00001.tif

PDF

Download

Open document

Transcript (if available)

Content INFORMATION TO USERS This manuscript has been reproduced from the microfilm master. UMI films the text directly from the original or copy submitted. Thus, some thesis and dissertation copies are in typewriter face, while others may be from any type of computer printer. The quality of this reproduction is dependent upon the quality of the copy submitted. Broken or indistinct print, colored or poor quality illustrations and photographs, print bleedthrough, substandard margins, and improper alignment can adversely affect reproduction. In the unlikely event that the author did not send UMI a complete manuscript and there are missing pages, these will be noted. Also, if unauthorized copyright material had to be removed, a note will indicate the deletion. Oversize materials (e.g., maps, drawings, charts) are reproduced by sectioning the original, beginning at the upper left-hand comer and continuing from left to right in equal sections with small overlaps. Each original is also photographed in one exposure and is included in reduced form at the back o f the book. Photographs included in the original manuscript have been reproduced xerographically in this copy. Higher quality 6” x 9” black and white photographic prints are available for any photographs or illustrations appearing in this copy for an additional charge. Contact UMI directly to order. UMI A Bell & Howell Information Company 300 North Zeeb Road, Ann Arbor MI 48106-1346 USA 313/761-4700 800/521-0600 Regulation of Hepatitis B Virus Core and Surface Gene Expression By Min Chen A Dissertation Presented to the FACULTY OF THE GRADUATE SCHOOL UNIVERSITY OF SOUTHERN CALIFORNIA In Partial Fulfillment of the Requirements for the Degree DOCTOR OF PHILOSOPHY (Molecular Microbiology and Immunology) December 1995 Copyright 1995 Min Chen UMI Number: 9617092 UMI Microform 9617092 Copyright 1996, by UMI Company. AH rights reserved. This microform edition is protected against unauthorized copying under Title 17, United States Code. UMI 300 North Zeeb Road Ann Arbor, MI 48103 UNIVERSITY OF SOUTHERN CALIFORNIA THE GRADUATE SCHOOL UNIVERSITY PARK LOS ANGELES, CALIFORNIA 90007 This dissertation, written by M in C h en under the direction of h.$X...... Dissertation Committee, and approved by all its members, has been presented to and accepted by The Graduate School, in partial fulfillment of re quirements for the degree of DOCTOR OF PHILOSOPHY c . . Dean of Graduate Studies D a te..... DISSERTATION COMMITTEE — .......... Chairperson DEDICATION To my beloved parents... Kewen Chen and Xiaoyun Yao ACKNOWLEDGMENTS I am indebted to my thesis advisor, Dr. James Ou, for his scientific guidance and generous support during the course of my graduate study. I am also grateful for the advice and encouragement from Drs. Henry Fong and Robert Maxson who served as the members of my dissertation committee. I wish to thank Dr. Benedict Yen for his advice and assistance. I would also like to thank my laboratory fellows for their helpful discussions and technical assistance. These include Wentong Guo, Chau-Ting Yeh, Shihyen Lo, Victor Buckwold, Wayne Liao, Sarina Hieng, Sunny Wong, and Billy Valentine. TABLE OF CONTENTS T ITL E PA G E ................................................................................................................... i D E D IC A T IO N ................................................................................................................... ii A C K N O W LED G M E N T S...............................................................................................iii LIST OF FIG U R ES.......................................................................................................v A B S T R A C T ........................................................................................................................ vii CH APTER 1. Introduction.......................................................................................... 1 CHAPTER 2. Regulation of hepatitis B virus ENI enhancer activity by hepatocyte-enriched transcription factor H N F 3 .......................... 18 CHAPTER 3. Hepatocyte-specific expression of the hepatitis B virus core promoter depends on both positive and negative regulation 39 CHAPTER 4. Cell type-dependent regulation of the negative regulatory element of the hepatitis B virus core promoter............................ 66 CHAPTER 5. Key role of a CCAAT element in regulating hepatitis B virus surface protein expression........................................................... 97 CHAPTER 6. Conclusions ......................................................................................I l l B IB L IO G R A P H Y ............................................................................................................ 121 LIST OF FIGURES Figure 1-1. Diagrammatic representation of the stincture of HBV virion (Dane p a rtic le )................................................................................................................................ 3 Figure 1-2. The HBV genome and its transcription units.......................................5 Figure 1-3. (Top) Schematic illustration of ENI enhancer/X promoter and ENII enhancer/C promoter regions of HBV. (Bottom) A schematic representation of cellular protein factors interacting with the ENI/X promoter region........................11 Figure 1-4. The life cycle of hepatitis B virus....................................................... 15 Figure 2-1. Schematic illustration of the HBV ENI enhancer.................................19 Figure 2-2. (A) Comparison of the 2c site sequence of the HBV ENI enhancer with the consensus sequence of the HNF3 binding sites. The binding of protein factors to the 2c site was suppressed by an HNF3 oligonucleotide.........................25 Figure 2-3. Characterization of protein factors binding to the 2c site of the HBV ENI en h an cer...................................................................................................................28 Figure 2-4. Mutational analysis of the HNF3 binding site in the ENI enhancer....... 31 Figure 2-5. Suppression of the ENI enhancer activity by HNF3 antisense seq u en ces............................................................................................................................ 35 Figure 3-1. Activation of HBV core promoter by HNF4 transcription factor...........46 Figure 3-2. DNase I footprint analysis of the core promoter................................. 48 Figure 3-3. Localization of the HNF4 site with DNase footprint analysis............... 52 Figure 3-4. Gel-shift analysis for the binding of HNF4 to the URS of the core p ro m o ter..............................................................................................................................54 Figure 3-5. Methylation-interference analysis of the HNF4 binding site in the core prom oter..................................................................................................................56 Figure 3-6. (A) HNF4 binding site in the core promoter as determined by methylation-interference experiments. (B) Comparison of the HNF4 binding sequence in the HBV ENII enhancer (or URS of the core promoter) and the consensus HNF4 binding sequence......................................................................... 58 Figure 3-7. Presence of a dominant negative element in the URS of the core p ro m o ter..............................................................................................................................61 Figure 4-1. Deletion analysis of the negative regulatory element (NRE) of the HBV core prom oter.....................................................................................................75 Figure 4-2. Orientation-independence of the NRE activity....................................77 Figure 4-3. Analysis of the NRE activity in HuH7 hepatoma cells.........................80 Figure 4-4. The gel-shift assay of the NREy subregion..........................................82 Figure 4-5. (A) The methylation interference assay. (B) The sequence of the footprints identified in (A )........................................................................................85 Figure 4-6. Mutation-analysis of the NREy subregion........................................... 88 Figure 4-7. (A) The gel-shift assay using both the HeLa and the HuH7 nuclear extracts. (B) The UV-cross-linking analysis of the protein factor binding to the NREy subregion .............................................................................................................90 Figure 4-8. DNase I-foot printing analysis of the NRE sequence........................... 93 Figure 5-1. Top. Map of the large BglH fragment of HBV strain adw in the plasmid PSAg. Bottom. Partial sequence of the S promoter................................ 99 Figure 5-2. Primer extension and Northern blot analysis of preSl and S transcripts in transfected cells.......................................................................................................102 Figure 5-3. Quantitation of surface proteins synthesized by transfected cells...........105 Figure 5-4. Immunofluorescence staining for surface proteins in cells nansfected with (A) wild-type pSAg, or (B) pSAg-LS3..........................................................108 Figure 6-1. Comparison of the NREy motif to the RFX1 consensus binding seq u en ce............................................................................................................................. 116 Figure 6-2. Gel-shift analysis with anti-R FX l...................................................... 117 ABSTRACT Hepatitis B virus primarily infects human hepatocytes and can cause acute and chronic liver diseases. This virus has a very small circular DNA genome which contains four genes named S, C, X, and Pol. The expression of these four genes is regulated by four different promoters and two enhancers. The core (C) promoter, giving rise to the transcripts coding for viral DNA polymerase, capsid protein and precore protein, as well as the pregenomic RNA for viral replication, is a key promoter for viral life cycle. Previous reports have indicated that the core promoter as well as the ENI enhancer is preferentially active in liver cells, and their liver-specific activities are at least partially responsible for the hepatotropism of HBV. However, the detailed mechanisms underlying this phenomenon have not yet been well characterized. In this thesis, I have investigated the molecular mechanisms mediating the liver specificity of these elements. I have found that the core promoter and the ENI enhancer require liver- enriched transcription factors HNF3 and HNF4, respectively, for their activities. The involvement of these liver-enriched factors may explain the liver specificity of these elements. Furthermore, I have identified and characterized a negative regulatory element (NRE) located upstream of the core promoter. This NRE can negatively regulate the core promoter activity in nonliver cell types and is also responsible for the liver specificity of the core promoter. The possible role of this NRE in temporal regulation of HBV gene expression will also be discussed. In addition, in order to understand the mechanisms that regulate HBV gene expression, I have studied the regulation of surface (S) gene expression. I here present evidence that a CCAAT element of S promoter is important for differentially regulating large surface (preSl) and major surface (S) promoter activities. This differential regulation is important for viral morphogenesis. 1 CHAPTER 1. INTRODUCTION Hepatitis B virus (HBV) is an important human pathogen which can cause acute and chronic hepatitis, and liver cirrhosis. Chronic HBV infection is also closely associated with the development of primary hepatocellular carcinoma (HCC) (Beasley et al., 1981; Beasley, 1988; Szmuness, 1978). It is estimated that there are 300 million HBV carriers worldwide, resulting in at least 300,000 deaths yearly (Beasley, 1988; Flehmig et al., 1988). Most deaths occur from cirrhosis and primary liver cancer directly attributable to chronic HBV infection. Thus HBV infection is a very severe health problem throughout the world. VIRUS CLASSIFICATION Hepatitis B virus belongs to the family of hepadnaviridae, of which a group of animal viruses including woodchuck hepatitis virus (WHV), ground squirrel hepatitis virus (GSHV) and duck hepatitis vims (DHBV) are also members. These viruses have similar virion structure, genome organization, mechanism of replication, narrow host range and high hepatotropism, which represent the principal criteria for defining the Hepadnaviridae family (Robinson, 1990). Hepatitis B vims also appears to be phylogenetically related to members of two other virus families: (i) Caulimoviridae and (ii) Retroviridae and related transposable elements. These viruses share similarity in gene number, function, and order. Moreover, they all use a reverse transcriptase step in genome replication, indicating that they are evolutionarily related (Robinson, 1990). 2 T H E STRU CTU RE OF HBV VIRION The infectious HBV virions, under electron microscopy, appear as spherical particles with a diameter of 42nm-47nm. These particles are called Dane particles (Fig. 1-1). The Dane particle consists of an electron-dense spherical inner core with a diameter of 22-25 nm and an outer shell or envelope approximately 7 nm in thickness. The lipid-containing envelope bears HBV surface (S) antigen (HBsAg). The inner core or nucleocapsid is constituted by the HBV core (C) antigen (HBcAg), the viral DNA polymerase, and the viral genomic DNA. The genomic DNA is a partially double stranded circular DNA molecule of 3.2 Kb in length, the smallest of any animal DNA virus identified so far. The minus strand of the DNA molecule is unit length, with a protein covalently linked to its 5' end; whereas the plus strand is less than unit length, with an oligoribonucleotide attached to its 5' end (Fig. 1-1 and Fig. 1-2). The length of the plus strand varies in different DNA molecules and the circularity is maintained by a 5' cohesive terminus of 224 bp ( For a review, see Ganem and Varmus, 1987). These unique features result from the novel replicative mechanism of the HBV genome. G EN O M IC O RGA N IZA TION O F HBV HBV has a very compact genome organization. Its 3.2 Kb DNA genome contains four overlapping open reading frames, all encoded by the minus strand DNA (for reviews, see Ganem and Varmus, 1987; Yen,1993) (Fig. 1-2). The S gene, which includes pre-Sl, pre-S2, and S regions delineated by three in-frame initiation codons, encodes the viral surface antigens in the virion envelope. Translation initiation from 3 Fig. 1-1. Diagrammatic representation of the structure o f HBV virion (Dane particle). Three forms of viral surface proteins present on the outer envelope are indicated. Embedded within the envelope is the icosahedral nucleocapsid which encapsulates the partially double-stranded HBV-DNA genome as well as the viral DNA polymerase. The 5' ends of the minus and plus DNA strands are attached to a protein primer and RNA primer, respectively. Dane Particle( 42 nm ) w Core Protein Pre-Si (large surface) Protein ^ Genomic DNA Pre-S2 (middle surface) _ Protein ™ ^ Terminal Protein S (major surface) Protein RNA Primer 5 Fig. 1-2. The HBV genome and its transcription units. Innermost circles: structure of virion DNA; small open circles: location of four viral promoters and two enhancers; boxes: viral open reading frames (ORFs); arrows: direction of transcription and translation; outermost gray lines: major viral transcripts. + stran 7 these three ATG codons generates large, middle, and major surface proteins, respectively. The C gene encodes the capsid protein of 21 Kd as well as the clinically defined 16 Kd e antigen (HBeAg). The e antigen is the processed and secreted form of the precore protein whose translation is initiated at an in-frame ATG codon 5' upstream of the core ATG. The P gene encodes a 90 Kd viral polymerase which has a reverse transcriptase activity and serves as the protein primer for minus strand synthesis. The X gene codes for the 17 Kd X protein which has been shown to have transactivation function (Aufiero et al., 1990; Colgrove et al., 1989) and may play a role in HBV associated hepatocellular oncogenesis (Kim et al., 1991). HBV GENE TRANSCRIPTION The HBV Transcripts Four groups of mRNA have been identified so far for HBV (Fig. 1-2) and correlated with specific functions in the viral life cycle. The 3.5 Kb and 2.1 Kb RNAs are abundant transcripts, consistent with their roles in providing the major structural components of the virion. The 2.4 Kb and 0.7 Kb RNAs are relative minor transcripts, correlated with the synthesis of the minor large envelope protein and of the regulatory X protein, respectively (for reviews, see Ganem and Varmus, 1987; Schaller and Fischer, 1991). Generation of these transcripts are controlled by four promoters and two enhancers. Synthesis of the genomic transcripts (3.5 kb RNAs) is controlled by the core promoter which has been mapped to a 150-bp region upstream of the genomic RNA start site (Yee, 1989). These longer-than-genome-size transcripts comprise the entire genome length and include a short terminal redundancy which is essential for genome replication and circularization. The 5' ends of the genomic transcripts are heterogeneous. Based upon the presence or absence of the precore translation initiation 8 codon, the genomic transcripts can be further grouped into two subsets, designated as precore mRNA and C-mRNA/pregenome, respectively. The longer precore mRNAs are the templates for the synthesis of the precore protein with the core antigen determinants at its C-terminus. The addition of so-called precore region to the core enables the precore protein to be translocated into the endoplasmic reticulum (ER), where it undergoes cleavage of its C-terminal basic domain and is then secreted as the e antigen (Ou et al., 1986). The slightly shorter C-mRNA/pregenome is the most abundant among the genomic transcripts. It is indispensable for HBV replication and morphogenesis since it serves as mRNA for synthesis of the structural capsid protein and, by internal translation initiation, of the polymerase. In addition, it is also the template for reverse transcription to generate the viral DNA genome. The 2.4 Kb mRNA is the transcript for the large surface protein, the pre-Sl protein. This mRNA possess a unique 5' end (Will et al., 1987) and is transcribed under the control of the liver specific pre-Sl promoter (Chang et al., 1989, Raney et al., 1990; Zhou and Yen, 1991). The pre-S2/S promoter directs the transcription of 2.1 Kb subgenomic RNAs which, like the genomic transcripts, also display heterogeneous 5' ends, here bracketing the preS2 initiator codon (Standring et al., 1984). As a result, the longer transcripts bearing the Pre-S2 AUG allow the translation of the middle surface protein, whereas the shorter transcripts bearing S AUG serve for the expression of the small surface protein ( the major envelope protein). The 0.7 Kb RNA is the shortest among HBV transcripts. It is synthesized under the control of the X promoter and serves as the mRNA for the X protein. All these HBV transcripts are unspliced and polyadenylated at a common 3' terminus which is 20 nucleotides downstream of the conserved TATAAA sequence in the core gene coding region (Ganem and Varmus, 1987). It is interesting that HBV is able to generate longer-than-genome-size mRNA (e.g. genomic transcripts) by reading through this element once and terminates on the second pass of this site. It has been suggested that the distance between the promoter and the termination signal is important for regulating termination (Guo et al., 1991). Cis-Acting Elements The ENI Enhancer Two enhancers have been found within the HBV genome so far. Of these, the ENI enhancer is located between the S gene and the X gene coding sequences and partially overlaps with the X gene promoter (Shaul et al., 1985; Tognoni et al., 1985) (Fig. 1-2 and Fig. 1-3). It has been demonstrated that this ENI enhancer can activate all four viral promoters (Antonucci and Rutter, 1989; Hu and Siddiqui, 1991) as well as the heterologous promoters in cis in a liver-specific manner (Su and Yee, 1992). Extensive deletion mapping and mutagenesis experiments suggest that ENI can be further divided into a basal enhancer module (BEM) and an accessory enhancer module (AEM) ( Guo et al., 1991) (Fig. 1-3). The basal enhancer module exhibits a liver- specific enhancer activity and is constituted by at least three different protein factor binding sites named 2c, GB, and EP/EF-C sites (Ben-Levy et al., 1989: Dikestein et al., 1990; Garcia et al., 1993; Guo et al., 1991; Ostapchuk et al., 1989). The cellular protein factors bound to GB site and EP/EF-C site have recently been identified as HNF4/RXRa and RFX1, respectively (Garcia et al., 1993; Huan and Siddiqui, 1992; Siegrist et al., 1993). The 2c site has been suggested to be bound by a liver-specific transcription factor (Guo et al., 1991; Trujillo et al., 1991), and its nature will be discussed in Chapter 2 of this thesis. The AEM contains two major protein factor binding sites named E and NF1 sites. The E site is recognized by C/EBP (Johnson et al., 1987; Pei and Shih, 1990) and API (Faktor et al., 1990) which may mediate transactivation of ENI enhancer by HBV X protein (Faktor and Shaul, 1990; Maguire 10 et al., 1991). Recently , a HNF3 site has also been identified between NF1 and API sites (Ori et al., 1995) (Fig. 1-3). The X Promoter The X promoter is located between nucleotide 1168 and 1323 and partially overlaps with ENI enhancer ( Siddiqui et al., 1987; Treinin and Laub, 1987; Trujillo et al., 1991) (Fig. 1-3). There are no TATA nor GC box sequences in this region, but a 23-bp sequence centered at nt 1239 has been suggested to be the potential initiator for X gene transcription and to be bound by a yet unidentified protein factor called XBP (Nakamura and Koike, 1992; Yaginuma et al., 1993). Two major mRNA start sites have been mapped at nucleotide position 1239 and 1246 which are about 130 bp upstream of X coding sequence (Trujillo et al., 1991; Hu and Siddiqui, 1991), although some other sites around those two have also been reported (Treinin and Laub, 1987; Yaginuma et al., 1993). Deletion mapping analyses suggest that the E site of the accessory enhancer module is also an essential component of the X promoter complex (Guo et al., 1991; Trujillo et al., 1991). ENII Enhancer and the Upstream Regulatory Sequence of the Core promoter The ENII enhancer which is mapped between nucleotides (nt) 1636 and 1741 (Yuh and Ting, 1991) can be divided into two components: the A component (nt 1636- 1686) and the B component (nt 1686-1741) (Fig. 1-3). The B component is the minimal ENII enhancer component and the A component is a modulating component which can enhance the activity of the B component (Wu et al., 1992). The ENII enhancer can activate the two S gene promoters and the X promoter in an orientation and position-independent manner (Su and Yee, 1992; Wang et al., 1990). However, this enhancer can only enhance the core promoter activity in an orientation and position- 11 Fig. 1-3. (top) Schematic illustration of ENI enhancer/X promoter and ENII enhancer/C promoter regions of HBV. BEM: basal enhancer module; AEM: accessory enhancer module; BCP: basal core promoter; CURS: core up-stream regulatory sequence. (bottom ) A schem atic representation o f cellu lar protein factors interacting with the ENI/X promoter region. X promoter Neg. Reg. Element i 1 ------1 i ---------- 1 ----------- 1 StuI SphI BamHI Styl ( 1115) ( 1235) ( 1403) ( 1646)________ IbEM ; AM ~j--------------- 1 -------------------- 1. A . i B BCP ' r — ' ' U U C J ^ ® C Esite ■ mSNA binding site ENI enhancer CURS/ENII enhancer X prom oter HNF3 HNF4 RFX1 . c~) iii « I dc Site I GBViye I site NF1 C/EBP Nf1 _C=T» ,C =^ » , I £ site I NF1 sire I API Basal enhancer module A ccessory enhancer module 13 dependent manner and, thus, in the context of the core promoter, has been called the "core upstream regulatory sequence" (CURS) (Yuh et al., 1992). The core promoter is highly liver specific (Honigwachs et al., 1989). Foot-printing analyses by several groups have shown binding by cellular proteins to a large stretch of DNA in this region. However, the identity of these proteins and their contribution to the function and liver specificity of the core promoter remain largely unknown. In this thesis, I have characterized one such factor which is a liver enriched transcription factor named HNF4. HNF4 binds to the ENII/CURS region and activates the core promoter (Chapter 3). In addition, I have identified a negative regulatory element located upstream of the CURS (Chapter 3 and 4). Both HNF4 and the negative regulatory element are important for regulating the liver specificity of the core promoter. The Basal Core Promoter (BCPi The basal core promoter has been mapped between nucleotides 1744 and 1804 of the HBV genome by deletion mapping (Yuh et al., 1992; Zhang and McLachlan, 1994). The canonical TATA box often found in the polll promoters (Hori and Carey, 1994) is not present in the BCP. Since TATA box is often important for specifying the precise transcription initiation at a site ~ 30 nt downstream (Breathnach and Chambon, 1981), its absence may be responsible for the observed 5'-end-heterogeneity of the C gene transcripts. Recent studies by Chen et al. (1995) suggests that the two A+T-rich regions between nucleotide 1750 and 1800 may be able to serve as the site for the formation of the transcription initiation complex. Transcription factors binding to the BCP region include Spl and HNF4 (Zhang et al., 1993; Zhang and McLachlan, 1994). The Pre-Sl Promoter The pre-Sl promoter, located between nt 2729 and 2809 (Raney et al., 1994) is 14 the only HBV promoter which contains a canonical TATA box, giving rise to a single transcript with a defined 5' end (Will et al., 1987). This promoter is highly liver specific, presumably due to the binding of liver-enriched transcription factors HNF1 and HNF3 to this region (Chang et al., 1989; Raney et al., 1990; Raney et al., 1995; Zhou and Yen, 1991). When tested by linking to a CAT reporter gene, the pre-Sl promoter shows comparable strength as the S promoter (Antonucci and Rutter, 1989; Chang and Ting, 1989). However, in both infected hepatocytes and transfected cells in culture, the amount of pre-Sl transcripts specified by the viral genome is much lower than the amount of S transcripts (Bulla and Siddiqui, 1989; Zhou and Yen, 1990). As I will discuss in Chapter 5, this is likely due to a CCAAT element in the S promoter region which is important for suppressing the pre-Sl promoter activity. The S Promoter The S promoter is embedded in two overlapping open reading frames (ORF P and ORF PreSl) (Fig. 1-2) and is located between nt 3035 and 3170. It contains several Spl binding sites (Raney et al., 1992), and a CCAAT element has been demonstrated to be important for high S promoter activity (Zhou and Yen, 1991). The S promoter does not contain a recognizable TATA box. Instead, it comprises two initiation elements responsible for the initiation of the pre-S2 and S transcripts, respectively (Zhou and Yen, 1991). REPLICATION OF HBV Resembling the replication strategy of reUoviruses, HBV genome is replicated via a RNA intermediate by reverse transcription (Ganem and Varmus, 1987) (Fig. 1-4). After entry of the vims into the hepatocyte, the partially double stranded HBV-DNA is 1-4. The life cycle of hepatitis B virus (see text for details). nucleus ccc DNA . /V/Vs; < \ A s \ V W \ cytoplasm core protein mRNA • polymerase RNA prim er % • • surface proteins 16 first transported to the nucleus, where it is got repaired and becomes covalently closed circular DNA (ccc DNA). Then the transcription from cccDNA begins, generating four groups of transcripts including the 3.5 kb pregenomic RNA. Subsequently, the viral proteins are produced. The core proteins encapsidate the pregenomic RNA together with the viral polymerase to form the nucleocapsid. Within the nucleocapsid, the minus strand DNA is then reverse transcribed from the pregenomic RNA by the viral polymerase using a protein primer also derived from the viral polymerase. The plus strand DNA is subsequently synthesized from the minus strand using an oligomer of viral RNA as the primer. During the synthesis of viral genome, the nucleocapsid, through the interaction with the envelope proteins in the ER membrane, is translocated across the ER membrane and then secreted out of the cell as a mature virion. THE GOAL OF THIS THESIS Hepatotropism is one of the most striking features of HBV infection. Although HBV DNA has been detected in other nonhepatic tissues such as kidney, bile duct epithelium, and peripheral blood leukocytes, it only actively replicates in human hepatocytes (Blum et al., 1983; Dejean et al., 1984; Lamelin and Trepo, 1990). It is the disruption of the normal anatomy and functions of the liver that underlies the pathogenesis of hepatitis B virus (Israel and London, 1991). Several possible mechanisms can be suggested to be responsible for the hepatotropism of hepatitis B virus. For example, HBV may require a liver specific receptor for attachment, a liver factor for uncoating and/or a liver cell environment to support the transcription and replication of the viral DNA. While the first two possible mechanisms remain to be verified, there is substantial evidence to support that liver specific expression of HBV genes is at least partially responsible for the liver tropism 17 of HBV. For example, transfection of HBV DNA into hepatoma cell lines, but not nonhepatic cell lines, can lead to the production of viral particles (Chang et al., 1987; Sells et al., 1987; Sureau et al., 1986; Yaginuma et al., 1987). Furthermore, the requirement for hepatoma cells to produce HBV viral particles in these transfection experiments can be circumvented if the expression of the pregenomic RNA is directed by an exogenous promoter rather than by the endogenous core promoter (Junker et al., 1987; Seeger et al., 1989), suggesting that a block to virus production in nonhepatic cells is at the level of transcription. In order to better understand the liver tropism of hepatitis B virus, I have thus decided to characterize the cis-acting elements and trans-acting factors which regulate the liver specific gene expression of HBV. My research attention has been focused on the core promoter and its regulatory elements since the core promoter plays a significant role in the HBV life cycle. Specifically, experiments were conducted to study: (1) mechanisms underlying the liver specificity of the ENI enhancer (Chapter 2); (2) mechanisms responsible for the liver specificity of the core promoter (Chapter 3); and (3) functional role of a negative regulatory element upstream of the core promoter (Chapter 4). In addition, I have carried out experiments to study the mechanisms that regulate surface gene expression (Chapter 5). 18 CHAPTER 2. REGULATION OF HEPATITIS B VIRUS ENI ENHANCER ACTIVITY BY HEPATOCYTE-ENRICHED TRANSCRIPTION FACTOR HNF3 ABSTRACT Hepatitis B vims (HBV) ENI enhancer can activate the expression of HBV and non-HBV genes in a liver-specific manner. By performing the electrophoretic mobility- shift assays, we demonstrated that the three related, liver-enriched, transcription factors, HNF3-alpha, HNF3-beta and HNF3-gamma, could all bind to the 2c site of the HBV ENI enhancer. Mutations introduced in the 2c site to abolish the binding by HNF3 reduced the enhancer activity approximately fifteen-fold. Moreover, expression of HNF3 antisense sequences to suppress the expression of HNF3 in Huh-7 hepatoma cells led to reduction of the ENI enhancer activity. These results indicate that H.NF3 positively regulates the ENI enhancer activity and this regulation is most likely mediated through the 2c site. The requirement of HNF3 for the ENI enhancer activity could explain the liver-specificity of this enhancer element. 19 INTRODUCTION Hepatitis B virus is a small DNA virus with a high degree of liver-specificity. This liver-tropism is partially due to the preferential expression of HBV genes in hepatocytes. The genome of HBV is about 3.2 Kb. This genome contains four different genes named S, C, X and Pol. The S gene encodes the envelope proteins, the C gene encodes the capsid protein and a secretory e antigen, the X gene encodes a transcriptional trans-activator, and the Pol gene encodes a DNA polymerase required for the replication of the HBV genome (Ganem and Varmus, 1987). The expression of these four genes are regulated by four different promoters and two enhancers (for recent reviews, see Schaller and Fischer, 1991; Shaul, 1991; Yen, 1993). A silencer capable of regulating the C gene expression has also been identified in the HBV genome (Gerlach and Schloemer, 1992; Guo et al., 1993). One of the HBV enhancers, the ENI enhancer, partially overlaps with the X gene promoter and is located between the S gene and the X gene coding sequences (Fig. 2-1) (Shaul et al., 1985; Tognoni et al., 1985). This enhancer which can activate gene expression in cis exhibits a greater activity in cells of hepatic origin than in cells of nonhepatic origins. The HBV ENI enhancer is about 120 bp in length. This enhancer can be divided into a basal enhancer module and an accessory enhancer module (Fig. 2- 1) (Guo et al., 1991). The basal enhancer module exhibits a liver-specific enhancer activity and can activate the herpes simplex virus thymidine kinase (TK) promoter five or ten-fold, depending on the orientation, in hepatoma cells but not in other cell types. This enhancer module is constituted by at least three different protein factor binding sites named 2c, GB and EP/EF-C sites (Ben-Levy et al; 1989; Dikstein et al., 1990; Garcia et al., 1993; Guo et al., 1991; Ostapchuk et al., 1989). The accessory module has no enhancer activity by itself. It, however, can increase the enhancer 20 Fig. 2-1. Schematic illustration of the HBV ENI enhancer. BEM, the basal enhancer module; AEM, the accessory enhancer module. Arrow marked the X mRNA transcription initiation site. The ENI enhancer partially overlaps with the X gene promoter (Guo et al., 1991). The locations of 2c, GB and EP sites in the basal enhancer module are indicated. 21 activity of the basal enhancer module approximately ten-fold (Guo et al., 1991). The liver-tropism of the HBV ENI enhancer is likely due to the requirement of trans-acting liver-specific transcription factor(s) for its activity. Previous results have indicated that a liver-specific transcription factor binds to the 2c site of the enhancer (Guo et al., 1991; Trujillo et al., 1991). The nature of this liver-specific factor, however, was unclear. To understand the mechanism that regulates the activity of the ENI enhancer, we have characterized the protein factor that binds to the 2c site. Our results indicated that the transcription factor HNF3 could bind to the 2c site and positively regulate the ENI enhancer activity. HNF3 is a family of liver-enriched transcription factors which share a high degree of sequence homology in their DNA binding domains (Lai et al., 1991; Lai et al., 1993). The transcription factors HNF3- alpha, HNF3-beta and HNF3-gamma all belong to this HNF3 gene family. These three HNF3 factors can bind to the same DNA sequence with different affinities (Lai et al., 1993). The requirement of HNF3 for the ENI enhancer activity could explain the liver-tropism of this enhancer element. MATERIALS AND METHODS Cell lines and DNA plasmids Huh-7 is a human hepatoma cell line. This cell line was maintained in a 1:1 ratio of Dulbecco's modified essential medium (DMEM) and F I2 medium. The medium was supplemented with 5% fetal bovine serum. The construction of the plasmids pTK- HGH and pENI-TK-HGH has been described before (Guo et al., 1991). In pTK- HGH, the expression of the human growth hormone was regulated by the herpes simplex virus TK promoter. In pENI-TK-HGH, the ENI enhancer was inserted in a sense orientation upstream of the TK promoter. The plasmid pENm-TK-HGH was 22 identical to pENI-TK-HGH except that a six-nucleotide mutation was introduced in the 2c site (Fig. 2-4A). The construction of the expression plasmids for HNF3-alpha and HNF3-beta have been described before (Pani et al., 1992). For the construction of the HNF3-alpha and HNF3-beta antisense plasmids, the cDNA inserts were excised out using EcoRI and reinserted in the reverse orientation into the original vector. The expression of the HNF3-alpha and HNF3-beta sense and antisense sequences was under the control of the immediate early (IE) promoter of cytomegalovirus (CMV). In both the antisense constructs, the entire cDNA sequence was used. The HNF3-gamma expression plasmid was constructed by inserting the EcoRI fragment isolated from pTZ18U-HNF3 (a gift of Eseng Lai) into the EcoRI site of the plasmid vector pRc/CMV (Strategen). The HNF3-gamma antisense plasmid was constructed by the same way except that the cDNA was inserted in a reversed orientation. The expression of the HNF3-gamma sequences in these two plasmids was also under the control of the CMV IE promoter. For the construction of plasmids for in vitro transcription, the EcoRI fragment containing the entire coding sequence of either HNF3-alpha or HNF3-beta was isolated and inserted into the unique EcoRI site of the pSP65 vector (Promega). In the plasmid pTZ18U-HNF3, the HNF3-gamma cDNA sequence was inserted downstream of the T7 phage promoter. Electrophoretic mobilitv-shift assays The preparation of Huh-7 nuclear extracts has been described before (Guo et al., 1993). The double-stranded oligonucleotide DNA probe containing the 2c site sequence was end-labeled with gamma-32p-ATP and T4 kinase. Approximately 0.01 pmole of the end-labeled DNA probe was then incubated with 5-10 ug Huh-7 nuclear extracts. The binding reaction was carried out at room temperature for 30 minutes as 23 described (Guo et al., 1993). After the binding reaction, the sample was analyzed on a 6% polyacrylamide gel using our previous procedures (Guo et al., 1993). For the competition assays, the double-stranded oligonucleotide competitor was added during the binding reaction. For the "super-shift" assays, 1 ul antibody was added after the binding reaction. The reaction was then allowed to continue for another 30 minutes at room temperature before gel electrophoresis. The sequences of the 2c oligonucleotide DNA probe, the HNF3 oligonucleotide competitor (Rigaud et al., 1991) and the nonspecific oligonucleotide competitor used were: 2c: 5' GATCCAGGCCTTTCTAAGTAAACAGTACA 3' 3’ GTCCGG A A AG ATTCATTTGTCATGTCT AG 5’ HNF3: 5’ CT AG A AC A A AC A AGTCCTGCGT 3’ 3' GATCTTGTTTGTTCAGGACGCA 5' non-specific oligo: 5’ G AT ACT AGTTTGTTCCTA ATT AGC A AG ATCATTTGT 31 3' ATG ATCA A ACA AGG ATTA ATCGTTCTAGTA A AC A AC 5’ In vitro transcription and translation Details of the procedures for the transcription reaction using the SP6 or T7 RNA polymerase have been described before (Guo et al., 1993). For translation, 0.5-1 ug of RNA was incubated in a reaction containing 10 ul rabbit reticulocyte lysates (Promega). The reaction was carried out at 30®C for one hour. 0.5-1 ul of the translation mixture was then used for the electrophoretic mobility-shift assay. DNA transfection The cells were transfected with the C aP04 precipitation method using our 24 previous procedures (Guo et al., 1991). Two days after transfection, the medium was collected and analyzed for the growth hormone activity using the radioimmunoassay kit (Nichols Inst.). The cells were lysed and analyzed for the chloramphenicol acetyl transferase (CAT) activity. RESULTS Binding of HNF3 to the 2c site of ENI enhancer It has been previously reported that 2c site of the ENI enhancer is bound by a liver-specific protein factor (Guo et al., 1991). As shown in Fig. 2-2A, this site contains a sequence which is homologous to the consensus sequence of HNF3 binding sites (Overdier et al., 1994). HNF3 is a family of liver-enriched transcription factors which share a highly conserved DNA binding domain of about 100 amino acids (Lai et al., 1993). The HNF3 binding site has been identified in the promoters of a number of liver-specific genes including albumin, alpha-fetoprotein, alpha-anti-trypsin, transthyretin and tyrosine aminotransferase (Lai and Darnell, 1991). To investigate whether HNF3 is indeed capable of binding to the 2c site, nuclear extracts prepared from Huh-7 cells, a human hepatoma cell line, were used for the electrophoretic mobility-shift assay (EMSA). As shown in Fig. 2-2B, three major shifted bands were detected on the gel when a double-stranded oligonucleotide containing the 2c sequence was used as the probe. The signal of band I was weak and not very-well resolved from band II. However, this weak signal was visible in other experiments (see below). The signals of these three bands could be competed away with an oligonucleotide containing the sequence of either the 2c site (Fig. 2-2B, lane 3) or the HNF3 binding site of the rat tyrosine aminotransferase gene promoter (Rigaud et al., 1991) (Fig. 2-2B, lane 4), but could not be competed away with an oligonucleotide containing a non-specific sequence 25 Fig. 2-2 (A) Comparison of the 2c sequence of the HBV ENI enhancer with the consensus sequence of the HNF3 binding sites. The HBV 2c sequence shown is the lower strand sequence of nucleotides 1122-1134 (Guo et al., 1991). The HNF3 binding sequence was from Overdier et al. (1994). (B) The binding of protein factors to the 2c site was suppressed by an HNF3 oligonucleotide. The double-stranded oligonucleotide containing the 2c sequence was end-labeled with 32p ancj incubated with the nuclear extract prepared from Huh-7 hepatoma cells for the electrophoretic mobility-shift assay (EMSA). Lane 1, free 2c DNA probe; lane 2, nuclear extract added; lane 3, nuclear extract plus 30 ng 2c oligonucleotide; lane 4, nuclear extract plus 30 ng HNF3 oligonucleotide; and lane 5; nuclear extract plus 40 ng of a non-specific (NS) oligonucleotide. The locations of the three shifted bands are marked with I, II and III. The sequences of the oligonucleotides used are described in Materials and Methods. 26 A 2C Site ACTGTTTACTTAG I I 1 1 1 ! 1 1 I 1 1 I HNF3 Consensus AATG TTTACTTAG T A G G T CT B Competitor - - 2c HNF3NS 1 2 3 4 5 27 (Fig. 2-2B, lane 5). These results indicated that the 2c factor was likely to be HNF3. The possibility that the 2c factor was HNF3 was further investigated by the experiments shown in Fig. 2-3A. In these experiments, HNF3-alpha, HNF3-beta and HNF3-gamma were synthesized in vitro using the rabbit reticulocyte lysates. As shown in the figure, all the three protein factors synthesized in vitro could bind to the oligonucleotide containing the 2c sequence. Note that the mobilities of the shifted DNA bands generated by HNF3-alpha, HNF3-beta and HNF3-gamma were similar to those of the shifted bands I, II and III, respectively. It is likely that bands I, II and III were generated by binding of HNF3-alpha, HNF-beta and HNF3-gamma, respectively, to the DNA probe. This speculation was further investigated by another set of experiments using the antibodies directed against HNF3 factors. As shown in Fig. 2- 3B, lane 4, addition of anti-HNF3-alpha to the binding reaction containing the 2c DNA probe and the Huh-7 nuclear extract resulted in the removal of the signal of band I from the gel. Although the removal of the signal is not apparent due to the close proximity of the signal of band II, it was apparent in another experiment (see below). Addition of anti-HNF3-beta to the binding reaction resulted in the "super-shift" of most of the signals of band II (Fig. 2-3B, lane 5), indicating that HNF3-beta was present in the band II complex. The signal of band I was clearly visible after the super-shift of the signal of band II. The signal of band I disappeared if anti-HNF3-alpha was also added to the binding reaction (Fig. 2-3B, lane 6). These results indicated that HNF3-alpha and HNF3-beta were present in the band I and band II complexes, respectively. The possibility that band III was a complex generated due to binding of HNF3- gamma to the 2c DNA probe was examined using anti-HNF3-gamma. As shown in Fig. 2-3C, addition of anti-HNF3-gamma to the binding reaction resulted in the removal of a significant fraction of the signal of band III. This result indicated that part of the signal of band III was generated due to binding by HNF3-gamma to the DNA 28 Fig. 2-3. Characterization of protein factors binding to the 2c site of the HBV ENI enhancer. (A) EMSA using individual HNF3 factors. Individual HNF3 factors were synthesized in vitro using the rabbit reticulocyte lysates. Lane 1, free 2c DNA probe; lane 2, Huh-7 nuclear extract added; lane 3, HNF3-alpha added; lane 4, HNF3-beta added; lane 5, HNF3-gamma added; and lane 6, control reticulocyte lysate added. (B) EMSA with anti-HNF3-alpha and anti-HNF3- beta. Lane 1, free DNA probe; lanes 2-6, Huh-7 nuclear extract added; lane 3, control rabbit serum added; lane 4, anti-HNF3-alpha added; lane 5, anti-HNF3-beta added; and lane 6, both anti-HNF3-alpha and anti-HNF3-beta added. The location of band I in lane 5 is denoted by dots. The signal of this band disappeared in lane 6 after the addition of anti-HNF3-alpha. This result is reproducible. The location of the super shifted band after the addition of anti-HNF3-beta is marked by an arrow. (C) EMSA with anti-H NF3-gam m a. Lane 1, free DNA probe; lanes 2-4, Huh-7 nuclear extracts added; lane 3, control rabbit serum added; and lane 4, anti-HNF3-gamma added. The signal of band III was significantly reduced in lane 4. Note that although anti-HNF3-beta could lead to super-shift of its target signal, anti-HNF3-alpha and anti- HNF3-gamma could only remove their respective target signals. This is presumably due to the disruption of the protein-DNA complex or suppression of DNA binding by the two latter antibodies (Lai et al., 1991; also R. Costa, unpublished observations). The anti-HNF3-alpha was made against amino acid 7-103 of HNF3-alpha and the anti- HNF3-beta was made against amino acid 7-86 of HNF3-beta. The anti-HNF3-gamma was a gift from Dr. E. Lai and has been previously described (Lai et al., 1991). All these antibodies were prepared in rabbits and did not cross-react. H uel. Ext HKF3B HNF33 HNF3T R * t f O . C on; Com. N > vo 30 probe. Since not all of the signal of band III was removed by anti-HNF3-gamma, other protein factors similar in size to HNF3-gamma might also bind to the DNA probe and contribute to the signal of band III. Thus, our results shown in Fig. 2-2 and Fig. 2-3 demonstrated that HNF3 could bind to the 2c site and is likely the 2c factor that regulates the ENI enhancer activity. Positive regulation of ENI enhancer activity bv the 2c site To investigate whether binding by HNF3 to the 2c site is important for the ENI enhancer activity, we have performed a mutagenesis experiment. A six-nucleotide mutation was introduced into the 2c site of the ENI enhancer (Fig. 2-4A). As shown in Fig. 2-4B, in contrast to the wild-type DNA sequence, the oligonucleotide containing the mutated sequence failed to remove the signals of shifted bands, indicating that the mutation introduced into the 2c site had effectively abolished binding by HNF3. The ENI enhancer containing the mutated sequence was then linked to the TK promoter and the human growth hormone (HGH) reporter. This plasmid, named pENmTK-HGH, was transfected into Huh-7 hepatoma cells. As shown in Fig. 2-4C, the mutation reduced the ENI enhancer activity approximately 15-fold. These results support the hypothesis that HNF3 binds to the 2c site and regulates the ENI enhancer activity. Positive regulation of the ENI enhancer activity bv HNF3 factors To further investigate whether HNF3 indeed positively regulates the ENI enhancer activity, we have performed cotransfection experiments using DNA plasmids that expressed the HNF3 antisense sequences. The HNF3 antisense plasmids were cotransfected with pENI-TK-HGH into the Huh-7 hepatoma cells. In the plasmid pENI-TK-HGH, the ENI enhancer was linked to the herpes simplex virus TK 31 Fig. 2-4. M utational analysis of the HNF3 binding site in the ENI enhancer. (A) Mutations introduced into the HNF3 binding site (2c site) of the ENI enhancer. Nucleotides mutated are shown in bold-faced small letter. The wild-type sequence is identical to the HBV sequence shown in Fig. 1A. (B) EMSA using the mutated 2c sequence as the competitor. Lane 1, free 2c DNA probe; lanes 2-4, Huh-7 nuclear extracts added; lane 3, 30 ng of wild-type 2c oligonucleotide added as the competitor; and lane 4, 30 ng of mutated 2c oligonucleotide used as the competitor. (C) DNA transfection into Huh-7 cells. 9 ug of the plasmids pTK-HGH (TK), pENI-TK-HGH (ENI-TK) and pENmTK- HGH (Mutant) were transfected separately into a 60 mm plate of Huh-7 cells. An additional 1 ug of pRSV-CAT (Guo et al., 1991) was included in the transfection experiments as an internal control for monitoring the transfection efficiency. The amount of the growth hormone expressed was measured with an RIA kit (Nichols Inst.) and normalized against the amount expressed from the pTK-HGH control. Each transfection experiment was repeated at least three times. The standard deviation is also shown in the figure. 32 A Wild typ e ACTGTTTACTTAG Mutant ACTGTacAgaTtc B Competitor: - - 2c mt 1 2 3 4 Relative activity (% K > O n o o o m 2 T" H 7s c 34 promoter and the human growth hormone reporter. As shown in Fig. 2-5, there was an inverse relationship between the amount of HGH expressed and the amount of the HNF3 antisense plasmids used for the co-transfection experiments. The suppression effect of the HNF3-a antisense plasmid was not as prominent as those of the HNF3-(3 and the HNF3-y antisense plasmids. This may be due to the relatively low level of expression of H NF3-a in Huh-7 hepatoma cells (see Fig. 2-2 and Fig. 2-3). The suppression curves generated by the HNF3-(3 and the HNF3-y antisense plasmids were similar. Note that although neither HNF3-(3 or HNF3-y appealed to constitute more than 50% of the total HNF3 amount in Huh-7 cells (Fig. 2-2), there was more than 60% of suppression of HGH expression when the amount of the HNF3-P or HNF3-y antisense plasmid used for the transfection experiment was high. This result was reproducible and may be caused by cross-hybridization of the antisense sequence to the related HNF3 sequences. All the members of the HNF3 gene family share a high degree of sequence homology in the DNA binding domain (Lai et al., 1993). Similar suppression results were obtained with a reporter plasmid containing only the basal enhancer module instead of the entire ENI enhancer (data not shown). To ensure that suppression of the HGH expression observed in Fig. 2-5 was not due to non-specific suppression of the TK promoter activity, a separate co transfection experiment was conducted using pTK-HGH, a control plasmid that contained only the TK promoter and the HGH reporter. The results indicated that the HNF3 antisense sequences had little effect on the TK promoter activity (data not shown). Thus, the results shown in Fig. 2-5 were in support of the results shown in Fig. 2-2 to Fig. 2-4 and indicated that HNF3 positively regulated the ENI enhancer activity. This regulation required only the basal enhancer module and was most likely mediated through the 2c site. 35 Fig. 2-5. Suppression of the ENI enhancer activity by HNF3 antisense sequences. 1 ug pENI-TK-HGH was co-transfected with the indicated amount of the antisense DNA plasmid into a 60 mm plate of Huh-7 cells. Similar to the experiments shown in Fig. 4C, 1 ug of pRSV-CAT was included in each transfection experiment for monitoring the transfection efficiency. The total amount of the DNA plasmids used for each transfection experiment was 15 ug. The difference was made up by including the required amounts of the control vector plasmid pRc/CMV (Strategen) in the transfection reactions. Each antisense suppression experiment was repeated at least three times. Similar results were obtained from all the experiments. Relative activity (%) 36 120 100 8 0 - 6 0 - 4 0 - HNF3 0 C HNF3 B HNF3 7 2 0 - 0 5 1 0 1 Amount of antisense plasmid (ug) 37 D ISC U SSIO N Previous studies have indicated that the 2c site of the HBV ENI enhancer is bound by a liver-specific protein factor (Guo et al., 1991; Trujillo et al., 1991). As shown in Fig. 2, the consensus HNF3 binding sequence is located in the 2c site. Using HNF3-specific antisera, we demonstrate that the 2c site is recognized by the HNF3 protein family. This site could be bound by HNF3-alpha, beta and gamma in vitro (Fig. 2-2 and Fig. 2-3). In addition, a mutation which abolished the binding of HNF3 to this site reduced the activity of the ENI enhancer approximately 15-fold, indicating that this HNF3 site is important for the ENI enhancer activity. The importance of HNF3 for the ENI enhancer activity was further supported by the observation that HNF3 antisense sequences suppressed the ENI enhancer activity in Huh-7 hepatoma cells (Fig. 2-5). These results together indicate that HNF3 positively regulates the ENI enhancer activity through the 2c site. Since HNF3 is a family of liver-enriched transcription factors, its requirement for the ENI enhancer activity could explain the liver-specificity of this enhancer element. We have examined whether the ENI enhancer can be activated by HNF3 in HeLa cells by performing co-transfection experiments using pENI-TK-HGH and HNF3 expression plasmids. HeLa cell is a cervical carcinoma cell line and does not express HNF3 (Lai et al., 1991). Surprisingly, our results indicated that HNF3 could not stimulate the ENI enhancer activity in HeLa cells. This could be due to the lack of a co-activator in HeLa cells for the HNF3 activity. We previously observed similar negative results of HNF3 in HeLa cells using CAT reporter constructs driven by four copies of the HNF3 binding site (Pani et al., 1992). As shown in Fig. 2-1, 2c site is juxtaposed to the GB site in the ENI enhancer. The GB site can be bound by HNF4 or RX Ra (Garcia et al., 1993; Huan and 38 Siddiqui, 1992). Since both HNF4 and RXR-alpha are liver-enriched transcription factors, it is also possible that HNF3 needs to interact with either of these two factors to activate the ENI enhancer. Garcia et al. (1993) reported that the ubiquitous transcription factor COUP-TF could also bind to the GB site and suppress the ENI enhancer activity. COUP-TF is a ubiquitous transcription factor which was previous identified due to its ability to bind to the chicken ovalbumin upstream promoter (Garcia et al., 1993). The inability of HNF3 to stimulate the ENI enhancer activity in HeLa cells could also be due to the suppression by COUP-TF. Since COUP-TF is also present in hepatocytes, it has been suggested that differential binding by RXR-alpha, HNF4 and COUP-TF to the GB site could lead to differential expression of HBV genes (Garcia et al., 1993). RXR-alpha, HNF4 and COUP-TF all belong to the steroid/thyroid nuclear receptor superfamily. Besides the GB site, as shown in Fig. 1, the basal enhancer module of the ENI enhancer also contains the 2c site and the EP site. Recent studies have provided compelling evidence that the EP factor is the transcription factor RFX1 (Siegrist et al., 1993). RFX1 is a ubiquitous transcription factor that binds to the X-box of the HLA class II promoter. The EP site can also be bound by c-abl, a member of the non receptor class of tyrosine kinases (Dikstein et al., 1992). The role of c-abl in the regulation of the ENI enhancer, however, is unclear. In this report, we have demonstrated that the 2c factor is HNF3. With the identification of the protein factors that bind to the basal enhancer module, it is now possible to perform reconstitution experiments to examine how these protein factors interact with each other and the ENI enhancer to regulate HBV gene expression. Future research in this area will undoubtedly generate many interesting results. 39 CHAPTER 3. HEPATOCYTE-SPECIFIC EXPRESSION OF THE HEPATITIS B VIRUS CORE PROMOTER DEPENDS ON BOTH POSITIVE AND NEGATIVE REGULATION ABSTRACT The core promoter of hepatitis B virus shows hepatocyte specificity, which is largely dependent on an up-stream regulatory sequence that overlaps with viral enhancer II. Foot-print analyses by numerous groups have shown binding by cellular proteins over a large stretch of DNA in this region, but the identity of these proteins and their role in core promoter function remain largely unknown. We present data here, showing that the transcription factor HNF-4 is one such factor, as it activates the core promoter approximately 20 fold via a binding site within the up-stream regulatory sequence. Since HNF-4 is enriched in hepatocytes, its involvement at least partially explains the hepatocyte specificity of this promoter. In addition, however, we have found a region up-stream of the HNF-4 site that suppresses activation by HNF-4 in HeLa cells but not in hepatoma cells. Therefore, the cell-type specificity of the core promoter appears to result from a combination of activation by one or more factors specifically enriched in hepatocytes, and repression by other factor(s) present in non- hepatocytes, and may provide a convenient model system for studying this type of tissue-specific transcriptional regulation in mammalian cells. 40 INTRODUCTION Hepatitis B virus (HBV) has a small circular DNA genome of about 3.2 kilobases (kb) that codes for at least seven primary translation products from four open reading frames (for a review, see Yen, 1993). There are four promoters, which are activated by two separate enhancers. The core promoter (Fig. 3-1) gives rise to transcripts coding for the viral polymerase and both forms of the core (capsid) protein, as well as the pregenomic RNA that is reverse transcribed to become the viral genomic DNA. Therefore, it is a key promoter for viral replication and morphogenesis. Numerous groups have shown that the core promoter shows strong hepatocyte specificity (Honigwachs et al., 1989; Lopez-Cabrera et al., 1990; Su and Yee, 1992; Yuh et al., 1992), which may partially explain the hepatotropism of this virus. The cis-elements that are important for hepatocyte-restricted expression of the core promoter are just beginning to be defined, while the trans-acting factors that bind to these elements are largely unknown. Others have shown that the core promoter, like other promoters, can be divided into a basal region that specifies the sites of transcriptional initiation, and an up-stream region that increases the efficiency of transcription in hepatoma cells (Yuh et al., 1992). This up-stream regulatory sequence (URS) of the core promoter coincides with the second viral enhancer (Enll) (Yee, 1989), which activates the surface gene promoter (Zhou and Yen, 1990), and the laboratories of Siddiqui (Lopez-Cabrera et al., 1991) and Ting (Yuh and Ting, 1991) have shown that the transcription factor c/EBP and related factors bind to portions of Enll. Since these factors are hepatocyte-enriched, this finding may partially explain the cell-type specificity of the core promoter. However, c/EBP and related factors can act as a negative regulator of transcription (Imagawa et al., 1991; Lopez-Cabrera et al., 1991; Pei and Shih, 1990), and c/EBP is not expressed in hepatoma cells such as 41 HepG2 (Friedman et al., 1989), which nonetheless show high core promoter activity (Yuh et al., 1992). Furthermore, Yuh et al. (Yuh and Ting, 1991) have shown that the URS, unlike Enll enhancer, does not function independently of position and orientation, with regard to the core promoter. Therefore, distinct factors may be needed for this region of HBV DNA to function as the core URS, vs. its acting as Enll. In view of the importance of this question for the HBV life cycle, we have investigated the cis-elements and trans-acting factors needed for core promoter activity in hepatocytes. By cotransfection studies into HeLa cells, we show here that HNF-4 is one hepatocyte-enriched transcription factor (Sladek et al., 1990) that can activate the core promoter via its URS. Gel-shift, foot-print and methylation interference analyses confirm the presence of an HNF-4 binding site in this region of the HBV genome. Surprisingly, a region up-stream of this site can suppress the activation by HNF-4 in HeLa cells but not in HuH-7 hepatoma cells. Therefore, the hepatocyte-specificity of the core promoter is due to a combination of up-regulation by at least one hepatocyte- enriched factor, and repression by other factor(s) that are present in non-hepatocytes. MATERIALS AND METHODS DNA Plasmids A promoter-less plasmid pUCAT was first constructed by inserting the 1.6 bp HindlH-BamHI DNA fragment of the plasmid pBRCAT into the polylinker site of pUC18 vector. This DNA fragment contains the coding sequence of the reporter chloramphenicol acetyl transferase (CAT) and the downstream polyadenylation sequence. An HBV DNA fragment (Sphl-FspI fragment, map positions 1240-1806) (Valenzuela et al., 1980) containing the core promoter and its upstream regulatory sequence (URS) was inserted in the unique Hindlll site located upstream of the CAT 42 coding sequence in pUCAT. This resulted in the creation of the plasmid pUCATO. pUCATl, pUCAT7, pUCAT8 and pUCAT9 plasmids were constructed the same way, except that the HBV DNA fragments used for constructing these four different plasmids were BamHI-FspI (nucleotides 1404-1806), Styl-FspI (nucleotides 1646-1806), HincII-FspI (nucleotide 1688-1806) and StuI-FspI (nucleotides 1705-1806) fragments, respectively. Cell Culture and DNA Transfection HeLa cervical carcinoma cells were grown in Dulbecco's modified essential medium (DME) containing 10% fetal bovine serum. HuH-7 hepatoma cells were grown in a medium containing 1:1 ratio of DME and F12 medium with 5% fetal bovine serum. They were transfected with the calcium phosphate co-precipitation method, as previously described (Guo et al., 1991). Each 60 mm plate of cells were cotransfected with 2 ug of the reporter plasmid and 5 ug of the HNF4-expressing plasmid (pLEN4- S) (Sladek et al., 1990). For the control experiment, the plasmid pLEN4-S was substituted with the plasmid pLENO. pLENO is the parental plasmid of pLEN4-S and does not contain the HNF4 coding sequence (Sladek et al., 1990). The CAT assay results were analyzed by thin layer chromatography (Guo et al., 1991) and an Ambis image scanner. In most cases, 0.5 ug of the plasmid pTKHGH (Selden et al., 1986) was included in each co-transfection experiment for monitoring the transfection efficiency. pTKGH contains the human growth hormone sequence under the expression control of the herpes virus thymidine kinase (tk) promoter (Selden et al., 1986). The transfection efficiency was measured through the amount of human growth hormone expressed from pTKGH. The amount of growth hormone expressed was measured by a commercial radioimmunoassay kit (Nichols). 43 Nuclear Extracts and DNase I Footprint Analysis HuH-7 and HeLa nuclear extracts were prepared as described previously (Guo et al., 1991). For DNasel footprint analysis, the 650 bp EcoRI-Sall DNA fragment of pUCAT6 containing the core promoter (nucleotides 1404-1806) and a part of the downstream CAT coding sequence was end-labeled with y -^ P -A T P and T4 polynucleotide kinase and used as the probe. For DNase footprint analysis, 15 ug of the crude HuH7 nuclear extract or 30 ug of the crude HeLa nuclear extract was pre incubated with 2.5 ug of Poly(dI)(dC) on ice for 10 min in a 20 ul reaction mixture containing 12.5 mM Tris-HCl, pH 8.0, 0.5 mM MgCl2, 50 mM KC1, 0.5 mM EDTA and 5% glycerol. After the addition of the DNA probe (approximately 0.05 pmole), the reaction mixture was further incubated at room temperature for 10 min. The DNasel digestion reaction was then carried out as previously described (Galas and Schmitz, 1978). For competition experiments, 50 ng of the double-stranded oligonucleotide competitor was added to the reaction mixture together with poly(dI)(dC) prior to the addition of the DNA probe. The sequence of the oligonucleotide competitor containing the HNF-4 binding site of apolipoprotein CIII (apoCIII) promoter (Sladek et al., 1990) was: TCGAGCGCTGGGCAAAGGTCACCTGC AGCTCGCGACCCGTTTCCAGTGGACG And the oligonucleotide containing the GCN4 transcription factor binding site was purchased from Sdategene. In vitro translation and methvlation-interference experiments In order to synthesize the HNF4 RNA for m vitro translation, a DNA plasmid named pSP64-HNF4 was constructed by inserting the BamHI DNA fragment of the plasmid pLEN4-S (Sladek et al., 1990) into the unique BamHI site of the plasmid 44 vector pSP64 (Promega). This BamHI fragment of pLEN4-S contained the HNF-4 coding sequence. pSP64-HNF4 was linearized with the restriction enzyme SphI and used for RNA synthesis with SP6 RNA polymerase (Boerhinger Mannheim) (Ou et al., 1990). Protein translation reaction was carried out at 30°C for 1 hour. A typical translation mixture contained 10 ul rabbit reticulocyte lysate (Promega), 0.5 ul 1 mM amino acid mixture and 0.5 ug of HNF4 RNA. For the gel-shift assay, 2 ul translation mixture was mixed with 2.5 ug poly(dI)(dC) and 11 ul binding buffer (20 mM Hepes, pH 7.9, 40 mM KC1, 2 mM MgCl2, 0.5 mM EGTA, 1 mM dithiothreitol, 4% Ficoll) and incubated on ice for ten min. Afterwards, approximately 100,000 cpm of the DNA probe was added and the reaction was further earned out at room temperature for twenty min. The sample was then electrophoresed on a non-denaturing 5% polyacrylamide gel. The gel running buffer contained 25 mM Tris, pH 8.0, 25 mM sodium borate and 0.25 mM EDTA. The DNA probe used for the gel-shift assay was the Styl-StuI fragment (nt. 1646-1705) of HBV (Valenzuela et al., 1980). For the competition assay, the oligonucleotide competitor was added into the reaction mixture prior to the addition of the DNA probe. Methylation-interference experiments were carried out using our previous procedures (Guo et al., 1991). R ESU LTS Activation of core promoter by HNF-4 HeLa cells, which do not express HNF-4 and have previously been used for HNF-4 expression studies (Sladek et al., 1990), were used in our experiments for studying the effect of HNF-4 on HBV core promoter. To determine if HNF-4 can activate the HBV core promoter, a CAT reporter plasmid driven by the core promoter 45 with up-stream sequences was co-transfected into HeLa cells, together with an expression plasmid with or without the coding sequence for HNF-4. As seen in Figure 3-1, the presence of HNF-4 resulted in an almost 20 fold increase of CAT expression. This increase was largely dependent on a small fragment of the up-stream region, since a deletion of 44 bp (between the Styl and HincII sites) essentially abolished the effect. Yuh et al. (1992) reported that deletion of this Styl-HincII region could lead to reduction of more than 80% of the core promoter activity in both HepG2 and HuH-7 hepatoma cells. The most parsimonious interpretation of their results and ours is that the URS of the core promoter, between the Styl and HincII sites, contains a HNF-4 binding site important for its function in hepatocytes. Footprint analysis of core promoter As the first step in confirming the presence of a HNF-4 site in the core URS, we utilized DNase protection analysis to localize sequences in the core promoter that bind nuclear factors present in HuH-7 but not in HeLa cells. Since HNF-4 is not expressed in HeLa cells, the expectation was that by comparing the footprint patterns in these two cell types, a putative HNF-4 site may be identified in this fashion. However, as can be seen in Fig. 3-2 and as recently reported by Yuh et al. (1992), numerous footprints were seen in both cell types up-stream of the core transcript start sites, including the region between the Styl and HincII sites. While closer inspection reveals fine differences in the footprint patterns in the two cell types (Fig. 3-2C), no sequence in this region that shows differential footprint patterns bears obvious homology to the consensus HNF-4 site. As an alternative method to localize the putative HNF-4 site, we performed a competition footprint experiment. The DNase I digestion was repeated in the presence of an excess of unlabeled competitor oligonucleotides containing either an authentic 46 Fig. 3-1. Activation of HBV core promoter by HNF-4 transcription factor. The construction of the DNA plasmids and the transfection of cells are described in detail in Materials and Methods. Cells were co-transfected with the reporter plasmid and the HNF-4 expression plasmid with or without HNF-4 coding sequence. The core promoter strength reported under "CAT Activity" was determined based on the percentage of ^C-chloram phenicol acetylated. Fold activation was calculated by dividing the CAT activity expressed in the presence of HNF-4 with that expressed in the absence of HNF4. The results shown represent the average of the results of at least three independent experiments. Cp, core promoter. Shaded boxes represent the Enll enhancer. Styl HincII StuI 1646 1688 1705 PU C A T 7 I pU C A T 8 pU C A T 9 1688 \///////////7 7 7 \ 1705 HeLa Cells > p i 106 CA T CAT Activity 2.1 + 40.5 Fold Activation 19.3 CAT 1.8 5.1 2.8 CAT 1.1 2.5 2.3 48 Fig. 3-2. DNase I footprint analysis of the core prom oter and its upstream regulatory region (URS). Details for the DNase footprint experiments are described in Materials and Methods. (A) DNase I footprint analysis using HuH-7 nuclear extract. The five different footprints are indicated by numbers. (B) DNase I footprint analysis using HeLa nuclear extract. The locations of the four footprints are indicated by a, b, c and d. The HincII and Styl restriction sites in the URS are also shown. (C) The locations of the footprints in the core promoter sequence. The putative HNF-4 binding site identified by the competition experiment is shown in italics and bold-face. • < T U l U > N ) N w * I i; - i I I ) M « ^ t |l » m M M l: t K & . l » a * E w m m . p m m i m t i m m w ' O. r > c - M Hindi- > G + A No Extract HuH-7 Extract C D G + A No Extract HeLa Extract 4 + VO c 1521 . . . r -------- 5 -------- -- ACGGC-GCGCACCTCTCTTTACGCGGTCTCCCCGTCTGTGCCTTCTCATCTGCCGG 4 - - 7 7 TCCGTGTGCACTTCGCTTCACCTCTGCACGTTGCATGGAGACCACCGTGAACGCC ^---------------------- . -------------------------^------------------------ ^ 3 -------- C A T C A G A T C C T G C C C A A G G T C T T A C A T A A G A G G A C T C T T G G A C T C C C A G C A A T G T - d ------------------------------T s t y i c ---------------------- 2 ------------------------------- C A A C G A C C G A C C T T G A G G C C T A C T T C A A A G A C T G T G T G T T T A A G G A C T G G G A G G A THincIl ---------------------------------- b ------------------------------------------------------------------------------------ ^ ! ^ G CTGGGGGA GGA GATTAG G TTA A AG G TCTTTGTATTAGG AG G CTG TA GG CA CAA A a 1 7 9 5 L /l O 51 HNF-4 binding site from the apoCIII promoter, or a yeast GCN-4 site. As seen in Fig. 3-3A, the latter oligonucleotide had no discernible effect on the footprint pattern obtained with HuH-7 extracts; in marked contrast, the HNF-4 oligonucleotide completely effaced the down-stream portion of Footprint 3. This was not a non specific effect, since no change in the HeLa foot-printing pattern was seen with the same HNF-4 oligonucleotide (Fig. 3-3B). Therefore, the down-stream portion of Footprint 3 may contain a binding site for HNF-4. Localization of the HNF-4 site To confirm the footprint results and to localize more finely the HNF-4 binding site, we performed gel-shift and methylation interference assays. HNF-4 was synthesized by transcription and translation i n vitro, and used to bind a labeled fragment of HBV DNA containing this putative HNF-4 binding site (Fig. 3-2C). Specific binding was observed, since non-denaturing gel-electrophoresis revealed a shifted band that was competed by an unlabeled fragment bearing the authentic HNF-4 site but not by a fragment bearing the T7 promoter (Fig. 3-4). The gel-shift experiment was then repeated, but with DNA that had been lightly methylated with dimethyl sulfate. The DNA within the bands corresponding to free DNA and HNF-4-bound DNA were recovered, cleaved at the methylated residues with piperidine, and electrophoresed on a sequencing gel. As seen in Fig. 3-5, the free DNA was methylated not only on all the guanine residues but also on many of the other residues to a lesser degree (evidently due to conditions during the methylation reaction that favored modification of non-G residues). However, in the case of HNF-4 bound DNA, methylation was not seen on a stretch of approximately 25 residues within the up-stream portion of Footprint 3 (Fig. 3-5). These residues define contact points between HNF-4 and HBV DNA in the region of Footprint 3 (Fig. 3-6A), thereby 52 Fig. 3-3. Localization of the HNF-4 site with DNase footprint analysis. (A) DNase I footprint analysis using HuH7 nuclear extract. In lane 4, an oligonucleotide containing the HNF-4 binding site was used as the competitor; and in lane 5, an oligonucleotide containing the GCN4 binding site was used as the competitor. The location of the putative HNF-4 binding site as revealed by the competition analysis is indicated by the bracket. (B) DNase I footprint analysis using HeLa nuclear extract. In lane 4, the HNF-4 oligonucleotide was used as a competitor in the footprint reaction. Details of the competition experiments are described in Materials and Methods. <ai s 7 1 -* ■ m ro i|| co 4* { cn 1 m *m i J M i i v m m t t a m i m 1 — m *+ 1 1 niMi it m m t if t t t r c s m t i f .d e a n 1 1 i n tit t t 1 1 in m e i f m m m : 1 t : :r r x:Wr> G + A No Extract HuH-7 Extract Extract+HNF-4 Oligo Extract+GCN4 Oligo r o 1 m i f f i i f i m i i < f a i « r a n B « - r o | f t tf ( t ( g f l l i M U lH I8 fil(|:^ ( B f f iB i co I I I I {111 3lt fi HeLa E x t r a c t ^ j \ \\ \ \ \ \ l f i t C R H Ext r a c t + HNF - 4 O ligo G + A No E x t r a c t Ul U ) 54 Fig. 3-4. Gel-shift analysis for the binding of HNF-4 to the URS of the core promoter. Details of the gel-shift assay are described in Materials and Methods. The tick marked with HNF-4 denotes the location of the band that could be competed away by the HNF-4 oligonucleotide competitor but not by the non-specific oligonucleotide containing the T7 promoter sequence. The sequence of the non-specific oligonucleotide competitor was: GTG A ATTCT A AT ACG ACTC ACT AT AGGGCG C ACTTA AG ATT ATGCTG AGTG AT ATCCCGCCT AG FP, free probe; retie., a non-specific band caused by the reticulocyte lysate. 55 © S HNF-4 lysate X ) ^ i - - - 2 = I I ^ 0 1 5 10 40 0 ng HNF-4 competitor o o ii: O 0 0 0 0 0 40 ng nonspecific competitor Retie 1 2 3 4 5 6 7 8 56 Fig. 3-5. M ethylation-interference analysis of the HNF-4 binding site in the core promoter. Details of the analysis are described in Materials and Methods. Brackets denote the locations of the footprints. Free, free DNA probe; bound, the shifted HNF-4 band shown in Fig. 3-4. I i I I I I i ; l I t i I * I Bound U l -o Minus S trand 58 Fig. 3-6. (A) HNF-4 binding site in the core promoter as determined by m ethylation-interference experiments. The nucleotides on which methylation interferes with the HNF4-binding are shown in bold-face. The HNF-4 binding sequence as revealed by the DNase I footprint experiment is shown in italics. The sequence homologous to the consensus HNF-4 recognition sequence is underlined. The inverted repeats of the core portion of the HNF-4 binding site are denoted by dash- line arrows. Two direct repeats which are also present in the HNF-4 binding sequence are denoted by solid-line arrows. (B) Comparison of the HNF-4 binding sequence in the HBV Enll enhancer (or URS of the core promoter) and the consensus HNF-4 binding sequence (Sladek et al., 1990). i n ro A 1 6 4 6 — - - - - - - ► ► - 1 7 0 5 ' G C C C A A G G TC TIA C A T A A G A G G A C T C T T G G A C T C C C A G C A A T G T C A A C G A C C G A C C T T G A G G C C ' C G G G TTC C A G A A .TG TA T1C TCC1G AG AACC TG A G GG TCG TTAC AG TTG C TG G CTG G AA CTCCG G B HBV TCCAAGAGTCCT I I I 1 I I I I I H N F -4 ^GC^Aq G™ CA q Ui V O 60 confirming the presence of a HNF-4 binding site. This site shows partial identity to the consensus HNF-4 site (Fig. 3-6B), but is somewhat off-set from the region defined by the competition footprint experiments shown in Fig. 3 (Fig. 3-6A). The discrepancy between the two sets of experiments can probably be explained by the presence of other factors that bind in this region (see discussion, below). Presence of a dominant negative element in non-hepatocvtes In the course of these experiments, we noticed an apparently anomalous result. Specifically, when HNF-4 co-transfection studies were performed with the CAT gene driven by the core promoter with a fragment of HBV DNA that extended up-stream of the HNF-4 site (pUCATl in Fig. 3-7), HNF-4 activation of the core promoter in HeLa cells was significantly suppressed. This result was reproducible. Furthermore, a similar result were obtained when a DNA construct including a even larger fragment of up-stream sequences was used (pUCATO in Fig. 3-7). Therefore, there appears to be an up-stream dominant negative element that can override activation by HNF-4 in HeLa cells. Similar experiments were done using HuH7 hepatoma cells. Note that although HNF-4 activated CAT expression from the pUCAT7 DNA construct by almost twenty fold in HeLa cells, it has a much smaller effect in HuH7 hepatoma cells. This is presumably because of the presence of endogenous HNF-4 in HuH7 cells (unpublished observation). No apparent negative regulation of core promoter by the up-stream dominant negative element was observed in HuH-7 cells (Fig. 3-7), suggesting that the up-stream sequences needed a cell-type specific trans-acting factor for its negative activity. Therefore, in the context of the viral genome, the core promoter is inactive in non-hepatocytes not only because of the absence of HNF-4, but also because of the presence of a negative factor. 61 Fig. 3-7. Presence of a dominant negative elem ent in the URS of the core promoter. Similar to described in the Fig. 3-1 legend, the core promoter strength reported under title "CAT activity" was measured based on the percentage of l^C-chloramphenicol acetylated. Fold-activation is calculated by dividing the CAT activity expressed in the presence of HNF-4 with that expressed in the absence of HNF-4. The results shown are the average results of at least three independent experiments. pUCATO p U C A T l pU C A T7 SphI Styl H incII StuI FspI 1240 1646 1688 1705 Cp 1806 I I 1 _________ I I ---- BamH I 1404 I I I W / // / // / // .W / / / // / // / // / // A 1646 CAT CAT CAT H u H 7 C e l l s CAT Fold Activity A ctivation - + 7.0 11.8 1.7 9.2 17.1 1.9 7.2 14.7 2.0 H e L a C e l l s CAT Fold Activity Activation - + 0.7 1.5 2.1 1.0 2.7 2.7 2.1 40.5 19.3 C7\ to 63 D IS C U S S IO N The HBV core promoter is an important regulatory element for the high level expression of virion structural proteins and viral replication in infected hepatocytes. It has a high degree of cell-type specificity (Honigwachs et al., 1989), which is presumably important for the hepatotropism of HBV. In addition, because of the small size of the HBV genome, it can serve as a useful general model system for studying cell-type specific transcription. Recently, the URS of the core promoter has been shown by Yuh et al. (1992) to be critical for the high rate of transcription in hepatoma cells. In particular, they identified an important up-regulatory region (called CURS-A by them) that extends from map positions 1636 to 1703. Howevei\ the hepatocyte- enriched factors that activate the core URS had not been identified. In this paper we have presented data showing that the URS of core promoter can be activated by HNF-4, a hepatocyte-enriched transcription factor. This activation is dependent on the presence of a URS fragment between the Styl and HincII sites (map positions 1646 to 1688), which comprises the central portion of CURS-A. Nuclease protection analysis using hepatoma nuclear extracts revealed a footprinted region (map positions 1665 to 1705) that became sensitive to DNase digestion in the presence of an excess of oligonucleotides bearing an authentic HNF-4 site. Gel-shift experiments with HNF-4 synthesized in vitro confirmed the presence of a HNF-4 site in this region, but methylation interference analysis mapped the binding site to positions 1650 to 1674, slightly up-stream of the site defined by footprint competition. This apparent discrepancy can be partially explained by the fact that other factors apparently have binding sites that partially overlap with the HNF-4 site. For example, in HuH-7 cells, Footprint 3 was partially effaced by the HNF-4 oligonucleotide competitor (Fig. 3-3A), suggesting the binding of HNF-4 and at least one other protein factor to this 64 region. This separate factor(s) could mask a part of the sequence when HNF-4 is competed away. In addition, there may be other HuH-7 cell-specific factors that are recruited to this region of the DNA by HNF-4; this phenomenon would extend the apparent HNF-4 site in the competition footprint analysis. For these reasons, and because methylation interference is a more direct assay for the binding site, we believe that positions 1650 to 1674 contain the actual HNF-4 site. This conclusion is bolstered by the fact that the bottom strand in this region shows moderate homology (9/12 identical residues) to the consensus HNF-4 site (Fig. 3-6B). The core portion of this homologous region is actually repeated once in the opposite orientation immediately up stream (Fig. 3-6A). Therefore, it is possible that more than one molecule of HNF-4 binds in this region. If so, this would account for the relatively large size (25 bp) of the binding site identified by methylation interference. Activation by HNF-4, a hepatocyte-enriched factor, can at least partially explain the hepatocyte specificity of the core promoter. However, the presence of HNF-4 appears to be insufficient to activate the core promoter in non-hepatocytes, when sequences further up-stream of the HNF-4 sites are present (i.e., in a situation similar to that found in the native viral genome). Deletion analysis reveals the presence of an up-stream region that acts as a dominant negative element, i.e., it prevents HNF-4 function. This element presumably acts by binding to a cellular factor that is either not expressed or inactive in HuH-7 hepatoma cells. Therefore, there are at least 2 layers of control to ensure hepatocyte-specific expression of the core promoter: activation by HNF-4 and probably other hepatocyte-enriched factors, and repression by factor(s) present in non-hepatocytes. The combination of positive and negative regulation in tissue-specific gene expression has been previously described for mammalian genes (for reviews, see Foulkes and Sassone-Corsi, 1992; Mitchell and Tjian, 1989). For the HBV core 65 promoter, the reason for this apparent duplication of effort may be ascribed to the fact that HNF-4 is not strictly liver-specific. Rather, the kidney and intestine also express HNF-4 (Sladek et al., 1990). Therefore, the presence of the negative element may be necessary for prevention of inappropriate expression in non-hepatocytes that express HNF-4. Interestingly, transgenic mice bearing the entire HBV genome expresses the core gene in the liver and kidney, but not the intestine (Farza et al., 1988). Therefore, it is possible that the negative trans-acting factor is present in intestinal cells but not kidney cells. Lastly, HNF-4 shows homology to the steroid/thyroid hormone family of receptors (Sladek et al., 1990). The ligand for HNF-4, if any, has not been identified. Nevertheless, this raises the interesting possibility that an extracellular factor can potentially influence HBV gene expression. If so, this may explain why there is great variation in the level of HBV expression from person to person, and even from hepatocyte to hepatocyte within the same person (Ray et al., 1976). In summary, we have presented data showing that the HBV core promoter shows hepatocellular specificity for two reasons. First, the hepatocellular-enriched factor HNF-4 binds to the core URS and activates core gene transcription. Second, an as yet unidentified factor in non-hepatocytes represses core promoter activity via a site up-stream of the core promoter. Because of the small size of the HBV genome, it will be relatively straightforward to identify the cis-element and trans-acting factor involved in this negative regulation. Therefore, the core gene may provide an ideal model system for studying tissue-specific transcription that depends on a combination of positive and negative regulation. 66 CHAPTER 4. CELL TYPE-DEPENDENT REGULATION OF THE ACTIVITY OF THE NEGATIVE REGULATORY ELEMENT OF THE HEPATITIS B VIRUS CORE PROMOTER A B STR A C T The Hepatitis B virus (HBV) core promoter regulates the expression of the core protein, the precore protein and the viral DNA polymerase. This promoter is transactivated by HNF4, a liver-enriched transcription factor, through an HNF4 binding site located upstream of the core promoter. The transactivation activity of HNF4 on the core promoter is antagonized by a negative regulatory element (NRE) located upstream of the HNF4 binding site. While the NRE can effectively antagonize HNF4 to suppress the core promoter in HeLa cervical carcinoma cells, it has only a marginal suppressing activity on the core promoter in Huh7 hepatoma cells. By performing deletion-mapping experiments, we have found that the NRE contains at least three independent subregions named NREa, NREP and NREy. Each of these three subregions possesses a weak suppressing activity, but they together generate a strong synergistic suppressing effect on the core promoter. The NREy subregion is active in both HeLa and Huh7 cells and is bound by a protein factor slightly less than 130 kD in molecular mass. The NREa and NREP subregions are active in HeLa cells but not in Huh7 cells. Thus, the marginal suppressing effect of the NRE observed in Huh7 cells was mostly due to the activity of the NREy subregion. No clear protein factor binding sites could be identified in the NREa and NREP subregions when the 67 HeLa nuclear extract was used for the DNasel-foot-printing analysis, indicating weak or no protein association with these two subregions in this cell type. However, extensive protein factor binding sites could be identified throughout the sequences of these two subregions when the Huh7 nuclear extract was used for the analysis. These results indicate that a different set of protein factors binds to the N REa and NRE(3 subregions in Huh7 cells and may account for the inactivity of these two subregions in this cell type. Thus, our results indicate that the cell type-dependent activity of the NRE is due to differential regulation of the activities of the NREa and NRE(5 subregions by the cell types. This regulation is most likely mediated by cell type-dependent protein factors. 68 INTRODUCTION Hepatitis B virus (HBV) is a small DNA virus with a 3.2 Kb circular genome. Despite its small size, the HBV genome contains four overlapping open reading frames which generate at least seven viral gene products (for a review, see Robinson, 1990). These four open reading frames, which reside in the same DNA strand of the HBV genome, are expressed under the regulation of four different promoters named SI, S2, C and X promoters. The SI promoter regulates the transcription of the mRNA encoding the large surface antigen and the S2 promoter regulates the transcription of the mRNAs encoding the middle and the major surface antigens. These surface antigens are the viral envelope proteins. The C (core) promoter controls the transcription of the mRNAs encoding the core protein, the precore protein and the viral DNA polymerase. The core protein is the major capsid protein and the precore protein is the precursor of the serum e antigen (Ou et al., 1988). The latter has been suggested to be important for the establishment of persistent infection after neonatal infection (Chen et al., 1992). The X promoter regulates the transcription of the mRNA encoding the X protein. The X protein is a transcriptional transactivator which can activate the expression of PolII and PolIII genes (Aufiero and Schneider, 1990; Colgrove et al., 1989). The activities of these four promoters are regulated by two enhancer elements named ENI and ENII (Dikstein et al., 1990; Guo et al., 1991; Su & Yee, 1992). These two enhancer elements display liver-specificity due to the requirement of liver-enriched transcription factors for their activities (Chen et al., 1994; Garcia et al., 1993; Guo et al., 1993; Trujillo et al., 1991; Yuh and Ting, 1991). Besides the enhancer elements, the expression of the HBV genes are also regulated by cis-acting negative elements. A CCAAT element, which resides in the S2 promoter and is essential for the S2 promoter activity, has been shown to suppress the 69 SI gene expression (Chapter 5). In addition, we and others have identified a negative regulatory element (NRE) located upstream of the core promoter (Gerlach and Schloemer, 1992; Guo et al., 1993; Chapter 3). This NRE can antagonize the activity of HNF4 to suppress the core promoter. HNF4 is a liver-enriched transcription factor (Sladek et al., 1990). It can transactivate the core promoter approximately twenty-fold through an HNF4 binding site located upstream of the core promoter (Fig. 4-1) (Chapter 3). The NRE is located further upstream of the HNF4 binding site (Fig. 4-1). The regulation by these cis-acting negative elements may be important for temporal regulation of HBV gene expression. Several different viruses including papillomavirus and Epstein-Barr vims also contain cis-acting negative elements in their genomes (May et al., 1994; Montalvo et al., 1991). It has been suggested that these negative elements may play important roles for temporal regulation of viral gene expression and/or for the establishment of latent infection (May et al., 1994). While the HBV NRE can effectively antagonize the HNF4 activity to suppress the core promoter in HeLa cells, it has only a marginal suppression effect on the core promoter activity in Huh-7 hepatoma cells (Chapter 3). Thus, the activity of the NRE is cell type-dependent. How the cell types regulate the activities of the NRE remains unclear. In order to understand how the cell types regulate the NRE activity and to investigate the possible role of the NRE in HBV gene expression during HBV replication, we have further characterized this NRE. Our results reveal that this NRE contains at least three different cis-acting subregions which act synergistically to suppress the core promoter activity. One of the NRE subregions is active in both HeLa and Huh7 cells and is apparently recognized by a ubiquitous protein factor. The other two subregions are active in HeLa cells but not in Huh7 cells. These two subregions are bound by Huh7 specific factors, which may be the reason why these two subregions are inactive in this cell type. The inactivity of these two subregions in Huh7 cells can explain the weak activity of the NRE in this cell type. 70 M A TERIA LS AND M ETHODS DNA plasmids The construction of pUCAT and pUCATl has been described before (Guo et al., 1993). pUCAT is a promoterless construct which contains a unique Hindlll cloning site in front of the chloramphenicol acetyl transferase (CAT) reporter sequence. pU CA Tl is a derivative of pUCAT. In this plasmid, the HBV sequence from nucleotide 1403 to 1803 was inserted into the unique H indlll cloning site of the pUCAT vector. The construction of pUCAT2, pUCAT3, pUCAT3T, pUCAT4, pUCAT4T and pUCAT7 was similar to that of pUCATl except that different HBV sequences were inserted into the Hindlll cloning site of the pUCAT vector. pUCAT- NRE-S is identical to pUCATl except that an EcoRV site and an EcoRI site were created between nucleotides 1627-1642. For the construction of pUCAT-NRE-AS, the Smal-EcoRV fragment, which contains the HBV sequence, was isolated from pUCAT- NRE-S and reinserted back into the Smal-EcoRV site of the same plasmid in an inverted orientation. Thus, pUCAT-NRE-AS is almost identical to pUCAT-NRE-S except that the HBV sequence was inverted. pUCAT-NREg-MT is identical to pUCATl except that six point mutations were created between nucleotides 1606-1622 by site-directed mutagenesis. Cell culture and DNA transfection HeLa cervical carcinoma cells were maintained in Dulbecco's modified essential medium (DME) containing 10% fetal bovine serum (FBS). Huh-7 hepatoma cells were maintained in a medium containing 1:1 ratio of DME and F12 medium with 5% FBS. 71 The cells were transfected by the CaP04 precipitation method as previously described (Chen et al., 1994). For HeLa cells, each 60 mm plate of cells was transfected with 2 pg of the reporter plasmid and 5 pg of the HNF4-expressing plasmid, pHNF4-S (Guo et al., 1993; Sladek et al., 1990). pLENO, the parental plasmid vector of pHNF4-S (Guo et al., 1993; Sladek et al., 1990), was used to substitute pHNF4-S for the control experiments. For Huh-7 cells, since it contains endogenous HNF4, the HNF4 expression plasmid pHNF4-S was not used for co-transfection. The transfection of Huh7 cells was carried out with 7 pg of the reporter plasmid alone. The CAT assay was performed using our previous procedures (Chen et al., 1994). In most cases, 0.5 p g of plasmid pTKHGH was included in each cotransfection experim ent for monitoring transfection efficiency. pTKHGH contains the human growth hormone sequence under the expression control of the heipes virus thymidine kinase promoter (Chen et al., 1994). Transfection efficiency was monitored by measuring the amount of human growth hormone secreted from the transfected cells using a commercial radioimmunoassay (RIA) kit (Nichols). Nuclear extracts and DNase I foot-printing analysis HeLa nuclear extracts were prepared as described previously (Guo et al., 1991; Guo et al., 1993). For DNase I foot-printing analysis, the Sall-EcoRI DNA fragment of pUCAT6 (Guo et al., 1993) containing the HBV sequence (adw subtype) from nucleotide 1403 to 1803 was end-labeled with y-32p-ATP and T4 polynucleotide kinase and used as the probe. 30 ug of the crude HeLa nuclear extract was pre incubated with 2.5 pg of poly(dl-dC) on ice for 10 min in a 20 ul reaction mixture containing 12.5 mM Tris-HCl (pH 8.0), 0.5 mM MgC12, 50 mM KC1, 0.5 mM EDTA, and 5% glycerol. After addition of approximately 0.05 pmole DNA probe, the reaction mixture was further incubated at room temperature for 10 min. The DNase I digestion 72 reaction was then carried out as previously described (Guo et al., 1991). The sample was then analyzed on a 5% sequencing gel. Gel-shift and methvlation-interference assays The 50 bp HBV DNA fragment (nucleotides 1576 to 1626) or the 28-mer double-stranded oligonucleotides containing the following sequence: 5’ TCGAGCACGTTGCATGGAGACCACCGTG 3' 3'CGTGCAACGTACCTCTGGTGGCACAGCT 5' was end-labeled with y-32p-ATP and T4 polynucleotide kinase and used for the gel- shift assay. Approximately 20,000 cpm of the DNA probe was incubated with 5-10 (ig nuclear extract, 2.5 |ig poly(dl-dC) and 4 pg salmon sperm DNA in 20 pi of the gel- shift buffer (20 mM Hepes, pH 7.9, 40 mM KC1, 2 mM MgC12, 1 mM DTT, 4% Ficoll and 0.1 mM EGTA) at room temperature for 20 minutes. The sample was then electrophoresed on a non-denaturing 5% polyacrylamide gel. The gel running buffer contained 25 mM Tris (pH 8.0), 25 mM sodium borate and 0.25 mM EDTA. For the competition experiments, the competitors were incubated with the nuclear extract for 10 minutes on ice prior to the addition of the probe. For the methylation-interference experiments, the 50 bp DNA probe was methylated with dimethylsulfate as previous described (Guo et al., 1991) and used for the gel-shift assay. The shifted DNA band identified by autoradiography was isolated from the gel, cleaved with piperidine and analyzed on a sequencing gel as previously described (Guo et al., 1991). UV-cross-linking analysis For the preparation of the DNA probe for the UV-cross-linking experiment, the oligonucleotide 5'-CACGGTGG-3' was used as a primer and annealed to the upper strand of the 28-mer oligonucleotide mentioned above. The filling-in reaction was then 73 carried out at room temperature for one hour with 1 unit of Klenow enzyme and 37.5 pM each of dATP and dTTP and 100 pCi each of a-32P-dCTP and a-32P-dGTP (>3000Ci/mmol, ICN) (Wen and Locker, 1994). The UV-cross-linking experiment was performed based on the procedures of Black et al. (1994) with some modifications. The DNA probe approximately 100,000 cpm) was incubated with approximately 75 pg nuclear extract, 5 pg poly(dl-dC) and 10 pg salmon sperm DNA in 20 pi of the gel-shift buffer at room temperature for 20 minutes. The reaction mixture was then irradiated on ice for 30 minutes with 254 nm UV light from a distance of 4 cm and subjected to electrophoresis on a non-denaturing gel. After autoradiography, the gel slice containing the DNA-protein complex was isolated and the sample was eluted overnight in a 100 pi solution containing 300 mM Tris-HCl, pH 6.8, 6% sodium dodecyl sulfate (SDS), 70 mM dithiothreitol (DTT) and 15% glycerol. After a brief centrifugation in a microfuge to remove the gel debris, the supernatant containing the sample was mixed with an equal volume of the sample buffer (80 mM Tris-HCl, pH 6.8, 2% SDS, 100 mM DTT, 10% glycerol and 0.1% bromophenol blue). The sample was heated at 100°C for five minutes and electrophoresed on a 10% PAGE gel for analysis. R ESU LTS Multiple cis-acting subregions in the negative regulatory element (NRE) Previous studies have mapped the NRE to a 240 bp region in the X protein coding sequence (Guo et al., 1993; Chapter 3). To further characterize this NRE, we have performed deletion-mapping experiments in HeLa cells. The reporters were co transfected with the HNF4 expression plasmid pHNF4-S into cells. Our previous results have shown that, in the absence of the NRE, HNF4 could stimulate the core 74 promoter approximately twenty-fold (Chapter 3). However, as shown in Fig. 4-1, in the presence of the complete NRE sequence (i.e, the pUCATl construct), this stimulation is suppressed approximately eleven-fold. The deletion of the DNA sequence between nucleotides 1403 and 1455 did not increase the core promoter activity. However, further deletion of the sequences between nucleotides 1455 and 1519, 1519 and 1576, 1576 and 1646 led to a successive two- to three-fold increase of the core promoter activity. Similar results were obtained, if the deletion was initiated from the opposite end of the NRE sequence. As shown in Fig. 4-1, introduction of point mutations in the sequence located between nucleotides 1626 and 1646 to create an EcoRV restriction site and an EcoRI restriction site had no significant effect on the activity of the core promoter. However, the successive deletion of the sequences between nucleotides 1576 and 1646, 1519 and 1576, and 1403 and 1519 led to a successive two- to three-fold increase of the core promoter activity. Thus, the results shown in Fig. 4-1 narrow the sequence of the NRE to a 170 bp region located between nucleotides 1455 and 1626 and, in addition, indicate that this NRE contains at least three different functional subregions located between nucleotides 1455 and 1519, 1519 and 1576, and 1576 and 1626. These three different subregions, which we named N R E a (nt. 1455-1519), NREp (nt. 1519-1576) and NREy (nt. 1576-1626), individually possess a weak two to three-fold suppressing activity and together generate a strong synergistic eleven-fold suppressing effect. As shown in Fig. 4-2, no significant loss of the suppressing activity of the negative element was detected when its orientation was inverted. Thus, similar to a silencer element (Baniahmad et al., 1990), this negative element suppressed the core promoter in an orientation-independent manner. 75 Fig. 4-1 Deletion analysis o f the negative regulatory elem ent (NRE) of the HBV core promoter. The top panel, 5'-deletion analysis; the bottom panel, 3'-deletion analysis. Construction of the DNA plasm ids and the procedures for transfection of cells are described in Materials and Methods. The reporters were co-transfected with the HNF4 expression plasmid, pLEN4-S, into HeLa cells. Forty-eight hours after transfection, the cells were lysed and the CAT activities expressed were measured. The CAT activity of individual plasmid was normalized against that of pUCATl, which contains the entire NRE previously identified (Guo et al., 1993). The results shown represent the average of at least three different transfection experiments, a , P and y represent the three subregions of the NRE. HNF4 indicates the HNF4 binding site and Cp indicates the core promoter. NRE HNF4 CD W3 Relative CAT Activity 1403 1455 1403 1403 1403 1403 15 1 9 1576 1646 1626 ^1 646 1576 1519 1646 1646 1646 1803 1803 1803 1803 1803 1803 1803 1803 1803 1803 pUCATl pUCAT2 pUCAT3 pUCAT4 pUCAT7 pUCATl pUCAT-NRE-S pUCAT4T pUCAT3T pUCAT7 0\ 77 Fig. 4-2. Orientation-independence of the NRE activity. The reporters were co-transfected with the HNF4 expression plasmid, pLEN4-S, into HeLa cells and the CAT activities were measured forty-eight hours after transfection. The CAT activities of various plasmids were normalized against the CAT activity of pUCATl. The results shown represent the average of at least three independent transfection experiments. HNF4 Relative CAT Activity pUCATl pUCAT-NRE-S pUCAT-NRE-AS pUCAT-7 -J oo 79 Cell tvpe-dependent activity of the NRE We have previously shown that the NRE displays little suppressing activity on the core promoter in Huh-7 hepatoma cells (Chapter 3). To investigate why the NRE is inactive in Huh-7 cells, the core promoter with or without its upstream NRE was linked to the CAT reporter and transfected into Huh-7 cells. As shown in Fig. 3, the NRE suppressed the core promoter activity only approximately three-fold in Huh-7 cells (pUCATl vs. pUCAT7). This marginal three-fold suppressing activity was not significantly affected when the NREa and NREP subregions were deleted. This result indicates that the marginal suppressing activity of the NRE observed in Huh-7 cells was likely mostly due to the activity of the NREy subregion. This possibility is supported by the observation that the deletion of the NREy subregion from the NRE sequence was sufficient to restore most of the core promoter activity in Huh7 cells (Fig. 4-3). Thus, the results shown in Fig. 4-3 indicate that NREa and NREP subregions are inactive in Huh-7 cells and the marginal suppressing activity of NRE observed in this cell type was mostly due to the activity of the NREy subregion. Characterization of the NREy subregion To further characterize the NREy subregion, the DNA sequence from nucleotides 1576 to 1626 which contains the NREy subregion was isolated, end-labeled with 32p and use(j as the probe for the gel-shift assay. As shown in Fig. 4-4, a specific shifted signal denoted by an arrow was detected when the HeLa nuclear extract was used for the binding reaction. This signal was reduced to an almost undetectable level by a specific competitor containing the sequence identical to that of the probe. On the other hand, this signal was not affected by a non-specific competitor (Fig. 4-4). The protein factor binding site in the DNA probe was then analyzed with the methylation-interference assay. The same DNA probe methylated with dimethyl sulfate 80 Fig. 4-3. A nalysis of the NRE activity in H uh-7 hepatom a cells, a , (3 and y represent the NREa, NREP and NREy subregions, respectively. NRE 1403 1403 1803 <TjDClD s 1803 1646 1803 1646 1803 Relative CAT A ctivity pUCATl pUCAT4 pUCAT4T pUCAT7 oo 82 Fig. 4-4. The gel-shift assay of the NRE-y subregion. Details of the gel- shift assay are described in Materials and Methods. Approximately 10 p.g HeLa nuclear extract was used in the binding reaction for each sample except for the sample marked "Free Probe". For this control sample, no nuclear extract was used in the binding reaction. The amount of competitors used during the binding reactions are indicated above each lane. The specific competitor used was the non-labeled DNA probe. The non-specific competitor used was a double-stranded oligonucleotide containing the following non-specific sequence: 5' GATACTAGTTTGTTCCTAATTAGCAAGATCATTTGT 3’ 3' ATG ATC A A AC A AGG ATT A ATCGTTCT AGTA A AC A AC 5' The asterisks mark the location of two non-specific bands which were not removed by the specific competitor. These two bands were not detected when a different DNA probe containing a shortened NREy sequence was used for the gel-shift assay (see Fig. 4-7 A). The arrow marks the location of the specific shifted DNA band. 83 ja HeLa Nuclear Extract Competitors O I ---------------------------- 1 u ^ 0 2 5 30 0 0 ng Specific 0 > £ 0 0 0 0 30 100 ng non-specific 1 2 3 4 5 6 7 84 was used in the gel-shift assay. The shifted band denoted by an arrow in Fig. 4-4 was isolated and cleaved with piperidine. The cleaved DNA sample was then analyzed on a sequencing gel. As shown in Fig. 4-5A, a footprint was detected in both DNA strands. This assay allowed us to identify the protein factor binding site in the NREy subregion to the sequence located between nucleotides 1606 and 1622 (Fig. 4-5B). To determine whether this protein factor binding site represents the active site of the NREy subregion, we have performed a mutagenesis experiment by randomly mutating six nucleotides in the sequence located between nucleotides 1606 and 1622 (Fig. 4-5B). As shown in Fig. 4-6, this mutation increased the core promoter activity approximately two- to three-fold in both Huh7 and HeLa cells. This result indicates that the protein factor binding site located between nucleotides 1606 and 1622 indeed represents the active site of the NREy subregion. A double-stranded 28-mer oligonucleotide containing the mapped NREy sequence was then synthesized and used for the gel-shift assay. As shown in Fig. 4- 7A, a major shifted band was again detected when the HeLa nuclear extract was used for the binding reaction. A similar shifted band was also detected when the Huh7 nuclear extract was used for the reaction. Note that several minor shifted protein bands were also detected when the Huh7 nuclear extract was used for the binding reaction. These minor bands could be generated due to binding by different Huh7 protein factors or, perhaps more likely, due to degradation of the Huh7 protein factor. The signals of these minor shifted bands were significandy reduced when the Huh7 nuclear extract of a different preparation was used for the assay (data not shown). The results shown in Fig. 4-7A indicate that the same protein factor that binds to the NREy DNA probe is likely present in both cell types. This possibility is supported by the result of the UV- cross-linking experiment shown in Fig. 4-7B. As shown in the figure, a cross-linked protein factor with molecular mass of approximately 130 kD was identified when either 85 Fig. 4-5. (A) The methylation-interference assay. Details of the methylation- interference assay are described in Materials and Methods. G+A, the G+A sequence ladder; Free, the free DNA probe; Bound, the shifted DNA band shown in Fig. 4-4. Brackets mark the locations of the footprints. (B) The sequence of the footprints identified in (A). The sequence of the protein factor binding site is shown in bold face. Circles mark the G residues which methylation affects the protein binding. The point mutations introduced into the protein factor binding site are shown above the wild-type sequence. ► Bound Bound 00 O n T CTGC G 1576 o I I V l ^ 1626 GTCCGTGTGCACTTCGCTTCACCTCTGCACGTTGCATGGAGACCACCGTGA CAGGCACACGTGAAGCGAAGTGGAGACGTGCAACGTACCTCTGGTGGCACT 88 Fig. 4-6. M utation-analysis of the NRE-y subregion. The point mutations introduced into the NREy subregion increased the CAT activity expressed by the core promoter approximately two to three-fold in both Huh7 and HeLa cells. Solid box (WT), the wild-type reporter pUCATl; shaded box (MT), the mutant reporter pUCAT- NREy-MT. Details of these two plasmids are described in Materials and Methods. Relative CAT Activity O -* l\> 00 -fc 1 I 1 I I I l _ _ l -J oo vo 90 Fig. 4-7. (A) The gel-shift assay using both the HeLa and the Huh7 nuclear extracts. Details of the gel-shift assay are described in Materials and Methods. The DNA probe used is a 28-mer double-stranded oligonucleotide containing the NREy sequence mapped by the methylation-interference experiment. Lane 1, HeLa nuclear extract used for the binding reaction; lanes 2-4, Huh7 nuclear extract used for the binding reaction. Lane 2, no competitor added in the binding reaction; lane 3, 30 ng of the specific competitor added in the binding reaction; lane 4, 30 ng of the non specific competitor added during the binding reaction. The arrow marks the location of the shifted DNA band. (B) The UV-cross-linking analysis of the protein factor binding to the NREy subregion. Details of the UV-cross-linking experiment are described in Materials and Methods. Lane 1, HeLa protein factor cross-linked to the NREy DNA; lane 2, Huh7 protein factor cross-linked to the NREy DNA. 91 A Huh7 Extract B J Z c o S C Competitor 1 2 -2 0 0 K - 9 7 K - 6 3 K - 4 3 K 1 2 3 4 92 the HeLa or the Huh7 nuclear extract was used for the binding reaction. Excluding the molecular mass of the DNA probe, the protein factor that bound to the NREy subregion will likely be slightly less than 130 kD in size. Thus, our results shown in Fig. 4-7 suggest that the same NREy factor is present in both HeLa and Huh7 cells. The presence of the same NREy factor in both cell types could explain why this subregion is active in both cell types. Binding bv cell tvpe-specific protein factors to NREa and NREft subregions We have conducted a DNasel foot-printing experiment using the HeLa nuclear extract to examine the protein factor binding sites in the NRE. As shown in Fig. 4-8, the result reveals a major footprint (footprint I) which overlaps most of the active site of the NREy subregion shown in Fig. 4-5B. No apparent footprints were detected between nucleotides 1455 and 1576 which include the entire N R E a and NREP subregions. This result indicates a weak or no association of protein factors to this region. Interestingly, when the Huh-7 nuclear extract was used for the DNasel foot- printing experiment, extensive footprints were detected throughout the entire NRE sequence including the N REa and the NREP subregions (Fig. 4-8). These results indicate that a different set of protein factors binds to the NREa and NREP subregions in Huh7 cells. The binding by Huh7-specific protein factors to the N REa and NREP subregions may be the reason why these two subregions are inactive in Huh7 cells. D IS C U S S IO N The HBV core promoter is stimulated by the liver-enriched transcription factor HNF4 (Guo et al., 1993). This stimulation is suppressed in HeLa cells by an upstream negative regulatory element (NRE) in an orientation-independent manner (Fig. 4-2). In 93 Fig. 4-8. D N asel-foot-printing analysis of the NRE sequence. G+A, the G+A sequencing ladder; Free, no nuclear extract added; HeLa, HeLa nuclear extract added; Huh7; Huh7 nuclear extract added, a and (3 mark the locations of the N REa and NREP subregions identified by the deletion-mapping experiments, y marks the location of the active site of the NREy subregion. HNF4 indicates the HNF4 binding site previously identified by us (Guo et al., 1993). Note that Footprint I is the major footprint detected in the NRE sequence when the HeLa nuclear exuact was used for the foot-printing analysis. On the other hand, extensive footprints can be detected throughout the entire NRE sequence when the Huh7 nuclear extract was used for the analysis. The locations of the footprints are marked by lines which boundaries were arbitrarily defined. 94 ]HNF4 95 this report, we have demonstrated that this NRE is composed of at least three different subregions named N REa, NREP and NREy. 1° HeLa cells, these three subregions individually possess a weak suppressor activity and together generate a strong synergistic effect to suppress the core promoter activity (Fig. 4-1). The silencers of a number of genes including the chicken lysozyme gene (Baniahmad et al., 1990), the chicken vimetin gene (Garzon et al., 1994), and the collagen II gene (Savagner et al., 1990) also contain multiple independent functional subregions. Thus, the utilization of multiple functional subregions to achieve the optimal suppressing effect may represent one major mechanism through which the silencers exert their activities. While the NREy subregion is recognized by a protein factor approximately 130 kD in size in HeLa cells (Fig. 4-7B), the NREa and the NREp subregions are weakly or not associated with proteins (Fig. 4-8). It has been reported that binding by protein factors is not required for the NRE activity of the mammalian dihydrofolate reductase gene (Pierce et al., 1992) and for the transcriptional silencer activity of the late promoter of the human papilloma vims type 8 (May et al., 1994). It has been suggested that the rigid DNA structure may be sufficient to limit interactions of the protein factors that bind adjacent to the negative regulatory regions (May et al., 1994; Pierce et al., 1992). If N REa and NREP are indeed not recognized by protein factors in HeLa cells, then they may exert their activities to suppress the core promoter through a mechanism similar to that proposed for the dihydrofolate reductase gene and the late promoter of the human papilloma virus. It is interesting that the NRE of the late promoter of the HPV-8 also worked in an orientation-independent manner (May et al., 1994) which resembles that of the NRE of the HBV core promoter (Fig. 4-2). The NRE has only a marginal three-fold suppressing activity on the core promoter in Huh-7 hepatoma cells (Fig. 4-3). This apparently is due to the inactivity of the N REa and NREP subregions in this cell type (Fig. 4-3). The NREy subregion is 96 active in both Huh7 and HeLa cells. This may be due to the regulation by the same or similar NREy protein factor(s) in these two cell types (Fig. 4-7). Recently, Lo and Ting (1994) reported that a sequence located between nucleotides 1613 and 1636 could suppress the ENII enhancer activity of HBV. This sequence partially overlaps and may be structurally identical to the active site of the NREy subregion mapped by us. If these two elements are indeed identical, then the NREy subregion is a dual-function regulator and can suppress both the core promoter activity and the ENII enhancer activity. While we were unable to detect protein factor binding sites in the NREa and the NRE(3 subregions when the HeLa nuclear extract was used for the DNasel foot- printing analysis, extensive footprints were detected in these two subregions when the Huh7 nuclear extract was used (Fig. 4-8). Thus, the inactivity of the N R Ea and NREP subregions in Huh7 cells is likely due to binding by the Huh7-specific protein factors. It is not unprecedented that binding by protein factors suppresses the activity of a transcriptional silencer. As mentioned above, the activity of the transcriptional silencer of the late promoter of the human papilloma virus type 8 requires no protein factor binding. However, this transcriptional silencer is inactivated when it is bound by the human papilloma vims E2 protein (May et al., 1994). In summary, our results indicate that the cell type-dependent activity of the NRE of the HBV core promoter is due to differential regulation of the activities of the NREa and NREP subregions by different cell types. This regulation involves cell type- specific protein factors. It is possible that the activities of these two subregions are also differentially regulated during different stages of the replication cycle of HBV. This differential regulation will enable HBV to activate and suppress the expression of its core gene and may be very important for the replication of HBV. 97 CHAPTER 5. KEY ROLE OF A CCAAT ELEMENT IN REGULATING HEPATITIS B VIRUS SURFACE PROTEIN EXPRESSION A B STR A C T Two separate promoters, the up-stream preSl and the down-stream S promoters, give rise to transcripts encoding three forms of the hepatitis B virus surface protein. Over-production of large surface protein because of increased preSl transcripts leads to a block in secretion of all forms of the surface protein and of virion particles. We show here that a CCAAT element in the S promoter not only increases the amount of S transcripts, but also decreases the amount of preSl transcripts by up to 5 fold. Consequently, mutations in this element cause intracellular accumulation of surface proteins because of the secretary block. Therefore, this CCAAT element appeals to be critical for maintaining the high ratio of S versus preSl transcripts that is necessary for the viral life cycle. 98 The hepatitis B virus (HBV) genome contains four promoters, all on the same DNA strand (For reviews, see Ganem and Varmus, 1987; Yen, 1993). Two promoters give rise to transcripts that encode various forms of the surface (envelope) protein (Figure 5-1, top). Transcripts -2.4 kb in size, derived from the up-stream preSl prom oter, are translated into the full-length large surface protein, while 5' heterogeneous transcripts -2.1 kb in size, derived from the down-stream S promoter, are translated into the middle and small (major) surface proteins, which are initiated from internal in-frame ATG codons of the surface gene. Normally, in both infected hepatocytes and transfected cells in culture, the majority of surface proteins synthesized is the small form, and deliberate over-expression of large surface protein can inhibit the secretion of both sub-viral surface protein particles and virion particles from host cells (Bruss and Ganem, 1991; Chisari et al., 1986; Persing et al., 1986; Standring et al., 1986). Not surprisingly, therefore, the amount of preSl transcripts specified by the viral genome is much lower than the amount of S transcripts. Yet, when assayed in reporter gene constructs, the preSl promoter is of roughly comparable strength as the S promoter (Antonucci and Rutter, 1989; Bulla and Siddiqui, 1989; Chang and Ting, 1989). Part of this disparity may be explained by the fact that viral enhancer II, which is down-stream of both promoters, appears to activate preferentially the S promoter (Su and Yee, 1992; Zhou and Yen, 1990). In addition, Bulla and Siddiqui (1989) have shown that the S promoter, when present down-stream of the preSl promoter, can decrease the amount of preSl transcripts. The cis-element(s) of the S promoter responsible for this unusual negative regulation have not been precisely mapped. We report here that a CCAAT element that is the main up-stream activating element of the S promoter also down-regulates the amount of the preSl transcripts. Consequently, mutation of this element leads to dys-regulated surface protein expression, such that the secretion of surface proteins is blocked. 99 Figure 5-1. Top. Map o f the large B glll fragment of HBV strain adw in the plasmid PSAg. This region comprises the preSl and S promoters, the entire S open-reading frame (shaded box), enhancers I and II (ENI and ENII, respectively), and the HBV polyadenylation signal (@). The preSl region of the S open-reading frame is unique to the large surface protein, while the preS2 region is present in both large and middle surface proteins but not in the small surface protein. The preSl and S transcripts are shown as arrows above the DNA. The x open-reading frame is not shown, to preserve clarity. Bottom. Partial sequence of the S promoter, showing the major transcriptional start sites (rightward pointing arrows) and the CCAAT element (outline type). The sequences of the various linker-substitution (LS) mutants and the M2 mutant are shown above or below the wild-type sequence, respectively. P r e S l GGTGACCTAA RNA E n l l < ? E n l D N A L SI L S 3 L S 9 GGTGACCTAA CAATTCCTCCTCCTGCCTCCACCMTCGGC . Hi TGG M2 4 0 b a s e s . GGTGACCTAA . AGACAGTCATCCTCAGGCCATGCAGTGGAATTCCACTGCC o o 101 For these studies, we used the plasmid pSAg (Zhou and Yen, 1990), which contains the Bglll fragment of the HBV genome, comprising both the preSl and S promoters, the entire surface open-reading frame, and the viral polyadenylation signal (Fig. 5-1). We have generated a series of linker-substitution mutants with lesions in the S promoter of this plasmid, and transfected them with the calcium phosphate co precipitation method (Chen et al., 1994; Zhou and Yen, 1990) into HuH-7 human hepatoma cells, in order to define all of the cis-elements in this promoter. In the course of these studies, we noted that the mutation that destroyed the CCAAT element (LS3 in Fig. 5-1) not only significantly lowered the amount of the S transcripts, as expected from previous work (Zhou and Yen, 1991), but also dramatically increased the amount of the preSl transcripts (compare lane 3 to lane 1, Fig. 5-2A), as determined by primer extension, performed as described previously (Huang et al., 1993). This effect was seen with 2 additional clones of pSAg-LS3 (data not shown). Furthermore, Figure 5- 2B shows that similar data were obtained with an entirely different mutant (m2 in Fig. 5-1) that contained only 3 clustered point mutations, previously shown by Zhou et al. (1991) to prevent the binding of host cellular factor(s) to the CCAAT element. Therefore, the up-regulation of the preSl transcripts was due to the CCAAT mutations, and was not caused by the presence of an undetected mutation accidentally introduced elsewhere in the surface gene by our mutagenic manipulations, or by a fortuitous activity of the linker sequence. These results are in agreement with previous data of Bulla and Siddiqui (1989), showing that the S promoter region can down-regulate preSl transcript levels. Similar results were obtained when the LS3 mutations were introduced into the entire circular HBV genome, and the amount of preSl and S transcripts measured by either primer extension (Fig. 5-2C) or Northern blotting (Fig. 5-2D), demonstrating that these changes in surface gene transcript levels were neither an artifact of using a sub-genomic fragment nor of the primer extension assay. 102 Figure 5-2. Primer extension and Northern blot analysis of preSl and S transcripts in transfected cells. A. Primer extension analysis of preSl and S transcripts in cells transfected with wild-type pSAg, or the indicated linker-substitution mutant. Note that this is a composite picture of two gels, each from a separate reaction using either the preSl or S primer (Huang et al., 1993); the numbers on the right indicate migration positions of labeled size-standards. The S transcripts are expected to give products ranging in size from 105-136 bases (Zhou et al., 1990), while the preSl transcripts should give rise to products approximately 153 bases long (Huang et al., 1993). The S transcript start sites of the LS9 mutant are shifted relative to those of the wild-type, since pSAg-LS9 contains mutations within the initiation region (Zhou et al., 1991). B. Primer extension analysis of preSl and S transcripts synthesized in cells transfected with pSAg or the M2 mutant. C. Primer extension analysis of preSl and S transcripts synthesized in cells transfected with circular wild-type HBV DNA, or circular HBV DNA with the LS3 mutations. D. Northern blot of HBV transcripts in cells transfected with circular wild-type HBV DNA, or circular HBV DNA with the LS3 mutations, using the X gene region (Thai to Bglll sites, nucleotide numbers 1356- 1987) as probe, as described previously (Guo et al., 1991). S, S transcripts (2.2 kb); preSl, preSl transcripts (2.6 kb); C, core gene transcripts (3.4 kb); X, greater-than- genome-length x gene transcripts resulting from run-on transcription through the HBV polyadenylation signal on the first pass (3.9 kb) (Guo et al., 1991). The amount of X and C transcripts specified by HBV-LS3 appears to be slightly greater than that specified by the wild-type HBV. This may have been due to slight variations in RNA loading, or may indicate a small effect of the CCAAT element on these transcripts, as well. n HBV-LS3 > T O pSAg p i pSAg-Mc O U> 104 The CCAAT element may be indirectly regulating the amount of preSl transcripts because of a general dominance of the S promoter over the preSl promoter; i.e., any decrease in S promoter strength might lead to an increase in preSl transcript levels, and vice versa. To examine this possibility, we measured the levels of preSl and S transcripts specified by two other linker-substitution mutants of the S promoter (see Fig. 5-1 for sequences). As seen in Figure 5-2A, lane 2, the LSI mutant produced-increased amounts of S transcripts, yet did not produce decreased amounts of preSl transcripts. On the other hand, the LS9 mutant produced decreased amounts of S transcripts, but did not produce significantly increased amounts of preSl transcripts (lane 4, Fig. 5-2A). Therefore, there was not an inverse relationship between the amount of these two transcripts specified by these two mutants. Hence, it appeal's that the CCAAT element specifically down-regulates the preSl transcript levels, independent of its activation of the S promoter. It is well known that over-expression of the large surface protein relative to the small surface protein can lead to a block in the secretion of all forms of the surface protein, which then accumulate in intracellular membranes (Chisari et al., 1986; Persing et al., 1986; Standring et al., 1986). Since mutation of the CCAAT element leads to an approximately 15 fold increase in the ratio of preSl to S transcripts, as estimated by molecular Dynamics Phosphor Imager analysis, it seemed probable that this change in surface gene expression would prevent surface protein secretion. Indeed, quantitation of surface proteins synthesized by transfected cells, using a com m ercial radioimmunoassay kit from Abbott, revealed that pSAg-LS3-transfected cells secreted very little surface protein (Fig. 5-3A), yet still contained a substantial amount of intracellular surface protein (Fig. 5-3B). Thus, the LS3 mutation gave rise to a greater than 6 fold increase in the intracellular retention of surface proteins (Fig. 5-3C). This is 105 Figure 5-3. Quantitation o f surface proteins synthesized by transfected cells. A. Relative amount of secreted surface-proteins released into the medium by cells, transfected with wild-type pSAg, or pSAg with the LS3 mutations, as measured by Abbott radioimmunoassay. B. Relative amount of intracellular surface proteins in the same cells, as measured by radioimmunoassay. C. Relative ratio of secreted to intracellular surface proteins of these cells. All results represent the mean ± standard deviation of three independent transfections, and are normalized to the value measured or calculated for pSAg-transfected cells. Rel ati ve Ratio of Intracellular vs. S e c r e t e d Surface Prot ei n Re lat Iv e Amount o f S e c r e t e d Surface Protein Re lat Ive A mount of in tr acellular Surface Protein 107 an underestimate of the effect, since the radioimmunoassay appeal's to be less sensitive in detecting intracellular membrane-bound surface proteins than secreted surface protein particles (Huang et al., 1993), and since non-secreted surface proteins are subject to degradation (Persing et al., 1986). A different set of experiments led to the same conclusion. It has been previously demonstrated (Chisari et al., 1986; Ou et al., 1987; Persing et al., 1986; Standring et al., 1986, Huang and Yen, 1993) that small surface proteins are released from cells as subviral particles via the constitutive secretary pathway, while non secreted surface proteins (large surface protein or mixtures of large and small surface proteins) accumulate in the endoplasmic reticulum-Golgi intermediate compartment, which is localized in a perinuclear region. Therefore, the surface proteins in cells transfected with pSAg-LS3 should have a different sub-cellular location than in cells transfected with the wild-type pSAg. Immunofluorescent detection of surface proteins, performed as described (Huang et al., 1993), confirmed this expectation. In cells transfected with pSAg, there is a light, diffuse staining of the cytoplasm in a granular/reticular pattern (Fig. 5-4A). In contrast, cells transfected with pSAg-LS3 show a dense, lumpy perinuclear staining pattern (Fig. 5-4B), consistent with accumulation of surface proteins in an expanded intermediate compartment. Similar results were seen in cells transfected with the entire HBV circular genome containing the LS3 mutations (data not shown). In summary, we have presented evidence that the CCAAT element of the S promoter not only up-regulates the amount of s transcripts, but also decreases the amount of preSl transcripts, mutation of this element leads to dys-regulated surface protein synthesis, such that surface protein secretion is blocked. Therefore, this 108 Figure 5-4. Im m unofluorescence staining for surface proteins in cells transfected with (A) wild-type pSAg, or (B) pSAg-LS3. Bar represents 10 pm. 110 element is critical in maintaining a balanced synthesis of the various surface proteins, that is important for viral morphogenesis. It is of interest to note that excessive large surface protein synthesis, leading to accumulation of surface proteins in the intracellular membranes of hepatocytes (so-called ground glass cells), is commonly seen during chronic HBV infection (Gerber and Thung, 1985). our results suggest that either decreased activity of the cellular trans-acting factor(s) that act through this element, or mutation of the CCAAT element in the HBV genome, may be the basis for ground glass cell formation. Interestingly, several groups (Fiordalisi et al., 1994; Gerken et al., 1991; Nakajimaet al., 1994; Yamamoto et al., 1994) have described the appearance in chronic hepatitis B patients of mutant HBV genomes, that contain in-frame deletions that span the CCAAT element. Therefore, it would be of interest to determine if these mutants can give rise to ground glass cells. The mechanism by which the CCAAT element down-regulates preSl transcription is not clear. While it may repress transcriptional initiation, its location within the preSl transcribed region raises the possibility that it may act at the post- transcriptional level. For example, it could retard transcriptional elongation, block processing or transport of pre-mRNA, or destabilize the mRNA in the cytoplasm. Further experiments to understand the function of this unusual bifunctional element are underway. I ll CHAPTER 6. CONCLUSIONS The goal of this study was to characterize the cis-acting elements and trans acting factors which regulate HBV gene expression and to advance our knowledge of the molecular mechanisms underlying the hepatotropism of this virus. In particular, the attention was focused on the core promoter region. The core promoter, directing the synthesis of the 3.5 Kb genomic transcripts that serves as mRNA for viral DNA polymerase, capsid protein and precore protein as well as the pregenomic RNA for viral replication, plays a significant role in the HBV life cycle. Previous reports have indicated that the core promoter and its upstream ENI enhancer are preferentially active in liver cells (Honigwachs et al., 1989). However, the detailed mechanisms underlying this phenomenon have not been well characterized. Since both positive and negative regulation have been described as the mechanisms mediating tissue specific gene expression of several mammalian genes (for reviews, see Foulkes and Sassone-Corsi, 1992; Mitchell and Tjian, 1989), and the transcriptional activity for a given gene is mainly determined by the combination of cis-control elements and the availability of transcription factors, two possibilities were considered to explore the mechanisms responsible for the liver specific expression of the HBV core gene in this thesis: (1) Liver specific expression of the HBV core gene is due to the presence of positive regulatory factors in hepatocytes which is required to activate the core gene promoter. (2) Liver specific expression of HBV core gene is due to the absence of negative regulatory factors in hepatocytes which can silence the core promoter by interacting with negative regulatory sequence. 112 To address these questions, deletion mapping experiments were first carried out to characterize the related cis-acting elements. DNase I foot-printing and methylation interference experiments were then performed to map the protein factor binding sites. UV-cross linking and antibody super-shift experiments were conducted in order to further identify the protein factors. Our results suggest that the cell type specific expression of HBV core gene results from a combination of activation by two or more liver enriched transcription factors in hepatocytes and repression by other factor(s) in nonhepatocytes. The seminal results are summarized and future directions are discussed below. H epatocyte-enriched transcription factor HNF3 activates the ENI enhancer through the 2c site The ENI enhancer can profoundly up-regulate the core promoter activity in a liver specific manner (Antonucci and Rutter, 1989). 2c site in ENI enhancer was previously identified as the binding site of a liver specific factor by Wendy Guo in our laboratory (Guo et al., 1991). In chapter 2, I have demonstrated that this 2c site is crucial for the activity of the enhancer and are bound by three related members of hepatocyte-enriched transcription factors HNF3. Moreover, abolishment of HNF3 binding either by mutating the 2c site sequence or by suppressing the expression of HNF3 with HNF3 antisense plasmid leads to the reduction of ENI enhancer activity, suggesting that HNF3 proteins positively regulate the enhancer activity through the 2c site (Chapter 2). The conclusion that the 2c site is the target of HNF3 proteins is further supported by the observation that a similar DNase I footprint pattern with DNase I hypersensitive sites was detected in the 2c site region of ENI enhancer when either HuH7 (a liver cell type) nuclear extract or purified HNF3 proteins were used for the experiments (Guo et al., 1991; Ori et al., 1995). Since HNF3 is a family of liver- 113 enriched transcription factors, its requirement for the ENI enhancer activity may explain the liver specificity of this enhancer element. However, HNF3 proteins are not likely to be the only factor responsible for the liver specificity of enhancer I, because the enhancer could not be activated in HeLa cells (a cervical carcinoma cell line) by cotransfecting the HNF3 activators alone (Chapter 2). It is possible that other liver enriched transcription factors such as HNF4, c/EBP are required to work together with HNF3 to activate enhancer. While this may be true for the case of HBV enhancer, the observation that a reporter plasmid driven by four copies of the HNF3 binding site is not HNF3 responsive in HeLa cells (Pani et al., 1992) points to the other possibility that the activity of HNF3 is dependent on the tissue specific coactivators. The coactivator might either modify the protein or be involved in an interaction with the general transcription machinery. The involvement of a tissue specific coactivator of the latter type was recently reported for the OCT2 activator whose activity in B cells is coactivator dependent (Luo et al., 1992). It will be very interesting to find out whether such a coactivator of HNF3 exists in hepatocytes or not. The in vitro reconstitution experiments will allow us to detect and characterize these additional factors in the future. HNF4 is crucial for the liver specific core promoter activity As demonstrated in chapter 3, liver specific activity of the core promoter is also dependent on another hepatocyte-enriched transcription factor named HNF4 (Chapter 3). HNF4 binds to a site in the upstream regulatory region of the core promoter and is able to activate the core promoter activity by ~ 20-fold in HeLa cells. HNF4 is preferentially expressed in liver cells types. However, it is also detected in kidney and intestine cells (Sladek et al., 1990). The fact that HNF4 is not strictly liver-specific suggests that additional mechanisms may be involved to ensure the liver specificity of 114 the core gene. Our results revealed that the presence of a negative regulatory element located upsueam of HNF4 binding site might account for this additional mechanism (Chapter 3 and 4). A negative regulatory element regulates the liver specific activity of the core promoter Our data presented in Chapter 3 originally indicated that the negative regulatory element (NRE) suppressed the core promoter activity in HeLa cells, but not in HuH7 hepatoma cells. By further characterization and carefully repeating the previous experiments, we found that this NRE had a marginal 2-3 fold suppressing effect on the core promoter in HuH7 cells, while it had a strong 12-fold effect in HeLa cells (Chapter 4). The weak activity of NRE in HuH7 cells may be due to the fact that only one of the three subregions of NRE (NREy) is active in Huh7 cells; In HeLa cells, all three subregions are active. The inactivity of the other two subregions (NREa and NRE(3) in HuH7 cells is likely due to the absence of the inhibitory factors in HuH7 hepatoma cells or the presence of positive factors in Huh7 cells to antagonize the negative effect of NRE. The observation that these two subregions were occupied in footprint analysis by protein factors derived from HuH7 nuclear exdact but not from HeLa nuclear extract (Chapter 4) favors the latter possibility that anti-repressors may be present in HuH7 cells to antagonize the activity of NRE. It is interesting to note that these two subregions were neither occupied when rat adult liver nuclear extract were used for DNase I footprint analysis (Lopez-Cabrera et al., 1990), raising the possibility that N REa and NRE(3 subregions may be active in the normal liver cells in the early stage of HBV infection to suppress the core gene expression, but inactive in the late stage of infection due to the expression of HBV X gene. The observation that, in the absence of the X gene, the HBV core gene as well as the S genes were poorly expressed in the 115 liver of transgenic mice (Nagashima et al., 1993) supports this hypothesis. We suspect that the poor expression of the core gene in this case is partially due to the activity of NRE and one function of the HBV X gene is to activate the HuH7-specific protein factors to antagonize the suppressing activities of NREa and NREf), thus resulting in the increased core gene expression needed at the late stage of viral infection. Further characterization of the factors binding to NREa and NRE|3 subregions and DNase I foot-printing experiment using mouse liver nuclear extracts from X gene transgenic mice will help us to verify this hypothesis. If this hypothesis turns out to be correct, the NRE may play a role in the temporal regulation of HBV gene expression as well as in the regulation of liver-specific expression of the core gene. Protein factor (s) responsible for the NREy activity has a recognition site which displays a high degree of sequence homology to the consensus binding sequence of transcription factor RFX1 (Chapter 4) (Fig. 6-1), raising the possibility that RFX1 may be the inhibitory factor binding to NREy. This speculation is further supported by the following evidences: (1) Molecular weight of RFX1 is around 130 kd (Reith et al., 1990; Reinhold et al., 1995), consistent with the size of the presumed repressor derived from UV cross-linking experiment (Chapter 4). (2) RFX1 antibody is able to supershift the protein complex containing the presumed repressor (Fig. 6-2). (3) RFX1 is present in both liver and nonliver cell types (Reith et al., 1994), consistent with the detection of the presumed repressor in both HuH7 and HeLa cells (Chapter 4). (4) RFX1 has been shown to be able to activate or suppress gene expression in different cases ( Reith et al., 1988; Reinhold et al., 1995; Siegrist et al., 1993). In order to find out whether RFX1 can really suppress the core promoter activity or not, RFX1 expression plasmid were cotransfected into both HuH7 and HeLa cell types together with the reporter. Surprisingly, overexpression of RFX1 activates the core promoter instead of suppressing it. However, noting that RFX1 works in dimer (Reith 116 Fig. 6-1. Comparison of the NREy motif to the RFX1 consensus binding sequence (Reinhold et al., 1995). NREy Motif CGTTGCATGGAGACCACC l l l l l l l I I I I I I RFX1 Consensus NGTTGCANGGCAACN C T A TC 117 Fig. 6-2. Gel-shift analysis with anti-R FX l. Lane 1, free DNA probe; lane 2-4, HeLa nuclear extract added; lane 3, RFX1 antibody added; lane 4, control rabbit serum added. The location of the previously identified shifted band is marked by an arrowhead. The location of the super-shifted band after the addition of RFX1 antibody is marked by an arrow. 118 4-Supershift i -Free Probe 119 et al., 1994), one may argue that this seemingly confusing result is simply due to that RFX1 heterodimer but not homodimer is required for the suppressing effect of RFX1, and that RFX1 homodimer may act as an activator instead. Alternatively, it is possible that both RFX1 homodimer and heterodimer act as activators, but the presence of another juxtaposed protein factor binding site converts the heterodimer activators to repressors. This activator-to-repressor switching ability has recently been described for several transcription factors which have DNA bending ability (Natesan and Gilman, 1993; Lehming et al., 1994). One prominent example among them is a HMG box- containing transcription factor (Jantzen et al., 1990) called DSP1. DSP1 is able to convert NFkB from an activator to a repressor through a site located adjacent to the NFkB site in P interferon promoter (Lehming et al., 1994). It will be very exciting if such a switching factor also exists to regulate the RFX1 transcriptional activity on the core promoter. If there is any, it might play a significant role in HBV life cycle. Additional cloning efforts are required to elucidate these possibilities. A CCAAT element is critical for maintaining the high ratio of S versus preSl transcripts The possible requirement for a liver specific receptor for HBV infection have also been suggested to be the mechanism governing the hepatotropism of this virus. Since HBV envelope proteins are responsible for interacting with the receptor, the mechanisms regulating surface gene expression were also studied in this thesis. Our results have demonstrated that a CCAAT element of S promoter (Zhou and Yen, 1991) not only up-regulates the amount of S transcripts, but also down-regulates the amount of preS 1 transcripts (Chapter 5). Mutation of this element leads to the dysregulated surface protein expression, such that the secretion of the surface proteins is blocked. Therefore, this element is critical for maintaining a balanced synthesis of various 120 surface proteins which is important for the viral morphogenesis (Chapter 5). More importantly, dysfunction of this element may have some clinical implications in disease pathogenesis during HBV infection (see Chapter 5). There are several possible mechanisms the CCAAT element may employ to down-regulate preS 1 transcription. While it may repress transcriptional initiation, its location within the preSl transcribed region raises the possibility that it may act at the post-transcriptional level. For example, it could retard transcriptional elongation, block processing or transport of pre- mRNA from the nucleus to the cytoplasm, or reduce the mRNA stability in cytoplasm. Further experiments are needed to elucidate these possibilities. 121 BIBLIOGRAPHY Antonucci, T.K.and Rutter, W.J. (1989). Hepatitis B virus (HBV) promoters are regulated by the HBV enhancer in a tissue-specific manner. J. Virol. 63, 579-583. Aufiero, B., and Schneider, R. J. (1990). The hepatitis B virus X-gene product trans- activates both RNA polymerase II and III promoters. EMBO J. 9, 497-504. Baniahmad, A., Steiner, C., Kohne, A.C., and Renkawitz, R. (1990). Modular structure of a chicken lysozyme silencer: involvement of an unusual thyroid hormone receptor binding site. Cell 61, 505-514. Beasley, R.P., Hwang, L.-Y., Lin, C.-C., and Chien, C.-S. (1981). Hepatocellular carcinoma and hepatitis B virus-A prospective study of 22707 men in taiwan. Lancet 2, 1129-1133. Beasley, R.P. (1988). Hepatitis B virus: the major etiology of hepatocellular carcinoma. In: Fortner, J.R., and Rhoads, J.E. (eds). Accomplishments in cancer research: 1987 prize year. Lippincott, Philadelphia. pp80-106. Ben-Levy, R., Faktor, O., Berger, I., and Shaul, Y. (1989). Cellular factors that interact with the hepatitis B vims enhancer. Mol. Cell. Biol. 9, 1804-1809. Black, A.C., Cristina, C.T., Ruland, T., Luo, J., Bakker, A., Fraser, J.K., and Rosenblatt, J.D. (1994). Binding of nuclear proteins to HTLV-II cis-acting Repressive sequence (CRS) RNA correlates with CRS function. Virol. 200, 29-41. Blum, H.E., Stowring, L.., Figus, A., Montgomery, C.K., Haase, A.T., and Vyas, G.N. (1983). Detection of hepatitis B virus DNA in hepatocytes, bile duct epithelium, and vascular elements by in situ hybridization. Proc. Natl. acad. Sci. USA. 80, 6685- 6688 . Breathnach, R., and Chambon, P. (1981). Organization and expression of eukaryotic split genes coding for proteins. Annu. Rev. Biochem. 50, 349-383. Bruss, V. and Ganem, D. (1991). The role of envelope proteins in hepatitis B virus assembly. Proc. Natl. Acad. Sci. USA 88, 1059-1063. Bulla, G.A. and Siddiqui, A. (1989). Negative regulation of the hepatitis B virus preSl promoter by internal DNA sequences. Virol. 170, 251-260. Chang, C„ Jeng, K.-S., Hu, C.-P., Lo, S. J., Su, T.-S., Ting, L.-P. Chou, C.-K., Han, S.-H., Ptaff, E., Salfeld, J., and Schaller, H. (1987). Production of hepatitis B virus in vitro by transient expression of cloned HBV DNA in hepatoma cell line. EMBO J. 6, 675-680. Chang, H.K. and Ting, L.P. (1989). The surface gene promoter of the human hepatitis B virus displays a preference for differentiated hepatocytes. Virol. 170, 176-183. 122 Chang, H. K., Wang, B.Y., Yuh, C.H., Wei, C.L., Ting, L. P. (1989). A liver- specific nuclear factor interacts with the promoter region of the large surface protein gene of human hepatitis B virus. Mol. Cell. Biol. 9, 5189-5197. Chen, H.-S., Kew, M.C., Hornbuckle, W.E., Tennant, B.C., Cote, P.J., Gerin, J.L., Purcell, R.H. and Miller, R.H. (1992). The precore gene of the woodchuck hepatitis virus genome is not essential for viral replication in the natural host. J. Virol. 66, 5682-5684. Chen, I.-H., Huang, C.-J., and Ting, L.-P. (1995). Overlapping initiator and TATA box function in the basal core promoter of hepatitis B virus. J. Virol. 69, 3647-3657. Chen, M., Hieng, S., Qian, X., Costa, R. and Ou, J.-H. (1994). Regulation of hepatitis B virus ENI enhancer activity by hepatocyte-enriched transcription factor HNF3. Virol. 205, 127-132. Chisari, F.V., Filippi, P., McLachlan, A., Milich, D.R., Riggs, M., Sun, L., Palmiter, R.D., Pinkert, C.A. and Brinster, R. (1986). Expression of hepatitis B virus large envelope polypeptides inhibits hepatitis B virus surface antigen secretion in transgenic mice. J. virol. 60, 880-887. Colgrove, R., Simon, G., and Ganem, D. (1989). Transcriptional activation of homologous and heterologous genes by the hepatitis B virus X gene product in cells permissive for viral replication. J. Virol. 63, 4019-4026. Dejean, A., Lugassy, C., Zafrani, S., Tiollais, P., and Branchot, C. (1984). Detection of hepatitis B virus DNA in pancreas, kidney and skin of two human earners of the virus. J. Gen. Virol. 65, 651-656. Dikstein, R., Faktor, O., Ben-Levy, R., and Shaul, Y. (1990). Functional organization of the hepatitis B virus enhancer. Mol. Cell. Biol. 10, 3683-3689. Dikstein, R., Heffetz, D., Ben-Neriah, Y., and Shaul, Y. (1992). C-abl has a sequence-specific enhancer binding activity. Cell 69, 751-757. Faktor, O., Budlovsky, S., Ben-levy, R. and Shaul, Y. (1990). A single element within the hepatitis B virus enhancer binds multiple proteins and responds to multiple stimuli. J. Virol. 64, 1861-1863. Faktor, O., and Shaul, Y. (1990). The identification of hepatitis B virus X gene responsive element reveals functional similarity of X and HTLV-I tax. Oncogene 5, 867-872. Farza, H., M. Hadchouel, J. Scotto, P. Tiollais, C. Babinet, and C. Pourcel. (1988). Replication and gene expression of hepatitis B virus in a transgenic mouse that contains the complete viral genome. J. Virol. 62, 4144-4152. Fiordalisi, G., Ghiotto, F., Castelnuovo, F., Primi, D. and Cariani, E. (1994). Analysis of the hepatitis B virus genome and immune response in HBsAg, anti-HBs positive chronic hepatitis. J. Hepatol. 20, 487-493. 123 Flehmig, B., Mauler, R. F., Noll, G., Weinmann E., Gregersen, J. P. (1988). Progress in the development of an attenuated , live hepatitis A vaccine. In: Zuckerman A.J., ed. Viral hepatitis and liver disease. New York: Alan R Liss, pp. 87-90. Foulkes, N. S., and P. Sassone-Corsi. (1992). More is better: activators and repressors from the same gene. Cell 68, 411- 414. Friedman, A. D., W. H. Landschulz, and S. L. McKnight. (1989). CCAAT/enhancer binding protein activates the serum albumin promoter in culture hepatoma cells. Genes Dev. 3, 1314-1322. Galas, D., and A. Schmitz. (1978). DNase foot-printing: a simple method for detection of protein-DNA binding specificity. Nucl. Acids Res. 5, 3157-3170. Ganem, D., and Varmus, H. E. (1987). The molecular biology of the hepatitis B viruses. Annu. Rev. Biochem. 56, 651-693. Garcia, A. D., Ostapchuk, P., and Hearing, P. (1993). Functional interaction of nuclear factors EF-C, HNF4, and RXRa with hepatitis B virus enhancer I. J. Virol. 67, 3940-3950. Garzon, R.J., and Zehner, Z.E. (1994). Multiple silencer elements are involved in regulating the chicken vimentin gene. Mol. Cell. Biol. 14, 934-943. Gerber, M.A. and Thung, S.N. (1985). Molecular and cellular pathology of hepatitis B virus. Lab. Invest. 52, 572-590. Gerken, G., Kremsdorf, D., Capel, F., Petit, M.A., Dauguet, C., Manns, M.P., Zum Buschenfelde, K.H.M. and Brechot, C. (1991). Hepatitis B defective virus with rearrangements in the preS gene during chronic HBV infection. Virol. 183, 555-565. Gerlach, K. K., and Schloemer, R. H. (1992). Hepatitis B virus C gene promoter is under negative regulation. Virol. 189, 59-66. Guo, W .T., W ang, J., Tam, G., Yen, T.S.B. and Ou, J.H. (1991). Leaky transcription termination produces larger and smaller than genome size hepatitis B virus X gene transcripts. Virol. 181, 630-636. Guo,W., Bell, K. D., and Ou, J. H. (1991). Characterization of the hepatitis B virus Enhl enhancer and X promoter complex. J. Virol. 65, 6686-6692. Guo, W., Chen, M., Yen, T. S. B., and Ou, J. H. (1993). Hepatocyte-specific expression of the hepatitis B virus core promoter depends on both positive and negative regulation. Mol. Cell. Biol. 13, 443-448. Honigwachs, J. O. Faktor, R. Dikstein, Y. Shaul., and O. Laub.(1989). Liver- specific expression of hepatitis B vims is determined by the combined action of the core gene promoter and the enhancer. J. Viol. 63, 919-924. Hori, R. and Carey, M. (1994). The role of activators in assembly of RNA polymerase II transcription complexes. Curr. Opi. Genet. Develop. 4, 236-244. 124 Hu, K., and Siddiqui, A. (1991). Regulation of the hepatitis B vims gene expression by the enhancer element I. Virol. 181, 721-726. Huan, B., and Siddiqui, A. (1992). Retinoid X receptor RXRa binds to and trans- activates the hepatitis B virus enhancer. Proc. Natl. Acad. Sci. 89, 9059-9063. Huang, Z.M. and Yen, T.S.B. (1993). Dysregulated surface gene expression from disrupted hepatitis B virus genomes. J. Virol. 67, 7032-7040. Imagawa, M., S. Osada, Y. Kovama, T. Suzuki, P. C. Hirom, M. B. Diccianni, S. Morimura, and M. Muramatsu. (1991). SF-B that binds to a negative element in glutathione transferase P gene is similar or identical to trans-activator LAP/IL6-DBP. Biochem. Biophys. Res. Comm. 179, 293-300. Israel, J., and London, W. T. (1991). Liver structure, function, and anatomy: effects of hepatitis B virus. Curr. Top. Microbiol. Immunol. 168, 1-20. Jantzen, H.M., Admon, A., Bell, P.B., and Tjian, R. (1990). Nucleolar transcription factor hUBF contains a DNA-binding motif with homology to HMG proteins. Nature 344, 830-836. Johnson, P. F., Landschulz, W. H., Graves, B. J., and McKnight, S. L. (1987). Identification of a rat liver nuclear protein that binds to the enhancer core element of three animal viruses. Genes Dev. 1, 133-146. Junker, M., Galle, P., and Schaller, H. (1987). Expression and replication of the hepatitis B virus genome under foreign promoter control. Nucleic Acids Res. 15, 10117-10132. Kim, C.-M., Koike, K., Saito, I., Miyamura, T., and Jay, G. (1991). HBx gene of hepatitis B virus induces liver cancer in transgenic mice. Nature 351, 317-319. Lai, E., Prezioso, V. R., Tao, W., Chen, W. S., and Darnell, J. E., Jr. (1991). Hepatocyte nuclear factor 3 a belongs to a gene family in mammals that is homologous to the Drosophila homeotic gene fork head. Genes Dev. 5,416-427. Lai, E., Clark, K. L., Burley, S. K., and Darnell, J. E., Jr. (1993). Hepatocyte nuclear factor3/fork head or "winged helix" proteins: a family of transcription factors of diverse biologic function. Proc. Natl. Acad. Sci. USA 90, 10421-10423. Lai, E., and Darnell, J. E., Jr. (1991). Transcriptional control in hepatocytes: a window on development. TIBS 16, 427-430. Lamelin, J.-P. and Trepo, C. (1990). The hepatitis B virus and the peripheral blood mononuclear cells: a brief review. J. Hepatol. 10, 120-124. Lehming, N., Thanos, D., Brickman, J., Ma, J., Maniatis, T., and Ptashne, M. (1994). An HMG-like protein that can switch a transcriptional activator to a repressor. Nature 371, 175-179. 125 Lo, W.-Y., and Ting, L.-P. (1994). Repression of enhancer II activity by a negative regulatory element in the hepatitis B vims genome. J. Virol. 68, 1758-1764. Lopez-Cabrera, M., J. Letovsky, K. Q. Hu, and A. Siddiqui. (1990). Multiple liver- specific factors bind to the hepatitis B virus core/pregenomic promoter: trans-activation and repression by CCAAT/enhancer binding protein. Proc. Natl. Acad. Sci. USA 87, 5069-5073. Lopez-Cabrera, M., J. Letovsky, K. Q. Hu, and A. Siddiqui. (1991). Transcription factor C/EBP binds to and transactivates the enhancer element II of the hepatitis B virus. Virol. 183, 825-829. Lu, C.-C., Chen, M., Ou, J.-H., and Yen, T.S.B. (1995). Key role of a CCAAT element in regulating hepatitis B virus surface protein expression. Virol. 206, 1155- 1158. Luo, Y., Fujii, H., Gerster, T., and Roeder, R. G. (1992). A novel B cell-derived coactivator potentiates the activation of immunoglobulin promoters by octamer-binding transcription factors. Cell 71, 231 -241. Maguire H.F., Hoeffler, J. P., and Siddiqui, A. (1991). HBV X protein alters the DNA binding specificity of CREB and ATF-2 by protein-protein interactions. Science 252, 842-844. May, M., Grassmann, K., Pfister, H., and Fuchs, P.G. (1994). Transcriptional silencer of the human papillomavirus type 8 late promoter interacts alternatively with the viral trans activator E2 or with a cellular factor. J. Virol. 68, 3612-3619. Mitchell, P.J., and R. Tjian. (1989). Transcriptional regulation in mammalian cells by sequence-specific DNA binding proteins. Science 245, 371-378. Montalvo, E.A., Shi, Y., Shenk, T.E., and Levine, A.J. (1991). Negative regulation of the BZLF1 promoter of Epstein-Barr virus. J. Virol. 65, 647-3655. Nagashima, H., Imai, M., and Iwakura, Y. (1993). Aberrant tissue specific expression of the transgene in transgenic mice that carry the hepatitis B virus genome defective in the X gene. Arch. Virol. 132, 381-387. Nakajima, E., Minami, M., Ochiya, T., Kagawa, K. and Okanoue, T. (1994). PreSl deleted variants of hepatitis B virus in patients with chronic hepatitis. J. Hepatol. 20, 329-335. Nakamura,I., and Koike,K. (1992). Identification of a binding protein to the X gene promoter region of hepatitis B virus. Virol. 191, 533-540. Natesan, S., and Gilman, M. Z. (1993). DNA bending and orientation-dependent function of YY1 in the c-fos promoter. Genes Dev. 7, 2497-2509. Ori, A., and Shaul, Y. (1995). Hepatitis B virus enhancer binds and is activated by the hepatocyte nuclear factor 3. Virol. 207, 98-106. 126 Ostapchuk, P., Scheirle, G., and Hearing, P. (1989). Binding of nuclear factor EF-C to a functional domain of the hepatitis B virus enhancer region. Mol. Cell. Biol. 9, 2787-2797. Ou, J.-H., Laub, O., and Rutter, W. J. (1986). Hepatitis B virus function : the precore region targets the core antigen to cellular membranes and causes the secretion of the e antigen. Proc. Natl. Acad. Sci. USA. 83, 1578-1582. Ou, J.H., and Rutter, W. J. (1987). Regulation of secretion of the hepatitis B virus major surface antigen by the preSl protein. J. Virol. 61, 782-786. Ou, J.-H., Standring, D.N., Masiarz, F.R., and Rutter, W.J. (1988). A signal peptide encoded within the precore region of hepatitis B virus directs the secretion of a heterogeneous population of e antigens in Xenopus oocytes. Proc. Natl. Acad. Sci. USA 85, 8405-8409. Ou, J.-H., H. Bao, C. Shih, and S. M. Tahara. (1990). Preferred translation of human hepatitis B virus polymerase from core protein but not from precore protein- specific transcript. J. Virol. 64, 4578-81. Overdier, D. G., Porcella, A., and Costa, R. H. (1994). The DNA- binding specificity of the hepatocyte nuclear factor 3/forkhead domain is influenced by amino acid residues adjacent to the recognition helix. Mol. Cell. Biol. 14, 2755-2766. Pani, L, Overdier, D. G., Porcella, A., Qian, X., Lai, E., and Costa, R. H. (1992). Hepatocyte nuclear factor 3(3 contains two transcriptional activation domains, one of which is novel and conserved with the Drosophila fork head protein. Mol. Cell. Biol. 12, 3723-3732. Pei, D., and Shih, C. (1990). Transcriptional activation and repression by cellular DNA-binding protein C/EBP. J. Virol. 64, 1517-1522. Persing, D.H., Varmus, H.E. and Ganem, D. (1986). Inhibition of secretion of hepatitis B virus surface antigen by a related presurface polypeptide. Science 234, 1388-1390. Pierce, A.J., Jambou, R.C., Jensen, D.E., and Azizkhan, J.C. (1992). A conserved DNA structural control element modulates transcription of a mammalian gene. Nucl. Acids Res. 20, 6583-6587. Raney, A. K., Easton, A.J., and McLachlan, A. (1994). Characterization of the minimal elements of the hepatitis B virus large surface antigen promoter. J. Gen. Virol. 75, 2671-2679. Raney, A.K., Le, H.B., and McLachlan, A. (1992). Regulation of uanscription from the hepatitis B vims major surface antigen promoter by the Spl transcription factor. J. Virol. 66, 6912-6921. Raney, A. K., M ilich, D. R., Easton, A. J., and M cLachlan, A. (1990). Differentiation -specific transcriptional regulation of the hepatitis B virus large surface 127 antigen gene in human hepatoma cell lines. J. Virol. 64, 2360-2368. Raney, A. K., Zhang, P., and McLachlan, A. (1995). Regulation of transcription from the hepatitis B virus large surface antigen promoter by hepatocyte nuclear factor 3. J. Virol. 69, 3265-3272. Ray, M. B., V. J. Desmet, A. F. Bradbume, J. Desmyter, J. Fevery, and J. DeGoote. (1976). Differential distribution of hepatitis B surface antigen and hepatitis B virus core antigen in the liver of hepatitis B patients. Gastroenterology 21, 462-469. Reinhold, W., Emens, L., Itkes, A., Blake, M., Ichinose, I., and Zajac-kaye, M. (1995). The myc intron-binding polypeptide associates with RFX1 in vivo and binds to the major histocompatibility complex class II promoter region, to the hepatitis B virus enhancer, and to regulatory regions of several distinct viral genes. Mol. Cell. Biol. 15, 3041-3048. Reith, W., Herrero-sanchez, C., Amaldi, I., Lisowska, G.B., Griscelli, C., Hadam, M. R., and Mach, B. (1988). Congenital immunodeficiency with a regulatory defect in MHC calss II gene expression lacks a specific HLA-DR promoter binding protein,. Cell 53, 897-906. Reith, W., Herrero-sanchez, C., Kobr, M., Silacci, P., Berte, C., Barras, E., Fey, S., and Mach, B. (1990). MHC class II regulatory factor RFX has a novel DNA-binding domain and a functionally independent dimerization domain. Genes Dev. 4, 1528- 1540. Reith, W., UCLA, C., Barras, E., Gaud, A., Durand, B., Herrero-sanchez, C., Kobr, M., and Mach, B. (1994). RFX1, a transactivator of hepatitis B virus enhancer I, belongs to a novel family of homodimeric and heterodimeric DNA-binding proteins. Mol. Cell. Biol. 14, 1230-1244. Rigaud, G., Roux, J., Pictet, R. and Grange, T. (1991). In vivo footprinting of rat TAT gene: dynamic inteiplay between the glucocorticoid receptor and a liver-specific factor. Cell 67, 977-986. Robinson, W. (1990). Hepadnaviridae and their replication. In "Fields Virology", eds. B.N. Fields, D.M. Knipe, R.M. Chanock, M.S. Hirsch, J.L. Melnick, T.P. Monath and B. Roizman. (Raven Press, New York), pp. 2137-2170. Savagner, P., Miyashita, T., and Yamada, Y. (1990). Two silencers regulate the tissue-specific expression of the collagen II gene. J. Biol. Chem. 265, 6669-6674. Schaller, H., and Fischer, M. (1991). Transcriptional control of hepadnavirus gene expression. Curr. Top. Microbiol. Immunol. 168, 21-39. Seeger, C., Baldwin, B,m and Tennant, B. C. (1989). Expression of infectious woodchuck hepatitis B virus in murine and avian fibroblasts. J. Virol. 63, 4665-4669. Selden, R. R., K. B. Howie, M. E. Rowe, H. M. Goodman, and D. D. Moore. (1986). Human growth hormone as a reporter gene in regulation studies employing transient gene expression. Mol. Cell. Biol. 6, 3173-3179. 128 Sells, M. A., Chen, M.-L., and Acs, G. (1987). Production of hepatitis B virus particles in HepG2 cells transfected with cloned hepatitis B virus DNA. Proc. Natl. Acad. Sci. USA. 84, 1005-1009. Shaul, Y., Rutter, W. J., and Laub, O. (1985). A human hepatitis B viral enhancer element. EMBO J. 4, 427-430. Shaul, Y. (1991). Regulation of hepadnavirus transcription. In McLachlan, A. (ed) Molecular biology of hepatitis B viruses. CRC, Boca Raton (CRC Uniscience). Siddiqui, A., Jameel, S., and Mapoles, J. (1987). Expression of hepatitis B virus X gene in mammalian cells. Proc. Natl. Acad. Sci. USA. 84, 2513-2517. Siegrist, C. A., Durand, B., Emery, P., David, E., Hearing, P., Mach, B., and Reith, W. (1993). RFX1 is identical to enhancer factor C and functions as a transactivator of the hepatitis B virus enhancer. Mol. Cell. Biol. 13, 6375-6384. Sladek, F. M., W. Zhong, E. Lai, and J. E. Darnell, Jr. (1990). Liver-enriched transcription factor HNF-4 is a novel member of the steroid hormone receptor superfamily. Genes Dev. 4, 2353-2365. Standring, D. N., Rutter, W. J., Varmus, H.E., and Ganem, D. (1984). Transcription of the hepatitis B surface antigen gene in cultured murine cells initiates within the presurface region. J. Virol. 50, 563-571. Standring, D.N., Ou, J.H. and Rutter, W. J. (1986). Assembly of viral particles in Xenopus oocytes presurface-antigens regulate secretion of the hepatitis B viral surface envelope particle. Proc. Natl. Acad.Sci. USA 83, 9338-9344. Su, H., and J.-K. Yee. (1992). Regulation of hepatitis B virus gene expression by its two enhancers. Proc. Natl. Acad. Sci. USA 89, 2708-2712. Sureau, C., Romet-Lemonne, J.-L., Mullins, J.I., and Essex, M. (1986). Production of hepatitis B virus by a differentiated human hepatoma cell line after transfection with cloned circular HBV DNA. Cell 47, 37-47. Szmuness, W. (1978). Hepatocellular carcinoma and the hepatitis B virus: evidence for a causal association. Prog. Med. Virol. 24, 40. Tognoni, A., Cattaneo, A. R., Serfling, E., and Schaffner, W. (1985). A novel expression selection approach allows precise mapping of the hepatitis B virus enhancer. Nucl. Acids Res. 13, 7457-7472. Treinin, M., and Laub., O. (1987). Identification of a promoter element located upstream from the hepatitis B virus X gene. Mol. Cell. Biol. 7, 545-548. Trujillo, M.A., Letovsky, J., Maguire, H. F., Lopez-Cabrera, M., and Siddiqui, A. (1991). Functional analysis of a liver specific enhancer of the hepatitis B virus. Proc. Natl. Acad. Sci. USA 88, 3797-3801. Valenzuela, P., M. Quriroga, J. Zaldivar, P. Gray, and W. J. Rutter. (1980). The 129 nucleotide sequence of the hepatitis B viral genome and the identification of the major genes, p. 57-70. In B. N. Fields, R Haenisch, and C. F. Fox (ed.), Animal virus genetics. Academic Press, Inc., New York. Wang, Y., Chen, P., Wu, X., Sun, A.-L., Wang, H., Zhu, Y.-A., and Li, Z.-P. (1990). A new enhancer elem ent, ENII, identified in the X gene of hepatitis B virus. J. Virol. 64, 3977-3981. Wen, P., and Locker, J. (1994). A novel hepatocytic transcription factor that binds the alpha-fetoprotein promoter-linked coupling element. Mol. Cell. Biol. 14, 6616-6626. Will, H., Reiser W., Weimer, T., Pfaff, E., Buscher, M., Sprengel, R., Cattaneo, C., Schaller, H. (1987). Replication strategy of human hepatitis B virus. J. Virol. 61, 904-911. Wu, X., Zhu, L„ Li, Z.-P., Koshy, R. and Wang, Y. (1992). Functional organization of enhancer(ENII) of hepatitis B virus. Virol. 191, 490-494. Yaginuma, K., Nakamura, I., Takada, S., and Koike, K. (1993). A transcription initiation site for the hepatitis B virus X gene is directed by the promoter-binding protein. J. Virol. 67, 2550-2565. Yaginuma, K., Shirakata, Y., Kobayashi, M., and Koike, K. (1987). Hepatitis B virus (HBV) particles are produced in a cell culture system by transient expression of transfected HBV DNA. Proc. Natl. Acad. Sci. USA. 84, 2678-2686. Yamamoto, K., Horikita, M., Tsuda, F., Itoh, K., Akahane, Y., Yotsumoto, S., Okamoto, H., Miyakawa,Y. and Mayumi, M. (1994). Naturally occurring escape mutants of hepatitis B virus with various mutations in the S gene in carriers seropositive for antibody to hepatitis B surface antigen. J. Virol. 68, 2671-2676. Yee, J.-K. (1989). A liver-specific enhancer in the core promoter region of human hepatitis B virus. Science 246, 658-661. Yen, T. S. B. (1993). Regulation of hepatitis B virus gene expression. Semin, in Virol. 4, 33-42. Yuh, C.-H., and L.-P. Ting. (1991). C/EBP-like proteins binding to the functional box-a and box-(3 of the second enhancer of hepatitis B virus. Mol. Cell. Biol. 11, 5044-5052. Yuh, C.-H., Y.-L. Chang, and L.-P. Ting. (1992). Transcriptional regulation of precore and pregenomic RNAs of hepatitis B virus. J. Virol. 66, 4073-4084. Zhang, P. and McLachlan, A. (1994). Differentiation-specific transcriptional regulation of the hepatitis B virus nucleocapsid gene in human hepatoma cell lines. Virol. 202, 430-440. Zhang, P., Raney, A.K., and McLachlan, A. (1993). Characterization of functional Spl transcription factor binding sites in the hepatitis B virus nucleocapsid promoter. J. 130 Virol. 67, 1472-1481. Zhou, D.X. and Yen, T.S.B. (1991). The hepatitis B virus S promoter comprises a CCAAT motif and two initiation regions. J. Biol. Chem. 266, 23416-23421. Zhou, D. X., and T. S. Yen. (1990). Differential regulation of the hepatitis B virus surface gene promoter by a second viral enhancer. J. Biol. Chem. 265, 20731-20734.

Abstract (if available)

Linked assets