University of Southern California Dissertations and Theses

The role of insulin-like growth factors in size regulation during embryonic feather development

(USC Thesis Other)

The role of insulin-like growth factors in size regulation during embryonic feather development

PDF

Download a page range

Download transcript

Copy asset link

Request this asset

Transcript (if available)

Content 1

The Role of Insulin-like Growth Factors in
Size Regulation during Embryonic Feather Development

Student: George Wang
Mentor: Ping Wu, Cheng-Ming Chuong
University of Southern California
Department of Pathology
Master of Science (Experimental and Molecular Pathology)
May 2018

2

Table of Contents

Abstract 3

Introduction 4

Materials and Methods 7

Results 13

Discussion 39

Future Direction 43

References 44

3

Abstract

Insulin-like growth factors (IGFs) serve to regulate the size of the overall body as well as
the size of organs, such as the heart and cartilage, during development. However, the
regulatory effects of IGF signaling on the size of skin appendages remains unknown.
We selected the chicken feather model to examine the role of IGF signaling in skin
appendages as the feather is by design malleable in both its size and its composition.
When using the feather bud’s embryonic developmental stages as a model for skin
appendage growth, in situ staining showed upregulation of IGFs and IGF-related
molecules coinciding with the elongation of the embryonic feather buds. IGF
upregulation experiments performed on the developing feather buds exhibited
enlargement of individual appendages as well as the fusion of multiple feather buds into
one single enlarged bud. Attempts to overexpress IGF2 during the early embryonic
stages of chicken development resulted in exceptionally high lethality rates. IGF
receptor inhibition experiments performed on embryonic feather buds exhibited varied
degrees of growth inhibition dependent upon both the developmental stage and
concentration of exposure. Signal inhibition during mid-development most often resulted
in forfeiture of the skin appendage. Exposure to inhibitors during early and late stages of
development resulted in varied degrees of stunted growth. The experiments presented
here demonstrate the critical role of IGF regulation in the size regulation and
development of chicken skin appendages.
4

Introduction

How an organism and its organs’ sizes are regulated has been a persistent question in
biology. The implications of size regulation spans multiple levels of the biological system,
from the individual as a whole down to their component cells and subcellular structural
makeup. Select basal taxa species do sometimes exhibit indeterminate growth, where
the individual continues to grow in size throughout its life, however the majority of
species display a termination of overall growth
1
. Cross-species comparison studies
performed on regulatory mechanisms for cell size and proliferation have demonstrated
functional analogies between species, but these same comparisons become less
genetically homologous when made further down the phylogenic tree
2
. Mammalian
adult body sizes range from the inch-sized adult Kitti’s hog-nosed bat (Craseonycteris
thonglongyai) to the hundred foot-long blue whales (Balaenoptera musculus), with both
of these species developing from eggs of roughly the same size
3
. This phenomenon
suggests that size regulation is tightly controlled, where individuals within a species
having an expected size range.

Growth hormone (GH) and insulin-like growth factors (IGF) have been suspected to be
the key determinants of mammalian body size
4
. Though a definitive picture has not yet
been established, research has pointed towards intricate interactions between GH and
IGFs in regulating the size of targeted tissues
5, 6
. The Somatomedin Hypothesis
postulates that GH-stimulated hepatic production of IGF1 is a key regulator of size
determination
7
. Hepatic IGF1 constitutes over 70% of the body’s IGF1 production and is
the primary source of serum IGF1. IGF1-KO mice models have demonstrated the
necessity of IGF1 in pre- and post-natal growth, however liver-specific IGF1-KO mice
models demonstrated that hepatic-derived circulating IGF1 was not absolutely
necessary for post-natal growth regulation
8, 9
. This suggests that local production of IGF
is sufficient for regulatory purposes
10, 11
. However, depending on the tissue, IGF2 may
be an essential biochemical ligand. Mouse studies demonstrated the importance of
IGF2 for skeletal development during embryogenesis
12, 13
, and zebrafish studies have
5

demonstrated its key function in myocardial development and regeneration
14
. Both IGF1
and IGF2 serve as a ligand for IGF1R, IGF2R, and the insulin receptor, through which
the binding cell’s receptor makeup may account for the varied biological responses
observed between different cell types and individual entities
15
.

The IGF signaling cascade facilitates cell proliferation. Activation of IGF1R triggers the
signaling cascade of Ras-Raf-MEK-MAPK/ERK through insulin receptor substrate
(IRS)-dependent phosphorylation
16
. Through the Sarc Homology 2 domain of the
IGR1R, a guanine nucleotide exchange factor activates Ras, which triggers the
phosphorylated activation of downstream kinases. MAPK/ERK 1/2 then enter the
nucleus to phosphorylate and activate transcription factors which lead to increased
cyclin D1 expression, reduced p21 and p27 expression, and ultimately cell
proliferation
17
. Activation of IGF1R also recruits PI3K, which leads to Akt activation. This
pathway inactivates pro-apoptotic factors and activates mTOR, promoting cell survival
and proliferation
16, 18
.Triggering these signaling cascades may result in cellular
proliferation or differentiation. Activated IGF1Rs in bone cells recruit downstream IRS1
and IRS2 for increased rates of bone formation or increased rates of bone resorption,
respectively
19, 20
. This allows the same signal molecule to be recycled amongst different
cell types to achieve different specializations and in turn promotes the hypothesis of
localized production and regulation of the IGF molecules
21
.

The feather model is an effective means for uncovering clues to answering the question
of growth regulation. While considered the most complex epidermal appendage found
on animals due to the feather varieties observed both across different species and upon
the same individual, the stem cells from which these feathers originate share the same
lineage
22
. These stem cells experience different environmental cues which result in the
various mature feather phenotypes we observe
23
. Graded responses to multiple inputs
lends phenotypic flexibility, allowing the basic feather model to be utilized for a myriad of
phenotype manipulation studies
24
.
6

From a previous study we found IGF2 mRNA to be upregulated in the dorsal feather
buds of E8 and E9 chicken embryos, coinciding with the developmental phase where
feather follicles begin their elongation growth process. Here we examined the in situ
expression patterns for IGF1, 2, IGF1R, IGF2R, the IGF1 binding proteins 1, 3, 5, and
IGF2 binding protein 2 to hypothesize possible roles being fulfilled by each molecule.
We performed skin explant studies of IGF2 overexpression and IGF1R inhibition to
induce promotion and inhibition of feather bud growth respectively, observing for
appendage enlargement and growth inhibition respectively. We also performed viral
injection of chicken embryos with the mIGF2 RCAS vector for a functional study,
observing skin appendage enlargement and partial fusion between multiple skin
appendage buds. With the experimental data presented in this thesis, we hope to
provide additional insight on the role of IGF signaling for developing skin appendages.

7

Materials and Methods

Chicken Embryos
Charles River specific pathogen-free (SPAFAS) eggs were used in retroviral infection
experiments
25
. Los Angeles local farm eggs were used in the embryonic in situ and skin
explant experiments
26, 27
. All chicken eggs were incubated in a 38°C and staged
according to the Hamburger-Hamilton stages before use
28
.

Tissue Preservation
Samples were fixed in 4% paraformaldehyde at 4°C overnight and then sequentially
dehydrated in 25%, 50%, 75%, and 100% MeOH for 30 minute intervals, or until
samples stopped floating in solution, at 4°C. Dehydrated samples were stored at -20°C.

Primer Design
National Center for Biotechnology Information (NCBI) primer design tools was used in
designing and blasting of primers. The promotor sequence of T7 RNA polymerase was
added to the 5’ end of the antisense primer, SP6 RNA polymerase to that of the sense
primer. Primer sequences used are as shown in Table 1.

Probe Design
Select genes were cloned from chicken embryonic cDNA using primers with the T7
promotor sequence (Table 1, page 12). Purified PCR products were transcribed with T7
RNA polymerase for the antisense probe if in reverse sequence and with the SP6 RNA
polymerase if in forward sequence. Probes were labeled with digoxigenin.

Whole Mount in situ Hybridization
Samples were rehydrated in 75%, 50%, 25%, and 0% methanol in PBS for 30 minute
intervals, or until samples stopped floating in solution. Samples were then treated with
8

6% H2O2 in PBT, 10µg/mL Proteinase K, and 0.2% glutaraldehyde/4% PFA in PBT for
20 minutes with PBT rinses in between treatments. Samples were then normalized in
prehybridization buffer for 2 hours and then incubated with a digoxigenin-labeled probe
at 65°C overnight (25mL formamide, 12.5mL 20X SSC, 50µL Tween-20, 1mL tRNA
(10mg/mL), 500µL 500mM EDTA, 250µL heparin (10mg/mL), 1g blocking reagent, fill to
50mL with DEPC. Shake at 60°C until components dissolve). Half of the pre-
hybridization buffer was then replaced with pre-warmed 65°C 2x SSC and agitated at
65°C for 10 minutes, repeated twice times. Solution was then changed to 65°C 2x SSC
and agitated at 65°C for 20 minutes, repeated twice. Solution was then changed to 65°C
0.2x SSC and agitated at 65°C for 20 minutes, repeated once. Samples were then pre-
blocked with 20% heat inactivated goat serum (inactivate at 65°C for 30 minutes).
Antibody against digoxigenin was then applied at 4°C overnight. Samples were then
washed with PBT containing 1mM Levamisole at room temperature for 1 hour, repeated
at least four times. Samples were then washed in NTMT for 15 minutes, repeated once
(2.5mL 2M Tris-HCl (pH9.5), 1.25mL 2M MgCl2, 1mL 5M NaCl, 12mg Levamisole, 50µL
tween-20, fill to 50mL with dH2O). Samples immersed in NTMT solution were incubated
with 4.5µL NBT and 3.5µL BCIP per mL NTMT solution for color development. A PBS
wash was used to stop the reaction once the desired signal intensity was achieved.
Samples were then dehydrated though a MeOH series, rehydrated, and stored in 50%
glycerol in PBS at 4°C.
Section in situ Hybridization
Sample slides with 16µm sections were incubated in a wet box at 65°C for 10 minutes,
then allowed to cool down to room temperature. Slides were dewaxed twice with xylene
for 10 minutes, then rehydrated with 95%, 80%, 50%, 25% ethanol diluted in DEPC H2O
for 2 minutes, and rinse in PBS or PBT for 5 minutes twice. Slides were then treated
with 5µg/mL Proteinase K in PBT for 10 minutes, followed with two washes in PBT or
PBS for 5 minutes. Slides were then refixed with fresh 4% PFA in PBS for 20 minutes,
and washed twice in PBT or PBS for 5 minutes. Slides were acetylated in 0.1
Triethanolamine buffer (pH8.0) for 10 minutes at room temperature, then rinsed with
0.25% acetic anhydride in 0.1M Triethanolamine buffer for 10 minutes at room
temperature, and then washed with 2x SSC for 10 minutes at room temperature. Slides
9

were then dehydrated at room temperature with ethanol at 25%, 50%, 80%, 95% for 5
minutes, and then twice with 100% ethanol for 5 minutes. The slides were then left to air
dry for at least 1 hour. 150µL of prehybridization solution containing 1~3µL of
designated probe was then added to the top of each slide, entirely covering the
sample(s) of interest. A Hyperslip (hybridization cover) was added on top of each slide
and the slides were incubated in the wet box at 65°C overnight. The wet box was sealed
with plastic wrap to minimize drying issues caused by evaporation of solution.
Coverslips were floated off the next day in a 50mL tube immersed in prewarmed 2x
SSC. The slides were then washed three times with prewarmed 2x SSC at 65°C for 10
minutes, then three times again with prewarmed 0.2x SSC at 65°C for 10 minutes.
Slides were then washed twice with PBT at room temperature. A pap pen was used to
draw circles around each sample, and preblocking was performed with 20% goat serum
in PBT for 2 hours at room temperature. While the slides were preblocking, anti-DIG-AP
antibody (1:1000 dilution) was preabsorbed in 20% goat serum in PBT at room
temperature for 2 hours as well. The anti-DIG-AP antibody solution was added to the
slides and incubated at 4°C overnight in the wet box. Plastic wrap was used to minimize
moisture loss from evaporation. The following day the slides were washed four times
with PBT containing 1mM levamisol at room temperature for 30 minutes. Two washes
with NTMT for 5 minutes each followed. NBT/BCIP/NTMT(4.5µL/3.5µL/1mL) solution
was added to the slides and left to develop color in the wet box for 1~72 hours. The
reaction was stopped by washing the slide with PBS. Optional counterstaining was done
by rinsing the slide with 2% eosin in water for 20 seconds, then rinsing with 95% ethanol,
100% ethanol, and xylene for 5 minutes. Slides were then mounted with a coverslip in
mounting medium and left to air dry for 3 hours.

Skin Explant Bead Preparation
27
Affi-Gel Blue Beads (Bio-Rad, 100-250µm diameter) were washed in 5x volume sterile
PBS at room temperature by short centrifugation, repeated twice. Approximately 100
beads were added to 5µL aliquots of BSA, FGF4, NVP-AEW541, and AG1024
respectively. Beads were stored in 4°C for up to 1 week. Beads were used within 12
10

hours after being immersed in desired solution, and was incubated briefly at 37°C prior
to use.

Chicken Embryo Skin Explant
27
Eggs are incubated in a humidified incubator at 38°C and staged according to
Hamburger and Hamilton
26
.Eggs are cleaned externally with 70% ethanol in dH2O,
cracked open with spatula and forceps, and the embryo is relocated to a 60-mm dish
with Hank’s buffered saline solution (HBSS, Gibco). Care is given to avoid having shell
fragments enter the egg interior. The embryonic head is removed with surgical scissors
and the embryonic torso is gently shaken in a separate dish filled with HBSS to wash
away excess blood residue before being moved into a 60-mm dish with HBSS. Two
longitudinal cuts are made along the flank region parallel to the midline. From the neck,
the dorsal skin flap is gently peeled towards the posterior. Extra care is taken at the
cervical and thoracic region due to strong muscle attachments in this region. Upon
reaching the sacral end, a transverse cut is made to finish the skin explant harvest.
Extra muscle tissue that remains attached to the epidermis was removed using a
watchmaker’s forceps. Extra care was taken to avoid tearing the skin sample during this
process. Completed skin explants were kept chilled in HBSS on an ice block for up to
an hour. The skin explants were then transplanted onto a 0.45µm culture insert, with up
to three explants per insert. 1.5mL of DMEM with 10% bovine serum, 2% chicken serum,
and 1% antibiotic was used to culture the explants for 48 hours at 37°C in 5% CO2
environmental conditions. Prolonged experiments saw the removal and re-addition of
culture media at least once every 72 hours. Compounds added to the explants included
recombinant mouse IGF2 (BioSource MBS953827) and the IGF1R inhibitors NVP-
AEW541 and AG-1024 (Caymen Chemicals #13641 and #14833).

11

Culturing Chicken Embryonic Fibroblast DF-1
DF-1 chicken fibroblast cells were rapidly thawed from liquid nitrogen storage and
cultured on 10cm culture plates (Falcon) in DMEM with 10% bovine serum and 2%
chicken serum. Cells were incubated at 37°C with 5% CO2. Cells were passaged 1:4
upon reaching 90% confluence.

Virus Collection
At 70% confluence, DF-1 cells were transfected with the RCAS-mIGF2 vector. The
RCAS-IGF2 plasmids used were designed using the method according to Jiang et. al.
29
,
and were provided by Dr. Daniel W. Fults of the University of Utah, School of Medicine
30
.
Verification of the insert was performed using the forward sequencing primer
RCAS6995 (5’-GACTCTGCTGGTGGCCTCGCGTAC-3’). The RCAS vector backbone
used was the replication-competent ALV splice-acceptor RCAS vector, derived from the
avian retrovirus ALV (subgroup A). Culture dishes were passaged at 1:4 upon reaching
full confluence. Culture media was switched to low serum (DMEM 1% bovine serum and
0.2% chicken serum). Media was collected and replaced every 24 hours for 72 hours,
filtered through a 0.45µm filter, and ultra-centrifuged at 26,000 G. Resulting supernatant
was removed and 200µL DMEM was added to the pellet. After gentle agitation of the
pellet, resulting solution was stored in 40µL aliquots at -80°C.

Virus Titer
DF-1 cells were seeded on Millicell 8-well glass and infected with Rous sarcoma virus at
40% confluence. Virus was diluted to 10
-4
, 10
-5
, and 10
-6
, representing 10
7
, 10
8
, and 10
9

IU/mL respectively. Cell cultures were then incubated at 37°C with 5% CO2 until
confluence or 48 hours. Cells were then fixed in 4% PFA and treated with H2O2. The
antibody AMV-3C2 was used to semi-quantify the viral titer.

12

Virus Injection
40µL aliquots of the virus were thawed at 37°C and mixed with 5µL Fast Green dye.
Approximately 3µL of the RCAS-mIFG2 solution was injected into each E3 chicken
embryo (HH20~21) at the desired location in sets of 20 embryos using 1, 1/10, 1/100,
and 1/1000 dilutions.
Injections of the RCAS-IGF2 virus were performed by Dr. Ping Wu of the University of
Southern California, Department of Pathology.

13

Results

I. Gene expression pattern.
With the intent to map the distribution of target gene products, the following mRNA
probes were designed to conduct in situ hybridization (Table 1).
Gene Forward Primer Backward Primer
IGF-1 ATGGAAAAAATCAACAGTCT TTACATTCTGTAGTTTCTGT
IGF-2 ACACTGCAGTTCGTCTGTGG CCCTCCTTGCTTGTGTCAGT
IGF-1R ATGAAGTCTGGCGCTGGAGG TCAGCAGGCCGAAGACTGGG
IGF-2R GCTGGATGTGAAGCAGACAA CATCAGTAGCAGCCTGTGGA
IGF-BP1 CGTGCACACAAGAGAAGCTG CTTCTCTGCTGAGCCTTTGC
IGF-BP3 CAGCCCTGCGGTATCTACAC CATATCCAGGAAGCGGTTGT
IGF-BP5 CTGGGTTCCTTCGTTCAGTG ATCCTCTGGCTGCTCTTCAG
IGF-2-BP2 GTCAATCAACAGGCCAACCT TTTTGCCACCTTTGCCTATC
Table 1. Whole mount in situ hybridization primers.
The in situ hybridization was performed on E7, E8, and E9 chicken embryos, with
sectioning performed on select E9 embryos, which exhibited a strong signal. SIX2
served as a positive control and TBX15 served as a negative control (Figure1). Their
signal, or lack thereof, served as a reference when evaluating the IGF in situ staining
results.

Scale bar represents 200µm.
Figure 1. Control for positive and negative in situ hybridization staining. Panel A is an in
situ staining of an E9 chicken embryo using a Six2 probe. Panel B is an in situ staining of
an E9 chicken embryo using no probe.
14

Scale bar represents 100µm.
Figure 2-A. IGF1 whole mount in situ hybridization of E7, E8, and E9 chicken
embryos. Panels A, B, and C depict the dorsal skin region. Panels D, E, and F
depict the femoral skin region. Panels G, H, and I depict the wing feather region.
Panels J, K, and L depict the tail feather region. Panels A, D, G, and J show the
early bud stages. Panels B, E, H, and K show the short bud stages. Panels C, F, I,
and L show the long bud stages.

15

Scale bar represents 10 µm.
Figure 2-B. IGF1 section in situ hybridization of E9 chicken embryo. Panels A, B,
and C depict the dorsal region. Panels D, E, and F depict the ventral region.
Panels G, H, and I depict the wing region. Panels J, K, and L depict the tail region.

16

The IGF1 whole mount in situ hybridization did not exhibit a strong signal in the chicken
embryonic feathers at the dorsal, femoral, or tail regions in the early bud stage (Figure
2-A A, D, G, J). Faint signals were detected in the dorsal, femoral, and tail regions in the
short bud stage (Figure 2-A B, E, K). Some signal was observed in the wing region in
the early bud and long bud stages (Figure 2-A H, I). The increasing presence over time
suggests that IGF1 signaling becomes more important during the elongation stages of
the developing feather bud and plays a lesser role in the stages establishing the feather
placode formation.
The section in situ hybridization exhibited a consistent signal in the epithelial layer. A
concentration of signal was observed within the mesenchyme of the developing
embryonic feather bud, which appeared to be stronger towards the posterior end of the
feather bud (Figure 2-B C, F). The epithelial signal appeared consistent in the bud and
the interbud regions (Figure 2-B B, K). This pattern suggests that the IGF1 signal
promotes local growth, with mesenchymal signal focused in the feather bud
mesenchyme, specifically the apical tip of the developing embryonic feather bud. The
epithelial layer is continuously growing to accommodate the growing chicken embryo,
thus the consistent presence of IGF1 signal in the interbud epithelium and the feather
epithelium.

17

Scale bar represents 100µm.
Figure 3-A. IGF2 whole mount in situ hybridization of E7, E8, and E9 chicken
embryos. Panels A, B, and C depict the dorsal skin region. Panels D, E, and F
depict the femoral skin region. Panels G, H, and I depict the wing feather region.
Panels J, K, and L depict the tail feather region. Panels A, D, G, and J show the
early bud stages. Panels B, E, H, and K show the short bud stages. Panels C, F, I,
and L show the long bud stages.

18

Scale bar represents 10 µm.
Figure 3-B. IGF2 section in situ hybridization of E9 chicken embryo. Panels A, B,
and C depict the dorsal region. Panels D, E, and F depict the ventral region.
Panels G, H, and I depict the wing region. Panels J, K, and L depict the tail region.

19

The IGF2 whole mount in situ hybridization exhibited signal in the early bud stage of the
chicken embryonic feather in the dorsal, femoral, wing, and tail regions (Figure 3-A A, D,
G). This signal intensifies into the short bud stage of development (Figure 3-A B, E, H,
K) and persists into the long bud stage (Figure 3-A C, F, I, L). The in situ signal
concentrated locally at the apical tip of the developing feather bud in all observed
regions. This characteristic persists into the long bud stage of feather development. The
pattern shifts over time suggest IGF2 becomes increasingly important as the developing
feather bud progresses from its initial growth and development stages into the
elongation stages. The signal’s persistence at the tip of the elongating feather buds and
absence in the interbud region and lower regions of the developing feather bud suggest
IGF2 signals where elongation of the feather bud will occur. When considered alongside
the in situ pattern for IGF1, it is likely that IGF2 is the major signal molecule for IGF
signaling during the observed phases of embryonic feather bud development.
The section in situ hybridization exhibited a consistent signal in the epithelial layer
(Figure 3-B B, K). However, a very distinct signal was also observed in the apical
posterior region of the feather bud mesenchyme (Figure 3-B C, F, I L). An unlabeled
layer of cells separates these two signals (Figure 3-B C, E, L). There did not appear to
be significant pattern differences between the dorsal, ventral, or tail section samples
that we observed. The wing sample showed a weaker epithelial staining in comparison.
The cross section data’s consistent pattern suggests the IGF2 ligand is tightly regulated
to local regions of growth, specifically at apical regions of the feather bud mesenchyme,
regulating the expansion of the developing feather bud. The layer of cells with no signal
between the mesenchyme and epithelial cells suggest a tightly regulated system, which
in turn prevents the feather bud from growing the random directions. This also suggests
the existence of an upstream regulatory mechanism which activates IGF2 production.

20

Scale bar represents 100µm.
Figure 4-A. IGF1R whole mount in situ hybridization of E7, E8, and E9 chicken
embryos. Panels A, B, and C depict the dorsal skin region. Panels D, E, and F
depict the femoral skin region. Panels G, H, and I depict the wing feather region.
Panels J, K, and L depict the tail feather region. Panels A, D, G, and J show the
early bud stages. Panels B, E, H, and K show the short bud stages. Panels C, F, I,
and L show the long bud stages.

21

Scale bar represents 10 µm.
Figure 4-B. IGF1R E9 section in situ hybridization of E9 chicken embryo. Panels A,
B, and C depict the dorsal region. Panels D, E, and F depict the ventral region.
Panels G, H, and I depict the wing region. Panels J, K, and L depict the tail region.

22

The IGF1R whole mount in situ hybridization exhibited no significant signal in the early
bud stage of the chicken embryonic feather in the dorsal, femoral, wing, or tail regions
(Figure 4-A A, D, G, J). A signal is observed in the apical region of the dorsal, femoral,
and wing regions in the short bud stage of development (Figure 4-A B, E, H). This signal
appeared to persist through the long bud stage (Figure 4-A C, F, I). Some signal is
observed in the tail region in the long bud stage of development (Figure 4-A L). IGF1R
is capable of binding both IGF1 and IGF2. With IGF1 mRNA’s first appearance and
IGF2’s mRNA upregulation coinciding with the upregulation of IGF1R mRNA production,
this suggests that the short bud stage is when the IGF signaling begins playing a key
role in embryonic feather development.
The section in situ hybridization exhibited a consistent signal in the epithelial
layer(Figure 4-B C, F, I, L). Concentration of signal was observed within the
mesenchyme of the developing feather bud, with the signal penetrating deeper in the
mesenchyme towards the posterior end of the bud (Figure 4-B C, F). This pattern is
reminiscent of the IGF1 section in situ pattern (Figure 2-B C, F). Combined with the
pattern from the IGF2 section in situ, it can be inferred that IGF2 is the dominant IGF1R
binding ligand of the feather mesenchyme at the developing tip, whereas in the
epithelium either IGF1 or IGF2 could be the dominant binding ligand to IGF1R.

23

Scale bar represents 100µm.
Figure 5-A. IGF2R whole mount in situ hybridization of E7, E8, and E9 chicken
embryos. Panels A, B, and C depict the dorsal skin region. Panels D, E, and F
depict the femoral skin region. Panels G, H, and I depict the wing feather region.
Panels J, K, and L depict the tail feather region. Panels A, D, G, and J show the
early bud stages. Panels B, E, H, and K show the short bud stages. Panels C, F, I,
and L show the long bud stages.

24

Scale bar represents 10 µm.
Figure 5-B. IGF2R section in situ hybridization of E9 chicken embryo. Panels A,
B, and C depict the dorsal region. Panels D, E, and F depict the ventral region.
Panels G, H, and I depict the wing region. Panels J, K, and L depict the tail
region.

25

The IGF2R whole mount in situ hybridization exhibited no significant signal in the early
and short bud stages of the chicken embryonic feather in the dorsal, femoral, wing, or
tail regions (Figure 5-A A, D, G, J). Signal is observed at the short bud stage in the wing
region (Figure 5-A H). Signal is observed in the long bud stage for the dorsal, femoral,
and tail regions (Figure 5-A C, F, L). The signal appears weaker in contrast to the
IGF1R signal (Figure 4-A C, F, H, L). As IGF2R is most commonly associated with the
lysosomes’ degradation of IGF1 and IGF2, its lack of presence at a time when the IGF
signals are being upregulated appears logical.
The section in situ hybridization exhibited a consistent signal in the epidermal layer
(Figure 5-B C, F, I, L). Some concentration of signal was observed within the
mesenchyme of the developing feather bud, with more signal positioned towards the
posterior end of the bud (Figure 5-B C, F). The signal’s position overlaps with the in situ
pattern of IGF1 and IGF2 (Figure 2-B C, F; Figure 3-B C, F). This points to localized
upregulation and downregulation of IGF signaling, with the upregulatory elements
predominating the downregulatory elements at the long bud stage of embryonic feather
bud development.

26

Scale bar represents 100µm.
Figure 6-A. IGFBP3 whole mount in situ hybridization of E7, E8, and E9 chicken
embryos. Panels A, B, and C depict the dorsal skin region. Panels D, E, and F
depict the femoral skin region. Panels G, H, and I depict the wing feather region.
Panels J, K, and L depict the tail feather region. Panels A, D, G, and J show the
early bud stages. Panels B, E, H, and K show the short bud stages. Panels C, F, I,
and L show the long bud stages.

27

Scale bar represents 10 µm.
Figure 6-B. IGFBP3 section in situ hybridization of E9 chicken embryo. Panels A,
B, and C depict the dorsal region. Panels D, E, and F depict the ventral region.
Panels G, H, and I depict the wing region. Panels J, K, and L depict the tail
region.

28

The IGFBP3 whole mount in situ hybridization exhibited no significant signal in the early
and short bud stages of the chicken embryonic feather in the dorsal, femoral, wing, nor
tail regions (Figure 6-A A, D, G, J; Figure 6-A B, E, H, K). A signal was observed in the
long bud stage of the dorsal and tail regions (Figure 6-A C, L). This is surprising as
IGFBP3 is the most commonly associated binding protein with serum IGF1 and IGF2,
found in ~80% of bound IGFs complexed with IGF-ALS to form a protein complex
resistant to degradation. This may suggest that the upregulated production of IGF1 and
IGF2 in the apical regions of developing embryonic feather buds are intended for local
short term use, and therefore extending its effective range and duration are
unnecessary energy costs to the individual. If true, this also suggests that continuous
production of the IGF signal molecules through the three studied stages of embryonic
feather development is evolutionarily more fit than alternatives such as IGF binding
protein production coupled with IGF downregulatory effects in non-target cells.
The section in situ hybridization consistently exhibited no epithelial signal (Figure 6-B B,
E, H, K). However, some weak mesenchymal signal is observed in the dorsal and tail
regions, with slight concentration at the apical region (Figure 6-B C, L). This pattern is
similar to that of IGF1 and IGF2 (Figure 2-B C, F; Figure 3-B C, F), but does not exhibit
the consistency across difference body regions as observed in IGF1 and IGF2. Further
refinement of the protocol to specifically IGFBP3 may yield additional insight.
29

Scale bar represents 200µm.
Figure 7. IGFBP1 whole mount in situ hybridization of E7, E8, and E9 chicken
embryos. Panels A, B, and C depict the dorsal view. Panels A`, B`, and C` depict
close up views of Panels A, B, and C respectively. Panels D, E, and F depict the
lateral view. Panels G, H, and I depict a close up view of the femoral region.
Panels A, A`, D, and G are E7 embryos. Panels B, B`, E, and H are E8 embryos.
Panels C, C`, F, and I are E9 embryos.
The IGFBP1 whole mount in situ hybridization exhibited no significant signal in the early
and short bud stages of the chicken embryonic feather in the dorsal and femoral regions
(Figure 7 A’, B’, D’, E’). Some signal is observed in the femoral region at the long bud
stage of development (Figure 7 F’).
30

Scale bar represents 200µm.
Figure 8. IGFBP5 whole mount in situ hybridization of E7, E8, and E9 chicken
embryos. Panels A, B, and C depict the dorsal view. Panels A`, B`, and C` depict
close up views of Panels A, B, and C respectively. Panels D, E, and F depict the
lateral view. Panels G, H, and I depict a close up view of the femoral region.
Panels A, A`, D, and G are E7 embryos. Panels B, B`, E, and H are E8 embryos.
Panels C, C`, F, and I are E9 embryos.
The IGFBP5 whole mount in situ hybridization exhibited no significant signal in the early
and short bud stages of the chicken embryonic feather in the dorsal and femoral regions
(Figure 8 A’, B’, D’, E’). Some signal is observed in the dorsal region at the long bud
stage of development (Figure 8 C’).
31

Scale bar represents 200µm.
Figure 9. IGF2BP2 whole mount in situ hybridization of E7, E8, and E9 chicken
embryo. Panels A and B depict the dorsal view. Panels A` and B` depict close up
views of Panels A and B respectively. Panels C and D depict the lateral view.
Panels E and F depict a close up view of the femoral region. Panels A, A`, C, and
E are E7 embryos. Panels B, B`, D, and F are E8 embryos.
32

The IGF2BP2 whole mount in situ hybridization exhibited no significant signal in the
early and short bud stages of the chicken embryonic feather in the dorsal and femoral
regions (Figure 9 A’, B’, C’, D’).

II. Chicken embryonic skin explant

Scale bar ticks represent 1mm.
Figure 10. E7 chicken embryonic skin explant with mouse recombinant IGF2 in
media. Panels A, B, and C depict initial addition of 0.5µg/mL mIGF2 in culture
media. Panels D, E, and F depict 24h post-addition of mIGF2 in culture media.
Panels G, H, and I depict 48h post-addition of mIGF2 in culture media.
The introduction of 0.5µg/mL of recombinant mIGF2 to the culture media did not appear
to significantly affect the phenotype of the developing feather buds in their early, short,
or long bud stages. Both the quantity and size of the feather buds were not significantly
different from the control (Figure 10 G, H, I). A higher concentration may be necessary
to induce significant phenotype deviation from the norm.
33

Scale bar represents 1mm.
Figure 11. Skin explants treated with 100µM IGF1R inhibitor beads and then
cultured for 48 hours. Panels A and A` depict 48h of culturing after initial
introduction of the inhibitor beads to an E6.5 chicken embryo dorsal skin explant.
Panels B and B` depict 48h of culturing after addition of the inhibitor beads to an
E7.5 chicken embryo dorsal skin explant. Panels C and C` depict 48h of culturing
after adding the inhibitor beads to an E8.5 chicken embryo dorsal skin explant.
Panels A, B, and C depict an overview of the explant. Panels A`, B`, and C` depict
a close up view of the explant.
The inhibitor lost approximately half of its potency after 24 hours of being incubated at
37°C.
When the inhibitor was applied to the E6.5 dorsal skin explant, during the early bud
stage, the feather buds were able to develop to their long bud stage with no significant
phenotype change (Figure 11 A’). Size and quantity of the feather buds appeared to not
be significantly different from the control.
When the inhibitor was added to the E7.5 skin explant, during the short bud stage, the
feather buds regressed and development did not occur (Figure 12 B’). The placode
formations were still observed in most cases, and when a feather bud developed its
phenotype was stunted and did not exhibit the elongation characteristics of the long bud
stage.
34

When the inhibitor was introduced to the E8.5 dorsal skin explant, during the long bud
stage, the feather buds did not appear to elongate (Figure 11 C’). The developing
feature buds did not elongate and appeared to experience a net reduction in size, but
did not regress as significantly as the E7.5 group.

Scale bar represents 1mm
Figure 12. E8.5 skin explants treated with IGF1R and AG-1024 inhibitors at
specified concentrations for 48 hours. Panels A, B, C, and D depict an overview of
the explant. Panels A`, B`, C`, and D` depict a close up view of the explant.
The inhibitor exhibited a gradient effect dependent on the concentration of drug the long
feather buds were exposed to. When exposed to 10µM and 50µM beads of NVP-
AEW541, the feather buds were able to avoid significant growth inhibition, with the
50µM treatment phenotype appearing slightly rounder than the 10µM treatment (Figure
12 A’, B’). When exposed to 100µM beads of NVP-AEW541, the feather buds failed to
elongate and remained in the short bud stage (Figure 12 C’). When 50µM of AG-1024
was added to the surface of the developing long feather bud, the protruding feather
buds disappeared and dark coloration is observed at the initial placode formation
(Figure 12 D’).
Taken together, Figures 11 and 12 indicate that the short bud stage is an important
phase for IGF signaling. The IGF1R inhibited phenotype is the most severe at this stage,
regardless of the method of inhibition.
35

III. RCAS

Figure 13. E14 chicken embryo injected with RCAS-IGF2 in the left leg.
The first test group of E3 embryos injected with the RCAS-IGF2 virus experienced a
high mortality rate, with only one embryo out of 50+ surviving past E9. At E14, the
embryo exhibited an abnormal phenotype at the base of its wing feathers. Each feather
developed an enlarged base external to the epidermis. The rest of the feather appeared
normal in phenotype.
36

Figure 14. E12 RCAS-IGF2 infected and control chicken wing. Panel A depicts the
overview of the RCAS-IGF2 and control wing samples. Panels B and C depict a
magnified view of the wings.
We injected 30 embryos with the lowest viral titer in the right wing bud at E4. The
majority of embryos perished by E6-E7, with only one surviving to E12. In the RCAS-
IGF2 infected specimen, abnormally shaped feather follicles were observed in the flight
feather region. Under higher magnification the abnormal feather follicles exhibit rounder,
wider tips and shorter feather lengths than their control counterpart (Figure 14 B, C).
The number of feather follicles did not appear to significantly differ between the control
and the IGF-upregulated sample.
37

Figure 15. E12 HE staining of E12 RCAS-IGF2 infected chicken wing feather
follicles. Panels A and A` depict the control group. Panels B, B`, C, C`, D, and D`
depict the RCAS-IGF2 infected group. Panels A`, B`, C`, and D` depict magnified
views of panels A, B, C, and D respectively.
HE staining of the RCAS-IGF2 infected feather follicles exhibited varying degrees of
follicular fusion in comparison to the control sample (Figure 15 A’, B’, C’).
38

Figure 16. AMV and
Shh staining of E12
RCAS-IGF2 infected
chicken wing feathers.
Panels A and B depict
AMV staining. Panels
C, D, and E depict Shh
staining. Panels A, C,
and E depict RCAS-
IGF2 infected tissue.
Panels B and D depict
the control sample.

The AMV-32C immunostained RCAS-IGF2 and Control samples demonstrated that the
RCAS infection is primarily in the dermis (Figure 16 A). In contrast, the control sample
exhibited no significant staining for the RCAS virus (Figure 16 B). Staining was
performed for Shh in both longitudinal and cross sectional planes. Abnormal branching
of feather filaments were observed in both RCAS-IGF2 samples in comparison to the
Control sample (Figure 16 C, E, D).
Figures 15 and 16 in conjunction demonstrate that IGF2 overexpression can cause
follicular fusion and aberrant barb ridge formation. This suggests IGF2 may play a
critical role in embryonic feather follicle formation and embryonic feather morphogenesis.
Additional samples would be necessary to verify these results.
39

Discussion

Size regulation spans multiple levels of the biological system, with perturbations at the
cellular level potentially affecting the overall sizes of the organ and individual. The role
of insulin-like growth factors in size regulation is an impactful study with both medical
and agricultural applications
13, 31
. To ascertain the effects of IGFs in size regulation, we
utilized the chicken feather model during its embryonic developmental stages
32
. To gain
a better understanding of the developmental timeline, we performed in situ hybridization
at E6.5, E7.5, and E8.5 in an attempt to visualize the gene expressions of the early,
short, and long bud stages of embryonic feather development. Dorsal skin explants
were then performed at E6.5, E7.5, and E8.5 with attempts at overexpression of IGF2
and inhibition of the IGF1R. Attempts were also made to upregulate IGF2 embryonic
expression levels through localized infection of the RCAS-IGF2 virus in E3 and E4
chicken embryos.
IGF1’s presence in the developing feather bud
The Somatomedin Hypothesis proposes that, while GH regulates growth of net body
length, a proxy compound termed somatomedin would serve as the intermediary
between GH released from the pituitary gland and a target area
5, 11
. Somatomedin was
later termed IGF1, with parallel in vitro and in vivo studies of growth plate cartilage
expansion demonstrating the necessity of IGF1 for growth
16
. Later amendments were
made to the Somatomedin Hypothesis as data indicated that IGF1 did not function
solely as a downstream signal to GH, but also worked alongside it and even against it at
times
33
. IGF1 affects the net functions of GH by enhancing the anabolic cellular
activities and somatic growth initiated by GH while also inhibiting the lipid and
carbohydrate metabolic effects of GH. More recent research also revealed additional
participants in the IGF regulatory pathway through IGF2, the IGF binding proteins, and
IGFALS
34, 35
. The in situ hybridization of our IGF1 probe showed some signal in the
early bud stages of the wing regions and the short bud stages of the dorsal, femoral,
and tail regions (Figure 2-A G, B, E, K). While the majority of IGF1 is hepatic in origin,
most cells of the body are capable of IGF1 production to some capacity. Our section in
situ data suggests that regulation of IGF1 production occurs during the development of
40

the feather as there is a distinct concentration of IGF1 mRNA in the region of the
developing bud (Figure 2-B C, F, I, L).
IGF2’s specific localization within the apical tip
RNA sequence analysis of chicken embryonic DNA performed by Dr. Wu and Dr. Lai
compared E9 feather regions to developmentally equivalent E11 scale regions
36
.
Significantly upregulated IGF2 activity was detected in the feather sample, with a 10:1
upregulation in feather over the scale regions. Animal experiments have demonstrated
that IGF2 plays a central role in placental development and prenatal growth regulation,
with particular emphasis in the dorsal midline tissues during segmentation
37
. It has also
been revealed that paralogs of IGF2 (genes related via duplication within the genome)
play specific roles in brain development and nephrogenesis
37
. In situ hybridization
exhibited a faint but distinct signal in the early feather bud stages, and clear signals
were detected in the developing feathers’ bud apical tip during the short and long
feather bud stages. Previous experiments had demonstrated that inducing lower IGF2
concentrations resulted in reduced organ, and body, sizes3
8
. The RCAS-IGF2
overexpression experiments exhibited a phenotypic change at the base of the feather,
with the stem exhibiting a more bulbous phenotype then the green fluorescent protein
control (Figure 13). Another phenotype observed from the overexpression experiments
was the fusion of multiple buds, with section in situ showing a disruption in the barb
ridges’ formation (Figure 15). Attempts to replicate this phenotype were hindered by a
high mortality rate of the embryos which escalated severely with higher titers of
infectious virus, suggesting that strict control of the IGF2 expression levels is critical
towards embryonic development. The strong expression of IGF2 during the early bud
stage, in conjunction with the low IGF1 signal previously observed, suggests that IGF2
may be the main source of IGF signaling during the early bud stage of development
(Figure 2-A, Figure 3-A).
IGF1R’s importance for IGF signaling.
Of the receptors the IGF ligands are capable of binding, the one most commonly
associated with downstream growth and development is IGF1R. Being a receptor
tyrosine kinase, IGF1R activation involves cross phosphorylation between two subunits
41

when bound by IGF1 or IGF2. The two subunits may be formed as homodimers of
IGF1R, or as a heterodimer with the insulin receptor. The quantity and ratio of IGF1R
homo/heterodimer receptors vary between different cell types, resulting in differential
ligand responses across tissue types
39
. In the in situ hybridization data, a weak signal is
detected in the short and long chicken embryo feather bud tip periphery (Figure 4-A B,E,
H). Repeat experiments with the same probe as well as a redesigned probe exhibited
similar results, suggesting the IGF1R receptors numbers are not being upregulated to
amplify downstream responses and that the growth exhibited between early and late
bud stages are likely due to the activation of previously inactive pathways. When we
inhibited IGF1R with chemical inhibitors NVP-AEW541 and AG-1024 by blocking the
phosphorylation step required for receptor activation, the resulting phenotype exhibited
a range of inhibitory effects dependent upon on the concentration of inhibitor exposure,
ranging from mild inhibition of feather bud elongation to the destruction of the feather
bud (Figure 12). The most susceptible stage appeared to be the short feather bud
developmental stage. Equivalent exposure of IGF1R inhibitors during the early and long
bud stages resulted in some inhibition to growth, but the early bud stage exhibited
destruction of the protruding portion of the feather bud (Figure 11). This suggests that
IGF1R signaling is not only critical for the growth of the feather bud, but that during the
early bud stage the IGF1R signaling is critical to maintaining the feather bud itself. It is
unlikely that this phenomenon is caused by the IGFs binding and activating a low-affinity
receptor as chemical inhibitors are designed to be specific to IGF1R. Therefore, it is
possible that a destructive pathway is activated in some fashion or that a checkpoint is
failed through the inhibition of IGF1R during the short bud stage of embryonic feather
development, leading to the regressed phenotype we observed.
IGF2R’s enigmatic purpose.
The IGF2R functions as a growth inhibitor. Previous loss of function experiments in
mammals have demonstrated a resulting increase in growth
40
. IGF2R primarily
functions to reduce the quantity of free-floating IGF ligands through its binding,
engulfing, and subsequent degradation via lysosomes
41
. The IGF2R binds to both IGF1
and IGF2 in mammalian species, with the exception of chickens and monotremes where
IGF2 does not bind with significant affinity to IGF2R
42, 43
. Our results show the initiation
42

of IGF2R production at the long bud stage of feather development, particularly in the
dorsal regions (Figure 5-A C, F, I, L). The functional purpose of IGF2R in chickens
remains unclear.
IGFBP’s prevalence.
The IGF binding proteins (IGFBP) serve to stabilize IGF1 and IGF2 in the circulation.
IGFBP3 is the most commonly observed stabilizing protein, comprising of ~80% of IGF-
IGFBP complexes, and complexes with the IGF acid labile subunit (IGFALS) to extend
the half-life of IGFs to over 4 hours. In contrast, unbound free IGFs exhibit a half-life of
approximately 20 minutes
44
. The IGFBPs also play other regulatory roles when not
serving as a carrier protein for the IGFs; IGFBP5 has been implicated in the
miniaturization of the dinosaurian body when it performs as a signal molecule for IGF1R
and IGFBP7 functions to inhibit IGF1R signaling
45, 46
. The in situ data did not exhibit
strong signals for any of the binding proteins that we stained for (Figure 6-A. Figure 7,
Figure 8, Figure 9), and it may be that further sequencing is necessary to accurately
determine the expression characteristics of IGF binding proteins.
Significance of IGF signaling in skin appendages
The role of IGF signaling has been known to play an important role in organ and body
size regulation. Here we demonstrate that IGF signaling also plays a critical role in skin
appendage development. However, its role does not appear to be limited to the
regulation of growth (Figure 14), but rather to also function as an important signal in
preventing appendage retrogression during certain points of development (Figure 12).
When IGF1R was inhibited during the short bud stages of embryonic feather
development the buds not only failed to elongate and grow, but appeared to be unable
to maintain its status quo and was aborted, resulting in loss of the protruding bud
entirely (Figure 12 D`). We conclude that IGF signaling is crucial for embryonic feather
development for both size regulation and appendage maintenance.
43

Future Direction

Because IGF1R is capable of binding both IGF1 and IGF2, to Inhibit IGF1 and IGF2’s
ability to bind IGF1R individually during the short bud stage of embryonic feather
development would provide further insight into the role of IGF2 signaling in the organ
forfeiture we observed with the IGF1R inhibition experiments.
A more refined skin explant experiment for IGF2 overexpression may need to be
designed, taking into account the natural concentration chicken tissues are accustomed
to and introducing a higher concentration of recombinant IGF2 to the culture sample. In
addition, a skin explant study on IGF2R, both independent and in conjunction with
IGF1R blocking, may provide insight into the situation when IGFs are forced to bind with
the lower-affinity IGF2R. Given that the function of IGF2R in chickens is currently still
unknown, this may yield clues helpful to other frontiers of science.
The RCAS study demonstrated that overexpression of IGF2 results in a high mortality
rate of the chicken embryo between E6 and E9. The cause for the high lethality at that
specific point of development c be clarified with gene sequencing of various embryonic
organs at that stage to determine if the upregulation overwhelms a natural
downregulation phenomenon is some specific organs.
When IGF1R is inhibited during the short bud stage of embryonic feather development,
the protruding bud is lost. However, the placode base appears to remain. Investigating
the characteristics of the placode, and whether a rescue is possible, may yield insight
into the regenerative capabilities of the feather system.
IGFBP3’s low mRNA presence is surprising to some degree. Further antibody staining
to determine the presence, or lack thereof, of IGFBP3 in the embryonic feather tissue
would further test the validity of the regional regulatory hypothesis proposed in this
thesis.

44

References

Introduction
[1] Hariharan IK, Wake DB, Wake MH: Indeterminate growth: Could it represent the
ancestral condition? Cold Spring Harbor Perspectives in Biology 2016, 8:a019174.
[2] Niklas KJ: A phyletic perspective on cell growth. Cold Spring Harbor Perspectives in
Biology 2015, 7:a019158.
[3] Austin CR: General egg biology. The Mammalian Egg 1961, pp.14-16.
[4] Puche JE, Castilla-Cortazar I: Human conditions of insulin-like growth factor 1 (IGF1)
deficiency. Journal of Translational Medicine 2012, 10(1):224-252.
[5] Salmon WD, Daughaday WH: A hormonally controlled serum factor which stimulates
sulfate incorporation by cartilage in vitro. Journal of Laboratory Clinical Medicine 1957,
49:825-836.
[6] Velloso CP: Regulation of muscle mass by growth hormone and IGF-1. British
Journal of Pharmacology 2008, 154(3):557-568.
[7] Denko CW, Bergenstal DM: The effect of hypophysectomy and growth hormone on
cartilage sulfate metabolism. Proceedings of the Society for Experimental Biology and
Medicine 1955, 84:603-605.
[8] Isaksson O, Ohlsson C, Sjorgren K, Wallenius K, Jansson JO: The somatomedin
hypothesis revisited in a transgenic model. Growth Hormone and IGF Research 2001,
11(SupplA):S49-52.
[9] Yakar S, Liu JL, Stannard B, Butler A, Accili D, Sauer B, LeRoith D: Normal growth
and development in the absence of hepatic insulin-like growth factor 1. Proceedings of
the National Academy of Sciences USA 1999, 96:7324-7329.
[10] D’Ercole AJ, Applewhite GT, Underwood LE: Evidence that somatomedin is
synthesized by multiple tissues in the fetus. Developmental Biology 1980, 75:315-328.
[11] Daughaday WH: A personal history of the origin of the Somatomedin Hypothesis
and recent challenges to its validity. Perspectives in Biology and Medicine 1989,
32(2):194-211.
[12] DeChiara TM, Efstratiadis A, Robertson EJ: A growth-deficiency phenotype in
heterozygous mice carrying an insulin-like growth factor 2 gene disrupted by targeting.
Nature 1990, 345:78-80.
[13] Wang E, Wang J, Chin E, Zhou J, Bondy CA: Cellular patterns of insulin-like growth
factor system gene expression in murine chrondrogenesis and osteogenesis.
Endocrinology 1995, 136:2741-2751.
45

[14] Huang Y, Harrison M, Osorio A, Kim J, Baugh A, Duan C, Sucov H, Lien CL: IGF
signaling is required for cardiomyocyte proliferation during zebrafish heart development
and regeneration. Public Library of Science ONE 2013, 8(6): e67266.
[15] Chao W, D’Amore PA: IGF2: epigenetic regulation and role in development and
disease. Cytokine Growth Factor Review 2008, 19:111-120.
[16] Le Roith D, Bondy C, Yakar S, Liu JL, Butler A: The somatomedin hypothesis: 2001.
Endocrine Review 2001, 22:53–74.
[17] Bertrand FE, Steelman LS, Chappell WH, Abrams SL, Shelton JG, White ER,
Ludwig DL, McCubrey JA: Synergy between an IGF1R antibody and Raf/MEK/ERK and
PI3K/Akt/mTOR pathway inhibitors in suppressing IGF1R-mediated growth in
hematopoietic cells. Leukemia 2006, 20:1254-1260.
[18] Playford MP, Bicknell D, Bodmer WF, Macaulay VM. Insulin-like growth factor 1
regulates the location, stability, and transcriptional activity of beta-catenin. Proceedings
of the National Academy of Sciences USA 2000, 97:12103–12108.
[19] Ogata N, Chikazu D, Kubota N, Terauchi Y, Tobe K, Azuma Y, Ohta T, Kadowaki T,
Nakamura K, Kawaguchi H: Insulin receptor substrate 1 in osteoblast is indispensable
for maintaining bone turnover. Journal of Clinical Investigation 2000, 105:935-943.
[20] Akune T, Ogata N, Hoshi K, Kubota N, Terauchi Y, Tobe K, Takagi H, Azuma Y,
Kadowaki T, Nakamura K, Kawaguchi H: Insulin receptor substrate 2 maintains
predominance of anabolic function over catabolic function of osteoblasts. Journal of Cell
Biology 2002, 159:147-156.
[21] Penzo-Mendez AI, Stanger BZ: Organ-size regulation in mammals. Cold Spring
Harbor Perspectives in Biology 2015, 7:a19240.
[22] Prum RO, Williamson S: Theory of the growth and evolution of feather shape.
Journal of Experimental Zoology (Molecular, Developmental, Evolution) 2001, 291:30-
57.
[23] Yu M, Yue Z, Wu P, Wu DY, Mayer JA, Medina M, Widelitz R, J TX, Chuong CM:
The developmental biology of feather follicles. International Journal of Developmental
Biology 2004, 48:181-191.
[24] Chang KW, Huang NA, Liu IH, Wang YH, Wu P, Tseng YT, Hughes MW, Jiang TX,
Tsai MH, Chen CY, Oyang YJ, Lin EC, Chuong CM, Lin SP. BioMed Central Genomics
2015, 16:22.
[25] Hughes SH: The RCAS vector system. Folia Biologica 2004, 50:107-119.
[26] Gilbert SF: Chapter 2: Section 2.4 Techniques of RNA analysis: In situ
hybridizations. Developmental : Emergence of differentially regulated pathways
associated with the development of regional specificity in chicken skin Biology Tenth
Edition 2013, 10: 176-182.
46

[27] Chuong CM: Chapter 12: Skin morphogenesis: Embryonic skin explant cultures.
Developmental Biology Protocols: Volume II. Methods in Molecular Biology 2000, 136:
101-106.
[28] Hamburger V, Hamilton HL: A series of normal stages in the development of the
chick embryo. Journal of Morphology 1951, 88:49-92.
[29] Jaign TX, Jung HS, Widelitz RB, Chuong CM: Self-organization of periodic
patterning by dissociated feather mesenchymal cells and the regulation of size, number
and spacing of primordia. Development 1999, 126:4997-5009.
[30] Rao G, Pedone C, Valle L, Reiss K, Holland E, Fults DW: Sonic hedgehog and
insulin-like growth factor signaling synergize to induce medulloblastoma formation from
nestin-expressing neural progenitors in mice. Oncogene 23: 6156-6162.
[31] Tang S, Sun D, Ou J, Zhang Y, Xu G, Zhang Y: Evaluation of IGFs (IGF1 and
IGF2) genes as candidates for growth, body measurement, carcass, and reproductive
traits in Beijing You and Silkie chickens. Animal Biotechnology 2010, 21(2):104-113.
[32] Lin SJ, Widelitz R, Yue Z, Li A, Wu X, Jiang TX, Wu P, Chuong CM: Feather
regeneration as a model for organogenesis. Development, Growth, and Differentiation
2013, 55(139-148).
[33] Kaplan SA, Cohen P: The Somatomedin Hypothesis 2007: 50 years later. The
Journal of Clinical Endocrinology and Metabolism 2007, 92(12): 4529-4535.
[34]Adams S, Nissey S, Handwerger S, Rechler M: Developmental patterns of insulin-
like growth factor -1 and -2 synthesis and regulation in rat fibroblasts. Nature 1983,
302:150-153.
[35] Ballard J, Baxter R, Binoux M, Clemmons D, Drop S, Hall K, Hintz R, Rechler M,
Rutanen E, Schwander J: On the nomenclature of the IGF binding proteins. Acta
Endocrinologica 1989, 121:751-752.
[36] Chang KW, Huang N, Liu IH, Wang YH, Wu P, Tseng YT, Hughes M, Jiang TX,
Tsai M H, Chen CY, Oyang YJ, Lin EC, Chuong CM, Lin SP: Emergence of differentially
regulated pathways associated with the development of regional specificity in chicken
skin. BioMed Central Genomics 2015, 16:22.
[37] White Y, Kyle J, Wood A: Targeted gene knockout in zebrafish reveals distinct
intraembryonic functions for insulin-like growth factor 2 signaling. Endocrinology 2009,
150(9):4366-4375.
[38] Scanes C, Dunnington E, Buonomo F, Siegel P: Plasma concentrations of insulin
like growth factors (IGF-)I and IGF-II in dwarf and normal chickens of high and low
weight selected lines. Growth, Development, and Aging 1989, 53:151-157.

47

[39] Bailyes E, Nave B, Soos M, Hayward A, Siddle K: Insulin receptor/IGF-1 receptor
hybrids are widely distributed in mammalian tissues: quantification of individual receptor
species by selective immunoprecipitation and immunoblotting. The Biochemical Journal
1997, 327(1): 209-215.
[30] Foulstone E, Prince S, Zaccheo O, Burns J, Jacobs C, Church D, Hassan AB:
Insulin-like growth factor ligands, receptors, and binding proteins in cancer. Journal of
Pathology 2005, 205:145-153.
[41] Brown J, DeLaine C, Zaccheo O, Siebold C, Gilbert R, van Boxel G, Denley A,
Wallace J, Hassan AB, Forbes B, Jones EY: Structure and functional analysis of the
IGF-2/IGF2R interaction. The European Molecular Biology Organization Journal 2007,
27(1):265-276.
[42] Hawkes C, Kar S: The insulin-like growth factor-2/mannose-g-phosphate receptor:
structure, distribution, and function in the central nervous system. Brain Research: Brain
Research Reviews 2004, 44:117-140.
[43] Killian J, Byrd J, Jirtle J, Munday B, Stoskopf M, MacDonald R, Jirtle R: M6P/IGF2R
imprinting evolution in mammals. Molecular Cell 2000, 5:707-716.
[44] Zapf J, Hauri C, Waldvogel M, Froesch E: Acute metabolic effects and half-lives of
intravenously administered insulinlike growth factors I and II in normal and
hypophyesctomized rats. Journal of Clinical Investigation 1986, 77(6): 1768-1775.
[45] Lowe C, Clarke J, Baker A, Haussler D, Edwards S: Feather development genes
and associated regulatory innovation predate the origin of dinosaurian. Molecular
Biology and Evolution 2014, 32(1): 23-28.
[46] Evdokimova V, Tognon C, Benatar T, Yang W, Krutikov K, Pollak M, Sorenson P,
Seth A: IGFBP7 binds to the IGF1 receptor and blocks its activation by insulin-like
growth factors. Science Signaling 2012, 225(5): ra92.

Abstract (if available)

Abstract Insulin-like growth factors (IGFs) serve to regulate the size of the overall body as well as the size of organs, such as the heart and cartilage, during development. However, the regulatory effects of IGF signaling on the size of skin appendages remains unknown. We selected the chicken feather model to examine the role of IGF signaling in skin appendages as the feather is by design malleable in both its size and its composition. When using the feather bud’s embryonic developmental stages as a model for skin appendage growth, in situ staining showed upregulation of IGFs and IGF-related molecules coinciding with the elongation of the embryonic feather buds. IGF upregulation experiments performed on the developing feather buds exhibited enlargement of individual appendages as well as the fusion of multiple feather buds into one single enlarged bud. Attempts to overexpress IGF2 during the early embryonic stages of chicken development resulted in exceptionally high lethality rates. IGF receptor inhibition experiments performed on embryonic feather buds exhibited varied degrees of growth inhibition dependent upon both the developmental stage and concentration of exposure. Signal inhibition during mid-development most often resulted in forfeiture of the skin appendage. Exposure to inhibitors during early and late stages of development resulted in varied degrees of stunted growth. The experiments presented here demonstrate the critical role of IGF regulation in the size regulation and development of chicken skin appendages.

Linked assets

University of Southern California Dissertations and Theses

Conceptually similar

PDF

Molecular aspects of skin early morphogenesis

PDF

Canonical and non-canonical Wnt signaling in the patterning of multipotent stem cells during feather development

PDF

Roles of Hox B genes in the development of chicken skin

PDF

Exploring the molecular and cellular underpinnings of organ polarization using feather as the model system

PDF

Adaptive patterning during skin formation: assembly of vasculature and adipose tissue

PDF

The role of fibroblast growth factor signaling on postnatal hepatic progenitor cell expansion

Asset Metadata

Creator Wang, George (author)

Core Title The role of insulin-like growth factors in size regulation during embryonic feather development

School Keck School of Medicine

Degree Master of Science

Degree Program Experimental and Molecular Pathology

Publication Date 03/14/2018

Defense Date 02/15/2018

Publisher University of Southern California (original), University of Southern California. Libraries (digital)

Tag AG-1024,chicken,dorsal skin explant,embryonic development,feather,igf,IGF1,IGF1R,IGF2,IGF2R,IGFBP3,in situ,NVP-AEW541,OAI-PMH Harvest,RCAS,size regulation

Language English

Contributor Electronically uploaded by the author (provenance)

Advisor Chuong, Cheng-Ming (committee chair), Merrill, Amy (committee member), Wu, Ping (committee member)

Creator Email gpswang@gmail.com,wanggeor@usc.edu

Permanent Link (DOI) https://doi.org/10.25549/usctheses-c40-485353

Unique identifier UC11268060

Identifier etd-WangGeorge-6113.pdf (filename),usctheses-c40-485353 (legacy record id)

Legacy Identifier etd-WangGeorge-6113.pdf

Dmrecord 485353

Document Type Thesis

Rights Wang, George

Type texts

Source University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Access Conditions The author retains rights to his/her dissertation, thesis or other graduate work according to U.S. copyright law. Electronic access is being provided by the USC Libraries in agreement with the a...

Repository Name University of Southern California Digital Library

Repository Location USC Digital Library, University of Southern California, University Park Campus MC 2810, 3434 South Grand Avenue, 2nd Floor, Los Angeles, California 90089-2810, USA