University of Southern California Dissertations and Theses

Functional characterization of a prostate cancer risk region

(USC Thesis Other)

Functional characterization of a prostate cancer risk region

PDF

Download a page range

Download transcript

Copy asset link

Request this asset

Transcript (if available)

Content Functional Characterization of a Prostate Cancer Risk Region
1

Functional Characterization of a Prostate Cancer
Risk Region

Hang Yang

MASTER OF SCIENCE
BIOCHEMISTRY AND MOLECULAR BIOLOGY
UNIVERSITY OF SOUTHERN CALIFORNIA
GRADUATION THESIS

December 2017

Functional Characterization of a Prostate Cancer Risk Region
2

Acknowledgements
It was a long journey for me to pursue a master of science in the school of
biochemistry and molecular biology. I came across some difficulties and stopped
moving forward. But fortunately, Dr. Peggy Farnham, my wonderful mentor always gives
me opportunities when I want to come back to face the difficulties and finish my study.
In my tough time, each piece of comment and feedback from Peggy was the strongest
encouragement in the world. Peggy spent her time after work to reviewed my thesis
draft so that I could finish it in time. I appreciate Peggy for all the effort she made to help
me.
I also want to express my gratitude to my committee members, Dr. Zoltan Tokes
and Dr. Judd Rice, thank you for giving me the precious suggestions which guides me
to finish a qualified dissertation.
To Dr. Gerry Coetzee, my first mentor in USC, thank you for helping me start my
master project and taught me valuable skills in lab and presentation.
In the past three years, I learnt a lot from all the members already left or still in the
Farnham lab –Suhn, Zhifei, Shannon, Esther, Lijing, Lijun, Heather and all. Thank you
for giving me such a good memory in the united states. To Phoebe, thank you for
teaching me every skill I need to finish my master project from the very beginning. You
are a strict teacher and a kind person.
To my friends and my family, thanks for all the support and encouragement you
ever gave me.

Functional Characterization of a Prostate Cancer Risk Region
3

Contents

Acknowledgements ......................................................................................................... 2
List of abbreviations ........................................................................................................ 4
List of figures and tables ................................................................................................. 5
Abstract ........................................................................................................................... 6
Introduction ..................................................................................................................... 7
Materials and Methods .................................................................................................. 11
Guide RNA Design .................................................................................................... 11
Strategy one-GFP method ......................................................................................... 14
Guide RNA and Cas9 Preparation ......................................................................... 14
Transformation and colony selection ...................................................................... 18
Genomic DNA and RNA isolation ........................................................................... 20
Stratagy two-Puromycin method ................................................................................ 21
Results .......................................................................................................................... 25
Specific Aim 1: CRISPR/Cas9 activity test on 293T cells .......................................... 25
Specific aim 2: Delete the rs11598549 region in the C42B prostate cancer cell line . 27
Specific Aim 3: Differential gene expression analysis on rs11598549 region deleted
clones ........................................................................................................................ 30
Conclusion .................................................................................................................... 34
Discussion ..................................................................................................................... 35
Future Directions ........................................................................................................... 37
References .................................................................................................................... 38
Appendix ....................................................................................................................... 41

Functional Characterization of a Prostate Cancer Risk Region
4

List of abbreviations

AR Androgen receptor
CRISPR Clustered Regularly Interspaced Short Palindromic Repeats
ChIA-
PET
Chromatin Interaction Analysis by Paired-End Tag Sequencing
CTBP2 C-terminal-binding protein 2
DEPC Diethyl pyrocarbonate
DHS DNase I hypersensitivity site
DSB Double strand break
eQTL Expression quantitative trait loci
FACS Fluorescence-activated cell sorting
GFP Green fluorescent protein
GWAS Genome-wide association studies
NGS Next generation sequencing
PCa Prostate cancer
SNP Single nucleotide polymorphism

Functional Characterization of a Prostate Cancer Risk Region
5

List of figures and tables
Figure 1. SNP distribution in genome ............................................................................. 7
Figure 2. Shown are the locations of the index SNP (blue) and other SNPs in high
linkage disequilibrium with the index SNP (red). ............................................................. 9
Figure 3. Testis eQTL data of CTBP2 gene .................................................................. 10
Figure 4. DNA and RNA bulges .................................................................................... 13
Figure 5. Regional deletion made by CRISPR/Cas9 and a pair of guide RNAs flanking
the target region ............................................................................................................ 14
Figure 6. Experiment flow chart. .................................................................................... 25
Figure 7. Gel electrophoresis figure of pooled sample .................................................. 27
Figure 8. Region of deletion .......................................................................................... 28
Figure 9. RNA-seq candidate clone selection ............................................................... 29
Figure 10. Replicates preparation for RNA sequencing ................................................ 31
Figure 11. CTBP2 gene and ADAM12 gene RNA sequencing data .............................. 33
Figure 12. Genome browser view of rs11598549 region ............................................... 36

Table1. 2-fold change cutoff differential expressed genes number in genome wide and
within ± 2MB window of deletion site. ............................................................................. 36
Table2. 2-fold change cutoff differential expressed genes number in genome wide and
within ± 2MB window of deletion site. ............................................................................. 36
Table3. 1.5-fold change cutoff upregulated gene list in genome w ide ……………….. .. .. 4 1
Table4. 1.5-fold change cutoff downregulated gene list in genome w ide ……………….4 2

Functional Characterization of a Prostate Cancer Risk Region
6

Abstract
The number of age-adjusted new cases of prostate cancer (PCa) in the USA was
~129 per 100,000 men per year during 2009-2013, and the number of deaths was ~20
per 100,000 men per year (http://seer.cancer.gov-/statfacts/html/prost.html). Based on
2010-2012 data, ~14.0 percent of men will be diagnosed with PCa at some point during
their lifetime. Genome-wide association studies (GWAS) have made a revolutionarily
impact in cancer genetics including PCa. However, the biological mechanisms by which
genetic factors contribute to prostate cancer risk are not yet fully characterized. In this
study, I focus on the functional annotation of a specific statistically significant prostate
cancer risk-associated single nucleotide polymorphism (SNP), rs11598549, that is
located in an intron of the C-terminal-binding protein 2 (CtBP2) gene. This SNP is
located in an androgen-responsive DNase I hypersensitivity site (DHS) and has been
suggested to influence expression of the CtBP2 gene through expression quantitative
trait loci (eQTLs) analysis. To experimentally determine if this risk region does influence
the expression of CTBP2 (or other genes), I deleted the region containing the SNP
using the Cas9 nuclease-CRISPR (Clustered Regularly Interspaced Short Palindromic
Repeats) system in C4-2B cells, a human prostate tumor cell line. I used RNA-seq to
identify differentially expressed genes in the deleted cells vs. the parental C42B cells. I
found that the CtBP2 gene was down-regulated ~2-fold in the deleted cells, indicating it
is regulated by the risk SNP.

Functional Characterization of a Prostate Cancer Risk Region
7

Introduction
The basic goal of human molecular genetics research is to study the relationship
between genetic variations and phenotypic variation, often related to disease. In the
past decade, most human genetic studies have been limited to investigating protein
coding sequence disruptions, which leads to protein structural abnormalities and
functional disorders. Recently, with the development of next generation sequencing
(NGS) technology [1], analysis of other types of genetic polymorphisms that may affect
gene expression has become feasible. Genome-wide association studies (GWAS) have
identified a large number of variants in which allelic frequency differences have been
statistically associated with hundreds of diseases [2]. Surprisingly the majority of the
single nucleotide polymorphisms (SNPs) defining these variants are located within
intergenic or intronic regions and therefore do not affect protein structure [3].

Figure 1. SNP distribution in genome.

However, the mechanisms by which these variant SNPs located in non-coding regions
can influence disease risk remain unknown. Efforts towards an understanding of such
Functional Characterization of a Prostate Cancer Risk Region
8

variation have been aided by data from the Reference Epigenome Mapping Consortium,
the International Human Epigenomics Consortium, BLUEPRINT and notably the
ENCODE Consortium [4]; members of these consortia have utilized methods such as
5C, ChIA-PET, DNase-seq, and ChIP-seq to catalog whole genome bio-features and
chromatin structures, including 3-dimensional looping of chromatin, accessible
chromatin regions, histone methylations and other modifications, and transcription factor
bound regions. Currently, data from the occupancy of 119 different transcription factors
have been determined for 147 cell types, including an androgen-sensitive prostate
adenocarcinoma cell line isolated from lymph-node metastasis called Lymph Node
Cancer of the Prostate (LNCaP) [5 –7]; this transcription factor binding data from LNCaP
provides a useful tool to explore the cancer biology of prostate cancer. A subline of
LNCaP cells denoted C42B shares common marker chromosomes with the parental
LNCaP cells, but is a more robust cell line with respect to proliferation and is also a
convenient model for PCa studies [8]. I have used C42B cells in my studies.
Previous studies have identified multiple risk regions and different analytic
approaches have been used to evaluate their activities and discover the mechanisms by
which these loci influence risk of diseases. Han, Y., Hazelett, D. J., et al. [9] analyzed
55 risk regions of PCa in GWAS studies, annotating 666 potential functional SNPs
based on chromatin features using a software tool called FunciSNP [3]. 193 (29%) of
the 666 SNPs overlapped with epigenetic marks or other putative functional regions
such as enhancers and transcription factor-bound regions (Fig.2).
One of the prostate cancer-associated risk SNPs that overlapped with a DNAse I
hypersensitive site (DHS) is rs11598549. DHS is an open chromatin region that bound
Functional Characterization of a Prostate Cancer Risk Region
9

by transcriptional factors. A risk SNP in DHS might break some transcriptional factor
motif to regulate target genes. Risk SNP 11598549 is in an intron of the C-terminal-
binding protein 2 (CtBP2) gene and eQTL analysis using data from the GTEx Portal
(The GTEx Consortium: https://www.gtexportal.org/home/eqtls/bySnp?snpId=rs-
11598549&tissueName=All) suggests that the SNP may be involved in transcriptional
regulation of CTBP2 (Fig. 3). The eQTL analysis indicates that the alternative allele
(adenine) is related to higher CTBP2 gene expression as compared to the reference
allele (guanine).

Figure 2. Shown are the locations of the index SNP (blue) and other SNPs in high linkage disequilibrium
with the index SNP (red). Although the index SNP, which was discovered to be linked to prostate cancer
because it was on the array, is not in a bio-feature, SNP rs11598549 is in a DNAse I hypersensitive site
(black rectangle). The rs11598549 SNP thus may be the functional SNP in the region.
Functional Characterization of a Prostate Cancer Risk Region
10

Figure 3. Testis eQTL data from GTEx Portal indicates that SNP rs11598549 may regulate CTBP2
expression; the reference allele is a G and the alternative allele is an A.

CtBP2 has previously been implicated in prostate cancer. For example,
Takayama, et al. have suggested that CtBP2 contributes to prostate cancer progression
by modulating the activity of the androgen receptor (AR) [12]. The AR is a key driver of
both early and advanced prostate cancer. CtBP2 expression is upregulated in prostate
cancer, and high expression of CtBP2 is correlated with poor prognosis in PCa patients.
Others have shown that CtBP2 can function as a transcriptional corepressor; perhaps
high expression of CtBP2 represses tumor suppressors and promotes cancer
progression [17].
Androgen treatment results in the creation of a DNAse I hypersensitive site at
risk SNP 11598549, as determined from ENCODE DNAse I data. This suggests that
Functional Characterization of a Prostate Cancer Risk Region
11

transcription factors bind here after androgen treatment. I hypothesized that this risk
SNP breaks or makes TF motifs leading to aberrant TF binding, resulting in altered
CtBP2 gene expression, and subsequently, other genes regulated by CtBP2. In my
thesis work, I used the CRISPR-Cas9 genomic modification technology to delete the
region containing the risk SNP rs11598549. Following generation of cell clones in which
the region was deleted, I carried out genome-wide gene expression analyses using
RNAseq [13-16]. I report below my findings related to the role of rs11598549 in gene
regulation in prostate cancer cells.

Materials and Methods
Human genome Hg19 assembly (The Genome Sequencing Consortium, 2009) is
used in all sequences and genomic locations within this study. Sequences, locations
and bio-features are visualized in UCSC Genome Browser [19].

Guide RNA Design
A CRISPR design website (crispr.mit.edu) was used in this study to search for
potential CRISPR binding site. Genomic sequences from the region of interest (taken
from the UCSC Genome Browser) and were entered into the website. Results were
generated with a score based on binding affinity and low off target binding. The sites
with high scores from the web tool were first examined using the NCBI BLAST website
tool (http://blast.ncbi.nlm.nih.gov/Blast.cgi) to exclude those sites that have replicates in
other locations in the genome. Then, the sequence candidates were entered into a
Functional Characterization of a Prostate Cancer Risk Region
12

webtool Cas-OFFinder (CRISPR RGEN Tools, http://www.rgenome.net/cas-offinder) to
check for possible binding with a DNA or RNA bulge. For a binding specificity check,
PAM type (5’-NGG- 3 ’) and genome hg19 were selected on the web tool, then the 20nt
gRNA without a PAM was entered as a query sequence. Firstly, the option of mismatch
number equal or less than 2 was selected to screen for gRNA that has mismatch
basepairs less than 2; this eliminates gRNAs that might bind with a DNA or RNA bulge.
Secondly, for the rest of the gRNA candidates, the 15nt gRNA that was close to a PAM
(without PAM) was entered as a query sequence. The option of mismatch number equal
or less than 1 was selected for further selection. Guide RNAs have 1bp mismatch was
allowed to use while the ones has 0bp mismatch other than the target site were
eliminated. A gRNA with 1bp or more than 1bp mismatch at the region that 15bp close
to PAM is very unlikely to have a DNA or RNA bulge, since the sequence near PAM is
critical for CRIPSR binding. However, if the 15bp sequence close to PAM perfectly
matched an off-target site, this gRNA would still have the possibility to form a bulge
binding on the off-target site, even all 5bp sequence close to 5’ end of gRNA
mismatched with an potential off-target site. Overall, the gRNA sequence should be the
100% counterpart of target DNA sequence. Guide RNA sequence which is repeatable in
other loci of the genome were elimilated by BLAST (NCBI tool), sequence has less than
2bp mismatch to an off-target siete was elimilated by the first step of Cas-OFFinder
screening, sequence perfectly matching an off-target site with its 15bp sequence close
to PAM was elimilated by the second step of Cas-OFFinder screening.
Functional Characterization of a Prostate Cancer Risk Region
13

Figure 4. DNA and RNA bulges. A guide RNA that does not perfectly match the DNA sequence can still
binds to the genome with a DNA or RNA bulge, which could cause off-target binding. To avoid this kind of
off target binding, Cas-OFFinder was used to eliminate this type of gRNA.

Two guide RNA cloning stratages, using either a GFP selection method or a
Puromycin selection method, were applied in this study. The GFP selection method was
based on the Church Lab gRNA synthesis protocol, version 01-14-2013 option B with
slight modifications (Mali et al., 2013). The Puromycin selection method was based on
the protocol generated by Ran et al [18]., modified by the Farnham Lab. The overall
strategy in both methods is to clone and then transfect guide RNA expression vectors
into a cell pool and then select individual cell clones.
Functional Characterization of a Prostate Cancer Risk Region
14

Figure 5. Regional deletion made by CRISPR/Cas9 and a pair of guide RNAs flanking the target region.
The CRISPR/Cas9 system consists of an enzyme called Cas9 and a piece of RNA called guide RNA
(gRNA). The gRNA binds to the target genome and guides the Cas9 to the right part of genome. The
Cas9 makes a DNA double strand break (DSB) at the target site with its endonuclease activity. By using
properly placed guide RNAs that make two DSB in the target region, the DNA sequence in between two
DBS can be deleted when the DNA is repaired by non-homologous end joining.

Strategy one-GFP method
Guide RNA and Cas9 Preparation
Strategy one (GFP method) is to insert the guide RNA sequences and their reverse
complements (as 60-mer oligonucleotides synthesized by Integrated DNA
Functional Characterization of a Prostate Cancer Risk Region
15

Technologies) into the guide RNA expression plasmid. The oligonucleotide and its
reverse complement were combined to produce a double stranded guide RNA insert
(100bp) by PCR reaction. The solution for the PCR reaction consisted of 5ul forward
and reverse oligos each, 2x Phusion High-Fidelity Master Mix (NEB), and nuclease-free
water for a total volume of 50ul. PCR was programmed as follows (all PCR reactions
were performed using the Bio-Rad T100 Thermal Cycler):
1. 98 °C for 2:00
2. 98 °C for 0:10
3. 53 °C for 0:20
4. 72 °C for 0:30
5. Goto 2, 3 times
6. 72 °C for 5:00

To purify the guide RNA expression plasmid, a Qiagen MinElute PCR Purification
kit (Qiagen) was used. 5 times the sample volume of PB was added into PCR product.
The solution was passed through a MinElute Spin Column by centrifugation at
maximum speed for 1 minute. The flow-through was discarded and the column was
washed with PE. Again, the column was centrifuged and flow-through was discarded.
The column was centrifuged for 1 extra minute to remove all the solution from the
column. DNA was eluted with 10ul of EB into a microcentrifuge tube. The DNA
concentration of purified product was measured by Nanodrop (Thermo Scientific).
A linearized guide RNA empty vector should be prepared as guide RNA
expression plasmid backbone. To linearize the guide RNA cloning vector (Addgene
Pasmid 41824), the plasmid was digested with AFl II (NEB); 1 ul of enzyme was added
to 1.5 ug of DNA along with 10X NEBuffer. Nuclease free water was added to a total
Functional Characterization of a Prostate Cancer Risk Region
16

volume of 50 ul and the sample was incubated for 3 hour at 37 ° C. The solution was run
next to the tridye 2-Log DNA Ladder (New England Biolabs) on a 1% agarose gel
stained with ethidium bromide and visualized under UV light. To isolate the linearized
gRNA cloning vector, the 600 bp band which is the size of linearized backbone plasmid
was excised from the gel. DNA was purified by the QiaQuick Gel Extraction Kit
(Qiagen). 3 volumes of buffer QG was added to 1 volume (by weight) of gel and
incubated at 50 °C for 10 minutes. After complete digestion, 1 gel volume of isopropanol
was added to the sample. The sample was transferred to a MinElute column and
centrifuged. After discarding flowthrough, 500 ul of QG buffer was added and
centrifuged. The column was washed once with PE, then placed in a microcentrifuge
tube. DNA was eluted in 10 ul of EB. The DNA concentration was measured on a
Nanodrop.
The Gibson Assembly (NEB) method was used to synthesis the complete guide
RNA expression plasmid. To increase synthesis efficiency, 50ng linearized backbone
vector, 250ng insert fragment, and 5ul 2x Gibson Assembly Master Mix was used for
one reaction. The total reaction volume was brought to 10 ul with nuclease free water.
The reaction mixture was incubated at 50 °C for 1 hour.

For transformation, 3ul of the Gibson Assembly product was added to 20 ul of
NEB5a competent cells followed by heat shock and shaking at 37° C for 1h in 200 ul of
SOC media. Cells were then plated on LB-kanamycin agar plates overnight (USC
Bioreagent and Cell Culture Core). Colonies were inoculated in 5ml of LB and incubated
overnight in a 37 °C shaking incubator. Bacterial stocks were frozen at -80 °C for future
Functional Characterization of a Prostate Cancer Risk Region
17

inoculations (400 ul of the bacteria in LB was mixed with 400 ul of glycine). The QiaPrep
Miniprep Kit (Qiagen) was used to isolate the plasmid. Transformed cells were
centrifugated and resuspended in buffer P1 buffer and subsequently lysed by buffer P2.
After 5 minutes, the reaction was terminated by the addition of buffer N3. The lysate
was centrifuged and the supernatant was transferred to a QiaPrep spin column. The
column was washed with buffer PB followed by buffer PE. Plasmid DNA was eluted in
50ul of buffer EB and DNA concentration was measured by Nanodrop.

To verify that the complete guide RNA expression plasmid was successfully
transfected into the cells, T7-F (5’- TAATACGACTCACTATAGGG) and Sp6-R (5’-
CGCCAAGCTATTTAGGTGACA ) primers were used for a PCR reaction with extracted
plasmid from transfected clones. The solution for the PCR reaction consisted of 2ul
forward and reverse primers (5uM) each, 20 ul 2x Phusion High-Fidelity Master Mix
(NEB), and nuclease-free water for a total volume of 40ul. Linearized backbone vector
(600bp) was used as negative control. The PCR product was run on a 1.5% agarose gel
stained with ethidium bromide and visualized under UV light. Experimental groups were
compared with negative control. Complete guide RNA plasmid PCR product should be
~700bp vs the negative control product of ~600bp. Complete guide RNA plasmids were
purified by the QiaQuick Gel Extraction Kit (Qiagen) and were sequenced by Genewiz
Inc to confirm proper ligation.
The Cas9 nuclease backbone vector is commercially available (Addgene Plasmid
44719). The ampicilin resistant gene is contained in Cas9 nuclease vector. LB solutions
Functional Characterization of a Prostate Cancer Risk Region
18

and LB plates supplemented with ampicilin were used to select competent cells
containing Cas9 plasmids.

Transformation and colony selection
For transfection into human cells, the human prostate cancer cell line C4-2B was
used as a model in this study. Cells were cultured in RPMI-1640 medium supplemented
with 5% FBS (Gibco by Life Technologies) and 1% penicillin/streptinomycin (USC
Bioreagent and Cell Culture Core facility) at 37 °C in 5.0% CO2. The trypsinization
method was used for detaching adherent cells from the growth surface to seed,
passage, or prepare for FACS sorting. Cells were washed with PBS, and then trypsin
was added evenly on the surface of cell layer. Cells were placed in the incubator for
approximately two minutes. RPMI-1640 media with FBS was added to the plate to
neotralize trypsin, cells were pipeted to be detached and disaggregated.

To make deletions in the C4-2B genome, I used Lipofectamine LTX or
Lipofectamine 3000 Transfection Reagent (Invitrogen by Life Technologies) to transfect
Cas9 and guide RNA expression plasmids into the C4-2B cells. The Opti-MEM solution
and Plus reagent were mixed with the plasmid DNA. The Lipofectamine reagent was
diluted in Opti-MEM, and then added to the DNA mixture. After incubation at room
temperature, the solution was added to the cells. For transfections carried out in 6-well
tissue culture plates (growth area 9.6cm^2), cells were seeded at a density of
approximately 6.25x10^5 per well. Transfection of cells in 6-well plates used 2.5 ug of
DNA and 6 ul of Lipofectamine reagent. For transfections carried out in 10cm tissue
Functional Characterization of a Prostate Cancer Risk Region
19

culture dishes (growth area 55cm^2), cells were seeded at a density of approximately
3.5x10^6 per plate and transfected with 12.5 ug DNA and 30 ug of Lipofectamine
reagent. For negative controls, only Cas9 plasmids and water were transfected in cells;
because of the lack of guide RNAs, the Cas9 will not make deletions in the genome.
To confirm CRISPR activity, I first transfected Cas9 and guide RNA plasmids in
293T cells, which have a higher success rate for transfection than do C42B cells. Using
a fluorescence microscope, I could see green fluorescent cells, due to a GFP tag on
the Cas9 protein. Fluorescence-activated cell sorting (FACS) was carried out to select
cells which were successfully transfected (indicated by GFP tag). This step was
performed in the Flow Cytomertry Core of the USC Norris Comprehensive Cancer
Center using a BD FACS Aria II cell sorter. Transfected cells were collected in 150ul of
5% FBS in PBS in microcentrifuge tubes 24 to 48 hours after transfection was
performed. Collected cells were transferred to Flow Cytomertry Core to sort cells with a
positive GFP signal. GFP positive cells were sorted one cell per well into 96-well tissue
culture plates, or into 5ml tubes containing RPMI-1640 growth media and subsequently
diluted to approximately 1 cell per ul in 96 wells tissue culture plates. Cells in 96-well
plates were confirmed to be single clones in each well under microscope, then they
were harvested for genomic DNA isolation when they reached confluency. When
collecting cells for genomic DNA isolation, a small portion of cells were transferred to a
new well in 24-well plates for backup.

In different colonies of C4-2B cells a different number of copies of the target
region might be deleted since the C4-2B cell line is tetraploid. Therefore, RT-PCR was
Functional Characterization of a Prostate Cancer Risk Region
20

carried out to determine how many copies of target regions were deleted.Two sets of
primers were designed to determine whether (and how many copies of) the target
region was succussfully deleted. One set of primer consists a primer upstream of the
deletion start site and a primer downstream of the deletion end site. The other set of
primers will detect the deleted region,with one primer in the target region and the other
primer upstream of the target region.

Genomic DNA and RNA isolation
Genomic DNA, required for enhancer deletion confirmation and deleted copy
number confirmation, was isolated using the QiaAmp DNA Mini Kit (Qiagen) as per
manufacturer protocol (Version 06/2012). Cells were harvested and pelleted by
centrifugation at 1,000 rpm for 10 minutes. Cells were then resuspended in PBS with
proteinase K and buffer AL. The sample was incubated at 56 °C for 10 minutes. Ethanol
was added and the sample was transferred to a QiaAmp Mini Spin Column. The column
was washed with buffer AW1 and AW2. DNA was eluted in 100 ul of EB.

For colonies confirmed to have tri-allelic or tetra-allelic genomic deletions, cell
pellets were collected to perform RNA extraction. Three independent passages of the
clones were collected for RNA-seq. The TRIzol Reagent (ThermoFisher Scientific) was
used to isolate RNA from sample cells, according to the TRIzol RNA Isolation Reagents
user guide (version 9 November 2016). RNAse AWAY was used to digest RNAse in the
environment. Briefly, TRIzol reagent was used to lyse harvested cells. Chloroform was
added, then the solution was centrifuged to separate the organic and aqueous phases.
Functional Characterization of a Prostate Cancer Risk Region
21

RNA was extracted from the aqueous phase and transferred into a new RNAse-free
tube. RNA was precipitated by adding isopropanol followed by centrifugation. The pellet
was washed with 75% ethanol and left to air dry. DEPC-treated water was used to
resuspend RNA and the solution was incubated at 55 °C and stored at -80 °C for future
RNA sequencing.
Viable frozen cell stocks were made by freezing down cells in 10% DMEM in FBS.
These cells were stored in -80 ℃ and liquid nitrogen for backup and future use.

Stratagy two-Puromycin method
The pSpCas9(BB)-2A-Puro (PX459) V2.0 (Addgene plasmid #62988) backbone
vector is used in this method. The Cas9-puro vector consists of Cas9, a puromycin
gene and guide RNA expression elements. For this method, a 29 bp guide RNA is
synthesized and ligated with the backbone vector.

The oligos were annealed in a PCR tube using T4 PNK enzyme. Annealing
solution consisted of 1µ l 100µ M Forward oligo, 1µ l 100µ M Reverse oligo, 1µ l 10X T4
Ligation Buffer (NEB), 0.5µ l T4 PNK enzyme and nuclease-free water for a total volume
of 10µ l. Solution was incubated in thermal cycler 37°C 30min, 95°C 5min, ramp down to
25°C at 5°C /min and hold at 10° C. Backbone vector pSpCas9(BB)-2A-Puro (PX459)
V2.0 (Addgene plasmid #62988) was digested with FastDigest BbsI (Thermo
Cat.#FD1014). Digesting solution consisted of 1µ l FastDigest BbsI, 2µ l PX459 vector
(up to 1µ g), 2µ l 10X FastDigest buffer and nuclease-free water to a total volume of 20
µ l. The digesting solution was incubated at 37° C for 5-30 mins.
Functional Characterization of a Prostate Cancer Risk Region
22

The BbsI-digested PX459 vector was purified using QIAquick Gel extraction kit
(QIAGEN, Cat# 28704/28706). Annealed oligo duplex was ligated with digested PX459
vector using Quick Ligase (NEB #M2200). Ligation solution consisted of 1µl diluted oligo
duplex (1:250), digested PX459 vector 50ng, 5 µl 2X Quick Ligation buffer (NEB), 1µ l
Quick Ligase and nuclease-free water for a total volume of 11µ l. Solution was incubated
at 37°C for 10 mins.Optionaly, the ligation reaction could be treated with PlasmidSafe
exonuclease to digest any residual linearize DNA: 11 µl ligation product from previous
step, 1.5 µl 10X PlasmidSafe Buffer, 1.5 µl 10Mm ATP and 1 µl PlasmidSafe
exonuclease was incubated at RT for 10 mins. Then PX459 ligation product was
transformed by using XL-10 gold Ultracompetent cells (Agilent Technologies, Cat#
200315): two 14ml BD Falcon polypropylene round-bottom tubes were pre-chilled on
ice. (One tube is for the experimental transformation and one tube is for the pUC18
control.) SOC medium was preheated to 42° C. The cells were thawed on ice. When
thawed, cells were gently mixed and aliquoted 100 μl into each of the two pre-chilled
tubes. 4 μl of the β-ME mix came with the kit was added to each aliquot of cells. The
tubes were swirled gently then cells were incubated on ice for 10 minutes, and swirled
gently every 2 minutes. 0.1-50 ng of the experimental DNA (or 2 μl of a ligation mixture)
was added to one aliquot of cells. The pUC18 control DNA (provided in the kit) was
added with sterile dH2O in a ratio of 1:10, then 1 μl of the diluted pUC18 DNA was
added to the other aliquot of cells. The tubes were swirled gently, then incubated on ice
for 30 minutes.The cells were heat-pulsed in a 42° C water bath for 30 seconds. The
duration of the heat pulse is critical. Then the cells were incubated on ice for 2 minutes.
0.9 ml of preheated (42° C) SOC medium was added to tubes and they were incubated
Functional Characterization of a Prostate Cancer Risk Region
23

at 37° C for 1 hour with shaking at 225-250 rpm. Less than 200 µl of the transformation
mixture was plated on LB agar plates containing the appropriate antibiotic (in this case,
ampicillin). For the pUC18 control transformation, 5 µl of the transformation was plated
on LB-ampicillin agar plates. The plates were incubated at 37° C overnight.The
recombinant plasmid was isolated by using QIAprep Spin Miniprep Kit(250) (Qiagen,
Cat# 27106). Then the plasmid was sent for Sanger sequencing to confirm successful
cloning.

The transfection and colony seletion, Genomic DNA/RNA isolation steps used to
create CRISPR knock out cell lines in strategy two (Puromycin method) were similar to
those steps in strategy one (GFP method). However, to select cells successfully
transfected by CRISPR plasmids, puromycin selection was used in strategy two. After
transfection, the transfection medium was replaced with 1ml of fresh complete growth
medium supplemented by puromycin (400-900ng/ml) then cells were incubated at 37° C
overnight. Cells were disassociated to single cell suspension and plated in 96-well plate
for single clone deletion verification.

Functional Characterization of a Prostate Cancer Risk Region
24

A
B
Functional Characterization of a Prostate Cancer Risk Region
25

Figure 6. A.GFP method flow chart. B. Puromycin method flow chart. C. Overall experiment flow chart.

Results
Specific Aim 1: CRISPR/Cas9 activity test on 293T cells
293T cells have a higher transfection rate than C42B cells. Therefore, I used
293T cells to confirm the guide RNA-directed CRISPR/Cas9 activity at the target site. I
transfected 293T cells with two different gRNA combinations using Strategy One, each
combination consisted of a set of forward and reverse gRNAs. After transfection,
genomic DNA of a pooled sample was extracted and tested for deletion using primers
flanking (primer 1,2) or inside (primer 3,4) the region targeted for deletion (Fig. 7A). For
gRNA combination 2 (forward gRNA L2 and reverse gRNA R2) transfected 293T cells,
C
Functional Characterization of a Prostate Cancer Risk Region
26

a large band (approximately 1200bp) amplified by primer 1 indicates that intact
rs11598549 region was detected, while a small band (approximately 400bp) indicates
that rs11598549 region was deleted in some of the cells. However, for gRNA
combination 1 (forward gRNA L1 and reverse gRNA R1) transfected 293T cells, only
the large band was amplified. The same result was obtained when using primer 2 for
PCR. This gives evidence that the gRNA combination 2 was successful in deleting the
target region but the gRNA combination 1 was not successful (Fig 7.B). Also, for gRNA
combination 2- transfected cells, a small band was amplified by the inner primer set
(primer 3,4), which indicates that rs11598549 region was not deleted in all copies in all
pooled samples.
I then tested gRNA combination 2 using C42B cells. The small band with correct
size demonstrates the positive activity of gRNA combination 2 in C42B cells.

A
Functional Characterization of a Prostate Cancer Risk Region
27

Figure 7. Gel electrophoresis figure of pooled sample. A. Four pairs of primers were used to detect
deletions. B. Pool sample test on 293T cells and C4-2B cells. (1, 3) are 293T cell tested by outter primers.
(2, 4) are C42B cell tested by outer primers. (5) is 293T cell tested by internal primers. The faint smaller
band of (1,2,3,4) shows the PCR product on deletion clones.

Specific aim 2: Delete the rs11598549 region in the C42B prostate cancer cell
line
Rs11598549 is located in the intron of the CTBP2 gene and near the ZRANB1
gene. This SNP is within a DNA hypersensitive site, indicating that this location is a
potential transcriptional factor binding site. I deleted 832bp, which includes the entire
DHS peak region, aiming to eliminate transcriptional factor binding at this location.
B
(1) (2) (3) (4) (5)
Functional Characterization of a Prostate Cancer Risk Region
28

Figure 8. Region of deletion. Deletion region is in the intron of CTBP2 gene and nearby ZRANB1 gene;
deletion size is 832bp. The deletion region covers rs11598549, the whole DHS and CTCF ChIP-seq peak
region in several cell lines including LNCaP and C42B.

Single clones were analyzed by PCR to identify deletions. Twenty-three out of
100 clones had at least one copy of the target region deleted. I picked several clones
which had the band pattern in Fig. 9A and performed RT-PCR to determine how many
copies were deleted for each clone. The small band of those clones I selected were
stronger than the big band, which gave higher chance to obtain three-copy deletion
clones. I identified three clones (2F3, 1G6, 1D7), which have three-copy deletions, as
determined by RT-PCR (Fig.9C).
Functional Characterization of a Prostate Cancer Risk Region
29

Figure 9. RNA-seq candidate clone selection. A.Single clones that had both deleted and undeleted alleles
were selected to test for deleted copy number using RT-PCR. B. RT-PCR primer design. C. Three clones
have less than 25% of the copies left. D. C4-2B cell karotype.

A
B
C D
Functional Characterization of a Prostate Cancer Risk Region
30

Specific Aim 3: Differential gene expression analysis on rs11598549 region
deleted clones
I prepared three RNA replicates from each clone for RNA-sequencing. To obtain
the replicates, I thawed clones into a 6-well plate, one clone in each well, and passaged
them into two dishes, saving one dish as replicate 1, and passaging the other dish to
get replicate 2; I then passaged the cells again to get replicate 3. The Experion
Automated Electrophoresis System was used to analyze the quality of the RNA
samples, which were then sent to the USC Molecular Genomics Sequecing Facility for
single read RNA-sequecing.

A
Functional Characterization of a Prostate Cancer Risk Region
31

Figure 10. Replicates preparation for RNA sequencing. A. Three deletion clones and two control clones
were involved in sample preparation. Three replicates were made for each clone. B. Replicates were
make by passaging the original clones. Cells were seeded in a well of a new 6-well plate with a number of
5*10^5, the rest of cells were grown for passaging to make another replicate. Three replicates were made
in three continuous day.

I analyzed the RNA-seq data with Partek Flow (Norris Medical Library version).
Tophat2 was used to align sequencing reads to hg19. To discover differential expressed
genes, each deletion clone was compared to an empty vector transfected control. The
RNA-seq data of three replicates for each sample was merged, and two control samples
were merged as one. Differential gene expression analysis used criteria that each gene
must have an RPKM greater than 1, a p value less than 0.05, and 2-fold change was
applied to discover significantly changed gene expression. Moreover, only results which
were repeatable in all three deletion samples were accepted. In other word, only genes
that met the criteria above in all three deletion samples were called as differentially
expressed.
B
Functional Characterization of a Prostate Cancer Risk Region
32

Using these criteria, I identified only 7 genes upregulated and 20 genes
downregulated in the genome and none of the genes were within +/- 2Mb from the
deletion site. Then, I changed the 2-fold change criteria to a 1.5-fold change and
identified 2 downregulated genes, CTBP2 and ADAM12, which are located in a ± 2Mb
window from the deletion site; note that the +/- 2 MB region contains 37 genes but only
2 were differentially expressed.
Functional Characterization of a Prostate Cancer Risk Region
33

Figure 11. CTBP2 gene and ADAM12 gene RNA sequencing data. Both genes were downregulated in
sample A,B,C, which are DHS deleted clones, compared to control sample. Reads were normalized by
upper quartile.

A
B
Functional Characterization of a Prostate Cancer Risk Region
34

Conclusion
In this work, a DNAse I hypersensitive site containing risk SNP 11598549 was
deleted by CRISPR. Two different methods, GFP method and puromycin method, were
used to select CRISPR and guide RNA plasmid transfected human cells. The results
shown in this work was using GFP method. I used the Puromycin method to create
other clones which were not described in this work. Differentially expressed genes were
identified by RNA sequncing two control samples and clones that deleted 3 of the 4
copies of the target region. Each sample was analzyed in triplicate to obtain convincing
data. Genes having more than 1.5 fold and repeatable in all three deletion samples
were regarded as significantly changed genes. The number of differentially expressed
genes genome-wide and within ± 2MB window of the deletion site is summerized in
Table 1. Differentially expressed genes within a ± 2MB window of deletion site, i.e.
CTBP2 gene and ADAM12, are more likely to show changes in expression as a direct
effect of DHS site deletion than are far away genes. Notably, the CTBP2 gene is highly
relevent to prostate cancer generation and development [12], which was approximately
two fold down regulated in all three deletion samples compared to control samples,
which gives evidence that the risk allele of rs11598549 may affect prostate cancer via
regulating CTBP2 gene.
Table 1. 2-fold change cutoff differential expressed genes number in genome wide and within ± 2MB
window of deletion site.

UP REGULATED
GENE No.
DOWN REGULATED GENE
No.
GENOME WIDE 7 20
DELETION SITE
± 2MB WINDOW
0 0

Functional Characterization of a Prostate Cancer Risk Region
35

Table 2. 1.5-fold change cutoff differential expressed genes number in genome wide and within ± 2MB
window of deletion site.

UP REGULATED
GENE No.
DOWN REGULATED GENE
No.
GENOME WIDE 25 53
DELETION SITE
± 2MB WINDOW
0 2

Discussion
The changes in gene expression observed in the deleted cells suggests that I
deleted a regulatory region. Data from ENCODE indicates that several TFs can bind to
this region. CTCF ChIP-seq data does show binding of this factor to the risk SNP
region in different prostate cancer cell lines, for example, LNCaP, indicating that this
region is a potential CTCF binding site (Fig. 12A). Moreover, Farnham lab CTCF ChIP-
seq data in C4-2B cell line shows a weak signal in this location (Fig.12B). CTCF is a
transcription factor binding region that is postulated to play a role as insulator which
establishes discrete inheritable functional chromatin domains by forming chromatin
looping. [10,11]. It ’s not clear yet that whether a weak binding of CTCF would contribute
to the regulation of the CTBP2 gene. However, CTCF should be considered a candidate
as the TF that is responsible for differential expression of the CtBP2 gene.
Knockout of this DNAse I hypersensitive site was found to be associated with
increased expression of LPHN2 gene, which is a antiproliferative and apoptotic gene.
LPHN2 gene is located at chromosome 1, so its upregulation might not be a direct effect
of the DHS deletion. Several genes related to cancer progression (e.g. CTBP2,
Functional Characterization of a Prostate Cancer Risk Region
36

ADAM12) were changed more than 1.5 fold in DHS deleted cells. LPHN2 gene might be
regulated by one or several of these genes, and the expression level change of those
genes results in the increase of LPHN2 gene expression and promote the cell
apoptosis.

Figure 12. Genome browser view of rs11598549 region. A. rs11598549 is in CTCF peak in several cell
lines. B. rs11598549 is in a weak CTCF peak in C4-2B cell line.

B
A
Functional Characterization of a Prostate Cancer Risk Region
37

Future Directions
The DNAse I hypersensitive site marked by prostate cancer rs11598549 was
demostrated to be a region regulating CTBP2 gene expression. However, the
mechanism by which this occurs remains unclear. I hypothesize that this region is
bound by one or several transcriptional factors that contribute to topological associated
domain formation. In other words, the transcriptional factor binds at this region as an
anchor to form DNA looping. Interestingly, there are ten enhancers within a ± 300kb
window from the DHS. Perhaps deleting the SNP region results in a change in the
topological domain in which the CTBP2 gene resides, removing the nearby enhancer
function and decreasing CTBP2 gene expression. Hi-C, which is a technique that can
comprehensively detect chromatin interactions in cells with high resolution, can be used
as a powerful method to examine the chromosome 3D structure in genome and in this
region. Future studies could focus on studying the 3D looping in the control vs the
deleted cells.

Functional Characterization of a Prostate Cancer Risk Region
38

References
1. Durmaz, A. A., Karaca, E., Demkow, U., Toruner, G., Schoumans, J., & Cogulu, O.
(2015). Evolution of genetic techniques: Past, present, and beyond. BioMed
Research International, 2015, 461524. doi:10.1155/2015/461524
2. Manolio, T. A. (2010). Genomewide association studies and assessment of the risk
of disease. The New England Journal of Medicine, 363(2), 166-176.
doi:10.1056/NEJMra0905980
3. Coetzee, S. G., Rhie, S. K., Berman, B. P., Coetzee, G. A., & Noushmehr, H.
(2012). FunciSNP: An R/bioconductor tool integrating functional non-coding data
sets with genetic association studies to identify candidate regulatory SNPs. Nucleic
Acids Research, 40(18), e139. doi:10.1093/nar/gks542
4. ENCODE Project Consortium. (2012). An integrated encyclopedia of DNA elements
in the human genome. Nature, 489(7414), 57-74. doi:10.1038/nature11247
5. Horoszewicz JS, Leong SS, Kawinski E, Karr JP, Rosenthal H, et al. (1983) LNCaP
model of human prostatic carcinoma. Cancer Research 43: 1809 –1818.
6. Sobel R, Sadar M (2005) Cell lines used in prostate cancer research: a compendium
of old and new linespart 1. The Journal of Urology 173: 342 –359.
7. Sobel R, Sadar M (2005) Cell lines used in prostate cancer research: a compendium
of old and new linespart 2. The Journal of Urology 173: 360 –372.
8. Thalmann, G. N., Anezinis, P. E., Chang, S. M., Zhau, H. E., Kim, E. E., Hopwood,
V. L., . . . Chung, L. W. (1994). Androgen-independent cancer progression and bone
metastasis in the LNCaP model of human prostate cancer. Cancer Research,
54(10), 2577-2581.
Functional Characterization of a Prostate Cancer Risk Region
39

9. Han, Y., Hazelett, D. J., Wiklund, F., Schumacher, F. R., Stram, D. O., Berndt, S.
I., . . . Haiman, C. A. (2015). Integration of multiethnic fine-mapping and genomic
annotation to prioritize candidate functional SNPs at prostate cancer susceptibility
regions. Human Molecular Genetics, 24(19), 5603-5618. doi:10.1093/hmg/ddv269
[doi]
10. Narendra, V., Rocha, P. P., An, D., Raviram, R., Skok, J. A., Mazzoni, E. O., &
Reinberg, D. (2015). CTCF establishes discrete functional chromatin domains at the
hox clusters during differentiation. Science (New York, N.Y.), 347(6225), 1017-1021.
doi:10.1126/science.1262088
11. Rao, S. S., Huntley, M. H., Durand, N. C., Stamenova, E. K., Bochkov, I. D.,
Robinson, J. T., . . . Aiden, E. L. (2014). A 3D map of the human genome at kilobase
resolution reveals principles of chromatin looping. Cell, 159(7), 1665-1680.
doi:10.1016/j.cell.2014.11.021
12. Takayama, K., Suzuki, T., Fujimura, T., Urano, T., Takahashi, S., Homma, Y., &
Inoue, S. (2014). CtBP2 modulates the androgen receptor to promote prostate
cancer progression. Cancer Research, 74(22), 6542-6553. doi:10.1158/0008-
5472.CAN-14-1030
13. Kim, D., Bae, S., Park, J., Kim, E., Kim, S., Yu, H. R., . . . Kim, J. S. (2015).
Digenome-seq: Genome-wide profiling of CRISPR-Cas9 off-target effects in human
cells. Nature Methods, 12(3), 43, 1 p following 243. doi:10.1038/nmeth.3284
14. Mali, P., Yang, L., Esvelt, K. M., Aach, J., Guell, M., DiCarlo, J. E., et al. (2013).
RNA-guided human genome engineering via Cas9. Science (New York,
N.Y.), 339(6121), 823-826. doi:10.1126/science.1232033
Functional Characterization of a Prostate Cancer Risk Region
40

15. O'Geen, H., Henry, I. M., Bhakta, M. S., Meckler, J. F., & Segal, D. J. (2015). A
genome-wide analysis of Cas9 binding specificity using ChIP-seq and targeted
sequence capture. Nucleic Acids Research, 43(6), 3389-3404.
doi:10.1093/nar/gkv137
16. Wang, X., Wang, Y., Wu, X., Wang, J., Wang, Y., Qiu, Z., et al. (2015). Unbiased
detection of off-target cleavage by CRISPR-Cas9 and TALENs using integrase-
defective lentiviral vectors. Nature Biotechnology, 33(2), 175-178.
doi:10.1038/nbt.3127
17. Chinnadurai, G. (2002). CtBP, an unconventional transcriptional corepressor in
development and oncogenesis. Molecular Cell, 9(2), 213-224. doi:S1097-
2765(02)00443-4
18. Ran, F. A. (2017). Adaptation of CRISPR nucleases for eukaryotic applications.
Analytical Biochemistry, 532, 90-94. doi:S0003-2697(16)30354-2
19. Tyner, C., Barber, G. P., Casper, J., Clawson, H., Diekhans, M., Eisenhart, C., …
Kent, W. J. (2017). The UCSC Genome Browser database: 2017 update. Nucleic
Acids Research, 45(Database issue), D626 –D634.
http://doi.org/10.1093/nar/gkw1134

Functional Characterization of a Prostate Cancer Risk Region
41

Appendix
Table 3. 1.5-fold change cutoff upregulated gene list in genome wide.
GENE
NAME
CHROMO-
SOME
FC in
Sample A
FC in
Sample B
FC in
Sample C
Average
FC Rank
LPHN2 1 2.18 5.64 40.26 16.03 1
TMSB4X X 5.22 7.28 11.48 7.99 2
CADPS2 7 4.45 8.85 8.85 7.38 3
IGFBP3 7 1.63 2.24 17.85 7.24 4
LPL 8 2.05 6.07 12.41 6.84 5
COLCA1 11 1.49 3.98 14.87 6.78 6
RND3 2 1.54 6.41 10.36 6.10 7
CCDC85A 2 6.94 3.54 3.54 4.67 8
SLPI 20 2.32 2.06 9.39 4.59 9
GRIK2 6 1.89 4.99 6.39 4.42 10
PTPRK 6 3.43 2.77 5.96 4.05 11
ZNF470s 19 3.57 1.57 4.04 3.06 12
CHMP4A 14 3.58 1.79 3.74 3.04 13
GLYATL2 11 1.58 2.58 4.44 2.87 14
C14ORF159 14 1.65 2.72 3.46 2.61 15
TFAP2A 6 3.22 1.87 2 2.36 16
ZNF71 19 2.74 1.61 2.64 2.33 17
PLEKHA4 19 3.13 1.91 1.94 2.33 18
FEZF1-AS1 7 1.73 1.78 2.62 2.04 19
LARGE 22 1.52 1.91 2.42 1.95 20
CRISP3 6 1.93 1.50 2.34 1.92 21
PCDHGA8 5 1.77 1.62 2.27 1.89 22
RNF43 17 1.78 2.07 1.77 1.87 23
AC010642.1 19 1.56 1.57 2.31 1.81 24
CYP4Z1 1 1.56 2.03 1.57 1.72 25

Functional Characterization of a Prostate Cancer Risk Region
42

Table 4. 1.5-fold change cutoff downregulated gene list in genome wide.
GENE
NAME
CHROMO-
SOME
FC in
Sample A
FC in
Sample B
FC in
Sample C
Average
FC Rank
ABCA4 1 -9.87 -13.04
-10.21
-11.04 1
TRGC1 7 -1.99 -2.58 -17.76 -7.44 2
MAP9 4 -4.64 -4.83 -8.67 -6.05 3
PCSK1N X -3.81 -4.09 -4.99 -4.30 4
NBL1 1 -3.79 -5.3 -2.64 -3.91 5
EPHA6 3 -2.48 -1.63 -6.82 -3.64 6
WLS 1 -2.97 -5.54 -2.33 -3.61 7
CACNA1H 16 -4.02 -4.73
-2.06
-3.60 8
KCNMA1 10 -4.27 -2.62 -3.38 -3.42 9
NAALAD2 11 -3.44 -3.1 -3.69 -3.41 10
ELOVL2 6 -2.15 -1.54 -5.78 -3.16 11
RALGPS2 1 -1.77 -2.87 -4.83 -3.16 12
TMEFF2 2 -3.76 -1.81 -3.88 -3.15 13
MAF 16 -5.51 -1.54 -1.69 -2.91 14
CHRNA7 15 -3.5 -3.03
-2.15
-2.89 15
OSBPL3 7 -2.37 -2.36 -3.95 -2.89 16
GYG2 X -3.11 -2.42 -2.63 -2.72 17
CDC42EP3 2 -1.94 -1.68 -4.18 -2.60 18
CTSO 4 -2.3 -1.62
-3.84
-2.59 19
SLC38A4 12 -2.83 -2.52 -2.22 -2.52 20
GALNT12 9 -1.89 -2.46 -3.09 -2.48 21
TRGC2 7 -1.90 -1.86 -3.62 -2.46 22
EBF2 8 -2.13 -2.47 -2.77 -2.46 23
BCAT1 12 -2.05 -3.09
-2.05
-2.40 24
KB-
1410C5.3 8 -2.29 -2.44 -2.39 -2.37 25
CTD-
2314B22.1 14 -2.07 -2.38
-2.61
-2.35 26
ATXN1 6 -2.1 -1.91
-2.92
-2.31 27
ARMC4 10 -2.19 -2.32
-2.35
-2.29 28
SLTM 15 -2.25 -2.25 -2.35 -2.28 29
FRY 13 -2.53 -1.86 -2.41 -2.27 30
KIF5C 2 -2.64 -1.63 -2.48 -2.25 31
ST6GAL1 3 -2.42 -1.91 -2.39 -2.24 32
HLA-DPA1 6 -2.06 -2.52 -2.07 -2.22 33
GSN 9 -2.13 -2.23 -2.29 -2.22 34
Functional Characterization of a Prostate Cancer Risk Region
43

CERS4 19 -2.49 -2.11 -1.88 -2.16 35
GNAI1 7 -2.33 -1.77 -2.25 -2.12 36
CTBP2 10 -2.32 -1.81
-2.1
-2.08 37
AC073869.1 2 -1.99 -2.18
-2.05
-2.07 38
RHOU 1 -2.08 -1.92 -2.22 -2.07 39
LA16C-
83F12.6 22 -1.93 -2.16 -2.1 -2.06 40
ABCC8 11 -2.84 -1.59 -1.68 -2.04 41
GPR158-
AS1 10 -2.14 -1.69 -2.08 -1.97 42
POTEI 2 -1.92 -2.29 -1.61 -1.94 43
ANKS6 9 -1.79 -1.62 -2.38 -1.93 44
AC131180.4 2 -2.23 -1.82 -1.66 -1.90 45
AC140481.1 2 -2.04 -2 -1.65 -1.90 46
TUBB6 18 -2.37 -1.77 -1.54 -1.89 47
PPARG 3 -2.05 -1.58 -2.04 -1.89 48
PAK3 X -1.91 -2.17 -1.55 -1.88 49
SH3RF3 2 -2.11 -1.53 -1.94 -1.86 50
TGM2 20 -2.05 -1.77 -1.61 -1.81 51
RORA 15 -2.2 -1.5 -1.64 -1.78 52
ADAM12 10 -2.11 -1.68 -1.50 -1.76 53

Abstract (if available)

Abstract The number of age-adjusted new cases of prostate cancer (PCa) in the USA was ~129 per 100,000 men per year during 2009-2013, and the number of deaths was ~20 per 100,000 men per year (https://seer.cancer.gov-/statfacts/html/prost.html). Based on 2010-2012 data, ~14.0 percent of men will be diagnosed with PCa at some point during their lifetime. Genome-wide association studies (GWAS) have made a revolutionarily impact in cancer genetics including PCa. However, the biological mechanisms by which genetic factors contribute to prostate cancer risk are not yet fully characterized. In this study, I focus on the functional annotation of a specific statistically significant prostate cancer risk-associated single nucleotide polymorphism (SNP), rs11598549, that is located in an intron of the C-terminal-binding protein 2 (CtBP2) gene. This SNP is located in an androgen-responsive DNase I hypersensitivity site (DHS) and has been suggested to influence expression of the CtBP2 gene through expression quantitative trait loci (eQTLs) analysis. To experimentally determine if this risk region does influence the expression of CTBP2 (or other genes), I deleted the region containing the SNP using the Cas9 nuclease-CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) system in C4-2B cells, a human prostate tumor cell line. I used RNA-seq to identify differentially expressed genes in the deleted cells vs. the parental C42B cells. I found that the CtBP2 gene was down-regulated ~2-fold in the deleted cells, indicating it is regulated by the risk SNP.

Linked assets

University of Southern California Dissertations and Theses

Conceptually similar

PDF

Functional analysis of a prostate cancer risk enhancer at 7p15.2

PDF

Understanding prostate cancer genetic susceptibility and chromatin regulation

PDF

Functional characterization of colon cancer risk-associated enhancers: connecting risk loci to risk genes

PDF

Functional characterization of colon cancer risk enhancers

PDF

Characterizing ZFX-mediated gene regulation to reveal possible candidates for clinical intervention

PDF

Identification and characterization of cancer-associated enhancers

PDF

Using CRISPR-mediated deletion to study prostate cancer regulatory elements located at loop anchors identified by Hi-C

PDF

The noncanonical role of telomerase in prostate cancer cells: exploring a non-telomeric signaling role for telomerase protein (TERT) in a cancer cell line

PDF

Genes and environment in prostate cancer risk and prognosis

PDF

Homologous cell systems for the study of progression of androgen-dependent prostate cancer to castration-resistant prostate cancer

PDF

Functional characterization of colorectal cancer GWAS loci

PDF

Study of the role of bone morphogenetic proteins in prostate cancer progression

PDF

Breast epithelial cell type specific enhancers and functional annotation of breast cancer risk loci

PDF

Using epigenetic toggle switches to repress tumor-promoting gene expression

PDF

Identification of novel androgen receptor target genes in prostate cancer

PDF

Prostate cancer: genetic susceptibility and lifestyle risk factors

PDF

Systematic analysis of single nucleotide polymorphisms in the human steroid 5-alpha reductase type I gene

PDF

Exploration of the roles of cancer stem cells and survivin in the pathogenesis and progression of prostate cancer

PDF

The role of GRP78 in the regulation of apoptosis and prostate cancer progression

PDF

Functional role of chromatin remodeler proteins in cancer biology

Asset Metadata

Creator Yang, Hang (author)

Core Title Functional characterization of a prostate cancer risk region

School Keck School of Medicine

Degree Master of Science

Degree Program Biochemistry and Molecular Biology

Publication Date 11/20/2017

Defense Date 08/22/2017

Publisher University of Southern California (original), University of Southern California. Libraries (digital)

Tag CRISPR,CtBP2 gene,GWAS,OAI-PMH Harvest,prostate cancer,SNP

Language English

Contributor Electronically uploaded by the author (provenance)

Advisor Farnham, Peggy (committee chair), Rice, Judd (committee member), Tokes, Zoltan (committee member)

Creator Email yanghang@sidansai.com,yanghang@usc.edu

Permanent Link (DOI) https://doi.org/10.25549/usctheses-c40-458128

Unique identifier UC11268429

Identifier etd-YangHang-5929.pdf (filename),usctheses-c40-458128 (legacy record id)

Legacy Identifier etd-YangHang-5929.pdf

Dmrecord 458128

Document Type Thesis

Rights Yang, Hang

Type texts

Source University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Access Conditions The author retains rights to his/her dissertation, thesis or other graduate work according to U.S. copyright law. Electronic access is being provided by the USC Libraries in agreement with the a...

Repository Name University of Southern California Digital Library

Repository Location USC Digital Library, University of Southern California, University Park Campus MC 2810, 3434 South Grand Avenue, 2nd Floor, Los Angeles, California 90089-2810, USA