will induce methylation of P16 promoter, and thus decrease
P16 level. (Zeng et al 2013) This network is suggested to be responsible for aging process in
regeneration control of beta cell. However, it is still unclear that whether AKT is the downstream
molecule of PTEN in this regulation, or which isoform of AKT plays a key role.

I-4 Rationale of the study

My thesis focuses on whether and how AKT1 is involved in the regulation of aged pancreatic beta
cell mass. Since PTEN is up-regulated in models of type 2 diabetes (Wang et al 2010), and Pten
deletion could rescue beta cell mass loss in old mice. (Zeng et al 2013) It is necessary to study the
downstream molecule to further elucidate PI3K/AKT signaling pathway in the proliferation of
aged beta cell. In addition, transgenic mice with constitutively active AKT1 (caAKT) showed a
gross increase in beta cell proliferation and islet mass. Glucose tolerance is improved, and glucose-

8

stimulated insulin secretion is also maintained. (Bernal-Mizrachi et al 2001) The molecular
mechanism study showed that caAKT induced beta cell proliferation in a manner dependent on
cdk4 which regulates cyclin D1, cyclin D2, and P21 levels. (Fatrai et al 2006) However, in mice
up to 6 months, deletion of Akt1 did not have any effect on beta cell function, islet mass and
glucose homeostasis. (Buzzi et al 2010)
Based on the preliminary result, I hypothesize that AKT1 may regulate the proliferation of aged
beta cells. Therefore, we bred Akt1 knockout mice for more than one year. Using this mouse model,
my thesis defined that AKT1 is important for beta cell mass maintenance and beta cell proliferation
in old mice.
In chapter II, I investigated the phenotypical changes of aging beta-cells in mice with or without
AKT1. Beta cell function is characterized in both wild type mice (WT) and Akt1 knockout mice
(A1KO). Islet mass is decreased in Akt1 deficient mice. There are two explanations for the decline:
decreased proliferation and increased apoptosis. Both are investigated. In chapter III, INS1 cells
are used to determine cell cycle difference when Akt1 is knockout. This further confirmed the
AKT1 function in proliferation of Akt1 deficient beta cell. Finally, analyzing cell cycle regulators
expression level allow propose relevant cell cycle regulators involved for AKT1 regulation of beta
cell mass.

9

Chapter II.
Akt1 deletion leads to decrease in islet size and proliferation rate in aged mice

II-1 Introduction and rationale

The expansion of pancreatic beta cell mass happens most in early stage of life. Proliferation rate
of beta cell decreases with age, while the incidence of diabetes increase. (Kushner et al 2013)
Therapeutics targeting functional beta cell regeneration has long been suggested for diabetes
treatment. Previously, we found that Pten deletion specifically in pancreatic beta cells would cause
islet mass and proliferation rate to increase dramatically, particularly in aged animals. However, it
is not characterized whether AKT is the downstream molecule regulating this change in beta cell
mass (Zeng et al 2010). To define whether AKT1 is involved in maintenance of beta cell mass and
regeneration capacity in aged mice, we generate a mouse model which are globally deficient of
Akt1. With this model, we are able to detect beta cell function and islet mass change in mice more
than 12 months old.

10

II-2 Results

II-2-1 Beta cell function is normal in Akt1 deficient old mice
Consistent with previous report, Akt1 loss results in retardation in growth. Body weight of A1KO
group is significantly lower than that of WT group (Figure 1). To address the role of AKT1 in the
maintenance of beta-cells of aged mice, I first performed fasting glucose test, glucose tolerance
test (GTT) and insulin tolerance test (ITT), glucose homeostasis in A1KO is normal compared
with WT group at the age of more than 12 months (Figure 2, 3, 4, 5). The GTT and ITT data
actually show better insulin sensitivity in Akt1 knockout mice, which is consistent with Buzzi et
al. In 2012, Wan et al reported that Akt1 deletion could increase energy expenditure, which means
more intake food is used for producing heat and thus have a lower body weight. (Wan et al 2012)
This could also partially explain improved insulin sensitivity, as peripheral tissues burning energy
faster and have more capacity for insulin action. These data suggest that Akt1 deletion do not affect
the formation of islet mass during pre- or post-natal period. In addition, islet function is also
maintained in Akt1 knockout mice under normal chow.

11

Figure 2. Body weight of wild type and Akt1 knockout old male mice. Both groups are on
normal chow for more than 12 months (n=5-6 per genotype), WT: wild type group; A1KO: Akt1
knockout group, * p<0.05 by student T test. All data are means ± SEM.

12

Figure 3. Fasting glucose of wild type and Akt1 knockout old male mice. Plasma glucose levels
were obtained from 16 hours overnight fasting mice (n=5-6 per genotype, age>12 months). WT:
wild type group; A1KO: Akt1 knockout group. All data are means ± SEM.

13

Figure 4. Glucose tolerance test (GTT) result of wild type and Akt1 knockout old male mice.
Blood glucose levels were measured in mice of 12 months old subjected to glucose tolerance test
as described in Materials and methods. (n=5-6 per genotype). WT: wild type group; A1KO: Akt1
knockout group. All data are means ± standard errors of the means of the blood glucose/basal
blood glucose ratio.

14

Figure 5. Insulin tolerance test (ITT) result of wild type and Akt1 knockout old male mice.
Blood glucose levels were measured in mice of 12 months old subjected to insulin tolerance test
as described in Materials and methods. (n=5-6 per genotype). WT: wild type group; A1KO: Akt1
knockout group. All data are means ± standard errors of the means of the blood glucose/basal
blood glucose ratio.

15

II-2-2 Beta cell mass decrease in Akt1 deficient old mice
Buzzi et al have reported that islet area and beta cell proliferation were unchanged when Akt1 is
deleted at age of 5 to 6months, suggesting Akt1 deletion do not affect beta cell turnover at least
during young age. However, Bernal et al suggest a conflict fact that AKT1 activation would lead
to cell cycle progression in beta cell. These conflict data arouse our interest to explore whether
AKT1 is involved in aged beta cell regeneration. To determine the role of AKT1 in the aged
population, I analyzed the islet mass of control and Akt1-/- mice at 12 months of age and older. In
the old mice of more than 12 months, the pancreas H&E staining result showed that islet mass area
decreases dramatically in aged A1KO mice (Figure 6,7). The significant decrease of islet size to
pancreas ratio suggest that the damaged insulin capacity in pancreatic beta cell. The metabolic
stress which is common in our daily life would require large amount of insulin that cannot be met
by the damaged insulin capacity. Thus glucose homeostasis would further deteriorate.

16

Figure 6. Representative islet mass H&E pancreas staining of wild type and Akt1 knockout
old male mice. H&E staining of pancreatic sections from mice of 12 months old were described
in Materials and methods. (n=5-6 per genotype) WT: wild type group; A1KO: Akt1 knockout
group. Scale Bar, 100 µM

17

Figure 7. Quantification of islet mass size of wild type and Akt1 knockout groups. Islet size
show in ratio of islet area to total pancreatic area. (n=5-6 per genotype, age>12 months) For each
animal, three sections are selected and an average of the three represent this individual. WT: wild
type group; A1KO: Akt1 knockout group. *p<0.05 by student T test. All data are means ± SEM.

18

II-2-3 Akt1 loss leads to decreased proliferation without increasing apoptosis
Two possible reasons could contribute to loss of beta cell mass: proliferation decrease and cell
death increase. Apoptosis is evaluated by Terminal deoxynucleotidyl transferase dUTP nick end
labeling (TUNEL) in both groups. There is no significant difference of TUNEL positive cells in
total pancreas between A1KO and WT group (Figure 7,8). 5-bromo-2-deoxyuridine (BrdU)
incorporation assay was employed to examine proliferation rate. Both groups were fed with water
containing BrdU for five days before euthanizing. We then used staining to quantify BrdU positive
beta cells. The ratio of BrdU positive beta cells to pancreas is significant high in WT (Figure 9,10).
These results suggest that beta cell proliferation decrease is most likely responsible for loss of islet
mass in aged Akt1 knockout mice. Combined with previous report that young mice do not share
this difference, we hypothesize that role of AKT1 in beta cell regeneration gradually takes effect
in aging progress.

19

20

Figure 8. Representative immunofluorescence images of terminal deoxynucleotidyl
transferase dUTP nick end labeling (TUNEL) staining of wild type and Akt1 knockout old
male mice. Pancreatic sections from mice of 12 months old were analyzed as described in
Materials and methods. Representative images of insulin (red), TUNEL (green) and DAPI (blue)
staining. The overlap of blue and green staining inside red color is regarded as positive staining.
WT: wild type group; A1KO: Akt1 knockout group. Scale Bar, 50 µM

21

Figure 9. Quantification of TUNEL staining results of wild type and Akt1 knockout groups.
Data show in ratio of TUNEL positive cells to total islet cells. The red color indicates insulin
producing islet cells; TUNEL positive is the overlap of blue and green staining inside red color
(n=5-6 per genotype, age>12 months) For each animal, three sections are selected and an average
of the three represent this individual. WT: wild type group; A1KO: Akt1 knockout group. All data
are means ± SEM.

22

23

Figure 10. Representative immunofluorescence images BrdU staining of wild type and Akt1
knockout old male mice. Pancreatic sections from mice of 12 months old were analyzed as
described in Materials and methods. Representative images of insulin (red), BrdU (green) and
DAPI (blue) staining. The side pictures show enlarged portion of each image. The overlap of blue
and green staining inside red color is regarded as positive staining as indicated in the side images
of WT groups. WT: wild type group; A1KO: Akt1 knockout group. Scale Bar, 50 µM

24

Figure 11. Quantification of BrdU staining results of wild type and Akt1 knockout groups.
Data show in ratio of BrdU positive cells to total islet cells. The red color indicates insulin
producing islet cells; BrdU positive cell is the overlap of blue and green staining inside red color
(n=5-6 per genotype, age>12 months) For each animal, three sections are selected and an average
of the three represent this individual. WT: wild type group; A1KO: Akt1 knockout group. *p<0.05
student T test. All data are means ± SEM.

25

II-2-4 Immunoblotting analysis of pancreatic beta cells from wild type and Akt1 knockout
mice
To further elucidate how the loss of AKT1 could decrease proliferation, we performed the
immunoblotting analysis to determine the molecular level change of cell cycle regulators. We
found that in Akt1 knockout mice there is significant decline of cyclin D1/D2/D3, while cyclin A
level is unexpectedly upregulated which will be discussed in discussion part. There is no obvious
change in P27 level and other protein level is not detected like P16, P21, cyclin E. These decrease
of several cell cycle regulators confirmed the proliferation decrease when delete Akt1. However,
it is still difficult to identify single of several molecules regulates cell cycle entry and to know
which phase is blocked in cell cycle. We need the in vitro cell model to further investigate the
detail of the cell cycle progression.

26

Figure 12. Immunoblotting analysis of cell cycle regulators in wild type and Akt1 knockout
old male mice. Islet isolation and western blot is performed as described in Materials and methods.
WT: wild type group; A1KO: Akt1 knockout group.

27

Chapter III.
Cell cycle arrest in G2/M phase of Akt1 knockout INS-1 cell

III-1 Introduction and rationale

Previous studies showed that in normal mice, beta cell turnover declines markedly to about 0.07%
by 12 months. (Teta et al 2005) Our data further demonstrated that adult Akt1 knockout mice have
even lower proliferation rate. However, it is still not elucidated how cell cycle progress is
influenced by Akt1 deletion. Previous in our lab, a regulatory axis of PI3K/AKT pathway is
identified in Pten knockout mice. (Zeng et al 2013) PTEN controls beta cell senescence through
cyclin D1/E2F/Ezh 2 pathway, as a result, P16 level will increase and cell cycle will be blocked.
However, it is still not known if Akt1 deletion will result in the decrease proliferation in the same
way that identified in Pten null model. To further explore cell cycle progression, we generated an
Akt1 knockout beta cell line (INS1) using CRISPR (Clustered Regularly-Interspaced Short
Palindromic Repeats) technology. With this cell line, we can determine how Akt1 loss could impact
cell cycle, and thus explain beta cell mass decrease. In addition, we will detect the protein level
change of several cell cycle regulators like cyclin E, cyclin A, P16, P27 to shed a light on future
work about molecular mechanism.

28

III-2 Results

III-2-1 Akt1 deletion arrest INS-1 cell in G2/M phase
After getting Akt1 null INS1 cell, we used thymidine synchronization to stop cell cycle progression
at G1/S phase, then release the cell in fresh medium for indicated time. To further elucidate the
cell cycle information, we used PI stain cells of both Akt1 deleted and wild type for flow cytometry.
(Figure 13) After thymidine synchronization, most cells are arrest in G1 phase. After release to
normal medium for indicate time, there is significant higher percentage of cells arrest in S phase
in Akt1 knockout group compared with control group at 4h and 8h. This data suggests that Akt1
deletion tend to arrest INS1 cell in S phase thus slow down cell cycle.

The higher percentage of Akt1 null cells in S phase seems to contradict to the lower Brdu positive
rate in Akt1 knockout mice. To explain this, we need to first understand in mouse model,
proliferation rate is very low especially in aged population with existence of negative regulators.
In addition, cells need enough phosphorylation of Rb to pass the G1/S checkpoint. Akt1 deletion
would decrease Rb phosphorylation and thus arrest cell around this checkpoint. However, the INS1
cell is a cancer cell line and is innate to proliferate at high rate. We can observe the loss of Akt1
function as a brake to slow down cell cycle progression, and many cell cycle regulators like D-
cyclins are at high level to compensate for Rb phosphorylation. So the cells can pass the G1/S
checkpoint but the progress is significant slow down.

29

Figure 13. Cell cycle progress analysis of wild type and Akt1 knockout INS-1 cell. Cell cycle
analysis was performed as described in Materials and methods. Thymidine was used for
synchronization and cells were released to fresh medium for indicated time (0h, 4h, 8h). Cells with
no treatment were used as control. Quantification is achieved by Flowjo. *p=0.0019; **p<0.0001
by two-way ANOVA. WT: wild type group; A1KO: Akt1 knockout group. All data are means ±
SEM.

30

Figure 13.a. Representative figure of cell cycle progress of wild type and Akt1 knockout INS-
1 cell without treatment. Quantification is achieved by Flowjo. WT: wild type group; A1KO:
Akt1 knockout group

31

Figure 13.b. Representative figure of cell cycle progress of wild type INS-1 cell. Cells were
synchronized by thymidine for 8 hours and then released to fresh medium for indicated time (0h,
4h, 8h). Quantification is achieved by Flowjo. WT: wild type group;

32

Figure 13.c. Representative figure of cell cycle progress of Akt1 knockout INS-1 cell. Cells
were synchronized by thymidine for 8 hours and then released to fresh medium for indicated time
(0h, 4h, 8h). Quantification is achieved by Flowjo. A1KO: Akt1 knockout group

33

III-2-2 Immunoblotting analysis of INS-1 cells from wild type and Akt1 knockout groups
After observing the cell cycle arrest in S phase, we want to look further into the protein level
change in accordance with this phenomenon. Samples collected from INS1 cells of both wild type
and Akt1 knockout groups are used for immunoblotting. As shown in Figure 14. Cyclin E level
decrease significantly in Akt1 knockout group. However, there is no obvious difference in the
cyclin A level between both groups. Also, the cell cycle inhibitors like P16, P21, P27, do not
increase in Akt1 knockout group. This results correspond to S phase arrest, as cyclin E and CDK2
complex plays a critical role in G1-S transition by phosphorylate Rb. However, further experiment
is still needed to elucidate the detail regulation of cyclin E by AKT1 and validate in mouse model.

34

Figure 14. Immunoblotting analysis of cell cycle regulators in wild type and Akt1 knockout
INS-1 cell. Western blot is performed as described in Materials and methods. WT: wild type group;
A1KO: Akt1 knockout group

35

Chapter IV.
Discussion
Decreased functional beta cell mass is indicated to be the hallmark of both type 1 and type 2
diabetes. Impaired proliferation and increased apoptosis of beta cells will lead to insufficient
insulin secretion, thus hyperglycemia. (Donath et al 2004) Although the loss of functional beta
cells is widely accepted as key in pathogenesis of both type 1 and type 2 diabetes, it remains
unknown about the mechanistic details on how the cell proliferation is regulated. (Fatrai et al 2006)
This ability of regeneration usually decreases with aging progress, as older individuals have higher
risks for developing type 2 diabetes and lower proliferation rates of beta cells.

Phosphoinositide 3-kinase (PI3K)/AKT signaling pathway is widely reported as playing a critical
role in regulation of beta cell turnover. The AKT kinase is regarded as a key regulator for beta
cell proliferation and survival. (Kido et al 2000; Withers et al 1998; Xuan et al 2002; Kulkarni et
al 2002; Buteau et al 2001) Several models have been used to further illustrate function of AKT.
One model is mice express constitutively active AKT (caAKT), the RIP-Akt transgenic mice
demonstrate beta cell proliferation and islet size increase. Fatrai et al have reported that cdk4
deletion would reduce the beta cell expansion caused by constitutively active AKT. The regulation
of cell proliferation also involves cyclin D1, cyclin D2, p21. However, this forced overexpression
of AKT will boost the PI3K signaling pathway to a supraphysiologic levels, which would not only
lead to proliferation, but also cause cell dedifferentiation or even raise the risk for developing
tumor. (Wang et al 2010) However, Buzzi et al have reported the AKT1 knockout model, the
AKT1 loss did not change islet mass and beta cell proliferation in young mice of 5- to 6-months.

36

This suggest that AKT1 may not play a fundamental role in regulation of beta cell regeneration at
the early age of individuals and the caAKT model may not be suitable to reflect the physical
condition, as PI3K/AKT signaling pathway is depressed and proliferation is decreased in type 2
diabetes. The importance of AKT1 in islet mass regulation is revealed in the old mice in this project.

Pten knockout model is fundamentally different from constitutively active AKT model. Deleting
Pten results in activation of PI3K/AKT signaling at physiologic levels due to removal of a
physiologic brake. (Wang et al 2010) Previously, Ni et al have employed Pten deletion specifically
in insulin producing cells. (Zeng et al 2013) Pten loss could prevent proliferation decline in aged
beta cells, and a novel signaling network PTEN/Cyclin D1/E2F/Ezh2/P16 is established to provide
explanation for decline in regeneration of aging beta cells. (Zeng et al 2013)

In my project, I want to illustrate the function of the downstream molecule AKT1 in regulation of
aged beta cell. First, we generate AKT1 knockout mice model. To investigate signaling pathway
at physiological condition of beta cells, we kept the mice under normal chow for more than twelve
months, during which functional tests like GTT, ITT were performed. Then, mice from both wild
type and AKT1 knockout groups were sacrificed, pancreas samples were used for islet size
quantification, IHC staining and immunoblotting. We did not observe any functional defect in
AKT1 knockout mice except for growth retardation. However, the islet mass is significantly
decreased compared with wild type. To explain the lack of beta cell did not result in disorder of
glucose homeostasis, we think there might be two reasons to explain. First is that the whole body
knockout of Akt1 also exert its effect on peripheral tissue like skeletal muscle. Previous reports
show the energy expenditure will increase in this transgenic mice, which would increase insulin

37

sensitivity and keep blood glucose in a normal range. The second is because mice were fed with
normal chow lacking metabolic stress like high fat diet (HFD), the beta cells are still able to handle
demand of insulin. If we increase metabolic burden with high fat diet, we should observe the higher
incidence of glucose level disorder, which is confirmed in our further study. Next, we performed
BrdU staining and TUNEL staining to further fugure out the cause of islet mass decline. What we
found is that proliferation decrease in AKT1 knockout mice, while there is no difference in
apoptosis of both groups.

To further elucidate the cell cycle progression alternation involved in the decreased proliferation,
we also performed immunoblotting of in vivo islet sample, and the result showed decrease of some
cell cycle regulators like D cyclins. To further illustrate the role of AKT1 in cell cycle regulation,
we generate AKT1 knockout INS1 cell using CRISPR technology. Following this, we performed
cycle cell analysis with flow cytometer of both wild type and AKT1 knockout INS1 cells. The
result showed that significant higher percentage of cell arrest in S phase in AKT1 knockout group.
Then we explored the protein level change with in vitro sample. The cyclin E level decrease in
AKT1 loss group could at least partially explain the S phase arrest phenomenon.

Cyclin A level is unexpectedly up-regulated in AKT1 deleted group. The observed increases in
cyclin A level when AKT1 knockout is deleted suggests higher proliferation rate maybe occurring
since cyclin A is induced at S phase. However, the observed decline of Ki67 staining contradict
this possibility. Liu et al reported that apart from well-known phosphorylation sites S473 by
mTORC2 and T308 by PDK1, phosphorylation at S477 and T479 at the extreme C-terminus of
AKT1 could also promotes its activation. (Liu et al 2014) They further demonstrate that cyclin

38

A/cdk 2 complex are responsible for this phosphorylation during cell cycle progress. (Liu et al
2014) When inactivation of cdk2/cyclin A, there will be a reduced phosphorylation at S477/T479,
S473, T308. Intriguingly, phosphorylation at S477/T479 would facilitate or compensate for S473
phosphorylation for AKT kinase activity. Moreover, AKT tail phosphorylation might provide extra
charge-charge interaction to further stabilize the active AKT conformation. Thus, when AKT1 is
deleted, cyclin A may increase as a feedback reaction. Although the mechanisms of this progress
is still unknown and require further investigation, it may provide a possible explanation for the
observed increase in cyclin A when AKT1 is lost. We could not observe the same upregulation of
cyclin A in INS1 cell sample. It is likelhy because of INS1 cells proliferate at very high rate even
with deletion of AKT1, so cyclin A level is at a very high level and we cannot discriminate any
difference even it is existed.

Furthermore, apart from the expression level change of those cell cycle regulatory proteins, there
are other issues to think about the regulation like translocation. To fulfill the function, the cell
cycle regulatory proteins need to translocate into nuclear. Most cyclins and their cdk partners are
predominantly present in the cytoplasm of human beta cells, including cyclin A, cyclin E, cdk 1,
cdk 2, D-cyclins, cdk 4/6. (Fiaschi-Taesch et al 2013) Recently, Tiwari et al further reported that
when overexpressed, cyclin E and cyclin A are able to translocate to nuclear, while cdk 1 and cdk
2 will take advantage of binding to them for translocation. (Tiwari et al 2015) The translocation of
those proteins could further lead to phosphorylation of retinoblastoma protein at different site and
thus increase proliferation of beta cells in vitro. Thus, changes in localization of the cyclins and
CDKs in different compartments of those proteins could also regulate cell cycle progress.

39

In summary, our study demonstrates that AKT1 is important in regulation of islet mass in old mice
by regulating beta cell proliferation through cyclin E and S phase progression. This study suggests
that PI3K/AKT signaling pathway plays a significant role in controlling the risk of diabetes in aged
individuals with the involvement of AKT1. To understand the detail of the regulation and to
explore therapeutic application, further study is still required, such as a mouse model specific
delete Akt1 in beta cell.

40

Chapter V.
Materials and methods

Animals
Global knockout of AKT1 C57BL/6J mice are kindly offered by Morris lab. (Wan et al 2011) The
mice of both wild type and AKT1 knockout groups are fed with normal chow for more than 12
months. For BrdU experiment, mice were administrated with drinking water containing BrdU for
five continuous days to determine cell proliferation capacity. Animals were housed in a room
controlled with humidity, temperature and light (12-h light/dark cycle), allowing access to water
and food freely. All experiments were conducted according to the Institutional Animal Care and
Use Committee of the University of Southern California research guidelines.

Glucose Tolerance Test
Glucose levels were measured by Therasense Glucose Meter from tail vein puncture blood
sampling. To rule out the possibility of circadian rhythm influence, we determined the random
glucose, fasting glucose and glucose tolerance test (GTT) in the morning around the same time.
Fasting glucose levels were checked after 16 hours overnight fasting, then i.p. injection of a single
dose (2g/kg body weight) of d-dextrose (Sigma-Aldrich). Subsequently, circulating glucose levels
were determined at indicated time point.

41

Insulin Tolerance Test
To avoid circadian rhythm difference, we performed insulin tolerance test (ITT) around the same
time in the afternoon. After 5 hours of fasting, mice were first measured baseline glucose and then
given one dose (0.5U/kg body weight) of human regular insulin (Novo Nordisk) by i.p. injection.
At indicated time point, circulating glucose levels were measured by glucose meter.

Immunohistochemistry
Zn-formalin was used to fix pancreatic tissue section which was then embedded in paraffin as
previous described (Stiles at al., 2006). Hemotoxylin and Eosin (H&E) staining was utilized to
analyzed morphological change. Antibodies used were: BrdU (BD Pharmingen), insulin (Abcam,
ab7842). Apoptosis was determined by Terminal deoxynucleotidyl transferase dUTP nick end
labeling (TUNEL) assay (Roche Diagnostics, Manheim Germany). Three sections per subject were
stained, and 5 subjects per group.

Cell Proliferation Determination
Bromodeoxyuridine (5-bromo-2'-deoxyuridine, BrdU) assay was performed to determine cell
proliferation rate. Mice were fed with drinking water containing BrdU (1mg/ml) (Sigma-Aldrich)
for five consecutive days. Then mice were euthanized on the sixth day and pancreas were collected
for immunohistochemistry (IHC) using BrdU and insulin antibody.

Islet isolation
Collagenase P solution (0.8mg/ml) were used to perfuse pancreas through pancreatic duct. Then
digest the tissue for 20 min at 37°C. Handpick islet for western blot.

42

Cell culture and AKT1 knockout INS1 cell
INS1 cells were cultured in RPMI1640 medium with 10% fetal bovine serum and 1%
Penicillin/Streptomycin Solution. We use the exon1 sequence of rat AKT1 to design sgRNA.
Because INS1 cells do not uptake plasmid efficiently, and lentivirus were used for delivery into
INS1 cell. Then cas9 is expressed and complex with sgRNA, and the complex will be guided to
target site recognized by sgRNA. The nuclease domain at the amino terminus of cas9 will cleave
double-strand break (DSB) and activate the DNA repair machinery called non-homologous end
joining (NHEJ) pathway. This repair mechanism is of low fidelity and will result in insertions
and/or deletions which will disrupt the expression of target protein. The CRISPR-Cas9 system
were used to generate AKT1 knockout INS1 cell. The CRISPR v2 vector encoding Cas 9 were
purchased from Addgene (Addgene plasmid #52961). The sequence of 20-bp sgRNA targeting
AKT were designed as follows: LentiCrispr rat-akt1 sg-d F:
CACCGTGGCTACAAGGAACGGCCTC; LentiCrispr rat-akt1 sg-d R:
AAAACGAGGCCGTTCCTTGTAGCCA. The oligonucleotides were first annealed and ligated
with CRISPR v2 vector digested with Bsmb1. The plasmid then would be transferred to E.Coli
cells for amplification and co-transfected into 293T cell with a plasmid mixture including: FUGW,
RRE, REV, VSV. The supernatant was used to transduce INS1 cell and then single cell was placed
into 96-well plate for further confirmation using western blotting.

Western blot
Tissue sample of mice islets and cell sample were collected and lysed in cell lysis buffer. The
protein lysate (40ug) were loaded for electrophoresis using SDS-PAGE gel, and then transferred
to PVDF membranes. Antibodies used: cyclin D1 (Santa Cruz, sc-8396), cyclin D2 (Cell Signaling

43

Tech.), cyclin D3 (Cell Signaling Tech., #2936), pAKT (Cell Signaling Tech., #4060), AKT (Santa
Cruz, sc-8312), P27 (Santa Cruz, sc-1641), P16ink4a (Santa Cruz, F-12 or M-156), cyclin A (Santa
Cruz, sc-751), cyclin E (Cell Signaling Tech., #4129), AKT1 (Santa Cruz, sc-1618), AKT2 (Santa
Cruz, sc-5270), GAPDH (Santa Cruz), β-actin (Sigma). Antibodies against cyclin D2, cyclin D3,
phosphor-AKT, cyclin E, GAPDH were from Cell Signaling Technology (Danvers, MA); anti-
AKT, anti-cyclin D1, anti-P27, anti-P16, anti-cyclin A, anti-AKT1, anti-AKT2 antibodies were
from Santa Cruz Biotechnology (Santa Cruz, CA); anti-actin antibody was from Sigma (St. Louis,
MO).

Propidium iodide (PI) staining and flow cytometry
INS1 cells were plated in 6-well plates at the density of 0.5-1 X 105 cells/well. After treating with
10mM H2O2 for 24 hrs, cells were trypsinized and then collected by centrifuge. As described
previously (Stiles et al 2002), cells re-suspended in PBS were stained with 1 ug/ml propidium
iodide (PI) for 15 min at room temperature. Samples were then analyzed immediately using the
BD LSR II flow cytometry system.

Statistical Analysis
The data are presented as means with an error bar of the standard deviation(SD). Differences
between individual groups were analyzed by Student’s t test, when two-tailed p values less than
0.05 were considered statistically significant difference.

44

Bibliography

Butler, P. C., Meier, J. J., Butler, A. E., & Bhushan, A. (2007). The replication of β cells in normal
physiology, in disease and for therapy. Nature clinical practice Endocrinology &
metabolism, 3(11), 758-768.

Meier, J. J., & Butler, P. C. (2005). Insulin secretion. Endocrinology, 5, 961-973.

Stefan, Y., Orci, L., Malaisse-Lagae, F., Perrelet, A., Patel, Y., & Unger, R. H. (1982). Quantitation
of endocrine cell content in the pancreas of nondiabetic and diabetic humans. Diabetes, 31(8), 694-
700.

Stanger, B. Z., Tanaka, A. J., & Melton, D. A. (2007). Organ size is limited by the number of
embryonic progenitor cells in the pancreas but not the liver.Nature, 445(7130), 886-891.

Georgia, S., Soliz, R., Li, M., Zhang, P., & Bhushan, A. (2006). p57 and Hes1 coordinate cell
cycle exit with self-renewal of pancreatic progenitors.Developmental biology, 298(1), 22-31.

Kassem, S. A., Ariel, I., Thornton, P. S., Scheimberg, I., & Glaser, B. (2000). Beta-cell
proliferation and apoptosis in the developing normal human pancreas and in hyperinsulinism of
infancy. Diabetes, 49(8), 1325-1333.

45

Dor, Y., Brown, J., Martinez, O. I., & Melton, D. A. (2004). Adult pancreatic β-cells are formed
by self-duplication rather than stem-cell differentiation.Nature, 429(6987), 41-46.

Teta, M., Rankin, M. M., Long, S. Y., Stein, G. M., & Kushner, J. A. (2007). Growth and
regeneration of adult β cells does not involve specialized progenitors. Developmental cell, 12(5),
817-826.

Cozar-Castellano, I., Fiaschi-Taesch, N., Bigatel, T. A., Takane, K. K., Garcia-Ocaña, A.,
Vasavada, R., & Stewart, A. F. (2006). Molecular control of cell cycle progression in the pancreatic
β-cell. Endocrine reviews, 27(4), 356-370.

Bouwens, L., & Rooman, I. (2005). Regulation of pancreatic beta-cell mass.Physiological
reviews, 85(4), 1255-1270.

Dai, C., Li, Y., Yang, J., & Liu, Y. (2003). Hepatocyte growth factor preserves beta cell mass and
mitigates hyperglycemia in streptozotocin-induced diabetic mice. Journal of Biological
Chemistry, 278(29), 27080-27087.

Chen, H., Gu, X., Liu, Y., Wang, J., Wirt, S. E., Bottino, R., ... & Kim, S. K. (2011). PDGF
signalling controls age-dependent proliferation in pancreatic [bgr]-cells. Nature, 478(7369), 349-
355.

46

Assmann, A., Hinault, C., & Kulkarni, R. N. (2009). Growth factor control of pancreatic islet
regeneration and function. Pediatric diabetes, 10(1), 14-32.

Kulkarni, R. N. (2005). New insights into the roles of insulin/IGF-I in the development and
maintenance of β-cell mass. Reviews in Endocrine and Metabolic Disorders, 6(3), 199-210.

Taniguchi, C. M., Emanuelli, B., & Kahn, C. R. (2006). Critical nodes in signalling pathways:
insights into insulin action. Nature reviews Molecular cell biology, 7(2), 85-96.

Zeng, N., Yang, K. T., Bayan, J. A., He, L., Aggarwal, R., Stiles, J. W., ... & Al-‐Abdullah, I. (2013).
PTEN controls β -‐cell regeneration in aged mice by regulating cell cycle inhibitor
p16ink4a. Aging cell, 12(6), 1000-1011.

Hennessy, B. T., Smith, D. L., Ram, P. T., Lu, Y., & Mills, G. B. (2005). Exploiting the PI3K/AKT
pathway for cancer drug discovery. Nature reviews Drug discovery, 4(12), 988-1004.

Osaki, M., Oshimura, M. A., & Ito, H. (2004). PI3K-Akt pathway: its functions and alterations in
human cancer. Apoptosis, 9(6), 667-676.

Cross, D. A., Alessi, D. R., Cohen, P., Andjelkovich, M., & Hemmings, B. A. (1995). Inhibition
of glycogen synthase kinase-3 by insulin mediated by protein kinase B. Nature, 378(6559), 785-
789.

47

Datta, S. R., Dudek, H., Tao, X., Masters, S., Fu, H., Gotoh, Y., & Greenberg, M. E. (1997). Akt
phosphorylation of BAD couples survival signals to the cell-intrinsic death machinery. Cell, 91(2),
231-241.

del Peso, L., González-Garcı́a, M., Page, C., Herrera, R., & Nuñez, G. (1997). Interleukin-3-
induced phosphorylation of BAD through the protein kinase Akt. Science, 278(5338), 687-689.

Evan, G. I., & Vousden, K. H. (2001). Proliferation, cell cycle and apoptosis in
cancer. Nature, 411(6835), 342-348.

Mayo, L. D., & Donner, D. B. (2001). A phosphatidylinositol 3-kinase/Akt pathway promotes
translocation of Mdm2 from the cytoplasm to the nucleus.Proceedings of the National Academy
of Sciences, 98(20), 11598-11603.

Zhou, B. P., Liao, Y., Xia, W., Zou, Y., Spohn, B., & Hung, M. C. (2001). HER-2/neu induces
p53 ubiquitination via Akt-mediated MDM2 phosphorylation. Nature cell biology, 3(11), 973-982.

Datta, S. R., Brunet, A., & Greenberg, M. E. (1999). Cellular survival: a play in three Akts. Genes
& development, 13(22), 2905-2927.

Garofalo, R. S., Orena, S. J., Rafidi, K., Torchia, A. J., Stock, J. L., Hildebrandt, A. L., ... &
McNeish, J. D. (2003). Severe diabetes, age-dependent loss of adipose tissue, and mild growth
deficiency in mice lacking Akt2/PKB β. The Journal of clinical investigation, 112(2), 197-208.

48

Muller, D., Huang, G. C., Amiel, S., Jones, P. M., & Persaud, S. J. (2006). Identification of Insulin
Signaling Elements in Human β -Cells Autocrine Regulation of Insulin Gene
Expression. Diabetes, 55(10), 2835-2842.

Holst, L. S., Mulder, H., Manganiello, V., Sundler, F., Ahrén, B., Holm, C., & Degerman, E.
(1998). Protein kinase B is expressed in pancreatic β cells and activated upon stimulation with
insulin-like growth factor I. Biochemical and biophysical research communications, 250(1), 181-
186.

Chen, W. S., Xu, P. Z., Gottlob, K., Chen, M. L., Sokol, K., Shiyanova, T., ... & Kadowaki, T.
(2001). Growth retardation and increased apoptosis in mice with homozygous disruption of the
Akt1 gene. Genes & development, 15(17), 2203-2208.

Cho, H., Thorvaldsen, J. L., Chu, Q., Feng, F., & Birnbaum, M. J. (2001). Akt1/PKB α is required
for normal growth but dispensable for maintenance of glucose homeostasis in mice. Journal of
Biological Chemistry, 276(42), 38349-38352.

Easton, R. M., Cho, H., Roovers, K., Shineman, D. W., Mizrahi, M., Forman, M. S., ... & Ludwig,
T. (2005). Role for Akt3/protein kinase B γ in attainment of normal brain size. Molecular and
cellular biology, 25(5), 1869-1878.

49

Tschopp, O., Yang, Z. Z., Brodbeck, D., Dummler, B. A., Hemmings-Mieszczak, M., Watanabe,
T., ... & Hemmings, B. A. (2005). Essential role of protein kinase B γ (PKB γ/Akt3) in postnatal
brain development but not in glucose homeostasis. Development, 132(13), 2943-2954.

Yang, Z. Z., Tschopp, O., Hemmings-Mieszczak, M., Feng, J., Brodbeck, D., Perentes, E., &
Hemmings, B. A. (2003). Protein kinase B α/Akt1 regulates placental development and fetal
growth. Journal of Biological Chemistry,278(34), 32124-32131.

Cho, H., Mu, J., Kim, J. K., Thorvaldsen, J. L., Chu, Q., Crenshaw, E. B., ... & Birnbaum, M. J.
(2001). Insulin resistance and a diabetes mellitus-like syndrome in mice lacking the protein kinase
Akt2 (PKB β). Science,292(5522), 1728-1731.

Garofalo, R. S., Orena, S. J., Rafidi, K., Torchia, A. J., Stock, J. L., Hildebrandt, A. L., ... &
McNeish, J. D. (2003). Severe diabetes, age-dependent loss of adipose tissue, and mild growth
deficiency in mice lacking Akt2/PKB β. The Journal of clinical investigation, 112(2), 197-208.

Buzzi, F., Xu, L., Zuellig, R. A., Boller, S. B., Spinas, G. A., Hynx, D., ... & Niessen, M. (2010).
Differential effects of protein kinase B/Akt isoforms on glucose homeostasis and islet
mass. Molecular and cellular biology, 30(3), 601-612.

Bernal-Mizrachi, E., Wen, W., Stahlhut, S., Welling, C. M., & Permutt, M. A. (2001). Islet β cell
expression of constitutively active Akt1/PKB α induces striking hypertrophy, hyperplasia, and
hyperinsulinemia. The Journal of clinical investigation, 108(11), 1631-1638.

50

Fatrai, S., Elghazi, L., Balcazar, N., Cras-Méneur, C., Krits, I., Kiyokawa, H., & Bernal-Mizrachi,
E. (2006). Akt induces β-cell proliferation by regulating cyclin D1, cyclin D2, and p21 levels and
cyclin-dependent kinase-4 activity.Diabetes, 55(2), 318-325.

Kushner, J. A. (2013). The role of aging upon β cell turnover. The Journal of clinical
investigation, 123(3), 990-995.

Finegood, D. T., Scaglia, L., & Bonner-Weir, S. (1995). Dynamics of β-cell mass in the growing
rat pancreas: estimation with a simple mathematical model. Diabetes, 44(3), 249-256.

Perl, S., Kushner, J. A., Buchholz, B. A., Meeker, A. K., Stein, G. M., Hsieh, M., ... & Tisdale, J.
F. (2010). Significant human β-cell turnover is limited to the first three decades of life as
determined by in vivo thymidine analog incorporation and radiocarbon dating. The Journal of
Clinical Endocrinology & Metabolism, 95(10), E234-E239.

Meier, J. J., Butler, A. E., Saisho, Y., Monchamp, T., Galasso, R., Bhushan, A., ... & Butler, P. C.
(2008). β-cell replication is the primary mechanism subserving the postnatal expansion of β-cell
mass in humans. Diabetes,57(6), 1584-1594.

Saisho, Y., Butler, A. E., Manesso, E., Elashoff, D., Rizza, R. A., & Butler, P. C. (2013). β-Cell
Mass and Turnover in Humans Effects of obesity and aging.Diabetes care, 36(1), 111-117.

51

Gregg, B. E., Moore, P. C., Demozay, D., Hall, B. A., Li, M., Husain, A., ... & Rhodes, C. J. (2012).
Formation of a human β-cell population within pancreatic islets is set early in life. The Journal
of Clinical Endocrinology & Metabolism, 97(9), 3197-3206.

Rankin, M. M., & Kushner, J. A. (2009). Adaptive β-cell proliferation is severely restricted with
advanced age. Diabetes, 58(6), 1365-1372.

Wang, L., Liu, Y., Lu, S. Y., Nguyen, K. T. T., Schroer, S. A., Suzuki, A., ... & Woo, M. (2010).
Deletion of Pten in pancreatic β-cells protects against deficient β-cell mass and function in
mouse models of type 2 diabetes.Diabetes, 59(12), 3117-3126.

Teta, M., Long, S. Y., Wartschow, L. M., Rankin, M. M., & Kushner, J. A. (2005). Very slow
turnover of β-cells in aged adult mice. Diabetes, 54(9), 2557-2567.

Wan, M., Easton, R. M., Gleason, C. E., Monks, B. R., Ueki, K., Kahn, C. R., & Birnbaum, M. J.
(2011). Loss of Akt1 in mice increases energy expenditure and protects against diet-induced
obesity. Molecular and cellular biology, MCB-05806.

Donath, M. Y., & Halban, P. A. (2004). Decreased beta-cell mass in diabetes: significance,
mechanisms and therapeutic implications. Diabetologia, 47(3), 581-589.

Kahn, S. E. (2001). The importance of β-cell failure in the development and progression of type
2 diabetes. The Journal of Clinical Endocrinology & Metabolism, 86(9), 4047-4058.

52

Bonner-Weir, S. (2000). Life and death of the pancreatic β cells. Trends in Endocrinology &
Metabolism, 11(9), 375-378.

Kulkarni, R. N., Brüning, J. C., Winnay, J. N., Postic, C., Magnuson, M. A., & Kahn, C. R. (1999).
Tissue-specific knockout of the insulin receptor in pancreatic β cells creates an insulin secretory
defect similar to that in type 2 diabetes. Cell, 96(3), 329-339.

Kido, Y., Burks, D. J., Withers, D., Bruning, J. C., Kahn, C. R., White, M. F., & Accili, D. (2000).
Tissue-specific insulin resistance in mice with mutations in the insulin receptor, IRS-1, and IRS-
2. The Journal of clinical investigation,105(2), 199-205.

Withers, D. J., Gutierrez, J. S., Towery, H., Burks, D. J., Ren, J. M., Previs, S., ... & Bonner-Weir,
S. (1998). Disruption of IRS-2 causes type 2 diabetes in mice. Nature, 391(6670), 900-904.

Xuan, S., Kitamura, T., Nakae, J., Politi, K., Kido, Y., Fisher, P. E., ... & Accili, D. (2002).
Defective insulin secretion in pancreatic β cells lacking type 1 IGF receptor. The Journal of
clinical investigation, 110(7), 1011-1019.

Kulkarni, R. N., Holzenberger, M., Shih, D. Q., Ozcan, U., Stoffel, M., Magnuson, M. A., & Kahn,
C. R. (2002). β-cell –specific deletion of the Igf1 receptor leads to hyperinsulinemia and glucose
intolerance but does not alter β-cell mass. Nature genetics, 31(1), 111-115.

53

Buteau, J., Foisy, S., Rhodes, C. J., Carpenter, L., Biden, T. J., & Prentki, M. (2001). Protein kinase
C ζ activation mediates glucagon-like peptide-1–induced pancreatic β -cell
proliferation. Diabetes, 50(10), 2237-2243.

Liu, P., Begley, M., Michowski, W., Inuzuka, H., Ginzberg, M., Gao, D., ... & Wan, L. (2014).
Cell-cycle-regulated activation of Akt kinase by phosphorylation at its carboxyl
terminus. Nature, 508(7497), 541.

Liu, P., Wang, Z., & Wei, W. (2014). Phosphorylation of Akt at the C-terminal tail triggers Akt
activation. Cell Cycle, 13(14), 2162-2164.

Fiaschi-Taesch, N. M., Kleinberger, J. W., Salim, F. G., Troxell, R., Wills, R., Tanwir, M., ... &
Stewart, A. F. (2013). Human pancreatic β-cell G1/S molecule cell cycle atlas. Diabetes, 62(7),
2450-2459.

Stiles, B. L., Kuralwalla-Martinez, C., Guo, W., Gregorian, C., Wang, Y., Tian, J., ... & Wu, H.
(2006). Selective deletion of Pten in pancreatic β cells leads to increased islet mass and resistance
to STZ-induced diabetes. Molecular and cellular biology, 26(7), 2772-2781.

Fiaschi-Taesch, N. M., Kleinberger, J. W., Salim, F. G., Troxell, R., Wills, R., Tanwir, M., ... &
Scott, D. K. (2013). Cytoplasmic-Nuclear Trafficking of G1/S Cell Cycle Molecules and Adult
Human β-Cell Replication A Revised Model of Human β-Cell G1/S Control. Diabetes, 62(7),
2460-2470.

54

Tiwari, S., Roel, C., Wills, R., Casinelli, G., Tanwir, M., Takane, K. K., & Fiaschi-Taesch, N. M.
(2015). Early and Late G1/S Cyclins and Cdks Act Complementarily to Enhance Authentic Human
β-Cell Proliferation and Expansion. Diabetes, 64(10), 3485-3498.

Paris, M., Bernard-Kargar, C., Berthault, M. F., Bouwens, L., & Ktorza, A. (2003). Specific and
combined effects of insulin and glucose on functional pancreatic β-cell mass in vivo in adult rats.
Endocrinology, 144(6), 2717-2727.

Heit, J. J., Karnik, S. K., & Kim, S. K. (2006). Intrinsic regulators of pancreatic β -cell
proliferation. Annu. Rev. Cell Dev. Biol., 22, 311-338.

Lee, Y. H., & White, M. F. (2004). Insulin receptor substrate proteins and diabetes. Archives of
pharmacal research, 27(4), 361-370.

Morgensztern, D., & McLeod, H. L. (2005). PI3K/Akt/mTOR pathway as a target for cancer
therapy. Anti-cancer drugs, 16(8), 797-803.

Kulkarni, R. N., Winnay, J. N., Daniels, M., Brüning, J. C., Flier, S. N., Hanahan, D., & Kahn, C.
R. (1999). Altered function of insulin receptor substrate-1–deficient mouse islets and cultured β-
cell lines. The Journal of clinical investigation, 104(12), R69-R75.

55

Withers, D. J., Burks, D. J., Towery, H. H., Altamuro, S. L., Flint, C. L., & White, M. F. (1999).
Irs-2 coordinates Igf-1 receptor-mediated β-cell development and peripheral insulin signalling.
Nature genetics, 23(1), 32-40.

Kitamura, T., Kahn, C. R., & Accili, D. (2003). Insulin receptor knockout mice. Annual review of
physiology, 65(1), 313-332.

Duvillié, B., Cordonnier, N., Deltour, L., Dandoy-Dron, F., Itier, J. M., Monthioux, E., ... &
Bucchini, D. (1997). Phenotypic alterations in insulin-deficient mutant mice. Proceedings of the
National Academy of Sciences, 94(10), 5137-5140.

Nandi, A., Kitamura, Y., Kahn, C. R., & Accili, D. (2004). Mouse models of insulin resistance.
Physiological reviews, 84(2), 623-647.

Brachmann, S. M., Ueki, K., Engelman, J. A., Kahn, R. C., & Cantley, L. C. (2005).
Phosphoinositide 3-kinase catalytic subunit deletion and regulatory subunit deletion have opposite
effects on insulin sensitivity in mice. Molecular and Cellular Biology, 25(5), 1596-1607.

Abstract (if available)

Abstract Pancreatic beta cells are key regulators of glucose homeostasis by producing insulin. AKT1 is an important molecule of PI3K/AKT pathway which controls cell proliferation, metabolism and survival. Previous reports have already shown that Pten deletion could increase beta cell regeneration which would decrease in an age-dependent manner. The current study will investigate if this effect is achieved through the downstream molecule AKT1 in aging condition. ❧ Global Akt1 knockout mice model were kept in normal chow condition for more than 12 months. The islet mass was significantly decreased compared with wild type mice. Using IHC, I determined that the decrease of cell proliferation is the main contribution to islet mass decrease rather than apoptosis increase. Using in vitro INS1 cell model, I further elucidate the function of AKT1 in control of cell regeneration. Significantly higher percentage of Akt1 knockout cells arrested in S phase compared with wild type cells. In addition, western blotting was performed to detected the protein level change of cell cycle regulators. I found that cyclin E level was decreased in Akt1 knockout cells which is correspond to the S phase arrest. In conclusion, AKT1 is involved in maintaining beta cell mass likely by controlling S phase entry. Lack of beta cell proliferation in mice lacking Akt1 decreases the beta cell mass in old age with high risk of diabetes.

Linked assets

University of Southern California Dissertations and Theses

Conceptually similar

PDF

Protein kinase Bα (AKT1) but not protein kinase Bβ (AKT2) controls pancreatic β cell growth and survival

PDF

PTEN loss antagonizes aging through promoting regeneration and prevents oxidative stress induced cell death

PDF

Pten regulates beta-cell regeneration intrinsically and independently of development

PDF

Short term high fat diet (HFD) stimulates β cell proliferation through mTOR while the prolonged treatment induces β cell senescence via p27

PDF

AKT exhibits isoform-specific function in hepatocyte transformation and response to cellular stress

PDF

Pten deletion in adult pancreatic beta-cells induces cell proliferation and G1/S cell cycle progression

PDF

PI3K/AKT signaling and the regulation of the mitochondrial energy-redox axis

PDF

Towards DNA-directed assembly of pMHC multimers for detection of low-affinity T cells

PDF

Steatosis induces Wnt/β-catenin pathway to stimulate proliferation of hepatic tumor initiating cells and promote liver cancer development

PDF

The regulation of fatty acid oxidation by estrogen related receptor alpha

PDF

Inhibition of NR3B1 attenuates the progression of NAFLD and NASH in liver-specific Pten knockout mice

PDF

Regulation of mitochondrial bioenergetics via PTEN (phosphatase and tensin homolog deleted on chromosome 10)/estrogen-related receptor alpha (ERRα) signaling

PDF

Pro-inflammatory Kupffer cells secrete CXCL5 to promote liver cancer

PDF

Mitochondrial dynamics regulate Leydig cell health and integrity

PDF

MAO a deficient mice exhibit an altered immune system in the brain and prostate

PDF

Molecular mechanism of transforming growth factor-beta signaling in skin wound healing

PDF

The mitochondrial energy – redox axis in aging and caloric restriction: role of nicotinamide nucleotide transhydrogenase

PDF

Mechanisms that dictate beta cells’ response to stress in the context of genetic mutation, pregnancy, and infection

Asset Metadata

Creator Fei, Fan (author)

Core Title Akt1 deletion decrease proliferation in aged pancreatic beta-cells by arresting cell cycle in S phase

School School of Pharmacy

Degree Master of Science

Degree Program Molecular Pharmacology and Toxicology

Publication Date 04/20/2016

Defense Date 04/19/2016

Publisher University of Southern California (original), University of Southern California. Libraries (digital)

Tag aged pancreatic beta cell,cycle cell regulation,OAI-PMH Harvest,PI3K/AKT signaling pathway

Format application/pdf (imt)

Language English

Contributor Electronically uploaded by the author (provenance)

Advisor Stiles, Bangyan (committee chair), Okamoto, Curtis T. (committee member), Xie, Jianming (committee member)

Creator Email feifanqhq@gmail.com,ffei@usc.edu

Permanent Link (DOI) https://doi.org/10.25549/usctheses-c40-234466

Unique identifier UC11279481

Identifier etd-FeiFan-4312.pdf (filename),usctheses-c40-234466 (legacy record id)

Legacy Identifier etd-FeiFan-4312.pdf

Dmrecord 234466

Document Type Thesis

Format application/pdf (imt)

Rights Fei, Fan

Type texts

Source University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Access Conditions The author retains rights to his/her dissertation, thesis or other graduate work according to U.S. copyright law. Electronic access is being provided by the USC Libraries in agreement with the a...

Repository Name University of Southern California Digital Library

Repository Location USC Digital Library, University of Southern California, University Park Campus MC 2810, 3434 South Grand Avenue, 2nd Floor, Los Angeles, California 90089-2810, USA