University of Southern California Dissertations and Theses

Development of targeted therapies for peroxisome biogenesis disorders

(USC Thesis Other)

Development of targeted therapies for peroxisome biogenesis disorders

PDF

Download a page range

Download transcript

Copy asset link

Request this asset

Transcript (if available)

Content

Development of Targeted Therapies for
Peroxisome Biogenesis Disorders

by
Ning Huang

A Dissertation Presented to the
FACULTY OF THE USC GRADUATE SCHOOL
UNIVERSITY OF SOUTHERN CALIFORNIA
In Partial Fulfillment of the
Requirements for the Degree
DOCTOR OF PHILOSOPHY
(MOLECULAR BIOLOGY)

August 2016

Copyright 2016 Ning Huang

ii

ACKNOWLEDGEMENTS

I would like to express my forever gratitude to my advisor and my Committee Chair,
Dr. Joseph Hacia, for giving me the chance to study and explore the power of small
molecule compounds for peroxisomal disorders in his lab, and providing me with
invaluable guidance, encouragement, inspiration and constant support during my Ph.D.
study at the University of Southern California. His mentorship significantly shaped my
career in medical research and my desire to make life-altering therapies available for
patients suffering from rare genetic diseases. From the moment I got involved in
peroxisomal disorders research, his passion and dedication for development of targeted
therapies has been contagious. He guided me to become an independent, insightful and
motivated thinker.
I am sincerely grateful to Dr. Michael Stallcup and Dr. Andrew Smith for their great
advice and serving as my Dissertation Committees. Their encouragement, insightful
suggestions and support has made this dissertation possible. Also I am grateful to Dr.
Norman Arnheim, Dr. Lin Chen, Dr. Sergey Nuzhdin, and Dr. Wange Lu for serving as my
Qualifying Exam Committees.
Special thanks must be conveyed to our collaborators in the Kennedy Krieger
Institute, Ann Moser, for the excellent work in lipid analysis, Dr. Steven Steinberg for
providing all the skin fibroblast cells from patients and tissues from mouse models. My
sincere thanks also go to Dr. James Inglese and Dr. Patricia Dranchak in NIH for their
wonderful work in conducting the high content screening, which leads to the major part of
this dissertation. I want to thank Dr. Nancy Braverman and her Ph.D. student Catherine
Argyriou in McGill University, for communicating scientific discoveries and sharing
iii

materials openly and honestly without holding back.
I would also like to take this opportunity to express my appreciation to the past and
current members in Dr. Hacia’s group for the numerous enjoyable and memorable moments
we had together: Dr. Xiaoming Wang, Dr. Wing-Yan Yik, Dr. Krishna Ramaswamy who
had initiated many projects in the lab and delightfully passed on their knowledge to me;
Bo Ram Kim, Angel Flores, Erin Oliphant, Leone D'Antonio, Andy Lei, Bradford
Steele for their everyday support and inspiring discussions; and Natasha Brisson Martin,
for always being enthusiastic in disease research while fighting disease herself and
initiating the HepG2 project – it is a real pity that she could not continue her research
anymore as we know she would be very happy and proud to see our progress.
I owe my deepest gratitude to my beloved family. My Dad, who is my role model,
my teacher for everything and the reason why my life must go on. I can never forget the
day when I was in college and so shocked to hear about his leukemia diagnosis, while the
last minute I was still recalling our exciting discussion of Human Genome Project over the
phone the day before. Missing him is the heartache that always motivates me on my
pursuing of Ph.D. and scientific career. My Mom, who is my best friend, greatest listener,
forever companion who encourages me with her shining smile even in the darkest days
while carefully hiding her grief. My Grandma, who can always make me feel her love by
my side. Without them, all my discoveries and achievements would never happen.
My final and most heartfelt acknowledgement must go to my dearest partner, Alex
Qiuyu Guo, for his love and support, for helping me become stronger, for our lovely
conversations about science, research, history, world, universe, life, and for everything he
has done for me throughout my graduate school years.
iv

TABLE OF CONTENTS
ACKNOWLEDGEMENTS ii

LIST OF TABLES vii

LIST OF FIGURES viii

ABSTRACT ix

CHAPTER 1: GENERAL INTRODUCTION 1

1.1 Overview of peroxisome discovery and biochemistry 1
1.2 Peroxisome biogenesis and assembly
6
1.3 Peroxisomal disorders 11
1.4 Diagnosis for peroxisomal disorders 16
1.5 Current therapy for peroxisomal disorders 17
1.6 Engineered cell culture models of peroxisome biogenesis
disorders
19
1.7 Mouse models of peroxisomal disorders 21

CHAPTER 2: PEROXISOME ASSEMBLY IN PATIENT-DERIVED CNS
AND HEPATOCYTE-LIKE CELLS
26

2.1 Abstract 26
2.2 Introduction 26
2.3 Materials and methods 29
2.3.1 Cell culture 29
2.3.2 Differentiation of iPSC to CNS cell lineages 31
2.3.3 Differentiation of iPSC to hepatocyte-like cells 32
2.3.4 Cell imaging 34
2.4 Results 35
Zellweger spectrum disorder patient-derived neural and
hepatocyte-like cells show defects in peroxisome assembly
35
2.5 Discussion 37

CHAPTER 3: PRECLINICAL STUDIES FOR RETINAL GENE
THERAPY FOR PEROXISOME BIOGENESIS
DISORDERS
40

3.1 Abstract 40
3.2 Introduction 41
3.3 Materials and methods 44
3.3.1 Gene expression profiling 44
3.3.2 AA V9-mediated delivery of human PEX1 gene 45
3.4 Results 46
v

3.4.1 Transcriptomic changes in the retinas of Pex1-p.G844D
homozygous mice
46

3.4.2 Recovery of peroxisome functions in Pex1-p.G844D
homozygous murine skin fibroblasts by transduction with
AA V9-PEX1 vector
48
3.5 Discussion 50

CHAPTER 4: HIGH-CONTENT SCREENING OF CHEMICAL
LIBRARIES TO IDENTIFY SMALL-MOLECULES THAT
ENHANCE PEROXISOME ASSEMBLY IN PBD-ZSD
PATIENT CELLS
55

4.1 Abstract 55
4.2 Introduction 56
4.3 Materials and methods 58
4.3.1 Cell lines and cell culture 58
4.3.2 High-content screening (HCS) method 59
4.3.3 Chemical compound library 60
4.3.4 Cell imaging 61
4.3.5 Immunoblotting 61
4.3.6 Lipid analysis 62
4.4 Results 62

4.4.1 Identification of small molecules that promote recovery
of peroxisome function in PBD-ZSD patient cells
62
4.4.2 Confirmation of chemical activity by cell-imaging 67

4.4.3 Blood permeable compounds recover peroxisomal
thiolase processing in patient cells
75

4.4.4 VLCFA levels are recovered In PBD-ZSD patient cells
in response to treatments
80
4.5 Discussion 82

CHAPTER 5: DEVELOPMENT AND V ALIDATION OF PEX1-
MUTANT HEPG2 CELLS
88

5.1 Abstract 88
5.2 Introduction 88
5.3 Materials and methods 91
5.3.1 Cell lines and cell culture 91
5.3.2 DNA sequencing analysis 93
5.3.3 Real-time quantitative PCR 94
5.4 Results 94

5.4.1 Identification of PEX1-null and PEX1-p.G843D cell
lines
94

5.4.2 Temperature sensitivity and chemical treatment
response of HepG2 PEX1 mutant cells
97
5.5 Discussion 99
vi

CHAPTER 6: CONCLUSIONS AND PERSPECTIVES 101

6.1 Defects in PBD-ZSD iPS cell derived CNS and hepatocyte-
like cells
101
6.2 Differential gene expression in PEX1-p.G844D mouse 103
6.3 High-content screening for peroxisomal disorders 104
6.4 Future directions 106

BIBLIOGRAPHY 109

vii

LIST OF TABLES
Table 2.1 Skin fibroblast donor information 30
Table 3.1 DEGs in retina tissues obtained from Pex1-p.G844D
homozygote and heterozygote mice
47
Table 4.1 Summary statistics for screening 64
Table 4.2 Compounds promoting rescue of peroxisome assembly in at
least 20% of cells in LOPAC screen as judged by visual
inspection
65
Table 5.1 Summary of mutations in HepG2 mutant candidate cell lines 95

viii

LIST OF FIGURES
Figure 1.1: Comparative schematic of mitochondrial and peroxisomal β-
oxidation pathways in human cells
5
Figure 1.2 Plasmalogen structure 6
Figure 1.3 Two pathways of peroxisome biogenesis 10
Figure 1.4 Model for peroxisome matrix protein import in human cells 11
Figure 1.5 Schematic representation of different types of peroxisomal
disorders
15
Figure 2.1 Schematic representation of the differentiation of iPSCs into
OPCs
32
Figure 2.2 Schematic representation of the differentiation of iPSCs into
hepatocytes
34
Figure 2.3 Peroxisome assembly in OPCs expressing the GFP-PTS1
reporter gene
36
Figure 2.4 Peroxisome assembly in hepatocyte-like cells expressing the
GFP-PTS1 reporter gene
37
Figure 3.1 Murine skin fibroblast cells expressing GFP-PTS1 reporter 49
Figure 4.1 Performance of positive chemical control diosmetin in HCS
of LOPAC1280 library
66
Figure 4.2 Response to hit compounds in immortalized fibroblasts
(PEX1-p.G843D/I700fs) expressing GFP-PTS1 at 5 days
70
Figure 4.3 The peroxisomal identity of the punctate structures in
immortalized fibroblasts M2H cultured with chemicals
71
Figure 4.4 Rescue of peroxisome assembly in immortalized fibroblasts
(PEX1-p.G843D/I700fs) expressing GFP-PTS1 at 5 days
72
Figure 4.5 Catalase import in primary human fibroblast cells lines with
PEX1-p.G843D/null and PEX1-null/null genotypes treated
with chemicals
73
Figure 4.6 Peroxisomal thiolase import in primary human fibroblast cells
lines with PEX1-p.G843D/null and PEX1-null/null genotypes
treated with chemicals
74
Figure 4.7 Thiolase processing rescued by chemical treatment in patient
primary fibroblast with different genetic background
78
Figure 4.8 Thiolase import recovery in PEX1 mutant cell lines cultured
in diosmetin and naltriben
79
Figure 4.9 Peroxisome functional recovery in patient skin fibroblast cells
with various genetic background
81
Figure 4.10 Chemical structures of active compounds uncovered in the
HCS that showed a similar structural motif
87
Figure 5.1 Structure and Sequence of Donor Vector
pUC57_PEX1G843D –CMV-PuroR(RV)
92
Figure 5.2 PEX1 expression in HepG2 mutant candidate lines 96
Figure 5.3 HepG2 and derived mutant cells expressing GFP-PTS1
reporter
98

ix

ABSTRACT
Peroxisome biogenesis disorders (PBDs) are a group of genetically heterogeneous
rare metabolic diseases caused by defects in peroxins, proteins encoded by PEX genes that
function in peroxisome biogenesis. PBDs display an autosomal recessive mode of
transmission with an estimated incidence of 1 in 50,000 births in America. Although the
genetic basis of PBDs is well understood, there is currently no curative therapy or long-
term effective treatment available.
In this dissertation, I described the identification and characterization of small
molecules that enhance peroxisome assembly and function in PBD patient cells through
high-content screening (HCS) of chemical libraries. Our therapeutic hypothesis is that the
rescue of peroxisome assembly and functions will be of therapeutic benefit to individuals
with peroxisome biogenesis disorders. We uncovered a novel group of compounds active
at the micromolar range that rescued peroxisome functions in patient cells based on cell
imaging, biochemical, and protein processing assays. Overall, the novel bioactive small
molecules we identified could provide tools for investigating peroxisome biogenesis and
novel leads for the development of targeted small molecule therapies, and the new cellular
and animal models can be the next generation screening tools to discover and characterize
more active compounds.
In addition, I describe the development of new model systems of PBDs, including
induced pluripotent stem cells (iPSCs), HepG2 cells and mice. We generated iPSCs from
primary skin fibroblasts of PBD patients and differentiated them into central nervous
system (CNS) and hepatocyte cell lineages and showed peroxisomal protein defects of the
derived cells. We also generated and characterized HepG2 PEX1 mutant cell lines with
x

peroxisome assembly defects. Finally, I also participated in the characterization of the
Pex1-p.G844D mouse which is the first mouse model with hypomorphic PEX alleles and
thus better disease model for PBD patients with milder clinical features. Gene expression
profiling of the murine retina and the recovery of peroxisomal protein import by adeno-
associated virus (AA V)-mediated gene expression suggested that the mice can serve as a
powerful model system for investigating retinal gene therapy. Overall, These iPSC, iPSC-
derived cells, murine model skin fibroblast and HepG2 cells carrying common PEX1
mutations can have future applications for chemical library screening for candidate drugs
that directly address the cell type specificity of disease and the nature of the mutations
found in the patient population.

1

CHAPTER 1
GENERAL INTRODUCTION
1.1 Overview of peroxisome discovery and biochemistry

Peroxisomes are subcellular organelles present in nearly all eukaryotic cells except
mature human erythrocyte, which are indispensable for human health and development
(Hruban et al., 1974; Purdue and Lazarow, 2001; Schluter et al., 2007; Wanders and
Waterham, 2006a; Wang et al., 2015). The number of peroxisomes per cell can range from
a few hundred to a few thousands (Hruban et al., 1974). They are single-membrane bound,
devoid of DNA, mainly spherical organelles with finely granular matrix and sized from
0.1μm to 1μm in diameter (Moser, 1991).
Peroxisomes were first named and characterized as organelles by Christian de Duve,
cytologist and biochemist awarded the Nobel Prize in Physiology or Medicine in 1974. De
Duve and his team successfully isolated peroxisomes from rat liver, which at that time were
described as “microbodies”. They discovered the co-localization of several H2O2-
producing oxidase and H2O2-degrading enzymes in the organelle matrix and established
the term “peroxisome” (De Duve and Baudhuin, 1966).
Peroxisomes are multi-purpose organelles with remarkably dynamic capacity to
respond to physiological changes in the cellular environment by adapting their number,
morphology, enzyme content and metabolic functions (Islinger et al., 2010; Ribeiro et al.,
2012). Peroxisomes play indispensable roles in metabolism of very long chain fatty acids
(VCLFA, 24-28 carbon atoms in length), branched chain fatty acids (including phytanic
and pristanic acid), and pipecolic acid. In addition, they play critical roles in the
biosynthesis of cholesterol, docosahexanoic acid (DHA), bile acids and ether-
2

phospholipids including plasmalogens. Peroxisomes also contain enzymes involved in
glyoxylate, amino acid, purine and pyrimidine metabolism (Moser, 1991). Moreover,
peroxisomes also generate and subsequently inactivate reactive oxygen species (ROS)
including hydrogen peroxide (Krause et al., 2009; Schrader and Fahimi, 2006).
In yeast and plants fatty acid β-oxidation takes place exclusively in peroxisomes
whereas in human and other mammals it occurs both in mitochondria and peroxisomes
(Kunau et al., 1995) (Figure 1.1). While their basic biochemical mechanisms are similar,
defects in peroxisomal and mitochondrial fatty acid β-oxidation result in different clinical
phenotypes (Rinaldo et al., 2002). Both peroxisomal and mitochondrial fatty acid β-
oxidation involves four consecutive chemical reactions: dehydrogenation, hydration, and
dehydrogenation again and thiolytic cleavage (Wanders, 2004). The result of one cycle of
β-oxidation is the reduction of a two-carbon unit in the form of an acetyl-CoA, which can
be further degraded in the Krebs citric acid cycle and produce carbon dioxide, water, and
ATP.
Despite their mechanistic similarities, peroxisomal and mitochondrial β-oxidation
pathways differ in their substrate types of fatty acid and their derivatives (Wanders, 2004).
Mitochondria catalyze the β-oxidation of dietary fatty acids including short- and medium-
chain fatty acids including palmitate, oleate, linoleate, and linolenate, while peroxisomal
β-oxidation substrates include:
1) very-long-chain fatty acids (VLCFA) derived from both dietary sources and
endogenously from shorter chain fatty acids, notably hexacosanoic acid (C26:0),
which are β-oxidized exclusively in peroxisomes;
2) pristanic acid (2, 6, 10, 14-tetramethylpentadecanoic acid) as derived from dietary
3

sources either directly or indirectly from phytanic acid (3, 7, 11, 15-tetramethyl
hexadecanoic acid); and
3) di- and tri-hydroxycholestanoic acid (DHCA and THCA, respectively), which are
intermediates generated during the biosynthesis of mature bile acids, cholic acid
and chenodeoxycholic acid, from cholesterol in the liver (Wanders, 2004).
As previously stated, peroxisomal fatty acid catabolism is a four step process in
mammalian cells. The first step is catalyzed by acyl-CoA oxidases (ACOX), which is
regarded to be the main enzymatic step controlling the flux through the pathway (Poirier
et al., 2006). The next step is the hydration of the bond between C-2 and C-3 followed by
the oxidation of the hydroxyl group into a keto group by bi-functional proteins with both
enoyl-CoA hydratase and 3-hydroxy-acyl-CoA dehydrogenase activities. The final step is
a thiolysis process catalyzed by thiolases that releases the first two carbon units as acetyl
CoA, and a fatty acyl-CoA minus two carbons. It is worth noting that in contrast to
mitochondrial fatty acid β-oxidation, peroxisomal fatty acid β-oxidation only results in
chain-shortened fatty acids, but not complete oxidation to carbon dioxide and water
(Wanders and Waterham, 2006a). The peroxisomal substrates are chain-shortened to short-
chain or medium-chain acyl-CoA esters which can then be transported into the
mitochondria as carnitine esters to allow complete oxidation to CO2 and H2O (Wanders,
2004).
The presence of an alkyl group at the C3 position of a fatty acyl-CoA can block
peroxisomal β-oxidation. Thus, the branched chain fatty acid phytanic acid (3,7,11,15-
tetramethyl hexadecanoic acid) must go through α-oxidative decarboxylation to produce
pristanic acid, an (n-1) fatty acid with the methyl-group at C2 position and then undergo
4

β-oxidation (Wanders and Waterham, 2006a). Impaired peroxisomal α-oxidation, most
typically as a result of mutations in the peroxin 7 (PEX7) or phytanoyl-CoA-hydroxylase
(PHYH) genes can result in the extensive accumulation of phytanic acid in various tissues
as discussed later. In the case of PHYH mutations, this leads to adult Refsum disease (ARD),
a peripheral neuropathy and loss of sensory neural functions that affect vision, hearing,
taste, and smell.
Another important role of peroxisomes in human health and disease is the
biosynthesis of ether-phospholipids (Figure 1.2). In fact, the first two steps of ether-
phospholipid biosynthesis happen exclusively in the peroxisome (Brites et al., 2004).
Plasmalogens are a type of ether-phospholipid characterized by the presence of a vinyl
ether linkage at the sn-1 position and an ester linkage at the sn-2 position. In mammals, the
sn-1 position is typically derived from C16:0, C18:0, or C18:1 fatty alcohols, while the sn-
2 position is most commonly occupied by polyunsaturated fatty acids.
Plasmalogens are the major component of myelin in the central nervous system
(CNS) as it accounts for up to 80% of the membrane phospholipids in the white matter of
the brain (Steinberg et al., 2006). Plasmalogens are also enriched in liver, kidney, lung,
heart, skeletal muscle and testis and make up 18% of the total phospholipid mass in human
(Steinberg et al., 2006; Wanders and Waterham, 2006a). Although their biochemical
functions are not fully defined, plasmalogens are believed to play crucial roles as
endogenous antioxidants, mediators of membrane dynamics and intracellular signaling.
This is exemplified by the physiological manifestations of mouse models of plasmalogen-
deficiencies and patient with rhizomelic chondrodysplasia punctate (RCDP) which is
caused by defects in plasmalogen biosynthesis as discussed later.
5

Figure 1.1 Comparative schematic of mitochondrial and peroxisomal β-oxidation
pathways in human cells.

A β-oxidation in mitochondria: FADH2 and NADH generated in the first and third steps of
fatty acid β-oxidation, directly enter the respiratory chain.
B β-oxidation in peroxisomes: First step is that O2, as electron acceptor is oxidized to
hydrogen peroxide, which is reconverted into O2 by catalase. Figure is adapted from
reference (Wanders and Waterham, 2006b).

6

Figure 1.2 Plasmalogen structure.

A Plasmalogens are glycerophospholipids characterized by the presence of a vinyl-ether
linkage at the sn-1 position and an ester-linkage at the sn-2 position. R1 and R2 represent
straight-chain carbon groups. At the sn-1 position, the chemical group highlighted in red is
an alkenyl group, which are used to measure plasmalogen abundance and molecular
composition. These alkenyl groups are mostly derived from C16:0, C18:0, or C18:1 fatty
alcohols. The sn-2 position of plasmalogens is most commonly occupied by
polyunsaturated fatty acids. X represents the head group, typically ethanolamine or choline
for plasmalogens. In contrast,
B diacylglycerophospholipids have ester-linkages at their sn-1 and sn-2 positions. R1 and
R2 represent straight-chain carbon groups and X represents the head group (Moser et al.,
2011).

1.2 Peroxisome biogenesis and assembly
It is believed that peroxisomes can be formed both autonomously by the growth
and division of pre-existing peroxisomes and de novo from the endoplasmic reticulum (ER)
(Figure 1.3). Autonomous biogenesis (also called the fission pathway) is believed to be the
primary pathway whereby the new peroxisomes arise from peroxisome division. It
proceeds through at least three partially overlapping steps: elongation, membrane
C
C
C C C
C
C
C
C
C
O
O
O
O
O
O
C
O
O
O
O
O
O
O
O
O
R
R R
R
X X H
H
H H
H
H
H H
P P
2 2
2 2
sn-1
position
sn-2
position
A B
1 1
2 2
head
group
7

constriction, and the final fission (Fagarasanu et al., 2007). In the de novo biogenesis (also
called the fusion pathway), pre-peroxisomal vesicles originate in specialized compartments
of the ER - that bud off and fuse (Lazarow and Fujiki, 1985; Purdue and Lazarow, 2001).
These immature peroxisomes house a partial complement of peroxisomal membrane
proteins (PMPs) and later soluble peroxisomal proteins translated in the cytoplasm are
imported into the peroxisome matrix to form mature peroxisomes, as discussed below
(Titorenko and Mullen, 2006).
About 85 human genes have been identified that encode peroxisomal proteins,
including metabolic enzymes and a family of PEX genes (Schrader and Fahimi, 2008).
PEX genes encode peroxins, which are peroxisomal proteins involved in the peroxisome
biogenesis, assembly and maintenance of functions. In mammals, 14 different peroxins are
known (without counting isoforms) with functions ranging from membrane synthesis and
matrix protein import (Islinger et al., 2010). The majority of the peroxisomal proteins are
synthesized on free polyribosomes in the cytosol and imported into the peroxisome post-
translationally (Lazarow and Fujiki, 1985). One current model for mammalian peroxisome
matrix protein import is illustrated in Figure 1.4. Proteins that are destined to peroxisome
matrix comprise either one of the two peroxisome targeting signals: PTS1 or PTS2. PTS1
is a carboxyl-terminal motif (the tripeptide (S/A/C)-(K/R/H)-(L/M)) that is recognized by
PEX5, a tetra-tricopeptide repeat (TPR) domain protein and utilized in the vast majority of
peroxisome matrix proteins (Brocard and Hartig, 2006). Only three mammalian
peroxisomal matrix proteins (ACAA1, AGPS and PHYH) contain an amino-terminal PTS2
motif (the nonapeptide: (R/K)-(L/V/I)-X(5)-(H/Q)-(L/A)) that is recognized by PEX7, a
WD40 domain protein with long form PEX5 as an accessory factor for import and often
8

cleaved in the peroxisomal matrix (Wanders, 2004). Peroxisome targeting signals appear
to be distinct and conserved among eukaryotes. In both pathways, the cargo proteins are
transported to the docking complex of PEX13 and PEX14 on peroxisome membrane
surface. Then the cargo binding PEX5 are integrated to the peroxisomal membrane and the
cargo is imported with the assistance of the really interesting new gene (RING)-finger
complex, composed of the PEX2, PEX10 and PEX12 proteins. After releasing the cargo,
PEX5 is mono-ubiquitinated and recycled to the cytosol for a next round of import by the
RING-finger recycling complex of the cytosolic AAA (ATPase associated with diverse
cellular activities) - ATPases PEX1 and PEX6 and the membrane protein PEX26 (Platta et
al., 2009; Platta et al., 2007; Prestele et al., 2010; Steinberg et al., 2006). Noteworthy, the
polyubiquitination of PEX5 is believed to be a quality control step that dysfunctional
proteins will be degraded in proteasome (Platta and Erdmann, 2007).
The peroxins PEX3, PEX16 and PEX19 are involved in membrane assembly and
insertion of PMPs. PMPs are synthesized on free ribosomes in the cytosol containing
internal membrane targeting sequence (mPTS) which comprise a PEX19 binding site and
a membrane-anchoring sequence (Van Ael and Fransen, 2006). A loss of PEX3, PEX16, or
PEX19 gene function results in the absence of detectable peroxisomes/peroxisomal
membranes, whereas reintroduction results in a de novo formation of peroxisomes from the
ER (Schrader and Fahimi, 2008). PEX11 is involved in the elongation step of peroxisome
division, whereas dynamin-related GTPases (DRPs) and Fis1p, a membrane adaptor for
DRPs catalyze the final fission event (Fagarasanu et al., 2007; Schluter et al., 2007). The
overexpression of PEX11 leads to peroxisome proliferation, while its inactivation results
in reduced peroxisome abundance (Baes and Van Veldhoven, 2006).
9

In mammalian cells, over 70 distinct enzymes are required for normal lipid
metabolism and other critical biochemical processes (Wanders and Waterham, 2006a).
Besides peroxins, a variety of peroxisomal transporters serve as the metabolite carriers to
transport the metabolites, such as different kinds of fatty acids, plasmalogens, ADP/ATP
and NAD+/NADH. The peroxisomal ATP-binding cassette (ABC) transporters are a major
group of peroxisomal metabolite carriers and are involved in transportation of VLCFAs
(Morita and Imanaka, 2012). A functional ABC transporter is composed of a homo- or
heterodimer of half ABC transporters, each having six transmembrane alpha helices and
one conserved hydrophilic nucleotide-binding domain. The mammalian peroxisomes
contain four types of half ABC transporters, the adrenoleukodystrophy protein (ALDP or
ABCD1), ALDRP (or ABCD2), PMP70 (or ABCD3), and PMP70R (or ABCD4) (Wanders
and Waterham, 2006a).
Peroxisome proliferator activated receptor-α (PPARα) is a nuclear transcription
factor controlling the expression of peroxisomal proteins (Islinger et al., 2001). In rodents,
but not primates or dogs, binding of PPARα to hypolipidemic drugs and plasticizers (so-
called peroxisome proliferators) results in remarkable increase in peroxisome number and
size, accompanied with an increase in the synthesis of peroxisomal enzymes in livers
(Issemann and Green, 1990; Wolfrum et al., 2001). This selective induction is associated
with the formation of hepatocarcinogenesis, specifically in rats and mice (Peters et al., 2005;
Reddy and Rao, 2006). However, the peroxisomal basis for cancer development is unclear
and, in fact, it has been proposed that this is due to c-Myc overexpression (Miller et al.,
1996).

10

Figure 1.3 Two pathways of peroxisome biogenesis.

The processes of de novo peroxisome biogenesis from the ER and peroxisome fission
pathway are as depicted (Fagarasanu et al., 2007).

11

Figure 1.4 Model for peroxisome matrix protein import in human cells.

Peroxisomal matrix protein with either peroxisome targeting signal 1 or 2 (PTS1/PTS2)
binds to PEX5 or PEX7 and docks on PEX13/PEX14 and translocates into the matrix
through interaction with PEX2/10/12 complex. The receptors PEX5/7 can be recycled back
to the cytosol for another round of import through PEX1/6/26.

1.3 Peroxisomal disorders
Peroxisome dysfunction can result in developmental abnormalities and
degenerative conditions that affect most major organ systems. Traditionally, peroxisomal
disorders are classified into two major categories, namely peroxisome biogenesis disorders
(PBDs) and peroxisomal single enzyme deficiencies (Figure 1.5). Here, we will place a
special emphasis on PBDs.
In general, PBDs are rare multi-systemic disorders that display autosomal recessive
12

modes of transmission. Collectively they have an estimated incidence of 1 in 50,000 births
in America (Steinberg et al., 2006). All PBDs share defects in the import of peroxisome
matrix proteins. Nevertheless, depending on the nature of the import defect, they are
divided into 2 groups: Zellweger spectrum disorder (PBD-ZSD, having defects in the PTS1
and PTS2 import pathways that can affect the import of all peroxisomal matrix proteins)
and rhizomelic chondrodysplasia punctata type 1 (RCDP1, only having defect in the PTS2
import pathway and thus affect the import of only three peroxisomal matrix proteins:
ACAA1, PHYH, and AGPS).
PBD-ZSD represents a complex spectrum of disorders, which are historically
described as infantile Refsum disease (IRD), neonatal adrenoleukodystrophy (NALD), and
Zellweger syndrome (ZS) before the discovery of their common peroxisomal basis
(Zellweger et al., 1988). These disorders affect brain and skeletal development, also cause
postnatal liver, adrenal, kidney dysfunction and loss of vision and hearing. In more recent
times, it has been recommended to replace these names with the overall classification of
PBD-ZSD ranging from mild (IRD), intermediate (NALD) and severe (ZS). The rationale
of this is to highlight the fact that the individual clinical pictures are along a spectrum of
disease severity and variant phenotypes continue to be described that do not fit into the
original assigned categories (Braverman et al., 2016). PBD-ZSDs are primarily associated
with mutations in any of 13 PEX genes, including PEX1, 2, 3, 5, 6, 10, 11, 12, 13, 14, 16,
19, and 26. Mutations in PEX1 account for nearly 70% of all PBD-ZSD cases and another
26% are caused by mutations in PEX6, 10, 12, 26, with the majority of these cases
involving PEX6 mutations (Ebberink et al., 2012; Ebberink et al., 2011; Steinberg et al.,
2004; Yik et al., 2009). As previously stated, virtually all PBD-ZSD patients have cellular
13

defects in both the PTS1 and in PTS2 peroxisomal matrix protein import pathways (Gould
and Valle, 2000). Due to impaired peroxisomal β-oxidation, they typically have elevated
VLCFA levels and due to impaired ether-phospholipid biosynthesis they show deficient
plasmalogens in blood, urine and cultured primary skin fibroblasts (Steinberg et al., 2006).
Consistent with the ubiquitous nature of peroxisomes in virtually all human cells,
nearly every organ is affected in PBD-ZSD patients, especially the liver and the central
nervous system (CNS) (Braverman et al., 2013; Poretti et al., 2013). The most severe ZS
patients have distinct craniofacial abnormalities, eye abnormalities, neuronal migration
defects, hepatomegaly and chondrodysplasia punctata. Affected children in the newborn
period manifest profound hypotonia, seizures and inability to feed. ZS patients usually
survive less than one year of age (Steinberg et al., 2006; Wanders and Waterham, 2006a).
NALD and IRD patients have less severe clinical presentations than ZS. NALD patients
have hypotonia, seizures and progressive white matter disease and can survive until late
infancy. IRD patients have phenotypically similar yet milder symptoms and may survive
beyond infancy or even reach young adulthood.
RCDP1 patients carry mutations in their PEX7 gene, the most common of which is
the PEX7-p.L292X nonsense mutation that is present in more than half of all patients
(Braverman et al., 2000; Motley et al., 2002). The main clinical features include shortening
of the proximal long bones (rhizomelia) with metaphyseal cupping, coronal clefts of the
vertebral bodies, generalized epiphyseal stippling (chondrodysplasia punctata) and other
evidence of disturbed ossification (Braverman et al., 2010; Brites et al., 2003; Motley et
al., 2002). Abnormalities of the CNS include cerebral and cerebellar atrophy, abnormalities
of myelination and neuronal migration defects (Steinberg et al., 2006). RCDP1 differs from
14

PBD-ZSD as the patients have PTS2-specific protein import defect. Thus, the import of
only three peroxisome matrix proteins is compromised: ACAA1, PHYH, and AGPS.
ACAA1 is a peroxisomal thiolase involved in peroxisomal β-oxidation, which is
functionally redundant and thus RCDP1 patients usually have normal VLCFA levels in
their red blood cells (RBCs). PHYH is a critical enzyme in peroxisomal α-oxidation. Defect
in PHYH import leads to elevated branched chain fatty acids (BCFA) such as phytanic acid
in RCDP1 patients. Given that phytanic acid is only obtained from the diet, patients are
often placed on low phytanic acid diets in order to avoid the effects of toxic buildups of
these BCFAs in cells and tissues. Defect in AGPS import results in plasmalogen
deficiencies (Wanders and Waterham, 2006a), which provide the etiological basis for
RCDP1.
There are more than 10 types of single peroxisomal enzyme deficiencies which can
be subdivided into distinct subgroups on the basis of the peroxisomal metabolic pathway
affected (Wanders and Waterham, 2006b). X-linked adrenoleukodystrophy (X-ALD) is the
most common type, with an incidence of approximately 1 in 17,000 newborn males
(Bezman et al., 2001). X-ALD is an X-linked disorder caused by mutations in the ATP-
Binding Cassette transporter subfamily D member1 gene (ABCD1) which encodes an
integral peroxisome membrane protein involved in peroxisome β-oxidation as a transporter
of VLCFA from the cytosol into the peroxisome (Berger and Gartner, 2006). X-ALD
patients are characterized by elevated VLCFAs, which is their cardinal biochemical
abnormality. This disease affects the cerebral white matter, peripheral nerves, adrenal
cortex and testis with highly variable clinical presentations that are influenced by modifier
genes and the environment (Kemp and Wanders, 2010). Two major classifications of X-
15

ALD include the childhood cerebral form of disease (CCALD) or adult form of diseases
(adrenomyeloneuropathy, AMN). CCALD is typified by early onset inflammatory
demyelination that can result in severe neurological damage. Untreated patients with
CCALD have 59% 5-year survival rate (from the time of onset of first symptoms) with
considerable variation in individual survival times (Mahmood et al., 2005). Current
treatment options include bone marrow transplantation at the earliest signs of
leukodystrophy and treatment with appropriate steroids to address adrenal insufficiency
(Glowniak and Loriaux, 1997; Mahmood et al., 2007). In contrast, AMN shows onset later
in life, typically after 20 years of age, results in spastic paraparesis and loss of lower limb
function due to loss of spinal cord neurons (Berkovic et al., 1983; Schaumburg et al., 1977;
van Geel et al., 1994).

Figure 1.5 Schematic representation of different types of peroxisomal disorders.

16

1.4 Diagnosis for peroxisomal disorders
When physicians observe clinical features of PBD-ZSD or elevated VLCFA levels
in blood spots on Guthrie cards during X-ALD newborn screening (NBS) (Raymond et al.,
2007; V ogel et al., 2015), evaluation of biochemical biomarkers in body fluids are
performed to diagnose peroxisomal disorders (Braverman et al., 2016). Recommended
tests to demonstrate defects in peroxisome dysfunction include VLCFAs in fasting plasma
sample (elevation of C26:0 and C26:1, ratio of C24:0/22:0, C26:0/22:0) (Steinberg et al.,
2008; Steinberg et al., 2006), branched chain fatty acids in RBCs (elevated phytanic acid
and pristanic acid), elevated pipecolic acid levels in urine/blood, elevated bile acid
intermediates (DHCA and THCA) in urine/blood, and reduced plasmalogen levels in RBC
membranes (Steinberg et al., 1993). Moreover, cultured skin fibroblasts can be obtained
for confirmatory tests, including lipid profiling described as above and the
localization/solubility of peroxisomal matrix proteins, such as catalase. The cultured skin
fibroblasts originated from patients can also be utilized as disease model for disease study
and therapy development (Dranchak et al., 2011; Krause et al., 2009; Wang et al., 2015).
For further confirmatory tests or for cases that are difficult to resolve by traditional
biochemical methods, genetic analysis can be performed to determine the DNA sequencing
of PEX genes and related peroxisomal single enzyme defects genes for mutations
(Braverman et al., 2016). Identification of mutations may have prognostic value since
residual PEX gene activity is associated with milder clinical phenotypes (Gartner et al.,
1999; Maxwell et al., 1999; Walter et al., 2001).
X-ALD NBS is based on combination of liquid chromatography and tandem mass
spectrometry (LC–MS/MS) to detect elevated levels of VLCFAs in blood spots obtained
17

from newborns (Hubbard et al., 2009). It has begun in New York state and its legislation
has passed in New Jersey, Connecticut, Illinois, Tennessee and California, with continuing
legislative efforts expected to expand in other states (Theda et al., 2014; V ogel et al., 2015).
The advantage of X-ALD newborn screening includes clinical surveillance for early
detection of symptom onset, treatment for affected males and counseling for carrier females.
Importantly, it should also detect the majority of PBD-ZSD cases that feature elevated
blood VLCFA levels, thereby permitting early diagnosis and determination of accurate
incidence estimates (Braverman et al., 2016).

1.5 Current therapy for peroxisomal disorders
Currently, there is no curative therapy or long-term effective treatment available for
PBDs (Braverman et al., 2016). The wide variation in clinical severity and rate of disease
progression adds complexity to the medical management of the patient group as a whole.
Some manifestations of PBD-ZSD that arise during fetal development, such as brain
malformations, cannot be reversed in the present day (Braverman et al., 2016).
Nevertheless, postnatal symptoms can benefit from management, with focus on
symptomatic therapy and palliative measures. Renal micronodular cortical cysts can be
observed by renal ultrasound. For seizure control, standard antiepileptic drugs may be used.
Feeding problems may require the placement of a gastrostomy tube (G-tube). With regards
to respiratory therapy, use of nasal cannula for oxygen may be necessary as the disease
progresses. Overall, for severe PBD-ZSD, seizure control, feeding and respiratory support
are often the main focus for management, although additional interventions as described
below may also be valuable for quality of life.
18

Since VLCFAs are mostly produced endogenously, a reduction in dietary VLCFAs
alone has no effect on blood VLCFA levels (Brown et al., 1982). Low phytanic acid diet
can be considered to reduce the health risk associated with phytanic acid accumulation.
However, it is expected that phytanic acid accumulation would only account for a minor
portion of the disease and would only manifest by adulthood in most cases. It is
recommended to supplement the fat-soluble vitamins, A, D, E, and K, due to defective bile
acid synthesis. Supplementation with DHA, bile acid and plasmalogen precursors may
compensate the reduced metabolites in patients which, however, showed marginal benefit
in clinical studies (Braverman et al., 2016). Recently, cholic acid (Cholbam) has been
approved by the United States Food and Drug Administration (FDA) to treat peroxisomal
disorders, including PBD-ZSD with liver dysfunction. Cholic acid may improve liver
function by reducing the accumulation of abnormal bile acid precursors such as DHCA and
THCA (Maeda et al., 2002; Setchell et al., 1992).
Sensory and brain functions, which can be affected by the degenerative nature of
disease, are often monitored in PBD-ZSD patients. Auditory functions should be evaluated
annually in children with PBD-ZSD. When hearing loss is severe and cannot be
compensated by hearing aids, cochlear implants may be considered. Periodic
ophthalmologic evaluations are recommended. If cataracts present, although rare, their
removal in early infancy may preserve vision. To monitor the development of
leukodystrophy, it is recommended to obtain baseline brain MRI followed by additional
studies if clinically indicated (Braverman et al., 2016).

19

1.6 Engineered cell culture models of peroxisome biogenesis disorders
To aid investigations into identifying small molecules that promote the recovery of
peroxisome assembly, immortalized patient fibroblasts containing the common disease
allele PEX1-p.G843D and PEX1-p.I700fs expressing a green fluorescent protein (GFP)
peroxisome targeting signal 1 (GFP-PTS1) reporter was developed by collaborator Dr.
Nancy Braverman (Zhang et al., 2010). The GFP-PTS1 reporter remained cytosolic at
baseline, and relocation to the peroxisome which appears as punctate green fluorescent
signal indicates improvement in peroxisome functions. They first tested this cell line with
nonspecific chemical chaperones including DMSO at 3%, proline at 300mM,
trimethylamine N-oxide (TMAO) at 200mM, and betaine (trimethylglycine) at 100mM and
observed robust recovery of punctate GFP-PTS1. These findings suggest that PEX1-
G843D is a misfolded protein amenable to chaperone therapy. Moreover, the Braverman
group established a high-content image-based screening assay based on this cell line’s
phenotype change and evaluated 2,080 small molecules. They identified 4 compounds that
partially recover matrix protein import, including acacetin diacetate (AD), epicholestanol,
PKC inhibitor GF109203x and PKC inhibitor Ro31-8220 whose percentage of cells with
recovered punctate structures are 45%, 30%, 60% and 65%, respectively.
Since the revolutionary development of methods to reprogram adult cells into
iPSCs in 2006, efforts have been made to reprogram patient-derived somatic cells, such as
skin fibroblasts, into an embryonic-like state for a patient-specific cell based disease model.
The first reported successful generation of iPSCs from mouse fibroblast involved the
delivery of four (‘Yamanaka’) transcription factors: Oct3/4, Sox2, Klf4 and c-Myc by
retroviral transduction (Takahashi and Yamanaka, 2006). Later, iPSCs were generated from
20

adult human dermal fibroblasts with the same set of transcription factors (Park et al., 2008;
Takahashi et al., 2007b), as well as a different set of reprogramming factors: OCT4, SOX2,
NANOG, and LIN28 (Yu et al., 2007). Researchers have been trying to improve the
reprogramming efficiency and safety of the iPSCs for in vivo application, such as replacing
retrovial transduction with non-integrating episomal vectors, PiggyBac transposons,
proteins of the transcription factors, microRNAs and non-viral mini-circle DNA vectors
(Jia et al., 2010; Kim et al., 2009; Li et al., 2011; Woltjen et al., 2009; Yu et al., 2009).
Patient-derived iPSCs hold promises for creating disease models for mechanism
and pathology studies, drug discovery and eventually regenerative medicine. The first iPSC
model derived from patient cells is amyotrophic lateral sclerosis (ALS). The patient iPSCs
were differentiated into functional motor neurons with ALS-related pathological
phenotypes (Dimos et al., 2008). Since then, efforts have been made to generate iPSC
models from patient cells that can be useful in disease modeling, drug discovery, and
eventually autologous cell replacement therapies, including spinal muscular atrophy (Ebert
et al., 2009), Parkinson's disease (Soldner et al., 2009), adenosine deaminase deficiency-
related severe combined immunodeficiency (ADA-SCID), Shwachman-Bodian-Diamond
syndrome (SBDS), Gaucher disease (GD) type III, Duchenne (DMD) and Becker muscular
dystrophy (BMD), Parkinson disease (PD), Huntington disease (HD), juvenile-onset, type
1 diabetes mellitus (JDM), Down syndrome (DS)/trisomy 21, and the carrier state of Lesch-
Nyhan syndrome (Park et al., 2008). The generation of iPSCs of childhood cerebral form
of X-ALD (CCALD) was reported by Dr. Hacia’s group, that the patient-derived iPSCs
show differentially expressed genes (DEGs) relevant to peroxisome abundance and
neuroinflammation compared to healthy donor derivatives (Wang et al., 2012).
21

Overall, iPSCs hold promise to provide patient-specific multi-organ disease model
system as they can differentiate to affected cell types that are otherwise difficult to obtain
or culture and represent the outcome of personalized disease genotype. Patient-derived
iPSCs have great potential in studying pathophysiology, disease progression, drug
screening, preclinical testing and eventually regenerative cell therapy. When combined
with genetic engineering technology to visualize peroxisome activity such as fluorescent
reporter or biochemistry marker, iPSCs can be powerful disease model systems for
studying peroxisomal disorders.

1.7 Mouse models of peroxisomal disorders
Mouse models with peroxisome biogenesis defects provided invaluable
information to understand the function of peroxisomes in different cell types and tissues.
The knockout mouse models of three Pex genes, Pex2, Pex5, Pex13, which are
indispensable for both PTS1 and PTS2 import pathways were generated (Baes et al., 1997;
Faust and Hatten, 1997; Maxwell et al., 2003). These mouse models exhibit similar clinical
features resembling biochemical abnormalities of PBD patients, including severe
hypotonia, growth retardation, neuronal development defects and shortened lifespan. These
mice have defective peroxisomal import pathways but assemble empty peroxisome
membrane ghosts. They have elevated VLCFA and phytanic acid, diminished plasmalogen
contents in liver and brain. The Pex2 knockout mice have defects in neuronal proliferation,
differentiation and survival, which may contribute to the developmental malformations for
Zellweger syndrome (Faust and Hatten, 1997), and they have Purkinje cells that displayed
severe abnormalities in dendritic branching (Faust et al., 2005; Faust et al., 2001). These
22

mice also have cholestasis, hepatosteatosis, hepatocyte hypertrophy, abnormal structure of
mitochondria and no functional peroxisomes in hepatocytes (Kovacs et al., 2004; (Dirkx et
al., 2005; Krysko et al., 2007; Peeters et al., 2011). Animal models with inactivated Pex5
and Pex13 show neuronal migration defects in neocortex, delayed neuronal maturation,
increased apoptosis in the cortical plate, and cerebellar abnormalities with reduced Purkinje
cell development (Baes et al., 1997; Maxwell et al., 2003). The reconstitution of
peroxisomal function in brains of the Pex5
-/-
mice exhibits a significant correction of the
neuronal migration defect (Janssen et al., 2003). These mice constitute authentic animal
models of peroxisome deficiency; however, they are of limited application in studies of
disease pathogenesis given the fact that they are either embryonically lethal or die at early
postnatal stage.
Besides the ubiquitous gene disruption models, cell type selective knockouts of
Pex5 and Pex13 were generated to illustrate effects of peroxisome inactivation in brain,
liver and testis. In hepatocyte selective Pex5 knockouts (Albumin-Cre;Pex5
fl/fl
), despite of
the appearance of steatosis, fibrosis, and carcinogenesis, their VLCFA and plasmalogen
levels are unaltered in the peroxisome deficient livers suggesting that intact peroxisomal
activities in other tissues degrade VLCFA and provide precursors for plasmalogens (Baes
and Van Veldhoven, 2006; Dirkx et al., 2005). The albumin/α-fetoprotein (Alfp)-
Cre;Pex5
fl/fl
mice show a partial arrest of neuronal migration in the cerebral neopallium in
postnatal period leading to a severe and persistent impact on the formation of cortex and
cerebellum (Krysko et al., 2007). However, the Nestin-Cre;Pex5
fl/fl
knockout mice with
local elimination of peroxisomes from the brain are affected differently, displaying a
developmental delay of cortical neuronal migration, formation of cerebellar folia and
23

fissure without obvious alteration of brain architecture (Hulshagen et al., 2008; Krysko et
al., 2007). Interestingly, these mice are able to survive into adulthood but develop
progressive motoric and coordination problems, impaired exploration, and a deficit in
cognition and die before the age of 6 months, with regionally specific accumulation of
neutral lipids, astrogliosis and microgliosis, upregulation of catalase, and scattered cell
death in both the white and gray matter of the CNS. These mice feature a dramatic
reduction of myelin staining in corpus callosum which is accompanied by a depletion of
alkenylphospholipids in myelin and differentially reduced immunoreactivity of myelin
proteins (Hulshagen et al., 2008). Mouse model of selective knockout of Pex5 in
oligodendrocytes (Cnp-Cre;Pex5
fl/fl
) help demonstrating the central role of peroxisomes in
myelination process. These mice develop normally, but within several months show ataxia,
tremor and premature death which is a similar pathology as the Nestin-Pex5 knockout mice
but with a later onset and slower progression (Kassmann et al., 2007). The absence of
functional peroxisomes in oligodendrocytes causes widespread axonal degeneration,
progressive subcortical demyelination and strong neuroinflammation. Another neuron-
specific peroxisome knockout model, NEX-Pex5, shows neither microscopic nor
metabolic abnormalities indicating that the lack of functional peroxisomes within neurons
does not cause axonal damage (Bottelbergs et al., 2010). Also, mice with peroxisomes
deleted from astrocytes (GF AP-Cre;Pex5
fl/fl
) have a marked accumulation of VLCFA and
a slight reduction in plasmalogens in brain but axonal integrity and normal behavior is
preserved, indicating that peroxisomal metabolites are shuttled between different brain cell
types (Bottelbergs et al., 2010). These suggest that the absence of peroxisomal metabolism
in neurons and astrocytes does not provoke the neurodegenerative phenotype observed
24

after deleting peroxisomes from oligodendrocytes. A mouse model with PEX13 deficiency
in brain (Nestin-Cre;Pex13
fl/fl
) was developed and exhibited cerebellar morphological
defects (Muller et al., 2011). These mice have reduce plasmalogen content but normal very-
long-chain fatty acid levels. The Nestin-Pex13 mutants exhibit defects in reflex and motor
development that correlate with impaired cerebellar formation. The cultured cerebellar
neurons from E19 Nestin-Pex13 mutants show elevated levels of oxidative stress.
Pex7-knockout mice were generated to study the role of peroxisomes in the
pathogenesis of the human disorder RCDP1 (Brites et al., 2003). These mice have similar
phenotypic characterizations as the RCDP1 patients such as severe hypotonia and growth
impairment and a delay in neuronal migration. They display Pex7-related abnormalities,
such as depletion of plasmalogens, impaired α-oxidation of phytanic acid and β-oxidation
of VLCFA. These mice die shortly after birth, thus have limited application potential as
other generalized knockout mice described as above. To avoid early mortality, a
hypomorphic mouse model with Pex7 transcript levels reduced to less than 5% of wild type
was engineered (Braverman et al., 2010). These mice are fertile and have a normal life span.
Furthermore, they mimic patients with milder PEX7 defects including tissue plasmalogen
deficiency, phytanic acid accumulation and growth retardation.
Pex11 proteins which are involved in peroxisome division are encoded by three
different genes in mammals: Pex11α, Pex11β and Pex11γ (Li and Gould, 2002). Pex11α
knockout mice have no distinguishable phenotypic abnormality, suggesting its function is
taken over by other Pex11 proteins (Li et al., 2002a). In contrast, Pex11β knockout mice
show similar pathologic features as Pex2, Pex5 and Pex13 knockout mice, including
hypotonia, growth retardation, neuronal migration defect, enhanced neuronal apoptosis and
25

neonatal lethality (Li et al., 2002b). Interestingly, these mice have normal peroxisomal
import and only mild peroxisomal β-oxidation defects. Moreover, deletion of a single allele
of the Pex11β gene is sufficient to cause oxidative stress, delayed differentiation and
neuronal death in mouse brain (Ahlemeyer et al., 2012).
The mouse models described above provided useful insights into peroxisome
disorders pathophysiology; however, they do not represent all aspects of the disease. Prior
to the work described in Chapter 3 of this dissertation, there was no transgenic mouse
carrying hypomorphic Pex gene mutations that are common in patient population. For
preclinical evaluation of pharmaceutical drug or gene therapy, there is a need for mouse
models carrying more common gene mutations associated with milder forms of PBD to
better recapitulate disease development and progression.
This dissertation describes 4 projects that I have been involved in as a member of
Dr. Hacia’s laboratory. These include: (1) differentiation and characterization of CNS and
hepatocyte-like cells derived from PBD-ZSD patient-derived iPSCs, (2) preclinical studies
of Pex1-p.G844D mice for retinal gene therapy for PBD-ZSD, (3) high-content screening
of small-molecules for peroxisome dysfunction recovery as well as follow-up testing of
“hit” compounds and (4) development and validation of PEX1-mutant HepG2 cell model
for PBD. Our goal is to utilize patient skin fibroblast cells and patient-derived iPSCs for
robust high-content drug screening and test the positive hits from the screening in cell
models and mouse models. Our ultimate goal is to contribute to the community efforts in
improving the quality of life of the patients suffering from peroxisomal disorders and
providing their family with hope in continuing scientific research of developing therapies.

26

CHAPTER 2
PEROXISOME ASSEMBLY IN PATIENT-DERIVED CNS AND HEPATOCYTE-
LIKE CELLS

2.1 Abstract
Due to their ease of accessibility, cultured skin fibroblasts from PBD-ZSD patients
and mouse models have been used as a powerful tool to investigate potential
pathomechanisms of disease. However, skin fibroblasts play less significant roles in the
pathophysiology of PBD-ZSD compared to cells in central nervous system and liver, whose
primary culture are difficult to obtain or maintain. The discovery of methods to reprogram
skin fibroblasts into iPSC and subsequently into other cell types allows the modeling of
human diseases with defects in multiple tissues and organs. Herein, we reported the
generation of iPSCs from PBD-ZSD patient-derived skin fibroblasts as well as from
healthy controls through retroviral expression of OCT4, SOX2, KLF4, and C-MYC. Since
peroxisomes are more abundant and play pivotal roles in central nervous system and liver,
we derived neural progenitor cells and hepatocyte-like cells from PBD-ZSD patient iPSCs
and healthy control iPSCs as cell models for PBD-ZSD. Noteworthy, patient-derived
oligodendrocytes and hepatocyte-like cells with PEX1 nonsense and missense mutations
have peroxisomal protein import defects.

2.2 Introduction
PBD-ZSD is a group of complex metabolic disorders caused by biallelic defects in
any of a series of PEX genes required for normal peroxisome assembly (Shimozawa, 2007).
Although the genetic basis for peroxisomal diseases can be conveniently deciphered by
27

sequencing, the exact roles that peroxisomes play in the pathophysiology of PBDs and
effective treatments that can rescue peroxisome function are yet to be discovered. A large
number of studies of peroxisomal activities were performed in in vitro cultures of skin
fibroblasts due to their accessibility from patients. However, skin fibroblasts have very
limited peroxisomal activity compared to CNS- and hepatic-lineage cells and thus are
relatively irrelevant models for uncovering the mechanistic basis for the pathophysiology
of PBD-ZSD.
Individuals with PBD-ZSD experience prominent neurological dysfuction
including defects in neuronal migration or differentiation, formation or maintenance of
central white matter, postdevelopmental neuronal degenerations, inflammatory
demyelination, non-inflammatory dysmyelination, and non-specific reductions in myelin
volume or staining with or without reactive astrocytosis (Powers and Moser, 1998).
Peroxisomes are found to be abundant in catecholaminergic neurons in CNS and more
enriched in synaptic terminals of differentiating neurons than mature ones (Arnold and
Holtzman, 1978; McKenna et al., 1976). Substantial numbers of peroxisomes are found in
oligodendrocyte cell bodies associated with forming myelin sheaths.
As discussed in Section 1.7, mice with depleted Pex2, Pex5, Pex7. Pex11β, and
Pex13 commonly demonstrate defects in CNS neuronal migration and delayed neuronal
maturation. Also, importantly, the CNS lineage tissue-specific ablation of Pex5 in mice
show that the absence of peroxisome in oligodendrocytes rather than neurons or astrocytes
is associated with loss of axonal integrity and neurological dysfunction, which is caused
by peroxisome deficiency, rather than the loss of ether lipid synthesis (Baes and Van
Veldhoven, 2006; Bottelbergs et al., 2010; Bottelbergs et al., 2012; Kassmann et al., 2007).
28

Due to the role of peroxisomes in CNS development and the fact that neuronal cells isolated
from animal models are at later point during development and terminally differentiated,
other cell resources are needed to study how peroxisomes function during the entire CNS
development and to apply in drug screening for possible treatments for peroxisomal
disorders.
Peroxisomes are found to be associated with human disease when researchers
realized that kidney and liver tissue from PBD-ZSD patients were devoid of peroxisomes
(Goldfischer et al., 1973). The liver is the most peroxisome-rich organ of the mammalian
body (Leighton et al., 1968), in which peroxisomes fulfill tissue-specific activities such as
peroxisomal fatty acid β-oxidation, bile acid synthesis and purine degradation (Islinger et
al., 2010). PBD-ZSD patients typically experience hepatomegaly, fatty liver, cholestasis,
cirrhosis and even liver failure (Braverman et al., 2013). As discussed in Section 1.7, Pex2
and Pex5 knockout mice show cholestasis, steatosis and steatohepatitis that is related to
impaired liver function. Hepatocytes comprise approximately 85% of the liver mass and
are the primary contributors to liver functions including glycogen storage, lipid and serum
protein biosynthesis, metabolism of many dietary lipids, and detoxification of drugs, most
of which involve peroxisome activities (Yi et al., 2012). However, primary hepatocytes
rapidly lose their cuboidal morphology and liver-specific functions over a few days in
culture (Shulman and Nahmias, 2013). Thus, new methods to generate hepatic linage cells
with interrupted peroxisome functions that are more relevant to peroxisomal disorders
pathology are necessary to discover new therapies.
IPSCs, with properties resembling human embryonic stem cells (hES), have the
potential to generate virtually any differentiated cell types that would be difficult to obtain
29

otherwise. IPSCs derived from skin fibroblasts have been able to be induced into motor
neurons (Egawa et al., 2012; Karumbayaram et al., 2009), astrocytes (Hu et al., 2010),
oligodendrocytes (Douvaras et al., 2014; Ogawa et al., 2011), and hepatic cells (Si-Tayeb
et al., 2010; Song et al., 2012; Song et al., 2009; Takayama et al., 2012). With the iPSC
generation and differentiation technology, we have the opportunity to obtain cell types that
can better demonstrate the roles of peroxisome in diseases. In 2012, Dr. Hacia’s laboratory
established CCALD patient iPSC resources (Wang et al., 2012). With the established iPSCs
generating protocols and discoveries in iPSC differentiation, iPSCs were generated from
PBD-ZSD patients and healthy donors in 2015 by Dr. Xiaoming Wang and Dr. Wing Yan
Yik in Dr. Hacia’s group (Blok et al., 2015). I participated in differentiating these cells into
hepatocyte-like cells and rosette-structured neural progenitor cells that were further
induced into oligodendrocyte progenitor cells. The iPSCs derived cells were characterized
and described in this chapter.

2.3 Materials and methods
2.3.1 Cell culture
Primary dermal fibroblast cultures from PBD-ZSD patients and controls were
obtained from the Kennedy Krieger Institute (KKI) and Coriell Institute Cell Repositories
(CIRC), respectively. Primary fibroblast cells were cultured with passage 5-15. The
mutations and patient information are listed in Table 2.1. All cells described herein were
cultured at 37 C with 5% CO2. Human primary dermal fibroblasts and mouse embryonic
fibroblasts (MEF) were cultured in fibroblast growth medium (DMEM supplemented with
10% FBS, L-glutamine, penicillin/streptomycin (antibiotic-antimycotic), vitamin solution,
30

essential amino acids and nonessential amino acids, all from Thermo Fisher Scientific).
Cell lines were tested with mycoplasma contamination before utilized in assays
(MycoAlert™ from Lonza). Inactivated mouse embryonic fibroblasts (iMEFs) were
generated with mitomycin C (Sigma-Aldrich) as described (Richards et al., 2002). IMEFs
were used as feeder layer to co-culture with iPSCs at a density of 50,000-60,000 cells/cm
2
on 0.1% gelatin coated plates and provide feeder-conditioned media.
Primary fibroblasts were transduced twice with a mixture of five retroviruses
expressing the human OCT4, SOX2, KLF4, and C-MYC reprogramming factors and green
fluorescent protein (GFP; to measure transduction efficiency) as described (Wang et al.,
2015). After 4 days, cells were trypsinized and re-plated on iMEF feeders and cultured in
iPSC medium (DMEM/F12 medium supplemented with 20% KSR, L-glutamine,
penicillin/streptomycin, nonessential amino acids, - mercaptoethanol and bFGF, all from
Thermo Fisher Scientific) containing 1 mM valproic acid (withdrwan after 2 weeks) as
described (Park et al., 2008; Takahashi et al., 2007a; Wang et al., 2015). In 4 weeks, iPSC
colonies started to form and candidate colonies were manually picked and expanded.
Confirmatory analyses were performed on multiple iPSC colonies from controls and PBD-
ZSD patient donors as described (Wang et al., 2015).

Table 2.1 Skin fibroblast donor information.
Current ID Prior ID Description PEX gene mutations PEX gene notes
Control1 AG05838
Healthy female, 36
years old
Presumed wild type -
Control2 AG09599
Healthy female, 30
years old
Presumed wild type -
PBD_PEX1fs1 PBD721 PBD-ZSD patient
PEX1 c.2097_2098insT
p.I700fs; c.2916delA
p.G973fs

Two null alleles
31

PBD_PEX1ms1 PBD615 PBD-ZSD patient
Homozygous PEX1
c.2528G>A p.G843D
Hypomorphic
alleles
*

*Skin fibroblasts derived from multiple patients with this genotype have a temperature-sensitive peroxisome
assembly defect (Imamura et al., 1998)

2.3.2 Differentiation of iPSC to CNS cell lineages
CNS lineages were derived from iPSCs following the protocol illustrated in Figure
2.1. The first step of oligodendrocyte differentiation is floating cultivation to form EBs
from iPSCs (Itskovitz-Eldor et al., 2000; Takahashi et al., 2007b; Wang et al., 2012). IPSCs
were detached from culture dishes with CTK (1mg/ml collagenase IV, 0.25% trypsin, 20%
KSR, 1mM CaCl2 in 1×DPBS) and maintained in suspension with transition medium (TM)
containing 50 % iPSC medium and 50 % glial restrictive medium (GRM, contains
DMEM:F12, 2 % B27 (Thermo Fisher Scientific), 25 μg/ml insulin, 6.3 ng/ml progesterone,
10 μg/ml putrescine, 50 ng/ml sodium selenite, 50 μg/ml holotransferrin, and 40 ng/ml
triiodothyronine (Sigma)), supplemented with 5 ng/ml fibroblast growth factor (bFGF) and
20 ng/ml endothelial growth factor (EGF) in low-adherent plates for 2 days. Then the
unattached EBs were switched to GRM supplemented with 20 ng/ml EGF and 5 μM
retinoic acid (RA) for 8 days, supplied with fresh medium daily and observed the formation
of yellow spheres at the end of the treatment. The yellow spheres were selected, maintained
by cutting to smaller pieces and cultured in GRM supplemented with 20 ng/ml EGF for
another 17 days. Then yellow spheres were cut to smaller pieces and attached to 1:30
diluted growth-factor-reduced Matrigel-coated (BD Biosciences) cell culture plates in the
same medium. After 7 days, the attached cell clusters were dissociated by 10–15 minutes
incubation in 1x HBSS and attached to poly-L-ornithine/fibronectin double-coated plates
for OPC expansion.
32

To maintain oligodendrocyte progenitor cells (OPC), cells were cultured in GRM
supplemented with 1 % N2, 10 ng/ml FGF2 and 20 ng/ml EGF (Thermo Fisher Scientific)
for 10 days, then switched to GRM supplemented with PDGF-AA (R&D systems), IGF1
(insulin-like growth factor 1, Peprotech), biotin, and cAMP (Sigma-Aldrich). To induce
termial oligodendrocyte (OL), differentiation, OPCs were maintained in GRM
supplemented with 1 % N2, 50 ng/ml noggin (R&D systems), 5 ng/ml FGF2 and 10 ng/ml
EGF for 2–3 days. Afterwards, FGF2 and EGF were removed from the medium along with
the addition of 1 mM cAMP, 200 nM ascorbic acid (Sigma-Aldrich), 20 ng/ml IGF, GDNF
(Glial cell line-derived neurotrophic factor), and CNTF (Ciliary neurotrophic factor,
Peprotech) (Hatch et al., 2009; Izrael et al., 2007; Nistor et al., 2005; Sharp et al., 2010;
Zhang et al., 2006).
Figure 2.1 Schematic representation of the differentiation of iPSCs into OPCs (with
the help from Dr. Xiaoming Wang).

2.3.3 Differentiation of iPSC to hepatocyte-like cells
Hepatic cell lineages were derived from iPSCs following the protocol of Duan et al
(Duan et al., 2007; Duan et al., 2010) with modifications (Figure 2.2). Briefly, iPSCs were
first cultured on Matrigel-coated (BD Biosciences) plates with MEF-conditioned medium.
33

The initiation of differentiation into definitive endoderm was induced by switching to
serum-free RPMI 1640 medium (Thermo Fisher Scientific) supplemented with 100 ng/ml
Activin A (Peprotech), 2 mM L-glutamine, and 1 % penicillin/streptomycin for 48 hours.
In the next 3-6 days, the supplements were switched to 1× B27 supplement (Thermo Fisher
Scientific) and 0.5 mM sodium butyrate (Sigma Aldrich).
In the next 10 days, definitive endodermal cells were treated with 20 ng/ml FGF4,
20 ng/ml bone morphogenic protein 2 (BMP2) and 20 ng/ml hepatocyte growth factor
(HGF) (Peprotech) in Iscove’s modified Dulbecco’s medium (Gibco) with 20 % FBS, 2
mM L-glutamine, 0.3 mM monothioglycerol (Sigma Aldrich), 1 % penicillin/streptomycin,
1 μM insulin (Gibco), 0.5 % DMSO and 100 nM dexamethosome (Sigma-Aldrich).
In the next step of hepatic maturation which takes 6-10 days, these cells were
cultured in hepatocyte culture medium supplemented with SingleQuots (Lonza Walkerville)
with 2 % FBS, 20 ng/ml FGF4, 20 ng/ml hepatocyte growth factor (HGF), 50 ng/ml
oncostatin M (R&D Systems), 100 nM dexamethasone and 0.5 % DMSO.

34

Figure 2.2 Schematic representation of the differentiation of iPSCs into hepatocytes
(with the help from Dr. Wing Yan Yik).

2.3.4 Cell imaging
Peroxisomes were labeled in OPCs and hepatocyte-like cells with CellLight®
Peroxisome-GFP, BacMam 2.0 (Thermo Fisher Scientific) by incubating overnight. Then
the cells were fixed in 4% paraformaldehyde for 20 minutes, permeabilized with 0.1%
Triton X-100 for 5 minutes for intracellular protein staining or without for surface protein,
and blocked in 1% BSA in 1× PBS for 1 hour at room temperature. Primary antibody
staining was performed at 4°C overnight, followed with 1 hour incubation at room
temperature with appropriate fluorescence conjugated secondary antibodies from Thermo
Fisher Scientific or Jackson ImmunoResearch. OPCs were immunostained with antibody
against PDGFRα (rabbit polyclonal IgG against human, Chemicon). Hepatocyte-like cells
were immunostained with antibody against albumin (Thermo Fisher Scientific). Nuclei
were visualized by staining with 100 ng/ml DAPI (Thermo Fisher Scientific).

35

2.4 Zellweger spectrum disorder patient-derived neural and hepatocyte-like cells
show defects in peroxisome assembly
PBD-ZSD patient iPSCs with homozygous PEX1 missense and nonsense mutations
and healthy control iPSCs can be differentiated into morphologically identical
oligodendrocyte progenitors expressing PDGFRα and SOX10. The same iPSCs can be
induced into definitive endoderm and hepatocyte-like cells with positive immunostaining
for albumin, AFP, HNF4a, and ASGPR.
Control- and patient-derived OPCs and hepatocyte-like cells were transduced with
vector expressing GFP-PTS1 reporter protein, which is imported to peroxisome appearing
as punctate structure in normal human cells and remains cytosolic in cells with peroxisomal
import defect (Zhang et al., 2010). In both OPCs and hepatocyte-like cells derived from
healthy donors, GFP-positive puncta were formed indicting intact peroxisomal assembly
(Figure 2.3, 2.4). In contrast, OPCs and hepatocyte-like cells from patients with either
PEX1 nonsense or missense mutation showed cytoplasmic distribution of GFP, reflecting
abnormal peroxisome assembly defect caused by PEX1 mutation.

36

Figure 2.3 Peroxisome assembly in OPCs expressing the GFP-PTS1 reporter gene.

OPCs were immunostained with antibodies against PDGFRα (red) and nuclei were
counterstained with DAPI (blue) in control cells (top row) and PBD-ZSD patient cells
(bottom two rows). Cells were transduced with vectors expressing GFP-PTS1. Arrows
highlight cells co-expressing PGFR-alpha and GFP-PTS1.

37

Figure 2.4 Peroxisome assembly in hepatocyte-like cells expressing the GFP-PTS1
reporter gene.

Hepatocyte-like cells were immunostained with antibodies against ALB (red) and nuclei
were counterstained with DAPI (blue) in control cells (top row) and PBD-ZSD patient cells
(bottom two rows). Cells were transduced with vectors expressing GFP-PTS1. Arrows
highlight cells co-expressing ALB and GFP-PTS1.

2.5 Discussion
While most organs are affected by the disease in PBD-ZSD patients, CNS and
hepatic cells play important roles in disease pathogenesis and progression. Thus, we
established iPSCs from PBD-ZSD patients and healthy donors skin fibroblasts and further
differentiated in to CNS and hepatocyte-like cell models. These cell resources with PBD-
38

ZSD patients genetic background can serve as new models to investigate the role that
peroxisomes plays in different organs in the pathophysiology of PBD-ZSD.
The iPSCs from control and PBD-ZSD patient show embryonic stem cell-like
morphology and positive immunostaining for pluripotency markers including OCT4,
SOX2, NANOG, TRA-1-60, and SSEA4. All candidate iPSCs could be differentiated in
vitro into cells derived from all three germ layers. Injection of the three candidate iPSCs
into immune-deficient mice produced teratomas with tissue representative of all three germ
layers. Patient iPSCs retained the original fibroblast PEX gene mutations and control iPSCs
lacked these PEX mutations (Wang et al., 2015).
PBD-ZSD patient-derived skin fibroblasts with mutations in different PEX genes
can be reprogrammed with similar efficiencies into iPSCs that could be maintained in
culture for prolonged times. These iPSCs have the ability to form EBs and spontaneously
differentiate in vitro into representative cell types of all three germ layers. Also, they have
the ability to form teratomas with evidence of cell types from all three germ layers. It is
interesting that the gene expression profiles of patient-specific iPSCs, but not skin
fibroblasts, are consistent with proposed pathological mechanisms of disease highlighting
cross-talk among multiple organelles that genes of mitochondrial functions tended to be
upregulated in patient iPSCs compared to control (Wang et al., 2015).
The iPSCs are capable of differentiating into a variety of cell types including
oligodendrocyte progenitor cells (OPCs) and hepatocyte-like cells. It is interesting that
generating branched mature MBP- and O4-expressing oligodendrocytes tended to be more
difficult in PBD-ZSD patient-derived OPCs than in controls (Wang et al., 2015). The
patient-derived O4 positive cells have poor branching capability and can be hardly
39

maintained as monolayer. Due to the limited donor lines we tested, this study should
include larger numbers of cell lines in both patient and healthy donor categories to
determine whether peroxisome dysfunction is casually responsible for these observations.
To evaluate peroxisome assembly in the differentiated cells, we transduced control and
patient-derived OPCs and hepatocyte-like cells with vectors expressing a GFP-PTS1
reporter protein, which will be transported into peroxisomes in cells with functional
peroxisomal import pathway. As expected, both healthy-donor derived OPCs and
hepatocyte-like cells showed punctate GFP fluorescence indicating intact peroxisome
assembly, while all patient-derived cell lines showed diffuse cytoplasmic localization of
the GFP-PTS1 reporter, indicating impaired peroxisome assembly (Figure 2.3 and 2.4).
Although the iPSC generating and differentiating protocols are established for
PBD-ZSD, further modification or alternative methods for higher efficiency and producing
more pure cell populations are needed to evaluate peroxisomal functions in control- and
patient-derived cells with immunostaining, lipid profiling and proteomic technologies.
40

CHAPTER 3
PRECLINICAL STUDIES FOR RETINAL GENE THERAPY FOR
PEROXISOME BIOGENESIS DISORDERS

3.1 Abstract
Zellweger spectrum disorder (PBD-ZSD) is a disease continuum caused by
inherited defects in PEX genes that result in abnormal peroxisome assembly, structure, and
function (Steinberg et al., 1993). Patients at the severe end of the spectrum can hardly
survive beyond infancy while milder patients may survive into early adulthood. 30% of
PBD-ZSD patients have the hypomorphic PEX1-p.G843D missense allele which is
associated with milder clinical and biochemical phenotypes including intellectual disability,
failure to thrive, and significant sensory deficits. To investigate candidate therapies that
improve human PEX1-p.G843D protein function, a novel Pex1-p.G844D knock-in mouse
model that represents the murine equivalent of the common human mutation was created.
These mice recapitulate many classic features of mild PBD-ZSD cases including
retinopathy with cone photoreceptor cell death. Gene expression profiling of the retina
identified four photoreceptor cone-specific genes that were down-regulated in mutant mice.
In addition, the peroxisomal import defect can be rescued in the mutant murine skin
fibroblast cells through overexpression of human PEX1 protein. Thus, the Pex1-p.G844D
mouse can serve as a powerful model system for investigating the mechanisms of
pathogenesis and testing candidate therapies, especially retinal gene therapy.

41

3.2 Introduction
Peroxisome biogenesis disorders (PBDs) are a heterogeneous group of autosomal
recessive neurodegenerative disorders that affect multiple organ systems. Approximately
80% of PBD patients are classified in the PBD-ZSD. Most of the PBD-ZSD patients have
progressive disorders in intermediate and mild category of the spectrum (Braverman et al.,
2013). PEX1 and PEX6 mutations account for ~70% and ~10% of PBD-ZSD patients,
respectively. A panel of mouse models with generalized and tissue-specific Pex gene
knockout has been created to study the consequences of peroxisome defects in different
organs (Baes and Van Veldhoven, 2012). However, there was no transgenic mouse carrying
specific point mutations of their human counterparts in peroxisomal disorders.
More than half of the PBD-ZSD patients have at least one hypomorphic PEX gene
mutation that encodes a PEX protein of partial function (Ebberink et al., 2011). A total of
41 mutations and five significant polymorphisms in PEX1 have been reported to be disease-
causing on PBD-ZSD patient cohort studies with a wide spectrum of ethnic backgrounds
(Crane et al., 2005). About 20–30% of PBD-ZSD patients carry at least one PEX1-
c.2528G>A p.G843D allele whose homozygosity is associated with mild phenotypes
(Steinberg et al., 2004). PEX1-p.G843D produces a misfolded and unstable PEX1 protein
with residual activity which contributes to milder clinical, biochemical and histological
phenotypes. The interaction between PEX1-p.G843D and PEX6 is reduced to less than 70%
of wild type (Geisbrecht et al., 1998). Interestingly, cultured patient fibroblast cells
carrying this mutation can form peroxisomes at 30°C but not at 37°C, suggesting a
temperature-sensitive peroxisome assembly responsible for the milder clinical features
(Imamura et al., 1998). The patients harboring this missense allele(s) suffer from growth
42

retardation, hypotonia as well as visual and hearing loss. These patients usually survive
beyond infancy, making it beneficial to provide them with early medical interventions that
either slow or halt disease progression prior to irreversible damage to multiple organ
systems (Hiebler et al., 2014).
To investigate how these patients can benefit from therapeutic interventions, mouse
models with longer life span and that recapitulate more aspects of disease progression are
needed. The inGenious Targeting Laboratories was contracted to generate a murine
equivalent model (Pex1-p.G844D) of mild PBD-ZSD caused by PEX1-p.G843D allele. We
characterized these mice in collaboration with Dr. Steven Steinberg at the Johns Hopkins
University and Dr. Jean Bennett at University of Pennsylvania (Hiebler et al., 2014), with
our lab focused on gene expression profiling and exploring the possibility of using these
mice as models for gene therapy testing. This is the first knock-in mouse model of
peroxisomal disorder and mimicking the milder PBD-ZSD phenotype including growth
retardation, fatty livers with cholestasis and retinopathy. Importantly, the homozygous
Pex1-p.G844D murine skin fibroblasts respond to chaperone-like compounds that
normalizes peroxisomal β-oxidation as in patient-derived skin fibroblasts (Zhang et al.,
2010). The abnormal retinal function of the Pex1-p.G844D homozygous mice makes it a
potential model to investigate retinal gene therapy approaches to slow down or potentially
halt vision loss in patients.
Retinal gene therapy holds great promise in treating different forms of non-
inherited and inherited blindness. Four independent research groups reported that patients
with the rare genetic retinal disease Leber's Congenital Amaurosis (LCA) type 2 had been
successfully treated using gene therapy with adeno-associated viral (AAV) vectors. The
43

researchers employed AA V2 to deliver a functional copy of the RPE65 (retinal pigment
epithelium-specific 65 kDa protein) gene subretinally, which restored vision in children
suffering from retinal degeneration and severe visual impairment due to improper
functioning or absence of RPE65 (Bainbridge et al., 2008; Cideciyan et al., 2008;
Hauswirth et al., 2008; Maguire et al., 2009). All these trials reported clinical measures of
vision improvement though to various levels of detail and significance. Furthermore, none
of them reported vector-related adverse events or toxic immune responses. In addition, the
efficiency of photoreceptor-specific delivery approaches were tested in different novel
recombinant AAV serotypes (Allocca et al., 2007).
These results inspire us that PBD patients with vision impairment could benefit
from the AA V-mediated applications in retinal disease. AAV is a non-enveloped small DNA
virus capable of infecting humans and some other primate species but not currently known
to cause disease. Its special features, such as only causing a very mild immune response,
capable of infecting both dividing and quiescent cells and persist in an extrachromosomal
state without integrating into the genome of the host cell (Deyle and Russell, 2009), make
it a very attractive candidate for creating viral vectors for gene therapy. Currently 11
serotypes of AAV were identified (Mori et al., 2004). AA V9 is capable of intravenously
bypassing the blood-brain barrier (BBB) and more efficiently targets CNS cells compared
with other AAV serotypes (Cearley and Wolfe, 2006; Foust et al., 2009).
To test the effect of PEX1 transgene expression in PBD-ZSD patients with vision
defect, we need to test whether PEX1 transgene expression can rescue peroxisome defects
in a mouse model with Pex1 gene mutation. Herein we utilized the skin fibroblast cells
obtained from Pex1-p.G844D homozygous mice to show the in vitro consequence of
44

human PEX1 transgene expression with AA V9 vector, since this cell type is more
obtainable and maintainable compared to retina cells. Two AA V9 vectors were designed to
express human PEX1 by Dr. Jean Bennett’s group: one with a RK1 promoter which drives
expression in rod and cone photoreceptors in retina and will be utilized in in vivo expression
of PEX1 in mouse, and the other with a CMV promoter which drives expression in skin
fibroblasts.

3.3 Materials and methods
3.3.1 Gene expression profiling
Mouse retina were dissected at 124 days of age by Dr. Steinberg’s laboratory and
sent to Dr. Hacia’s laboratory in RNA-later. Total RNA was isolated using Quick-RNA™
MiniPrep (Plus) kit from Zymo Research. RNA integrity number (RIN) was determined by
Agilent 2100 Bioanalyzer (optimal RIN≥7). The retina RNA (100ng per sample) was
converted into biotin-labeled cRNA targets (Affymetrix GeneChip
®
IVT Labeling Kit) and
analyzed on GeneChip
®
Mouse Genome 430a2.0 Arrays (Affymetrix) designed to
interrogate over 14,000 transcripts for global gene expression. The resulting .CEL files
were processed using WebArray software that utilized RMA (Robust Multi-array Average)
algorithm to generate log2-scaled gene expression values for each transcript (Irizarry et al.,
2003; Pelikan et al., 2013; Wang et al., 2009). Using linear model statistical analysis
(LIMMA) package, differentially expressed genes (DEGs) were identified with selected
probes set to absolute fold change greater than 1.2 and false discovery rates (FDRs) value
less than 0.05 (calculated using the spacings LOESS histogram (SPLOSH) method)
(Pounds and Cheng, 2004; Smyth, 2004). The original .CEL data files are available for
45

download from the Gene Expression Omnibus (http://www.ncbi.nlm.nih.gov/geo/) under
GEO accession number 52348.

3.3.2 AA V9-mediated PEX1 overexpression
Dermal fibroblast cultures were obtained from seven-day-old pups by Dr.
Steinberg’s group. HEK293 cells were a kindly gift from Dr. Wange Lu’s laboratory. All
cells used here were cultured as previously described in Section 2.3.1.
For lentivirus packaging, 5µg for each of pMD2.G (expressing VSV-G envelope
protein), psPAX2 (expressing Pol and Gag) and pCT-Pero-GFP (lentiviral vector designed
to express GFP-PTS1 reporter gene, from System Biosciences) were co-delivered into
HEK293 cells using the Lipofectamine
®
LTX kit (Thermo Fisher Scientific) in 100-mm
dish. The lentivirus-containing medium was harvested at 36 hours and 48 hours after the
transfection, pooled and filtered through 0.45µm filter. Then the lentivirus-containing
medium was concentrated using Lenti-X™ Concentrator (Clontech) and resuspended in
fibroblast medium. Murine skin fibroblasts were transduced twice with lentivirus
expressing GFP-PTS1 reporter as described (Wang et al., 2015). GFP positive cells were
selected using 2µg/mL puromycin.
AA V9-CMV-PEX1 vectors were produced by Dr. Bennett’s group. These vectors
are designed to express human PEX1 protein using CMV promoter. On the day before
transduction, murine skin fibroblasts expressing GFP-PTS1 reporter were seeded at 3-5 x
10
5
per well in a 6-well plate. On day 1, change the medium and add AA V vectors at three
different multiplicity of infection (MOI): 1 x 10
5
(low),

5 x 10
5
(medium), and

1 x 10
6
(high)

particles/cell. Leave the AA V vectors on the cells for 48 hours and repeat the transduction
46

on day 3. On day 5, cells were fixed with 3% formaldehyde / 1 × Dulbecco's PBS solution
(DPBS) and nuclei were counterstained with 100 ng/ml DAPI (Thermo Fisher Scientific).

3.4 Results
3.4.1 Transcriptomic changes in the retinas of Pex1-p.G844D homozygous mice
Global gene expression analysis was conducted of retinas obtained from four Pex1-
p.G844D homozygous mice and four heterozygous littermates. The heterozygous Pex1-
p.G844D served as control group here since Pex1-p.G844D heterozygotes mice have
similar results as wild type mice in all other studies performed by Dr. Steinberg’s group,
including normal retinal histology, peroxisomal biochemical profile, growth and survival.
A group of eight probe sets indicated DEGs between these two groups (Table 3.1). This
contained six probe sets representing four unique genes (Arr3, Pde6h, Gnat2, and Opn1mw)
that had lower expression in the Pex1-p.G844D homozygous mice relative to the
heterozygous mice. Arr3, also named arrestin 3 retinal or X-arrestin, encodes highly retina-
specific Arrestin 3 protein that is associated with Leber congenital amaurosis and retinitis
pigmentosa (Murakami et al., 1993). Studies of the tissue distribution by in situ
hybridization demonstrated expression of this gene in the inner and outer segments and the
inner plexiform regions of the retina. Pde6h, or Phosphodiesterase 6H encodes the
inhibitory subunit of the cone-specific cGMP phosphodiesterase that is specifically
expressed in the retina, and is involved in the transmission and amplification of the visual
signal (Shimizu-Matsumoto et al., 1996). The mutations of this gene are associated with
retinal cone dystrophy type 3A (RCD3A) (Piri et al., 2005). Gnat2, or G protein subunit
alpha transducin 2, encodes the Alpha subunit of Transducin in cones which stimulates the
47

coupling of rhodopsin and cGMP-phoshodiesterase during visual impulses (Kohl et al.,
2002). Opn1mw, or opsin 1 (cone pigments), encodes a light absorbing visual pigment
called green cone photopigment whose defect may lead to deuteranopic colorblindness
(Deeb and Motulsky, 1993). All four of these genes have been reported as photoreceptor
cone-specific genes and having reduced expression in a mouse model with photoreceptor
cell loss (Swiderski et al., 2007).
There were two probe sets with increased expression in Pex1-p.G844D
homozygous relative to heterozygous mice representing the Cyp4a14 and Ufd1l genes.
Cyp4a14, or cytochrome P450, family 4, subfamily a, polypeptide 14, is a commonly used
indicator gene for Ppar-α activation (Anderson et al., 2002). Ufd1l or ubiquitin fusion
degradation 1 like, gene encodes a protein that plays a critical role in degradation of
misfolded ER proteins and cholesterol metabolism (Cao et al., 2007).

Table 3.1: DEGs in retina tissues obtained from P e x1 - p.G844 D homozygote and
heterozygote mice.

Probe ID Symbol Gene description Gene ID
a

Ho
mean
b

Het
mean
c

Fold changed
d
FDR
e

1423257_at Cyp4a14
Cytochrome P450, family 4,
subfamily a, polypeptide 14
13,119 3.9 13.2 3.38 0.033
1432367_a_at Ufd1l
Ubiquitin fusion degradation
1 like
22,230 28.8 43.2 1.5 0.075
1425232_x_at Arr3 Arrestin 3, retinal 170,735 43.3 14.9 −2.91 0.045
1450329_a_at Arr3 Arrestin 3, retinal 170,735 124.2 45.5 −2.73 0.005
1450765_a_at Pde6h
Phosphodiesterase 6H,
cGMP-specific, cone
gamma
78,600 781.2 327.7 −2.38 0.009
1450766_at Pde6h
Phosphodiesterase 6H,
cGMP-specific, cone,
gamma
78,600 928.9 416.2 −2.23 0.015
1422907_at Gnat2
Guanine nucleotide binding
protein, alpha transducing 2
14,686 417 212 −1.97 0.061
1419723_at Opn1mw Opsin 1 (cone Pigments) 14,539 93.3 50.1 −1.86 0.003
a NCBI Gene ID.
b Geometric mean gene expression score for Pex1-p.G844D homozygote retinal tissue.
c Geometric mean gene expression score for Pex1-p.G844D heterozygote retinal tissue.
d Fold change= Ho mean / Het mean.
e False discovery rate.

48

3.4.2 Recovery of peroxisome functions in Pe x1- p.G 844D homozygous murine skin
fibroblasts by transduction with AA V9-PEX1 vector
Pex1-p.G844D homozygous and heterozygous murine skin fibroblast cells were
transduced with lentiviral vector designed to express GFP-PTS1 reporter protein, which is
imported to peroxisomes causing peroxisomes to appear as punctate structures in cells with
intact peroxisomal import pathway, and remains cytosolic in cells with peroxisomal import
defect (Zhang et al., 2010). In Pex1-p.G844D heterozygous cells, GFP-positive puncta
were formed indicating intact peroxisomal assembly (Figure 3.1A). In contrast, Pex1-
p.G844D homozygous cells showed mainly cytoplasmic distribution of GFP, reflecting
abnormal peroxisome assembly defect caused by Pex1 mutation. Consistent with
expectation, there is small amount of GFP puncta in homozygous cells, which results from
the partially functional Pex1 protein as the Pex1-p.G843D is hypomorphic missense allele.
Furthermore, the GFP-PTS1 expressing Pex1-p.G844D homozygous skin
fibroblast were transduced with AA V9-CMV-PEX1 vectors at three different MOI: 1 x 10
5

(low),

5 x 10
5
(medium), and

1 x 10
6
(high)

particles/cell (Figure 3.1B). The peroxisomal
import was restored in a dose-dependent manner that more GFP-PTS1 reporter was
relocated to form punctate structure with some remaining cytosolic distribution when
transduced with low MOI of AAV9-expressing PEX1, and almost all GFP-PTS1 reporter
was relocated into punctate structure when transduced with medium or high MOI. This
peroxisomal import rescue suggests that overexpression of human PEX1 protein can
correct the import defect caused by Pex1 hypomorphic mutation in mouse cells, qualifying
the Pex1-p.G844D homozygous mouse as a great model to evaluate retinal gene therapy.

49

Figure 3.1 Murine skin fibroblast cells expressing GFP-PTS1 reporter.

A Pex1-p.G844D homozygous and heterozygous murine skin fibroblast cells expressing
GFP-PTS1 reporter protein (green) and nuclei were counterstained with DAPI (blue). Note
that the heterozygous cells show punctate structures of GFP indicating normal peroxisomal
import while homozygous cells show cytosolic distribution of GFP with some punctate
structures of GFP indicating partially functional peroxisomal import.
B Peroxisomal import in Pex1-p.G844D homozygous cells was rescued by PEX1
overexpression in a dose-dependent manner.

50

Figure 3.1 continued

3.5 Discussion
Peroxisomal disorder patients display variable metabolic abnormalities and
different genetic mutations (Steinberg et al., 1993). As previously discussed in Section 1.7,
there are limitations in using the currently available mouse models of PBDs to investigate
disease mechanism or test therapies due to early postnatal death and not representing the
most common PEX gene mutations (Bottelbergs et al., 2010; Kassmann et al., 2007;
Krysko et al., 2007). The first mouse model with hypomorphic PEX alleles was not
reported until 2014, when mice homologous for Pex1-p.G844D allele (the murine ortholog
of the common human PEX1-p.G843D mutation) were generated and characterized by Dr.
Steinberg’s group (Hiebler et al., 2014).
51

The Pex1-p.G844D mice were generated by substituting c.2531G>A in Pex1 exon
15. The Pex1-p.G844D homozygous mice show numerous metabolic phenotypes that
reflect those found in patients on the mild end of the PBD-ZSD. The Pex1-p.G844D
heterozygous mice show phenotypes indistinguishable to wild type mice, and thus were
utilized as control group. The Pex1-p.G844D homozygous mice have shorter lifespan and
marked growth retardation compared to control group. Also, the bile acid intermediates
DHCA and THCA were significantly elevated in feces, plasma and liver homogenate of
Pex1-p.G844D homozygous mice, which stays consistent with the consequence of liver
dysfunction in PBD-ZSD patients. Importantly, the Pex1-p.G844D homozygous mice have
abnormal retinal function which is associated with a loss of cone photoreceptors. Some
cone photoreceptors were retained in the Pex1-p.G844D homozygote retina at 3 weeks but
completely degenerated at adulthood. This suggests that a window exists for therapies to
restore peroxisome function and preserve cone photoreceptor cells survival and function,
which can also be the case for children with PBD-ZSD. We conducted global gene
expression analysis of retinas obtained from homozygous and heterozygous littermates.
Four unique photoreceptor cone-specific genes (Arr3, Pde6h, Gnat2, and Opn1mw)
showed lower expression in Pex1-p.G844D homozygote retina. The decreased expression
of these genes is consistent with the observation of specific loss of photoreceptor cone cells
in the Pex1-p.G844D homozygote retina relative to those of the controls. It is necessary to
investigate whether these gene are markers of cone cell death or are part of a downstream
pathway which is down-regulated with reduced Pex1 function. Nevertheless, the Pex1-
p.G844D homozygous mice hold great promise to be utilized as a pre-clinical model to
evaluate retinal gene therapy approaches. PBD-ZSD patients, especially those at the milder
52

end of the disease spectrum, can benefit from therapies that slow down or potentially halt
vision loss, which have to be first shown effective in mice. The skin fibroblast cell lines
were established from Pex1-p.G844D homozygous and heterozygous mice. Standard
clinical biochemical assays used to diagnose PBD-ZSD patients were performed on these
cells. VLCFA were significantly elevated and the oxidation of the branched chain fatty
acids (phytanic acid and pristanic acid) was reduced in cultured Pex1-p.G844D
homozygous fibroblasts relative to the control (Hiebler et al., 2014). To our surprise,
plasmalogen synthesis was normal, which suggest that the residual function of Pex1-
p.G844D is sufficient for its role in plasmalogen synthesis activity.
In addition to these key clinical phenotypes resembling those observed in patients
with milder forms of PBD-ZSD, the Pex1-p.G844D homozygous murine skin fibroblast
cells responded to chaperone molecules (1% DMSO and 200 mM TMAO) treatments as
the C26:0/C22:0 was reduced to the level of control cell lines (Hiebler et al., 2014). This
indicates that the Pex1-p.G844D protein responded similarly to the human orthologous
PEX1-p.G843D protein. We went one step further to demonstrate in principle that the
peroxisomal import defect can be corrected by AAV mediated overexpression of human
PEX1 in murine skin fibroblast. We first transduced the murine skin fibroblast cells with
lentiviral vectors to express GFP-PTS1 reporter to visualize peroxisomal import activity.
The reporter is supposed to be imported into peroxisomes forming green fluorescent
punctate structures in cells from control group and stay cytosolic in cells from Pex1-
p.G844D mice, suggesting peroxisomal import dysfunction (Figure 3.1A). Then, AA V9
vectors designed to express human PEX1 protein with either CMV or RK1 promoter were
produced by Dr. Bennett’s group. The AA V9-CMV-PEX1 vector is transduced with Pex1-
53

p.G844D homozygous skin fibroblast cells at three different MOI and showed peroxisome
function restored in a dose-dependent manner (Figure 3.1B). The low MOI show partial
rescue of peroxisomal import compared to the baseline import of GFP-PTS1 reporter under
residual Pex1 function. The medium and high MOI of AA V9-CMV-PEX1 transduction led
to robust green fluorescent punctate structures forming and almost no GFP-PTS1 reporter
remained in cytosol, which is the same observation for control cells. It will be interesting
to test the change of biochemical biomarkers such as VLCFA and plasmalogen levels in
the cells after AAV9 transduction. Given the fact that culturing cells from retina is difficult,
the Pex1-p.G844D skin fibroblast provided valuable information for understanding the
consequence of PEX1 overexpression in cells with Pex1 hypomorphic mutation.
Gene therapy may allow treatment of a disorder by inserting a gene into a patient's
cells instead of using pharmaceuticals or surgical intervention. This technology provides
great opportunity to reserve vision for PBD-ZSD patients who are vulnerable to vision
defects due to photoreceptor cells degradation as a consequence of peroxisome dysfunction.
Recently, tremendous focus has been given to develop gene therapies aimed at improving
the quality of life in patients with inherited retinal disease. The eye, being comparatively
accessible, compartmentable and having a contralateral control, is an ideal organ for gene-
replacement therapy (Boye et al., 2013).
Overall, the Pex1-p.G844D mice provide multiple opportunities to deepen the
understanding of pathophysiology of milder forms of PBD-ZSD, as well as serve as
valuable mouse model to evaluate small molecule interventions and pave the way for
clinical study of retinal gene therapy. In addition, these mice can be utilized to generate
another animal model compound heterozygous for Pex1-p.G844D hypomorphic allele and
54

a Pex1-null allele to better reflect the genotype frequently found in PBS-ZSD patient
population. These two alleles combined are predicted to associate with more sever clinical
presentations than the Pex1-p.G844D homozygote.
55

CHAPTER 4
HIGH-CONTENT SCREENING OF CHEMICAL LIBRARIES TO IDENTIFY
SMALL-MOLECULES THAT ENHANCE PEROXISOME ASSEMBLY IN PBD-
ZSD PATIENT CELLS
4.1 Abstract
While PBD-ZSD patients on the severe end of the spectrum are born with multiple
congenital abnormalities, most patients have a milder, but progressive, disease that
typically result in intellectual disabilities, vision and hearing loss, liver dysfunction,
decreased bone density, kidney stones, and thin enamel (Gartner et al., 1999; Maxwell et
al., 1999). To date, treatment options are palliative in nature and no targeted therapies exist
that directly address peroxisome dysfunction in patients with PBD-ZSD (Braverman et al.,
2016).
With the help of our collaborator Dr. James Inglese and Dr. Patricia Dranchak, we
applied a quantitative cell image-based high content screening (qHCS) assay in 1536-well
format to screen the LOPAC 1280 collection of pharmacologically active agents for small
molecules that improve peroxisome assembly in PBD-ZSD patient-derived skin fibroblasts
harboring the common PEX1-p.G843D hypomorphic and PEX1-p.I700fs null alleles. We
screened this library at seven concentrations, consistently obtained Z-factors of 0.4, and
demonstrated sensitivity by identifying the previously known flavonoid apigenin as a
bioactive molecule (Liang et al., 2001). We also uncovered a novel group of compounds
active at the micromolar range and rescued peroxisome functions in patient cells based on
cell imaging, biochemical, and protein processing assays. Two compounds, naltriben and
naltrindole, are opioid receptor antagonists known cross the blood-brain-barrier in rodents
56

(Lever and Scheffel, 1998; Portoghese et al., 1988). Naltriben is the first reported molecule
to reduce very long chain fatty acid levels in patient cells two PEX1-null alleles. Overall,
the novel bioactive small molecules we identified could provide tools for investigating
peroxisome biogenesis and provide novel leads for the development of targeted small
molecule therapies for PBD-ZSD and common diseases associated with peroxisome
dysfunction.

4.2 Introduction
Most PBD-ZSD patients have milder forms of disease that typically result in
intellectual disabilities and progressive vision and hearing loss, liver dysfunction,
osteopenia, kidney stones, and enamel hypoplasia (Braverman et al., 2016; Klouwer et al.,
2015; Poll-The and Gartner, 2012). While this is compatible with longer-term survival,
sometimes into adulthood, milder disease can progress to complete hearing and visual loss
later in life and patients are at risk for leukodystrophy (Braverman et al., 2016; Klouwer et
al., 2015; Poll-The and Gartner, 2012). Current treatment options are palliative in nature
(Braverman et al., 2016; Klouwer et al., 2015; Poll-The and Gartner, 2012) and there is a
need to develop targeted therapies that address the peroxisome assembly defects
responsible for disease development and progression.
A cell-image-based HCS assay was previously developed to identify small
molecules that enhance peroxisome assembly in immortalized skin fibroblasts obtained
from a PBD-ZSD patient compound heterozygous for the common hypomorphic PEX1-
p.G843D and null PEX1-p.I700fs mutations (Zhang et al., 2010). The PEX1-p.G843D
allele, present in about 30% of the patient population, encodes a misfolded and unstable
57

PEX1 protein with partial activity (Steinberg et al., 2004). Consistent with this residual
activity, the presence of at least one PEX1-p.G843D allele is more predictive of a milder
disease course than the presence of two PEX1-null alleles (Majewski et al., 2011; Poll-The
et al., 2004; Walter et al., 2001). Therefore, this assays system is relevant to more mildly
effected PBD-ZSD patients who could benefit from therapies that address disease
progression. To track peroxisome assembly, these patient fibroblasts were engineered to
express a reporter green fluorescent protein (GFP) harboring a C-terminal peroxisome
targeting sequence 1 (GFP-PTS1) (referred to as M2H cell line) is imported into the
peroxisome matrix in cells from healthy donors, but is primarily cytoplasmic in this system.
In principle, this assay can identify small molecules that act by any mechanism that results
in a rescue of peroxisome assembly.
This cell-based GFP-PTS1 assay has been applied in a pilot HCS of over 2,000
small molecules at a single concentration (Zhang et al., 2010). Four small molecules that
enhance peroxisome assembly in these patient cells were uncovered with three confirmed
using independent assays (Zhang et al., 2010). The verified hits included a flavonoid and
protein kinase C inhibitor, both of which were previously shown to bind the ATP binding
site of ABC transporter proteins. Based on prior studies involving other related proteins
(Katayama et al., 2007; Lu et al., 2005), it was suggested a mechanism for their action as
a pharmacological chaperone, binding to the ATP binding sites in the AAA protein, PEX1-
p.G843D (Zhang et al., 2010). Coupled with prior observations that PEX1-p.G843D is a
temperature-sensitive allele and responds to other potential molecular chaperones
(Berendse et al., 2013; Walter et al., 2001), it was proposed that the misfolded PEX1-
p.G843D protein is amenable to molecular chaperone therapy. Building upon the results of
58

this study, an ongoing clinical trial is testing the effectiveness of one molecular chaperone,
betaine, for the treatment of PBD-ZSD (Braverman et al., 2016). Nevertheless, small
molecule therapies applicable to patients homozygous for null PEX gene alleles have not
been reported.
Here, we adapted the cell-based GFP-PTS1 assay for the qHCS in miniaturized
1536-well format of the Sigma LOPAC1280 collection of pharmacologically active agents
for small molecules that improve peroxisome assembly. Compounds showing activity in
the initial screen were subject to follow-up validation using cell imaging, biochemical, and
protein processing assays. Brain-permeable small molecules that could rescue peroxisomal
activities in cultured cells homozygous for null PEX gene alleles were identified. This
provides proof-of-concept of small molecules that promote the rescue of peroxisome
assembly in cells with two PEX1 null alleles, which are also potential reagents for
investigating mechanistic aspects of peroxisome biology and developing targeted therapies
applicable to an extended group of patients with PBD-ZSD.

4.3 Materials and methods
4.3.1 Cell lines and cell culture
Primary cells were cultured as previously described in Section 2.3.1. Immortalized
patient skin fibroblast M2H cells were kind gift from Dr. Nancy Braverman’s group.
Briefly, they are immortalized human fibroblasts obtained from a PBD-ZSD patient
compound heterozygous for the hypomorphic PEX1-p.G843D and null PEX1-p.I700fs
alleles, expressed the GFP-PTS1 reporter protein. When the GFP expressing cell
59

proportion is below 95%, M2H cells were cultured in medium containing 2 mg/mL G-418
(Sigma Aldrich) for three days.

4.3.2 High-content screening (HCS) method
The chemical compound library screening was performed at NIH by Dr. James
Inglese and Dr. Patricia Dranchak. The M2H cells were used in the quantitative HCS as
previously described (Zhang et al., 2010). Cells were grown for 72 hours at 37 °C with 5%
CO2 and 90% relative humidity (RH) in fibroblast growth medium prior to distributing to
sample wells in 1536-well format (Wang et al., 2012; Wang et al., 2015). After incubating
for two days at 37 °C with 5% CO2 and 90% RH prior to staining with DAPI and data
analysis, there was an average of 577 ± 44 cells per well.
The GE INCell Analyzer 2000 high-content imaging system was used to acquire
data with a 20×/0.45 ELWD Plan Fluor objective with excitation wavelengths DAPI (350
nm) and FITC (495 nm), and emission wavelengths DAPI (470 nm) and FITC (520 nm) to
image the DAPI-stained nuclei and GFP-labeled PTS1, respectively. Estimates of the
percentage of positively responding cells in a well were based on the average total cellular
area composed of appropriately sized and shaped puncta. We also employed visual
inspection by 3 independent observers for data analysis with scoring based on the clarity
of the cytoplasmic staining and the appearance of cells with at least 7 distinct punctate
cytoplasmic structures consist with peroxisome size and shape. In the latter case, wells
showing at least 30% of cells with rescue of peroxisome assembly at the highest compound
concentration (38.4 µM) were initially prioritized for further analysis. Prior to data analysis,
compounds showing appreciable (at least 30%) rescue at a lower concentration, but no
60

subsequent rescue at the next highest concentration(s) would be discarded as hits unless
toxicity was noted at these higher concentrations. In no circumstance did this latter
situation occur.

4.3.3 Chemical compound library
The chemical compound library screening was performed at NIH by Dr. James
Inglese and Dr. Patricia Dranchak. Briefly, the Sigma Library of Pharmacologically Active
Compounds (LOPAC), a chemically library of 1280 compounds, was purchased as 10 mM
stock solutions in DMSO. As previously described (Urban et al., 2008), all compounds
were reformatted into 1536-well assay plates with final compound concentrations in a 3 μl
assay volume in a 7 point titration ranging from 2.5 nM to 38.4 μM (0.1% DMSO final
concentration for all compounds tested). Each assay plate contained the positive ‘chemical
control’ diosmetin present in the 7 point titration and a positive ‘genetic control’, PBD-
ZSD patient cells, described below, transduced with PEX1-lentiviral vector present in 7
plate different wells in 0.1% DMSO. Each assay plate also contained a negative 0.1%
DMSO vehicle control, final concentration, present in 7 different wells.
For the validation assays, diosmetin, naltriben methanesulfonate hydrate,
naltrindole hydrochloride, CGP 57380, H-8 dihydrochloride, and actinonin were obtained
from Sigma Aldrich. Diosmetin, naltriben methanesulfonate hydrate, CGP 57380, H-8
dihydrochloride were dissolved to 30 mM, as well as naltrindole hydrochloride and
actinonin to 10mM in corresponding solvent and stored at -20C as stock solution. When
performing chemical treatments to the cells, chemical stock solution was further dissolved
61

in cell culture medium to desired concentration immediately before use. Solvent
concentration was kept ≤ 0.1%.

4.3.4 Cell imaging
Cells were fixed after culturing in desired condition with 3% formaldehyde/PBS.
When necessary, they were further permeabilized with 0.1% Triton X-100 and in 5%
donkey normal serum (Abcam) to block unspecific antibody binding. Primary antibody
staining was performed at room temperature for 2 hours, followed with processing
described in Section 2.3.4. Peroxisome memberane was immunostained with antibody
against PMP70 (rabbit polyclonal IgG against human, Thermo Fisher Scientific) or PEX13
(goat polyclonal IgG against human, Abcam) and double stained with peroxisome matrix
protein catalase (sheep polyclonal IgG against human) and thiolase (rabbit polyclonal IgG
against human, purified from antiserum), respectively.

4.3.5 Immunoblotting
Cells were cultured at desired condition before protein harvesting with
Radioimmunoprecipitation assay (RIPA) buffer and stored at -80C. Protein was boiled for
10 minutes in Laemmli buffer containing 10% 2-mercaptoethanol. 20 mg protein/lane was
loaded on 7.5-10% SDS-PAGE minigels (Bio-Rad) and run at 100 V for 1-3 hours.
Separated proteins were transferred to PVDF membrane at 100 V, 4 C for 1 hour.
Membranes were blocked with 5% milk/TBST or SuperBlock/PBS blocking buffer
(Thermo Fisher Scientific) at room temperature for 1 hour. Primary antibody against
ACAA1 (peroxisomal thiolase, Abcam, 1:5000), GAPDH (Abcam, 1:5000) in 3%
62

BSA/TBST incubation was performed at 4C overnight followed with corresponding anti-
mouse or –rabbit HRP conjugated secondary antibody at room temperature for 1 hour. The
blotted membranes were visualized by ECL prime detection agent (GE Healthcare). Images
were processed and quantified by ImageJ software.

4.3.6 Lipid analysis
Cells of interests were trypsinized, washed with 1X PBS for 3 times and
resuspended in deionized water. Lipid analysis of these cells was performed by our
collaborator Ann B. Moser at the Peroxisomal Diseases Labroatory located at the Kennedy
Krieger Institute. Cell lysates were processed and relative sVLCFA (saturated VLCFA)
levels were evaluated by determining the ratio of C26:0-lysophosphorylcholine and C22:0-
lysophosphorylcholine levels (i.e. C26:0LPC/C22:0LPC) using liquid chromatography–
tandem mass spectrometry (LC-MS/MS) (Bjorkhem et al., 1986; Gootjes et al., 2002;
Steinberg et al., 2008). We report %C26:0LPC as being relative to the total amount of all
lysophosphatidylcholine (LPC) molecular species (C26:0, C24:0, C22:0, C20:0, C18:0,
C18:1, and C18:2 LPCs) and lyso-platelet activating factor molecular species (C16:0-
Lyso-PAF, and 1-C18:0-Lyso-PAF) determined in the same LC-MS/MS analysis.

4.4 Results
4.4.1 Identification of small molecules that promote recovery of peroxisome
function in PBD-ZSD patient cells
Building upon prior HCS conducted in 96-well plates (Zhang et al., 2010), we
implemented a cell image-based qHCS assay in 1536-well plate format for compounds that
63

enhance peroxisome assembly in PBD-ZSD patient cells. Immortalized PBD-ZSD patient-
derived skin fibroblasts, harboring common hypomorphic PEX1-p.G843D and null PEX1-
p.I700fs mutations, and engineered to express a GFP-PTS1 reporter protein provided the
basis for this assay. These PEX1-mutant cells show a cytosolic localization of the GFP-
PTS1 reporter in contrast to its peroxisomal localization in cells from healthy donors. Each
assay plate contains 7 replicates of a negative vehicle control (0.1% DMSO), a 7 point
titration of the positive chemical control diosmetin, and 7 replicates of a positive genetic
control.
In 1536-well format, we verified the predominantly cytoplasmic localization of the
GFP-PTS1 reporter protein in the PBD-ZSD cells and rescue of peroxisome assembly in
these same cells when transduced with PEX1-lentiviral delivery system. The consistent
appearance of GFP-PTS1-positive puncta the size and shape of peroxisomes and clearing
of cytoplasmic signals indicates a robust rescue of peroxisome assembly upon treatment
with the highest concentration (38.4 µM) of diosmetin. We achieved Z-factors of 0.39 ±
0.07 across all 1536-well assay plates based on data from the negative and positive
chemical control (38.4 µM diosmetin). In addition, 7-point titration showed a dose-
dependent improvement of peroxisome assembly in diosmetin-treated cells (Figure 4.1).
The positive genetic control cells showed robust rescue, but were not used in subsequent
data analysis. Other quality control metrics are provided in Table 4.1.
Lead compounds were identified through quantitative analysis using InCell
Analyzer software and by semi-quantitative visual inspection of all wells. We identified 31
compounds that provided evidence of improved peroxisome assembly in at least 20% of
patient cells in a given well at 38.4 µM, the highest concentration tested (Table 4.2).
64

Background recovery levels were typically less than 5% in this assay. We focused on the
8 compounds (naltriben methanesulfonate hydrate, actinonin, CGP57380, indirubin-3’-
oxime, naltrindole hydrochloride, H-8 dihydrochloride, and apigenin) that showed
evidence of assembly rescue in at least 40% of cells (Table 4.2). The flavonoid apigenin
served as another independent positive control since it was previously identified in a prior
study as rescuing peroxisome assembly in PBD-ZSD patient cells (Braverman et al. in
preparation).

Table 4.1 Summary statistics for screening (Provided by Dr. Patricia Dranchak).
Screening was performed in 1536-well plates of 1280 compounds, each at 7 titrations.
Output signal reports the mean value and CV reports the coefficient of variation. Z’
statistical analysis provides an indication of overall assay robustness based on the average
and standard deviation of a positive and negative control. Z’ values above 0.4 indicate a
robust and acceptable assay. Diosmetin was used as positive control.

Parameters
Assay Parameters
Total Area of Puncta
Cell number (cytotoxicity) based on nuclei
count
1536-well plates 7 (+2 DMSO) 7 (+2 DMSO)
Compounds tested 1280 1280
Points per titration 7 7
Data points 8960 8960
Output signal
DMSO
34.1 ± 6.3
Diosmetin
124.5 ± 12.3
577 ± 44
CV 18.5 ± 2.3 9.9 ± 1.6 7.7 ± 2.5
Z’ factor 0.39 ± 0.07 N/A
Control condition 1 Diosmetin (38.3 µM) Zero cells
Control IC50 (µM) 13.1 ± 4.5 N/A

65

Table 4.2 Compounds promoting rescue of peroxisome assembly in at least 20% of
cells in LOPAC screen as judged by visual inspection. Background recovery levels
were typically less than 5% in this assay.

Compound Name
Positive
Recovery
No
Recovery
Questionable
Recovery
Total
Number of
Cells
% Rescued
Naltriben methanesulfonate hydrate 207 24 2 233 88.8%
Actinonin 155 73 6 234 66.2%
CGP 57380 252 133 4 389 64.8%
Indirubin-3′-oxime 119 77 5 201 59.2%
Naltrindole hydrochloride 186 135 0 321 57.9%
H-8 dihydrochloride 135 106 5 246 54.9%
Apigenin 141 118 5 264 53.4%
1-(5-Isoquinolinylsulfonyl)-3-
methylpiperazine dihydrochloride
148 163 0 311 47.6%
Nifedipine 95 143 3 241 39.4%
Bay 11-7085 84 127 4 215 39.1%
BAY 61-3606 hydrochloride hydrate 123 197 6 326 37.7%
Pentamidine isethionate salt 99 161 4 264 37.5%
Bay 11-7082 87 144 2 233 37.3%
6-Methylaminopurine 9-ribofuranoside 127 211 5 343 37.0%
Leflunomide 104 190 9 303 34.3%
8-(Diethylamino)octyl-3,4,5-
trimethoxybenzoate hydrochloride
81 155 1 237 34.2%
IRAK-1/4 Inhibitor I 106 213 7 326 32.5%
P1,P4-Di(adenosine-5′) tetraphosphate
ammonium salt
97 204 1 302 32.1%
BIO (6-bromoindirubin-3′-oxime) 121 258 5 384 31.5%
1-(5-Isoquinolinylsulfonyl)-2-
methylpiperazine dihydrochloride (H-7
Dihydrochloride)
115 261 3 379 30.3%
Roscovitine 49 118 1 168 29.2%
SP600125 66 171 4 241 27.4%
HA-100 68 218 5 291 23.4%
Ribavirin 75 256 2 333 22.5%
Piribedil maleate salt 83 281 0 364 22.8%
TBBz 56 202 5 263 21.3%
LY-294,002 hydrochloride 38 135 0 173 22.0%
Tetracaine hydrochloride 67 251 5 323 20.7%
LFM-A13 76 279 1 356 21.3%
N-Acetyltryptamine 73 272 2 347 21.0%
Tyrphostin AG 1478 67 263 1 331 20.2%

66

Figure 4.1 Performance of positive chemical control diosmetin in HCS of
LOPAC1280 library (Provided by Dr. Patricia Dranchak).

A. Relative area of punctate structures in treated PBD-ZSD patient-derived assay cells
(black) is plotted along with the relative total number of cells (blue), estimated by nuclei
count, in each well against diosmetin concentration.
B. Data from all plates used in the HCS screening assay are provided.

67

4.4.2 Confirmation of chemical activity by cell-imaging
To confirm that the subset of the most promising compounds from the HCS
improves peroxisome function, we retested the 8 compounds that showed evidence of
assembly rescue in at least 40% of cells in HCS with M2H cells in 6-well format. After 5-
10 days culturing, M2H cells were fixed and nuclear-stained with DAPI. Images of 200-
300 cells/well were obtained for each well and evaluated by visual inspection. We set the
criterium of rescued cells as containing ≥7 distinct punctate cytoplasmic structures
consisting with peroxisome size and shape, or importing peroxisomes per cell. Then, the
percentage of rescued cell per well was determined for each compound at each
concentration tested. Rescued cells ranged from 2.63% to 7.71% in the untreated and
vehicle control, while 95.57% in the positive control 30 µM diosmetin (Figure 4.2 and 4.4).
With this methodalogy, five hit compounds were confirmed: 30 µM naltriben, 15 µM
naltridole and 30 µM CGP 57380, in which 80.95%, 77.5%, 76.54% of cells were
recovered with punctate structures presenting, respectively, and 30 µM H-8
dihydrochloride and 10 µM actinonin, in which 48.67% and 42.65% recovery, respectively.
Representative images from the confirmatory tests were shown in Figure 4.2. The
structurally similar compounds naltriben methanesulfonate hydrate and naltrindole
hydrochloride promoted a reproducible robust rescue of peroxisome assembly (Figure 4.2
and 4.4). The peroxisomal identity of the punctate structures was confirmed by co-staining
the treated cells with antibodies against the peroxisomal membrane protein PMP70, and all
punctate GFP structures colocalized with peroxisome membranes, with examples of
diosmetin-, naltriben-, naltrindole-, CGP 57380- and H8 HCL- treated cells (Figure 4.3).
Given its structural similarity to naltriben methanesulfonate hydrate and naltrindole
hydrochloride, we also conducted pilot studies of the FDA-approved drug naltrexone
68

(Garbutt et al., 2014; Goonoo et al., 2014) at multiple concentrations for 5 and 10 days and
found no cellular rescue of punctate GFP-PTS1 signals or clearing of cytoplasmic GFP-
PTS1 staining (data not shown).
CGP 57380 treatment also promoted an overall robust rescue of peroxisome
assembly (Figure 4.2 and 4.4); however, there was strong evidence of peroxisomal
mosaicism with patches of rescued cells adjacent to patches of cells that did not show
rescue. The other compounds that showed assembly rescue in over 40% of cells from the
primary screen (actinonin, H-8 dihydrochloride, and indirubin-3'-oxime) showed sporadic
rescue of GFP-PTS1 punctate staining and often toxicity in the follow-up experiments,
which required low doses of compound to be tested (Figure 4.2 and 4.4). Nevertheless,
evidence consistent with the ability of these compounds could promote partial rescue of
peroxisome assembly was apparent. Other compounds tested that showed at least moderate
(25%) rescue of peroxisome assembly in the immortalized GFP-PTS1 expressing assay
cells included LY-294,002 hydrochloride, 1-(5-Isoquinolinylsulfonyl)-3-methylpiperazine
dihydrochloride, and (R)-Roscovitine (Table 4.2).
Furthermore, we performed immunostaining to examine peroxisome import in
primary human fibroblast cells lines with PEX1-p.G843D/null and PEX1-null genotypes.
In cells from healthy donors, peroxisomal matrix proteins catalase or peroxisomal thiolase
colocalize with peroxisome membranes (Figure 4.5A and 4.6A). As expected, patient cells
treated with vehicle control (0.1% DMSO) showed cytoplasmic localization of either the
peroxisomal matrix proteins catalase or peroxisomal thiolase and a limited number of
peroxisomal ‘ghost’ membranes (Figure 4.5B,E and 4.6 B,E). Diosmetin treatment resulted
in a dramatic visual rescue of catalase and thiolase import in the PEX1-p.G843D/null cells,
69

but not cells with the PEX1-null genotype, consistent with its proposed role as a molecular
chaperone (Figure 4.5C and 4.6C). In contrast, naltriben treatment only showed evidence
of modest rescue of thiolase and catalase import in the PEX1-p.G843D/null cells, but not
cells with the PEX1-null genotype. This could be due to genetic selectivity of naltriben and
diosmetin, that they work as chaperon to rescue the folding of PEX1-p.843D protein.
Another reason could be that immunofluorescence is not sensitive to detect functional
recovery caused by the chemicals in PEX1-null cell lines.

70

Figure 4.2 Response to hit compounds in immortalized fibroblasts (PEX1
p.G843D/I700fs) expressing GFP-PTS1 at 5 days. Cells were cultured for 5 days with
chemical and imaged after fixation. Note the redistribution of GFP-PTS1 reporter from the
cytosol to the peroxisome in the treated groups, which stays in agreement with the high-
content screening results. In CGP 57380-treated cells, we observed pacthes of recovered
(left) and no effect areas (right). Green: GFP-PTS1; blue: DAPI nuclear counterstaining.

71

Figure 4.3 The peroxisomal identity of the punctate structures in immortalized
fibroblasts M2H cultured with chemicals. Treated cells were fixed and incubated with
PMP70 antiserum and rhodamine conjugated secondary antibody. Green: GFP-PTS2
reporter; red: PMP70; blue: DAPI nuclear counterstaining. The co-localization of PMP70
and GFP is indicated by the yellow punctate structures in the merged images on the right.

72

Figure 4.4 Rescue of peroxisome assembly in immortalized fibroblasts (PEX1
p.G843D/I700fs) expressing GFP-PTS1 at 5 days. After fixing the treated cells, images
of 200-300 cells/well were obtained for each well and evaluated by visual inspection. The
percentage of rescued cell per well was determined for each compound at each
concentration tested and reported as mean ± SD.

73

Figure 4.5 Catalase import in primary human fibroblast cells lines with PEX1-
p.G843D/null and PEX1-null/null genotypes treated with chemicals. PMP70 is
peroxisomal membrane protein, whose staining indicated the location of peroxisomes in
the cell. Catalase utilizes PTS1 to be recognized by peroxisome import machinery. In both
cell lines, smeary distribution of catalase in cytosol after 0.1% DMSO treatment indicates
defect of peroxisomal transportation at baseline. Note the redistribution of catalase from
cytosol to peroxisome in PEX1-p.G843D/null cell line in both the diosmetin- and naltriben-
treated groups, suggesting recovery of peroxisome import and diosmetin caused more
robust recovery. In contrast, in PEX1-null cell line, neither diosmetin nor naltriben caused
a detectable recovery of catalase import. Green: PMP70; red: catalase; blue: DAPI nuclear
counterstaining.

74

Figure 4.6 Peroxisomal thiolase import in primary human fibroblast cells lines with
PEX1-p.G843D/null and PEX1-null/null genotypes treated with chemicals. PEX13 is
peroxisomal membrane protein, whose staining indicated the location of peroxisomes in
the cell. Thiolase utilized PTS2 to be recognized by peroxisome import machinery. A small
amount of Thiolase in PEX1-p.G843D/null cell line was imported into peroxisome as
shown in DMSO 0.1% treated group. Both diosmetin and naltriben resulted in a increased
amount of import of thiolase, with higher reduction of cytosolic thiolase in diosmetin-
treated group compared to naltriben-treated group. In contrast, in PEX1-null cell line,
neither diosmetin nor naltriben caused a detectable recovery of thiolase import. Green:
PEX13; red: peroxisomal thiolase; blue: DAPI nuclear counterstaining.

75

4.4.3 Blood permeable compounds recover peroxisomal thiolase processing in
patient cells
To better evaluate the recovery of N-terminal processing of peroxisomal thiolase
upon import into the peroxisome matrix, we performed immunoblotting of whole cell
lysates from patient primary fibroblast cells from 8 different donors including PBD-ZSD
patients (Figure 4.7 A-F,H) and a patient with rhizomelic chondrodysplasia punctata type
1 (RCDP1), that should also have a thiolase import defect (Figure 4.7G), cultured in 0.1%
DMSO as vehicle control (lane 1), 30 µM diosmetin (lane 2) and 30 µM naltriben for 5
days (lane 3) (Figure 4.7). The whole cell lysates from healthy donor skin fibroblast (lane
C1) and PEX1-null patient (lane C2) were used as controls to locate the 42k-Da mature
(processed) and 44-kDa premature (unprocessed) forms of peroxisomal thiolase in SDS-
PAGE.
In PBD-ZSD patient cells harboring one or two copies of the PEX1-p.G843D allele
(Figure 4.7A-C), compared with the vehicle control-treated group, there was relatively
more mature peroxisomal thiolase in naltriben-treated group and robustly more mature
peroxisomal thiolase in diosmetin-treated group. To our surprise, PEX1-null cells line also
had improvement in thiolase processing after naltriben but not diosmetin treatment,
indicating that the effect caused by diosmetin required the presence of protein while
naltriben did not (Figure 4.7D). Considering that PEX1 peroxin interacts with PEX6,
another AAA ATPase, we evaluated if the chemicals recover peroxisome functions in
PEX6 defective cell lines. As shown in Figure 4.7E, a PEX6-null patient cell line had
improvement in peroxisomal thiolase processing only after naltriben treatment. Since
PEX1 and PEX6 peroxins will form complex together with PEX26, we also evaluated
76

chemical treatments in patient cell line homozygous for PEX26-p.R98W allele. In this case,
diosmetin treatment led to a large increase of mature thiolase while naltriben had no effect
(Figure 4.7F). This indicates that diosmetin is likely to recover peroxisome functions in
cell lines carrying peroxin missense mutations. Given the fact that thiolase is recognized
and imported to peroxisome by PEX7, we also determine the chemical treatment effect in
a PEX7-null patient cell line, in which neither diosmetin nor naltriben caused improvement
in thiolase processing (Figure 4.7G). This was indicative of a primary defect in PTS2-
import pathway alone. Lastly, we evaluated the chemical treatments in a PEX2-null patient
cell line. Again, only naltriben but not diosmetin resulted in an improvement of thiolase
processing (Figure 4.7H). These findings suggest that naltriben not only recovers
peroxisome functions in cell lines carrying PEX1 missense mutation, but also in cell lines
carrying other peroxins null mutations.
Next, we quantified the effect of thiolase processing recovery in primary patient
cell lines (Figure 4.8). In PEX1-p.G843D/null cell line (left panel), we observed minimal
import of thiolase in vehicle control group (DMSO 0.1%) that 8.9% and 8.2% of thiolase
was imported in peroxisome after culturing for 5 and 10 days, respectively, likely due to
residual activity of the small amount of mutant PEX1 protein. In diosmetin-treated group
of this cell line, diosmetin resulted in a significant improvement whereas 72.5% (n = 9, P
< 0.005) and 77.3% (n = 7, P < 0.005) of thiolase was imported into peroxisome after 5
and 10 days, respectively. Also, naltriben treatment resulted in a substantial improvement
whereas 42.2% (n = 9, P < 0.005) and 42.8% (n = 7, P < 0.005) of thiolase was imported
into peroxisome after 5 and 10 days, respectively. In PEX1-p.G843D/G843D cell line
(middle panel), vehicle control group had 2.8% and 2.1% imported peroxisomal thiolase
77

as background for 5 and 10 days treatment, respectively. Diosmetin treatment led to a
significant increase of import with 74.4% (n = 5, P < 0.005) and 62.5% (n = 5, P < 0.05)
of peroxisomal thiolase was imported for 5 and 10 days, respectively. As expected,
naltriben treatment also resulted in a significant increase of import with 24.1% (n = 5, P <
0.05) and 15.4% (n = 5, P < 0.005) of peroxisomal thiolase was imported for 5 and 10 days
treatment, respectively. In PEX1-null cell line (right panel), vehicle control group had low
baseline background mature thiolase while diosmetin treatment did not improve it. In
contrast, naltriben treatment led to a significant increase of mature thiolase with 17.0% (n
= 7, P < 0.05) and 7.4% (n = 6, P < 0.005) of peroxisomal thiolase was imported after 5
and 10 days, respectively.
78

Figure 4.7 Thiolase processing rescued by chemical treatment in patient primary
fibroblast with different genetic background. Lane C1: control group with 42kD
processed thiolase from healthy donor skin fibroblast; lane C2, control group with 44kD
unprocessed thiolase from patient skin fibroblast carrying two PEX1-null alleles; lane 1,
vehicle control, 0.1% DMSO treatment; lane 2, diosmetin 30µM treatment; lane 3,
naltriben 30µM treatment.

A and B Recovery of 42-kDa thiolase in two PEX1-p.G843D/null compound heterozygous
cell lines by both diosmetin and naltriben treatment.
C Recovery of 42-kDa thiolase in PEX1p.G843D homozygous cell line by both diosmetin
and naltriben treatment.
D Recovery of 42-kDa thiolase in PEX1-null cell line by naltriben but not diosmetin
treatment.
E Recovery of 42-kDa thiolase in PEX6-null cell line by naltriben but not diosmetin
treatment.
F Recovery of 42-kDa thiolase in PEX26-p.R98W homozygous cell line by diosmetin but
not naltriben treatment.
G Neither diosmetin nor naltriben treatment leads to recovery of thiolase in PEX7-null cell
line.
H Recovery of 42-kDa thiolase in PEX2-null cell line by naltriben but not diosmetin
treatment.

79

Figure 4.8 Thiolase import recovery in PEX1 mutant cell lines cultured in diosmetin
and naltriben. The amount of processed (42-kDa) and unprocessed (44-kDa) peroxisomal
thiolase (ACAA1) were evaluated by Western blot in three PEX1 mutant cell lines with
different mutations after 5 or 10 days treatment. Values are reported as mean ± s.e.m. (* P
< 0.05; ** P < 0.005; ns = P not statistically significant).

80

4.4.4 VLCFA levels are recovered in PBD-ZSD patient cells in response to
treatments
Given its evidence of rescue of thiolase processing, we further investigated the
effects of naltriben methanesulfonate hydrate treatments on peroxisomal biochemical
activities of PBD-ZSD cells. We evaluated the relative and absolute levels of sVLCFA in
a group of patient-derived primary fibroblasts (Figure 4.9). Consistent with prior reports
(Steinberg et al., 2006), all PBD-ZSD patient skin fibroblasts showed elevated relative and
absolute sVLCFA levels relative to control (skin fibroblasts-derived from an individual
with PEX7 mutations expected to show normal relative sVLCFA levels). Diosmetin
treatment resulted in a significant lowering of relative and absolute sVLCFA levels in
PBD-ZSD cells either homozygous or compound heterozygous for the hypomorphic
PEX1-p.G843D missense mutation at 5 and 10 days. Nevertheless, absolute and relative
sVLCFA levels were unaltered or increased in response to diosmetin treatments in two
different PBD-ZSD-derived primary fibroblasts homozygous or compound heterozygous
for two PEX1-null mutations. Evidence of sVLCFA lowering in diosmetin-treated PEX6-
mutant cells was found after 10 days but not 5 days treatment.
In contrast, naltriben methanesulfonate hydrate treatments resulted in dramatic
lowering of sVLCFA levels in all PEX1-mutant fibroblasts tested, including the PEX1-
mutant PBD-ZSD patient-derived fibroblasts homozygous or compound heterozygous for
null mutations with PEX1-p.G843D as well as the PEX6-mutant fibroblasts. Similar results
were observed at 5 and 10 day treatments. This is consistent with the rescue of thiolase
processing in the treated patient cells.

81

Figure 4.9 Peroxisome functional recovery in patient skin fibroblast cells with various
genetic background. The sVLCFA levels were evaluated by LC-MS/MS. Values are
reported as mean ± SD (* P < 0.05; ** P < 0.005; ns = P not statistically significant; n=3).

A. Relative sVLCFA levels, as indicated by the C26:C22:0 LPC ratios (y-axis), for patient
cells treated with 0.1% vehicle control, 30 µM diosmetin, or 30 µM naltriben for 5 days
(5D) and 10 days (10D). Patient genotypes are provided.
B. %C26:0 levels (y-axis) for patient cells treated as indicated in panel A.

82

Figure 4.9 continued

4.5 Discussion
PBD-ZSD is a term that encompasses a heterogeneous group of autosomal
recessive disorders whose peroxisomal etiology was first recognized over 40 years ago
(Goldfischer et al., 1973). The causative role of PEX gene mutations in human PBDs was
first described about twenty years ago (Braverman et al., 1997; Goldfischer et al., 1973)
with an appreciation of that the PEX1 gene is mutated in the majority of PBD-ZSD patients
identified to date (Rosewich et al., 2005; Steinberg et al., 2004; Yik et al., 2009). Similar
to numerous other rare disorders with a well-characterized molecular etiology, current
83

treatment options for PBD-ZSD remain largely palliative in nature (Braverman et al., 2016;
Klouwer et al., 2015; Poll-The and Gartner, 2012). The expanding implementation of
newborn screening for PBD-ZSD and other peroxisomal disorders provides additional
impetus to identify and developed more effective targeted therapies that address the
molecular underpinnings of disease in the clinic (Braverman et al., 2013).
To identify small molecules that can enhance peroxisome assembly and also
provide novel reagents to investigate peroxisome biology, we adapted an established cell-
image based HCS assay and implemented it as a robust miniaturized HCS platform in
1536-well assay plates. This cell-based assay was chosen due to a number of favorable
characteristics. Since the PBD-ZSD patient cells harbor the common hypomorphic PEX1-
p.G843D missense and null PEX1-p.I700fs frameshift mutations, this provides an
opportunity to address the molecular basis for disease in the largest segment of the PBD-
ZSD patient population. Furthermore, the cell-image based assay provides an opportunity
to identify compounds that promote peroxisome assembly by any mechanism. Given its
successful implementation in 96-well assay plates (Zhang et al., 2010), the miniaturization
provides an opportunity to interrogate larger chemical libraries in a more cost-effective
manner to investigate responses to multiple doses of each compound assayed.
In our initial screen of the Sigma LOPAC1280 chemical library, we identified a
group of eight compounds with rescue of peroxisome assembly in over 50% of patient cells
treated with the highest concentration of drug. Taking advantage of the 7 point titration of
every compound, we could definitively state that enhanced peroxisome assembly in
substantive numbers of cells, as evidenced by the appearance of punctate GFP-PTS1
84

structures, was not observed in response to treatment with sub-micromolar concentrations
of this library at the two day timeframe.
Our initial validation steps involved retesting ‘hit’ compounds in the same
immortalized PBD-ZSD patient fibroblasts used in HCS of the LOPAC1280 library.
Robust rescue of peroxisome assembly, as shown by punctate GFP-PTS1 signals, was
demonstrated for naltriben methanesulfonate hydrate, naltrindole hydrochloride, and CGP
57380. The other compounds tested also demonstrated evidence of improved peroxisome
assembly, including actinonin, H-8 dihydrochloride, and indirubin-3'-oxime. Importantly,
a flavonoid compound known to improve peroxisome assembly in PBD-ZSD cells
harboring at least one PEX1-p.G843D allele (Braverman, personal communication) was
independently identified in this screen in a blinded manner.
The compound naltriben methanesulfonate hydrate was chosen for most intensive
analysis in primary PBD-ZSD cells of various genotypes by cell immunostaining (Figure
4.5 and 4.6), analysis of peroxisomal thiolase processing (Figure 4.7 and 4.8), and
biochemical analysis of relative and absolute sVCLFA levels (Figure 4.9). Again, in
agreement with prior observations, diosmetin treatments lead to a robust rescue of
peroxisome assembly in cells with PEX1-p.G843D alleles. Surprisingly, we found
evidence of improved thiolase processing in PBD-ZSD patient cells treated with naltriben
methanesulfonate hydrate not only carrying PEX1-p.G843D alleles, but also those
homozygous or compound heterozygous for null alleles for PEX1, PEX2, and PEX6
(Figure 4.7). In the case of null alleles, peroxisome thiolase import was close to 10%, which
indicates relatively minor rescue.
85

As a more direct functional assay of peroxisomal activities, relative and absolute
VLCFA levels were measured in PBD-ZSD donor-derived primary fibroblasts treated with
diosmetin and naltriben methanesulfonate hydrate. In agreement with the thiolase
processing assays naltriben methanesulfonate hydrate treatments resulted in a dramatic
lowering of relative and absolute sVLCFA levels in PBD-ZSD cells harboring PEX1-
p.G843D alleles or null PEX1 or PEX6 alleles. Similar results were found in pilot studies
involving the structurally similar naltrindole hydrochloride and CGP 57380 compounds.
The mechanistic basis for the rescue of peroxisomal functions in the PBD-ZSD
patient derived cells treated with naltriben methanesulfonate hydrate, naltrindole
hydrochloride, and CGP57380 are unknown. As a means of interrogating these functional
aspects of these small molecules, we investigated the activity of the structurally similar
FDA-approved drug naltrexone and found no evidence of peroxisome activity. This
indicates the potential functional importance of the highlighted chemical moiety (Figure
4.10) that is shared by the molecules naltriben methanesulfonate hydrate, naltrindole,
CGP57380, (R)-roscovitine, and indirubin-3’-oxime that showed activity in the initial HCS
screen and in follow-up functional assays we conducted (Table 4.2).
Of special importance, we note that naltriben methanesulfonate hydrate and
naltrindole hydrochloride are brain permeable opioid receptor antagonists that are used in
studies of chemical addiction in rodents (Beaudry et al., 2015; Fenalti et al., 2014).
CGP57380 is a cell-permeable selective inhibitor of mitogen-activated protein kinase-
interacting kinase 1 (MNK1) (Grzmil et al., 2014), whose brain permeability has not been
reported. Nevertheless, the brain permeability of naltriben methanesulfonate hydrate and
86

naltrindole hydrochloride is an intriguing property of these compounds given the
neurological aspects of PBD-ZSD.
Unraveling the mechanistic basis for rescue of peroxisome assembly by the
compounds highlighted in this study can be challenging and is dependent upon the mode
of activity. As discussed the pilot HCS uncovered molecules previously shown to bind the
ATP binding site of ABC transporter proteins (Zhang et al., 2010). Coupled with prior
observations that PEX1-p.G843D is a temperature-sensitive allele and responds to other
potential molecular chaperones (Berendse et al., 2013; Walter et al., 2001), it was proposed
that the misfolded PEX1-p.G843D allele protein is amenable to molecular chaperone
therapy. Nevertheless, the ability of naltriben methanesulfonate hydrate to rescue
peroxisome assembly in cells that are incapable of producing PEX1, PEX6, or PEX2
protein indicates a differing mode of activity from previously discovered compounds,
including diosmetin whose activity is proposed to be a molecular chaperone (Braverman
et al. in preparation). The development of in vitro peroxisome assembly assays (Blok et al.,
2015; Gardner et al., 2015; Tan et al., 2016) could provide valuable tools for investigations
into whether there are direct interactions with the peroxisome assembly machinery. Other
lines of investigation involving transcriptomic or proteomic investigations will also be of
value, but their utility is highly dependent upon the number of molecular changes observed
that could potentially mask molecular pathways of greatest importance to the rescue of
peroxisome assembly.
Investigations into structure–activity relationships for the confirmed hits could
potentially generate a set of lead compounds that can be studied in emerging iPSC models
(Wang et al., 2015) and genetically engineered mouse models (Baes and Van Veldhoven,
87

2012), especially the Pex1-p.G844D model of mild PBD-ZSD (Hiebler et al., 2014), and
other invertebrate models (Van Veldhoven and Baes, 2013). In addition, the elucidation of
their mechanism of activity can lead into valuable insights into peroxisome structure,
function, replication, and cellular homeostasis. We also note the potential of small
molecules detected in such screens for more common diseases, including diabetes (Sexton
et al., 2010) and Alzheimer’s disease (Dorninger et al., 2015).
Figure 4.10 Chemical structures of active compounds uncovered in the HCS that
showed a similar structural motif. Naltrexone (red) did not show activity in the chemical
screen and is provided to highlight the shared structural motif absence of this structural
motif in a related, but non-active compound. The names of the active compounds are
provided in green.

88

CHAPTER 5
DEVELOPMENT AND VALIDATION OF PEX1-MUTANT HEPG2 CELLS

5.1 Abstract
Most PBD-ZSD patient suffer from liver disease and have abnormal peroxisomes
in their hepatocytes. Consistent with their functional significance in lipid metabolism,
peroxisomes are more abundant in hepatocytes relative to skin fibroblasts. However, the
commonly-used cell-based model of PBD-ZSD is cultured skin fibroblasts from patients
and mouse models due to their easy accessibility and maintenance. To bypass the difficulty
in obtaining primary hepatocyte cell culture from patients, we hypothesized that HepG2
cells carrying common PBD-ZSD associated mutations will serve as a better model for
elucidating the mechanistic bases of the peroxisomal diseases and can increase the
sensitivity of diagnostic test and drug screening and toxicity testing. Herein, we reported
the generation HepG2 PEX1-p.G843D/null and PEX1-null cell lines. The mutant line with
hypomorphic PEX1-p.G843D allele showed expected temperature sensitivity in
peroxisome protein import and responded to protein chaperon treatment.

5.2 Introduction
Most patients in the PBD-ZSD have liver disease, variable neural-developmental
delay, retinopathy and perceptive deafness since birth. Skin fibroblasts from patients and
mouse models for PBD-ZSD are easy to obtain and thus have been used as a powerful tool
to understand patient-specific mutations and screen small molecule libraries for
compounds that restore peroxisome function (Yik et al., 2009; Zhang et al., 2010).
89

However, genes related to mitochondrial functions and organelle cross-talk were
differentially expressed among iPSCs derived from PBD-ZSD patients and healthy donors
while skin fibroblasts had similar gene expression profiles. Also, given the functional
significance of peroxisomes in lipid metabolism, they are more abundant in hepatocytes
relative to skin fibroblasts. Thus, cells that play pivotal roles in the pathophysiology of
PBD-ZSD are necessary to better understand the disease and develop effective therapy.
Hepatocytes are the major structural units of liver body and functional units for
both liver metabolism and regeneration (Si-Tayeb et al., 2010). However, it is not ethical
to obtain sufficient number of primary human hepatocytes from PBD patients on the scale
required for laboratory experimentation. In addition, due to the scarce availability of fresh
human liver samples, complicated isolation procedures and limited life span, primary
human hepatocytes can hardly be engineered, maintained or utilized as PBD-ZSD disease
model (Madan et al., 2003). To overcome these limitations, immortalized liver-derived cell
lines were proposed as an ideal alternative model to study liver diseases pathophysiology
and perform drug screening.
Human hepatocellular carcinoma cell line HepG2 was the first widely used
hepatocyte alternative. They are highly differentiated and display many of the genotypic
features of normal liver cells (Sassa et al., 1987). Thus, HepG2 cells were used to study
non-alcoholic fatty liver disease (Shi et al., 2014), and the effects of hypoxia (Tazuke et
al., 1998), and to screen the drug-induced hepatotoxicity potential of new chemical entities
at early stage during drug development (Gerets et al., 2009). They are suitable in vitro
model system for studies of liver metabolism and toxicity of xenobiotics. If the peroxisome
90

related genes in HepG2 cells can be modified to reflect mutations carried by patients, these
cells can be suitable in vitro model system for the study of peroxisome disorders.
The recently characterized clustered regularly interspaced short palindromic repeat
(CRISPR)-CRISPR-associated Cas9 system has enabled remarkable developments in
precisely and efficiently targeting, editing and modifying genomic loci in cells and
organisms (Hsu et al., 2014). The CRISPR-Cas9 technology originates from type II
CRISPR-Cas systems in bacteria that provide adaptive immunity to viruses and plasmids.
The CRISPR-associated protein Cas9 is an endonuclease that uses an RNA guide sequence
tracrRNA:crRNA that form base pairs with the DNA target sequences to introduce a site-
specific double-strand break in the DNA and further facilitate homology-directed repair
with minimal mutagenic activity (Cong et al., 2013). This system features fast design and
synthesis, inexpensive, efficient and easy validation and thus starts a transformative chapter
in genome editing technology. Some analyses showed that CRISPR-Cas9-mediated
genome editing has more than 80% efficiency on target, which is as high as or higher than
the levels observed using other techniques despite the possible imprecise comparison due
to differences in target sites and protein expression levels (Doudna and Charpentier, 2014).
The CRISPR-Cas9 technology can precisely introduce double strand break (DSB) at
defined positions to generate cells bearing tumor-associated chromosomal translocations
resembling lung cancer, acute myeloid leukemia and Ewing’s sarcoma (Chen et al., 2014;
Choi and Meyerson, 2014; Torres et al., 2014). Another application is the genome-scale
loss-of-function screening to identify genes pivotal for cell viability in cancer and
pluripotent stem cells (Shalem et al., 2014). Also, the targeted CRISPR-Cas9 technology
was shown to efficiently cleave and mutate the long terminal repeat sites of HIV-1 and
91

remove infected cell internal viral genes (Ebina et al., 2013; Hu et al., 2014). Besides its
wide application in cell lines, CRISPR-Cas9 system was utilized to generate liver cancer
and myeloid malignancy mouse models (Heckl et al., 2014; Xue et al., 2014). Excitingly,
CRISPR-Cas9 technology was reported to correct genetic mutations responsible for
inherited disorders. The mice that had cataracts due to a Crygc gene mutation were rescued
by injection of CRISPR-Cas9 system targeting the mutant allele and are able to transmit
the corrected allele to their progeny (Wu et al., 2013). In addition, CRISPR-Cas9
technology was reported to facilitate the correction of the CFTR locus in cultured intestinal
stem cells of cystic fibrosis patients (Schwank et al., 2013).
Therefore, we hypothesized that CRISPR-Cas9 genome editing system can be
utilized to generate HepG2 mutant cells with PEX1c.2528G>A p.G843D mutation that will
serve as a better model for elucidating the mechanistic bases of the peroxisomal diseases,
increasing the sensitivity of drug screening and toxicity testing. The PEX1-p.G843D
mutation was selected due to its frequent appearance among patients as previously
discussed in Section 3.2.

5.3 Materials and methods
5.3.1 Cell lines and cell culture
HepG2 cells were purchased from the Coriell Institute Cell Repositories (CIRC),
and cultured as previously described in Section 2.3.1. For low temperature test, cells were
transferred to 30C with 5% CO2 and cultured for desired length. HepG2 cells were
transduced twice with lentivirus expressing GFP-PTS1 reporter as previously described in
92

Section 3.3.2. Chemical compound treatment were performed as previously described in
Section 4.3.3.
GenScript was contracted to generate PEX1 mutant HepG2 cells. First, HepG2 cells
were transfected with CRISPR-Cas9 system to introduces PEX1 null allele, which resulted
in a PEX1c.2522delA carrier. Next, a donor vector to substitute PEX1c.2528G>A p.G843D
within exon 15 was designed with a CMV promoter-driven puromycin resistant gene
expression cassette (Figure 5.1). Silent mutation sites were incorporated to avoid
miscleavage of gRNA. HepG2 cells were transfected with CRISPR-Cas9 system and the
donor vector followed by puromycin selection. Then, the cells were seeded into 96-well
plates through ten-fold serial dilution at 1 cell/well density. Single cell colonies (will refer
to as HepG2 mutant candidate cell lines) were expended and analyzed for targeted mutation
by Sanger sequencing.

Figure 5.1 Structure and Sequence of Donor Vector pUC57_PEX1G843D –CMV-
PuroR(RV).

93

5.3.2 DNA sequencing of mutations
Genomic DNAs were extracted from cultured HepG2 and HepG2 mutant candidate
cell lines. Primers flanking and within the sequence of PEX1 gene coding exon 15 were
designed as followed:
gPEX1e14-1-Forward: 5’- CACTATAGATTTGTCAACCTGATTTTC -3’,
gPEX1e14-2-Forward: 5’- CAGAGTATATCCACCAGAGA -3’,
gPEX1e15-1-Reverse: 5’- TTGAGACCTCACTCTGTCAT -3’,
gPEX1e15-4-Reverse: 5’- CAACAAGTGTTTACTGAGTTACCA -3’,
and gPEX1e16-1-Reverse: 5’- TGTCTTTCACACCAACTGCA -3’.
PCR reactions were set up in 20 µL containing 100 ng of template gDNA, 4 µL 5X
Phusion HF Buffer, 0.5 µM of each primer, 0.2 mM dNTPs and 0.4 units of Phusion (New
England Biolabs). Thirty-five cycles (98 C for 10 seconds, 60-65 C for 30 seconds, and
72C for 1-3 minutes) of PCR were performed following an initial denaturation at 98C
for 30 seconds and finished with a final extension at 72 C for 10 minutes. DNA-free
controls were run in parallel to monitor for DNA contamination. All reactions were
analyzed on agarose gels to verify the presence of appropriately sized products. The
appropriate amplicons were subcloned using the pCR®Blunt II-TOPO® vector (Thermo
Fisher Scientific) and plasmid DNA of individual subclones were extracted and sequenced
to confirm the identity of mutations. The appropriate PCR products were purified using
DNA Clean & Concentrator™-5 kit (Zymo) and sequenced to confirm the identity of
mutations.

94

5.3.3 Real-time quantitative PCR
Total RNA was extracted from cells by Quick-RNA mini prep kit (Zymo Research)
and 100ng of total RNA was used for cDNA synthesis with qScript cDNA Super Mix kit
(Quanta Biosciences) according to the manufacturer’s protocol. Real-time PCR were set
up in triplicate with SYBR Green Master Mix (Quanta Biosciences) and analyzed with
CFX96 Touch™ Real-Time PCR detection System. Expression values were normalized to
the average expression of the housekeeping gene GAPDH and relative to unmodified
HepG2 cells. The sequences of primers used are listed below.
PEX1-mRNA-Forward: 5’- GAGGAGAAAAAATCAAAGTGG -3’,
PEX1-mRNA-Reverse: 5’- GTTACAACATATGGAAAAGCC -3’,
GAPDH-Forward: 5’- GAGTCCACTGGCGTCTTCA -3’,
GAPDH-Reverse: 5’- GGGGTGCTAAGCAGTTGGT-3’,

5.4 Results
5.4.1 Identification of PEX1-null and PEX1-p.G843D cell lines
We obtained 20 of HepG2 mutant candidate lines after signle cell colony expansion,
7 of which were subjected to genotyping (No. 1-7). One line (No. 1) was identified as PEX1
c.2522delA/2519del14, and all other six (No. 2-6) were PEX1c.2528G>A (Table 5.1). The
allele with 2522delA or 2519del14 results in a frameshift in protein transcription which
will generate premature termination of PEX1 protein. The allele with 2528G>A missense
mutation will generate partially functional PEX1 protein. Thus, candidate cell line No.1
will be referred to as “HepG2 mutant PEX1-null” and No.7 will be representing candidate
cell lines with same mutation in PEX1 and refered to as “HepG2 mutant PEX1-
p.G843D/null”.
95

Next, we evaluated the PEX1 expression levels in HepG2 mutant candidate cell
lines by Western blot and real-time quantitative reverse transcription PCR. As expected, in
HepG2 mutant PEX1-null cell line we observed no PEX1 protein and the mRNA level was
decreased to 29.3% of wild type due to nonsense-mediated decay (Figure 5.2). To our
surprise, there was no detectable PEX1 protein in HepG2 mutant PEX1-p.G843D/null. This
could be a result of PEX1 protein with the missense mutation being degraded and Western
blot assay’s limited capability in detecting low abundance of PEX1 protein. The PEX1
mRNA level in this cell line increased to 358.0% of wild type, possibly a compensation
action of the cells with decreased PEX1 protein level (Figure 5.2).

Table 5.1 Summary of mutations in HepG2 mutant candidate lines.
Candidate line No.
PEX1 1
st
allele PEX1 2
nd
allele
Note
Coding Protein Coding Protein
1 c.2519del14 p.K840fs c.2522delA p.I841fs
HepG2 mutant
PEX1-null
2 c.2528G>A p.G843D c.2522delA p.I841fs
3 c.2528G>A p.G843D c.2522delA p.I841fs
4 c.2528G>A p.G843D c.2522delA p.I841fs
5 c.2528G>A p.G843D c.2522delA p.I841fs
6 c.2528G>A p.G843D c.2522delA p.I841fs
7 c.2528G>A p.G843D c.2522delA p.I841fs
HepG2 mutant
PEX1-
G843D/null

96

Figure 5.2 PEX1 expression in HepG2 mutant candidate lines. Neither HepG2 PEX1-
p.G843D/null nor PEX1-null has detectable PEX1 protein. The PEX1 mRNA level of
HepG2 PEX1-null was reduced and PEX1- p.G843D/null was increased, suggesting a
compensation in the mRNA expression due to the missense PEX1 mutation.
A PEX1 protein levels in HepG2 PEX1 mutant cell line compared to wild type by Western
blot. Lane C1, human skin fibroblast cells from healthy donor; C2, human skin fibroblast
cells from PBD-ZSD patient homozygote for PEX1-null; β-actin was used to evaluate
protein loading.
B Quantification of PEX1 mRNA level in HepG2 PEX1 mutant cell line compared to wild
type by qRT-PCR. GAPDH was as internal control to normalize the data and the wild type
expression was set as 1. The mean and SD (error bars) of the pooled results were reported
herein (n = 3).

97

5.4.2 Temperature sensitivity and chemical treatment response of HepG2 PEX1
mutant cells
HepG2 wild type and PEX1 mutant cells were transduced with lentiviral vector
designed to express GFP-PTS1 reporter protein, which is imported to peroxisome
appearing as punctate structure in cells with intact peroxisomal import pathway and
remains cytosolic in cells with peroxisomal import defect (Zhang et al., 2010). In wild type
cells, GFP-positive puncta were formed indicting intact peroxisomal assembly, which was
not affected by culturing at 30°C or with 30 µM diosmetin (Figure 5.3 left column). In
contrast, PEX1-p.G843D/null cells showed mainly cytoplasmic distribution of GFP,
reflecting abnormal peroxisome assembly defect caused by PEX1 mutation (Figure 5.3
middle column). As expected, peroxisomal protein import was recovered when these cells
were cultured at 30°C or with 30 µM diosmetin, whose activity is proposed to be a
molecular chaperone (Braverman et al. in preparation). However, we observed evidence of
peroxisomal protein import recovery in HepG2 PEX1-null cell line culturing at 30°C
(Figure 5.3 right column). Also, 30 µM diosmetin treatment caused a robust peroxisomal
protein import recovery in this cell line, suggesting that diosmetin may work under another
mechanism other than being molecular chaperone.

98

Figure 5.3 HepG2 and derived mutant cells expressing GFP-PTS1 reporter. HepG2
and derived cells expressing GFP-PTS1 reporter protein (green) and nuclei counterstained
with DAPI (blue). Note that HepG2 cells show punctate structures of GFP indicating
normal peroxisomal import while mutant cells show cytosolic distribution of GFP. HepG2
PEX1- p.G843D/null cells, when cultured at 30°C and with 30 µM diosmetin have more
peroxisomal protein import activity. HepG2 PEX1-null cells also showed evidence of
peroxisomal protein import recovery by 30°C culture and 30 µM diosmetin.

99

5.5 Discussion
All human diseases caused by peroxisome dysfunction and most mouse models
with loss of peroxisome function are characterized by liver disease, underscoring the
importance of peroxisomes in liver function. HepG2 cells provide a cell culture model
system that mimics some properties of hepatocytes, albeit with limitations such as the
aneuploidy. Here, we generated and characterized immortalized HepG2 cells modified to
express one PEX1-p.G843D and one PEX1-null allele as well as two PEX1-null alleles. As
expected, the PEX1-null cell line has no detectable PEX1 protein and the PEX1 mRNA
was significantly reduced compared to wild type due to nonsense-mediated decay. The
PEX1-p.G843D allele should generate PEX1 mutant protein that is unstable and
temperature sensitive (Imamura et al., 1998). However, in the PEX1-p.G843D/null cells
we were not able to detect PEX1 protein. This is likely due to the PEX1-p.G843D protein
being unstable and degraded, or the PEX1 protein level is too low to be detected by Western
blot in HepG2 PEX1-p.G843D/null cells. In order to detect trace amount of the PEX1-
p.G843D protein, we will treat the cells with proteasome inhibitor and expect to detect
PEX1 protein in both HepG2 and PEX1-p.G843D/null mutant but not PEX1-null cells.
When the HepG2 PEX1 mutant cells were cultured at 30°C, the PEX1-
p.G843D/null cells showed a robust peroxisomal protein import suggested by the forming
of GFP punctate structures (Figure 5.3), which is consistent with the temperature sensitivity
of PEX1-p.G843D protein. The PEX1-null cells showed slight increase in peroxisomal
protein import which can be due to a change of cell metabolism not caused by PEX1 gene
mutation. As expected, the diosmetin treatment resulted in peroxisomal protein import
recovery in PEX1-p.G843D/null cells, which is consistent with what we have observed
100

when skin fibroblast cells with the same genetic background were cultured with this
compound as described in Chapter 4 (Figure 5.3). The PEX1-null cells also showed better
peroxisomal protein import after diosmetin treatment, which is different from what we
observed in skin fibroblast cells with two PEX1-null alleles. This indicates that unlike what
we used to believe, i.e. diosmetin functions as protein chaperon and requires PEX1 protein
to be present in order to recover peroxisomal protein import, it also works under a new
mechanism that can only be detected in hepatocyte cell lineage. The recovery of
peroxisomal protein import in these cells has to be evaluated with higher statistical power
and quantification method in order to determine the effect caused by PEX1 gene mutation.
Also, the aneuploidy, gene expression profiling and biochemical lipid profiling should be
investigated in these cell lines with and without chemical compound treatments and
cultured at different temperatures.
Overall, the generation of these HepG2 PEX1 mutant cell lines will enable us to
investigate pathomechanisms of hepatocyte-dysfunction in PBDs and also serve as model
systems for drug screening. Also, with our initial characterization of these cells, they have
different sensitivity in reaction to chemical compounds and are potentially better tools for
drug screening and toxicity testing for peroxisomal diseases.

101

CHAPTER 6
CONCLUSIONS AND PERSPECTIVES
PBD-ZSD patient life spans are severely shortened, with severe patients usually
surviving less than one year of age while milder patients usually live until late infancy and
even reach young adulthood. Currently, there is no curative therapy or long-term effective
treatment available for PBDs and available treatments focus on symptomatic therapy and
palliative measures. The ongoing biochemical studies and drug testing on the peroxisomal
disorders primarily utilize patient primary cell cultures, particularly primary skin fibroblast
cultures due to their easy accessibility but have limited peroxisomal activity, and knockout
mouse models, which do not mirror the exact human mutations or certain aspects of human
symptoms. In this dissertation, the immortalized PBD-ZSD patient skin fibroblast cells
with the common PEX1-p.G843D mutation were applied in high content screening of
chemical libraries to identify active compounds that recover peroxisome assembly and
function. Also, new model systems of PBD-ZSD as next generation drug screening tools,
including iPSCs, HepG2 cells and first mouse model with hypomorphic PEX alleles.

6.1 Defects in PBD-ZSD iPS cell derived CNS and hepatocyte-like cells
We have generated iPSCs using skin fibroblasts from PBD-ZSD patients and
healthy donors. These iPSCs were similar to hES cells in their morphology, expression of
the hallmark pluripotency genes, achievement of global epigenetic reprogramming, and the
ability to differentiate into cell types of all three germ layers. These iPSCs can be stably
maintained for extensive passages without losing growth potential, pluripotency or genome
integrity. We differentiated these cells to CNS and hepatocyte lineage cells that expressed
102

many key cell markers. The derived oligodendrocyte precursors showed identical
morphology and had similar ability being differentiated into O4-positive oligodendrocytes.
Interestingly, highly branched mature oligodendrocytes expressing MBP can be obtained
from healthy donor iPSC derived oligodendrocyte population while patient
oligodendrocytes with homozygous PEX1-p.G843D missense mutations were poorly
branched and were unable to remain attached under terminal differentiation conditions,
which may be directly associated with reduced peroxisomal activity in these cells but
requires higher statistical power to verify (Wang et al., 2015) whether truly caused by the
PEX gene defects. The oligodendrocyte precursor cells and hepatocyte-like cells derived
from PBD-ZSD patient skin fibroblast demonstrated defective peroxisomal protein import
abnormality. These cells, if can be better purified and enriched, would be valuable tools to
gain in-depth knowledge of the mechanisms underlying the cellular defects. Furthermore,
they have utility to characterize and validate specific markers or features for the
development of new drug screening platform.
To identify the differences truly associated with peroxisomal mutations but not
other background sequence changes in the genome, we need to overcome or minimize the
random variations among all iPSCs. Increasing the number of iPSCs for each individual
and the number of parental fibroblasts will increase the statistical power of analysis. Any
phenotypical difference observed between patient and control cells requires verification in
multiple iPSCs with the same genetic background. Also, our differentiation protocol can
be optimized to increase the yield of desired cells as well as purify and enrich the cells to
apply in down-stream studies and high throughput/content drug screening systems.

103

6.2 Differential gene expression in Pex1-p.G844D mouse
Approximately 60–70% of PBD-ZSD patients have PEX1 defects (Collins and
Gould, 1999), 20–30% among which carry at least one common PEX1-c.2528G>A
p.G843D allele (Steinberg et al., 2004). Unlike the other null alleles that usually associate
with severe clinical and biochemical phenotype, this hypomorphic allele encodes an
unstable, misfolded protein that has residual activity and is associated with a milder clinical
phenotype (Preuss et al., 2002; Walter et al., 2001). The PBD-ZSD patients with
progressive disorders in the intermediate and mild end of the spectrum and should benefit
from therapeutic interventions that can halt or ameliorate further deterioration (Braverman
et al., 2013). Thus, we generated murine equivalent model of mild PBD-ZSD caused by
the common human PEX1-p.G843D allele to serve as model system for this group of
patients. This is the first knock-in mouse model of peroxisome disorder and complements
the existing Pex gene knock-out mice that represent the severe end of PBD-ZSD (Hiebler
et al., 2014). The initial characterization of these mice showed similar features as milder
PBD-ZSD patients, such as growth retardation and defective lipid metabolism. The fact
that these mice have abnormal retinal function and gradually lose cone photoreceptors
indicates that a window exists to preserve cone cell survival and function, which makes
them novel platform to evaluate retinal gene therapy and small molecule interventions.
The global gene expression analysis of whole retinas show the photoreceptor cone-
specific genes with reduced expression in Pex1-p.G844D mice compared to their normal
littermates. It will be interesting to investigate whether this is a marker of cone cell death
or a direct consequence of affected Pex1 function. In addition to recapitulating key clinical
symptoms observed in PBD-ZSD patients, we have demonstrated in principle that the
104

Pex1-p.G844D homozygous mice will be valuable for testing retinal gene therapy as the
peroxisomal protein import defect in their cultured skin fibroblast cells can be recovered
by AAV9-mediated human PEX1 transgene expression. Overall, the Pex1-p.G844D mouse
provides multiple opportunities to expand our understanding of the pathophysiology
associated with mild defects in PBD-ZSD and the requirements for peroxisome functions
in organ homeostasis from the postnatal period onwards. More gene expression analyses
on the brain, liver, adrenal glands, kidneys and other organs from Pex1-p.G844D mice
could provide valuable information to guide the development of rationally designed
therapies for patients affected with milder forms of PBD-ZSD. Moreover, the loxP-sites in
the targeting construct used to generate the Pex1-p.G844D mice allow for the development
of tissue and cell type specific knockouts of the Pex1 gene in the genetic background of
hypomorphic Pex1 alleles. This could allow for rigorous investigations into the varying
role of peroxisome in the cell type specific clinical phenotypes observed in PBD-ZSD
patients.

6.3 High-content screening for peroxisomal disorders
The causative role of PEX gene mutations in human PBDs has been characterized
for more than two decades while current treatment options still remain largely palliative in
nature. Identifying small molecules that enhance peroxisome assembly can provide novel
reagents to develop more effective targeted therapies. In order to perform large scale
screening of chemical libraries, we adapted an established cell-image based HCS assay
(Zhang et al., 2010) and implemented it as a robust miniaturized HCS platform in 1536-
well assay plates. The cell model harbor the common hypomorphic PEX1-p.G843D
105

missense and null PEX1-p.I700fs frameshift mutations, which addresses the molecular
basis for disease in the largest segment of the PBD-ZSD patient population. In our initial
screen of the Sigma LOPAC1280 chemical library, we identified a group of eight
compounds with rescue of peroxisome assembly in over 50% of patient cells treated with
the highest concentration of drug. These ‘hit’ compounds were retested using the same
immortalized PBD-ZSD patient fibroblasts as in HCS. Three compounds demonstrated
robust rescue of peroxisome assembly, as shown by punctate GFP-PTS1 signals in the cells,
including naltriben methanesulfonate hydrate, naltrindole hydrochloride, and CGP 57380.
Other compounds with evidence of improved peroxisome assembly include actinonin, H-
8 dihydrochloride, and indirubin-3'-oxime. We also identified apigenin, a flavonoid
compound known to improve peroxisome assembly in PBD-ZSD cells harboring at least
one PEX1-p.G843D allele (Braverman, personal communication) in the screening in a
blinded manner which indicates the unbiased nature of the assay.
We chose naltriben methanesulfonate hydrate for the most intensive follow-up
analysis given its most robust recovery. In agreement with prior observations, naltriben
treatments lead to an strong evidence of rescue of peroxisome assembly in primary PBD-
ZSD cells with PEX1-p.G843D alleles shown by cell immunostaining, peroxisomal
thiolase processing and biochemical analysis of relative and absolute sVCLFA levels. To
our surprise, we found evidence of improved thiolase processing in PBD-ZSD patient cells
treated with naltriben that were homozygous or compound heterozygous for null alleles for
the PEX1, PEX2, and PEX6 genes. Moreover, naltriben treatments resulted in a dramatic
lowering of relative and absolute sVLCFA levels in PBD-ZSD cells harboring PEX1-
p.G843D alleles or null PEX1 or PEX6 alleles. Similar results were found in pilot studies
106

involving the structurally similar naltrindole hydrochloride and CGP57380 compounds.
Naltriben methanesulfonate hydrate and naltrindole hydrochloride are brain permeable
opioid receptor antagonists that are used in previous rodent chemical addiction studies
(Beaudry et al., 2015; Fenalti et al., 2014). The brain permeability of them can be crucial
to address the neurological defects of PBD-ZSD.
To investigate the mechanistic basis for the rescue of peroxisomal functions in the
PBD-ZSD patient derived cells treated with the “hit” compounds, we investigated the
activity of the structurally similar FDA-approved drug naltrexone and found no evidence
of peroxisome activity (data not shown). This leads to a finding of potential functional
important chemical moiety as shown in Figure 4.10 that is shared by the molecules with
activity in the initial HCS screen and in follow-up functional assays we conducted. It will
be interesting to apply other assays to investigate the mechanisms of the “hit” compounds,
such as in vitro peroxisome assembly and more robust transcriptomic or proteomic
investigations. With the establishment of such a HCS platform, we can apply other cell-
based model systems such as iPSCs (Wang et al., 2015), cells derived from genetically
engineered mouse models (Baes and Van Veldhoven, 2012; Hiebler et al., 2014) and HepG2
PEX1 mutant cells and potentially identify new sets of lead compounds.

6.5 Future directions
We have successfully implemented a cell-image based model system in HCS assay
and identified ‘hit’ compounds with robust rescue of peroxisome assembly. It will be of
interest to interrogate their activities in PBD patient cells with different genetic
backgrounds to expand the patient population they can potentially benefit. Also, testing
107

them in cell lines derived from other peroxisomal disorders patients, such as X-ALD that
have VLCFA deficiency will be of interest to expand the potential use and further
understand their mechanism. Biochemical lipid profile and global gene expression profile
analysis at different doses for each ‘hit’ compound treatment in patient cells with different
genetic backgrounds will be of great value to shed light on their underlying molecular
mechanism in peroxisome function recovery. Moreover, synergistic study of the identified
compounds or with FDA-approved drugs of structural similarity may yield more robust
peroxisome assembly and function recovery in a broader range of PBD associated genetic
background.
We have managed to differentiate PBD patient iPSCs into putative oligodendrocyte
precursor cells and hepatocyte-like cells that show peroxisome assembly defects. In vitro
derived patient cell culture that is impossible to obtain otherwise is a good candidate for
studying peroxisomal disorder pathomechanism in specific tissues and screening
therapeutic agents targeting tissue-specific defects in peroxisomal disorders. However, it is
crucial to optimize the differentiation protocol in order to obtain a homogeneous cell
population with higher differentiation efficiency for large scale application. The HepG2
PEX1 mutant cell line we generated are easily maintained and fast growing and thus
provides solid foundation in large scale drug screening and testing.
By demonstrating peroxisomal protein import recovery with AA V9-mediated CMV
promoter-driven human PEX1 protein expression in Pex1-p.G844D mouse skin fibroblast
cells, we showed in principle that these mice with progressing retinal function abnormality
are valuable for evaluating retinal gene therapy. If primary cell lines from the retina can be
obtained and cultured, the RK1 promoter version of AA V9-hPEX1 vector can be evaluated
108

before testing in mouse.
With the successful application of PBD patient-derived cells in large scale
screening of chemical library as well as the establishment and characterization of tissue-
specific cell lineages, we have made improvement in the resources of peroxisomal disorder
model systems. With these progress, we can continue to deepen our knowledge of
peroxisomal function in a cell type specific manner in peroxisomal disorder pathology,
which will provide platforms for novel therapy development and eventually improve the
quality of life of the patients suffering from peroxisomal disorders.

109

BIBLIOGRAPHY
Ahlemeyer, B., Gottwald, M., and Baumgart-V ogt, E. (2012). Deletion of a single allele of the Pex11beta
gene is sufficient to cause oxidative stress, delayed differentiation and neuronal death in mouse brain. Dis
Model Mech 5, 125-140.
Allocca, M., Mussolino, C., Garcia-Hoyos, M., Sanges, D., Iodice, C., Petrillo, M., Vandenberghe, L.H.,
Wilson, J.M., Marigo, V ., Surace, E.M., et al. (2007). Novel adeno-associated virus serotypes efficiently
transduce murine photoreceptors. J Virol 81, 11372-11380.
Anderson, S.P., Yoon, L., Richard, E.B., Dunn, C.S., Cattley, R.C., and Corton, J.C. (2002). Delayed liver
regeneration in peroxisome proliferator-activated receptor-alpha-null mice. Hepatology 36, 544-554.
Arnold, G., and Holtzman, E. (1978). Microperoxisomes in the central nervous system of the postnatal rat.
Brain Res 155, 1-17.
Baes, M., Gressens, P., Baumgart, E., Carmeliet, P., Casteels, M., Fransen, M., Evrard, P., Fahimi, D.,
Declercq, P.E., Collen, D., et al. (1997). A mouse model for Zellweger syndrome. Nat Genet 17, 49-57.
Baes, M., and Van Veldhoven, P.P. (2006). Generalised and conditional inactivation of Pex genes in mice.
Biochim Biophys Acta 1763, 1785-1793.
Baes, M., and Van Veldhoven, P.P. (2012). Mouse models for peroxisome biogenesis defects and beta-
oxidation enzyme deficiencies. Biochim Biophys Acta 1822, 1489-1500.
Bainbridge, J.W., Smith, A.J., Barker, S.S., Robbie, S., Henderson, R., Balaggan, K., Viswanathan, A., Holder,
G.E., Stockman, A., Tyler, N., et al. (2008). Effect of gene therapy on visual function in Leber's congenital
amaurosis. N Engl J Med 358, 2231-2239.
Beaudry, H., Gendron, L., and Moron, J.A. (2015). Implication of delta opioid receptor subtype 2 but not
delta opioid receptor subtype 1 in the development of morphine analgesic tolerance in a rat model of chronic
inflammatory pain. Eur J Neurosci 41, 901--907.
Berendse, K., Ebberink, M.S., Ijlst, L., Poll-The, B.T., Wanders, R.J., and Waterham, H.R. (2013). Arginine
improves peroxisome functioning in cells from patients with a mild peroxisome biogenesis disorder.
Orphanet J Rare Dis 8, 138.
Berger, J., and Gartner, J. (2006). X-linked adrenoleukodystrophy: clinical, biochemical and pathogenetic
aspects. Biochim Biophys Acta 1763, 1721-1732.
Berkovic, S.F., Zajac, J.D., Warburton, D.J., Merory, J.R., Fellenberg, A.J., Poulos, A., and Pollard, A.C.
(1983). Adrenomyeloneuropathy--clinical and biochemical diagnosis. Aust N Z J Med 13, 594-600.
Bezman, L., Moser, A.B., Raymond, G.V ., Rinaldo, P., Watkins, P.A., Smith, K.D., Kass, N.E., and Moser,
H.W. (2001). Adrenoleukodystrophy: incidence, new mutation rate, and results of extended family screening.
Ann Neurol 49, 512-517.
Bjorkhem, I., Sisfontes, L., Bostrom, B., Kase, B.F., and Blomstrand, R. (1986). Simple diagnosis of the
Zellweger syndrome by gas-liquid chromatography of dimethylacetals. J Lipid Res 27, 786-791.
Blok, N.B., Tan, D., Wang, R.Y ., Penczek, P.A., Baker, D., DiMaio, F., Rapoport, T.A., and Walz, T. (2015).
Unique double-ring structure of the peroxisomal Pex1/Pex6 ATPase complex revealed by cryo-electron
microscopy. Proc Natl Acad Sci U S A 112, E4017-4025.
Bottelbergs, A., Verheijden, S., Hulshagen, L., Gutmann, D.H., Goebbels, S., Nave, K.A., Kassmann, C., and
110

Baes, M. (2010). Axonal integrity in the absence of functional peroxisomes from projection neurons and
astrocytes. Glia 58, 1532-1543.
Bottelbergs, A., Verheijden, S., Van Veldhoven, P.P., Just, W., Devos, R., and Baes, M. (2012). Peroxisome
deficiency but not the defect in ether lipid synthesis causes activation of the innate immune system and axonal
loss in the central nervous system. J Neuroinflammation 9, 61.
Boye, S.E., Boye, S.L., Lewin, A.S., and Hauswirth, W.W. (2013). A comprehensive review of retinal gene
therapy. Mol Ther 21, 509-519.
Braverman, N., Steel, G., Lin, P., Moser, A., Moser, H., and Valle, D. (2000). PEX7 gene structure, alternative
transcripts, and evidence for a founder haplotype for the frequent RCDP allele, L292ter. Genomics 63, 181-
192.
Braverman, N., Steel, G., Obie, C., Moser, A., Moser, H., Gould, S.J., and Valle, D. (1997). Human PEX7
encodes the peroxisomal PTS2 receptor and is responsible for rhizomelic chondrodysplasia punctata. Nat
Genet 15, 369-376.
Braverman, N., Zhang, R., Chen, L., Nimmo, G., Scheper, S., Tran, T., Chaudhury, R., Moser, A., and
Steinberg, S. (2010). A Pex7 hypomorphic mouse model for plasmalogen deficiency affecting the lens and
skeleton. Mol Genet Metab 99, 408-416.
Braverman, N.E., D'Agostino, M.D., and Maclean, G.E. (2013). Peroxisome biogenesis disorders: Biological,
clinical and pathophysiological perspectives. Dev Disabil Res Rev 17, 187-196.
Braverman, N.E., Raymond, G.V ., Rizzo, W.B., Moser, A.B., Wilkinson, M.E., Stone, E.M., Steinberg, S.J.,
Wangler, M.F., Rush, E.T., Hacia, J.G., et al. (2016). Peroxisome biogenesis disorders in the Zellweger
spectrum: An overview of current diagnosis, clinical manifestations, and treatment guidelines. Mol Genet
Metab 117, 313-321.
Brites, P., Motley, A.M., Gressens, P., Mooyer, P.A., Ploegaert, I., Everts, V ., Evrard, P., Carmeliet, P.,
Dewerchin, M., Schoonjans, L., et al. (2003). Impaired neuronal migration and endochondral ossification in
Pex7 knockout mice: a model for rhizomelic chondrodysplasia punctata. Hum Mol Genet 12, 2255-2267.
Brites, P., Waterham, H.R., and Wanders, R.J. (2004). Functions and biosynthesis of plasmalogens in health
and disease. Biochim Biophys Acta 1636, 219-231.
Brocard, C., and Hartig, A. (2006). Peroxisome targeting signal 1: is it really a simple tripeptide? Biochim
Biophys Acta 1763, 1565-1573.
Brown, F.R., 3rd, Van Duyn, M.A., Moser, A.B., Schulman, J.D., Rizzo, W.B., Snyder, R.D., Murphy, J.V .,
Kamoshita, S., Migeon, C.J., and Moser, H.W. (1982). Adrenoleukodystrophy: effects of dietary restriction
of very long chain fatty acids and of administration of carnitine and clofibrate on clinical status and plasma
fatty acids. Johns Hopkins Med J 151, 164-172.
Cao, J., Wang, J., Qi, W., Miao, H.H., Wang, J., Ge, L., DeBose-Boyd, R.A., Tang, J.J., Li, B.L., and Song,
B.L. (2007). Ufd1 is a cofactor of gp78 and plays a key role in cholesterol metabolism by regulating the
stability of HMG-CoA reductase. Cell Metab 6, 115-128.
Cearley, C.N., and Wolfe, J.H. (2006). Transduction characteristics of adeno-associated virus vectors
expressing cap serotypes 7, 8, 9, and Rh10 in the mouse brain. Mol Ther 13, 528-537.
Chen, C., Liu, Y ., Rappaport, A.R., Kitzing, T., Schultz, N., Zhao, Z., Shroff, A.S., Dickins, R.A., Vakoc,
C.R., Bradner, J.E., et al. (2014). MLL3 is a haploinsufficient 7q tumor suppressor in acute myeloid leukemia.
Cancer Cell 25, 652-665.
111

Choi, P.S., and Meyerson, M. (2014). Targeted genomic rearrangements using CRISPR/Cas technology. Nat
Commun 5, 3728.
Cideciyan, A.V ., Aleman, T.S., Boye, S.L., Schwartz, S.B., Kaushal, S., Roman, A.J., Pang, J.J., Sumaroka,
A., Windsor, E.A., Wilson, J.M., et al. (2008). Human gene therapy for RPE65 isomerase deficiency activates
the retinoid cycle of vision but with slow rod kinetics. Proc Natl Acad Sci U S A 105, 15112-15117.
Collins, C.S., and Gould, S.J. (1999). Identification of a common PEX1 mutation in Zellweger syndrome.
Hum Mutat 14, 45-53.
Cong, L., Ran, F.A., Cox, D., Lin, S., Barretto, R., Habib, N., Hsu, P.D., Wu, X., Jiang, W., Marraffini, L.A.,
et al. (2013). Multiplex genome engineering using CRISPR/Cas systems. Science 339, 819-823.
Crane, D.I., Maxwell, M.A., and Paton, B.C. (2005). PEX1 mutations in the Zellweger spectrum of the
peroxisome biogenesis disorders. Hum Mutat 26, 167-175.
De Duve, C., and Baudhuin, P. (1966). Peroxisomes (microbodies and related particles). Physiol Rev 46,
323-357.
Deeb, S.S., and Motulsky, A.G. (1993). Red-Green Color Vision Defects. In GeneReviews(R), R.A. Pagon,
M.P. Adam, H.H. Ardinger, S.E. Wallace, A. Amemiya, L.J.H. Bean, T.D. Bird, C.T. Fong, H.C. Mefford,
R.J.H. Smith, et al., eds. (Seattle (WA)).
Deyle, D.R., and Russell, D.W. (2009). Adeno-associated virus vector integration. Curr Opin Mol Ther 11,
442-447.
Dimos, J.T., Rodolfa, K.T., Niakan, K.K., Weisenthal, L.M., Mitsumoto, H., Chung, W., Croft, G.F., Saphier,
G., Leibel, R., Goland, R., et al. (2008). Induced pluripotent stem cells generated from patients with ALS can
be differentiated into motor neurons. Science 321, 1218-1221.
Dirkx, R., Vanhorebeek, I., Martens, K., Schad, A., Grabenbauer, M., Fahimi, D., Declercq, P., Van Veldhoven,
P.P., and Baes, M. (2005). Absence of peroxisomes in mouse hepatocytes causes mitochondrial and ER
abnormalities. Hepatology 41, 868-878.
Dorninger, F., Brodde, A., Braverman, N.E., Moser, A.B., Just, W.W., Forss-Petter, S., Brugger, B., and
Berger, J. (2015). Homeostasis of phospholipids - The level of phosphatidylethanolamine tightly adapts to
changes in ethanolamine plasmalogens. Biochim Biophys Acta 1851, 117-128.
Doudna, J.A., and Charpentier, E. (2014). Genome editing. The new frontier of genome engineering with
CRISPR-Cas9. Science 346, 1258096.
Douvaras, P., Wang, J., Zimmer, M., Hanchuk, S., O'Bara, M.A., Sadiq, S., Sim, F.J., Goldman, J., and Fossati,
V . (2014). Efficient generation of myelinating oligodendrocytes from primary progressive multiple sclerosis
patients by induced pluripotent stem cells. Stem Cell Reports 3, 250-259.
Dranchak, P.K., Di Pietro, E., Snowden, A., Oesch, N., Braverman, N.E., Steinberg, S.J., and Hacia, J.G.
(2011). Nonsense suppressor therapies rescue peroxisome lipid metabolism and assembly in cells from
patients with specific PEX gene mutations. J Cell Biochem 112, 1250-1258.
Duan, Y ., Catana, A., Meng, Y ., Yamamoto, N., He, S., Gupta, S., Gambhir, S.S., and Zern, M.A. (2007).
Differentiation and enrichment of hepatocyte-like cells from human embryonic stem cells in vitro and in vivo.
Stem Cells 25, 3058-3068.
Duan, Y ., Ma, X., Zou, W., Wang, C., Bahbahan, I.S., Ahuja, T.P., Tolstikov, V ., and Zern, M.A. (2010).
Differentiation and characterization of metabolically functioning hepatocytes from human embryonic stem
112

cells. Stem Cells 28, 674-686.
Ebberink, M.S., Koster, J., Visser, G., Spronsen, F., Stolte-Dijkstra, I., Smit, G.P., Fock, J.M., Kemp, S.,
Wanders, R.J., and Waterham, H.R. (2012). A novel defect of peroxisome division due to a homozygous non-
sense mutation in the PEX11beta gene. J Med Genet 49, 307-313.
Ebberink, M.S., Mooijer, P.A., Gootjes, J., Koster, J., Wanders, R.J., and Waterham, H.R. (2011). Genetic
classification and mutational spectrum of more than 600 patients with a Zellweger syndrome spectrum
disorder. Hum Mutat 32, 59-69.
Ebert, A.D., Yu, J., Rose, F.F., Jr., Mattis, V .B., Lorson, C.L., Thomson, J.A., and Svendsen, C.N. (2009).
Induced pluripotent stem cells from a spinal muscular atrophy patient. Nature 457, 277-280.
Ebina, H., Misawa, N., Kanemura, Y ., and Koyanagi, Y . (2013). Harnessing the CRISPR/Cas9 system to
disrupt latent HIV-1 provirus. Sci Rep 3, 2510.
Egawa, N., Kitaoka, S., Tsukita, K., Naitoh, M., Takahashi, K., Yamamoto, T., Adachi, F., Kondo, T., Okita,
K., Asaka, I., et al. (2012). Drug screening for ALS using patient-specific induced pluripotent stem cells. Sci
Transl Med 4, 145ra104.
Fagarasanu, A., Fagarasanu, M., and Rachubinski, R.A. (2007). Maintaining peroxisome populations: a story
of division and inheritance. Annu Rev Cell Dev Biol 23, 321-344.
Faust, P.L., Banka, D., Siriratsivawong, R., Ng, V .G., and Wikander, T.M. (2005). Peroxisome biogenesis
disorders: the role of peroxisomes and metabolic dysfunction in developing brain. J Inherit Metab Dis 28,
369-383.
Faust, P.L., and Hatten, M.E. (1997). Targeted deletion of the PEX2 peroxisome assembly gene in mice
provides a model for Zellweger syndrome, a human neuronal migration disorder. J Cell Biol 139, 1293-1305.
Faust, P.L., Su, H.M., Moser, A., and Moser, H.W. (2001). The peroxisome deficient PEX2 Zellweger mouse:
pathologic and biochemical correlates of lipid dysfunction. J Mol Neurosci 16, 289-297; discussion 317-221.
Fenalti, G., Giguere, P.M., Katritch, V ., Huang, X.P., Thompson, A.A., Cherezov, V ., Roth, B.L., and Stevens,
R.C. (2014). Molecular control of delta-opioid receptor signalling. Nature 506, 191-196.
Foust, K.D., Nurre, E., Montgomery, C.L., Hernandez, A., Chan, C.M., and Kaspar, B.K. (2009).
Intravascular AA V9 preferentially targets neonatal neurons and adult astrocytes. Nat Biotechnol 27, 59-65.
Garbutt, J.C., Greenblatt, A.M., West, S.L., Morgan, L.C., Kampov-Polevoy, A., Jordan, H.S., and Bobashev,
G.V . (2014). Clinical and biological moderators of response to naltrexone in alcohol dependence: a systematic
review of the evidence. Addiction 109, 1274-1284.
Gardner, B.M., Chowdhury, S., Lander, G.C., and Martin, A. (2015). The Pex1/Pex6 complex is a
heterohexameric AAA+ motor with alternating and highly coordinated subunits. J Mol Biol 427, 1375-1388.
Gartner, J., Preuss, N., Brosius, U., and Biermanns, M. (1999). Mutations in PEX1 in peroxisome biogenesis
disorders: G843D and a mild clinical phenotype. J Inherit Metab Dis 22, 311-313.
Geisbrecht, B.V ., Collins, C.S., Reuber, B.E., and Gould, S.J. (1998). Disruption of a PEX1-PEX6 interaction
is the most common cause of the neurologic disorders Zellweger syndrome, neonatal adrenoleukodystrophy,
and infantile Refsum disease. Proc Natl Acad Sci U S A 95, 8630-8635.
Gerets, H.H., Hanon, E., Cornet, M., Dhalluin, S., Depelchin, O., Canning, M., and Atienzar, F.A. (2009).
Selection of cytotoxicity markers for the screening of new chemical entities in a pharmaceutical context: a
113

preliminary study using a multiplexing approach. Toxicol In Vitro 23, 319-332.
Glowniak, J.V ., and Loriaux, D.L. (1997). A double-blind study of perioperative steroid requirements in
secondary adrenal insufficiency. Surgery 121, 123-129.
Goldfischer, S., Moore, C.L., Johnson, A.B., Spiro, A.J., Valsamis, M.P., Wisniewski, H.K., Ritch, R.H.,
Norton, W.T., Rapin, I., and Gartner, L.M. (1973). Peroxisomal and mitochondrial defects in the cerebro-
hepato-renal syndrome. Science 182, 62-64.
Goonoo, N., Bhaw-Luximon, A., Ujoodha, R., Jhugroo, A., Hulse, G.K., and Jhurry, D. (2014). Naltrexone:
a review of existing sustained drug delivery systems and emerging nano-based systems. J Control Release
183, 154-166.
Gootjes, J., Mooijer, P.A., Dekker, C., Barth, P.G., Poll-The, B.T., Waterham, H.R., and Wanders, R.J. (2002).
Biochemical markers predicting survival in peroxisome biogenesis disorders. Neurology 59, 1746-1749.
Gould, S.J., and Valle, D. (2000). Peroxisome biogenesis disorders: genetics and cell biology. Trends Genet
16, 340-345.
Grzmil, M., Huber, R.M., Hess, D., Frank, S., Hynx, D., Moncayo, G., Klein, D., Merlo, A., and Hemmings,
B.A. (2014). MNK1 pathway activity maintains protein synthesis in rapalog-treated gliomas. J Clin Invest
124, 742-754.
Hatch, M.N., Nistor, G., and Keirstead, H.S. (2009). Derivation of high-purity oligodendroglial progenitors.
Methods Mol Biol 549, 59-75.
Hauswirth, W.W., Aleman, T.S., Kaushal, S., Cideciyan, A.V ., Schwartz, S.B., Wang, L., Conlon, T.J., Boye,
S.L., Flotte, T.R., Byrne, B.J., et al. (2008). Treatment of leber congenital amaurosis due to RPE65 mutations
by ocular subretinal injection of adeno-associated virus gene vector: short-term results of a phase I trial. Hum
Gene Ther 19, 979-990.
Heckl, D., Kowalczyk, M.S., Yudovich, D., Belizaire, R., Puram, R.V ., McConkey, M.E., Thielke, A., Aster,
J.C., Regev, A., and Ebert, B.L. (2014). Generation of mouse models of myeloid malignancy with
combinatorial genetic lesions using CRISPR-Cas9 genome editing. Nat Biotechnol 32, 941-946.
Hiebler, S., Masuda, T., Hacia, J.G., Moser, A.B., Faust, P.L., Liu, A., Chowdhury, N., Huang, N., Lauer, A.,
Bennett, J., et al. (2014). The Pex1-G844D mouse: a model for mild human Zellweger spectrum disorder.
Mol Genet Metab 111, 522-532.
Hruban, Z., Gotoh, M., Slesers, A., and Chou, S.F. (1974). Structure of hepatic microbodies in rats treated
with acetylsalicylic acid, clofibrate, and dimethrin. Lab Invest 30, 64-75.
Hsu, P.D., Lander, E.S., and Zhang, F. (2014). Development and applications of CRISPR-Cas9 for genome
engineering. Cell 157, 1262-1278.
Hu, B.Y ., Weick, J.P., Yu, J., Ma, L.X., Zhang, X.Q., Thomson, J.A., and Zhang, S.C. (2010). Neural
differentiation of human induced pluripotent stem cells follows developmental principles but with variable
potency. Proc Natl Acad Sci U S A 107, 4335-4340.
Hu, W., Kaminski, R., Yang, F., Zhang, Y ., Cosentino, L., Li, F., Luo, B., Alvarez-Carbonell, D., Garcia-Mesa,
Y ., Karn, J., et al. (2014). RNA-directed gene editing specifically eradicates latent and prevents new HIV-1
infection. Proc Natl Acad Sci U S A 111, 11461-11466.
Hubbard, W.C., Moser, A.B., Liu, A.C., Jones, R.O., Steinberg, S.J., Lorey, F., Panny, S.R., V ogt, R.F., Jr.,
Macaya, D., Turgeon, C.T., et al. (2009). Newborn screening for X-linked adrenoleukodystrophy (X-ALD):
114

validation of a combined liquid chromatography-tandem mass spectrometric (LC-MS/MS) method. Mol
Genet Metab 97, 212-220.
Hulshagen, L., Krysko, O., Bottelbergs, A., Huyghe, S., Klein, R., Van Veldhoven, P.P., De Deyn, P.P.,
D'Hooge, R., Hartmann, D., and Baes, M. (2008). Absence of functional peroxisomes from mouse CNS
causes dysmyelination and axon degeneration. J Neurosci 28, 4015-4027.
Imamura, A., Tamura, S., Shimozawa, N., Suzuki, Y ., Zhang, Z., Tsukamoto, T., Orii, T., Kondo, N., Osumi,
T., and Fujiki, Y . (1998). Temperature-sensitive mutation in PEX1 moderates the phenotypes of peroxisome
deficiency disorders. Hum Mol Genet 7, 2089-2094.
Irizarry, R.A., Hobbs, B., Collin, F., Beazer-Barclay, Y .D., Antonellis, K.J., Scherf, U., and Speed, T.P. (2003).
Exploration, normalization, and summaries of high density oligonucleotide array probe level data.
Biostatistics 4, 249-264.
Islinger, F., Gekle, M., and Wright, S.H. (2001). Interaction of 2,3-dimercapto-1-propane sulfonate with the
human organic anion transporter hOAT1. J Pharmacol Exp Ther 299, 741-747.
Islinger, M., Cardoso, M.J., and Schrader, M. (2010). Be different--the diversity of peroxisomes in the animal
kingdom. Biochim Biophys Acta 1803, 881-897.
Issemann, I., and Green, S. (1990). Activation of a member of the steroid hormone receptor superfamily by
peroxisome proliferators. Nature 347, 645-650.
Itskovitz-Eldor, J., Schuldiner, M., Karsenti, D., Eden, A., Yanuka, O., Amit, M., Soreq, H., and Benvenisty,
N. (2000). Differentiation of human embryonic stem cells into embryoid bodies compromising the three
embryonic germ layers. Mol Med 6, 88-95.
Izrael, M., Zhang, P., Kaufman, R., Shinder, V ., Ella, R., Amit, M., Itskovitz-Eldor, J., Chebath, J., and Revel,
M. (2007). Human oligodendrocytes derived from embryonic stem cells: Effect of noggin on phenotypic
differentiation in vitro and on myelination in vivo. Mol Cell Neurosci 34, 310-323.
Janssen, A., Gressens, P., Grabenbauer, M., Baumgart, E., Schad, A., Vanhorebeek, I., Brouwers, A., Declercq,
P.E., Fahimi, D., Evrard, P., et al. (2003). Neuronal migration depends on intact peroxisomal function in brain
and in extraneuronal tissues. J Neurosci 23, 9732-9741.
Jia, F., Wilson, K.D., Sun, N., Gupta, D.M., Huang, M., Li, Z., Panetta, N.J., Chen, Z.Y ., Robbins, R.C., Kay,
M.A., et al. (2010). A nonviral minicircle vector for deriving human iPS cells. Nat Methods 7, 197-199.
Karumbayaram, S., Novitch, B.G., Patterson, M., Umbach, J.A., Richter, L., Lindgren, A., Conway, A.E.,
Clark, A.T., Goldman, S.A., Plath, K., et al. (2009). Directed differentiation of human-induced pluripotent
stem cells generates active motor neurons. Stem Cells 27, 806-811.
Kassmann, C.M., Lappe-Siefke, C., Baes, M., Brugger, B., Mildner, A., Werner, H.B., Natt, O., Michaelis,
T., Prinz, M., Frahm, J., et al. (2007). Axonal loss and neuroinflammation caused by peroxisome-deficient
oligodendrocytes. Nat Genet 39, 969-976.
Katayama, K., Masuyama, K., Yoshioka, S., Hasegawa, H., Mitsuhashi, J., and Sugimoto, Y . (2007).
Flavonoids inhibit breast cancer resistance protein-mediated drug resistance: transporter specificity and
structure-activity relationship. Cancer Chemother Pharmacol 60, 789-797.
Kemp, S., and Wanders, R. (2010). Biochemical aspects of X-linked adrenoleukodystrophy. Brain Pathol 20,
831-837.
Kim, D., Kim, C.H., Moon, J.I., Chung, Y .G., Chang, M.Y ., Han, B.S., Ko, S., Yang, E., Cha, K.Y ., Lanza,
115

R., et al. (2009). Generation of human induced pluripotent stem cells by direct delivery of reprogramming
proteins. Cell Stem Cell 4, 472-476.
Klouwer, F.C., Berendse, K., Ferdinandusse, S., Wanders, R.J., Engelen, M., and Poll-The, B.T. (2015).
Zellweger spectrum disorders: clinical overview and management approach. Orphanet J Rare Dis 10, 151.
Kohl, S., Baumann, B., Rosenberg, T., Kellner, U., Lorenz, B., Vadala, M., Jacobson, S.G., and Wissinger, B.
(2002). Mutations in the cone photoreceptor G-protein alpha-subunit gene GNAT2 in patients with
achromatopsia. Am J Hum Genet 71, 422-425.
Krause, C., Rosewich, H., and Gartner, J. (2009). Rational diagnostic strategy for Zellweger syndrome
spectrum patients. Eur J Hum Genet 17, 741-748.
Krysko, O., Hulshagen, L., Janssen, A., Schutz, G., Klein, R., De Bruycker, M., Espeel, M., Gressens, P., and
Baes, M. (2007). Neocortical and cerebellar developmental abnormalities in conditions of selective
elimination of peroxisomes from brain or from liver. J Neurosci Res 85, 58-72.
Kunau, W.H., Dommes, V ., and Schulz, H. (1995). beta-oxidation of fatty acids in mitochondria, peroxisomes,
and bacteria: a century of continued progress. Prog Lipid Res 34, 267-342.
Lazarow, P.B., and Fujiki, Y . (1985). Biogenesis of peroxisomes. Annu Rev Cell Biol 1, 489-530.
Leighton, F., Poole, B., Beaufay, H., Baudhuin, P., Coffey, J.W., Fowler, S., and De Duve, C. (1968). The
large-scale separation of peroxisomes, mitochondria, and lysosomes from the livers of rats injected with triton
WR-1339. Improved isolation procedures, automated analysis, biochemical and morphological properties of
fractions. J Cell Biol 37, 482-513.
Lever, J.R., and Scheffel, U. (1998). Selective in vivo binding of [3H]naltriben to delta-opioid receptors in
mouse brain. Eur J Pharmacol 350, 335-344.
Li, X., Baumgart, E., Dong, G.X., Morrell, J.C., Jimenez-Sanchez, G., Valle, D., Smith, K.D., and Gould, S.J.
(2002a). PEX11alpha is required for peroxisome proliferation in response to 4-phenylbutyrate but is
dispensable for peroxisome proliferator-activated receptor alpha-mediated peroxisome proliferation. Mol
Cell Biol 22, 8226-8240.
Li, X., Baumgart, E., Morrell, J.C., Jimenez-Sanchez, G., Valle, D., and Gould, S.J. (2002b). PEX11 beta
deficiency is lethal and impairs neuronal migration but does not abrogate peroxisome function. Mol Cell Biol
22, 4358-4365.
Li, X., and Gould, S.J. (2002). PEX11 promotes peroxisome division independently of peroxisome
metabolism. J Cell Biol 156, 643-651.
Li, Z., Yang, C.S., Nakashima, K., and Rana, T.M. (2011). Small RNA-mediated regulation of iPS cell
generation. EMBO J 30, 823-834.
Liang, Y .C., Tsai, S.H., Tsai, D.C., Lin-Shiau, S.Y ., and Lin, J.K. (2001). Suppression of inducible
cyclooxygenase and nitric oxide synthase through activation of peroxisome proliferator-activated receptor-
gamma by flavonoids in mouse macrophages. FEBS Lett 496, 12-18.
Lu, H., Chang, D.J., Baratte, B., Meijer, L., and Schulze-Gahmen, U. (2005). Crystal structure of a human
cyclin-dependent kinase 6 complex with a flavonol inhibitor, fisetin. J Med Chem 48, 737-743.
Madan, A., Graham, R.A., Carroll, K.M., Mudra, D.R., Burton, L.A., Krueger, L.A., Downey, A.D.,
Czerwinski, M., Forster, J., Ribadeneira, M.D., et al. (2003). Effects of prototypical microsomal enzyme
inducers on cytochrome P450 expression in cultured human hepatocytes. Drug Metab Dispos 31, 421-431.
116

Maeda, K., Kimura, A., Yamato, Y ., Nittono, H., Takei, H., Sato, T., Mitsubuchi, H., Murai, T., and Kurosawa,
T. (2002). Oral bile Acid treatment in two Japanese patients with Zellweger syndrome. J Pediatr Gastroenterol
Nutr 35, 227-230.
Maguire, A.M., High, K.A., Auricchio, A., Wright, J.F., Pierce, E.A., Testa, F., Mingozzi, F., Bennicelli, J.L.,
Ying, G.S., Rossi, S., et al. (2009). Age-dependent effects of RPE65 gene therapy for Leber's congenital
amaurosis: a phase 1 dose-escalation trial. Lancet 374, 1597-1605.
Mahmood, A., Dubey, P., Moser, H.W., and Moser, A. (2005). X-linked adrenoleukodystrophy: therapeutic
approaches to distinct phenotypes. Pediatr Transplant 9 Suppl 7, 55-62.
Mahmood, A., Raymond, G.V ., Dubey, P., Peters, C., and Moser, H.W. (2007). Survival analysis of
haematopoietic cell transplantation for childhood cerebral X-linked adrenoleukodystrophy: a comparison
study. Lancet Neurol 6, 687-692.
Majewski, J., Wang, Z., Lopez, I., Al Humaid, S., Ren, H., Racine, J., Bazinet, A., Mitchel, G., Braverman,
N., and Koenekoop, R.K. (2011). A new ocular phenotype associated with an unexpected but known systemic
disorder and mutation: novel use of genomic diagnostics and exome sequencing. J Med Genet 48, 593-596.
Maxwell, M., Bjorkman, J., Nguyen, T., Sharp, P., Finnie, J., Paterson, C., Tonks, I., Paton, B.C., Kay, G.F.,
and Crane, D.I. (2003). Pex13 inactivation in the mouse disrupts peroxisome biogenesis and leads to a
Zellweger syndrome phenotype. Mol Cell Biol 23, 5947-5957.
Maxwell, M.A., Nelson, P.V ., Chin, S.J., Paton, B.C., Carey, W.F., and Crane, D.I. (1999). A common PEX1
frameshift mutation in patients with disorders of peroxisome biogenesis correlates with the severe Zellweger
syndrome phenotype. Hum Genet 105, 38-44.
McKenna, O., Arnold, G., and Holtzman, E. (1976). Microperoxisome distribution in the central nervous
system of the rat. Brain Res 117, 181-194.
Miller, R.T., Glover, S.E., Stewart, W.S., Corton, J.C., Popp, J.A., and Cattley, R.C. (1996). Effect on the
expression of c-met, c-myc and PPAR-alpha in liver and liver tumors from rats chronically exposed to the
hepatocarcinogenic peroxisome proliferator WY-14,643. Carcinogenesis 17, 1337-1341.
Mori, S., Wang, L., Takeuchi, T., and Kanda, T. (2004). Two novel adeno-associated viruses from cynomolgus
monkey: pseudotyping characterization of capsid protein. Virology 330, 375-383.
Morita, M., and Imanaka, T. (2012). Peroxisomal ABC transporters: structure, function and role in disease.
Biochim Biophys Acta 1822, 1387-1396.
Moser, A.B., Steinberg, S.J., Watkins, P.A., Moser, H.W., Ramaswamy, K., Siegmund, K.D., Lee, D.R., Ely,
J.J., Ryder, O.A., and Hacia, J.G. (2011). Human and great ape red blood cells differ in plasmalogen levels
and composition. Lipids Health Dis 10, 101.
Moser, H.W. (1991). Peroxisomal disorders. Clin Biochem 24, 343-351.
Motley, A.M., Brites, P., Gerez, L., Hogenhout, E., Haasjes, J., Benne, R., Tabak, H.F., Wanders, R.J., and
Waterham, H.R. (2002). Mutational spectrum in the PEX7 gene and functional analysis of mutant alleles in
78 patients with rhizomelic chondrodysplasia punctata type 1. Am J Hum Genet 70, 612-624.
Muller, C.C., Nguyen, T.H., Ahlemeyer, B., Meshram, M., Santrampurwala, N., Cao, S., Sharp, P., Fietz, P.B.,
Baumgart-V ogt, E., and Crane, D.I. (2011). PEX13 deficiency in mouse brain as a model of Zellweger
syndrome: abnormal cerebellum formation, reactive gliosis and oxidative stress. Dis Model Mech 4, 104-119.
Murakami, A., Yajima, T., Sakuma, H., McLaren, M.J., and Inana, G. (1993). X-arrestin: a new retinal arrestin
117

mapping to the X chromosome. FEBS Lett 334, 203-209.
Nistor, G.I., Totoiu, M.O., Haque, N., Carpenter, M.K., and Keirstead, H.S. (2005). Human embryonic stem
cells differentiate into oligodendrocytes in high purity and myelinate after spinal cord transplantation. Glia
49, 385-396.
Ogawa, S., Tokumoto, Y ., Miyake, J., and Nagamune, T. (2011). Induction of oligodendrocyte differentiation
from adult human fibroblast-derived induced pluripotent stem cells. In Vitro Cell Dev Biol Anim 47, 464-
469.
Park, I.H., Zhao, R., West, J.A., Yabuuchi, A., Huo, H., Ince, T.A., Lerou, P.H., Lensch, M.W., and Daley,
G.Q. (2008). Reprogramming of human somatic cells to pluripotency with defined factors. Nature 451, 141-
146.
Peeters, A., Swinnen, J.V ., Van Veldhoven, P.P., and Baes, M. (2011). Hepatosteatosis in peroxisome deficient
liver despite increased beta-oxidation capacity and impaired lipogenesis. Biochimie 93, 1828-1838.
Pelikan, R.C., Iwata, J., Suzuki, A., Chai, Y ., and Hacia, J.G. (2013). Identification of candidate downstream
targets of TGFbeta signaling during palate development by genome-wide transcript profiling. J Cell Biochem
114, 796-807.
Peters, J.M., Cheung, C., and Gonzalez, F.J. (2005). Peroxisome proliferator-activated receptor-alpha and
liver cancer: where do we stand? J Mol Med (Berl) 83, 774-785.
Piri, N., Gao, Y .Q., Danciger, M., Mendoza, E., Fishman, G.A., and Farber, D.B. (2005). A substitution of G
to C in the cone cGMP-phosphodiesterase gamma subunit gene found in a distinctive form of cone dystrophy.
Ophthalmology 112, 159-166.
Platta, H.W., El Magraoui, F., Baumer, B.E., Schlee, D., Girzalsky, W., and Erdmann, R. (2009). Pex2 and
pex12 function as protein-ubiquitin ligases in peroxisomal protein import. Mol Cell Biol 29, 5505-5516.
Platta, H.W., El Magraoui, F., Schlee, D., Grunau, S., Girzalsky, W., and Erdmann, R. (2007). Ubiquitination
of the peroxisomal import receptor Pex5p is required for its recycling. J Cell Biol 177, 197-204.
Platta, H.W., and Erdmann, R. (2007). Peroxisomal dynamics. Trends Cell Biol 17, 474-484.
Poirier, Y ., Antonenkov, V .D., Glumoff, T., and Hiltunen, J.K. (2006). Peroxisomal beta-oxidation--a
metabolic pathway with multiple functions. Biochim Biophys Acta 1763, 1413-1426.
Poll-The, B.T., and Gartner, J. (2012). Clinical diagnosis, biochemical findings and MRI spectrum of
peroxisomal disorders. Biochim Biophys Acta 1822, 1421-1429.
Poll-The, B.T., Gootjes, J., Duran, M., De Klerk, J.B., Wenniger-Prick, L.J., Admiraal, R.J., Waterham, H.R.,
Wanders, R.J., and Barth, P.G. (2004). Peroxisome biogenesis disorders with prolonged survival: phenotypic
expression in a cohort of 31 patients. Am J Med Genet A 126A, 333-338.
Poretti, A., Blaser, S.I., Lequin, M.H., Fatemi, A., Meoded, A., Northington, F.J., Boltshauser, E., and
Huisman, T.A. (2013). Neonatal neuroimaging findings in inborn errors of metabolism. J Magn Reson
Imaging 37, 294-312.
Portoghese, P.S., Sultana, M., and Takemori, A.E. (1988). Naltrindole, a highly selective and potent non-
peptide delta opioid receptor antagonist. Eur J Pharmacol 146, 185-186.
Pounds, S., and Cheng, C. (2004). Improving false discovery rate estimation. Bioinformatics 20, 1737-1745.
118

Powers, J.M., and Moser, H.W. (1998). Peroxisomal disorders: genotype, phenotype, major neuropathologic
lesions, and pathogenesis. Brain Pathol 8, 101-120.
Prestele, J., Hierl, G., Scherling, C., Hetkamp, S., Schwechheimer, C., Isono, E., Weckwerth, W., Wanner, G.,
and Gietl, C. (2010). Different functions of the C3HC4 zinc RING finger peroxins PEX10, PEX2, and PEX12
in peroxisome formation and matrix protein import. Proc Natl Acad Sci U S A 107, 14915-14920.
Preuss, N., Brosius, U., Biermanns, M., Muntau, A.C., Conzelmann, E., and Gartner, J. (2002). PEX1
mutations in complementation group 1 of Zellweger spectrum patients correlate with severity of disease.
Pediatr Res 51, 706-714.
Purdue, P.E., and Lazarow, P.B. (2001). Peroxisome biogenesis. Annu Rev Cell Dev Biol 17, 701-752.
Raymond, G.V ., Jones, R.O., and Moser, A.B. (2007). Newborn screening for adrenoleukodystrophy:
implications for therapy. Mol Diagn Ther 11, 381-384.
Reddy, J.K., and Rao, M.S. (2006). Lipid metabolism and liver inflammation. II. Fatty liver disease and fatty
acid oxidation. Am J Physiol Gastrointest Liver Physiol 290, G852-858.
Ribeiro, D., Castro, I., Fahimi, H.D., and Schrader, M. (2012). Peroxisome morphology in pathology. Histol
Histopathol 27, 661-676.
Richards, M., Fong, C.Y ., Chan, W.K., Wong, P.C., and Bongso, A. (2002). Human feeders support prolonged
undifferentiated growth of human inner cell masses and embryonic stem cells. Nat Biotechnol 20, 933-936.
Rinaldo, P., Matern, D., and Bennett, M.J. (2002). Fatty acid oxidation disorders. Annu Rev Physiol 64, 477-
502.
Rosewich, H., Ohlenbusch, A., and Gartner, J. (2005). Genetic and clinical aspects of Zellweger spectrum
patients with PEX1 mutations. J Med Genet 42, e58.
Sassa, S., Sugita, O., Galbraith, R.A., and Kappas, A. (1987). Drug metabolism by the human hepatoma cell,
Hep G2. Biochem Biophys Res Commun 143, 52-57.
Schaumburg, H.H., Powers, J.M., Raine, C.S., Spencer, P.S., Griffin, J.W., Prineas, J.W., and Boehme, D.M.
(1977). Adrenomyeloneuropathy: a probable variant of adrenoleukodystrophy. II. General pathologic,
neuropathologic, and biochemical aspects. Neurology 27, 1114-1119.
Schluter, A., Fourcade, S., Domenech-Estevez, E., Gabaldon, T., Huerta-Cepas, J., Berthommier, G., Ripp,
R., Wanders, R.J., Poch, O., and Pujol, A. (2007). PeroxisomeDB: a database for the peroxisomal proteome,
functional genomics and disease. Nucleic Acids Res 35, D815-822.
Schrader, M., and Fahimi, H.D. (2006). Peroxisomes and oxidative stress. Biochim Biophys Acta 1763, 1755-
1766.
Schrader, M., and Fahimi, H.D. (2008). The peroxisome: still a mysterious organelle. Histochem Cell Biol
129, 421-440.
Schwank, G., Koo, B.K., Sasselli, V ., Dekkers, J.F., Heo, I., Demircan, T., Sasaki, N., Boymans, S., Cuppen,
E., van der Ent, C.K., et al. (2013). Functional repair of CFTR by CRISPR/Cas9 in intestinal stem cell
organoids of cystic fibrosis patients. Cell Stem Cell 13, 653-658.
Setchell, K.D., Bragetti, P., Zimmer-Nechemias, L., Daugherty, C., Pelli, M.A., Vaccaro, R., Gentili, G.,
Distrutti, E., Dozzini, G., Morelli, A., et al. (1992). Oral bile acid treatment and the patient with Zellweger
syndrome. Hepatology 15, 198-207.
119

Sexton, J.Z., He, Q., Forsberg, L.J., and Brenman, J.E. (2010). High content screening for non-classical
peroxisome proliferators. Int J High Throughput Screen 2010, 127-140.
Shalem, O., Sanjana, N.E., Hartenian, E., Shi, X., Scott, D.A., Mikkelsen, T.S., Heckl, D., Ebert, B.L., Root,
D.E., Doench, J.G., et al. (2014). Genome-scale CRISPR-Cas9 knockout screening in human cells. Science
343, 84-87.
Sharp, J., Frame, J., Siegenthaler, M., Nistor, G., and Keirstead, H.S. (2010). Human embryonic stem cell-
derived oligodendrocyte progenitor cell transplants improve recovery after cervical spinal cord injury. Stem
Cells 28, 152-163.
Shi, D., Zhan, X., Yu, X., Jia, M., Zhang, Y ., Yao, J., Hu, X., and Bao, Z. (2014). Inhibiting CB1 receptors
improves lipogenesis in an in vitro non-alcoholic fatty liver disease model. Lipids Health Dis 13, 173.
Shimizu-Matsumoto, A., Itoh, K., Inazawa, J., Nishida, K., Matsumoto, Y ., Kinoshita, S., Matsubara, K., and
Okubo, K. (1996). Isolation and chromosomal localization of the human cone cGMP phosphodiesterase
gamma cDNA (PDE6H). Genomics 32, 121-124.
Shimozawa, N. (2007). Molecular and clinical aspects of peroxisomal diseases. J Inherit Metab Dis 30, 193-
197.
Shulman, M., and Nahmias, Y . (2013). Long-term culture and coculture of primary rat and human hepatocytes.
Methods Mol Biol 945, 287-302.
Si-Tayeb, K., Noto, F.K., Nagaoka, M., Li, J., Battle, M.A., Duris, C., North, P.E., Dalton, S., and Duncan,
S.A. (2010). Highly efficient generation of human hepatocyte-like cells from induced pluripotent stem cells.
Hepatology 51, 297-305.
Smyth, G.K. (2004). Linear models and empirical bayes methods for assessing differential expression in
microarray experiments. Stat Appl Genet Mol Biol 3, Article3.
Soldner, F., Hockemeyer, D., Beard, C., Gao, Q., Bell, G.W., Cook, E.G., Hargus, G., Blak, A., Cooper, O.,
Mitalipova, M., et al. (2009). Parkinson's disease patient-derived induced pluripotent stem cells free of viral
reprogramming factors. Cell 136, 964-977.
Song, M., Paul, S., Lim, H., Dayem, A.A., and Cho, S.G. (2012). Induced pluripotent stem cell research: a
revolutionary approach to face the challenges in drug screening. Arch Pharm Res 35, 245-260.
Song, Z., Cai, J., Liu, Y ., Zhao, D., Yong, J., Duo, S., Song, X., Guo, Y ., Zhao, Y ., Qin, H., et al. (2009).
Efficient generation of hepatocyte-like cells from human induced pluripotent stem cells. Cell Res 19, 1233-
1242.
Steinberg, S., Chen, L., Wei, L., Moser, A., Moser, H., Cutting, G., and Braverman, N. (2004). The PEX Gene
Screen: molecular diagnosis of peroxisome biogenesis disorders in the Zellweger syndrome spectrum. Mol
Genet Metab 83, 252-263.
Steinberg, S., Jones, R., Tiffany, C., and Moser, A. (2008). Investigational methods for peroxisomal disorders.
Curr Protoc Hum Genet Chapter 17, Unit 17 16.
Steinberg, S.J., Dodt, G., Raymond, G.V ., Braverman, N.E., Moser, A.B., and Moser, H.W. (2006).
Peroxisome biogenesis disorders. Biochim Biophys Acta 1763, 1733-1748.
Steinberg, S.J., Raymond, G.V., Braverman, N.E., and Moser, A.B. (1993). Peroxisome Biogenesis Disorders,
Zellweger Syndrome Spectrum. In GeneReviews(R), R.A. Pagon, M.P. Adam, H.H. Ardinger, S.E. Wallace,
A. Amemiya, L.J.H. Bean, T.D. Bird, C.T. Fong, H.C. Mefford, R.J.H. Smith, et al., eds. (Seattle (WA)).
120

Swiderski, R.E., Nishimura, D.Y ., Mullins, R.F., Olvera, M.A., Ross, J.L., Huang, J., Stone, E.M., and
Sheffield, V .C. (2007). Gene expression analysis of photoreceptor cell loss in bbs4-knockout mice reveals an
early stress gene response and photoreceptor cell damage. Invest Ophthalmol Vis Sci 48, 3329-3340.
Takahashi, K., Okita, K., Nakagawa, M., and Yamanaka, S. (2007a). Induction of pluripotent stem cells from
fibroblast cultures. Nat Protoc 2, 3081-3089.
Takahashi, K., Tanabe, K., Ohnuki, M., Narita, M., Ichisaka, T., Tomoda, K., and Yamanaka, S. (2007b).
Induction of pluripotent stem cells from adult human fibroblasts by defined factors. Cell 131, 861-872.
Takahashi, K., and Yamanaka, S. (2006). Induction of pluripotent stem cells from mouse embryonic and adult
fibroblast cultures by defined factors. Cell 126, 663-676.
Takayama, K., Inamura, M., Kawabata, K., Katayama, K., Higuchi, M., Tashiro, K., Nonaka, A., Sakurai, F.,
Hayakawa, T., Furue, M.K., et al. (2012). Efficient generation of functional hepatocytes from human
embryonic stem cells and induced pluripotent stem cells by HNF4alpha transduction. Mol Ther 20, 127-137.
Tan, D., Blok, N.B., Rapoport, T.A., and Walz, T. (2016). Structures of the double-ring AAA ATPase Pex1-
Pex6 involved in peroxisome biogenesis. FEBS J 283, 986-992.
Tazuke, S.I., Mazure, N.M., Sugawara, J., Carland, G., Faessen, G.H., Suen, L.F., Irwin, J.C., Powell, D.R.,
Giaccia, A.J., and Giudice, L.C. (1998). Hypoxia stimulates insulin-like growth factor binding protein 1
(IGFBP-1) gene expression in HepG2 cells: a possible model for IGFBP-1 expression in fetal hypoxia. Proc
Natl Acad Sci U S A 95, 10188-10193.
Theda, C., Gibbons, K., Defor, T.E., Donohue, P.K., Golden, W.C., Kline, A.D., Gulamali-Majid, F., Panny,
S.R., Hubbard, W.C., Jones, R.O., et al. (2014). Newborn screening for X-linked adrenoleukodystrophy:
further evidence high throughput screening is feasible. Mol Genet Metab 111, 55-57.
Titorenko, V .I., and Mullen, R.T. (2006). Peroxisome biogenesis: the peroxisomal endomembrane system and
the role of the ER. J Cell Biol 174, 11-17.
Torres, R., Martin, M.C., Garcia, A., Cigudosa, J.C., Ramirez, J.C., and Rodriguez-Perales, S. (2014).
Engineering human tumour-associated chromosomal translocations with the RNA-guided CRISPR-Cas9
system. Nat Commun 5, 3964.
Urban, D.J., Zheng, W., Goker-Alpan, O., Jadhav, A., Lamarca, M.E., Inglese, J., Sidransky, E., and Austin,
C.P. (2008). Optimization and validation of two miniaturized glucocerebrosidase enzyme assays for high
throughput screening. Comb Chem High Throughput Screen 11, 817-824.
Van Ael, E., and Fransen, M. (2006). Targeting signals in peroxisomal membrane proteins. Biochim Biophys
Acta 1763, 1629-1638.
van Geel, B.M., Assies, J., Weverling, G.J., and Barth, P.G. (1994). Predominance of the
adrenomyeloneuropathy phenotype of X-linked adrenoleukodystrophy in The Netherlands: a survey of 30
kindreds. Neurology 44, 2343-2346.
Van Veldhoven, P.P., and Baes, M. (2013). Peroxisome deficient invertebrate and vertebrate animal models.
Front Physiol 4, 335.
V ogel, B.H., Bradley, S.E., Adams, D.J., D'Aco, K., Erbe, R.W., Fong, C., Iglesias, A., Kronn, D., Levy, P.,
Morrissey, M., et al. (2015). Newborn screening for X-linked adrenoleukodystrophy in New York State:
diagnostic protocol, surveillance protocol and treatment guidelines. Mol Genet Metab 114, 599-603.
Walter, C., Gootjes, J., Mooijer, P.A., Portsteffen, H., Klein, C., Waterham, H.R., Barth, P.G., Epplen, J.T.,
121

Kunau, W.H., Wanders, R.J., et al. (2001). Disorders of peroxisome biogenesis due to mutations in PEX1:
phenotypes and PEX1 protein levels. Am J Hum Genet 69, 35-48.
Wanders, R.J. (2004). Metabolic and molecular basis of peroxisomal disorders: a review. Am J Med Genet A
126A, 355-375.
Wanders, R.J., and Waterham, H.R. (2006a). Biochemistry of mammalian peroxisomes revisited. Annu Rev
Biochem 75, 295-332.
Wanders, R.J., and Waterham, H.R. (2006b). Peroxisomal disorders: the single peroxisomal enzyme
deficiencies. Biochim Biophys Acta 1763, 1707-1720.
Wang, X.M., Yik, W.Y ., Zhang, P., Lu, W., Dranchak, P.K., Shibata, D., Steinberg, S.J., and Hacia, J.G. (2012).
The gene expression profiles of induced pluripotent stem cells from individuals with childhood cerebral
adrenoleukodystrophy are consistent with proposed mechanisms of pathogenesis. Stem Cell Res Ther 3, 39.
Wang, X.M., Yik, W.Y ., Zhang, P., Lu, W., Huang, N., Kim, B.R., Shibata, D., Zitting, M., Chow, R.H., Moser,
A.B., et al. (2015). Induced pluripotent stem cell models of Zellweger spectrum disorder show impaired
peroxisome assembly and cell type-specific lipid abnormalities. Stem Cell Res Ther 6, 158.
Wang, Y ., McClelland, M., and Xia, X.Q. (2009). Analyzing microarray data using WebArray. Cold Spring
Harb Protoc 2009, pdb prot5260.
Wolfrum, C., Borrmann, C.M., Borchers, T., and Spener, F. (2001). Fatty acids and hypolipidemic drugs
regulate peroxisome proliferator-activated receptors alpha - and gamma-mediated gene expression via liver
fatty acid binding protein: a signaling path to the nucleus. Proc Natl Acad Sci U S A 98, 2323-2328.
Woltjen, K., Michael, I.P., Mohseni, P., Desai, R., Mileikovsky, M., Hamalainen, R., Cowling, R., Wang, W.,
Liu, P., Gertsenstein, M., et al. (2009). piggyBac transposition reprograms fibroblasts to induced pluripotent
stem cells. Nature 458, 766-770.
Wu, Y ., Liang, D., Wang, Y ., Bai, M., Tang, W., Bao, S., Yan, Z., Li, D., and Li, J. (2013). Correction of a
genetic disease in mouse via use of CRISPR-Cas9. Cell Stem Cell 13, 659-662.
Xue, W., Chen, S., Yin, H., Tammela, T., Papagiannakopoulos, T., Joshi, N.S., Cai, W., Yang, G., Bronson,
R., Crowley, D.G., et al. (2014). CRISPR-mediated direct mutation of cancer genes in the mouse liver. Nature
514, 380-384.
Yi, F., Liu, G.H., and Izpisua Belmonte, J.C. (2012). Human induced pluripotent stem cells derived
hepatocytes: rising promise for disease modeling, drug development and cell therapy. Protein Cell 3, 246-
250.
Yik, W.Y ., Steinberg, S.J., Moser, A.B., Moser, H.W., and Hacia, J.G. (2009). Identification of novel
mutations and sequence variation in the Zellweger syndrome spectrum of peroxisome biogenesis disorders.
Hum Mutat 30, E467-480.
Yu, J., Hu, K., Smuga-Otto, K., Tian, S., Stewart, R., Slukvin, II, and Thomson, J.A. (2009). Human induced
pluripotent stem cells free of vector and transgene sequences. Science 324, 797-801.
Yu, J., V odyanik, M.A., Smuga-Otto, K., Antosiewicz-Bourget, J., Frane, J.L., Tian, S., Nie, J., Jonsdottir,
G.A., Ruotti, V ., Stewart, R., et al. (2007). Induced pluripotent stem cell lines derived from human somatic
cells. Science 318, 1917-1920.
Zellweger, H., Maertens, P., Superneau, D., and Wertelecki, W. (1988). History of the cerebrohepatorenal
syndrome of Zellweger and other peroxisomal disorders. South Med J 81, 357-364.
122

Zhang, P.L., Izrael, M., Ainbinder, E., Ben-Simchon, L., Chebath, J., and Revel, M. (2006). Increased
myelinating capacity of embryonic stem cell derived oligodendrocyte precursors after treatment by
interleukin-6/soluble interleukin-6 receptor fusion protein. Mol Cell Neurosci 31, 387-398.
Zhang, R., Chen, L., Jiralerspong, S., Snowden, A., Steinberg, S., and Braverman, N. (2010). Recovery of
PEX1-Gly843Asp peroxisome dysfunction by small-molecule compounds. Proc Natl Acad Sci U S A 107,
5569-5574.

Abstract (if available)

Abstract Peroxisome biogenesis disorders (PBDs) are a group of genetically heterogeneous rare metabolic diseases caused by defects in peroxins, proteins encoded by PEX genes that function in peroxisome biogenesis. PBDs display an autosomal recessive mode of transmission with an estimated incidence of 1 in 50,000 births in America. Although the genetic basis of PBDs is well understood, there is currently no curative therapy or long-term effective treatment available. ❧ In this dissertation, I described the identification and characterization of small molecules that enhance peroxisome assembly and function in PBD patient cells through high-content screening (HCS) of chemical libraries. Our therapeutic hypothesis is that the rescue of peroxisome assembly and functions will be of therapeutic benefit to individuals with peroxisome biogenesis disorders. We uncovered a novel group of compounds active at the micromolar range that rescued peroxisome functions in patient cells based on cell imaging, biochemical, and protein processing assays. Overall, the novel bioactive small molecules we identified could provide tools for investigating peroxisome biogenesis and novel leads for the development of targeted small molecule therapies, and the new cellular and animal models can be the next generation screening tools to discover and characterize more active compounds. ❧ In addition, I describe the development of new model systems of PBDs, including induced pluripotent stem cells (iPSCs), HepG2 cells and mice. We generated iPSCs from primary skin fibroblasts of PBD patients and differentiated them into central nervous system (CNS) and hepatocyte cell lineages and showed peroxisomal protein defects of the derived cells. We also generated and characterized HepG2 PEX1 mutant cell lines with peroxisome assembly defects. Finally, I also participated in the characterization of the Pex1-p.G844D mouse which is the first mouse model with hypomorphic PEX alleles and thus better disease model for PBD patients with milder clinical features. Gene expression profiling of the murine retina and the recovery of peroxisomal protein import by adeno-associated virus (AAV)-mediated gene expression suggested that the mice can serve as a powerful model system for investigating retinal gene therapy. Overall, These iPSC, iPSC-derived cells, murine model skin fibroblast and HepG2 cells carrying common PEX1 mutations can have future applications for chemical library screening for candidate drugs that directly address the cell type specificity of disease and the nature of the mutations found in the patient population.

Linked assets

University of Southern California Dissertations and Theses

Conceptually similar

PDF

IPS and CNS cell models of peroxisomal disorders

PDF

Developing novel in vitro model systems to investigate therapeutic hypotheses for peroxisome biogenesis disorders

PDF

Characterization of mouse models of peroxisome biogenesis disorders: a study of dental enamel phenotypes

PDF

Development of computational tools to assist high content screening to identify drug therapies for peroxisome biogenesis disorders

PDF

Estimation of carrier frequencies of peroxisomal disorders and deficiencies in global populations

PDF

Exploring stem cell pluripotency through long range chromosome interactions

PDF

An iPSC-based biomarker strategy to identify neuroregenerative responders to allopregnanolone

PDF

The mechanisms of somatic cell reprogramming

PDF

Craniofacial skull joint and temporomandibular joint (TMJ) in homeostasis and disease

PDF

Functional compensation between hematopoietic stem cell clones in vivo

PDF

Genetics and the environment: evaluating the role of noncoding RNA in autism spectrum disorder

PDF

Identification of CBP/FOXM1 as a molecular target in triple negative breast cancer

PDF

A novel screening approach to identify regulators of polycomb-dependent gene silencing

PDF

Interaction of epigenetics and SMAD signaling in stem cells and diseases

PDF

Development of immunotherapy for small cell lung cancer using novel modified antigens

PDF

The splicing error of FOXP1 in type I myotonic dystrophy

PDF

Modeling SynGAP1 truncating mutations in neurodevelopmental disease using iPSC-derived neurons

PDF

Application of genetic association methods in mice to understand phenotypes with a complex etiology

PDF

Improving adeno-associated viral vector for hematopoietic stem cells gene therapy

PDF

Elucidating the functional role of CHD7 associated nuclear PDH complex and other associated proteins on neural crest development

Asset Metadata

Creator Huang, Ning (author)

Core Title Development of targeted therapies for peroxisome biogenesis disorders

School College of Letters, Arts and Sciences

Degree Doctor of Philosophy

Degree Program Molecular Biology

Publication Date 08/03/2018

Defense Date 06/21/2016

Publisher University of Southern California (original), University of Southern California. Libraries (digital)

Tag HepG2 cells,high-content screening,induced pluripotent stem cells,OAI-PMH Harvest,peroxins,peroxisome biogenesis disorders,PEX1,Pex1-p.G844D mouse,small molecules

Format application/pdf (imt)

Language English

Contributor Electronically uploaded by the author (provenance)

Advisor Hacia, Joseph (committee chair), Smith, Andrew (committee member), Stallcup, Michael (committee member)

Creator Email ninghuan@usc.edu

Permanent Link (DOI) https://doi.org/10.25549/usctheses-c40-298640

Unique identifier UC11281244

Identifier etd-HuangNing-4747.pdf (filename),usctheses-c40-298640 (legacy record id)

Legacy Identifier etd-HuangNing-4747.pdf

Dmrecord 298640

Document Type Dissertation

Format application/pdf (imt)

Rights Huang, Ning

Type texts

Source University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Access Conditions The author retains rights to his/her dissertation, thesis or other graduate work according to U.S. copyright law. Electronic access is being provided by the USC Libraries in agreement with the a...

Repository Name University of Southern California Digital Library

Repository Location USC Digital Library, University of Southern California, University Park Campus MC 2810, 3434 South Grand Avenue, 2nd Floor, Los Angeles, California 90089-2810, USA