University of Southern California Dissertations and Theses

To adapt or not to adapt: the age-specific and sex-dependent differences in the adaptive stress response

(USC Thesis Other)

To adapt or not to adapt: the age-specific and sex-dependent differences in the adaptive stress response

PDF

Download a page range

Download transcript

Copy asset link

Request this asset

Transcript (if available)

Content TO ADAPT OR NOT TO ADAPT: THE AGE-SPECIFIC AND SEX-DEPENDENT DIFFERENCES IN THE ADAPTIVE STRESS RESPONSE by Laura Corrales-Diaz Pomatto A Dissertation Presented To The FACULTY OF THE USC GRADUATE SCHOOL UNIVERSITY OF SOUTHERN CALIFORNIA In Partial Fulfillment of the Requirements for the Degree DOCTOR OF PHILOSOPHY (BIOLOGY OF AGING) May 2017 Copyright 2017 Laura Corrales-Diaz Pomatto i ACKNOWLEDGMENTS As I near the end of my doctoral work, I have reflected upon my time at USC, not only as a doctoral student, but as an undergraduate student, and recognize how true the phrase is that it takes a village to raise a PhD student. I would especially like to thank my mentor, Dr. Kelvin J. A. Davies, who has seen my grow-up from an undergraduate student into who I am today. Thank you for always supporting my many ideas, passions, and never-ending applications! Thank you for giving me the freedom to explore and grow throughout my five years in the lab. You will always be an academic father to me. Thank you for your continual support. To my parents, Larry and Susan Pomatto, you are my everything. You have always cheered me forward and motivated me to reach for the stars and the moon. Since I was little to today, I have always looked up to you both, my super-heroes. Thank you for always believing in me. The achievement of this degree is as much mine as it is yours. And to my grandparents, Hillary and Irene Pomatto and Patricia Corrales-Diaz, thank you for your never-ending love and affection. I want to thank Dr. Rachel Raynes, who offered not only mentorship, but friendship. Thank you for always believing and supporting me through this process. I would like to thank Daniel Scalese for his ever constant belief in my success, even when I doubted myself. Thank you for always cheering me forward, since we were undergrads to today. I could not have gotten this far without your always optimistic perspective. Thank you Buck. To Dr. Andrew M. Pickering, I always strove to follow in your footsteps, and those were mighty big shoes to fill! Thank you for being a mentor and friend since I first started in the lab to ii today. Your future undergraduate, graduate, and post-docs will be very fortunate to have you as a mentor. To Dr. Jenny Ngo, thank you for providing me with a positive research experience when I first started as an undergraduate. Thank you for taking the time to show me the ropes and getting me off and running on my research career. I am deeply grateful for the opportunity to mentor an amazing team of undergraduates over the past five years, including Caroline Carney, Brenda Shen, Elisabeth Hopkins, Steffi Bolton, and Kelly Halaszynski. I would like to especially thank my very first undergraduate student, Marie Danielian, who was not only a great mentee, but a good friend, and soon to be a Doctor of Pharmacy herself! I would like to thank Mayme Cline for joining our lab, her continual persistence has greatly helped in moving forward key projects. A special thank you is owed to Sarah Wong, who I have had the privilege in mentoring for the past two years. Not only is Sarah a dedicated researcher, but a good friend. Her continual positive outlook has helped to shape a wonderful lab environment and I know she will do great things at USC and beyond. Her continual determination has accelerated forward the majority of these projects. Thank you! I would like to thank Dr. John Tower for his continual support of my fruit-fly projects over the past years. Thank you for teaching me the ropes in fruit-fly genetics, and always being supportive of project ideas. I would like to thank Dr. Henry Forman for his continual guidance and direction on multiple projects. Thank you for always being a willing listener and offering sound advice. iii Lastly, I would like to thank my committee members: Dr. John Tower, Dr. Henry Forman, Dr. Enrique Cadenas, and Dr. Gordan Lithgow, for their continual support, guidance, and advice that they have provided over the past years. iv TABLE OF CONTENTS Acknowledgments i List of Figures viii List of Tables xii Abbreviations xiii Abstract xvi Chapter 1: Introduction 1 The Lon Protease 1 Overview of the Lon Protease 1 Lon’s Role as a Stress Responsive Enzyme 3 The Age-Associated and Disease-Related Changes of Lon 6 20S Proteasome 10 Overview of the Proteasome 10 The Structure of the 20S Proteasome 13 Assembly of the 20S Proteasome 16 The Function of the 20S Proteasome 18 Kinetics of the 20S Proteolytic Core 21 The Role of the 20S Proteasome in Adaptation to Oxidative Stress 24 The Role of the 20S Proteasome in Aging and in Age-Related Diseases 26 Immunoproteasome 31 Overview of the Immunoproteasome 31 Assembly of the Immunoproteasome 33 The Role of the Immunoproteasome 34 Age-Associated Changes of the Immunoproteasome 35 Model Organisms in Aging 36 The Role of C. elegans 37 The Role of D. melanogaster 40 Limitations of Invertebrate Models 43 v Role of M. musculus 44 Limitations of Mouse Models 45 Sexual Dimorphism 46 Cellular Roles of Hydrogen Peroxide and Paraquat 50 The Role of Hydrogen Peroxide as a Signaling Molecule 50 Paraquat: a Redox Cycler 54 Paraquat: The Involvement of its Redox-Cycling Products and Cellular Signaling 58 Chapter 2: The age-related and sex-specific differences of the mitochondrial Lon protease in D. melanogaster 60 Abstract 60 Background 61 Results 64 Sex-Dependent Variation of Lon Expression in D. melanogaster 64 Oxidant Pretreatment Does Not Alter Lon mRNA Levels 67 Hydrogen Peroxide Pretreatment Induces Female-Specific Lon Protein Expression and Activity 69 Paraquat Pretreatment Induces Male-Specific Lon Protein Expression and Activity 72 Sensitivity to Hydrogen Peroxide Increases with Age 74 Females But Not Males Adapt to H2O2 Stress 76 Lon is Required for H2O2 Adaptation in Females 78 Over-Expression of Lon Increases H2O2 Stress Adaptation In Females But Not Males 82 Paraquat is Toxic to Both Sexes 84 Males But Not Females Adapt to Paraquat Stress 85 Lon is Required for Paraquat Stress Adaptation in Males 87 Continual Over-Expression or RNAi-Mediated Knockdown is Detrimental to Lifespan 89 Transformation of Males into Pseudo-females Confers the Female Pattern of Lon Expression 91 vi Pseudo-females Showed Induction Following H2O2 Pretreatment 93 Pseudo-females Showed No Induction Following PQ Pretreatment 97 Pseudo-females were Conferred with H2O2 Adaptation 97 Sex-dimorphic Expression of Lon Protein Isoforms in Mammalian Tissues 100 Discussion 101 Materials and Methods 108 Chapter 3: The Adaptive Decline of the 20S Proteasome in D. melanogaster 115 Abstract 115 Background 115 Results 119 Aging Diminishes Hydrogen Peroxide Stress Resistance 119 The Age-Dependent Loss of Hydrogen Peroxide Adaptation 120 The Adaptive Increase of the 20S Proteasome Expression Declines with Age in a Sex-Dependent Manner 123 The Adaptive Proteolytic Capacity of the 20S Proteasome Diminishes with Age in a Sex-Dependent Manner 125 The Age-Related Loss in Adaptation is Accompanied by Increased Protein Oxidation 129 The Female-Specific Adaptive Expression of the 20S Proteasome is Age and Tissue-Dependent 132 Males Showed No Tissue-Specific or Age-Related Adaptation of the 20S Proteasome 136 Age-Related Differences within Individual subunits of the 20S Proteasome 140 Adaptation is Dependent Upon the 20S Proteasome 140 The Loss of Subunits of the 20S Proteasome or its Regulators Impacts Lifespan 145 Stress Resistance Improves upon Continual Loss of Keap1 149 Discussion 152 Materials and Methods 159 Chapter 4: The Impact of Nano-particulate Exposure upon the 20S Proteasome and its Regulators in 3-month and 18-month Female Mice 165 vii Abstract 165 Background 166 Results 171 Tissue-Specific Differences in the 20S Proteasomal Subunit Expression Following nPM Exposure 171 Tissue-Specific Differences in the 20S Proteasomal Subunit Activity Following nPM Exposure 175 Preferential Degradation of Oxidized Substrates by the 20S Proteasome 178 Expression of the 20S Subunit Transcriptional Regulator, Nrf2, Shows an Age and nPM-Dependent Increase 180 Aging and nPM-Exposure, Cause Increased Expression of the Transcriptional Suppressor, Bach1 182 Induction of the Mitochondrial Lon Protease Increases with Age and nPM Exposure 184 Proteolytic Capacity of the Immunoproteasome is Impacted with Age and nPM Exposure 186 nPM Exposure Further Increases the Presence of Oxidized Proteins 188 Discussion 190 Materials and Methods 196 Chapter 5: Conclusion and Final Thoughts 201 Supplemental Figures 211 Supplemental Tables 222 References 235 viii LIST OF FIGURES Figure 1.1 Protein Domains of the Mitochondrial and Peroxisome Lon 2 Figure 1.2 The Dynamic Role of the Lon Protease 4 Figure 1.3 The Age-Related Decline in the Inducibility of the Lon Protease 6 Figure 1.4 Disassembly of the 26S Proteasome during Oxidative Stress 12 Figure 1.5 The Structure of the 20S and 26S Proteasome 14 Figure 1.6 The Structure and Subunit Activity of the 20S Proteasome and Immunoproteasome 32 Figure 1.7 The Developmental Lifecycles of the Model-Organisms, C. elegans and D. melanogaster 38 Figure 1.8 Modulation of Target Gene Expression through the Gene-Switch System 42 Figure 2.1 Sex-Dependent Variation of Lon Expression in D. melanogaster 66 Figure 2.2 Levels of Lon mRNA Expression Remain Unchanged Following H2O2 Pretreatment nor Show Basal Changes with Age 68 Figure 2.3 Levels of Lon mRNA Expression Remain Unchanged Following Paraquat Pretreatment in Young and Aged Flies. 69 Figure 2.4 H2O2 Pretreatment Induces Lon Protein Expression in a Female-Specific Manner that Diminishes with Age 70 Figure 2.5 H2O2 Pretreatment Induces Lon Proteolytic Capacity in a Female- Specific Manner that Diminishes with Age 72 Figure 2.6 Paraquat Pretreatment Induces Lon Protein Expression in a Male- Specific Manner that Diminishes with Age 73 Figure 2.7 Paraquat Pretreatment Induces Lon Proteolytic Capacity in a Male- Specific Manner that Diminishes with Age 74 Figure 2.8 Sensitivity to Hydrogen Peroxide Increases with Age 75 Figure 2.9 Hydrogen Peroxide Adaptation is Female-Specific and Lost with Age 77 ix Figure 2.10 Knockdown of Lon Expression Using the Gene-Switch System 79 Figure 2.11 Lon is Required for Hydrogen Peroxide Adaptation Observed Only in Females 81 Figure 2.12 Over-Expression of Lon Using the Gene-Switch System 83 Figure 2.13 Both Sexes are Sensitive to Paraquat Toxicity 85 Figure 2.14 Adaptation to Paraquat is Male-Specific and Lost with Age 86 Figure 2.15 Lon is Necessary for Paraquat Adaptation in a Male-Specific Manner 88 Figure 2.16 Chronic Knock-Down or Over-Expression of Lon is Detrimental to Lifespan 90 Figure 2.17 TraF Transformation Using the Gene-Switch System 92 Figure 2.18 Adaptive Expression and Activity of the Lon Protease in Pseudo-Females 94 Figure 2.19 Lon Protease Expression and Activity in Transformed Flies 96 Figure 2.20 Adaptation in Transformed Flies 99 Figure 2.21 Multiple Lon Transcripts are Conserved Across Species 100 Figure 2.22 Variation in Lon Expression is Conserved in Higher Organisms 101 Figure 3.1 Hydrogen Peroxide Resistance Declines with Age 120 Figure 3.2 Hydrogen Peroxide Adaptation Declines with Age in Females 122 Figure 3.3 20S expression is Induced in Females, But Declines with Age 124 Figure 3.4 Adaptive Proteolytic Capacity of the 20S Proteasome Diminishes with Age Only in Females 126 x Figure 3.5 Adaptive Proteolysis of Oxidized Hemoglobin by the 20S Proteasome 127 Figure 3.6 Inhibition of the 20S Proteasome Proteolytic Activity 128 Figure 3.7 Decline in 20S Proteasome Induction is Coupled with Accumulation of Oxidized Proteins 131 Figure 3.8 Adaptive Expression of the 20S Proteasome is Age and Tissue- Dependent in Females 133 Figure 3.9 Tissue-Specific Differences of the Adaptive Proteolytic Capacity of the 20S Proteasome in Females 135 Figure 3.10 Males Show No Tissue-Specific or Age-Related Adaptive Changes of the 20S Proteasome 137 Figure 3.11 Tissue-Specific Differences of the Adaptive Proteolytic Capacity of the 20S Proteasome in Males 139 Figure 3.12 Loss of the 20S Proteasome Removes the Adaptive Response 142 Figure 3.13 Adaptive Proteolytic Capacity is Blocked in 20S Beta RNAi strains 143 Figure 3.14 Adaptation is Dependent upon the 20S Proteasome 145 Figure 3.15 Loss of Proteasomal Subunits Impacts Lifespan 147 Figure 3.16 Loss of Proteasomal Regulators Impacts Lifespan 148 Figure 3.17 Hydrogen Peroxide Stress Resistance Improves upon Continual Knockdown of Keap1 151 Figure 4.1 Administration of Freeway-Derived Nanoparticulates (nPM) in 3-month and 18-month C57BL/6J Female Mice 172 Figure 4.2 20S Proteasomal Subunit Expression Change with Age and nPM Exposure 174 Figure 4.3 Changes in 20S Proteolytic Activity with Age and nPM Exposure 177 Figure 4.4 Preferential Degradation of Oxidized Substrates by the 20S Proteasome 179 Figure 4.5 Expression of the 20S Proteasome Transcriptional Regulator, Nrf2, is nPM- and Age-Dependent 181 xi Figure 4.6 Expression of the Nrf2 Transcriptional Competitor, Bach1, Increases with Age and nPM Exposure 183 Figure 4.7 Expression of the Mitochondrial Lon Protease Increases with Age and nPM Exposure 185 Figure 4.8 Change in Immunoproteasome Proteolytic Capacity upon nPM-exposure and Aging 187 Figure 4.9 Oxidized Proteins Increase with Age, which is Further Augmented upon nPM exposure 189 Figure 4.10 Age-Associated Loss in the Adaptive Stress Response 191 Figure 5.1 The Imperfect System: Age-Dependent Protein Aggregation 210 Supplemental Figure 1 Induction of mRNA Levels of Glutathione S Transferase 211 Supplemental Figure 2 Basal Changes in Lon Expression with Age 212 Supplemental Figure 3 Basal Proteolytic Activity of the Lon Protease 213 Supplemental Figure 4 RU486, Alone, Does Not Impact Lon expression 214 Supplemental Figure 5 In the Presence or Absence of RU486, Alone, Does Not Impact Adaptation 215 Supplemental Figure 6 Over-Expression of Lon is Beneficial to H2O2 Adaptation in a Female- Specific Manner 216 Supplemental Figure 7 Constitutive Modulation in Lon Expression is Detrimental to Survival 217 Supplemental Figure 8 Schematic of the TraF Transformation Using the Gene-Switch System 218 Supplemental Figure 9 The Presence of RU486, Alone, Does Not Impact Toxicity 219 Supplemental Figure 10 Administration of H2O2 Pretreatment and Challenge Dose in Fruit Flies 220 Supplemental Figure 11 The Presence of RU486 Shows No Difference in Adaptation Upon Chronic Exposure (60 days) 221 xii LIST OF TABLES Table 1 Benefits of Model Organisms 36 Supplemental Table 1 Hydrogen Peroxide Adaptation Statistical Summary 222 Supplemental Table 2 Paraquat Adaptation Statistical Summary 223 Supplemental Table 3 RU486 Has No Impact Upon Adaptation Statistical Summary 224 Supplemental Table 4 Hydrogen Peroxide Adaptation Lon RNAi Strains Statistical Summary 225 Supplemental Table 5 Hydrogen Peroxide Adaptation Lon OE Strains Statistical Summary 226 Supplemental Table 6 Paraquat Adaptation Lon RNAi Strains Statistical Summary 227 Supplemental Table 7 Adaptation in Sex Transformation Statistical Summary 228 Supplemental Table 8 Lon Lifespan Statistical Summary 229 Supplemental Table 9 Hydrogen Peroxide Adaptation in 3 Day and 60 Day Old Males and Females Statistical Summary 230 Supplemental Table 10 Hydrogen Peroxide Adaptation in Beta1 and Beta2 RNAi Strains 231 Supplemental Table 11 20S Beta Subunits and Regulators Lifespan Statistical Summary 232 Supplemental Table 12 Hydrogen Peroxide Adaptation Following Loss of Keap1 in 60 Day Old Females and Males 233 Supplemental Table 13 Hydrogen Peroxide Adaptation in the Presence or Absence of RU486 in 60 Day Old Flies 234 xiii ABBREVIATIONS Actin-GS-255B: Actin linked Gene switch 255B AKT: Protein kinase B AMC: 7-amino-4-methylcoumarin ARE: anti-oxidant response element ATP: adenosine triphosphate Bach1: BTB Domain and CNC Homolog 1 BTB: Broad complex, Tramtrack, and Bric a brac/poxvirus and zinc finger C. elegans: Caenorhabditis elegans Cnc-C: Cap n Collar isoform C D. melanogaster: Drosophila melanogaster EpRE: electrophile response element GSH/GSSG: glutathione disulfide reduced and oxidized states GstD: Glutathione-S-Transferase D H2O2: hydrogen peroxide Hb: hemoglobin Hbox: oxidized-hemoglobin HO-1: heme oxygenase 1 xiv Hsp70: heat-shock promoter 70 Keap1: Kelch-like ECH-associated protein 1 L1, L2, L3, L4: C. elegans larval stages 1, 2, 3, 4 mtDNA: mitochondrial DNA mTOR: target of rapamycin NADPH: Nicotinamide adenine dinucleotide phosphate nPM: vehicular-derived nano-particulate matter NQO1: NAD(P)H quinone dehydrogenase 1 Nrf2: Nuclear factor (erythroid-derived-2)-like 2 O2 .- : superoxide PCR: polymerase chain reaction PI3K: Phosphatidylinositol-4,5-bisphosphate 3-kinase PQ: paraquat qPCR: quantitative polymerase chain reaction RNAi: ribonucleic acid interference rtPCR: reverse transcriptase polymerase chain reaction Skn-1: Skinhead-1 SDS-PAGE: sodium dodecyl sulfate polyacrylamide gel electrophoresis xv SOD1: superoxide dismutase 1 Suc-LLVY-AMC: N-succinyl-Leu-Leu-Val-Tyr-7-amino-4-methylcoumarin TCA: Trichloroacetic acid Z-ARR-AMC: Z-Ala-Arg-Arg-amino-4-methylcoumarin Z-LLG-AMC: Z-Leu-Leu-Glu-amino-4-methylcoumarin xvi ABSTRACT A major hallmark of aging is the loss of protein homeostasis and the dysregulation of the adaptive stress response pathways or ‘adaptive homeostasis’ (Davies, 2016). Loss of adaptive homeostasis, increases cellular vulnerability for DNA, protein, and lipid damage. If damage is not immediately removed, protein aggregates can accumulate and accelerate cellular senescence. To mitigate damage accrual from environmental or physiological stress, adaptive homeostasis is a widely-characterized phenomenon, which enables cells, tissues, or organisms, pretreated with a mild stress, to activate the stress responsive pathway to mitigate future oxidative insult. Two crucial proteins in this pathway are the cytosolic 20S proteasome and the mitochondrial ATP- dependent Lon protease, both of which act to remove oxidized or misfolded proteins. In vitro studies in cell culture showed both the expression of the Lon protease (Ngo & Davies, 2009) and the 20S proteasome (Pickering & Davies, 2012) were inducible following transient exposure to a mild dose of an oxidant. Yet few studies have addressed whether the inducibility of the mitochondrial Lon protease is retained beyond tissue culture. To fill this gap, I utilized the model organism, Drosophila melanogaster, more commonly known as the fruit-fly, to assess the age- and sex-specific differences in the adaptability of the Lon protease. Signaling of the adaptive stress response was achieved by pre-treatment or ‘priming’ using a non-toxic, micromolar concentration of the redox signaling molecule hydrogen peroxide (H2O2). Following pretreatment, flies were assessed for inducibility of the mitochondrial Lon protease (protein expression and activity). I discovered xvii only young females, pretreated with H2O2, were capable of inducing Lon protein expression and activity. Moreover, pretreatment, enabled young females to survive longer (adapt) when subjected to a sub-lethal amount of H2O2. A finding which was lost with age and not present in males. Conversely, when flies were pretreated with the redox cycler, paraquat (PQ), a superoxide generating molecule, only young males, pretreated with a low, micromolar concentration, were found to have increased Lon protein expression and activity. As well, pretreatment enabled males to survive longer when exposed to a semi-toxic amount of PQ, which showed an age- dependent response (restricted to young males) with no impact in females. Moreover, my work is the first-known identification of sex-specific protein isoforms of the Lon protease. Females have three Lon protein isoforms: 100kD, 60kD, 50kD, whereas males have only two of these isoforms: 100kD and 60kD. A finding I show is found to be conserved in highly sexually dimorphic tissues of the mouse liver and reproductive organs. To address the sexual disparity in Lon protein expression, I generated pseudo-females and pseudo-males to test whether adaptation to an oxidant is sex-dependent. Using a transgenic strain to force the over-expression of the female-specific form of transformer, enabled the creation of flies that were phenotypically female, but chromosomally male. Upon pretreatment with H2O2, pseudo females showed increased Lon protein expression, proteolytic capacity, and were able to withstand a toxic-dose of H2O2 (adaptation). As well, pseudo-females were unable to adapt upon PQ pretreatment. In contrast, pseudo-males, generated by using an RNAi-strain against xviii transformer, generated flies phenotypically male, but chromosomally female, which were unable to adapt following H2O2 pretreatment. My next major project sought to address the age-associated changes in the adaptive stress response upon the 20S proteasome in D. melanogaster. Previous work had shown the 20S proteasome was inducible in young female fruit-flies (Pickering, Staab, Tower, Sieburth, & Davies, 2013). I found that with age, 60 day old females are no longer able to adapt and become more sensitive to high concentrations of H2O2. A finding common in both sexes. In addition, proteolytic activity assays revealed that females pretreated with an adaptive dose of H2O2 show increased proteolysis by the 20S proteasome, which is removed with age and remains non- responsive in males. Lastly, in an attempt to restore the adaptive response, the Nrf2 cytosolic repressor, Keap1, was chronically knockdown, for a duration of 60 days, prior to flies being pretreated with an adaptive dose of H2O2. Unfortunately, neither males nor females showed increased survival with pretreatment. Yet, chronic Keap1 knock-down did increase stress resistance in both sexes. Lastly, I sought to determine if findings in D. melanogaster were potentially translatable in the mammalian mouse model. Short-term exposure to vehicular-derived nano-particulates (nPM), collected from the 110 freeway, were delivered in a re-aerosolized form to 3-month or 18-month C57BL/6 female mice. Lysate from the lung, heart, and liver were assessed for the induction of the stress response. Specifically, changes in the 20S proteasome and immunoproteasome (protein expression and activity) were measured, along with changes in the mitochondrial Lon protease. xix Protein expression of Nrf2 and its negative regulators, Bach1 and c-Myc, were also measured. Accumulation of oxidized proteins, measured through carbonyl content was quantified. 1 CHAPTER 1: INTRODUCTION The Lon protease Overview of the Lon Protease The Lon protease is highly conserved from E. coli to humans and is the primary mitochondrial protease to degrade oxidized proteins (Wang, Gottesman et al. 1993, Lau, Wang et al. 2012). Regardless the organism, Lon is recognized for the three characteristic domains of the Lon A family: a substrate-recognition domain, an ATPase domain, and a serine-lysine dyad that enables proteolysis (Botos, Melnikov et al. 2004). In humans, Lon is encoded on chromosome 19, translated in the cytoplasm as a precursor polypeptide, and is transported to mitochondria via its N-terminal mitochondrial targeting sequence (Figure 1.1). Upon translocation, the mitochondrial targeting sequence is cleaved allowing the protein to fold into its native structure, which is a six (human) or seven-membered (yeast) monomeric ring (Botos, Melnikov et al. 2004, Duman and Löwe 2010). The substrate recognition domain faces outward, allowing for recognition and binding to the hydrophobic patches on damaged proteins in an ATP-independent manner. Upon binding, the ATPase domain hydrolyzes ATP, which widens the ring opening further. ATP hydrolysis is an important step to simultaneously promote easier access to the proteolytic domain and facilitate unfolding of the substrate. Once the substrate has entered the ring, it is degraded by a catalytically active serine resulting in peptide fragments ranging in size from 5-20 amino acids in length (Ondrovičová, Liu et al. 2005). 2 3 During periods of oxidative stress, Lon preferentially binds and degrades oxidized substrates, thereby promoting mitochondrial homeostasis. In mammalian cells, oxidized aconitase was initially discovered as a primary target for Lon degradation (Bota and Davies 2002). Subsequently, other proteins, such as steroidogenic acute regulatory protein (StAR), cytochrome C oxidase, and PINK1 have all been found to be degraded by Lon (Fukuda, Zhang et al. 2007, Granot, Kobiler et al. 2007, Thomas, Andrews et al. 2014). However, in the absence of ATP and during periods of homeostasis, Lon is sequestered to the mitochondrial DNA (Sonezaki, Okita et al. 1995). Sequestration of Lon prevents inappropriate degradation of native proteins and facilitates the interaction and possible regulation of various mitochondrial DNA transcription factors and replication machinery, such as mitochondrial transcription factor A (TFAM), mitochondrial DNA polymerase γ, and the twinkle helicase (Fu and Markovitz 1998, Liu, Lu et al. 2004, Matsushima, Goto et al. 2010, Lu, Lee et al. 2013). Lon’s Role as a Stress Responsive Enzyme The Lon protease has been primarily characterized as a stress response protein (Ngo and Davies 2009). It was initially discovered in E. coli for its role in the degradation of misfolded proteins and its specificity for degrading small hydrophobic peptides (Goldberg and Waxman 1985, Laskowska, Kuczyńska-Wiśnik et al. 1996, Botos, Melnikov et al. 2004). This role was further demonstrated in mammalian Lon’s preference to degrade oxidized aconitase at a much higher rate compared to native aconitase (Bota and Davies 2002). The necessity of Lon is keenly evident following an oxidative stress when controlled proteolysis is critical in order to quickly triage damaged proteins and to restore homeostasis (Davies and Lin 1988) (Figure 1.2). Lon expression is inducible in both mammalian cells and yeast following various types of stress 4 including heat stress, serum deprivation, hypoxia, and hydrogen peroxide (Hori, Ichinoda et al. 2002, Ngo and Davies 2009, Bender, Leidhold et al. 2010). In turn, increased Lon expression reduces the accumulation of oxidized proteins (Ngo and Davies 2009, Ngo, Pomatto et al. 2011). In addition, a study conducted on the fungus Podospora Anserina found that continual expression of Lon results in lifespan extension and is believed to occur due to increased ATPase activity, a decrease in damaged proteins and a reduction in the endogenous production of hydrogen peroxide (Luce and Osiewacz 2009). Conversely, the removal of Lon is detrimental to the cell. Following loss of Pim1, the yeast orthologue for Lon, there is a reduction of ATP-dependent proteolysis, an increase in mitochondrial DNA (mtDNA) deletions, and the formation of electron-dense aggregates within the mitochondrial matrix, thereby demonstrating Lon’s importance for protein homeostasis (Suzuki, Suda et al. 1994, Van Dyck, Pearce et al. 1994). In mammalian cells, silencing of Lon triggers an aging phenotype characterized by decreased mitochondrial function and protein 5 aggregation (Bota, Ngo et al. 2005). Lon siRNA studies further demonstrate that inhibition of Lon induction following an oxidative stress results in the accumulation of carbonylated proteins, a hallmark for general protein oxidation (Ngo and Davies 2009, Bayot, Gareil et al. 2014). Taken together, Lon’s role as a mitochondrial protease is a critical component of mitochondrial protein homeostasis. Lon induction is also required for hormesis, an adaptive response triggered by an acute short- term stress that may provide a key coping strategy for cellular survival. Rapid induction of various stress response proteins and pathways transiently increases the cell’s stress response mechanisms, allowing it to cope with higher levels of stress (Davies, Lowry et al. 1995, Shringarpure, Grune et al. 2001, Pickering, Staab et al. 2013). Yet, chronic high levels of oxidative stress, result in an inability of the cell or organism to mount an adequate cellular defense (Ngo, Pomatto et al. 2011). The ability to rapidly and efficiently induce various stress response proteins, including Lon, is diminished with age (Shringarpure and Davies 2002, Ngo, Pomatto et al. 2011). One potential cause is chronic oxidative stress due to aging, which may be the underlying cause of the age-associated changes observed in Lon regulation (Figure 1.3). Prolonged exposure and/or generation of high levels of endogenous oxidizing agents coupled with reduced periods of recovery, results in the diminished ability to mount an appropriate cellular defense (Pickering, Vojtovich et al. 2013). In turn, previously adaptive doses become toxic. This was demonstrated in human lung fibroblasts that lose the capacity to adapt to stress when aged to replicative senescence. Loss of Lon adaptation correlated with an overall accumulation of protein damage (Ngo, Pomatto et al. 2011). 6 The Age-Associated and Disease-Related Changes of Lon Basal expression of Lon was also found to decline with age. This was initially uncovered when baseline Lon mRNA levels declined 4-fold in aged mice (Lee, Klopp et al. 1999). These findings were confirmed at the protein level in a comparison between wild type aged mice and those heterozygous for Manganese Superoxide Dismutase (MnSOD -/+ ). Interestingly, aged MnSOD -/+ mice had a greater decrease in Lon basal expression and conversely, increased accumulation of carbonylated proteins compared to the aged control (Bota, Van Remmen et al. 2002). Subsequent 7 mouse studies found that ageing-related changes in Lon expression are tissue-specific. Lon proteolytic capacity showed a 25% reduction in liver from aged mice (27 months) when compared to liver from 3 month old mice (Delaval, Perichon et al. 2004). This decline in Lon activity is accompanied by a decrease in aconitase activity and the accumulation of its oxidized, non-functional form (DAS, Levine et al. 2001, Bota, Van Remmen et al. 2002, Delaval, Perichon et al. 2004, Yarian, Toroser et al. 2006). However, Lon activity appears to remain constant in cardiac tissue (5-fold higher than that of the liver), potentially highlighting the adaptive differences that arise in cells in the post-mitotic state versus those that can regenerate. Other species have been found to show a similar decline in Lon proteolytic capacity with age; the budding yeast Saccharomyces cerevisiae loses Lon activity, with a concommitant decrease in baseline Lon/Pim1 expression and a parallel increase in protein aggregates (Erjavec, Bayot et al. 2013). In addition, loss of Pim1 shortens the replicative life span of the mother cell and interestingly, results in a marked accumulation of oxidized and ubiquitinylated cytosolic proteins, potent inhibitors of proteolytic activity of the 20S proteasome (Grune, Jung et al. 2004). Thus in the yeast model, Lon is crucial for mitochondrial function and, if lost will eventually become detrimental to overall cellular function. However, the age-attenuated loss of Lon appears to be slightly reversed with exercise, a known stimulant of oxidative stress and mitochondrial biogenesis (Davies, Quintanilha et al. 1982, Alessio 1993, Radak, Chung et al. 2008), in aged mice (Koltai, Hart et al. 2012). Male Wistar rats, ages 3 months (young) and 26 months (old) were separated into either young/control, young/exercised, old/control, or old/exercised with those in the exercised groups receiving a six- week training regimen. As expected, Lon protein expression was found to decline in the aged 8 control when compared to either young control or exercised, however it was moderately restored in aged/exercised mice. Thus decline in Lon expression appears to be a critical marker of the aging process. Dysregulation of Lon expression also occurs in various ageing-related disease states. The liver tissue from diabetic (db/db) 10-week old mice show a 60% reduction in Lon basal expression (Lee, Chung et al. 2011). Loss of Lon also triggers insulin resistance in hepatocytes with an increase in gluconeogenesis, presumably due to decreased Lon involvement in the assembly of the electron transport chain complex, COX II (Hori, Ichinoda et al. 2002). Similarly, loss of mitochondrial function has been linked as an underlying cause of heart failure (Lesnefsky, Moghaddas et al. 2001). A mouse model, used to simulate heart failure through a transverse aortic constriction (TAC) demonstrated that mitochondrial proteolytic capacity was significantly reduced (Hoshino, Okawa et al. 2014). In addition, TAC tissue showed a decrease in the level of cysteine reduction in Lon, accompanied with an increase in the amount of Lon carbonylation. This suggests that excessive oxidative stress following the TAC procedure oxidizes Lon and triggers a reduction in proteolytic capacity (Hoshino, Okawa et al. 2014). In contrast, malignant cancers, shown to be excellent activators of multiple stress response pathways (Valko, Rhodes et al. 2006), have high levels of Lon expression. Lung, colorectal, and head-and-neck cancers have all been linked to having increased Lon basal mRNA expression (Cheng, Kuo et al. 2013). A rodent study using Wistar rats with hyperthyroidism that was triggered by the Zajdela hepatoma tumor, showed up-regulation of Lon mRNA levels, protein levels, and activity, which was attributed to hyper-elevated mitochondrial biogenesis (Luciakova, 9 Sokolikova et al. 1999). A clinical study of patients with bladder cancer found that malignant cells contain high levels of Lon mRNA and protein with a corresponding reduction in survivorship (Liu, Lan et al. 2014). One possible mechanistic explanation for the benefits of chronic Lon over-expression in tumorogenesis is the stabilization of NADH dehydrogenase (ubiquinone), a critical iron-sulfur protein of Complex I (Cheng, Kuo et al. 2013). This in turn, triggers an increase in the endogenous generation of reactive oxygen species, which further promotes cancer cell survival and malignancy progression. Consequently there is growing evidence that chronically high expression of Lon is essential for tumor progression. This is evident when Lon expression is suppressed in malignant cells and causes an increase in chemo-sensitivity and susceptibility to cell death. This is accompanied by a decrease in the endogenous production of reactive oxygen species (Liu, Lan et al. 2014). A similar pattern arises following Lon suppression in cervical, breast, and lung cancers (Xue, Zhu et al. 2007, Wang, Cheng et al. 2010, Bernstein, Venkatesh et al. 2012, Nie, Li et al. 2013). In addition, Lon haploinsufficiency in mice (Lonp +/- ) protects the animal from tumor progression and metastasis formation, whereas its over-expression (Lonp +/+ ) increases tumorgenesis (Quirós, Español et al. 2014). Overall, proper regulation of Lon is critical in mitochondrial fitness and to prevent the transition into a disease state. Here, I present work showing the sex-dependent and age-related changes in Lon adaptation within the model organism, D. melanogaster. 10 20S Proteasome Overview of the Proteasome The proteasome is a key component in the proteolytic degradation pathway of the cell and is the primary enzyme to degrade cellular proteins (Coux, Tanaka et al. 1996). It is highly conserved from yeast to mammals, with homology between human, rat, drosophila, and yeast showing sequence similarity between the proteasome subunits within the different organisms (Hershko and Ciechanover 1992, Groll, Ditzel et al. 1997). In addition, any deletions of the various subunits shown to be lethal in yeast, emphasizing its important role in protein turnover within the cell (Arendt and Hochstrasser 1997). As such, the proteasome is the second most-abundant cellular protein and constitutes approximately 5% of the total cellular proteome mass (Marguerat, Schmidt et al. 2012), and is primarily located within the cytoplasm and the nucleus (Waxman, Fagan et al. 1987). Due to its relative ‘abundance’ within the cell compared to other proteolytic enzymes, the proteasome is implicated in the degradation of a variety of different cellular proteins. Yet expression level of the proteasome is tissue-specific: tissues with high levels of protein turnover, such as the liver, have elevated proteasome expression (Waxman, Fagan et al. 1987). Therefore the proteasome not only turns over the bulk of cytosolic proteins, but its degradation of transcriptional regulators is critical for proper cellular function (Coux, Tanaka et al. 1996). Thus the Ubiquitin-Proteasome system (UPS) maintains and regulates the proteome level within the cell. This pathway does so through two variations of the proteasome. The 26S proteasome is principally involved in homeostatic maintenance of regulatory proteins. It has also been implicated in degrading proteins that result from nonsense or missense mutations (Waelter, 11 Boeddrich et al. 2001). Whereas, following an immediate onslaught of oxidative stress, the ATP- independent 20S proteasome degrades oxidized proteins (Höhn and Grune 2014). Therefore during oxidative stress the ability to not only degrade damaged proteins but various regulatory proteins allow for a more robust response from the cell. This is demonstrated in the degradation of the Nrf2 cytosolic suppressor: Keap1. Under homeostatic conditions, Keap1 enables the polyubiquitin of Nrf2, causing its subsequent degradation by the 26S proteasome. However, during periods of oxidative stress, Keap1, itself, becomes oxidized. In consequence, the 20S proteasome degrades it, allowing for the release of Nrf2 and its subsequent translocation into the nucleus (Figure 1.4). As a result, the UPS allows for de novo synthesis of the proteolytic core, the 19S regulator and plethora of other phase II genes (Höhn and Grune 2014). 12 13 The Structure of the 20S Proteasome The 20S proteasome has been shown to be present throughout multiple species and cell types and is the core of all other forms of the proteasome within the cell, including the 26S proteasome. The different catalytic activities of the 20S proteasome were originally characterized by Wilk and Orlowski (1980), who showed that it possesses trypsin, chymotrypsin, and peptidyl-glutamyl peptide hydrolyzing catalytic activities for protein breakdown (Groll, Heinemeyer et al. 1999). It has a cylindrical shape made up of four unique rings, with each subunit ranging in size from 20 to 32 kD (Kopp, Steiner et al. 1986). The structural setup of the 20S proteasome has been shown to be conserved across multiple species, including T. acidophilium (Löwe, Stock et al. 1995) , yeast (Groll, Ditzel et al. 1997), and mammals (Unno, Mizushima et al. 2002). The outermost rings of the proteasome are dubbed the α rings (consisting of 7 different α subunits, α1-α7) and typically are viewed as the ‘holding chamber’ of the protein targeted for degradation or portions of the protein that have not been fully degraded (Sharon, Witt et al. 2006). The two inner rings of the proteolytic core are the β rings, consisting of seven unique β subunits (β1-β7) (Pickering and Davies 2012). The proteolytic activity of the proteasome is confined to the beta-rings, specifically β1, β2, and β5 (Pickering and Davies 2012) (Figure 1.5). Together, these four rings form a barrel-shape cylinder where proteins are fed through on one end of the cylinder, and broken down into short amino acid fragments that can be reused by the cell (Coux, Tanaka et al. 1996). 14 15 Yet, the stoichiometric interactions between the different rings of the 20S proteasome were not fully investigated until the work by Sharon and colleagues (2006) who employed a combination of tandem mass spectrometry and electron microscopy to elucidate the stoichiometric relationship between the proteolytic core and its substrates. According to their findings, when a substrate binds to the alpha ring it induces a conformational change, which remains even after the substrate is translocated through the alpha ring (Sharon, Witt et al. 2006). A potential outcome of the substrate binding and its subsequent progression into the proteolytic core may have the complimentary effect of releasing the previously degraded product. To explore the size and number of proteins that can fit into the proteolytic core, researchers used cytochrome c (~12kD) and GFP (~27kD). They found that approximately one GFP and two cytochrome c molecules could be accommodated, simultaneously, within the catalytic chamber (Sharon, Witt et al. 2006). This indicates that the number of substrates capable of being in the proteolytic core is primarily dependent upon their size. Yet, to further understand the interaction between the 20S core and the number of substrates it can interact with, an inhibitor of the 20S proteasome was employed. This provided a snapshot of substrate binding within all three regions of the barrel, simultaneously: both antechambers of the α rings and the proteolytic core of the β rings (Hutschenreiter, Tinazli et al. 2004, Sharon, Witt et al. 2006). In addition, it was shown that substrate binding is a cooperative process and even in the presence of high substrate and low proteasome, does not alter the activity of the proteasome, rather the implying the dominant form is for the maximum amount of substrate to be bound to the proteasome, continuously (Sharon, 16 Witt et al. 2006). The structure of the proteasome appears to have evolved to maximize its functional output: the ability to rapidly and continuously degrade oxidized proteins. Assembly of the 20S Proteasome The assembly of the 20S proteasome relies upon a combination of chaperone assistance and self- folding. Assembly begins with the formation of the alpha rings (Gerards, Enzlin et al. 1997), which in mammals, relies upon the heterodimeric chaperone complex, dubbed the Proteasome Assembling Chaperones 1 & 2 (PAC1/2) (Hirano, Hendil et al. 2005). PAC1/2 bind directly with the α5 and α7 subunits. More importantly, PAC1/2 work to suppress the formation of alpha-ring dimers, which can prevent the proper generation of half-proteasomes (consisting of one ring of the 7 alpha subunits and one ring of the 7 beta subunits). In vitro studies found that upon removal of either PAC1 or PAC2 causes decreased alpha ring assembly and the accumulation of alpha ring dimers (Hirano, Hendil et al. 2005). Conversely, overexpression of either chaperone results in the acceleration of the 20S precursor proteasome (Hirano, Hendil et al. 2005). Moreover, PAC1 and PAC2 require the presence of each other, as removal of either, prevents the stable formation of the PAC1/2 heterodimer, and subsequently, decreased alpha ring formation (Hirano, Hendil et al. 2005). An additional chaperone, PAC3, works synergistically with PAC1/2 to help the maturation of the 20S proteasome. Specifically, PAC3 assists in the formation of alpha rings, and together with PAC1/2, mediates the correct formation of half-proteasomes (Hirano, Hayashi et al. 2006). Unlike PAC1/2, which can only interact with the alpha ring, PAC3 can interact with the beta subunits (Hirano, Hayashi et al. 2006). In turn, the PAC1/2/3 complex, along with the alpha ring, provides the scaffolding for the beta-subunit assembly (assisted by the direct interaction of 17 PAC3), resulting in the catalytically active N-terminal sites of the beta subunits directed inwards, and the C-terminal sites directed outwards. During the maturation step, PAC3 dissociates from the half-proteasome and is recycled for further de novo proteasome assembly (Hirano, Hayashi et al. 2006, Murata, Yashiroda et al. 2009). In contrast, PAC1/2 remain attached, and subsequently are degraded, as indicated by their rapid turnover (~30 minutes) (Yang, Fruh et al. 1995). An additional accessory chaperone was also identified, originally in yeast as Ump1p (Ramos, Höckendorff et al. 1998), and later identified in mammals, as the proteasome maturation protein (POMP) (Fricke, Heink et al. 2007). Similar to the PAC1/2, POMP has a short half-life, which is indicative of its degradation following mature proteasome assembly. Its role is necessary for the initiation of the beta-ring formation, and has been shown to interact with the alpha ring prior to beta subunit attachments, and is necessary to facilitate the incorporation of the β2 subunit (Hirano, Kaneko et al. 2008). Additionally, knockdown of Ump1 impairs β5 recruitment (Hirano, Hayashi et al. 2006). Conversely, overexpression of Ump1/POMP was found to be beneficial against oxidative stress, during cellular senescence (Chondrogianni and Gonos 2007). The final step of mature proteasome formation, relies upon proteasome self-assembly. As found in other proteases, the proteasome is a propeptide, which carries out its own folding and molecular assembly (Kingsbury, Griffin et al. 2000). An essential step in formation relies upon the interaction of the C-terminus of β2 interacting with β3. Cells that lack the propetide activity of β2, blocks β3 recruitment, and is lethal (Hirano, Kaneko et al. 2008). Additionally, the C- 18 terminus of β7, which interacts with β1 and β2 in the opposite beta ring, is critical in uniting the two half-proteasomes. Upon correct dimerization, the beta-propetides are removed and Ump1 is degraded, resulting in a maturely formed 20S proteasome (Murata, Yashiroda et al. 2009). Moreover, a synergistic relationship exists between the proteasome subunits. Largely because a coordinated response of the individual subunits is necessary for efficient assembly. Studies in human lung fibroblasts and myeloid leukemia cells found that upregulation of the β5 subunit triggered a complimentary increase in all three of the beta subunits (Chondrogianni, Tzavelas et al. 2005). Additionally, an early study found a similar trend, as stable expression of either the β1 or β5 increased the activity of the other two beta subunits. This finding was important as alterations in proteasome expression and activity occur with age (Chondrogianni, Stratford et al. 2003, Chondrogianni, Tzavelas et al. 2005). Indeed, by forcing the overexpression of the β5 subunit, late passage cells, increased the number of population doublings and delayed cellular senescence (Chondrogianni, Tzavelas et al. 2005). Thus, offering a potential approach of increasing the available pool of functional 20S proteasomes. The Function of the 20S Proteasome Some of the early evidence for the 20S proteasome ATP-independent activity was shown by treating samples with a low concentration of SDS (0.04% SDS), a detergent, providing a good in vitro approach to cause protein misfolding. Samples that contained only the 20S core or samples that contained both the 20S and the 19S complex (the 26S proteasome), showed increased proteolytic activity in the absence of ATP, demonstrating not only the 20S core was a common feature in both forms of the proteasome, but its ATP independent proteolytic activity(Bond and 19 Butler 1987, Hershko and Ciechanover 1992). Further evidence to show that the proteasome core is made up of the 20S was highlighted when samples treated with a 20S inhibitor showed not only loss of proteolytic activity, but its activity was also stopped in the presence of ATP, further implicating the role of the 20S core as the region of the proteasome to degrade proteins (Eytan, Ganoth et al. 1989). One of the primary roles of the 20S proteasome is to degrade oxidized proteins (Pickering and Davies 2012). This is critical due to the internal and external stresses that can damage the protein machinery of a cell. Hindrance or overall inability to degrade oxidized proteins can jeopardize cell survival due to the formation of bulky protein aggregates. Across multiple cell types and murine models, it has been demonstrated that proteins are naturally susceptible to protein oxidation, and in consequence, transforming them into primary substrates of the proteasome (Davies 1986, Grune, Reinheckel et al. 1995). In addition, studies demonstrating that low levels of oxidative stress, resulting in mild oxidative damage, cause these substrates to be prime targets of the proteasome. However, with high levels of oxidative damage, cause extensive protein aggregation and accumulation, making these protein aggregates difficult for the proteasome to degrade, and in consequence, a decrease in proteolysis (Grune, Jung et al. 2004). One of the confounding issues in understanding the proteasome and its relation to protein degradation was determining if the 26S or the 20S, alone, was capable of degrading oxidized non-ubiquitinated proteins. Some early work demonstrated that the 26S proteasome was capable of degrading oxidized, non-ubiquitin tagged proteins (Ferrington, Sun et al. 2001). However, it was later discovered that this was likely not the case because with increasing concentrations of 20 hydrogen peroxide, the 26S proteasome falls apart, whereas the 20S proteasome is still capable of proteolysis (Reinheckel, SITTE et al. 1998). Interestingly, the concentration of hydrogen peroxide necessary to cause 50% inhibition of the 20S proteasome activity is physiologically never reached within the environment of the cell, indicating the 20S proteasome ability to degrade, without becoming susceptible to oxidative damage, itself (Reinheckel, SITTE et al. 1998). The dynamics between the 26S and 20S proteasome in relation to proteolysis was demonstrated in K562 cells, upon increasing levels of oxidative stress, found that independent of ATP, cellular lysate was still capable of protein degradation, providing a measure of 20S activity. However, in the presence of ATP and immediately following hydrogen peroxide exposure, overall proteolysis was measured (26S and 20S complexes) and protein degradation decreased. Yet to determine if the 26S proteasome is permanently damaged, following hydrogen peroxide exposure, cells treated with various concentrations of hydrogen peroxide were allowed to recover for 24 hours. Subsequently, cell lysates, in the presence of substrate and ATP, showed proteolytic activity. Thus this work demonstrated that the 20S proteasome is the immediate response mechanism to degrade oxidized proteins. In addition, even slight exposure to hydrogen peroxide caused the 26S proteasome to disassemble (Reinheckel, SITTE et al. 1998). This potentially may allow for increasing the immediate pool of 20S cores available to degraded oxidized proteins. Overall this presented the model that the 20S core acts as the immediate protease to degrade oxidized proteins, whereas the 26S proteasome becomes active only after an initial recovery period. 21 Kinetics of the 20S Proteolytic Core The unique differences between the two ring structures of the 20S core sum together to promote high degradation efficiency by the proteasome. The rate of substrate degradation is dependent upon the opening width of the different ring structures and the length of the substrate. The α rings act as a gate that determines the rate substrates enter or exit the proteolytic core and the mean length of the degradation peptides (Groll, Bajorek et al. 2000, Köhler, Cascio et al. 2001). The opening of the α rings allows substrates to enter, whereas the duration of gate constriction promotes substrate degradation into peptides ranging in length from 3 to 24 amino acids (Kisselev, Akopian et al. 1999). Overall, size exclusion chromatography has uncovered three subpopulations of different amino acids (aa) that are generated after proteolysis: 2-3 aa fragments, 8-10 aa fragments, 20-30 aa fragments (Köhler, Cascio et al. 2001). In certain instances, short periods of the α ring closure results in an average increases in the length of the amino acids generated (Kisselev, Akopian et al. 1999, Köhler, Cascio et al. 2001). This was demonstrated through the generation of proteasome mutants incapable of constricting the α rings (Groll, Bajorek et al. 2000). These mutants were able to degrade substrates faster, but the average length of the generated fragment increased by approximately 20% (Groll, Bajorek et al. 2000, Köhler, Cascio et al. 2001). Rapid opening of the α ring has been implicated during the immune response. Two possibilities may trigger changes in the rate of fragment efflux. By reducing the degradation rate of foreign material (viruses or bacteria) may expedite the ability to signal a microbial attack and to ensure large fragments of foreign material can be incorporated for antigen presentation (Kisselev, Akopian et al. 1999). 22 To better understand the rate of proteolysis by the 20S core, a novel mathematical approach was generated to determine degradation rates based entirely upon the amino acid length of the protein (Luciani, Keşmir et al. 2005). Prior mathematical modeling of the rate of the 20S proteasome were based upon certain proteins with known cleavage sites (Holzhütter and Kloetzel 2000, Peters, Janek et al. 2002). To create a generalized mathematical model for the rate of degradation of the proteolytic core, two key assumptions were integrated into the model. The first being the preferential cleavage after nine amino acids from the terminal end of the substrate. For substrate degradation to occur, the substrate must bind to one of the proteolytic-containing grooves within the β rings, with a preferred substrate motif consisting of 7 to 9 amino acids in length (Groll and Huber 2003). The second is the rate of degradation fragments exiting the proteasome is proportional to the length: the longer the fragment the longer the amount of time it remains in the proteolytic core (Luciani, Keşmir et al. 2005). The model generated by Luciani and colleagues, shows the rate of proteolysis follows Michaelis- Menten kinetics. Initially, there is a rapid spike in proteolytic activity as the proteasome fills and breaks down substrates, regardless substrate length and the influx of substrate. The rate of degradation continually increases as substrate concentration increases, until it reaches a plateau of maximum capacity at high substrate concentrations. When both the cleavage and export rates are similar, the three subpopulations of aa fragments are generated, with the 8-10 aa fragment being the most favored due to the preferred cleavage occurring at approximately every 9 amino acids of the substrate (Köhler, Cascio et al. 2001). However, with increased length of the substrate, coupled with high substrate concentration, reduces the overall maximum degradation velocity that can be achieved by the proteolytic core (Luciani, Keşmir et al. 2005). 23 Yet what is to prevent newly fragmented amino acids from re-entering the proteasome core? The cytosolic environment contains a plethora of other peptidases and proteases that work to degrade small peptides into their individual amino acids (Reits, Neijssen et al. 2004). Yet, it is still possible for small fragments to re-enter the proteasome, though this is not a favored direction of the reaction (Luciani, Keşmir et al. 2005). Typically when long fragments are being degraded there is little back entry from small peptides. Only when the substrate is greater than 80% degraded does the ratio of fragments begin to dominate. These re-entry fragments constitute the majority of small fragments (2-4 aa) that are generated and as the pool of fragments increase and their rate of re-entry, leads to an overall reduction in the proteolytic capacity (Köhler, Cascio et al. 2001, Luciani, Keşmir et al. 2005). Overall, the rate limiting component of the proteasome appears not to be dependent upon the amount of substrate in the environment, as the maximum velocity does not change (Luciani, Keşmir et al. 2005). Rather, it appears to be the ratio of substrate to fragments that reduce its proteolytic capacity. As more substrate is degraded, results in an increase in the fragment pool. High concentrations of the cytosolic peptide pool may outweigh the rate of other peptidases and proteases to degrade these fragments (Reits, Neijssen et al. 2004). In consequence, these fragments may re-enter the proteasome and reduce its proteolytic capacity. Thus, the proteolytic capacity appears not to be hindered by high levels of substrate concentration, rather the rate limiting component appears to be its own degradation product (Luciani, Keşmir et al. 2005). 24 The Role of the 20S Proteasome in Adaptation to Oxidative Stress Various terms, such as adaptive response, adaptive homeostasis, dose-response, and hormesis are used to describe the ability of cells and whole organisms to increase their tolerance to stress on a transient basis. Hormesis specifically refers to the adaptive response to low-dose toxin exposure, while dose-response is considered a pharmacological term. We favor the terms adaptive response and adaptive homeostasis because it better conveys the physiological relevance, and allows for the inclusion of agents or conditions which may not be stressors in themselves, but which control signal transduction pathways that regulate stress resistance. Transient adaptive stress-responses result in the transcription of protective genes that promote cell survival. A number of cellular stress-response pathways have evolved to manage dysfunction in protein homeostasis including the heat shock response, oxidative stress response, and proteasome-dependent protein degradation. The first studies to demonstrate adaption to oxidative stress in the 1980’s used E. coli, S. typhimurium, and S. cerevisiae to show that after recovery from a mild dose of H2O2, the organisms transiently became more tolerant of a subsequent, normally toxic or lethal exposure (Demple and Halbrook 1983, Christman, Morgan et al. 1985, Davies, Lowry et al. 1995, Davies 1995). Since then, this phenomenon has also been demonstrated in C. elegans (Pickering, Staab et al. 2013), D. melanogaster (Pickering, Staab et al. 2013), and mammalian cell culture (Wiese, Pacifici et al. 1995). Recently, it has become apparent that a great degree of crosstalk exists between these mechanisms. For instance, adaptation to oxidative-stress provides some heat-stress tolerance, and results in an upregulation of heat shock proteins including hsp70, which is crucial for the reassembly of the 26S proteasome following an oxidative insult (Grune, Catalgol et al. 2011, Kastle, Reeg et al. 2012). 25 One of the most well-characterized transcriptional regulators of the oxidative stress response is the Nuclear Factor (erythroid-derived 2)-Like 2 (Nrf2), which controls the transcriptional response of an array of antioxidant response genes, including glutathione peroxidases and glutathione transferases (Itoh, Chiba et al. 1997), and the 20S proteasome (Pickering, Linder et al. 2012). Under normal homeostatic conditions, Nrf2 is bound to the Kelch-like ECH-associated protein 1 (Keap1)-Cullin 3 (CUL3) E3 ligase complex, enabling the active glycogen synthase kinase-3 (GSK-3) to phosphorylate serine residues within the Nrf2 DSGIS motif (Rada, Rojo et al. 2012). In turn, promoting constitutive polyubiquitinylation of Nrf2 by the β-transducin repeat- containing protein (β-TrCP) Cul1-based E3 ubiquitin ligase complex (SCF β-TrCP ), which promotes the degradation of Nrf2 by the 26S proteasome (Rada, Rojo et al. 2011, Taguchi, Motohashi et al. 2011). In response to oxidative stress, cysteine residues (Cys151 and Cys273) on Keap1 are modified and GSK-3 activity is inhibited by phosphorylation of its N-terminal serine residues (Ser 9 and Ser 21 in GSK-3β and GSK-3α, respectively) by protein kinase B (PKB)/Akt. This in turn, blocks the ubiquitin ligase from phosphorylating Nrf2 (Kobayashi, Kang et al. 2004, Salazar, Rojo et al. 2006). Nrf2 is then able to translocate into the nucleus, where it binds to Antioxidant Response Elements (also called Electrophile Response Elements), consisting of the sequence {5’-A/G TGA C/G NNNGC A/G-3’} (Paul, McMahon et al. 2003, Taguchi, Motohashi et al. 2011) The promoter regions of many 20S α- and β-subunits, and PA28αβ subunits, possess EpRE/ARE domains consisting of the core motif RTGACnnnGC or the extended motif TMAnnRTGAYnnnGCAwwww (Nerland 2007, Pickering, Linder et al. 2012). Following 26 exposure to adaptive doses of H2O2, mammalian cells showed increased cellular levels of Nrf2, translocation of Nrf2 to the nucleus, and an increase in recruitment to the β5 subunit promoter (Pickering, Linder et al. 2012). Inhibition of Nrf2 with siRNA and retinoic acid abrogate the adaptive increase in 20S proteasomes, PA28αβ, proteolytic capacity and stress resistance (Pickering, Linder et al. 2012). Interestingly, this pathway is conserved in the C. elegans homolog, SKN-1, and the D. melanogaster homologs, CnC and dKeap1 (Sykiotis and Bohmann 2008, Pickering, Staab et al. 2013, Tsakiri, Sykiotis et al. 2013). Both knockdown using RNAi, and a deletion mutant for skn-1, negatively impact oxidative stress-induced 20S proteasome expression and cytoprotection (Pickering, Staab et al. 2013). While adaptation applies to a number of cytoprotective pathways in response to a variety of stressors, the response to oxidative damage is of particular interest because of the association for oxidative damage accumulation during aging. The Role of the 20S Proteasome in Aging and in Age-Related Diseases A hallmark of aging is the decline in the quality control mechanisms of the cellular proteome (Taylor and Dillin 2011). Loss of protein homeostasis results in an increase in protein oxidation, protein misfolding, and protein aggregation that can lead to aging-related diseases, including cardiovascular disease (CVD) (Wang and Robbins 2006), ischemic stroke (Chen, Yoshioka et al. 2011), and neurodegenerative disorders (Morimoto 2008). Proteasome activity has long been described to decline with age, thus contributing to the overall loss in protein homeostasis during aging. However, this assertion appears to be in opposition to the aging-related increase in muscle wasting that is observed in C. elegans (Herndon, Schmeissner et al. 2002), rats (Medina, Wing et al. 1995), and humans (Suetta, Frandsen et al. 2012). Specifically, the use of proteasome 27 inhibitors, such as Bortezomib, were able to partially alleviate muscle wasting within mouse models of congenital muscular dystrophy, which led to improved body weight, locomotion, and survival (Korner, Fontes-Oliveira et al. 2014). Patients diagnosed with Duchenne Muscular Dystrophy (DMD) show increased activation of the ubiquitin-dependent proteolysis (Kumamoto, Fujimoto et al. 2000). Treatment with Veclade, an FDA approved selective proteasome inhibitor, showed improvement within muscle-related markers (Gazzerro, Assereto et al. 2010). The discrepancies over the age-related changes in proteasome activity and expression may be, in part, due to differences in tissue, age, sex, and the lack of clearly distinguishing between the 20S and 26S proteasome activity. Differences in basal expression of the 20S proteasome have been shown to be higher in females (Tsakiri, Sykiotis et al. 2013) or found to have no difference (Mitchell, Madrigal-Matute et al. 2016). Whereas, 10 day old C. elegans were found to have higher basal expression and activity compared to their 3 day old counterparts (Raynes, Juarez et al. 2016), indicating both sex and species’ variation. Other studies, exploring proteolytic capacity, found that in the spinal cord of rats ranging from 3 weeks to 28 months, chymotrypsin- like activity steadily decreases with age (Keller, Huang et al. 2000). However, when this same assay is used to assess proteasome activity in the triceps of aging rats, it was found that proteolytic activity increased, in addition to elevated levels of the ubiquitin ligases and proteasome β-subunits (Altun, Besche et al. 2010), indicating the importance of exploring tissue- specific differences in the 20S activity. In support of this data, a recent human trial found that the ubiquitin-proteasome pathway was activated in both young and old individuals upon immobilization, thereby triggering muscular atrophy (Suetta, Frandsen et al. 2012). Thus, it 28 seems that increased ubiquitin-dependent proteolysis is a major determinant of sarcopenia and muscle wasting during aging. Oxidation is capable of damaging all cellular components, including DNA, lipids, and proteins, and several lines of evidence have indicated that oxidative stress is central to aging and the development of many aging-related diseases (Halliwell and Gutteridge 1999, Jacob, Noren Hooten et al. 2013). Hence, the importance of cellular repair mechanisms, including the proteasome, to remove damaged proteins. While activity of the 26S proteasome and ubiquitin- dependent proteolysis does appear to increase in a tissue-specific manner during aging, the ability to degrade oxidized proteins by the 20S proteasome, appears to diminish with age. Loss in protein turnover by the 20S may be considered one of the major contributing factors in the overall decline in protein homeostasis (López-Otín, Blasco et al. 2013). Heart failure is the number one cause of hospitalization for people aged 65 and older, and nearly all patients with, or at risk for, heart disease have enhanced levels of oxidative stress (Madamanchi, Vendrov et al. 2005, Hall, Levant et al. 2012). Oxidative stress has also been demonstrated to have a major role in the initiation and progression of atherosclerosis, which is an underlying cause for a number of cardiovascular complications (Bonomini, Tengattini et al. 2008). Moreover, in hypertensive rats, oxidative stress was found to mediate progressive cardiac fibrosis by enhancing TGF-β1 expression (Zhao, Zhao et al. 2008). As oxidative stress increases with age, the capacity to degrade misfolded and oxidized proteins within the cell declines. A study using human lung fibroblast WI-38 cells, as a model for replicative senescence, found that both 20S expression and activity were mitigated in senescent 29 cells, correlating with an increase in carbonylated and ubiquitinylated proteins (Chondrogianni, Stratford et al. 2003). In addition, blocking the proteolytic activity of the 20S core in low passage WI-38 cells induced an aged-phenotype (Chondrogianni, Stratford et al. 2003). In an in vivo study using rat liver tissue, 20S proteasome expression did not change for old animals compared to young animals, but caspase-like activity showed a 60% reduction in aged rats (Hayashi and Goto 1998). Conversely, fibroblasts from long-lived rodent and bird species showed lower susceptibility to protein oxidation, along with higher basal 20S activity. As well, fibroblast cultures from healthy centenarians showed functional proteasomes on par with fibroblasts from young individuals (Chondrogianni, Petropoulos et al. 2000). Moreover, there was no lifespan correlation found between the 26S activity and increased survival (Pickering, Lehr et al. 2015). As well, the 20S proteasomal activity is elevated in the livers of the long-lived naked mole rat in side-by-side comparisons to standard mice strains (Rodriguez, Edrey et al. 2012). Furthermore, over-expression of 20S proteasome subunits has resulted in lifespan extension in yeast (Chen, Thorpe et al. 2006) and worms (Vilchez, Morantte et al. 2012, Chondrogianni, Georgila et al. 2015). Together, demonstrating optimal maintenance of basal proteasome activity may outweigh proteasome expression. A number of mammalian cell culture studies, including mitotic and post-mitotic cells (Sitte, Huber et al. 2000, Sitte, Merker et al. 2000, Sitte, Merker et al. 2000, Grune, Shringarpure et al. 2001, Grune, Jung et al. 2004, Grune, Merker et al. 2005), and extending into model organisms (David, Ollikainen et al. 2010, Demontis and Perrimon 2010, Tsakiri, Sykiotis et al. 2013, Raynes, Juarez et al. 2016), have shown an age-related increase in the accumulation of oxidized and aggregated proteins. Fundamentally, protein oxidation leads to structural rearrangement, 30 resulting in exposure of hydrophobic patches, which, under periods of acute stress, are the primary recognition motifs by the ATP-independent 20S core. However, with age, the excess protein damage may overwhelm the 20S capacity, leading to aggregation. Such oxidized protein aggregates often have volatile amino acid residues, such as tyrosyl or tryptophanyl radicals, which can react to form permanent covalent cross-links between proteins, thus further stabilizing the damaged aggregates (Leeuwenburgh, Rasmussen et al. 1997). More importantly, the mechanical limitations of the 20S opening may further hamper turnover rate. With age, large protein aggregates, exceeding the limited aperture of the 20S proteasome, are not readily degraded. These cross-linked protein aggregates do, however, attract 20S proteasomes, at which point the α-subunits can bind to the hydrophobic regions, thus trapping the proteasomes and removing them from the active pool of proteases (Stenoien, Cummings et al. 1999, Shringarpure and Davies 2002, Verhoef, Lindsten et al. 2002). Essentially, this is a special case of reversible non-competitive proteasome inhibition. While some studies have indicated an increase in 20S proteasome synthesis and activity in cell lysates during aging, this may not produce an accurate reflection of functional proteasomes in vivo. Proteasomes that are sequestered at aggregation sites within the cell cannot degrade oxidized proteins, but lysates from these cells will reflect the increased number of proteasomes and demonstrate their activity in vitro once liberated from protein aggregates, thus giving a false indication of overall proteolytic capacity during aging. These studies clearly show that oxidatively-damaged protein aggregates, such as observed in aging and senescent cells, can decrease the functional pool of 20S proteasomes, and therefore the overall capacity of aged cells to degrade oxidatively damaged proteins. 31 Immunoproteasome Overview of the Immunoproteasome The immunoproteasome resembles the 20S proteasome in structure, except that the three β subunits of the catalytic 20S core are replaced by three different immunoproteasome βi subunits, all of which are inducible by interferon-γ stimulation (IFN- γ) (Aki, Shimbara et al. 1994, Huber, Basler et al. 2012) or by oxidative stress (Pickering and Davies 2012). The immunoproteasome β2i subunit (MECL-1) has trypsin-like activity, matching the 20S β2 subunit. Similarly, the β5i subunit (LMP7), like its β5 counterpart in the 20S core, demonstrates chymotrypsin-like activity. However, unlike the 20S β1 subunit, which shows caspase-like activity, the immunoproteasome β1i subunit (LMP2) exhibits chymotrypsin-like activity. This apparent redundancy of activity in both the β1i and β5i may explain the overall increased chymotrypsin-like activity of the immunoproteasome compared to the 20S catalytic core. This in turn, aids in the generation of peptides with hydrophobic C-termini to fit in the groove of MHC class I molecules (Gomes 2013). In addition, the immunoproteasome assembles more quickly than does the 20S proteasome (Heink, Ludwig et al. 2005). However, the immunoproteasome lacks the ability to cleave peptide bonds after aspartate or glutamate residues, perhaps implying specificity for its role in the immune response (Figure 1.6) (Huber, Basler et al. 2012, Gomes 2013). 32 33 Assembly of the Immunoproteasome Similar to the assembly in the 20S proteasome, the immunoproteasome is assembled in a stepwise fashion. During proteasome biogenesis, either the constitutive beta subunits (β1, β2, and β5) or the inducible catalytic subunits (β1i, β2i, and β5i) are incorporated, dependent upon the cellular stress (Akiyama, Yokota et al. 1994, Groettrup, Kraft et al. 1996). During assembly, when both the IFN-γ inducible subunits and constitutive subunits are present, the amount of either pre-LMP2 and pre-MECL when compared to pre-β5, may determine which pathway dominates (Stohwasser, Standera et al. 1997). Additionally, preproteasomes that already contain pre-LMP2 and pre-MECL may favor the incorporation of LMP7, resulting in mature immunoproteasomes, and vice versa if pre-β5 is already present. Conversely, overexpression of the β5 subunit, favors the 20S proteasome formation (Gaczynska, Goldberg et al. 1996). The tendency towards cooperative incorporation of all immunoproteasome or all 20S specific catalytic subunits, may be critical in ensuring completion of certain antigen-processing functions that may require all three of the immunoproteasome subunits. Moreover, it disfavors the generation of ‘mixed’ proteasomes, or only under certain conditions where it random peptide processing may be beneficial, such as in the antiviral response (Groettrup, Kraft et al. 1996). One striking difference between 20S and immunoproteasome assembly is the early entrance of the β1i/LMP2 into the assembly process. In turn, pre-immunoproteasome complexes form an intermediate that contains the α-ring and β1i, β2i, β3, and β4 (Nandi, Woodward et al. 1997). At this intermediate stage, the incorporation of β1i and β2i are dependent upon each other, yet it is possible for β1i to be incorporated, independent β2i (Groettrup, Standera et al. 1997, Griffin, Nandi et al. 1998). Lastly, the incorporation of β5i is necessary for its propeptide activity upon 34 β1i and β2i (Griffin, Nandi et al. 1998), indicating the interdependency between all three immunoproteasome subunits. Consistent with these findings, removal of either the β1i or β2i results in impaired immunoproteasome formation, whereas it has little impact upon the β5i subunit, as it can be incorporated within the 20S proteasome (De, Jayarapu et al. 2003) The Role of the Immunoproteasome The immunoproteasome has primarily been studied for its role in generating peptides for antigen presentation by MHC class I molecules in the immune response (Basler, Kirk et al. 2013). The necessity of the immunoproteasome becomes apparent when assessing the impact in immunoproteasome deficient mice. They show altered formation of pathogen-derived epitopes (Kincaid, Che et al. 2012). In turn, providing an immune-dominance in favor of viral epitopes or inability of T-cells to mount a sufficient response to specific viral antigens (Deol, Zaiss et al. 2007, Zanker, Waithman et al. 2013). However, beyond its role in the immune system, the immunoproteasome is an active participant in the clearance of oxidized proteins (Pickering, Koop et al. 2010, Pickering and Davies 2012). Although postulated for some time (Ding, Reinacker et al. 2003, Teoh and Davies 2004, Ding, Martin et al. 2006), the first demonstration that the immunoproteasome can actually preferentially degrade oxidized proteins with an activity and selectivity equal to, or greater than, that of the 20S proteasome has been shown within the past decade (Pickering, Koop et al. 2010, Grimm, Ott et al. 2012, Pickering and Davies 2012, Yun, Kim et al. 2016). In addition, binding of the 11S (Pa28) regulator to the immunoproteasome clearly improves both its activity and selectivity for oxidized proteins (Pickering, Koop et al. 2010, Pickering and Davies 2012). 35 More recently, the immunoproteasome has been implicated as critical in the proteome maintenance in long-lived animals. Cross-species comparisons of fibroblasts from long-lived versus short-lived rodent species, showed decreased accumulation of protein oxidation (Pickering, Lehr et al. 2015) and possess higher basal stress resistance (Harper, Salmon et al. 2007, Harper, Wang et al. 2011). Intriguingly, proteasome activity in fibroblasts from longer- lived species showed increased proteolytic capacity of the immunoproteasome, rather than the 20S proteasome. (Pickering, Lehr et al. 2015). Age-Associated Changes of the Immunoproteasome Recently, work on the immunoproteasome has suggested an age-related increase. This is in stark contrast to the age-associated stagnation, and in some instances, decline of the 20S proteasome expression and activity (Chondrogianni and Gonos 2005, Chondrogianni, Petropoulos et al. 2014), suggesting the age-associated increase in the immuno-subunits may provide a compensatory mechanism (Husom, Peters et al. 2004). Nor was the increase in immunoproteasome solely dependent upon an inflammatory response (Hussong, Kapphahn et al. 2010). Tissue-specific changes in the immunoproteasome have also been explored. Early microarray studies found that in the brain of aged mice, immunoproteasome subunits increased following IFN- γ and TNF-α stimulation(Lee, Weindruch et al. 2000). Indeed, aged rat hippocampus showed increased expression of the LMP7 subunit, which parallels the age-related increase in neuro-inflammation (Gavilán, Castaño et al. 2009). Additional studies found that immunoproteasome increased not only in the brains of Alzheimer’s patients, but also in the 36 brains of healthy older individuals (Mishto, Bellavista et al. 2006). Whereas, subunit expression remained unchanged in the heart (Lee, Allison et al. 2002), and decreased in skeletal muscle (Lee, Klopp et al. 1999). However, differing reports on immunoproteasome activity in skeletal muscle, requires more work for clarification (Husom, Peters et al. 2004). Overall, indicating tissue-specific differences in the immunoproteasome activity. Model Organisms in Aging Table 1. Benefits of Model Organism C. elegans D. melanogaster M. musculus Practicality Progeny time 3-5 days 10-14 days 3-4 weeks Life span 10 days 6-14 weeks* Years Maintenance costs Low Low High Size 1mm 3mm 10cm Human similarity Total number of genes 19000 13000 25000 Conserved genes >50% >60% >90% Anatomical similarity Very Low Low High Genetic tools Targeted gene knockout No Yes Yes Generation of transgenic lines Weeks Weeks Month *This is dependent upon temperature and diet (modified after (Brandt and Vilcinskas 2013)). One of the major hurdles in understanding the human aging process is the duration. Humans require decades to present an aging phenotype, making it nearly impossible for researchers to 37 study the entire process. Moreover, both cross-sectional and longitudinal studies, though providing valuable observational evidence, affords limited mechanistic understanding. To overcome this limitation, researchers rely upon model organisms. The introduction of the nematode worm (C. elegans) and the fruit fly (D. melanogaster) has helped to greatly accelerate our understanding behind the aging process, which in turn can be explored in the mammalian mouse model. Moreover, due to the simple genetics of invertebrate models, allows for relatively easy tractability in understanding the conserved pathways in aging. As well, a more obvious link, is that like humans, these models will all age and die, though at different rates (3 week in C. elegans, 3 months in D. melanogaster, and 3 years in mice). Furthermore, because of discoveries of conserved genetic pathways, has enabled researchers to extend model organism lifespan, but improved health span in all three of these organisms, implying the potential for a similar outcome in humans. The Role of C. elegans The nematode worm, C. elegans, was first introduced as a model organism to study development and neurobiology in the 1970s (Brenner 1974). Since then, studies in the nematode worm have increased our understanding of conserved pathways, including those involved in metabolism, ageing, and gene regulation (Kimura, Tissenbaum et al. 1997). As well, C. elegans are cheap to propagate, subsisting on E. coli for its food source. In addition, as the majority of nematode worms are hermaphrodites, results in high progeny number (~300 progeny per self-fertilization and ~1400 progeny per mating), which not only allows for approximately thousands of animals, 38 daily, but also genetically identical organisms. Combined with the short generation time (3 days to develop into an adult) and short life cycle (15 days to generate an aged population) makes it an ideal model to understand the mechanisms underlying shared pathways (Figure 1.7A). 39 Indeed, the nematode worm provided the first taste of the genetic simplicity in uncovering genes involved in the aging process. The discovery of the age-1 recessive mutation, the homologue of the mammalian phosphatidylinositol-3-OH kinase (PI3K) gene, was found to extend both the average (+65%) and the maximal lifespan (+110%) in nematode hermaphrodites (Friedman and Johnson 1988). Since this initial discovery, others have identified key conserved pathways, most notable being the insulin/IGF-1 pathway, necessary for development and growth. Thus the discovery of the DAF-2 mutant (Kimura, Tissenbaum et al. 1997), later identified as the mammalian homologue of the insulin/insulin-like growth factor (IGF)-1 receptor (Tatar, Bartke et al. 2003), led to the identification of the life-extending DAF-16 mutant (Lin, Dorman et al. 1997). In turn, the DAF-16 mutant enabled the discovery of the mammalian forkhead/winged- helix transcription factor (FOXO), a critical stress-responsive and energy-sensitive master regulator that controls a plethora of cellular defensive mechanisms (Greer and Brunet 2005). Identification of these highly conserved enzymes may have been greatly delayed if we were limited to only cell culture and/or direct human models. As well, the morphological changes the nematode worm undergoes, makes it a good model in understanding the parallel phenotypic changes that arise in aging humans. Most notable, and highly relevant, is the age-associated muscle deterioration (or muscle atrophy) (Myllyharju and Kivirikko 2004). Adult nematode worms contain approximately ~960 somatic cells, which during senescence, demonstrate characteristics very reminiscent to sarcopenia in humans (Roubenoff 2000). More intriguing is the high variability of these characteristics that arise in worms that are genetically identical and cultured in highly uniform environments (Herndon, Schmeissner et al. 2002). A finding that matches the increased variability that occurs during 40 human aging (Finch and Kirkwood 2000). Providing an additional benefit of the worm as a model organism: opportunity to explore the mechanisms behind stochastic cellular damage, which may account for the variability seen in aged worms. With growing evidence attributing this variation to mutations within the mitochondrial DNA (Golden and Melov 2001). Moreover, long-lived mutant strains, largely gain their increased longevity through improved stress resistance (Lithgow and Walker 2002). Taken together, these findings indicate the usefulness of the nematode worm for deepening our understanding behind the mechanistic process of aging. The Role of D. melanogaster D. melanogaster have been utilized as a model species since the early 1900s (Arias 2008). In large part because of its short developmental lifecycle (Figure 1.7B), easy genetic manipulation, the presence of both sexes, and high progeny production, allowing for the creation of genetically homogenous organisms. In addition, they are relatively easy and cheap to grow, with transgenic stocks requiring fresh food every month, dependent upon the temperature (19°C). Thus making them an ideal model for generating large progeny sets with identical genetic backgrounds. For aging researchers, the short life cycle of D. melanogaster makes them particularly appealing, as the range in lifespan is within months. Although the D. melanogaster genome is 5% the size of the mammalian genome (Adams, Celniker et al. 2000), many of the pathways, central in mammalian aging, are found within the fruit fly (Doronkin and Reiter 2008). One of the first genes identified for controlling longevity was the identification of the conserved insulin- like/IGF-1 pathway, first identified in the worms, and dubbed ‘chico,’ due to the small size of the 41 fly mutants (Clancy, Gems et al. 2001). Therefore, indicating a conserved age-related pathway that is consistent between model organisms. The use of D. melanogaster in aging studies became further advantageous upon the advent of the conditional gene expression system, Gene-switch (Osterwalder, Yoon et al. 2001, Ford, Hoe et al. 2007). The technique allows for the easy manipulation of a gene-of-interest to determine its function. The gene of interest contains an upstream activation site (UAS), which upon the addition of RU486/Mifepristone, activates the GeneSwitch-GAL4 protein. In turn, binding to the gene of interest, resulting in transcriptional activation. This is illustrated in Figure 1.8, females of the Actin-‘Gene-Switch’-255B (Actin-GS-255B) driver strain are mated to males containing the target gene. Upon the addition of RU486, it binds to the progesterone receptor domain, causing the GAL4 DNA binding domain to interact with the upstream activation site to modulate the expression of the target gene. Depending on the upstream enhancer, the gene-of-interest can have tissue-wide expression or tissue-specific expression (such as in the nervous tissue or muscles). In addition, as RU486 is added directly to the food, allows for gene regulation at any stage within the lifespan, from larval development or adulthood. 42 Moreover, the fruit-fly has proven to be a good model for understanding age-related chronic diseases. Due to the high cross-over in shared genes between humans and fruit-flies, has enabled mechanistic understanding in diseases, including Alzheimer’s disease (AD), Type II Diabetes, Parkinson’s Disease, sarcopenia, macular degeneration, and the majority of cancers (Bernards and Hariharan 2001). Thus providing a relatively cheap approach in uncovering the dysregulation that occurs during disease pathology and means of testing approaches to slow phenotypic presentation. 43 Two of the leading diseases to face the aging population is Alzheimer’s disease (Association 2013) and cardiovascular disease (Santulli 2013). Due to the enormity of not only the economic, but social cost, it is critical we develop interventions to eliminate or slow the disease progression. Again, fruit-flies have offered a strong model in increasing our basic understanding behind AD development. For example, D. melanogaster neurons are sensitive to Aβ toxicity, which when expressed, triggers a neurodegenerative phenotype, and amyloid deposits, mimicking the human disease presentation (Finelli, Kelkar et al. 2004). Moreover, the fruit-fly can also be used to assess cardiac dysfunction, as it is the only invertebrate model with a heart. Similar to the human heart, the performance of the fly heart decreases with age, presented in the form of arrhythmias (Ocorr, Akasaka et al. 2007). Taken together, these findings show the strong tool the fruit-fly offers to researchers in the aging field. Limitations of Invertebrate Models Although invertebrate models have provided extensive foundational work in understanding common age-associated pathways in ourselves, additional models may be necessary in furthering the identification of other ‘longevity’ genes or age-related pathways. Since the inception of the nematode worm and the fruit-fly, a great amount of divergence has evolved between these invertebrates and humans, resulting in extensive genetic loss (Austad 2009). Moreover, the larvae (especially in C. elegans) is capable of entering an organism-specific state that is not present in humans (the dauer state), in response to stress or limited nutrient supply (Riddle and Albert 1997, Murthy and Ram 2015). As well, both invertebrates have limited ability for tissue renewal and repair mechanisms that are key in mammalian tissue homeostasis (Austad 2009). 44 Hence, additional alternatives need to be explored to increase our genetic toolkit in order to answer specific questions related to aging. Role of M. musculus The mouse model is arguably, the primary mammalian model in aging research and interventions. In part, because of the high genetic similarity between mice and humans. Moreover, the large array of genetic tools, mutant strains, the presence of both sexes, and similar physiological functions to that of humans, make the mouse an ideal candidate (Vanhooren and Libert 2013). Additionally, although invertebrate models have uncovered many conserved pathways, many researchers argue that the mouse mammalian model system is necessary to fully understand aging. As well, clinical trials require data from mammalian models to assess safety and efficacy, much of which has been dominated by data from mouse models (Denayer, Stöhr et al. 2014). Indeed, mouse studies have offered insight into longevity interventions, which have provided the groundwork for future studies in humans. One of the most well-characterized interventions is caloric restriction (CR). Originally demonstrated as beneficial for lifespan extension in rats (McCay, Crowell et al. 1935), the approach has since been found to extend the mean and the maximum lifespan in multiple mouse strains (Weindruch, Walford et al. 1986, Sohal, Agarwal et al. 1994) and various levels of CR (Mitchell, Madrigal-Matute et al. 2016). Furthermore, CR has been shown to delay the onset of age-related diseases, including cancer (Weindruch and Walford 1982), neurodegenerative diseases (Halagappa, Guo et al. 2007), and cardiovascular disease 45 (Mattson and Wan 2005). Yet, recent evidence has shown that the benefits of CR may be strain- specific and sex-dependent (Liao, Rikke et al. 2010) Mouse models have also demonstrated the beneficial impact of drug interventions, most notable being metformin, rapamycin, and resveratrol. In each case, these CR-mimetics have demonstrated improved health-span (Pearson, Baur et al. 2008, Martin-Montalvo, Mercken et al. 2013, Zhang, Bokov et al. 2014), and in the case of metformin and rapamycin, increased lifespan (Anisimov, Berstein et al. 2008, Cox and Mattison 2009). Moreover, these findings set the groundwork for seminal human clinical trials utilizing metformin as a therapeutic approach to delay aging in healthy older adults (Clinical Trial NCT02432287), with future clinical trials of other mimetics most likely to follow. Limitations of Mouse Models Yet, no model is perfect, and laboratory mouse models do have their drawbacks. Although mouse models provide insight into therapeutic safety and efficacy, a mouse is not a human. Hence, the high failure rate between therapies deemed successful in the mouse model, yet shown to fail in human trials. Indeed, over 85% of novel drugs fail within Phase II clinical studies (Ledford 2011). Moreover, this discrepancy prevents a blaring problem in translational research, due to the high rate of therapeutic failure, evident in various cancer therapies, where less than 8% of pre-clinical drugs successfully translate from animals to humans (Mak, Evaniew et al. 2014). As our population is living longer, but facing a higher incidence of chronic diseases, the need for developing successful interventions is fiscally crucial. 46 Moreover, utilizing mice for a disease phenotype they are not prone to naturally develop, further hinders translational progression. This is highly prevalent in Alzheimer’s disease (AD) research. Although aged mice, similar to cognitively healthy older adults, can develop neuropathological lesions that mirror the AD pathology, they do not develop the crippling cognitive loss associated with the disease (Walker 1997). Hence, given the enormity of expense in developing a drug (Adams and Brantner 2006), it is paramount that the models used, will help to provide a strong basis for a similar outcome in humans (Sharpless and DePinho 2006, Pandey and Nichols 2011). Sexual Dimorphism Across species, females typically outlive males (Holzenberger, Dupont et al. 2003, Barford, Dorling et al. 2006, Maklakov and Lummaa 2013, Gems 2014, Zhu, Li et al. 2015). Emphasizing an underlying mechanism which accounts for this lifespan disparity. Many current longevity interventions are beneficial in a sex-specific (female-favored) manner (Shen, Landis et al. 2016). Sexual differences or sexual dimorphism in longevity, may be a consequence of the maternal transmission of the mitochondrial genome (Birky 1995). This invokes a sex-specific selection, with the mitochondrial DNA (mtDNA) only capable of responding to changes that act directly upon females (Frank 1996, Camus, Clancy et al. 2012). As a result, an asymmetric pattern of mitochondrial lineage arises, causing the mitochondrial genome to be best adapted for females, at the detriment of males. Indeed, sexual asymmetry was found in the nuclear gene expression in D. melanogaster. Mitochondrial polymorphisms, which had little impact on nuclear gene expression in females, were found to have major effects in males, modifying nearly 10% of nuclear transcripts, resulting in a greater mutational burden in males (Innocenti, Morrow et al. 2011). Additionally, strains that possessed different naturally-occurring mitochondrial 47 haplotypes, with the same nuclear background, caused wide variations in mutational load, which impacted aging only in males, not females (Camus, Clancy et al. 2012). This was further supported by the demonstration of the direct link between single point mutations within the mtDNA, causing decreased male longevity (Camus, Wolf et al. 2015). Hence, many mutations that have neutral, or in some instances, a positive impact on females, may lead to a mitochondrial burden in males, and may accelerate male aging. This is highlighted in the mitochondrial function of tissues largely involved in energy metabolism such as liver (Roy and Chatterjee 1983, Udy, Towers et al. 1997), muscle (Yang, Schadt et al. 2006) or brown fat tissue (Rodríguez, Monjo et al. 2001, Combs, Berg et al. 2003, Bloor and Symonds 2014). Under basal conditions, mitochondria from female rat liver has been found to have a higher membrane potential, increased substrate oxidation capacity, and lower reactive oxygen species production compared to males, indicating a more efficient, female- adapted mitochondria (Borrás, Sastre et al. 2003, Justo, Boada et al. 2005). In turn, potentially resulting in males having higher basal peroxide production than age-matched females (Borrás, Sastre et al. 2003). As well, females have higher basal activity of nuclear encoded antioxidant genes, such as Manganese Superoxide Dismutase (MnSOD) and glutathione peroxidase, which may contribute to the four-fold difference in oxidative damage that accumulates in male mitochondria (Pinto and Bartley 1969, Borrás, Sastre et al. 2003). Further, this dualism in mitochondrial function appears to remain true even upon conditions that modify mitochondrial demand, such as during caloric restriction. Female mitochondria have been found better able to cope, exhibiting elevated mitochondrial function, increased protein 48 content per mitochondria, and increased oxygen consumption compared to males, further pointing to a female suited mitochondria (Valle, Guevara et al. 2007). As well, aging, itself, could be viewed as a chronic mitochondrial burden. As mitochondria are both the producers and targets of reactive oxygen species, making their DNA, lipids, and proteins highly susceptible to damage (Shigenaga, Hagen et al. 1994, Sastre, Pallardo et al. 1996). Conversely, aged tissue show increased mitochondrial hydrogen peroxide production and oxidation of glutathione (GSH), a frontline antioxidant defense (Esteve, Mompo et al. 1999). Yet, even with an age- related elevation, females of the same chronological age as males, show approximately 40% higher levels of mitochondrial GSH, and conversely, 50% lower levels of oxidant generation (Brigelius, Muckel et al. 1983). In turn, demonstrating that aging provides the greatest distinction between the sexes, with mortality rising faster in males than in females. Sexual dimorphism has been found not only to be limited to the mitochondrial genome, but extends to the nuclear genome. This is arguably due to the simple fact that females have two X- chromosomes, whereas males have an X and Y chromosome, setting up a juxtaposition between the sexes. Multiple studies have shown sexual differences occurring at the transcriptional level in D. melanogaster (Chang, Dunham et al. 2011, Lacher, Lee et al. 2015), mice (Dewing, Shi et al. 2003, Yang, Schadt et al. 2006) , and humans (Chen, Lopes-Ramos et al. 2016), with differences also uncovered in sex-determinant transcription factors (Udy, Towers et al. 1997, Tullis, Krebs et al. 2003, Venables, Tazi et al. 2012). Moreover tissue-wide transcriptome comparisons found 60% of autosomal genes were sexually dimorphic, with intriguing differences uncovered in master transcriptional regulators, including the Forkhead Box P1/P4 (FOXO) and the Breast cancer 1 gene (BRCA) (Chen, Lopes-Ramos et al. 2016). Additionally, studies in D. 49 melanogaster, found that upon the expression of different mitochondrial strains in the same nuclear background, caused a disproportionate impact upon male nuclear gene expression (Innocenti, Morrow et al. 2011). Furthermore, of the 10% of the nuclear encoded genes impacted depending on the mitochondrial origin, many were found to be involved in oxidative phosphorylation (OXPHOS), the electron transport chain and ATP synthesis. This suggests that many of the nuclear genes involved in mitochondrial function are regulated by retrograde signaling (Vögtle and Meisinger 2012), allowing not only for real-time adjustment of mitochondrial function, but demonstrates a potential compensatory mechanism in the male nuclear genome to cope with the asymmetric adaptation of the female-suited mtDNA. Conversely, D. melanogaster studies which utilized two different mitochondrial DNA haplotypes within two different nuclear backgrounds, resulted in transcriptional variations that were markedly different between the sexes, and demonstrated that both nuclear and mitochondrial backgrounds impact each other, causing a mito-nuclear dependence that was unique to each sex (Mossman, Tross et al. 2016). Nor are the sexual trade-offs limited to the cellular level. Mitochondrial-specific diseases have been linked to having a higher prevalence in males (Frank 1996). One such direct example is Leber’s hereditary optic neuropathy (LHON), with only 10% of women as carriers of the mutated mitochondrial DNA, this rate is five times higher in men (Wallace 1992, Giordano, Iommarini et al. 2014). In a broader context, the dichotomy between mitochondrial and nuclear genomes may impact the prevalence of common diseases in a sex-dependent manner. Men are at a greater risk for developing Parkinson’s disease compared to women (Wooten, Currie et al. 2004). As well, men have a higher risk of obesity-driven Type II Diabetes, due to sex-specific 50 adipose distribution (Nedungadi and Clegg 2009). Men are also at increased risk for cancer development (Clocchiatti, Cora et al. 2016). Additionally, men show higher rates of autism, ischemic heart disease, and hypertension (Freeman 2001). In contrast, women are much more susceptible to developing Alzheimer’s disease, osteoporosis, and Rheumatoid arthritis (Ostrer 1999, Kaminsky, Wang et al. 2006). Demonstrating that the balance between the mitochondrial and nuclear genes is a continual push-and-pull between the sexes. Together, the importance of understanding the interplay between the mitochondria and nuclear genomes may have large implications in aging studies. Indeed, recent work has found that the adaptive stress response, critical in mitigating cellular damage, may also differ between males and females (Pickering, Staab et al. 2013). In turn, acting to accelerate the aging process in males. Lastly, due to the differences in response between the sexes, highlights the need to study both in translational models. As women typically outlive men, it is important we not only understand the mechanisms that promote female longevity, but also why males are more susceptible, in order to develop approaches that may compress this lifespan gap. Cellular Roles of Hydrogen Peroxide and Paraquat The Role of Hydrogen Peroxide as a Signaling Molecule First considered a noxious molecule within the cell, hydrogen peroxide (H2O2) was originally believed to cause only cellular destruction if left unchecked within the cell (Chance 1952). Since then, the paradigm has shifted, and H2O2 is now recognized as a crucial cellular messenger, in large part because of its relative stability and the relative ease of it diffusing across the membrane. This is in part due to early discoveries of macrophages producing large amounts of 51 H2O2 in an attempt to ward off invading pathogens (Forman and Torres 2002). Indeed, at low concentrations, H2O2 was found to act as an insulin mimetic (Czech, Lawrence et al. 1974), trigger cell proliferation (Christman, Storz et al. 1989, Davies, Lowry et al. 1995), and activate various transcription factors involved in the adaptive stress response (Schreck, Rieber et al. 1991). Moreover, the type of signaling is concentration dependent. Seemingly opposing responses are evident upon high and low concentrations of H2O2 in studies conducted in hepatocytes: high extracellular H2O2 [25-50µM] downregulates the insulin-stimulated AKT pathway, and instead, upregulates the JNK signaling pathway. Whereas at low extracellular H2O2 [5-10µM] causes enhanced insulin-stimulated signaling, mediated by the AKT pathway (Iwakami, Misu et al. 2011). Furthermore, the rate of H2O2 breakdown is dependent on catalase (Mueller, Riedel et al. 1997), which is further influenced by solution pH and redox equilibrium within the cell. As increasing work has shifted to understanding if the phenomenon of H2O2-mediated signaling is maintained beyond cell-culture into model organisms (C. elegans and D. melanogaster), there is still much work that is needed to understand how relatively low amounts of H2O2 (µM) is capable of causing an adaptive response (Pickering, Staab et al. 2013, Raynes, Juarez et al. 2016). In both cases, the delivery mechanism relies upon H2O2 being diluted in various solutions (5% sucrose for D. melanogaster or M9 buffer for C. elegans). Therefore, it is possible that H2O2 directly works to modify components in these solutions, which are then taken up. Thus, H2O2 may be indirectly causing an effect via chemical modifications of buffer components, which may cause them to act in a manner similar to an electrophile, a strong activator of the Nrf2 pathway (Itoh, Tong et al. 2004) This must be explored and characterized in future studies. 52 H2O2 works to induce transcription factors that are necessary for mediating key cellular responses, indicative of the well-studied second messenger calcium (Bootman, Collins et al. 2001). Both c-Jun and c-Fos were found to have increased transcription, mediated by H2O2, via the activation of the c-Jun amino-terminal kinase (JNK) and the extracellular signal-regulated protein kinase (ERK) pathways (Whitmarsh and Davis 1996, Matsuzawa and Ichijo 2008). Another crucial transcription factor, hypoxia-inducible factor (HIF-1α) was found to be H2O2 dependent. Specifically, activation of Angiotensin II, which mediates transcriptional activation of HIF-1α, is dependent upon the upstream phosphorylation of the phosphatidylinositol 3-kinase (PI3K) pathway (Pagé, Robitaille et al. 2002). Moreover, upon the addition of an extracellular bolus concentration of H2O2 was found to mediate increased HIF-1α transcription (Bonello, Zähringer et al. 2007). The role of H2O2 signaling also plays a role in translational activation. Typically, during oxidative stress, protein synthesis is blocked, potentially as a cellular protective measure to prevent the formation of misfolded, de novo proteins and enable the cell to devote its translational machinery to the synthesis of stress responsive enzymes. Specifically, protein translation is mediated by two mechanisms. Under homeostatic conditions, translation is predominantly completed by CAP-dependent ribosomal scanning, which relies upon the interaction between the eukaryotic initiation factor 4F complex (eIF4F) and the recruitment of the 40S ribosome. Upon identification of the initiation codon, AUG, in the untranslated region of mRNA, triggers protein synthesis (Richter and Sonenberg 2005). However, during stress conditions, the CAP-independent translation machinery takes precedence, relying upon the 53 internal ribosomal entry sties (IRESs) predominantly found in the mRNA of stress responsive enzymes (Holcik and Sonenberg 2005). Following H2O2 signaling, IRES trans-acting factors (ITAFs), normally sequestered in the nucleus under homeostasis, migrate to the cytosol, where they interact with IRES for ribosomal recruitment and translation (Stoneley and Willis 2004). This in turn, enables the rapid translation of key enzymes that are necessary for the cellular defense machinery. As suggested earlier, H2O2 can activate either system, in a biphasic manner that is concentration dependent. H2O2 signaling has been implicated in the transactivation of key stress-responsive enzymes, with one of the most notable being Nrf2 (predominantly activated by electrophiles) (Itoh, Tong et al. 2004). During periods of homeostasis, Nrf2 remains in the cytosol, bound to Keap1, where it is phosphorylated by GSK-3, in turn causing it to be ubiquitinated by an E3 ligase, resulting in its degradation by the 26S proteasome. Yet, upon oxidative stress, such as the addition of H2O2, or in the presence of an electrophile, Nrf2 disassociates from Keap1, enabling it to translocate and bind to target antioxidant response elements within the nucleus (Taguchi, Motohashi et al. 2011). Recently, in vitro findings have also found concurrent synthesis of de novo Nrf2, directly mediated by extracellular H2O2. Specifically, these findings suggest 50% of maximal de novo Nrf2 protein synthesis was possible in Hela cells in the presence of micromolar levels of H2O2 [12.5µM], predominantly mediated by the CAP-independent translational machinery (Covas, Marinho et al. 2013). This finding demonstrates an additional process that is independent of Nrf2 stabilization. Moreover, the ITAF, La Autoantigen, was identified to specifically bind to the 5’ untranslated region of Nrf2 following micromolar amounts of H2O2 (Zhang, Dinh et al. 2012), 54 with its translocation to the cytosol suggested to be mediated in an AKT-dependent manner (Brenet, Socci et al. 2009). Nor is H2O2 signaling limited to transcription factors. This is most notable in the dynamic fluctuation in the cytosolic proteasomal pool. Under homeostatic conditions, the predominant form of the proteasome is the 26S proteasome, which consists of the 20S catalytic core and the 19S regulatory caps, enabling it to degrade ubiquitin-tagged proteins, in an ATP-dependent manner. In the presence of an adaptive amount of H2O2, triggers the sequestering of the 19S regulatory caps by HSP70 (Grune, Catalgol et al. 2011, Reeg, Jung et al. 2016) and ECM 29 (Lehmann, Niewienda et al. 2010), facilitating an immediate pool of available 20S proteasome for immediate turnover of oxidized proteins. Concurrently, H2O2 stimulation also activates de novo 20S transcriptional synthesis, which enables the cell to better withstand a future oxidative insult. Thus highlighting the additional signaling roles of H2O2. Paraquat: a Redox Cycler Paraquat (1,1’-dimethyl-4-4’-bipyridnium dichloride; methyl viologen) is a very “strong” redox cycling agent, most notable for its role as a herbicide, and later discovered as an agent for inducing Parkinsonian-like symptoms in humans (Andersen 2003) and animal models (Thiruchelvam, McCormack et al. 2003). Paraquat (PQ) predominantly accumulates in the lung, with the rate of accumulation dependent on the species (Forman, Aldrich et al. 1982). Indeed, studies of rat lung tissue found PQ to accumulate, in vitro, ten-fold, and in vivo, six-fold, compared to the amount in surrounding fluid (Rose, Lock et al. 1976). Due to the high concentration of PQ in the lung (far surpassing that found in the serum) indicated its mechanism 55 of entry was most likely an energy-dependent process (Sharp, Ottolenghi et al. 1972, Rose, Smith et al. 1974). Moreover, tissues with high metabolic demand, including the lung and the brain, showed excess PQ buildup (Rose, Lock et al. 1976). Indeed, upon the administration of the metabolic inhibitors, rotenone and iodoacetate, blocked PQ accumulation (Rose, Lock et al. 1976). PQ import was later identified to be mediated by a similar uptake process as used for the polyamine and putrescine (Smith and Wyatt 1981), arguably due to the similarity of the PQ structure to that of endogenous diamine and polyamine (Smith 1987). Indeed, putrescine was shown to have decreased uptake in the presence of PQ (Hoet, Lewis et al. 1994). In vitro studies also suggest PQ preference for lung-specific proteins over other tissues (Hollinger and Giri 1978), with the highest affinity occurring in the lung epithelium (Charles, Abou-Donia et al. 1978), specifically granular pneumocytes (Smith, Heath et al. 1974). Yet, one of the primary modes of entry for PQ is through ingestion rather than inhalation. Both rats and dogs show absorption to occur within the gastrointestinal tract (Smith, Wright et al. 1974). Indeed, upon oral administration of the agent to rats, showed that plasma concentrations remained relatively constant for approximately 24 hours, at which point, accumulation in the lung was evident. Moreover, in an attempt to clear PQ from the blood, the kidneys had the second highest accumulation of the redox cycler (Smith, Wright et al. 1974). The toxicity of PQ stems from its redox cycling capacity to continually generate superoxide. It does so, through its regenerative capability to continually cycle between its reduced and oxidized states. Upon uptake by the cell, PQ predominantly interacts and is reduced by cytochrome P450 reductase: an endoplasmic-reticulum bound enzyme that contains an FAD-FMN binding domain. 56 Resulting in the net transfer of two electrons from NADPH (resulting in oxidized NADP + ) to cytochrome P450 (Iyanagi, Makino et al. 1974, Vermilion and Coon 1978, Forman, Nelson et al. 1980), in turn, generating the paraquat radical (PQ .+1 ), which in the presence of oxygen, can continually generate superoxide (O2 .- ) as a cellular byproduct. Due to the redox cycling capacity of PQ, it can quickly deplete cellular stores of NADPH (Forman, Nelson et al. 1980). In turn, chronic depletion of cellular NADPH levels, mediated by PQ, has been suggested to contribute to the net increase in lipid peroxidation (Aldrich, Fisher et al. 1983), as evident by the increase in malondialdehyde (MDA) production (Glass, Sutherland et al. 1985). This is because NADPH is necessary for the regeneration of reduced glutathione, a critical molecule in the cellular antioxidant armory (Salvemini, Franzé et al. 1999). Additionally, unique tissue differences occur, as evident in studies of pulmonary epithelial cells, which found that thioredoxin reductase, which relies upon oxygen, and requires either NADH or NADPH, can generate the reduced paraquat radical, promoting paraquat-induced lung toxicity (Gray, Heck et al. 2007). Farther reaching consequences of chronic NADPH depletion may include impairment of fatty acid and lipoprotein synthesis and the inhibition of additional detoxification mechanisms (Tierney, Ayers et al. 1973). Moreover, due to the necessity of NADPH for PQ cycling, it has been shown to induce metabolic remodeling. Specifically, as one of the primary sources of intracellular NADPH arises from the pentose phosphate pathway, it is not surprising that flux through this pathway is found to be elevated upon PQ exposure (Bassett and Fisher 1978). This is because the rate of the pentose phosphate pathway is responsive to the cellular ratio of NADPH/NADP + : as glutathione reductase (and in the case of PQ toxicity, cytochrome P450 reductase) lowers the cellular pool of available NADPH, the pathway speeds up in an attempt to compensate for depleted NADPH 57 stores. Indeed, studies in rats with continual PQ exposure, showed elevated glucose-6-phosphate dehydrogenase (the first enzyme in the pentose phosphate pathway) (Bus, Cagen et al. 1976). Hence a vicious cycle ensues upon PQ exposure: chronic PQ cycling directly results in the generation of superoxide, lipid peroxidation, and depletion of cellular NADPH levels, presenting a chronic oxidative insult the cell must bear. Besides its interaction within the cytosol, some studies suggest the mode of action for paraquat can also occur within the mitochondria. Indeed, mitochondrial swelling has been linked as an early indicator of PQ toxicity (Hirai, Ikeda et al. 1992). Moreover, studies which target antioxidants to the mitochondria appear to be more protective than those limited to the cytosol upon PQ exposure (Mockett, Bayne et al. 2003). Specifically, studies have shown PQ to directly interact with NADH-cytochrome b5 oxidoreductase and NADH-coenzyme Q oxidoreductase of the mitochondrial outer membrane (Hirai, Ikeda et al. 1992) and complex I of the electron transport chain, located within the inner mitochondrial membrane (Cochemé and Murphy 2008). In turn, further contributing to the cellular rise in superoxide production. Although PQ is a cation, it theoretically should be able to easily move across the mitochondrial membrane, which has a high membrane potential. Yet, the high surface charge of PQ and its polar interface with water, precludes its easy movement across the mitochondrial inner membrane (Ross, Da Ros et al. 2006). Therefore, mitochondrial uptake of PQ is energy costly, and its import is mediated by a voltage-dependent carrier/transport protein. Once imported, PQ is able to interact with complex I and NAD(P)H substrates for redox cycling (Cochemé and Murphy 2008). 58 Paraquat: The Involvement of its Redox-Cycling Products and Cellular Signaling Extracellular stimuli are capable of inducing a plethora of cellular responses, including survival, growth, differentiation, and cell death (apoptosis), which is partially mediated by the activation of a group of mitogen-activated protein kinases (MAPKs). These include extracellular signaling regulated kinases (ERKs), the p38 MAPK, and the c-Jun N-terminal kinase (JNKs) (Johnson and Lapadat 2002). Specifically, the JNKs are activated in response to extracellular stress, including heat shock, UV radiation, and during oxidative stress, including paraquat (Kyriakis and Avruch 2001, Johnson and Lapadat 2002, Peng, Mao et al. 2004). The JNK pathway has been found to be activated as a means of cellular protection (Minamino, Yujiri et al. 1999), yet under prolonged stress, may promote apoptosis (Tournier, Hess et al. 2000). Moreover, studies conducted in D. melanogaster larvae, found a series of genes that were induced upon oxidative stress, mediated by the JNK pathway (Jasper, Benes et al. 2001). Follow-up studies found that upon PQ exposure, resulted in the activation of one component of the stress response, which was under the control of the JNK signaling pathway, measured through four genes that were found to be transcriptionally dependent upon this pathway (Wang, Bohmann et al. 2003). In addition, overexpression of JNK signaling, limited to neurons, was capable of improving male survival in D. melanogaster (Wang, Bohmann et al. 2003). Furthermore, the redox cycling ability of PQ to continually generate superoxide (which undergoes dismutation into H2O2, which then directly acts to mediate a signaling response), has been shown to increase the expression of key antioxidant enzymes, including superoxide dismutase and catalase, both necessary in the breakdown of superoxide (Abrashev, Krumova et al. 2011, Krůček, Korandová et al. 2015). Additionally, chronic exposure of PQ has been 59 implicated in the activation of glutathione reductase. In turn, glutathione reductase acts to restore the balance of the cellular ratio of reduced and oxidized glutathione (Allen, Farmer et al. 1984), in an attempt to limit the cellular damage produced by PQ. 60 CHAPTER 2: THE AGE-RELATED AND SEX-SPECIFIC DIFFERENCES OF THE MITOCHONDRIAL LON PROTEASE IN D. MELANOGASTER Abstract The mitochondria are central to cellular metabolism. However, an evitable trade-off is electron leakage, and the resulting generation of reactive oxygen species, from the electron transport chain (ETC). To minimize the accumulation of oxidative damage, mitochondria utilize reducing enzymes, repair systems, and proteolysis to maintain function. A key proteolytic mitochondrial- matrix enzyme is the nuclear-encoded Lon protease: an ATP-stimulated protein that degrades oxidized proteins. Prior cell culture studies have shown Lon is a stress response protein as measured by protein levels following exposure to multiple stressors: hydrogen peroxide (H2O2), heat shock, and serum starvation. Due to Lon’s role in the maintenance of the mitochondrial proteome, our aim was to study the conserved role of Lon during aging in the model organism, D. melanogaster. Upon H2O2 stress, females, but not males are capable of adaptation. Females show increased Lon protein expression and activity, which is lost with age. In contrast, males, regardless age or H2O2 pretreatment, show no change in Lon protein expression or activity. Conversely, pretreatment with paraquat, a superoxide generator, induces male-specific Lon expression and activity, which is lost with age. The sex-specific differences in stress response may be attributed to the expression of the mitochondrial Lon protease: females show three unique Lon protein isoforms, whereas only two are present in the males. In addition, the sex-specific expression of the Lon 61 protein isoforms was observed in mammalian tissues, suggesting a possible conservation of sex- specific Lon regulation. To assess Lon’s involvement in the male and female adaptive differences, males were transformed into ‘pseudo-females’ through over-expression of the female-specific Transformer (TraF) splicing factor. Pseudo-females recapitulated the female-specific Lon protein isoforms and H2O2 adaptation. These findings suggest the use of D. melanogaster as a model for sex- specific stress adaptation regulated by the Lon protease, with potential implications for understanding sexual-dimorphism in disease. Background Stress adaptation, also termed ‘adaptive homeostasis’(Davies 2016), refers to the phenomenon where a mild stress enables cells, tissues or whole organisms to withstand future toxic levels of that stress (Davies, Lowry et al. 1995, Shringarpure, Grune et al. 2001, Pickering, Staab et al. 2013). Stress adaptation is thought to result from the up-regulation of specific stress responsive factors, including proteases, molecular chaperones, and heat shock proteins (Hsps) (Shringarpure, Grune et al. 2001, Tower 2009, Tower 2011). Moreover, adaptation to hydrogen peroxide (H2O2) stress has been studied in cultured mammalian cells, C. elegans, and D. melanogaster, all of which require increased expression of the 20S proteasome subunits, regulated by the conserved CnC-C/Nrf2 transcription factor (Davies, Lowry et al. 1995, Grune, Reinheckel et al. 1997, Cadenas and Davies 2000, GuhaThakurta, Palomar et al. 2002, Pickering, Staab et al. 2013, Raynes, Juarez et al. 2016). 62 The mitochondrial electron transport chain (ETC) is the primary source of the cellular oxidants hydrogen peroxide and superoxide. The proximity of the mitochondrial proteome to the ETC makes mitochondrial proteins highly susceptible to oxidative damage and loss of function (Gibson 2005, Bugger, Schwarzer et al. 2010). To counteract the accumulation of damaged and misfolded proteins, the mitochondria rely upon the highly conserved Lon protease (Lee and Suzuki 2008). Lon is responsible for the turnover of several mitochondrial proteins, and preferentially degrades oxidatively-damaged proteins in an ATP-dependent manner (Bota and Davies 2002). Initially discovered in E. coli, Lon has since been shown to be a critical stress response protease in organisms ranging from yeast (Suzuki, Suda et al. 1994) to humans (Bota, Ngo et al. 2005). The application of exogenous hydrogen peroxide has been identified to induce the human nuclear-encoded Lon protease within the mitochondrial matrix (Ngo and Davies 2009). In turn, upregulation of Lon expression protects the cell from future oxidative insult (Ngo and Davies 2009). Prior cell culture studies have shown Lon is adept at quickly responding to various forms of oxidative stress, evident through rapid elevation in protein content, with mild to no change at the mRNA level (Hori, Ichinoda et al. 2002, Ngo and Davies 2009), demonstrating its important role in cell protection . Posttranscriptional regulation has been observed in multiple stress-responsive proteins, which ensures quick triage of cellular damage without the time delay associated with mRNA synthesis and processing (Holcik and Sonenberg 2005). More importantly, loss of Lon results in increased accumulation of oxidized proteins upon hydrogen peroxide stress (Bota, Ngo et al. 2005), indicating Lon’s critical role for proteome maintenance. 63 More interestingly, the use of the model organism, D. melanogaster has enabled the exploration of sex-specific differences in the adaptive response of the Lon protease. A limitation of cell culture work. This is important as several human diseases, all of which involve chronic oxidative stress, show a marked sex bias. As Lon is critical in the maintenance of an efficient mitochondrial proteome, it is reasonable to explore if sexual differences in Lon’s response may provide a good model to assess the underlying mechanisms behind human diseases. For example, heart failure involves maladaptive hypertrophy and altered mitochondrial turnover regulated by mTOR, and mitochondrial metabolic reprogramming regulated by p53. Both pathways are activated by hydrogen peroxide and superoxide (Battiprolu, Lopez-Crisosto et al. 2013). This sex-dependent difference in response is evident as men are generally more susceptible to cardiovascular disease, however diabetic cardiomyopathy preferentially affects women (Jia, DeMarco et al. 2016). Currently, the mechanisms for sexual-dimorphism in maladaptive tissue remodeling remains unclear. However studies in mice indicate greater baseline mTOR activity in female heart tissue relative to males (Baar, Carbajal et al. 2016). Insulin/IGF-1-like signaling (IIS) activates TOR via the PI3K and AKT kinases (Guevara- Aguirre, Balasubramanian et al. 2011). Both IIS and p53 pathway interventions have sex-specific effects on life span in mice and in Drosophila, suggesting that females may have greater baseline activity of both IIS and p53 (Selman, Lingard et al. 2008, Waskar, Landis et al. 2009, Shen and Tower 2010, Tower 2015, Shen, Landis et al. 2016). Physiological studies also indicate relatively greater IIS in women than in men (Magkos, Wang et al. 2010). Sex-bias in the cellular response to acute oxidative stress has been reported for humans and mice, where female cells generally show greater stress resistance than do male cells (Wang, He et al. 2010, Tower 2015). In 64 contrast, the potential for sex-specific oxidative stress adaptation of cells and animals remains relatively unexplored. Here, we report the development of Drosophila melanogaster as a model for sex-specific oxidative stress adaptation regulated by the mitochondrial Lon protease. Drosophila females but not males adapt to hydrogen peroxide stress, whereas males but not females adapt to paraquat (superoxide) stress. Interestingly, oxidative stress adaptation, in both sexes, required the expression of the Lon protease and was associated with expression of sex-specific Lon protein isoforms. Sex-specific expression of Lon protein isoforms was also observed in mammalian tissues, suggesting a possible conservation of sex-specific Lon regulation. Results Sex-Dependent Variation of Lon Expression in D. melanogaster The human Lon protease was originally estimated to range from 100-110 kDa in molecular weight, depending on the cell line studied (Wang, Gottesman et al. 1993). Human Lon protein is expressed as a short-lived ~107kD precursor, which includes a mitochondrial targeting motif at the amino-terminus. Following import into the mitochondria, the targeting motif is removed, yielding the mature protein of ~100kDa (Wang, Maurizi et al. 1994). To analyze Lon in adult flies, protein was isolated from adult control flies, and analyzed by western blot using D. melanogaster-specific Lon polyclonal antibody. Three distinct bands were observed in females (100kD, 60kD, and 50kD), and two in males (100kD and 60kD) (Figure 2.1A). No prior reports, to my knowledge, had previously observed additional protein isoforms or Lon, nor the sex- specific changes in Lon expression. To ensure that the additional bands we observed in flies were 65 not a result of unspecific detection by the Lon antibody, immunoprecipitation was used to isolate the bands for mass spectrometry to identify the peptide fragments. All bands detected by the Lon antibody, in both sexes, represented regions of the Lon protein (Figure 2.1B). In D. melanogaster, the Lon transcript is spliced into two isoforms: Lon RC and Lon RA (Figure 2.1C). In order to assess the changes in the Lon banding pattern were not a consequence of transcriptional variants, changes in the Lon transcripts were investigated. It was confirmed that for both sexes the ratio of Lon RA was two-fold higher than Lon RC (Figure 2.1D). These results indicate that sex-specific expression of Lon is not determined at the transcriptional level as no differences in the ratio of Lon RA and RC were detected between the sexes. In addition, re- analysis of whole-body transcriptome of 12 day-old virgin females, mated females, and males found no sex-related variation in expression of Lon exons (Figure 2.1E) (Landis, Salomon et al. 2015). Therefore the 60kD and 50kD Lon protein isoforms do not appear to result from alternative splice variants of lon mRNA. 66 67 Oxidant Pretreatment Does Not Alter Lon mRNA Levels Prior studies in mammalian cell culture have shown that Lon is a stress-inducible protease whose expression diminishes with age (Ngo and Davies 2009, Ngo, Pomatto et al. 2011). To determine if the Lon protease is induced following an oxidative stress on the organismal level, stress adaptation in D. melanogaster was tested using hydrogen peroxide (H2O2) (Pickering, Staab et al. 2013). Three-day old flies were selected to represent young (Pickering, Staab et al. 2013, Pickering, Vojtovich et al. 2013), and 60 day old flies to represent the aged time point, for which >80% of the population had survived, in order to avoid selection bias (Landis, Shen et al. 2012). Flies were pretreated with an adaptive dose of H2O2 [0-100µM] for 8 hours, followed by a 16 hour recovery. Flies were collected for RNA extraction, and lon expression was measured using quantitative PCR (qPCR) (see methods section for primers). Assessment of mRNA levels of Glutathione S-Transferase, following H2O2 pretreatment, was used as a positive control (Supplemental Figure 1). Pretreatment with H2O2 resulted in no significant changes in lon expression, irrespective sex (Figure 2.2A,B) or age (Figure 2.2C). This finding is consistent with previous observations that Lon is not induced at the RNA level in mammalian cells (Ngo and Davies 2009, Ngo, Pomatto et al. 2011) or adult flies (Landis, Shen et al. 2012) in response to H2O2. 68 Next, I wanted to test whether other oxidants impacted the transcriptional levels of Lon. The most common oxidant used for oxidative stress assays in fly culture is methyl viologen dichloride (paraquat), which has been previously shown to be more responsive in males (Sykiotis and Bohmann 2008, Rahman, Sykiotis et al. 2013). 3 day old and 60 day old flies were pretreated with an adaptive dose of paraquat [0-10µM] for 8 hours, followed by a 16 hour 69 recovery. Pretreatment with paraquat caused no change in Lon mRNA levels, irrespective sex or age (Figure 2.3). Hydrogen Peroxide Pretreatment Induces Female-Specific Lon Protein Expression and Activity Next, experiments were conducted to determine if Lon protein expression was altered following pretreatment in a sex and/or age-dependent manner. Three-day old pretreated females exhibited an increase in the 100kD Lon protein isoform, following pretreatment with 10µM and 100µM H2O2 (Figure 2.4A), whereas no changes were detected in the 60kD or 50kD protein isoforms (Supplemental Figure 2C). No change in Lon protein expression following H2O2 pre-treatment was observed in old females (Figure 2.4C). Nor was the lack of response in old females due to a 70 decline in lon RNA levels, as both young and aged females had equivalent expression of lon mRNA and protein levels (Figure 2.2C & Supplemental Figure 2A,B). Male flies showed no change in Lon protein expression, regardless of pre-treatment, sex, or age (Figure 2.4B,D & Supplemental Figure 2D). The lack of response in males to the mild stress may underlie the inability of males to adapt to H2O2. Nor was the lack of male-specific H2O2 adaptation due to insufficient level of pre-treatment exposure, as greater concentrations H2O2 (up to 1,000uM) was 71 shown to cause increased toxicity, yet did not yield an adaptive response ((Pickering, Staab et al. 2013) and data not shown). Lon proteolytic activity was assayed in fly mitochondria extracts to determine if changes in Lon protein levels represented a functional protease. Prior studies have shown that Lon activity is most robust in the presence of ATP and oxidized substrates, and this finding was confirmed in mitochondria of both sexes (Supplemental Figure 3A,B) (Bota and Davies 2002). In the presence of ATP and oxidized aconitase, mitochondrial extracts from aged female and male flies exhibited a decrease in basal Lon protease activity compared to their young counterparts (Supplemental Figure 3C), despite Lon protein levels being similar between young and old flies of each sex (Supplemental Figure 2A,B). Mitochondrial extracts from young females that had been pre-treated with H2O2 showed increased proteolytic activity, whereas mitochondrial extracts from pre-treated old females showed no change (Figure 2.5A). The age-related loss of proteolytic induction, evident in aged females, is not a result of diminished basal amounts of Lon, as both young and old females showed equivalent levels of Lon protein expression (Supplemental Figure 2A,B). This finding is consistent with previous analyses of young and old mouse liver tissue extracts, where basal Lon protein expression was similar but basal proteolytic capacity was decreased in old animals (Delaval, Perichon et al. 2004), although mouse skeletal muscles exhibit significant loss of both Lon protein and Lon activity (Bota and Davies 2002). Mitochondrial extracts from male flies showed no induction in Lon proteolytic capacity, regardless of pre-treatment or age (Figure 2.5B). 72 Paraquat Pretreatment Induces Male-Specific Lon Protein Expression and Activity Early studies using Paraquat (PQ), found that male and female flies, pretreated with low doses of PQ, were able to increase catalase and superoxide dismutase (SOD) transcript levels and SOD activity, which were blunted upon increasingly higher PQ concentrations (Krůček, Korandová et al. 2015). Unlike hydrogen peroxide, PQ works as a redox cycler, resulting in the perpetual generation of superoxide. Hence, it has been extensively used to assess stress resistance (Lin, Seroude et al. 1998, Honda and Honda 1999, Fabrizio, Pozza et al. 2001), and typically showing a stronger response in males (Sykiotis and Bohmann 2008). 73 To explore if PQ triggered any differences in protein induction, 3 day and 60 day old flies were pretreated with low doses of PQ [1µM and 10µM] and protein levels of Lon were assessed. Females showed no change in any of the three Lon protein bands, irrespective of pre-treatment or age (Figure 2.6A,C). In contrast, pre-treated young males showed increased amounts of 100kD 74 Lon isoform, which was coupled with a decrease in the 60kD band (Figure 2.6B). Yet with age, male no longer showed an increase in Lon expression (Figure 2.6D). Similarly, proteolytic capacity was unaffected in females (Figure 2.7A), but increased in pretreated males, which was lost with age (Figure 2.7B). Sensitivity to Hydrogen Peroxide Increases with Age In adult Drosophila, dietary H2O2 causes decreased survival, which has been associated with the activation of the MAPK/ERK pathway and downstream apoptosis in the central nervous tissue 75 (Lee, Lim et al. 2015). Virgin females of the Actin-GS-255B strain were mated to males of the w[1118] strain and progeny were collected. To assess the age-related changes in H2O2 toxicity, flies were aged to 3 days and 35 days, prior to being fed various concentrations of H2O2 [1M- 8M] and survival scored every 8 hours (Figure 2.8). H2O2 toxicity was similar for males and females, with slightly greater sensitivity observed in males. Interestingly, beginning in ‘middle- age,’ 35 day old flies showed increased sensitivity, as marked by the decreased survival (Figure 2.8C,D). 76 Females But Not Males Adapt to H2O2 Stress Prior studies have shown that during normal physiological function, organisms possess a range of detoxifying enzymes that limit the damage caused by endogenous oxidant generation (Zhang, Davies et al. 2015). However, during an acute stress, survival is dependent upon adaptation, which is a transient increase in various stress response proteases and chaperones, including the Lon protease, which primes the organism to withstand a future oxidative insult (Davies 2016). Initial adaptation studies in D. melanogaster found 3 day old females, pretreated with a low-dose of H2O2 were able to adapt (i.e. survive longer) when fed a semi-lethal dose. In contrast, 3 day old males, irrespective pretreatment, were unable to adapt (i.e. no change in survival) (Pickering, Staab et al. 2013). To assess the age-associated change in the adaptive response, 3 day old and 35 day old control flies were fed only 5% sucrose or adaptive doses of H2O2 [10µM or 100µM]. Following the 16- hour recovery, flies were fed a semi-lethal dose [4.4M H2O2] (Supplemental Figure 10). 3 day old females, which were pretreated with H2O2, showed increased survival following H2O2 challenge (Figure 2.9A & Supplemental Table 1). However, 35 day old females lost the adaptive response (Figure 2.9A & Supplemental Table 1). Pretreatment in males, irrespective of age, produced no adaptive response (Figure 2.9B, Supplemental Table 1), consistent with our previous observations (Pickering, Staab et al. 2013). 77 78 Lon Is Required for H2O2 Stress Adaptation In Females Earlier findings showed the female-specific increase in Lon protein expression and activity following H2O2 pretreatment (see earlier in the chapter). To further explore the role of Lon in adaptation to oxidative stress, the mifepristone (RU486)-activated “Gene-Switch” system was used to modulate Lon expression (Ford, Hoe et al. 2007). The Gene-Switch transcription factor was expressed in a tissue-general pattern using the cytoplasmic actin Actin5C gene promoter in the “driver” line Actin-GS-255B, ensuring the transcription factor is expressed in all tissues with actin (Ford, Hoe et al. 2007). In assays involving RU486, virgin progeny were used to prevent any potential confounding effects, specifically the beneficial impact of RU486 in blocking the negative impacts of mating upon the lifespan in females (Landis, Salomon et al. 2015). Control flies contained the Actin-GS-255B driver construct but not the Lon RNAi construct, and were assayed to confirm that RU486, itself, did not cause changes in lon mRNA or protein expression (Supplemental Figure 4). Two strains containing different target constructs of Lon RNAi sequences (Lon RNAi strains R1 and R2) were under control of the UAS-based promoter. Adult flies were fed RU486 in the media for 9 days. This caused the activation of the Gene-Switch system and expression of the target construct (Figure 2.10). For the LonR1 RNAi strain, both females and males exhibited 50% or greater decrease in basal lon mRNA (Figure 2.10A,B). Similar findings were observed in Lon R2 RNAi strain (Figure 2.10C,D). Conditional expression of Lon R1 resulted in decreased protein expression for all three Lon protein isoforms in females (Figure 2.10E) and a decrease in only the 100kD isoform in males (Figure 2.10F), which is potentially due to differences in Lon processing between the sexes. Similarly, conditional expression of Lon R2 led to decreased protein expression of the 100kD isoform in both sexes (Figure 2.10G,H). 79 80 Control and experimental flies were fed ±mifepristone for 9 days, then pre-treated with H2O2 for 8 hours, allowed to recover for 16 hours, and then subjected to lethal H2O2 challenge. As expected, control females, but not males, could adapt to H2O2, as indicated by increased survival time upon toxic challenge (Supplemental Figure 5 & Supplemental Table 3). For both Lon R1 and R2 RNAi, females raised in absence of mifepristone also adapted to H2O2 (Figure 2.11A,C & Supplemental Table 4). However, females fed mifepristone to knock-down Lon expression were not capable of adaptation (Figure 2.11B,D & Supplemental Table 3). Males of Lon R1 and R2 RNAi showed no ability to adapt to H2O2, both with and without knockdown of Lon (Figure 2.11E-H & Supplemental Table 3). 81 82 Over-Expression of Lon Increases H2O2 Stress Adaptation In Females But Not Males Two transgenic Lon over-expression lines were used. Females of the Actin-GS-255B driver strain were mated to Lon over-expression strains, Lon OE1 and Lon OE2. Progeny were fed ±RU486 for 9 days. Afterwards, basal lon mRNA and protein were measured. Both male and female progeny of Lon OE2 crossed showed approximately four-fold increase in lon mRNA (Figure 2.12A,B), whereas Lon OE1 progeny showed a more modest increase (Figure 2.12C,D). The difference in expression levels may be attributable to different chromosomal insertion sites for Lon OE1 and OE2 transgenes. In females, the abundance of 100kD Lon isoform increased in Lon OE2, whereas the 60kD and 50kD bands were not detectably altered (Figure 2.12G). Similarly, in the presence of RU486, overexpression of Lon in males from the Lon OE2 strain also showed an increase in the 100kD isoform, but no detectable change in 60kD isoform (Figure 2.12H). No significant changes in Lon protein abundance were observed in either females or male progeny of the Lon OE1 cross, which is consistent with the relatively smaller increase in transcript levels produced by this strain (Figure 2.12E,F). Both males and females showed increased proteolytic capacity upon Lon over-expression, consistent with the increase in Lon protein (Figure 2.12I-L). Even upon over-expression, males showed no increase in the proteolytic capacity following H2O2 pre-treatment, irrespective the Lon over expression strain (Figure 2.12J,L). Proteolytic capacity in females was increased in both Lon OE1 and OE2 upon RU486 treatment, which was only further increased upon H2O2 pre-treatment (Figure 2.12I,K). 83 84 Next, the Lon over-expression strains were pretreated with H2O2 to measure oxidative stress adaptation. Progeny of the Lon OE1 and OE2 crosses were fed ±RU486 for 9 days to induce Lon over-expression. Flies were then pre-treated with H2O2 [10µM] for 8 hours, allowed to recover for 16 hours, and then subjected to lethal H2O2 challenge [4.4M]. In the absence of RU486, Lon OE1 pre-treated females showed trend towards increased survival, whereas Lon OE2 females were unaffected (Supplemental Figure 6A,C & Supplemental Table 5). The lack of adaptive response in Lon OE2 females raised in the absence of RU486 is potentially attributed to variation in genetic background of the parental strain. However, upon RU486-induced Lon overexpression, both Lon OE1 and OE2 females showed an adaptive stress response (Supplemental Figure 6B,D & Supplemental Table 5), consistent with the positive role of Lon in conferring H2O2 stress adaptation in females. In contrast, males showed no ability to adapt following H2O2 pretreatment with or without Lon over-expression (Supplemental Figure 6E-H & Supplemental Table 5). Therefore, tissue-general over-expression of Lon (100kD) in males was not sufficient to confer H2O2 stress adaptation. Paraquat is Toxic to Both Sexes Paraquat interacts at both the cell and mitochondrial membranes. However, its primary point of interaction is still under debate. PQ reacts with NADPH oxidase in the mitochondria and the cell membrane, to produce the PQ radical (Bonneh-Barkay, Reaney et al. 2005, Cocheme and Murphy 2008). PQ radical in turn interacts with molecular oxygen to form superoxide, which in turn, activates the Nrf2-mediated transcriptional stress response (Sykiotis and Bohmann 2008). To test for possible sex-specific PQ toxicity, 3 day and 35 day old male and female flies were fed various concentrations of PQ [10mM-100mM] and survival measured. Males and females exhibited similar sensitivity to PQ, which increased with age (Figure 2.13). 85 Males But Not Females Adapt to Paraquat Stress Next, adaptation to PQ was tested. 3 day and 35 day old flies were pre-treated with 5% sucrose, alone, or with low concentrations of PQ [1µM and 10µM]. Following the 16-hour recovery, flies were administrated the toxic dose of PQ [30mM]. Young pre-treated males exhibited an adaptive response, as seen by the increased survival following the toxic challenge, but was lost with age 86 (Figure 2.14B,D & Supplemental Table 2). In contrast, pre-treated females showed no adaptation, which was irrespective of age (Figure 2.14A,C & Supplemental Table 2). 87 Lon is Required for Paraquat Stress Adaptation in Males To address the potential role of Lon in PQ stress adaptation, Gene-Switch was again employed to knock-down expression of Lon. As similar in the H2O2 pretreatment, flies were fed ±RU486 for 9 days prior to being pre-treated with 1uM PQ before being subjected to lethal PQ challenge [30mM]. As expected, control males, but not females, showed PQ adaptation, irrespective if fed RU486 or not (Supplemental Figure 5E-I & Supplemental Table 3). Similarly, in the absence of RU486, males of both Lon R1 and Lon R2 RNAi strains showed PQ adaptation (Figure 2.15E,G & Supplemental Table 6). However, knock-down of Lon by RU486 removed the PQ adaptation in males (Figure 2.15F,H & Supplemental Table 6). Females showed no adaptation to PQ, regardless of RU486 treatment and knock-down of Lon (Figure 2.15A-D & Supplemental Table 6). 88 89 Continual Over-Expression or RNAi-Mediated Knockdown is Detrimental to Lifespan Lon expression is necessary for adaptation to oxidative stress in a sex-specific manner. Previous studies in yeast have shown that loss of Lon dramatically decreases lifespan (Erjavec, Bayot et al. 2013). Conversely, partial knock-down of Lon using RNAi in late L4 stage C. elegans was reported to extend lifespan (Reis-Rodrigues, Czerwieniec et al. 2012). However, that finding may be unique to the nematode and/or to partial knock-down, as Lon null mutation in mice (Lon - /- ) caused embryonic lethality and accelerated cellular senescence (Quirós, Español et al. 2014). Here, Lon RNAi and over-expression strains were used to test impact of increased or decreased Lon expression upon the lifespan in adult Drosophila. Males of the tissue-general Actin-GS- 255B driver strain were mated to virgin females of the Lon OE and Lon RNAi strains, and virgin progeny were collected 48 hours following eclusion. Adult flies were fed RU486 throughout adulthood, and survival was recorded every other day. Constitutive feeding of mifepristone had no detectable impact on lifespan in control flies (Supplemental Figure 7A,B & Supplemental Table 8). Knock-down of Lon using the Lon R1 and the Lon R2 strains, showed decreased lifespan in both sexes (Figure 2.16A,B, Supplemental Figure 7C,D & Supplemental Table 8), indicating a requirement for Lon for normal longevity. Remarkably, constitutive over-expression of Lon using Lon OE2 strain resulted in dramatic decline in lifespan in both males and females (Figure 2.16C,D & Supplemental Table 8), indicating that abnormally high levels of Lon are also toxic. Lon OE1 flies showed no difference in lifespan upon over-expression in either sex (Supplemental Figure 7E,F & Supplemental Table 8), however this may be attributable to relatively weaker Lon expression produced by this strain. Taken together, the results indicate that 90 normal levels of Lon expression are necessary for optimal longevity in Drosophila males and females. 91 Transformation of Males into Pseudo-females Confers the Female Pattern of Lon Expression A large part of Drosophila somatic sexual differentiation is determined by the expression of either male-specific or female-specific transcripts of transformer gene (Verhulst, van de Zande et al. 2010). To further investigate the sex-specific nature of Lon expression, the Gene-Switch system was used to change genetically-determined males into phenotypic females by forcing the expression of the female-specific transformer (‘TraF’). Hence, progeny raised on RU486 were chromosomally male, but phenotypically female (‘pseudo females’) (Supplemental Figure 7). Larvae developed in the presence or absence of RU486, and successful phenotypic transformation was assessed by the development of female genitalia and the female-specific pigmentation patterns (Figure 2.17C,D) and lacked male-specific characteristics, such as sex combs (Figure 2.17E). Pseudo-female gonads showed the male-specific Lon protein pattern (Figure 2.17F), consistent with the role of TraF being limited to feminization of the soma (Casper and Van Doren 2009). Expression of TraF in pseudo-females caused no change in ratio of Lon RA to Lon RC compared to normal chromosomal males (Figure 2.17A), indicating no detectable effect of TraF expression on lon mRNA splicing patterns. Remarkably, these pseudo- females recapitulated the Lon protein banding pattern specific to females, with the addition of the 50 kDa band (Figure 2.17B). Nor was the formation of the additional female band simply a result of the increased concentration of RU486, as control males showed no additional 50 kDa Lon band (Supplemental Figure 9I). 92 93 Pseudo-females Showed Induction Following H2O2 Pretreatment Because pseudo-females showed the female-specific Lon protein expression, induction of Lon expression and activity were assessed. Upon pretreatment with H2O2, pseudo-females showed increased Lon expression and proteolytic capacity (Figure 2.18A,B,E). These findings mirrored the increase in Lon expression and activity found in chromosomal females. Nor did feeding of RU486 or transformer over-expression impact the induction of Lon in chromosomal females (Figure 2.18A,B,C). Similarly, in the absence of RU486, chromosomal males showed no change in Lon expression or activity (Figure 2.18A,B,E). 94 95 Next, to rule-out if the adaptive response was due to the development of a female-phenotype or because of female-specific transformer, adult specific over-expression of TraF was also tested. Progeny of the TraF strain mated to the Actin-GS-255B driver strain were raised in the absence or presence of RU486 for 10 days prior to H2O2 pretreatment. Following pretreatment, adult males, raised in the presence of RU486, developed the 50kD female-specific Lon isoform, an increase in the 100kD isoform, and increased proteolytic activity (Figure 2.19A,B,E). Together, showing that the adaptive response requires both the presence of the 50kD isoform and induction of the 100kD isoform to confer H2O2 stress adaptation. 96 97 Pseudo-females Showed No Induction Following PQ Pretreatment As pseudo-females are chromosomally male, we wanted to assess if pretreatment with PQ would result in an adaptive response of Lon. Pseudo-females, pretreated with PQ, showed no increase in Lon expression or proteolytic capacity (Figure 2.18C,D,F). Next, the converse was tested. A Tra RNAi strain was used to cause the default pattern of the male soma. Progeny, raised in the presence of RU486, were chromosomally female, but phenotypically male.Thus the expression of Tra RNAi in chromosomal females caused transformation to pseudo-males, based on production of male-like genitalia and sex combs, as expected (Rideout, Dornan et al. 2010, Verhulst, van de Zande et al. 2010, Rideout, Narsaiya et al. 2015). In turn, this eliminated the increase in the 100kD Lon isoform and no change in the proteolytic activity after H2O2 pretreatment (Figure 2.19C,D,F), which is analogous to normal chromosomal males. Similarly, expression of Tra RNAi in chromosomal males, had no impact on Lon expression and proteolytic activity, whereas chromosomal females, raised in the absence of RU486, showed induction of the Lon 100kD isoform and proteolytic capacity (Figure 2.19C,D,F). Pseudo-females were Conferred with H2O2 Adaptation As the Lon banding pattern in pseudo-females matched that of chromosomal females, it offered a model to determine if sex-specific expression of Lon contributes to adaptation. Consistent with previous results, normal chromosomal males were unable to adapt to H2O2 stress, as evident by no change in the survival curve (Figure 2.20A & Supplemental Figure 7). In contrast, pseudo- females showed H2O2 stress adaptation, as pretreated pseudo-females lived longer compared to those not pretreated (Figure 2.20B & Supplemental Figure 7), which was equivalent to normal chromosomal females (Figure 2.20C,D & Supplemental Figure 7). Nor did the presence of 98 RU486, alone, provide a beneficial increase in survival (Supplemental Figure 9). In contrast, normal chromosomal males were capable of PQ adaptation (Figure 2.20E & Supplemental Figure 7), whereas pseudo-females, like normal chromosomal females, were unable to adapt to PQ (Figure 2.20F-H & Supplemental Figure 7). Strikingly, adult-specific expression of TraF, in chromosomal males, was sufficient to confer H2O2 adaptation, consistent with transformation of adult male tissues to the pseudo-female state by the presence of the Lon 50kD isoform (Figure 2.20J & Supplemental Table 7). However, adaptation was not as strong as normal chromosomal females (Figure 2.20K,L & Supplemental Table 7), or as evident in pseudo-females generated by developmental expression of TraF. Lastly, pseudo-males, like normal chromosomal males, showed no H2O2 adaptive response (Figure 2.20M,N,P & Supplemental Table 7). In contrast, females raised in the absence of RU486 showed an H2O2 mediated adaptive response (Figure 2.20O & Supplemental Table 7). Together, these findings indicate that the sex-specific expression of Transformer is needed to regulate the female-specific Lon protein expression and H2O2 adaptation. 99 100 Sex-dimorphic Expression of Lon Protein Isoforms in Mammalian Tissues Variants of Lon transcriptional isoforms are conserved in higher eukaryotes, including humans and mice (Figure 2.21). At the transcriptional level, Lon has two variants detected in D. melanogaster, which increases upon organismal complexity, as evident in the number of transcript variants found in mice and humans. More importantly the ratio between the two transcripts, found in D. melanogaster, does not vary based on sex (Chang, Dunham et al. 2011). To test if sexual differences of Lon expression arose in other species, tissue from three month old black C57BI/6 male and female mice were utilized. Western blot of the muscle hindleg showed a Lon banding pattern that was the same in both sexes: a 100 kD band, as predicted for the full- length Lon, an additional 55 kD band, and the faint detection of an 80 kD band (Figure 2.22A). Similarly, western blot of cardiac tissue showed banding patterns to occur at the same positions, but with a stronger detection of the 80 kD band (Figure 2.22B). Whereas, in the mouse liver, which is a highly sexually dimorphic tissue (Yang, Schadt et al. 2006), there was a greater abundance of the 55 kD band in females, with only a slight detection in males (Figure 2.22C). As well, western blots of mouse gonadal tissue showed an additional 55kD Lon isoform in the testes 101 that was not present in the ovaries (Figure 2.22D). These results indicate that sexual dimorphism in expression of Lon protein isoforms is observed in mouse tissues, including the increased abundance of a ~55kD Lon isoform in female liver and male testes. Discussion This study identified multiple isoforms of the mitochondrial Lon protease expressed in sex- specific patterns, and to our knowledge, is the first identification of additional Lon protein isoforms. Adult Drosophila males were found to express 100kD and 60kD Lon isoforms, whereas Adult Drosophila females expressed an additional 50kD isoform. Interestingly, males 102 and females showed similar sensitivity to high concentrations of H2O2 and PQ, which was increased in an age-dependent manner, as shown by the decreased survival, starting at 35 day old flies. These findings demonstrate that both sexes efficiently absorbed H2O2 and PQ, and experienced a similar toxic stress. This is noted by the similar survival times in 3 day old flies. More importantly, as males consume less media, due to their smaller body size, the per unit intake should have a greater effect than that found in females. Yet, PQ pretreatment led to male- specific adaptive response and improved survival, whereas there was no impact in females. Together, indicating that these results are not simply because of sex differences in the amount of PQ intake. In contrast, females showed an adaptive response and increased survival following H2O2 pretreatment, whereas males showed no change. Nor was this finding simply because of differences in the amount of intake, as prior studies found that females typically ingest three times the amount of food compared to males. However, even with higher concentrations of H2O2 pretreatment, did not provide a beneficial adaptive response in males (Wong, Piper et al. 2009, Pickering, Staab et al. 2013). Indicating that these findings are not simply a result of dose- dependent ingestion across the species, as PQ led to male-specific stress-adaptation. The adaptive response was associated with an increase in the 100kD Lon protein isoform in females (upon H2O2 pretreatment), and increases of the 100kD and 60kD isoforms in males (upon PQ pretreatment). The amount of lon mRNA levels remained unchanged, consistent with the sex-specific post-transcriptional up-regulation of Lon expression. Similarly, prior studies of human female-derived lung fibroblasts and rhabdomyosarcoma cells exposed to H2O2 showed an 103 induction of the 100kD form of Lon protein, with lesser to no increase in mRNA levels, which is consistent with a post-transcriptional up-regulation of Lon (Hori, Ichinoda et al. 2002, Ngo and Davies 2009, Ngo, Pomatto et al. 2011). More notable, is smaller sized Lon protein isoforms have not been previously identified in those female-derived human cell lines (Ngo and Davies 2009). However, in this study, Lon isoforms were observed in mouse liver and gonad tissues, suggesting a possible evolutionary conservation of tissue-specific and sex-specific expression of alternative Lon protein isoforms. The increased expression of Lon protein and proteolytic activity in Drosophila females upon H2O2 pre-treatment and in Drosophila males upon PQ pre-treatment, offers a likely mechanism that may contribute to stress adaptation, as the increased Lon activity is expected to allow the animals to more efficiently degrade oxidatively-damaged mitochondrial proteins produced during subsequent toxic challenges. Furthermore, the over-expression of Lon, in D. melanogaster, increased the H2O2-mediated stress response in females, but was not enough to endow H2O2 stress adaptation in males. As well, the transgenic over-expression of Lon produced a greater magnitude of H2O2 stress adaptation in females, providing further evidence in support of the specific role of Lon. Together, these findings suggest that both the increase in Lon expression, combined with the female-specific pattern of Lon protein, are necessary for H2O2 stress adaptation. Consistent with this conclusion, transformation of males into pseudo-females through the utilization of the Gene- Switch system to force the female-specific transformer variant (TraF), generated flies that 104 displayed both the female-specific pattern of Lon protein expression and ability to adapt following H2O2 pretreatment. Lon was required for adaptation to oxidative stress in each sex, yet both increased and decreased expression of Lon was detrimental for longevity. These results suggest there may be a trade-off, wherein the transient oxidative stress adaptation produced by increased Lon is beneficial for survival upon near-term stress challenges, but is ultimately costly for longevity. Consistent with this conclusion, repeated H2O2 pre-treatments of females reduced longevity (Pickering, Vojtovich et al. 2013). Transformer was initially characterized as a regulator of alternative splicing for downstream genes in the canonical somatic sex determination pathway, including the transcription factor genes doublesex and fruitless (Verhulst, van de Zande et al. 2010). Therefore one possible mechanism for how TraF might regulate the expression of alternative Lon protein isoforms is through alternative splicing of the primary lon transcript. However, the known lon RNA alternative splice forms, Lon RC and Lon RA, are predicted to produce Lon proteins that differ by only ~3kD, which is not sufficient to explain the observed 60kD and 50kD Lon isoforms. Moreover, the relative abundance of Lon RC and Lon RA was not affected by sex or by forced TraF expression. Finally, RNAseq analysis of RNA isolated from whole adult flies indicated the same relative expression of Lon exons in males and females. Taken together these data indicate that TraF does not regulate expression of the novel 60kD and 50kD Lon isoforms through regulation of alternative splicing of the Lon transcript. One alternative possibility is that TraF regulates expression of a sex-specific Lon protein processing machinery. The protein sequencing 105 data indicates that both the 60kD and 50kD Lon protein isoforms correspond to the central region of the primary 100kD Lon protein, suggesting that Lon may be cleaved at both the amino and carboxyl ends. Moreover, the female-specific 50kD band may be predominantly involved in a regulatory or chaperone-like role, as Lon has been previously shown to regulate the assembly of protein complexes in the mitochondria and to bind to mitochondrial DNA, independent of its function as a protease (Rep, van Dijl et al. 1996, Pinti, Gibellini et al. 2015). Recently TraF has been reported to regulate the female-specific expression of a number of genes independent of doublesex and fruitless, through mechanisms that are not yet clear, but that may involve direct or indirect transcriptional regulation by Tra (Hudry, Khadayate et al. 2016). Normal TraF expression in the female fat body caused increased secretion of insulin-like peptides and increased IIS in females relative to males (Rideout, Narsaiya et al. 2015). The up- regulation of IIS by TraF may help explain the female-specific induction of Lon and adaptation to H2O2 stress compared to males. Several lines of evidence suggest that females have greater baseline IIS than do males in D. melanogaster, mice and humans (Macotela, Boucher et al. 2009, Tower 2015). In mammals, a localized burst of H2O2 produced by membrane-associated NADPH oxidase enzymes has been shown to stimulate IIS by increasing receptor tyrosine phosphorylation and the activity of downstream signaling kinases including AKT (Mahadev, Motoshima et al. 2004). Therefore one possibility is that Drosophila females are physiologically better equipped to respond to the low-concentration H2O2 pre-treatment because of the greater expression and sensitivity of IIS. 106 The observation that Drosophila males but not females were capable of PQ adaptation likely results from the different oxidative toxicity caused by PQ. PQ reacts with NADPH oxidase enzymes and molecular oxygen in the mitochondria and at the cell membrane to generate PQ radical and superoxide (Bonneh-Barkay, Reaney et al. 2005, Cocheme and Murphy 2008). The superoxide is converted to H2O2 by superoxide-dismutase enzymes, and in the presence of iron the superoxide and H2O2 can combine to create the highly-toxic hydroxyl radical. These free radicals can in turn cause damage to cellular macromolecules, including proteins, consistent with the beneficial effect of up-regulated Lon protease activity upon PQ stress adaptation. The fact that Lon is required for PQ stress adaptation in Drosophila indicates that the mitochondrial proteome is one critical target of PQ-induced damage. More importantly as PQ toxicity was similar in males and females, albeit females have larger body size, indicates the sex-dependent differences are not solely a dose-dependent effect. Studies in Drosophila and mice reveal that dopaminergic neurons are particularly susceptible to PQ toxicity, and implicate membrane NADPH oxidase as an important target for superoxide generation (Chaudhuri, Bowling et al. 2007, Cristovao, Choi et al. 2009). Male Drosophila are more sensitive to behavioral disruptions caused by PQ, and mutations that increase dopamine levels, such as Catecholamines up (Catsup), conferred increased resistance to PQ stress, whereas mutations that decreased dopamine levels caused increased sensitivity (Chaudhuri, Bowling et al. 2007, Cassar, Issa et al. 2015). Notably, increased expression of the D1-like dopamine receptor DAMB increased PQ sensitivity (Cassar, Issa et al. 2015), and DAMB is expressed at higher levels in adult males relative to adult females. Therefore, one possibility is that Drosophila males are physiologically better-equipped to respond to PQ pre-treatment than are females because of the greater basal 107 expression of PQ/superoxide sensitive pathways such as DAMB, while at the same time, this creates a greater target for toxic levels of PQ/superoxide stress. These results may be relevant to understanding sex-dimorphism in human diseases involving chronic oxidative stress. Intriguingly, men are at greater risk for Parkinson’s Disease (PD) than are women, and PD preferentially targets dopaminergic neurons (Gillies, Pienaar et al. 2014). One possibility is that greater expression and activity of dopamine signaling in men confers greater sensitivity to PQ/superoxide stress, yielding more effective stress adaptation at low stress, such as observed here for male Drosophila, but at the same time provides a greater target for toxic stress, such as in the development of PD. Because the mitochondria are inherited almost exclusively from the mother, natural selection can only act to optimize mitochondrial gene function and nuclear-mitochondrial gene interactions in females, and as a consequence mitochondrial function is expected to be better optimized for the female than for the male (Gemmell, Metcalf et al. 2004, Tower 2015). This was supported by evidence showing the detrimental impact of mitochondrial variants impeding only male-specific nuclear transcripts in Drosophila (Innocenti, Morrow et al. 2011), and may be one explanation for the presence of a beneficial female-specific 50kD Lon isoform. One possibility is that females have evolved to better handle H2O2 because this is a normal signaling molecule generated by the mitochondria (Cadenas and Davies 2000). Consistent with this idea, mammalian cardiomyocytes isolated from females were more resistant to H2O2 toxicity than were male-derived cells (Wang, He et al. 2010). Moreover, rodent and human studies show that 108 females have a higher survival rate following cardiac ischemia-reperfusion, which is characterized by a burst of mitochondrial-derived H2O2 (Zaha, Qi et al. 2016). Increased expression of Lon in human tumor cells is positively correlated with the switch from oxidative to glycolytic metabolism and more aggressive cancer (Pinti, Gibellini et al. 2015). Women are marked by both greater insulin sensitivity and reduced cancer incidence relative to men. IIS negatively regulates the Foxo tumor suppressor by stimulating AKT phosphorylation of Foxo. In turn, Foxo positively regulates insulin-like receptor expression and insulin sensitivity in both mammals and in flies (Puig and Tjian 2006). Potentially, increased IIS pathway expression and sensitivity in women may allow for more robust regulation of Foxo, both negative and positive, thereby facilitating Foxo interactions with p53 and with Lon to reduce tumor incidence. Overall these findings highlight the facility of D. melanogaster as a model organism to study sex-based regulation of oxidative stress adaptation, including the role of the conserved mitochondrial Lon protease, with potential implications for our understanding of sex-bias in human disease. Materials & Methods Preparation of fruit-fly tissue 20 flies were collected for each treatment group and frozen. Tissue was re-suspended in 200µL of tissue protein extraction buffer (no. 78501, Thermo-Scientific), supplemented with protease inhibitors (no. 04693159001, Roche), and homogenized using an electric pestle. Afterwards, to 109 maximize lysis, samples underwent a ‘freeze-thaw’ cycle, consisting of a 5min incubation on dry-ice followed with a 5min incubation in water, and then vortexed, and repeated 2 additional times. Samples were then centrifuged at 10,000g for 10min at 4°C to remove cuticle fragments and unlysed cells. Protein content was quantified with the Bicinchoninic acid assay (BCA) reducing agent compatible kit (no. 23252, Thermo-Scientific). Preparation of mouse tissue Mouse tissue from 3 month old male and female black C57Bl/6 purchased from Jackson labs was generously provided by Dr. Valter Longo. For protein extraction, 5mg of tissue were disrupted using Omni Tissue Disruptor, by completing 3 cycles at 45 second intervals at medium speed. Microtubes were centrifuged at 10,000g for 10min at 4°C to remove any tissue fragments. Protein content was quantified with the Bicinchoninic acid assay (BCA) reducing agent compatible kit (no. 23252, Thermo-Scientific). 20µg of protein, for each sex, were run on 10% SDS-PAGE gels and transferred to a PVDF membrane. Mouse Lon protein was detected using a commercially available rabbit polyclonal anti-Lon antibody (1:200 dilution) (no.1-81734, Novus Biologicals). Preparation of 10% SDS-PAGE gels Gels were prepared using the following preparation: Components 10% separating gel 4% stacking gel 30% Acrylamide solution 2.5mL 1mL 1.5M Tris/HCl (pH 8.8) 2.5mL 0.5M Tris/HCl (pH 6.8) 2.5mL 110 10% SDS 100µL 100µL Water 4.85mL 6.36mL TEMED 4µL 10µL 10% APS 100µL 100µL Upon the addition of the TEMED and 10% APS, the solution was loaded onto the casting platform. Following crosslinking TEMED and 10% APS was added to the stacking gel, which was then added on top of the 10% separating gel. Western Blots Protein samples were run on a 10% SDS-PAGE gel and transferred to a PVDF membrane. For D. melanogaster tissue, custom rabbit polyclonal Lon antibody directed against the Drosophila Lon (CG8798) peptide at amino acids Asp613 to Ser838 (1:200 dilution) was generously provided by Dr. Laurie Kaguni (Matsushima, Goto et al. 2010). To detect 20S expression, the mouse monoclonal antibody specific for detection of the α subunit of the 20S core of D. melanogaster origin (1:100 dilution, no. sc-65755, Santa Cruz Biotechnology) was used. The goat polyclonal anti-Actin-HRP antibody, conjugated to horseradish peroxidase (1:1000 dilution, no. sc-1616, Santa Cruz Biotechnology) was used for all loading controls in both mouse and fruit-fly. RNA extraction Flies were collected in 500µL TRIzol (no. 15596-026, Life Technologies) and frozen. RNA extraction was performed following manufacturer’s instructions with slight modification. Flies 111 were homogenized in 500µL TRIzol, followed with the addition of 500µL TRIzol and incubated at room temperature for 5min. Samples were centrifuged at 12,000g for 10min at 4°C to remove cuticle fragments. Supernatant was decanted and 200µL of chloroform was added, and samples were vigorously shaken for 15 seconds, and then incubated at room temperature for 5min. Samples were centrifuged at 12,000g for 15min at 4°C. Aqueous phase was collected, and 500µL ice-cold 100% isopropanol was added, and samples were incubated at room temperature for 10min. Samples were centrifuged at 12,000g for 10min at 4°C, and RNA pellet was retained. To the RNA pellet, 1mL of ice-cold 70% ethanol was added, briefly vortexed, and centrifuged at 7,500g for 5min at 4°C. Pellet was dried and re-suspended in DEPC-treated water, and RNA concentration was assessed using a Nanodrop spectrophotometer (Thermo-Scientific). Quantitative RT-PCR RNA was reverse transcribed to cDNA using TaqMan® Reverse Transcription Reagents (no. N8080234, Life Technologies) and quantitative PCR was performed using iTaq SYBR Green (no. 1725120, Bio-Rad). Amplification for mRNA targets were carried out using sequences listed in the primer utilized table (see below). Primers were designed using the NCBI Primer- Blast software (Ye, Coulouris et al. 2012). Table: Primers Utilized Sequence Primer Lon qPCR F 5’ GAAGATAGTGGAGGTATCCA 3’ Lon qPCR R 5’ TGATGGCGAAGAGGAGCTTA 3’ 112 Lon RA qPCR F 5’ CCAGTCTCAGGTTCCACTATC 3’ Lon RA qPCR R 5’ CTAAGCCCGCTGAAGATCAAA 3’ Lon RC qPCR F 5’ TGACAACTTTGCATTATCCTCT 3’ Lon RC qPCR R 5’ GACTCGACTTTGCCTGATTT 3’ GSDT1 qPCR F 5’ GACTCCCTGTACCCTAAGTGC 3’ GSTD 1 qPCR R 5’ TCGGCTACGGTAAGGGAGTCA 3’ Rp49 qPCR F 5’ CGGATCGATATGCTAAGCTGT 3’ Rp49 qPCR R 5’ GCGCTTGTTCGATCCGTA 3’ Mitochondrial isolation Mitochondrial isolation was conducted as previously described with slight modification (Sohal, Agarwal et al. 1995, Miwa, St-Pierre et al. 2003). Following pretreatment experiments, 200 flies were collected per replicate for each treatment group. Flies were transferred into homogenization buffer (0.32M sucrose, 10mM EDTA, 10mM Tris/HCl, 2% BSA) and gently pressed using pre- chilled mortar and pestle. Samples were then centrifuged at 200g for 3min to remove cuticle fragments. Lysate was then centrifuged for 10min at 2200g, supernatant was removed and the pellet was re-suspended in non-BSA containing homogenization buffer. Pellets were then lysed by passing through a 21 gauge needle, followed with 3 cycles of freeze-thaw and an additional centrifugation. Protein content was quantified using the BCA protein assay reducing agent compatible kit (Thermo-Scientific), 15µg of protein were used for the activity assay. 113 Substrate preparation Protein substrates for activity assay, tritium-tagged aconitase and hemoglobin were labeled and oxidized as previously described (Bota and Davies 2002). Briefly, 5mg of acontiase or hemoglobin was dissolved in 0.1M Hepes buffer with the addition of 6.6uCi [H3]Formaldehyde and 20mM sodium cyanoborohydride. Mixture was incubated at room temperature on an end- over-end shaker for 1 hr. To one mixture, hydrogen peroxide was added at a final concentration of 5mM, and mixtures were rocked for an additional hour. Mixtures were dialyzed through a 10,000 MWCO filter (Millipore) at 15,000g for 30min, eluent was discarded, and slurry re- suspended in Hepes buffer. This was repeated for an additional 7 washes to decrease background signal. Protein content was quantified with BCA assay kit (Thermo-Scientific). Proteolysis using Tritium-labeled substrates by radioactive liquid scintillation assay Isolated mitochondrial lysate was incubated in the presence of 5µg of protein substrate, with ± 5mM ATP and 2mM MgCl2. Samples were incubated at 37°C on a tube shaker for 2 hrs. Afterwards, 10µL of 20% BSA and 20µL of Tricloroacetic Acid (TCA) was added to the sample and centrifuged at 14,000g for 10min to quench the reaction. Supernatant was transferred to 5mL of scintillation fluid, and counts were read and calculated as acid-soluble counts minus background counts on a liquid scintillation counter (Wallace 1410). Lifespan assays Lifespan assays were performed as previously described (Ren, Webster et al. 2007). Briefly, to generate age-synchronized cohorts of flies, virgin males and females were collected from culture bottles over a 48 hour period following eclosion. 20 females and 25 males were housed per vial. 114 Flies were transferred to fresh media every other day and deaths were recorded. The mean, median, percent change in the mean and median, and the log-rank p value were calculated using the R statistical software (R Development Core Team 2010). Drosophila hydrogen peroxide pretreatment 24 hours prior to H2O2 exposure, flies were transferred to vials containing 5% sucrose on a Kimwipe. Upon pretreatment, flies were placed in vials containing either no H2O2 [0µM] or various concentrations of H2O2 [10µM and 100µM] for 8 hours. Flies were then transferred to vials containing 5% sucrose for 16 hours to allow for adaptation. Afterwards, flies were either immediately collected to assess Lon expression and activity, or were placed into vials containing a toxic dose of H2O2 and survival was measured to assess adaptation. Drosophila paraquat pretreatment 24 hours prior to paraquat exposure, flies were transferred to vials containing 5% sucrose on a Kimwipe. Upon pretreatment, flies were placed in vials containing either no paraquat [0µM] or mild concentrations of paraquat [1µM or 10µM] for 8 hours. Afterwards, flies were transferred to vials containing 5% sucrose for 16 hours to allow for adaptation. Then, flies were either immediately collected to asses Lon expression and activity, or were placed into vials containing a toxic dose of paraquat and survival was measured. 115 CHAPTER 3: THE ADAPTIVE DECLINE OF THE 20S PROTEASOME IN D. MELANOGASTER Abstract A major hallmark of aging is the loss of protein homeostasis. However, increasing evidence suggests loss of homeostasis is accompanied by the dysregulation of the adaptive stress response pathways or ‘adaptive homeostasis’. Loss of adaptive homeostasis, increases cellular vulnerability for DNA, protein, and lipid damage. The 20S proteasome is a crucial for its role in protein turnover. During periods of acute stress, the Nrf2-regulated 20S proteasome quickly degrades damaged proteins in an ATP-independent manner. Here, we demonstrate the adaptive response of the 20S proteasome following exposure to a mild oxidative stress in the model organism, D. melanogaster. We find female-specific increases in 20S expression and activity, which are lost with age. We also explore the impact of continual removal of Keap1, the cytosolic inhibitor of Cnc-C, the D. melanogaster orthologue of Nrf2, as a means to increase stress resistance with age. Background Multiple byproducts of cellular metabolism, with which aerobic organisms must cope include numerous free radicals and reactive oxygen/nitrogen species, which can damage lipids, proteins, and DNA (Dröge 2002). If damage is not immediately removed, protein aggregates can accumulate and accelerate cellular senescence (Squier 2001, Tanase, Urbanska et al. 2016). To cope, with these insults, cells, tissues, and organisms rely upon an array of stress responsive enzymes, including the well-characterized 20S proteasome, which can rapidly degrade oxidized 116 proteins, thus preventing them from forming toxic cross-linked aggregates (Grune, Reinheckel et al. 1996, Grune, Reinheckel et al. 1997, Grune, Merker et al. 2003). Transient short-term adaptation, or ‘adaptive homeostasis’ is a widely-characterized phenomenon that can mitigate against damage accrual from environmental or physiological stresses (Davies 2016). The adaptive homeostasis process describes the ability of cells, tissues, or organisms, to activate various stress-responsive pathways, including de novo synthesis of the 20S proteasome, in response to exposure to very low and non-toxic levels of a stimulating agent or condition. Protective enzymes synthesized during adaptive homeostasis then act as a means to mitigate against future oxidative insult, even levels of toxicants that might otherwise be severely damaging or lethal (Davies, Lowry et al. 1995, Espinosa-Diez, Miguel et al. 2015). The response is not binary, but rather exhibits a dynamic range, that enables the fine-tuning in its activation. With age, this dynamic range of adaptive responses compresses (Ben-Zvi, Miller et al. 2009, Haigis and Yankner 2010). As a result, the ability to adapt to varying levels of oxidative stress declines. Accumulation of oxidized proteins is a hallmark of aging (Squier 2001, Tanase, Urbanska et al. 2016), and is indicative of a decline in protein turnover (Reis-Rodrigues, Czerwieniec et al. 2012). Conversely, long-lived organisms, including human centenarians, maintain their homeostatic balance between protein degradation and turnover (Chondrogianni, Petropoulos et al. 2000, Lewis, Wason et al. 2015, Pickering, Lehr et al. 2015). The loss of proteostasis has largely been attributed to the dysregulation of the ubiquitin-proteasome system (UPS), assessed by the degradation of ubiquitin-tagged proteins by the 26S proteasome, which is comprised of 117 the 20S catalytic core and 19S regulatory caps on each end (Pickering and Davies 2012, Raynes, Pomatto et al. 2016). Indeed, age-related aggregation of polyubiquintated proteins is evident from mammalian cell culture to humans (Pan, Short et al. 1993, Vernace, Arnaud et al. 2007, Demontis, Piccirillo et al. 2013). However, polyubiquitaition is not the only means for protein turnover, as oxidized proteins have been shown to be degraded, independent of ubiquitin tagging (Shringarpure, Grune et al. 2003, Pickering, Koop et al. 2010, Wiggins, Tsvetkov et al. 2011, Silva, Finley et al. 2015). Furthermore, activity of the ubiquitin activating/conjugating system, the main signal for protein degradation by the 26S proteasome, is actually suppressed during oxidative stress (Shang and Taylor 1995). This is evident by the 26S proteasome undergoing transient disassembly, (into free 20S proteasomes and 19S regulators bound to HSP70) in a process catalyzed by HSP70 and Ecm29 (Wang, Yen et al. 2010, Grune, Catalgol et al. 2011). The release of ATP-independent free 20S proteasomes, many of which immediately attach to 11S (also called Pa28) regulators, ensures immediate degradation of oxidized proteins. Studies in mouse models further weaken the age-related importance of the 26S proteasome, as aging, alone, does not accelerate protein ubiquitination (Cook, Gass et al. 2009). Nor do the 19S regulatory caps appear essential, as oxidative stress can render them inactive, irrespective of age (REINHECKEL, SITTE et al. 1998). Nor is the deletion of the 19S caps lethal (Sahakian, Szweda et al. 1995). Taken together, these findings indicate the need to reassess the predominant focus given to the UPS system as the primary marker for the age-associated decline in protein turnover. 118 Furthermore, the utilization of D. melanogaster enables exploration of differences in the adaptive response between the sexes. Sexual differences, or sexual dimorphism, is a consequence of the maternal transmission of the mitochondrial genome (Bonduriansky, Maklakov et al. 2008, Finch and Tower 2014). Indeed, the asymmetry of mitochondrial inheritance has resulted in differences in lifespan (typically favoring females) as evident in flies (Camus, Clancy et al. 2012, Shen, Landis et al. 2016), mice (Holzenberger, Dupont et al. 2003, Miller, Harrison et al. 2014), and humans (Seifarth, McGowan et al. 2012). Moreover, females typically show higher levels of stress resistance (Holzenberger, Dupont et al. 2003, Minois, Carmona-Gutierrez et al. 2012, Ross and Howlett 2012). As well, more recent studies have shown that the adaptive stress response is inducible in a female-specific manner (Pickering, Staab et al. 2013, Pickering, Vojtovich et al. 2013). Therefore, we wanted to further understand the age-associated changes, between the sexes, in regards to the basal levels and inducibiltiy of the 20S proteasome. Here, we propose the importance of assessing the age-associated and sex-specific decline of the adaptive response of the ATP-independent 20S proteasome catalytic core. We utilized the model organism, D. melanogaster, in order to assess the age-related and sex-specific differences in the adaptive response of the 20S proteasome. 3 day and 60 day old flies were pretreated with various adaptive concentrations of hydrogen peroxide (H2O2) to assess the adaptive response of the 20S proteasome (expression and activity). Following pretreatment, flies were subjected to semi-lethal concentrations of H2O2 to determine changes in survival (adaptation). The impact of suppressing the inducibility of the 20S beta subunits upon the adaptive response and lifespan was also explored. Lastly, in an attempt to restore the adaptive response, flies underwent chronic knock- down of Keap1, prior to assessing changes in adaptation. 119 Results Aging Diminishes Hydrogen Peroxide Stress Resistance Stress resistance is the ability of an organism to withstand an acute and highly toxic oxidative insult. Moreover, stress resistance is associated with longevity in mutant strains of model organisms (Harshman and Haberer 2000). Prior studies have suggested there is an age-related decline in stress resistance (Semenchenko, Khazaeli et al. , Pérez, Buffenstein et al. 2009). The age-associated changes in survival following exposure to toxic levels of hydrogen peroxide (H2O2) were explored. Progeny of the Actin-GS-255B strain mated to the w[1118] strain were used and aged to different time point. 3 day old flies were selected to represent young (Pickering, Staab et al. 2013, Pickering, Vojtovich et al. 2013), and 60 day old flies were selected to represent the aged time point (Landis, Abdueva et al. 2004), for which >80% of the population had survived, in order to limit selection bias. Flies were fed various concentrations of H2O2 [0M- 8M] and survival was scored every 8 hours. Young males and females were both sensitive to high concentrations of H2O2 (Figure 3.1A,B). With age, both males and females showed increased sensitivity to H2O2 toxicity, as noted by the survival decreasing by approximately 30 hours at the lowest concentration (Figure 3.1C,D). Thus indicating the age-dependent increase in oxidant sensitivity. Interestingly, this finding differs from those found in C. elegans. With age, 10-day old nematode worms show higher resilience (i.e. survival) compared to 3-day old worms (Raynes, Juarez et al. 2016). This may be in part due to the thickening of the nematode worm’s outer cuticle (Zuckerman and Himmelhoch 1980, Johnstone 1994). In turn, potentially limiting the rate of molecular diffusion, and hence the need for higher oxidant exposure. 120 The Age-Dependent Loss of Hydrogen Peroxide Adaptation Adaptation, is the transient activation of the cellular stress response pathway, which enables cells (Wiese, Pacifici et al. 1995, Pickering, Linder et al. 2012), tissues (Divald and Powell 2006), and whole organisms (Pickering, Staab et al. 2013, Pickering, Vojtovich et al. 2013, Raynes, Juarez et al. 2016) to withstand future oxidative insult for a period of time, also referred to as ‘Adaptive 121 homeostasis’ (Davies 2016). To test the age-related changes in adaptation, 3 day old and 60 day old flies were pretreated with either 0µM or 10µM H2O2 for 8 hours and then allowed to recover for 16 hours prior to exposure to a normally toxic dose. Previous studies had confirmed uptake and ingestion by both males and females of hydrogen peroxide over the 8-hour period (Pickering, Staab et al. 2013). Young females, pretreated with H2O2, showed an adaptive response, as measured by the increased survival upon the addition of the toxic dose of H2O2 [4.4M] (Figure 3.2A & Supplemental Table 9). However, with age, females showed increased sensitivity and inability to adapt following pretreatment (Figure 3.2C & Supplemental Table 9). In addition, aged females were no longer able to withstand the same semi-lethal dose of their younger counterparts. Instead, they were challenged with approximately half the concentration [2M]. Males, regardless age or pretreatment, showed no change in survival (Figure 3.2B,D & Supplemental Table 9). In addition, aged males showed even greater sensitivity to H2O2 toxicity with age, with 1M H2O2 exposure causing rapid death. 122 123 The Adaptive Increase of the 20S Proteasome Expression Declines with Age in a Sex- Dependent Manner. Prior mammalian cell culture studies have demonstrated that the 20S proteasome is inducible, following oxidative stress (Pickering and Davies 2012, Pickering, Linder et al. 2012), but proteolytic capacity diminishes with age (Grune, Jung et al. 2004). To understand the age-related changes in the adaptive expression of the 20S proteasome, 3 day old and 60 day old male and female fruit flies were used. Following H2O2 [0µM-100µM] pretreatment, entire flies were homogenized and the lysates were analyzed by western blot. The blots were incubated with a monoclonal antibody directed against the D. melanogaster α-subunit of the 20S proteasome, and protein loading was normalized to the Actin-HRP antibody. Total lysate from young females showed a robust increase in proteasome expression (Figure 3.3A). However, aged females, though they are no longer capable of inducing the 20S proteasome expression, basal levels matched the maximum induction achieved by young pretreated females (Figure 3.3A). In contrast, total lysate from males, regardless age or pretreatment, showed no change in 20S proteasome expression and amount (Figure 3.3B). Moreover, this finding is similar to that found in C. elegans. As 10 day old worms show higher basal 20S proteasome expression compared their 3 day old counterparts (Raynes, Juarez et al. 2016). Yet, in both organisms, induction of the 20S proteasome diminishes with age. To measure both age-related and sex-specific differences in basal 20S proteasome expression, young and old female and male lysate were run on the same western blot for quantification. 124 Interestingly, aged females showed a higher basal expression compared to young females. Whereas, males showed no difference with age (Figure 3.3C). 125 The Adaptive Proteolytic Capacity of the 20S Proteasome Diminishes with Age in a Sex- Dependent Manner As proteasome expression was found to be inducible in a sex-specific manner, proteolytic activity of the 20S proteasome was quantified. 3 day old and 60 day old flies, pretreated with various concentrations of H2O2 [0µM-100µM], were collected following a 16-hour recovery. Total lysate was used to assess proteolytic capacity to degrade fluorogenic peptides, which act as specific substrates for each of the proteasome subunits: Z-LLG-AMC for caspase-like/β1 activity, Z-ARR-AMC for trypsin-like/β2 activity, and Suc-LLVY-AMC for chymotrypsin- like/β5 activity. Upon increasing concentrations of H2O2, young females (pink) showed a marked increase in proteolytic capacity in the activity of all three proteasomal subunits (Figure 3.4A,C,E). Indeed, increased proteolytic capacity was proteasome-dependent, as inhibition of proteolytic capacity blocked the inductive response, evident in young pretreated females (Figure 3.6A,B). In contrast, aged females (black), showed loss of proteasome induction and basal decrease in proteasome degradation (Figure 3.4A,C,E). Both, young (blue) and aged males (black) showed no change in proteolysis following H2O2 pretreatment, nor a basal change in proteolytic capacity with age (Figure 3.4B,D,F). 126 127 As oxidized proteins are the primary substrates of the 20S proteasome (Grune, Reinheckel et al. 1996, Grune, Reinheckel et al. 1997), lysate from whole flies were incubated with oxidized hemoglobin ([ 3 H]Hboxdized). Increased scintillation counts corresponded to increased 20S proteasome degradation. Young pretreated females, showed increased proteolytic degradation compared to controls, whereas with age, H2O2-induced proteolytic capacity was lost. Males, irrespective pretreatment or age, showed no change in proteolysis following pretreatment (Figure 3.5). 128 129 The Age-Related Loss in Adaptation is Accompanied by Increased Protein Oxidation Early studies found an age-related increase in basal protein oxidation levels in various model systems (Stadtman 2001). Protein carbonylation is an irreversible consequence of oxidative damage that often leads to loss of protein function (Stadtman and Levine 2003). Moreover, both dividing and non-dividing fibroblasts were found to have a positive increase in protein carbonyl content (Sitte, Merker et al. 2000, Jung, Höhn et al. 2009). Therefore, it was hypothesized that an adaptive increase in the amount of functional 20S proteasome would impact the clearance of oxidized proteins. Indeed, early studies suggested that increased proteasome expression resulted in decreased accumulation of damaged proteins (Breusing, Arndt et al. 2009). As well, prior studies in cell culture demonstrated cells, pretreated with an adaptive dose, showed improved protein clearance when subsequently subjected to a challenge dose of an oxidant (Ngo and Davies 2009, Ngo, Pomatto et al. 2011, Raynes, Juarez et al. 2016). To determine the consequence of increased 20S proteasome expression after adaptation, western blotting was used to assess protein carbonylation levels. To induce expression and activity of the 20S proteasome, flies were pretreated with a range of adaptive H2O2 levels [0µM-100µM] for 8 hours, allowed to adapt for an additional 16 hours, before being subjected to the [4.4M] toxic dose for 24 hours. As all flies were subjected to the semi-lethal dose, only pretreated 3 day old females showed decreased amounts of total carbonyl content (Figure 3.7A). As early findings showed pretreatment in young 3 day old females was able to stimulate increased 20S proteasome expression and activity, the decreased oxidation during the challenge dose, is arguably due to the increased levels of the 20S catalytic core. However, similar to the loss in the adaptive response, 60 day old females demonstrated no change in the protein carbonylation levels, irrespective 130 pretreatment with H2O2 (Figure 3.7B). Furthermore, male flies showed no change in protein carbonylation upon pretreatment with H2O2 for young or aged flies (Figure 3.7C,D). These results for cumulative protein damage reflect the changes in the 20S proteasome expression observed in pretreated flies. 131 132 The Female-Specific Adaptive Expression of The 20S Proteasome is Age and Tissue- Dependent. Next, various tissues were analyzed to determine if tissue-specific differences in the adaptive response of the 20S proteasome were present. 3 day old and 60 day old flies were pretreated with adaptive concentrations of H2O2 [0µM-100µM] before tissues (head, thorax, and abdomen) were collected. Expression of the 20S proteasome was measured in tissue homogenate by western blot, by using a D. melanogaster-specific antibody to the α-subunit. Young females showed a marked increase in the 20S proteasome expression within the abdomen (Figure 3.8A) and head (Figure 3.8B). However, the thorax, regardless pretreatment, showed no induction of the 20S proteasome (Figure 3.8C). With age, the adaptive response, visible in the 3 day old abdomen and head, was lost (Figure 3.8D,E). Whereas in the 60 day old thoraxes, there was no change in 20S proteasome expression upon pretreatment (Figure 3.8F). 133 134 The proteasome core is crucial in the immediate removal of damaged proteins. However, loss of protein turnover is a hallmark of aging (Grune, Jung et al. 2004, David, Ollikainen et al. 2010), accompanied by diminished basal proteolytic capacity of the 20S proteasome (Tsakiri, Sykiotis et al. 2013, Gohlke, Mishto et al. 2014), though this finding is not universal (Louie, Kapphahn et al. 2002, Vernace, Arnaud et al. 2007, Petersen, Honarvar et al. 2010, Caniard, Ballweg et al. 2015, Raynes, Juarez et al. 2016). To test, individual tissues (abdomen, head, thorax) from 3 day old and 60 day old females, pretreated with various concentrations of H2O2 [0µM-100µM] were measured for changes in fluorescence following the addition of fluorogenic peptides, which were specific for the three proteolytic subunits of the 20S core. Similar to increased proteasome expression, all three subunits of the abdomen and head showed increased proteolysis in 3 day old H2O2 pretreated females (Figure 3.9A-F). Whereas, thoracic tissue showed no change in proteolysis, regardless pretreatment (Figure 3.9G-I), mirroring findings of proteasome protein expression within the thoracic tissue. 135 136 Males Showed No Tissue-Specific or Age-Related Adaptation of the 20S Proteasome Whole tissue extracts showed no change in proteasome expression or activity in males following H2O2 [0µM-100µM] pretreatment. To test if lack of proteasome induction was inherent within individual tissues, 3 day old and 60 day old males were pretreated with varying amounts of H2O2 [0µM-100µM], before tissue collection (head, abdomen, and thorax). Following pretreatment, 20S expression remained unchanged, irrespective pretreatment (Figure 3.10A-C) or age (Figure 3.10D-F). The lack of tissue-specific adaptive responses in males recapitulates the earlier finding of whole male lysate showing no adaptive response to H2O2 pretreatment. 137 138 Next, proteolysis was assessed within the young and aged pretreated male tissues (head, abdomen, and thorax). Pretreated tissue lysate was incubated in the presence of fluorogenic substrates: caspase-, trypsin-, and chymotrypsin-like activities. Irrespective tissue, there was no change in caspase-like activity (Figure 3.11 A,D,G), nor a change in the trypsin-like activity (Figure 3.11 B,E,H), or chymotrypsin-like activity, following H2O2 pretreatment (Figure 3.11C,F,I). 139 140 Age-Related Differences within Individual subunits of the 20S Proteasome Interestingly, aged tissue showed a shift in proteasomal activity. This was consistent in both sexes. Specifically, aged females showed basal increases in the caspase-like activity in all three tissues (Figure 3.9 A,D,G), and no significant change in the trypsin-like activity within the abdomen or thorax (Figure 3.9B,H). In contrast, aged females showed a robust decrease in the chymotrypsin-like activity in all tissues (Figure 3.9C,F,I). Similarly, basal caspase-like activity was increased with age within all male tissues (Figure 3.11A,D,G). As well, male head and abdominal tissue showed marked increases in basal trypsin-like activity with age (Figure 3.11B,E). And, similar to females, basal chymotrypsin-like activity showed a significant decrease in aged male tissue (Figure 3.11C,F,I). This shift in proteasomal activity with age may hint at the underlying decrease in protein degradation, regardless the increase in basal protein expression (Vernace, Arnaud et al. 2007), and is indicative of the chymotrypsin-like proteolysis as the potential rate-limiting step in protein degradation by the 20S core. Adaptation is Dependent Upon the 20S Proteasome To assess the role of the 20S proteasome in the adaptive response, the ‘Gene-Switch’ system was used to suppress subunit expression (Ford, Hoe et al. 2007). Males of the RNAi strains for the β1 and β2 subunits were mated to virgin females of the Actin-GS-255B driver strain to ensure tissue-general knockdown. Adult progeny were raised in the absence or presence of RU486 for 10 days. Flies were collected to assess mRNA and protein knockdown efficiency. In both sexes, the mRNA levels of the beta subunits decreased by at least 50% (Figure 3.12A-D). In addition, the adaptive increase in the amount of the 20S proteasome was blunted in the presence of RU486 in females in the absence of both beta subunits (Figure 3.12E,G). However, irrespective RU486 141 exposure, males showed no change in the amount of proteasome expression following H2O2 pretreatment (Figure 3.12F,H). As well, induction of the proteolytic capacity of the individual subunits was diminished in females raised in the presence of RU486 following H2O2 pretreatment (Figure 3.13A,C). Of note, upon the removal of the beta 1 subunit, all subunits showed loss of the inductive increase, with the caspase-like activity showing significant decrease in activity compared to activity in females raised in the absence of RU486 (Figure 3.13A). Similarly, upon knockdown of the beta 2 subunit, the inductive increase in proteolysis was eliminated in all three subunits from females cultured in the presence of RU486 (Figure 3.13C). Conversely, males showed no change in proteolytic capacity (Figure 3.13B,D). 142 143 144 Next, flies were pretreated with adaptive doses of H2O2 [10µM & 100µM] before being fed the semi-lethal dose [4.4M]. In the absence of RU486 (black), females showed an adaptive response, measured by the increased survival in pretreated females (Figure 3.14A,C & Supplemental Table 10). In contrast, in the presence of RU486, females were no longer able to adapt (Figure 3.14A,C & Supplemental Table 10). Moreover, the shape in the curve, following removal of beta 1 in females, is indicative of the Strehler-Mildvan relationship, evident by the increase in the early mortality rate (pink) (Strehler and Mildvan 1960, Zheng, Yang et al. 2011). A finding indicative which is indicative of poor immune function, suggesting the 20S beta1 subunit may play a strong, yet not well-known role, in the D. melanogaster gut health (Shen, Landis et al. 2016). Interestingly, although females lacking beta2 were unable to adapt, they did not show the early mortality rate presented by loss in the beta1 females. Similar to earlier results, males, in the absence of RU486 (black), were unable to adapt upon H2O2 pretreatment (Figure 3.14B,D & Supplemental Table 10). However, upon loss of either subunit, males were more sensitive to the increased challenge dose, evident by the shortened survival time (blue). Additionally, matching the early mortality rate in females with suppressed beta1 inducibility, males fed RU486 also showed a slight increase in the early mortality rate. 145 The Loss of Subunits of the 20S Proteasome or its Regulators Impacts Lifespan The 20S proteasome is necessary for the adaptive response to oxidative stress in a sex-specific manner (Figure 3.14). Previous studies in yeast have shown that loss of the 20S proteasome dramatically decreases lifespan (Chen and Hochstrasser 1996). Additional work has also shown continual feeding of proteasome inhibitors dramatically reduces lifespan (Tsakiri, Sykiotis et al. 146 2013). Conversely, overexpression of the 20S proteasome was beneficial in providing a lifespan extension (Chondrogianni, Georgila et al. 2015). The proteasome is the primary cytosolic clearance mechanism for oxidized proteins. To assess the impact of loss of the 20S proteasome subunits or its transcriptional regulator, Nrf2, upon the lifespan, two RNAi strains were used. The 20S RNAi β1 and β2 strains were mated to the Actin- GS-255B driver strain for tissue-general knockdown, to determine the impact of decreased 20S expression on lifespan. We also used the CnC and Keap1 RNAi strains. Virgin flies were cultured in the presence or absence of RU486 for the entirety of their lifespan (Ren, Finkel et al. 2009, Landis, Salomon et al. 2015). To ensure RU486, alone, did not provide lifespan extension, constitutive feeding of RU486 had no impact on the lifespan of control flies (Figure 3.15A,B & Supplemental Table 11). We found that RU486-induced 20S RNAi had a negative impact on lifespan for both male and female flies (Figure 3.15C-F) & Supplemental Table 11). Upon removal of CnC, both males and females showed a marked decrease in lifespan, albeit not as detrimental as upon direct removal of the 20S beta subunits (Figure 3.16A,B & Supplemental Table 11). Conversely, upon removal of Keap1, males and females showed a slight increase in lifespan (Figure 3.16C,D & Supplemental Table 11), matching earlier findings (Sykiotis and Bohmann 2008). 147 148 149 Stress Resistance Improves upon Continual Loss of Keap1 Adaptive homeostasis is necessary to ensure protein quality control under the highly dynamic cellular environment. Inability to ensure protein turnover, is a marked sign of cellular senescence (Morimoto and Cuervo 2014, Hamilton and Miller 2016). Due to the crucial role of the 20S proteasome in degradation of oxidized proteins, the age-associated loss of inducibility, in response to a mild oxidative stress, may be a marker of protein dysregulation (Raynes, Juarez et al. 2016). Moreover, earlier studies showed Nrf2/CnC transcription factors regulate the 20S proteasome subunits (Pickering, Linder et al. 2012, Pickering, Staab et al. 2013, Raynes, Juarez et al. 2016). Hence, Nrf2/CnC responsiveness to oxidative stress impacts de novo 20S proteasome formation (Sykiotis and Bohmann 2008, Pickering, Linder et al. 2012, Pickering, Staab et al. 2013, Tsakiri, Sykiotis et al. 2013). The age-related decline in the induction of the 20S proteasome expression and activity is potentially linked to changes in Nrf2/CnC transcriptional regulation. As well, RNAi studies against Keap1, the cytosolic inhibitor of CnC, resulted in elevation of the proteasomal subunits (Tsakiri, Sykiotis et al. 2013). Therefore, I sought to address if continual removal of Keap1, throughout the lifespan, would be beneficial in mediating an adaptive response in aged flies. Male and female flies of the Keap1 RNAi strain were aged, continually, in the absence (blue) or presence (pink) of RU486. After 60 days, flies were pretreated with 0µM or 10µM H2O2, prior to being challenged with 2M (females) or 1M (males) H2O2. Unfortunately, adaptation (increased survival) was not restored upon H2O2 pretreatment, following continual knock-down of Keap1, compared to flies aged in the absence of RU486, with normal levels of Keap1 (Figure 3.17 & Supplemental Table 12). However, comparison between flies fed only the 150 challenge dose, showed overall stress resistance was improved upon constant Keap1 removal in females (Figure 3.17A & Supplemental Table 12) and males (Figure 3.17B & Supplemental Table 12). Nor was this improved stress resistance a consequence of RU486, alone, as control flies, continually aged either in the absence or presence of RU486, showed no difference in stress resistance (Supplemental Figure 11). Therefore, although adaptation was not restored, stress resistance was improved. 151 152 Discussion The adaptive stress response is the short-term activation of various protective genes and pathways, following exposure to a mild adaptive stress, which enables an organism to withstand and mitigate damage from a future oxidative insult. Studies in mammalian cell culture have demonstrated the adaptive increase of the 20S proteasome, following exposure to mild adaptive doses (including H2O2 and heat shock) (Beedholm, Clark et al. 2004, Pickering, Linder et al. 2012). A finding found to be conserved in higher organisms, including C. elegans and D. melanogaster. In both organisms, exposure to short-term H2O2, heat shock, 100% oxygen or irradiation, increased survival (Lithgow, White et al. 1995, Cypser and Johnson 2002, Moskalev, Shaposhnikov et al. 2009, Pickering, Staab et al. 2013, Pickering, Vojtovich et al. 2013, Raynes, Juarez et al. 2016). However, the dynamic range of the adaptive homeostasis compresses (Davies 2016). A finding that begins as early as middle age (Zhang, Liu et al. 2012). To compensate, aging cells and organisms show chronic activation of stress responsive pathways (Haigis and Yankner 2010, Raynes, Juarez et al. 2016). Here, the age-associated and sex-specific loss of the adaptive capacity of the 20S proteasome in D. melanogaster was explored. Protein turnover is crucial for cellular function. For efficient protein quality control, cells, tissues, and organisms rely upon the 20S proteasome as one of the primary clearance mechanisms of oxidized proteins (Grune, Reinheckel et al. 1997, Shringarpure, Grune et al. 2001, Grune, Merker et al. 2003). Yet it is paramount cells are able to dynamically modulate their available pool of free 20S proteasomes. Indeed, early studies found that immediately following oxidative stress, 26S proteasomes are disassembled by heat shock factor 70 (HSP70) chaperones, which bind and sequester away the 19S subunits (Grune, Catalgol et al. 2011). In 153 turn, supplying the cell with an immediate and functional pool of 20S proteasomes. To prevent against future stress, de novo 20S proteasomes are formed, further increasing the cellular pool (Grune, Catalgol et al. 2011). Yet, once the stress response is shut-off, the amount of 20S proteasomes are restored to homeostatic conditions. Hence, understanding the age-associated change in the adaptive homeostatic capacity of the 20S proteasome is crucial. To begin answering this question, the adaptive response in 3 day old and 60 day old flies after H2O2 pretreatment were compared. 3 day old H2O2 pretreated females demonstrated increased 20S expression, proteolytic capacity, and survival, which was abrogated in their 60 day old counterparts. A finding that is consistent in the nematode worm (Raynes, Juarez et al. 2016). Moreover, it was demonstrated that the adaptive proteolytic capacity was dependent upon the 20S core, as inhibition eliminates the adaptive increase in proteolysis in pretreated lysate. Evident in whole fly lysate treated with various catalytic inhibitors of the 20S core. As the central role of the 20S catalytic core is to degrade damaged proteins, it is important to assess the age-related changes in protein degradation. While, the general consensus is in accord with the amount and activity of the catalytic core declining with age (SITTE, HUBER et al. 2000), it is not universal (Vernace, Arnaud et al. 2007, Caniard, Ballweg et al. 2015), and is highly tissue-dependent (Rodriguez, Gaczynska et al. 2010, Tsakiri, Sykiotis et al. 2013). Moreover, earlier studies indicate an age-associated increase in the basal activity of the 20S proteasome in rat muscle (Husom, Peters et al. 2004, Ferrington, Husom et al. 2005), C. elegans (Raynes, Juarez et al. 2016), and as presented here, in D. melanogaster. 154 These findings substantiate earlier studies that suggest a similar trend in the dysregulation of proteasome expression and activity. For example, post-mitotic aging in human lung fibroblasts demonstrated loss of chymotrypsin-like proteasomal activity (SITTE, HUBER et al. 2000). As well, tissue-specific declines in proteolysis have been reported in a plethora of tissue, including the brain (Keller, Hanni et al. 2000), liver (Hayashi and Goto 1998), heart (Bulteau, Szweda et al. 2002), and retina (Louie, Kapphahn et al. 2002), albeit, findings differ and vary between the catalytic subunits. This is potentially attributed to the increased accumulation of oxidized proteins with age (Oliver, Ahn et al. 1987). Furthermore, these highly oxidized proteins are potentially no longer the ideal proteasome substrate, as heavily aggregated proteins have been shown to inhibit the 20S catalytic core (Powell, Wang et al. 2005). Indeed, early in vitro studies suggested that partial oxidation of hemoglobin (resulting in partial denaturation) resulted in the ideal proteasome substrate, as low levels of hemoglobin oxidation increased proteasome activity. Conversely, the higher the oxidation rate, and the more hemoglobin unfolding, acts to suppress proteasome capacity (Pacifici, Kono et al. 1993). More recently, work to elucidate the ‘insolubolome’, or proteins that become insoluble with age, found subunits of the 20S proteasome to accumulate alongside these protein aggregates (Reis-Rodrigues, Czerwieniec et al. 2012). Thus to cope with increased protein damage, the organism, at the cellular level, may upregulate the 20S expression, but if the substrate is too bulky, it is plausible the 20S may accumulate, in attempt to degrade the oxidized proteins, adding to the overall aggregation, rather than its removal. Evidence for this hypothesis has been explored in the brains of Alzheimer’s disease (AD) patients, as protein aggregates, in 155 the form of plaques and tangles, is arguably a contributing factor in disease progression (Smith, Carney et al. 1991). Additionally, amyloid-beta has been suggested to inhibit proteasome activity (Tseng, Green et al. 2008). Indeed various studies assessing changes in proteasome, indicate it is not a decline in proteasome expression, but rather a loss in proteolytic activity that may contribute to disease manifestation (Keller, Hanni et al. 2000, Cecarini, Ding et al. 2007). The age-related dichotomy between the amount versus proteolytic capacity of the 20S core was found to be consistent in aged fruit-flies. Here, aged females showed an age-associated basal increase in 20S expression. Yet, proteolytic capacity of the three catalytic subunits (caspase-like, trypsin-like, and chymotrypsin-like) showed a significant decline within 60-day old whole-body lysate. A finding mirrored upon the addition of physiologically-relevant substrates, specifically oxidized proteins (Grune, Merker et al. 2003). Upon the addition of oxidized hemoglobin, only young pretreated females showed increased proteolytic capacity, which was lost in aged pretreated females. Males showed no change in proteolytic capacity, regardless age or pretreatment. Indeed the importance of the 20S catalytic core is highlighted upon the dramatic shortening in lifespan that is evident, in both sexes, upon the removal of the catalytically active beta subunits, indicative of the crucial role of the 20S in protein turnover. Together, these findings suggest a maximal threshold that is reached in proteasome expression as a possible age- dependent compensatory mechanism. Indeed, the narrowing of the homeostatic range is a conserved feature of aging, as chronic activation of the stress response is evident in aged tissue and model organisms (Bishop, Lu et al. 2010, Haigis and Yankner 2010, Raynes, Juarez et al. 2016). 156 As indicated by earlier studies, the activity of the three catalytic subunits of the 20S core are subject to tissue-dependent variation (Bulteau, Petropoulos et al. 2000, Petersen, Honarvar et al. 2010, Rodriguez, Gaczynska et al. 2010, Tsakiri, Sykiotis et al. 2013, Gohlke, Mishto et al. 2014). However, to our knowledge, tissue-specific changes in the adaptive response, with age, have not been explored. Here, young females, pretreated with H2O2, showed increased proteolytic activity in all three beta-subunits within the abdomen and head. Increased proteasome activity mirrored the inductive increase in the tissue expression of the 20S core. However, no change was found in the thoracic tissue, most likely due to delivery method of H2O2, and may require direct thoracic injection to elicit a response (Cochemé, Quin et al. 2011). In contrast, males, irrespective the tissue, showed no increase in proteolytic activity following H2O2 pretreatment. However with age, although induction of proteasome expression and activity was lost, the tissue specific differences in the catalytic subunits was revealing. Female tissue (head, abdomen, and thorax), showed a basal increase in caspase-like activity, whereas trypsin-like activity only declined in the abdomen. Conversely, the chymotrypsin-like activity showed a significant basal decrease with age in the abdomen, head, and thorax. The males showed a similar pattern in the individual proteolytic capacity, with a significant basal increase in the caspase-like activity, coupled with a significant basal decrease in the chymotrypsin-like activity in all three tissues. The loss of the chymotrypsin-like activity is relevant as studies using site-specific mutagenesis and site-specific inhibitors found the chymotrypsin-like activity to be the rate-limiting step for protein degradation (Lee and Goldberg 1996, Craiu, Gaczynska et al. 1997). This finding is further supported by substrate interaction, as substrates, which bind to the chymotrypsin site, 157 results in the activation of the caspase site, but not vice versa (Kisselev, Akopian et al. 1999). More importantly mutagenic studies that rendered the β5 subunit inactive, resulted in cells hypersensitive to oxidative stress (Li, Arnaud et al. 2004). Indeed, we find a similar outcome here, as aged flies show increased sensitivity to hydrogen peroxide, paralleled by a dramatic decrease in chymotrypsin-like activity. Thus the loss of chymotrypsin-like activity most likely has the greatest detrimental impact upon protein turnover, and ultimately cell survival. Lastly, a highly relevant finding is the sex-specific differences in proteasome response. Initial D. melanogaster studies showed age-related basal declines in proteolytic activity, albeit did little to address sex-dependent differences as they used mixed populations of flies (Vernace, Arnaud et al. 2007). A later study found females to have higher basal proteolytic activity in both the 26S and 20S compared to males (Tsakiri, Sykiotis et al. 2013). However, as the 20S proteasome is the primary defense for immediate removal of oxidized proteins, it is important to assess the sex- specific differences in its adaptive homeostatic capacity. Here, we demonstrated that although young males and females showed similar stress resistance upon increasing amounts of hydrogen peroxide, males showed no difference in survival following H2O2 pretreatment. Nor is the difference dependent upon pretreatment dosage, as increasing amounts of hydrogen peroxide have been previously shown to be detrimental to males (Pickering, Staab et al. 2013). In addition, only young pretreated females showed induction of proteasome response and decreased protein oxidation, whereas pretreated males showed no difference. Nor are sex-differences diminished with age, as aged males are less stress resistant than aged females. 158 The relevance for exploring the sex-dependent differences of the adaptive proteasome response may be important in understanding the underlying cause for sex-dependent differences in lifespan. Females typically outlive males, as evident in fruit-flies (Magwere, Chapman et al. 2004, Camus, Clancy et al. 2012), rodents (Anisimov, Piskunova et al. 2010), and humans (Austad 2006). Some have suggested these sex-dependent differences are due to mitochondrial function (Borrás, Sastre et al. 2003). Under basal conditions, mitochondria from female rat liver have been found to have a higher membrane potential, increased substrate oxidation capacity, and lower reactive oxygen species production compared to males, indicating a more efficient, female-adapted mitochondria (Borrás, Sastre et al. 2003, Justo, Boada et al. 2005). A finding that is maintained with age (Brigelius, Muckel et al. 1983). As well, females have higher basal activity of nuclear encoded antioxidant genes, such as Manganese Superoxide Dismutase (MnSOD) and glutathione peroxidase, which may contribute to the four-fold difference in oxidative damage that accumulate in male mitochondria (Pinto and Bartley 1969, Borrás, Sastre et al. 2003). Indeed, studies suggest, including ours, that females have a higher basal proteolytic capacity compared to males (Hansen, Sarup et al. 2012, Tsakiri, Sykiotis et al. 2013). Thus it is plausible females are more efficient at modulating the stress response, including proteasome expression and activity. Overall, these findings highlight the importance of understanding the age-related and sex- specific changes in the adaptive stress response of the 20S proteasome. Further work will be needed to uncover the underlying mechanism, and potentially, means of restoring the 20S adaptive function with age. 159 Materials and Methods: Drosophila strains and culture Flies were cultured on standard agar/dextrose/corn meal/yeast media at 25°C as described previously (Ren, Finkel et al. 2009). Flies expressing RNAi against two proteasome subunits were obtained from the Vienna Drosophila RNAi center (VDRC, Vienna, Austria), w[1118]; P[GD13913]v35923 (abbreviated B1 RNAi), w[1118]; P[GD10938]v24749 (abbreviated B2 RNAi). Strains expressing RNAi against the cap ‘n’ collar transcription factor (an orthologue of the mammalian Nrf2) and dkeap-1 (an orthologue of the mammalian Keap1) were kindly donated by Dr. Dirk Bohman (Sykiotis and Bohmann 2008, Sykiotis and Bohmann 2010). Males from these lines (or w[1118] as a control) were crossed to virgin females of the Actin- ‘Geneswitch’-255B (Actin-GS-255B) driver strain (Ford, Hoe et al. 2007). Virgin progeny were collected over 48 hours following eclosion. Adult flies were maintained on media adjusted to final concentration of 160µg/mL mifepristone (RU486, no. M8046, Sigma-Aldrich) or ethanol, and transferred to fresh media every other day. Preparation of Drosophila Twenty flies were collected per treatment group and re-suspended in 200µL proteolysis buffer (50mM Tris/HCl, 20mM KCl, 5mM MgAc, 1mM DTT, pH 7.5) and homogenized using an electric pestle. Further lysis was performed by three ‘freeze-thaw’ cycles, which consisted of 5min incubation on dry ice, followed by 5min incubation in water, and vortexed. To remove cuticle fragments, samples were centrifuged for 10,000g for 10min at 4°C. Protein concentration was measured using the Bicinchoninic acid assay (BCA) reducing agent compatible kit (no. 23252, Thermo-Scientific). 160 Western Blots Protein samples were run on a 4-15% gradient SDS-PAGE gel (no. 4568084, Bio-Rad) and transferred to a PVDF membrane (no. 1620177XTU, Bio-Rad). Mouse monoclonal antibody specific for detection of the α subunit of the 20S core of D. melanogaster origin (1:100 dilution, no. sc-65755, Santa Cruz Biotechnology). The goat polyclonal anti-Actin-HRP antibody, conjugated to horseradish peroxidase (1:1000 dilution, no. sc-1616, Santa Cruz Biotechnology) was used for protein loading control. Fluoropeptide Proteolytic Activity Assays 5µg of lysate from treatment groups were transferred, in triplicate, to 96-well plates, and 2µM of various proteasome specific-subunit substrates were used: Caspase-like/β1 activity, Z-LLG-AMC (no. 539141, Calbiochem), Trypsin-like/β2 activity, Z-ARR-AMC (no. 539149, Calbiochem) Chymotrypsin-like/β5 activity, Suc-LLVY-AMC (no. 539142, Calbiochem). Plates were incubated at 37°C, and fluorescence readings were recorded every 10 minutes for 4h using an excitation wavelength of 355nm and an emission wavelength of 444nm. Fluorescence units were converted to moles of free 7-amino-4-methylcoumarin (AMC), using an AMC standard curve of known amounts (no. 164545, Merck), with background subtracted. To measure proteolytic inhibition, 20µM of the proteasome inhibitors, lactacystin (no. 80052-806, VWR) or epoxomicin (no. E3652, Sigma-Aldrich), were added directly to lysate, and incubated on plate shaker for 30min at 300rpm, after which, substrate was added. 161 Preparation of [ 3 H]-labeled substrates Tritium-tagged oxidized-hemoglobin ([ 3 H]-OxHb) was generated as previously described (Grune, Reinheckel et al. 1996). Briefly, 5mg of hemoglobin was dissolved in 0.1M Hepes buffer with the addition of 6.6uCi [H3]Formaldehyde and 20mM sodium cyanoborohydride (Jentoft and Dearborn 1979). Mixture was incubated at room temperature on an end-over-end shaker for 1 hr. Hydrogen peroxide (H2O2) was added at a final concentration of 5mM, and mixture was rocked for an additional hour. Mixture was dialyzed through a 10,000 MWCO filter (Millipore) at 15,000g for 30min, eluent was discarded, and slurry re-suspended in Hepes buffer. This was repeated for an additional 7 washes to remove unbound [H3]Formaldehyde. Protein content was quantified with BCA assay kit (Thermo-Scientific). [ 3 H]-labeled substrates Proteolytic Activity Assay 5µg of oxidized [ 3 H] hemoglobin (([ 3 H]-OxHb) was added to 15µg of cell lysate. Samples were incubated on a plate shaker at 300rpm for 2 hours at 37°C. To precipitate any remaining intact protein, 20% trichloroacetic acid and 2% BSA was added. Samples were centrifuged at 13,000rpm for 10min and supernatant was collected and added to 10mL of scintillation fluid. The release of acid-soluble counts were read on a scintillation counter. Background was subtracted and the amount of liberated radiolabel was reported. Carbonyl content The protein oxidation detection kit, Oxyblot (no. S7150, Millipore) was utilized to perform immunoblot detection of oxidatively modified proteins. 5µg of protein from young flies (3 days) and aged flies (60 days) was prepared in the same manner as samples for western blot analysis. 162 Carbonyl groups in samples were derivatized to 2,4-dinitrophenylhydrazone (DNP-hydrazone) by reaction with 2,4-dinitrophenylhydrazine (DNPH). Samples were run on a 10% SDS-PAGE gel and transferred to a PVDF membrane for western blot analysis as described previously. Blots were incubated with goat polyclonal anti-Actin-HRP antibody, conjugated to horseradish peroxidase (1:1000 dilution, no. sc-1616, Santa Cruz Biotechnology) to assess protein loading, and detection of carbonylated proteins was measured with the mouse monoclonal anti-DNP antibody (no.MAB2223, Millipore). RNA isolation and Quantitative RT-PCR RNA isolation was performed following manufacturer’s instructions with slight modification. Flies were homogenized in 500µL TRIzol (no.15596-026, Life Technologies) before an additional 500µL TRIzol were added and incubated at room temperature for 5min. Samples were centrifuged at 12,000g for 10min at 4°C to remove cuticle. 200µL of chloroform was added to the supernatant before samples were shaken for 15 seconds, and incubated at room temperature for 5min. Samples were centrifuged at 12,000g for 15min at 4°C. To the aqueous phase, 500µL of ice-cold 100% isopropanol was added, and samples were incubated at room temperature for 10min. To pellet the RNA, samples were centrifuged at 12,000g for 10min at 4°C and supernatant was decanted. To wash the RNA pellet, 1mL of 70% ice-cold ethanol was added, briefly vortexed before being centrifuged at 7500g for 5min at 4°C. The RNA pellet was dried before re-suspended in DEPC-treated water. RNA concentration was measured using a Nanodrop spectrophotometer (Thermo-Scientific). 163 For cDNA generation, RNA was reverse transcribed using TaqMan® Reverse Transcription Reagents (no. N8080234, Life Technologies). Quantitative PCR was carried out using iTaq SYBR Green (no. 1725120, Bio-Rad). Amplification of the Beta1 subunit was conducted using the following primer sequence (Forward: 5’ CAGTCATTTCGTGTTCGTGC Reverse: 5’ TCGAACTCCACTGCCATAATG). Amplification of the Beta2 subunit was conducted using the following primer sequence (Forward: 5’AGGTGGTGTTATTCTGGGC Reverse: 5’ TCCGTAGTCATCTCAGTGTCC). Primers for Rp49 were used as an internal control (Forward: 5’CGGATCGATATGCTAAGCTGT Reverse: 5’ GCGCTTGTTCGATCCGTA). Primers were designed using the NCBI Primer-Blast software (Ye, Coulouris et al. 2012). Drosophila hydrogen peroxide challenge assays Flies were aged for 3 days (young) or 60 days (old) before being transferred onto Kimwipes containing 5% sucrose, 24 hours prior to H2O2 exposure. Flies were subsequently transferred to vials containing various toxic doses of H2O2 [0M-8M] and survival was scored. Drosophila hydrogen peroxide pretreatment 24 hours prior to H2O2 exposure, flies were transferred to vials containing 5% sucrose on a Kimwipe. Upon pretreatment, flies were placed in vials containing various concentrations of H2O2 [0µM-100µM] for 8 hours. Flies were then transferred to vials containing 5% sucrose for 16 hours to allow for adaptation. Afterwards, flies were either immediately collected to assess proteasome expression, or were placed into vials containing a toxic dose of H2O2 and survival was measured to assess adaptation. 164 Lifespan assays Lifespan assays were performed as previously described (Ren, Webster et al. 2007). Age- synchronized flies of virgin males and females were collected from culture bottles over a 48 hour period following eclosion. 20 females and 25 males were housed per vial. Flies were transferred to fresh media every other day and deaths were recorded. The mean, median, percent change in the mean and median, and the log-rank p value were calculated using the R statistical software (R Development Core Team 2010). The values are located in the supplemental lifespan table. 165 CHAPTER 4: THE IMPACT OF NANO-PARTICULATE EXPOSURE UPON THE 20S PROTEASOME AND ITS REGULATORS IN 3-MONTH AND 18-MONTH FEMALE MICE Abstract Environmental toxicants may act as an accelerator of protein damage, and if the damaged protein is not removed, protein aggregation. Moreover, excess accumulation of protein-aggregates may promote the aging process. To counteract that, the primary cellular defense relies upon the 20S proteasome to degrade oxidatively-damaged proteins. However, with age, its efficiency decreases. Moreover, as prior work has shown the age-related loss in 20S activity in model organisms, the next step was to assess the age-related change in a mammalian model. To understand the impact of environmental toxicants, young (3 month) and middle-aged (18 month) female mice were exposed to vehicular-derived nanoparticulate matter. Treatment consisted of female mice exposed to either ambient air or reaerosolized particulate matter (nPM) collected from the 110 Freeway (Southern California). Both 3 month and 18 month female mice were exposed for 5 hours a day, 3 days a week, for 10 weeks. Afterwards, heart, liver, and lung tissue was collected and protein expression, activity, and oxidation was assessed. These findings suggest nPM exposure and age, impact the inducibility of proteasome expression and activity. Moreover, these findings extend to tissue indirectly exposed to nPM, including the liver and heart. In all three tissue types, nPM exposure resulted in loss of inducibilty of the proteasome. Yet, expression increased in an age- and nPM-dependent manner. Interestingly, 166 Nrf2, the transcriptional activator of the proteasome, showed age-related increases, accompanied by an age-related increase in its transcriptional suppressor, Bach1. These findings provide further evidence for the age-related loss in the proteasome activity, which may be partly due to cells being unable to turnover non-functional proteasome and/or the increase in transcriptional suppressors, which limits the generation of functional 20S proteasome. In addition, these findings can help to provide a clearer understanding of the effects of pollution on aging and the proteasomes’ specific involvement in the aging process. Background Early studies showed the deleterious impact of chronic exposure to nanoparticulates (nPM), largely arising in high-smog environments. This is in part because nPM exposure has been found to cause inflammation and trigger oxidative stress in multiple tissues (Araujo, Barajas et al. 2008, Li, Xia et al. 2008, Mühlfeld, Rothen-Rutishauser et al. 2008), even those indirectly exposed to the particles. Moreover, in vitro studies found that nPM exposure results in mitochondrial impairment, and eventually, apoptosis (Piao, Kang et al. 2011, Teodoro, Simões et al. 2011, Siddiqui, Alhadlaq et al. 2013). Yet, even more troubling, are the implications of nPM exposure upon human health. Emerging evidence suggests that chronic exposure to traffic-derived nano-sized particles can indirectly impact neonatal health, as chronic exposure has been linked to poor neuronal development (Mendola, Selevan et al. 2002, Bellinger 2012, Davis, Bortolato et al. 2013, Woodward, Finch et al. 2015). Moreover indirect exposure to vehicular-derived smog, increases the risk of infants 167 developing a wide-array of neuropsychiatric disorders, including autism (Volk, Lurmann et al. 2013). At the other end of the developmental spectrum, chronic nPM exposure has been linked to neurodegeneration in the older population (Weuve, Puett et al. 2012, Davis, Akopian et al. 2013, Power, Weisskopf et al. 2013). This is potentially due to inert nano-sized particles capable of promoting beta-amyloid aggregation in vitro (Lee, Kim et al. 2014). In turn, providing further evidence tying the increased risk for chronic nPM-exposure to accelerating the formation of neurodegenerative diseases. Indeed, chronic nPM exposure was linked to a 4% increased risk of all-cause mortality for every additional 10µg/m 3 in nPM exposure (Pope III, Burnett et al. 2002). Nor is nPM exposure limited to neurological disorders, chronic exposure has been linked to elevated risk for coronary heart disease (Crouse, Peters et al. 2015, Huang, Chen et al. 2016) and respiratory diseases (Hiraiwa and van Eeden 2013, Bharadwaj, Graff Zivin et al. 2016) More striking, was the impact of nPM exposure not limited to very frail older adults, but can result in cumulative and harmful changes, causing increased mortality (Pope III, Schwartz et al. 1992). Furthermore, chronic nPM exposure has been associated with accelerated aging, as indicated by changes in both telomere length and epigenetic biomarkers (Ward-Caviness, Nwanaji-Enwerem et al. 2016). Yet, our mechanistic understanding behind nPM-promoted neurodegeneration is just beginning to be explored. As the cellular stress response is crucial for the maintenance of cellular homeostasis, it is paramount we understand how this pathway is impacted following nPM exposure. 168 Cellular stress response pathways are evolutionarily-conserved mechanisms that prevent, manage, and remove cellular damage to lipids, proteins, and DNA (Davies 2016). Dysregulated protein homeostasis and adaptive stress responses are considered 2 of the 7 contributing factors of aging (Kennedy, Berger et al. 2014). A critical lynchpin of the stress response pathway relies upon NF-E2-related factor 2 (Nrf2), a crucial master transcriptional regulator of many Phase II detoxification and stress responsive enzymes. Nuclear translocation of Nrf2 has been shown to arise following exposure to stressful environments, including exogenous oxidants (Jaiswal 2004), heavy metals (García-Niño and Pedraza-Chaverrí 2014), and nanoparticulate exposure (Zhang, Liu et al. 2012). Under homeostatic conditions, Nrf2, bound to Kelch-like ECH-associated protein 1 (Keap1) is phosphorylated by GSK-3 and ubiquitin-tagged by the E3-ligase complex. Subsequently, targeting Nrf2 for degradation by the 26S proteasome (Kobayashi, Kang et al. 2004), and preventing the translocation of Nrf2 into the nucleus. However, upon oxidative stress, Keap1 dissociates from Nrf2 and GSK-3 is prevented from phosphorylating Nrf2, as it is inactivated by Akt phosphorylation, allowing for the immediate nuclear translocation of Nrf2, and binding to antioxidant response elements (ARE) in the promoter regions of Phase II genes (such as HO-1 (Alam and Cook 2003), GstDs (Thimmulappa, Mai et al. 2002), NQO1 (Zhang, Davies et al. 2015) and stress-responsive proteins, including the 20S proteasome (Pickering, Linder et al. 2012) and SOD1 (Zhu, Jia et al. 2008). Interestingly, prior work has shown that mild and transient exposure to low doses of an oxidant (such as hydrogen peroxide) is capable of activing the Nrf2-mediated pathway, without causing 169 undo cellular harm (Davies, Lowry et al. 1995, Wiese, Pacifici et al. 1995). A process dubbed ‘adaptive homeostasis’ (Davies 2016). Adaptive doses of hydrogen peroxide have been shown to stimulate the adaptive stress response, causing Nrf2 nuclear translocation, without the resulting harm associated with oxidative stress. This has been demonstrated in cell culture (Pickering, Linder et al. 2012) and model organisms, including C. elegans (Raynes, Juarez et al. 2016) and D. melanogaster (Pickering, Staab et al. 2013, Pickering, Vojtovich et al. 2013). Yet, the next critical step in addressing changes in the adaptive response is to generate a model in a mammalian system. One such physiologically relevant approach is the use of mice at varying ages, exposed to sub-lethal amounts of particles collected from air-pollution (Zhang, Liu et al. 2012). Not only would this help transition our understanding of the adaptive stress response, but places it within the context of the daily exposure humans are subjected to. Yet, with age, Nrf2 activation appears to go awry in a tissue-dependent manner. One study suggests Nrf2 decreases in rat liver from 20 month old animals (Suh, Shenvi et al. 2004, Shih and Yen 2007), whereas another suggests Nrf2 levels rise in senescent tissue (Mori, Blackshear et al. 2007, Landis, Shen et al. 2012). Indeed, Nrf2-dysregulation becomes starkly evident when assessing the age-associated impact upon the levels of Phase II detoxification genes. Many of which become inconsistent in regards to direction and the extent of change (Ji, Dillon et al. 1990, Fanò, Mecocci et al. 2001, İnal, Kanbak et al. 2001). One key enzyme impacted by the dysregulation of Nrf2 expression (and potentially more important, translocation) is the 20S proteasome. Numerous studies have assessed the age-associated impact upon 20S expression and activity, yet no conclusive finding is apparent. Variation arises between tissues (Keller, Gee et al. 2002, Attaix, Mosoni et al. 2005, Farout and Friguet 2006, Chapple, Siow et al. 2012), species 170 (Weindruch, Kayo et al. 2001, Tsakiri, Sykiotis et al. 2013), and the sexes (Pickering, Staab et al. 2013, Rodriguez, Dodds et al. 2014, Racca, Chen et al. 2016), which only further complicates our understanding of Nrf2 age-dependent dysregulation. Hence, more work is necessary in addressing this age-dependent discord within the stress response. The majority of the work associated with our understanding of the adaptive stress response has centered upon changes related to Nrf2. Yet, other regulators, which directly interact with Nrf2, may be worth closer examination. One such, is the constitutively expressed repressor Bach1, an Nrf2 nuclear antagonist, which also binds to the promoter region of ARE elements (Oyake, Itoh et al. 1996), in turn, preventing ARE-mediated gene expression (Suzuki, Tashiro et al. 2003). Moreover, phosphorylation of Bach1 triggers its nuclear export following oxidative stress (Kaspar and Jaiswal 2010). This enables Nrf2 to easily bind to and activate stress responsive genes. Interestingly, downregulation of Bach1 has been associated with various cancers (Ghaziani, Shan et al. 2006, Hayes and McMahon 2009), indicating its role as a suppressor may be a necessary means of dampening the Nrf2 response. However, further work may be necessary as recent work in Bach1 knockout mouse showed no increase in cancer incidence (Ota, Brydun et al. 2014). Lastly, it is notable that the majority of prior work on aging relies upon comparing a young organism to an aged organism. Though relevant in helping to understand the impact of aging upon the stress response, little work has centered upon understanding the transformative period that arises during middle-age. Indeed, early studies comparing transcriptional variation between young and middle-age mice (Lee, Allison et al. 2002), present a new temporal area of 171 exploration within the aging process. Moreover, a prior study comparing nPM exposure in young (3 month) and middle-age (18-month) male mice found dysregulation in Nrf2 and its transcriptional repressors, Bach1 and c-Myc (Zhang, Liu et al. 2012, Zhang, Davies et al. 2015), indicating the deleterious consequences of aging may begin at a much earlier time frame. In the present study, we sought to address the age-associated and tissue-specific changes in 3- month versus 18-month old female mice exposed to either filtered air or non-toxic amounts (equivalent to the exposure level on the 110 Freeway) of nPM-filled air. As the 20S proteasome is crucial in protein homeostasis, we measured changes in subunit expression and activity. We also wanted to address the impact of nPM exposure upon the immunoproteasome, which has been previously linked to inflammation. Here, we sought to understand if low exposure to nPM caused changes in immunoproteasome expression and activity. Lastly, we explored changes in Nrf2 expression, along with its transcriptional inhibitor, Bach1. Results Tissue Specific Differences in the 20S Proteasomal Subunit Expression Following nPM Exposure Chronic exposure to vehicular-derived nanoparticulate matter (nPM) has been previously shown to trigger inflammation in multiple tissues (Mühlfeld, Rothen-Rutishauser et al. 2008, Campbell, Araujo et al. 2009), and to activate the oxidative stress response (Zhang, Liu et al. 2012). Indeed, ultrafine particle exposure (<0.18µm) triggered the up-regulation of Nrf2-mediated stress responsive genes (Araujo, Barajas et al. 2008), of which includes the 20S proteasomal subunits (Pickering, Linder et al. 2012). Due to the important role of the 20S proteasome in clearance of 172 oxidized proteins, a consequence of oxidative stress, we sought to assess the impact of low amounts of nPM exposure in young and middle-aged female mice upon 20S expression (Figure 4.1). It is important to note that studies utilized 3 month (young) and 18 month (middle-aged) to begin the treatment regiment, tissues were collected following the subsequent 10 week exposure, resulting in mice being 6 months and 21 months, respectively. In both the liver and the heart, expression of the 20S beta1 subunit was induced in 3 month-old nPM-exposed females compared to 3-month controls (Figure 4.2). Moreover, all three subunits showed a basal age- related increase in tissue derived from 18-month old female controls (Figure 4.2). Yet, tissue-specific differences arose, as evident in comparison between mitotic (liver) versus post-mitotic (heart) tissue. A finding highlighting the tissue-specific variances associated with 173 aging and nPM exposure in proteasome expression. Within cardiac tissue, increase in the beta2 subunit was evident in 18-month nPM-exposed females (Figure 4.2A). Whereas, in the beta1 and beta5 subunits, induced expression in nPM exposed 18 month females was not evident in 18- month controls. Conversely, both the beta1 and beta5 subunits were suppressed upon nPM exposure in 18 month old liver tissue (Figure 4.2B). 174 175 Tissue Specific Differences in the 20S Proteasomal Subunit Activity Following nPM Exposure Next, proteolytic capacity of the individual subunits of the 20S catalytic core were measured in the lysate of three tissues (heart, lung, and liver). Proteolytic capacity was measured in total lysates for the ability to degrade model fluorogenic peptides, designed to be specific for each catalytic activity of the individual beta subunits of the 20S proteasome: Z-LLG-AMC for caspase-like/β1 activity (green), Z-ARR-AMC for trypsin-like/β2 activity (orange), and Suc- LLVY-AMC for chymotrypsin-like/β5 activity (purple). Basal levels of the β1 subunit was first examined. Caspase-like activity was lowest in the heart and liver in comparison to the other 2 subunit specific activities. Age-specific changes in caspase-like activity showed basal proteolytic capacity to increase from 3 month to 18 month controls (solid bars). Whereas, nPM exposure induced caspase-like activity in 3 month nPM treated lungs compared to 3 month controls (Figure 4.3B). In contrast, nPM treatment in young females suppressed caspase-like activity in the heart (Figure 4.3A), or caused no change in the liver (Figure 4.3C), both of which were indirectly exposed to the treatment (hash bars). With age, nPM exposure suppressed caspase-like activity in all three tissues (Figure 4.3). Next, trypsin-like activity of the β2 subunit was measured. Trypsin-like activity was highest in all three tissues. Basal proteolytic capacity increased in both the heart (Figure 4.3A) and lung (Figure 4.3B) in 18 month controls compared to 3 month controls (solid bars). Interestingly, nPM exposure in young 3 month induced trypsin-like activity in only the lung tissue, when compared to 3 month controls (Figure 4.3B). In both the heart and the liver, nPM in young 176 caused no change in trypsin-like activity. Next, aged nPM exposed females, demonstrated a blunting of proteolytic capacity when compared to 18 month controls, in the heart and the lung. Moreover, liver tissue from 18 month nPM mice, showed proteolytic capacity to be lower than 3 month controls (Figure 4.3C). Lastly, chymotrypsin-like activity, arguably the rate-limiting activity of the 20S catalytic core (Chondrogianni, Tzavelas et al. 2005), was examined. Baseline chymotrypsin-like capacity increased in both the heart (Figure 4.3A) and liver (Figure 4.3C) in 18 month controls compared to 3 month controls (solid bars). Interestingly, nPM exposure in 3 month old females caused either no change or suppressed chymotrypsin-like activity in all three tissues when compared to 3 month controls. A result that was further exacerbated, in all tissues, between 18 month controls and 18 month nPM treated females. 177 178 Preferential Degradation of Oxidized Substrates by the 20S Proteasome Prior studies showed oxidized proteins are the preferred substrate of the 20S proteasome (Grune, Reinheckel et al. 1996, Grune, Reinheckel et al. 1997). To demonstrate preference for oxidized substrates, lysate was incubated with either native ([ 3 H]Hb) or oxidized hemoglobin ([ 3 H]Hboxdized). Increased scintillation counts was related to increased 20S proteasome degradation. Here, basal levels of oxidized hemoglobin (black) were higher in all three tissues, compared to native hemoglobin (white). As well, nPM exposure in young lung lysate showed increased degradation of oxidized hemoglobin compared to 3 month controls (Figure 4.4B). Whereas nPM exposure in young female lysate showed no change compared to 3 month controls in heart (Figure 4.4A) or liver (Figure 4.4C). Moreover, lysate from 18 month control or nPM- exposed tissues did not show a decrease in the 20S proteasome degradation. As 18 months are typically viewed as ‘middle-aged’ mice, dramatic declines in 20S proteolysis may not be evident until older ages (Shibatani, Nazir et al. 1996), which may explain the lack of change between 3 month and 18 month control tissue. 179 180 Expression of the 20S-Subunit Transcriptional Regulator, Nrf2, Shows an Age and nPM- Dependent Increase Transcriptional activation of stress responsive genes is critical in mediating the transient adaptive response to short term oxidative stress. One of the primary regulators of this process is Nrf2. Prior work has shown that upon low concentrations of hydrogen peroxide in mouse embryonic fibroblasts, Nrf2 binds to eletrophile response elements (EpREs), including those of the 20S proteasome beta subunits (Pickering, Linder et al. 2012), ensuring de novo 20S proteasome synthesis. Here, expression levels of total Nrf2 were explored in 3 month and 18 month female mice exposed to either ambient or oxidant-inducing nPM air. Upon nPM exposure, 3 month heart and lung tissue show induced expression of Nrf2 levels compared to 3 month controls (Figure 4.5A,B). Moreover, aging, alone, shows a basal increase in Nrf2 expression, within all three tissues (Figure 4.5). The age-associated increase is further elevated in tissues indirectly exposed to nPM air in 18-month females, as evident in lysate from the heart and the liver, when compared to 3 month controls (Figure 4.5A,C). Interestingly, upon nPM exposure in 18 month old females, basal increases in Nrf2 expression are blunted in the lung tissue (Figure 4.5B). Potentially indicating that the ability of the lung tissue, which acts as the direct interface for nPM exposure, is no longer able to mount a robust response to the potentially harmful oxidant exposure that is associated with nanoparticulate matter (Limbach, Wick et al. 2007). 181 182 Aging and nPM-Exposure, Cause Increased Expression of the Transcriptional Suppressor, Bach1 Bach1 is a conserved negative regulator of Nrf2 that is ubiquitously expressed in a wide-array of tissues (Sun, Hoshino et al. 2002, Dhakshinamoorthy, Jain et al. 2005). Bach1 acts by competing with Nrf2 for binding of antioxidant response elements, a role which may be critical in dampening the stress response when no longer necessary. During periods of oxidative stress, the cell relies upon not only expedient import of Nrf2 coupled with the time-delayed import of Bach1 (Goven, Boutten et al. 2009). Moreover, previous work has indicated a potential loss in temporal balance between Nrf2 and Bach1 expression (Zhang, Liu et al. 2012). Here, we wished to understand the age-related and nPM-impact upon Bach1 expression in 3 month and 18 month female mouse tissue. In all three tissues studied (heart, lung, and liver), basal increase in Bach1 is evident in 18 month controls (Figure 4.6). Interestingly, nPM exposure in 3 month female cardiac tissue, showed a marked induction of Bach1 expression (Figure 4.6A), and an upward trend in female liver tissue (Figure 4.6C). Yet, in 18 month old nPM-exposed females, though Bach1 levels matched the elevated expression levels of 18 month controls, nPM exposure was no longer capable of inducing Bach1. Together, these findings match prior results in male mice undergoing nPM exposure (Zhang, Liu et al. 2012), indicating that the basal increase in Bach1 expression is potentially a compensatory mechanism to turn off the similarly elevated Nrf2 levels, evident in aged mice. 183 184 Induction of the Mitochondrial Lon Protease Increases with Age and nPM Exposure One of the key proteases in the maintenance of the mitochondrial protein homeostasis is the mitochondrial Lon protease. Prior work has shown the rapid induction of Lon expression following oxidative stress (Ngo and Davies 2009), which is diminished with age (Ngo, Pomatto et al. 2011). Here, we sought to understand if low exposure to nPM particles was capable of inducing Lon expression and if expression diminished with age in an in vivo mammalian model. Interestingly, cardiac (Figure 4.7A) and liver tissue (Figure 4.7C) from 3-month nPM exposed females showed increased expression of Lon, compared to tissue from 3-month control females. Strikingly, lung tissue from 3-month nPM exposed females showed no induction of Lon expression (Figure 4.7B). This tissue-specific difference is potentially linked to direct versus indirect nPM exposure. Alternatively, as the lung is already in a highly oxidant-rich environment (20% oxygen), may hint at an additional role of Lon, as oxygen sensitive. As well, basal levels of Lon increased with in an age-dependent manner in both the heart and liver tissue. However, lung tissue did not show a basal increase with age. Rather Lon expression remained constant between 3-month and 18-month controls. In addition, nPM exposure was no longer able to induce Lon expression in 18-month exposed females, as both heart and liver tissue showed the same amount of Lon between 18 month controls and nPM treated (Figure 4.7A,C). Interestingly, nPM exposure significantly suppressed Lon expression only in the lung tissue, causing levels to be reduced back to 3 month controls (Figure 4.7B). 185 186 Proteolytic Capacity of the Immunoproteasome is Impacted with Age and nPM Exposure The immunoproteasome is an alternative form of the ATP-independent 20S proteasome (Johnston-Carey, Pomatto et al. 2016). Originally characterized for its role in peptide-processing necessary for activation of the immune response (Tanoka and Kasahara 1998). Since then, our understanding of the immunoproteasome has evolved, so too has its increasing importance within the cell. Specifically, immunoproteasome has been linked with increased expression following adaptive pretreatment (Hussong, Kapphahn et al. 2010, Pickering and Davies 2012) and preferential degradation of oxidized proteins (Pickering, Lehr et al. 2015). Moreover, removal of immunoproteasome subunits in mice, led to increased susceptibly to oxidative stress (Opitz, Koch et al. 2011). To address the growing role of the immunoproteasome in the adaptive stress response, we sought to measure immunoproteasome-specific activity. Specifically, lysate from the heart, lung and liver, were incubated in the presence of immunoproteasome subunit-specific substrate, with an increase in AMC fluorescence, corresponding to increased proteolytic capacity. Interestingly, heart and liver tissue (both indirectly impacted by nPM exposure), showed similar trypsin-like and chymotrypsin-like activities, whereas lung tissue showed significantly lower chymotrypsin-like activity. Indeed, female cardiac tissue showed an age-associated basal increase in trypsin like activity (pink solid bars), which was mitigated upon nPM exposure in both the heart (Figure 4.8A) and the liver (Figure 4.8C) in 18 month old females. Conversely, lung tissue from 3 month nPM exposed females, showed a significant decrease in immunoproteasome trypsin-like activity (Figure 4.8B), which was further dampened in 18-month nPM exposed females. Next, chymotrypsin-like activity of the immunoproteasome was explored. Only lysate from 18 month control cardiac 187 tissue showed a significant increase in activity (Figure 4.8A). Both the liver and lung tissue showed significant decrease in activity (Figure 4.8B,C) 188 nPM Exposure Further Increases the Presence of Oxidized Proteins Increased protein oxidation has been implicated as a hallmark of protein damage (Chevion, Berenshtein et al. 2000), and consequently, a measure of aging (Stadtman 1992). Following exploration of the 20S proteasome expression and activity in 3-month and 18-month control or nPM-treated female mice, protein lysate was analyzed for total content of oxidized proteins. To measure protein oxidation, the lysate were first derivatized with dinitrophenylhydrazine (DNP), at which point, carbonyls (oxidized proteins) could be detected via western blot using an anti- DNP antibody. Interestingly, levels of protein oxidation remained relatively unchanged between 3-month controls, 3-month nPM-treated, and 18-month controls, which is a similar trend in middle-passage cells (Oliver, Ahn et al. 1987, Ngo, Pomatto et al. 2011) and model organisms (Raynes, Juarez et al. 2016). Yet, in all three tissues, nPM exposure in 18 month females, caused marked increase in protein oxidation (Figure 4.9). Indicating that nPM exposure in middle-aged mice may act as an accelerator of protein damage, mirroring increased oxidation evident in chronic age-associated diseases (Dalle-Donne, Giustarini et al. 2003). 189 190 Discussion: Here, we demonstrate that low, short-term exposure to vehicular-derived nanoparticles (nPM) results in an adaptive increase in various stress responsive proteins (Lon protease, the 20S proteasome, the immunoproteasome, and Nrf2) in young females. Yet with age, although basal levels of stress responsive enzymes rose, the adaptive response was compressed, and in some instances suppressed, in 18-month old females (Figure 4.10). Suggesting that the homeostatic range, necessary to mitigate cellular damage, potentially shrinks with age. These results support previous findings that demonstrate the activation of the stress response upon nPM exposure. Primarily, mediated by the increased expression of Nrf2-regulated genes in the young, evident in this study, and shown in both rat (Araujo, Barajas et al. 2008) and mouse models (Zhang, Liu et al. 2012). As well, the increase in Nrf2 expression was not limited to tissue-direct exposure (i.e. the lung), but extended to indirect tissues, such as the heart and the liver. Moreover, the age-related changes shown here, follow a similar trend, in male 3-month and 18-month mice (Zhang, Liu et al. 2012). The similar increase of Nrf2, in all three tissues, suggests a systemic response to nPM exposure. Ultrafine particles (0.001-0.1µmol/L), which are the primary combustion products, act by first penetrating the alveoli, before entering into systemic circulation (Bhatnagar 2006). Indeed, ultrafine particles, largely studied in the context of the lung, have been shown to trigger a pro- inflammatory response (Ghio and Devlin 2001). Moreover, fine-particulates have been linked as pro-oxidant generators, eliciting an oxidative stress response (Behndig, Mudway et al. 2006, Nel, Xia et al. 2006). As various stress responsive proteins were shown to have elevated expression in 191 young nPM-exposed females (the Lon protease, subunits of the 20S proteasome, and Nrf2), these findings further supports prior work. As the 20S proteasome is crucial in preventing the accumulation of protein aggregates, proteasome expression and activity were examined. In the liver and the heart, proteasome expression was inducible upon nPM exposure in young females and demonstrated an age- associated increase in all three subunits. Moreover, tissue-specific differences in subunit activity was evident, with heart and liver tissue showing an age-related increase in chymotrypsin-like 192 activity, which was the inverse in the lung. As well, the heart and the lung showed a basal increase in trypsin-like activity, which was not present in the lung. The caspase-like activity increased with age in the liver and the lung, but not in the heart. Interestingly, only the lung tissue showed an adaptive increase in the caspase-like and trypsin-like activity, which was blunted in the 18-month nPM exposed tissues. Upon the addition of oxidized hemoglobin, only 3-month nPM treated lung lysate showed an adaptive increase in proteolysis. Taken together, suggests that although the amount of proteasome expression increased with age, induction of proteolytic capacity did not follow suit. Early studies suggest a similar trend in the blunting of proteasome activity upon acute exposure to diesel fuel exhaust (Kipen, Gandhi et al. 2011, Pettit, Brooks et al. 2012). The lack of protein turnover by the 20S proteasome, may also be evident in the accumulation of protein carbonyls, a marker of protein oxidation (Dalle-Donne, Rossi et al. 2003). We found only a significant accumulation of protein carbonyls in 18-month nPM treated lung tissue, which mirrors similar in vitro particulate exposure (Lai, Lee et al. 2016). The lack of increasing amounts of protein oxidation in the heart and the liver, may be partially due to differences in protein turnover in tissues indirectly exposed nPM. Moreover, the dichotomy between the age-associated increase in proteasome expression, yet the lack in subunit-specific activity, builds upon our findings in the nematode worm and fruit-fly. In both cases, showing an age-related basal increase in proteasome expression, but inability to induce expression and activity. A finding we confirm here. A unique finding of this study was the impact of nPM-exposure upon the immunoproteasome. With age, basal activity of the immunoproteasome increased in a tissue- and subunit-specific manner. Matching prior findings of increased immunoproteasome in aged rat liver tissue 193 (Pickering, Lehr et al. 2015). Yet, immunoproteasome-specific activity was dampened upon nPM exposure in 18-month old females. The change evident in the immunoproteasome activity, touches on its role in both the pro-inflammatory pathway and oxidative stress response. Originally identified for its role in peptide production, which is necessary for antigen presentation (Johnston-Carey, Pomatto et al. 2016), it has since been coined as the ‘inducible- proteasome’ (Griffin, Nandi et al. 1998, Ebstein, Kloetzel et al. 2012, Gvozdeva, Prassolov et al. 2016). This is in part because pretreatment with an adaptive dose of an oxidant, was shown to trigger an inducible response. Moreover, proteolytic capacity matched that of the 20S proteasome (Pickering, Koop et al. 2010, Pickering and Davies 2012). Indeed, recent studies have indicated a growing role of the immunoproteasome in various environmental-derived lung diseases (Verheyen, Nuijten et al. 2004, Meiners and Eickelberg 2012), suggesting further work is necessary in exploring the interplay between the 20S proteasome and the immunoproteasome. In addition, the mitochondrial Lon protease appears to increase with age and nPM-exposure. As Lon has been previously identified as a stress-inducible protein (Ngo and Davies 2009), we confirm that here in a mammalian model. Yet, other studies suggest the converse, with Lon protein levels decreasing with age, shown in both senescent cellular models (Bota, Ngo et al. 2005, Ngo, Pomatto et al. 2011) and in aged mice (Bota, Van Remmen et al. 2002). Arguably, the difference between our findings and those of earlier publications is due to the differences in age. Here, we utilized middle-aged mice, whereas prior studies focused on aging tissue, indicating that middle-age is an area that should be studied on its own, and may provide greater insight into the mechanistic transition between young and old. 194 The Nrf2 transcriptional competitor, Bach1, demonstrated an adaptive increase in all three tissues of 3-month females, treated with nPM. Bach1, a member of CNC-related bZIP superfamily of transcriptional factors, possess a unique BTB domain in its N-terminal region, which has been linked to transcriptional repression (Bardwell and Treisman 1994, Chen, Zollman et al. 1995). Hence, under basal conditions, it has been suggested that Bach1 heterodimerizes with a small Maf protein, and together, bind to tandem repeats of ARE elements, (ARE) which suppresses target gene expression (Sun, Hoshino et al. 2002). Due to Bach1’s interaction with stress responsive genes and its potential for regulation due to the high amount of cysteine residues (34), which exceeds the number found on the redox-sensitive Keap1, suggests Bach1 acts as a stress-responsive transcriptional mediator. However, it is important to note that high prevalence of cysteine residues are only a potential sign an enzyme is a redox mediator, as in the case of the cysteine-rich metallothioneine (Mehus, Muhonen et al. 2014). However, further evidence of Bach1’s role in the stress response was presented in a study that suggested in the presence of the sulfhydryl oxidizing agent, diamide, was shown to reverse Bach1 suppression of ARE target genes (Ishikawa, Numazawa et al. 2005). However, whether diamide is capable of inducing a signaling response, or caused a change in Bach1 due to it acting as a metaphorical toxic ‘hammer’ to the cells, is still up for debate. Therefore, as the stress response requires both an activator (Nrf2) and suppressor (potentially Bach1), it is plausible that the interplay between these transcriptional regulators is necessary for an adaptive stress response. Indeed, this temporal relationship is evident when comparing the nuclear translocation of Nrf2 and Bach1 in cell extract treated with cigarette smoke condensate (CSC). Within 6 hours of CSC exposure, Nrf2 translocated into the nucleus, followed by a 195 delayed exodus at approximately 48 hours, which was coupled with Bach1 nuclear accumulation (Goven, Boutten et al. 2009). Together, suggesting the sequential relationship between Nrf2 and Bach1: the cell is able to combat the immediate stress, via activation of the stress response, yet have the means to turn-off the response when no longer necessary. Our own findings suggest a similar occurrence. Interestingly, with age, basal levels of Bach1 rose, in all three tissues. A finding that is consistent in other age-associated studies (Zhang and Forman 2010, Zhang, Liu et al. 2012, Currais and Maher 2013). A similar trend is present in various chronic diseases, most notably, lung-related diseases. In chronic obstructive pulmonary disease (COPD), Bach1 protein levels were found to increase, and to exceed those of Nrf2 (Goven, Boutten et al. 2008). Moreover, age-associated increase in Bach1 expression limited the ability of nPM-mediated induction of Bach1, matching findings conducted in male mice (Zhang, Liu et al. 2012). Together, this suggests that the increased Bach1 expression may act as a compensatory mechanism associated with the age- related increase in inflammation and oxidative stress (Grimble 2003, Chung, Lee et al. 2011). Unfortunately, as levels of stress responsive enzymes (including the immunoproteasome, 20S proteasome, and the Lon protease) show an age-associated increase, the ability to mitigate an oxidative insult is potentially compromised. This is evident when comparing the inducibility of these enzymes in young nPM treated females compared to middle-aged nPM treated females: young show an increase in expression, yet with age, as basal levels have potentially already reached a maximal threshold, induction is no longer possible, a finding consistent in males 196 undergoing the same treatment (Zhang, Liu et al. 2012). Thus presenting support for the decline in the adaptive stress response with age. Overall, these findings suggest additional factors that need to be assessed in understanding the transition from young to old. Specifically, the interplay between Nrf2 and its potential inhibitors, such as Bach1. This is important because, with age, the adaptive homeostatic set-point appears to shift. In our comparison of young and middle-aged tissues, we found that basal levels increased, yet induction, clearly evident in young, is no longer possible with age, a trend that matches our findings in model organisms. In turn, this suggests that with age, the homeostatic set-point shifts upward, limiting any future induction. This results in animals that are more susceptible damage, and are at a greater risk for mortality. Materials and Methods Animal Exposure to Nanoparticles C57BL/6J female mice (3 months and 18 months) were kept under standard conditions with ad lib food and water access. Particles were collected and prepared as previously described (Zhang, Liu et al. 2012). Briefly, reaerosolized particles or particle-free filtered air were delivered to the sealed exposure chambers for 5 hrs/day, 3 days/week for 10 weeks. Animals did not have evidence of respiratory distress, nor did they lose weight, indicating deliverance of a low non- toxic dosage. Following the 10 weeks, animals were euthanized after isoflurane anesthesia, tissue was collected and stored at -80°C. All procedures were approved by the USC Intuitional Animal Care and Use Committee. 197 Preparation of Mouse Samples Tissue was prepared by isolating approximately 5mg of tissue samples (N=6) by placing the organ within ice-cold PBS and cutting the appropriate amount of tissue using a sterilized razor- blade. Afterwards, tissue was transferred to 2mL reinforced tubes containing 2.8mm ceramic beads (no. 19-628, Omni International) containing 500mL mPER buffer (no.19-040, Thermo- Fisher Scientific,). No protease inhibitors were added to the buffer as proteolytic capacity was measured. Afterwards, samples were placed into the Bead Ruptor 24© (no. 19-040, Omni International), at which point samples underwent 3 cycles of 15 seconds on/30 seconds off, before lysate was transferred to fresh tubes. Samples were diluted by 1:4 in mPER buffer before determining protein concentration. To measure protein concentration, the bicinchoninic acid (BCA) assay, with reducing agent, was used (no.23252, Pierce). Western Blot Protein samples were run on 10%, 15-well, SDS-PAGE gels (no. 4561036, Bio-Rad), and transferred to a PVDF membrane (no. 1620177XTU, Bio-Rad). The goat polyclonal anti-Actin- HRP antibody, conjugate dot horseradish peroxidase (1:1000 dilution, no. sc-1616, Santa Cruz Biotechnology) was used for protein loading control. The following antibodies were used for protein detection. Antibody Name Company Product Number 20S Proteasome β1 Santa Cruz Biotechnology sc-67345 20S Proteasome β2 Santa Cruz Biotechnology sc-58410 20S Proteasome β5 Santa Cruz Biotechnology sc-55012 LMP2 Santa Cruz Biotechnology sc-373689 198 All primary antibodies were incubated, overnight in 5mL blocking buffer on a rocker at 4°C (no. 37543, Thermo-Scientific). Afterwards, blots were washed in washing buffer for 3 x 10minutes: 100mL TBS 10x (no. 46-012-CM, Corning), 500µL Tween (no. P1379-500mL, Sigma-Aldrich), and total volume was raised to 1000mL with deionized water. Afterwards, blots were incubated in secondary antibody in 5mL blocking buffer for 1 hour at room temperature, at which point the washing step was repeated an additional time. Commercially-available chemiluminescent kit (no. 32132, Thermo-Fisher) was used for detection of protein bands by chemiluminescence. Afterwards, blots were stripped by incubating in 15mL commercially-available stripping buffer at room temperature (no. 21059, Thermo-Fisher). Blots were then washed in washing buffer as above. Fluoropeptide Proteolytic Activity Assays 5µg of lysate were measured in triplicate in a 96-well flat-bottom black plate, suspended in proteolysis buffer (50mM Tris, 25mM KCl, 10mM NaCl, 1mM MgCl2, pH 7.5), and 2µM of various proteasome subunit-specific substrates were added: Caspase-like/β1 activity, Z-LLG- AMC (no. 539141, Calbiochem), Trypsin-like/β2 activity, Z-ARR-AMC (no. 539149, Calbiochem) Chymotrypsin-like/β5 activity, Suc-LLVY-AMC (no. 539142, Calbiochem). As LMP7 Santa Cruz Biotechnology sc-134503 Nrf-2 Santa Cruz Biotechnology sc-722 Bach1 Santa Cruz Biotechnology sc-28738 c-Myc Santa Cruz Biotechnology Sc-40 Lon protease Novus Biotechnology NPB1-81734 199 well, immunoproteasome subunit-specific substrates were added: Tryspin-like/β1i activity, Ac- PAL-AMC (no. S-310, BostonBiochem) and chymotrypsin-like/ β5i and β2i activity, Ac-ANW- AMC (no. S-320, BostonBiochem). Plates were incubated at 37°C, and fluorescence readings were recorded every 10 minutes for 4h using an excitation wavelength of 355nm and an emission wavelength of 444nm. Fluorescence units were converted to moles of free 7-amino-4-methylcoumarin (AMC), using an AMC standard curve of known amounts (no. 164545, Merck), with background subtracted. Preparation of [ 3 H]-labeled substrates Tritium-tagged oxidized-hemoglobin ([ 3 H]-OxHb) was generated as previously described (Grune, Reinheckel et al. 1996). Briefly, 5mg of hemoglobin was dissolved in 0.1M Hepes buffer with the addition of 6.6uCi [H3]Formaldehyde and 20mM sodium cyanoborohydride (Jentoft and Dearborn 1979). Mixture was incubated at room temperature on an end-over-end shaker for 1 hr. At which point, hydrogen peroxide (H2O2) was added at a final concentration of 5mM, and the mixture was rocked for an additional hour. Mixture was dialyzed through a 10,000 MWCO filter (Millipore) at 15,000g for 30min, eluent was discarded, and slurry re-suspended in Hepes buffer. This was repeated for an additional 7 washes to remove unbound [H3]Formaldehyde. Protein content was quantified using BCA assay kit (no.23252, Pierce). [ 3 H]-labeled substrates Proteolytic Activity Assay 5µg of oxidized [ 3 H] hemoglobin (([ 3 H]-OxHb) was added to 15µg of cell lysate. Samples were incubated on a plate shaker at 300rpm for 2 hours at 37°C. To precipitate any remaining intact 200 protein, 20% trichloroacetic acid and 2% BSA was added. Samples were centrifuged at 13,000rpm for 10min and supernatant was collected and added to 10mL of scintillation fluid. The release of acid-soluble counts were read on a scintillation counter. Background was subtracted and the amount of liberated radiolabel was reported. Carbonyl Content The protein oxidation detection kit, Oxyblot (no. S7150, Millipore) was used to perform immunoblot detection of oxidatively modified proteins. 5µg of protein from tissue was prepared according to the manufacture instructions. Carbonyl groups in samples were derivatized to 2,4- dinitrophenylhydrazone (DNP-hydrazone) by reaction with 2,4-dinitrophenylhydrazine (DNPH). Samples were run on a 10% SDS-PAGE gel and transferred to a PVDF membrane for western blot analysis as described previously. Immediately following transfer, blots were reactivated by quickly submerging in ethanol to reactivate the membrane before incubating for approximately 30 minutes, at room temperature, in ponceau stain (no. 51284, VWR) to measure total protein loading. To remove background stain, blots were washed in 5% acetic acid (25mL 100% acetic acid and 500mL deionized water) until bands were visible and scanned in. To completely remove Ponceau stain, blots were incubated at room temperature in 9mL washing buffer (as described above) and 1mL 1M NaOH, until stain was completely removed. To detect carbonylated proteins, blots were incubated, overnight, with the mouse monoclonal anti-DNP antibody, according to manufacturer’s instructions (no.MAB2223, Millipore). 201 CHAPTER 5: CONCLUSION AND FINAL THOUGHTS The Adaptive Response is Sex-Specific I have demonstrated that both the 20S proteasome and the mitochondrial Lon protease are necessary for hydrogen peroxide adaptation in D. melanogaster (i.e. increased survival), as presented in chapters 2 and 3. Moreover, suppression of either enzyme eliminates the female- specific adaptive response. This was assessed in RNAi strains against the beta subunits of the 20S proteasome or the Lon protease. In both instances, females were unable to adapt upon RNAi activation. The utilization of the female-specific form of transformer (TraF) enabled tissue-general transformation of chromosomal males into phenotypic females. The resulting progeny of pseudo- females demonstrated hydrogen peroxide adaptation, increased Lon expression and proteolysis. Moreover, when pseudo-females were pretreated with paraquat they were unable to adapt, reiterating the response found in true-chromosomal females. Conversely, the generation of pseudo-males, mediated by an RNAi strain against transformer, generated flies that were chromosomally female, but phenotypically male, and upon hydrogen peroxide pretreatment were unable to adapt. Together, these findings suggest a sex-dependent adaptive response. A unique finding was the discovery of sex-dependent Lon protein isoforms, with females having three isoforms (100kD, 60kD, and 50kD), whereas males had two isoforms (100kD and 60kD). Upon pretreatment, either with paraquat (males) or hydrogen peroxide (females), the 100kD band increased, with little change in the additional bands, potentially indicating that these additional isoforms may be involved in Lon’s role as a regulator. This is important especially in 202 the context of earlier work, showing Lon directly binds to the small non-coding control region of the mitochondrial DNA (mtDNA), termed the displacement-loop (D-loop), even in the absence of Lon’s proteolytic capacity (Lu, Yadav et al. 2007). This suggests a role for the additional bands may be involved in mtDNA replication and transcription (Zehnbauer, Foley et al. 1981, Fu and Markovitz 1998). A finding that is further supported during oxidatively stressed conditions, where mtDNA show increased susceptibility to lesion accumulation in the absence of Lon (Lu, Yadav et al. 2007). Lon has also been shown to modulate the mitochondrial transcription factor (TFAM) expression (Matsushima, Goto et al. 2010), a key enzyme in mtDNA replication (Kaufman, Durisic et al. 2007). These prior studies may be highly relevant in suggesting alternative roles for the additional Lon protein isoforms, which may uncover another sex- dependent difference in mitochondrial DNA maintenance and replication. One limitation of these studies is the utilization of tissue-general transformation in the creation of pseudo flies. In turn, tissue-general expression eliminates the ability to deduce if a subset of tissues are necessary for sex-specific adaptation. To answer this question, future studies that employ tissue-specific driver fly strains will be critical, specifically those which target transformer over-expression to the nervous tissue, fat bodies, and muscle. Indeed, tissue-specific knockdown of transformer in the female fat body was found to cause systemic growth defects in females, which upon overexpression in the fat body, could rescue the phenotype in pseudo- males. Thus suggesting fat bodies are capable of non-autonomous signaling that is unique to the female fat body (Rideout, Narsaiya et al. 2015). Moreover, significant sexual differences exist in the gene expression within the adult midgut, a highly regenerative tissue, with higher turnover 203 found to occur in females (Hudry, Khadayate et al. 2016). Together, highlighting that a specific tissue (or combination of tissues) may orchestrate the adaptive stress response. Moreover, the ability to elicit a sex-specific response, which is dependent upon the type of oxidant, is a very unique finding. The ability of females to adapt upon pretreatment with a mild dose of hydrogen peroxide, whereas males adapt upon pretreatment with a low amount of the redox cycling reagent, paraquat (PQ), implies potentially two different stress responsive pathways may be involved. Indeed, early work in bacteria and yeast has suggested differential effects from these reagents (Angelova, Pashova et al. 2005, Abrashev, Krumova et al. 2011). Paraquat can continually generate superoxide (and in turn, continually generate hydrogen peroxide via the dismutation of superoxide) as a product of redox-cycling (Sandy, Moldeus et al. 1986). In contrast, direct addition of hydrogen peroxide, though capable of wide cellular diffusion, is relatively short-lived within the cell and is typically scavenged by intracellular antioxidant enzymes, limiting its impact (and potential damage) (Imlay 2008). In turn, highlighting the vast difference in the consequence of these molecules within the cell and potential pathways that are impacted. However, it is important to note that although there is a sexual phenomenon that is dependent on the oxidant used, the delivery mechanism of hydrogen peroxide and paraquat to D. melanogaster was dependent on the chemical being diluted in 5% sucrose, which can be directly modified by these oxidants. Thus, further work is still needed to determine where, directly, these molecules or molecular modifications are interacting within the fly, upon uptake. 204 From a tissue-general perspective, these reagents may have tissue-specific targets. For example, PQ has been shown to predominantly accumulate in the lung and brain tissue. This is highlighted in one of the most well-known phenotypes of PQ toxicity being manifested as a parkinsonian- like presentation, due to PQ targeting dopaminergic neurons (McCormack, Thiruchelvam et al. 2002). Moreover, in D. melanogaster, PQ specifically targets tyrosine hydroxylase (Argue and Neckameyer 2013), the rate limiting enzyme in dopamine synthesis, which has been shown to have altered expression between the sexes (Neckameyer and Weinstein 2005). Indeed, PQ exposure elicits a change in male heart rate, with no effect on females. Yet upon the removal tyrosine hydroxylase, males are no longer responsive to PQ exposure, and females are, indicating a sex-specific difference in neuronal recruitment during the stress response (Argue and Neckameyer 2013). Future studies involving PQ adaptation may be important in providing insight into PQ remodeling upon the central nervous system in males and tissue-specific differences in the adaptive response, as the level of PQ uptake is tissue-dependent. As males have a higher preponderance for developing Parkinson’s disease (Gillies, Pienaar et al. 2014), the ability to understand, at the neuronal level, changes in male-specific adaptive responses may provide critical insight in helping slow the disease progression. Conversely, hydrogen peroxide (or in the case of D. melanogaster, its modification of a sugar molecule upon delivery) appears to interact with cell-surface proteins in a tissue general manner. It has been implicated in activating the insulin-like signaling (IIS) receptor (Jimenez-Gomez, Mattison et al. 2013). Indeed, mutations of the insulin receptor in D. melanogaster was found to cause increased lifespan in females (up to 85%), whereas males lived shorter (Tatar, Kopelman et al. 2001). Loss of the insulin receptor substrate, a mutation dubbed ‘chico,’ showed a 48% 205 increase in median survival of females, yet mutant males lived shorter than controls (Clancy, Gems et al. 2001). Conversely, loss of the insulin-like receptor in C. elegans, known as daf-2, causes greater life extension in male worms compared to hermaphrodites (Gems and Riddle 2000). In higher organisms, deletion of the insulin receptor endowed increased lifespan only in female mice (Holzenberger, Dupont et al. 2003). Indeed, IIS expression level has been found to be basally higher within females across multiple species, including D. melanogaster, mice, and humans (Magwere, Chapman et al. 2004, Macotela, Boucher et al. 2009). Together, indicating a sex-dependent difference in insulin-like signaling, which can be activated by hydrogen peroxide. In a disease context, women are at a higher risk for developing diabetic-induced stroke (Peters, Huxley et al.) and coronary heart disease (Peters, Huxley et al. 2014), both of which stems from IIS dysregulation. Thus the utilization of hydrogen-peroxide adaptation in females, may offer a model to explore how the adaptive response changes in the context of disease. Indeed, future follow-up studies may involve a comparison between the H2O2 elicited adaptive response in IIS mutant strains and those which can elicit a similar phenotype to that of mammalian Type II Diabetes, such as the development of insulin resistance in D. melanogaster (Musselman, Fink et al. 2011) or modeling of diet-induced heart disease (Birse, Choi et al. 2010). Overall, the sex-bias that emerged from my work highlights the importance of understanding the pathways which regulate these sex-dependent differences in adaptation, especially the impact upon protein homeostasis, viewed as one of the key hallmarks of aging (López-Otín, Blasco et al. 2013). The inability to efficiently and rapidly remove damaged proteins is arguably an underlying cause of age-associated diseases, including neurodegenerative diseases, cancer, 206 immune dysfunction, diabetes and cardiovascular disease. Studies in D. melanogaster may help further elucidate the age-related changes in the adaptive stress response between the sexes. Age-Related Loss of Adaptive Homeostasis A major finding of this work is the age-dependent loss in the adaptive stress response. Both the 20S proteasome and the mitochondrial Lon protease showed an age-dependent loss in the inducibility of protein expression and activity (chapters 2 and 3) in the model organism, D. melanogaster. In both instances, upon hydrogen peroxide pretreatment, young females are capable of increased expression and proteolytic capacity of the 20S proteasome and the ATP- stimulated mitochondrial Lon protease. Albeit with age, hydrogen-peroxide mediated signaling is no longer capable of inducing a response. This finding is consistent with prior work that has shown, in cell culture, the strong induction of these stress responsive enzymes to multiple forms of stress signaling (Ngo and Davies 2009, Pickering, Koop et al. 2010, Pickering, Linder et al. 2012). Moreover, cellular senescence shows a marked absence in the ability of cells to upregulate these enzymes upon exposure to a mild stress (Grune, Jung et al. 2004, Ngo, Pomatto et al. 2011), resulting in increased cellular damage and protein oxidation. The loss in adaptation is also evident in the model organism, C. elegans. Young (3 days) nematode worms showed increased 20S expression and proteolytic capacity upon H2O2 pretreatment (Pickering, Staab et al. 2013, Raynes, Juarez et al. 2016). Yet, prior work from our lab found that aged nematode worms (10 days) showed a marked basal increase in the 20S proteasome expression, yet, upon pretreatment, increased 20S proteasome expression was not possible (Raynes, Juarez et al. 2016). Moreover, inducible proteolysis was blunted in aged 207 worms. Overall, suggesting that an upper-limit in the adaptive homeostatic range may have been reached. In an attempt to restore the adaptive response, chronic knockdown of the Nrf2 cytosolic antagonist, Keap1, was performed for a duration of 60 days in fruit flies. Upon hydrogen peroxide pretreatment, 60 day old males and females were unable to adapt, irrespective Keap1 knockdown. Albeit, both sexes showed improved stress resistance upon the chronic suppression of Keap1. A similar approach was attempted in the nematode worm through the chronic over- expression of the Nrf2 orthologue, Skn1. Upon pretreatment, 10 day old Skn1 over-expression strains were unable to adapt (i.e. survive longer) when a semi-lethal H2O2 challenge dose was applied. These findings highlight that simply improving the stress resistance may not improve overall survival, as both aged worms and flies appear to lose the dynamic regulation of the stress response. Together, indicating future studies may require a more nuanced approach in attempts to restore the adaptive stress response with age. More surprising, was the consistency in the age-dependent loss in enzymatic induction, found to hold true in female mice (chapter 4). Short-term exposure to vehicular-derived nanoparticles (nPM) in young 3-month female mice showed tissue-specific increases in proteasome activity and expression, along with its regulator, Nrf2. A similar increase was also evident for the mitochondrial Lon protease. Yet, short-term nPM exposure was no longer able to induce these stress responsive enzymes, rather a basal increase, irrespective nPM exposure, was noted in 18- month females. A similar trend was also evident in studies of 3-month and 18-month males. Upon nPM exposure, young males showed an nPM-dependent increase in phase II detoxification 208 enzymes and their transcriptional regulator, Nrf2. Moreover, with age, basal levels of these enzymes increased, independent nPM exposure (Zhang, Liu et al. 2012). Highlighting a similar trend that is consistent between both sexes and with age. Together, these findings help present a trend that is now consistent across three model organisms: nematode worms, fruit-flies, and mice. The importance of dynamic regulation of the adaptive stress response is crucial in protein maintenance, as loss in proteostasis is considered a central contributor towards the aging process (Morimoto and Cuervo 2014). Protein turnover is critical in the maintenance of a healthy proteome. Yet no system is perfect. It is estimated that approximately 30% of newly synthesized proteins are misfolded (Fabunmi, Wigley et al. 2000), which may only increase in the presence of cellular mutations or external stress (Wetzel 1994). The exposure of these hydrophobic regions in misfolded proteins (normally sequestered internally in a natively-folded protein), causes protein aggregation in an attempt to sequester away these hydrophobic patches. Normally, to prevent protein accumulation, the cell relies upon various proteases (including the 20S proteasome and the Lon protease) to combat protein aggregation, and for the majority of an organism’s life this is possible. Yet these safety mechanisms, though they can remove a majority of misfolded proteins, are unable to guarantee complete clearance. This is further hindered by the size of protein substrates. Both the proteasome and the Lon protease rely upon a central ring structure, which enables these enzymes to ‘feed-through’ an oxidized substrate through their opening for proteolysis. Early in vitro studies suggested that slight oxidation of hemoglobin actually accelerated its degradation by the 20S proteasome, yet heavy oxidation can hinder, and 209 in some instances, inhibit the 20S proteolytic capacity (Sitte, Huber et al. 2000). A similar trend was found upon increasing amounts of oxidized aconitase in relation to Lon proteolytic capacity (Bota and Davies 2002). Hence, gradually, with age, oxidized proteins, which may have escaped proteasome and Lon protease degradation, may accumulate and aggregate, causing them to no longer be the ideal substrates for protein degradation (Figure 5.1). As a result, these protein aggregates may form clumps of non-functioning masses, which the proteasome, in a futile attempt to degrade may latch onto, which may further contribute to protein aggregation. Support for this model has been demonstrated in cell culture, and now, in multiple model organisms. Overall Conclusion The central conclusion of my work uncovered that aged organisms (D. melanogaster, C. elegans, M. muscus) share the common characteristic of basal increases in stress responsive enzymes, including the mitochondrial Lon protease and the 20S proteasome. Yet, these aged organisms are no longer able to induce the adaptive stress response. Leading to a compression of the adaptive range in old organisms in comparison to young. This demonstrates that with age, as older organisms cope with chronic oxidative stress, the adaptive homeostatic set-point may shift upward, resulting in the basal increase. Moreover, as older organisms are more likely to face chronic oxidative stress, may cause the continual activation of the stress response, which in turn, may provide an explanation for the age-dependent basal increase. In consequence, with age, when the need to activate a robust cellular stress response is critical, it is no longer feasible, leaving an organism vulnerable to cellular damage and eventual senescence. 210 Future Thoughts Though our lifespan has dramatically expanded, we are coping with a greater number of chronic diseases, hence living longer, but sicker (Angel, Angel et al. 2014). The need to successfully restore the balance between the adaptive stress response and removal of protein damage is arguably a fundamental cornerstone in helping to mitigate disease onset, and ensuring improved quality of life. By understanding the mechanisms behind the age-related changes of the adaptive stress response, may be critical in our pursuit towards expanding the health-span. 211 SUPPLEMENTAL FIGURES 212 213 214 215 216 217 218 219 220 221 222 SUPPLEMENTAL TABLES 223 224 225 226 227 228 229 230 231 232 233 234 235 REFERENCES Abrashev, R., E. Krumova, V. Dishliska, R. Eneva, S. Engibarov, I. Abrashev and M. Angelova (2011). "Differential effect of paraquat and hydrogen peroxide on the oxidative stress response in Vibrio cholerae non O1 26/06." Biotechnology & Biotechnological Equipment 25(sup1): 72-76. Adams, C. P. and V. V. Brantner (2006). "Estimating the cost of new drug development: is it really $802 million?" Health affairs 25(2): 420-428. Adams, M. D., S. E. Celniker, R. A. Holt, C. A. Evans, J. D. Gocayne, P. G. Amanatides, S. E. Scherer, P. W. Li, R. A. Hoskins and R. F. Galle (2000). "The genome sequence of Drosophila melanogaster." Science 287(5461): 2185-2195. Aki, M., N. Shimbara, M. Takashina, K. Akiyama, S. Kagawa, T. Tamura, N. Tanahashi, T. Yoshimura, K. Tanaka and A. Ichihara (1994). "Interferon-γ induces different subunit organizations and functional diversity of proteasomes." Journal of biochemistry 115(2): 257-269. Akiyama, K., K.-y. Yokota, S. Kagawa, N. Shimbara, T. Tamura, H. Akioka, H. G. Nothwang, C. Noda, K. Tanaka and A. Ichihara (1994). "cDNA cloning and interferon gamma down- regulation of proteasomal subunits X and Y." Science 265(5176): 1231-1234. Alam, J. and J. Cook (2003). "Transcriptional regulation of the heme oxygenase-1 gene via the stress response element pathway." Current pharmaceutical design 9(30): 2499-2511. Aldrich, T. K., A. Fisher, E. Cadenas and B. Chance (1983). "Evidence for lipid peroxidation by paraquat in the perfused rat lung." The Journal of laboratory and clinical medicine 101(1): 66-73. Alessio, H. M. (1993). "Exercise-induced oxidative stress." Medicine and science in sports and exercise 25(2): 218-224. Allen, R., K. Farmer, R. Newton and R. Sohal (1984). "Effects of paraquat administration on longevity, oxygen consumption, lipid peroxidation, superoxide dismutase, catalase, glutathione 236 reductase, inorganic peroxides and glutathione in the adult housefly." Comparative Biochemistry and Physiology Part C: Comparative Pharmacology 78(2): 283-288. Altun, M., H. C. Besche, H. S. Overkleeft, R. Piccirillo, M. J. Edelmann, B. M. Kessler, A. L. Goldberg and B. Ulfhake (2010). "Muscle wasting in aged, sarcopenic rats is associated with enhanced activity of the ubiquitin proteasome pathway." J Biol Chem 285(51): 39597-39608. Andersen, J. K. (2003). "Paraquat and iron exposure as possible synergistic environmental risk factors in Parkinson’s disease." Neurotoxicity research 5(5): 307-313. Angel, R. J., J. L. Angel and T. D. Hill (2014). "Longer lives, sicker lives? Increased longevity and extended disability among Mexican-origin elders." The Journals of Gerontology Series B: Psychological Sciences and Social Sciences: gbu158. Angelova, M. B., S. B. Pashova, B. K. Spasova, S. V. Vassilev and L. S. Slokoska (2005). "Oxidative stress response of filamentous fungi induced by hydrogen peroxide and paraquat." Mycological research 109(02): 150-158. Anisimov, V. N., L. M. Berstein, P. A. Egormin, T. S. Piskunova, I. G. Popovich, M. A. Zabezhinski, M. L. Tyndyk, M. V. Yurova, I. G. Kovalenko and T. E. Poroshina (2008). "Metformin slows down aging and extends life span of female SHR mice." Cell Cycle 7(17): 2769-2773. Anisimov, V. N., T. S. Piskunova, I. G. Popovich, M. A. Zabezhinski, M. L. Tyndyk, P. A. Egormin, M. V. Yurova, S. V. Rosenfeld, A. V. Semenchenko and I. G. Kovalenko (2010). "Gender differences in metformin effect on aging, life span and spontaneous tumorigenesis in 129/Sv mice." Aging (Albany NY) 2(12): 945-958. Araujo, J. A., B. Barajas, M. Kleinman, X. Wang, B. J. Bennett, K. W. Gong, M. Navab, J. Harkema, C. Sioutas, A. J. Lusis and A. E. Nel (2008). "Ambient Particulate Pollutants in the 237 Ultrafine Range Promote Early Atherosclerosis and Systemic Oxidative Stress." Circulation Research 102(5): 589-596. Arendt, C. S. and M. Hochstrasser (1997). "Identification of the yeast 20S proteasome catalytic centers and subunit interactions required for active-site formation." Proceedings of the National Academy of Sciences 94(14): 7156-7161. Argue, K. J. and W. S. Neckameyer (2013). "Sexually Dimorphic Recruitment of Dopamine Neurons into the Stress Response Circuitry." Behavioral neuroscience 127(5): 734-743. Arias, A. M. (2008). "Drosophila melanogaster and the development of biology in the 20th century." Drosophila: Methods and Protocols: 1-25. Association, A. s. (2013). "2013 Alzheimer's disease facts and figures." Alzheimer's & dementia 9(2): 208-245. Attaix, D., L. Mosoni, D. Dardevet, L. Combaret, P. P. Mirand and J. Grizard (2005). "Altered responses in skeletal muscle protein turnover during aging in anabolic and catabolic periods." The international journal of biochemistry & cell biology 37(10): 1962-1973. Austad, S. N. (2006). "Why women live longer than men: sex differences in longevity." Gend Med 3(2): 79-92. Austad, S. N. (2009). "Is There a Role for New Invertebrate Models for Aging Research?" The Journals of Gerontology Series A: Biological Sciences and Medical Sciences 64A(2): 192-194. Baar, E. L., K. A. Carbajal, I. M. Ong and D. W. Lamming (2016). "Sex‐and tissue‐specific changes in mTOR signaling with age in C57BL/6J mice." Aging cell 15(1): 155-166. Bardwell, V. J. and R. Treisman (1994). "The POZ domain: a conserved protein-protein interaction motif." Genes & development 8(14): 1664-1677. 238 Barford, A., D. Dorling, G. Davey Smith and M. Shaw (2006). "Life expectancy: women now on top everywhere." Bmj 332. Basler, M., C. J. Kirk and M. Groettrup (2013). "The immunoproteasome in antigen processing and other immunological functions." Current opinion in immunology 25(1): 74-80. Bassett, D. and A. Fisher (1978). "Alterations of glucose metabolism during perfusion of rat lung with paraquat." American Journal of Physiology-Endocrinology And Metabolism 234(6): E653. Battiprolu, P. K., C. Lopez-Crisosto, Z. V. Wang, A. Nemchenko, S. Lavandero and J. A. Hill (2013). "Diabetic cardiomyopathy and metabolic remodeling of the heart." Life sciences 92(11): 609-615. Bayot, A., M. Gareil, L. Chavatte, M.-P. Hamon, C. L'Hermitte-Stead, F. Beaumatin, M. Priault, P. Rustin, A. Lombès and B. Friguet (2014). "Effect of Lon protease knockdown on mitochondrial function in HeLa cells." Biochimie 100: 38-47. Beedholm, R., B. F. C. Clark and S. I. S. Rattan (2004). "Mild heat stress stimulates 20S proteasome and its 11S activator in human fibroblasts undergoing aging in vitro." Cell Stress & Chaperones 9(1): 49-57. Behndig, A., I. Mudway, J. Brown, N. Stenfors, R. Helleday, S. Duggan, S. Wilson, C. Boman, F. R. Cassee and A. Frew (2006). "Airway antioxidant and inflammatory responses to diesel exhaust exposure in healthy humans." European Respiratory Journal 27(2): 359-365. Bellinger, D. C. (2012). "A strategy for comparing the contributions of environmental chemicals and other risk factors to neurodevelopment of children." Environmental health perspectives 120(4): 501. 239 Ben-Zvi, A., E. A. Miller and R. I. Morimoto (2009). "Collapse of proteostasis represents an early molecular event in Caenorhabditis elegans aging." Proceedings of the National Academy of Sciences 106(35): 14914-14919. Bender, T., C. Leidhold, T. Ruppert, S. Franken and W. Voos (2010). "The role of protein quality control in mitochondrial protein homeostasis under oxidative stress." PROTEOMICS 10(7): 1426-1443. Bernards, A. and I. K. Hariharan (2001). "Of flies and men—studying human disease in Drosophila." Current opinion in genetics & development 11(3): 274-278. Bernstein, S. H., S. Venkatesh, M. Li, J. Lee, B. Lu, S. P. Hilchey, K. M. Morse, H. M. Metcalfe, J. Skalska and M. Andreeff (2012). "The mitochondrial ATP-dependent Lon protease: a novel target in lymphoma death mediated by the synthetic triterpenoid CDDO and its derivatives." Blood 119(14): 3321-3329. Bharadwaj, P., J. Graff Zivin, J. T. Mullins and M. Neidell (2016). "Early life exposure to the Great Smog of 1952 and the development of asthma." American Journal of Respiratory And Critical Care Medicine(ja). Bhatnagar, A. (2006). "Environmental Cardiology." Studying Mechanistic Links Between Pollution and Heart Disease 99(7): 692-705. Birky, C. W. (1995). "Uniparental inheritance of mitochondrial and chloroplast genes: mechanisms and evolution." Proceedings of the National Academy of Sciences 92(25): 11331- 11338. Birse, R. T., J. Choi, K. Reardon, J. Rodriguez, S. Graham, S. Diop, K. Ocorr, R. Bodmer and S. Oldham (2010). "High-fat-diet-induced obesity and heart dysfunction are regulated by the TOR pathway in Drosophila." Cell metabolism 12(5): 533-544. 240 Bishop, N. A., T. Lu and B. A. Yankner (2010). "Neural mechanisms of ageing and cognitive decline." Nature 464(7288): 529-535. Bloor, I. D. and M. E. Symonds (2014). "Sexual dimorphism in white and brown adipose tissue with obesity and inflammation." Hormones and behavior 66(1): 95-103. Bond, J. S. and P. E. Butler (1987). "Intracellular proteases." Annual review of biochemistry 56(1): 333-364. Bonduriansky, R., A. Maklakov, F. Zajitschek and R. Brooks (2008). "Sexual selection, sexual conflict and the evolution of ageing and life span." Functional Ecology 22(3): 443-453. Bonello, S., C. Zähringer, R. S. BelAiba, T. Djordjevic, J. Hess, C. Michiels, T. Kietzmann and A. Görlach (2007). "Reactive oxygen species activate the HIF-1α promoter via a functional NFκB site." Arteriosclerosis, thrombosis, and vascular biology 27(4): 755-761. Bonneh-Barkay, D., S. H. Reaney, W. J. Langston and D. A. Di Monte (2005). "Redox cycling of the herbicide paraquat in microglial cultures." Mol. Brain Res. 134(1): 52-56. Bonneh-Barkay, D., S. H. Reaney, W. J. Langston and D. A. Di Monte (2005). "Redox cycling of the herbicide paraquat in microglial cultures." Molecular Brain Research 134(1): 52-56. Bonomini, F., S. Tengattini, A. Fabiano, R. Bianchi and R. Rezzani (2008). "Atherosclerosis and oxidative stress." Histol Histopathol 23(3): 381-390. Bootman, M. D., T. J. Collins, C. M. Peppiatt, L. S. Prothero, L. MacKenzie, P. De Smet, M. Travers, S. C. Tovey, J. T. Seo, M. J. Berridge, F. Ciccolini and P. Lipp (2001). "Calcium signalling--an overview." Semin Cell Dev Biol 12(1): 3-10. Borrás, C., J. Sastre, D. García-Sala, A. Lloret, F. V. Pallardó and J. Viña (2003). "Mitochondria from females exhibit higher antioxidant gene expression and lower oxidative damage than males." Free Radical Biology and Medicine 34(5): 546-552. 241 Bota, D. A. and K. J. Davies (2002). "Lon protease preferentially degrades oxidized mitochondrial aconitase by an ATP-stimulated mechanism." Nature cell biology 4(9): 674-680. Bota, D. A., J. K. Ngo and K. J. Davies (2005). "Downregulation of the human Lon protease impairs mitochondrial structure and function and causes cell death." Free Radical Biology and Medicine 38(5): 665-677. Bota, D. A., H. Van Remmen and K. J. Davies (2002). "Modulation of Lon protease activity and aconitase turnover during aging and oxidative stress." FEBS letters 532(1): 103-106. Botos, I., E. E. Melnikov, S. Cherry, A. G. Khalatova, F. S. Rasulova, J. E. Tropea, M. R. Maurizi, T. V. Rotanova, A. Gustchina and A. Wlodawer (2004). "Crystal structure of the AAA+ α domain of E. coli Lon protease at 1.9Å resolution." Journal of Structural Biology 146(1–2): 113-122. Botos, I., E. E. Melnikov, S. Cherry, J. E. Tropea, A. G. Khalatova, F. Rasulova, Z. Dauter, M. R. Maurizi, T. V. Rotanova and A. Wlodawer (2004). "The catalytic domain of Escherichia coli Lon protease has a unique fold and a Ser-Lys dyad in the active site." Journal of Biological Chemistry 279(9): 8140-8148. Brandt, A. and A. Vilcinskas (2013). "The Fruit Fly Drosophila melanogaster as a Model for Aging Research." Adv Biochem Eng Biotechnol 135: 63-77. Brenet, F., N. Socci, N. Sonenberg and E. Holland (2009). "Akt phosphorylation of La regulates specific mRNA translation in glial progenitors." Oncogene 28(1): 128-139. Brenner, S. (1974). "The genetics of Caenorhabditis elegans." Genetics 77(1): 71-94. Breusing, N., J. Arndt, P. Voss, N. Bresgen, I. Wiswedel, A. Gardemann, W. Siems and T. Grune (2009). "Inverse correlation of protein oxidation and proteasome activity in liver and lung." Mechanisms of Ageing and Development 130(11–12): 748-753. 242 Brigelius, R., C. Muckel, T. P. Akerboom and H. Sies (1983). "Identification and quantitation of glutathione in hepatic protein mixed disulfides and its relationship to glutathione disulfide." Biochemical pharmacology 32(17): 2529-2534. Bugger, H., M. Schwarzer, D. Chen, A. Schrepper, P. A. Amorim, M. Schoepe, T. D. Nguyen, F. W. Mohr, O. Khalimonchuk, B. C. Weimer and T. Doenst (2010). "Proteomic remodelling of mitochondrial oxidative pathways in pressure overload-induced heart failure." Cardiovascular Research 85(2): 376-384. Bulteau, A.-L., I. Petropoulos and B. Friguet (2000). "Age-related alterations of proteasome structure and function in aging epidermis." Experimental gerontology 35(6): 767-777. Bulteau, A.-L., L. I. Szweda and B. Friguet (2002). "Age-dependent declines in proteasome activity in the heart." Archives of Biochemistry and Biophysics 397(2): 298-304. Bus, J. S., S. Z. Cagen, M. Olgaard and J. E. Gibson (1976). "A mechanism of paraquat toxicity in mice and rats." Toxicology and applied pharmacology 35(3): 501-513. Cadenas, E. and K. J. Davies (2000). "Mitochondrial free radical generation, oxidative stress, and aging." Free Radical Biology and Medicine 29(3): 222-230. Cadenas, E. and K. J. Davies (2000). "Mitochondrial free radical generation, oxidative stress, and aging." Free Radic Biol Med 29(3-4): 222-230. Campbell, A., J. A. Araujo, H. Li, C. Sioutas and M. Kleinman (2009). "Particulate matter induced enhancement of inflammatory markers in the brains of apolipoprotein E knockout mice." Journal of nanoscience and nanotechnology 9(8): 5099-5104. Camus, M. F., D. J. Clancy and D. K. Dowling (2012). "Mitochondria, maternal inheritance, and male aging." Current Biology 22(18): 1717-1721. 243 Camus, M. F., Jochen B. W. Wolf, Edward H. Morrow and Damian K. Dowling (2015). "Single Nucleotides in the mtDNA Sequence Modify Mitochondrial Molecular Function and Are Associated with Sex-Specific Effects on Fertility and Aging." Current Biology 25(20): 2717- 2722. Caniard, A., K. Ballweg, C. Lukas, A. Ö. Yildirim, O. Eickelberg and S. Meiners (2015). "Proteasome function is not impaired in healthy aging of the lung." Aging (Albany NY) 7(10): 776. Casper, A. L. and M. Van Doren (2009). "The establishment of sexual identity in the Drosophila germline." Development 136(22): 3821-3830. Cassar, M., A. R. Issa, T. Riemensperger, C. Petitgas, T. Rival, H. Coulom, M. Iche-Torres, K. A. Han and S. Birman (2015). "A dopamine receptor contributes to paraquat-induced neurotoxicity in Drosophila." Hum Mol Genet 24(1): 197-212. Cecarini, V., Q. Ding and J. N. Keller (2007). "Oxidative inactivation of the proteasome in Alzheimer's disease." Free radical research 41(6): 673-680. Chance, B. (1952). "The state of catalase in the respiring bacterial cell." Science 116(3008): 202- 203. Chang, P. L., J. P. Dunham, S. V. Nuzhdin and M. N. Arbeitman (2011). "Somatic sex-specific transcriptome differences in Drosophila revealed by whole transcriptome sequencing." BMC genomics 12(1): 364. Chapple, S. J., R. C. Siow and G. E. Mann (2012). "Crosstalk between Nrf2 and the proteasome: therapeutic potential of Nrf2 inducers in vascular disease and aging." The international journal of biochemistry & cell biology 44(8): 1315-1320. 244 Charles, J. M., M. B. Abou-Donia and D. B. Menzel (1978). "Absorption of paraquat and diquat from the airways of the perfused rat lung." Toxicology 9(1-2): 59-67. Chaudhuri, A., K. Bowling, C. Funderburk, H. Lawal, A. Inamdar, Z. Wang and J. M. O'Donnell (2007). "Interaction of genetic and environmental factors in a Drosophila parkinsonism model." J Neurosci 27(10): 2457-2467. Chen, C.-Y., C. M. Lopes-Ramos, M. L. Kuijjer, J. N. Paulson, A. R. Sonawane, M. Fagny, J. Platig, K. Glass, J. Quackenbush and D. L. DeMeo (2016). "Sexual dimorphism in gene expression and regulatory networks across human tissues." bioRxiv: 082289. Chen, C.-Y., C. M. Lopes-Ramos, M. L. Kuijjer, J. N. Paulson, A. R. Sonawane, M. Fagny, J. Platig, K. Glass, J. Quackenbush and D. L. DeMeo (2016). "Sexual dimorphism in gene expression and regulatory networks across human tissues." bioRxiv. Chen, H., H. Yoshioka, G. S. Kim, J. E. Jung, N. Okami, H. Sakata, C. M. Maier, P. Narasimhan, C. E. Goeders and P. H. Chan (2011). "Oxidative stress in ischemic brain damage: mechanisms of cell death and potential molecular targets for neuroprotection." Antioxid Redox Signal 14(8): 1505-1517. Chen, P. and M. Hochstrasser (1996). "Autocatalytic subunit processing couples active site formation in the 20S proteasome to completion of assembly." Cell 86(6): 961-972. Chen, Q., J. Thorpe, J. R. Dohmen, F. Li and J. N. Keller (2006). "Ump1 extends yeast lifespan and enhances viability during oxidative stress: central role for the proteasome?" Free Radical Biology and Medicine 40(1): 120-126. Chen, W., S. Zollman, J.-L. Couderc and F. A. Laski (1995). "The BTB domain of bric à brac mediates dimerization in vitro." Molecular and Cellular Biology 15(6): 3424-3429. 245 Cheng, C., C. Kuo, C. Fan, W. Fang, S. Jiang, Y. Lo, T. Wang, M. Kao and A. Y. Lee (2013). "Overexpression of Lon contributes to survival and aggressive phenotype of cancer cells through mitochondrial complex I-mediated generation of reactive oxygen species." Cell death & disease 4(6): e681. Chevion, M., E. Berenshtein and E. Stadtman (2000). "Human studies related to protein oxidation: protein carbonyl content as a marker of damage." Free Radical Research 33: S99-108. Chondrogianni, N., K. Georgila, N. Kourtis, N. Tavernarakis and E. S. Gonos (2015). "20S proteasome activation promotes life span extension and resistance to proteotoxicity in Caenorhabditis elegans." The FASEB Journal 29(2): 611-622. Chondrogianni, N. and E. S. Gonos (2005). "Proteasome dysfunction in mammalian aging: steps and factors involved." Experimental gerontology 40(12): 931-938. Chondrogianni, N. and E. S. Gonos (2007). "Overexpression of hUMP1/POMP proteasome accessory protein enhances proteasome-mediated antioxidant defence." Experimental Gerontology 42(9): 899-903. Chondrogianni, N., I. Petropoulos, C. Franceschi, B. Friguet and E. S. Gonos (2000). "Fibroblast cultures from healthy centenarians have an active proteasome." Experimental gerontology 35(6): 721-728. Chondrogianni, N., I. Petropoulos, S. Grimm, K. Georgila, B. Catalgol, B. Friguet, T. Grune and E. S. Gonos (2014). "Protein damage, repair and proteolysis." Molecular aspects of medicine 35: 1-71. Chondrogianni, N., F. L. Stratford, I. P. Trougakos, B. Friguet, A. J. Rivett and E. S. Gonos (2003). "Central role of the proteasome in senescence and survival of human fibroblasts: 246 induction of a senescence-like phenotype upon its inhibition and resistance to stress upon its activation." J Biol Chem 278(30): 28026-28037. Chondrogianni, N., F. L. L. Stratford, I. P. Trougakos, B. Friguet, A. J. Rivett and E. S. Gonos (2003). "Central Role of the Proteasome in Senescence and Survival of Human Fibroblasts: INDUCTION OF A SENESCENCE-LIKE PHENOTYPE UPON ITS INHIBITION AND RESISTANCE TO STRESS UPON ITS ACTIVATION." Journal of Biological Chemistry 278(30): 28026-28037. Chondrogianni, N., C. Tzavelas, A. J. Pemberton, I. P. Nezis, A. J. Rivett and E. S. Gonos (2005). "Overexpression of proteasome β5 assembled subunit increases the amount of proteasome and confers ameliorated response to oxidative stress and higher survival rates." Journal of Biological Chemistry 280(12): 11840-11850. Christman, M. F., R. W. Morgan, F. S. Jacobson and B. N. Ames (1985). "Positive control of a regulon for defenses against oxidative stress and some heat-shock proteins in Salmonella typhimurium." Cell 41(3): 753-762. Christman, M. F., G. Storz and B. N. Ames (1989). "OxyR, a positive regulator of hydrogen peroxide-inducible genes in Escherichia coli and Salmonella typhimurium, is homologous to a family of bacterial regulatory proteins." Proceedings of the National Academy of Sciences 86(10): 3484-3488. Chung, H., E. Lee, Y. Choi, J. Kim, D. Kim, Y. Zou, C. Kim, J. Lee, H. Kim and N. Kim (2011). "Molecular inflammation as an underlying mechanism of the aging process and age-related diseases." Journal of dental research 90(7): 830-840. 247 Clancy, D. J., D. Gems, L. G. Harshman, S. Oldham, H. Stocker, E. Hafen, S. J. Leevers and L. Partridge (2001). "Extension of life-span by loss of CHICO, a Drosophila insulin receptor substrate protein." Science 292(5514): 104-106. Clocchiatti, A., E. Cora, Y. Zhang and G. P. Dotto (2016). "Sexual dimorphism in cancer." Nat Rev Cancer 16(5): 330-339. Cocheme, H. M. and M. P. Murphy (2008). "Complex I is the major site of mitochondrial superoxide production by paraquat." J Biol Chem 283(4): 1786-1798. Cocheme, H. M. and M. P. Murphy (2008). "Complex I is the major site of mitochondrial superoxide production by paraquat." J. Biol. Chem. 283(4): 1786-1798. Cochemé, H. M. and M. P. Murphy (2008). "Complex I is the major site of mitochondrial superoxide production by paraquat." Journal of biological chemistry 283(4): 1786-1798. Cochemé, Helena M., C. Quin, Stephen J. McQuaker, F. Cabreiro, A. Logan, Tracy A. Prime, I. Abakumova, Jigna V. Patel, Ian M. Fearnley, Andrew M. James, Carolyn M. Porteous, Robin A. J. Smith, S. Saeed, Jane E. Carré, M. Singer, D. Gems, Richard C. Hartley, L. Partridge and Michael P. Murphy (2011). "Measurement of H2O2 within Living Drosophila during Aging Using a Ratiometric Mass Spectrometry Probe Targeted to the Mitochondrial Matrix." Cell Metabolism 13(3): 340-350. Combs, T. P., A. H. Berg, M. W. Rajala, S. Klebanov, P. Iyengar, J. C. Jimenez-Chillaron, M. E. Patti, S. L. Klein, R. S. Weinstein and P. E. Scherer (2003). "Sexual differentiation, pregnancy, calorie restriction, and aging affect the adipocyte-specific secretory protein adiponectin." Diabetes 52(2): 268-276. 248 Cook, C., J. Gass, J. Dunmore, J. Tong, J. Taylor, J. Eriksen, E. McGowan, J. Lewis, J. Johnston and L. Petrucelli (2009). "Aging is not associated with proteasome impairment in UPS reporter mice." PLoS One 4(6): e5888. Coux, O., K. Tanaka and A. L. Goldberg (1996). "Structure and functions of the 20S and 26S proteasomes." Annual review of biochemistry 65(1): 801-847. Covas, G., H. S. Marinho, L. Cyrne and F. Antunes (2013). "Activation of Nrf2 by H2O2: de novo synthesis versus nuclear translocation." Methods Enzymol 528: 157-171. Cox, L. S. and J. A. Mattison (2009). "Increasing longevity through caloric restriction or rapamycin feeding in mammals: common mechanisms for common outcomes?" Aging Cell 8(5): 607-613. Craiu, A., M. Gaczynska, T. Akopian, C. F. Gramm, G. Fenteany, A. L. Goldberg and K. L. Rock (1997). "Lactacystin and clasto-lactacystin beta-lactone modify multiple proteasome beta- subunits and inhibit intracellular protein degradation and major histocompatibility complex class I antigen presentation." J Biol Chem 272(20): 13437-13445. Cristovao, A. C., D. H. Choi, G. Baltazar, M. F. Beal and Y. S. Kim (2009). "The role of NADPH oxidase 1-derived reactive oxygen species in paraquat-mediated dopaminergic cell death." Antioxid Redox Signal 11(9): 2105-2118. Crouse, D. L., P. A. Peters, A. van Donkelaar, M. S. Goldberg, P. J. Villeneuve, O. Brion, S. Khan, D. O. Atari, M. Jerrett and C. A. Pope III (2015). Risk of nonaccidental and cardiovascular mortality in relation to long-term exposure to low concentrations of fine particulate matter: a Canadian national-level cohort study, University of British Columbia. Currais, A. and P. Maher (2013). "Functional consequences of age-dependent changes in glutathione status in the brain." Antioxidants & redox signaling 19(8): 813-822. 249 Cypser, J. R. and T. E. Johnson (2002). "Multiple stressors in Caenorhabditis elegans induce stress hormesis and extended longevity." The Journals of Gerontology Series A: Biological Sciences and Medical Sciences 57(3): B109-B114. Czech, M. P., J. C. Lawrence and W. S. Lynn (1974). "Evidence for the involvement of sulfhydryl oxidation in the regulation of fat cell hexose transport by insulin." Proceedings of the National Academy of Sciences 71(10): 4173-4177. Dalle-Donne, I., D. Giustarini, R. Colombo, R. Rossi and A. Milzani (2003). "Protein carbonylation in human diseases." Trends in Molecular Medicine 9(4): 169-176. Dalle-Donne, I., R. Rossi, D. Giustarini, A. Milzani and R. Colombo (2003). "Protein carbonyl groups as biomarkers of oxidative stress." Clinica chimica acta 329(1): 23-38. DAS, N., R. Levine, W. Orr and R. Sohal (2001). "Selectivity of protein oxidative damage during aging in Drosophila melanogaster." Biochem. J 360: 209-216. David, D. C., N. Ollikainen, J. C. Trinidad, M. P. Cary, A. L. Burlingame and C. Kenyon (2010). "Widespread protein aggregation as an inherent part of aging in C. elegans." PLoS Biol 8(8): e1000450. Davies, J. M., C. V. Lowry and K. J. Davies (1995). "Transient adaptation to oxidative stress in yeast." Archives of biochemistry and biophysics 317(1): 1-6. Davies, K. J. (1986). "Intracellular proteolytic systems may function as secondary antioxidant defenses: an hypothesis." Journal of free radicals in biology & medicine 2(3): 155-173. Davies, K. J. (1995). Oxidative stress: the paradox of aerobic life. Biochemical Society Symposia, PORTLAND PRESS-LONDON. Davies, K. J. (2016). "Adaptive homeostasis." Molecular Aspects of Medicine. Davies, K. J. (2016). "Adaptive homeostasis." Molecular aspects of medicine 49: 1-7. 250 Davies, K. J. and S. W. Lin (1988). "Degradation of oxidatively denatured proteins in Escherichia coli." Free Radic Biol Med 5(4): 215-223. Davies, K. J. A., A. T. Quintanilha, G. A. Brooks and L. Packer (1982). "Free radicals and tissue damage produced by exercise." Biochemical and Biophysical Research Communications 107(4): 1198-1205. Davis, D. A., G. Akopian, J. P. Walsh, C. Sioutas, T. E. Morgan and C. E. Finch (2013). "Urban air pollutants reduce synaptic function of CA1 neurons via an NMDA/NȮ pathway in vitro." Journal of neurochemistry 127(4): 509-519. Davis, D. A., M. Bortolato, S. C. Godar, T. K. Sander, N. Iwata, P. Pakbin, J. C. Shih, K. Berhane, R. McConnell, C. Sioutas, C. E. Finch and T. E. Morgan (2013). "Prenatal Exposure to Urban Air Nanoparticles in Mice Causes Altered Neuronal Differentiation and Depression-Like Responses." PLoS ONE 8(5): e64128. De, M., K. Jayarapu, L. Elenich, J. J. Monaco, R. A. Colbert and T. A. Griffin (2003). "Beta 2 subunit propeptides influence cooperative proteasome assembly." J Biol Chem 278(8): 6153- 6159. Delaval, E., M. Perichon and B. Friguet (2004). "Age-related impairment of mitochondrial matrix aconitase and ATP-stimulated protease in rat liver and heart." Eur. J. Biochem. 271(22): 4559-4564. Delaval, E., M. Perichon and B. Friguet (2004). "Age‐related impairment of mitochondrial matrix aconitase and ATP‐stimulated protease in rat liver and heart." European Journal of Biochemistry 271(22): 4559-4564. Demontis, F. and N. Perrimon (2010). "FOXO/4E-BP signaling in Drosophila muscles regulates organism-wide proteostasis during aging." Cell 143(5): 813-825. 251 Demontis, F., R. Piccirillo, A. L. Goldberg and N. Perrimon (2013). "Mechanisms of skeletal muscle aging: insights from Drosophila and mammalian models." Disease Models and Mechanisms 6(6): 1339-1352. Demple, B. and J. Halbrook (1983). "Inducible repair of oxidative DNA damage in Escherichia coli." Nature 304(5925): 466-468. Denayer, T., T. Stöhr and M. Van Roy (2014). "Animal models in translational medicine: Validation and prediction." New Horizons in Translational Medicine 2(1): 5-11. Deol, P., D. M. Zaiss, J. J. Monaco and A. J. Sijts (2007). "Rates of processing determine the immunogenicity of immunoproteasome-generated epitopes." The Journal of Immunology 178(12): 7557-7562. Dewing, P., T. Shi, S. Horvath and E. Vilain (2003). "Sexually dimorphic gene expression in mouse brain precedes gonadal differentiation." Molecular Brain Research 118(1): 82-90. Dhakshinamoorthy, S., A. K. Jain, D. A. Bloom and A. K. Jaiswal (2005). "Bach1 Competes with Nrf2 Leading to Negative Regulation of the Antioxidant Response Element (ARE)- mediated NAD(P)H:Quinone Oxidoreductase 1 Gene Expression and Induction in Response to Antioxidants." Journal of Biological Chemistry 280(17): 16891-16900. Ding, Q., S. Martin, E. Dimayuga, A. J. Bruce-Keller and J. N. Keller (2006). "LMP2 knock-out mice have reduced proteasome activities and increased levels of oxidatively damaged proteins." Antioxidants & redox signaling 8(1-2): 130-135. Ding, Q., K. Reinacker, E. Dimayuga, V. Nukala, J. Drake, D. A. Butterfield, J. C. Dunn, S. Martin, A. J. Bruce-Keller and J. N. Keller (2003). "Role of the proteasome in protein oxidation and neural viability following low-level oxidative stress." FEBS letters 546(2): 228-232. 252 Divald, A. and S. R. Powell (2006). "Proteasome mediates removal of proteins oxidized during myocardial ischemia." Free Radical Biology and Medicine 40(1): 156-164. Doronkin, S. and L. T. Reiter (2008). "Drosophila orthologues to human disease genes: an update on progress." Progress in nucleic acid research and molecular biology 82: 1-32. Dröge, W. (2002). "Free radicals in the physiological control of cell function." Physiological reviews 82(1): 47-95. Duman, R. E. and J. Löwe (2010). "Crystal structures of Bacillus subtilis Lon protease." Journal of molecular biology 401(4): 653-670. Ebstein, F., P.-M. Kloetzel, E. Krüger and U. Seifert (2012). "Emerging roles of immunoproteasomes beyond MHC class I antigen processing." Cellular and Molecular Life Sciences 69(15): 2543-2558. Erjavec, N., A. Bayot, M. Gareil, N. Camougrand, T. Nystrom, B. Friguet and A.-L. Bulteau (2013). "Deletion of the mitochondrial Pim1/Lon protease in yeast results in accelerated aging and impairment of the proteasome." Free Radical Biology and Medicine 56: 9-16. Espinosa-Diez, C., V. Miguel, D. Mennerich, T. Kietzmann, P. Sánchez-Pérez, S. Cadenas and S. Lamas (2015). "Antioxidant responses and cellular adjustments to oxidative stress." Redox Biology 6: 183-197. Esteve, J., J. Mompo, J. G. De La Asuncion, J. Sastre, M. Asensi, J. Boix, J. Vina, J. Vina and F. Pallardo (1999). "Oxidative damage to mitochondrial DNA and glutathione oxidation in apoptosis: studies in vivo and in vitro." The FASEB Journal 13(9): 1055-1064. Eytan, E., D. Ganoth, T. Armon and A. Hershko (1989). "ATP-dependent incorporation of 20S protease into the 26S complex that degrades proteins conjugated to ubiquitin." Proceedings of the National Academy of Sciences 86(20): 7751-7755. 253 Fabrizio, P., F. Pozza, S. D. Pletcher, C. M. Gendron and V. D. Longo (2001). "Regulation of longevity and stress resistance by Sch9 in yeast." Science 292(5515): 288-290. Fabunmi, R. P., W. C. Wigley, P. J. Thomas and G. N. DeMartino (2000). "Activity and regulation of the centrosome-associated proteasome." Journal of Biological Chemistry 275(1): 409-413. Fanò, G., P. Mecocci, J. Vecchiet, S. Belia, S. Fulle, M. C. Polidori, G. Felzani, U. Senin, L. Vecchiet and M. F. Beal (2001). "Age and sex influence on oxidative damage and functional status in human skeletal muscle." Journal of Muscle Research & Cell Motility 22(4): 345-351. Farout, L. and B. Friguet (2006). "Proteasome function in aging and oxidative stress: implications in protein maintenance failure." Antioxidants & redox signaling 8(1-2): 205-216. Ferrington, D. A., A. D. Husom and L. V. Thompson (2005). "Altered proteasome structure, function, and oxidation in aged muscle." The FASEB journal 19(6): 644-646. Ferrington, D. A., H. Sun, K. K. Murray, J. Costa, T. D. Williams, D. J. Bigelow and T. C. Squier (2001). "Selective degradation of oxidized calmodulin by the 20 S proteasome." Journal of Biological Chemistry 276(2): 937-943. Finch, C. E. and T. B. Kirkwood (2000). Chance, development, and aging, Oxford University Press, USA. Finch, C. E. and J. Tower (2014). "Sex-specific aging in flies, worms, and missing great- granddads." Cell 156(3): 398-399. Finelli, A., A. Kelkar, H.-J. Song, H. Yang and M. Konsolaki (2004). "A model for studying Alzheimer's Aβ42-induced toxicity in Drosophila melanogaster." Molecular and Cellular Neuroscience 26(3): 365-375. 254 Ford, D., N. Hoe, G. N. Landis, K. Tozer, A. Luu, D. Bhole, A. Badrinath and J. Tower (2007). "Alteration of Drosophila life span using conditional, tissue-specific expression of transgenes triggered by doxycyline or RU486/Mifepristone." Exp. Gerontol. 42(6): 483-497. Ford, D., N. Hoe, G. N. Landis, K. Tozer, A. Luu, D. Bhole, A. Badrinath and J. Tower (2007). "Alteration of Drosophila life span using conditional, tissue-specific expression of transgenes triggered by doxycyline or RU486/Mifepristone." Experimental gerontology 42(6): 483-497. Forman, H., T. K. Aldrich, M. A. Posner and A. B. Fisher (1982). "Differential paraquat uptake and redox kinetics of rat granular pneumocytes and alveolar macrophages." Journal of Pharmacology and Experimental Therapeutics 221(2): 428-433. Forman, H., J. Nelson and A. Fisher (1980). "Rat alveolar macrophages require NADPH for superoxide production in the respiratory burst. Effect of NADPH depletion by paraquat." Journal of Biological Chemistry 255(20): 9879-9883. Forman, H. J. and M. Torres (2002). "Reactive oxygen species and cell signaling: respiratory burst in macrophage signaling." American journal of respiratory and critical care medicine 166(supplement_1): S4-S8. Frank, S. (1996). "Mitochondria and male disease." Nature 383: 224. Freeman, D. L. (2001). "Harrison's principles of internal medicine." JAMA: The Journal of the American Medical Association 286(8): 971-972. Fricke, B., S. Heink, J. Steffen, P. M. Kloetzel and E. Krüger (2007). "The proteasome maturation protein POMP facilitates major steps of 20S proteasome formation at the endoplasmic reticulum." EMBO reports 8(12): 1170-1175. 255 Friedman, D. B. and T. E. Johnson (1988). "Three mutants that extend both mean and maximum life span of the nematode, Caenorhabditis elegans, define the age-1 gene." J Gerontol 43(4): B102-109. Fu, G. K. and D. M. Markovitz (1998). "The human LON protease binds to mitochondrial promoters in a single-stranded, site-specific, strand-specific manner." Biochemistry 37(7): 1905- 1909. Fukuda, R., H. Zhang, J.-w. Kim, L. Shimoda, C. V. Dang and G. L. Semenza (2007). "HIF-1 regulates cytochrome oxidase subunits to optimize efficiency of respiration in hypoxic cells." Cell 129(1): 111-122. Gaczynska, M., A. L. Goldberg, K. Tanaka, K. B. Hendil and K. L. Rock (1996). "Proteasome subunits X and Y alter peptidase activities in opposite ways to the interferon-γ-induced subunits LMP2 and LMP7." Journal of Biological Chemistry 271(29): 17275-17280. García-Niño, W. R. and J. Pedraza-Chaverrí (2014). "Protective effect of curcumin against heavy metals-induced liver damage." Food and Chemical Toxicology 69: 182-201. Gavilán, M. P., A. Castaño, M. Torres, M. Portavella, C. Caballero, S. Jiménez, A. García‐ Martínez, J. Parrado, J. Vitorica and D. Ruano (2009). "Age‐related increase in the immunoproteasome content in rat hippocampus: molecular and functional aspects." Journal of neurochemistry 108(1): 260-272. Gazzerro, E., S. Assereto, A. Bonetto, F. Sotgia, S. Scarfi, A. Pistorio, G. Bonuccelli, M. Cilli, C. Bruno, F. Zara, M. P. Lisanti and C. Minetti (2010). "Therapeutic potential of proteasome inhibition in Duchenne and Becker muscular dystrophies." Am J Pathol 176(4): 1863-1877. Gemmell, N. J., V. J. Metcalf and F. W. Allendorf (2004). "Mother's curse: the effect of mtDNA on individual fitness and population viability." Trends Ecol Evol 19(5): 238-244. 256 Gems, D. (2014). "Evolution of sexually dimorphic longevity in humans." Aging (Albany NY) 6(2): 84. Gems, D. and D. L. Riddle (2000). "Genetic, behavioral and environmental determinants of male longevity in Caenorhabditis elegans." Genetics 154(4): 1597-1610. Gerards, W. L., J. Enzlin, M. Haner, I. L. Hendriks, U. Aebi, H. Bloemendal and W. Boelens (1997). "The human alpha-type proteasomal subunit HsC8 forms a double ringlike structure, but does not assemble into proteasome-like particles with the beta-type subunits HsDelta or HsBPROS26." J Biol Chem 272(15): 10080-10086. Ghaziani, T., Y. Shan, R. W. Lambrecht, S. E. Donohue, T. Pietschmann, R. Bartenschlager and H. L. Bonkovsky (2006). "HCV proteins increase expression of heme oxygenase-1 (HO-1) and decrease expression of Bach1 in human hepatoma cells." Journal of hepatology 45(1): 5-12. Ghio, A. J. and R. B. Devlin (2001). "Inflammatory lung injury after bronchial instillation of air pollution particles." American journal of respiratory and critical care medicine 164(4): 704-708. Gibson, B. W. (2005). "The human mitochondrial proteome: oxidative stress, protein modifications and oxidative phosphorylation." The international journal of biochemistry & cell biology 37(5): 927-934. Gillies, G. E., I. S. Pienaar, S. Vohra and Z. Qamhawi (2014). "Sex differences in Parkinson's disease." Front Neuroendocrinol 35(3): 370-384. Gillies, G. E., I. S. Pienaar, S. Vohra and Z. Qamhawi (2014). "Sex differences in Parkinson’s disease." Frontiers in neuroendocrinology 35(3): 370-384. Giordano, C., L. Iommarini, L. Giordano, A. Maresca, A. Pisano, M. L. Valentino, L. Caporali, R. Liguori, S. Deceglie and M. Roberti (2014). "Efficient mitochondrial biogenesis drives incomplete penetrance in Leber’s hereditary optic neuropathy." Brain 137(2): 335-353. 257 Glass, M., M. W. Sutherland, H. Forman and A. B. Fisher (1985). "Selenium deficiency potentiates paraquat-induced lipid peroxidation in isolated perfused rat lung." Journal of Applied Physiology 59(2): 619-622. Gohlke, S., M. Mishto, K. Textoris-Taube, C. Keller, C. Giannini, F. Vasuri, E. Capizzi, A. D’Errico-Grigioni, P.-M. Kloetzel and B. Dahlmann (2014). "Molecular alterations in proteasomes of rat liver during aging result in altered proteolytic activities." Age 36(1): 57-72. Goldberg, A. L. and L. Waxman (1985). "The role of ATP hydrolysis in the breakdown of proteins and peptides by protease La from Escherichia coli." J Biol Chem 260(22): 12029-12034. Golden, T. R. and S. Melov (2001). "Mitochondrial DNA mutations, oxidative stress, and aging." Mech Ageing Dev 122(14): 1577-1589. Gomes, A. V. (2013). "Genetics of proteasome diseases." Scientifica 2013. Goven, D., A. Boutten, V. Leçon-Malas, J. Boczkowski and M. Bonay (2009). "Prolonged cigarette smoke exposure decreases heme oxygenase-1 and alters Nrf2 and Bach1 expression in human macrophages: Roles of the MAP kinases ERK1/2 and JNK." FEBS Letters 583(21): 3508-3518. Goven, D., A. Boutten, V. Leçon-Malas, J. Marchal-Sommé, N. Amara, B. Crestani, M. Fournier, G. Lesèche, P. Soler and J. Boczkowski (2008). "Altered Nrf2/Keap1-Bach1 equilibrium in pulmonary emphysema." Thorax. Granot, Z., O. Kobiler, N. Melamed-Book, S. Eimerl, A. Bahat, B. Lu, S. Braun, M. R. Maurizi, C. K. Suzuki and A. B. Oppenheim (2007). "Turnover of mitochondrial steroidogenic acute regulatory (StAR) protein by Lon protease: the unexpected effect of proteasome inhibitors." Molecular Endocrinology 21(9): 2164-2177. 258 Gray, J. P., D. E. Heck, V. Mishin, P. J. S. Smith, J.-Y. Hong, M. Thiruchelvam, D. A. Cory- Slechta, D. L. Laskin and J. D. Laskin (2007). "Paraquat Increases Cyanide-insensitive Respiration in Murine Lung Epithelial Cells by Activating an NAD(P)H:Paraquat Oxidoreductase: IDENTIFICATION OF THE ENZYME AS THIOREDOXIN REDUCTASE." Journal of Biological Chemistry 282(11): 7939-7949. Greer, E. L. and A. Brunet (2005). "FOXO transcription factors at the interface between longevity and tumor suppression." Oncogene 24(50): 7410-7425. Griffin, T. A., D. Nandi, M. Cruz, H. J. Fehling, L. V. Kaer, J. J. Monaco and R. A. Colbert (1998). "Immunoproteasome assembly: cooperative incorporation of interferon gamma (IFN- gamma)-inducible subunits." J Exp Med 187(1): 97-104. Griffin, T. A., D. Nandi, M. Cruz, H. J. Fehling, L. Van Kaer, J. J. Monaco and R. A. Colbert (1998). "Immunoproteasome assembly: cooperative incorporation of interferon γ (IFN-γ)– inducible subunits." The Journal of experimental medicine 187(1): 97-104. Grimble, R. F. (2003). "Inflammatory response in the elderly." Current Opinion in Clinical Nutrition & Metabolic Care 6(1): 21-29. Grimm, S., C. Ott, M. Hörlacher, D. Weber, A. Höhn and T. Grune (2012). "Advanced- glycation-end-product-induced formation of immunoproteasomes: involvement of RAGE and Jak2/STAT1." Biochemical Journal 448(1): 127-139. Groettrup, M., R. Kraft, S. Kostka, S. Standera, R. Stohwasser and P. M. Kloetzel (1996). "A third interferon‐γ‐induced subunit exchange in the 20S proteasome." European journal of immunology 26(4): 863-869. 259 Groettrup, M., S. Standera, R. Stohwasser and P. M. Kloetzel (1997). "The subunits MECL-1 and LMP2 are mutually required for incorporation into the 20S proteasome." Proc Natl Acad Sci U S A 94(17): 8970-8975. Groll, M., M. Bajorek, A. Köhler, L. Moroder, D. M. Rubin, R. Huber, M. H. Glickman and D. Finley (2000). "A gated channel into the proteasome core particle." Nature Structural & Molecular Biology 7(11): 1062-1067. Groll, M., L. Ditzel, J. Löwe, D. Stock, M. Bochtler, H. D. Bartunik and R. Huber (1997). "Structure of 20S proteasome from yeast at 2.4 A resolution." NATURE-LONDON-: 463-471. Groll, M., W. Heinemeyer, S. Jäger, T. Ullrich, M. Bochtler, D. H. Wolf and R. Huber (1999). "The catalytic sites of 20S proteasomes and their role in subunit maturation: A mutational and crystallographic study." Proceedings of the National Academy of Sciences 96(20): 10976-10983. Groll, M. and R. Huber (2003). "Substrate access and processing by the 20S proteasome core particle." The international journal of biochemistry & cell biology 35(5): 606-616. Grune, T., B. Catalgol, A. Licht, G. Ermak, A. M. Pickering, J. K. Ngo and K. J. Davies (2011). "HSP70 mediates dissociation and reassociation of the 26S proteasome during adaptation to oxidative stress." Free Radical Biology and Medicine 51(7): 1355-1364. Grune, T., B. Catalgol, A. Licht, G. Ermak, A. M. Pickering, J. K. Ngo and K. J. A. Davies (2011). "HSP70 mediates dissociation and reassociation of the 26S proteasome during adaptation to oxidative stress." Free Radical Biology and Medicine 51(7): 1355-1364. Grune, T., T. Jung, K. Merker and K. J. Davies (2004). "Decreased proteolysis caused by protein aggregates, inclusion bodies, plaques, lipofuscin, ceroid, and 'aggresomes' during oxidative stress, aging, and disease." Int J Biochem Cell Biol 36(12): 2519-2530. 260 Grune, T., T. Jung, K. Merker and K. J. Davies (2004). "Decreased proteolysis caused by protein aggregates, inclusion bodies, plaques, lipofuscin, ceroid, and ‘aggresomes’ during oxidative stress, aging, and disease." The international journal of biochemistry & cell biology 36(12): 2519-2530. Grune, T., K. Merker, T. Jung, N. Sitte and K. J. Davies (2005). "Protein oxidation and degradation during postmitotic senescence." Free Radic Biol Med 39(9): 1208-1215. Grune, T., K. Merker, G. Sandig and K. J. Davies (2003). "Selective degradation of oxidatively modified protein substrates by the proteasome." Biochemical and biophysical research communications 305(3): 709-718. Grune, T., T. Reinheckel and K. Davies (1997). "Degradation of oxidized proteins in mammalian cells." The FASEB Journal 11(7): 526-534. Grune, T., T. Reinheckel and K. J. Davies (1996). "Degradation of oxidized proteins in K562 human hematopoietic cells by proteasome." Journal of Biological Chemistry 271(26): 15504- 15509. Grune, T., T. Reinheckel, M. Joshi and K. J. Davies (1995). "Proteolysis in cultured liver epithelial cells during oxidative stress Role of the multicatalytic proteinase complex, proteasome." Journal of Biological Chemistry 270(5): 2344-2351. Grune, T., R. Shringarpure, N. Sitte and K. Davies (2001). "Age-related changes in protein oxidation and proteolysis in mammalian cells." J Gerontol A Biol Sci Med Sci 56(11): B459- 467. Guevara-Aguirre, J., P. Balasubramanian, M. Guevara-Aguirre, M. Wei, F. Madia, C.-W. Cheng, D. Hwang, A. Martin-Montalvo, J. Saavedra and S. Ingles (2011). "Growth hormone receptor 261 deficiency is associated with a major reduction in pro-aging signaling, cancer, and diabetes in humans." Science translational medicine 3(70): 70ra13-70ra13. GuhaThakurta, D., L. Palomar, G. D. Stormo, P. Tedesco, T. E. Johnson, D. W. Walker, G. Lithgow, S. Kim and C. D. Link (2002). "Identification of a novel cis-regulatory element involved in the heat shock response in Caenorhabditis elegans using microarray gene expression and computational methods." Genome Res 12(5): 701-712. Gvozdeva, O. V., V. S. Prassolov, M. A. Zenkova, V. V. Vlassov and E. L. Chernolovskaya (2016). "Silencing of Inducible Immunoproteasome Subunit Expression by Chemically Modified siRNA and shRNA." Nucleosides, Nucleotides and Nucleic Acids 35(8): 389-403. Haigis, M. C. and B. A. Yankner (2010). "The Aging Stress Response." Molecular Cell 40(2): 333-344. Halagappa, V. K. M., Z. Guo, M. Pearson, Y. Matsuoka, R. G. Cutler, F. M. LaFerla and M. P. Mattson (2007). "Intermittent fasting and caloric restriction ameliorate age-related behavioral deficits in the triple-transgenic mouse model of Alzheimer's disease." Neurobiology of disease 26(1): 212-220. Hall, M. J., S. Levant and C. J. DeFrances (2012). "Hospitalization for congestive heart failure: United States, 2000-2010." NCHS Data Brief(108): 1-8. Halliwell, B. and J. M. Gutteridge (1999). Free radicals in biology and medicine, Oxford university press Oxford. Hamilton, K. L. and B. F. Miller (2016). "What is the evidence for stress resistance and slowed aging?" Experimental gerontology 82: 67-72. 262 Hansen, T. Ø., P. Sarup, V. Loeschcke and S. I. Rattan (2012). "Age-related and sex-specific differences in proteasome activity in individual Drosophila flies from wild type, longevity- selected and stress resistant strains." Biogerontology 13(4): 429-438. Harper, J. M., A. B. Salmon, S. F. Leiser, A. T. Galecki and R. A. Miller (2007). "Skin-derived fibroblasts from long-lived species are resistant to some, but not all, lethal stresses and to the mitochondrial inhibitor rotenone." Aging Cell 6(1): 1-13. Harper, J. M., M. Wang, A. T. Galecki, J. Ro, J. B. Williams and R. A. Miller (2011). "Fibroblasts from long-lived bird species are resistant to multiple forms of stress." J Exp Biol 214(Pt 11): 1902-1910. Harshman, L. G. and B. A. Haberer (2000). "Oxidative Stress Resistance: A Robust Correlated Response to Selection in Extended Longevity Lines of Drosophila melanogaster?" The Journals of Gerontology Series A: Biological Sciences and Medical Sciences 55(9): B415-B417. Hayashi, T. and S. Goto (1998). "Age-related changes in the 20S and 26S proteasome activities in the liver of male F344 rats." Mechanisms of ageing and development 102(1): 55-66. Hayashi, T. and S. Goto (1998). "Age-related changes in the 20S and 26S proteasome activities in the liver of male F344 rats." Mech Ageing Dev 102(1): 55-66. Hayes, J. D. and M. McMahon (2009). "NRF2 and KEAP1 mutations: permanent activation of an adaptive response in cancer." Trends in biochemical sciences 34(4): 176-188. Heink, S., D. Ludwig, P. M. Kloetzel and E. Kruger (2005). "IFN-gamma-induced immune adaptation of the proteasome system is an accelerated and transient response." Proc Natl Acad Sci U S A 102(26): 9241-9246. 263 Herndon, L. A., P. J. Schmeissner, J. M. Dudaronek, P. A. Brown, K. M. Listner, Y. Sakano, M. C. Paupard, D. H. Hall and M. Driscoll (2002). "Stochastic and genetic factors influence tissue- specific decline in ageing C. elegans." Nature 419(6909): 808-814. Hershko, A. and A. Ciechanover (1992). "The ubiquitin system for protein degradation." Annual review of biochemistry 61(1): 761-807. Hirai, K.-I., K. Ikeda and G.-Y. Wang (1992). "Paraquat damage of rat liver mitochondria by superoxide production depends on extramitochondrial NADH." Toxicology 72(1): 1-16. Hiraiwa, K. and S. F. van Eeden (2013). "Contribution of lung macrophages to the inflammatory responses induced by exposure to air pollutants." Mediators of inflammation 2013. Hirano, Y., H. Hayashi, S.-i. Iemura, K. B. Hendil, S.-i. Niwa, T. Kishimoto, M. Kasahara, T. Natsume, K. Tanaka and S. Murata (2006). "Cooperation of multiple chaperones required for the assembly of mammalian 20S proteasomes." Molecular cell 24(6): 977-984. Hirano, Y., K. B. Hendil, H. Yashiroda, S. Iemura, R. Nagane, Y. Hioki, T. Natsume, K. Tanaka and S. Murata (2005). "A heterodimeric complex that promotes the assembly of mammalian 20S proteasomes." Nature 437(7063): 1381-1385. Hirano, Y., T. Kaneko, K. Okamoto, M. Bai, H. Yashiroda, K. Furuyama, K. Kato, K. Tanaka and S. Murata (2008). "Dissecting beta-ring assembly pathway of the mammalian 20S proteasome." Embo j 27(16): 2204-2213. Hoet, P. H., C. P. Lewis, M. Demedts and B. Nemery (1994). "Putrescine and paraquat uptake in human lung slices and isolated type II pneumocytes." Biochemical pharmacology 48(3): 517- 524. Höhn, T. J. A. and T. Grune (2014). "The proteasome and the degradation of oxidized proteins: Part II–protein oxidation and proteasomal degradation." Redox biology 2: 99-104. 264 Holcik, M. and N. Sonenberg (2005). "Translational control in stress and apoptosis." Nature reviews Molecular cell biology 6(4): 318-327. Hollinger, M. and S. Giri (1978). "Binding to radioactivity from [14C] paraquat to rat lung protein, in vitro." Research communications in chemical pathology and pharmacology 19(2): 329. Holzenberger, M., J. Dupont, B. Ducos, P. Leneuve, A. Géloën, P. C. Even, P. Cervera and Y. Le Bouc (2003). "IGF-1 receptor regulates lifespan and resistance to oxidative stress in mice." Nature 421(6919): 182-187. Holzhütter, H.-G. and P.-M. Kloetzel (2000). "A kinetic model of vertebrate 20S proteasome accounting for the generation of major proteolytic fragments from oligomeric peptide substrates." Biophysical journal 79(3): 1196-1205. Honda, Y. and S. Honda (1999). "The daf-2 gene network for longevity regulates oxidative stress resistance and Mn-superoxide dismutase gene expression in Caenorhabditis elegans." The FASEB journal 13(11): 1385-1393. Hori, O., F. Ichinoda, T. Tamatani, A. Yamaguchi, N. Sato, K. Ozawa, Y. Kitao, M. Miyazaki, H. P. Harding and D. Ron (2002). "Transmission of cell stress from endoplasmic reticulum to mitochondria enhanced expression of Lon protease." The Journal of cell biology 157(7): 1151- 1160. Hori, O., F. Ichinoda, T. Tamatani, A. Yamaguchi, N. Sato, K. Ozawa, Y. Kitao, M. Miyazaki, H. P. Harding, D. Ron, M. Tohyama, M. S. D and S. Ogawa (2002). "Transmission of cell stress from endoplasmic reticulum to mitochondria: enhanced expression of Lon protease." J Cell Biol 157(7): 1151-1160. 265 Hoshino, A., Y. Okawa, M. Ariyoshi, S. Kaimoto, M. Uchihashi, K. Fukai, E. Iwai-Kanai and S. Matoba (2014). "Oxidative Post-Translational Modifications Develop LONP1 Dysfunction in Pressure Overload Heart Failure." Circulation: Heart Failure 7(3): 500-509. Huang, F., R. Chen, Y. Shen, H. Kan and X. Kuang (2016). "The Impact of the 2013 Eastern China Smog on Outpatient Visits for Coronary Heart Disease in Shanghai, China." International Journal of Environmental Research and Public Health 13(7): 627. Huber, E. M., M. Basler, R. Schwab, W. Heinemeyer, C. J. Kirk, M. Groettrup and M. Groll (2012). "Immuno-and constitutive proteasome crystal structures reveal differences in substrate and inhibitor specificity." Cell 148(4): 727-738. Hudry, B., S. Khadayate and I. Miguel-Aliaga (2016). "The sexual identity of adult intestinal stem cells controls organ size and plasticity." Nature 530(7590): 344-348. Husom, A. D., E. A. Peters, E. A. Kolling, N. A. Fugere, L. V. Thompson and D. A. Ferrington (2004). "Altered proteasome function and subunit composition in aged muscle." Archives of Biochemistry and Biophysics 421(1): 67-76. Hussong, S. A., R. J. Kapphahn, S. L. Phillips, M. Maldonado and D. A. Ferrington (2010). "Immunoproteasome deficiency alters retinal proteasome’s response to stress." Journal of neurochemistry 113(6): 1481-1490. Hutschenreiter, S., A. Tinazli, K. Model and R. Tampé (2004). "Two‐substrate association with the 20S proteasome at single‐molecule level." The EMBO journal 23(13): 2488-2497. Imlay, J. A. (2008). "Cellular defenses against superoxide and hydrogen peroxide." Annual review of biochemistry 77: 755-776. İnal, M. E., G. Kanbak and E. Sunal (2001). "Antioxidant enzyme activities and malondialdehyde levels related to aging." Clinica Chimica Acta 305(1): 75-80. 266 Innocenti, P., E. H. Morrow and D. K. Dowling (2011). "Experimental Evidence Supports a Sex- Specific Selective Sieve in Mitochondrial Genome Evolution." Science 332(6031): 845-848. Innocenti, P., E. H. Morrow and D. K. Dowling (2011). "Experimental Evidence Supports a Sex- Specific Selective Sieve in Mitochondrial Genome Evolution." Science 332(6031): 845. Ishikawa, M., S. Numazawa and T. Yoshida (2005). "Redox regulation of the transcriptional repressor Bach1." Free Radical Biology and Medicine 38(10): 1344-1352. Itoh, K., T. Chiba, S. Takahashi, T. Ishii, K. Igarashi, Y. Katoh, T. Oyake, N. Hayashi, K. Satoh, I. Hatayama, M. Yamamoto and Y.-i. Nabeshima (1997). "An Nrf2/Small Maf Heterodimer Mediates the Induction of Phase II Detoxifying Enzyme Genes through Antioxidant Response Elements." Biochemical and Biophysical Research Communications 236(2): 313-322. Itoh, K., K. I. Tong and M. Yamamoto (2004). "Molecular mechanism activating Nrf2–Keap1 pathway in regulation of adaptive response to electrophiles." Free Radical Biology and Medicine 36(10): 1208-1213. Iwakami, S., H. Misu, T. Takeda, M. Sugimori, S. Matsugo, S. Kaneko and T. Takamura (2011). "Concentration-dependent dual effects of hydrogen peroxide on insulin signal transduction in H4IIEC hepatocytes." PLoS One 6(11): e27401. Iyanagi, T., N. Makino and H. Mason (1974). "Redox properties of the reduced nicotinamide adenine dinucleotide phosphate-cytochrome P-450 and reduced nicotinamide adenine dinucleotide-cytochrome b5 reductases." Biochemistry 13(8): 1701-1710. Jacob, K. D., N. Noren Hooten, A. R. Trzeciak and M. K. Evans (2013). "Markers of oxidant stress that are clinically relevant in aging and age-related disease." Mech Ageing Dev 134(3-4): 139-157. 267 Jaiswal, A. K. (2004). "Nrf2 signaling in coordinated activation of antioxidant gene expression." Free Radical Biology and Medicine 36(10): 1199-1207. Jasper, H., V. Benes, C. Schwager, S. Sauer, S. Clauder-Münster, W. Ansorge and D. Bohmann (2001). "The genomic response of the Drosophila embryo to JNK signaling." Developmental cell 1(4): 579-586. Jentoft, N. and D. G. Dearborn (1979). Labeling of proteins by reductive methylation using sodium cyanoborohydride, American Society for Biochemistry and Molecular Biology. Ji, L., D. Dillon and E. Wu (1990). "Alteration of antioxidant enzymes with aging in rat skeletal muscle and liver." American Journal of Physiology-Regulatory, Integrative and Comparative Physiology 258(4): R918-R923. Jia, G., V. G. DeMarco and J. R. Sowers (2016). "Insulin resistance and hyperinsulinaemia in diabetic cardiomyopathy." Nat Rev Endocrinol 12(3): 144-153. Jimenez-Gomez, Y., J. A. Mattison, K. J. Pearson, A. Martin-Montalvo, H. H. Palacios, A. M. Sossong, T. M. Ward, C. M. Younts, K. Lewis and J. S. Allard (2013). "Resveratrol improves adipose insulin signaling and reduces the inflammatory response in adipose tissue of rhesus monkeys on high-fat, high-sugar diet." Cell metabolism 18(4): 533-545. Johnson, G. L. and R. Lapadat (2002). "Mitogen-activated protein kinase pathways mediated by ERK, JNK, and p38 protein kinases." Science 298(5600): 1911-1912. Johnston-Carey, H. K., L. C. Pomatto and K. J. Davies (2016). "The Immunoproteasome in oxidative stress, aging, and disease." Critical reviews in biochemistry and molecular biology 51(4): 268-281. Johnstone, I. L. (1994). "The cuticle of the nematode Caenorhabditis elegans: a complex collagen structure." Bioessays 16(3): 171-178. 268 Jung, T., A. Höhn, B. Catalgol and T. Grune (2009). "Age-related differences in oxidative protein-damage in young and senescent fibroblasts." Archives of biochemistry and biophysics 483(1): 127-135. Justo, R., J. Boada, M. Frontera, J. Oliver, J. Bermudez and M. Gianotti (2005). "Gender dimorphism in rat liver mitochondrial oxidative metabolism and biogenesis." American Journal of Physiology-Cell Physiology 289(2): C372-C378. Kaminsky, Z., S. C. Wang and A. Petronis (2006). "Complex disease, gender and epigenetics." Annals of Medicine 38(8): 530-544. Kaspar, J. W. and A. K. Jaiswal (2010). "Antioxidant-induced Phosphorylation of Tyrosine 486 Leads to Rapid Nuclear Export of Bach1 That Allows Nrf2 to Bind to the Antioxidant Response Element and Activate Defensive Gene Expression." Journal of Biological Chemistry 285(1): 153-162. Kastle, M., S. Reeg, A. Rogowska-Wrzesinska and T. Grune (2012). "Chaperones, but not oxidized proteins, are ubiquitinated after oxidative stress." Free Radic Biol Med 53(7): 1468- 1477. Kaufman, B. A., N. Durisic, J. M. Mativetsky, S. Costantino, M. A. Hancock, P. Grutter and E. A. Shoubridge (2007). "The mitochondrial transcription factor TFAM coordinates the assembly of multiple DNA molecules into nucleoid-like structures." Molecular biology of the cell 18(9): 3225-3236. Keller, J. N., J. Gee and Q. Ding (2002). "The proteasome in brain aging." Ageing research reviews 1(2): 279-293. Keller, J. N., K. B. Hanni and W. R. Markesbery (2000). "Impaired proteasome function in Alzheimer's disease." Journal of neurochemistry 75(1): 436-439. 269 Keller, J. N., F. F. Huang and W. R. Markesbery (2000). "Decreased levels of proteasome activity and proteasome expression in aging spinal cord." Neuroscience 98(1): 149-156. Kennedy, B. K., S. L. Berger, A. Brunet, J. Campisi, A. M. Cuervo, E. S. Epel, C. Franceschi, G. J. Lithgow, R. I. Morimoto and J. E. Pessin (2014). "Geroscience: linking aging to chronic disease." Cell 159(4): 709-713. Kimura, K. D., H. A. Tissenbaum, Y. Liu and G. Ruvkun (1997). "daf-2, an insulin receptor-like gene that regulates longevity and diapause in Caenorhabditis elegans." Science 277(5328): 942- 946. Kincaid, E. Z., J. W. Che, I. York, H. Escobar, E. Reyes-Vargas, J. C. Delgado, R. M. Welsh, M. L. Karow, A. J. Murphy and D. M. Valenzuela (2012). "Mice completely lacking immunoproteasomes show major changes in antigen presentation." Nature immunology 13(2): 129-135. Kingsbury, D. J., T. A. Griffin and R. A. Colbert (2000). "Novel propeptide function in 20 S proteasome assembly influences beta subunit composition." J Biol Chem 275(31): 24156-24162. Kipen, H. M., S. Gandhi, D. Q. Rich, P. Ohman-Strickland, R. Laumbach, Z. H. Fan, L. Chen, D. L. Laskin, J. Zhang and K. Madura (2011). "Acute decreases in proteasome pathway activity after inhalation of fresh diesel exhaust or secondary organic aerosol." Environ Health Perspect 119(5): 658-663. Kisselev, A. F., T. N. Akopian, V. Castillo and A. L. Goldberg (1999). "Proteasome active sites allosterically regulate each other, suggesting a cyclical bite-chew mechanism for protein breakdown." Molecular cell 4(3): 395-402. Kisselev, A. F., T. N. Akopian, K. M. Woo and A. L. Goldberg (1999). "The sizes of peptides generated from protein by mammalian 26 and 20 S proteasomes Implications for understanding 270 the degradative mechanism and antigen presentation." Journal of Biological Chemistry 274(6): 3363-3371. Kobayashi, A., M.-I. Kang, H. Okawa, M. Ohtsuji, Y. Zenke, T. Chiba, K. Igarashi and M. Yamamoto (2004). "Oxidative stress sensor Keap1 functions as an adaptor for Cul3-based E3 ligase to regulate proteasomal degradation of Nrf2." Molecular and cellular biology 24(16): 7130-7139. Köhler, A., P. Cascio, D. S. Leggett, K. M. Woo, A. L. Goldberg and D. Finley (2001). "The Axial Channel of the Proteasome Core Particle Is Gated by the Rpt2 ATPase and Controls Both Substrate Entry and Product Release." Molecular Cell 7(6): 1143-1152. Koltai, E., N. Hart, A. W. Taylor, S. Goto, J. K. Ngo, K. J. A. Davies and Z. Radak (2012). Age- associated declines in mitochondrial biogenesis and protein quality control factors are minimized by exercise training. Kopp, F., R. Steiner, B. Dahlmann, L. Kuehn and H. Reinauer (1986). "Size and shape of the multicatalytic proteinase from rat skeletal muscle." Biochimica et Biophysica Acta (BBA)- Protein Structure and Molecular Enzymology 872(3): 253-260. Korner, Z., C. C. Fontes-Oliveira, J. Holmberg, V. Carmignac and M. Durbeej (2014). "Bortezomib partially improves laminin alpha2 chain-deficient muscular dystrophy." Am J Pathol 184(5): 1518-1528. Krůček, T., M. Korandová, M. Šerý, R. Č. Frydrychová and K. Szakosová (2015). "Effect of low doses of herbicide paraquat on antioxidant defense in Drosophila." Archives of insect biochemistry and physiology 88(4): 235-248. 271 Kumamoto, T., S. Fujimoto, T. Ito, H. Horinouchi, H. Ueyama and T. Tsuda (2000). "Proteasome expression in the skeletal muscles of patients with muscular dystrophy." Acta Neuropathol 100(6): 595-602. Kyriakis, J. M. and J. Avruch (2001). "Mammalian mitogen-activated protein kinase signal transduction pathways activated by stress and inflammation." Physiological reviews 81(2): 807- 869. Lacher, S. E., J. S. Lee, X. Wang, M. R. Campbell, D. A. Bell and M. Slattery (2015). "Beyond antioxidant genes in the ancient NRF2 regulatory network." Free Radical Biology and Medicine. Lai, C.-H., C.-N. Lee, K.-J. Bai, Y.-L. Yang, K.-J. Chuang, S.-M. Wu and H.-C. Chuang (2016). "Protein oxidation and degradation caused by particulate matter." Scientific Reports 6: 33727. Landis, G., J. Shen and J. Tower (2012). "Gene expression changes in response to aging compared to heat stress, oxidative stress and ionizing radiation in Drosophila melanogaster." Aging (Albany NY) 4(11): 768-789. Landis, G., J. Shen and J. Tower (2012). "Gene expression changes in response to aging compared to heat stress, oxidative stress and ionizing radiation in Drosophila melanogaster." Aging (Albany NY) 4(11): 768. Landis, G. N., D. Abdueva, D. Skvortsov, J. Yang, B. E. Rabin, J. Carrick, S. Tavaré and J. Tower (2004). "Similar gene expression patterns characterize aging and oxidative stress in Drosophila melanogaster." Proceedings of the National Academy of Sciences of the United States of America 101(20): 7663-7668. Landis, G. N., M. P. Salomon, D. Keroles, N. Brookes, T. Sekimura and J. Tower (2015). "The progesterone antagonist mifepristone/RU486 blocks the negative effect on life span caused by mating in female Drosophila." Aging (Albany NY) 7(1): 53-69. 272 Laskowska, E., D. Kuczyńska-Wiśnik, J. Skórko-Glonek and A. Taylor (1996). "Degradation by proteases Lon, Clp and HtrA, of Escherichia coli proteins aggregated in vivo by heat shock; HtrA protease action in vivo and in vitro." Molecular Microbiology 22(3): 555-571. Lau, E., D. Wang, J. Zhang, H. Yu, M. P. Y. Lam, X. Liang, N. Zong, T.-Y. Kim and P. Ping (2012). "Substrate- and Isoform-Specific Proteome Stability in Normal and Stressed Cardiac Mitochondria." Circulation Research 110(9): 1174-1178. Ledford, H. (2011). "Translational research: 4 ways to fix the clinical trial." Nature 477(7366): 526-528. Lee, C.-K., D. B. Allison, J. Brand, R. Weindruch and T. A. Prolla (2002). "Transcriptional profiles associated with aging and middle age-onset caloric restriction in mouse hearts." Proceedings of the National Academy of Sciences 99(23): 14988-14993. Lee, C.-K., R. G. Klopp, R. Weindruch and T. A. Prolla (1999). "Gene expression profile of aging and its retardation by caloric restriction." Science 285(5432): 1390-1393. Lee, C.-K., R. Weindruch and T. A. Prolla (2000). "Gene-expression profile of the ageing brain in mice." Nature genetics 25(3): 294-297. Lee, D. H. and A. L. Goldberg (1996). "Selective inhibitors of the proteasome-dependent and vacuolar pathways of protein degradation in Saccharomyces cerevisiae." J Biol Chem 271(44): 27280-27284. Lee, H., Y. Kim, A. Park and J. M. Nam (2014). "Amyloid‐β Aggregation with Gold Nanoparticles on Brain Lipid Bilayer." Small 10(9): 1779-1789. Lee, H. J., K. Chung, H. Lee, K. Lee, J. H. Lim and J. Song (2011). "Downregulation of mitochondrial lon protease impairs mitochondrial function and causes hepatic insulin resistance in human liver SK-HEP-1 cells." Diabetologia 54(6): 1437-1446. 273 Lee, I. and C. K. Suzuki (2008). "Functional mechanics of the ATP-dependent Lon protease- lessons from endogenous protein and synthetic peptide substrates." Biochimica et Biophysica Acta (BBA)-Proteins and Proteomics 1784(5): 727-735. Lee, S. Y., I. A. Lim, G. U. Kang, S. J. Cha, V. Altanbyek, H. J. Kim, S. Lee, K. Kim and J. Yim (2015). "Protective effect of Drosophila glutathione transferase omega 1 against hydrogen peroxide-induced neuronal toxicity." Gene 568(2): 203-210. Leeuwenburgh, C., J. E. Rasmussen, F. F. Hsu, D. M. Mueller, S. Pennathur and J. W. Heinecke (1997). "Mass spectrometric quantification of markers for protein oxidation by tyrosyl radical, copper, and hydroxyl radical in low density lipoprotein isolated from human atherosclerotic plaques." J Biol Chem 272(6): 3520-3526. Lehmann, A., A. Niewienda, K. Jechow, K. Janek and C. Enenkel (2010). "Ecm29 fulfils quality control functions in proteasome assembly." Molecular cell 38(6): 879-888. Lesnefsky, E. J., S. Moghaddas, B. Tandler, J. Kerner and C. L. Hoppel (2001). "Mitochondrial dysfunction in cardiac disease: ischemia–reperfusion, aging, and heart failure." Journal of molecular and cellular cardiology 33(6): 1065-1089. Lewis, K. N., E. Wason, Y. H. Edrey, D. M. Kristan, E. Nevo and R. Buffenstein (2015). "Regulation of Nrf2 signaling and longevity in naturally long-lived rodents." Proceedings of the National Academy of Sciences 112(12): 3722-3727. Li, N., T. Xia and A. E. Nel (2008). "The role of oxidative stress in ambient particulate matter- induced lung diseases and its implications in the toxicity of engineered nanoparticles." Free Radical Biology and Medicine 44(9): 1689-1699. 274 Li, Z., L. Arnaud, P. Rockwell and M. E. Figueiredo‐Pereira (2004). "A single amino acid substitution in a proteasome subunit triggers aggregation of ubiquitinated proteins in stressed neuronal cells." Journal of neurochemistry 90(1): 19-28. Liao, C. Y., B. A. Rikke, T. E. Johnson, V. Diaz and J. F. Nelson (2010). "Genetic variation in the murine lifespan response to dietary restriction: from life extension to life shortening." Aging cell 9(1): 92-95. Limbach, L. K., P. Wick, P. Manser, R. N. Grass, A. Bruinink and W. J. Stark (2007). "Exposure of engineered nanoparticles to human lung epithelial cells: influence of chemical composition and catalytic activity on oxidative stress." Environmental science & technology 41(11): 4158- 4163. Lin, K., J. B. Dorman, A. Rodan and C. Kenyon (1997). "daf-16: An HNF-3/forkhead family member that can function to double the life-span of Caenorhabditis elegans." Science 278(5341): 1319-1322. Lin, Y.-J., L. Seroude and S. Benzer (1998). "Extended life-span and stress resistance in the Drosophila mutant methuselah." Science 282(5390): 943-946. Lithgow, G. J. and G. A. Walker (2002). "Stress resistance as a determinate of C. elegans lifespan." Mech Ageing Dev 123(7): 765-771. Lithgow, G. J., T. M. White, S. Melov and T. E. Johnson (1995). "Thermotolerance and extended life-span conferred by single-gene mutations and induced by thermal stress." Proceedings of the National Academy of Sciences 92(16): 7540-7544. Liu, T., B. Lu, I. Lee, G. Ondrovičová, E. Kutejová and C. K. Suzuki (2004). "DNA and RNA Binding by the Mitochondrial Lon Protease Is Regulated by Nucleotide and Protein Substrate." Journal of Biological Chemistry 279(14): 13902-13910. 275 Liu, Y., L. Lan, K. Huang, R. Wang, C. Xu, Y. Shi, X. Wu, Z. Wu, J. Zhang and L. Chen (2014). "Inhibition of Lon blocks cell proliferation, enhances chemosensitivity by promoting apoptosis and decreases cellular bioenergetics of bladder cancer: potential roles of Lon as a prognostic marker and therapeutic target in baldder cancer." Oncotarget 5(22): 11209. López-Otín, C., M. A. Blasco, L. Partridge, M. Serrano and G. Kroemer (2013). "The hallmarks of aging." Cell 153(6): 1194-1217. Louie, J. L., R. J. Kapphahn and D. A. Ferrington (2002). "Proteasome function and protein oxidation in the aged retina." Experimental eye research 75(3): 271-284. Löwe, J., D. Stock, B. Jap, P. Zwickl, W. Baumeister and R. Huber (1995). "Crystal structure of the 20S proteasome from the archaeon T. acidophilum at 3.4 A resolution." Science (New York, NY) 268(5210): 533-539. Lu, B., J. Lee, X. Nie, M. Li, Y. I. Morozov, S. Venkatesh, D. F. Bogenhagen, D. Temiakov and C. K. Suzuki (2013). "Phosphorylation of Human TFAM in Mitochondria Impairs DNA Binding and Promotes Degradation by the AAA+ Lon Protease." Molecular cell 49(1): 121- 132. Lu, B., S. Yadav, P. G. Shah, T. Liu, B. Tian, S. Pukszta, N. Villaluna, E. Kutejová, C. S. Newlon, J. H. Santos and C. K. Suzuki (2007). "Roles for the Human ATP-dependent Lon Protease in Mitochondrial DNA Maintenance." Journal of Biological Chemistry 282(24): 17363- 17374. Luce, K. and H. D. Osiewacz (2009). "Increasing organismal healthspan by enhancing mitochondrial protein quality control." Nature cell biology 11(7): 852-858. 276 Luciakova, K., B. Sokolikova, M. Chloupkova and B. D. Nelson (1999). "Enhanced mitochondrial biogenesis is associated with increased expression of the mitochondrial ATP- dependent Lon protease." FEBS Letters 444(2–3): 186-188. Luciani, F., C. Keşmir, M. Mishto, M. Or-Guil and R. J. de Boer (2005). "A Mathematical Model of Protein Degradation by the Proteasome." Biophysical journal 88(4): 2422-2432. Macotela, Y., J. Boucher, T. T. Tran and C. R. Kahn (2009). "Sex and depot differences in adipocyte insulin sensitivity and glucose metabolism." Diabetes 58(4): 803-812. Macotela, Y., J. Boucher, T. T. Tran and C. R. Kahn (2009). "Sex and depot differences in adipocyte insulin sensitivity and glucose metabolism." Diabetes 58(4): 803-812. Madamanchi, N. R., A. Vendrov and M. S. Runge (2005). "Oxidative stress and vascular disease." Arterioscler Thromb Vasc Biol 25(1): 29-38. Magkos, F., X. Wang and B. Mittendorfer (2010). "Metabolic actions of insulin in men and women." Nutrition 26(7-8): 686-693. Magwere, T., T. Chapman and L. Partridge (2004). "Sex differences in the effect of dietary restriction on life span and mortality rates in female and male Drosophila melanogaster." The Journals of Gerontology Series A: Biological Sciences and Medical Sciences 59(1): B3-B9. Mahadev, K., H. Motoshima, X. Wu, J. M. Ruddy, R. S. Arnold, G. Cheng, J. D. Lambeth and B. J. Goldstein (2004). "The NAD(P)H oxidase homolog Nox4 modulates insulin-stimulated generation of H2O2 and plays an integral role in insulin signal transduction." Mol Cell Biol 24(5): 1844-1854. Mak, I. W. Y., N. Evaniew and M. Ghert (2014). "Lost in translation: animal models and clinical trials in cancer treatment." American Journal of Translational Research 6(2): 114-118. 277 Maklakov, A. A. and V. Lummaa (2013). "Evolution of sex differences in lifespan and aging: causes and constraints." BioEssays 35(8): 717-724. Marguerat, S., A. Schmidt, S. Codlin, W. Chen, R. Aebersold and J. Bähler (2012). "Quantitative analysis of fission yeast transcriptomes and proteomes in proliferating and quiescent cells." Cell 151(3): 671-683. Martin-Montalvo, A., E. M. Mercken, S. J. Mitchell, H. H. Palacios, P. L. Mote, M. Scheibye- Knudsen, A. P. Gomes, T. M. Ward, R. K. Minor and M.-J. Blouin (2013). "Metformin improves healthspan and lifespan in mice." Nature communications 4. Matsushima, Y., Y.-i. Goto and L. S. Kaguni (2010). "Mitochondrial Lon protease regulates mitochondrial DNA copy number and transcription by selective degradation of mitochondrial transcription factor A (TFAM)." Proceedings of the National Academy of Sciences 107(43): 18410-18415. Matsuzawa, A. and H. Ichijo (2008). "Redox control of cell fate by MAP kinase: physiological roles of ASK1-MAP kinase pathway in stress signaling." Biochimica et Biophysica Acta (BBA)- General Subjects 1780(11): 1325-1336. Mattson, M. P. and R. Wan (2005). "Beneficial effects of intermittent fasting and caloric restriction on the cardiovascular and cerebrovascular systems." The Journal of nutritional biochemistry 16(3): 129-137. McCay, C., M. F. Crowell and L. Maynard (1935). "The effect of retarded growth upon the length of life span and upon the ultimate body size." J nutr 10(1): 63-79. McCormack, A. L., M. Thiruchelvam, A. B. Manning-Bog, C. Thiffault, J. W. Langston, D. A. Cory-Slechta and D. A. Di Monte (2002). "Environmental Risk Factors and Parkinson's Disease: 278 Selective Degeneration of Nigral Dopaminergic Neurons Caused by the Herbicide Paraquat." Neurobiology of Disease 10(2): 119-127. Medina, R., S. S. Wing and A. L. Goldberg (1995). "Increase in levels of polyubiquitin and proteasome mRNA in skeletal muscle during starvation and denervation atrophy." Biochem J 307 ( Pt 3): 631-637. Mehus, A. A., W. W. Muhonen, S. H. Garrett, S. Somji, D. A. Sens and J. B. Shabb (2014). "Quantitation of human metallothionein isoforms: a family of small, highly conserved, cysteine- rich proteins." Molecular & Cellular Proteomics 13(4): 1020-1033. Meiners, S. and O. Eickelberg (2012). "What shall we do with the damaged proteins in lung disease? Ask the proteasome!" European Respiratory Journal 40(5): 1260-1268. Mendola, P., S. G. Selevan, S. Gutter and D. Rice (2002). "Environmental factors associated with a spectrum of neurodevelopmental deficits." Mental retardation and developmental disabilities research reviews 8(3): 188-197. Miller, R. A., D. E. Harrison, C. M. Astle, E. Fernandez, K. Flurkey, M. Han, M. A. Javors, X. Li, N. L. Nadon and J. F. Nelson (2014). "Rapamycin‐mediated lifespan increase in mice is dose and sex dependent and metabolically distinct from dietary restriction." Aging cell 13(3): 468- 477. Minamino, T., T. Yujiri, P. J. Papst, E. D. Chan, G. L. Johnson and N. Terada (1999). "MEKK1 suppresses oxidative stress-induced apoptosis of embryonic stem cell-derived cardiac myocytes." Proceedings of the National Academy of Sciences 96(26): 15127-15132. Minois, N., D. Carmona-Gutierrez, M. Bauer, P. Rockenfeller, T. Eisenberg, S. Brandhorst, S. Sigrist, G. Kroemer and F. Madeo (2012). "Spermidine promotes stress resistance in Drosophila 279 melanogaster through autophagy-dependent and-independent pathways." Cell death & disease 3(10): e401. Mishto, M., E. Bellavista, A. Santoro, A. Stolzing, C. Ligorio, B. Nacmias, L. Spazzafumo, M. Chiappelli, F. Licastro, S. Sorbi, A. Pession, T. Ohm, T. Grune and C. Franceschi (2006). "Immunoproteasome and LMP2 polymorphism in aged and Alzheimer's disease brains." Neurobiology of Aging 27(1): 54-66. Mitchell, S. J., J. Madrigal-Matute, M. Scheibye-Knudsen, E. Fang, M. Aon, J. A. González- Reyes, S. Cortassa, S. Kaushik, M. Gonzalez-Freire and B. Patel (2016). "Effects of sex, strain, and energy intake on hallmarks of aging in mice." Cell Metabolism 23(6): 1093-1112. Mitchell, Sarah J., J. Madrigal-Matute, M. Scheibye-Knudsen, E. Fang, M. Aon, José A. González-Reyes, S. Cortassa, S. Kaushik, M. Gonzalez-Freire, B. Patel, D. Wahl, A. Ali, M. Calvo-Rubio, María I. Burón, V. Guiterrez, Theresa M. Ward, Hector H. Palacios, H. Cai, David W. Frederick, C. Hine, F. Broeskamp, L. Habering, J. Dawson, T. M. Beasley, J. Wan, Y. Ikeno, G. Hubbard, Kevin G. Becker, Y. Zhang, Vilhelm A. Bohr, Dan L. Longo, P. Navas, L. Ferrucci, David A. Sinclair, P. Cohen, Josephine M. Egan, James R. Mitchell, Joseph A. Baur, David B. Allison, R. M. Anson, José M. Villalba, F. Madeo, Ana M. Cuervo, Kevin J. Pearson, Donald K. Ingram, M. Bernier and R. de Cabo (2016). "Effects of Sex, Strain, and Energy Intake on Hallmarks of Aging in Mice." Cell Metabolism 23(6): 1093-1112. Miwa, S., J. St-Pierre, L. Partridge and M. D. Brand (2003). "Superoxide and hydrogen peroxide production by Drosophila mitochondria." Free Radical Biology and Medicine 35(8): 938-948. Mockett, R. J., A.-C. V. Bayne, L. K. Kwong, W. C. Orr and R. S. Sohal (2003). "Ectopic expression of catalase in Drosophila mitochondria increases stress resistance but not longevity." Free Radical Biology and Medicine 34(2): 207-217. 280 Mori, K., P. E. Blackshear, E. K. Lobenhofer, J. S. Parker, D. P. Orzech, J. H. Roycroft, K. L. Walker, K. A. Johnson, T. A. Marsh and R. D. Irwin (2007). "Hepatic transcript levels for genes coding for enzymes associated with xenobiotic metabolism are altered with age." Toxicologic pathology 35(2): 242-251. Morimoto, R. I. (2008). "Proteotoxic stress and inducible chaperone networks in neurodegenerative disease and aging." Genes Dev 22(11): 1427-1438. Morimoto, R. I. and A. M. Cuervo (2014). "Proteostasis and the aging proteome in health and disease." The Journals of Gerontology Series A: Biological Sciences and Medical Sciences 69(Suppl 1): S33-S38. Moskalev, A., M. Shaposhnikov and E. Turysheva (2009). "Life span alteration after irradiation in Drosophila melanogaster strains with mutations of Hsf and Hsps." Biogerontology 10(1): 3- 11. Mossman, J. A., J. G. Tross, N. Li, Z. Wu and D. M. Rand (2016). "Mitochondrial-Nuclear Interactions Mediate Sex-Specific Transcriptional Profiles in Drosophila." Genetics. Mueller, S., H.-D. Riedel and W. Stremmel (1997). "Direct Evidence for Catalase as the Predominant H2O2 -Removing Enzyme in Human Erythrocytes." Blood 90(12): 4973. Mühlfeld, C., B. Rothen-Rutishauser, F. Blank, D. Vanhecke, M. Ochs and P. Gehr (2008). "Interactions of nanoparticles with pulmonary structures and cellular responses." American Journal of Physiology-Lung Cellular and Molecular Physiology 294(5): L817-L829. Murata, S., H. Yashiroda and K. Tanaka (2009). "Molecular mechanisms of proteasome assembly." Nat Rev Mol Cell Biol 10(2): 104-115. 281 Murthy, M. and J. L. Ram (2015). "Invertebrates as model organisms for research on aging biology." Invertebrate Reproduction & Development 59(sup1): 1-4. Musselman, L. P., J. L. Fink, K. Narzinski, P. V. Ramachandran, S. S. Hathiramani, R. L. Cagan and T. J. Baranski (2011). "A high-sugar diet produces obesity and insulin resistance in wild- type Drosophila." Disease Models and Mechanisms 4(6): 842-849. Myllyharju, J. and K. I. Kivirikko (2004). "Collagens, modifying enzymes and their mutations in humans, flies and worms." Trends in Genetics 20(1): 33-43. Nandi, D., E. Woodward, D. B. Ginsburg and J. J. Monaco (1997). "Intermediates in the formation of mouse 20S proteasomes: implications for the assembly of precursor beta subunits." Embo j 16(17): 5363-5375. Neckameyer, W. S. and J. S. Weinstein (2005). "Stress affects dopaminergic signaling pathways in Drosophila melanogaster." Stress 8(2): 117-131. Nedungadi, T. P. and D. J. Clegg (2009). "Sexual Dimorphism in Body Fat Distribution and Risk for Cardiovascular Diseases." Journal of Cardiovascular Translational Research 2(3): 321-327. Nel, A., T. Xia, L. Mädler and N. Li (2006). "Toxic potential of materials at the nanolevel." science 311(5761): 622-627. Nerland, D. E. (2007). "The antioxidant/electrophile response element motif." Drug Metab Rev 39(1): 235-248. Ngo, J. K. and K. J. Davies (2009). "Mitochondrial Lon protease is a human stress protein." Free Radic. Biol. Med. 46(8): 1042-1048. Ngo, J. K. and K. J. Davies (2009). "Mitochondrial Lon protease is a human stress protein." Free Radic Biol Med 46(8): 1042-1048. 282 Ngo, J. K. and K. J. Davies (2009). "Mitochondrial Lon protease is a human stress protein." Free Radical Biology and Medicine 46(8): 1042-1048. Ngo, J. K., L. C. Pomatto, D. A. Bota, A. L. Koop and K. J. Davies (2011). "Impairment of lon- induced protection against the accumulation of oxidized proteins in senescent wi-38 fibroblasts." The Journals of Gerontology Series A: Biological Sciences and Medical Sciences 66(11): 1178- 1185. Ngo, J. K., L. C. Pomatto, D. A. Bota, A. L. Koop and K. J. Davies (2011). "Impairment of lon- induced protection against the accumulation of oxidized proteins in senescent wi-38 fibroblasts." J. Gerontol. A Biol. Sci. Med. Sci. 66(11): 1178-1185. Ngo, J. K., L. C. Pomatto, D. A. Bota, A. L. Koop and K. J. Davies (2011). "Impairment of lon- induced protection against the accumulation of oxidized proteins in senescent wi-38 fibroblasts." J Gerontol A Biol Sci Med Sci 66(11): 1178-1185. Nie, X., M. Li, B. Lu, Y. Zhang, L. Lan, L. Chen and J. Lu (2013). "Down-regulating overexpressed human Lon in cervical cancer suppresses cell proliferation and bioenergetics." PloS one 8(11): e81084. Ocorr, K., T. Akasaka and R. Bodmer (2007). "Age-related cardiac disease model of Drosophila." Mechanisms of ageing and development 128(1): 112-116. Oliver, C. N., B.-W. Ahn, E. J. Moerman, S. Goldstein and E. R. Stadtman (1987). "Age-related changes in oxidized proteins." Journal of Biological Chemistry 262(12): 5488-5491. Ondrovičová, G., T. Liu, K. Singh, B. Tian, H. Li, O. Gakh, D. Perečko, J. Janata, Z. Granot and J. Orly (2005). "Cleavage site selection within a folded substrate by the ATP-dependent lon protease." Journal of Biological Chemistry 280(26): 25103-25110. 283 Opitz, E., A. Koch, K. Klingel, F. Schmidt, S. Prokop, A. Rahnefeld, M. Sauter, F. L. Heppner, U. Völker and R. Kandolf (2011). "Impairment of immunoproteasome function by β5i/LMP7 subunit deficiency results in severe enterovirus myocarditis." PLoS Pathog 7(9): e1002233. Osterwalder, T., K. S. Yoon, B. H. White and H. Keshishian (2001). "A conditional tissue- specific transgene expression system using inducible GAL4." Proceedings of the National Academy of Sciences 98(22): 12596-12601. Ostrer, H. (1999). "Sex-based differences in gene transmission and gene expression." Lupus 8(5): 365-369. Ota, K., A. Brydun, A. Itoh-Nakadai, J. Sun and K. Igarashi (2014). "Bach1 deficiency and accompanying overexpression of heme oxygenase-1 do not influence aging or tumorigenesis in mice." Oxidative medicine and cellular longevity 2014. Oyake, T., K. Itoh, H. Motohashi, N. Hayashi, H. Hoshino, M. Nishizawa, M. Yamamoto and K. Igarashi (1996). "Bach proteins belong to a novel family of BTB-basic leucine zipper transcription factors that interact with MafK and regulate transcription through the NF-E2 site." Molecular and cellular biology 16(11): 6083-6095. Pacifici, R., Y. Kono and K. Davies (1993). "Hydrophobicity as the signal for selective degradation of hydroxyl radical-modified hemoglobin by the multicatalytic proteinase complex, proteasome." Journal of Biological Chemistry 268(21): 15405-15411. Pagé, E. L., G. A. Robitaille, J. Pouysségur and D. E. Richard (2002). "Induction of hypoxia- inducible factor-1α by transcriptional and translational mechanisms." Journal of Biological Chemistry 277(50): 48403-48409. 284 Pan, J.-X., S. R. Short, S. A. Goff and J. F. Dice (1993). "Ubiquitin pools, ubiquitin mRNA levels, and ubiquitin-mediated proteolysis in aging human fibroblasts." Experimental gerontology 28(1): 39-49. Pandey, U. B. and C. D. Nichols (2011). "Human disease models in Drosophila melanogaster and the role of the fly in therapeutic drug discovery." Pharmacological reviews 63(2): 411-436. Paul, N., M. McMahon, I. Ken, M. Yamamoto and J. D. Hayes (2003). "Identification of a novel Nrf2-regulated antioxidant response element (ARE) in the mouse NAD (P) H: quinone oxidoreductase 1 gene: reassessment of the ARE consensus sequence." Biochemical Journal 374(2): 337-348. Pearson, K. J., J. A. Baur, K. N. Lewis, L. Peshkin, N. L. Price, N. Labinskyy, W. R. Swindell, D. Kamara, R. K. Minor and E. Perez (2008). "Resveratrol delays age-related deterioration and mimics transcriptional aspects of dietary restriction without extending life span." Cell metabolism 8(2): 157-168. Peng, J., X. O. Mao, F. F. Stevenson, M. Hsu and J. K. Andersen (2004). "The Herbicide Paraquat Induces Dopaminergic Nigral Apoptosis through Sustained Activation of the JNK Pathway." Journal of Biological Chemistry 279(31): 32626-32632. Pérez, V. I., R. Buffenstein, V. Masamsetti, S. Leonard, A. B. Salmon, J. Mele, B. Andziak, T. Yang, Y. Edrey and B. Friguet (2009). "Protein stability and resistance to oxidative stress are determinants of longevity in the longest-living rodent, the naked mole-rat." Proceedings of the National Academy of Sciences 106(9): 3059-3064. Peters, B., K. Janek, U. Kuckelkorn and H.-G. Holzhütter (2002). "Assessment of proteasomal cleavage probabilities from kinetic analysis of time-dependent product formation." Journal of molecular biology 318(3): 847-862. 285 Peters, S. A., R. R. Huxley and M. Woodward (2014). "Diabetes as risk factor for incident coronary heart disease in women compared with men: a systematic review and meta-analysis of 64 cohorts including 858,507 individuals and 28,203 coronary events." Diabetologia 57(8): 1542-1551. Peters, S. A. E., R. R. Huxley and M. Woodward "Diabetes as a risk factor for stroke in women compared with men: a systematic review and meta-analysis of 64 cohorts, including 775 385 individuals and 12 539 strokes." The Lancet 383(9933): 1973-1980. Petersen, A., A. Honarvar and M. Zetterberg (2010). "Changes in activity and kinetic properties of the proteasome in different rat organs during development and maturation." Current gerontology and geriatrics research 2010. Pettit, A. P., A. Brooks, R. Laumbach, N. Fiedler, Q. Wang, P. O. Strickland, K. Madura, J. Zhang and H. M. Kipen (2012). "Alteration of peripheral blood monocyte gene expression in humans following diesel exhaust inhalation." Inhal Toxicol 24(3): 172-181. Piao, M. J., K. A. Kang, I. K. Lee, H. S. Kim, S. Kim, J. Y. Choi, J. Choi and J. W. Hyun (2011). "Silver nanoparticles induce oxidative cell damage in human liver cells through inhibition of reduced glutathione and induction of mitochondria-involved apoptosis." Toxicology letters 201(1): 92-100. Pickering, A., A. Koop, C. Teoh, G. Ermak, T. Grune and K. Davies (2010). "The immunoproteasome, the 20S proteasome and the PA28alphabeta proteasome regulator are oxidative-stress-adaptive proteolytic complexes." Biochem. J 432: 585-594. Pickering, A. M. and K. J. Davies (2012). "Degradation of Damaged Proteins-The Main Function of the 20S Proteasome." Progress in molecular biology and translational science 109: 227. 286 Pickering, A. M. and K. J. Davies (2012). "Differential roles of proteasome and immunoproteasome regulators Pa28αβ, Pa28γ and Pa200 in the degradation of oxidized proteins." Archives of biochemistry and biophysics 523(2): 181-190. Pickering, A. M. and K. J. A. Davies (2012). "Degradation of Damaged Proteins-The Main Function of the 20S Proteasome." Progress in molecular biology and translational science 109: 227. Pickering, A. M. and K. J. A. Davies (2012). "Differential roles of proteasome and immunoproteasome regulators Pa28 alpha beta, Pa28 gamma and Pa200 in the degradation of oxidized proteins." Archives of Biochemistry and Biophysics 523(2): 181-190. Pickering, A. M. and K. J. A. Davies (2012). "Differential roles of proteasome and immunoproteasome regulators Pa28αβ, Pa28γ and Pa200 in the degradation of oxidized proteins." Archives of biochemistry and biophysics 523(2): 181-190. Pickering, A. M., A. L. Koop, C. Y. Teoh, G. Ermak, T. Grune and K. J. Davies (2010). "The immunoproteasome, the 20S proteasome and the PA28alphabeta proteasome regulator are oxidative-stress-adaptive proteolytic complexes." Biochem J 432(3): 585-594. Pickering, A. M., A. L. Koop, C. Y. Teoh, G. Ermak, T. Grune and K. J. Davies (2010). "The immunoproteasome, the 20S proteasome and the PA28αβ proteasome regulator are oxidative- stress-adaptive proteolytic complexes." Biochemical Journal 432(3): 585-595. Pickering, A. M., M. Lehr, W. J. Kohler, M. L. Han and R. A. Miller (2015). "Fibroblasts from longer-lived species of primates, rodents, bats, carnivores, and birds resist protein damage." The Journals of Gerontology Series A: Biological Sciences and Medical Sciences 70(7): 791-799. 287 Pickering, A. M., M. Lehr, W. J. Kohler, M. L. Han and R. A. Miller (2015). "Fibroblasts From Longer-Lived Species of Primates, Rodents, Bats, Carnivores, and Birds Resist Protein Damage." J Gerontol A Biol Sci Med Sci 70(7): 791-799. Pickering, A. M., M. Lehr and R. A. Miller (2015). "Lifespan of mice and primates correlates with immunoproteasome expression." The Journal of clinical investigation 125(5): 2059-2068. Pickering, A. M., R. A. Linder, H. Zhang, H. J. Forman and K. J. Davies (2012). "Nrf2- dependent induction of proteasome and Pa28alphabeta regulator are required for adaptation to oxidative stress." J Biol Chem 287(13): 10021-10031. Pickering, A. M., R. A. Linder, H. Zhang, H. J. Forman and K. J. Davies (2012). "Nrf2- dependent induction of proteasome and Pa28αβ regulator are required for adaptation to oxidative stress." Journal of Biological Chemistry 287(13): 10021-10031. Pickering, A. M., R. A. Linder, H. Zhang, H. J. Forman and K. J. A. Davies (2012). "Nrf2- dependent Induction of Proteasome and Pa28αβ Regulator Are Required for Adaptation to Oxidative Stress." Journal of Biological Chemistry 287(13): 10021-10031. Pickering, A. M., T. A. Staab, J. Tower, D. Sieburth and K. J. Davies (2013). "A conserved role for the 20S proteasome and Nrf2 transcription factor in oxidative stress adaptation in mammals, Caenorhabditis elegans and Drosophila melanogaster." The Journal of experimental biology 216(4): 543-553. Pickering, A. M., T. A. Staab, J. Tower, D. Sieburth and K. J. Davies (2013). "A conserved role for the 20S proteasome and Nrf2 transcription factor in oxidative stress adaptation in mammals, Caenorhabditis elegans and Drosophila melanogaster." J Exp Biol 216(Pt 4): 543-553. Pickering, A. M., T. A. Staab, J. Tower, D. Sieburth and K. J. Davies (2013). "A conserved role for the 20S proteasome and Nrf2 transcription factor in oxidative stress adaptation in mammals, 288 Caenorhabditis elegans and Drosophila melanogaster." Journal of Experimental Biology 216(4): 543-553. Pickering, A. M., T. A. Staab, J. Tower, D. Sieburth and K. J. A. Davies (2013). "A conserved role for the 20S proteasome and Nrf2 transcription factor in oxidative stress adaptation in mammals, Caenorhabditis elegans and Drosophila melanogaster." J. Exp. Biol. 216(4): 543-553. Pickering, A. M., T. A. Staab, J. Tower, D. Sieburth and K. J. A. Davies (2013). "A conserved role for the 20S proteasome and Nrf2 transcription factor in oxidative stress adaptation in mammals, Caenorhabditis elegans and Drosophila melanogaster." The Journal of Experimental Biology 216(4): 543-553. Pickering, A. M., L. Vojtovich, J. Tower and K. J. A. Davies (2013). "Oxidative stress adaptation with acute, chronic, and repeated stress." Free Radical Biology and Medicine 55: 109- 118. Pickering, A. M., L. Vojtovich, J. Tower and K. J. A. Davies (2013). "Oxidative stress adaptation with acute, chronic, and repeated stress." Free Radical Biology and Medicine 55(0): 109-118. Pickering, A. M., L. Vojtovich, J. Tower and K. J. Davies (2013). "Oxidative stress adaptation with acute, chronic, and repeated stress." Free Radical Biology and Medicine 55: 109-118. Pinti, M., L. Gibellini, Y. Liu, S. Xu, B. Lu and A. Cossarizza (2015). "Mitochondrial Lon protease at the crossroads of oxidative stress, ageing and cancer." Cell Mol Life Sci 72(24): 4807-4824. Pinto, R. and W. Bartley (1969). "The effect of age and sex on glutathione reductase and glutathione peroxidase activities and on aerobic glutathione oxidation in rat liver homogenates." Biochem. J 112: 109-115. 289 Pope III, C. A., R. T. Burnett, M. J. Thun, E. E. Calle, D. Krewski, K. Ito and G. D. Thurston (2002). "Lung cancer, cardiopulmonary mortality, and long-term exposure to fine particulate air pollution." Jama 287(9): 1132-1141. Pope III, C. A., J. Schwartz and M. R. Ransom (1992). "Daily mortality and PM10 pollution in Utah Valley." Archives of Environmental Health: An International Journal 47(3): 211-217. Powell, S. R., P. Wang, A. Divald, S. Teichberg, V. Haridas, T. W. McCloskey, K. J. Davies and H. Katzeff (2005). "Aggregates of oxidized proteins (lipofuscin) induce apoptosis through proteasome inhibition and dysregulation of proapoptotic proteins." Free Radical Biology and Medicine 38(8): 1093-1101. Power, M. C., M. G. Weisskopf, S. E. Alexeeff, R. O. Wright, B. A. Coull, A. Spiro and J. Schwartz (2013). "Modification by hemochromatosis gene polymorphisms of the association between traffic-related air pollution and cognition in older men: a cohort study." Environmental Health 12(1): 1. Puig, O. and R. Tjian (2006). "Nutrient availability and growth: regulation of insulin signaling by dFOXO/FOXO1." Cell Cycle 5(5): 503-505. Quirós, P. M., Y. Español, R. Acín-Pérez, F. Rodríguez, C. Bárcena, K. Watanabe, E. Calvo, M. Loureiro, M. S. Fernández-García and A. Fueyo (2014). "ATP-dependent Lon protease controls tumor bioenergetics by reprogramming mitochondrial activity." Cell reports 8(2): 542-556. Quirós, Pedro M., Y. Español, R. Acín-Pérez, F. Rodríguez, C. Bárcena, K. Watanabe, E. Calvo, M. Loureiro, M. S. Fernández-García, A. Fueyo, J. Vázquez, José A. Enríquez and C. López- Otín (2014). "ATP-Dependent Lon Protease Controls Tumor Bioenergetics by Reprogramming Mitochondrial Activity." Cell Rep. 8(2): 542-556. 290 R Development Core Team (2010). R: A language and environment for statistical computing. Vienna, Austria, R Foundation for Statistical Computing. Racca, J. D., Y.-S. Chen, Y. Yang, N. B. Phillips and M. A. Weiss (2016). "Human Sex Determination at the Edge of Ambiguity Inherited XY Sex Reversal Due to Enhanced Ubiquitination and Proteasomal Degradation of a Master Transcription Factor." Journal of Biological Chemistry 291(42): 22173-22195. Rada, P., A. I. Rojo, S. Chowdhry, M. McMahon, J. D. Hayes and A. Cuadrado (2011). "SCF/β- TrCP promotes glycogen synthase kinase 3-dependent degradation of the Nrf2 transcription factor in a Keap1-independent manner." Molecular and cellular biology 31(6): 1121-1133. Rada, P., A. I. Rojo, N. Evrard-Todeschi, N. G. Innamorato, A. Cotte, T. Jaworski, J. C. Tobón- Velasco, H. Devijver, M. F. García-Mayoral and F. Van Leuven (2012). "Structural and functional characterization of Nrf2 degradation by the glycogen synthase kinase 3/β-TrCP axis." Molecular and cellular biology 32(17): 3486-3499. Radak, Z., H. Y. Chung, E. Koltai, A. W. Taylor and S. Goto (2008). "Exercise, oxidative stress and hormesis." Ageing research reviews 7(1): 34-42. Rahman, M. M., G. P. Sykiotis, M. Nishimura, R. Bodmer and D. Bohmann (2013). "Declining signal dependence of Nrf2-MafS-regulated gene expression correlates with aging phenotypes." Aging Cell 12(4): 554-562. Ramos, P. C., J. Höckendorff, E. S. Johnson, A. Varshavsky and R. J. Dohmen (1998). "Ump1p is required for proper maturation of the 20S proteasome and becomes its substrate upon completion of the assembly." Cell 92(4): 489-499. 291 Raynes, R., C. Juarez, L. C. Pomatto, D. Sieburth and K. J. Davies (2016). "Aging and SKN-1- dependent Loss of 20S Proteasome Adaptation to Oxidative Stress in C. elegans." The Journals of Gerontology Series A: Biological Sciences and Medical Sciences: glw093. Raynes, R., C. Juarez, L. C. D. Pomatto, D. Sieburth and K. J. A. Davies (2016). "Aging and SKN-1-dependent Loss of 20S Proteasome Adaptation to Oxidative Stress in C. elegans." The Journals of Gerontology Series A: Biological Sciences and Medical Sciences. Raynes, R., L. C. Pomatto and K. J. Davies (2016). "Degradation of oxidized proteins by the proteasome: Distinguishing between the 20S, 26S, and immunoproteasome proteolytic pathways." Molecular aspects of medicine. Reeg, S., T. Jung, J. P. Castro, K. J. A. Davies, A. Henze and T. Grune (2016). "The molecular chaperone Hsp70 promotes the proteolytic removal of oxidatively damaged proteins by the proteasome." Free Radical Biology and Medicine 99: 153-166. Reinheckel, T., N. SITTE, O. ULLRICH, U. KUCKELKORN, K. Davies and T. GRUNE (1998). "Comparative resistance of the 20S and 26S proteasome to oxidative stress." Biochem. J 335: 637-642. REINHECKEL, T., N. SITTE, O. ULLRICH, U. KUCKELKORN, K. J. DAVIES and T. GRUNE (1998). "Comparative resistance of the 20S and 26S proteasome to oxidative stress." Biochemical Journal 335(3): 637-642. Reis-Rodrigues, P., G. Czerwieniec, T. W. Peters, U. S. Evani, S. Alavez, E. A. Gaman, M. Vantipalli, S. D. Mooney, B. W. Gibson, G. J. Lithgow and R. E. Hughes (2012). "Proteomic analysis of age-dependent changes in protein solubility identifies genes that modulate lifespan." Aging Cell 11(1): 120-127. 292 Reits, E., J. Neijssen, C. Herberts, W. Benckhuijsen, L. Janssen, J. W. Drijfhout and J. Neefjes (2004). "A major role for TPPII in trimming proteasomal degradation products for MHC class I antigen presentation." Immunity 20(4): 495-506. Ren, C., S. E. Finkel and J. Tower (2009). "Conditional inhibition of autophagy genes in adult Drosophila impairs immunity without compromising longevity." Experimental gerontology 44(3): 228-235. Ren, C., P. Webster, S. E. Finkel and J. Tower (2007). "Increased internal and external bacterial load during Drosophila aging without life-span trade-off." Cell metabolism 6(2): 144-152. Rep, M., J. M. van Dijl, K. Suda, G. Schatz, L. A. Grivell and C. K. Suzuki (1996). "Promotion of mitochondrial membrane complex assembly by a proteolytically inactive yeast Lon." Science 274(5284): 103-106. Richter, J. D. and N. Sonenberg (2005). "Regulation of cap-dependent translation by eIF4E inhibitory proteins." Nature 433(7025): 477-480. Riddle, D. L. and P. S. Albert (1997). "26 Genetic and Environmental Regulation of Dauer Larva Development." Cold Spring Harbor Monograph Archive 33: 739-768. Rideout, E. J., A. J. Dornan, M. C. Neville, S. Eadie and S. F. Goodwin (2010). "Control of sexual differentiation and behavior by the doublesex gene in Drosophila melanogaster." Nat. Neurosci. 13(4): 458-466. Rideout, E. J., M. S. Narsaiya and S. S. Grewal (2015). "The Sex Determination Gene transformer Regulates Male-Female Differences in Drosophila Body Size." PLoS Genet. 11(12): e1005683. Rideout, E. J., M. S. Narsaiya and S. S. Grewal (2015). "The sex determination gene transformer regulates male-female differences in Drosophila body size." PLoS Genet 11(12): e1005683. 293 Rodríguez, E., M. Monjo, S. Rodríguez-Cuenca, E. Pujol, B. Amengual, P. Roca and A. Palou (2001). "Sexual dimorphism in the adrenergic control of rat brown adipose tissue response to overfeeding." Pflügers Archiv 442(3): 396-403. Rodriguez, K. A., S. G. Dodds, R. Strong, V. Galvan, Z. Sharp and R. Buffenstein (2014). "Divergent tissue and sex effects of rapamycin on the proteasome-chaperone network of old mice." Frontiers in molecular neuroscience 7. Rodriguez, K. A., Y. H. Edrey, P. Osmulski, M. Gaczynska and R. Buffenstein (2012). "Altered composition of liver proteasome assemblies contributes to enhanced proteasome activity in the exceptionally long-lived naked mole-rat." PloS one 7(5): e35890. Rodriguez, K. A., M. Gaczynska and P. A. Osmulski (2010). "Molecular mechanisms of proteasome plasticity in aging." Mechanisms of ageing and development 131(2): 144-155. Rose, M. S., E. A. Lock, L. L. Smith and I. Wyatt (1976). "Paraquat accumulation: tissue and species specificity." Biochemical pharmacology 25(4): 419-423. Rose, M. S., L. L. Smith and I. Wyatt (1974). "Evidence for energy-dependent accumulation of paraquat into rat lung." Ross, J. L. and S. E. Howlett (2012). "Age and ovariectomy abolish beneficial effects of female sex on rat ventricular myocytes exposed to simulated ischemia and reperfusion." PLoS One 7(6): e38425. Ross, M. F., T. Da Ros, F. H. Blaikie, T. A. Prime, C. M. Porteous, I. I. Severina, V. P. Skulachev, H. G. Kjaergaard, R. A. Smith and M. P. Murphy (2006). "Accumulation of lipophilic dications by mitochondria and cells." Biochemical journal 400(1): 199-208. Roubenoff, R. (2000). "Sarcopenia and its implications for the elderly." European journal of clinical nutrition 54: S40-47. 294 Roy, A. K. and B. Chatterjee (1983). "Sexual dimorphism in the liver." Annual review of physiology 45(1): 37-50. Sahakian, J. A., L. I. Szweda, B. Friguet, K. Kitani and R. L. Levine (1995). "Aging of the liver: proteolysis of oxidatively modified glutamine synthetase." Archives of biochemistry and biophysics 318(2): 411-417. Salazar, M., A. I. Rojo, D. Velasco, R. M. de Sagarra and A. Cuadrado (2006). "Glycogen synthase kinase-3β inhibits the xenobiotic and antioxidant cell response by direct phosphorylation and nuclear exclusion of the transcription factor Nrf2." Journal of Biological Chemistry 281(21): 14841-14851. Salvemini, F., A. Franzé, A. Iervolino, S. Filosa, S. Salzano and M. V. Ursini (1999). "Enhanced glutathione levels and oxidoresistance mediated by increased glucose-6-phosphate dehydrogenase expression." Journal of Biological Chemistry 274(5): 2750-2757. Sandy, M. S., P. Moldeus, D. Ross and M. T. Smith (1986). "Role of redox cycling and lipid peroxidation in bipyridyl herbicide cytotoxicity: Studies with a compromised isolated hepatocyte model system." Biochemical pharmacology 35(18): 3095-3101. Santulli, G. (2013). "Epidemiology of cardiovascular disease in the 21st century: updated numbers and updated facts." JCvD 1(1): 1-2. Sastre, J., F. V. Pallardo, R. Plá, A. Pellín, G. Juan, J. E. O'Connor, J. M. Estrela, J. Miquel and J. Vina (1996). "Aging of the liver: Age‐associated mitochondrial damage in intact hepatocytes." Hepatology 24(5): 1199-1205. Schreck, R., P. Rieber and P. A. Baeuerle (1991). "Reactive oxygen intermediates as apparently widely used messengers in the activation of the NF-kappa B transcription factor and HIV-1." The EMBO journal 10(8): 2247. 295 Seifarth, J. E., C. L. McGowan and K. J. Milne (2012). "Sex and life expectancy." Gender medicine 9(6): 390-401. Selman, C., S. Lingard, A. I. Choudhury, R. L. Batterham, M. Claret, M. Clements, F. Ramadani, K. Okkenhaug, E. Schuster, E. Blanc, M. D. Piper, H. Al-Qassab, J. R. Speakman, D. Carmignac, I. C. Robinson, J. M. Thornton, D. Gems, L. Partridge and D. J. Withers (2008). "Evidence for lifespan extension and delayed age-related biomarkers in insulin receptor substrate 1 null mice." Faseb J 22(3): 807-818. Semenchenko, G. V., A. A. Khazaeli, J. W. Curtsinger and A. I. Yashin "Stress resistance declines with age: analysis of data from a survival experiment with Drosophila melanogaster." Biogerontology 5(1): 17-30. Shang, F. and A. Taylor (1995). "Oxidative stress and recovery from oxidative stress are associated with altered ubiquitin conjugating and proteolytic activities in bovine lens epithelial cells." Biochemical Journal 307(1): 297-303. Sharon, M., S. Witt, K. Felderer, B. Rockel, W. Baumeister and C. V. Robinson (2006). "20S proteasomes have the potential to keep substrates in store for continual degradation." Journal of Biological Chemistry 281(14): 9569-9575. Sharp, C. W., A. Ottolenghi and H. S. Posner (1972). "Correlation of paraquat toxicity with tissue concentrations and weight loss of the rat." Toxicology and applied pharmacology 22(2): 241-251. Sharpless, N. E. and R. A. DePinho (2006). "The mighty mouse: genetically engineered mouse models in cancer drug development." Nature reviews Drug discovery 5(9): 741-754. Shen, J., G. N. Landis and J. Tower (2016). "Multiple Metazoan Life-span Interventions Exhibit a Sex-specific Strehler–Mildvan Inverse Relationship Between Initial Mortality Rate and Age- 296 dependent Mortality Rate Acceleration." The Journals of Gerontology Series A: Biological Sciences and Medical Sciences: glw005. Shen, J., G. N. Landis and J. Tower (2016). "Multiple Metazoan Life-span Interventions Exhibit a Sex-specific Strehler–Mildvan Inverse Relationship Between Initial Mortality Rate and Age- dependent Mortality Rate Acceleration." The Journals of Gerontology Series A: Biological Sciences and Medical Sciences. Shen, J. and J. Tower (2010). "Drosophila foxo acts in males to cause sexual-dimorphism in tissue-specific p53 life span effects." Exp Gerontol 45: 97-105. Shibatani, T., M. Nazir and W. F. Ward (1996). "Alteration of Rat Liver 20S Proteasome Activities by Age and Food Restriction." The Journals of Gerontology Series A: Biological Sciences and Medical Sciences 51A(5): B316-B322. Shigenaga, M. K., T. M. Hagen and B. N. Ames (1994). "Oxidative damage and mitochondrial decay in aging." Proceedings of the National Academy of Sciences 91(23): 10771-10778. Shih, P.-H. and G.-C. Yen (2007). "Differential expressions of antioxidant status in aging rats: the role of transcriptional factor Nrf2 and MAPK signaling pathway." Biogerontology 8(2): 71- 80. Shringarpure, R. and K. J. Davies (2002). "Protein turnover by the proteasome in aging and disease." Free Radic Biol Med 32(11): 1084-1089. Shringarpure, R. and K. J. Davies (2002). "Protein turnover by the proteasome in aging and disease 1, 2." Free Radical Biology and Medicine 32(11): 1084-1089. Shringarpure, R., T. Grune and K. Davies (2001). "Protein oxidation and 20S proteasome- dependent proteolysis in mammalian cells." Cellular and Molecular Life Sciences CMLS 58(10): 1442-1450. 297 Shringarpure, R., T. Grune, J. Mehlhase and K. J. Davies (2003). "Ubiquitin conjugation is not required for the degradation of oxidized proteins by proteasome." J Biol Chem 278(1): 311-318. Siddiqui, M. A., H. A. Alhadlaq, J. Ahmad, A. A. Al-Khedhairy, J. Musarrat and M. Ahamed (2013). "Copper oxide nanoparticles induced mitochondria mediated apoptosis in human hepatocarcinoma cells." PLoS One 8(8): e69534. Silva, G. M., D. Finley and C. Vogel (2015). "K63 polyubiquitination is a new modulator of the oxidative stress response." Nat Struct Mol Biol 22(2): 116-123. Sitte, N., M. Huber, T. Grune, A. Ladhoff, W.-D. Doecke, T. Von Zglincki and K. J. A. Davies (2000). "Proteasome inhibition by lipofuscin/ceroid during postmitotic aging of fibroblasts." The FASEB Journal 14(11): 1490-1498. SITTE, N., M. HUBER, T. GRUNE, A. LADHOFF, W.-D. DOECKE, T. VON ZGLINICKI and K. J. A. DAVIES (2000). "Proteasome inhibition by lipofuscin/ceroid during postmitotic aging of fibroblasts." The FASEB Journal 14(11): 1490-1498. Sitte, N., M. Huber, T. Grune, A. Ladhoff, W. D. Doecke, T. Von Zglinicki and K. J. Davies (2000). "Proteasome inhibition by lipofuscin/ceroid during postmitotic aging of fibroblasts." FASEB J 14(11): 1490-1498. Sitte, N., K. Merker, T. Von Zglinicki, K. J. Davies and T. Grune (2000). "Protein oxidation and degradation during cellular senescence of human BJ fibroblasts: part II--aging of nondividing cells." FASEB J 14(15): 2503-2510. Sitte, N., K. Merker, T. Von Zglinicki, K. J. A. Davies and T. Grune (2000). "Protein oxidation and degradation during cellular senescence of human BJ fibroblasts: part II—aging of nondividing cells." The FASEB Journal 14(15): 2503-2510. 298 Sitte, N., K. Merker, T. Von Zglinicki, T. Grune and K. J. Davies (2000). "Protein oxidation and degradation during cellular senescence of human BJ fibroblasts: part I--effects of proliferative senescence." FASEB J 14(15): 2495-2502. Smith, C., J. M. Carney, P. Starke-Reed, C. Oliver, E. Stadtman, R. Floyd and W. Markesbery (1991). "Excess brain protein oxidation and enzyme dysfunction in normal aging and in Alzheimer disease." Proceedings of the National Academy of Sciences 88(23): 10540-10543. Smith, L., A. Wright, I. Wyatt and M. Rose (1974). "Effective treatment for paraquat poisoning in rats and its relevance to treatment of paraquat poisoning in man." Br Med J 4(5944): 569-571. Smith, L. L. (1987). "Mechanism of Paraquat Toxicity in Lung and its Relevance to Treatment." Human & Experimental Toxicology 6(1): 31-36. Smith, L. L. and I. Wyatt (1981). "The accumulation of putrescine into slices of rat lung and brain and its relationship to the accumulation of paraquat." Biochemical pharmacology 30(10): 1053-1058. Smith, P., D. Heath and J. Kay (1974). "The pathogenesis and structure of paraquat‐induced pulmonary fibrosis in rats." The Journal of pathology 114(2): 57-67. Sohal, R., S. Agarwal, M. Candas, M. J. Forster and H. Lal (1994). "Effect of age and caloric restriction on DNA oxidative damage in different tissues of C57BL/6 mice." Mechanisms of ageing and development 76(2-3): 215-224. Sohal, R. S., A. Agarwal, S. Agarwal and W. C. Orr (1995). "Simultaneous Overexpression of Copper- and Zinc-containing Superoxide Dismutase and Catalase Retards Age-related Oxidative Damage and Increases Metabolic Potential in Drosophila melanogaster." Journal of Biological Chemistry 270(26): 15671-15674. 299 Sonezaki, S., K. Okita, T. Oba, Y. Ishii, A. Kondo and Y. Kato (1995). "Protein substrates and heat shock reduce the DNA-binding ability of Escherichia coli Lon protease." Applied Microbiology and Biotechnology 44(3-4): 484-488. Squier, T. C. (2001). "Oxidative stress and protein aggregation during biological aging." Experimental gerontology 36(9): 1539-1550. Stadtman, E. and R. Levine (2003). "Free radical-mediated oxidation of free amino acids and amino acid residues in proteins." Amino acids 25(3-4): 207-218. Stadtman, E. R. (1992). "Protein oxidation and aging." Science 257(5074): 1220-1224. Stadtman, E. R. (2001). "Protein oxidation in aging and age‐related diseases." Annals of the New York Academy of Sciences 928(1): 22-38. Stenoien, D. L., C. J. Cummings, H. P. Adams, M. G. Mancini, K. Patel, G. N. DeMartino, M. Marcelli, N. L. Weigel and M. A. Mancini (1999). "Polyglutamine-expanded androgen receptors form aggregates that sequester heat shock proteins, proteasome components and SRC-1, and are suppressed by the HDJ-2 chaperone." Hum Mol Genet 8(5): 731-741. Stohwasser, R., S. Standera, I. Peters, P. M. Kloetzel and M. Groettrup (1997). "Molecular cloning of the mouse proteasome subunits MC14 and MECL‐1: reciprocally regulated tissue expression of interferon‐γ‐modulated proteasome subunits." European journal of immunology 27(5): 1182-1187. Stoneley, M. and A. E. Willis (2004). "Cellular internal ribosome entry segments: structures, trans-acting factors and regulation of gene expression." Oncogene 23(18): 3200-3207. Strehler, B. L. and A. S. Mildvan (1960). "General theory of mortality and aging. a stochastic model relates observations on aging, physiologic decline, mortality, and radiation." Science See Saiensu 132. 300 Suetta, C., U. Frandsen, L. Jensen, M. M. Jensen, J. G. Jespersen, L. G. Hvid, M. Bayer, S. J. Petersson, H. D. Schroder, J. L. Andersen, K. M. Heinemeier, P. Aagaard, P. Schjerling and M. Kjaer (2012). "Aging affects the transcriptional regulation of human skeletal muscle disuse atrophy." PLoS One 7(12): e51238. Suh, J. H., S. V. Shenvi, B. M. Dixon, H. Liu, A. K. Jaiswal, R.-M. Liu and T. M. Hagen (2004). "Decline in transcriptional activity of Nrf2 causes age-related loss of glutathione synthesis, which is reversible with lipoic acid." Proceedings of the National Academy of Sciences of the United States of America 101(10): 3381-3386. Sun, J., H. Hoshino, K. Takaku, O. Nakajima, A. Muto, H. Suzuki, S. Tashiro, S. Takahashi, S. Shibahara and J. Alam (2002). "Hemoprotein Bach1 regulates enhancer availability of heme oxygenase‐1 gene." The EMBO journal 21(19): 5216-5224. Suzuki, C., K. Suda, N. Wang and G. Schatz (1994). "Requirement for the yeast gene LON in intramitochondrial proteolysis and maintenance of respiration." Science 264(5156): 273-276. Suzuki, C. K., K. Suda, N. Wang and G. Schatz (1994). "Requirement for the yeast gene LON in intramitochondrial proteolysis and maintenance of respiration." Science 264(5156): 273-276. Suzuki, H., S. Tashiro, J. Sun, H. Doi, S. Satomi and K. Igarashi (2003). "Cadmium induces nuclear export of Bach1, a transcriptional repressor of heme oxygenase-1 gene." Journal of Biological Chemistry 278(49): 49246-49253. Sykiotis, G. P. and D. Bohmann (2008). "Keap1/Nrf2 signaling regulates oxidative stress tolerance and lifespan in Drosophila." Dev. Cell. 14(1): 76-85. Sykiotis, G. P. and D. Bohmann (2008). "Keap1/Nrf2 signaling regulates oxidative stress tolerance and lifespan in Drosophila." Developmental cell 14(1): 76-85. 301 Sykiotis, G. P. and D. Bohmann (2008). "Keap1/Nrf2 signaling regulates oxidative stress tolerance and lifespan in Drosophila." Dev Cell 14(1): 76-85. Sykiotis, G. P. and D. Bohmann (2010). "Stress-activated cap’n’collar transcription factors in aging and human disease." Science signaling 3(112): re3. Taguchi, K., H. Motohashi and M. Yamamoto (2011). "Molecular mechanisms of the Keap1- Nrf2 pathway in stress response and cancer evolution." Genes Cells 16(2): 123-140. Tanase, M., A. M. Urbanska, V. Zolla, C. C. Clement, L. Huang, K. Morozova, C. Follo, M. Goldberg, B. Roda and P. Reschiglian (2016). "Role of Carbonyl Modifications on Aging- Associated Protein Aggregation." Scientific reports 6: 19311. Tanoka, K. and M. Kasahara (1998). "The MHC class I ligand‐generating system: roles of immunoproteasomes and the interferon‐4gMY‐inducible proteasome activator PA28." Immunological reviews 163(1): 161-176. Tatar, M., A. Bartke and A. Antebi (2003). "The endocrine regulation of aging by insulin-like signals." Science 299(5611): 1346-1351. Tatar, M., A. Kopelman, D. Epstein, M.-P. Tu, C.-M. Yin and R. Garofalo (2001). "A mutant Drosophila insulin receptor homolog that extends life-span and impairs neuroendocrine function." Science 292(5514): 107-110. Taylor, R. C. and A. Dillin (2011). "Aging as an event of proteostasis collapse." Cold Spring Harb Perspect Biol 3(5). Teodoro, J. S., A. M. Simões, F. V. Duarte, A. P. Rolo, R. C. Murdoch, S. M. Hussain and C. M. Palmeira (2011). "Assessment of the toxicity of silver nanoparticles in vitro: a mitochondrial perspective." Toxicology in Vitro 25(3): 664-670. 302 Teoh, C. Y. and K. J. A. Davies (2004). "Potential roles of protein oxidation and the immunoproteasome in MHC class I antigen presentation: the ‘PrOxI’hypothesis." Archives of biochemistry and biophysics 423(1): 88-96. Thimmulappa, R. K., K. H. Mai, S. Srisuma, T. W. Kensler, M. Yamamoto and S. Biswal (2002). "Identification of Nrf2-regulated genes induced by the chemopreventive agent sulforaphane by oligonucleotide microarray." Cancer research 62(18): 5196-5203. Thiruchelvam, M., A. McCormack, E. K. Richfield, R. B. Baggs, A. W. Tank, D. A. Di Monte and D. A. Cory‐Slechta (2003). "Age‐related irreversible progressive nigrostriatal dopaminergic neurotoxicity in the paraquat and maneb model of the Parkinson's disease phenotype." European Journal of Neuroscience 18(3): 589-600. Thomas, R. E., L. A. Andrews, J. L. Burman, W.-Y. Lin and L. J. Pallanck (2014). "PINK1- Parkin Pathway Activity Is Regulated by Degradation of PINK1 in the Mitochondrial Matrix." PLoS Genet 10(5): e1004279. Tierney, D., L. Ayers, S. Herzog and J. Yang (1973). "Pentose Pathway and Production of Reduced Nicotinamide Adenine Dinucleotide Phosphate: A Mechanism That May Protect Lungs from Oxidants 1, 2." American Review of Respiratory Disease 108(6): 1348-1351. Tournier, C., P. Hess, D. D. Yang, J. Xu, T. K. Turner, A. Nimnual, D. Bar-Sagi, S. N. Jones, R. A. Flavell and R. J. Davis (2000). "Requirement of JNK for stress-induced activation of the cytochrome c-mediated death pathway." Science 288(5467): 870-874. Tower, J. (2009). "Hsps and aging." Trends Endocrinol Metab 20(5): 216-222. Tower, J. (2011). "Heat shock proteins and Drosophila aging." Exp Gerontol 46(5): 355-362. Tower, J. (2015). "Mitochondrial maintenance failure in aging and role of sexual dimorphism." Archives of Biochemistry and Biophysics 576: 17-31. 303 Tower, J. (2015). "Mitochondrial maintenance failure in aging and role of sexual dimorphism." Arch Biochem Biophys 576: 17-31. Tsakiri, E. N., G. P. Sykiotis, I. S. Papassideri, V. G. Gorgoulis, D. Bohmann and I. P. Trougakos (2013). "Differential regulation of proteasome functionality in reproductive vs. somatic tissues of Drosophila during aging or oxidative stress." The FASEB Journal 27(6): 2407- 2420. Tsakiri, E. N., G. P. Sykiotis, I. S. Papassideri, E. Terpos, M. A. Dimopoulos, V. G. Gorgoulis, D. Bohmann and I. P. Trougakos (2013). "Proteasome dysfunction in Drosophila signals to an Nrf2-dependent regulatory circuit aiming to restore proteostasis and prevent premature aging." Aging Cell 12(5): 802-813. Tsakiri, E. N., G. P. Sykiotis, I. S. Papassideri, E. Terpos, M. A. Dimopoulos, V. G. Gorgoulis, D. Bohmann and I. P. Trougakos (2013). "Proteasome dysfunction in Drosophila signals to an Nrf2-dependent regulatory circuit aiming to restore proteostasis and prevent premature aging." Aging Cell 12(5): 802-813. Tseng, B. P., K. N. Green, J. L. Chan, M. Blurton-Jones and F. M. LaFerla (2008). "Aβ inhibits the proteasome and enhances amyloid and tau accumulation." Neurobiology of Aging 29(11): 1607-1618. Tullis, K. M., C. J. Krebs, J. Y. Leung and D. M. Robins (2003). "The regulator of sex-limitation gene, rsl, enforces male-specific liver gene expression by negative regulation." Endocrinology 144(5): 1854-1860. Udy, G. B., R. P. Towers, R. G. Snell, R. J. Wilkins, S.-H. Park, P. A. Ram, D. J. Waxman and H. W. Davey (1997). "Requirement of STAT5b for sexual dimorphism of body growth rates and liver gene expression." Proceedings of the National Academy of Sciences 94(14): 7239-7244. 304 Unno, M., T. Mizushima, Y. Morimoto, Y. Tomisugi, K. Tanaka, N. Yasuoka and T. Tsukihara (2002). "The Structure of the Mammalian 20S Proteasome at 2.75 Å Resolution." Structure 10(5): 609-618. Valko, M., C. Rhodes, J. Moncol, M. Izakovic and M. Mazur (2006). "Free radicals, metals and antioxidants in oxidative stress-induced cancer." Chemico-biological interactions 160(1): 1-40. Valle, A., R. Guevara, F. J. Garcia-Palmer, P. Roca and J. Oliver (2007). "Sexual dimorphism in liver mitochondrial oxidative capacity is conserved under caloric restriction conditions." American Journal of Physiology-Cell Physiology 293(4): C1302-C1308. Van Dyck, L., D. A. Pearce and F. Sherman (1994). "PIM1 encodes a mitochondrial ATP- dependent protease that is required for mitochondrial function in the yeast Saccharomyces cerevisiae." Journal of Biological Chemistry 269(1): 238-242. Vanhooren, V. and C. Libert (2013). "The mouse as a model organism in aging research: Usefulness, pitfalls and possibilities." Ageing Research Reviews 12(1): 8-21. Venables, J. P., J. Tazi and F. Juge (2012). "Regulated functional alternative splicing in Drosophila." Nucleic Acids Research 40(1): 1-10. Verheyen, G. R., J.-M. Nuijten, P. Van Hummelen and G. R. Schoeters (2004). "Microarray analysis of the effect of diesel exhaust particles on in vitro cultured macrophages." Toxicology in vitro 18(3): 377-391. Verhoef, L. G., K. Lindsten, M. G. Masucci and N. P. Dantuma (2002). "Aggregate formation inhibits proteasomal degradation of polyglutamine proteins." Hum Mol Genet 11(22): 2689- 2700. Verhulst, E. C., L. van de Zande and L. W. Beukeboom (2010). "Insect sex determination: it all evolves around transformer." Curr Opin Genet Dev 20(4): 376-383. 305 Verhulst, E. C., L. van de Zande and L. W. Beukeboom (2010). "Insect sex determination: it all evolves around transformer." Curr. Opin. Genet. Dev. 20(4): 376-383. Vermilion, J. L. and M. J. Coon (1978). "Identification of the high and low potential flavins of liver microsomal NADPH-cytochrome P-450 reductase." Journal of Biological Chemistry 253(24): 8812-8819. Vernace, V. A., L. Arnaud, T. Schmidt-Glenewinkel and M. E. Figueiredo-Pereira (2007). "Aging perturbs 26S proteasome assembly in Drosophila melanogaster." The FASEB Journal 21(11): 2672-2682. Vilchez, D., I. Morantte, Z. Liu, P. M. Douglas, C. Merkwirth, A. P. Rodrigues, G. Manning and A. Dillin (2012). "RPN-6 determines C. elegans longevity under proteotoxic stress conditions." Nature 489(7415): 263-268. Vögtle, F.-N. and C. Meisinger (2012). "Sensing mitochondrial homeostasis: the protein import machinery takes control." Developmental cell 23(2): 234-236. Volk, H. E., F. Lurmann, B. Penfold, I. Hertz-Picciotto and R. McConnell (2013). "Traffic- related air pollution, particulate matter, and autism." JAMA psychiatry 70(1): 71-77. Waelter, S., A. Boeddrich, R. Lurz, E. Scherzinger, G. Lueder, H. Lehrach and E. E. Wanker (2001). "Accumulation of mutant huntingtin fragments in aggresome-like inclusion bodies as a result of insufficient protein degradation." Molecular biology of the cell 12(5): 1393-1407. Walker, L. C. (1997). "Animal models of cerebral β-amyloid angiopathy." Brain research reviews 25(1): 70-84. Wallace, D. C. (1992). "Diseases of the mitochondrial DNA." Annual review of biochemistry 61(1): 1175-1212. 306 Wang, F., Q. He, Y. Sun, X. Dai and X. P. Yang (2010). "Female adult mouse cardiomyocytes are protected against oxidative stress." Hypertension 55(5): 1172-1178. Wang, H. M., K. C. Cheng, C. J. Lin, S. W. Hsu, W. C. Fang, T. F. Hsu, C. C. Chiu, H. W. Chang, C. H. Hsu and A. Y. L. Lee (2010). "Obtusilactone A and (−)‐sesamin induce apoptosis in human lung cancer cells by inhibiting mitochondrial Lon protease and activating DNA damage checkpoints." Cancer science 101(12): 2612-2620. Wang, M. C., D. Bohmann and H. Jasper (2003). "JNK Signaling Confers Tolerance to Oxidative Stress and Extends Lifespan in Drosophila." Developmental Cell 5(5): 811-816. Wang, N., S. Gottesman, M. C. Willingham, M. M. Gottesman and M. R. Maurizi (1993). "A human mitochondrial ATP-dependent protease that is highly homologous to bacterial Lon protease." Proceedings of the National Academy of Sciences 90(23): 11247-11251. Wang, N., M. R. Maurizi, L. Emmert-Buck and M. M. Gottesman (1994). "Synthesis, processing, and localization of human Lon protease." J. Biol. Chem. 269(46): 29308-29313. Wang, X. and J. Robbins (2006). "Heart failure and protein quality control." Circ Res 99(12): 1315-1328. Wang, X., J. Yen, P. Kaiser and L. Huang (2010). "Regulation of the 26S Proteasome Complex During Oxidative Stress." Science signaling 3(151): ra88-ra88. Ward-Caviness, C. K., J. C. Nwanaji-Enwerem, K. Wolf, S. Wahl, E. Colicino, L. Trevisi, I. Kloog, A. C. Just, P. Vokonas and J. Cyrys (2016). "Long-term exposure to air pollution is associated with biological aging." Oncotarget. Waskar, M., G. N. Landis, J. Shen, C. Curtis, K. Tozer, D. Abdueva, D. Skvortsov, S. Tavare and J. Tower (2009). "Drosophila melanogaster p53 has developmental stage-specific and sex- 307 specific effects on adult life span indicative of sexual antagonistic pleiotropy." Aging (Albany NY) 1(11): 903-936. Waxman, L., J. M. Fagan and A. L. Goldberg (1987). "Demonstration of two distinct high molecular weight proteases in rabbit reticulocytes, one of which degrades ubiquitin conjugates." Journal of Biological Chemistry 262(6): 2451-2457. Weindruch, R., T. Kayo, C.-K. Lee and T. A. Prolla (2001). "Microarray profiling of gene expression in aging and its alteration by caloric restriction in mice." The Journal of nutrition 131(3): 918S-923S. Weindruch, R. and R. L. Walford (1982). "Dietary restriction in mice beginning at 1 year of age: effect on life-span and spontaneous cancer incidence." Science 215(4538): 1415-1418. Weindruch, R., R. L. Walford, S. Fligiel and D. Guthrie (1986). "The retardation of aging in mice by dietary restriction: longevity, cancer, immunity and lifetime energy intake." J Nutr 116(4): 641-654. Wetzel, R. (1994). "Mutations and off-pathway aggregation of proteins." Trends in biotechnology 12(5): 193-198. Weuve, J., R. C. Puett, J. Schwartz, J. D. Yanosky, F. Laden and F. Grodstein (2012). "Exposure to particulate air pollution and cognitive decline in older women." Archives of internal medicine 172(3): 219-227. Whitmarsh, A. and R. Davis (1996). "Transcription factor AP-1 regulation by mitogen-activated protein kinase signal transduction pathways." Journal of molecular medicine 74(10): 589-607. Wiese, A. G., R. E. Pacifici and K. J. Davies (1995). "Transient adaptation to oxidative stress in mammalian cells." Archives of Biochemistry and Biophysics 318(1): 231-240. 308 Wiese, A. G., R. E. Pacifici and K. J. A. Davies (1995). "Transient Adaptation to Oxidative Stress in Mammalian Cells." Archives of biochemistry and biophysics 318(1): 231-240. Wiggins, C. M., P. Tsvetkov, M. Johnson, C. L. Joyce, C. A. Lamb, N. J. Bryant, D. Komander, Y. Shaul and S. J. Cook (2011). "BIMEL, an intrinsically disordered protein, is degraded by 20S proteasomes in the absence of poly-ubiquitylation." Journal of Cell Science 124(6): 969-977. Wong, R., M. D. Piper, B. Wertheim and L. Partridge (2009). "Quantification of food intake in Drosophila." PloS one 4(6): e6063. Woodward, N., C. E. Finch and T. E. Morgan (2015). "Traffic-related air pollution and brain development." AIMS environmental science 2(2): 353. Wooten, G. F., L. J. Currie, V. E. Bovbjerg, J. K. Lee and J. Patrie (2004). "Are men at greater risk for Parkinson’s disease than women?" Journal of Neurology, Neurosurgery & Psychiatry 75(4): 637-639. Xue, X., Y. Zhu and J. Mao (2007). "[Effect of RNA interference for Lon gene silencing on growth and apoptosis of human breast cancer MCF7 cells]." Nan fang yi ke da xue xue bao= Journal of Southern Medical University 27(6): 870-874. Yang, X., E. E. Schadt, S. Wang, H. Wang, A. P. Arnold, L. Ingram-Drake, T. A. Drake and A. J. Lusis (2006). "Tissue-specific expression and regulation of sexually dimorphic genes in mice." Genome research 16(8): 995-1004. Yang, Y., K. Fruh, K. Ahn and P. A. Peterson (1995). "In vivo assembly of the proteasomal complexes, implications for antigen processing." J Biol Chem 270(46): 27687-27694. Yarian, C. S., D. Toroser and R. S. Sohal (2006). "Aconitase is the main functional target of aging in the citric acid cycle of kidney mitochondria from mice." Mechanisms of ageing and development 127(1): 79-84. 309 Ye, J., G. Coulouris, I. Zaretskaya, I. Cutcutache, S. Rozen and T. L. Madden (2012). "Primer- BLAST: a tool to design target-specific primers for polymerase chain reaction." BMC bioinformatics 13(1): 134. Ye, J., G. Coulouris, I. Zaretskaya, I. Cutcutache, S. Rozen and T. L. Madden (2012). "Primer- BLAST: a tool to design target-specific primers for polymerase chain reaction." BMC bioinformatics 13(1): 1. Yun, Young S., Kwan H. Kim, B. Tschida, Z. Sachs, Klara E. Noble-Orcutt, Branden S. Moriarity, T. Ai, R. Ding, J. Williams, L. Chen, D. Largaespada and D.-H. Kim (2016). "mTORC1 Coordinates Protein Synthesis and Immunoproteasome Formation via PRAS40 to Prevent Accumulation of Protein Stress." Molecular Cell 61(4): 625-639. Zaha, V. G., D. Qi, K. N. Su, M. Palmeri, H. Y. Lee, X. Hu, X. Wu, G. I. Shulman, P. S. Rabinovitch, R. R. Russell, 3rd and L. H. Young (2016). "AMPK is critical for mitochondrial function during reperfusion after myocardial ischemia." J Mol Cell Cardiol 91: 104-113. Zanker, D., J. Waithman, J. W. Yewdell and W. Chen (2013). "Mixed proteasomes function to increase viral peptide diversity and broaden antiviral CD8+ T cell responses." The Journal of Immunology 191(1): 52-59. Zehnbauer, B. A., E. C. Foley, G. W. Henderson and A. Markovitz (1981). "Identification and purification of the Lon+ (capR+) gene product, a DNA-binding protein." Proceedings of the National Academy of Sciences 78(4): 2043-2047. Zhang, H., K. J. Davies and H. J. Forman (2015). "Oxidative stress response and Nrf2 signaling in aging." Free Radical Biology and Medicine 88: 314-336. 310 Zhang, H. and H. J. Forman (2010). "Reexamination of the electrophile response element sequences and context reveals a lack of consensus in gene function." Biochimica et Biophysica Acta (BBA)-Gene Regulatory Mechanisms 1799(7): 496-501. Zhang, H., H. Liu, K. J. Davies, C. Sioutas, C. E. Finch, T. E. Morgan and H. J. Forman (2012). "Nrf2-regulated phase II enzymes are induced by chronic ambient nanoparticle exposure in young mice with age-related impairments." Free Radical Biology and Medicine 52(9): 2038- 2046. Zhang, J., T. N. Dinh, K. Kappeler, G. Tsaprailis and Q. M. Chen (2012). "La autoantigen mediates oxidant induced de novo Nrf2 protein translation." Molecular & Cellular Proteomics 11(6): M111. 015032. Zhang, Y., A. Bokov, J. Gelfond, V. Soto, Y. Ikeno, G. Hubbard, V. Diaz, L. Sloane, K. Maslin and S. Treaster (2014). "Rapamycin extends life and health in C57BL/6 mice." The Journals of Gerontology Series A: Biological Sciences and Medical Sciences 69(2): 119-130. Zhao, W., T. Zhao, Y. Chen, R. A. Ahokas and Y. Sun (2008). "Oxidative stress mediates cardiac fibrosis by enhancing transforming growth factor-beta1 in hypertensive rats." Mol Cell Biochem 317(1-2): 43-50. Zheng, H., Y. Yang and K. C. Land (2011). "Heterogeneity in the Strehler-Mildvan general theory of mortality and aging." Demography 48(1): 267-290. Zhu, F., Q. Li, F. Zhang, X. Sun, G. Cai, W. Zhang and X. Chen (2015). "Chronic lithium treatment diminishes the female advantage in lifespan in Drosophila melanogaster." Clinical and Experimental Pharmacology and Physiology 42(6): 617-621. Zhu, H., Z. Jia, L. Zhang, M. Yamamoto, H. P. Misra, M. A. Trush and Y. Li (2008). "Antioxidants and Phase 2 Enzymes in Macrophages: Regulation by Nrf2 Signaling and 311 Protection Against Oxidative and Electrophilic Stress." Experimental Biology and Medicine 233(4): 463-474. Zuckerman, B. M. and S. Himmelhoch (1980). "Nematodes as models to study aging." Nematodes as biological models 2: 3-28.

Abstract (if available)

Abstract A major hallmark of aging is the loss of protein homeostasis and the dysregulation of the adaptive stress response pathways or ‘adaptive homeostasis’ (Davies, 2016). Loss of adaptive homeostasis, increases cellular vulnerability for DNA, protein, and lipid damage. If damage is not immediately removed, protein aggregates can accumulate and accelerate cellular senescence. ❧ To mitigate damage accrual from environmental or physiological stress, adaptive homeostasis is a widely-characterized phenomenon, which enables cells, tissues, or organisms, pretreated with a mild stress, to activate the stress responsive pathway to mitigate future oxidative insult. Two crucial proteins in this pathway are the cytosolic 20S proteasome and the mitochondrial ATP-dependent Lon protease, both of which act to remove oxidized or misfolded proteins. In vitro studies in cell culture showed both the expression of the Lon protease (Ngo & Davies, 2009) and the 20S proteasome (Pickering & Davies, 2012) were inducible following transient exposure to a mild dose of an oxidant. ❧ Yet few studies have addressed whether the inducibility of the mitochondrial Lon protease is retained beyond tissue culture. To fill this gap, I utilized the model organism, Drosophila melanogaster, more commonly known as the fruit-fly, to assess the age- and sex-specific differences in the adaptability of the Lon protease. Signaling of the adaptive stress response was achieved by pre-treatment or ‘priming’ using a non-toxic, micromolar concentration of the redox signaling molecule hydrogen peroxide (H₂O₂). Following pretreatment, flies were assessed for inducibility of the mitochondrial Lon protease (protein expression and activity). I discovered only young females, pretreated with H₂O₂, were capable of inducing Lon protein expression and activity. Moreover, pretreatment, enabled young females to survive longer (adapt) when subjected to a sub-lethal amount of H₂O₂. A finding which was lost with age and not present in males. Conversely, when flies were pretreated with the redox cycler, paraquat (PQ), a superoxide generating molecule, only young males, pretreated with a low, micromolar concentration, were found to have increased Lon protein expression and activity. As well, pretreatment enabled males to survive longer when exposed to a semi-toxic amount of PQ, which showed an age-dependent response (restricted to young males) with no impact in females. ❧ Moreover, my work is the first-known identification of sex-specific protein isoforms of the Lon protease. Females have three Lon protein isoforms: 100kD, 60kD, 50kD, whereas males have only two of these isoforms: 100kD and 60kD. A finding I show is found to be conserved in highly sexually dimorphic tissues of the mouse liver and reproductive organs. ❧ To address the sexual disparity in Lon protein expression, I generated pseudo-females and pseudo-males to test whether adaptation to an oxidant is sex-dependent. Using a transgenic strain to force the over-expression of the female-specific form of transformer, enabled the creation of flies that were phenotypically female, but chromosomally male. Upon pretreatment with H₂O₂, pseudo females showed increased Lon protein expression, proteolytic capacity, and were able to withstand a toxic-dose of H₂O₂ (adaptation). As well, pseudo-females were unable to adapt upon PQ pretreatment. In contrast, pseudo-males, generated by using an RNAi-strain against transformer, generated flies phenotypically male, but chromosomally female, which were unable to adapt following H₂O₂ pretreatment. ❧ My next major project sought to address the age-associated changes in the adaptive stress response upon the 20S proteasome in D. melanogaster. Previous work had shown the 20S proteasome was inducible in young female fruit-flies (Pickering, Staab, Tower, Sieburth, & Davies, 2013). I found that with age, 60 day old females are no longer able to adapt and become more sensitive to high concentrations of H₂O₂. A finding common in both sexes. In addition, proteolytic activity assays revealed that females pretreated with an adaptive dose of H₂O₂ show increased proteolysis by the 20S proteasome, which is removed with age and remains non-responsive in males. Lastly, in an attempt to restore the adaptive response, the Nrf2 cytosolic repressor, Keap1, was chronically knockdown, for a duration of 60 days, prior to flies being pretreated with an adaptive dose of H₂O₂. Unfortunately, neither males nor females showed increased survival with pretreatment. Yet, chronic Keap1 knock-down did increase stress resistance in both sexes. ❧ Lastly, I sought to determine if findings in D. melanogaster were potentially translatable in the mammalian mouse model. Short-term exposure to vehicular-derived nano-particulates (nPM), collected from the 110 freeway, were delivered in a re-aerosolized form to 3-month or 18-month C57BL/6 female mice. Lysate from the lung, heart, and liver were assessed for the induction of the stress response. Specifically, changes in the 20S proteasome and immunoproteasome (protein expression and activity) were measured, along with changes in the mitochondrial Lon protease. Protein expression of Nrf2 and its negative regulators, Bach1 and c-Myc, were also measured. Accumulation of oxidized proteins, measured through carbonyl content was quantified.

Linked assets

University of Southern California Dissertations and Theses

Conceptually similar

PDF

The role of the proteasome & its regulators in adaptation to oxidative stress

PDF

The human Lon protease in mitochondrial stress protection and aging

PDF

Role of neuronal nitric oxide synthase in aging and neurodegeneration

PDF

Sex differences in aging and the effects of mitochondria

PDF

Pathways of cell death in response to HIV protease cocktail Ritonavir/Lopinavir in primary hepatocytes

PDF

The mitochondrial energy – redox axis in aging and caloric restriction: role of nicotinamide nucleotide transhydrogenase

PDF

Air pollution neurotoxicity throughout the lifespan: studies on the mechanism of toxicity and interactions with effects of sex and genetic background

PDF

Mediating the homeostatic response during light & cytotoxic induced retinal damage

PDF

Signaling mechanisms governing intestinal regeneration and gut-glia cross-talk in Drosophila

PDF

The regulation, roles, and mechanism of action of mitochondrial-derived-peptides (MDPs) in aging

PDF

Endogenous H2O2 signaling positively regulates the release of neuropeptides during a neuron-gut axis mediated oxidative stress response in caenorhabditis elegans

PDF

Defining the functional roles of neurotransmitters and neuropeptides in neural circuits

PDF

Defining intrarenal sexual dimorphisms to obesity and hypertension: understanding the female advantage

Asset Metadata

Creator Corrales-Diaz Pomatto, Laura (author)

Core Title To adapt or not to adapt: the age-specific and sex-dependent differences in the adaptive stress response

School Leonard Davis School of Gerontology

Degree Doctor of Philosophy

Degree Program Biology of Aging

Publication Date 02/03/2017

Defense Date 02/03/2017

Publisher University of Southern California (original), University of Southern California. Libraries (digital)

Tag 20S proteasome,adaptation,aging,Air pollution,Lon protease,nanoparticulate matter,Nrf2,OAI-PMH Harvest,oxidative stress,sexual dimorphism

Language English

Contributor Electronically uploaded by the author (provenance)

Advisor Davies, Kelvin J. A. (committee chair), Cadenas, Enrique (committee member), Forman, Henry (committee member), Lithgow, Gordan (committee member), Tower, John (committee member)

Creator Email lcorrale@usc.edu

Permanent Link (DOI) https://doi.org/10.25549/usctheses-c40-329115

Unique identifier UC11255789

Identifier etd-CorralesDi-4992.pdf (filename),usctheses-c40-329115 (legacy record id)

Legacy Identifier etd-CorralesDi-4992.pdf

Dmrecord 329115

Document Type Dissertation

Rights Corrales-Diaz Pomatto, Laura

Type texts

Source University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Access Conditions The author retains rights to his/her dissertation, thesis or other graduate work according to U.S. copyright law. Electronic access is being provided by the USC Libraries in agreement with the a...

Repository Name University of Southern California Digital Library

Repository Location USC Digital Library, University of Southern California, University Park Campus MC 2810, 3434 South Grand Avenue, 2nd Floor, Los Angeles, California 90089-2810, USA