University of Southern California Dissertations and Theses

The effects of hepatitis C virus infection on host immune response and signaling pathways

(USC Thesis Other)

The effects of hepatitis C virus infection on host immune response and signaling pathways

PDF

Download

Open document

Flip pages

Download a page range

Download transcript

Copy asset link

Request this asset

Transcript (if available)

Content
The Effects of Hepatitis C Virus Infection
On Host Immune Response and Signaling Pathways

By

Stephanie T. Chan

______________________________________________

A Dissertation Presented to the

FACULTY OF THE GRADUATE SCHOOL
UNIVERSITY OF SOUTHERN CALIFORNIA

In Partial Fulfillment of the

Requirements for the Degree

DOCTOR OF PHILOSOPHY
(MEDICAL BIOLOGY)

December 2016
ii

Dedicated to my mother, father and brother for all their love and joy they bought to my life.

iii
ACKNOWLEDGEMENTS
I would like to thank my advisor, Dr. James Ou, with all my heart for all the
guidance, support and patience. I went to him during the worst year during my graduate
studies, where he accepted me into his lab. I would like to thank him gratefully because I did
not lose hope and faith in pursuing my interest in research. Whenever I feel lost with
unsuccessful experiments, he was able to direct me towards the positive direction. During the
last years of my doctoral training was the most important to me and sparked my interest in
research again. I truthfully appreciate his help.
I am also grateful to have two wonderful committee members, Dr. Pinghui Feng and
Dr. Weiming Yuan for their guidance and support. Dr. Pinghui Feng gave numerous
technical suggestions and reagents that greatly accelerated the experiment speed. Dr.
Weiming Yuan provided feedback for my experiments and assisted me to maintain a positive
attitude towards future perspective beyond graduate studies. I appreciate their contributions
to my project and advice during my training.
I would also like to extend my gratitude towards my Ou lab members, friends and
colleagues. My lab members helped me and assisted me with new protocols. They also raise
numerous questions to build my studies into a stronger one. My friends and colleagues
provided many support and discussion. I am grateful for every contribution provided.
Lastly, I really want to acknowledge the core player of my thesis, HCV. Without
HCV being so challenging and intelligent, I would not be able to learn numerous new
techniques and think critically about what is going on. You are a truly remarkable virus that
led me to develop so many faulty hypotheses, but each mistake I made enrich my knowledge
and formed better hypotheses. I am grateful to have HCV as my challenger.
iv
TABLE OF CONTENTS

Dedication …………………………………………………………………….………………ii

Acknowledgements ………………………………………………………….………………iii

List of Figures ………………………………………………………..………………………vi

List of Tables ……………………………………………………….………………………viii

Abstract……………………………………………………………….………………………ix

Chapter 1: Introduction to Hepatitis C Virus …………………………………………………1

The Silent Killer – HCV …………………………………………….…………......…1

The HCV Life Cycle …………………………………………………….……………2

HCV Viral Proteins ……………………………………………………….………..…4

Host Innate Immune Response……………….……………………………………….5

Toll-Like Receptor Pathways…………………………………………………………7
TRAF6, the Critical Mediator of Inflammation……………………………………….9

TNFAIP3/A20, the Feedback Inhibitor of Signaling Pathways…………………........9

HCV Evasion of Host Immune Response……………………………………………10

Chapter 2: Suppression of Host Innate Immune Response by HCV via the Induction of
Autophagic Degradation of TRAF6………………………………………………………….12

Introduction…………………………………………………………………………..12

Results………………………………………………………………………………..14

Suppression of TRAF6 Expression by HCV………………………..……….14

Degradation of TRAF6 by HCV-induced Autophagy…………………….…17

Autophagic Degradation of TRAF6 mediated by p62……………………….23

v
Negative Regulation of HCV Replication by TRAF6……………………….25

TRAF6 supports Cytokine Response in HCV-infected cells…………...……28

Discussion……………………………………………………………………………30

Materials and Methods…………………………………………………………….…34

Chapter 3: The Induction of TNFAIP3 by HCV Infection…………………………………..37

Introduction…………………………………………………………………………..37

Results………………………………………………………………………………..39

HCV Infection induces TNFAIP3 protein levels and mRNA expression…...39

USF-1 binding to ELIE site on TNFAIP3 promoter during HCV
Infection…………………………………………………………...………....42

HCV Infection enhances USF-1 Degradation by ubiquitin proteasome
system………………………..………………………………………………46

Effects of TNFAIP3 on HCV Replication…………………………………...48

NF- B related genes were enhanced after silencing TNFAIP3 during HCV
Infection………………………………….……………….………………….50

Discussion……………………………………………………………………………51

Materials and Methods……………………………………………………………….54

Chapter 4: Concluding Remarks and Future Perspectives…………………………………...57

References……………………………………………………………………………………59

vi
LIST OF FIGURES

Figure 1: The HCV genome and HCV Life Cycle……………………………………………3
Figure 2: The Relationship between HCV Infection and Host Innate Immunity…………..…6
Figure 3: The TLR Signaling Pathway……………………………………………..…………8
Figure 4: Suppression of TRAF6 Expression by HCV……………………………..…..……15
Figure 5: Analysis of Intermediates in TLR Pathway……………………………………….16
Figure 6: Stabilization of TRAF6 in HCV-infected cells by Bafilomycin A1, but not by
MG132……………………………………………………………………………………….18

Figure 7: Colocalization Analysis of TRAF6 and Autophagic Vacuoles in Mock- and HCV-
Infected Cell..………………………………………………………………………...20

Figure 8: Bafilomycin A1 has no effect on TRAF6 mRNA expression. ……………………21
Figure 9: Subgenomic Replicon cells has no effect on TRAF6 protein levels………………22
Figure 10: Analysis of the Interaction between p62 and TRAF6 in HCV-infected
Cells…………………………………………………………………………...……..24
Figure 11: Effects of TRAF6 on HCV Replication……………………………………….…26
Figure 12: TRAF6 overexpression reduces HCV Core Protein while TRAF2 does not….…27
Figure 13: Effects of TRAF6 on the NF-kB promoter and the expression of cytokines in
HCV-infected c………………………………………..…………………………..…29

Figure 14: A Model Illustration of the Relationships among HCV, TRAF6 and p62.........…33
Figure 15: HCV Infection induces TNFAIP3. ………………………………………………39
Figure 16: HCV Infection specifically induces TNFAIP3………..…………………………40
Figure 17: HCV Infection enhances TNFAIP3 as compared to TNFa………………………41
Figure 18: Mutations Introduced to TNFAIP3 Promoter……………………………………42
Figure 19: Analysis of TNFAIP3 promoter …………………………………………...…….43
vii
Figure 20: USF-1 Binding to TNFAIP3 Promoter was Reduced after HCV Infection...……45
Figure 21: HCV infection depletes USF-1 through a post-translational mechanism……..…46
Figure 22: HCV depletes USF-1 through ubiquitin proteasome system. …………………...47
Figure 23: Overexpressing TNFAIP3 does not effect HCV replication. ……………………48
Figure 24: Silencing TNFAIP3 increase HCV viral proteins and HCV RNA. …………......49
Figure 25: Silencing TNFAIP3 increase the expression of TNFa, IL-6 and CXCL10………50

viii
LIST OF TABLES

Table 1: List of RT-qPCR primers used in TRAF6 studies………………………….………36
Tables 2: List of RT-qPCR primers used in TNFAIP3 studies……………………...………56

ix
ABSTRACT

Viral infection triggers various host innate immunity responses and activates signaling
pathways depending on specific pattern recognitions on the virus. These responses act
together to assist the host to eradicate the pathogen, but many viruses have evolved advanced
machinery to overcome these effects and maintain its infection. Hepatitis C virus has adopted
sophisticated mechanism to maintain its replication and persistent infection by restricting the
host response. We found HCV degraded and induced specific mediating proteins to disrupt
the host antiviral response. Tumor necrosis factor receptor-associated factor 6 (TRAF6) is an
important adapter molecule that mediates the TNFR family and interleukin-1/Toll-like
receptor (IL-1/TLR) signaling cascades. In this study, we demonstrated that HCV infection
decreased the TRAF6 level in its host cells through a post-translational mechanism. This
reduction of TRAF6 by HCV was not affected by MG132, a proteasome inhibitor, but it was
abolished by bafilomycin A1, a vacuolar ATPase inhibitor that inhibits the autophagic
protein degradation. Further analysis confirmed the colocalization of TRAF6 with
autophagosomes in HCV-infected cells. The autophagic degradation of TRAF6 was mediated
by p62/SQSMT1, a protein factor important for selective autophagy, as it could bind to
TRAF6 and its silencing prevented HCV from depleting TRAF6. TRAF6 was important for
the activation of NF-κB and the induction of pro-inflammatory cytokines in HCV-infected
cells, and the overexpression of TRAF6 suppressed HCV replication and conversely, the
silencing of TRAF6 enhanced HCV replication. Our results thus indicated that HCV could
disrupt the host innate immune response via the induction of autophagic degradation of
TRAF6 to enhance its replication. We also identified TNFAIP3, a TNFα induced protein, to
be significantly induced after HCV infection. In this study, we analyzed the promoter of
x
TNFAIP3 and found the induction was due to its ELIE site, an elongation inhibitory element.
Further analysis confirmed HCV infection reduces the binding of USF-1, an inhibitory
transcription factor, to ELIE by enhancing the proteasome degradation of USF-1. Because
TNFAIP3 is involved with a signaling feedback loop, we also investigate its effect on HCV
replication. Our overexpression analysis of TNFAIP3 did not determine its role since HCV
viral protein and RNA remained the same. Conversely, the silencing of TNFAIP3 showed
increase protein expression and RNA, which suggests TNFAIP3 to be the negative regulator
during HCV replication. However, additionally studies with NF-κB related inflammatory
cytokines did not provide an explanation to this observation. Taken together, these findings
with TRAF6 and TNFAIP3 studies represented how HCV is a successful virus in
maintaining its infection by limiting host antiviral response in the host through controlling
critical signaling mediators.

1
CHAPTER 1
Introduction to Hepatitis C Virus

The Silent Killer - Hepatitis C Virus
Hepatitis C Virus (HCV) was identified in 1989 after a screening in chimpanzee
serum for a post-transfusion, non-A, non-B hepatitis cause and then classified into the
Flaviviridae family (1). Currently, there are about 170 million people infected with 3 to 4
million new infections worldwide each year (2). Acute HCV infection can remain
asymptomatic for many years, while persistent infection will develop severe liver disease
such as hepatic cirrhosis, fibrosis and hepatocellular carcinoma (3). The current treatment is
pegylated interferon-α with ribavirin or direct acting antiviral (DAA) drugs, which targets
specific viral factors (4, 5). Even though clinical trials proved high success rates in recovery,
the success of the treatment is still based significantly on the host genetic profile and daily
habits (6). The most recent advances proved the success of our research with HCV, but many
steps remained to be discovered.

2
The HCV Life Cycle
HCV is a positive single stranded RNA virus with a 9.6kb genome, which encodes 3
structural proteins and 7 nonstructural proteins (3). The 5’ noncoding region of HCV RNA is
uncapped and contains a 5’ triphosphate, which may contain additional modifications. The 3’
noncoding region contains three domains, a variable region with 2 stem loops, single-
stranded poly U/UC region and a conserved “X” region (7). The HCV life cycle begins with
E1 and E2 anchoring to a host cell-derived double-layer lipid envelope with the core protein
forming a nucleocapsid that encloses the genomic RNA. HCV only infects chimpanzees and
humans and mainly targets hepatocytes through the receptors LDLR, CD81, SR-BI and
claudin-1 (8). HCV enters the cells through clathrin-mediated endocytosis and fuses with
endocytosis into a low pH compartment to release the HCV genome (9, 10). Since HCV
genome lacks a 5’ cap, the initiation of translation depends on its internal ribosome entry site
(IRES) site to recruit ribosomal subunits and eukaryotic initiation factors (eIFs) (11). The
translation process generates a large polypeptide that is cleaved into 10 proteins (3). The
structural proteins and p7 are processed by endoplasmic reticulum signal peptidase, while the
nonstructural proteins are processed with NS2/3, an autoprotease that cleaves at the NS2 and
NS3 junction, or NS3/4A, a serine protease that cleaves downstream sites on the polypeptide
(12). These proteins act together to sustain viral RNA replication and assemble new virion in
infected hepatocytes.

3

Figure 1: The HCV Genome and HCV Life Cycle. (Left) HCV enters hepatocytes through
endocytosis and releases its RNA after fusion with low pH compartment. The translation of
the polypeptide occurs at the ER and cleaved with viral factors or cellular proteins. These
proteins initiate and sustain RNA replication, virus assembly and release to sustain further
viral infection. (Right) HCV genome encodes for 10 proteins, each with a specific function
for HCV infection. The polypeptide is located on the ER. Image adapted from reference 13.

4
HCV Viral Proteins
All nonstructural proteins participate in RNA replication while few also interfere with
cellular functions such as signal transduction and translation. The accumulation of excess
non-structural proteins seems to antagonize host cell innate immunity together, while each
protein also have its specific function (13). NS3/4A complex encodes the DExH/D-box RNA
helicase that unwinds the double-stranded RNA and thought to play a role in initiation of
RNA synthesis (14). It also functions as a serine protease known to cleave MAVS and TRIF
to prevent downstream antiviral response (15, 16). NS4B participates in the replication
complex and recently found to inhibit the maturation of autophagy by inducing Rubicon (17,
18). NS5A is a phosphoprotein where its hyperphosphorylated form correlates with lowered
replication levels and interaction with cellular proteins such as human vesicle-associated
membrane protein A (hVAP-A) (19-21). NS5B is a RNA polymerase that synthesizes the
complementary negative-strand RNA to positive and vice versa (22). Because it is a critical
protein in RNA replication, it became a major target for drug development and proved to be
highly successful with sofosbuvir (23). However, NS5B also lacks proofreading skills and its
error prone transcription at a rate of 1/10
3
bp allows HCV to constantly evolve under stress
from inhibitors (24). In summary, HCV has proved to be remarkably successful in achieving
persistent infection and counteracting our host innate immune system. Newly developed
DAAs can generate over 90% sustained response rate, but there is still much to learn from its
life cycle. It is necessary to understand how HCV interacts with host innate immune response
to further improve our current therapy and reverse infected individuals.

5
Host Innate Immune Response
Interferon is the first line of defense against viral infection and the classic method to
treat various viruses (25). Its expression and secretion is based on retinoic acid-inducible
gene 1-like receptor (RLR) or toll-like receptor (TLR) to recognize pathogen-associated
molecular patterns (PAMPs) (26). Interferon signaling begins through a paracrine mechanism
and binds to the interferon receptor (IFNAR) of neighboring cells (27, 28). This triggers the
dimerization of IFNAR to recruit JAK1 and TYK2 to phosphorylate STAT1 and STAT2
forming a heterodimer (29, 30). The STAT1/2 complex will recruit IRF9 to form the ISGF3
complex and translocate to the nucleus to induce over 300 interferon stimulated genes (ISGs)
(31). Together, these genes block various steps in the viral life cycle and represent the host
antiviral state (32). Nonetheless, successful viruses often develop elaborate mechanisms to
escape the antiviral system by blocking the expression of interferon.
HCV is a ssRNA virus and encodes regions with secondary dsRNA that is recognized
by RIG-I, a DEx/D-box RNA helicase with a caspase activation and recruitment domain
(CARD) (33-35). Once RIG-I binds with dsRNA structure, the two CARD domains open and
localize from the cytosol to mitochondria, where it interacts with MAVS to recruit further
downstream signaling factors to induce interferon secretion and activate transcription factors
(36, 37). TBK1 will phosphorylate IRF3 allowing its dimerization and translocation into the
nucleus (16, 38). IKK complex initiates the degradation of IκB by phosphorylation to release
NF-κB into the nucleus (39). Together, IRF3 and NF-κB act as an enhanceosome and bind to
the promoter of interferon and induce inflammatory cytokines (40). Multiple laboratories in
the field have confirmed these studies.

6

Figure 2: The relationship between HCV Infection and Host Innate Immunity. (a) HCV
dsRNA can be detected by TLR, the TIR dimers and recruits TRIF, MYD88, IRAK, TRAF6.
This will activate NF-κB after IKK complex phosphorylates IκB and IRF3 through TBK1
phosphorylation. (b) HCV RNA is detected by RIG-I, where it interacts with MAVS through
the CARD domain. This interaction recruits TBK1 and IKK complex to activate induce IFNβ
expression. (c) Once IFNβ is produced and secreted, it binds to IFNAR to induce the JAK-
STAT pathway. TYK2 and JAK1 phosphorylates STAT1 and STAT2, allowing them to
dimerize to recruit IRF9, forming the ISGF3 complex. This complex binds and induces ISG
expression through ISRE. Image adapted from reference 28.

7
Toll-Like Receptor Pathways
TLRs are implicated to be secondary innate immune response due to its recognize of
later HCV replication products but it is still not clear how HCV factors may inhibit the TLRs
signaling pathways (41). Recent discoveries demonstrated that HCV RNA is recognized by
TLR3 (dsRNA) and TLR7/8 (ssRNA) and able to activate downstream signaling pathways
(42, 43). Our lab recently reported that HCV infection was detected by TLR7/8 to induce the
production of TNFα (42). This study confirms HCV also activates TLR signaling and may
limit this pathway to prevent cellular response.
TLR signaling is activated once the viral component binds to the corresponding TLR.
This leads to TLR dimerization and binding with Toll-IL-1 receptor domain-containing
adaptor inducing interferon (TRIF) (44). This complex recruits TRAF6, IRAK and MYD88
to phosphorylate TBK1 and IKK. Then, this enhanceosome translocate to activate NFkB to
produce interferon and inflammatory cytokines, similar to the RLR pathway (45). Despite
our understanding of TLR pathways, the relationship between TLR and its effect on HCV
remains to be determined.

8

Figure 3: The TLR Signaling Pathway. TLR signaling is initiated by ligand binding, which
causes the dimerization of receptors. Each receptor binds to specific class of ligands as
indicated. Next, the Toll-IL-1-resistance (TIR) domain recruits MYD88, IRAKs, and
TRAF6. This leads to the activation of NF-κB, AP-1, CREB, IRF3 and IRF7. Together, these
transcription factors activate the production of pro-inflammatory cytokine and/or interferon.
Image adapted from reference 45.

9
TRAF6, the Critical Mediator of Inflammation
TRAF6 is a member of the TNF receptor associated factor protein family (46). It is a
unique factor in its family due to its role in interleukin-1 (IL-1) receptor/Toll-like receptor
(IL-1R/TLR) superfamily(47). TRAF6 is comprised of a C-terminal TRAF domain, N-
terminal zinc-binding domain, and RING finger followed by several zinc fingers (48). These
domains are all essential for downstream signaling and its E3 ubiquitin ligase activity. IRAK
recruits TRAF6 to TAK1-TAB1-TAB2 complex on the membrane to activate IKK and MAP
kinase, which downstream activates NF-κB (49). TRAF6 is known to response to signals
from CD40, TRANCE/TANKL, and TLR pathways. TRAF6-deficient mice also showed
irregular maturation and development in immune cells (50) and also malfunctioning in
response to inflammation (51). This makes TRAF6 a potential target for many viral
infections to restrict host innate immune response.
Many previous studies have reported viral infection causes TRAF6 depletion.
Vesicular stomatitis virus (VSV) depletes TRAF6 to inhibit RIG-I dependent interferon
production (52). Similar results were obtained with Newcastle disease virus infection in
murine fibroblast (53), enterovirus (54), hepatitis B virus (55). With its involvement in
various innate immune response and numerous protein depletion reports by viral infection,
TRAF6 is a likely target for HCV to limit and evade host signaling cascades.

TNFAIP3, the feedback inhibitor in Signaling Pathways
TNFAIP3 is a TNFα induced protein first discovered in human umbilical vein
endothelial cells (HUVEC) and later found to be expressed in various cell types. It is induced
by NF-κB signals, but also restricts its activity once expressed. Thus, TNFAIP3 activity
10
constitutes a negative feedback loop for NF-κB signaling triggered by TLR, NLR, TNFR1,
CD40, and IL-1R (56). TNFAIP3-deficient mice develop lupus and arthritis, which states its
critical role in maintaining inflammatory homeostasis (57) and confirmed with
polymorphism studies in human (58, 59). Physiological functions of TNFAIP3 are mostly
studied in immune cells, but its inhibitory effects are confirmed in other cell types. Because
TNFAIP3 is critical to numerous cells and involve with immune cell activation, it is likely
for pathogen to hijack this factor. By controlling a feedback inhibitory factor of the
inflammatory pathways, HCV infection will have a better chance to maintain persistent
infection.

Evasion of Host Immune Response
HCV has established many strategies to interfere with these pathways and prevent
interferon production, which suggest why some patients are resistance to interferon therapy
leading to chronic infection (60). HCV core protein induces suppressor of cytokine signaling
1 and 3 (SOCS1 and SOCS3), which represses JAK and prevent STAT1 phosphorylation
(61, 62). This restrains the formation of ISGF3 and limit ISG expression. HCV NS3/4a
protease is able to bind to MAVS on the mitochondria and cleave MAVS to dislocate the N-
terminal portion preventing downstream signaling cascades (63). This same protease also
cleaves TRIF to prevent TLR signaling and further limiting the induction of interferon (15).
Other than these specific viral protein inhibitory tactics, HCV also induces cellular
functions such as ER stress and autophagy to combat ISGs. ER stress response leads to
calcium release and upregulates PP2A (64, 65). This decreases the methylation of STAT1
and cause reduced binding to ISRE and ISG production. Autophagy is a cellular response to
11
remove damaged organelles by forming a double-layered vesicle and fusing with lysosome.
The induction of autophagy seems to suppress interferon in the early stage of HCV infection.
But others also report the inhibition of autophagy could induce the expression of ISGs and
IFN (66, 67). These contrary studies may indicate a complicated regulation of between
cytokine production and autophagy.
My thesis will be focusing on how HCV evades host innate immunity response by
dissecting the intermediates in these signaling pathways. TLR signaling pathway seems to be
the secondary defense in HCV detection and host innate immunity response, especially after
RNA translation and replication has started. Its activation induces NF-κB pathways and
secret inflammatory cytokines to nearby cells and thus assisting the host to eradicate the
virus. However, the activation of TLR and intermediates after HCV remains to be poorly
understood. This study is aimed towards understanding the TLR signaling mechanisms after
HCV infection and dissects how HCV may affect the critical mediators in these pathways.

12
CHAPTER 2

Suppression of Host Innate Immune Response by HCV via the Induction of Autophagic
Degradation of TRAF6

Hepatitis C virus (HCV) chronically infects 170 million people worldwide. It is a
hepatotropic virus that can cause progressive inflammation-associated liver diseases to result
in liver failure or hepatocellular carcinoma (68, 69). HCV infection of hepatocytes triggers
various host cellular responses and activates innate immunity signaling pathways, which are
known to assist the host to eradicate the virus (70). However, HCV has also evolved
sophisticated mechanisms to overcome these host responses and even utilize these responses
to maintain its replication and persistent infection (71).
HCV infection is sensed by its host cells, which use pattern recognition receptors
(PRRs) that include RIG-I-like receptors (RLRs) and Toll-like receptors (TLRs) to recognize
pathogen-associated molecular patterns (PAMPs) associated with HCV RNAs or proteins
(26, 42, 72-75). Upon the activation of TLRs, their cytosolic Toll/interleukin-1 receptor
domain (TIR) will interact with downstream adaptor proteins to activate NF-κB and IRF3,
which then stimulate a variety of host innate immune responses including the production of
pro-inflammatory cytokines and interferons (76, 77). Indeed, TLR7 and TLR9 agonists have
been shown to reduce HCV viral load in patients (78, 79). Polymorphisms of the TLR4 gene
also affect the downstream signaling of TLR4 and are also associated with chronic HCV
infection (80-82). These observations indicated the importance of PRRs in the control of
HCV infection.
Autophagy is also a type of cellular innate immune responses that can remove
intracellular microbial pathogens. It begins with the appearance of membrane crescents
13
known as phagophores or isolation membranes, which will grow to sequester part of the
cytoplasm to form enclosed double-membrane vesicles known as autophagosomes.
Autophagosomes mature by fusing with lysosomes to form autolysosomes, in which the
cargoes of autophagosomes are digested (83). HCV infection can induce the autophagic
response and temporally regulate the maturation of autophagosomes in its host cells (17).
Rather than suppressing HCV replication, autophagy induced by HCV on the contrary
enhances HCV replication (84, 85).
In this report, we studied the interplay between HCV and the innate immune response
of its host cells. We found that HCV could deplete TRAF6 via autophagy to suppress the
induction of cytokines. TRAF6 belongs to the tumor necrosis factor receptor-associated
factor (TRAF) family and participates in interleukin-1 receptor and TLR signaling. It is an
important factor that mediates the activation of NF-κB after TLR is activated. Our further
studies indicated that TRAF6 negatively regulated HCV replication and thus provided an
additional explanation to how autophagy enhances HCV replication.

14
Results

Suppression of TRAF6 expression by HCV
To study how HCV might interfere with the innate immune response of its host cells, we
examined the possible effect of HCV on TRAF6, an important mediator of the TLR signaling
pathway. We infected Huh7 cells, a human hepatoma cell line, with a cell culture-adapted
HCV JFH1 variant (86), and analyzed the protein level of TRAF6 at different time points
after infection. As shown in Figure 4A, the TRAF6 protein level was not significantly
affected by HCV at 24 hours post-infection, but it was significantly reduced at 48 hours and
became undetectable at 72 hours. In contrast, TRAF2, another member of the TRAF family,
was not affected by HCV at any time point. When the TRAF6 mRNA was analyzed by real-
time RT-PCR, no significant difference of TRAF6 mRNA levels was detected at different
time points (Figure 4B). As a positive control, we also measured the HCV RNA levels,
which increased and reached the peak at 36 hours post-infection. These results indicated that
HCV likely suppressed the expression of TRAF6 via a post-translational mechanism.

15

Figure 4. Suppression of TRAF6 expression by HCV. Huh7 cells were infected with HCV
at the multiplicity of infection (MOI) of 1. At 3 hours post-infection, the inoculum was
removed and cells were incubated in fresh media. Cells were harvested at the time points
indicated for immunoblot analysis (A) or for real-time RT-PCR analysis for TRAF6 mRNA
(B) or HCV RNA 9C). In (B), the TRAF6 mRNA level in mock-infected cells was
arbitrarily defined as 1. The results shown in (B) and (C) represent the average of at least
three independent experiments.

16

Figure 5: Analysis of intermediates in TLR pathway. Huh7 cells were infected with HCV
and harvested at indicated times. Cells were collected for either protein analysis using
western blotting or mRNA analysis using RT-qPCR.

17
To ensure this degradation was specific, we also investigated other critical intermediates in
the common TLR signaling pathway. We infected Huh7 cells and analyzed the protein levels
and mRNA expression of MYD88, IRAK1, and IRAK4. After TLR activation, MYD88
recruits IRAK1 and IRAK4, which gets phosphorylated and then recruit TRAF6.
Interestingly, MYD88 protein levels and mRNA expression increased after HCV infection.
IRAK1 and IRAK4 protein also increased while mRNA levels remained the same (Figure 5).
Taken together, other critical mediators did not get degraded after HCV infection. Thus,
HCV specifically reduce TRAF6 levels.

Degradation of TRAF6 by HCV-induced autophagy
To determine the mechanism that might be responsible for the depletion of TRAF6 by HCV,
we treated HCV-infected cells with MG132, which inhibits the proteolytic activity of the 26S
proteasome. As shown in Figure 6A, the treatment of cells with 5 or 10 µM of MG132
increased the TRAF6 protein level in mock-infected cells, but it did not restore the protein
level of TRAF6 in HCV-infected cells. In contrast, MG132 increased the level of HIF-1α, a
protein degraded by proteasome, in both mock-infected cells and HCV-infected cells. These
results indicated that TRAF6 was unlikely degraded by proteasome in HCV-infected cells.
As the peak time points of TRAF6 loss (i.e., 48 and 72 hours post-infection) coincided with
the peak activity of autophagic protein degradation induced by HCV (17), we tested the
possible effect of autophagy in the reduction of TRAF6 by treating cells with bafilomycin
A1, a vacuolar ATPase inhibitor that inhibits the autophagic protein degradation. As shown
in Figure 2B, bafilomycin A1 increased the LC3-II and the p62 protein levels in both mock-
infected and HCV-infected cells. LC3 is the microtubule-associated protein light chain 3. It is
18
lipidated during autophagy and its lipidation is required for the formation of
autophagosomes. The lipidated LC3 (i.e., LC3-II) is delipidated and released back into the
cytosol for recycling after the maturation of autophagosomes or it may be digested in
autolysosomes if it resides in the inner membrane of autophagosomes (87). The p62/SQSTM
protein is degraded by autophagy. The increase of the protein levels of LC3-II and p62 was
consistent with the inhibitory activity of bafilomycin A1 on the maturation of
autophagosomes. Interestingly, as also shown in Figure 6B, although bafilomycin A1 had no
effect on the TRAF6 protein level in mock-infected cells, it partially restored the TRAF6
protein level in HCV-infected cells at 48 hours post-infection. These results suggested that
TRAF6 might be degraded by autophagy in HCV-infected cells.

Figure 6. Stabilization of TRAF6 in HCV-infected cells by bafilomycin A1 but not by
MG132. Huh7 cells were infected with HCV for 24 hours and then treated with 5 or 10 µM
MG132 dissolved in DMSO for 16 hours (A) or with 100 nM bafilomycin A1 (bafiloA1) for
24 hours (B). Cells were then lysed for immunoblot analysis.
19
To further test this possibility, we conducted confocal microscopy to examine the possible
co-localization of TRAF6 with autophagosomes. Huh7 cells stably expressing the GFP-LC3
fusion protein were infected with HCV or mock-infected. As shown in Figure 7A, TRAF6 in
mock-infected cells displayed a diffused staining pattern in the whole cell, in agreement with
the previous reports (88, 89). Few autophagic vacuoles (i.e., GFP-LC3 puncta) could be
detected in mock-infected cells. The TRAF6 signal became largely undetectable in HCV-
infected cells at 48 hours post-infection, also in agreement with the results shown in Figure
1A. In these HCV-infected cells, GFP-LC3 puncta became apparent, confirming the previous
reports that HCV could induce autophagic vacuoles (17). In mock-infected cells treated with
bafilomycin A1, TRAF6 signals in the cytoplasm became punctate, suggesting the possible
aggregation of TRAF6 or its association with cellular organelles. In these cells, GFP-LC3
puncta also became apparent due to the inhibition of the maturation of autophagosomes,
leading to their accumulation. Approximately 30% of TRAF6 was found to colocalize with
GFP-LC3 puncta in these cells (Figure 7B). This percentage was statistically insignificant
from that observed in mock-infected cells not treated with bafiloymycin A1. In HCV-
infected cells that were treated with bafilomycin A1, the TRAF6 signals were partially
restored, and approximately 80% of them colocalized with GFP-LC3 puncta. The association
of TRAF6 with autophagic puncta is consistent with the degradation of TRAF6 by HCV-
induced autophagy.
20

Figure 7. Colocalization analysis of TRAF6 and autophagic vacuoles in mock- and
HCV-infected cells. (A) Huh7-GFP-LC3 cells were mock-infected or infected with HCV for
24 hours and then treated with either DMSO or Bafilomycin A1 for 24 hours. TRAF6 (red)
and the HCV core protein (blue) were then immunostained for confocal microscopy. The
scale bar is 20 µm with the exception of that in the enlarged image, which is 10 µm. (B)
Percentage of TRAF6 colocalized with GFP-LC3 puncta. The results represent the mean ±
SEM of >30 cells analyzed.

21

To ensure Bafilomycin A1 did not have any direct effects with TRAF6 expression and HCV
infection, we performed additional analysis. We measured the mRNA expression level of
TRAF6 after infection and Bafilomycin A1 treatment and found no significant change. HCV
RNA copy number was slightly reduced after Bafilomycin A1 treatment. This is consistent
with other studies since HCV replication requires autophagy. In addition, HCV infected cells
treated with Bafilomycin A1 rescues TRAF6 protein levels, which may lead to the reduction
of HCV. Bafilomycin A1 did not have any direct effects on TRAF6 expression.

Figure 8: Bafilomycin A1 has no effect on TRAF6 mRNA expression. Huh7 cells were
infected with HCV for 24 hours and subject to 100nM of Bafilomycin A1 or DMSO
treatment for 24 hours. Cells were collected and RNA was extracted for RT-qPCR analysis.
The relative expression was calculated by normalizing to GAPDH.
22
To confirm TRAF6 degradation is through HCV-induced autophagy, we utilized a stable
Huh7 cells containing HCV Con1 subgenomic RNA replicon to investigate TRAF6 levels.
As shown in Figure X, TRAF6 protein levels in Huh7 and replicon cells are the same. This is
consistent with previous findings that demonstrates the maturation of autophagosomes in
replicon cells are inefficient (17). Taken together, TRAF6 cannot be degraded by
autophagosomes in replicon cells, leading to its accumulation.

Figure 9: Subgenomic replicon cells has no effect on TRAF6 protein levels. (A) Huh7
cells and Huh7 cells containing HCV Con1 subgenomic RNA replicon were collected and
subjected to protein analysis using western blot.

23
Autophagic degradation of TRAF6 mediated by p62/SQSTM1
To further investigate how TRAF6 was targeted to autophagic vacuoles for degradation, we
performed the siRNA knockdown experiment to analyze the role of p62/SQSTM1, which
could bind to TRAF6 to mediate the activation of NF-κB and also interact with LC3 to target
ubiquitinated proteins to autophagosomes for degradation (90-92). As shown in Fig. 10A, the
treatment of Huh7 cells with the control siRNA had no effect on the depletion of TRAF6 by
HCV at 48 hours after infection. However, the treatment of Huh7 cells with the p62 siRNA,
which significantly inhibited the expression of p62, prevented HCV from depleting TRAF6
at 48 hours post-infection. These results indicated an important role of p62 in mediating the
depletion of TRAF6 induced by HCV. To determine whether p62 could also bind to TRAF6
in HCV-infected cells, we conducted the co-immunoprecipitation experiments. Huh7 cells
were infected with HCV and immunoprecipitated with either the control antibody or the anti-
p62 antibody followed by immunoblot analysis using the anti-TRAF6 antibody. As shown in
Figure 10B, TRAF6 could be co-immunoprecipitated with p62 in mock-infected cells,
indicating that these two proteins could bind to each other. This interaction was enhanced by
HCV and this enhancement was highly prominent at 48 hours post-infection when the input
TRAF6 protein levels prior to co-immunoprecipitation were reduced. This enhanced binding
between TRAF6 and p62 at 48 hours post-infection was confirmed by the treatment of Huh7
cells with bafilomycin A1, which stabilized TRAF6. As also shown in Figure 10B, the
stabilization of TRAF6 at 48 hours post-infection increased the level of TRAF6 that was co-
immunoprecipitated with p62. These results together provided a strong support to the
argument that TRAF6 was recruited by p62 to autophagic vacuoles for degradation in HCV-
infected cells.
24

Figure 10. Analysis of the interaction between p62 and TRAF6 in HCV-infected cells.
(A) Huh7 cells were transfected with the control siRNA or the p62 siRNA twice on
consecutive days and then infected with HCV for 24 or 48 hours using an MOI of 1. Cells
were then lysed for immunoblot analysis. (B) Huh7 cells were infected with HCV and then
treated with DMSO or Bafilomycin A1 for 24 hours. The total HCV infection time was either
24 or 48 hours. Cells were then lysed and immunoprecipitated with either the control IgG or
the anti-p62 antibody followed by immunoblot analysis using the anti-TRAF6 antibody (top
panel). The total cell lysates were also used for immunoblot to serve as the input control.

25
Negative regulation of HCV replication by TRAF6
The depletion of TRAF6 by HCV prompted us to investigate the possible effect of TRAF6
on HCV replication. We transfected a plasmid that expressed the Flag-tagged TRAF6 into
Huh7 cells and then infected the cells with HCV for either 24 or 48 hours. The same as the
endogenous TRAF6, the protein level of Flag-tagged TRAF6 was not affected by HCV at 24
hours post-infection but it was significantly reduced by HCV after 48 hours of infection
(Figure 11A). As the expression of Flag-tagged TRAF6 was driven by the EF1α promoter,
this result further supported the notion that the depletion of TRAF6 by HCV was mediated
by a post-translational mechanism. This expression of Flag-tagged TRAF6 reduced the HCV
core protein level at both 24 and 48-hour time points (Figure 11A) and significantly reduced
the HCV RNA levels in cells (Figure 11B), indicating that TRAF6 suppressed the HCV
replication. To confirm this finding, we performed the siRNA knockdown experiment. Huh7
cells were transfected with either the control siRNA or the TRAF6 siRNA and then infected
with HCV for 24 or 48 hours. As shown in Figure 11C-E, the suppression of TRAF6
expression increased HCV core protein and RNA levels and the amount of progeny virus
released into the incubation media, confirming that TRAF6 is a negative regulator of HCV
replication.

26

Figure 11: Effects of TRAF6 on HCV replication. (A) Huh7 cells were transfected with
the control vector or the plasmid that expressed the Flag-tagged TRAF6 for 24 and then
mock-infected or infected with HCV for 24 hours (left panels) or 48 hours (right panels). Cell
lysates were then collected for immunoblot analysis. (B) Huh7 cells infected by HCV as
mentioned in (A) were lysed for quantification of HCV RNA using real-time RT-PCR. The
HCV RNA levels were normalized against GAPDH RNA. (C-E) Huh7 cells were transfected
twice with the control siRNA or the TRAF6 siRNA and then infected with HCV for 24 or 48
hours with an MOI of 1. Cells were then lysed for immunoblot analysis (C), or real-time RT-
PCR analysis for quantification of HCV RNA. The incubation media were also harvested at
24 and 48 hours for titration of infectious HCV particles using the focus-formation assay as
previously described (93). *, p< 0.05; **, p< 0.005.
27
To ensure the specificity of TRAF6 effect on HCV replication, we also analyzed TRAF2, a
highly homologous protein with TRAF6. In Figure 12, we analyzed the core protein levels
after the overexpression of TRAF6 and TRAF2. TRAF6 overexpression was able to reduce
HCV protein levels, while TRAF2 did not. This indicates the negative regulation on HCV by
TRAF6 is specific.

Figure 12: TRAF6 overexpression reduces HCV core protein while TRAF2 does not.
Huh7 cells were transfected with Flag-tagged TRAF6, Flag-tagged TRAF2 and empty
plasmid for 24 hours followed by 48 hour HCV infection at MOI of 1. Protein lysates were
analyzed using western blotting with indicated antibodies.

28
TRAF6 supports cytokine response in HCV-infected cells
HCV infection can activate NF-κB and induce the expression of cytokines (42, 94, 95).
TRAF6 is an important mediator for the activation of NF-κB and the expression of pro-
inflammatory cytokines (46, 96-98). To determine whether TRAF6 is also important for the
activation of NF-κB and the expression of pro-inflammatory cytokines in HCV-infected cells,
we first analyzed the effect of TRAF6 on the NF-κB promoter by transfecting Huh7 cells
with either a control siRNA or the TRAF6 siRNA and a firefly luciferase reporter construct
linked to the NF-κB promoter. Cells were then infected with HCV for 24 or 48 hours. As
shown in Figure 6A, similar to our previous report (42), HCV infection could activate the
NF-κB promoter, but this activation was abolished when the expression of TRAF6 was
suppressed. We then analyzed the effect of TRAF6 knockdown on the expression of IL-6 and
TNF-α, two pro-inflammatory cytokines. Similarly, HCV could induce the expression of IL-
6 and TNF-α, but this induction was abolished and reduced below the basal level when the
expression of TRAF6 was suppressed (Figure 13B and 13C). As our previous studies
indicated that TNF-α could suppress HCV replication, these results provided an explanation
to how TRAF6 suppressed HCV replication.

29

Figure 13: Effects of TRAF6 on the NF-κB promoter and the expression of cytokines in
HCV-infected cells. (A) Huh7 cells were transfected with the NF-κB-luciferase reporter and
either the control siRNA or the TRAF6 siRNA for 24 hours. The CMV-renilla luciferase
reporter was also used for co-transfection to monitor the transfection efficiencies. Cells were
then infected with HCV for 24 hours or 48 hours and then lysed for measuring the luciferase
activities using the dual luciferase assay kit (Promega). The results represent the mean ±
SEM of two independent experiments. (B) Huh7 cells transfected with the control siRNA or
the TRAF6 siRNA were infected with HCV for 24 or 48 hours. Cells were then lysed for
quantification of IL-6 (left) or TNF-α mRNAs using real-timed RT-PCR. The levels of IL-6
and TNF-α mRNAs of mock-infected cells transfected with the control siRNA was arbitrarily
defined as 1.

30
Discussion
HCV infection can trigger a variety of innate immune responses in its host cells.
These responses include the activation of RIG-I, which recognizes the polyU motif in the 3’
untranslated region of the HCV genome (99), MDA5 (100), which is another member of the
RLR family, the double-stranded RNA-dependent kinase PKR (101), TLR3 (102), TLR7 and
TLR8 (42). The activation of these PRRs can lead to the activation of their downstream
signaling pathways and the production of interferons and pro-inflammatory cytokines to
suppress HCV replication. However, HCV has also developed mechanisms to suppress the
host innate immune responses. For example, the HCV NS3/4A protease can cleave MAVS,
the downstream adaptor molecule of RIG-I, to suppress the induction of interferons (63). It
can also cleave TRIF, another signaling adaptor protein, to disrupt the signaling of TLR3
(103), which senses double-stranded RNA. In this report, we identified TRAF6 as another
factor that is targeted by HCV for degradation. TRAF6 is an important molecule that
mediates the signaling pathways of TLRs and the activation of NF-κB for the expression of
antiviral cytokines. We found that TRAF6 was depleted by HCV via a post-translational
mechanism in a time-dependent manner. This mechanism was independent of proteasomes,
as the depletion of TRAF6 by HCV could not be abolished by the proteasome inhibitor
MG132. However, it was dependent on autophagy, as it could be inhibited by bafilomycin
A1, which inhibits the maturation of autophagosomes and the autophagic protein
degradation, and it was found to colocalize with autophagosomes when its degradation was
suppressed by bafilomycin. Our further analysis indicated that the depletion of TRAF6 by
HCV was dependent on p62, which could bind to TRAF6. p62 contains an LC3-interacting
region (LIR) and can bind to LC3. It also contains an ubiquitin-associated domain and can
31
bind to ubiquitinated proteins. Due to these dual activities, p62 can target ubiquitinated
protein aggregates and organelles to autophagic vacuoles for removal and plays a very
important role in mediating selective autophagy. It is conceivable that HCV uses the same
pathway and the ability of TRAF6 to bind to p62 to deplete TRAF6, which led to suppression
of the NF-κB promoter and the expression of pro-inflammatory cytokines, and the
enhancement of HCV replication. A model illustrating how HCV uses the autophagic
pathway to deplete TRAF6 and the activation of NF-κB is shown in Figure 14.
Autophagy can be stimulated by the infection of microbial pathogens and used by the
host cells to remove intracellular pathogens including viruses in a process known as
xenophagy (104). It has been very well demonstrated that HCV could also induce autophagy,
although similar to a number of RNA viruses (105), this induction of autophagy enhances
rather than suppresses HCV replication (85). Our recent studies indicated that HCV could
temporally regulate the maturation of autophagosomes. It stimulated the autophagic response
of its host cells but suppressed the maturation of autophagosomes in the early time points of
infection. This suppression of autophagosomal maturation allows autophagosomes to
accumulate in cells, which is beneficial to HCV replication, as HCV could use
autophagosomal membranes for its RNA replication. HCV allows the autophagosomes to
mature and fuse with lysosomes in the later stage of infection, likely because the importance
of autophagosomes for its RNA replication diminishes in the later stage of infection either
due to the shift of the stage of the life cycle from RNA replication to the assembly of progeny
viral particles or the extensive reorganization of cellular membranes such as the appearance
of smaller double-membrane vesicles that were found to also support HCV RNA replication
(106). Our studies presented in this report indicated that the maturation of autophagosomes in
32
the later stage of infection was also important for HCV, as it allowed HCV to deplete this
TRAF6 to suppress the host innate immune response to favor HCV persistence. Cleary, HCV
has developed sophisticated mechanisms to control the host autophagic response to enhance
its replication.

33

Figure 14. A model illustration of the relationships among HCV, TRAF6 and p62. TLR
signaling is mediated by TRAF6, which activates NF-κB to induce the expression of antiviral
cytokines. HCV infection could induce autophagic degradation of TRAF6 via p62, leading to
the disruption of TLR signaling and the enhancement of HCV replication.

34
Materials and Methods
Cells and viruses
Huh7 cells, a human hepatoma cell line, was maintained in Dulbecco’s modified essential
medium (DMEM) supplemented with 10% FBS, penicillin (10,000 IU/mL), amphotericin
(25 µg/mL), streptomycin (10,000 µg/mL), and nonessential amino acids (0.1 mM). Huh7
cell that stably expressed the GFP-LC3 fusion protein had been previously described
(reference).

Plasmid and siRNAs
The Flag-tagged TRAF6 expression plasmid was constructed by inserting the Flag-tagged
TRAF6 coding sequence into the pEF-Myc/His Version C vector (Life Technologies). The
siRNAs targeting TRAF6 and p62 were purchased from Sigma and transfected with
Lipofectamine RNAiMax.

Confocal immunofluorescence microscopy
Huh7-GFP-LC3 cells were plated on glass slides for 24 hours and then infected with HCV.
The cells were fixed with 3.7% of formaldehyde in phosphate-buffered saline (PBS) for 10
minutes, permeabilized with 0.02% Triton X-100 in PBS for 10 minutes, and blocked with
PBS containing 5% BSA for 1 hour. Immunofluorescence assays were performed using the
mouse anti-TRAF6 (1:100) and rabbit anti-HCV core (1:500) primary antibodies in PBS
containing 3% BSA for 1 hour, followed by incubation with Alexa-Flor 594, 405-conjugated
secondary antibodies (?). The slides were mounted with 70% glycerol in PBS. All images
were taken with Carl Zeiss LSM 510 confocal system at the Cell and Tissue Imaging Core of
35
University of Southern California Research Center for Liver Diseases. All images were
analyzed with Zen Black Edition lite, version 2009.

Immunoblot analysis
All cell samples were lysed in modified radioimmunoprecipitation assay buffer [150 mM
NaCl, 0.5% sodium deoxycholate, 10 mM Tris (pH 7.5), 1% Triton X-100] supplemented
with the complete protease inhibitor cocktail (Roche). After cells were lysed, protein samples
were subjected to electrophoresis in an SDS/PAGE gel; transferred to PVDF membrane and
blocked with PBS containing 5% nonfat milk for 1 hour. Membranes were incubated
overnight at 4
o
C or 1 hour at room temperature with the antibodies.

Gene expression analysis and the reporter assay
RNA was extracted using Qiagen RNeasy Kit. Real-time quantitative PCR was conducted
using the SYBR green-based one step RT-PCR method (Applied Biosciences). Relative RNA
levels were determined after normalization against the GAPDH RNA. The analysis of the
NF-κB promoter was conducted using the firefly luciferase reporter in the plasmid pGL3-NF-
κB. The plasmid containing the renilla luciferase linked to the CMV promoter was used for
the co-transfection to monitor the transfection efficiency. The luciferase activities were
measured using the Dual Luciferase Reporter Assay (Promega) according to the
manufacturer’s protocol. The firefly luciferase activities were normalized against the renilla
luciferase activities.

36

Table 1: List of RT-qPCR primers used in TRAF6 studies.

Gene Primer Sequence

GAPDH F ACAACTTTGGTATCGTGGAAGG
GAPDH R GCCATCACGCCACAGTTTC

TNFa F ATCAATCGGCCCGACTATCTC
TNFa R GCAATGATCCCAAAGTAGACCTG

IL-6 F ACTCACCTCTTCAGAACGAATTG
IL-6 R CCATCTTTGGAAGGTTCAGGTTG

TRAF6 F TTTGCTCTTATGGATTGTCCCC
TRAF6 R CATTGATGCAGCACAGTTGTC

MYD88 F GGCTGCTCTCAACATGCGA
MYD88 R CTGTGTCCGCACGTTCAAGA

IRAK1 F TGAGGAACACGGTGTATGCTG
IRAK1 R GTTTGGGTGACGAAACCTGGA

IRAK4 F CCTGACTCCTCAAGTCCAGAA
IRAK4 R ACAGAAATGGGTCGTTCATCAAA

37
CHAPTER 3
The Induction of TNFAIP3 by HCV Infection
Hepatitis C Virus infection causes severe liver disease, including hepatic cirrhosis and
eventually hepatocellular carcinoma. Even though infection triggers the host innate immunity
response, HCV still manages to escape, which leads to chronic infection in 80% of the
patients. This is most likely due to a dysregulation in signaling pathways that disrupts the
activation of inflammatory cytokines and genes needed to suppress the virus. HCV has
adopted multiple mechanisms to restrict host detection and response to maintain persistent
infection.
Innate immune responses are characterized by multiple transcription factors like IRF3
and NF-κB, which leads to the quick induction of various inflammation or antiviral genes to
combat pathogen invasion. At the same time, the host must regulate these pathways carefully
to prevent excessive activation through feedback inhibition. Because these mechanisms exist,
many viruses have adapted to disrupt these pathways to enhance their replication. TNFAIP3
is a TNFα induced protein that acts as a feedback inhibition to restrict NF-κB activation (56).
Epstein-Barr virus and influenza A virus have shown to induce TNFAIP3 upon infection
(107, 108). Recent studies have shown that HCV infected patients have increase amounts of
TNFAIP3 in their myeloid dendritic cells and macrophages, which impaired the anti-viral
response from immune cells (109, 110). These results provided an explanation to how HCV
infection causes inhibitory effects in the overall host immune cells, but the mechanism is still
poorly understood.
HCV mainly infects hepatocytes and their signaling pathways are critical to maintain
proper interaction with immune cells to eradicate HCV. After the host detects HCV infection,
38
various pathways are induced leading to the production of various cytokines (111). Our lab
has recently found TNFα to be secreted after HCV infection through TLR7/8 detection in
hepatocytes (42). This strongly suggests that TNFAIP3 may also be induced to dysregulate
NF-κB-related signaling cascades. In this report, we investigated the role of TNFAIP3 and its
promoter activity after HCV infection to further understand the induction of TNFAIP3 in
hepatocytes.

39
RESULTS
HCV Infection induces TNFAIP3 protein levels and mRNA expression.
To examine the induction TNFAIP3 after HCV infection, we performed a time-course
experiment with HCV infection and analyzed the protein levels and mRNA expression. Huh7
cells were plates and infected for 3 hours at a MOI of 1 and samples were collected for
protein or mRNA analysis. Both mRNA expression and protein levels were significantly
induced after HCV infection (Figure 15). This is consistent with previous screenings using
HCV core expressing stable cell line and patient samples (109, 112). Our results
demonstrated that TNFAIP3 induction is also in hepatocytes, which is the main site of HCV
infection.

Figure 15: HCV infection induces TNFAIP3. Huh7 cells were infected with HCV for 16,
24, 36, 48, and 72 hours. Samples were collected and separated for (A) protein analysis using
40
western blotting or (B) mRNA analysis using RT-qPCR. Each sample was measured in
triplicates and normalized against GAPDH RNA.
Our lab has previously shown that HCV infection causes TNFα induction, so we wanted to
confirm whether TNFAIP3 induction was specific. We measured the relative expression of
other TNFα induced proteins after HCV infection for 24 and 48 hours. We found that all
proteins were induced around 24 hours, which is likely due to HCV induced TNFα
production, but only TNFAIP3 maintained the induction and was significantly increased by
50-fold (Figure 16). Our previous results showed HCV infection produce about 120 pg/mL of
TNFα. Thus, we treated Huh7 cells with 100ng/mL of TNFα, about 1000 times more
compared to TNFa produced after HCV infection measured in Huh7 cells, to stimulate the
induction of TNFAIP3 and only found a 12-fold induction (Figure 17). Taken together, the
induction of TNFAIP3 is specific to HCV infection and not only due to HCV induced TNFα
production.

Figure 16: HCV infection specifically induces TNFAIP3. Huh7 cells were infected with
HCV for 24 ad 48 hours at MOI of 1. RNA was extracted from the cells and analyzed for the
41
expression using RT-qPCR. Each sample was done in triplicates and normalized against
GAPDH RNA.

Figure 17: HCV infection enhances TNFAIP3 expression as compared to TNFa. Huh7
cells were either treated with 100ng/mL of TNFa for 8 and 24 hours or infected with HCV
for 48 hours. Each sample was collected for RNA extraction. RT-qPCR was used to measure
the relative levels of TNFAIP3 normalized against GAPDH RNA.

42
USF-1 binding to ELIE site on TNFAIP3 promoter during HCV Infection
To identify how HCV infection induces TNFAIP3, we analyzed the promoter using
TNFAIP3 native promoter sequence (-240 to -10) fused to luciferase gene. We confirmed
that HCV infection activate the TNFAIP3 promoter. To further dissect the factors on the
promoter, we introduced mutations to the NFκB binding site (mNFkB) and ELIE binding site
(mELIE), an elongation inhibitory element. We hypothesized mutations in NFκB will abolish
the TNFAIP3 induction, but surprisingly, mutations in NFκB only reduced induction by half
while mutations in ELIE almost completely abolished the induction (Figure 19). These
results demonstrate that HCV induction of TNFAIP3 is not through NFκB and through a
binding factor on the ELIE region. Together, HCV induces TNFAIP3 through a pathway
other than NFκB activation.

Figure 18: Mutations introduced to TNFAIP3 promoter. A schematic representation of
the TNFAIP3 promoter to show the elongation inhibitory element (ELIE) and two NFkB
binding sites are indicated. Mutations were introduced as shown to prevent binding on NFkB
site (mNFkB) and ELIE site (mELIE). Dashed lines represent no change while nucleotides
mutated are shown.

43

Figure 19: Analysis of TNFAIP3 promoter. Huh7 cells were plated and transfected with
pGL3-WT, mNFkB, or mELIE reporter plasmids fused with luciferase and pCMV-renilla for
24 hours. Cells were infected with HCV at MOI of 0.5 and 1 for 48 hours and then lysed for
measuring luciferase activity using dual luciferase assay kit (Promega). Each measurement
was done in triplicate and normalized against renilla activity to calculate relative luciferase
units (RLU). The results represent the mean ± SEM of two independent experiments.

44
To further test how HCV regulates the TNFAIP3 promoter via ELIE, we examined USF-1, a
known upstream transcription factor. USF-1 binds to ELIE to recruit DSIF (SPT4/SPT5) to
inhibit the elongation of RNA polymerase II on the TNFAIP3 promoter. To confirm the
binding of USF-1 in Huh7 cells, we performed chromatin immunoprecipitation. Our results
indicated that USF-1 binds to TNFAIP3 promoter and this binding is reduced after HCV
infection for 48 hours (Figure 20). Anti-H3 was used as a positive control. Interestingly,
HCV infection does not alter SPT5 binding to the promoter, which indicates USF-1 binding
to play a more significant role in TNFAIP3 induction.

45

Figure 20: USF-1 binding to TNFAIP3 promoter was reduced after HCV infection.
Huh7 cells were either mock-infected or infected with HCV at MOI of 1 for 24 hours. Cells
were counted and fixed with formaldehyde for ChIP analysis. Indicated antibodies were
rocked overnight with samples and pulled-down with protein A beads. IgG and H3 was used
as a negative and positive control respectively. The immunoprecipiated DNA was analyzed
by PCR. ImageJ was used to quantify the bands and normalized to input amount.

46
HCV Infection enhances USF-1 Degradation by ubiquitin proteasome system.
Because USF-1 binding decreased after HCV infection, we were curious how HCV infection
affected USF-1. We measured the protein levels of USF-1 and found HCV infection
decreases USF-1 (Figure 21A), while the mRNA level remained the same (Figure 21B).
Thus, the reduction of USF-1 binding to TNFAIP3 promoter may be due to the reduction of
USF-1 protein levels.

Figure 21: HCV infection depletes USF-1 through a post-translational mechanism.
Huh7 cells were infected with HCV for 24, 48 and 72 hours at MOI of 1. (A) Protein lysates
were collected and subjected to western blotting analysis. (B) RNA was extracted for USF-1
mRNA analysis using RT-qPCR. Samples were done in triplicates and normalized to
GAPDH RNA.

47
To examine how USF-1 is degraded via a post-translational mechanism since the mRNA
expression remains the same while the protein levels are reduced. We tested the effects of
MG-132, a proteasome inhibitor, after HCV infection. Our results demonstrated that USF-1
was restored after MG-132 treatment during HCV infection and TNFAIP3 induction was also
abolished (Figure 22). This further confirms the direct correlation between USF-1 and
TNFAIP3 induction. MG-132 treatment alone also enhanced the levels of USF-1, which
implies that basal levels of USF-1 is also degraded through ubiquitin proteasome pathway.
Taken together, HCV infection enhanced the proteasome pathways to degrade USF-1, which
leads to the further activation of TNFAIP3.

Figure 22: HCV depletes USF-1 through ubiquitin proteasome system. Huh7 cells were
either mock-infected or infected with HCV at MOI of 1 for 36 hours followed by 12 hours of
DMSO or MG132 (10uM) for a total of 48 hours post infection. Protein lysates were
subjected to western blotting with indicated antibodies.
48
Effects of TNFAIP3 on HCV Replication
HCV infection induces TNFAIP3 led us to investigate the role of TNFAIP3 during HCV
replication. We overexpressed TNFAIP3 and found HCV viral protein and RNA copy
number similar to the control plasmid expression (Figure 23). Since HCV infection induces
TNFAIP3 significantly, the similarity may be due to the saturation of TNFAIP3 expression in
Huh7 cells. Thus, no significant change in HCV replication was observed. Because of this,
we silenced TNFAIP3 by transfecting Huh7 cells with siTNFAIP3 and siControl followed by
infection for 24 and 48 hours. We found HCV core protein expression was significantly
increase and consistent with HCV RNA copy number (Figure 24). These finding implicate
that TNFAIP3 may be a negative regulator of HCV replication.

Figure 23: Overexpressing TNFAIP3 does not effect HCV replication. Huh7 cells were
transfected with V5-tagged TNFAIP3 or empty plasmid followed by mock-infection or HCV
infection for 24 and 48 hours. Samples were separated for protein analysis with western
blotting or mRNA measurement using RT-qPCR.

49

Figure 24: Silencing TNFAIP3 increase HCV viral proteins and HCV RNA. Huh7 cells
were transfected with siControl or siTNFAIP3 twice followed with mock-infection or HCV
infection for 24 to 48 hours. Samples were collected and separated for protein analysis by
western blotting or mRNA measurements using RT-qPCR.

50
NF-κB related genes were enhanced after silencing TNFAIP3 during HCV Infection.
TNFAIP3 is known to block NFκB pathways and thus reduce the inflammatory cytokine
production. We measured the relative mRNA expression of TNFα, IL-6 and CXCL10, three
inflammatory-related genes that contains NF-κB binding sites in its promoter. Our results
show the silencing TNFAIP3 will increase the production of inflammatory cytokines (Figure
25). Thus, the negative regulation of HCV replication is not due to the increase in cytokine
production.

Figure 25: Silencing TNFAIP3 increase the expression of TNFa, IL-6 and CXCL10.
Silencing TNFAIP3 increase HCV viral proteins and HCV RNA. Huh7 cells were
transfected with siControl or siTNFAIP3 twice followed with mock-infection or HCV
infection for 24 to 48 hours. RNA extraction was done with RNasy Kit (Qiagen) and
subjected to RT-qPCR analysis. Each sample was done in triplicates and normalized to
GAPDH RNA.
51
DISCUSSION
TNFAIP3 is a newly identified negative regulator of NFκB-related activation and plays a
critical role in regulating host innate immune response. To date, no studies have examined
the role of TNFAIP3 in hepatocytes after HCV infection or how HCV causes the induction of
TNFAIP3. In this study, we confirmed HCV infection induced TNFAIP3 protein levels and
mRNA expression in hepatocytes. Because HCV infection produces TNFα, we ensured that
TNFAIP3 induction was not a general trend and HCV infection further stimulates TNFAIP3
compared to TNFα alone. We dissected the promoter of TNFAIP3 and found the activation is
not only due to NFκB, but more significantly due to the ELIE site. USF-1 was previously
identified to cooperate with DSIF (SPT4/SPT5) to inhibit RNA polymerase II on the ELIE
site. Given that ELIE negatively regulates TNFAIP3 activity, it is likely that HCV will
disrupt these factors. Our ChIP results showed the lost of USF-1 did not dissociate DSIF
from TNFAIP3 promoter, which suggest the binding of USF-1 and DSIF together is required
to inhibit the elongation step. Next, we examined how USF-1 binding was reduced and found
USF-1 was degraded after HCV infection through a post-translational mechanism. The lost
of USF-1 was rescued using MG-132, a proteasome inhibitor, after HCV infection. Since
MG-132 treatment alone also increased USF-1, it is likely that HCV infection enhanced the
degradation of USF-1 via ubiquitin proteasome pathways through a mechanism that is yet to
be determined. Nonetheless, HCV infection induces TNFAIP3 by degrading USF-1 to reduce
its binding on the ELIE site in the TNFAIP3 promoter.
Previous studies have shown that TNFAIP3 negatively regulates innate immune
response during chronic HCV infection in dendritic cells collected from patients. However,
the role of TNFAIP3 in hepatocytes was not examined, which covers 80% of all cells in the
52
liver. The immune responses by hepatocytes are critical to the recruitment and activation of
other immune cells, such as kuffper cells, natural killer cells, and dendritic cells. We
investigated the role of TNFAIP3 during HCV infection in hepatocytes. Our overexpression
studies found no change in HCV viral proteins and RNA copies. Because HCV infection
induces TNFAIP3, further expression of TNFAIP3 may not trigger any differences and
without NFkB activation, it cannot enact its inhibitory effects. Silencing TNFAIP3 reduced
HCV core protein levels and RNA copy number, which suggest that HCV replication is
impaired. We also investigated the expression of TNFa and IL-6, two inflammatory cytokine,
after HCV infection and silencing of TNFAIP3. As expected, silencing TNFAIP3, an
inhibitor of NFKB, will increase the expression of these cytokines. However, this did not
provide an explanation to how HCV replication was impaired after the lost of TNFAIP3. One
possibility is that the lost of TNFAIP3 may alter the cytokine profile expression in
hepatocytes. Previous reports suggested the silencing of TNFAIP3 reduced IL-10, while
inducing IL-12, despite their similar promoter elements (109). These changes are significant
to the interaction between immune cells and hepatocytes and become very complicated to
study. Alternatively, the lost of TNFAIP3 may contribute to excessive inflammatory
response as suggested with increased levels of TNFa and IL-6, which prevents the detailed
study of its function. Many studies have implied the difficulty to define disease phenotype
after reducing TNFAIP3 expression due its collaboration with other genes and environmental
factors (56).
In conclusion, this study demonstrates that the HCV infection induces TNFAIP3 by
degrading an inhibitory transcription factor, USF-1. This presents the mechanism on how
TNFAIP3 is induced in hepatocytes. While the role of TNFAIP3 function after HCV
53
infection is not clearly understood, our results suggest TNFAIP3 to be a negative regulator
during HCV infection, but the mechanisms are yet to be discovered. This study may help to
clarify how HCV cause dysregulation in hepatocytes by disrupting critical feedback loops
that may be the cause to hepatitis. Further investigations should reveal how this complex
regulator functions during HCV infection and provide new insights to reversing liver
inflammation.

54
Materials and Methods
Cells and viruses
Huh7 cells, a human hepatoma cell line, was maintained in Dulbecco’s modified essential
medium (DMEM) supplemented with 10% FBS, penicillin (10,000 IU/mL), amphotericin
(25 µg/mL), streptomycin (10,000 µg/mL), and nonessential amino acids (0.1 mM). Stable
Huh7 cells that contained the HCV Con1 subgenomic RNA replicon has been described
(113).

Plasmid and siRNAs
The V5-tagged A20 expression plasmid was a gift from Dr. Pinghui Feng. The siRNAs
targeting A20 were purchased from Sigma and transfected with Lipofectamine RNAiMax.

Immunoblot analysis
All cell samples were lysed in modified radioimmunoprecipitation assay buffer [150 mM
NaCl, 0.5% sodium deoxycholate, 10 mM Tris (pH 7.5), 1% Triton X-100] supplemented
with the complete protease inhibitor cocktail (Roche). After cells were lysed, protein samples
were subjected to electrophoresis in an SDS/PAGE gel; transferred to PVDF membrane and
blocked with PBS containing 5% nonfat milk for 1 hour. Membranes were incubated
overnight at 4
o
C or 1 hour at room temperature with the antibodies.

Electrophoretic Mobility Shift Assay (EMSA)
DNA probe was biotinylated with kit (Thermo). Nuclear extracts were prepared using Abcam
Nuclear Extraction kit. Binding reactions were performed using EMSA kit supplemented
55
with 50mM KCl and 1mM EDTA (Thermo). Samples were incubated at room temperature
for 10 mins and nucleotides were added for an additional 10 mins. DNA-protein complexes
were resolved using nondenaturing polyacrylamide gels; transferred to a positive nylon
membrane and crosslinked with UV for 10 mins.

Chromatin Immunoprecipitation Assay (ChIP)
Cells were collected and counted for 4 x 10
6
cells per sample and fixed with formaldehyde
for 10 mins at room temperature followed by glycine. Cell were lysed with Abcam buffers
with protease inhibitor and sonicated for 1 min in ice for 5 times. About 15% was saved for
input and then each sample was equally separated into 4 tubes (~1 x 10
6
cells each). Each
tube was rocked overnight with 2 ug of anti-H3, anti-USF-1, anti-SPT5, and IgG. Then,
protein A beads where added and rocked for an additional 2 hours. Reverse cross-link was
performed with DNA slurry (Abcam Kit) with proteinase K incubation for 30 mins at 55°
and 10 mins in 98° followed by centrifugation. PCR was performed using Promega GoTaq
mix for 30 cycles and analyzed using gel electrophoresis in a 2% agarose gel. The primers
used were CAGCCCGACCCAGAGAGTCAC (forward) and CTCCGGGCCCCGCGATCC
(reverse) with a gene produce size around 300bp. Quantification measurements were
performed with ImageJ normalized to input arbitrary units.

Gene expression analysis and the reporter assay
RNA was extracted using Qiagen RNeasy Kit. Real-time quantitative PCR was conducted
using the SYBR green-based one step RT-PCR method (Applied Biosciences). Relative RNA
levels were determined after normalization against the GAPDH RNA. The analysis of the
56
A20 promoter was conducted using the firefly luciferase reporter in the plasmid pGL3-A20,
pGL3-A20-m1 and pGL3-A20_mNFkB. The plasmid containing the renilla luciferase linked
to the CMV promoter was used for the co-transfection to monitor the transfection efficiency.
The luciferase activities were measured using the Dual Luciferase Reporter Assay (Promega)
according to the manufacturer’s protocol. The firefly luciferase activities were normalized
against the renilla luciferase activities.

Table 2: List of RT-qPCR primers used in TNFAIP3 studies.
Gene Primer Sequence

GAPDH F ACAACTTTGGTATCGTGGAAGG
GAPDH R GCCATCACGCCACAGTTTC

TNFAIP1 F ACCTCCGAGATGACACCATCA
TNFAIP1 R GGCACTCTGGCACATATTCAC

TNFAIP2 F GGCCAATGTGAGGGAGTTGAT
TNFAIP2 R CCCGCTTTATCTGTGAGCCC

TNFAIP3 F TCCTCAGGCTTTGTATTTGAGC
TNFAIP3 R TGTGTATCGGTGCATGGTTTTA

USF-1 F TCCCAGACTGCTCTATGGAGA
USF-1 R CGGTGGTTACTCTGCCGAAG

HCV 3'UTR F CGGGAGAGCCATAGTGG
HCV 3'UTR R AGTACCACAAGGCCTTTCG

TNFa F ATCAATCGGCCCGACTATCTC
TNFa R GCAATGATCCCAAAGTAGACCTG

IL-6 F ACTCACCTCTTCAGAACGAATTG
IL-6 R CCATCTTTGGAAGGTTCAGGTTG

CXCL10 F GTGGCATTCAAGGAGTACCTC
CXCL10 R TGATGGCCTTCGATTCTGGATT
57
CHAPTER 4
Concluding Remarks and Future Perspectives
My thesis focuses on the importance of host innate immune response and TLR
signaling pathway during HCV infection. It is clear that HCV must restrict the antiviral
signaling response after host detection to maintain its propagation. This work was conducted
to decipher how HCV infection evades the host innate immune response and NF-κB
activation through two factors, TRAF6 and TNFAIP3. These two molecules provided new
insights to how HCV evade critical host innate immunity responses, which leads to
dysregulation of signaling cascades in the liver.
TRAF6 is a critical mediator to TLR signaling pathways after detection of HCV. My
studies found HCV depletes TRAF6 through an autophagy degradation mechanism mediated
by p62. This provides an explanation why HCV infection initiates autophagy, but regulates it
maturation. Autophagy is necessary for HCV replication, but it also wants to utilize this
cellular function to degrade anti-viral mediators, leading to this complex relationship. While
the degradation of TRAF6 through autophagy by p62 is understood, how HCV boost the
interaction between TRAF6 and p62 remains to be discovered. TRAF6 was demonstrated to
negatively regulate HCV replication by reducing NFkB activation and related inflammatory
cytokine production. This explains why HCV depletes TRAF6 to enhance its own
replication. This study can be further improved by dissecting how inflammatory cytokines
causes hepatitis and the role of other immune cells in response to the HCV depletion of
TRAF6. Taken together, this work revealed a new perspective of HCV-mediated autophagy
and how it assists HCV replication by degrading host factors.
58
The second part of my work consists of understanding how HCV infection induces
TNFAIP3, a potent inhibitor of NF-kB activation. Many studies found TNFAIP3 to be
induced after HCV infection, but how the induction mechanism was unknown. My
investigation demonstrated that TNFAIP3 protein and mRNA expression was enhanced after
HCV infection by depleting an inhibitory transcription factor, USF-1, through ubiquitin
proteasome system. Further investigations can be conducted by understanding how HCV
infection enhanced proteasome activity to degrade USF-1, which is still poorly understood in
this field. In addition, my studies found the lost of TNFAIP3 to enhanced HCV replication
while the overexpression had no effect. My further analysis in cytokine production did not
provide a clear mechanism to explain this phenotype. Further studies are necessary to
understand how TNFAIP3 functions during HCV infection by dissecting the signaling
pathways and gene profile. In summary, this research revealed the induction of an inhibitory
regulator, TNFAIP3, which may potentially used to limit host innate immunity response and
impact the homeostasis in the liver.
HCV is a truly remarkable virus with over 25 years of discovery and many questions
still remain to be unanswered. We have constantly developed new therapeutics that tackles
individual viral proteins, but we still cannot fully understand its life cycle and its adaptations
to the human liver. This present study addressed questions on how HCV is able to control
critical signaling pathways and redirect cellular activity in favor of its replication. It is
interesting to observe HCV depleting specific proteins to re-establish new instructions to
cellular functions, which restricts host innate immune response to eradicate HCV. This battle
between HCV and humans will continue until we completely dissect each step HCV takes to
fight the host.
59
REFERENCES:

1. Choo QL, Kuo G, Weiner AJ, Overby LR, Bradley DW, Houghton M. Isolation of a
cDNA clone derived from a blood-borne non-A, non-B viral hepatitis genome. Science.
1989;244(4902):359-62. PubMed PMID: 2523562.
2. Hutin Y, Kitler ME, Dore GJ, Perz JF, Armstrong GL, Dusheiko G, Ishibashi H,
Grob P, Kew M, Marcellin P, Seeff LB, Beutels P, Nelson C, Stein C, Zurn P, Clifford G,
Vranckx R, Alberti A, Hallaj ZS, Hadler S, Lavanchy D, Working GBHC. Global burden of
disease (GBD) for hepatitis C. Journal of clinical pharmacology. 2004;44(1):20-9. doi:
10.1177/0091270003258669. PubMed PMID: WOS:000187428700002.
3. Moradpour D, Penin F, Rice CM. Replication of hepatitis C virus. Nature Reviews
Microbiology. 2007;5(6):453-63. doi: 10.1038/nrmicro1645. PubMed PMID:
WOS:000246603700014.
4. Wang CS, Ko HH, Yoshida EM, Marra CA, Richardson K. Interferon-based
combination anti-viral therapy for hepatitis C virus after liver transplantation: a review and
quantitative analysis. Am J Transplant. 2006;6(7):1586-99. doi: 10.1111/j.1600-
6143.2006.01362.x. PubMed PMID: 16827859.
5. Sadler MD, Lee SS. Revolution in hepatitis C antiviral therapy. Br Med Bull.
2015;113(1):31-44. doi: 10.1093/bmb/ldv004. PubMed PMID: 25680808.
6. Yee BE, Nguyen NH, Jin M, Lutchman G, Lim JK, Nguyen MH. Lower response to
simeprevir and sofosbuvir in HCV genotype 1 in routine practice compared with clinical
trials. BMJ Open Gastroenterol. 2016;3(1):e000056. doi: 10.1136/bmjgast-2015-000056.
PubMed PMID: 26966547; PMCID: PMC4780041.
7. Horner SM, Gale M, Jr. Intracellular innate immune cascades and interferon defenses
that control hepatitis C virus. Journal of interferon & cytokine research : the official journal
of the International Society for Interferon and Cytokine Research. 2009;29(9):489-98. doi:
10.1089/jir.2009.0063. PubMed PMID: 19708811; PMCID: PMC2956657.
8. Su AI, Pezacki JP, Wodicka L, Brideau AD, Supekova L, Thimme R, Wieland S,
Bukh J, Purcell RH, Schultz PG, Chisari FV. Genomic analysis of the host response to
hepatitis C virus infection. Proceedings of the National Academy of Sciences of the United
States of America. 2002;99(24):15669-74. doi: 10.1073/pnas.202608199. PubMed PMID:
12441396; PMCID: PMC137774.
9. Blanchard E, Belouzard S, Goueslain L, Wakita T, Dubuisson J, Wychowski C,
Rouille Y. Hepatitis C virus entry depends on clathrin-mediated endocytosis. Journal of
virology. 2006;80(14):6964-72. doi: 10.1128/JVI.00024-06. PubMed PMID: 16809302;
PMCID: PMC1489042.
10. Tscherne DM, Jones CT, Evans MJ, Lindenbach BD, McKeating JA, Rice CM.
Time- and temperature-dependent activation of hepatitis C virus for low-pH-triggered entry.
60
Journal of virology. 2006;80(4):1734-41. doi: 10.1128/JVI.80.4.1734-1741.2006. PubMed
PMID: 16439530; PMCID: PMC1367161.
11. Han JH, Shyamala V, Richman KH, Brauer MJ, Irvine B, Urdea MS, Tekamp-Olson
P, Kuo G, Choo QL, Houghton M. Characterization of the terminal regions of hepatitis C
viral RNA: identification of conserved sequences in the 5' untranslated region and poly(A)
tails at the 3' end. Proceedings of the National Academy of Sciences of the United States of
America. 1991;88(5):1711-5. PubMed PMID: 1705704; PMCID: PMC51094.
12. Hijikata M, Mizushima H, Akagi T, Mori S, Kakiuchi N, Kato N, Tanaka T, Kimura
K, Shimotohno K. Two distinct proteinase activities required for the processing of a putative
nonstructural precursor protein of hepatitis C virus. Journal of virology. 1993;67(8):4665-75.
PubMed PMID: 8392606; PMCID: PMC237852.
13. Lindenbach BD, Rice CM. Unravelling hepatitis C virus replication from genome to
function. Nature. 2005;436(7053):933-8. doi: 10.1038/nature04077. PubMed PMID:
16107832.
14. Yao N, Reichert P, Taremi SS, Prosise WW, Weber PC. Molecular views of viral
polyprotein processing revealed by the crystal structure of the hepatitis C virus bifunctional
protease-helicase. Structure. 1999;7(11):1353-63. PubMed PMID: 10574797.
15. Li K, Foy E, Ferreon JC, Nakamura M, Ferreon AC, Ikeda M, Ray SC, Gale M, Jr.,
Lemon SM. Immune evasion by hepatitis C virus NS3/4A protease-mediated cleavage of the
Toll-like receptor 3 adaptor protein TRIF. Proceedings of the National Academy of Sciences
of the United States of America. 2005;102(8):2992-7. doi: 10.1073/pnas.0408824102.
PubMed PMID: 15710891; PMCID: PMC548795.
16. Meylan E, Curran J, Hofmann K, Moradpour D, Binder M, Bartenschlager R,
Tschopp R. Cardif is an adaptor protein in the RIG-I antiviral pathway and is targeted by
hepatitis C virus. Nature. 2005;437(7062):1167-72. doi: 10.1038/nature04193. PubMed
PMID: WOS:000232660500047.
17. Wang L, Tian Y, Ou JH. HCV induces the expression of Rubicon and UVRAG to
temporally regulate the maturation of autophagosomes and viral replication. PLoS pathogens.
2015;11(3):e1004764. doi: 10.1371/journal.ppat.1004764. PubMed PMID: 25807108;
PMCID: PMC4373777.
18. Egger D, Wolk B, Gosert R, Bianchi L, Blum HE, Moradpour D, Bienz K.
Expression of hepatitis C virus proteins induces distinct membrane alterations including a
candidate viral replication complex. Journal of virology. 2002;76(12):5974-84. PubMed
PMID: 12021330; PMCID: PMC136238.
19. Quintavalle M, Sambucini S, Di Pietro C, De Francesco R, Neddermann P. The alpha
isoform of protein kinase CKI is responsible for hepatitis C virus NS5A
hyperphosphorylation. Journal of virology. 2006;80(22):11305-12. doi: 10.1128/Jvi.01465-
06. PubMed PMID: WOS:000241821300039.
61
20. Reed KE, Gorbalenya AE, Rice CM. The NS5A/NS5 proteins of viruses from three
genera of the family Flaviviridae are phosphorylated by associated serine/threonine kinases.
Journal of virology. 1998;72(7):6199-206. PubMed PMID: WOS:000074160500106.
21. Evans MJ, Rice CM, Goff SP. Phosphorylation of hepatitis C virus nonstructural
protein 5A modulates its protein interactions and viral RNA replication. Proceedings of the
National Academy of Sciences of the United States of America. 2004;101(35):13038-43. doi:
10.1073/pnas.0405152101. PubMed PMID: WOS:000223694700048.
22. Hengrung N, El Omari K, Martin IS, Vreede FT, Cusack S, Rambo RP, Vonrhein C,
Bricogne G, Stuart DI, Grimes JM, Fodor E. Crystal structure of the RNA-dependent RNA
polymerase from influenza C virus. Nature. 2015;527(7576):114-7. doi:
10.1038/nature15525. PubMed PMID: WOS:000364270700054.
23. Stedman C. Sofosbuvir, a NS5B polymerase inhibitor in the treatment of hepatitis C:
a review of its clinical potential. Therapeutic advances in gastroenterology. 2014;7(3):131-
40. doi: 10.1177/1756283x13515825. PubMed PMID: WOS:000335752200004.
24. Powdrill MH, Bernatchez JA, Gotte M. Inhibitors of the Hepatitis C Virus RNA-
Dependent RNA Polymerase NS5B. Viruses-Basel. 2010;2(10):2169-95. doi:
10.3390/v2102169. PubMed PMID: WOS:000284581900002.
25. Sen GC. Viruses and interferons. Annu Rev Microbiol. 2001;55:255-81. doi: DOI
10.1146/annurev.micro.55.1.255. PubMed PMID: WOS:000171732600011.
26. Horner SM, Gale M, Jr. Regulation of hepatic innate immunity by hepatitis C virus.
Nature medicine. 2013;19(7):879-88. doi: 10.1038/nm.3253. PubMed PMID: 23836238;
PMCID: PMC4251871.
27. Ivashkiv LB, Donlin LT. Regulation of type I interferon responses. Nature Reviews
Immunology. 2014;14(1):36-49. doi: 10.1038/nri3581. PubMed PMID:
WOS:000328962200012.
28. Wong MT, Chen SS. Emerging roles of interferon-stimulated genes in the innate
immune response to hepatitis C virus infection. Cellular & molecular immunology.
2016;13(1):11-35. doi: 10.1038/cmi.2014.127. PubMed PMID: 25544499; PMCID:
PMC4712384.
29. Stark GR, Darnell JE. The JAK-STAT Pathway at Twenty. Immunity.
2012;36(4):503-14. doi: 10.1016/j.immuni.2012.03.013. PubMed PMID:
WOS:000303223900001.
30. Levy DE, Darnell JE. STATs: Transcriptional control and biological impact. Nat Rev
Mol Cell Bio. 2002;3(9):651-62. doi: 10.1038/nrm909. PubMed PMID:
WOS:000177787300014.
31. Rusinova I, Forster S, Yu S, Kannan A, Masse M, Cumming H, Chapman R, Hertzog
PJ. INTERFEROME v2.0: an updated database of annotated interferon-regulated genes.
62
Nucleic acids research. 2013;41(D1):D1040-D6. doi: 10.1093/nar/gks1215. PubMed PMID:
WOS:000312893300148.
32. Schoggins JW, Wilson SJ, Panis M, Murphy MY, Jones CT, Bieniasz P, Rice CM. A
diverse range of gene products are effectors of the type I interferon antiviral response.
Nature. 2011;472(7344):481-U545. doi: 10.1038/nature09907. PubMed PMID:
WOS:000289949600036.
33. Saito T, Owen DM, Jiang FG, Marcotrigiano J, Gale M. Innate immunity induced by
composition-dependent RIG-I recognition of hepatitis C virus RNA. Nature.
2008;454(7203):523-7. doi: 10.1038/nature07106. PubMed PMID: WOS:000257860300053.
34. Kato H, Takeuchi O, Sato S, Yoneyama M, Yamamoto M, Matsui K, Uematsu S,
Jung A, Kawai T, Ishii KJ, Yamaguchi O, Otsu K, Tsujimura T, Koh CS, Sousa CRE,
Matsuura Y, Fujita T, Akira S. Differential roles of MDA5 and RIG-I helicases in the
recognition of RNA viruses. Nature. 2006;441(7089):101-5. doi: 10.1038/nature04734.
PubMed PMID: WOS:000237248600041.
35. Yoneyama M, Kikuchi M, Natsukawa T, Shinobu N, Imaizumi T, Miyagishi M, Taira
K, Akira S, Fujita T. The RNA helicase RIG-I has an essential function in double-stranded
RNA-induced innate antiviral responses. Nature immunology. 2004;5(7):730-7. doi:
10.1038/ni1087. PubMed PMID: WOS:000222331200026.
36. Kowalinski E, Lunardi T, McCarthy AA, Louber J, Brunel J, Grigorov B, Gerlier D,
Cusack S. Structural Basis for the Activation of Innate Immune Pattern-Recognition
Receptor RIG-I by Viral RNA. Cell. 2011;147(2):423-35. doi: 10.1016/j.cell.2011.09.039.
PubMed PMID: WOS:000296199300019.
37. Liu HM, Gale M. Hepatitis C Virus Evasion from RIG-I-Dependent Hepatic Innate
Immunity. Gastroenterology research and practice. 2010. doi: Artn 548390
10.1155/2010/548390. PubMed PMID: WOS:000287870300001.
38. Heim MH. HCV Innate Immune Responses. Viruses-Basel. 2009;1(3):1073-88. doi:
10.3390/v1031073. PubMed PMID: WOS:000280413200036.
39. Scheidereit C. IkappaB kinase complexes: gateways to NF-kappaB activation and
transcription. Oncogene. 2006;25(51):6685-705. doi: 10.1038/sj.onc.1209934. PubMed
PMID: 17072322.
40. Hoffmann A, Natoli G, Ghosh G. Transcriptional regulation via the NF-kappaB
signaling module. Oncogene. 2006;25(51):6706-16. doi: 10.1038/sj.onc.1209933. PubMed
PMID: 17072323.
41. Horner SM, Gale M. Intracellular Innate Immune Cascades and Interferon Defenses
That Control Hepatitis C Virus. J Interf Cytok Res. 2009;29(9):489-98. doi:
10.1089/jir.2009.0063. PubMed PMID: WOS:000269855700003.
63
42. Lee J, Tian Y, Chan ST, Kim JY, Cho C, Ou JH. TNF-alpha Induced by Hepatitis C
Virus via TLR7 and TLR8 in Hepatocytes Supports Interferon Signaling via an Autocrine
Mechanism. PLoS pathogens. 2015;11(5):e1004937. doi: 10.1371/journal.ppat.1004937.
PubMed PMID: 26023919; PMCID: PMC4449221.
43. Li K, Foy E, Ferreon JC, Nakamura M, Ferreon ACM, Ikeda M, Ray SC, Gale M,
Lemon SM. Immune evasion by hepatitis C virus NS3/4A protease-mediated cleavage of the
Toll-like receptor 3 adaptor protein TRIF. Proceedings of the National Academy of Sciences
of the United States of America. 2005;102(8):2992-7. doi: 10.1073/pnas.0408824102.
PubMed PMID: WOS:000227232400058.
44. Fleer A, Krediet TG. Innate immunity: toll-like receptors and some more. A brief
history, basic organization and relevance for the human newborn. Neonatology.
2007;92(3):145-57. doi: 10.1159/000102054. PubMed PMID: 17476116.
45. O'Neill LA, Golenbock D, Bowie AG. The history of Toll-like receptors - redefining
innate immunity. Nat Rev Immunol. 2013;13(6):453-60. doi: 10.1038/nri3446. PubMed
PMID: 23681101.
46. Wu H, Arron JR. TRAF6, a molecular bridge spanning adaptive immunity, innate
immunity and osteoimmunology. BioEssays : news and reviews in molecular, cellular and
developmental biology. 2003;25(11):1096-105. doi: 10.1002/bies.10352. PubMed PMID:
14579250.
47. Funakoshi-Tago M, Tago K, Hayakawa M, Tominaga S, Ohshio T, Sonoda Y,
Kasahara T. TRAF6 is a critical signal transducer in IL-33 signaling pathway. Cellular
signalling. 2008;20(9):1679-86. doi: 10.1016/j.cellsig.2008.05.013. PubMed PMID:
WOS:000258368400011.
48. Rothe M, Wong SC, Henzel WJ, Goeddel DV. A novel family of putative signal
transducers associated with the cytoplasmic domain of the 75 kDa tumor necrosis factor
receptor. Cell. 1994;78(4):681-92. PubMed PMID: 8069916.
49. Deng L, Wang C, Spencer E, Yang L, Braun A, You J, Slaughter C, Pickart C, Chen
ZJ. Activation of the IkappaB kinase complex by TRAF6 requires a dimeric ubiquitin-
conjugating enzyme complex and a unique polyubiquitin chain. Cell. 2000;103(2):351-61.
PubMed PMID: 11057907.
50. Kobayashi T, Walsh PT, Walsh MC, Speirs KM, Chiffoleau E, King CG, Hancock
WW, Caamano JH, Hunter CA, Scott P, Turka LA, Choi YW. TRAF6 is a critical factor for
dendritic cell maturation and development. Immunity. 2003;19(3):353-63. doi: Doi
10.1016/S1074-7613(03)00230-9. PubMed PMID: WOS:000185499800007.
51. Naito A, Yoshida H, Nishioka E, Satoh M, Azuma S, Yamamoto T, Nishikawa S,
Inoue J. TRAF6-deficient mice display hypohidrotic ectodermal dysplasia. Proceedings of
the National Academy of Sciences of the United States of America. 2002;99(13):8766-71.
doi: 10.1073/pnas.132636999. PubMed PMID: WOS:000176478200055.
64
52. Hou J, Wang P, Lin L, Liu XG, Ma F, An HZ, Wang ZG, Ca XT. MicroRNA-146a
Feedback Inhibits RIG-I-Dependent Type I IFN Production in Macrophages by Targeting
TRAF6, IRAK1, and IRAK2. Journal of immunology. 2009;183(3):2150-8. doi:
10.4049/jimmunol.0900707. PubMed PMID: WOS:000268519500075.
53. Akiyama T, Shiraishi T, Qin JW, Konno H, Akiyama N, Shinzawa M, Miyauchi M,
Takizawa N, Yanai H, Ohashi H, Miyamoto-Sato E, Yanagawa H, Yong WD, Shou WN,
Inoue J. Mitochondria-Nucleus Shuttling FK506-Binding Protein 51 Interacts with TRAF
Proteins and Facilitates the RIG-I-Like Receptor-Mediated Expression of Type I IFN. PloS
one. 2014;9(5). doi: ARTN e95992
10.1371/journal.pone.0095992. PubMed PMID: WOS:000335510600062.
54. Ho BC, Yu IS, Lu LF, Rudensky A, Chen HY, Tsai CW, Chang YL, Wu CT, Chang
LY, Shih SR, Lin SW, Lee CN, Yang PC, Yu SL. Inhibition of miR-146a prevents
enterovirus-induced death by restoring the production of type I interferon. Nature
communications. 2014;5. doi: ARTN 3344
10.1038/ncomms4344. PubMed PMID: WOS:000332669400003.
55. Kang LJ, Choi YJ, Lee SG. Stimulation of TRAF6/TAK1 degradation and inhibition
of JNK/AP-1 signalling by ginsenoside Rg3 attenuates hepatitis B virus replication. The
international journal of biochemistry & cell biology. 2013;45(11):2612-21. doi:
10.1016/j.biocel.2013.08.016. PubMed PMID: 24004833.
56. Ma A, Malynn BA. A20: linking a complex regulator of ubiquitylation to immunity
and human disease. Nat Rev Immunol. 2012;12(11):774-85. doi: 10.1038/nri3313. PubMed
PMID: 23059429; PMCID: PMC3582397.
57. Lee EG, Boone DL, Chai S, Libby SL, Chien M, Lodolce JP, Ma A. Failure to
regulate TNF-induced NF-kappaB and cell death responses in A20-deficient mice. Science.
2000;289(5488):2350-4. PubMed PMID: 11009421; PMCID: PMC3582399.
58. Hammer GE, Turer EE, Taylor KE, Fang CJ, Advincula R, Oshima S, Barrera J,
Huang EJ, Hou B, Malynn BA, Reizis B, DeFranco A, Criswell LA, Nakamura MC, Ma A.
Expression of A20 by dendritic cells preserves immune homeostasis and prevents colitis and
spondyloarthritis. Nature immunology. 2011;12(12):1184-93. doi: 10.1038/ni.2135. PubMed
PMID: 22019834; PMCID: PMC3419270.
59. Wellcome Trust Case Control C. Genome-wide association study of 14,000 cases of
seven common diseases and 3,000 shared controls. Nature. 2007;447(7145):661-78. doi:
10.1038/nature05911. PubMed PMID: 17554300; PMCID: PMC2719288.
60. Pawlotsky JM. The nature of interferon-alpha resistance in hepatitis C virus infection.
Curr Opin Infect Dis. 2003;16(6):587-92. doi: 10.1097/01.qco.0000104300.87920.03.
PubMed PMID: 14624110.
61. Yao ZQ, Waggoner SN, Cruise MW, Hall C, Xie X, Oldach DW, Hahn YS. SOCS1
and SOCS3 are targeted by hepatitis C virus core/gC1qR ligation to inhibit T-cell function.
65
Journal of virology. 2006;80(16):8287. doi: 10.1128/JVI.01181-06. PubMed PMID:
16873288; PMCID: PMC1563827.
62. Shao RX, Zhang L, Peng LF, Sun E, Chung WJ, Jang JY, Tsai WL, Hyppolite G,
Chung RT. Suppressor of cytokine signaling 3 suppresses hepatitis C virus replication in an
mTOR-dependent manner. Journal of virology. 2010;84(12):6060-9. doi:
10.1128/JVI.02484-09. PubMed PMID: 20375166; PMCID: PMC2876663.
63. Li XD, Sun L, Seth RB, Pineda G, Chen ZJ. Hepatitis C virus protease NS3/4A
cleaves mitochondrial antiviral signaling protein off the mitochondria to evade innate
immunity. Proceedings of the National Academy of Sciences of the United States of
America. 2005;102(49):17717-22. doi: 10.1073/pnas.0508531102. PubMed PMID:
16301520; PMCID: PMC1308909.
64. Christen V, Treves S, Duong FH, Heim MH. Activation of endoplasmic reticulum
stress response by hepatitis viruses up-regulates protein phosphatase 2A. Hepatology.
2007;46(2):558-65. doi: 10.1002/hep.21611. PubMed PMID: 17526027.
65. Merquiol E, Uzi D, Mueller T, Goldenberg D, Nahmias Y, Xavier RJ, Tirosh B,
Shibolet O. HCV causes chronic endoplasmic reticulum stress leading to adaptation and
interference with the unfolded protein response. PloS one. 2011;6(9):e24660. doi:
10.1371/journal.pone.0024660. PubMed PMID: 21949742; PMCID: PMC3176279.
66. Shrivastava S, Bhanja Chowdhury J, Steele R, Ray R, Ray RB. Hepatitis C virus
upregulates Beclin1 for induction of autophagy and activates mTOR signaling. Journal of
virology. 2012;86(16):8705-12. doi: 10.1128/JVI.00616-12. PubMed PMID: 22674982;
PMCID: PMC3421755.
67. Vescovo T, Refolo G, Romagnoli A, Ciccosanti F, Corazzari M, Alonzi T, Fimia
GM. Autophagy in HCV infection: keeping fat and inflammation at bay. BioMed research
international. 2014;2014:265353. doi: 10.1155/2014/265353. PubMed PMID: 25162004;
PMCID: PMC4138948.
68. Negro F, Alberti A. The global health burden of hepatitis C virus infection. Liver
international : official journal of the International Association for the Study of the Liver.
2011;31 Suppl 2:1-3. doi: 10.1111/j.1478-3231.2011.02537.x. PubMed PMID: 21651699.
69. Lavanchy D. The global burden of hepatitis C. Liver international : official journal of
the International Association for the Study of the Liver. 2009;29 Suppl 1:74-81. doi:
10.1111/j.1478-3231.2008.01934.x. PubMed PMID: 19207969.
70. Fredericksen B, Akkaraju GR, Foy E, Wang C, Pflugheber J, Chen ZJ, Gale M, Jr.
Activation of the interferon-beta promoter during hepatitis C virus RNA replication. Viral
immunology. 2002;15(1):29-40. doi: 10.1089/088282402317340215. PubMed PMID:
11952144.
71. Rose R, Markov PV, Lam TT, Pybus OG. Viral evolution explains the associations
among hepatitis C virus genotype, clinical outcomes, and human genetic variation. Infection,
66
genetics and evolution : journal of molecular epidemiology and evolutionary genetics in
infectious diseases. 2013;20:418-21. doi: 10.1016/j.meegid.2013.09.029. PubMed PMID:
24140473.
72. Lemon SM. Induction and evasion of innate antiviral responses by hepatitis C virus.
The Journal of biological chemistry. 2010;285(30):22741-7. doi: 10.1074/jbc.R109.099556.
PubMed PMID: 20457596; PMCID: PMC2906263.
73. Takeuchi O, Akira S. Innate immunity to virus infection. Immunological reviews.
2009;227(1):75-86. doi: 10.1111/j.1600-065X.2008.00737.x. PubMed PMID: 19120477.
74. Chang S, Dolganiuc A, Szabo G. Toll-like receptors 1 and 6 are involved in TLR2-
mediated macrophage activation by hepatitis C virus core and NS3 proteins. Journal of
leukocyte biology. 2007;82(3):479-87. doi: 10.1189/jlb.0207128. PubMed PMID: 17595379.
75. Dolganiuc A, Oak S, Kodys K, Golenbock DT, Finberg RW, Kurt-Jones E, Szabo G.
Hepatitis C core and nonstructural 3 proteins trigger toll-like receptor 2-mediated pathways
and inflammatory activation. Gastroenterology. 2004;127(5):1513-24. PubMed PMID:
15521019.
76. Park SH, Rehermann B. Immune responses to HCV and other hepatitis viruses.
Immunity. 2014;40(1):13-24. doi: 10.1016/j.immuni.2013.12.010. PubMed PMID:
24439265; PMCID: PMC4480226.
77. Xagorari A, Chlichlia K. Toll-like receptors and viruses: induction of innate antiviral
immune responses. Open Microbiol J. 2008;2:49-59. doi: 10.2174/1874285800802010049.
PubMed PMID: 19088911; PMCID: PMC2593046.
78. Horsmans Y, Berg T, Desager JP, Mueller T, Schott E, Fletcher SP, Steffy KR,
Bauman LA, Kerr BM, Averett DR. Isatoribine, an agonist of TLR7, reduces plasma virus
concentration in chronic hepatitis C infection. Hepatology. 2005;42(3):724-31. Epub
2005/08/24. doi: 10.1002/hep.20839. PubMed PMID: 16116638.
79. McHutchison JG, Bacon BR, Gordon SC, Lawitz E, Shiffman M, Afdhal NH,
Jacobson IM, Muir A, Al-Adhami M, Morris ML, Lekstrom-Himes JA, Efler SM, Davis HL.
Phase 1B, randomized, double-blind, dose-escalation trial of CPG 10101 in patients with
chronic hepatitis C virus. Hepatology. 2007;46(5):1341-9. doi: 10.1002/hep.21773. PubMed
PMID: 17929306.
80. Al-Qahtani AA, Al-Anazi MR, Al-Zoghaibi F, Abdo AA, Sanai FM, Khan MQ,
Albenmousa A, Al-Ashgar HI, Al-Ahdal MN. The association of toll-like receptor 4
polymorphism with hepatitis C virus infection in Saudi Arabian patients. BioMed research
international. 2014;2014:357062. doi: 10.1155/2014/357062. PubMed PMID: 25177689;
PMCID: PMC4142570.
81. Figueroa L, Xiong Y, Song C, Piao W, Vogel SN, Medvedev AE. The Asp299Gly
polymorphism alters TLR4 signaling by interfering with recruitment of MyD88 and TRIF.
67
Journal of immunology. 2012;188(9):4506-15. doi: 10.4049/jimmunol.1200202. PubMed
PMID: 22474023; PMCID: PMC3531971.
82. Agundez JA, Garcia-Martin E, Devesa MJ, Carballo M, Martinez C, Lee-Brunner A,
Fernandez C, Diaz-Rubio M, Ladero JM. Polymorphism of the TLR4 gene reduces the risk
of hepatitis C virus-induced hepatocellular carcinoma. Oncology. 2012;82(1):35-40. doi:
10.1159/000335606. PubMed PMID: 22286521.
83. Levine B, Kroemer G. Autophagy in the pathogenesis of disease. Cell.
2008;132(1):27-42. doi: 10.1016/j.cell.2007.12.018. PubMed PMID: 18191218; PMCID:
PMC2696814.
84. Ploen D, Hildt E. Hepatitis C virus comes for dinner: How the hepatitis C virus
interferes with autophagy. World journal of gastroenterology : WJG. 2015;21(28):8492-507.
doi: 10.3748/wjg.v21.i28.8492. PubMed PMID: 26229393; PMCID: PMC4515832.
85. Wang L, James Ou JH. Hepatitis C virus and autophagy. Biological chemistry.
2015;396(11):1215-22. doi: 10.1515/hsz-2015-0172. PubMed PMID: 26024249.
86. Jiang J, Luo G. Cell culture-adaptive mutations promote viral protein-protein
interactions and morphogenesis of infectious hepatitis C virus. Journal of virology.
2012;86(17):8987-97. doi: 10.1128/JVI.00004-12. PubMed PMID: 22674987; PMCID:
PMC3416171.
87. Klionsky DJ. Stepping back from the guidelines: Where do we stand? Autophagy.
2016;12(2):223-4. doi: 10.1080/15548627.2016.1139264. PubMed PMID: 26902583.
88. Geng J, Sun X, Wang P, Zhang S, Wang X, Wu H, Hong L, Xie C, Li X, Zhao H, Liu
Q, Jiang M, Chen Q, Zhang J, Li Y, Song S, Wang HR, Zhou R, Johnson RL, Chien KY, Lin
SC, Han J, Avruch J, Chen L, Zhou D. Kinases Mst1 and Mst2 positively regulate phagocytic
induction of reactive oxygen species and bactericidal activity. Nature immunology.
2015;16(11):1142-52. doi: 10.1038/ni.3268. PubMed PMID: 26414765; PMCID:
PMC4618176.
89. Vilotti S, Codrich M, Dal Ferro M, Pinto M, Ferrer I, Collavin L, Gustincich S,
Zucchelli S. Parkinson's disease DJ-1 L166P alters rRNA biogenesis by exclusion of TTRAP
from the nucleolus and sequestration into cytoplasmic aggregates via TRAF6. PloS one.
2012;7(4):e35051. doi: 10.1371/journal.pone.0035051. PubMed PMID: 22532838; PMCID:
PMC3332112.
90. Sanz L, Diaz-Meco MT, Nakano H, Moscat J. The atypical PKC-interacting protein
p62 channels NF-kappaB activation by the IL-1-TRAF6 pathway. The EMBO journal.
2000;19(7):1576-86. doi: 10.1093/emboj/19.7.1576. PubMed PMID: 10747026; PMCID:
PMC310227.
91. Bjorkoy G, Lamark T, Brech A, Outzen H, Perander M, Overvatn A, Stenmark H,
Johansen T. p62/SQSTM1 forms protein aggregates degraded by autophagy and has a
protective effect on huntingtin-induced cell death. The Journal of cell biology.
68
2005;171(4):603-14. doi: 10.1083/jcb.200507002. PubMed PMID: 16286508; PMCID:
PMC2171557.
92. Katsuragi Y, Ichimura Y, Komatsu M. p62/SQSTM1 functions as a signaling hub and
an autophagy adaptor. The FEBS journal. 2015;282(24):4672-8. doi: 10.1111/febs.13540.
PubMed PMID: 26432171.
93. Yi M. Hepatitis C virus: propagation, quantification, and storage. Curr Protoc
Microbiol. 2010;Chapter 15:Unit 15D 1. doi: 10.1002/9780471729259.mc15d01s19.
PubMed PMID: 21053255; PMCID: PMC3039288.
94. Yoshida H, Kato N, Shiratori Y, Otsuka M, Maeda S, Kato J, Omata M. Hepatitis C
virus core protein activates nuclear factor kappa B-dependent signaling through tumor
necrosis factor receptor-associated factor. The Journal of biological chemistry.
2001;276(19):16399-405. doi: 10.1074/jbc.M006671200. PubMed PMID: 11278312.
95. Israelow B, Narbus CM, Sourisseau M, Evans MJ. HepG2 cells mount an effective
antiviral interferon-lambda based innate immune response to hepatitis C virus infection.
Hepatology. 2014;60(4):1170-9. doi: 10.1002/hep.27227. PubMed PMID: 24833036;
PMCID: PMC4176518.
96. Sun LJ, Deng L, Ea CK, Xia ZP, Chen ZJJ. The TRAF6 ubiquitin ligase and TAK1
kinase mediate IKK activation by BCL10 and MALT1 in T lymphocytes. Molecular cell.
2004;14(3):289-301. doi: Doi 10.1016/S1097-2765(04)00236-9. PubMed PMID:
WOS:000221352700002.
97. Deng L, Wang C, Spencer E, Yang LY, Braun A, You JX, Slaughter C, Pickart C,
Chen ZJ. Activation of the I kappa B kinase complex by TRAF6 requires a dimeric ubiquitin-
conjugating enzyme complex and a unique polyubiquitin chain. Cell. 2000;103(2):351-61.
doi: Doi 10.1016/S0092-8674(00)00126-4. PubMed PMID: WOS:000089864300018.
98. Darnay BG, Ni J, Moore PA, Aggarwal BB. Activation of NF-kappa B by RANK
requires tumor necrosis factor receptor-associated factor (TRAF) 6 and NF-kappa B-inducing
kinase - Identification of a novel TRAF6 interaction motif. Journal of Biological Chemistry.
1999;274(12):7724-31. doi: Doi 10.1074/Jbc.274.12.7724. PubMed PMID:
WOS:000079268100021.
99. Saito T, Owen DM, Jiang F, Marcotrigiano J, Gale M, Jr. Innate immunity induced by
composition-dependent RIG-I recognition of hepatitis C virus RNA. Nature.
2008;454(7203):523-7. doi: 10.1038/nature07106. PubMed PMID: 18548002; PMCID:
PMC2856441.
100. Cao XZ, Ding Q, Lu J, Tao WY, Huang B, Zhao YN, Niu JQ, Liu YJ, Zhong J.
MDA5 plays a critical role in interferon response during hepatitis C virus infection. Journal
of hepatology. 2015;62(4):771-8. doi: 10.1016/j.jhep.2014.11.007. PubMed PMID:
WOS:000351305300005.
69
101. Kang JI, Kwon SN, Park SH, Kim YK, Choi SY, Kim JP, Ahn BY. PKR protein
kinase is activated by hepatitis C virus and inhibits viral replication through translational
control. Virus research. 2009;142(1-2):51-6. doi: 10.1016/j.virusres.2009.01.007. PubMed
PMID: WOS:000266366600007.
102. Wang N, Liang Y, Devaraj S, Wang J, Lemon SM, Li K. Toll-like receptor 3
mediates establishment of an antiviral state against hepatitis C virus in hepatoma cells.
Journal of virology. 2009;83(19):9824-34. doi: 10.1128/JVI.01125-09. PubMed PMID:
19625408; PMCID: PMC2747996.
103. Ferreon JC, Ferreon AC, Li K, Lemon SM. Molecular determinants of TRIF
proteolysis mediated by the hepatitis C virus NS3/4A protease. The Journal of biological
chemistry. 2005;280(21):20483-92. doi: 10.1074/jbc.M500422200. PubMed PMID:
15767257.
104. Knodler LA, Celli J. Eating the strangers within: host control of intracellular bacteria
via xenophagy. Cellular microbiology. 2011;13(9):1319-27. doi: 10.1111/j.1462-
5822.2011.01632.x. PubMed PMID: WOS:000302010600003.
105. Sir D, Ou JHJ. Autophagy in viral replication and pathogenesis. Molecules and cells.
2010;29(1):1-7. doi: 10.1007/s10059-010-0014-2. PubMed PMID: WOS:000276614800001.
106. Paul D, Hoppe S, Saher G, Krijnse-Locker J, Bartenschlager R. Morphological and
biochemical characterization of the membranous hepatitis C virus replication compartment.
Journal of virology. 2013;87(19):10612-27. doi: 10.1128/JVI.01370-13. PubMed PMID:
23885072; PMCID: PMC3807400.
107. Fries KL, Miller WE, RaabTraub N. Epstein-Barr virus latent membrane protein 1
blocks p53-mediated apoptosis through the induction of the A20 gene. Journal of virology.
1996;70(12):8653-9. PubMed PMID: WOS:A1996VT70400048.
108. Onose A, Hashimoto S, Hayashi S, Maruoka S, Kumasawa F, Mizumura K, Jibiki I,
Matsumoto K, Gon Y, Kobayashi T, Takahashi N, Shibata Y, Abiko Y, Shibata T, Shimizu
K, Horie T. An inhibitory effect of A20 on NF-kappa B activation in airway epithelium upon
influenza virus infection. European journal of pharmacology. 2006;541(3):198-204. doi:
10.1016/j.ejphar.2006.03.073. PubMed PMID: WOS:000238875200011.
109. Ma L, Zhou Y, Zhang Y, Li Y, Guo Y, He Y, Wang J, Lian J, Hao C, Moorman JP,
Yao ZQ, Zhou Y, Jia Z. Role of A20 in interferon-alpha-mediated functional restoration of
myeloid dendritic cells in patients with chronic hepatitis C. Immunology. 2014;143(4):670-8.
doi: 10.1111/imm.12350. PubMed PMID: 24965710; PMCID: PMC4253515.
110. Fan C, Zhang Y, Zhou Y, Li B, He Y, Guo Y, Jia Z. Up-regulation of A20/ABIN1
contributes to inefficient M1 macrophage polarization during Hepatitis C virus infection.
Virology journal. 2015;12:147. doi: 10.1186/s12985-015-0379-0. PubMed PMID: 26382585;
PMCID: PMC4574525.
70
111. Nishitsuji H, Funami K, Shimizu Y, Ujino S, Sugiyama K, Seya T, Takaku H,
Shimotohno K. Hepatitis C Virus Infection Induces Inflammatory Cytokines and
Chemokines Mediated by the Cross Talk between Hepatocytes and Stellate Cells. Journal of
virology. 2013;87(14):8169-78. doi: 10.1128/Jvi.00974-13. PubMed PMID:
WOS:000321017700035.
112. Nguyen H, Sankaran S, Dandekar S. Hepatitis C virus core protein induces
expression of genes regulating immune evasion and anti-apoptosis in hepatocytes. Virology.
2006;354(1):58-68. doi: 10.1016/j.virol.2006.04.028. PubMed PMID: 16876223.
113. Choi J, Lee KJ, Zheng Y, Yamaga AK, Lai MM, Ou JH. Reactive oxygen species
suppress hepatitis C virus RNA replication in human hepatoma cells. Hepatology.
2004;39(1):81-9. doi: 10.1002/hep.20001. PubMed PMID: 14752826.

Abstract (if available)

Abstract Viral infection triggers various host innate immunity responses and activates signaling pathways depending on specific pattern recognitions on the virus. These responses act together to assist the host to eradicate the pathogen, but many viruses have evolved advanced machinery to overcome these effects and maintain its infection. Hepatitis C virus has adopted sophisticated mechanism to maintain its replication and persistent infection by restricting the host response. We found HCV degraded and induced specific mediating proteins to disrupt the host antiviral response. Tumor necrosis factor receptor-associated factor 6 (TRAF6) is an important adapter molecule that mediates the TNFR family and interleukin-1/Toll-like receptor (IL-1/TLR) signaling cascades. In this study, we demonstrated that HCV infection decreased the TRAF6 level in its host cells through a post-translational mechanism. This reduction of TRAF6 by HCV was not affected by MG132, a proteasome inhibitor, but it was abolished by bafilomycin A1, a vacuolar ATPase inhibitor that inhibits the autophagic protein degradation. Further analysis confirmed the colocalization of TRAF6 with autophagosomes in HCV-infected cells. The autophagic degradation of TRAF6 was mediated by p62/SQSMT1, a protein factor important for selective autophagy, as it could bind to TRAF6 and its silencing prevented HCV from depleting TRAF6. TRAF6 was important for the activation of NF-κB and the induction of pro-inflammatory cytokines in HCV-infected cells, and the overexpression of TRAF6 suppressed HCV replication and conversely, the silencing of TRAF6 enhanced HCV replication. Our results thus indicated that HCV could disrupt the host innate immune response via the induction of autophagic degradation of TRAF6 to enhance its replication. We also identified TNFAIP3, a TNFα induced protein, to be significantly induced after HCV infection. In this study, we analyzed the promoter of TNFAIP3 and found the induction was due to its ELIE site, an elongation inhibitory element. Further analysis confirmed HCV infection reduces the binding of USF-1, an inhibitory transcription factor, to ELIE by enhancing the proteasome degradation of USF-1. Because TNFAIP3 is involved with a signaling feedback loop, we also investigate its effect on HCV replication. Our overexpression analysis of TNFAIP3 did not determine its role since HCV viral protein and RNA remained the same. Conversely, the silencing of TNFAIP3 showed increase protein expression and RNA, which suggests TNFAIP3 to be the negative regulator during HCV replication. However, additionally studies with NF-κB related inflammatory cytokines did not provide an explanation to this observation. Taken together, these findings with TRAF6 and TNFAIP3 studies represented how HCV is a successful virus in maintaining its infection by limiting host antiviral response in the host through controlling critical signaling mediators.

Linked assets

University of Southern California Dissertations and Theses

Conceptually similar

PDF

The effects of autophagy on hepatitis C virus

PDF

Effect of hepatitis C virus infection on signal transduction adaptor protein: TRAF6

PDF

Virus customization of host protein machinery for efficient propagation

PDF

Characterization of three novel variants of the MAVS adaptor

PDF

TNF-alpha, an early hepatocellular response to HCV infection

PDF

CAD-mediated metabolic reprogramming is regulated by innate immune kinases TBK1 and IKKβ

PDF

Alcohol attenuates the antiviral innate immune response of interferon

PDF

Study of protein deamidation in innate immune signaling

PDF

The analysis and modeling of signaling pathways induced by the interactions of the SARS-CoV-2 spike protein with cellular receptors

PDF

Cellular proteins that interact with the hepatitis C virus F protein

PDF

The role of amphisomes and Rab11 protein in release of mature hepatitis B viral particles and analysis of the arginine-rich C-terminal domain of HBV precore protein

PDF

Role of TLR4 and AID in lymphomagenesis induced by obesity and hepatitis C virus

PDF

Selective innate immune activation by murine gamma-herpesvirus 68 (ɣHV68)

PDF

Role of hepatitis C virus F protein in viral protein expression and RNA replication

PDF

Mechanism of ethanol-mediated increase of SARS-COV-2 entry through GRP78 induction

PDF

The molecular studies of HCV RNA replication and translation

PDF

The role of envelope protein in SARS-CoV-2 evasion of CD1d antigen presentation pathway

PDF

Modulation of host antigen presentation by herpes simplex virus 1

PDF

Protein deamidation mediated metabolic reprogramming during KSHV lytic replication

PDF

Herpes Simplex virus-1 UL56 collaborates with Nedd4 E3 ubiquitin ligase to downregulate surface CD1d and facilitate immune evasion of NKT cell function

Asset Metadata

Creator Chan, Stephanie T. (author)

Core Title The effects of hepatitis C virus infection on host immune response and signaling pathways

School Keck School of Medicine

Degree Doctor of Philosophy

Degree Program Medical Biology

Publication Date 09/28/2016

Defense Date 06/17/2016

Publisher University of Southern California (original), University of Southern California. Libraries (digital)

Tag HCV,hepatitis c virus,innate immunity,OAI-PMH Harvest,signaling pathways

Format application/pdf (imt)

Language English

Contributor Electronically uploaded by the author (provenance)

Advisor Ou, James (committee chair), Feng, Pinghui (committee member), Yuan, Weiming (committee member)

Creator Email chanstep@usc.edu,stephanietcchan@gmail.com

Permanent Link (DOI) https://doi.org/10.25549/usctheses-c40-306683

Unique identifier UC11281560

Identifier etd-ChanStepha-4820.pdf (filename),usctheses-c40-306683 (legacy record id)

Legacy Identifier etd-ChanStepha-4820.pdf

Dmrecord 306683

Document Type Dissertation

Format application/pdf (imt)

Rights Chan, Stephanie T.

Type texts

Source University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Access Conditions The author retains rights to his/her dissertation, thesis or other graduate work according to U.S. copyright law. Electronic access is being provided by the USC Libraries in agreement with the a...

Repository Name University of Southern California Digital Library

Repository Location USC Digital Library, University of Southern California, University Park Campus MC 2810, 3434 South Grand Avenue, 2nd Floor, Los Angeles, California 90089-2810, USA