University of Southern California Dissertations and Theses

Viral and cellular N⁶-methyladenosine and N⁶,2'-O-dimethyladenosine epitranscriptomes in the Kaposi’s sarcoma‐associated herpesvirus life cycle

(USC Thesis Other)

Viral and cellular N⁶-methyladenosine and N⁶,2'-O-dimethyladenosine epitranscriptomes in the Kaposi’s sarcoma‐associated herpesvirus life cycle

PDF

Download

Open document

Flip pages

Download a page range

Download transcript

Copy asset link

Request this asset

Transcript (if available)

Content

VIRAL AND CELLULAR N
6
-METHYLADENOSINE AND
N
6
,2′-O-DIMETHYLADENOSINE EPITRANSCRIPTOMES IN THE
KAPOSI’S SARCOMA-ASSOCIATED HERPESVIRUS LIFE CYCLE

by

Brandon Jiann Hann Tan

A Dissertation Presented to the
FACULTY OF THE USC GRADUATE SCHOOL
UNIVERSITY OF SOUTHERN CALIFORNIA
In Partial Fulfillment of the
Requirements for the Degree
DOCTOR OF PHILOSOPHY
(MEDICAL BIOLOGY)

May 2018

Copyright 2018 Brandon Jiann Hann Tan

ACKNOWLEDGEMENTS
In pursuit of this degree, I relied on the love, encouragement, and trust from many. With
my deepest gratitude, I would like to acknowledge the thoughts and actions of those who have
guided me for the past five years.
To my mom, dad, and sister for their patience and words of love, showing me that family
is never far away despite being 16-time zones apart. Thank you for reminding me to watch my
physical and mental health so I could return to fight the next day.
To my mentor, Dr. Shou-Jiang Gao for believing in my potential as a young student
while providing constant guidance and support when I was doubtful. I have learnt much from
you and I seek to emulate your thoughtful foresight and dedication in my professional career.
To my bioinformatics collaborators, Dr. Hui Liu, Dr. Lin Zhang, Dr. Xiaodong Cui, Dr.
Songyao Zhang, Dr. Jia Meng and Dr. Yufei Huang for their unwavering commitment to the
project.
To my thesis committee members Dr. Michael Stallcup and Dr. James Ou for their advice
and critical reading of this thesis.
To my colleagues in Dr. Shou-Jiang Gao’s laboratory for the great camaraderie that made
those long days go by quicker.
To my stateside support team of friends, especially my fiancé Yao and her family for
believing and supporting my ambitions.

TABLE OF CONTENTS

ABSTRACT .................................................................................................................................... 1
CHAPTER 1: INTRODUCTION ................................................................................................... 2
N
6
-methyladenosine is the most abundant internal messenger RNA modification .................... 2
Next generation sequencing unravels the m
6
A epitranscriptome ................................................ 3
Cellular m
6
A machinery .............................................................................................................. 6
Regulation of replication of RNA viruses by m
6
A ................................................................... 10
HIV ............................................................................................................................................ 11
Flaviviruses ............................................................................................................................... 12
Influenza A virus ....................................................................................................................... 13
m
6
A in the lifecycle of Kaposi’s sarcoma-associated herpesvirus ............................................ 14
CHAPTER 2: RESULTS .............................................................................................................. 16
Viral latent transcripts are marked with m
6
A/m........................................................................ 16
Most KSHV transcripts are methylated during viral lytic replication ...................................... 22
YTHDF2 inhibits KSHV lytic replication by promoting degradation of viral transcripts........ 26
Cellular m
6
A/m epitranscriptome is reprogrammed during KSHV latent infection ................. 34
KSHV lytic replication induces dynamic changes in cellular m
6
A/m epitranscriptome .......... 44
CHAPTER 3: DISCUSSION ........................................................................................................ 49
CHAPTER 4: METHODS ............................................................................................................ 55
Cell culture ................................................................................................................................ 55
Antibodies ................................................................................................................................. 56
Isolation of m
6
A/m RNA fragments.......................................................................................... 57
Preparation of m
6
A/m-seq complementary DNA library .......................................................... 58
Genome annotation ................................................................................................................... 59
m
6
A/m-seq data analysis ........................................................................................................... 59
m
6
Am analysis........................................................................................................................... 60
Gene expression analysis .......................................................................................................... 61
siRNA knockdown .................................................................................................................... 61
RT-qPCR for gene expression and MeRIP-qPCR for m
6
A/m-seq validation .......................... 62
Western blotting analysis .......................................................................................................... 65
Measurement of transcript half-life ........................................................................................... 66
RIP-qPCR .................................................................................................................................. 66
Pathway analysis ....................................................................................................................... 67

Statistical analyses..................................................................................................................... 67
REFERENCES ............................................................................................................................. 68

LIST OF TABLES

Table 1: Comparison of current transcriptome-wide m
6
A profiling techniques ............................. 5
Table 2. Summary of cellular m
6
A/m peaks from three biological replicates of all cell types .... 35

LIST OF FIGURES

Figure 1: Cellular m
6
A machinery and their roles in mRNA metabolism. ..................................... 8
Figure 2. Expression of m
6
A/m-related enzymes in uninfected cells, cells latently infected by
KSHV, and cells induced for lytic replication. ............................................................ 17
Figure 3. KSHV m
6
A/m epitranscriptome during viral latent infection. ...................................... 19
Figure 4. Read tracks and m
6
A/m peaks of the KSHV genome in different cell types from three
biological replicates. ..................................................................................................... 21
Figure 5. KSHV m
6
A/m epitranscriptome during viral lytic replication. ..................................... 24
Figure 6. Effect of YTHDF1, YTHDF3, YTHDC1, or YTHDC2 knockdown on KSHV lytic
replication. .................................................................................................................... 27
Figure 7. Silencing of YTHDF2 enhances KSHV lytic replication. ............................................. 31
Figure 8. mRNA lifetimes of m
6
A/m, m
6
Am and unmethylated transcripts in KiSLK cells treated
with a control siRNA (siCl) or a siRNA to YTHDF2 (siY2-1). .................................. 32
Figure 9. Analyses of conserved and unique methylated cellular genes among four different
uninfected cells. ............................................................................................................ 36
Figure 10. Illustration and validation of selected cellular m
6
A/m peaks in four pairs of uninfected
cells and cells latently infected by KSHV. ................................................................... 37
Figure 11. Reprogramming of cellular m
6
A/m epitranscriptome during KSHV latency. ............ 41
Figure 12. Clustering analysis of different types of cells latently infected by KSHV, and
uninduced and induced KiSLK and BCBL1-R cells. ................................................... 43
Figure 13. Reprogramming of cellular m
6
A/m epitranscriptome during KSHV lytic replication.45
Figure 14. Illustration and validation of selected cellular m
6
A/m peaks in uninduced cells and
cells induced for lytic replication. ................................................................................ 48
Figure 15. Schematic illustration of features of viral and cellular m
6
A/m epitranscriptomes in
KSHV latent and lytic infection, and model of YTHDF2-mediated inhibition of KSHV
lytic replication. ............................................................................................................ 54

LIST OF PUBLICATIONS

Tan B, Liu H, Zhang S, da Silva SR, Zhang L, Meng J, Cui X, Yuan H, Sorel O, Zhang SW,
Huang Y, Gao SJ: Viral and cellular N(6)-methyladenosine and N(6),2'-O-dimethyladenosine
epitranscriptomes in the KSHV life cycle. Nature microbiology 2018, 3:108-20.

Gruffaz M, Vasan K, Tan B, Ramos da Silva S, Gao SJ: TLR4-Mediated Inflammation Promotes
KSHV-Induced Cellular Transformation and Tumorigenesis by Activating the STAT3 Pathway.
Cancer research 2017, 77:7094-108.

He M, Tan B, Vasan K, Yuan H, Cheng F, Ramos da Silva S, Lu C, Gao SJ: SIRT1 and AMPK
pathways are essential for the proliferation and survival of primary effusion lymphoma cells. The
Journal of pathology 2017, 242:309-21.

Yuan H, Tan B, Gao SJ: Tenovin-6 impairs autophagy by inhibiting autophagic flux. Cell death
& disease 2017, 8:e2608.

He M, Yuan H, Tan B, Bai R, Kim HS, Bae S, Che L, Kim JS, Gao SJ: SIRT1-mediated
downregulation of p27Kip1 is essential for overcoming contact inhibition of Kaposi's sarcoma-
associated herpesvirus transformed cells. Oncotarget 2016, 7:75698-711.

Seo GJ, Yang A, Tan B, Kim S, Liang Q, Choi Y, Yuan W, Feng P, Park HS, Jung JU: Akt
Kinase-Mediated Checkpoint of cGAS DNA Sensing Pathway. Cell reports 2015, 13:440-9.

1

ABSTRACT

N
6
-methyladenosine (m
6
A) and N
6
,2'-O-dimethyladenosine (m
6
Am) modifications
(m
6
A/m) of messenger RNA mediate diverse cellular functions. Oncogenic Kaposi's sarcoma-
associated herpesvirus (KSHV) has latent and lytic replication phases that are essential for the
development of KSHV-associated cancers. To date, the role of m
6
A/m in KSHV replication and
tumorigenesis is unclear. Here, we provide mechanistic insights by examining the viral and
cellular m
6
A/m epitranscriptomes during KSHV latent and lytic infection. KSHV transcripts
contain abundant m
6
A/m modifications during latent and lytic replication, and these
modifications are highly conserved among different cell types and infection systems.
Knockdown of the m
6
A ‘reader’ YTHDF2 enhanced lytic replication by impeding KSHV RNA
degradation. YTHDF2 binds to viral transcripts and differentially mediates their stability. KSHV
latent infection induces 5' untranslated region (UTR) hypomethylation and 3'UTR
hypermethylation of the cellular epitranscriptome, regulating oncogenic and epithelial-
mesenchymal transition pathways. KSHV lytic replication induces dynamic reprogramming of
epitranscriptome, regulating pathways that control lytic replication. These results reveal a critical
role of m
6
A/m modifications in KSHV lifecycle and provide rich resources for future
investigations.

2

CHAPTER 1: INTRODUCTION

N
6
-methyladenosine is the most abundant internal messenger RNA modification
More than 100 post-transcriptional chemical modifications are present on RNA from all
kingdoms of life. Most of these modifications are found on ribosomal RNA (rRNA) and transfer
RNA (tRNA), which modulate their structures and functions, and hence translation as they are
accessory molecules in these processes [1]. Messenger RNA (mRNA), which is primarily an
information bearing molecule, is also post-transcriptionally modified albeit with fewer types of
modifications compared to other RNA species [1]. Early studies on mRNA modifications
revealed that N
6
-methyladenosine (m
6
A) was the most abundant internal modification on poly(A)
RNA in hepatoma cells and mouse myeloma cells [2-4]. m
6
A was subsequently detected in both
adenovirus and influenza A virus (IAV) with an average of three m
6
A modifications per viral
mRNA in IAV, a level which is similar to that of cellular m
6
A [5-7].
Further studies in the 1970s-80s detected m
6
A in the RNA of human cancer cell lines,
mouse white blood cells, bovine mRNA, mosquito cells, and in a variety of viruses that replicate
in the nucleus such as herpes simplex virus type 1 (HSV-1), Rous sarcoma virus (RSV), simian
virus 40 (SV40), B77 avian sarcoma virus, and feline leukemia virus [3, 4, 8-28]. These early
studies showed that viral transcripts contain m
6
A levels similar compared to cellular RNA. Two
studies mapped a cluster of seven m
6
A bases on the src and env coding regions of RSV RNA at
the single nucleotide level and revealed that each site was heterogeneously methylated,
indicating different stoichiometry for each m
6
A site. These results suggested potential host-
pathogen interactions that converge on viral RNA [9, 18]. It was also revealed that in cells
infected by adenovirus, viral nuclear pre-mRNA had a higher level of m
6
A than viral
3

cytoplasmic mRNA (2.5 vs 1.5 m
6
A bases/transcript), hinting that either m
6
A located in intronic
regions are lost during splicing or m
6
A methylation of mRNA is a dynamic process [6, 7]. Since
these early studies did not map m
6
A at the transcriptome-wide level, and no knowledge of the
methyltransferases, demethylases, or m
6
A-binding proteins was available, the function of m
6
A
remained elusive for decades. Nevertheless, results of these studies have pointed to potential
important roles of m
6
A in the lifecycle of RNA and DNA viruses, which will be the focus of the
current review.

Next generation sequencing unravels the m
6
A epitranscriptome
Transcriptome-wide mapping of m
6
A was unavailable until N
6
-methyladenosine-
sequencing (m
6
A-seq) was published by two independent groups in 2012 [29, 30]. In this
technique, total RNA or poly(A)-selected RNA was isolated from the cells and fragmented to
~100 nucleotides. Then, an m
6
A-specific antibody was used to pull down the fragmented RNA
followed by deep sequencing of the immunoprecipitated and input fractions. m
6
A peaks on the
transcripts were determined by comparing immunoprecipitated and input reads. Both studies
found that m
6
A on cellular mRNA was enriched in the 3’UTR and with RRm
6
ACH motifs. As
an epitranscriptomic mark, m
6
A was found on orthologous genes in both human and mouse cell
lines [29]. Analysis of methylated genes revealed enrichments of pathways related to RNA
metabolism, transcriptional regulation, splicing, and developmental pathways [29, 30]. One
difference between these two studies was that m
6
A was found to be enriched at the 5’UTR near
the transcription start site in the Dominissini et al. study but not in the Meyer et al. study. This
difference was attributed to different peak calling methods but it could also be due to the
limitation in m
6
A-seq, which is unable to distinguish m
6
A from another RNA modification,
4

N
6
,2’-O-dimethyladenosine (m
6
Am) mostly found on the first few nucleotides of mRNA [29,
31]. Due to the resolution of m
6
A-seq, which is limited to 100-200 nucleotides, clusters of m
6
A
within 200 nucleotides cannot be sufficiently resolved.
Since then, other techniques have been invented to overcome the limitations of m
6
A-seq
(Table 1). One of them called photo-crosslinking-assisted m
6
A-sequencing (PA-m
6
A-seq) which
is involved with UV-crosslinking the anti-m
6
A antibody to poly(A) RNA from cells grown in
media containing the photoactivatable ribonucleosides, 4-thiouridine (4SU) or 6-thioguanosine
(6SG), enhancing the resolution to ~23 nucleotides [32]. A few months later, a technique called
m
6
A individual-nucleotide-resolution cross-linking and immunoprecipitation (miCLIP) was
published, which enabled transcriptome-wide mapping of m
6
A or m
6
Am at single nucleotide
resolution [33]. This technique improved on previous techniques by UV-crosslinking the anti-
m
6
A antibody to RNA and then digesting all but a small part of the antibody in contact with the
RNA using proteinase K. The remaining antibody fragment caused mutations during the
preparation of sequencing library, resulting in an antibody-dependent mutational signature or a
truncation in sequencing reads close to m
6
A or m
6
Am sites. The truncations allow this technique
to differentiate between m
6
A and m
6
Am. In contrast to m
6
A, m
6
Am does not contain the
RRm
6
ACH motif; instead it is present around BCA motifs and mainly in the 5’UTR. Another
technique, m
6
A-level and isoform-characterization sequencing (m
6
A-LAIC-seq), enables the
quantification of the stoichiometry and identification of isoforms of methylated transcripts by
using excess anti-m
6
A antibody to pull down full length RNA [34]. Deep sequencing of the pull
down and flow-through fractions enable quantification of methylated vs unmethylated transcripts
at the transcriptome-wide level, without site-specific mapping of m
6
A. They found diversity in
m
6
A stoichiometry among different cell types, and that methylation influences the choice of
5

alternative polyadenylation sites. Another group capitalized on m
6
A’s slight interference on A-
T/A-U base pairing and developed a tiling microarray technique to detect m
6
A [35]. Tiling RNA
or DNA probes of 25 nucleotides in length complementary to the RNA sequences of interest
were constructed and hybridized to the target RNA. This technique avoids the biases introduced
by antibody-based techniques. However, it is less sensitive compared to the antibody-based
techniques.
Using the modern techniques outlined above, evidence of dynamic regulation of the m
6
A
epitranscriptome has been shown during DNA damage [36], heat shock [37, 38], response to
interferon-γ, stem cell differentiation [39-42], spermatogenesis and oogenesis [43-47], yeast
sporulation [48], circadian rhythm [49], and plant development [50-52]. In the remaining part of
this review, we discuss the regulation of viral replication of RNA and DNA viruses by m
6
A.

Table 1: Comparison of current transcriptome-wide m
6
A profiling techniques
Technique Description Advantages Disadvantages References
m
6
A-seq Immunoprecipitation of
fragmented RNA with
an anti-m
6
A antibody
followed by deep
sequencing.
High
sensitivity,
widely-
adopted.
Resolution at 100-200
nucleotides;
Does not discriminate
between m
6
A and
m
6
Am;
False positives due to
non-specific antibody
interactions.
[29, 30]
PA-m
6
A-
seq
Cells grown in 4SU or
6SG followed by UV-
crosslinking of isolated
RNA to an anti-m
6
A
antibody. Mutations
generated during
library preparation
offer improved
resolution over m
6
A-
seq.
~23
nucleotide
resolution.
Incorporation of 4SU or
6SG requires live cells;
Does not discriminate
between m
6
A and
m
6
Am;
False positives due to
non-specific antibody
interactions.
[32]
6

miCLIP UV-crosslinking of an
anti-m
6
A antibody to
RNA during the
immunoprecipitation
step results in
mutations or
truncations during the
preparation of
sequencing library;
Detecting precise
location of m
6
A/m
6
Am.
Single
nucleotide
resolution;
Can
distinguish
between m
6
A
and m
6
Am.
Mutational signature is
dependent on antibody
type;
False positives due to
non-specific antibody
interactions.
[33]
m
6
A-
LAIC-seq
Full-length RNA is
immunoprecipitated
with excess anti-m
6
A
antibody followed by
sequencing of
immunoprecipitated
and flow-through
fractions.
Identifies
stoichiometry
of m
6
A and
methylated
vs
unmethylated
isoforms.
Since full-length
transcripts are used, site-
specific detection of
m
6
A is not possible.
[34]
Microarray A tiling array of
RNA/DNA probes of
25 nucleotides
complementary to
RNA of interest is
generated. m
6
A
disrupts A-T or A-U
base pairing, resulting
in weaker hybridization
with the probe.
Free from
non-specific
interactions
of antibody-
based
methods.

Low sensitivity. [35]

Cellular m
6
A machinery
The cellular machinery driving the m
6
A dynamics can be divided into four main groups:
methyltransferases or ‘writers’, demethylases or ‘erasers’, m
6
A-binding proteins or ‘readers’, and
m
6
A-repelled proteins or ‘anti-readers’ (Fig. 1). In humans, the m
6
A writer is a large, nearly 1
mega-Dalton complex, however, only a few subunits have been identified to date - METTL3,
METTL14, WTAP, KIAA1429, RBM15, and RBM15B [53-58]. Of these subunits, METTL3
and METTL14 contain domains of methyltransferase but only METTL3 is catalytically active.
METTL14 forms a heterodimer with METTL3, which plays a role in substrate recognition [59,
7

60]. WTAP, KIAA1429, RBM15 and RBM15B function as regulatory subunits for this complex
and are likely involved in the selective methylation of m
6
A sites [56, 58]. Depletion of WTAP or
KIAA1429 in the cell results in a decrease in the amount of m
6
A in the cell, and
RBM15/RBM15B is required for methylation of the long non-coding RNA XIST [56-58]. Since
the RRACH motif is prevalent throughout the transcriptome, it is still not well understood how
specificity for an m
6
A site is achieved under different physiological conditions. Under steady-
state conditions, the methyltransferase complex is localized to the nucleus, however, METTL3 is
also present in the cytoplasm of cancer cells and is associated with eIF3 to enhance translation
[61]. This demonstrates that the localization of METTL3 could be cell type or cell condition
dependent and that it may have other functions in addition to its role as a methyltransferase.

8

Figure 1: Cellular m
6
A machinery and their roles in mRNA metabolism. In steady-state
cells, the methyltransferase complex (‘writers’) and demethylases (‘erasers’) are nuclear
localized and can affect splicing and nuclear export of mRNA. The nuclear reader YTHDC1 has
been implicated in both splicing and nuclear export. In the cytoplasm, YTHDF3 can recruit
either YTHDF1 or YTHDF2 to promote translation or degradation of mRNA, respectively.
YTHDC2 promotes both translation and degradation of mRNA.

9

To date, two m
6
A ‘erasers’ have been characterized. FTO and ALKBH5 are oxygen-,
alpha-ketoglutarate-, and iron-dependent enzymes [47, 62]. Before its function as an ‘eraser’ was
known, a single nucleotide polymorphism (SNP) in the first intron of FTO was shown to be
strongly correlated with obesity [63]. Since it does not affect the protein coding sequence of FTO
and the correlation between the mutant FTO protein and obesity is inconclusive, the mechanism
behind FTO’s effect on obesity remains unknown [64]. Recently, one SNP in the FTO intron was
shown to affect long range DNA-DNA interactions in the promoter of IRX3, resulting in the
increase of IRX3 expression and an obesity phenotype [65]. After its role as a demethylase was
elucidated, FTO was shown to affect global alternative splicing [66] and plays a role in
adipogenesis by regulating the alternative splicing of RUNX1T1 [67]. FTO-deficiency in mouse
models and humans resulted in growth retardation, malformations, metabolic changes and
abnormal neuronal signaling [68-70]. However, it was later reported that FTO preferred
demethylation of m
6
Am over m
6
A in vivo, leaving ALKBH5 as the sole m
6
A demethylase [71].
Knockdown of ALKBH5 in HeLa cells accelerated mRNA export from the nucleus and male
ALKBH5-deficient mice were infertile due to aberrant spermatogenesis [47, 72]. In
spermatocytes, ALKBH5 is essential for the correct splicing of the 3’UTR of transcripts [72].
ALKBH5 also promotes the maintenance of glioblastoma stem-like cells by upregulating
FOXM1 expression [73]. Another study found that ALKBH5 expression was induced during
hypoxia, leading to increased NANOG expression in breast cancer stem cells [74].
Among the ‘reader’ proteins, the YTH-domain family of proteins, YTHDF1, YTHDF2,
YTHDF3, YTHDC1, and YTHDC2 have been most well-studied. YTHDF1 recruits the
translation pre-initiation complex to methylated transcripts to enhance translation [75]; YTHDF2
promotes the degradation of methylated transcripts [76]; YTHDF3 facilitates binding of
10

methylated transcripts to either YTHDF1 or YTHDF2 [77, 78]; YTHDC1 is involved in splicing
and nuclear export [79, 80]; and YTHDC2 affects both translation and degradation of RNA [45,
81]. Recently, two independent studies screened for additional ‘reader’ proteins and
characterized FMR1 as a sequence-context-dependent m
6
A reader that promotes translation of
methylated transcripts [82, 83]. Interestingly, a class of ‘anti-reader’ proteins have been
discovered where they preferentially bind to GGACU motifs in the absence of m
6
A [82, 83].
Two of these proteins, G3BP1 and G3BP2, are stress granule proteins that stabilize unmethylated
transcripts [82, 83].
To date, numerous studies have revealed a role of m
6
A in viral replication by modulating
the levels of ‘writers’, ‘erasers’, and ‘readers’ in cells. As viruses hijack cellular pathways to
favor their replication, it is not surprising that these proteins either promote or inhibit viral
replication, depending on the virus or infected cell type. Conversely, it is also possible that the
host cells use m
6
A and its associated proteins as an antiviral mechanism to restrict viral
replication.

Regulation of replication of RNA viruses by m
6
A
As intracellular parasites, viruses depend on cellular machinery for replication. Since the
‘writers’ and ‘erasers’ are found in the nucleus of resting cells, it is assumed that only viruses
that replicate in the nucleus like HIV, IAV, adenovirus, and HSV-1 can utilize m
6
A in their
lifecycle. Indeed, m
6
A was not detected on the genomes of RNA viruses that replicate in the
cytoplasm such as vesicular stomatitis virus, reovirus, and vaccinia virus in studies done prior to
next generation sequencing [84-86]. However, more recent works with hepatitis C virus (HCV)
11

and liver cancer cell lines have shown that the methylation machinery is present in the cytoplasm
[87].

HIV
Three independent groups have characterized the involvement of m
6
A in HIV replication
using CD4+ T cells, 293T cells, and HeLa cells [88-90]. All three studies showed an enrichment
of m
6
A at the 3’UTR of HIV genomic RNA, but two of the studies showed additional m
6
A sites
throughout the genome [89, 90]. This discrepancy could be due to the different mapping
techniques used. Kennedy et al. used PA-m
6
A-seq whereas the other two studies used m
6
A-seq.
Cell line or HIV strain could also cause variations even though all three studies included CD4+ T
cells. Two of these studies demonstrated a pro-viral role of m
6
A as knockdown of
METTL3/METTL14 or ALKBH5 inhibited or enhanced viral replication, respectively [88, 89].
All three YTHDF proteins were shown to bind to HIV RNA and favor HIV replication [88, 89].
However, the study by Tirumuru et al. showed that all three YTHDF proteins antagonize HIV
replication [90]. The reason for this discrepancy is unclear but could be attributed to the use of a
genetically modified virus that contains a luciferase reporter in its genome. Lichinchi et al. also
characterized the function of two potential m
6
A sites within the Rev response element (RRE) of
HIV. The presence of m
6
A on the RRE enhanced binding of Rev to viral RNA, facilitating
export of viral RNA. However, m
6
A mapping done by the two other studies failed to identify
these m
6
A sites on the RRE. It is possible that the plastic nature of the HIV genome may
contribute to this discrepancy; however, the RRE is a relatively stable region of the HIV genome.
If m
6
A is a positive regulator of HIV replication, it should be evolutionarily conserved in this
polymorphic virus.
12

Flaviviruses
Two independent groups simultaneously published epitranscriptomic maps of m
6
A on
Flaviviral genomes and proposed m
6
A-related mechanisms that regulate the replication of Zika
virus (ZIKV) and HCV [87, 91]. The m
6
A profiles in the genomes of the positive single-stranded
Flaviviruses like HCV, Dengue virus, yellow fever virus, ZIKV, and West Nile virus are
conserved [87]. Knocking down METTL3 or METTL14 in host cells enhanced the viral titers of
HCV and ZIKV. Knockdown of FTO lowered the viral titers of both viruses whereas knockdown
of ALKBH5 had no effect on HCV viral production but lowered ZIKV viral titers in the
supernatants. Since Flaviviruses replicate in the cytoplasm, both studies presented evidence that
the ‘writers’ and ‘erasers’ can be found in the cytoplasm of the host cells. Despite the different
cellular functions of the ‘readers’ YTHDF1, YTHDF2, and YTHDF3, all of them negatively
impact HCV and ZIKV replication. In the context of HCV, Gokhale et al. mapped the binding
sites of YTHDF1, YTHDF2, and YTHDF3 on the viral genome and shown that these proteins
compete with HCV core protein to bind to regions on the Env gene to suppress packaging of
viral RNA into new virions. This suppressive effect was hypothesized by Gokhale et al. to be
advantageous for HCV infection as a slower replication rate reflects chronic infection in the
liver. The study by Lichinchi et al. revealed 5’UTR hypermethylation of host transcripts after
ZIKV infection. In addition, host immune-related transcripts were dynamically modified during
ZIKV infection, indicating that the host cell may be utilizing m
6
A to promote an antiviral
response. It is also possible that the virus utilizes m
6
A to suppress the host antiviral response by
recruiting ‘writers’ or ‘erasers’ to specific cellular transcripts [91]. In contrast to HIV, m
6
A
negatively affects Flavivirus replication by affecting viral packaging.

13

Influenza A virus
Work by Courtney et al. showed that inhibition of methylation with 3-deazaadenosine
(3DAA) and METTL3 knockout A549 lung cancer cells decreased the replication of IAV by
reducing both viral mRNA and protein levels [92]. Contrary to YTHDF2’s role in promoting
RNA degradation, overexpression of YTHDF2 during IAV infection enhanced levels of viral
mRNA, protein, and the release of infectious virions. Overexpression of YTHDF1 and YTHDF3
had no effect on IAV replication and viral production even though all three ‘readers’ were found
to bind to viral RNA. Using PAR-CLIP and PA-m
6
A-seq binding data of YTHDF1, YTHDF2,
and YTHDF3, Courtney et al. found numerous m
6
A sites on the negative sense vRNA and
positive sense mRNA of IAV. They generated two mutant viruses by making silent mutations of
m
6
A sites on the positive and negative sense RNAs of the hemagglutinin segment, respectively.
However, they could not mutate all the m
6
A sites as some could have introduced non-
synonymous mutations of the hemagglutinin protein. These two mutants had decreased levels of
hemagglutinin protein, replication in culture and pathogenicity in a mouse infection model. The
mechanism behind the positive effect of METTL3 or YTHDF2 on IAV replication remains
unknown. The authors also investigated the possibility that methylation of viral RNAs might
prevent the activation of innate immune sensors such as RIG-I or MDA5 but saw no additional
activation of interferon-β when cells were infected with their mutant virions that carried fewer
m
6
A sites. It is possible that YTHDF2 binding to viral RNA sequesters it away from innate RNA
immune sensors, but no loss of function data was shown.
The function of YTHDC1 and YTHDC2 in the lifecycle of RNA viruses has not been
investigated so far. Since splicing is critical for HIV replication, it is likely that YTHDC1 could
be involved in regulating this process to promote HIV replication, which would agree with the
14

pro-viral role of m
6
A in the context of HIV. For Flaviviruses, it is unclear if the nuclear ‘reader’
YTHDC1 is present in the cytoplasm but it is possible since the ‘writers’ and ‘erasers’ are
involved in their cytoplasmic replicative cycles.

m
6
A in the lifecycle of Kaposi’s sarcoma-associated herpesvirus
The role of m
6
A in the lifecycles of RNA viruses have predominantly been investigated
at the genomic RNA level in positive stranded RNA viruses except for IAV, where both negative
stranded genomic RNA and positive stranded mRNA have been investigated. DNA viruses such
as Kaposi’s sarcoma-associated herpesvirus (KSHV), which replicates in the nucleus utilizing
host machinery, is likely to usurp m
6
A machinery to promote its replication.
KSHV is the etiologic agent of Kaposi’s sarcoma, primary effusion lymphoma (PEL),
multicentric Castleman’s disease and KSHV-induced inflammatory cytokine syndrome (KICS)
[93-96]. KSHV latently infects endothelial progenitor cells, B cells, and mesenchymal stem cells
[93, 97-102], however, results of recent studies show that KS might be originated from
mesenchymal stem cells [98, 100, 102]. During viral latency, a few viral genes and a cluster of
miRNA’s are expressed [103-107], which are essential for KSHV-induced cellular
transformation [100, 108, 109]. Like other herpesviruses, KSHV latently infected cells can be
reactivated to a lytic lifecycle, expressing viral lytic genes in a cascade manner transcribing
immediate early, early, and late genes that culminates in virion production [110-112]. Hence,
KSHV lytic replication is a complex process, which is regulated by multiple cellular processes,
possibly including m
6
A and its related machinery.
15

Although most tumor cells are latently infected by KSHV in KS tumors, a small subset of
them also undergo spontaneous lytic replication. These cells secrete viral cytokines such as viral
interleukin 6 (vIL6), and induce pro-inflammatory and proangiogenic cytokines such as IL6,
bFGF, and oncostatin M [113-116]. This cytokine milieu promotes the growth of KS cells via an
autocrine and paracrine mechanism [113]. Another lytic viral protein, vGPCR, promotes the
expression of VEGF to stimulate angiogenesis and survival [117, 118]. Hence, KSHV lytic
replication in a small subset of tumor cells is a key contributor to local inflammation and
angiogenesis, which are the features of KS tumors. Understanding the alterations of viral and
cellular m
6
A modifications during KSHV latent and lytic infection could provide insights into
the mechanism of KSHV-induced tumorigenesis.
In the current study, we have examined both viral and cellular m
6
A epitranscriptomes in
diverse cell types latently infected by KSHV and in KSHV-infected cells undergoing lytic
replication. We have found wide-spread m
6
A modifications on viral transcripts during KSHV
latent and lytic replication. Importantly, YTHDF2 negatively affects KSHV lytic replication by
enhancing decay of viral transcripts. During latent infection, KSHV reprograms cellular m
6
A/m
epitranscriptome preferentially at the 5’ UTR and 3’ UTR resulting in the deregulation of
pathways critical for KSHV latent infection and tumorigenesis. During lytic replication, a subset
of cellular genes that regulate KSHV lytic replication is dynamically methylated. These results
reveal an important role of m
6
A/m in KSHV lifecycle and provide rich resources for further
understanding the molecular basis of KSHV infection and KSHV-induced oncogenesis.

16

CHAPTER 2: RESULTS
Viral latent transcripts are marked with m
6
A/m
To determine the role of m
6
A/m modifications in the KSHV lifecycle, we began by
mapping the KSHV epitranscriptomes in five types of cells latently infected by KSHV using
m
6
A-seq which is referred to as m
6
A/m-seq in this study since it is now known to detect both
m
6
A and m
6
Am (m
6
A/m) [33]. These cell types include a PEL line BCBL1-R stably expressing
doxycycline-inducible replication and transcription activator (RTA); KTIME, a telomerase-
immortalized human microvascular endothelial cell line (TIME) infected by recombinant KSHV
BAC36; KMSC, which are primary human adipose tissue-derived mesenchymal stem cells
(MSC) infected and transformed by BAC36; KMM, which are primary rat metanephric
mesenchymal precursor cells (MM) infected and transformed by BAC36; and KiSLK, a renal
carcinoma cell line stably expressing doxycycline-inducible RTA (iSLK) infected by
recombinant KSHV BAC16.
KSHV infection did not significantly alter the expression levels of transcripts of m
6
A/m
‘writers’, ‘erasers’ and ‘readers’ in four pairs of cell types examined (Fig. 2a). Upregulation at
protein level by KSHV was observed with METTL14, FTO, ALKBH5 and YTHDF2 in iSLK
cells (KiSLK versus iSLK); ALKBH5 and YTHDF1 in TIME cells (KTIME versus TIME); and
YTHDF1 in MSC cells (KMSC versus MSC) (Fig. 2b). All m
6
A/m-related enzymes were also
expressed in latent BCBL1-R cells (Fig. 2c,d). These results indicated that m
6
A/m related
proteins were likely functional in these cells.

17

Figure 2. Expression of m
6
A/m-related enzymes in uninfected cells, cells latently infected by
KSHV, and cells induced for lytic replication. a,b, Transcript (a) and protein (b) levels of
m
6
A/m-related proteins in uninfected cells and cells latently infected by KSHV examined by RT-
qPCR and Western-blotting, respectively. Results are from a single experiment. c,d, Transcript
(c) and protein (d) levels of m
6
A/m-related proteins in KiSLK (left) and BCBL1-R (right) cells
induced for lytic replication examined by RT-qPCR and Western-blotting, respectively. The
experiments were independently repeated two times. RT-qPCR results are presented as mean.
Western-blots from one representative experiment are presented.
18

Only a few KSHV genes, including ORF71 (vFLIP), ORF72 (vCyclin) and ORF73
(LANA), were expressed in KMM, indicating tight viral latency (Fig. 3a). However, robust
spontaneous lytic replication was observed in BCBL1-R cells but to a lesser extent in KiSLK
cells, followed by KTIME and KMSC cells, resulting in reads from lytic transcripts during
latency. Spurious transcripts spanning the ORF17-ORF20 region in KTIME, KMSC and KMM
were likely due to the insertion of a CMV promoter-driven bacterial artificial chromosome
(BAC) cassette containing a GFP gene and a hygromycin resistance gene [119].
We subjected three biological replicates of poly-A purified RNA of each cell type to
m
6
A/m-seq followed by peak calling using the exomePeak package with a stringent peak calling
setting [120]. The results of three biological replicates were highly consistent (Fig. 4). The most
prominent m
6
A/m peaks conserved among all cell types were detected in transcripts of latent
genes with the most enriched region centered in the vCyclin coding region extending into the
LANA C terminus (Fig. 3b, left). Because these latent genes are essential for KSHV latency and
cellular transformation, m
6
A/m modifications in this locus might regulate their expression and
functions. The transcript of tegument protein ORF75, which is essential for lytic replication and
silencing immune surveillance, is also methylated across all cell lines (Fig. 3b, right). It is highly
expressed in KMSC, BCBL1-R and KiSLK cells, but at lower levels in KTIME and KMM cells.
Multiple m
6
A/m peaks are present on ORF75 transcripts in all cell types except KMM cells. The
m
6
A/m peaks on vCyclin and ORF75 transcripts were confirmed by methylated RNA
immunoprecipitation reverse transcription quantitative real-time PCR (MeRIP-qPCR) (Fig. 3c).
Furthermore, vFLIP, vCyclin, LANA and ORF75 transcripts had m
6
A/m peaks conserved across
all five cell types during KSHV latency (Fig. 3d).

19

Figure 3. KSHV m
6
A/m epitranscriptome during viral latent infection. a, Transcriptome-
wide maps of KSHV m
6
A/m-IP reads, input reads and m
6
A/m peaks in KiSLK, BCBL1-R,
KTIME, KMSC and KMM cells latently infected by KSHV. Selected genes containing m
6
A/m
peaks are listed below each track. Reads were normalized to KiSLK for ease of comparison. b,
Enlarged regions of ORF71, ORF72 and ORF73 (left), and ORF75 (right) from a containing the
positions of quantitative PCR amplicons and RRACH motifs. c, Validation of m
6
A/m peaks in
ORF72 and ORF75 by MeRIP-qPCR. Fold enrichment was determined by calculating the fold
change of IP to input Ct values. Experiments were independently repeated three times, and
results are presented as mean ± s.d. from the three experiments. d, Venn diagram showing the
20

overlaps of methylated viral genes in all latently infected cells. qPCR, quantitative real-time
PCR.

21

Figure 4. Read tracks and m
6
A/m peaks of the KSHV genome in different cell types from
three biological replicates. Read tracks indicating IP (red) and input (blue) reads, and m
6
A/m
peaks of the KSHV genome from three biological replicates of KiSLK (latent, 24 h, and 48 h),
BCBL1-R (latent and 48 h), KTIME (latent), KMSC (latent), and KMM (latent) cells.
22

Most KSHV transcripts are methylated during viral lytic replication
We further mapped the KSHV m
6
A/m epitranscriptome during lytic replication.
Treatment with doxycycline efficiently triggers KSHV lytic replication in KiSLK and BCBL1-R
cells [121, 122]. Upon induction of lytic replication, m
6
A/m-related enzymes remained largely
unchanged at both mRNA and protein levels in KiSLK cells; however, they declined at both
mRNA and protein levels in BCBL1-R cells, with ALKBH5, YTHDF1 and YTHDF2 proteins
having the sharpest decreases 24 h after induction (Fig. 2c,d).
Purified mRNA from three biological replicates of lytically induced cells at 24 h and 48 h
from KiSLK cells and at 48 h from BCBL1-R cells was subjected to m
6
A/m mapping. Again, we
observed highly consistent results among three biological replicates (Fig. 4). During viral lytic
replication, transcripts of most KSHV genes were expressed (Fig. 5a) with increase in reads by
76- and 119-fold at 24 h and 48 h, respectively, in KiSLK cells, and by 46-fold at 48 h in
BCBL1-R cells. We detected abundant m
6
A/m peaks on transcripts after lytic induction (Fig. 5a).
First, we observed gains of additional m
6
A/m peaks on vFLIP, vCyclin and LANA latent
transcripts during lytic replication in both KiSLK and BCBL1-R cells, particularly new m
6
A/m
peaks in LANA central and N-terminal regions, which were absent during latency (Fig. 5b). The
latent locus contained many immunoprecipitation (IP) reads spanning its entire region, which
might be due to multiple m
6
A/m bases that could not be sufficiently resolved by this approach.
Second, we examined the RTA locus, which expresses multiple transcripts coding for RTA, an
early protein K8 and a late protein K8.1 (Fig. 5b). Because of the RTA cassette, reads from the
region contained those from the cassette and those endogenously transcribed. m
6
A/m peaks were
23

24

Figure 5. KSHV m
6
A/m epitranscriptome during viral lytic replication. a, Transcriptome-
wide maps of KSHV m
6
A/m-IP reads, input reads and m
6
A/m peaks in KiSLK cells before
(latent) and after induction for lytic replication for 24 h or 48 h, and in BCBL1-R cells before
(latent) and after induction for lytic replication for 48 h. Selected genes containing m
6
A/m peaks
are listed below each track. The latent datasets were reproduced from Fig. 3a for ease of
comparison with the lytic datasets. Reads were normalized to KiSLK latent cells. b, Enlarged
regions of ORF71, ORF72, ORF73, RTA, ORF-K8, ORF-K8.1, ORF-K1, ORF4, ORF6, ORF-
K3, ORF70, ORF8, ORF9, ORF10, ORF11 and ORF57 containing the positions of quantitative
PCR amplicons and RRACH motifs. c, Validation of m
6
A/m peaks by MeRIP-qPCR. Fold
enrichment was determined by calculating the fold change of IP to input Ct values. Experiments
were independently repeated three times, and results are presented as mean ± s.d. from the three
experiments. d, Venn diagrams comparing the number of methylated viral genes before (latent)
and after induction for lytic replication in KiSLK (left) and BCBL1-R (right) cells. e,
Comparison of methylated genes at 48 h after induction for lytic replication between KiSLK and
BCBL1-R cells.
25

detected on the N and C termini and the central region of RTA in lytic KiSLK cells, but only on
the central and C-terminal regions in lytic BCBL1-R cells. Interestingly, the expression of K8.1
was already robust in latent BCBL1-R cells compared to KiSLK cells and was significantly
increased in both lytic BCBL1-R and KiSLK cells. An m
6
A/m peak was detected on the C-
terminal region of K8.1 transcripts. Third, we observed other conserved m
6
A/m peaks between
the two cell lines on transcripts of ORF-K1, ORF4, ORFK3, ORF8, ORF11 and ORF57 (Fig.
5b). Numerous m
6
A/m peaks were cell type specific. For example, the m
6
A/m peak on the ORF6
transcript was present in latent and lytic KiSLK cells but not in BCBL1-R cells. Fourth, all the
selected m
6
A/m peaks were confirmed by MeRIP-qPCR (Fig. 5c).
Compared to latent KiSLK cells, there were significant gains in methylated viral genes in
lytic KiSLK cells, reflecting the increased expression levels of viral genes (Fig. 5d, left). In
contrast, similar methylated viral genes were observed in latent and lytic BCBL1-R cells,
reflecting high spontaneous lytic replication in these latent cells (Fig. 5d, right). Importantly,
most of the methylated viral genes at 48 h lytic replication were conserved between KiSLK and
BCBL1-R cells (Fig. 5e). The abundance of m
6
A/m peaks on viral transcripts during lytic
replication and their conserved nature between two cell types point to an important role of
m
6
A/m modifications in KSHV lytic replication.

26

YTHDF2 inhibits KSHV lytic replication by promoting degradation of viral transcripts
Since the functions of m
6
A/m modifications are executed by the ‘reader’ proteins, we
investigated their roles in KSHV lytic replication. Knockdown of YTHDF1, YTHDC1 or
YTHDC2 had no significant or consistent effect on viral lytic replication (Fig. 6a–c). While
knockdown of YTHDF3 reduced viral lytic replication by 40% and 70% with the two siRNAs,
respectively, examination of viral transcripts and proteins did not yield consistent results (Fig.
6d,e). In contrast, we observed consistent effect of YTHDF2 knockdown on KSHV lytic
replication. Efficient knockdown of YTHDF2 was achieved 2 days after siRNA transfection
(Fig. 7a,b), which consistently led to a fourfold increase in viral production (Fig. 7c).
Accordingly, we observed two- to six-fold increases in RTA, ORF57, ORF-K8 and ORF65 lytic
transcripts (Fig. 7d), which also led to increases in their proteins (Fig. 7e). Overexpression of
YTHDF2 led to decreased viral production and reduced levels of viral proteins (Fig. 7f–h).
RNA-binding protein immunoprecipitation and reverse transcription quantitative real-time PCR
(RIP-qPCR) showed that YTHDF2 strongly bound to RTA, vIL6, ORF-K8 and ORF57 lytic
transcripts and, to lesser extents, LANA, PAN RNA and ORF65 transcripts (Fig. 7i).
Since YTHDF proteins enhance degradation and deadenylation of m
6
A/m-containing
transcripts [76, 123], we examined the half-lives of cellular transcripts with and without
YTHDF2 knockdown. As expected, the presence of m
6
A/m shortened the half-lives of transcripts
(Fig. 8a). Interestingly, YTHDF2 knockdown did not alter the negative effect of m
6
A/m on
mRNA stability, though all the transcripts became more stable (Fig. 8b). Hence, YTHDF2
knockdown increased the half-lives of cellular transcripts (Fig. 8c). These results could be due to
other reader proteins such as YTHDF1, YTHDF3 and YTHDC2, which redundantly mediate
m
6
A/m-dependent mRNA stability [45, 76, 123].
27

Figure 6. Effect of YTHDF1, YTHDF3, YTHDC1, or YTHDC2 knockdown on KSHV lytic
replication. a,b, Examination of knockdown efficiency of each reader by Western-blotting (a)
and RT-qPCR (b) on day 2 post-transfection with the respective siRNA. c, Quantification of
KSHV virions in culture supernatant by qPCR at day 3 after induction of lytic replication. For
YTHDF1 (Y1) and YTHDF1 (Y3), experiments were repeated three times and results are
28

presented as mean +/- SD from the three experiments (b,c). For YTHDC1 (DC1) and YTHDC2
(DC2), experiments were repeated twice and results are presented as mean (b,c). Western-
blotting results are representative results from one experiment (a). d,e, Levels of viral transcripts
(d) and proteins (e) were examined by RT-qPCR and Western-blotting, respectively, at day 3
after induction of lytic replication. Experiments were repeated three times and results are
presented as mean +/- SD from the three experiments. NS = not significant, * p<0.05, ** p<0.01,
*** p<0.001. Western-blotting results are representative results from one experiment (e). Gel
image for Y1 (a) was cropped from a single blot.
29

These reader proteins might compensate its function following YTHDF2 knockdown. Indeed,
the YTHDF proteins have been reported to redundantly mediate the genome stability of several
RNA viruses, including HCV, ZIKA and HIV-1 [87-91]. The fact that we detected a consistent
effect of single knockdown only in YTHDF2 but not other reader proteins on KSHV lytic
replication could be due to its relatively higher expression level in cells [76].
We hypothesized that knockdown of YTHDF2 would prolong the half-lives of viral
transcripts, leading to their accumulation. Indeed, silencing YTHDF2 caused an increase of the
overall half-life of KSHV transcripts (Fig. 7j). Quantitative PCR with reverse transcription (RT-
qPCR) confirmed that the half-lives of LANA, ORF57, ORF59, ORF-K8 and ORF65 transcripts
were increased by an average of ~1.5-fold (Fig. 7k). The half-life of PAN RNA, a long non-
coding RNA localized to the nucleus, was not significantly affected as it might escape YTHDF2-
mediated degradation in the cytoplasm. Examination of transcript stability by transcript class
showed that latent transcripts coding for LANA, vCyclin and vFLIP, and early transcripts coding
for ORF-K8, ORF37 and ORF-K6, had the largest increases in half-life following YTHDF2
knockdown, whereas immediate-early transcripts were least affected (Fig. 7l). Taken together,
our results indicated that YTHDF2 might inhibit KSHV lytic replication by promoting the
degradation of viral lytic transcripts. It is possible that YTHDF2 might act as a cellular defense
mechanism to inhibit viral replication by restricting the expression of viral transcripts.

30

31

Figure 7. Silencing of YTHDF2 enhances KSHV lytic replication. a,b, Knockdown of
YTHDF2 shown at the protein (a) and mRNA (b) levels in KiSLK cells at day 2 post-
transfection of siRNAs. c–e, Quantification of KSHV virions in culture supernatant by qPCR (c),
and levels of viral transcripts (d) and proteins (e) were examined by RT-qPCR and western
blotting, respectively, at day 3 after induction of lytic replication. For virion production, lytic
siCl cells were used as ‘1’ for comparison. Experiments were independently repeated three
times, and results are presented as mean ± s.d. from the three experiments (b–d), except (a,e)
where representative results from one experiment are presented. NS, not significant; *P < 0.05,
**P < 0.01, ***P < 0.001. f, YTHDF2 overexpression in KiSLK cells 2 days after lentiviral
transduction. g,h, KSHV virions in culture supernatant were quantified by qPCR (g) and levels
of viral proteins (h) were examined by western blotting at day 3 after induction of lytic
replication. For virion production, lytic vector cells were used as ‘1’ for comparison.
Experiments were independently repeated three times and results are presented as mean ± s.d.
from the three experiments (g), except (f,h) where representative results from one experiment are
presented. i, KiSLK cells overexpressing Flag-YTHDF2 were induced for lytic replication, and
cell lysate was collected at 48 h to detect YTHDF2 binding of viral RNAs by RIP-qPCR. SON
and MALAT1 are cellular positive and negative controls, respectively. Experiments were
independently repeated twice, and results are presented as mean from the two experiments. j,
Lifetimes of KSHV transcripts were measured in cells transfected with YTHDF2 siRNA (siY2-
1) or a control siRNA (siCl). Results are from two independent experiments. k, Quantification of
levels of viral and cellular transcripts following treatment with actinomycin D at day 3 after
induction of lytic replication in KiSLK cells transfected with an siY2-1 or an siCl. The half-lives
of the transcripts in hours were calculated. Experiments were independently repeated twice, and
32

results are presented as mean ± s.d. from the two experiments. l, Fold changes of KSHV
transcripts in cells transfected with siY2-1 and siCl at 0 h and 16 h post-actinomycin D treatment
sorted by transcript class. Results are from two independent experiments. IE, immediate-early.

Figure 8. mRNA lifetimes of m
6
A/m, m
6
Am and unmethylated transcripts in KiSLK cells
treated with a control siRNA (siCl) or a siRNA to YTHDF2 (siY2-1). a, Cellular mRNA
lifetimes of m
6
A/m, m
6
Am, and unmethylated mRNA in siCl cells. b, Cellular mRNA lifetimes
of m
6
A/m, m
6
Am, and unmethylated mRNA in YTHDF2 knockdown cells. c, mRNA lifetimes
33

of cellular transcripts in siCl and YTHDF2 knockdown cells. Results are from two independent
experiments.
34

Cellular m
6
A/m epitranscriptome is reprogrammed during KSHV latent infection
To determine whether KSHV modulates the cellular epitranscriptome, we examined the
four pairs of uninfected and KSHV latently infected cells (Fig. 2a). We included BCBL1-R
because of its unique B-cell origin representing PEL. The three biological replicates showed
excellent m
6
A/m-seq overlaps (Table 2). First, we compared the uninfected cells and identified
3,233 methylated genes that were conserved among TIME, MSC, MM and iSLK cells,
accounting for about 40–60% of methylated genes in each cell type (Fig. 9). These results are
expected as the m
6
A epitranscriptome is conserved among organisms. An m
6
A/m peak in Dicer1
and another in JunB as well as an unmethylated Dicer1 region conserved among all four cell
types were selected and confirmed by MeRIPqPCR (Fig. 10a,b). Among the three human cell
types, another 2,685 methylated genes (34–35%) were conserved, indicating that over 74–76%
of the methylated genes were conserved among the human cells. MM cells had the highest
number of uniquely methylated genes (1,156), indicating that the effect of species was stronger
than cell type in specifying m
6
A/m methylation pattern. MM and MSC cells also shared many
methylated genes (3,887), which could be attributed to both being primary precursor cells.
Further clustering analysis confirmed the results, and identified conserved and specific m
6
A/m
patterns among these cells (Fig. 10).
Next, we compared the methylated genes among the five latently infected cells. Like the
uninfected cells, 3,042 methylated genes (33–51% of total genes) were conserved among all
types of cells, with more conservation observed among the human cells (5,227 genes or ~56–
72% of total genes) (Fig. 11a). Of the human cells, BCBL1-R cells had 1,329 uniquely
methylated genes compared to 245, 454 and 218 genes in KiSLK, KTIME and KMSC cells,
respectively. Clustering analysis confirmed the results, and identified conserved and specific
35

Table 2. Summary of cellular m
6
A/m peaks from three biological replicates of all cell types

36

Figure 9. Analyses of conserved and unique methylated cellular genes among four different
uninfected cells. a, Venn diagram showing the overlaps of methylated cellular genes in four
types of uninfected cells. b, Cluster analysis of m
6
A/m methylated cellular genes of four types of
uninfected cells. The results are from three biological replicates.

37

Figure 10. Illustration and validation of selected cellular m
6
A/m peaks in four pairs of
uninfected cells and cells latently infected by KSHV. a, Regions of Dicer1 with and without
38

an m
6
A/m peak and JunB containing an m
6
A/m peak with qPCR amplicons indicated. For KMM
and MM cells, no m
6
A/m peak was detected by exomePeak in Dicer1 as the gene was not
annotated by the rn5 rat genome. b, Validation of cellular m
6
A/m peaks shown in (a) by MeRIP-
qPCR. Experiments were independently repeated three times, and results are presented as mean
+/- SD from the three experiments.

39

m
6
A/m patterns among these cells (Fig. 12a). The same m
6
A/m peaks in Dicer1 and JunB were
also confirmed by MeRIP-qPCR (Fig. 10).
We detected the canonical ‘GGAC’ m
6
A motif as the most common motif in both
uninfected and infected cells, indicating that most m
6
A/m peaks were likely m
6
A peaks (Fig.
11b). Because this mapping approach cannot directly identify the m
6
Am peaks, we predicted the
potential m
6
Am peaks as those ‘A’s at the beginning of a transcript, containing the m
6
Am
conserved BCA motif [33], and inside exomePeak predicted peaks. Only 7–20% of the peaks
were predicted to be putative m
6
Am peaks (Fig. 11c).
Because we could not precisely map and distinguish m
6
A and m
6
Am motifs, we analyzed
the overall m
6
A/m methylated genes without separating both types of peaks. Most methylated
genes in uninfected cells remained methylated in KSHV-infected cells (Fig. 11d). Surprisingly,
among the small number of differentially methylated genes, most occurred in 5′ UTR and 3′
UTR (Fig. 11e). We detected a loss of 5′ UTR methylation and a slight gain of 3′ UTR
methylation following KSHV infection in KiSLK, KMSC and KMM cells. The distributions of
m
6
A/m in KTIME cells were different from other cells, possibly reflecting their untransformed
state. Hence, we focused further analyses on KiSLK, KMSC and KMM cells. Most 5′ UTR
hypomethylated and 3′ UTR hypermethylated genes were unique (Fig. 11f), indicating that
m
6
A/m might affect expression or translation of these two groups of genes by different
mechanisms. Pathway analysis identified 12 conserved pathways that were 5′ UTR
hypomethylated and one conserved pathway that was 3′ UTR hypermethylated across all three
pairs of cell types (Fig. 11g). However, it was obvious that KMSC and KMM cells shared more
common 5′ UTR hypomethylated pathways compared to KiSLK cells. KMSC and KMM are
primary cells transformed by KSHV, which are excellent models for studying KSHV-induced
40

oncogenesis [100, 102]. Indeed, the top 5′ UTR hypomethylated and 3′ UTR hypermethylated
pathways in both KMM versus MM and KMSC versus MSC were broadly related to
oncogenic/mitogenic signaling, cytoskeleton and extracellular signaling, endocytosis, loss of
contact inhibition, remodeling of adherens junction and cellular adhesion/invasion, all of which
have been implicated in KSHV latency and cellular transformation (Fig. 11h). These findings
indicated that m
6
A/m modifications might mediate cellular pathways implicated in KSHV-
induced cellular transformation. We did not find any correlation of the extent and site of
methylation (5′ UTR versus 3′ UTR) with gene expression, suggesting that m
6
A/m might
mediate post-transcriptional gene regulation such as splicing, nuclear export or translation.
We investigated the role of m
6
Am in the deregulation of cellular pathways during KSHV
latency because of its presence at the start of transcripts, which might contribute to the 5′ UTR
hypomethylation. The ratios of the predicted m
6
Am hypermethylated to hypomethylated genes
were similar to that of the overall m
6
A/m-containing genes (Fig. 11c). Pathway analysis of
m
6
Am-containing genes did not yield any significantly enriched pathways, indicating a minimal
contribution of m
6
Am to the altered oncogenic pathways of 5′ UTR hypomethylation in KSHV
latent cells.

41

Figure 11. Reprogramming of cellular m
6
A/m epitranscriptome during KSHV latency. a,
Venn diagram showing the overlaps of methylated cellular genes in all five types of cells latently
infected by KSHV. b, Most significant motifs in cellular m
6
A/m peaks identified by MEME in
42

uninfected cells and cells latently infected by KSHV. c, The predicted proportions of m
6
A and
m
6
Am methylated transcripts, and the percentages of hypermethylated and hypomethylated
genes. d, Comparison of cellular m
6
A/m genes in different pairs of uninfected cells and cells
latently infected by KSHV. e, Distribution of cellular m
6
A/m peaks on transcripts in different
pairs of uninfected cells and cells latently infected by KSHV as plotted by the Guitar software
package. f, Comparisons between cellular 5′ hypomethylated genes and 3′ hypermethylated
genes in different pairs of uninfected cells and cells latently infected by KSHV. g, Venn diagram
showing overlaps of significantly enriched pathways of cellular 5′ hypomethylated genes (left)
and 3′ hypermethylated genes (right) as a result of KSHV latent infection in different types of
cells. h, Heat maps of significantly enriched pathways of 5′ hypomethylated genes (left) and 3′
hypermethylated genes (right) sorted by P values as a result of KSHV latent infection in different
types of cells. The results are from three biological replicates. CDS, coding DNA sequence.

43

Figure 12. Clustering analysis of different types of cells latently infected by KSHV, and
uninduced and induced KiSLK and BCBL1-R cells. a, Cluster analysis of m
6
A/m methylated
cellular genes of five types of cells latently infected by KSHV. b, Cluster analysis of m
6
A/m
methylated cellular genes of uninduced and induced KiSLK and BCBL1-R cells. The results are
from three biological replicates.
44

KSHV lytic replication induces dynamic changes in cellular m
6
A/m epitranscriptome
We analyzed cellular m
6
A/m epitranscriptome during KSHV lytic replication. Over 83%
and 41% of m
6
A/m genes remained methylated when KSHV was reactivated from latency in
KiSLK and BCBL1-R cells, respectively (Fig. 13a). We confirmed the m
6
A/m peaks in Dicer1
and JunB by MeRIP-qPCR (Fig. 14a,b). There were more de novo methylated genes in KiSLK
cells than BCBL1-R cells (1,138 versus 51) at 48 h after lytic induction (Fig. 13a). However, the
m
6
A/m epitranscriptomes were clustered by cell type rather than replication status (Fig. 12b).
KiSLK and BCBL1-R cells shared most of the m
6
A/m genes during latent and lytic replication,
respectively, albeit we observed small subsets of cell type-specific methylated genes (Fig. 13b).
Similar to latently infected cells, we detected ‘GGAC’ as the most common motif in the lytic
cells (Fig. 13c).
The most apparent difference between the two cell types was the overall change of
m
6
A/m distribution on the transcripts when cells were reactivated from latency, with KiSLK
cells being 5′ UTR hypermethylated and 3′ UTR hypomethylated, and BCBL1-R cells being 5′
UTR hypomethylated and 3′ UTR hypermethylated (Fig. 13d). Interestingly, of all significantly
hypermethylated or hypomethylated genes in both cell types, over 50% of the enriched pathways
in BCBL1-R cells overlapped with those in KiSLK cells (Fig. 13e). The common enriched
pathways in both cell types included protein ubiquitination, ERK/MAPK signaling, integrin
signaling, hypoxia signaling and sumoylation pathways (Fig. 13f,g), which have been implicated
in KSHV lytic replication [124-127].
Since YTHDF2 mediated the degradation of transcripts (Fig. 8c), we further examined
whether it might target genes according to m
6
A/m distribution. We did not find that different
45

Figure 13. Reprogramming of cellular m
6
A/m epitranscriptome during KSHV lytic
replication. a, Venn diagrams comparing the number of methylated cellular genes before (latent)
46

and after induction for lytic replication in KiSLK (left) and BCBL1-R (right) cells. b,
Comparison of methylated cellular genes between KiSLK and BCBL1-R cells during latency
(left) and lytic replication (right) at 48 h after induction. c, Most significant motifs in cellular
m
6
A/m peaks identified by MEME in latent and lytic KiSLK and BCBL1-R cells. The latent
KiSLK motifs are the same as in Fig. 11b and are replicated in this panel for ease of comparison.
d, Distribution of cellular m
6
A/m peaks on transcripts in latent versus lytic cells in KiSLK cells
(left) and BCBL1-R cells (right) as plotted by the Guitar software package. e, Comparison of
significantly enriched pathways of cellular genes that are hypermethylated (left) or
hypomethylated (right) as a result of reactivation from latency in KiSLK and BCBL1-R cells. f,
Heat map of conserved hypermethylated pathways between KiSLK and BCBL1-R cells sorted
by P value. g, Heat map of conserved hypomethylated pathways between KiSLK and BCBL1-R
cells sorted by P value. h, The proportions of m
6
A and m
6
Am methylated transcripts, and the
percentages of hypermethylated and hypomethylated genes. The results are from three biological
replicates.

47

locations of m
6
A/m on the transcripts affected the half-lives of cellular transcripts. Nevertheless,
it remains possible that YTHDF2 binding to different positions on the transcripts might
differentially affect their stability.
Similarly, we investigated m
6
Am during KSHV lytic replication. Only 18% and 16% of
peaks were predicted to be m
6
Am in KiSLK and BCBL1-R cells, respectively (Fig. 13h).
Furthermore, few enriched pathways of the hypermethylated and hypomethylated m
6
Am genes
overlap with those of m
6
A/m. Hence, m
6
Am had a minimal contribution to the overall m
6
A/m-
altered pathways during KSHV lytic replication. Whereas the presence of m
6
A/m shortened the
half-lives of cellular transcripts, m
6
Am had only a marginal effect (Fig. 8a), which was abolished
following YTHDF2 knockdown (Fig. 8b). Hence, YTHDF2 might be involved in m
6
Am
regulation of mRNA stability in a small subset of transcripts. Among the viral transcripts, m
6
Am
was only predicted to be present in ORF65, ORF66 and ORF67 transcripts in lytic KiSLK cells,
and both latent and lytic BCBL1-R cells; and in ORF34, ORF35 and ORF36 transcripts in lytic
BCBL1-R cells, indicating that m
6
Am was minimally involved in regulating the stability of viral
transcripts.
48

Figure 14. Illustration and validation of selected cellular m
6
A/m peaks in uninduced cells
and cells induced for lytic replication. a, Regions of Dicer1 with and without a m
6
A/m peak
and JunB containing a m
6
A/m peak with qPCR amplicons indicated. b, Validation of cellular
m
6
A/m peaks shown in (a) by MeRIP-qPCR. Experiments were independently repeated three
times, and results are presented as mean +/- SD from the three experiments.

49

CHAPTER 3: DISCUSSION
Systematic profiling and characterization have revealed conservation across different
kingdoms and diverse cellular functions of m
6
A/m modifications on mRNA [29, 30]. m
6
A has
been found on HSV-1 mRNA for decades but the transcript and position containing the
modification as well as the underlying function remain unclear [21]. Numerous studies have
recently profiled m
6
A/m modifications in genomes of RNA viruses including HIV-1, ZIKV and
HCV [87-91]. We have mapped m
6
A/m modifications on KSHV and cellular transcripts in
diverse KSHV-infected cell types undergoing latent and lytic infection. This is the first effort to
systematically profile viral and cellular m
6
A/m epitranscriptomes in cells infected by a large
DNA virus.
Because of the limited resolution of the technique used in this study, we cannot
distinguish the m
6
A and m
6
Am peaks, and precisely map their positions. Hence, we have
analyzed their combined m
6
A/m peaks. Nevertheless, based on the feature of m
6
Am, we have
predicted that less than 20% and 18% of the methylation peaks are m
6
Am peaks on the cellular
transcripts in latent and lytic KSHV infected cells, respectively (Figs. 11c,13h).
We have identified a highly conserved m
6
A/m peak within the latent transcript, which
contains as many as ten potentially methylated RRACH motifs during latent infection (Fig. 3).
During lytic replication, there are widespread m
6
A/m modifications on almost all viral transcripts
(Fig. 5a), reflecting the overall expression of viral transcripts, albeit there is no correlation
between an m
6
A/m peak or peak level and the actual expression level of a transcript. m
6
A/m
peaks on KSHV transcripts are conserved across KiSLK and BCBL1-R cells undergoing lytic
replication (Fig. 5e), suggesting an essential role for m
6
A/m in the KSHV lifecycle.
50

We show that YTHDF2 suppresses KSHV lytic replication (Fig. 7). Since YTHDF2
mediates the degradation and deadenylation of mRNA [76, 123], we propose that YTHDF2
might act as a cellular restriction factor of KSHV lytic replication by mediating degradation of
lytic transcripts. YTHDF2 could transiently shuttle mRNA to P-bodies [76]; however, it might
also directly shuttle viral transcripts to exonucleases, deadenylases or decapping enzymes such
as XRN1, PARN, CCR4-NOT or DCP1/2 for degradation in a P-body-independent mechanism.
Indeed, an example of P-body independent mRNA degradation occurs during KSHV lytic
replication via the viral SOX protein, an endonuclease that cleaves host mRNA at specific sites
and recruits the 5′ –3′ exonuclease XRN1 to complete the degradation of host mRNA [128].
Coincidently, we have observed that mRNA levels of m
6
A/m-related enzymes rapidly decline in
BCBL1-R cells during KSHV lytic replication (Fig. 2c,d), which could be attributed to the effect
of SOX-mediated degradation [128]. Results of a microarray study also show that METTL3,
WTAP, FTO, YTHDF1 and YTHDF2 are degraded during KSHV lytic replication, presumably
by SOX45. However, we have observed more potent SOX activity in BCBL1-R than KiSLK
cells (Fig. 2c). It is currently unclear whether YTHDF2 and m
6
A/m modifications are involved in
SOX mediated RNA degradation.
We propose that the host cells might restrict KSHV lytic replication by degrading
methylated viral transcripts via YTHDF2. Alternatively, KSHV might have hijacked this host
function in favoring viral latency. Recent studies showed that YTHDF1, YTHDF2 and YTHDF3
suppressed ZIKV and HCV replication but enhanced HIV-1 replication [87-89, 91]. Although we
did not detect any consistent roles of other reader proteins in KSHV lytic replication, more
comprehensive works are required to exclude the possibility that they might regulate different
stages of viral replication. As KSHV is a large DNA virus with a complex viral replication
51

program involving multiple stages that are regulated by many viral and cellular factors, fine-
tuning of each of these stages might be necessary to ensure optimal outcomes for its lifecycle.
In cells that are latently infected by KSHV, the most apparent phenotypes are consistent
5′ UTR hypomethylation and 3′ UTR hypermethylation in all pairs of cells, except KTIME
versus TIME cells (Fig. 11e). Of these genes, numerous pathways implicated in cellular
transformation are enriched. In particular, the epithelial-mesenchymal transition (EMT) process
is critical for embryogenesis and wound healing; however, KS and other cancer cells have
hijacked this process to promote tumor growth, invasion, vascular extravasation and metastasis
[100, 102, 129]. EMT can be induced by various stimuli including growth factors and oncogenic
signaling [129, 130]. Indeed, the common enriched pathways among KMM and KMSC cells that
are dynamically methylated include oncogenic pathways such as ephrin receptor signaling, ILK
signaling, hypoxia signaling, BMP signaling, hepatic fibrosis and mTOR signaling, as well as
pathways of remodeling of adherens junctions, Rho GTPase, Rac signaling and regulation of
actin-based motility by Rho directly involved in EMT in cancer [129, 130]. Therefore, KSHV
might induce cellular transformation by manipulating post-transcriptional mRNA modification.
Since 5′ UTR m
6
A/m methylation has been shown to mediate translation through an eIF4E-
dependent pathway [37], whereas the 3′ UTR is preferentially targeted by miRNAs and is often
enriched for m
6
A/m [29, 30], it would be interesting to investigate how m
6
A modifications at the
5′ UTR or 3′ UTR might mediate translation and miRNA targeting of the transcripts during
KSHV latency. Indeed, we have previously shown that multiple KSHV miRNAs are essential for
KSHV-induced cellular transformation and tumorigenesis [108]. Examinations of KMM versus
MM and KMSC versus MSC have not found any significant correlation of differential
methylation in total, 3′ UTR or 5′ UTR with targets of KSHV miRNAs. It remains possible that
52

another mechanism such as specific m
6
A/m location, secondary structure of the transcript and
miRNA binding site or recruitment of other cellular proteins might be involved, which has
evaded our detection.
We have observed alterations of m
6
A/m modifications in a subset of the cellular
transcripts during KSHV reactivation from latency, with more de novo methylated genes
observed in KiSLK cells than BCBL1-R cells (Fig. 13a). This is not due to different sequencing
depth among the samples. Furthermore, there was a striking cell type-specific difference in the
distribution of m
6
A/m on these cellular transcripts, with 5′ UTR manifesting hypermethylation in
KiSLK cells and hypomethylation in BCBL1-R cells (Fig. 13d). This differential effect could be
due to the more robust SOX activity in BCBL1-R cells than KiSLK cells that might cause
preferential degradation of 5′ UTR methylated transcripts (Fig. 2c,d). Importantly, the enriched
pathways that are hypermethylated in KiSLK or hypomethylated in BCBL1-R cells are highly
overlapped (Fig. 13e). First, the ubiquitin/proteasome pathway, which is hypermethylated during
lytic replication, is hijacked by KSHV RTA, ORF-K3, ORF-K5 and ORF-K7 ubiquitin ligases
that downregulate the host cell immune surveillance by inducing proteasomal degradation of key
immune response molecules [131]. Our results suggest that hypermethylation of gene transcripts
might play a role in promoting the activity of this pathway. Second, pathways including integrin,
actin nucleation, PI3K/AKT, hypoxia, ERK/MAPK and ATM signaling implicated in lytic
replication [124-127] are both hypermethylated or hypomethylated, indicating that KSHV might
deregulate these pathways by regulating m
6
A/m modifications to favor viral lytic replication.
In conclusion, as an additional layer of gene regulation at posttranscriptional level, it is
not surprising that m
6
A/m is utilized by KSHV to mediate different stages of its lifecycle.
Although we have established the landscape of viral and cellular m
6
A/m epitranscriptomes
53

during KSHV latent and lytic replication, and identified novel roles of m
6
A/m in KSHV lifecycle
(Fig. 15), the functions of specific m
6
A/m modifications and m
6
A/m-related factors in different
stages of KSHV lifecycle, as well as how KSHV manipulates the m
6
A/m epitranscriptome to
facilitate its infection and replication leading to the induction of KSHV-associated malignancies,
remain to be further investigated.

54

Figure 15. Schematic illustration of features of viral and cellular m
6
A/m epitranscriptomes
in KSHV latent and lytic infection, and model of YTHDF2-mediated inhibition of KSHV
lytic replication.

55

CHAPTER 4: METHODS
Cell culture
iSLK, a renal carcinoma cell line containing a stable doxycycline inducible cassette of
RTA (ORF50), a KSHV immediate-early gene, which is essential and sufficient for activating
KSHV lytic replication, was grown in HyClone DMEM supplemented with 10% fetal bovine
serum (FBS; Sigma-Aldrich, St. Louis, MO), 1 μg per ml puromycin, 250 μg per ml G418 and
1% penicillin-streptomycin. KiSLK cells derived from iSLK cells by infection with a
recombinant KSHV BAC16 [121] were grown as iSLK cells, except that the medium also
contained 1.2 mg per ml hygromycin B. BCBL1-R, a KSHV-infected PEL cell line BCBL1
stably expressing doxycycline-inducible RTA, was grown in RPMI1640 supplemented with 10%
FBS, 1% penicillin-streptomycin and 20 μg per ml hygromycin B35. MSC cells, which are
primary human adipose tissue-derived mesenchymal stem cells, were cultured in MSC medium
(ScienCell Research Laboratories, Carlsbad, CA) containing 20% FBS, as previously described
[102]. KMSC cells derived from MSC cells by infection and transformation with BAC36 [102,
119] were cultured in the same media with the addition of 100 μg per ml hygromycin B. TIME, a
telomerase-immortalized human microvascular endothelial cell line, and KTIME cells derived
from TIME cells by infection with BAC36, were cultured as previously described [132]. MM
cells, which are primary rat metanephric mesenchymal precursor cells, and KMM cells derived
from MM cells by infection and transformation with BAC36, were cultured as previously
described [100].
No further authentication of the cell lines was performed for this study. iSLK, KiSLK and
BCBL1-R cells were obtained from Dr. Jae Jung. TIME cells were obtained from Dr. Don
Ganem. KMM, MM, KMSC, MSC and KTIME cells were generated in our laboratory. iSLK
56

cells were isolated from a KS lesion of an AIDS patient; however, they were later found to be of
renal cell carcinoma origin. Since iSLK cells support efficient and robust KSHV lytic
replication, they have been used for studying KSHV lytic replication. In this study, we employed
iSLK cells to study KSHV lytic replication. iSLK, KiSLK, BCBL1-R, KMM, MM, KMSC,
MSC, TIME and KTIME cells were tested for mycoplasma and showed to be negative.
KSHV lytic replication was induced in KiSLK and BCBL1-R cells by adding 1 μg per ml
doxycycline to the culture media, as previously described [121, 122]. Infectious virions, viral
transcripts and proteins were examined at day 3 after induction of lytic replication unless noted
otherwise.

Antibodies
Antibodies used in this study included a rabbit anti-m
6
A/m antibody (202-003, Synaptic
Systems, Goettingen, Germany); a rabbit anti-human METTL3 antibody (A301-567A, Bethyl
Laboratories, Inc., Montgomery, TX); a rabbit anti-human METTL14 antibody (HPA038002,
Sigma); a rabbit anti-human WTAP antibody (NBP1-83040, Novus Biologicals, LLC, Littleton,
CO); a mouse anti-FTO antibody (ab92821, Abcam, Cambridge, MA); a rabbit anti-ALKBH5
antibody (HPA007196, Sigma); a rabbit anti-human YTHDF1 antibody (ab99080,
Abcam); a rabbit anti-human YTHDF3 antibody (ab103328, Abcam); a goat anti-mouse
YTHDF3 antibody (sc-87503, Santa Cruz Inc., Dallas, TX); a rat anti-LANA antibody (ab4103,
Abcam); a rabbit anti-human YTHDF2 antibody (24744-1-AP, Proteintech Group, Rosemont,
IL); a mouse anti-ORFK8 antibody (sc-57889, Santa Cruz Inc.); a rabbit anti-human YTHDC1
antibody (ab133836, Abcam); a rabbit anti-human YTHDC2 antibody (ab176846, Abcam); and a
57

mouse anti-human β -actin antibody (sc-47778, Santa Cruz Inc.). An anti-ORF57 antibody was
generated by Sigma-Aldrich by immunizing a rabbit with the peptide IDGESPRFDDSIIP. The
rabbit antibody to RTA and the mouse antibody to ORF65 were previously described [133, 134].

Isolation of m
6
A/m RNA fragments
Isolation of m
6
A/m-containing fragments was performed as previously described with
minor modifications [135]. Briefly, total RNA was extracted from cells using TRI Reagent
(Sigma-Aldrich) followed by one round of polyA purification with Dynabeads mRNA DIRECT
Kit according to manufacturers’ instructions (ThermoFisher Scientific, Waltham, MA). The
mRNA was fragmented in a buffer containing 100 mM Tris-HCl at pH 7.0 and 100 mM ZnCl2
followed by incubation at 94 °C for 3 min. Successful fragmentation of mRNA with sizes close
to 100 nucleotides was validated using a BioRad Experion Automated Electrophoresis Station
(Bio-Rad, Hercules, CA). Before immunoprecipitation, 10 μg of anti-m
6
A/m antibody was
incubated with 30 μl slurry of Pierce Protein A Agarose beads (ThermoFisher Scientific) by
rocking in 250 μl PBS at 4 °C for 3 h. The beads were washed three times in cold PBS followed
by one wash in an immunoprecipitation (IP) buffer containing 10 mM Tris-HCl at pH 7.4, 150
mM NaCl and 1% Igepal CA-630 (Sigma-Aldrich). To isolate the m
6
A/m-containing fragments,
120 μg of fragmented mRNA was added to the antibody-bound beads in 250 μl IP buffer
supplemented
with RNasin Plus RNase inhibitor (Promega, Madison, WI), and the mixture was mixed at 4 °C
for 2 h. The beads were washed seven times with 1 ml IP buffer before elution with 100 μ l IP
buffer supplemented with 6.67 mM of m
6
A salt (M2780, Sigma-Aldrich). The mixture was
58

incubated for 1 h at 4 °C and the eluate collected. A second elution was carried out and the
eluates were pooled together before purification with TRI Reagent.

Preparation of m
6
A/m-seq complementary DNA library
Purified eluate and input samples were used for preparation of libraries and sequencing at
the Genome Sequencing Facility at the Greehey Children’s Cancer Research Institute at the
University of Texas Health Science Center at San Antonio. Approximately 10–25 ng of mRNA
was used for RNA sequencing (RNA-seq) library preparation using the TruSeq stranded mRNA
kit (Illumina, San Diego, CA) according to manufacturer’s protocol with two modifications.
First, the elute-frag-prime stage was done at 80°C for 2 min to allow annealing without causing
fragmentation. RNA was reverse transcribed into first strand cDNA using reverse transcriptase
and random primers. This was followed by the second strand cDNA synthesis using DNA
Polymerase I and RNase H. The cDNA fragments then went through an end repair process with
the addition of a single ‘A’ base followed by ligation of adapters. The products were then
purified and enriched by PCR amplification for ten cycles to generate the final RNA-seq library.
The second modification was done to adjust the bead/DNA ratio to preserve smaller fragments
during the adapter ligation double beads clean-up step. A beads/DNA ratio of 1:3 instead of 1:1
was used. cDNA libraries were quantified and pooled for cBot amplification and subsequent
sequencing on an Illumina HiSeq 2000 platform 50 bp single read sequencing module. After the
sequencing run, demultiplexing with CASAVA was employed to generate a fastq file for each
sample.

59

Genome annotation
For KSHV BAC36 and BAC16 genomes, we collected annotation information from
previous studies of RNA-seq, 5′ and 3′ rapid amplification of cDNA ends and transcript isoform
mapping to generate a comprehensive annotation of viral transcripts [136-141]. UCSC hg19 and
rn5 reference genomes of human and rat, and annotation files, were downloaded
from Illumina iGenome.

m
6
A/m-seq data analysis
Reads of the IP/Input samples were aligned to the corresponding genomes using Tophat2
Aligner v2.0.6, which implicitly calls Bowtie2 with default options [142, 143]. Following this,
peak calling and differential m
6
A/m methylation analyses were performed using the exomePeak
R/Bioconductor package, a software specifically designed for m
6
A-seq data analysis [120, 144].
The peak calling is based on the Przyborowski and Wilenski method for comparing the means of
two Poisson distributions (C-test) [145], which computes the methylation enrichment of
normalized IP reads over normalized input reads (or mRNA abundance) as the test statistics.
Only the loci that show significant methylation enrichment are determined as peak regions. For
differential m
6
A/m analysis, the fold changes of methylation enrichments between two
conditions are calculated and a rescaled hypergeometric test is applied to determine the
significance of differential fold enrichment. The output of exomePeak includes the loci of the
(differential) m
6
A/m peaks, the gene symbol of the transcripts to which peaks localize, the
detection P values, false discovery rates (FDR) and methylation enrichment (for peak calling) or
enrichment fold-change (for differential m
6
A/m analysis). For both m
6
A/m peak calling and
differential peak discovery, an FDR threshold of 0.05 is used. m
6
A/m peaks were annotated with
60

identifiers such as Gene Symbol and RefSeq ID as well as regional overlapping status (5′
UTR/coding DNA sequence/3′ UTR). Regional distribution of m
6
A/m was plotted using the
Guitar package [146]. Motif analysis of m
6
A/m peaks was performed using the MEME package
[147].
The m
6
A/m-seq technology cannot measure the stoichiometry of m
6
A/m methylation and
the predicted peaks could have low stoichiometry. However, exomePeak predicts m6A/m peaks
based on their enrichment of IP reads over input reads. Although this enrichment cannot directly
estimate the stoichiometry, it preserves, to some extent, the relationship of the stoichiometry
between different sites. That is, the higher the enrichment, the larger the stoichiometry the
predicted site is likely to have. As a result, the significant peaks predicted by exomePeak are
likely to have relatively higher stoichiometry. Nevertheless, because of the experimental and
modelling noise, there is always a chance that the predicted peaks might have low stoichiometry.

m
6
Am analysis
Using the m
6
A/m-seq datasets, we predicted m
6
Am sites as ‘A’s that locate at the
beginning of RefSeq-annotated transcripts, contain the BCA motif [33] and are inside the
exomePeak-predicted peaks. If a peak was mapped to a RefSeq transcript with multiple transcript
start sites, only the ‘A’ that is closest to the peak center was predicted as an m
6
Am site. Because
of the limitation of m
6
A/m-seq, these predicted m
6
Am sites are only putative m6Am sites in the
transcriptome and this method would miss the true m
6
Am sites without the BCA motifs.
Furthermore, the predicted results could change if a different transcript annotation system is
used. Clustering analysis. To investigate the methylation behavior of genes across samples, the
highest fold enrichment among all peaks within a gene was considered as the methylation fold
61

enrichment of the gene. Hierarchical clustering with Euclidean distance was used to group
similarly methylated genes according to sample.

Gene expression analysis
The expression of transcripts and isoforms and differential expression levels were
calculated using cufflinks and cuffdiff, respectively, based on the input samples [148, 149]. To
avoid underestimating the expression of viral genes during lytic replication, we used reads
mapped to both cellular and viral genomes to calculate the fragments per kilobase of transcript
per million mapped reads (FPKM). All the other bioinformatics analyses were performed on
Matlab, R or Perl.

siRNA knockdown
siRNA silencing was performed by transfecting 2.5 pmol of each siRNA per well in a 12-
well plate into the KiSLK cells using Lipofectamine RNAi Max according to manufacturer’s
instructions (ThermoFisher Scientific). Two days after transfection, the cells were monitored for
knockdown efficiency of the target gene by RT-qPCR and western blotting, and induced for lytic
replication with 1 μg per ml of doxycycline. siRNAs were purchased from Sigma-Aldrich. Their
product numbers and sequences are as follows.
YTHDF1 si1: SASI_Hs01_00233686 (5′ -CAGAGCUCCGCGUAUGGGA-3′ );
YTHDF1 si2: SASI_Hs01_00233688 (5′ -GUCAAUGGGAGUGGGCAUU-3′ );
YTHDF1 si3: SASI_Hs01_00233689 (5′ -GAAACGCGGCGUUUGGGCA-3′ );
YTHDF2 si1: SASI_Hs01_00133215 (5′ -GUUCCAUUAAGUAUAAUAU-3′ );
YTHDF2 si2: SASI_Hs01_00133214 (5′ -CUGCUUAUCGUUCCAUGAA-3′ );
62

YTHDF3 si1: SASI_Hs01_00202277 (5′ -CAAACCUCAACCGAAACUU-3′ );
YTHDF3 si2: SASI_Hs01_00202278 (5′ -CAAUUCAAGGGACACUCAA-3′ );
YTHDC1 si1 SASI_Hs01_00115890 (5′ -CUUGUAUCAGGUCAUUCAU-3′ );
YTHDC1 si2 SASI_Hs01_00363062 (5′ -GUGAUGGACAGGAAAUUGA-3′ );
YTHDC2 si1 SASI_Hs01_00161045 (5′ -CAACUUAGAGCAUCAGGUU-3′ );
YTHDC2 si2 SASI_Hs01_00161046 (5′ -GCCUAUUUAUAACCACUGA-3′ ); and
siControl (siCl): Sigma siRNA Universal Negative Control #1 (SIC001-10NMOL).

RT-qPCR for gene expression and MeRIP-qPCR for m
6
A/m-seq validation
Total RNA was isolated with TRI Reagent according to the manufacturer’s protocol.
Reverse transcription was performed with 1 μg of total RNA using Maxima H Minus First
Strand cDNA Synthesis Kit (Cat. # K1652, ThermoFisher Scientific). Quantitative PCR was
done using SsoAdvanced Universal SYBR Green Supermix (BioRad) and analyzed with a CFX
Connect Real-Time PCR Detection System (BioRad). Relative gene expression levels were
obtained by normalizing the cycle threshold (CT) values to those of 18 S to yield 2-ΔΔCt values.
For validation of m
6
A/m-seq, 5 ng of eluate or input mRNA was subjected to RT-qPCR. Fold
enrichment was calculated by calculating the 2-ΔCt of eluate relative to the input sample. The
primers used for gene expression are:
ATCAACTTTCGATGGTAGTCG (forward) and TCCTTGGATGTGGTAGCCG (reverse) for
human 18 S; CATTCGAACGTCTGCCCTAT (forward) and GTTTCTCAGGCTCCCTCTCC
(reverse) for rat 18 S; CGACAGCGCTGGAATCCTAT (forward) and
GCCATCAAGGGATCCACTCC (reverse) for human SON;
GCAAGAAGGTAGGGGTCATGT (forward) and AGGGGTAAATCCCTGTCAAACA
63

(reverse) for human METTL3; GATAGCCGCTTGCAGGAGAT (forward) and
ACTTTCAGCTCCCAACTGCT (reverse) for human METTL14;
ATCAGGCAAGTGAAAGCCTCA (forward) and GTCCAGGATGACCTTATGGGTT
(reverse) for human WTAP; GTGGAGACTTCTCTTGGCCC (forward) and
GGGCACCATTTCCTAGCTGT (reverse) for human FTO; TCAAGCCTATTCGGGTGTCG
(forward) and ATCCACTGAGCACAGTCACG (reverse) for human ALKBH5;
CTCAATGAGCGACCCCTACC (forward) and AGTAGACCACGGAGCCTCAT (reverse) for
human YTHDF1; TGTTGGAGAAGCTTCGGTCC (forward) and
ACCCGGCCATGTTTCAGATT (reverse) for human YTHDF2;
ATTGTGGACCCGAGAAGCAG (forward) and GAAGAGGCCCGTCTTTTCCG (reverse) for
human YTHDF3; ACGTCCATCCCGTCGAGAAC (forward) and
ACACATCTCGGCGAACTCCT (reverse) for human YTHDC1;
AAGGGGCTGAAGGACATTCG (forward) and CCATTTCTCTCTGGTCCCCG (reverse) for
human YTHDC2; AAGCAGCAGTTCGTGGTGAA (forward) and
TCGTTAGCGCTCCTTCCTTC (reverse) for human MALAT1;
ATGTGCAGCCCAACTGGATT (forward) and CTGTGCTTAAACCGGGCAAC (reverse) for
rat METTL3; GGGGAAGGATTGGACCTTGG (forward) and GCAGTGCTCCTTTGTCCTCT
(reverse) for rat METTL14; AGCAGCAACAGCAGGAATCT (forward) and
GGTGCACTCTTGCATCTCCT (reverse) for rat WTAP; AGAAGGCCAATGAAGACGCT
(forward) and CTTCATCATCGCAGGACGGT (reverse) for rat FTO;
ACGGCCTCAGGACATCAAAG (forward) and AAGCATAGCTGGGTGGCAAT (reverse) for
rat ALKBH5; TCAGGACAAGTGGAAGGGGA (forward) and
TCTGATGTGCCGCAGTTGAT (reverse) for rat YTHDF1; GGACACTCAGGAAGTGCCTC
64

(forward) and TGGCTTCCTCCTCCTCTTGA (reverse) for rat YTHDF2;
ACTTTCAAGCACACCACCTCA (forward) and TGGCTTCCTCCTCCTCTTGA (reverse) for
rat YTHDF3; CCAGGAAGTCCCACAGTGTT (forward) and
AGACACAGGATGGGATGGAG (reverse) for LANA; AGGTCCCCCTCACCAGTAAA
(forward) and GAGGACGTGTGTTTTGACCG (reverse) for ORF57;
CATGCTGATGCGAATGTGC (forward) and AGCTTCAACATGGTGGGAGTG (reverse) for
ORF-K8; TTTAGCACTGGGACTGCCC (forward) and CAAGAAGGCAAGCAGCGAG
(reverse) for PAN RNA; AATGTCAGCGTCCACTCCTG (forward) and
GAAGAGGGGGCACAGGTAAC (reverse) for RTA; AAGGTGAGAGACCCCGTGAT
(forward) and AGGGTATTCATGCGAGCCAC (reverse) for ORF65; and
TTCTTAACCCCAGAACGCCAG (forward) and CAAGTGCACGGATCGGCTT (reverse) for
ORF59; and TAAAAAGCTCGCCGATGGCT (forward) and
ACTGATTTTCCAAACTCCGTCG (reverse) for vIL6. The LANA primers were also used for
quantification of virions. The primers used for validation of m
6
A/m peaks are:
GCTGCACATCAAGGTGCTAA (forward) and GCAACGTTCTGCAGTTCACA (reverse) for
the human Dicer1 m
6
A/m peak; AAACGAAGGCAGTGCTACCC (forward) and
GGGCTGATCAGGTCTGGGATA (reverse) for the human Dicer1 without m
6
A/m peak;
GAACGCCTGATTGTCCCCAA (forward) and AAAAGTACTGTCCCGGGGGT (reverse) for
the human JUNB m
6
A/m peak; AGGTGCTACTAGACCCTCCTT (forward) and
GAGCTTAGCAGGTGACTCGG (reverse) for rat the Dicer1 m
6
A/m peak;
AAACGAAGGCAGTGCTACCC (forward) and CAGGGTTGATCGGGTTTGGG (reverse) for
the rat Dicer1 without m
6
A/m peak; AACTGGAGCGCTTGATCGTC (forward) and
TAAAAGTACTGTCCCGGAGGC (reverse) for the rat JUNB m
6
A/m peak;
65

GACTCCTTTTCCCGCCAAGA (forward) and AAGTGACGTCCGTCGCTAAG
(reverse) for ORF72 m
6
A/m peak; TCTGCAAAACCGTGACGTTG (forward)
and TAGGGACTACCGCTGCGTG (reverse) for ORF75 m
6
A/m peak;
GCGGTCAAATTTGGGTGGAC (forward) and TGGAGCTTCTGACGAAGACC
(reverse) for vIL6 m
6
A/m peak; TCCATGGTAGACCTCAGCGA (forward) and
ATGTTGGGATGGGGTTTGCT (reverse) for RTA m
6
A/m peak;
AGAGGAAGAGACGCGCACTA (forward) and GCAATAAACCCACAGCCCAT
(reverse) for ORF-K8.1 m
6
A/m peak; AGTTGGACCACATTCCATTGC (forward) and
CCTGCGAGTTCACAGGTTGG (reverse) for ORF4 m
6
A/m peak;
CCGGCAGGTCTGTAACCATT (forward) and CACCAGTGGCACGGTAATGA
(reverse) for ORF6 m
6
A/m peak; AAGCGGGAGAACCAACACAT (forward) and
AGCGCCCAAGTTGTTACAGT (reverse) for ORF-K3 m
6
A/m peak;
GAACTTCCTGGCGGGGTAAA (forward) and GGGAACCGGACACCTAACTG
(reverse) for ORF11 m
6
A/m peak; and CACCATGGCGCATGTTTCAA (forward) and
CCCTGTCCGTAAACACCTCC (reverse) for ORF57 m
6
A/m peak.

Western blotting analysis
Protein samples were lysed in Laemmli buffer, separated by SDS-PAGE and transferred
to a nitrocellulose membrane. The membrane was blocked with 5% milk and then incubated with
the appropriate primary antibody overnight at 4 °C. The membrane was washed with TBS-
Tween and probed with a secondary antibody conjugated to horseradish peroxidase (HRP). After
further washing with TBS-T, the blot was visualized with Luminata Crescendo Western HRP
66

substrate (Millipore, Billerica, MA) and imaged on a UVP BioSpectrum Imaging System (UVP,
LLC, Upland, CA).

Measurement of transcript half-life
KiSLK cells induced for lytic replication were treated with 2 μg per ml actinomycin D.
RNA was collected at 0, 2, 4, 8, 16 and 24 h after the treatment, and examined by RT-qPCR.
RNA from 0, 4 and 16 h were poly(A) selected, converted to cDNA libraries and sequenced on a
HiSeq 2000 platform using the 50 bp single read sequencing module. Reads were converted
to FPKM by cuffdiff and normalized to GAPDH. mRNA lifetime profiling was calculated using
methods previously described [76]. Fold changes of the half-lives of KSHV transcripts in the
heat map were calculated by dividing siY2-1 FPKM by siCl FPKM based on values from 0 h and
16 h.

RIP-qPCR
KiSLK cells were transduced with lentivirus carrying an empty vector or Flag-YTHDF2.
One day after transduction, cells were split to a 10 cm tissue culture dish. Once 80% confluent,
lytic replication was induced with 1 μg per ml doxycycline for 48 h. Cells were lysed with lysis
buffer containing 25 mM Tris-HCl pH 7.4, 150 mM NaCl, 1 mM EDTA and 1% Igepal CA-630
for 20 min at 4 °C. A fraction of the lysate (10%) was saved as input. The cell lysate was
incubated with mouse anti-flag M2 beads (Sigma-Aldrich) overnight. The next day, the beads
were washed five times with lysis buffer and RNA was collected by adding TRI Reagent to the
beads. Input lysate (1%) and all the immunoprecipitated RNA were used for RT-qPCR.

67

Pathway analysis
Significantly differentially methylated genes were identified by applying an FDR (log10
FDR) filter of < –1.3, and enriched pathways were determined using the default settings of
QIAGEN’s Ingenuity Pathway Analysis (IPA, QIAGEN Redwood City,
www.qiagen.com/ingenuity). Comparison analysis was done by sorting the P values of the
commonly enriched pathways by score.

Statistical analyses
All the experiments were independently performed at least three times, unless stated
otherwise, and the results were analyzed and presented. Student’s t-test was used for RT-qPCR,
MeRIP-qPCR, RIP-PCR and western blotting band intensity analyses in Microsoft Excel.
Transcript half-life was calculated using one phase decay nonlinear regression and the
significance between the decay curves was determined using the Wilcoxon signed-rank test in
GraphPad Prism 5 (GraphPad Software Inc., La Jolla, CA). The Mann-Whitney test was used to
calculate the significance of curves of half-lives of transcripts with and without YTHDF2
knockdown. In all results, NS denotes ‘not significant’, *P < 0.05, **P < 0.01 and ***P < 0.001.

68

REFERENCES

[1] Boccaletto P, Machnicka MA, Purta E, Piatkowski P, Baginski B, Wirecki TK, de Crecy-
Lagard V, Ross R, Limbach PA, Kotter A, Helm M, Bujnicki JM: MODOMICS: a database of
RNA modification pathways. 2017 update. Nucleic acids research 2017.

[2] Adams JM, Cory S: Modified nucleosides and bizarre 5'-termini in mouse myeloma mRNA.
Nature 1975, 255:28-33.

[3] Desrosiers R, Friderici K, Rottman F: Identification of methylated nucleosides in messenger
RNA from Novikoff hepatoma cells. Proceedings of the National Academy of Sciences of the
United States of America 1974, 71:3971-5.

[4] Desrosiers RC, Friderici KH, Rottman FM: Characterization of Novikoff hepatoma mRNA
methylation and heterogeneity in the methylated 5' terminus. Biochemistry 1975, 14:4367-74.

[5] Krug RM, Morgan MA, Shatkin AJ: Influenza viral mRNA contains internal N6-
methyladenosine and 5'-terminal 7-methylguanosine in cap structures. Journal of virology 1976,
20:45-53.

[6] Sommer S, Salditt-Georgieff M, Bachenheimer S, Darnell JE, Furuichi Y, Morgan M,
Shatkin AJ: The methylation of adenovirus-specific nuclear and cytoplasmic RNA. Nucleic acids
research 1976, 3:749-65.

[7] Moss B, Koczot F: Sequence of methylated nucleotides at the 5'-terminus of adenovirus-
specific RNA. Journal of virology 1976, 17:385-92.

[8] Aloni Y, Dhar R, Khoury G: Methylation of nuclear simian virus 40 RNAs. Journal of
virology 1979, 32:52-60.

[9] Beemon K, Keith J: Localization of N6-methyladenosine in the Rous sarcoma virus genome.
Journal of molecular biology 1977, 113:165-79.

[10] Canaani D, Kahana C, Lavi S, Groner Y: Identification and mapping of N6-
methyladenosine containing sequences in simian virus 40 RNA. Nucleic acids research 1979,
6:2879-99.

69

[11] Dimock K, Stoltzfus CM: Sequence specificity of internal methylation in B77 avian
sarcoma virus RNA subunits. Biochemistry 1977, 16:471-8.

[12] Dimock K, Stolzfus CM: Cycloleucine blocks 5'-terminal and internal methylations of avian
sarcoma virus genome RNA. Biochemistry 1978, 17:3627-32.

[13] Finkel D, Groner Y: Methylations of adenosine residues (m6A) in pre-mRNA are important
for formation of late simian virus 40 mRNAs. Virology 1983, 131:409-25.

[14] Furuichi Y, Shatkin AJ, Stavnezer E, Bishop JM: Blocked, methylated 5'-terminal sequence
in avian sarcoma virus RNA. Nature 1975, 257:618-20.

[15] Hashimoto SI, Green M: Multiple methylated cap sequences in adenovirus type 2 early
mRNA. Journal of virology 1976, 20:425-35.

[16] Horowitz S, Horowitz A, Nilsen TW, Munns TW, Rottman FM: Mapping of N6-
methyladenosine residues in bovine prolactin mRNA. Proceedings of the National Academy of
Sciences of the United States of America 1984, 81:5667-71.

[17] HsuChen CC, Dubin DT: Methylated constituents of Aedes albopictus poly (A)-containing
messenger RNA. Nucleic acids research 1977, 4:2671-82.

[18] Kane SE, Beemon K: Precise localization of m6A in Rous sarcoma virus RNA reveals
clustering of methylation sites: implications for RNA processing. Molecular and cellular biology
1985, 5:2298-306.

[19] Lavi S, Shatkin AJ: Methylated simian virus 40-specific RNA from nuclei and cytoplasm of
infected BSC-1 cells. Proceedings of the National Academy of Sciences of the United States of
America 1975, 72:2012-6.

[20] Lavi U, Fernandez-Munoz R, Darnell JE, Jr.: Content of N-6 methyl adenylic acid in
heterogeneous nuclear and messenger RNA of HeLa cells. Nucleic acids research 1977, 4:63-9.

[21] Moss B, Gershowitz A, Stringer JR, Holland LE, Wagner EK: 5'-Terminal and internal
methylated nucleosides in herpes simplex virus type 1 mRNA. Journal of virology 1977, 23:234-
9.

[22] Narayan P, Ayers DF, Rottman FM, Maroney PA, Nilsen TW: Unequal distribution of N6-
methyladenosine in influenza virus mRNAs. Molecular and cellular biology 1987, 7:1572-5.

70

[23] Narayan P, Ludwiczak RL, Goodwin EC, Rottman FM: Context effects on N6-adenosine
methylation sites in prolactin mRNA. Nucleic acids research 1994, 22:419-26.

[24] Stoltzfus CM, Dimock K: Evidence of methylation of B77 avian sarcoma virus genome
RNA subunits. Journal of virology 1976, 18:586-95.

[25] Thomason AR, Brian DA, Velicer LF, Rottman FM: Methylation of high-molecular-weight
subunit RNA of feline leukemia virus. Journal of virology 1976, 20:123-32.

[26] Wei CM, Gershowitz A, Moss B: Methylated nucleotides block 5' terminus of HeLa cell
messenger RNA. Cell 1975, 4:379-86.

[27] Wei CM, Gershowitz A, Moss B: 5'-Terminal and internal methylated nucleotide sequences
in HeLa cell mRNA. Biochemistry 1976, 15:397-401.

[28] Wei CM, Moss B: Nucleotide sequences at the N6-methyladenosine sites of HeLa cell
messenger ribonucleic acid. Biochemistry 1977, 16:1672-6.

[29] Dominissini D, Moshitch-Moshkovitz S, Schwartz S, Salmon-Divon M, Ungar L, Osenberg
S, Cesarkas K, Jacob-Hirsch J, Amariglio N, Kupiec M, Sorek R, Rechavi G: Topology of the
human and mouse m6A RNA methylomes revealed by m6A-seq. Nature 2012, 485:201-6.

[30] Meyer KD, Saletore Y, Zumbo P, Elemento O, Mason CE, Jaffrey SR: Comprehensive
analysis of mRNA methylation reveals enrichment in 3' UTRs and near stop codons. Cell 2012,
149:1635-46.

[31] Saletore Y, Meyer K, Korlach J, Vilfan ID, Jaffrey S, Mason CE: The birth of the
Epitranscriptome: deciphering the function of RNA modifications. Genome biology 2012,
13:175.

[32] Chen K, Lu Z, Wang X, Fu Y, Luo GZ, Liu N, Han D, Dominissini D, Dai Q, Pan T, He C:
High-resolution N(6) -methyladenosine (m(6) A) map using photo-crosslinking-assisted m(6) A
sequencing. Angewandte Chemie 2015, 54:1587-90.

[33] Linder B, Grozhik AV, Olarerin-George AO, Meydan C, Mason CE, Jaffrey SR: Single-
nucleotide-resolution mapping of m6A and m6Am throughout the transcriptome. Nature
methods 2015, 12:767-72.

71

[34] Molinie B, Wang J, Lim KS, Hillebrand R, Lu ZX, Van Wittenberghe N, Howard BD,
Daneshvar K, Mullen AC, Dedon P, Xing Y, Giallourakis CC: m(6)A-LAIC-seq reveals the
census and complexity of the m(6)A epitranscriptome. Nature methods 2016, 13:692-8.

[35] Li Y, Wang Y, Zhang Z, Zamudio AV, Zhao JC: Genome-wide detection of high abundance
N6-methyladenosine sites by microarray. Rna 2015, 21:1511-8.

[36] Xiang Y, Laurent B, Hsu CH, Nachtergaele S, Lu Z, Sheng W, Xu C, Chen H, Ouyang J,
Wang S, Ling D, Hsu PH, Zou L, Jambhekar A, He C, Shi Y: RNA m(6)A methylation regulates
the ultraviolet-induced DNA damage response. Nature 2017, 543:573-6.

[37] Meyer KD, Patil DP, Zhou J, Zinoviev A, Skabkin MA, Elemento O, Pestova TV, Qian SB,
Jaffrey SR: 5' UTR m(6)A Promotes Cap-Independent Translation. Cell 2015, 163:999-1010.

[38] Zhou J, Wan J, Gao X, Zhang X, Jaffrey SR, Qian SB: Dynamic m(6)A mRNA methylation
directs translational control of heat shock response. Nature 2015, 526:591-4.

[39] Batista PJ, Molinie B, Wang J, Qu K, Zhang J, Li L, Bouley DM, Lujan E, Haddad B,
Daneshvar K, Carter AC, Flynn RA, Zhou C, Lim KS, Dedon P, Wernig M, Mullen AC, Xing Y,
Giallourakis CC, Chang HY: m(6)A RNA modification controls cell fate transition in
mammalian embryonic stem cells. Cell stem cell 2014, 15:707-19.

[40] Geula S, Moshitch-Moshkovitz S, Dominissini D, Mansour AA, Kol N, Salmon-Divon M,
Hershkovitz V, Peer E, Mor N, Manor YS, Ben-Haim MS, Eyal E, Yunger S, Pinto Y, Jaitin DA,
Viukov S, Rais Y, Krupalnik V, Chomsky E, Zerbib M, Maza I, Rechavi Y, Massarwa R, Hanna
S, Amit I, Levanon EY, Amariglio N, Stern-Ginossar N, Novershtern N, Rechavi G, Hanna JH:
Stem cells. m6A mRNA methylation facilitates resolution of naive pluripotency toward
differentiation. Science 2015, 347:1002-6.

[41] Wang Y, Li Y, Toth JI, Petroski MD, Zhang Z, Zhao JC: N6-methyladenosine modification
destabilizes developmental regulators in embryonic stem cells. Nature cell biology 2014, 16:191-
8.

[42] Yoon KJ, Ringeling FR, Vissers C, Jacob F, Pokrass M, Jimenez-Cyrus D, Su Y, Kim NS,
Zhu Y, Zheng L, Kim S, Wang X, Dore LC, Jin P, Regot S, Zhuang X, Canzar S, He C, Ming
GL, Song H: Temporal Control of Mammalian Cortical Neurogenesis by m(6)A Methylation.
Cell 2017, 171:877-89 e17.

[43] Qi ST, Ma JY, Wang ZB, Guo L, Hou Y, Sun QY: N6-Methyladenosine Sequencing
Highlights the Involvement of mRNA Methylation in Oocyte Meiotic Maturation and Embryo
72

Development by Regulating Translation in Xenopus laevis. The Journal of biological chemistry
2016, 291:23020-6.

[44] Ivanova I, Much C, Di Giacomo M, Azzi C, Morgan M, Moreira PN, Monahan J, Carrieri
C, Enright AJ, O'Carroll D: The RNA m(6)A Reader YTHDF2 Is Essential for the Post-
transcriptional Regulation of the Maternal Transcriptome and Oocyte Competence. Molecular
cell 2017, 67:1059-67 e4.

[45] Hsu PJ, Zhu Y, Ma H, Guo Y, Shi X, Liu Y, Qi M, Lu Z, Shi H, Wang J, Cheng Y, Luo G,
Dai Q, Liu M, Guo X, Sha J, Shen B, He C: Ythdc2 is an N(6)-methyladenosine binding protein
that regulates mammalian spermatogenesis. Cell research 2017, 27:1115-27.

[46] Xu K, Yang Y, Feng GH, Sun BF, Chen JQ, Li YF, Chen YS, Zhang XX, Wang CX, Jiang
LY, Liu C, Zhang ZY, Wang XJ, Zhou Q, Yang YG, Li W: Mettl3-mediated m(6)A regulates
spermatogonial differentiation and meiosis initiation. Cell research 2017, 27:1100-14.

[47] Zheng G, Dahl JA, Niu Y, Fedorcsak P, Huang CM, Li CJ, Vagbo CB, Shi Y, Wang WL,
Song SH, Lu Z, Bosmans RP, Dai Q, Hao YJ, Yang X, Zhao WM, Tong WM, Wang XJ, Bogdan
F, Furu K, Fu Y, Jia G, Zhao X, Liu J, Krokan HE, Klungland A, Yang YG, He C: ALKBH5 is a
mammalian RNA demethylase that impacts RNA metabolism and mouse fertility. Molecular cell
2013, 49:18-29.

[48] Schwartz S, Agarwala SD, Mumbach MR, Jovanovic M, Mertins P, Shishkin A, Tabach Y,
Mikkelsen TS, Satija R, Ruvkun G, Carr SA, Lander ES, Fink GR, Regev A: High-resolution
mapping reveals a conserved, widespread, dynamic mRNA methylation program in yeast
meiosis. Cell 2013, 155:1409-21.

[49] Fustin JM, Doi M, Yamaguchi Y, Hida H, Nishimura S, Yoshida M, Isagawa T, Morioka
MS, Kakeya H, Manabe I, Okamura H: RNA-methylation-dependent RNA processing controls
the speed of the circadian clock. Cell 2013, 155:793-806.

[50] Li Y, Wang X, Li C, Hu S, Yu J, Song S: Transcriptome-wide N(6)-methyladenosine
profiling of rice callus and leaf reveals the presence of tissue-specific competitors involved in
selective mRNA modification. RNA biology 2014, 11:1180-8.

[51] Luo GZ, MacQueen A, Zheng G, Duan H, Dore LC, Lu Z, Liu J, Chen K, Jia G, Bergelson
J, He C: Unique features of the m6A methylome in Arabidopsis thaliana. Nature
communications 2014, 5:5630.

73

[52] Shen L, Liang Z, Gu X, Chen Y, Teo ZW, Hou X, Cai WM, Dedon PC, Liu L, Yu H: N(6)-
Methyladenosine RNA Modification Regulates Shoot Stem Cell Fate in Arabidopsis.
Developmental cell 2016, 38:186-200.

[53] Bokar JA, Rath-Shambaugh ME, Ludwiczak R, Narayan P, Rottman F: Characterization
and partial purification of mRNA N6-adenosine methyltransferase from HeLa cell nuclei.
Internal mRNA methylation requires a multisubunit complex. The Journal of biological
chemistry 1994, 269:17697-704.

[54] Bokar JA, Shambaugh ME, Polayes D, Matera AG, Rottman FM: Purification and cDNA
cloning of the AdoMet-binding subunit of the human mRNA (N6-adenosine)-methyltransferase.
Rna 1997, 3:1233-47.

[55] Liu J, Yue Y, Han D, Wang X, Fu Y, Zhang L, Jia G, Yu M, Lu Z, Deng X, Dai Q, Chen
W, He C: A METTL3-METTL14 complex mediates mammalian nuclear RNA N6-adenosine
methylation. Nature chemical biology 2014, 10:93-5.

[56] Patil DP, Chen CK, Pickering BF, Chow A, Jackson C, Guttman M, Jaffrey SR: m(6)A
RNA methylation promotes XIST-mediated transcriptional repression. Nature 2016, 537:369-73.

[57] Ping XL, Sun BF, Wang L, Xiao W, Yang X, Wang WJ, Adhikari S, Shi Y, Lv Y, Chen YS,
Zhao X, Li A, Yang Y, Dahal U, Lou XM, Liu X, Huang J, Yuan WP, Zhu XF, Cheng T, Zhao
YL, Wang X, Rendtlew Danielsen JM, Liu F, Yang YG: Mammalian WTAP is a regulatory
subunit of the RNA N6-methyladenosine methyltransferase. Cell research 2014, 24:177-89.

[58] Schwartz S, Mumbach MR, Jovanovic M, Wang T, Maciag K, Bushkin GG, Mertins P, Ter-
Ovanesyan D, Habib N, Cacchiarelli D, Sanjana NE, Freinkman E, Pacold ME, Satija R,
Mikkelsen TS, Hacohen N, Zhang F, Carr SA, Lander ES, Regev A: Perturbation of m6A writers
reveals two distinct classes of mRNA methylation at internal and 5' sites. Cell reports 2014,
8:284-96.

[59] Wang P, Doxtader KA, Nam Y: Structural Basis for Cooperative Function of Mettl3 and
Mettl14 Methyltransferases. Molecular cell 2016, 63:306-17.

[60] Wang X, Feng J, Xue Y, Guan Z, Zhang D, Liu Z, Gong Z, Wang Q, Huang J, Tang C, Zou
T, Yin P: Structural basis of N(6)-adenosine methylation by the METTL3-METTL14 complex.
Nature 2016, 534:575-8.

[61] Lin S, Choe J, Du P, Triboulet R, Gregory RI: The m(6)A Methyltransferase METTL3
Promotes Translation in Human Cancer Cells. Molecular cell 2016, 62:335-45.

74

[62] Jia G, Fu Y, Zhao X, Dai Q, Zheng G, Yang Y, Yi C, Lindahl T, Pan T, Yang YG, He C:
N6-methyladenosine in nuclear RNA is a major substrate of the obesity-associated FTO. Nature
chemical biology 2011, 7:885-7.

[63] Lindgren CM, Heid IM, Randall JC, Lamina C, Steinthorsdottir V, Qi L, Speliotes EK,
Thorleifsson G, Willer CJ, Herrera BM, Jackson AU, Lim N, Scheet P, Soranzo N, Amin N,
Aulchenko YS, Chambers JC, Drong A, Luan J, Lyon HN, Rivadeneira F, Sanna S, Timpson NJ,
Zillikens MC, Zhao JH, Almgren P, Bandinelli S, Bennett AJ, Bergman RN, Bonnycastle LL,
Bumpstead SJ, Chanock SJ, Cherkas L, Chines P, Coin L, Cooper C, Crawford G, Doering A,
Dominiczak A, Doney AS, Ebrahim S, Elliott P, Erdos MR, Estrada K, Ferrucci L, Fischer G,
Forouhi NG, Gieger C, Grallert H, Groves CJ, Grundy S, Guiducci C, Hadley D, Hamsten A,
Havulinna AS, Hofman A, Holle R, Holloway JW, Illig T, Isomaa B, Jacobs LC, Jameson K,
Jousilahti P, Karpe F, Kuusisto J, Laitinen J, Lathrop GM, Lawlor DA, Mangino M, McArdle
WL, Meitinger T, Morken MA, Morris AP, Munroe P, Narisu N, Nordstrom A, Nordstrom P,
Oostra BA, Palmer CN, Payne F, Peden JF, Prokopenko I, Renstrom F, Ruokonen A, Salomaa
V, Sandhu MS, Scott LJ, Scuteri A, Silander K, Song K, Yuan X, Stringham HM, Swift AJ,
Tuomi T, Uda M, Vollenweider P, Waeber G, Wallace C, Walters GB, Weedon MN, Wellcome
Trust Case Control C, Witteman JC, Zhang C, Zhang W, Caulfield MJ, Collins FS, Davey Smith
G, Day IN, Franks PW, Hattersley AT, Hu FB, Jarvelin MR, Kong A, Kooner JS, Laakso M,
Lakatta E, Mooser V, Morris AD, Peltonen L, Samani NJ, Spector TD, Strachan DP, Tanaka T,
Tuomilehto J, Uitterlinden AG, van Duijn CM, Wareham NJ, Hugh W, Procardis C, Waterworth
DM, Boehnke M, Deloukas P, Groop L, Hunter DJ, Thorsteinsdottir U, Schlessinger D,
Wichmann HE, Frayling TM, Abecasis GR, Hirschhorn JN, Loos RJ, Stefansson K, Mohlke KL,
Barroso I, McCarthy MI, Giant C: Genome-wide association scan meta-analysis identifies three
Loci influencing adiposity and fat distribution. PLoS genetics 2009, 5:e1000508.

[64] Loos RJ, Yeo GS: The bigger picture of FTO: the first GWAS-identified obesity gene.
Nature reviews Endocrinology 2014, 10:51-61.

[65] Smemo S, Tena JJ, Kim KH, Gamazon ER, Sakabe NJ, Gomez-Marin C, Aneas I, Credidio
FL, Sobreira DR, Wasserman NF, Lee JH, Puviindran V, Tam D, Shen M, Son JE, Vakili NA,
Sung HK, Naranjo S, Acemel RD, Manzanares M, Nagy A, Cox NJ, Hui CC, Gomez-Skarmeta
JL, Nobrega MA: Obesity-associated variants within FTO form long-range functional
connections with IRX3. Nature 2014, 507:371-5.

[66] Bartosovic M, Molares HC, Gregorova P, Hrossova D, Kudla G, Vanacova S: N6-
methyladenosine demethylase FTO targets pre-mRNAs and regulates alternative splicing and 3'-
end processing. Nucleic acids research 2017, 45:11356-70.

[67] Zhao X, Yang Y, Sun BF, Shi Y, Yang X, Xiao W, Hao YJ, Ping XL, Chen YS, Wang WJ,
Jin KX, Wang X, Huang CM, Fu Y, Ge XM, Song SH, Jeong HS, Yanagisawa H, Niu Y, Jia GF,
Wu W, Tong WM, Okamoto A, He C, Rendtlew Danielsen JM, Wang XJ, Yang YG: FTO-
dependent demethylation of N6-methyladenosine regulates mRNA splicing and is required for
adipogenesis. Cell research 2014, 24:1403-19.
75

[68] Hess ME, Hess S, Meyer KD, Verhagen LA, Koch L, Bronneke HS, Dietrich MO, Jordan
SD, Saletore Y, Elemento O, Belgardt BF, Franz T, Horvath TL, Ruther U, Jaffrey SR,
Kloppenburg P, Bruning JC: The fat mass and obesity associated gene (Fto) regulates activity of
the dopaminergic midbrain circuitry. Nature neuroscience 2013, 16:1042-8.

[69] Fischer J, Koch L, Emmerling C, Vierkotten J, Peters T, Bruning JC, Ruther U: Inactivation
of the Fto gene protects from obesity. Nature 2009, 458:894-8.

[70] Boissel S, Reish O, Proulx K, Kawagoe-Takaki H, Sedgwick B, Yeo GS, Meyre D, Golzio
C, Molinari F, Kadhom N, Etchevers HC, Saudek V, Farooqi IS, Froguel P, Lindahl T, O'Rahilly
S, Munnich A, Colleaux L: Loss-of-function mutation in the dioxygenase-encoding FTO gene
causes severe growth retardation and multiple malformations. American journal of human
genetics 2009, 85:106-11.

[71] Mauer J, Luo X, Blanjoie A, Jiao X, Grozhik AV, Patil DP, Linder B, Pickering BF,
Vasseur JJ, Chen Q, Gross SS, Elemento O, Debart F, Kiledjian M, Jaffrey SR: Reversible
methylation of m(6)Am in the 5' cap controls mRNA stability. Nature 2017, 541:371-5.

[72] Tang C, Klukovich R, Peng H, Wang Z, Yu T, Zhang Y, Zheng H, Klungland A, Yan W:
ALKBH5-dependent m6A demethylation controls splicing and stability of long 3'-UTR mRNAs
in male germ cells. Proceedings of the National Academy of Sciences of the United States of
America 2017.

[73] Zhang S, Zhao BS, Zhou A, Lin K, Zheng S, Lu Z, Chen Y, Sulman EP, Xie K, Bogler O,
Majumder S, He C, Huang S: m(6)A Demethylase ALKBH5 Maintains Tumorigenicity of
Glioblastoma Stem-like Cells by Sustaining FOXM1 Expression and Cell Proliferation Program.
Cancer cell 2017, 31:591-606 e6.

[74] Zhang C, Samanta D, Lu H, Bullen JW, Zhang H, Chen I, He X, Semenza GL: Hypoxia
induces the breast cancer stem cell phenotype by HIF-dependent and ALKBH5-mediated m(6)A-
demethylation of NANOG mRNA. Proceedings of the National Academy of Sciences of the
United States of America 2016, 113:E2047-56.

[75] Wang X, Zhao BS, Roundtree IA, Lu Z, Han D, Ma H, Weng X, Chen K, Shi H, He C:
N(6)-methyladenosine Modulates Messenger RNA Translation Efficiency. Cell 2015, 161:1388-
99.

[76] Wang X, Lu Z, Gomez A, Hon GC, Yue Y, Han D, Fu Y, Parisien M, Dai Q, Jia G, Ren B,
Pan T, He C: N6-methyladenosine-dependent regulation of messenger RNA stability. Nature
2014, 505:117-20.
76

[77] Li A, Chen YS, Ping XL, Yang X, Xiao W, Yang Y, Sun HY, Zhu Q, Baidya P, Wang X,
Bhattarai DP, Zhao YL, Sun BF, Yang YG: Cytoplasmic m(6)A reader YTHDF3 promotes
mRNA translation. Cell research 2017, 27:444-7.

[78] Shi H, Wang X, Lu Z, Zhao BS, Ma H, Hsu PJ, Liu C, He C: YTHDF3 facilitates
translation and decay of N(6)-methyladenosine-modified RNA. Cell research 2017, 27:315-28.

[79] Xiao W, Adhikari S, Dahal U, Chen YS, Hao YJ, Sun BF, Sun HY, Li A, Ping XL, Lai WY,
Wang X, Ma HL, Huang CM, Yang Y, Huang N, Jiang GB, Wang HL, Zhou Q, Wang XJ, Zhao
YL, Yang YG: Nuclear m(6)A Reader YTHDC1 Regulates mRNA Splicing. Molecular cell
2016, 61:507-19.

[80] Roundtree IA, Luo GZ, Zhang Z, Wang X, Zhou T, Cui Y, Sha J, Huang X, Guerrero L, Xie
P, He E, Shen B, He C: YTHDC1 mediates nuclear export of N(6)-methyladenosine methylated
mRNAs. eLife 2017, 6.

[81] Wojtas MN, Pandey RR, Mendel M, Homolka D, Sachidanandam R, Pillai RS: Regulation
of m(6)A Transcripts by the 3'-->5' RNA Helicase YTHDC2 Is Essential for a Successful
Meiotic Program in the Mammalian Germline. Molecular cell 2017, 68:374-87 e12.

[82] Edupuganti RR, Geiger S, Lindeboom RGH, Shi H, Hsu PJ, Lu Z, Wang SY, Baltissen
MPA, Jansen P, Rossa M, Muller M, Stunnenberg HG, He C, Carell T, Vermeulen M: N(6)-
methyladenosine (m(6)A) recruits and repels proteins to regulate mRNA homeostasis. Nature
structural & molecular biology 2017, 24:870-8.

[83] Arguello AE, DeLiberto AN, Kleiner RE: RNA Chemical Proteomics Reveals the N(6)-
Methyladenosine (m(6)A)-Regulated Protein-RNA Interactome. Journal of the American
Chemical Society 2017.

[84] Abraham G, Rhodes DP, Banerjee AK: The 5' terminal structure of the methylated mRNA
synthesized in vitro by vesicular stomatitis virus. Cell 1975, 5:51-8.

[85] Furuichi Y, Morgan M, Muthukrishnan S, Shatkin AJ: Reovirus messenger RNA contains a
methylated, blocked 5'-terminal structure: m-7G(5')ppp(5')G-MpCp. Proceedings of the National
Academy of Sciences of the United States of America 1975, 72:362-6.

[86] Wei CM, Moss B: Methylated nucleotides block 5'-terminus of vaccinia virus messenger
RNA. Proceedings of the National Academy of Sciences of the United States of America 1975,
72:318-22.

77

[87] Gokhale NS, McIntyre ABR, McFadden MJ, Roder AE, Kennedy EM, Gandara JA,
Hopcraft SE, Quicke KM, Vazquez C, Willer J, Ilkayeva OR, Law BA, Holley CL, Garcia-
Blanco MA, Evans MJ, Suthar MS, Bradrick SS, Mason CE, Horner SM: N6-Methyladenosine
in Flaviviridae Viral RNA Genomes Regulates Infection. Cell host & microbe 2016, 20:654-65.

[88] Kennedy EM, Bogerd HP, Kornepati AV, Kang D, Ghoshal D, Marshall JB, Poling BC,
Tsai K, Gokhale NS, Horner SM, Cullen BR: Posttranscriptional m(6)A Editing of HIV-1
mRNAs Enhances Viral Gene Expression. Cell host & microbe 2016, 19:675-85.

[89] Lichinchi G, Gao S, Saletore Y, Gonzalez GM, Bansal V, Wang Y, Mason CE, Rana TM:
Dynamics of the human and viral m(6)A RNA methylomes during HIV-1 infection of T cells.
Nature microbiology 2016, 1:16011.

[90] Tirumuru N, Zhao BS, Lu W, Lu Z, He C, Wu L: N(6)-methyladenosine of HIV-1 RNA
regulates viral infection and HIV-1 Gag protein expression. eLife 2016, 5.

[91] Lichinchi G, Zhao BS, Wu Y, Lu Z, Qin Y, He C, Rana TM: Dynamics of Human and Viral
RNA Methylation during Zika Virus Infection. Cell host & microbe 2016, 20:666-73.

[92] Courtney DG, Kennedy EM, Dumm RE, Bogerd HP, Tsai K, Heaton NS, Cullen BR:
Epitranscriptomic Enhancement of Influenza A Virus Gene Expression and Replication. Cell
host & microbe 2017, 22:377-86 e5.

[93] Cesarman E, Chang Y, Moore PS, Said JW, Knowles DM: Kaposi's sarcoma-associated
herpesvirus-like DNA sequences in AIDS-related body-cavity-based lymphomas. The New
England journal of medicine 1995, 332:1186-91.

[94] Chang Y, Cesarman E, Pessin MS, Lee F, Culpepper J, Knowles DM, Moore PS:
Identification of herpesvirus-like DNA sequences in AIDS-associated Kaposi's sarcoma. Science
1994, 266:1865-9.

[95] Soulier J, Grollet L, Oksenhendler E, Cacoub P, Cazals-Hatem D, Babinet P, d'Agay MF,
Clauvel JP, Raphael M, Degos L, et al.: Kaposi's sarcoma-associated herpesvirus-like DNA
sequences in multicentric Castleman's disease. Blood 1995, 86:1276-80.

[96] Uldrick TS, Wang V, O'Mahony D, Aleman K, Wyvill KM, Marshall V, Steinberg SM,
Pittaluga S, Maric I, Whitby D, Tosato G, Little RF, Yarchoan R: An interleukin-6-related
systemic inflammatory syndrome in patients co-infected with Kaposi sarcoma-associated
herpesvirus and HIV but without Multicentric Castleman disease. Clinical infectious diseases :
an official publication of the Infectious Diseases Society of America 2010, 51:350-8.

78

[97] Carroll PA, Brazeau E, Lagunoff M: Kaposi's sarcoma-associated herpesvirus infection of
blood endothelial cells induces lymphatic differentiation. Virology 2004, 328:7-18.

[98] Li Y, Zhong C, Liu D, Yu W, Chen W, Wang Y, Shi S, Yuan Y: Evidence for Kaposi's
Sarcoma originating from Mesenchymal Stem Cell through KSHV-induced Mesenchymal-to-
Endothelial Transition. Cancer research 2017.

[99] Hong YK, Foreman K, Shin JW, Hirakawa S, Curry CL, Sage DR, Libermann T, Dezube
BJ, Fingeroth JD, Detmar M: Lymphatic reprogramming of blood vascular endothelium by
Kaposi sarcoma-associated herpesvirus. Nature genetics 2004, 36:683-5.

[100] Jones T, Ye F, Bedolla R, Huang Y, Meng J, Qian L, Pan H, Zhou F, Moody R, Wagner B,
Arar M, Gao SJ: Direct and efficient cellular transformation of primary rat mesenchymal
precursor cells by KSHV. The Journal of clinical investigation 2012, 122:1076-81.

[101] Wang HW, Trotter MW, Lagos D, Bourboulia D, Henderson S, Makinen T, Elliman S,
Flanagan AM, Alitalo K, Boshoff C: Kaposi sarcoma herpesvirus-induced cellular
reprogramming contributes to the lymphatic endothelial gene expression in Kaposi sarcoma.
Nature genetics 2004, 36:687-93.

[102] Lee MS, Yuan H, Jeon H, Zhu Y, Yoo S, Shi S, Krueger B, Renne R, Lu C, Jung JU, Gao
SJ: Human Mesenchymal Stem Cells of Diverse Origins Support Persistent Infection with
Kaposi's Sarcoma-Associated Herpesvirus and Manifest Distinct Angiogenic, Invasive, and
Transforming Phenotypes. mBio 2016, 7:e02109-15.

[103] Cai X, Lu S, Zhang Z, Gonzalez CM, Damania B, Cullen BR: Kaposi's sarcoma-associated
herpesvirus expresses an array of viral microRNAs in latently infected cells. Proceedings of the
National Academy of Sciences of the United States of America 2005, 102:5570-5.

[104] Pfeffer S, Sewer A, Lagos-Quintana M, Sheridan R, Sander C, Grasser FA, van Dyk LF,
Ho CK, Shuman S, Chien M, Russo JJ, Ju J, Randall G, Lindenbach BD, Rice CM, Simon V, Ho
DD, Zavolan M, Tuschl T: Identification of microRNAs of the herpesvirus family. Nature
methods 2005, 2:269-76.

[105] Sarid R, Flore O, Bohenzky RA, Chang Y, Moore PS: Transcription mapping of the
Kaposi's sarcoma-associated herpesvirus (human herpesvirus 8) genome in a body cavity-based
lymphoma cell line (BC-1). Journal of virology 1998, 72:1005-12.

[106] Staskus KA, Zhong W, Gebhard K, Herndier B, Wang H, Renne R, Beneke J, Pudney J,
Anderson DJ, Ganem D, Haase AT: Kaposi's sarcoma-associated herpesvirus gene expression in
endothelial (spindle) tumor cells. Journal of virology 1997, 71:715-9.
79

[107] Zhong W, Wang H, Herndier B, Ganem D: Restricted expression of Kaposi sarcoma-
associated herpesvirus (human herpesvirus 8) genes in Kaposi sarcoma. Proceedings of the
National Academy of Sciences of the United States of America 1996, 93:6641-6.

[108] Moody R, Zhu Y, Huang Y, Cui X, Jones T, Bedolla R, Lei X, Bai Z, Gao SJ: KSHV
microRNAs mediate cellular transformation and tumorigenesis by redundantly targeting cell
growth and survival pathways. PLoS pathogens 2013, 9:e1003857.

[109] Zhu Y, Ramos da Silva S, He M, Liang Q, Lu C, Feng P, Jung JU, Gao SJ: An Oncogenic
Virus Promotes Cell Survival and Cellular Transformation by Suppressing Glycolysis. PLoS
pathogens 2016, 12:e1005648.

[110] Jenner RG, Alba MM, Boshoff C, Kellam P: Kaposi's sarcoma-associated herpesvirus
latent and lytic gene expression as revealed by DNA arrays. Journal of virology 2001, 75:891-
902.

[111] Renne R, Zhong W, Herndier B, McGrath M, Abbey N, Kedes D, Ganem D: Lytic growth
of Kaposi's sarcoma-associated herpesvirus (human herpesvirus 8) in culture. Nature medicine
1996, 2:342-6.

[112] Sun R, Lin SF, Staskus K, Gradoville L, Grogan E, Haase A, Miller G: Kinetics of
Kaposi's sarcoma-associated herpesvirus gene expression. Journal of virology 1999, 73:2232-42.

[113] Ensoli B, Sturzl M: Kaposi's sarcoma: a result of the interplay among inflammatory
cytokines, angiogenic factors and viral agents. Cytokine & growth factor reviews 1998, 9:63-83.

[114] Grundhoff A, Ganem D: Inefficient establishment of KSHV latency suggests an additional
role for continued lytic replication in Kaposi sarcoma pathogenesis. The Journal of clinical
investigation 2004, 113:124-36.

[115] Liu C, Okruzhnov Y, Li H, Nicholas J: Human herpesvirus 8 (HHV-8)-encoded cytokines
induce expression of and autocrine signaling by vascular endothelial growth factor (VEGF) in
HHV-8-infected primary-effusion lymphoma cell lines and mediate VEGF-independent
antiapoptotic effects. Journal of virology 2001, 75:10933-40.

[116] Miles SA, Martinez-Maza O, Rezai A, Magpantay L, Kishimoto T, Nakamura S, Radka
SF, Linsley PS: Oncostatin M as a potent mitogen for AIDS-Kaposi's sarcoma-derived cells.
Science 1992, 255:1432-4.

80

[117] Bais C, Santomasso B, Coso O, Arvanitakis L, Raaka EG, Gutkind JS, Asch AS, Cesarman
E, Gershengorn MC, Mesri EA: G-protein-coupled receptor of Kaposi's sarcoma-associated
herpesvirus is a viral oncogene and angiogenesis activator. Nature 1998, 391:86-9.

[118] Masood R, Cai J, Zheng T, Smith DL, Naidu Y, Gill PS: Vascular endothelial growth
factor/vascular permeability factor is an autocrine growth factor for AIDS-Kaposi sarcoma.
Proceedings of the National Academy of Sciences of the United States of America 1997, 94:979-
84.

[119] Zhou FC, Zhang YJ, Deng JH, Wang XP, Pan HY, Hettler E, Gao SJ: Efficient infection
by a recombinant Kaposi's sarcoma-associated herpesvirus cloned in a bacterial artificial
chromosome: application for genetic analysis. Journal of virology 2002, 76:6185-96.

[120] Meng J, Cui X, Rao MK, Chen Y, Huang Y: Exome-based analysis for RNA epigenome
sequencing data. Bioinformatics 2013, 29:1565-7.

[121] Brulois KF, Chang H, Lee AS, Ensser A, Wong LY, Toth Z, Lee SH, Lee HR, Myoung J,
Ganem D, Oh TK, Kim JF, Gao SJ, Jung JU: Construction and manipulation of a new Kaposi's
sarcoma-associated herpesvirus bacterial artificial chromosome clone. Journal of virology 2012,
86:9708-20.

[122] Nakamura H, Lu M, Gwack Y, Souvlis J, Zeichner SL, Jung JU: Global changes in
Kaposi's sarcoma-associated virus gene expression patterns following expression of a
tetracycline-inducible Rta transactivator. Journal of virology 2003, 77:4205-20.

[123] Du H, Zhao Y, He J, Zhang Y, Xi H, Liu M, Ma J, Wu L: YTHDF2 destabilizes m(6)A-
containing RNA through direct recruitment of the CCR4-NOT deadenylase complex. Nature
communications 2016, 7:12626.

[124] Davis DA, Rinderknecht AS, Zoeteweij JP, Aoki Y, Read-Connole EL, Tosato G, Blauvelt
A, Yarchoan R: Hypoxia induces lytic replication of Kaposi sarcoma-associated herpesvirus.
Blood 2001, 97:3244-50.

[125] Greene W, Gao SJ: Actin dynamics regulate multiple endosomal steps during Kaposi's
sarcoma-associated herpesvirus entry and trafficking in endothelial cells. PLoS pathogens 2009,
5:e1000512.

[126] Hollingworth R, Skalka GL, Stewart GS, Hislop AD, Blackbourn DJ, Grand RJ:
Activation of DNA Damage Response Pathways during Lytic Replication of KSHV. Viruses
2015, 7:2908-27.

81

[127] Xie J, Ajibade AO, Ye F, Kuhne K, Gao SJ: Reactivation of Kaposi's sarcoma-associated
herpesvirus from latency requires MEK/ERK, JNK and p38 multiple mitogen-activated protein
kinase pathways. Virology 2008, 371:139-54.

[128] Covarrubias S, Gaglia MM, Kumar GR, Wong W, Jackson AO, Glaunsinger BA:
Coordinated destruction of cellular messages in translation complexes by the gammaherpesvirus
host shutoff factor and the mammalian exonuclease Xrn1. PLoS pathogens 2011, 7:e1002339.

[129] Chen T, You Y, Jiang H, Wang ZZ: Epithelial-mesenchymal transition (EMT): A
biological process in the development, stem cell differentiation, and tumorigenesis. Journal of
cellular physiology 2017, 232:3261-72.

[130] Moustakas A, Heldin CH: Signaling networks guiding epithelial-mesenchymal transitions
during embryogenesis and cancer progression. Cancer science 2007, 98:1512-20.

[131] Brulois K, Jung JU: Interplay between Kaposi's sarcoma-associated herpesvirus and the
innate immune system. Cytokine & growth factor reviews 2014, 25:597-609.

[132] Lee MS, Jones T, Song DY, Jang JH, Jung JU, Gao SJ: Exploitation of the complement
system by oncogenic Kaposi's sarcoma-associated herpesvirus for cell survival and persistent
infection. PLoS pathogens 2014, 10:e1004412.

[133] Cheng F, Sawant TV, Lan K, Lu C, Jung JU, Gao SJ: Screening of the Human Kinome
Identifies MSK1/2-CREB1 as an Essential Pathway Mediating Kaposi's Sarcoma-Associated
Herpesvirus Lytic Replication during Primary Infection. Journal of virology 2015, 89:9262-80.

[134] Gao SJ, Deng JH, Zhou FC: Productive lytic replication of a recombinant Kaposi's
sarcoma-associated herpesvirus in efficient primary infection of primary human endothelial cells.
Journal of virology 2003, 77:9738-49.

[135] Dominissini D, Moshitch-Moshkovitz S, Salmon-Divon M, Amariglio N, Rechavi G:
Transcriptome-wide mapping of N(6)-methyladenosine by m(6)A-seq based on
immunocapturing and massively parallel sequencing. Nature protocols 2013, 8:176-89.

[136] Arias C, Weisburd B, Stern-Ginossar N, Mercier A, Madrid AS, Bellare P, Holdorf M,
Weissman JS, Ganem D: KSHV 2.0: a comprehensive annotation of the Kaposi's sarcoma-
associated herpesvirus genome using next-generation sequencing reveals novel genomic and
functional features. PLoS pathogens 2014, 10:e1003847.

[137] Bai Z, Huang Y, Li W, Zhu Y, Jung JU, Lu C, Gao SJ: Genomewide mapping and
screening of Kaposi's sarcoma-associated herpesvirus (KSHV) 3' untranslated regions identify
82

bicistronic and polycistronic viral transcripts as frequent targets of KSHV microRNAs. Journal
of virology 2014, 88:377-92.

[138] Majerciak V, Ni T, Yang W, Meng B, Zhu J, Zheng ZM: A viral genome landscape of
RNA polyadenylation from KSHV latent to lytic infection. PLoS pathogens 2013, 9:e1003749.

[139] Pearce M, Matsumura S, Wilson AC: Transcripts encoding K12, v-FLIP, v-cyclin, and the
microRNA cluster of Kaposi's sarcoma-associated herpesvirus originate from a common
promoter. Journal of virology 2005, 79:14457-64.

[140] Tang S, Zheng ZM: Kaposi's sarcoma-associated herpesvirus K8 exon 3 contains three 5'-
splice sites and harbors a K8.1 transcription start site. The Journal of biological chemistry 2002,
277:14547-56.

[141] Yamanegi K, Tang S, Zheng ZM: Kaposi's sarcoma-associated herpesvirus K8beta is
derived from a spliced intermediate of K8 pre-mRNA and antagonizes K8alpha (K-bZIP) to
induce p21 and p53 and blocks K8alpha-CDK2 interaction. Journal of virology 2005, 79:14207-
21.

[142] Kim D, Pertea G, Trapnell C, Pimentel H, Kelley R, Salzberg SL: TopHat2: accurate
alignment of transcriptomes in the presence of insertions, deletions and gene fusions. Genome
biology 2013, 14:R36.

[143] Langmead B, Salzberg SL: Fast gapped-read alignment with Bowtie 2. Nature methods
2012, 9:357-9.

[144] Meng J, Lu Z, Liu H, Zhang L, Zhang S, Chen Y, Rao MK, Huang Y: A protocol for RNA
methylation differential analysis with MeRIP-Seq data and exomePeak R/Bioconductor package.
Methods 2014, 69:274-81.

[145] Krishnamoorthy K, Thomson J: A more powerful test for comparing two Poisson means.
Journal of Statistical Planning and Inference 2004, 119:23-35.

[146] Cui X, Wei Z, Zhang L, Liu H, Sun L, Zhang SW, Huang Y, Meng J: Guitar: An
R/Bioconductor Package for Gene Annotation Guided Transcriptomic Analysis of RNA-Related
Genomic Features. BioMed research international 2016, 2016:8367534.

[147] Bailey TL, Boden M, Buske FA, Frith M, Grant CE, Clementi L, Ren J, Li WW, Noble
WS: MEME SUITE: tools for motif discovery and searching. Nucleic acids research 2009,
37:W202-8.
83

[148] Trapnell C, Hendrickson DG, Sauvageau M, Goff L, Rinn JL, Pachter L: Differential
analysis of gene regulation at transcript resolution with RNA-seq. Nature biotechnology 2013,
31:46-53.

[149] Trapnell C, Williams BA, Pertea G, Mortazavi A, Kwan G, van Baren MJ, Salzberg SL,
Wold BJ, Pachter L: Transcript assembly and quantification by RNA-Seq reveals unannotated
transcripts and isoform switching during cell differentiation. Nature biotechnology 2010, 28:511-
5.

Abstract (if available)

Abstract N⁶-methyladenosine (m⁶A) and N⁶,2'-O-dimethyladenosine (m⁶Am) modifications (m⁶A/m) of messenger RNA mediate diverse cellular functions. Oncogenic Kaposi's sarcoma‐associated herpesvirus (KSHV) has latent and lytic replication phases that are essential for the development of KSHV‐associated cancers. To date, the role of m⁶A/m in KSHV replication and tumorigenesis is unclear. Here, we provide mechanistic insights by examining the viral and cellular m⁶A/m epitranscriptomes during KSHV latent and lytic infection. KSHV transcripts contain abundant m⁶A/m modifications during latent and lytic replication, and these modifications are highly conserved among different cell types and infection systems. Knockdown of the m⁶A ‘reader’ YTHDF2 enhanced lytic replication by impeding KSHV RNA degradation. YTHDF2 binds to viral transcripts and differentially mediates their stability. KSHV latent infection induces 5' untranslated region (UTR) hypomethylation and 3'UTR hypermethylation of the cellular epitranscriptome, regulating oncogenic and epithelial‐mesenchymal transition pathways. KSHV lytic replication induces dynamic reprogramming of epitranscriptome, regulating pathways that control lytic replication. These results reveal a critical role of m⁶A/m modifications in KSHV lifecycle and provide rich resources for future investigations.

Linked assets

University of Southern California Dissertations and Theses

Conceptually similar

PDF

FoxO1 suppresses Kaposi's sarcoma-associated herpesvirus lytic replication and controls viral latency

PDF

An essential role of argininosuccinate synthase 1 in Kaposi’s sarcoma-associated herpesvirus-induced cellular transformation

PDF

Epigenomic analyses of Kaposi's sarcoma-associated herpesvirus

PDF

Regulation of inflammation and angiogenesis by Kaposi’s sarcoma-associated herpesvirus

PDF

Kaposi's sarcoma associated herpes-virus induces cellular proxi expression to modulate host gene expression that benefits viral infection and oncogenesis

PDF

Regulation of acute KSHV infection by SIRT1

PDF

Lymphatic cell environment promotes sustained KSHV lytic replication and viral maintenance

PDF

Kaposi's sarcoma‐associated herpesvirus‐Bcl-2 mediated regulation of NM23-H2 is required for KSHV lytic replication

PDF

Virus customization of host protein machinery for efficient propagation

PDF

The effects of autophagy on hepatitis C virus

PDF

Protein deamidation mediated metabolic reprogramming during KSHV lytic replication

PDF

Study of protein deamidation in innate immune signaling

PDF

The effects of hepatitis C virus infection on host immune response and signaling pathways

PDF

Improving adeno-associated viral vector for hematopoietic stem cells gene therapy

PDF

Molecular strategies towards inhibition of KSHV-associated malignancies

PDF

TLR8-transferred miR-192 acts as a tumor suppressor in neuroblastoma by inhibiting CTCF

PDF

Disrupted ER-to-Golgi trafficking underlies anti-HIV drugs and alcohol induced cellular stress and hepatic injury

PDF

Novel roles for Maf1 in embryonic stem cell differentiation and adipogenesis

PDF

Exosomal inhibitory activity of clinically approved tertiary amines for the treatment of Kaposi’s sarcoma tumorigenesis

PDF

Characterization of three novel variants of the MAVS adaptor

Asset Metadata

Creator Tan, Brandon Jiann Hann (author)

Core Title Viral and cellular N⁶-methyladenosine and N⁶,2'-O-dimethyladenosine epitranscriptomes in the Kaposi’s sarcoma‐associated herpesvirus life cycle

School Keck School of Medicine

Degree Doctor of Philosophy

Degree Program Medical Biology

Publication Date 03/09/2018

Defense Date 02/26/2018

Publisher University of Southern California (original), University of Southern California. Libraries (digital)

Tag cancer,epitranscriptome,KSHV,m⁶A,m⁶Am,N⁶,2'-O-dimethyladenosine,N⁶-methyladenosine,OAI-PMH Harvest,tumorigenesis,viral replication,virus,YTHDF2

Language English

Contributor Electronically uploaded by the author (provenance)

Advisor Ou, James (committee chair), Gao, Shou-Jiang (committee member), Stallcup, Michael (committee member)

Creator Email brandojt@usc.edu,btjh86@gmail.com

Permanent Link (DOI) https://doi.org/10.25549/usctheses-c40-484094

Unique identifier UC11268272

Identifier etd-TanBrandon-6096.pdf (filename),usctheses-c40-484094 (legacy record id)

Legacy Identifier etd-TanBrandon-6096.pdf

Dmrecord 484094

Document Type Dissertation

Rights Tan, Brandon Jiann Hann

Type texts

Source University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Access Conditions The author retains rights to his/her dissertation, thesis or other graduate work according to U.S. copyright law. Electronic access is being provided by the USC Libraries in agreement with the a...

Repository Name University of Southern California Digital Library

Repository Location USC Digital Library, University of Southern California, University Park Campus MC 2810, 3434 South Grand Avenue, 2nd Floor, Los Angeles, California 90089-2810, USA