University of Southern California Dissertations and Theses

Role of beta-catenin in mouse epiblast stem cell, embryonic stem cell self-renewal and differentiation

(USC Thesis Other)

Role of beta-catenin in mouse epiblast stem cell, embryonic stem cell self-renewal and differentiation

PDF

Download a page range

Download transcript

Copy asset link

Request this asset

Transcript (if available)

Content ROLE OF BETA-CATENIN IN MOUSE EPIBLAST STEM CELL, EMBRYONIC STEM CELL
SELF-RENEWAL AND DIFFERENTIATION

By

Hoon Kim

A Dissertation Presented to the
FACULTY OF THE USC GRADUATE SCHOOL
UNIVERSITY OF SOUTHERN CALIFORNIA
In Partial Fulfillment of the
Requirements for the Degree
DOCTOR OF PHILOSOPHY
(GENETIC, MOLECULAR, AND CELLULAR BIOLOGY)

December 2012

Copyright 2012 Hoon Kim
ii

ACKNOWLEDGMENTS

My gratitude goes to my academic advisor, Dr. Qi-long Ying, for his creativity, passion, and
patient guidance for the past 4 years of my doctoral research works. He is not only my first
scientific advisor, but also my role model as a scientific researcher and mentor.
I wish to thank my dissertation committee members, Dr. Shao-yao Ying, Dr. Le Ma and Dr.
Derek Sieburth for their persistent attention on my research project and final approval of
my doctoral works.
Lastly, I wish to thank my wife, Claire E. Shin, for her dedication, encouragement and
emotional support on me during last five years of research works.

iii

TABLE OF CONTENTS
ACKNOWLEDGMENTS ................................................................................................................................... ii
LIST OF TABLES, FIGURES AND DIAGRAM .................................................................................................... iv
ABSTRACT ..................................................................................................................................................... xi
INTRODUCTION ............................................................................................................................................. 1
RESULTS ........................................................................................................................................................ 8
DISCUSSION ................................................................................................................................................. 72
EXPERIMENTAL PROCEDURES ..................................................................................................................... 83
REFERENCES ................................................................................................................................................ 91

iv

LIST OF TABLES, FIGURES AND DIAGRAM

Figure 1.1a. Locus map of the Ctnnb1 conditional knockout mouse ....................................................... 8

Figure 1.1b. Phase contrast image of β-catenin
fl/fl
ESCs. .......................................................................... 9

Figure 1.1c. Schematic diagram of generation of β-catenin -/- embryonic stem cell. ............................ 9

Figure 1.1d. Doxycycline treatment and Genetic ablation of β-catenin induces cell death. ................. 10

Figure 1.2a. Effect of excision of β-catenin gene on proliferation of mouse ESCs. ................................ 11

Figure 1.3a. Schematic diagram of generation of β-catenin -/- ESCs. .................................................... 12

Figure 1.3b. G-csf induces enhanced activation of STAT3 signaling pathway.. ..................................... 13

Figure 1.3c. Time course experiment to investigate the activation and sustenance of STAT3
activation. ................................................................................................................................................... 14

Figure 1.3d. Gcsf-mediated hyperactivation of STAT3 pathway ensures the self-renewal of β-catenin-
knockout ESCs. ........................................................................................................................................... 15

Figure 1.3e. Protein expression of β-catenin is undetectable in β-catenin knockout ESCs. ................. 16

Figure 1.3f. Confirmation of elimination of β-catenin/TCF-dependent transcription activity in β-
catenin knockout cells using luciferase assay.. ....................................................................................... 17

Figure 1.4a. Genetic ablation of β-catenin induces cell death and differentiation even in the presence
of LIF. .......................................................................................................................................................... 19

Figure 1.4c. Expression of pluripotency markers β-catenin -/- ESCs maintained in LIF/PD03
supplemented medium. ............................................................................................................................ 20

v

Figure 2.1a. Activation of Wnt/β-catenin pathway by GSK3 inhibitor, CHIR99021, induces rapid cell
death and differentiation of mouse EpiSCs ............................................................................................. 22

Figure 2.1b. De-regulation of Wnt/β-catenin by treatment of XAV939, axin stabilizer, alone does not
guarantee long-term maintenance of mouse EpiSCs .............................................................................. 23

Figure 2.1c. EpiSCs cultured in CHIR/XAV expresses key pluripotency markers. ................................ 24

Figure 2.1e. Representative images of fully self-renewing colony and fully differentiated colony in
colony formation assay ............................................................................................................................. 25

Figure 2.1d. Colony formation assay on EpiSCs to compare FGF2/activin and CHIR/XAV medium. .. 25

Figure 2.1f. De novo derivation of CD1 mouse EpiSCs. ........................................................................... 26

Figure 2.1g. De novo derivation of 129 SvE mouse EpiSCs. .................................................................... 26

Figure 2.1 h&i. Derivation of EpiSCs from E7.5 post-implantation Sprague-Dawley rat embryos and
Dark Agouti rat embryos. .......................................................................................................................... 27

Figure 2.2a. Quantitative RT-PCR analysis of gene expression in mouse EpiSCs maintained in
CHIR/XAV or FGF2/activin A.................................................................................................................... 28

Figure 2.2b. Bisulfite sequencing of DNA methylation of the promoter regions of Stella, Oct4, and
Vasa in mouse ESCs maintained in 2i and EpiSCs maintained in CHIR/XAV.. ...................................... 29

Figure 2.2c. Quantification of Oct4 distal enhancer (DE) and proximal enhancer (PE) reporter
activities in mouse ESCs and EpiSCs. ....................................................................................................... 30

Figure 2.2d. Pluripotency of mouse EpiSCs derived and cultured in CHIR/XAV condition. ................ 31

Figure 2.2e. Teratoma from EpiSCs derived and maintained in CHIR/XAV condition forms three
germ layers................................................................................................................................................. 31

vi

Figure 2.2f. Heatmap of global gene expression patterns in mouse ESCs and EpiSCs. ......................... 32

Figure 2.2g. Scatter plot analyses comparing global gene expression patterns among the three
groups of cells. ........................................................................................................................................... 33

Figure 2.2h. Phase contrast and fluorescence images of purified Oct4-GFP-positive EpiSCs after 7
passages in FGF2/activin A. ...................................................................................................................... 34

Figure 2.2i&j. CHIR/XAV condition insures high ratio of Oct4-EGFP-positive EpiSCs after prolonged
passages. .................................................................................................................................................... 35

Figure 2.2k. Heatmap of the differentiation-related genes that are differentially induced/suppressed
by CHIR, XAV, or CHIR/XAV. ..................................................................................................................... 36

Figure 2.2l. Genes whose expression differed more than 1.5-fold between CHIR/XAV-treated and
untreated conditions. ................................................................................................................................ 37

Figure 2.3a. Oct4 immunostaining of β-catenin -/- EpiSCs maintained in FGF2/activin A. ................. 38

Figure 2.3b. Phase contrast image of β-catenin -/- EpiSCs cultured in CHIR/XAV for 7 days after the
removal of FGF2/activin A. ....................................................................................................................... 38

Figure 2.4a. β-catenin/TCF-dependent transcription activity elicited by CHIR99021 treatment is
attenuated by co-administration of axin stabilizers such as XAV939 and IWR1. ................................ 40

Figure 2.4b. Phase contrast image of CD1 mouse EpiSCs cultured in the indicated conditions for 7
days. ............................................................................................................................................................ 40

Figure 2.4c. IWR1 stabilizes both Axin1 and Axin2 and CHIR/IWR1 further stabilizes Axin1 and
Axin2. .......................................................................................................................................................... 41

Figure 2.4d. Co-IP of β-catenin in CD1 mouse EpiSCs. ............................................................................ 42

Figure 2.4e. TOPFlash assay in β-catenin -/- + β-catenin mutant EpiSCs.. ............................................ 43
vii

Figure 2.4f. Schematic diagram of two β-catenin mutant forms and β-catenin knockout EpiSCs stably
expressing TCF non-binding form of β-catenin can be maintained as EpiSCs without supplementing
CHIR/XAV. .................................................................................................................................................. 44

Figure 2.5a. Schematic diagram of ESC to EpiSC transition and CHIR/XAV medium facilitate the ESC
to EpiSC transition in vitro ........................................................................................................................ 46

Figure 2.5b. Gene expression pattern confirms the ESC to EpiSC transition in CHIR/XAV condtion.. 46

Figure 2.5c. CHIR/XAV condition allows derivation of EpiSC lines from E3.5 blastocysts .................. 47

Figure 2.5d. ESCs cultured in 2i medium expresses both Rex1 and Oct4. ............................................. 47

Figure 2.5e. CHIR/XAV medium allow the maintenance of Rex1-negative, Oct4-positive EpiSCs in
vitro............................................................................................................................................................. 47

Figure 2.5f. N-terminus truncated form of β-catenin is sufficient to replace the effect of CHIR99021.
.................................................................................................................................................................... 48

Figure 2.5g. Stable expression of β-catenin form that cannot bind to TCF induces differentiation of
ESCs. ........................................................................................................................................................... 49

Figure 2.5h. Stable expression of β-catenin that cannot bind TCF induces differentiation of ESCs to
EpiSCs. ........................................................................................................................................................ 49

Figure 2.5i. Gene expression pattern shows that stable expression of β-catenin that cannot bind TCF
induces differentiation of ESCs to EpiSCs.. .............................................................................................. 50

Figure 2.6a. TCF3-/- mouse ESCs can be maintained without supplementation of CHIR99021 for
short periods. ............................................................................................................................................. 51

Figure 2.6b. GSK3 inhibition by CHIR99021 is required for long term maintenance of TCF3-/- mouse
ESCs ............................................................................................................................................................ 52
viii

Figure 2.6c. TCF3 mutant that cannot bind to β-catenin do not respond to CHIR99021. TCF3
∆N/∆N
mouse ESCs maintained in LIF + PD0325901 (Upper panel). ............................................................... 52

Figure 2.6d. TCF3-/- ESCs are refractory to ESC to EpiSC transition. .................................................... 53

Figure 2.6e. Both CHIR99021 and XAV939 are required for maintenance of TCF3
∆N/∆N
mouse EpiSCs.
.................................................................................................................................................................... 54

Figure 2.6f. TCF/β-catenin-dependent transcription is elicited by treatment of Wnt3a and
CHIR99021 in TCF3-/- and TCF3
∆N/∆N
cells. ........................................................................................... 54

Figure 2.7a. Protein expression of both Axin1 and Axin2 are stabilized by XAV, IWR1, CHIR/XAV,
and CHIR/IWR1 treatments. .................................................................................................................... 55

Figure 2.7b. Axin2 overexpression mimics effect of CHIR/XAV. Overexpression of axin1 and axin2 on
CD1 EpiSCs. ................................................................................................................................................ 56

Figure 2.7c. Knockdown efficiency of axin1 and axin2 on CD1 EpiSC confirmed by real-time RT-PCR.
.................................................................................................................................................................... 57

Figure 2.7d. shRNA-mediated knockdown of axin1 and axin2 on CD1 EpiSC.. ..................................... 57

Figure 2.7e. Generation of axin2-overexpressing β-catenin -/- EpiSC line. .......................................... 58

Figure 2.7f. Axin2 proteins do not engage in β-catenin degradation. .................................................... 59

Figure 2.7g. Axin2 overexpression abrogate binding of TCF3 with β-catenin in the nucleus. ............. 60

Figure 2.7h. Immunostaining of β-catenin-T2ER in the absence and presence of tamoxifen. ............. 61

Figure 2.7i. Forced nuclear localization of β-catenin induces differentiation of EpiSCs even in the
presence of CHIR/IWR1.. .......................................................................................................................... 62
ix

Figure 3.1a. H9 human ESCs exhibit same pattern of TOPFlash activity upon Wnt/β-catenin-
modulating small molecules treatments. ................................................................................................ 64

Figure 3.1b. Binding of β-catenin with TCF3 elicited by CHIR99021 treatment is attenuated by co-
administration with IWR1 and XAV.. ....................................................................................................... 65

Figure 3.1c. CHIR99021 induces differentiation of H9 human ESCs. ..................................................... 65

Figure 3.1d. CHIR/IWR1 condition allows maintenance of human ESCs in the absence of FGF2.. ..... 66

Figure 3.1e. CHIR/IWR1 allows enhanced survival and proliferation of human ESCs after single cell
dissociation. ............................................................................................................................................... 67

Figure 3.1f. Human ESCs cultured in CHIR/IWR1 express key pluripotency markers. ....................... 67

Figure 3.1g. Human ESCs cultured in CHIR/IWR1 are pluripotent and are able to differentiate into
all three germ layers.. ................................................................................................................................ 68

Figure 3.1h. Human ESCs cultured in CHIR/IWR1 condition are able to form teratoma when injected
to immunodeficient mice.. ........................................................................................................................ 68

Figure 3.1i. Stable expression of β-catenin form that cannot engage in TCF/β-catenin mediated
transcription activity promote self-renewal of human ESCs in the absence of CHIR/IWR1 or FGF2.
.................................................................................................................................................................... 69

Figure 3.1j. TCF3 mutant form that cannot bind to β-catenin promote self-renewal of human ESCs. 70

Figure 3.1k. Protein level of Axin2 is stabilized in CHIR/IWR1 condition. ............................................ 70

Figure 3.1l. Human ESCs stably expressing Axin2 can be maintained without addition of FGF2 or
CHIR/IWR1. ............................................................................................................................................... 71

x

Table 1: Similarities and differences between mouse ESCs and EpiSCs…………………………………………..5
Table 2: Different response to β-catenin signaling pathway between mouse ESCs and EpiSCs………79
Diagram 1: Model of ESC and EpiSC self-renewal mediated by β-catenin…………………………………… ..82

xi

ABSTRACT
Wnt/β-catenin signaling plays a central role in regulating stem cell fates. Its exact role in
the maintenance of mouse epiblast stem cells (EpiSCs) and human embryonic stem cells
(ESCs), however, remains undefined. Here, we show that activation of Wnt/β-catenin
signaling in mouse EpiSCs and human ESCs can promote self-renewal or differentiation,
with the self-renewal effect being realized only when β-catenin mediated T-cell factors
(TCFs)-dependent transcription activities are blocked. Introduction of a stabilized β-
catenin transgene harboring point mutations at the TCF binding site enables mouse EpiSCs
and human ESCs to self-renew without exogenous growth factors. By contrast, β-catenin-
mediated self-renewal in mouse ESCs requires TCF-binding activity. Moreover, we show
that Axin2, but not Axin1, functions to redistribute β-catenin mainly on cell cytoplasm, and
accumulated β-catenin in cytoplasm promote both mouse EpiSCs and human ESCs self-
renewal and convert mouse ESCs into EpiSCs. Our results reveal a novel mechanism by
which β-catenin mediates EpiSC and ESC self-renewal, and will have broad implication in
understanding stem cell fate regulation.

1

INTRODUCTION

Introduction Part I: Balance among Stat3, beta-catenin and MAPK pathway is
necessary for mouse ESCs self-renewal
Wnt/β-catenin signaling was shown to improve maintenance of both mouse and human
ESCs (Sato et al., 2004; Anton et al., 2007) although precise mechanism is not yet clear. LIF
stimulate self-renewal via the gp130 signal transducing receptor that activates Jak kinases
and the transcription factor signal transducer and activator of transcription 3 (Stat3).
Downstream targets of LIF/Stat3 pathway include Oct4, Nanog, Sox2, and Klf4, which are
key transcription factors for ESC self-renewal (Niwa et al., 2009). Stat3 and Wnt/β-catenin
signals are two major contributors for naï ve ES pluripotency; however, there have been
few attempts to define signaling links between these pathways. It was proposed that there
is no direct cross talk between β-catenin and Stat3 pathways, but rather they work in a
synergistical way (Ogawa et al., 2006). However, usage of wild-type ESCs to judge the
signaling relationships between these two pathways cannot be a stringent method because
basal signals of one pathway may mask effects of another. Conclusions regarding signaling
dynamics between Stat3 and β-catenin signaling pathways can be clearly drawn by
utilization of both Stat3 knockout and β-catenin knockout embryonic stem cells. In a Stat3-
independent ground state self-renewal of ES cells, canonical Wnt/β-catenin signaling play a
prominent role in self-renewal of ESCs. This was confirmed by isolation of Stat3 null ES
cells in 2i media. Many of previously reported β-catenin deficient ESCs are more analogous
to EpiSCs rather than true ESCs demonstrated by their unique culture conditions and
molecular features (Soncin et al., 2009; Anton et al., 2007). In this study, we have
2

successfully generated β-catenin knockout ESCs and devised optimal culture conditions for
their maintenance in a naïve state. By using β-Catenin null and Stat3 null ES cell lines, we
investigated signal dynamics among Stat3, Wnt/β-catenin, and Mapk signaling pathways in
naï ve state pluripotency of ES cells.

3

Introduction Part II: Comparison of mouse embryonic stem cells and epiblast stem
cells and role of beta-catenin in two distinct pluripotent stem cell types.

Mouse embryonic stem cells (ESCs) are derived from the inner cell mass (ICM) of the pre-
implantation blastocysts (Brook and Gardner, 1997; Evans and Kaufman, 1981). Mouse
ESCs can be maintained in culture indefinitely and retain the distinctive capability to
colonize blastocyst chimeras and contributes to germline plus all somatic lineages (Keller,
2005; Bradley et al., 1984). Mouse epiblast stem cells(EpiSCs) are derived from post-
implantation epiblasts (Brons et al., 2007; Tesar et al., 2007), and share several properties
with mouse ESCs, including the expression of core pluripotency factors Oct4, Nanog and
Sox2, and the ability to differentiate into all three primary germ layers even after long-term
culture. Despite these similarities, mouse EpiSCs and ESCs differ significantly in their
requirements for self-renewal. Mouse ESC self-renewal is mediated by the activation of
signal transducer and activator of transcription 3 (STAT3) by leukemia inhibitory factor
(LIF) (Niwa et al., 1998), whereas mouse EpiSCs are non-responsive to LIF/STAT3
signaling and instead require fibroblast growth factor 2 (FGF2) and activin A for self-
renewal (Brons et al., 2007; Tesar et al., 2007). Why mouse EpiSCs and ESCs respond
differently to the same extracellular signaling cues, however, remains largely unknown.
Morever, EpiSCs are normally passaged as small clumps because they survive poorly upon
single cell dissociation, suggesting that the current FGF2/activin A culture condition is sub-
optimal for the maintenance of EpiSCs. Recent studies revealed that mouse ESC self-
renewal can be maintained through activation of the canonical Wnt/β-catenin pathway,
4

without the need for LIF/STAT3 signaling (ten Berge et al., 2011; Ying et al., 2008).
Analogously, the self-renewal of mouse EpiSCs might also be regulated by signaling
pathways other than FGF2/activin A. Wnt/β-catenin in one such candidate pathway, as it
has been shown to play a central and conserved role in controlling cell proliferation and
lineage specification during early embryogenesis (Logan and Nusse, 2004; van Amerogen
and Nusse, 2009). In the absence of Wnt signaling, β-catenin, the key mediator of the
canonical Wnt/β-catenin pathway, is phosphorylated by glycogen synthase kinase 3
(GSK3), leading to proteasome-mediated degradation of β-catenin. When Wnt ligand binds
to its receptor complex composed of Frizzled and low-density-lipoprotein-receptor-related
protein 5 or 6 (Lrp5/6), the canonical Wnt/β-catenin pathway is activated, leading to the
inhibition of GSK3 and the stabilization of β-catenin. Stabilized β-catenin then translocates
to the nucleus, where it interacts with T-cell factors (TCFs) to regulate gene expression.

Although canonical Wnt/β-catenin signaling has been implicated in promoting self-renewal
of various types of tissue-specific stem cells (Clevers, 2006; Nusse, 2008), its exact role in
stem cell fate regulation remains controversial. Activation of Wnt/β-catenin signaling often
produces diverse and sometimes opposite outcomes in different cell types. It has been
proposed that Wnt/β-catenin regulates stem cell fates in a context- and cell type-
dependent manner (Sokol, 2011). Investigation of the exact role of Wnt/β-catenin signaling
in a given stem cell type and the mechanisms underlying that role, however, has been
hampered by the lack of well-established methods for the maintenance of pure tissue-
specific stem cells. By contrast, homogenous mouse EpiSCs and ESCs can be readily derived
5

and genetically modified without changes to their identity. Whilst these two types of stem
cells are closely related developmentally, they are molecularly and functionally different as
summarized in Table 1, and therefore provide an ideal model system for determining
whether and how Wnt/β-catenin regulates stem cell fates through a context- and stage-
dependent manner. Here, we show that stabilized β-catenin maintains mouse EpiSC self-
renewal only when its β-catenin/TCF-dependent transcriptional activity is blocked by
stabilization of Axin2, not Axin1. Unlike mouse EpiSC and human ESC, mouse ESC self-
renewal mediated by β-catenin requires β-catenin/TCF binding activity.

Table 1: Similarities and differences between mouse ESCs and EpiSCs. Both cell types are
pluripotent meaning that they can give rise to three germ layers, such as ectoderm, mesoderm, and
mesoderm. Only ESCs can contribute to germ line transmission. Mouse ESCs rely on LIF/STAT3 and
simultaneous activation of BMP signaling for self-renewal. Mouse EpiSCs rely on FGF2-MAPK and
simultaneous activation of activin/NODAL signaling pathway for self-renewal. Key markers for
ESCs include Rex1, Nr0b1, Stella, while EpiSCs express high level of Fgf5.
ESCs EpiSCs
6

Introduction Part III: Comparison of mouse EpiSCs and human ESCs and role of beta-
catenin in two distinct pluripotent stem cell types.
Like mouse ESCs, Human ESCs, are derived from the ICM part of human preimplantation
embryos. Therefore, mouse ESCs and human ESCs share several molecular and cellular
characteristic, for example, self-renewal capacity and pluripotency. Many key transcription
factors such as Oct4, Nanog, and Sox2 are critical in both mouse and human ESCs. Knocking
out or de-regulating these gene expression frequently has deleterious effects on self-
renewal of mouse and human ESCs (Fong et al., 2008; Hay et al., 2004; Ivanova et al., 2006;
Zaehres et al., 2005). However, human ESCs and mouse ESCs differ in their response to
signaling pathways to support their self-renewal. LIF/STAT3 pathway is required for self-
renewal of mouse ESCs. In contrast, human ESCs do not respond to LIF/STAT3 pathway
(Dahéron et al., 2004), instead human ESCs rely on activation of MAPK pathway elicited by
FGF2 stimulation. Self-renewal of mouse ESCs benefit from mimicking Wnt/β-catenin
pathway by usage of CHIR99021, a highly specific and potent GSK3 inibitor (Ying et al.,
2008). However, Wnt/beta-catenin signaling pathway induces human ESCs differentiation
under chemically defined conditions (Sumi et al., 2008). Our current study shows that
Wnt/β-catenin pathway also promotes differentiation of mouse EpiSCs. Since mouse
EpiSCs and human ESCs shares defining similarities such as signaling pathways for self-
renewal and differentiation, we hypothesized that stabilized beta-catenin forms that do not
engage in TCF-dependent transcription activity might promote self-renewal of human ESCs
as well. We conducted series of same experiments again on human ESCs, and we also
demonstrated that β-catenin promote human ESC self-renewal through a mechanism
7

similar to that in mouse EpiSCs, further supporting the notion that human ESCs are more
closely related to mouse EpiSCs than to mouse ESCs.

8

RESULTS

Result Part I: Balance among Stat3, beta-catenin and MAPK pathway is necessary for
mouse ESCs self-renewal

1. Establishment and characterization of β-catenin -/- mouse ESCs.

1.1 Genetic ablation of β-catenin induces mouse ESCs undergo cell death and
differentiation in a standard mouse ESC culture condition
We attempted to establish β-catenin -/- mouse ESCs in order to delineate the exact roles of
β-catenin in ESC self-renewal and differentiation. We isolated embryonic day (E) 3.5
blastocysts from mice that are homozygous for loxP sites located in intron 1 and intron 6 of
β-catenin gene (Fig1.1 a).

Figure 1.1a. Locus map of the Ctnnb1 conditional knockout mouse: Genome contains loxP sites located in introns 1 and
6 of the Ctnnb1 (β-catenin) gene. Expression of Cre recombinase excises exons 2 and 6 leaving the expression of truncated
and non-functional form of β-catenin.
Following derivation and expansion of outgrowths of β-catenin-
fl/fl
blastocysts in LIF/10%
Fetal Bovine Serum (FBS) on mouse embryonic fibroblast (MEF) cells (Fig 1.1 b), β-catenin
9

fl/fl
ESCs were transfected with doxycycline-inducible Cre recombinase construct to remove
genomic β-catenin and establish β-catenin -/- ESC lines (Fig 1.1 c).

Figure 1.1b. Phase contrast image of β-catenin
fl/fl
ESCs: ESCs are maintained in GMEM/10% FBS supplemented with
LIF on mouse embryonic fibroblast layer.

Figure 1.1c. Schematic diagram of generation of β-catenin -/- embryonic stem cell. Inducible CRE system was
introduced into β-catenin
fl/fl
ESCs by co-transfection of pCAG-rtTA-IRES-Zeocin and pBI-CRE-EGFP-IRES-Puromycin
plasmids. Doxycycline induces expression of rtTA and rtTA bind promoter region of pBI-CRE-EGFP-IRES-Puromycin,
thereby eliciting the expression of Cre recombinase and EGFP proteins. Upon 1mg/ml doxycycline treatment, Cre
Recombinase excise out genomic β-catenin gene.

Upon doxycycline treatment, number of ESCs rapidly diminishes and surviving colonies
exhibits flattened morphology in no later than 7 days in the supplement of LIF/10% FBS
condition, a standard mouse ESC culture medium (Fig 1.1 d).
10

Figure 1.1d. Doxycycline treatment and Genetic ablation of β-catenin induces cell death. Day 1 after 1mg/ml
doxycycline treatment on β-catenin
fl/fl
ESCs with inducible CRE. No obvious cell deaths were observed yet (Left). Day 4
after 1mg/ml doxycycline treatment. Massive cell deaths were observed indicated by small number of proliferating
colonies (Right). Green cells indicates the expression of Cre recombinase and EGFP.

This led us to speculate that LIF/STAT3 signaling is not sufficient to maintain ESCs when β-
catenin is genetically ablated, and basal level of β-catenin signal is essential for the
maintenance of mouse ESCs. Due to massive cell death and differentiation caused by
genetic removal of β-catenin under a standard mouse ESC culture medium, we were not
able to obtain β-catenin -/- ESC lines initially.

1.2 Activation of LIF/STAT3 pathway is beneficial yet not sufficient to maintain β-
catenin deficient mouse ESCs.
We then examined whether activation of LIF/STAT3 signaling pathway is beneficial on
growth and self-renewal of β-catenin -/- ESCs. We plated β-catenin-
fl/fl
ESCs onto feeder
and treated cells with doxycycline in order to remove the genomic β-catenin. In the
presence of LIF, number of viable cells was approximately two folds higher compared to
11

condition without LIF supplement on day 4. It suggests that LIF/STAT3 signaling has a
positive effect on proliferation of β-catenin -/- mouse ESCs (Fig 1.2 a).

Figure 1.2a. Effect of excision of β-catenin gene on proliferation of mouse ESCs. Growth curve of β-catenin
fl/fl
ESCs
with inducible CRE with indicated treatments. LIF treatment has, yet not sufficient, on proliferation of β-catenin deficient
ESCs. Upon doxycycline treatment and excision of β-catenin gene, ESCs gradually die off over the course of 4 days with or
without supplement of LIF. ESCs were grown on GMEM/10%FBS medium with the presence of MEF cells.

However, cells both in LIF condition, as well as in without LIF condition, failed to form
compact ESC colonies and gradually died and differentiated following several consecutive
passages. It suggests that although LIF/STAT3 signaling is beneficial for the growth of β-
catenin -/- ESCs to some extends, activation of LIF/STAT3 signaling alone is not sufficient
for the maintenance of β-catenin -/- ESCs.
1.3 Artificially elevated STAT3 signaling supports β-catenin -/- mouse ESC self-
renewal.
LIF/STAT3 pathway is activated by binding of LIF on gp130/LIF chimeric receptors and
consequent phosphorylation at tyrosine 705 and at serine 727 residues of Stat3.
Phosphorylated Stat3s dimerize each other and Stat3 dimers translocate into nucleus for
12

transcriptional activities. LIF/STAT3 pathway in mouse ESCs is known to activate various
transcription factors such as Oct4, Klf4 and Nanog, known to support self-renewal of mouse
ESCs (Niwa et al., 2009). Although activation of LIF/STAT3 signaling fails to sustain self-
renewal of rat ESCs, elevated STAT3 signaling is beneficial for rat ESC self-renewal. We
found that cell death and differentiation of rat ESCs can be alleviated by artificially
heightened and sustained activation of STAT3 signaling pathway (Li et al., 2008; Buehr et
al., 2008). It suggests that activation of STAT3 signaling pathway is beneficial for ESC self-
renewal in a dosage-dependent manner. Therefore, we tested whether cell death and
differentiation of mouse ESCs caused by the Cre recombinase-medicated genomic excision
of β-catenin could be prevented by elevating and sustaining STAT3 signaling pathway in an
artificial manner (Fig 1.3 a)

Figure 1.3a. Schematic diagram of generation of β-catenin -/- ESCs. To hyper-activate and sustain the activation of
STAT3 signaling pathway, β-catenin
fl/fl
ESCs were transfected with GY118F receptor. Once β-catenin
fl/fl
- GY118F ESCs are
expanded under GMEM/10%FBS/G-csf condition, genomic β-catenin was removed by transient expression of Cre
recombinase, and maintained in the presence of G-csf. Both β-catenin
fl/fl
ESCs and β-catenin
fl/fl
- GY118F were cultured on
the layer of MEF cells throughout the experiments.

13

To engineer STAT3 signal more tunable in β-catenin
fl/fl
ESCs, we created β-catenin
fl/fl
ESCs
by plasmid transfection to express a chimeric receptor, GY118F, that elicit hyperactivation
of endogenous Stat3 (Niwa et al., 1998). The ligand binding domain of the Granulocyte
colony-stimulating factor (G-csf) receptor is fused to the transmembrane and cytoplasmic
domains of the LIF receptor signal transducer gp130 receptor. In the cytoplasmic domain,
tyrosine 118 residue of the gp130 receptor is genetically mutated to phenylalanine. This
mutation eliminates the docking site for tyrosine phosphatase Shp2 which links to
Ras/mitogen activated protein kinase (MAPK) and Phosphoinositide 3-kinase (PI3K)
signaling pathways. Therefore, Jak-Stat3 pathway alone is activated by the stimulation of
GY118F signals by G-csf treatment. Unlike activation LIF/STAT3 pathway, G-csf/GY118F
signals induce heightened and sustained phosphorylation on Y705 residue of Stat3
(Burdon et al., 1999). Elevated and sustained Y705 phosphorylation of Stat3 under G-csf
treatment was confirmed by the Western blotting analysis (Fig 1.3 b & c).

Figure 1.3b. G-csf induces enhanced activation of STAT3 signaling pathway. Degree of STAT3-Y705 phosphorylation
after treatment of G-csf on β-catenin
fl/fl
- GY118F ESCs. G-csf mediated STAT3 phosphorylation at tyrosine 705 site is
increased after 1 hour treatment of LIF and G-csf. ESCs were serum-starved for 6 hours using GMEM medium prior to LIF
or G-csf treatment. One hour after the treatment of LIF or G-csf, ESCs were collected by trypsin dissociation and lysed
using RIPA buffer.

14

Figure 1.3c. Time course experiment to investigate the activation and sustenance of STAT3 activation. G-csf
mediated STAT3 phosphorylation at tyrosine 705 site is increased and sustained over 24 hours. All ESCs were serum-
starved for 6 hours prior to LIF and G-csf treatment.

When cultured in LIF/10%FBS on MEF layer, β-catenin
fl/fl
ESCs stably expressing GY118F
chimeric receptor exhibited indistinguishable phenotype as that of β-catenin
fl/fl
ESCs
indicating that functionality of endogenouis LIF /gp130 chimeric receptor was not affected
by over-expression of GY118F receptor. These ESCs can be routinely cultured in a standard
mouse ESC medium containing LIF/10%FBS on MEF layer. After established and expanded
β-catenin
fl/fl
-GY118F ESC lines, we transiently introduced Cre recombinase by
lipotransfection to excise genomic β-catenin. After transient introduction of Cre
recombinase, we dissociated ESC colonies and replated them on different culture
conditions including LIF/10%FBS and G-csf/10%FBS. No colony formation was observed
in LIF/10%FBS condition. However, compact colonies were formed and proliferated
robustly in G-csf/10%FBS condition (Fig 1.3 d).

15

Figure 1.3d. Gcsf-mediated hyperactivation of STAT3 pathway ensures the self-renewal of β-catenin-knockout
ESCs. Alkaline phosphatase staining for β-catenin -/- cells cultured in indicated conditions for 5 days. ESC colonies are
stained with red.

It indicates that enhanced STAT3 signaling pathway through G-csf-mediated GY118F
signals promoted self-renewal and proliferation of β-catenin -/- ESCs. Then several
colonies proliferated in G-csf/10%FBS condition were picked up and continuously
expanded multiple passages under the same condition. After establishment of β-catenin -/-
ESC lines, Western blotting was performed to verify the ablation of protein expression of β-
catenin on these cell lines, and indeed β-catenin expression was abrogated in this β-catenin
-/- ESCs (Fig 1.3 e).

16

Figure 1.3e. Protein expression of β-catenin is undetectable in β-catenin knockout ESCs. In order to remove the
contamination of cell lysates from MEF cells, mixed populations of ESCs and MEF cells were trypsinized together followed
by neutralization of trypsin with GMEM/10%FBS medium and then they were plated onto gelatin-coated 10cm
2
tissue
culture dish for 1 to 2 hours. Due to the difference in size and mass of ESCs and MEFs, MEFs attach on the gelatin-coated
dish earlier than ESCs. Once majority of MEFs attach on gelatin-coated dish, supernatant containing ESCs are gently
collected by pippeting for lysis. Both intact form of β-catenin and degrading form of β-catenin were probed by Western
blotting method.

In addition to ablation of β-catenin protein expression, we wanted to ensure that there was
no functional Wnt/β-catenin signaling in β-catenin -/- ESC lines. To this end, luciferase-
based TCF Optimal Promoter(TOPFlash) plasmids were transfected into both wild-type
and β-catenin -/- ESCs. Upon treatment of Wnt3a, cells were lysed and assayed for
luciferase activities and β-catenin -/- ESCs did not show any TOPFlash activity while wild-
type ESCs showed heightened TOPFlash activity confirming that there is no functional
Wnt/β-catenin signaling pathway activated in β-catenin -/- ESCs (Fig 1.3 f).

17

Figure 1.3f. Confirmation of elimination of β-catenin/TCF-dependent transcription activity in β-catenin knockout
cells using luciferase assay. TOPFlash assay of β-catenin
fl/fl
ESCs cultured in GMEM/10%FBS/LIF and β-catenin -/- ESCs
cultured in GMEM/10% FBS/G-csf. β-catenin
fl/fl
ESCs respond to CHIR99021 treatment, while β-catenin -/- ESCs are
refractory to β-catenin/TCF-mediated transcription. ESCs were transfected with SuperTOP and Renilla plasmid using
Amaxa® transfection kit and plated on the gelatin-coated dishes in indicated conditions. After 24 hours of transfection,
cells were collected using Dual-luciferase kit® .

1.4 MAPK inhibition and LIF/STAT3 activation synergistically enhance self-renewal
of mouse ESCs including β-catenin -/- ESCs.
Extracellular signal-regulated kinase (ERK) and MAPK signaling is antagonistic to self-
renewal of mouse ESCs (Kunnath et al., 2007). Differentiation of mouse ESCs involves auto-
inductive stimulation of Mapk by fibroblast growth factor 4(Fgf4). Attenuation of ERK
pathway enhances LIF/STAT3-mediated self-renewal of mouse ESCs (Ying et al., 2008;
Burdon et al., 1999). We tested whether ERK inhibition works cooperatively with
LIF/STAT3 activation to further enhance self-renewal of mouse ESCs. To this end, we
seeded wild-type mouse ESCs onto gelatinized substrates. One group received LIF only
while other received LIF and PD0325901, a highly selective and potent inhibitor of ERK
18

pathway. After seven days of incubation, Alkaline Phosphatase (AP) staining was conducted
to quantify the number of self-renewing colonies. AP staining revealed that colonies in LIF
and PD0325901 proliferated significantly more than colonies in LIF alone.
Β-catenin -/- ESCs were shown to stop proliferation in a standard mouse ESC culture
condition. Therefore, we utilized LIF/PD0325901 condition to promote self-renewal of β-
catenin -/- ESCs without supplementation of G-csf. To test this, β-catenin -/- ESCs
continuously expanded in G-csf/10% FBS condition were dissociated and replated onto
LIF/PD0325901 medium and cultured for several consecutive passages. As expected,
LIF/PD0325901 medium supported long-term and robust proliferation of β-catenin -/-
ESCs, while cells plated onto LIF-supplemented medium failed to expand beyond 1 passage
(Fig 1.4 a).
19

Figure 1.4a. Genetic ablation of β-catenin induces cell death and differentiation even in the presence of LIF. Phase
contrast image (first panel) and alkaline phosphatase staining (second panel) of β-catenin -/- ESCs cultured in indicated
conditions for 5 days. Phase contrast image of AP staining of β-catenin
fl/fl
ESCs(third panel) and β-catenin
-/-
ESCs (fourth
panel) in indicated conditions for 5 days.

Immuno-staining method reveal that β-catenin -/- ESCs cultured in G-csf/10% FBS medium
and LIF/PD0325901 medium express ESC markers (Fig 1.4 c ).
20

Figure 1.4c. Expression of pluripotency markers β-catenin -/- ESCs maintained in LIF/PD03 supplemented
medium. Immunostaining of β-catenin -/- ESCs with indicated markers. Oct3/4 is the key marker of ESCs, SSEA-1 is
specific surface marker expressed both in mouse ESCs and EpiSCs. GATA4 is expressed in cells commited into medoserm
lineage.

These results suggest that activation of LIF/STAT3 signaling pathway and concurrent
inhibition of ERK pathway guarantee the self-renewal of β-catenin -/- ESCs.

21

Result Part II. Role of beta-catenin in mouse ESC and EpiSCs and novel culture
medium for the maintenance of mouse EpiSCs.

2. Novel culture condition for the maintenance of mouse EpiSCs and mechanisms

2.1 Combination of CHIR99021 and XAV939 maintains mouse EpiSC self-renewal
We recently found that two small molecule inhibitors (2i), CHIR99021 (CHIR) and
PD0325901, can efficiently maintain mouse ESC self-renewal independent of LIF/STAT3
signaling (Ying et al., 2008). CHIR stabilized β-catenin through inhibition of GSK3, and
exerts its self-renewal effect in mouse ESCs only when the MAPK pathway is suppressed
simultaneously by PD0325901. To ascertain whether this inhibitor-based system is also
capable of maintaining self-renewal in EpiSCs, we administered CHIR with or without
PD0325901 and found that EpiSCs rapidly differentiated or died in both cases, even in the
presence of FGF2 and activin A (Fig 2.1 a).

22

Fig 2

We therefore reasoned that if CHIR induces EpiSC differentiation through stabilization of β-
catenin, de-stabilizing β-catenin might promote EpiSC self-renewal. We tested this
hypothesis by administering a small molecule, XAV939, to mouse EpiSC cultures. XAV939
stabilizes axin through inhibition of tankyrase, leading to formation of a complex that
degrades β-catenin (Huang et al., 2009). Mouse EpiSCs remained undifferentiated for
approximately 1 week in the presence of XAV939, but differentiated subsequently after
passaging (Fig 2.1b).

Figure 2.1a. Activation of Wnt/β-catenin pathway by GSK3 inhibitor, CHIR99021, induces rapid cell death and
differentiation of mouse EpiSCs. Phase-contrast image of CD1 mouse EpiSCs maintained in FGF2/activin A (left
panel). Mouse EpiSCs differentiated 3 days after addition of 3μm CHIR99021 (middle panel) or 2i (3μM CHIR99021
+ 1μM PD0325901) (right panel)
23

Surprisingly, a combination of CHIR and XAV939 (“CHIR/XAV” hereafter) allowed long-
term maintenance of undifferentiated EpiSCs without exogenous growth factors or
cytokines (Fig 2.1 c).

SSEA1
DAPI
DAPI
DAPI
Figure 2.1b. De-regulation of Wnt/β-catenin by treatment of XAV939, axin stabilizer, alone does not guarantee
long-term maintenance of mouse EpiSCs. Phase contrast image showing differentiating CD1 mouse EpiSCs at the
second passage in GMEM/10%FBS with 2μM XAV939
24

Figure 2.1c. EpiSCs cultured in CHIR/XAV expresses key pluripotency markers. CD1 mouse EpiSCs were cultured in
CHIR/XAV for 7 passages and were subsequently immunostained with antibodies against pluropotency markers including
Oct4, Nanog, and SSEA1. Scale bars, 50μm

EpiSCs cultured in CHIR/XAV can be routinely passaged by single-cell dissociation and
replating onto gelatin-coated dishes, as well as cryo-preserved and recovered at high
efficiency by standard techniques. We compared the clonogenicity of EpiSCs cultured in
different conditions. Approximately 13% of individual EpiSCs plated onto gelatin-coated
96-well plates and cultured in CHIR/XAV formed morphologically-undifferentiated
colonies. This colony forming frequency is approximately six times higher than that of
EpiSCs cultured in FGF2/activin A, the standard EpiSC culture medium (Fig 2.1 d & e).

25

Figure 2.1e. Representative images of fully self-renewing colony and fully differentiated colony in colony
formation assay. Left panel: Phase –contrast image showing undifferentiated colony formed from a single CD1 mouse
EpiSC deposited into one well of a 96-well plate and cultured in CHIR/XAV

EpiSC colonies formed in CHIR/XAV were readily expanded to establish stable cell lines.
The high propagation efficiency of EpiSCs in CHIR/XAV prompted us to test the de novo
derivation of new EpiSC lines. As expected, under the CHIR/XAV condition, EpiSCs were
readily derived from E 5.75 embryos of CD1 and 129 SvE mice (Fig 2.1 f & g).

Figure 2.1d. Colony formation assay on EpiSCs to compare FGF2/activin and CHIR/XAV medium. Number of
colonies formed at day 9 after single-cell deposition into 96-well plates in the indicated conditions. Results are shown as
mean  s.d. of six biological replicates.
26

Figure 2.1f. De novo derivation of CD1 mouse EpiSCs. Epiblast tissue (outlined in red dashed line) of the 5.75 CD1
mouse embryo was dissected and cultured in CHIR/XAV. The outgrowth formed from the plated epiblast (middle panel)
was disaggregated to establish a stable EpiSC line (right panel). Thirteen EpiSC lines were established from 13 plated CD1
mouse embryos. Scale bars, 50μm

Figure 2.1g. De novo derivation of 129 SvE mouse EpiSCs. Epiblast tissue (left panel, outlined in red dashed line) of the
E5.75 129SvE mouse embryo was dissected and cultured in CHIR/XAV. The outgrowth formed from the plated epiblast
(middle panel) was disaggregated to establish a stable EpiSC line (right panel). Three EpiSC lines were established from
three plated 129 SvE mouse embryos. Scale bars, 50μm

27

EpiSCs were also established from E7.5 Sprague-Dawley and Dark Agouti rat embryos
using CHIR/XAV (Fig 2.1 h & i).

Figure 2.1 h&i. Derivation of EpiSCs from E7.5 post-implantation Sprague-Dawley rat embryos and Dark Agouti rat
embryos. Five EpiSC lines were established from seven plated epiblasts of Sprague-Dawley rat embryos (Upper panel)
and Dark Agouti rat embryos(Lower panel). Scale bars, 50μm

2.2 EpiSCs derived and maintained in CHIR/XAV exhibit the molecular hallmarks of
EpiSCs
To determine whether the cells derived and maintained in the CHIR/XAV condition retain
an EpiSC identity, we examined their molecular signatures and their differentiation
potential. These cells expressed Oct4 and Sox2, the key pluripotency genes, and Fgf5, a
post-implantation epiblast-specific marker (Brons et al., 2007; Tesar et al., 2007). Their
expression of Rex1, Nr0b1, and Stella, markers for the pre-implantation epiblast and
primordial germ cells (PGCs), was significantly lower than that of ESCs (Fig 2.2 a).
28

Figure 2.2a. Quantitative RT-PCR analysis of gene expression in mouse EpiSCs maintained in CHIR/XAV or
FGF2/activin A. Expression levels are relative to those of mouse ESCs maintained in 2i. Oct4 expression level is similar
among ESCs in 2i, EpiSCs in FGF2/activin A, and EpiSCs in CHIR/XAV condition, while Rex1 and Fgf5 expression patterns
are different between ESCs and EpiSCs. Data represent mean  s.d. of triplicate samples from three independent
experiments.

In EpiSCs maintained CHIR/XAV, the Oct4 promoter was unmethylated, while promoter
regions of Stella and Vasa, specific markers for ESCs and PGCs, were heavily methylated
(Fig 2.2 b).

29

Figure 2.2b. Bisulfite sequencing of DNA methylation of the promoter regions of Stella, Oct4, and Vasa in mouse
ESCs maintained in 2i and EpiSCs maintained in CHIR/XAV. Black dots represent methylated cytosine on CpG islands
on the promoter of indicated genes. White dots represent un-methylated cytosine on CpG islands on the promoter of
indicated genes. Hyper-methylated promoter regions correspond to tight suppression of gene expression. Hypo-
mehtylated promoter regions correspond to active transcription.

EpiSCs maintained CHIR/XAV showed strong activity in the Oct4-proximal enhancer, which
is preferentially used in EpiSCs, in contrast with ESCs, which mainly utilize the distal
enhancer (Bao et al., 2009; Yeom et al., 1996) (Fig 2.2 c).

30

Figure 2.2c. Quantification of Oct4 distal enhancer (DE) and proximal enhancer (PE) reporter activities in mouse
ESCs and EpiSCs. High luciferase activity in Oct4-DE means distal enhancer is predominantly utilized for the transcription
of Oct4 gene. Data represent mean  s.d. of three experimental replicates.

EpiSCs readily formed embryoid bodies (EBs) in suspension culture upon withdrawl of
CHIR/XAV and differentiated into cells of all three germlayers (Fig 2.2 d). We injected CD1
mouse EpiSCs derived and maintained in CHIR/XAV into two SCID mice. Teratomas
containing tissues of all three germlayers were formed in both mice (Fig 2.2 e). We also test
the chimera formation ability of these CD1 EpiSCs by injecting them into C57BL/6 mouse
blastocysts. No chimeras ensued from 58 blastocysts injected, an outcome consistent with
previous observations (Brons et al., 2007; Tesar et al., 2007).
31

Figure 2.2d. Pluripotency of mouse EpiSCs derived and cultured in CHIR/XAV condition. Immunostaining showing
Tuj-positive neurons (ectoderm), myosin-positive beating cardiomyocytes (mesoderm), and Gata4-positive endoderm
cells derived from CD1 mouse EpiSCs through EB formation. Scale bars, 50μm

Figure 2.2e. Teratoma from EpiSCs derived and maintained in CHIR/XAV condition forms three germ layers.
Hematoxylin and eosin (H&E) staining of teratomas generated from CD1 mouse EpiSCs derived and cultured in
CHIR/XAV. Scale bars, 50μm

32

To further confirm the identity of EpiSCs maintained in CHIR/XAV, we performed whole-
genome microarray analysis. EpiSCs derived and grown in CHIR/XAV and FGF2/activin A
exhibited similar gene expression patterns that were distinct from those of mouse ESCs
(Fig 2.2 f).

Notably, expression of some ESC-specific genes, including Dppa2, Dppa4, Dppa5a (Han et
al., 2010; Maldonado-Saldivia et al., 2007), was up-regulated while expression of the
differentiation-related genes such as Eomes and Nodal was down-regulated in EpiSCs
maintained in CHIR/XAV but not in EpiSCs in FGF2/activin A (Fig 2.2 g).
Figure 2.2f. Heatmap of global gene expression patterns in mouse ESCs and EpiSCs. Of the total number
of genes, 9.39% show more than a 1.5-fold difference in gene expression levels between mouse ESCs and
the two groups of EpiSCs. Color intensity plot is shown at the bottom.
33

Figure 2.2g. Scatter plot analyses comparing global gene expression patterns among the three groups of cells. Red
dots represent genes whose expression levels changed less than 2-fold between the samples being compared. Genes
exhibiting a 2-fold or greater increase in expression level in ordinate samples compared with abscissa samples are
indicated by green dots; genes exhibiting a 2-fold or greater decrease are shown as blue dots. The r
2
value (square of
linear correlation) in each plot was obtained by comparing global gene expression (35,556 transcripts total) in the two
indicated samples.

These results suggest that although EpiSCs in CHIR/XAV have EpiSC identity, they might be
developmentally closer to ESCs than EpiSCs grown in FGF2/activin A. We took advantage of
Oct4-GFP EpiSCs to explore this further. The GFP transgene in Oct4-GFP EpiSCs in under
the control of a 18kb genomic Oct4 fragment containing the entire regulatory region of the
Oct4 gene (Yeom et al., 1996). Oct4-GFP-positive and –negative EpiSCs represent E5.5
early-stage and E6.5 late-stage in vivo epiblast cells, respectively (Han et al., 2010). We
purified Oct4-GFP-positive EpiSCs and cultured them in CHIR/XAV or FGF2/Activin A. The
percentage of Oct4-GFP-positive cells decreased to approximately 5% over 7 passages in
34

FGF2/activin (Fig 2.2 h). In CHIR/XAV, however, approximately 95% of EpiSCs were still
GFP-positive after 7 passages, and approximately 75% were GFP-positive at passage 21
(Fig 2.2 i & j). These results confirm that EpiSCs representing early stage in vivo epiblasts
are preferentially maintained CHIR/XAV, whereas EpiSCs representing late stage in vivo
epiblasts are the dominant population in FGF2/activin A.

Figure 2.2h. Phase contrast and fluorescence images of purified Oct4-GFP-positive EpiSCs after 7 passages in
FGF2/activin A. Approximately 7% Oct4-GFP-positive cells were counted after 7 passages from purified Oct4-GFP-
positive EpiSCs. Scale bars, 50μm

35

Figure 2.2i&j. CHIR/XAV condition insures high ratio of Oct4-EGFP-positive EpiSCs after prolonged passages. Phase
contrast and fluorescence images of purified Oct4-GFP-positive EpiSCs after 7 passages in CHIR/XAV(i, upper panel) or 21
passages in CHIR/XAV (j, lower panel). Scale bars, 50μm

CHIR promotes differentiation of EpiSCs when used alone. To better define how CHIR and
XAV act together to maintain EpiSC self-renewal, we performed microarray analyses to
identify their downstream targets. EpiSCs were treated with CHIR, XAV, or both for 2 hours,
after which total RNA was extracted for analysis. CHIR induced the expression of many
differentiation-related genes, including Sox1, Cdx4, Hoxb1, brachyury(T), Hoxb2, Eomes,
Nodal, and Fst. Notably, these differentiation-related genes induced by CHIR were
predominantly suppressed by XAV(Fig 2.2 k). Nevertheless, the combination of CHIR and
XAV could still induce or suppress the expression more than 30 genes (Fig 2.2 l)
36

Figure 2.2k. Heatmap of the differentiation-related genes that are differentially induced/suppressed by CHIR, XAV,
or CHIR/XAV. Color intensity plot is shown at the bottom. Differentiation-related genes such as Sox2, Cdx4 and T which
are induced by CHIR99021 treatment are suppressed by co-treatment with XAV939.

37

Figure 2.2l. Genes whose expression differed more than 1.5-fold between CHIR/XAV-treated and untreated
conditions.

2.3 Self-renewal of EpiSCs in CHIR/XAV is β-catenin dependent
By inhibiting GSK3 phosphorylation of β-catenin, CHIR stabilizes β-catenin, which then
translocates to the nucleus and forms complexes with DNA-binding proteins, including
TCFs, to activate transcription (Logan and Nusse, 2004). To investigate whether CHIR/XAV
promote EpiSC self-renewal through β-catenin, we derived EpiSCs from mouse embryos
carrying
fl/fl
alles for β-catenin. Stable β-catenin -/- EpiSC lines were generated from these
β-catenin
fl/fl
EpiSCs by transient transfection of Cre recombinase, and could be routinely
maintained in FGF2/activin A. Β-catenin -/- EpiSCs remained undifferentiated even after
long-term culture in FGF2/activin (Fig 2.3 a). However, they differentiated after the
38

removal of FGF2/activin A even in the presence of CHIR/XAV (Fig 2.3 b), suggesting that
EpiSC self-renewal in CHIR/XAV is likely mediated by β-catenin.

Figure 2.3a. Oct4 immunostaining of β-catenin -/- EpiSCs maintained in FGF2/activin A. β-catenin -/- EpiSCs can be
routinely cultured in a standard EpiSC culture condition, FGF2/activin A, without overt differentiation. Scale bars, 50 μm

Figure 2.3b. Phase contrast image of β-catenin -/- EpiSCs cultured in CHIR/XAV for 7 days after the removal of
FGF2/activin A. After removal of FGF2/activin A β-catenin -/- EpiSCs start to differentiate and cannot be passaged
beyond 2 passages. Scale bars, 50 μm

39

2.4 Stabilizing β-catenin and concurrent attenuation of β-catenin/TCF-dependent
transcription maintains EpiSC self-renewal
Next, we investigated the mechanism by which β-catenin mediates self-renewal of EpiSCs
maintained in CHIR/XAV. As expected, CHIR strongly activated the TOPFlash reporter in
mouse EpiSCs, and addition of XAV abolished the TOPFlash activity induced by CHIR (Fig
2.4a). We tested three other inhibitors of the Wnt/β-catenin signaling pathway: IWR-1,
IWP-2, and Pyrivinium (Chen et al., 2009; Thorne et al., 2010). Similar to XAV, IWR-1
completely blocked TOPFlash reporter activity induced by CHIR and both inhibitors
together promoted EpiSC self-renewal. Conversely, IWP-2 and Pyrivinium only marginally
decreased TOPFlash reporter activity induced by CHIR and were unable to support EpiSC
self-renewal (Fig 2.4 a & b).

40

Figure 2.4a. β-catenin/TCF-dependent transcription activity elicited by CHIR99021 treatment is attenuated by co-
administration of axin stabilizers such as XAV939 and IWR1.TOPFlash assay in CD1 mouse EpiSCs treated with the
indicated inhibitors for 12 hours. Small molecules that inhibit Wnt/β-catenin pathway at the Wnt receptor level, such as
IWP2 and Pyrivinium, fail to attenuate TOPFlash activity elicited by CHIR99021 treatment. Data represent mean  s.d. of
three biological replicates.

Figure 2.4b. Phase contrast image of CD1 mouse EpiSCs cultured in the indicated conditions for 7 days. CHIR/IWP2
and CHIR/Pyrvinium fail to maintain EpiSCs. EpiSCs in these conditions differentiate no later than 5 days after treatment
with these inhibitors. Scale bars, 50 μm

Both XAV and IWR-1 destabilize β-catenin/TCF-dependent transcription by stabilizing
axin. To confirm it in EpiSCs, we treated EpiSCs with XAV, IWR-1, CHIR/XAV, and
41

CHIR/IWR-1 for 12 hours and measured the quantity of both axin1 and axin2 by Western
blotting and verified the stabilization of axin proteins after treatment with IWR1 (Fig 2.4 c).
These results suggest that stabilization of β-catenin and concurrent inhibition of β-
catenin/TCF-dependent transcriptional activity is necessary for β-catenin to mediate EpiSC
self-renewal.

Figure 2.4c. IWR1 stabilizes both Axin1 and Axin2 and CHIR/IWR1 further stabilizes Axin1 and Axin2. Western
blotting analysis showing both axin1 and axin2 protein level increases upon the treatment of IWR1 or CHIR/IWR1 for 12
hrs. EpiSCs were cultured in FGF2/activin A condition for 3 passages and switched to indicated conditions. 12 hours after
drug treatment, cell lysates were collected using RIPA buffer for Western blot analysis.

To confirm that CHIR-mediated β-catenin/TCF interaction can be abrogated by co-
administration of XAV, we performed co-immunoprecipitation(co-IP) experiment. The
amount of TCF3 and TCF4 proteins bound to β-catenin in nucleus were increased
significantly by CHIR treatment, and this effect was abrogated when XAV was co-
administered (Fig 2.4 d), indicating that XAV blocks the CHIR-induced binging of β-catenin
to TCFs.
42

Figure 2.4d. Co-IP of β-catenin in CD1 mouse EpiSCs. EpiSCs were cultured in FGF2/activin A condition for 3 passages
and were treated with the indicated cytokines/inhibitors for 12 h.

To confirm that EpiSC self-renewal is indeed maintained by stabilizing β-catenin and
blocking its TCF-binding, we generated a constitutively stable β-catenin mutant (∆N β-
catenin) by deleting the N-terminal 89 amino acids, which include the GSK3 binding site
(Kolligs et al., 1999). We then introduced two sequential point mutations at A295 and I296
(referred to as A295W/I296W) to the ∆N89 β-catenin mutant. These point mutations
render β-catenin unable to bind TCFs but preserve its ability to bind other proteins,
including E-cadherin (Graham et al., 2000). β-catenin -/- EpiSC lines overexpressing these
β-catenin mutants were established under the FGF2/activin A condition. A TOPFlash assay
confirmed that ∆N β-catenin is constitutively active whereas ∆N β-catenin/A295W/I296W
exhibits no TOPFlash activity even in the presence of CHIR (Fig 2.4 e).
43

Figure 2.4e. TOPFlash assay in β-catenin -/- + β-catenin mutant EpiSCs. Cells were treated with or without 3 μM CHIR
for 12 h. 1.β-catenin
fl/fl
EpiSCs; 2. β-catenin -/- EpiSCs; 3. β-catenin-/- + ∆N89 β-catenin EpiSCs; 4. β-catenin -/- + ∆N89 β-
catenin/A295W/I296W EpiSCs.

β-catenin -/- EpiSCs overexpressing ∆N89 β-catenin rapidly differentiated after the
removal of FGF2/activin A. In contrast, β-catenin -/- EpiSCs overexpressing ∆N β-
catenin/A295W/I296W were expanded in the absence of FGF2/activin A and CHIR/XAV
more than 20 passages without overt differentiation (Fig 2.4 f).

44

Figure 2.4f. Schematic diagram of two β-catenin mutant forms and β-catenin knockout EpiSCs stably expressing
TCF non-binding form of β-catenin can be maintained as EpiSCs without supplementing CHIR/XAV. Schematic
diagram of ΔN89-β-catenin form that cannot be degraded by destruction complex and constitutively bind to TCFs(Top
panel); and ∆N89 β-catenin/A295W/I296W form that cannot be degraded but fails to bind TCFs (Middle panel). Oct4
immunostaining of β-catenin -/- + ∆N89 β-catenin/A295W/I296W EpiSCs maintained in GMEM/10% FBS, passage 21.
Scale bars, 50 μm (Bottom panel)

When a full-length β-catenin transgene harboring the A295W/I296W point mutations was
introduced into β-catenin -/- EpiSCs, CHIR alone was sufficient to maintain their self-
renewal (data not shown). Taken together, these data demonstrate that EpiSC self-renewal
mediated by β-catenin requires stabilization of β-catenin as well as attenuation of β-
catenin/TCF-mediated transcription, which can be achieved by combined use of CHIR and
XAV.
45

2.5 β-catenin mediates self-renewal of mouse ESCs and EpiSCs via distinct
mechanisms
Stabilizing β-catenin by CHIR or Wnt3a promotes mouse ESC self-renewal (Lyashenko et
al., 2011; ten Berge et al., 2011; Wray et al., 2011; Yi et al., 2011; Ying et al., 2008). We
investigated whether β-catenin mediates mouse ESC and EpiSC self-renewal through a
common mechanism. Mouse ESCs propagated robustly in 2i, but failed to expand when XAV
was co-administered. ESC lines could not be derived from E3.5 mouse blastocysts in 2i plus
XAV (0/5). These results imply that β-catenin-TCF binding is required for β-catenin-
mediated mouse ESC self-renewal. Interestingly, replacement of 2i with CHIR/XAV had the
effect of converting ESCs to cells that express Oct4 and Fgf5, but not Rex1, a characteristic
of EpiSCs (Fig 2.5 a & b). E3.5 mouse blastocysts plated in CHIR/XAV gave rise to EpiLCs
instead of ESCs (Fig 2.5 c). We further verified these results using the Rex1-GFP-Oct4-Puro
ESCs in which a GFP reporter and a Pac transgene were knocked into the Rex1 and Oct4
loci, respectively (Toyooka et al., 2008). ESCs maintained in 2i remained Rex1-GFP-positive
and were resistant to puromycin (Fig 2.5 d). In the presence of XAV, however, they
gradually died or differentiated and could not be expanded continuously. When cultured in
CHIR/XAV, ESCs lost Rex1-GFP expression but were still resistant to puromycin, implying
that they had been converted to EpiSCs (Fig 2.5 e). These converted EpiSCs were
propagated in CHIR/XAV for over 15 passages without overt differentiation, but failed to
expand when PD0325901 was added, mainly due to cell death.

46

Figure 2.5a. Schematic diagram of ESC to EpiSC transition and CHIR/XAV medium facilitate the ESC to EpiSC
transition in vitro. Schematic diagram of ESC to EpiSC transition (top panel).Phase contrast image of E14TG2a mouse
ESCs maintained in 2i (Bottom left panel). Cells acquired a typical EpiSC morphology following 5 days culture in
CHIR/XAV (Bottom right panel). Scale bars, 50 μm.

Figure 2.5b. Gene expression pattern confirms the ESC to EpiSC transition in CHIR/XAV condtion. Quantitative RT-
PCR analysis of Oct4, Rex1, and Fgf5 gene expression. Data are average of triplicate samples. 1, E14TG2a mouse ESCs
maintained in 2i; 2, E14TG2a mouse ESC-converted EpiSCs after 5 passages in CHIR/XAV; 3, Differentiating E14TG2a
mouse ESCs after 5 days of culture in 10 ng/ml BMP4; 4, CD1 mouse EpiSCs derived and maintained in CHIR/XAV.

47

Figure 2.5c. CHIR/XAV condition allows derivation of EpiSC lines from E3.5 blastocysts. De novo derivation of mouse
EpiSC-like cells from E3.5 129SvE blastocysts plated on feeders and cultured in the CHIR/XAV condition. Two of the eight
plated blastocysts gave rise to EpiSC-like cell lines that could be continuously propagated. Scale bars, 50 μm

Figure 2.5d. ESCs cultured in 2i medium expresses both Rex1 and Oct4. GFP and Oct4 immunostaining of Rex1-GFP-
Oct4-Puro ESCs maintained in 2i. Scale bars, 50 μm

Figure 2.5e. CHIR/XAV medium allow the maintenance of Rex1-negative, Oct4-positive EpiSCs in vitro. GFP and Oct4
immunostaining of Rex1-GFP-Oct4-Puro cells after 5 passages in CHIR/XAV. 1µg/ml puromycin was added to the
CHIR/XAV medium to remove Oct4-puromycin-negative cells.

48

To further confirm the role of β-catenin-TCF binding in mouse ESC self-renewal, we
introduced a β-catenin transgene harboring the A295W/I296W mutations into β-catenin
-/- ESCs. β-catenin -/- ESCs were derived and maintained in G-csf/10% FBS or LIF and
PD032591 as described, and were non-responsive to CHIR. As expected, PD0325901 was
sufficient to maintain self-renewal of β-catenin -/- ESCs overexpressing ∆N89 β-catenin
(Fig 2.5 f).

Figure 2.5f. N-terminus truncated form of β-catenin is sufficient to replace the effect of CHIR99021. Phase contrast
(top) and alkaline phosphatase staining (bottom) images of β-catenin-/- + ∆N89 β-catenin ESCs maintained in N2B27
plus 1μM PD0325901 for 10 passages. Scale bars, 50μm

β-catenin -/- ESCs overexpressing ∆N β-catenin/A295W/I296W or full-length β-
catenin/A295W/I296W could not be maintained in LIF and PD0325901 or 2i, indicating
the essential role of β-catenin-TCF binding in β-catenin-mediated mouse ESC self-renewal.
In the absence of PD0325901, β-catenin -/- ESCs stably expressing ∆N89 β-
49

catenin/A295W/I296W ESCs differentiated into EpiSCs even in the presence of LIF, and
could be expanded continuously with or without LIF while retaining in EpiLC identity (Fig
2.5 g,h,i). These results reveal opposite roles for β-catenin-TCF binding in the maintenance
of mouse ESC and EpiSC self-renewal.

Figure 2.5g. Stable expression of β-catenin form that cannot bind to TCF induces differentiation of ESCs. Oct4 and
SSEA-1 immunostaining of β-catenin -/- + ∆N89 β-catenin/A295W/I296W ESCs cultured in LIF without PD0325901 for
19 passages. Scale bars, 50μm

Figure 2.5h. Stable expression of β-catenin that cannot bind TCF induces differentiation of ESCs to EpiSCs. Western
blot analysis of Klf4, Sox2 and Oct4 expression. 1, β-catenin
fl/fl
ESCs; 2, β-catenin-/- + ∆N89 β-catenin/A295W/I296W
ESCs maintained in LIF and PD0325901, passage 10; 3, β-catenin-/- + ∆N89 β-catenin/A295W/I296W ESCs maintained in
LIF only, passage 10.

50

Figure 2.5i. Gene expression pattern shows that stable expression of β-catenin that cannot bind TCF induces
differentiation of ESCs to EpiSCs. Quantitative RT-PCR analysis of gene expression in the indicated cells. β-catenin -/- +
ΔN89 β-catenin/A295W/I296W ESCs in LIF condition gradually differentiate into EpiSC-like cells and exhibit hallmarks of
EpiSCs; high Oct4 and Fgf5 expression and low Rex1 expression. Data represent mean  s.d. of three biological replicates.

2.6 TCF3 plays opposite roles in mouse ESC and EpiSC self-renewal
Next, we investigated the role of TCF3 in mouse ESC and EpiSC self-renewal by comparing
the responsiveness of TCF3
-/-
and TCF3
∆ N/∆ N
mouse ESCs and EpiSCs to CHIR treatment.
TCF3
∆ N/∆ N
ESCs were generated by deleting the nine residues necessary for β-catenin
binding in both of the endogenous TCF3 alleles (Yi et al., 2011). TCF3 is the predominant
TCF in mouse ESCs (Wray et al., 2011). It co-occupies promoters throughout the genome
with the core pluripotency factors Oct4, Sox2 and Nanog, and acts as a transcriptional
repressor (Cole et al., 2008; Marson et al., 2008). Stabilized β-catenin abrogates TCF3’s
repressor function through direct binding to TCF3, and this has been suggested to be the
key mechanism by which β-catenin promotes ESC self-renewal (Wray et al., 2011; Yi et al.,
51

2011). TCF3
-/-
mouse ESCs were less-responsive to CHIR compared with wild-type ESCs,
and remained undifferentiated for at least 5 passages in PD0325901 alone (Fig 2.6 a), a
finding consistent with previous reports (Wray et al., 2011; Yi et al., 2011).

Figure 2.6a. TCF3-/- mouse ESCs can be maintained without supplementation of CHIR99021 for short periods.
TCF3 -/- mouse ESCs maintained in PD0325901 alone, passage 5. Scale bar, 50μm

Nevertheless, PD0325901 alone failed to sustain long-term self-renewal of TCF3
-/-
mouse
ESCs, and addition of CHIR was still required (Fig 2.6 b), suggesting that abrogating TCF3’s
repressor function is only part of CHIR’s effect in promoting ESC self-renewal. TCF3
∆ N/∆ N

ESCs, on the other hand, could be routinely maintained in the LIF+PD0325901 condition,
but rapidly differentiated after the replacement of LIF with CHIR (Fig 2.6 c), implying that
expression of TCF3
∆N/∆N
renders CHIR unable to support ESC self-renewal. Taken together,
these results suggest that inhibiting TCF3’s repressor function by β-catenin-TCF3 binding
is necessary but not sufficient for mouse ESC self-renewal mediated by CHIR or β-catenin.

52

Figure 2.6b. GSK3 inhibition by CHIR99021 is required for long term maintenance of TCF3-/- mouse ESCs. TCF3 -/-
mouse ESCs maintained in 2i condition, passage 10 (Left panel). TCF3 -/- mouse ESCs differentiated after 10 passages in
PD0325901 alone (right panel). Scale bars, 50μm

Figure 2.6c. TCF3 mutant that cannot bind to β-catenin do not respond to CHIR99021. TCF3
∆N/∆N
mouse ESCs
maintained in LIF + PD0325901 (Upper panel). TCF
∆N/∆N
mouse ESCs could not be maintained in the 2i condition, passage
5 (Lower panel). Scale bars, 50μm

To determine the role of TCF3 in mouse EpiSC self-renewal, we converted TCF3
-/-
and
TCF3
∆ N/∆ N
ESCs into EpiSCs under the FGF2/activin condition. While TCF3
∆ N/∆ N
ESCs were
readily converted into EpiSCs, TCF3
-/-
ESCs retained an ESC identity even after 5 passages
under the FGF2/activin condition (Fig 2.6 d), indicating the critical role of TCF3 in
promoting the transition from an ESC state to an EpiSC state. TCF3
∆ N/∆ N
EpiSCs could be
53

maintained by CHIR alone for up to 5 passages. However, co-administration of XAV is still
required for their long-term maintenance (Fig 2.6 e). These results suggest that expression
of TCF3
∆N / ∆ N
can promote, but is not sufficient for EpiSC self-renewal, and blocking the
binding of β-catenin to other TCF members might also be necessary, as TOPFlash activity is
still strongly induced by CHIR and Wnt3a in both TCF
-/-
and TCF3
∆ N/∆ N
EpiSCs (Fig 2.6 f).

Figure 2.6d. TCF3-/- ESCs are refractory to ESC to EpiSC transition. Quantitative RT-PCR analysis of Oct4, Nrb01, and
Fgf5 expression. Data represent mean  s.d. of three biological replicates. 1. Mouse EpiSCs maintained in FGF2/activin A;
2. TCF3-/- mouse ESCs cultured in FGF2/activin A for 5 passages; 3. TCF3
∆N/∆N
mouse ESCs cultured in FGF2/activin A for
5 passages.

54

Figure 2.6e. Both CHIR99021 and XAV939 are required for maintenance of TCF3
∆N/∆N
mouse EpiSCs. TCF3
∆N/∆N

mouse EpiSCs cultured in CHIR only, passage 5 (top left); passage 10 (top right). TCF3
∆N/∆N
mouse EpiSCs cultured in XAV
only, passage 10 (bottom left); TCF3
∆N/∆N
mouse EpiSCs cultured in CHIR/XAV, passage 10 (bottom right). Scale bars,
50μm

Figure 2.6f. TCF/β-catenin-dependent transcription is elicited by treatment of Wnt3a and CHIR99021 in TCF3-/-
and TCF3
∆N/∆N
cells. TOPFlash assay in TCF3+/+, TCF3-/-, and TCF3
∆N/∆N
cells treated with 3μM CHIR 99021, 50ng/ml
Wnt3a, or 2.5 μM XAV for 12 h. Data represent mean  s.d. of three biological replicates.

55

2.7 Elevated axin2, not axin1, promote EpiSC self-renewal by accumulating
cytoplasmic β-catenin
Stabilization of axin by XAV promotes degradation of β-catenin, and GSK inhibition by CHIR
mimics activation of Wnt/β-catenin pathway yielding accumulation of β-catenin. Axin has
two isoforms, Axin1 and Axin2. As expected, XAV or IWR-1 treatment significantly
increased the expression level of Axin1 and Axin2 in mouse EpiSCs, likely through
stabilization of both proteins. The expression of Axin2, but not Axin1, was induced by CHIR,
an outcome consistent with previous findings that Axin2 is a direct downstream target of
the Wnt//b-catenin signaling. As expected, combination of CHIR with either XAV or IWR-1
further increased Axin2 expression level (Fig 2.7 a).

Figure 2.7a. Protein expression of both Axin1 and Axin2 are stabilized by XAV, IWR1, CHIR/XAV, and CHIR/IWR1
treatments. Western blot analysis of stabilized axin1 and axin2 after 12 hrs treatment with indicated inhibitors; NT: No
treatment, C: CHIR, X: XAV, R1: IWR-1. Axin2 protein level is further stabilized by co-administration with CHIR.

Indeed, both axin1 and axin2 protein level increased after XAV and IWR1 treatment. Then
we overexpressed both axin1 and axin2 on CD1 EpiSCs to verify the effects of XAV and
IWR1 on promotion of self-renewal. Axin2 overexpressing EpiSCs, not axin1, self-renewed
56

in CHIR-supplemented medium or without any inhibitors suggesting that up-regulation of
axin2 plays the major role in maintaining EpiSC self-renewal (Fig 2.7 b).

Figure 2.7b. Axin2 overexpression mimics effect of CHIR/XAV. Overexpression of axin1 and axin2 on CD1 EpiSCs.
Overexpression of axin2, not axin1, mimics the effect of XAV or IWR1. EpiSCs were transfected with plasmid harboring
axin1 or axin2 coding sequences and cultured for 5 passages in indicated conditions.; NT: No Treatment.

To determine whether Axin1 and Axin2 mediate EpiSC self-renewal in CHIR/XAV or CHIR/IWR-1,
we designed small hairpin RNA (shRNA) to knockdown Axin1 and Axin2. Interestingly, knockdown
of Axin2, but not Axin1, impaired the self-renewal-promoting effect of CHIR/IWR-1 and CHIR/XAV
(Fig 2.7 c, d).

57

Figure 2.7c. Knockdown efficiency of axin1 and axin2 on CD1 EpiSC confirmed by real-time RT-PCR.

Figure 2.7d. shRNA-mediated knockdown of axin1 and axin2 on CD1 EpiSC. Down-regulation of Axin2 on EpiSCs
induces differentiation even in the presence of CHIR/IWR1.

58

Next, we investigate how Axin2 mediates EpiSC self-renewal. First, we sought to determine
whether β-catenin is still required for EpiSC self-renewal mediated by Axin2. To this end,
we generated β-catenin
-/-
EpiSCs overexpressing Axin2 under the FGF2/activin2 condition
(Fig 2.7 e).

Figure 2.7e. Generation of axin2-overexpressing β-catenin -/- EpiSC line. Western blot showing over-expression of
axin2-flag protein (left panel). Differentiation of axin2-overexpressing β-catenin -/- EpiSCs both in NT(no treatment) and
CHIR conditions.

These cells differentiated overnight after the removal of FGF2/activin, even in the presence
of CHIR or CHIR/XAV (Figure 2.7 e), suggesting that EpiSC self-renewal mediated by Axin2
is β-catenin-dependent. We then analyzed β-catenin protein levels in the nucleus and
cytoplasm fractions. Although total β-catenin in Axin2-EpiSCs slightly increased compared
to Axin1-EpiSCs, nuclear translocation of β-catenin and TOPFlash reporter activity induced
by CHIR were largely blocked in Axin2-EpiSCs, but not in Axin1-EpiSCs (Figure 2.7 f).
59

Figure 2.7f. Axin2 proteins do not engage in β-catenin degradation. Total β-catenin protein level remains unchanged
in axin2- overexpressing EpiSC, not axin1-overexpressing EpiSC, confirmed by Western blot.

In Axin2-EpiSCs, Axin2 and β-catenin bound to each other, as shown by co-
immunoprecipitation; however, the binding between β-catenin and TCF3 was barely
detectable, even in the presence of CHIR (Figure 2.7 g).

60

Figure 2.7g. Axin2 overexpression abrogate binding of TCF3 with β-catenin in the nucleus. Co-IP experiment
conducted on axin2-overexpressing CD1 EpiSC. Binding of β-catenin with TCF3 was abrogated in axin2-overexpressing
EpiSC, while total protein level of β-catenin remained the same.

These results suggest that Axin2 might bind to β-catenin and retain it in the cytoplasm,
preventing it from translocating into the nucleus and subsequent binding to TCFs.
To determine whether retention of β-catenin in the cytoplasm is necessary and sufficient
for EpiSC self-renewal mediated by Axin2, we introduced a ΔNβ-catenin-ERT2 transgene
into mouse EpiSCs. ΔNβ-catenin-ERT2 is a fusion protein containing an N-terminally
truncated, stabilized β-catenin and a mutant estrogen ligand-binding domain (ERT2) (Lo
Celso, C, Watt FM. 2004). ΔNβ-catenin-ERT2 will remain in the cytoplasm, and translocates
into the nucleus only when 4-hydroxytamoxifen (4-OHT) is added, as confirmed by
immunochemistry staining (Figure 2.7 h).

61

Figure 2.7h. Immunostaining of β-catenin-T2ER in the absence and presence of tamoxifen. β-catenin-T2ER proteins
are mainly localized in the cytoplasm (upper pane). After 4 hours treatment of tamoxyfen, cytosolic β-catenin diffuses into
nucleus as indicated by immunostaining against ER (lower panel).

EpiSCs overexpressing ΔNβ-catenin-ERT2 have been expanded continuously for more than
15 passages in basal medium without addition of exogenous cytokines or small molecules
while retaining an EpiSC identity (data not shown). In contrast, these cells differentiated
rapidly after the addition of 4-OHT, even in the presence of FGF2/activin, XAV, or IWR-1
(Fig 2.7 i). These results suggest that retention of stabilized β-catenin in the cytoplasm is
likely necessary and sufficient for EpiSC self-renewal mediated by Axin2, and that nuclear-
localized β-catenin might exhibit a dominant-negative effect in EpiSC self-renewal.
+Tamoxyfen, 4 hrs
62

Figure 2.7i. Forced nuclear localization of β-catenin induces differentiation of EpiSCs even in the presence of
CHIR/IWR1. Maintenance of β-catenin-T2ER EpiSCs in CHIR/IWR1 condition, passage21 (left panel). Differentiation of β-
cateni-T2ER EpiSCs in CHIR/IWR1 two days after addition of tamoxifen (right panel).

63

Result Part III: Application of CHIR/XAV medium on human ESC maintenance and
mechanism

3.1 Modulating β-catenin function maintains human ESC self-renewal
As human ESCs share defining features with mouse EpiSCs (Hanna et al., 2010; Rossant,
2008; Tesar et al., 2007), we tested whether modulating β-catenin function can also
promote human ESC self-renewal. Similar to mouse EpiSCs, TOPFlash reporter activity in
H9 human ESCs was strongly induced by CHIR; addition of either XAV or IWR1 abolished
TOPFlash activity induced by CHIR while IWP-2 only partially suppressed such activity (Fig
3.1 a).
64

Figure 3.1a. H9 human ESCs exhibit same pattern of TOPFlash activity upon Wnt/β-catenin-modulating small
molecules treatments. TOPFlash assay in H9 human ESCs with the indicated treatments for 24 hours. Data represent
mean  s.d. of three biological replicates.

In addition, CHIR stimulation increased the amount of TCF3 bound to β-catenin in H9
human ESCs, and this effect was abrogated by XAV or IWR1, but only partially blocked by
IWP2 (Fig 3.1 b).
65

Figure 3.1b. Binding of β-catenin with TCF3 elicited by CHIR99021 treatment is attenuated by co-administration
with IWR1 and XAV. Co-IP of β-catenin in H9 human ESCs treated with the indicated cytokines/inhibitors for 24 h.
Immunoprecipitates were then probed with TCF3 antibody.

Next, we tested the effect of CHIR/XAV and CHIR/IWR1 on human ESC self-renewal. CHIR
alone induced differentiation of H9 human ESCs, even in the presence of FGF2 (Fig 3.1 c).

Figure 3.1c. CHIR99021 induces differentiation of H9 human ESCs. Phase contrast images of H9 human ESCs cultured
in the indicated conditions for 3 passages.

In contrast, co-administration of CHIR with either IWR1 or XAV resulted in robust self-
renewal of H9 human ESCs (Fig 3.1 d).
66

Figure 3.1d. CHIR/IWR1 condition allows maintenance of human ESCs in the absence of FGF2. Phase contrast images
of H9 human ESCs cultured in CHIR/XAV or CHIR/IWR-1 for 11 passages (Upper panel). (upper panel). Images of AP
staining of H9 human ESCs cultured on indicated conditions for 3 passages (lower panel). CHIR/IWR1 alone promotes
self-renewal of H9 human ESCs in the absence of FGF2. CHIR treatment without IWR1 promotes differentiation even in
the presence of FGF2.

CHIR/IWR1 is more effective than CHIR/XAV in promoting human ESC self-renewal,
especially under feeder- and FGF2-free condition; therefore, we focused on CHIR/IWR1 for
human ESC study. Supplementation of conventional human ESC medium with CHIR/IWR1
allowed robust propagation of H9 human ESCs even at clonal density. The clonogenicity of
H9 human ESCs cultured in CHIR/IWR1 was significantly higher than that in the FGF2
condition (Fig 3.1 e).
67

Figure 3.1e. CHIR/IWR1 allows enhanced survival and proliferation of human ESCs after single cell dissociation.
Colony forming efficiency assay on human ESCs cultured in FGF2 or CHIR/IWR1 conditions. Data represent mean  s.d. of
three biological replicates. Right panel: a representative image showing alkaline phosphatase staining of colonies formed
from H9 human ESCs plated onto a Matrigel-coated 4-well plate at 200 cells/well and cultured in either FGF2 or
CHIR/IWR1 condition.

Similar results were obtained in H1 and H3S3 human ESCs (data not shown). H9 human
ESCs maintained in CHIR/IWR1 express pluripotency markers Oct4, Nanog and Sox2 (Fig
3.1 f), and retain the ability to differentiate into cells of all three germ layers, both in vitro
and in vivo (Fig 3.1 g & h). These results indicate that CHIR/IWR1 or CHIR/XAV mediates
similar self-renewal responses in human ESCs and mouse EpiSCs.

Figure 3.1f. Human ESCs cultured in CHIR/IWR1 express key pluripotency markers. Human ESCs cultured in
CHIR/IWR1 for 11 passages were immunostained with the indicated antibodies.

68

Figure 3.1g. Human ESCs cultured in CHIR/IWR1 are pluripotent and are able to differentiate into all three germ
layers. Embryoid bodies (EBs) were generated from H9 human ESCs cultured in CHIR/IWR-1 for 11 passages. The
outgrowths of EBs were immunostained with the indicated antibodies. AFP(Alpha-fetoprotein) is expressed in liver
cells(mesoderm); αSMA(alpha-smooth muscle actin) is expressed in heart cells(endoderm); Tuj1 is expressed in
neuron(ectoderm).

Figure 3.1h. Human ESCs cultured in CHIR/IWR1 condition are able to form teratoma when injected to
immunodeficient mice. H&E staining of teratomas generated from H9 ESCs cultured in CHIR/IWR-1 for 20 passages.
Endothelium cells stained with blue dye represents glandular tissues (endoderm, left panel), white, large cells represents
adipose tissue (mesoderm, middle panel) and blue-dyed cell clusters represents neural stem cells (ectoderm, right panel),
respectively.

To dissect the mechanism by which CHIR/IWR1 maintains human ESC self-renewal, we
introduced two types β-catenin mutants into HES2 human ESCs. HES2 human ESCs
transfected with the ∆N89 β-catenin mutant rapidly differentiated after 2 passages even in
the presence of FGF2; in contrast, HES2 human ESCs overexpressing ∆N89 β-
69

catenin/A295W/I296W could be continuously passage without overt differentiation (Fig
3.1 i).

Figure 3.1i. Stable expression of β-catenin form that cannot engage in TCF/β-catenin mediated transcription
activity promote self-renewal of human ESCs in the absence of CHIR/IWR1 or FGF2. Phase contrast images of
differentiated HES2 human ESCs overexpressing ∆N89(left panel, passage 2 in KSR/FGF2) or self-renewing HES2 human
ESCs overexpressing ∆N89/A295W/I296W β-catenin mutant (right panel, passage 5 in KSR only).

These results suggest a shared mechanism of mouse EpiSC and human ESC self-renewal
regulated by β-catenin. To further confirm that IWR1 promote human ESC self-renewal by
attenuating β-catenin-TCF-dependent transcription, we stably introduced either wild-type
TCF3 or TCF3
∆N/ ∆N
transgene into H9 human ESCs. In the presence of CHIR alone, H9
human ESCs overexpressing wild-type TCF3 rapidly differentiated while those
overexpressing TCF3
∆N/∆N
could be maintained for more than 5 passages without
differentiation (Fig 3.1 j), suggesting that β-catenin and TCF3 interaction plays a major role
in regulating human ESC self-renewal similar to what we observed in mouse EpiSCs.
70

Figure 3.1j. TCF3 mutant form that cannot bind to β-catenin promote self-renewal of human ESCs. Phase contrast
images of H9 human ESCs overexpressing wild-type TCF3 (left panel, passage 2 in CHIR) or TCF3
∆N/∆N
(right panel,
passage 5 in CHIR).

To verify that combination of CHIR and IWR1 stabilize axin2 level more significantly than
IWR1 alone, Western blotting was conducted after 12 hours of inhibitors administration. In
agreement to mouse EpiSC result, co-administration of CHIR and IWR1 ensured highly
stable expression of axin2 in H9 human ESCs (Fig 3.1 k).

Figure 3.1k. Protein level of Axin2 is stabilized in CHIR/IWR1 condition. Western blot analysis showing human axin-2
is stabilized in IWR-1 and CHIR/IWR-1 condition. Human H9 ESCs were treated with indicated inhibitors/cytokine for 12
hr; CR1: CHIR/IWR1

71

Then we overexpressed axin2 on H9 human ESCs, and, as expected, axin2-overexpressing
human ESCs were able to self-renew even in the absence of CHIR/IWR1 (Fig 3.1 l).

Figure 3.1l. Human ESCs stably expressing Axin2 can be maintained without addition of FGF2 or CHIR/IWR1.
Immunostaining of human ESCs overexpressing Axin2. Stained for Oct4(middle); Distribution of Axin2-flag exclusively in
the cytoplasmic part of the cells (left)

72

DISCUSSION

Discussion Part1: Dynamics of Wnt/β-catenin, LIF/STAT3 and MAPK pathways for
ESC self-renewal.
Role of Wnt/β-catenin signaling on ES cell self-renewal has been controversial. Several
independent groups reported maintenance and characterization of β-catenin -/- ES cells
concluding that Wnt/β-catenin signaling is dispensable for ES cell self-renewal (Soncin et
al., 2009; Anton et al., 2007). Our results, however, demonstrate that ES cells cannot be
maintained in a naïve state without basal β-catenin activities in regular LIF/10%FBS
condition. In LIF/10%FBS medium, β-catenin deficient ESCs gradually differentiate into
epiblast stem cell stage and proliferate robustly once cells undergo adaptation to the
culture condition. ESCs to EpiSCs conversion can be prevented by artificially
hyperactivating endogenous Stat3 or activating Stat3 by LIF in combination with Mapk
inhibition using a specific blocker, PD0325901. According to our mutational analysis using
various mutant β-catenin forms, it is clear that binding of β-catenin with TCF is essential for
ESC self-renewal under a standard mouse ESC culture condition. Once β-catenin -/- cells
pass beyond the ESC state and reach EpiSC stage, these cells self-renew via LIF-
independent way and require FGF2/activin A for their proliferation and maintenance. β-
catenin -/- EpiSCs are resistant to further differentiation possibly due to requirement of
Wnt/β-catenin signaling for various lineage commitments. Since we demonstrated that β-
catenin -/- ESCs are predisposed to progress into EpiSC stages under LIF and 10%FBS
condition, we conclude that β-catenin is a key mediator in maintenance of ESC
73

pluripotency, and down-regulation of Wnt/β-catenin might be involved in ESCs to EpiSCs
conversion both in vivo and in vitro.
Mouse ES cell self-renewal mechanisms were thought to be processed through extrinsic
stimuli (Smith, 2001). Among extrinsic stimuli, LIF was first shown to be a key cytokine
that support mouse ES cell self-renewal (Smith et al., 1988; Williams et al., 1988). Later we
have demonstrated that BMPs are major factors contained in a serum that support self-
renewal of mouse ES cells in collaboration with LIF/Stat signals (Ying et al., 2003).
Recently, we have proven that ES cells can self-renew independent of these growth factors
and cytokines if ES cells are protected from inductive differentiation cues (Ying et al., 2008;
Li et al., 2008). Complete bypass of LIF/STAT3 signaling for ESC self-renewal was
confirmed by successful isolation of Stat3 -/- ES cells in a serum-free 2i media (Ying et al.,
2008). These indicate that both LIF/STAT3 and BMP pathways, which are two major
extrinsic cues for ES cell self-renewals, are completely dispensable. It signifies that ES cells
have an innate program for self-proliferation that does not require extrinsic instructions.
Here, we demonstrated that basal Wnt/β-catenin pathway could also entirely be bypassed
when the loss of β-catenin was compensated by modulation of other collaborating
pathways; i.e. hyperactivation of Stat3 or endogenous LIF/STAT3 activation in combination
with MAPK inhibitions. Our results indicate that maintenance of ESC state do not depend
on certain pathways; rather, it is the dynamics of several important pathways that
determines the status of naï ve state pluripotency. Mouse ESCs in LIF and 10%FBS
conditions undergo spontaneous differentiation. This marginal differentiation can be
completely eliminated by addition of PD0325901 to reduce Erk1/2 activation or by
supplementing CHIR to recapitulate the activation of Wnt/β-catenin pathway. When self-
74

renewal signals are adequate enough to offset intrinsic activation of MAPK pathway, MAPK
inhibition becomes unnecessary. However, MAPK inhibition becomes critical when self-
renewal signals diminishes due to Stat3 or β-catenin gene ablation. These findings led us to
formulate a “balance hypothesis”. There might be many signaling pathways that help to
promote ESC self-renewals as well as numerous signals to induce differentiations. We
regard LIF/STAT3 and Wnt/β-catenin signaling as two key pathways in one side of ESC
self-renewal circuitry, and MAPK activation as another major pathway in an opposite side.
We propose that ESC state pluripotency can be preserved once one aspect; i.e. Erk1/2
activation, is counter-balanced by activation of another aspects such as LIF/STAT3 or β-
catenin or by both of them. Surprisingly, we have found out that Stat3 pathway, which is
generally considered as a self-renewal factor, can assume a biphasic role depending on its
activation level. We hyper-activated STAT3 pathway on Stat3-overexpressing ESCs by
using GY118F receptor and treatment with G-csf. When balance is broken by maximum
activation of Stat3 pathway, mouse ESCs also undergo rapid differentiation into primitive
endoderm lineage (Schultz et al., 2010). These suggest that ESC state is at a fine-balanced
status among signaling pathways. Breaking this balancing either by activation or gene
ablation will induce differentiation, and broken balance can be recovered by enhancing
collaborating pathways.
It is of interest to investigate whether β-catenin signaling can influence reprogramming
process. Induced pluripotent stem (iPS) cells hold a potential promise for future
therapeutic applications; however, virus-mediated gene integration significantly limits the
potential usage of this technique. Small molecule application therefore might replace gene
integration methods due to its simplicity and safety. The diverse nature of Wnt signaling
75

pathway makes it open to small molecule applications. GSK3β inhibition by CHIR99021 is
now widely used to enhance reprogramming efficiency although precise mechanism is not
yet clear. Supplementation of CHIR plus LIF and PD0325901 was shown to be sufficient or
to improve the reprogramming efficiency from epiblast stem cells of both permissive and
non-permissive mouse strains as well as human embryonic stem cells (Hanna et al., 2010).
Activated Wnt/β-catenin improves the efficiency of cell fusion-based reprogramming (Lluis
et al., 2008). Investigation is currently underway to gain the mechanistic insights of β-
catenin signaling on reprogramming processes by utilizing β-catenin null ES cells and -/-
ESC derivatives harboring various mutant β-catenin forms.
Additionally, it is of great significance to investigate the role β-catenin in directing specific
lineage commitments from ES cell stage. Wnt/β-catenin signaling was shown to be
required for neuronal differentiation as well as maintenance of many multi-potent stem
cell stages including neural stem cells and hematopoetic stem cells (Lie et al., 2005; Adachi
et al., 2007; Reya et al., 2003). Our genuine β-catenin -/- ES cells can be used as a valuable
tool to investigate the function of β-catenin in various lineage commitment patterns. We
are utilizing tunable expression system in β-catenin -/- ES cells where exogenous β-catenin
expression can be turned on and off or adjusted at any developmental stages. This might
pave the way for the identification of complex role of Wnt/β-catenin signaling and provide
pivotal background for the application of this pathway for therapeutic uses.

76

Discussion Part II: Role of β-catenin in maintaining mouse EpiSCs and development
of novel culture system for the maintenance of EpiSCs.
In this study we show that stabilization of β-catenin in the cytoplasm and concurrent
attenuation of β-catenin/TCF-dependent transcriptional activity in mouse EpiSCs and
human ESCs switches β-catenin’s function from promoting differentiation to promoting
self-renewal. These results reveal a new functional avenue of the canonical Wnt/β-catenin
pathway, which current dogma depicts as being functionally defined by β-catenin-TCF
binding and the subsequent activation or suppression of downstream targets.

In β-catenin-/- EpiSCs, introduction of stabilized β-catenin induces rapid differentiation,
whereas expression of stabilized β-catenin lacking TCF binding ability maintains EpiSC self-
renewal. These results demonstrate the critical effect of attenuating β-catenin/TCF-
dependent transcription in β-catenin-mediated EpiSC self-renewal. XAV and IWR1 abolish
β-catenin-TCF transcription and this is likely the key mechanism by which they promote
EpiSC self-renewal, as β-catenin-/- EpiSCs overexpressing TCF binding incompetent
β-catenin are self-renewing even in the absence of XAV and IWR1. XAV and IWR1 are
small molecules designed to promote phosphorylation and subsequent degradation of β-
catenin by stabilizing axin (Chen et al., 2009; Huang et al., 2009). Interestingly, XAV or
IWR1 treatment of EpiSCs does not lead to the degradation of β-catenin; instead, it
prevents the binding of β-catenin to TCFs. Especially,
. Nevertheless, our results suggest that TCF binding-incompetent β-catenin is still
functionally active in mouse EpiSCs.

77

Regulation of TCF3 plays a key role in determining the functional outcome of β-
catenin/TCF signaling (Wray et al., 2011). β-catenin-TCF binding has been shown to be
required for the phosphorylation of TCF3 that leads to the dissociation of TCF3 from its
target promoters (Hikasa et al., 2010). Interestingly, TCF3 expression is down-regulated by
CHIR treatment (Figure 5D), and this effect is probably alsomediated through binding of β-
catenin to TCF3. In mouse ESCs, TCF3 acts as a pro-differentiation factor by
transcriptionally repressing the expression of pluripotency genes such as Oct4, Nanog, and
Sox2 (Cole et al., 2008; Marson et al., 2008). Stabilization of β-catenin alleviates the
repressive effect of TCF3, and this has been hypothesized to be the key mechanism by
which β-catenin promotes mouse ESC self-renewal (Wray et al., 2011; Yi et al., 2011). This
hypothesis is supported by our data showing that TCF3-/- ESCs are less dependent on β-
catenin for self-renewal, whereas overexpression of TCF3ΔN/ΔN, a non-β-catenin binding
mutant, induces ESC differentiation. Interestingly, EpiSC selfrenewal
is promoted by overexpression of TCF3ΔN/ΔN, indicating a pro-self-renewal effect of TCF3
in EpiSCs. It is intriguing that TCF3 exhibits contrary roles in the maintenance of mouse
ESCs and EpiSCs. One explanation is that TCF3 turns from a repressor of pluripotency
genes in ESCs to a repressor of differentiation genes in EpiSCs. Further experiments, such
as ChiP-sequencing, are needed to confirm whether this is the case.
Overexpression of stabilized β-catenin replaces the requirement for CHIR for mouse ESC
self-renewal, but CHIR is still needed for the long-term maintenance of TCF3-/- mouse
ESCs, suggesting that TCF3 is not the only downstream effector of β-catenin in mouse ESCs.
Indeed, TCF1 has also been shown to contribute to β-catenin-mediated mouse ESC self-
renewal (Yi et al., 2011). In EpiSCs, the requirement for XAV or IWR1 for self-renewal can
78

be circumvented by overexpression of β-catenin lacking TCF binding activity, but not by
overexpressing TCF3ΔN/ΔN, implying that blocking the binding of β-catenin to other TCFs
is also necessary for EpiSC self-renewal mediated by β-catenin.
Recent studies suggest that β-catenin lacking its c-terminal transactivation domain can still
mediate mouse ESC self-renewal (Kelly et al., 2011; Wray et al., 2011). However, the
conclusion drawn by these studies that transactivation of β-catenin/TCF target genes is not
requisite for β-catenin’s function in ESC self-renewal is premature, as this β-catenin mutant
could still activate -catenin/TCF-responsive TOPFlash reporter and β-catenin/TCF
downstream target genes, although at much reduced levels (Kelly et al., 2011; Wray et al.,
2011). By studying the function of different β-catenin mutants in β-catenin-/-
ESCs, we have unveiled the essential role of β-catenin-TCF binding in β-catenin-mediated
mouse ESC self-renewal. Role of β-catenin in mouse ESCs and EpiSCs are summarized in
table 2.

79

Table2: Different response to β-catenin signaling pathway between mouse ESCs and EpiSCs. Binding of β-catenin
and TCF by administration of CHIR99021 promote self-renewal of mouse ESCs while β-catenin/TCF –mediated
transcription activities promote differentiation of mouse EpiSCs. De-regulation of β-catenin/TCF-mediated transcription
by treatment of XAV939 promotes self-renewal of EpiSCs while stimulates differentiation of ESCs.

80

Discussion Part III: Application of novel culture system of mouse EpiSCs on human
ESCs maintenance and role of β-catenin on human ESCs self-renewal

The role of β-catenin in human ESC self-renewal has been controversial. It has been
suggested that activation of β-catenin by Wnt ligands or GSK3 inhibitors can promote
human ESC self-renewal (Cai et al., 2007; Sato et al., 2004). Other studies, however, showed
that Wnt/β-catenin signaling is dispensable for human ESC self-renewal, and that its
activation predominantly induces differentiation (Davidson et al., 2012; Dravid et al.,
2005). Our findings that activation of β-catenin can promote human ESC self-renewal
or differentiation, and that the respective outcome is dictated by the binding status of β-
catenin to TCFs, might provide a rational explanation for these discrepant results. We
found that -/- Serum Replace (KSR), bovine serum albumin, and feeders can all partially
block β-catenin/TCF transcriptional activity induced by CHIR (data not shown). These
components were included in the culture conditions under which activation of β-catenin
was shown to promote human ESC self-renewal. Some of the contradicted
results on β-catenin’s role in human ESC self-renewal, therefore, may be attributable to the
variations in β-catenin-TCF binding under different culture conditions.
Human ESCs self-renewal mediated by FGF2 requires activation of both PI3K and MAPK
pathways (Singh et al., 2012). Under the CHIR/IWR1 culture condition, however, human
ESCs remain undifferentiated even in the presence of both PI3K and MAPK inhibitors (data
not shown), suggesting that human ESC self-renewal mediated by CHIR/IWR1 is
independent of the PI3K and MAPK pathways.
81

Nevertheless, FGF2 and CHIR/IWR1 work synergistically to promote human ESC self-
renewal. This is noteworthy because in mouse ESCs, LIF and CHIR/PD can also
independently promote self-renewal, yet there is a synergistic effect when the two are
combined (Ogawa et al., 2006; Wray et al., 2010).
Understanding how these different pathways work independently or synergistically to
maintain stem cell self-renewal will advance our efforts to better control stem cell fate,
which is critical to the future regenerative medicine.
Based on the results reported here and previous findings (Wray et al., 2011; Yi et al., 2011;
Ying et al., 2008), we propose that stabilized β-catenin in stem cells can activate programs
responsible for both self-renewal and lineage commitment, and that it exerts its self-
renewal effect only when the lineage commitment effect is blocked. In mouse EpiSCs and
human ESCs, abolishing β-catenin-TCF binding with XAV or IWR1 serves to block lineage-
commitment and enable stabilized β-catenin to promote self-renewal, whereas in mouse
ESCs, PD0325901 blocks lineage commitment and β-catenin-TCF binding activity is
required for self-renewal mediated by stabilized β-catenin (diagram 1). Our findings thus
provide novel insights into the mechanism by which β-catenin regulates stem cell fate.

82

Diagram 1: Model of ESC and EpiSC self-renewal mediated by β-catenin. Β-catenin stabilized by CHIR can initiate
cellular responses related to both self-renewal and differentiation. Stabilized β-catenin promote ESC and EpiSC self-
renewal only when its differentiation is blocked by PD0325901 (in naï ve ESCs) and XAV (in primed EpiSCs) through
inhibition of MAPK signaling and attenuation of β-catenin/TCF-dependent transcription, respectively. Stabilizing β-
catenin and blocking β-catenin/TCF-dependent transcription by CHIR/XAV can also convert naï ve ESCs to primed EpiSCs.

83

EXPERIMENTAL PROCEDURES
Small-Molecule Inhibitors
The following small-molecule inhibitors were used at the indicated final concentrations:
CHIR99021 (3 µM), PD0325901 (1 µM), XAV939 (Sigma, 2 µM), IWR-1 (Sigma, 2.5 µM),
IWP-2 (Stemgent, 2.5 µM), Pyrvinium (Sigma, 100 nM), and Y27632 (Stemgent, 10 µM).
CHIR99021 and PD0325901 were synthesized in the Division of Signal Transduction
Therapy, University of Dundee.

Derivation and Propagation of EpiSCs
Post-implantation epiblasts were isolated from E5.75 embryos of CD1 (Charles River) and
129SvE (Taconic) mice, as previously described(Chenoweth and Tesar, 2010). Each
epiblast was transferred to one drop (25 μl) of Cell Dissociation Buffer (Gibco) and
incubated at room temperature for 3-5 minutes, after which the Reichert’s membrane and
visceral endoderm were surgically removed, using sharp glass needles. Each epiblast
fragment was then placed into an individual well of a 4-well plate pre-seeded with -
irradiated mouse embryonic fibroblasts (MEFs). Epiblasts were cultured in either the
conventional FGF2/activin condition(Brons et al., 2007) or the CHIR/XAV condition, which
consisted of GMEM medium (Sigma) supplemented with 10% FBS (Hyclone), 2 mM L-
glutamine (Gibco), 1 mM sodium pyruvate (Gibco), 1% nonessential amino acids (Gibco),
0.1 mM β-mercaptoethanol (Sigma), 3 µM CHIR99021, and 2 µM XAV939. After 3-4 days,
the epiblast outgrowths of were disaggregated into small clumps and replated in the same
FGF2/activin or CHIR/XAV conditions. Emerging EpiSCs were trypsinized and expanded
every 2-3 days at a subculture ratio of 1:4. For derivation of rat EpiSCs, post-implantation
84

epiblasts were isolated from E7.5 Sprague–Dawley and Dark Agouti rat embryos (Harlan)
and cultured in the CHIR/XAV condition. For derivation of EpiSC-like cells from blastocysts,
blastocysts isolated from E3.5 129SvE mouse embryos were directly plated on MEFs and
cultured in CHIR/XAV. For the conversion of TCF3
+/+
, TCF3
Δ N/Δ N
, TCF3
+/+
ESCs into EpiSCs,
ESCs were plated onto gelatin-coated dishes and cultured in the conventional FGF2/activin
medium until homogeneous flattened EpiSC-like colonies emerged. Animal experiments
were performed according to the investigator’s protocols approved by the University of
Southern California Institutional Animal Care and Use Committee.

Generation of β-Catenin
-/-
EpiSCs and ESCs
β-catenin
fl/fl
EpiSCs and ESCs were derived from B6.129-Ctnnb1
tm2Kem
/KnwJ mice (The
Jackson Laboratory) that possess loxP sites located in introns 1 and 6 of the Ctnnb1 ( β-
catenin) gene (Brault et al., 2001) (Supplementary Fig. 4a). β-catenin
fl/fl
EpiSCs were
derived and maintained in the FGF2/activin condition as described above. β-catenin
fl/fl

ESCs were derived from E3.5 blastocysts on MEF feeders with GMEM supplemented with
10% FBS, 2 mM L-glutamine, 1 mM sodium pyruvate, 1% nonessential amino acids, 0.1 mM
β-mercaptoethanol, and 10 ng/ml human LIF (Sigma). β-catenin
-/-
ESCs were generated
from β-catenin
fl/fl
ESCs by transient transfection of the pCAG-Cre-IRES-Puro plasmid using
Lipofectamine (Invitrogen). Transfectants were selected for 7 days in GMEM/10% FBS
medium supplemented with 10 ng/ml LIF, 1 μM PD0325901, and 1µg/ml puromycin.
Puromycin-resistant ESC colonies were picked and expanded in the LIF+PD0325901
condition (LIF alone was not sufficient to maintain self-renewal of β-catenin
-/-
ESCs). Loss
of β-catenin in β-catenin
-/-
ESCs was confirmed by Western blotting analysis. β-catenin
-/-

85

EpiSCs were generated from β-catenin
fl/fl
EpiSCs by transient transfection of the pCAG-Cre-
IRES-Puro plasmid or from β-catenin
-/-
ESCs by placing them into the EpiSC culture medium
containing FGF2 and activin A(Guo et al., 2009; Hanna et al., 2009). β-catenin
-/-
EpiSCs were
routinely maintained in the FGF2/activin condition.

Human ESC Culture
H1, H9, HES-2 and HES-3 human ESC lines were kindly provided by the University of
Southern California Stem Cell Core Facility. Human ESCs were routinely maintained on γ-
irradiated MEF feeders in Knockout
TM
DMEM medium (Invitrogen) supplemented with
20% Knockout
TM
serum replacement (KSR; Invitrogen), 10 ng/ml FGF2 (PeproTech), 1%
nonessential amino acids, 2 mM L-glutamine, and 0.1 mM β-mercaptoethanol. For culture
in the CHIR/XAV condition, human ESCs were plated onto dishes pre-coated with Matrigel
(BD Biosciences) and cultured in DMEM/KSR or MEF-conditioned media supplemented
with 3 µM CHIR99021 and 2 µM XAV939. MEF-conditioned medium was prepared as
described (Xu et al., 2001). 10 ng/ml FGF2 was added when non-conditioned DMEM/KSR
medium was used. For passaging, human ESCs were dissociated into single cells with
0.05% trypsin or small clumps with the Calcium Trypsin KSR(CTK) solution every 2-4 days
as previously described (Hasegawa et al., 2006), and replated into the CHIR/XAV condition.

Construction of β-Catenin Mutant Plasmids.
pcDNA3-human β-catenin and pcDNA3-human ΔN89 β-catenin plasmids (Kolligs et al.,
1999) (Addgene) were double-digested with BamH1 and Not1. Full-length and ΔN89 β-
catenin fragments were collected and ligated into the pCAG-IRES-hygro vector. The A295W
86

and I296W point mutations (Graham et al., 2000) were introduced into full-length β-
catenin and the ΔN89 β-catenin mutant by PCR-driven overlap extension (Heckman and
Pease, 2007) using the two PCR primer pairs shown in Supplementary Table 1. Full-length
β-catenin or β-catenin mutants were transfected into β-catenin
-/-
mouse ESCs, β-catenin
-/-

mouse EpiSCs, and human ESCs by electroporation. Hygromycin-resistant colonies were
picked and expanded to establish stable cell lines.

Teratoma Formation and in vitro Differentiation of Mouse EpiSCs and Human ESCs
Mouse EpiSCs and H9 human ESCs maintained in CHIR/XAV or CHIR/IWR1 conditions
were tested for their ability to form teratomas in immunodeficient SCID mice. Colonies
were dissociated into small cell clumps with CTK solution and cells were resuspended in
PBS at a concentration of 1×10
7
cells/ml. Five hundred microliters of cell suspension was
subcutaneously injected into right and left flank of 12 weeks old NOD SCID mice (Charles
River). Tumors were allowed to develop for 8 weeks. Teratomas were removed and fixed in
4% paraformaldehyde for 48 hours, followed by paraffin embedding, section, and staining
with hematoxylin and eosin (H&E). In vitro EpiSC differentiation was induced by formation
of embryoid bodies (EBs). EpiSC-derived EBs were plated onto gelatin-coated dishes and
cultured in GMEM/10% FBS medium. Spontaneously beating cardiomyocytes appeared
after 2 weeks in culture. Neural differentiation of EpiSCs was induced as previously
described (Ying and Smith, 2003; Ying et al., 2003).

87

Axin plasmids construction
The coding regions of Axin1 and Axin2 were cloned by using complementary DNA(cDNA)
from CD1 EpiSCs and KOD Hot Start DNA polymerase(EMD). Cloned regions then were
inserted into the BglII and XhoI sites of the PiggyBac transposon vectors. For RNA
interference of Axin1 and Axin2 in EpiSCs, short hairpin (shRNA) constructs were designed
to target 21 base-pair gene-specific regions in Axin1 and Axin2 and then amplified into the
plko.1-TRC vector(Addgene). The targeted sequences are as follows: Axin1,
GCCACAGAAATTTGCTGAAGA; Axin2, GGTTTGCTTGTAATGGGTTCA.

Cell transfection
For overexpression of Axin1 or Axin2 in EpiSCs, 2µg transposon vector was co-transfected
with 2ug PiggyBac vector plasmid containing axin1 or axin2 coding sequences into EpiSCs
using Lipofectamine® LTX & Plus reagent (Invitrogen) according to the manufacturer’s
instructions. After 12 hours, puromycin was added to the cell culture medium at a
concentration of 2ug/ml for drug selection. For RNAi experiments, Plko.1-TRC-based
lentiviral vectors were transfected with packaging plasmids pMD2.G and psPAX2 into
293FT cells(Invitrogen) using Lipofectamine® LTX & Plus reagent (Invitrogen). Virus-
containing supernatants were collected 48hrs after transfection. EpiSCs were incubated in
the virus supernatant supplemented with 8 ug/ml polybrene (Sigma) for 24 hr. Supernants
were then removed and cells were then cultured in CHIR/IWR1 medium with 2ug/ml
puromycin for drug selection.

88

Immunostaining and AP Staining
Immunostaining was performed according to a standard protocol. Primary antibodies used
include the following: Oct4 (C-10, Santa Cruz, 1:200), Sox2 (Y-17, Santa Cruz, 1:200), SSEA-
1 (480, Santa Cruz, 1:200), GATA-4 (G-4, Santa Cruz, 1:200), Nanog (R&D Systems, 1:200),
βIII-tubulin (Invitrogen, 1:2,000), Myosin (MF-20, DSHB, 1:5), FLAG (Sigma, 1:200),
Estrogen Receptor (C-311, Santa Cruz, 1:200), and GFP (4B10, Cell Signaling, 1:200). Alexa
Flour fluorescent secondary antibodies (Invitrogen) were used at a 1: 2,000 dilution. Nuclei
were visualized with DAPI. AP staining was performed with an alkaline phosphatase kit
(Sigma) according to the manufacturer’s instructions.

qRT-PCR and Western Blotting
Total RNA was extracted with the RNeasy Mini Kit (Qiagen). cDNA was synthesized with 1
ng of total RNA, using the QuantiTech Rev. Transcription Kit (Qiagen). qRT-PCR was
performed with Power SYBR Green PCR Master Mix (Applied Biosystems) according to the
manufacturer’s instructions. Signals were detected with an ABI7900HT Real-Time PCR
System (Applied Biosystems). The relative expression level was determined by the 2-ΔCT
method and normalized against GAPDH. The primers used for qRT-PCR are listed in the
Supplementary Table 2. Western blotting was performed according to a standard protocol.
Nuclear and cytoplasmic β-catenin was extracted using NE-PER Nuclear protein Extraction
Kit (Thermo). Primary antibodies used include the following: anti-β-catenin (BD
Bioscience, 1:2,000), anti-TCF3 (M-20, Santa Cruz, 1:500), anti-phospho-Ser45 β-catenin
(9564, Cell Signaling, 1:500), anti-actin (C-11, Santa Cruz, 1:1,000), anti-FLAG (Sigma,
1:2,000), anti-Sox2 (Y-17, Santa Cruz, 1:1000), anti-Klf4 (R&D Systems, 1:1,000), Axin1
89

(C95H11, Cell Signaling, 1:1,000), Axin2 (Abcam, 1:1,000) and anti-α-tubulin (DM1A,
Sigma, 1:2,000).

Co-Immunoprecipitation Assay
Cell extracts were prepared using the Nonidet P-40 lysis buffer (20 mM Tris-HCl, 150 mM
NaCl, 1% Nonidet P-40, 1 mM EDTA, 1 mM Na3VO4, 1 mM NaF, 1 mM
phenylmethylsulfonyl fluoride and 10 μg ml aprotinin). The supernatant was collected
and incubated with 5 µg anti-β-catenin antibody (BD Biosciences) at 4° C overnight
following incubation with protein A/G agarose (Santa Cruz) for 3 h. The beads were
washed five times with lysis buffer and resuspended in SDS sample buffer.

Promoter/Enhancer Reporter Assay
For quantifying relative Oct3/4 enhancer activities, pGL3-Oct4 DE and pGL3-Oct4 PE
plasmids (gifts from Hans Schöler’s lab) were co-transfected with the Renilla vector, using
the Amaxa Transfection Kit (Lonza). Dual Luciferase Assay (Promega) was performed the
following day according to the manufacturer’s instructions. For quantifying relative β-
catenin/Tcf transcriptional activity, pGL2-SuperTOP plasmid (gift from Randall Moon) was
co-transfected with the Renilla vector and assayed accordingly.

Flow Cytometry
Cells were collected by trypsinization, resuspended in N2B27 medium, and filtered through
a 40-µm cell strainer (BD Bioscience). GFP-positive cells were analyzed on a FACSAria/LSR
II flow cytometer (BD). Purification of Rex1-GFP-positive ESCs or Oct4-GFP-positive EpiSCs
90

was carried out by fluorescence-activated cell sorting (FACS) on a FACSAria II cell sorter
(BD Bioscience).

Bisulfite Sequencing
Genomic DNA was extracted with the QIAamp DNA Mini Kit (Qiagen). Approximately 500
ng DNA from each sample was treated with the EZ DNA methylation kit (ZYMO) to convert
the unmethylated C’s to U’s. The promoter regions of Oct4, Stella, and Vasa were amplified
with primer sets, as previously described (Han et al., 2010), using the Expand High-fidelity
PCR system (Roche), cloned into the pCR-BluntII-TOPO vector (Invitrogen) and sequenced
with the T7-promoter primer.

DNA Microarray Analysis
Total RNA was extracted with the RNeasy Mini Kit (Qiagen). RNA was amplified, labeled,
and hybridized to the GeneChip Mouse Gene 1.0 ST Array according to standard Affymetrix
protocols. A DNA microarray was performed at the University of California, Los Angeles
DNA Microarray core facility. The data analysis was performed using Partek Microarray
Software.

Accession Numbers
Microarray data reported in this paper have been deposited in the Gene Expression
Omnibus database with the accession number of GSE1461.

91

REFERENCES

Bao, S., Tang, F., Li, X., Hayashi, K., Gillich, A., Lao, K., and Surani, M.A. (2009). Epigenetic
reversion of post-implantation epiblast to pluripotent embryonic stem cells. Nature 461,
1292-1295.

Brons, I.G., Smithers, L.E., Trotter, M.W., Rugg-Gunn, P., Sun, B., Chuva de Sousa Lopes, S.M.,
Howlett, S.K., Clarkson, A., Ahrlund-Richter, L., Pedersen, R.A., et al. (2007). Derivation of
pluripotent epiblast stem cells from mammalian embryos. Nature 448, 191-195.

Brault, V., Moore, R., Kutsch, S., Ishibashi, M., Rowitch, D.H., McMahon, A.P., Sommer, L.,
Boussadia, O., and Kemler, R. (2001). Inactivation of the β-catenin gene by Wnt1-Cre-
mediated deletion results in dramatic brain malformation and failure of craniofacial
development. Development 128, 1253-1264.

Cai, L., Ye, Z., Zhou, B.Y., Mali, P., Zhou, C., and Cheng, L. (2007). Promoting human
embryonic stem cell renewal or differentiation by modulating Wnt signal and culture
conditions. Cell Res 17, 62-72.

Chen, B., Dodge, M.E., Tang, W., Lu, J., Ma, Z., Fan, C.W., Wei, S., Hao, W., Kilgore, J., Williams,
N.S., et al. (2009). Small molecule-mediated disruption of Wnt-dependent signaling in
tissue regeneration and cancer. Nat Chem Biol 5, 100-107.

Chenoweth, J.G., and Tesar, P.J. (2010). Isolation and maintenance of mouse epiblast stem
cells. Methods Mol Biol 636, 25-44.

Clevers, H. (2006). Wnt/β-catenin signaling in development and disease. Cell 127, 469-480.

Cole, M.F., Johnstone, S.E., Newman, J.J., Kagey, M.H., and Young, R.A. (2008). Tcf3 is an
integral component of the core regulatory circuitry of embryonic stem cells. Genes Dev 22,
746-755.

Dahéron , L., Opitz, S.L., Zaehres, H., Lensch, M.W., Lensch, W.M., Andrews, P.W., Itskovitz-
Eldor, J., and Daley, G.Q. (2004). LIF/STAT3 signaling fails to maintain self-renewal of
human embryonic stem cells. Stem Cells 22, 770-778.

Davidson, K.C., Adams, A.M., Goodson, J.M., McDonald, C.E., Potter, J.C., Berndt, J.D., Biechele,
T.L., Taylor, R.J., and Moon, R.T. (2012). Wnt/β-catenin signaling promotes differentiation,
not self-renewal, of human embryonic stem cells and is repressed by Oct4. Proc Natl Acad
Sci U S A 109, 4485-4490.

Dravid, G., Ye, Z., Hammond, H., Chen, G., Pyle, A., Donovan, P., Yu, X., and Cheng, L. (2005).
Defining the role of Wnt/β-catenin signaling in the survival, proliferation, and self-renewal
of human embryonic stem cells. Stem Cells 23, 1489-1501.
92

Fong, H., Hohenstein, K.A.,, and Donovan, P.J. (2008). Regulation of self-renewal and
pluripotency by Sox2 in human embryonic stem cells. Stem Cells 26, 1931-1938

Graham, T.A., Weaver, C., Mao, F., Kimelman, D., and Xu, W. (2000). Crystal structure of a β-
catenin/Tcf complex. Cell 103, 885-896.

Guo, G., Yang, J., Nichols, J., Hall, J.S., Eyres, I., Mansfield, W., and Smith, A. (2009). Klf4
reverts developmentally programmed restriction of ground state pluripotency.
Development 136, 1063-1069.

Han, D.W., Tapia, N., Joo, J.Y., Greber, B., Arauzo-Bravo, M.J., Bernemann, C., Ko, K., Wu, G.,
Stehling, M., Do, J.T., et al. (2010). Epiblast stem cell subpopulations represent mouse
embryos of distinct pregastrulation stages. Cell 143, 617-627.

Hanna, J., Cheng, A.W., Saha, K., Kim, J., Lengner, C.J., Soldner, F., Cassady, J.P., Muffat, J.,
Carey, B.W., and Jaenisch, R. (2010). Human embryonic stem cells with biological and
epigenetic characteristics similar to those of mouse ESCs. Proc Natl Acad Sci U S A 107,
9222-9227.

Hanna, J., Markoulaki, S., Mitalipova, M., Cheng, A.W., Cassady, J.P., Staerk, J., Carey, B.W.,
Lengner, C.J., Foreman, R., Love, J., et al. (2009). Metastable pluripotent states in NOD-
mouse-derived ESCs. Cell Stem Cell 4, 513-524.

Hasegawa, K., Fujioka, T., Nakamura, Y., Nakatsuji, N., and Suemori, H. (2006). A method for
the selection of human embryonic stem cell sublines with high replating efficiency after
single-cell dissociation. Stem Cells 24, 2649-2660.

Hay, D.C., Sutherland, L, Clark, J., and Burdon, T. (2004). Oct-4 knockdown induces similar
patterns of endoderm and trophoblast differentiation markers in human and mouse
embryonic stem cells. Stem Cells 22, 225-235.

Heckman, K.L., and Pease, L.R. (2007). Gene splicing and mutagenesis by PCR-driven
overlap extension. Nat Protoc 2, 924-932.

Hikasa, H., Ezan, J., Itoh, K., Li, X., Klymkowsky, M.W., and Sokol, S.Y. (2010). Regulation of
TCF3 by Wntdependent phosphorylation during vertebrate axis specification. Dev Cell 19,
521-532.

Huang, S.M., Mishina, Y.M., Liu, S., Cheung, A., Stegmeier, F., Michaud, G.A., Charlat, O.,
Wiellette, E., Zhang, Y., Wiessner, S., et al. (2009). Tankyrase inhibition stabilizes axin and
antagonizes Wnt signalling. Nature 461, 614-620.

Ivanova, N., Dobrin, R., Lu, R., Kotenko, I., Levorse, J., DeCoste, C., Schafer, X., Lun, Y., and
Lemischka, I.R. (2006). Dissecting self-renewal in stem cells with RNA interference. Nature
442, 533-538.
93

Kelly, K.F., Ng, D.Y., Jayakumaran, G., Wood, G.A., Koide, H., and Doble, B.W. (2011). β-
catenin enhances Oct-4 activity and reinforces pluripotency through a TCF-independent
mechanism. Cell Stem Cell 8, 214-227.

Kolligs, F.T., Hu, G., Dang, C.V., and Fearon, E.R. (1999). Neoplastic transformation of RK3E
by mutant β-catenin requires deregulation of Tcf/Lef transcription but not activation of c-
myc expression. Mol Cell Biol 19, 5696-5706.

Logan, C.Y., and Nusse, R. (2004). The Wnt signaling pathway in development and disease.
Annu Rev Cell Dev Biol 20, 781-810.

Lyashenko, N., Winter, M., Migliorini, D., Biechele, T., Moon, R.T., and Hartmann, C. (2011).
Differential requirement for the dual functions of β-catenin in embryonic stem cell self-
renewal and germ layer formation. Nat Cell Biol 13, 753-761.

Maldonado-Saldivia, J., van den Bergen, J., Krouskos, M., Gilchrist, M., Lee, C., Li, R., Sinclair,
A.H., Surani, M.A., and Western, P.S. (2007). Dppa2 and Dppa4 are closely linked SAP motif
genes restricted to pluripotent cells and the germ line. Stem Cells 25, 19-28.

Marson, A., Levine, S.S., Cole, M.F., Frampton, G.M., Brambrink, T., Johnstone, S., Guenther,
M.G., Johnston, W.K., Wernig, M., Newman, J., et al. (2008). Connecting microRNA genes to
the core transcriptional regulatory circuitry of embryonic stem cells. Cell 134, 521-533.

Niwa, H., Burdon, T., Chambers, I., and Smith, A. (1998). Self-renewal of pluripotent
embryonic stem cells is mediated via activation of STAT3. Genes Dev 12, 2048-2060.

Nusse, R. (2008). Wnt signaling and stem cell control. Cell Res 18, 523-527.

Ogawa, K., Nishinakamura, R., Iwamatsu, Y., Shimosato, D., and Niwa, H. (2006). Synergistic
action of Wnt and LIF in maintaining pluripotency of mouse ES cells. Biochem Biophys Res
Commun 343, 159-166.

Rossant, J. (2008). Stem cells and early lineage development. Cell 132, 527-531.

Sato, N., Meijer, L., Skaltsounis, L., Greengard, P., and Brivanlou, A.H. (2004). Maintenance of
pluripotency in human and mouse embryonic stem cells through activation of Wnt
signaling by a pharmacological GSK-3-specific inhibitor. Nat Med 10, 55-63.

Singh, A.M., Reynolds, D., Cliff, T., Ohtsuka, S., Mattheyses, A.L., Sun, Y., Menendez, L., Kulik,
M., and Dalton, S. (2012). Signaling network crosstalk in human pluripotent cells: a
Smad2/3-regulated switch that controls the balance between self-renewal and
differentiation. Cell Stem Cell 10, 312-326.

Sokol, S.Y. (2011). Maintaining embryonic stem cell pluripotency with Wnt signaling.
Development 138, 4341-4350.
94

Sumi, T., Tsuneyoshi, N., Nakatsuji, N., and Suemore, H. (2008). Defining early lineage
specification of human embryonic stem cells by the orchestrated balance of canonical
Wnt/beta-catenin, Activin/Nodal and BMP signaling. Development 135, 2969-2979.

ten Berge, D., Kurek, D., Blauwkamp, T., Koole, W., Maas, A., Eroglu, E., Siu, R.K., and Nusse,
R. (2011). Embryonic stem cells require Wnt proteins to prevent differentiation to epiblast
stem cells. Nat Cell Biol 13, 1070-1075.

Tesar, P.J., Chenoweth, J.G., Brook, F.A., Davies, T.J., Evans, E.P., Mack, D.L., Gardner, R.L., and
McKay, R.D. (2007). New cell lines from mouse epiblast share defining features with human
embryonic stem cells. Nature 448, 196-199.

Thorne, C.A., Hanson, A.J., Schneider, J., Tahinci, E., Orton, D., Cselenyi, C.S., Jernigan, K.K.,
Meyers, K.C., Hang, B.I., Waterson, A.G., et al. (2010). Small-molecule inhibition of Wnt
signaling through activation of casein kinase 1alpha. Nat Chem Biol 6, 829-836.

Toyooka, Y., Shimosato, D., Murakami, K., Takahashi, K., and Niwa, H. (2008). Identification
and characterization of subpopulations in undifferentiated ES cell culture. Development
135, 909-918.

van Amerongen, R., and Nusse, R. (2009). Towards an integrated view of Wnt signaling in
development. Development 136, 3205-3214.

Wray, J., Kalkan, T., Gomez-Lopez, S., Eckardt, D., Cook, A., Kemler, R., and Smith, A. (2011).
Inhibition of glycogen synthase kinase-3 alleviates Tcf3 repression of the pluripotency
network and increases embryonic stem cell resistance to differentiation. Nat Cell Biol 13,
838-845.

Xu, C., Inokuma, M.S., Denham, J., Golds, K., Kundu, P., Gold, J.D., and Carpenter, M.K. (2001).
Feederfree growth of undifferentiated human embryonic stem cells. Nat Biotechnol 19,
971-974.

Wray, J., Kalkan, T., and Smith, A.G. (2010). The ground state of pluripotency. Biochem Soc
Trans 38, 1027-1032.

Yeom, Y.I., Fuhrmann, G., Ovitt, C.E., Brehm, A., Ohbo, K., Gross, M., Hubner, K., and Scholer,
H.R. (1996). Germline regulatory element of Oct-4 specific for the totipotent cycle of
embryonal cells. Development 122, 881-894.

Yi, F., Pereira, L., Hoffman, J.A., Shy, B.R., Yuen, C.M., Liu, D.R., and Merrill, B.J. (2011).
Opposing effects of Tcf3 and Tcf1 control Wnt stimulation of embryonic stem cell self-
renewal. Nat Cell Biol 13, 762-770.

Ying, Q.L., Wray, J., Nichols, J., Batlle-Morera, L., Doble, B., Woodgett, J., Cohen, P., and Smith,
A. (2008). The ground state of embryonic stem cell self-renewal. Nature 453, 519-523.

95

Ying, Q.L., and Smith, A.G. (2003). Defined conditions for neural commitment and
differentiation. Methods Enzymol 365, 327-341.

Zaehres, H., Lensch, M.W., Daheron, L., Stewart, S.A. Itskovitz-Eldor, J., and Daley, G.Q.
(2005). High-efficiency RNA interference in human embryonic stem cells. Stem Cells 23,
299-305.

Abstract (if available)

Abstract Wnt/β-catenin signaling plays a central role in regulating stem cell fates. Its exact role in the maintenance of mouse epiblast stem cells (EpiSCs) and human embryonic stem cells (ESCs), however, remains undefined. Here, we show that activation of Wnt/β-catenin signaling in mouse EpiSCs and human ESCs can promote self-renewal or differentiation, with the self-renewal effect being realized only when β-catenin mediated T-cell factors (TCFs)-dependent transcription activities are blocked. Introduction of a stabilized β-catenin transgene harboring point mutations at the TCF binding site enables mouse EpiSCs and human ESCs to self-renew without exogenous growth factors. By contrast, β-catenin-mediated self-renewal in mouse ESCs requires TCF-binding activity. Moreover, we show that Axin2, but not Axin1, functions to redistribute β-catenin mainly on cell cytoplasm, and accumulated β-catenin in cytoplasm promote both mouse EpiSCs and human ESCs self-renewal and convert mouse ESCs into EpiSCs. Our results reveal a novel mechanism by which β-catenin mediates EpiSC and ESC self-renewal, and will have broad implication in understanding stem cell fate regulation.

Linked assets

University of Southern California Dissertations and Theses

Conceptually similar

PDF

Molecular basis of mouse epiblast stem cell and human embryonic stem cell self‐renewal

PDF

Investigating the role of STAT3 in mouse and rat embryonic stem cell self-renewal and differentiation

PDF

Role of STAT3 phosphorylation in mouse embryonic stem cell self-renewal and differentiation

PDF

Pleotropic potential of Stat3 in determining self-renewal, apoptosis, and differentiation in mouse embryonic stem cells

PDF

β-catenin couples self-renewal, induction and epithelial morphogenesis and patterning at the outset of mammalian nephrogenesis

PDF

The role of ERK1/2 in mouse embryonic stem cell fate control

PDF

Differential role of two coactivators, CCAR1 and CARM1, for dysregulated beta-catenin activity in colorectal cancer cell growth and gene expression

PDF

Leucine-rich amelogenin peptide induces osteogenesis in mouse embryonic stem cells

PDF

Effects of a GSK-3 inhibitor on retroviral-mediated gene transfer to human CD34+ hematopoietic progenitor cells

PDF

Importance of alpha-catenin and cell-cell interactions in hair follicle stem cells homeostasis

PDF

Interaction of epigenetics and SMAD signaling in stem cells and diseases

PDF

Harnessing the power of stem cell self-renewal pathways in cancer: dissecting the role of BMI-1 in Ewing’s sarcoma initiation and maintenance

PDF

Novel roles for Maf1 in embryonic stem cell differentiation and adipogenesis

PDF

Derivation and characterization of human embryonic stem (hES) cells and human induced pluripotent stem (hiPS) cells in clinical grade conditions

PDF

The role of Wnt signaling in organogenesis: limb and lung

PDF

The role of LGR5 in the pathogenesis of Ewing sarcoma: a marker of aggressive disease and a contributor to the malignant phenotype

PDF

Hepatitis B virus X protein regulation of β-catenin and NANOG and co-regulatory role with YAP1 in HCC malignancy

PDF

Steatosis induces Wnt/β-catenin pathway to stimulate proliferation of hepatic tumor initiating cells and promote liver cancer development

PDF

Epigenetic plasticity of cultured female human embryonic stem cells and regulation of gene expression and chromatin by PR-SET7 mediated H4K20me1

PDF

From mesenchymal stem cell therapy to discovery of drug therapy for systemic sclerosis

Asset Metadata

Creator Kim, Hoon (author)

Core Title Role of beta-catenin in mouse epiblast stem cell, embryonic stem cell self-renewal and differentiation

School Keck School of Medicine

Degree Doctor of Philosophy

Degree Program Genetic, Molecular and Cellular Biology

Publication Date 11/27/2013

Defense Date 10/22/2012

Publisher University of Southern California (original), University of Southern California. Libraries (digital)

Tag Activin-A,axin1,axin2,beta-catenin,CHIR99021,cytoplasmic beta-catenin,differentiation,FGF2,human embryonic stem cells,IWR-1,mouse embryonic stem cells,mouse Epiblast stem cells,nuclear beta-catenin,OAI-PMH Harvest,self-renewal,TCF/LEF1,TOPFlash assay,XAV939

Language English

Contributor Electronically uploaded by the author (provenance)

Advisor Ma, Le (committee chair), Sieburth, Derek (committee member), Ying, Qi-Long (committee member), Ying, Shao-yao (committee member)

Creator Email gandalph@hanmail.net,hoonkim@usc.edu

Permanent Link (DOI) https://doi.org/10.25549/usctheses-c3-120578

Unique identifier UC11291505

Identifier usctheses-c3-120578 (legacy record id)

Legacy Identifier etd-KimHoon-1356.pdf

Dmrecord 120578

Document Type Dissertation

Rights Kim, Hoon

Type texts

Source University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Access Conditions The author retains rights to his/her dissertation, thesis or other graduate work according to U.S. copyright law. Electronic access is being provided by the USC Libraries in agreement with the a...

Repository Name University of Southern California Digital Library

Repository Location USC Digital Library, University of Southern California, University Park Campus MC 2810, 3434 South Grand Avenue, 2nd Floor, Los Angeles, California 90089-2810, USA